text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
a description will now be given of a magnetic disk apparatus in the first embodiment of the present invention , with reference to fig3 through 5 . hereinafter , the dimensions of a magnetic disk apparatus and its component parts in the vertical direction , in the horizontal transversal direction , and in the horizontal longitudinal direction will be referred to as the height , the width , and the length , respectively , for the sake of convenience . fig3 is an exploded view of a magnetic disk apparatus 50 in the first embodiment of the present invention . this apparatus 50 is built by combining a 5 - inch disk drive unit 51 and a 3 . 5 - inch disk drive unit 52 into a one - piece unit . a front panel 55 is arranged to cover the front of the 5 - inch disk drive unit 51 and the front of the 3 . 5 - inch disk drive unit 52 . fig4 shows an assembled condition of the magnetic disk apparatus 50 . in fig4 the front panel 55 has at its lower portion an insertion opening 53 through which a 5 - inch disk cartridge 40 is inserted , and has at its upper portion an insertion opening 54 through which a 3 . 5 - inch disk cartridge 41 is inserted . the height of the front panel 55 is the same as the height of the front panel of the conventional magnetic disk apparatus . in fig3 the 5 - inch disk drive unit 51 is assembled by fitting a disk motor 57 , a head carriage unit 58 , and a disk clamp unit 59 onto a die - cast chassis 56 . the chassis 56 has side walls 60 at sides thereof , and each of the side walls 60 has two supporting columns 61 attached to the side wall . each of the four supporting columns 61 has a top surface 61a , and a threaded hole 62 is formed in the middle of the top surface . as a chassis 70 of the 3 . 5 - inch disk drive unit 52 is wide enough to cover the top of the 5 - inch disk drive unit 51 , the 5 - inch disk drive unit 51 has no top plate covering an entire top area of the 5 - inch disk drive unit 51 . fig5 is an exploded view of the 3 . 5 - inch disk drive unit 52 of the first embodiment shown in fig3 . in fig5 a slider 71 , a holder 72 , and a top cover 73 are fitted together on the chassis 70 of the 3 . 5 - inch disk drive unit 52 . each of the slider 71 and the holder 72 has a size equivalent to the size of the 3 . 5 - inch disk cartridge 52 . the chassis 70 of the 3 . 5 - inch disk drive unit 52 has a width w1 that is equivalent to the width of the 5 - inch disk drive unit 51 , as shown in fig5 . the chassis 70 has holder supporting portions 75 and 76 and extended surface portions 77 and 78 . the supporting portions 75 and 76 vertically extend and the holder 72 is supported on the holder supporting portions 75 and 76 when the holder 72 is fitted onto the chassis 70 . the chassis 70 is wider than the holder 72 in the horizontal transversal direction . the extended surface portions 77 and 78 horizontally extend from around the holder supporting portions 75 and 76 in the horizontal transversal direction respectively . a disk motor 80 and a head carriage unit 79 for the 3 . 5 - inch disk are arranged in the middle of the chassis 70 . the chassis 70 is formed integrally with four leg portions 81 which transversely extend from both the sides of the chassis 70 . the height of the chassis 70 in the magnetic disk apparatus 50 is approximately equal to the height of the chassis in the 3 . 5 - inch disk drive unit 14 . in order to increase the stiffness of the chassis 70 having the width w1 , the chassis 70 is formed at its front edge with a reinforcement rib 84 , as shown in fig5 . when the 3 . 5 - inch disk drive unit 52 is arranged on the 5 - inch disk drive unit 51 , the leg portions 81 are brought into contact with the top surfaces of the supporting columns 61 of the 5 - inch disk drive unit 51 . four machine screws 82 are fitted into the threaded holes 62 of the supporting columns 61 and fastened so that the 3 . 5 - inch disk drive unit 52 is firmly attached to the top of the 5 - inch disk drive unit 51 . the top surface of the 5 - inch disk drive unit 51 is covered with the chassis 70 of the 3 . 5 - inch disk drive unit 52 after the assembly mentioned above is performed . the height of the chassis 70 of the 3 . 5 - inch disk drive unit 52 , arranged on the top of the 5 - inch disk drive unit 51 , is essentially the same as the height of the chassis of the 3 . 5 - inch disk drive unit in the above conventional magnetic disk apparatus . performance of adjusting operations for the parts of the 3 . 5 - inch disk drive unit 52 is necessary only once after the disk drive unit 52 is attached to the disk drive unit 51 . in fig5 a positioning screw 85 is provided in a hole in the chassis 70 , and this screw is used to adjust the fitted position of the 3 . 5 - inch disk drive unit 52 over the 5 - inch disk drive unit 51 . the positioning screw 85 is located in the extended surface portion 78 of the chassis 70 , and the hole thereof is exposed at a location outwardly deviating from the side of the holder 72 . an index mark on the 5 - inch disk drive unit 51 can be easily viewed from above through the hole of the positioning screw 85 after the 3 . 5 - inch disk drive unit 52 is fitted on the 5 - inch disk drive unit 51 . thus , the fitted position of the disk drive unit 52 to the disk drive unit 51 can be easily and accurately adjusted by loosening and re - tightening the positioning screw 85 . the 3 . 5 - inch disk drive unit 52 includes a motor base 74 to which the disk motor 80 is attached . the motor base 74 is provided on the bottom of the chassis 70 , and an upper portion of the disk motor 80 is exposed from an opening 80a of the chassis 70 over the surface of the chassis 70 . as the 5 - inch disk drive unit 51 does not require a top plate , the chassis 70 can have a height sufficient to enable the disk motor 80 to be included in the 3 . 5 - inch disk drive unit 52 while satisfying the need for a magnetic disk apparatus which is compact and low in the manufacturing cost . further , the motor base 74 on the bottom of the disk motor 80 comes into contact with the top of the 5 - inch disk drive unit 51 . the disk motor 80 of the 3 . 5 - inch disk drive unit 52 comprises a rotating shaft rotatably supported by a set of bearings , a ring - like permanent magnet fixed to the inside peripheral wall of a yoke , and a stator coil with its iron core arranged on the motor base 74 . as the disk drive unit 51 has no top plate , the height of the disk motor 80 can be increased to a height greater than that of the above conventional device . in order to satisfy the need for a magnetic disk device which is compact and to maintain the required magnetic characteristics of the disk motor , it is necessary that the permanent magnet of the conventional device be reduced in thickness by increasing a concentration of a certain component element in the permanent magnet . however , increasing the concentration of the above component element in the permanent magnet makes the manufacturing cost of the conventional device high . in the first embodiment of the present invention , the disk motor 80 can have a sufficient thickness without the need to increase the concentration of the above component element in the permanent magnet . further , it is possible to satisfy the need for a magnetic disk apparatus which is compact and low in the manufacturing cost and to realize an efficient assembly of the apparatus with a smaller number of manufactured parts . a sheet plate of the chassis 70 in the first embodiment may be thicker than a sheet plate of the chassis in the conventional device in fig1 a . thus , the 3 . 5 - inch disk drive unit 52 having the chassis 70 in the first embodiment can have a higher vibration resistance than the above conventional device . the bottom of the motor base 74 in the first embodiment is located at a position equivalent to the position of the bottom of the top plate 13 of the conventional device in fig1 a . the motor base 74 can be located at a position that is lower than the position of the motor base of the above conventional device by a height equivalent to the height of the top plate 13 . as the position of the motor base 74 in the first embodiment can be lower than the position of the motor base in the above conventional device , the height of the disk motor 80 in the first embodiment can be greater than the height of the disk motor in the above conventional device . thus , it is not necessary to make the thickness of the permanent magnet of the disk motor 80 smaller by using a permanent magnet with an increased concentration of the above component element in the permanent magnet . further , the permanent magnet of the disk motor 80 is inexpensive as compared with the permanent magnet of the disk motor in the above conventional device , and the thickness of the permanent magnet in the first embodiment is greater than the thickness of the permanent magnet in the above conventional device . in addition , because of the increased height of the disk motor 80 , the number of turns of wires of the stator coil of the disk motor 80 in the first embodiment can be made greater than the number of turns of wires of the stator coil of the disk motor in the above conventional device . accordingly , the disk motor 80 in the first embodiment is inexpensive as compared with the disk motor in the above conventional device . further , since the 5 - inch disk drive unit 51 in the first embodiment has no top plate and it is necessary to perform the adjusting operations for the parts of the 3 . 5 - inch disk drive unit 52 only once , the manufacturing cost of the first embodiment is remarkably less than the manufacturing cost of the conventional device . in addition , the number of the required parts of the magnetic disk apparatus 50 in the first embodiment is less than that of the conventional device . next , a description will be given of a slider latching mechanism of a conventional disk drive device , with reference to fig2 a , for the sake of comparative analysis with the present invention . fig2 a shows a slider latching mechanism of a conventional disk drive device . generally , a slider and a holder are arranged on a chassis of the disk drive device , and the slider is latched at a given latch position by using a latch lever . when a disk cartridge is inserted into the disk drive device and the disk cartridge is held by the holder , the latch lever is pushed by the disk cartridge to make the slider slide in an insertion direction . after the disk cartridge is inserted and held by the holder , the slider is latched by the latch lever . when an eject button is depressed , the slider is released from the latch lever and the disk cartridge in the holder is ejected from the disk drive device . in fig2 a , a chassis 141 of the disk drive unit 14 has a surface plate 141a , and a drive motor 142 which is projecting from a motor base ( not shown ) is arranged on the surface plate 141a from an opening of the surface plate 141a . a mounting pin 140 is arranged on the surface plate 141a at a given position , and a latch lever 143 is fitted onto the mounting pin 140 on the surface plate 141a . the latch lever 143 comprises a pair of supporting holes 143a and 143b and a contact portion 143c . the mounting pin 140 is inserted into the supporting holes 143a and 143b of the latch lever 143 so that the latch lever 143 is rotatably supported by the mounting pin 140 on the chassis 141 . when a 3 . 5 - inch disk cartridge when it is inserted in the 3 . 5 - inch disk drive unit 14 , the leading edge of the disk cartridge is brought into contact with the contact portion 143c of the latch lever 143 . that is , the contact portion 143c is pushed by the disk cartridge when it is inserted . in the 3 . 5 - inch disk drive unit in fig2 a , a torsion spring 144 , a ring mounting member 145 and an e - ring 146 are attached to the latch lever 143 . the torsion spring 144 is provided to give a biasing force to rotate the latch lever 143 around the pin 140 . the e - ring 146 is attached to the latch lever 143 by using the ring mounting member 145 . in order to prevent the removal of the latch lever 143 from the chassis 141 , it is necessary that the e - ring 146 be attached to the latch lever 143 . there is the need for a magnetic disk apparatus which is compact and low in the manufacturing cost , which apparatus is built by combining two disk drive units of different types into a single unit . however , it is necessary to fit together various parts to assemble the above conventional device including the slider latching mechanism , which assembly of the above conventional device is time consuming and somewhat difficult to perform . next , a description will be given of the magnetic disk apparatus in the second embodiment of the present invention , with reference to figs . 6 through 8 . the magnetic disk apparatus in the second embodiment includes a slider latching mechanism which enables efficient assembly of the apparatus with a smaller number of manufactured parts while satisfying the need for the apparatus which is compact and low in the manufacturing cost . fig6 shows a 3 . 5 - inch disk drive unit of the magnetic disk apparatus in the second embodiment . in fig6 a slider 71 , a holder 72 and a cover 73 are arranged on a die - cast chassis 70 of the 3 . 5 - inch disk drive unit . each of the slider 71 , the holder 72 and the cover 73 has a size equivalent to that of the 3 . 5 - inch disk cartridge 41 . in fig6 a disk motor 80 and a head carriage unit 79 are arranged on the chassis 70 so that the 3 . 5 - inch disk drive unit 52 accesses a 3 . 5 - inch disk contained in the 3 . 5 - inch disk cartridge . the 3 . 5 - inch disk drive unit 52 includes a motor base on which the disk motor 80 is mounted . the motor base is provided on the bottom of the chassis 70 , and an upper portion of the disk motor 80 is arranged from an opening 80a of the chassis 70 on the surface of the chassis 70 . the motor base is electrically connected to an input / output interface board via a connecting cord . fig7 a and 7b show a latch lever 240 which is rotatably supported on the chassis 70 in fig6 . the latch lever 240 serves to latch the slider 71 at a given latch position on the chassis 70 . in fig7 a and 7b , the latch lever 240 comprises a rotating body 251 , a central hole 252 , a contact portion 253 , and an engagement portion 255 . the rotating body 251 is rotatable around the central hole 252 . the contact portion 253 is pushed by the leading edge of the 3 . 5 - inch disk cartridge when it is inserted . the engagement portion 255 is slidably engaged with the chassis 70 . as shown in fig6 the latch lever 240 is arranged on the chassis 70 with a coil spring 241 . the latch lever 240 further comprises a hook portion 254 . the coil spring 241 is connected at one end with the hook portion 254 , and is connected at the other end with a side wall 70a of the chassis 70 . the chassis 70 is formed with a projection 238 and a semi - circular guide opening 239 in the surface plate 70c at given positions . the central hole 252 of the latch lever is fitted into the projection 238 , and the engagement portion 255 of the latch lever is slidably engaged with the guide opening 239 of the chassis . as shown in fig7 a and 7b , the engagement portion 255 of the latch lever 40 is l - shaped in its cross - section . the engagement portion 255 extends outward and downward from the bottom of the rotating body 251 , and the hook portion 254 extends upward from the rotating body 251 . the latch lever 240 further comprises a pawl portion 256 which is engaged with the slider 71 to latch the slider 71 on the chassis 70 . in fig6 the slider 71 is arranged on the chassis 70 . the slider 71 includes side walls 61a and 61b . each of the side walls 61a and 61b is formed with two guide opening portions 62 which are slanted with respect to the horizontal direction . the slider 71 includes an eject portion 63 and an extended portion 65 at front and rear edges of the side wall 61a . the slider 71 is integrally formed with a connecting portion 64 in the side wall 61a . the eject portion 63 is connected with an eject button of the magnetic disk unit . the connecting portion 64 is connected with the pawl portion 256 of the latch lever . fig8 shows an assembled condition of the latch lever 240 on the chassis 70 in fig6 . in the assembled condition , the extended portion 65 of the slider 71 is located over the central hole 252 of the latch lever in order to prevent the removal of the latch lever 240 from the chassis 70 . the connecting portion 64 of the slider is formed with a step on the slider , and a downwardly bent pawl 64a is formed at a given position of the connecting portion 64 . when the latch lever 240 is rotated by a 3 . 5 - inch disk cartridge being inserted , the pawl portion 256 of the latch lever 240 is connected with the pawl 64a of the connecting portion 64 so that the slider 71 is latched by the latch lever 240 . if the latch lever 240 is rotated by the coil spring 241 or the inserted disk cartridge , the removal of the latch lever 240 from the chassis 70 can be prevented by means of the engagement portion 255 and the extended portion 65 in the second embodiment . fitting the e - ring 146 on the latch lever 143 on the disk drive unit 14 using the ring mounting member 145 , as shown in fig2 a , is not needed . thus , the second embodiment enables efficient assembly of the magnetic disk apparatus with a smaller number of manufactured parts while the need for the apparatus which is compact and low in the manufacturing cost is satisfied . unlike the disk drive unit 14 in fig2 a , the disk drive unit 52 in the second embodiment includes the chassis 70 which is formed with the projection 238 having a low height , and it does not require the pin 140 having a relatively great height on the chassis . thus , the second embodiment enables efficient assembly of the magnetic disk apparatus while the need for the apparatus which is compact and low in the manufacturing cost . in fig6 the chassis 70 has holder supporting portions 75 and 76 . the supporting portions 75 and 76 vertically extend from the surface of the chassis 70 , and the holder 72 is supported on the holder supporting portions 75 and 76 after the holder 72 is arranged on the chassis 70 . the holder 72 includes two transversely extending ribs 72c on each of the side walls 72a and 72b . the ribs 72c of the holder are connected with the guide portions 62 of the slider 71 so that the slider 71 guides the holder 72 to enable a vertical movement of the holder within the disk drive unit 52 . an arch - like shutter lever 74 is arranged with a spring 74c on the holder 72 . the shutter lever 74 is rotatable around a shaft 74a . the spring 74c is connected at one end to the holder 72 and connected at the other end to the shutter lever 74 . the spring 74c gives a biasing force to maintain the original position of the shutter lever 74 . the leading edge of the shutter lever 74 is guided along the periphery of a slot 74b in the holder 72 . when a 3 . 5 - inch disk cartridge is inserted into the disk drive unit 52 , a shutter of the inserted disk cartridge is opened by the shutter lever 74 . next , a description will be given of a slider braking mechanism of a conventional disk drive device , with reference to fig2 b , for the sake of comparative analysis with the present invention . fig2 b shows a slider braking mechanism of a conventional 3 . 5 - inch disk drive device . in fig2 b , a slider 310 and a latch lever 312 are arranged on a chassis ( not shown ) of the 3 . 5 - inch disk drive unit . the latch lever 312 is rotatably supported on the chassis . a spring - 314 connected to the chassis provides a biasing force to rotate the latch lever 312 . the slider 310 is slidable on the chassis in directions indicated by arrows x1 and x2 in fig2 b . a return spring 311 connected to the chassis gives a biasing force to draw back the slider 310 in the direction indicated by the arrow x1 . the slider 310 includes an upwardly extending hook 310a , and the latch lever 312 includes an arm portion 312a . in fig2 b , the slider 3 , 10 is latched by the latch lever 312 at a latch position where the arm portion 312a is connected with the hook 310a . the slider braking mechanism in fig2 b includes an oil damper 313 . the oil damper 313 has a case and a fin whose shaft is rotatable within oil enclosed in the case . the fin of the oil damper 313 is engaged with a rack portion 310b of the slider 310 . when a 3 . 5 - inch disk cartridge 320 is inserted into the disk drive unit and held in a holder ( not shown ), an upwardly extending portion 312b of the latch lever 312 is pushed by the leading edge of the inserted disk cartridge . the latch lever 312 is thus rotated against the biasing force of the spring 314 . the arm portion 312a of the latch lever 312 at this time is released from the hook 310a of the slider 310 , and the slider is moved relative to the chassis in the direction x1 because of the biasing force of the return spring 311 . as the slider 310 is moved relative to the chassis in the direction x1 , the holder in which the disk cartridge 320 is held is lowered relative to the chassis , so that a 3 . 5 - inch disk contained in the disk cartridge 320 is set to a read / write position within the disk drive unit . generally , an oil damper is expensive , and the manufacturing cost of the disk drive unit becomes high if the oil damper is used by the disk drive unit . the oil damper 313 serves to brake the slider 310 when the slider 310 is moved relative to the chassis in the direction x1 . the braking action of the oil damper 313 helps the slider 310 be slowly moved in the direction x1 . thus , the disk in the disk cartridge 320 can be set to the read / write position at an appropriate speed . however , the viscosity of the oil used in the oil damper 313 varies depending on the ambient temperature . therefore , the braking performance of the oil damper 313 also varies depending on the ambient temperature of the environment where the magnetic disk apparatus is placed . for example , when the ambient temperature is low , the braking force provided by the oil damper 313 is increased . the moving speed of the slider 310 at this time is extremely low , and it is accordingly difficult to set the disk in the disk cartridge 320 to the read / write position . the center hole of the disk at this time may not completely fitted into a rotating shaft of a disk motor within the disk drive unit , which will cause a trouble of the reading / writing of the disk in the disk drive unit . next , a description will be given of the magnetic disk apparatus in the third embodiment of the present invention , with reference to fig9 through 11 . the magnetic disk apparatus in the third embodiment includes a slider braking mechanism to enable a safe and reliable setting of an inserted disk cartridge within the apparatus by braking a sliding movement of the slider , and is designed to satisfy the need for the apparatus which is compact and low in the manufacturing cost . fig1 shows a 3 . 5 - inch disk drive unit of the magnetic disk apparatus in the third embodiment . in fig1 , a slider 71 , a holder 72 and a cover 73 are arranged on a chassis 70 of the 3 . 5 - inch disk drive unit . each of the slider 71 , the holder 72 and the cover 73 is arranged according to the size equivalent to the 3 . 5 - inch disk cartridge 41 . the disk drive unit in fig1 is essentially the same as those shown in fig5 and 6 , except that a slider braking mechanism including a torsion coil spring 101 is arranged in the extended surface portion 78 of the chassis 70 . the torsion coil spring 101 has a portion which is connected with or released from the slider when it is moved relative to the chassis . similarly to the second embodiment described above , the magnetic disk apparatus in the third embodiment is built by combining two disk drive units of different types into a single unit . the 3 . 5 - inch disk drive unit in the third embodiment includes a latch lever 240 which is rotatably supported on the chassis 70 . the latch lever 240 serves to latch the slider 71 at a given latch position on the chassis 70 . the latch lever 240 comprises a rotating body 251 , a central hole 252 , a contact portion 253 , and an engagement portion 255 . the rotating body 251 is rotatable around the central hole 252 . the contact portion 253 is pushed by the leading edge of the 3 . 5 - inch disk cartridge when it is inserted . the engagement portion 255 is slidably engaged with the chassis 70 . the latch lever 240 is arranged on the chassis 70 with a coil spring 241 . the latch lever 240 comprises a hook portion 254 . the coil spring 241 is connected at one end with the hook portion 254 , and is connected at the other end with a side wall 70a of the chassis 70 . the chassis 70 is formed with a projection 238 and a semi - circular guide opening 239 in the surface plate 70c at given positions . the central hole 252 of the latch lever is fitted into the projection 238 , and the engagement portion 255 of the latch lever is slidably engaged with the guide opening 239 of the chassis . the engagement portion 255 of the latch lever 40 is l - shaped in a vertical cross - section . the engagement portion 255 is extending outward and projects downward from the rotating body 251 , and the hook portion 254 is extending upward from the rotating body 251 . the latch lever 240 further comprises a pawl portion 256 which is engaged with the slider 71 to latch the slider 71 on the chassis 70 . the slider 71 is arranged on the chassis 70 . the slider 71 includes side walls 61a and 61b . each of the side walls 61a and 61b is formed with two guide opening portions 62 which are slanting with respect to the horizontal direction . the slider 71 includes an eject portion 63 and an extended portion 65 at front and rear edges of the side wall 61a . the slider 71 is integrally formed with a connecting portion 64 in the side wall 61a . the eject portion 63 is connected with an eject button of the magnetic disk unit . the connecting portion 64 is connected with the pawl portion 256 of the latch lever . in an assembled condition of the latch lever 240 , the extended portion 65 of the slider 71 is located over the central hole 252 of the latch lever in order to prevent the removal of the latch lever 240 from the chassis 70 . the connecting portion 64 of the slider is formed with a step on the slider , and a downwardly bent pawl 64a is formed at a given position of the connecting portion 64 . when the latch lever 240 is rotated by a 3 . 5 - inch disk cartridge being inserted , the pawl portion 256 of the latch lever 240 is connected with the pawl 64a of the connecting portion 64 so that the slider 71 is latched by the latch lever 240 . when a 3 . 5 - inch disk cartridge is inserted into the disk drive unit and held by the holder 72 , the contact portion 253 of the latch lever 240 is pushed by the leading edge of the inserted disk cartridge . the latch lever 312 is rotated against the biasing force of the spring 241 . the connecting portion 256 of the latch lever 240 at this time is released from the hook 64a of the slider 71 , the slider 71 is moved relative to the chassis 70 in the direction indicated by the arrow x1 in fig1 because of a biasing force of a return spring . as the slider 71 is moved relative to the chassis 70 in the direction x1 , the holder 72 in which the disk cartridge is held is lowered relative to the chassis 70 in the direction indicated by the arrow z1 in fig1 , so that a 3 . 5 - inch disk contained in the disk cartridge is set to a read / write position within the disk drive unit . when the slider 71 is moved relative to the chassis 70 in the direction x1 , a slider braking mechanism 100 of the third embodiment serves to brake the slider 71 . the braking action of the slider braking mechanism 100 helps the slider 71 be slowly moved in the direction x1 , and the disk in the disk cartridge can be set to the read / write position at an appropriate speed . fig9 shows the slider braking mechanism 100 of the magnetic disk apparatus in the third embodiment . fig1 is a side view of the slider braking mechanism taken along a line a -- a in fig9 . in fig1 , the side wall 70b shown in fig9 is omitted . fig1 a and 13a show a condition of the slider braking mechanism 100 when the slider 71 is not moved relative to the chassis 70 in the direction x1 . fig1 d and 13d show a condition of the slider braking mechanism 100 after the sliding movement of the slider 71 is completed . fig1 b and 13b show an intermediate condition of the slider braking mechanism 100 in the course of the sliding movement of the slider 71 . fig1 c and 13c show an intermediate condition of the slider braking mechanism 100 when the braking force of the torsion coil spring to brake the slider 71 is canceled . in fig9 the position of the torsion coil spring 101 when the slider 71 is not moved relative to the chassis 70 in the direction x1 is indicated by solid lines , and the position of the torsion coil spring 101 after the sliding movement of the slider 71 is completed is indicated by two - dot chain lines . in fig9 and 11 , the slider braking mechanism 100 comprises the torsion coil spring 101 , an upwardly extending pin 102 of the chassis 70 , and a machine screw 102 . the torsion coil spring 101 includes a coil portion 101a , a first arm portion 101b extending from the coil portion 101a , and a second arm portion 101c extending from the coil portion 101a in the direction opposite to the first arm portion 101b . the coil portion 101a is fitted into the pin 102 of the chassis 70 , and the screw 103 is fastened to the pin 102 so as to prevent the removal of the torsion coil spring 101 from the pin 102 . the first arm portion 101b is connected with the side wall 70b of the chassis 70 . as shown in fig9 and 11 , the second arm portion 101c of the torsion coil spring 101 is shaped into a predetermined three - dimensional figure by bending . the second arm portion 101c comprises a u - shaped part 101c - 1 around the coil portion 101a , and an l - shaped part 101c - 2 at a leading edge of the torsion coil spring 101 . the l - shaped part 101c - 2 includes a vertical segment 101c - 3 and a horizontal segment 101c - 4 . in fig9 an l - shaped slit 104 is formed at a left corner portion of the slider 71 . the l - shaped slit 104 comprises a longitudinally extending first slit portion 104a , and a second slit portion 104b which is transversely extending from an edge of the first slit portion 104a . the first slit portion 104a is longer than a stroke of the sliding movement of the slider 71 in the directions x1 and x2 in fig9 . the second slit portion 104b has an edge 104b - 1 . the chassis 70 of the 3 . 5 - inch disk drive unit 52 includes a guide opening 105 at a location corresponding to the location of the l - shaped slit 104 of the slider 71 . the guide opening 105 has a guide edge 105a . the guide edge 105a of the guide opening 105 is formed into a generally straight line , and the line of the guide edge 105a is preset to be slanting , so that it is at an angle &# 34 ; α &# 34 ; ( approximately 50 °) with the direction x1 in which the slider 71 is moved relative to the chassis 70 . in other words , the chassis 70 is formed with the guide opening 105 such that the guide edge 105a generally extends along an arc drawn around the u - shaped part 101c - 1 as the center of the arc . fig9 a and 13a show the condition of the slider braking mechanism 100 when the slider 71 is not moved relative to the chassis 70 in the direction x1 . the second slit portion 104b of the slider at this time matches with the guide opening 105 . the l - shaped part 101c - 2 of the second arm portion passes through the second slit portion 104b of the slider and the guide opening 105 of the chassis 70 . the horizontal segment 101c - 4 at the leading edge of the second arm portion is placed under the bottom of the chassis 70 , so as to prevent the removal of the torsion coil spring 101 from the slider 71 and the chassis 70 . the vertical segment 101c - 3 of the torsion coil spring is placed at the right corner of the edge 104b - 1 of the l - shaped slit 104 of the slider , so as to prevent the slider 71 from being moved in both the direction x2 and the direction y2 . in fig9 the second arm portion 101c is resiliently deformed in the direction x1 , and the slider 71 is moved in the direction x2 due to the biasing force given by the torsion coil spring 101 . when the 3 . 5 - inch disk cartridge 41 is inserted into the disk drive unit 52 , the latch lever is released from the slider 71 , and the slider 71 is moved relative to the chassis 70 in the direction x1 due to a biasing force of a coil spring . a position of the rear edge of the slider 71 before the sliding movement mentioned above is indicated by &# 34 ; s1 &# 34 ; in fig9 a - 12d and 13a - 13d . the slider 71 has two stages of the sliding movements in the direction x1 . in the first stage ( fig1 a - 12c and fig1 a - 13c ), the slider 71 is moved relative to the chassis 70 in the direction x1 while the biasing force from the torsion coil spring 101 so as to move the slider 71 in the opposite direction x2 is applied to the slider 71 . in the second stage ( fig1 c - 12d and fig1 c - 13d ), the slider 71 is moved relative to the chassis 70 in the direction x1 while no biasing force from the torsion coil spring 101 is applied to the slider 71 . as shown in fig1 b and 13b , the slider 71 is moved relative to the chassis 70 in the direction x1 against the biasing force given by the torsion coil spring 101 . during this sliding movement , the vertical segment 101c - 3 of the torsion coil spring is pushed by the edge 104b - 1 of the second slit portion 104b of the slider 71 , and the vertical segment 101c - 3 is guided by the guide edge 105a of the chassis . in other words , when the slider 71 is sliding in the direction x1 , a braking force from the slider braking mechanism 100 is applied to the slider 71 so as to move the slider 71 at an decreasing sliding speed . as shown in fig1 c and 13c , the slider 71 is moved relative to the chassis 70 in the direction x1 to reach a position at which the vertical segment 101c - 3 of the torsion coil spring 101 is separated from the edge 104b - 1 of the second slit portion 104b of the slider 71 . a position of the rear edge of the slider 71 in this condition is indicated by &# 34 ; s2 &# 34 ; in fig1 c - 12d and 13c - 13d . as shown in fig1 d and 13d , after the vertical segment 101c - 3 is separated from the edge 104b - 1 , the biasing force given by the slider braking mechanism 100 is not applied to the slider 71 , and the slider 71 is further moved relative to the chassis 70 in the direction x1 at an increasing speed to a rear end position of the slider 71 on the chassis 70 . the rear end position of the slider 71 in this condition is indicated by &# 34 ; s3 &# 34 ; in fig1 d and 13d . the vertical segment 101c - 3 of the torsion coil spring 101 at this position is within the first slit portion 104a of the slider 71 . as the slider 71 is moved relative to the chassis 70 in the direction x1 at a prescribed speed to the rear end position , the holder 72 is moved down relative to the chassis 70 in the direction z1 at the prescribed speed . therefore , the 3 . 5 - inch disk cartridge held by the holder 72 can be set to the read / write position within the 3 . 5 - inch disk drive unit with no interference between the parts of the disk drive unit being caused . as the biasing force from the slider braking mechanism 100 is not applied to the slider 71 , the slider can be moved to the rear end position at the prescribed sliding speed . as the slider braking mechanism 100 described above has the torsion coil spring 101 , the characteristics of the slider braking mechanism 100 are not influenced by any change in the ambient temperature of the magnetic disk apparatus , even when the temperature of the environment in which the magnetic disk apparatus is placed is very low . unlike the oil damper in the above conventional device , the slider braking mechanism 100 described above is inexpensive and serves to stably and safely set the inserted 3 . 5 - inch disk cartridge to the read / write position within the disk drive unit while it is not influenced by any change in the ambient temperature of the magnetic disk apparatus . when an eject button of the magnetic disk apparatus is depressed , the slider 71 is moved relative to the chassis 70 in the direction x2 . after the disk cartridge is ejected from the magnetic disk apparatus , the slider 71 is returned back to the position s1 in fig9 . the sequence of sliding movements of the slider 71 at that time is opposite to that of the sliding movements of the slider shown in fig1 a - 12d and 13a - 13d , but the slider braking mechanism 100 at that time has no braking effect on the slider 71 . the slider braking mechanism 100 including the torsion coil spring 101 shown in fig1 has a structure which satisfies the need for the 3 . 5 - inch disk drive unit which is compact , and the torsion coil spring 101 is inexpensive as compared with the oil damper . in the third embodiment described above , it is possible that a magnetic disk apparatus designed to satisfy the need for the apparatus which is compact and low in the manufacturing cost has a slider braking mechanism which enables a safe and reliable setting of an inserted disk cartridge in the apparatus . next , a description will be given of a cartridge impact preventing mechanism of a conventional disk drive unit , with reference to fig2 c , for the sake of comparative analysis with a fourth embodiment of the present invention . fig2 c is a cross sectional view of the cartridge impact preventing mechanism taken along a transversal line in the above conventional device . the cartridge impact preventing mechanism in fig2 c includes a transversely movable guide member , a rotatably supported l - shaped lever , and a projecting portion of a chassis of a 3 . 5 - inch disk drive unit . the guide member includes at its leading edge a guide portion which a disk cartridge is brought into contact with . the l - shaped lever is provided between the guide portion and a slider of the disk drive unit . in fig2 c , the 3 . 5 - inch disk drive unit includes the chassis 414 , the holder 418 , and a head carriage unit 416 . the guide portion 411a of the guide member is placed on the top of the projecting portion 415 on the chassis 414 , and the top of the guide member 411 is arranged at a position within the disk drive unit slightly higher than the top of a lower magnetic head 417 on the head carriage unit 416 . when a 3 . 5 - inch disk cartridge 441 is inserted into the holder 418 , the inserted disk cartridge is placed on the top of the guide member 411 . the guide member 411 serves to prevent the disk cartridge from hitting the lower magnetic head 417 . however , the cartridge impact preventing mechanism mentioned above is comprised of too many parts : the guide member , the l - shaped lever and the projecting portion . the above mentioned mechanism of the conventional device requires a relatively large space to incorporate the mechanism in the disk drive unit . as the guide member is arranged on the top of the projecting portion arranged on the chassis , the above conventional mechanism requires a relatively large height to be provided within the disk drive unit . thus , it is difficult to satisfy the need for the magnetic disk apparatus which is compact and low in the manufacturing cost . next , a description will be given of a cartridge impact preventing mechanism of a magnetic disk apparatus in a fourth embodiment of the present invention , with reference to fig1 through 19b . fig1 , 18a and 19a show a condition of the cartridge impact preventing mechanism in the fourth embodiment before a disk cartridge is inserted . fig1 , 18b and 19b show a condition of the cartridge impact preventing mechanism after the disk cartridge is inserted and set to the read / write position . fig1 shows a 3 . 5 - inch disk drive unit of the magnetic disk apparatus in which the cartridge impact preventing mechanism in fig1 is incorporated . in fig1 , the head carriage unit 79 is supported on the chassis 70 of the 3 . 5 - inch disk drive unit . the head carriage unit 79 includes a lower arm portion 185 and an upper arm portion 186 , and , on the lower arm portion 185 , there is provided a magnetic head 187 via a gimbal plate 188 . the chassis 70 in the fourth embodiment includes an opening 191 in the vicinity of the front end of the head carriage unit 79 , and this opening 191 includes a slanting surface 192 . the opening 191 of the chassis is formed so that a cartridge guide portion 144 , which will be described below , is engaged with the opening 191 . the slanting surface 192 of the opening 191 is arranged so that the cartridge guide portion 144 is smoothly disengaged from the opening 191 of the chassis . fig1 a through 17d show a disk cartridge guide member 140 of the cartridge impact preventing mechanism in the fourth embodiment in fig1 . in fig1 a through 17d , the disk cartridge guide member 140 includes a bearing 141 , a first u - shaped arm 142 , a second u - shaped arm 143 , the cartridge guide portion 144 , and a connecting portion 145 . the disk cartridge guide member 140 is a molded part which is made of synthetic resin . the first u - shaped arm 142 includes a base portion 142a extending from the bearing 141 , and a thin , resiliently - deformable arm portion 142b extending from the base portion 142a . the arm portion 142b has a given thickness &# 34 ; t &# 34 ;. the bottom surface of the first u - shaped arm 142 includes a flat projection 142c at the end of the base portion 142a near the arm portion 142b . the flat projection 142c forms the base of the disk cartridge guide member 140 which is brought into contact with the chassis 70 . the disk cartridge guide member 140 is horizontally supported on the chassis 70 by use of the flat projection 142c even if a burr is projecting from the bottom surface of the base portion 142a or if the bottom surface of the base portion 142a has a warping . the thin , resiliently - deformable arm portion 142b includes a slit 142b - 1 , and two separated arm segments 142b - 2 and 142b - 3 which are separated from each other by the slit 142b - 1 . the separated arm segments 142b - 2 and 142b - 3 are resiliently deformable , independently of each other , without interference , and the arm portion 142b can be smoothly twisted in directions indicated by arrows &# 34 ; a &# 34 ; and &# 34 ; b &# 34 ; in fig1 d . the cartridge guide portion 144 includes an upwardly - projecting head 144a , extending from the arm portion 142b , and a downwardly - projecting , semi - spherical base 144b . the head 144a includes a top surface 144c with a slanting surface 144d which is formed slantingly at the front side of the top surface 144c . the second u - shaped arm 143 extends from the bearing 141 in the direction opposite to the direction of the first u - shaped arm 142 . the second u - shaped arm 143 is u - shaped in order to increase the area of the disk cartridge guide member 140 which contacts with the chassis 70 and to allow a reliable and safe rotating movement of the member 140 on the chassis 70 . in addition , a rotating force acts on the first u - shaped arm 142 in the direction , indicated by the arrow &# 34 ; c &# 34 ; in fig1 c , when the cartridge guide portion 144 is engaged with the opening of the chassis by the inserted disk cartridge . the second u - shaped arm is u - shaped in order to cancel the rotating force mentioned above so as to prevent the first u - shaped arm 142 from being raised from the chassis 70 . the connecting portion 145 extends from the second u - shaped arm 143 , and it includes an upwardly projecting portion which is engaged with the slider 71 . the disk cartridge guide member 140 described above is rotatably arranged on the chassis 70 by supporting the bearing 141 on a shaft 146 on the chassis 70 and by fitting the connecting portion 145 into a slot 147 in the slider 71 . as described above , the disk cartridge guide member 140 is in the condition shown in fig1 , 18a and 19a before the 3 . 5 - inch disk cartridge 41 is inserted . in fig1 a , the cartridge guide portion 144 is placed on the chassis 70 , and the position of the cartridge guide portion 144 is located slightly in front of a magnetic head 187 of the head carriage unit 79 in the direction x1 . the top surface 144c of the cartridge guide portion is located slightly above the magnetic head 187 . when the 3 . 5 - inch disk cartridge 41 is inserted into the holder 72 , the disk cartridge 41 does not contact the magnetic head 187 . the disk cartridge 41 is guided by the slanting surface 144d of the cartridge guide portion and slides along the top surface 144c thereof , so that the inserted disk cartridge 41 is placed above the magnetic head 187 . thus , by means of the disk cartridge guide member 140 , the disk cartridge 41 can be inserted into the holder 72 at its rear end position without interfering with the magnetic head 187 . as the disk cartridge 41 is inserted into the holder 72 at its rear end position , the slider 71 is released from the latch lever ( not shown ) and is moved relative to the chassis 70 in the direction x1 by the biasing force of the spring ( not shown ). when the slider 71 is moved in the direction x1 , the disk cartridge guide member 140 is in the condition shown in fig1 , 18b and 19b . the disk cartridge guide member 140 is rotated around the shaft 146 by the sliding movement of the slider 71 . the cartridge guide portion 144 at this time is placed above the opening 191 of the chassis 70 . as the holder 72 is lowered relative to the chassis 70 in the direction z1 by the sliding movement of the slider 71 , the disk cartridge 41 held by the holder 72 is also lowered in the direction z1 . the cartridge guide portion 144 is pushed downward by the disk cartridge 41 , and the arm segments 142b - 2 and 142b - 3 of the arm portion 142bare resiliently deformed . as shown in fig1 b , the cartridge guide portion 144 at this time is engaged with the opening 191 of the chassis 70 . thus , the inserted disk cartridge 41 is safely set to the read / write position within the disk drive unit . the arm segments 142b - 2 and 142b - 3 are resiliently deformable , independently of each other , and the cartridge guide portion 144 can be smoothly connected with the opening 191 of the chassis as shown in fig1 b . as the arm portion 142b can be smoothly twisted in the directions indicated by the arrows &# 34 ; a &# 34 ; and &# 34 ; b &# 34 ; in fig1 d , the cartridge guide portion 144 can be smoothly engaged with the opening 191 of the chassis . the rotating force acts on the first u - shaped arm 142 in the direction indicated by the arrow &# 34 ; c &# 34 ; in fig1 c , when the cartridge guide portion 144 is engaged with the opening 191 of the chassis . however , the second u - shaped arm 143 at this time is supported on the chassis 70 , thereby preventing the first u - shaped arm 142 from moving upward from the chassis 70 . on the other hand , when the disk cartridge 41 is ejected from the disk drive unit , the operations of the disk cartridge guide member 100 at that time is reversal to the above described operations of the disk cartridge guide member 100 . more specifically , the slider 71 is moved relative to the chassis 70 in the direction x2 when the eject button is depressed , and the holder 72 is raised from the chassis 70 in the direction z2 . the disk cartridge guide member 140 is rotated around the shaft 146 . the cartridge guide portion 144 is smoothly released from the opening 191 of the chassis since the downwardly - projecting , semi - spherical base 144b is guided by the slanting surface 192 of the opening 191 . as an alternative of the above mentioned opening 191 of the chassis 70 , a recessed portion equivalent to the opening 191 may be formed in the chassis 70 at the corresponding location . the recessed portion as the alternative has a slating surface equivalent to the slanting surface 192 . the magnetic disk apparatus in the fourth embodiment has a cartridge impact preventing mechanism which can be built by a single disk cartridge guide member . the disk cartridge impact guide member in the fourth embodiment is inexpensive since it is a molded part made of synthetic resin , and has a simple , flat structure which can be incorporated into a 3 . 5 - inch disk drive unit . thus , the magnetic disk apparatus in the fourth embodiment can satisfy the need for the apparatus which is compact and low in the manufacturing cost , and the cartridge impact preventing mechanism enables a safe and reliable holding of an inserted disk cartridge and prevents the disk cartridge from impacting a magnetic head when the disk cartridge is set to a read / write position . next , a description will be given of an impact prevention mechanism of a conventional magnetic disk device , with reference to fig2 d , for the sake of comparative analysis with the present invention . fig2 d shows an impact prevention mechanism of a conventional disk drive device . in fig2 d , an upright wall 510 upwardly extending from a chassis 511 of the above conventional device is provided . the chassis 511 is made of a sheet metal , and the upright wall 510 is formed by partially cutting the sheet metal of the chassis 511 and bending the cut part of the sheet metal . a lead screw 512 is arranged at a rear portion of the chassis 511 , and this lead screw 512 is rotated by a stepping motor 513 to move a head carriage unit 515 in a radial direction of a magnetic disk . a magnetic head 514 to access the magnetic disk is provided on the head carriage unit 515 . the lead screw 512 is supported at one end by the upright wall 510 . when a disk cartridge 520 is forcibly inserted in the direction x2 by an operator , the leading edge of the inserted disk cartridge 520 impacts the upright wall 510 of the above disk drive device . if the disk cartridge 520 is inserted by use of a strong force , the upright wall 510 may be permanently deformed so that it slantingly extends from the chassis 511 . the deformation of the upright wall 510 makes the alignments of the lead screw 512 and the magnetic head 514 deviate from the desired alignment lines . therefore , the above conventional device has a problem in that the disk contained in the disk cartridge 520 may be accessed by using such a magnetic head , and the disk is fatally damaged . in order to eliminate this problem , it is necessary to provide a magnetic disk apparatus including an impact preventing mechanism which prevents the leading edge of an inserted disk cartridge from impacting a wall of a chassis on which a lead screw is supported . next , a description will be given of an impact prevention mechanism of a magnetic disk apparatus in a fifth embodiment of the present invention , with reference to fig2 through 24 . fig2 and 21 show the impact prevention mechanism of the magnetic disk apparatus in the fifth embodiment . in fig2 and 21 , there are provided the head carriage unit 79 , a guide rod 91 , a lead screw 93 , a lower arm 94 , and an upper arm 95 . the guide rod 91 guides the head carriage unit 79 when it is moved relative to the chassis 70 in directions indicated by arrows &# 34 ; x1 &# 34 ; and &# 34 ; x2 &# 34 ; in fig2 . the lead screw 93 is rotated by a stepping motor ( not shown ) to move the head carriage unit 79 in the directions x1 and x2 . in the head carriage unit 79 , a lower magnetic head 96 is provided on the top of the lower arm 94 , and an upper magnetic head 97 is provided on the bottom of the upper arm 95 . a transversely extending arm 98 is provided on the side of the head carriage unit 79 , and the arm 98 is connected with the lead screw 93 . the arm 98 includes at its leading end an upper connecting portion 99 and a lower connecting portion 100 . the lower connecting portion 100 is slightly longer than the upper connecting portion 99 , and transversely extends beyond the lead screw 93 . the lead screw 93 is interposed between the two connecting portions 99 and 100 . at the front end of the lead screw 93 , a supporting wall 101 upwardly extending from the chassis 70 is provided . the lead screw 93 is supported by the supporting wall 101 . the chassis 70 is made of a sheet metal , and the supporting wall 101 is formed by partially cutting the sheet metal of the chassis 70 and bending the cut part of the sheet metal . fig2 and 24 show a stopper member 110 of the impact prevention mechanism in the fifth embodiment in fig2 . the stopper member 110 is a molded product made of synthetic resin . the stopper member 110 comprises a rectangular main body 111 , a pair of ribs 112 and 113 transversely extending from the side of the main body , a fixing portion 114 , a pair of latching legs 115 and 116 , and a locating pin 117 . the fixing portion 114 , the latching legs 115 and 116 , and the locating pin 117 are downwardly extending from the bottom of the main body 110 as shown . the ribs 112 and 113 are arranged on the side of the main body 111 , and they are apart from each other along the side of the main body 111 by a prescribed distance &# 34 ; a &# 34 ; that is slightly longer than the stroke of the movement of the head carriage unit 79 in the directions x1 and x2 . the stopper member 110 has a front - end surface 119 which serves as a first stopper 120 to prevent the leading edge of an inserted disk cartridge from impacting the supporting wall 101 . the transversely extending ribs 112 and 113 serve as a second stopper 118 to prevent the head carriage unit 79 from impacting the disk motor 80 or a rear end wall 86 of the chassis 70 . the stopper member 110 has a top surface 121 which serves as a third stopper 122 to prevent the cover 73 from impacting the head carriage unit 79 when the disk drive unit is gripped by a hand of an assembly robot by use of a strong force . as shown in fig2 and 21 , the stopper member 110 is fitted to the chassis 70 so that it lies adjacent to the lead screw 93 . fig2 shows a 3 . 5 - inch disk drive unit of the magnetic disk apparatus in which the impact prevention mechanism in fig2 is incorporated . as shown in fig2 , the stopper member 110 is arranged on the chassis 70 by fitting the fixing portion 114 to a recessed portion 131 of an opening 130 , fitting the locating pin 117 to a hole 132 , and connecting the latching legs 115 and 116 to holes 133 and 134 respectively . in fig2 , a stepping motor 92 is provided behind the rear end wall 86 of the chassis 70 , and the stepping motor 92 is connected to the lead screw 93 to rotate the lead screw 93 . as shown in fig2 , the front end surface 119 of the stopper member is located at a position that deviates from the position of the supporting wall 101 in the forward direction x1 on the chassis 70 by a prescribed distance &# 34 ; b &# 34 ;. thus , the front end surface 119 of the stopper member serves as the first stopper 120 mentioned above . the top surface 121 of the stopper member is located beneath the cover 73 of the disk drive unit . the top surface 121 serves as the third stopper 122 mentioned above . if the disk cartridge 41 is inserted into the disk drive unit 52 by use of a strong inserting force , the leading edge of the inserted disk cartridge 41 comes to a position indicated by a two - dot chain line in fig2 . the leading edge of the inserted disk cartridge 41 at that time does not impact the supporting wall 101 and hits the front end surface 119 of the stopper member 110 . any inserting force to insert the disk cartridge 41 is canceled by the first stopper 120 mentioned above when the leading edge of the disk cartridge 41 touches the front end surface 119 of the stopper member 110 . thus , it is possible to prevent the leading edge of an inserted disk cartridge from impacting the supporting wall 101 even if a strong force is used to insert the disk cartridge 41 . as the supporting wall 101 is not at all hit by the inserted disk cartridge , the supporting wall 101 is never permanently deformed . the lead screw 93 is supported by the supporting wall 101 , and the head carriage unit 79 is connected with the lead screw 93 . as the supporting wall 101 is never deformed , it is possible to prevent the alignment of the magnetic head 96 on the head carriage unit 79 from deviating from the desired alignment line . if the stepping motor 92 should malfunction , the head carriage unit 79 may exceed a desired range of the movement in the directions x1 and x2 . however , in the magnetic disk apparatus including the impact prevention mechanism described above , when the head carriage unit 79 is excessively moved relative to the chassis 70 in the direction x1 , the lower connecting portion 100 of the arm 98 is brought into contact with the rib 113 of the stopper member 110 . on the other hand , when the head carriage unit 79 is excessively moved relative to the chassis 70 in the direction x2 , the lower connecting portion 100 of the arm 98 is brought into contact with the rib 112 of the stopper member 110 . therefore , the forward and backward movements of the head carriage unit 79 are restricted by the stopper member 110 . it is possible to prevent the head carriage unit 79 from impacting the disk motor 80 or the rear end wall 86 of the chassis . when the magnetic disk apparatus is assembled by use of an assembly robot , the disk drive unit is occasionally gripped by a hand of the assembly robot . the chassis 70 and the cover 73 of the disk drive unit 52 are depressed by use of a strong force . if the cover 73 is exceedingly deformed , the head carriage unit 79 may be damaged by the bottom of the cover 73 due to the depressing force . however , in the magnetic disk apparatus including the impact prevention mechanism described above , when the cover 73 is exceedingly deformed , the bottom of the cover 73 is supported by the top surface 121 of the stopper member . thus , it is possible to prevent the cover 73 from impacting the head carriage unit 79 by means of the third stopper 122 of the stopper member mentioned above . further , the present invention is not limited to the above described embodiments , and variations and modifications may be made without departing from the scope of the present invention .
| 6 |
referring now to fig1 , a clip applier 10 according to the invention generally includes a flexible wound outer coil 12 having a proximal end 14 and a distal end 16 . an end effector assembly 18 is coupled to the distal end 16 of the coil 12 and an actuator assembly 20 is coupled to the proximal end 14 of the coil 12 . a plurality of pull / push wires 58 , 60 ( shown and described below with reference to fig2 - 4 ) extend through the coil 12 and couple the end effector assembly 18 to the actuator assembly 20 . the clip applier 10 is similar to the clip applier described in detail in previously incorporated co - owned application ser . no . 10 / 010 , 908 , entitled “ flexible surgical clip applier ”, filed simultaneously herewith . however , in this application , the end effector assembly 18 is designed specifically for fundoplication using a clip significantly larger than that used in the clip applier of the aforesaid co - owned application . fig2 - 4 illustrate the details of the end effector assembly 18 according to a first embodiment of the invention . the end effector assembly 18 includes a pair of jaws 22 , 24 which are rotatably coupled to a clevis 26 . in particular , the clevis 26 has a central channel 28 ( seen best in fig4 ) which is defined by clevis arms 30 , 32 . although the term “ clevis ” is used because of its general acceptance in the art of endoscopic instruments , the “ clevis ” 26 is preferably covered on top and bottom so that the only exit from the channel 28 is at the distal end . the jaw 22 is rotatably coupled to the clevis arm 30 by an axle 34 and the jaw 24 is rotatably coupled to the clevis arm 32 by an axle 36 . the axles 34 and 36 are dimensioned such that they do not significantly obscure the channel 28 . the jaws 22 , 24 are substantially identical . each jaw 22 , 24 includes a proximal tang 38 , 40 , a mounting bore 42 , 44 , a distal hook shaped anvil 46 , 48 and a plurality of medial teeth 50 , 52 . as seen best in fig4 , the medial teeth 50 , 52 are arranged on one side of the jaw and a short wall 51 , 53 is arranged on the opposite side of the jaw to define a groove ( or guiding channel ) 54 , 56 . the grooves 54 , 56 meet the anvils 46 , 48 each of which has a helical surface . the interior ( proximal ) helical surfaces of the anvils act to bend the clip retainers as described below with reference to fig1 - 24 . the proximal tang 38 , 40 of each jaw is coupled to a respective pull / push wire 58 , 60 via two links 62 , 64 and 66 , 68 . the links 62 , 66 are substantially l - shaped and are rotatably coupled near their elbow to the clevis arms 30 , 32 by axles 70 , 72 which do not significantly obscure the channel 28 between the clevis arms . one end of the link 62 , 66 is coupled to the pull / push wire 58 , 60 and the other end of the link 62 , 66 is rotatably coupled to one end of the link 64 , 68 . the other end of the link 64 , 68 is rotatably coupled to the tang 38 , 40 . the combined coupling of each jaw 22 , 24 to each pull / push wire 58 , 60 forms a linkage which amplifies the force from the pull / push wires to the jaws . in particular , as the jaws close , the mechanical advantage increases . the proximal ends of the pull / push wires 58 , 60 are coupled to the actuator assembly ( 20 in fig1 ) as described in previously incorporated co - owned application ser . no . 10 / 010 , 908 , entitled “ flexible surgical clip applier ”, filed simultaneously herewith . a clip pusher ( not shown ) disposed in the interior of the coil is coupled to a push wire ( not shown ) which is coupled to the actuator assembly as described in previously incorporated co - owned application ser . no . 10 / 010 , 908 , entitled “ flexible surgical clip applier ”, filed simultaneously herewith . unlike the previously incorporated co - owned application , the jaws of the instant clip applier are significantly longer and designed for use with clips approximately 17 - 20 mm long ( after the clip is applied ) as compared to the 5 - 7 mm clips shown in the previously incorporated co - owned application . turning now to fig5 - 8 , a second embodiment of the jaws 22 ′, 24 ′ is illustrated . the jaws 22 ′, 24 ′ are substantially identical to each other and are designed for use with any of the clips illustrated in fig1 - 24 . each jaw 22 ′, 24 ′ includes a proximal tang 38 ′, 40 ′, a mounting bore 42 ′, 44 ′, a distal hook shaped anvil 46 ′, 48 ′ and a plurality of medial teeth 50 ′, 52 ′. the medial teeth 50 ′, 52 ′ are arranged on one side of the jaw and a short wall 51 ′, 53 ′ is arranged on the opposite side of the jaw to define a groove ( or guiding channel ) 54 ′, 56 ′. the grooves 54 ′, 56 ′ meet the interior surfaces of the anvils 46 ′, 48 ′ which curve about a single axis . the interior surfaces of the anvils act to bend the clip retainers as described below with reference to fig1 - 24 and as shown by the clip 310 in fig5 . according to this embodiment , as seen best in fig6 - 8 , the guiding channels 54 ′, 56 ′ and the anvils 46 ′, 48 ′ are angled relative to the vertical axis of the jaw 22 ′, 24 ′. this angle causes the clip to twist as it is pushed through the jaws so that the ends of the clip are offset as shown in fig5 , for example . according to the presently preferred embodiment , the guiding channels 54 ′, 56 ′ and the anvils 46 ′, 48 ′ are angled approximately 22 ° relative to the vertical axis of the jaw 22 ′, 24 ′. according to a method of the invention , clips for use with this embodiment of the jaws are pre - bent in the bridge area to facilitate movement through the angled channels . fig2 illustrates an enlarged portion of the clip applier of fig5 showing that the clip 310 rests inside an applier groove 54 ′, 56 ′ and is bent by the anvil 48 ′ as it pierces a folded over portion of body tissue 500 . referring now to fig9 , a third embodiment of the jaws 22 ″, 24 ″ is illustrated . the jaws 22 ″, 24 ″ are not identical to each other and are designed for use with clips of the type illustrated in fig1 - 18 . each jaw 22 ″, 24 ″ includes a proximal tang 38 ″, 40 ″ and a mounting bore 42 ″, 44 ″. one jaw 22 ″ terminates with two spaced apart distal hooks 46 ″, 47 ″ and has two rows of medial teeth 50 ″. the other jaw 24 ″ terminates with a single distal hook shaped anvil 48 ″ and has two rows of medial teeth 52 ″. the medial teeth 50 ″, 52 ″ are arranged on both sides of the jaw and a groove ( or guiding channel ) 54 ″, 56 ″ lies between the rows of teeth . the groove 54 ″ terminates with an undercut well ( not shown ) as described in co - owned ser . no . 10 / 010 , 908 , whereas the groove 56 ″ continues on to the interior of the anvil 48 ″ which has a surface which curves about a single axis . those skilled in the art will appreciate that when the jaws are closed , the anvil 48 ″ will reside between the hooks 46 ″ and 47 ″ and the teeth 50 ″ will be interleaved with the teeth 52 ″. the interior surface of the anvil 48 ″ bends the clip retainer as described below with reference to fig1 - 18 and as shown and described in previously incorporated co - owned applications ser . no . 09 / 891 , 775 , and ser . no . 10 / 010 , 908 . turning now to fig1 - 14 , a method of using the clip applier of the invention is illustrated in context with an existing endoscope 100 having a single lumen through which a small grasper 102 is supplied and an external working channel 104 which is attached to the scope 100 and through which the clip applier is delivered . the external working channel 104 is preferably one of the type described in previously incorporated application ser . no . 09 / 931 , 528 , filed aug . 16 , 2001 , entitled “ methods and apparatus for delivering a medical instrument over an endoscope while the endoscope is in a body lumen ”. according to a method of the invention , after the endoscope assembly is delivered transorally to the procedural site , as shown in fig1 , the fundus is grasped by the graspers and pulled in between the open jaws of the clip applier . the jaws of the clip applier are then closed onto the invaginated fundus as shown in fig1 . as the jaws are closed the medial teeth of the jaws puncture the invaginated fundus as shown in fig1 and 12 . when the jaws are completely closed ( or closed as much as possible ), they are preferably locked , the grasper is optionally released , and the clip pusher is activated to push forward , advance , and / or slide , with or without tissue contact , a clip 106 as shown in fig1 and as described in the previously incorporated , co - owned , simultaneously filed application and discussed in detail hereinafter . after the clip 106 is applied , the jaws of the clip applier are opened as shown in fig1 and the clip 106 remains in place and plicates the fundus . depending on the location of the clip and the nature of the patient &# 39 ; s condition , a single clip may be sufficient . if other clips are deemed desirable by the practitioner , the clip applier is removed and re - loaded with another clip . after re - delivering the clip applier , the procedure may be repeated at another location as shown in fig1 . given the size of the clips of the invention , anywhere from 1 - 4 clips will typically be used . according to one aspect of the invention , the medial teeth on the jaws of the clip applier are long enough and sharp enough to damage the fundus sufficiently such that when the fundus heals adhesion occurs , binding the plicated fundus to the extent that the clip may no longer be needed . thus , preferably , the teeth are long enough to pierce all layers of the fundus . from the foregoing , those skilled in the art will appreciate that the methods of the invention may be performed with different types of graspers . in particular , alternative grasping devices such as a “ cork screw ” grasper can be used in conjunction with the clip applier of the invention to perform the methods of the invention . it will also be appreciated that the clip applier of the invention may be attached to an endoscope in other ways as described in previously incorporated application ser . no . 09 / 931 , 528 , filed aug . 16 , 2001 , entitled “ methods and apparatus for delivering a medical instrument over an endoscope while the endoscope is in a body lumen ”. as mentioned above , the clip applier of the invention has an outside diameter of approximately 6 mm . as shown in fig1 - 14 , the clip applier is used in conjunction with an endoscope having an outside diameter of approximately 12 mm . to accommodate the clip applier , an exterior working channel having an exterior diameter of approximately 7 mm is optionally coupled to the endoscope as described in the previously incorporated co - owned applications ser . no . 09 / 931 , 528 and 60 / 292 , 419 . fig1 is a scale representation of the cross - sectional area of the 12 mm endoscope 100 with the attached external 7 mm working channel 104 , shown in horizontal shading . the cross sectional area of a prior art device 108 having an exterior diameter of approximately 24 mm is shown in diagonal shading . from fig1 , it will be appreciated that the methods and apparatus of the invention allow for a substantially smaller device which is more easily delivered transorally and which is more easily manipulated . the overall cross - sectional area of the apparatus of the invention is approximately 152 mm 2 as compared to the 314 mm 2 of the prior art devices . as mentioned , the clip applier of the invention may also be used with a dual lumen endoscope . fig1 is a scale representation of a dual lumen endoscope 110 having an optical lumen 112 and two 6 mm working lumina 114 , 116 . as compared to the device 108 in fig1 , the endoscope 110 has a substantially smaller cross - sectional area than the prior art device . the clips used by the clip applier of the invention are substantially longer than the clips described in the previously incorporated co - owned applications , ser . no . 09 / 891 , 775 and the simultaneously filed application , which are approximately 7 mm in length and adequate for general surgical applications . the retainer portion of the clips of the present invention is substantially longer in order to assure that all of the layers of the fundus are punctured . turning now to fig1 and 18 , a first embodiment of a surgical clip 210 according to the invention includes first and second arms 212 , 214 , respectively , and a bridge portion 216 therebetween such that the arms and bridge portion are in a generally u - shaped configuration . the first arm 12 is provided with an end catch 220 , and the second arm 214 extends ( or transitions ) into a deformable retainer 222 having a tissue piercing tip 224 and a plurality of catch engagements , e . g . 226 , 228 . the arms define an open space 230 between them . the clip 210 is preferably made from a unitary piece of titanium , titanium alloy , stainless steel , tantalum , platinum , other high z ( substantially radiopaque ) materials , nickel - titanium alloy , martensitic alloy , or plastic , although other suitable biocompatible materials may be used . the first and second arms 212 , 214 , as well as the bridge portion 216 are relatively stiff and not plastically deformable within the limits of force applied to the arms during use , while the retainer 222 is relatively easily plastically deformable by the clip applier . referring now to fig2 - 4 and 17 - 18 , when the clip 210 is pushed forward in the clip applier with the jaws 22 , 24 of the clip applier closed , the retainer 222 is bent across the opening 230 between the first and second arms 212 , 214 and into engagement with the end catch 220 of the first arm 212 as shown in fig1 . the anvil formed by the grooves on the interior of the hooks 46 , 48 of the clip applier jaws guide the bending of the retainer 222 causing it to puncture the fundus and couple to the end catch 220 . the clip 210 shown in fig1 and 18 is provided with an optional bendable barb 232 which provides a secondary stabilizing fixation point which helps keep the clip from rotating . as the clip is pushed forward over the fundus , tissue catches the barb 232 and bends it as shown in fig1 . the clip 210 is also provided with an ear 233 on the bridge 216 . the ear is used by the pushing mechanism ( not shown ) to grasp the end of the clip when it is loaded into the clip applier . a second embodiment of a clip 310 according to the invention is shown in fig1 and 20 . the clip 310 has two arms 312 , 314 connected by a bridge 316 . both arms terminate in retainers 320 , 322 , each having a sharp end 321 , 323 . in one embodiment , each of the retainers 320 , 322 extend from their respective arms 312 , 314 in a direction that is substantially parallel to , or at least non - perpendicular to , the respective arm from which it extends . the clip 310 is also provided with a pair of ears 333 , 335 on the bridge 316 . the ears are used by the pushing mechanism ( not shown ) to grasp the end of the clip when it is loaded into the clip applier . this embodiment is intended for use with a clip applier having hooks with interior grooves which diverge , or which are in parallel planes . with reference to fig2 - 4 and 15 - 16 , when the clip 310 is pushed forward , the retainer 320 is bent by the groove inside the hook 46 and the retainer 322 is bent by the groove inside the hook 48 to the configuration shown in fig2 . from fig2 , it will be appreciated that each retainer punctures the fundus twice substantially forming a circular fastener . thus , it will also be appreciated that the retainers 320 , 322 are significantly longer than the retainer 222 shown in fig1 and 18 and preferably are of a length at least p times the distance between the arms 312 , 314 . insofar as the retainers 320 , 322 each form a complete fastener , the function of the arms 312 , 314 and the bridge 316 may be considered redundant . fig2 - 23 illustrate a third embodiment of a clip 410 according to the invention . the clip 410 is similar to the clip 310 ( with similar reference numerals increased by 100 referring to similar parts ) except that the retainers 420 , 422 are removable from the arms 412 , 414 . the arms 412 , 414 terminate in female couplings 413 , 415 which receive ends of the retainers 420 , 422 in a slight interference fit . the clip 410 is also provided with a pair of ears 433 , 435 on the bridge 416 . the ears are used by the pushing mechanism ( not shown ) to grasp the end of the clip when it is loaded into the clip applier . the clip 410 is applied to the fundus in substantially the same way as described above with reference to the clip 310 . however , after the retainers 420 , 422 are bent by the anvils and the jaws are opened , the clip 410 is not released from the clip applier and the retainers are separated from the arms 412 , 414 . the resulting fastener formed by the retainers 420 , 422 is shown in fig2 . this is actually two substantially parallel “ b ” shaped fasteners . thus , it may only be necessary to apply a single retainer as shown in fig2 , for example . there have been described and illustrated herein several embodiments of methods and apparatus for the endoluminal treatment of gastroesophageal reflux disease . while particular embodiments of the invention have been described , it is not intended that the invention be limited thereto , as it is intended that the invention be as broad in scope as the art will allow and that the specification be read likewise . it will therefore be appreciated by those skilled in the art that yet other modifications could be made to the provided invention without deviating from its spirit and scope as so claimed .
| 0 |
fig1 shows a first preferred embodiment of the present invention including a container end 10 with a mouth or pour opening defined by a mouth panel 30 , and a vent opening defined by vent panel 62 . the container end 10 may include a peripheral seam or rim 12 that is secured to the cylindrical body ( not shown ) of the container . located radially inside the peripheral seam 12 is a peripheral channel or depression 14 . located radially inward of the peripheral channel may be one or more ridges or forms 16 , created in a concentric arrangement as shown . located within the ridge 16 is the main panel 18 . another ridge 20 is shown radially within the main panel 18 . the most interior portion of the lid is defined by a depressed or lowered interior panel 22 located within the ridge 20 . a mouth score 26 defines the peripheral boundary of the mouth panel 30 . another formed area or ridge 24 is shown as surrounding the mouth score 26 and located interiorly of the panel 22 . optionally , one or more additional formed areas or ridges 28 may be located on the mouth panel 30 . the various formed areas / ridges provide additional strength for the container end , and it shall be understood that the number and configurations of these elements can be changed without departing from the present invention . therefore , it will be understood that the particular arrangement shown in fig1 is but one example of various formed areas / ridges that can be used . located at the center of the container end 10 is a rivet 38 that holds the rotatable tab to the container . the tab includes a handle end 32 , a pressure applying end 34 , and a body 36 interconnecting the ends . the tab further includes the characteristic semi - circular shaped opening 40 that enables a user to lift the handle end 32 of the tab , thereby placing the pressure applying end 34 in contact with the mouth panel 30 . as shown , the semi - circular shaped opening 40 is oriented to partially surround the rivet 38 . with adequate pressure applied , the mouth score 26 fails , enabling the mouth panel 30 to rotate inward towards the contents of the container , thereby forming the mouth opening . the vent of the container end is defined by a raised vent panel 62 and a peripheral vent score 60 defining the peripheral edge of the vent panel 62 . force is applied against the raised vent panel 62 in order to break the vent score 60 , thereby forming a vent opening . the vent panel 62 remains attached to the container end along vent bending line 64 . the bending line 64 is not scored , but defines the area along which the vent panel 62 bends . in order to facilitate easier bending of the vent panel along this line 64 , the vent panel may be dimpled along the line 64 , such as by forming a crease that reduces the thickness of the panel . optionally , the area located circumferentially exterior of the vent score 60 , shown as edge 66 , may be formed or creased in order to provide additional strength around the vent score 60 enabling it to more easily separate when force is applied against the vent panel 62 . fig2 is an enlarged view of the vent , better illustrating the arrangement of the vent elements . the bending line 64 extends substantially perpendicular to a radial line extending from the center of the container lid at the rivet 38 . the vent is circular or elliptical shaped in the fig2 , but the shape of the vent can be modified . when the tab is in its normal orientation , that is , aligned so that the end 34 is in position to contact the panel 30 , the vent panel 62 is not covered by the tab . the vent panel 62 is located between one side edge of the tab and the bend or ridge 20 . the vent panel is also shown as being located laterally offset from the tab as compared to the axis y - y , and between the rivet 38 and the handle end 32 of the tab . fig1 illustrates the offset from the central axis y - y at an angle a . this angle a is shown in the preferred embodiment as being approximately 45 degrees . however the angle a can be in the range of between about 33 to 50 degrees . referring to fig3 a , the convex shape of the raised vent panel 62 is illustrated . as shown , the vent score 60 is formed in the material and the circumferential edge 70 of the panel 62 may be flat or co - planar with the surrounding interior panel 22 . a raised convex portion 72 lies within the circumferential edge 70 . the convex portion 72 is shown as being symmetrical about center axis - x - x . the highest point on the raised convex portion 72 is shown as point 74 that intersects the center axis x - x . referring to fig3 b , an alternate embodiment is shown for the raised vent panel 62 . the vent panel 62 is not symmetrical about the center axis x - x -, but rather is skewed or shifted to one side of the center axis . more specifically , the vent panel 62 has the flat circumferential edge 70 , but the symmetrical convex shape is replaced with an asymmetrical protrusion having a steeper sloping side 76 , and a more gradual sloping slide 78 . in the example of fig3 b , the steeper sloping side 76 would be located closest to the portion of the vent score 60 opposite the vent bending line 64 when viewing fig2 . pressure applied by the tab against the raised vent tab would first break the score at this location , which may be advantageous in creating the vent opening . however , it shall be understood that asymmetrical shaped vent panel 62 shown in fig3 b could be configured so that the steeper sloping side 76 is located closer to any selected location around the vent score 60 in order to thereby manipulate the breaking of the vent score in a controlled manner . referring to fig4 , a cross - sectional view is shown of the concave formed area 50 of the tab . the concave area 50 is characterized by a gradual circumferential sloping edge 52 that transitions into a symmetrical curved portion 56 terminating at a lowest point 54 . the concave area 50 is symmetrical about the axis x 1 - x 1 , and the lowest point 54 intersects this axis x 1 - x 1 . preferably , the concave area 50 extends continuously between lateral side edges of the handle end 32 of the tab and extends continuously between the rear edge of the handle end 32 and the more forward portion of the handle end 32 adjacent the semicircular shaped opening 40 . when the user wishes to open the vent , the user may rotate the tab as shown in fig5 so that the concave area 50 is centered over the raised vent panel 62 . referring to specifically to fig6 , the concave area 50 is centered over the vent panel 62 . pressure applied downwardly against the tab results in contact of the concave area 50 against the vent panel 62 . with adequate force , the vent score 60 is broken , thereby creating a vent opening for the container . as shown in fig6 , one preferred embodiment includes alignment of the vent panel 62 with the concave area 50 so that both are symmetrical about the axis x - x . referring to fig7 , the asymmetrical raised vent panel 62 of fig3 b is illustrated . the lowest point 54 of the concave area 50 makes contact with the skewed or shifted location of the highest point 74 of the vent panel 62 . according to this figure , a greater amount of the initial force transferred from the tab to the vent panel 62 would be concentrated along the portion of the score 60 closest to the steeper side 76 of the vent panel . thus , one advantage of providing an asymmetrical - shaped vent panel 62 is that force may be directed to be concentrated along any portion of the vent score 60 in order to controllably commence breakage of the score to create the vent opening . referring to fig8 , another embodiment is shown in which the concave area 50 of the tab is shifted to the right and therefore , does not contact the raised vent panel 62 at the highest point 74 , but rather , contacts the vent panel 62 along the gradual sloping side 78 . shifting of the tab in this manner can be achieved either by shortening the length of the tab handle end 32 or moving the location of the vent panel 62 radially outward from the center of the container end . with the arrangement shown in fig8 , yet a different type of breakage will occur along the score 60 that may be more advantageous for a particular type of tab used , as well as other factors in the overall design of the container lid . referring to fig9 , yet another embodiment is shown in which the shape of the concave area 50 is changed to accommodate a controlled direction and location of applied force . in this figure , the vent panel 62 is a symmetrical shaped convex raised area while the concave area is asymmetrical having a steeper sloping side 80 and a more gradual sloping side 82 . thus , with this arrangement , the application of force can be controlled with the preselected shape of the concave area 50 . it is further contemplated that both the vent panel 62 and the concave area 50 can be asymmetrically shaped in order to control the direction and location of applied force . the advantageous configuration of the raised vent panel and the protruding vent panel provide a great number of options for fine control of force applied to break the vent score . with the combination of the raised vent panel along with the concave - formed area on the tab , an effective structure is provided for creating a vent opening in the container lid . the vent opening may also be created by use of some other implement to push in the vent panel . one readily apparent advantage of the present invention is that the user does not have to use the hand to create the vent opening , which may otherwise create a safety concern by contact of the user &# 39 ; s hand with the exposed edge of the container end surrounding the vent panel . the force multiplying attribute of the concave formed area of the tab provides an effective tool for creating the vent opening . according to the method of the present invention , a user may first create the mouth opening and then the vent opening , or vice versa . when the vent is to be opened , the user may take advantage of the force multiplying feature in the concave area of the tab . rotation of the tab and alignment of the handle end of the tab to cover the vent panel provides an optimum position for applying force to contact the vent panel . the method also involves selected force transfer by the tab to the raised vent panel by shaping the vent panel so that the highest point on the vent panel is located closest to the desired location where vent score breakage is to occur . the method also contemplates controlled and directed application of force by configuring the location where the concave portion of the tab contacts the raised vent tab . either the vent panel or the concave portion of the tab , or both , may be shaped to control and direct the application of force . although the invention has been described with respect to preferred embodiments , it shall be understood that various changes and modifications may be made considering the teachings of the invention as a whole , and taking into consideration the scope of the claims appended hereto .
| 1 |
referring now to the drawings , preferred embodiments of the apparatus for applying a viscous liquid material according to the present invention will be described . fig7 is an explanatory view generally showing a systemic construction of an embodiment of the apparatus for applying a viscous liquid material according to the present invention . the apparatus 20 of this embodiment is illustrated as a frit coater , and it includes a main tank 22 and two sub - tanks 24 each of which is connected to the main tank 22 through a flexible tube 26 , respectively , in order that a viscous liquid material , specifically , a frit in this embodiment , can be distributedly applied to two objects , or two funnels 2 , at a time . of course , the apparatus may include only one sub - tank . the main tank 22 has a large capacity for storing a sufficient amount of the frit , for example , about 50 liters . on the other hand , the sub - tank 24 has a rather small capacity such that only an amount of frit which is necessary for application treatment to one object to three objects to be applied can be contained . each of the sub - tank 24 is supported by a movable hand 28 which is operated by a robot 30 ( these of the right side sub - tank unit are omitted from the drawing ) above each of production lines ( not shown ) which runs along a direction perpendicular to the plane of the drawing in this embodiment and transports funnels 2 to be applied to a location under the sub - tank 28 . the sub - tank 24 moves with the hand 28 relative to an applied surface of the funnel 2 in order to draw a band of frit on the surface to be applied , with being controlled by the robot 30 . of course , if necessary , the production lines can be modified so that the funnel also can move for application treatment . an air line pipe 32 is provided on the main tank 22 for pressuring the frit inside thereof to feed the frit to the sub - tanks 24 through the tubes 26 . moreover , inside the main tank 22 provided is an agitating blade 34 which is rotated by drive of a motor 36 . at a bottom of the main tank 22 , each of two control valves 38 are arranged between each of the tubes 26 and the main tank 22 , respectively . inside of each of the sub - tanks 24 provided is an agitating blade 40 which is rotated by an actuator 42 such as a motor . moreover , each of the sub - tank 24 is connected by a line tube 44 to a solenoid valve 46 through a vaporizing tank 48 for supplying an atmosphere of vaporized solvent and a regulator 50 , so that a vaporized solvent is fed into the sub - tank 24 to pressure the frit at a preset pressure level , being controlled by the regulator 50 . moreover , at a bottom of each of the sub - tanks 24 , an injection port 52 for discharging the frit from the sub - tank 24 , details of which will be described hereinafter , is formed respectively , and a shutter device 54 is arranged on the sub - tank 24 so as to open and close the injection port outside the sub - tank 24 . according to this construction , if the shutter device 54 opens the injection port 52 , the frit is injected , being pressed out by the preset level of vapor pressure . moreover , a level sensor 56 is provided on each of the sub - tank 24 on the side thereof , and the level sensor 56 sends information concerning the frit level in the sub - tank 24 to the corresponding control valve 38 so that , if the frit level in either of the sub - tanks 24 falls down to a predetermined level , the corresponding control valve 38 opens to supply the frit from the main tank 22 to the sub - tank 24 . outside of each of the sub - tank 24 near the injection port 52 , a sensor 58 ( this for the right side unit is omitted from the drawing ) is arranged for detecting an initial point of the frit band drawn on the funnel 2 during the application treatment , details of which will be described hereinafter . fig8 shows details of the main tank 22 . the main tank 22 is supported by a frame 60 . the motor 20 is fixedly mounted on the upper portion of the frame 60 and connected to the agitating blade 34 through a bearing unit 62 which is fixed with the frame 60 , a transmission part 64 and a universal joint 66 . the main tank 22 has a window 68 on the top thereof , through which the frit is supplied into the tank 22 . it can also serve as a observation hole . moreover , a leak valve and a pressure indicator ( not shown ) are arranged on the main tank 22 . the main tank 22 also includes a distributor 70 which is connected to the control valves 38 and the tubes 26 . in order to maintain the temperature of the frit in the main tank 22 at a predetermined level , the main tank 22 is covered with a thermostatic chamber 72 in which isothermic water is fed from an inlet tube 74 to an outlet tube 76 . the numeral 78 depicts a control panel . according to the above construction , a frit which is supplied from the window 68 into the main tank 22 is agitated by the blade 34 , while its temperature is maintained to the predetermined level by the water supplied from the inlet tube 74 to the thermostatic chamber 72 . supply of the frit from the main tank 22 into either of the sub - tanks 24 is controlled by operating the corresponding control valve 38 appropriately in accordance with information given from each side of the sub - tanks for requesting frit supply . for the supply to the sub - tanks , there may arises a slight deterioration of the feeding pressure due to employment of the flexible tubes 26 for connection . nevertheless , it does not cause any problem about frit application at the injection ports , because the frit is further pressured in each of the sub - tanks 24 . moreover , in the present invention , since the pressure applied to the frit in the main tank 22 can be decreased to a level such as being required only for feeding the frit from the main tank 22 to the sub - tanks 24 , it can avoid excess load and a large decrease of the pressure at the valve 38 which may badly affect the frit . fig9 shows the robot 30 with the movable hand 28 in detail . the robot 30 comprises an x - axis displacement unit 80 , y - axis displacement unit 82 and a z - axis displacement unit 84 for operating the hand 28 in three dimensional movement . the hand 28 which holds the sub - tank 24 is connected through the y - axis displacement unit 82 to a support arm 86 , and the arm 86 is supported on a body 88 in such a manner that the arm can be shifted by the z - axis displacement unit 84 along a vertical direction which is illustrated by an arrow z in fig9 . the body 88 is mounted on the x - axis displacement unit 80 so as to be movable along a horizontal direction which is shown by an arrow x in fig9 . the y - axis displacement unit 82 includes first , second and third parts 90 , 92 and 94 . the first part 90 is fixed to the arm 86 , and the second part 92 which extends horizontally is connected to the first part 90 at a base portion thereof in such a manner that the second part 92 can rotate relative to the first part 90 with respect to a rotational axis b which is parallel to the direction z . the third part 94 extending vertically is connected at one end thereof to a tip portion of the second part 92 rotatably with respect to a rotational axis c which is also parallel to the direction z , and the hand 28 is fixed to the other end of the third part 94 and extends horizontally . accordingly , an amount of y - directional displacement of the sub - tank 24 can be preferably regulated by appropriately controlling a rotation angle θ 1 of the second part 92 and a rotation angle θ 2 of the third part 94 and the hand 28 . according to the above construction , the robot 30 can voluntarily shift the position of the sub - tank 24 above a funnel . moreover , the robot can be operated under computer - automated control in order to automatically and cyclically repeat a predetermined stroke of application such as a round stroke of frit coating along a brim of a funnel and the like . fig1 illustrates a set of the sub - tank 24 and the shutter device 54 in detail . in regard to the sub - tank 24 , a nozzle member 96 with a nozzle hole 97 which is narrowed to the injection port 52 is fitted on the bottom of the sub - tank 24 with a screw , so that frit charged to the sub - tank 24 is vertically injected through the nozzle hole 97 out of the injection port 52 . on the other hand , the shutter device 54 , which is set beside the sub - tank 24 so as to accompany the sub - tank 24 for application operation , comprises an air cylinder device 98 with a piston rod 100 which can move in a horizontal direction . a guide plate 102 is fixedly connected to the air cylinder 98 through a support member 104 so that the plate 102 is horizontally located below the sub - tank 24 . a shutter plate 106 interposes between the nozzle member 96 and the guide plate 102 so as to slide on the guide plate 102 . moreover , a rod 108 is arranged on the support member 104 in such a manner that it can rotate with respect to a center 110 between the air cylinder 98 and the shutter plate 106 . one end of the rod 108 is connected to the piston rod 100 and the other end is inserted in a hole 112 which is formed on an end portion of the shutter plate 106 so that , in response to reciprocal motions of the piston rod 100 , the rod 108 swings to reciprocally slide the shutter plate 106 in a horizontal direction which is shown by an arrow d in fig1 . the shutter plate 106 has a bore 114 whose dimension at the upper side of the plate 106 is preferably larger than that of the injection port 52 so as to smoothly pass the frit therethrough . however , it is of course possible to use a bore having the same size as that of the injection port at the upper side of the plate . moreover , the dimension of the bore is increased at the lower side of the plate . the guide plate is provided with an aperture 116 at a location under the injection port 52 , and the size of the aperture 116 is preferably larger than those of the injection port 52 and the bore 114 in order to easily pass the injected frit therethrough . according to the above construction , if the piston rod 100 reciprocally moves , the shutter plate 106 reciprocally slides in the directions opposite to the motions of the piston rod . accordingly , in fig1 , the bore 114 shifts between a position under the injection port 52 and a position on the right side of the injection port 52 in the drawing , thereby releasing and covering the injection port 52 . therefore , if the sub - tank is then moving in the direction shown by an arrow e in fig1 along the sliding direction d of the shutter plate 106 , the injection port is opened in accordance with a backward movement of the bore 114 and is closed with a forward movement . fig1 shows a modified arrangement of the bore 114 . in this embodiment , the bore 114 is located so that it reciprocates between a position under the injection port 52 and a position on the left side of the injection port 52 in the drawing . therefore , if the sub - tank is then moving in the direction shown by an arrow e in fig1 , the injection port opens in accordance with a forward movement of the bore 114 and closes with a rearward movement . of course , it is also possible to bring such an operation state by using the shutter device 54 of fig1 , if the sub - tank 24 of fig1 is moved in a direction opposite to the direction e . in the above embodiments , injection of the frit is stopped at the nozzle port 52 by a flat and thin shutter plate moving along a plane crossing the direction in which the frit is injected from the port , and the shutter plate breaks in and cuts off the corded frit injection like a knife . therefore , it can prevent frit near the injection port from being undesirably forced out of the nozzle in such a manner that a valve body forces in the prior art apparatus which is shown in fig1 and 2 and described above . the direction in which the frit is injected can be altered as necessity arises , and an angle formed between the injection direction and the plane on which the shutter plate moves also may be changed . however , in view of equality of application efficiency in omnidirectional movement of the injection port , it is preferred that the injection is directed perpendicularly to the surface to be applied and the plane along which the shutter plate moves crosses the injecting direction perpendicularly . therefore , in the above embodiments , the injected frit is directed to the vertical direction , and the shutter plate is arranged to move horizontally , namely perpendicularly to the injecting direction . moreover , if necessary , it is also possible to use a curved shutter plate to slide on a plane curved correspondingly and cover the injection port . moreover , since the bore 114 is tapered toward the injection port 52 to form an acute edge like a knife around the bore 52 on the upper side of the shutter plate 106 , the edge can sharply cut in the frit injected from the port 52 when the upper surface of the plate covers the injection port . therefore , an amount of the injected frit can be accurately regulated . moreover , it is of course possible to use a shutter plate with no bore and arrange the shutter plate so as to cover the injection port at a peripheral end portion of the shutter plate . in this case , the peripheral portion is preferably edged with an acute angle in a manner similar to that described above . the edged periphery may be shaped to draw a curve such as an arc line and the like . in each of the above embodiments , the air cylinder 98 is connected via a flexible hose to a solenoid valve device ( not shown ) for driving the air cylinder , thus the shutter plate 106 and the rod 108 are not directly driven by the solenoid valve device , but are indirectly driven via the air cylinder 98 . the reason for this is because air cylinders are generally lighter in weight than solenoid valve devices , and also the moving velocity of the shutter plate 106 can be controlled easier by an air cylinder than by a solenoid valve device . fig1 shows a modification of the nozzle hole 97 . in this embodiment , the nozzle hole 97 is formed so as to include a cylindrical pass vertically extending to the injection port 52 and having substantially the same diameter size d as that of the injection port 52 . the length h of the cylindrical pass is larger than the diameter d . according to this construction , flow of the frit before injection is rectified to be uniformly introduced to the injection port 52 . therefore , due to the improvement of directionality of the frit flow , the direction in which the frit is injected from the injection port can be prevented from fluctuation . fig1 is a diagrammatic view showing a relationship between the operation speed ( a ) of the robot hand 28 , operation ( b ) of the shutter plate 106 and detection ( c ) of the initial point by the sensor 58 for explanation of operation timing . in this drawing , the robot hand 28 begins to trace on an application track at a time t 1 from an origin which lies on the track , and a tracing speed increases and reaches to a constant value v n . next , the shutter plate 106 begins to open the injection port 52 at a time t 2 at which the viscous liquid in the sub - tank 24 begins to be injected from the injection port 52 , and completes the opening at a time t 3 . the moving velocity of the shutter plate 106 and the bore 114 relative to the injection port 52 being a definite value v s1 , a period δt (= t 2 - t 1 ) which is necessary for completely opening the injection port 52 practically lies within a range of about 0 . 05 to 0 . 1 sec . during this period δt , the sub - tank 24 and the injection port 52 cover a distance of v n · δt , that is , a multiplication of the tracing speed v n of the sub - tank by the period δt for the open operation . fig1 ( a ), 14 ( b ), 14 ( c ), 15 and 16 illustrate initiation of the frit application achieved by the embodiment of the apparatus shown in fig1 . in fig1 ( a ) through ( c ), the shutter plate 106 with the bore 114 oppositely moves at the velocity v s1 relative to the injection port 52 which travels at the velocity v n . the shape of an opening s 1 made by the edges of the injection port 52 and the bore 114 changes through ones shown in fig1 ( a ) and ( b ) to one in fig1 ( c ). accordingly , a tip portion 118 of the injected frit , in theory , must be shaped corresponding to change of the opening , and it actually resembles to the shape shown in fig1 especially when a viscosity of the liquid material is rather high . however , since liquid materials easily change shape any time in accordance with forces which works thereon , an actual shape of the injected frit may be varied from one which is shown in fig1 according to many factors such as a viscosity , a density and a surface tension of the liquid , an injecting volume and the like . the tip portion 118 of the frit after injected reaches on the applied surface of the funnel 2 and makes a band of the frit on the surface , tracing on a track to be applied , as shown in fig1 . fig1 ( a ), 17 ( b ), 17 ( c ) 18 , and 19 show initiation of application achieved by the embodiment of the apparatus shown in fig1 . in fig1 ( a ) through ( c ), the injection port 52 which moves rightwards in the drawing at the velocity v n , and the shutter plate 106 and the bore 114 move at the velocity v s1 relative to the injection port 52 in the same direction as that in the injection port 52 . the shape of an opening s 2 at the injection port 52 changes through ones shown in fig1 ( a ) and ( b ) to one in fig1 ( c ). accordingly , a tip portion 120 of the injected frit also must be shaped correspondingly as shown in fig1 . however , since a viscous liquid material easily changes the shape any time in accordance with forces which works thereon , an actual shape of the frit may be varied from one which is shown in fig1 according to many factors such as a viscosity , a density and a surface tension of the liquid and the like . in the above description , it may also be expected that the motion of the shutter plate 106 at the velocity of v s1 affects the injection of the frit to incline the injected frit toward the direction in which the shutter plate moves , namely leftwards in fig1 and rightwards in fig1 , respectively . however , this seems quite uncertain , because other factors also affect the results in a complicated manner . moreover , the frit shape at the tip may change with time before the tip reaches on the funnel . in particular , during application process through which the injection port makes a loop and returns to the initial point of the frit band , the initial frit is somewhat deformed due to the weight of the frit itself to laterally spread and be flattened . therefore , there would be found no longer a clear difference in shape of the initial portion between both cases described above , and any tip portion of the applied liquid has similarly an inclined and curved outline as shown by a broken line in fig1 and 19 . while the follow of the application track is continued , the band of the frit is drawn and extended uniformly , with being slightly spread laterally due to the weight of the frit . making a loop , the injection port 52 then approaches the initial point again from the opposite side of the initial point to the frit band lying . the sensor 58 detects presence of the initial portion of the frit band and signals to the shutter device at a time t 4 in fig1 . the shutter plate 106 begins to close the injection port 52 at a time t 5 that is later than the time t 4 by a period δt which is previously set by using a timer . since a suitable period δt changes in accordance with location of the sensor 58 , responsibility of the shutter plate 106 , a distance between the injection port 52 and the surface to be applied and the like , it is preferred to be settled by making trial of application , correcting the period δt little by little and appropriately repeating them so that a tail portion of the injected frit suitably falls on the initial portion of the frit band to be joined together . the shutter plate 106 moves at a velocity of v s2 relative to the injection port and completely close the injection port 52 at a time t 6 . after that , motion of the robot hand 28 is decelerated at a time t 7 and completely stopped at a time t 8 to finish a cycle of application . then , the treated funnel moves away and the next funnel comes up under the sub - tank along the production line , before another cycle of frit application starts at a time t 9 . fig2 ( a ), 20 ( b ), 20 ( c ), 21 and 22 illustrate termination of tracing in the case of using the apparatus shown in fig1 . at the time t 5 , the shutter plate 106 begins to close the injection port 52 in the forward direction , or in the same direction as that of the motion of the injection port 52 , at a velocity v s2 relative to the injection port 52 , and the opening s 1 at the injection port 52 changes its shape from one shown in fig2 ( a ) through ones in fig2 ( b ) and 20 ( c ). accordingly , a terminal portion 122 of the injected frit , in theory , is shaped correspondingly as shown in fig2 . the terminal portion 122 of the frit then falls on the initial portion 118 of the frit band , while being deformed by the weight of the frit , as shown in fig2 and 22 to be fused and . joined together with time . of course , since liquid materials easily deform any time in accordance with forces which works thereon , an actual shape of the frit may be slightly varied from ones which are shown in fig2 and 22 according to differences in various factors such as a viscosity , a density and a surface tension of the liquid , an injecting volume and the like . in the above case , the motion velocity v s2 of the shutter plate 106 also can affect the results . namely , due to viscosity of the liquid material and the like , the terminal end portion of the frit can be slightly attracted forwards by the shatter plate 106 moving forwards to be further tapered , so that a sectional view of the frit is smoothly thinned according to termination . this is considered to be advantageous in ease of joining of the both end portions and result in fine finishing of products . fig2 ( i a ), 23 ( b ), 23 ( c ) 24 and 25 illustrate termination of tracing in the case of the apparatus shown in fig1 . at the time t 5 , the shutter plate 106 begins to close the injection port 52 in the rearward direction , or the opposite direction to that of the motion of the injection port 52 , at a velocity v s2 relative to the injection port 52 , and the opening s 2 at the injection port 52 changes its shape from one shown in fig2 ( a ) through ones in fig2 ( b ) and 23 ( c ). accordingly , a terminal portion 122 of the injected frit is also shaped correspondingly as shown in fig2 . the terminal portion 122 of the frit then falls on the initial portion 120 of the frit band , while being deformed by the weight of the frit , as shown in fig2 and 25 to be fused and joined together with time . here , for the same reason as described above , an actual shape of the frit may be slightly different from ones which are shown in fig2 and 25 , similarly . moreover , in this case , the motion velocity v s2 of the shutter plate 106 is considered to affect the results so that the terminal portion of the frit is slightly attracted rearwards with the shatter plate 106 moving relatively rearwards , being bent slightly upwards . therefore , a section of the frit is smoothly thinned according to termination , and additionally , a lower surface of terminal portion 124 of the frit curves so as to suite the upper curved surface of the initial portion 120 of the frit . as a result , the terminal portion 124 can easily merge into the initial portion 120 . fig2 ( a ) and 26 ( b ) show a join of the initial and terminal portions of the frit band . as appeared in the drawings , the frit band formed by the apparatus according to the present invention is uniform , and the join of the frit band disappears a little later to be hardly seen with the naked eye . even when it is watched carefully , at most , only a slightly raised portion can be found on the applied frit at a overlapping area l at which the initial portion and the terminal portion join together , as shown in fig2 ( b ). a volume of the raised portion changes according to a length of the overlapping area l , and the length of the area l can be controlled by appropriately regulating the period δt at setting of a timer . however , a volume change of the raised portion according to alteration of the period δt is rather small . therefore , a small adjustment error of the length of the overlapping area l , or , of the period δt and the velocity v s2 of the shutter plate described above , does not much affect the result , accordingly . in other words , severe adjustment is not required for the apparatus according to the present invention to set it for a preferred condition . fig2 illustrates a method of adjusting the period δt to a suitable value by way of example . at the step 201 , a digital timer is appropriately set for an initial value p 0 for the period δt , and an application trial for the value p 0 is made at the step 202 . then , after observation of the result , it is judged at the step 203 if the result is satisfactory or not . if the judgement is yes , the period δt is determined to the present value δt (= p 0 ) and stored in a memory device at the step 204 . if the judgement is no , a variation δp is added to the present value of the period δt (= p 0 ) and the timer is set for the new period δt (= p 0 + δp ). then , the application trial and resetting of the timer are repeated by n times until a satisfactory result can be obtained for a renewed δt ( n ) (= p 0 + nδp , n ≧ 0 ). the variation δp can be preferably selected within a range of 1 to 10 msec . and a range of - 10 to - 1 msec . the above operation can be managed by using a computer - automated system so that an initial value for the period δt is automatically selected by various application conditions such as properties of the liquid material , a dimension and a shape of the injection port and the like . moreover , the motion velocity v s of the shutter plate 106 can be freely changed by controlling an air pressure which works in the air cylinder 98 as necessity arises . if the velocity v s is raised , the length of the tapered portion of the injected frit at the initiation or termination is shortened . on the other hand , since the sectional shape of the injected frit can be changed in accordance with the shape of the injection port , the shape of the tapered end portion of the frit also can be regulated by modifying the injection port . in the above embodiments , the apparatus is used for applying a frit to a funnel . however , it is , of course , possible to utilize the apparatus for other application works such as application of a sealant to a sheet glass and the like . in the above embodiments , if the edge of the injection port and the shutter plate are coated with anti - blocking agent , it is possible to decrease influence of the moving shutter on the injected viscous liquid material , so that shapes of the initial and terminal portions of the injected material can be accurately controlled by suitably selecting a value for the motion speed v s of the shutter and shapes for the injection port and the bore of the shutter plate . as described above , an injecting amount and a sectional shape of the corded liquid material can be correctly controlled by the shutter plate which is arranged on the injection port to move across the injecting direction according to the present invention , therefore , the apparatus for applying a viscous liquid material of the present invention can be utilize as not only a frit coater and an adhesive applier but also an applying machine for other viscous liquid materials , such as fluid semisolid materials which is creamy , syrupy , solated or the like . it must be understood that the invention is in no way limited to the above embodiments and that many changes may be brought about therein without departing from the scope of the invention as defined by the appended claims .
| 1 |
referring now to the drawings , like reference numerals are used to identify identical components in the various views . as illustrated below the present invention is particularly suited for use in connection with a microfluidic device . one skilled in the art , however , would recognize that the teachings of the present invention may be well suited for use in a variety of industries such as genomics , surface coating , apportionment , proteomics and inkjet applications . the present invention can be used particularly in the industrialization of drug discovery processes including synthesis analysis and screening . the present invention increases speed and productivity while providing researchers with expanded capabilities and assuring quality . the invention provides substantial time and efficiency advantages over prior techniques . the invention provides miniaturized liquid handling systems which perform the biological , chemical and the analytical processes fundamental to life sciences , research and development . the invention can be utilized to perform thousands of reactions simultaneously in an integrated format , which substantially reduces the time , effort and expense required while improving the quality of the test results . the processor in accordance with the present invention generally incorporates a modular configuration with distinct layers or plates . the processor or microfluidic device 10 , as shown in fig1 is capable of conducting parallel synthesis of thousands of small molecule compounds through the precise delivery of reagents to discrete reaction sites . this helps create a significantly larger number and variety of small molecules more effectively and with fewer resources . with the present invention , arrays of dna can be synthesized and transported on demand . the processor can also be used for high volume of sample processing and testing , as well as the search for new molecular targets and determining expression levels and response to known drugs . the processor can incorporate multiple assay formats , such as receptor binding , antibody - antigen interactions , dna / rna amplification and detection , as well as magnetic deed base separations . the versatility of the processor and its architecture make it available for use with synthesis work stations , genomic support stations , and analytical preparation systems . a basic multiple fluid sample processor or microfluidic device 10 in accordance with the present invention is shown in fig1 and 2 . the microfluidic device is illustrated as a three - layered structure in the embodiment illustrated . the microfluidic device 10 is also called a fluid assay layered device ( fald ), or a fluidic array . the microfluidic device 10 includes a top layer 12 , which is also called a reagent reservoir . the microfluidic device 10 also includes a middle layer or fluidic delivery layer 14 , as well as a bottom layer or well plate 16 . the top layer 12 is also called a feed - through plate and serves as a cover for the microfluidic device 10 . layer 12 contains a number of apertures 18 which are selectively positioned immediately above apertures 20 in layer 14 . apertures 20 are connected by an elongated micro - channels 22 which in turn have a plurality of branches extending therefrom . as illustrated , layer 14 comprises one layer , however , one skilled in the art would recognize that layer 14 may comprise several layers . well plate 16 has a plurality of wells 24 which are used to hold the reagents and other materials in order for them to react and synthesize . the three layers 12 , 14 and 16 are stacked together to form a modular configuration . they are also coupled together tightly to form a liquid - tight seal . if desired , the top layer 12 can be bounded or fused to the center distribution plate 14 or layer . the bottom or well plate layer 16 , however , is detachably coupled to layer 16 . the plates 12 , 14 and 16 may be made from any desirable material , such as glass , fused silica , quartz , or silicon wafer material . the reservoirs , micro - channels and reaction cells are controllably etched or otherwise formed onto the plates using traditional semi - conductor fabrication techniques with a suitable chemical etchant or laser drilling . top plate 12 contains apertures 18 positioned above the openings 20 located in central plate 14 . apertures 18 provide the necessary openings for loading module to fill the reservoirs with a plurality of agents or other materials . as will be further described below , a pressure pumping mechanism , is preferably used to assist in loading and distributing the reagents and other materials within the layers . a typical need is for one of the sample plates to have each sample conveyed , transported and / or processed while eventually being delivered into the well plate . during this time , the samples are typically exposed to the atmosphere and can oxidize , evaporate or cross - contaminate to an undesirable extent . with the present invention , however , the multi - layered sample microfluidic device 10 with detachable well plates inhibits cross - contamination of the fluids used in the combinatorial process . the detachable layers in accordance with the present invention are preferably of a common dimensionality for ease of being handled by robotic or other automation means . a common set of dimensions has been adopted by many manufacturers which match that of the 96 - well plate known as a “ micro titer ” plate . preferably , the plates 12 , 14 and 16 are connected to each other by an indexing means of detents , flanges or locating pins so they are closely aligned in the horizontal and vertical directions . while engaged in such manner , samples from one of the plates can be caused to be moved and transported to another plate . means for transporting or moving the samples from one of the plates to the other can be by pumping , draining , or capillary action . while the samples are engaged , and as a result of the transport of the samples from one layer to the other , the samples may be processed , reacted , separated , or otherwise modified by chemical or physical means , and then finalized by optical , electrochemical , chemical , or other means . samples or fluids can be delivered to the microfluidic device 10 by being contained in one of the members of physically engaging sample multi - well plates , such as a top layer 12 , or other means of sample introduction can be utilized , such as through the edges of such layer . referring now to fig3 a block diagram of a fluid transportation system 30 formed according to the present invention is illustrated . fluid transportation system 30 controls the amount of fluid distributed from or within microfluidic device 10 . fluid transportation system 30 is illustrated adjacent to a mass spectrometer 32 that is used for analyzing the composition of a fluid delivery 34 from microfluidic device 10 . mass spectrometer 32 analyzes the composition of fluid delivery 34 in a well - known manner . microfluidic device 10 has a fluid input 36 which is coupled to a first fluid reservoir 38 . as will be further described below , a second fluid reservoir 40 may also be coupled in series with first fluid reservoir 38 . a pump 42 is used to move fluid from first reservoir 38 and second fluid reservoir 40 into fluid input 36 . a power supply 44 is electrically coupled to buffer reservoir or pump 42 to an electrode 46 in microfluidic device 10 and mass spectrometer 32 . a controller 48 is coupled to power supply 44 and may be coupled to pump 42 . controller 48 controls the coupling of power to electrode 46 , pump 42 , and mass spectrometer 32 . controller 48 is preferably microprocessor based . controller 48 , however , in its simplest form may comprise a number of switches . in the microprocessor form , controller 48 may include an internal timer . a flow meter 50 may be positioned between fluid reservoir 38 and fluid input 36 . flow meter 50 may provide feedback to controller 48 with regard to the amount of fluid transported to microfluidic device 10 . other feedback means to controller 48 may , for example , be timing for pump 42 . if pump flows at a certain rate when operated , the amount of fluid delivered to microfluidic device 10 may be determined by a timer . the timer may be incorporated within pump 42 or within controller 48 as described above . in operation , controller 48 controls pump 42 to supply a predetermined amount of fluid from reservoirs 38 and 40 . as will be further described below , as a droplet of fluid forms at an opening of microfluidic device 10 , power supply 44 under the control of controller 48 applies power to contacts 46 and between a target 52 . a voltage potential difference exists between contact 46 and target 52 so that fluid delivery 34 is formed therebetween . a first reservoir 38 and second reservoir 40 may be used to electrically isolate pump 42 from microfluidic device 10 . in this manner , second reservoir 40 provides isolation . second reservoir 40 may be eliminated if another manner for electrical isolation is employed . in the illustration of fig3 a single pump and a pair of series reservoirs 38 , 40 are employed . however , it is likely that various numbers of pumps and reservoirs may be used to provide various reagents to microfluidic device 10 . referring now to fig4 and 5 , a portion of a microfluidic device 10 is shown . the portion shown , may , for example , be a well plate 54 having a well 56 . a well plate 54 is described in fig1 and 2 as bottom layer 16 . well 56 receives fluids from the other layers of microfluidic device 10 . each fluid within each of the wells 56 of the device 10 must be analyzed . for many applications , it is desirable , however , to analyze only a small portion of the fluidic solution in well 56 . a sample outlet 58 is provided from well 56 through well plate 54 . an opening 60 is formed at sample outlet 60 . sample outlet also has an entrance 62 adjacent to well 56 . to sample fluid from well 56 , fluid moves through entrance 62 through sample outlet 58 and through opening 60 . sample outlet 58 acts as a capillary channel from well 56 . a capillary barrier or “ break ” 64 is formed at opening 60 of sample outlet 58 . capillary break 64 is formed by the surface tension of the fluid in sample outlet 58 when opening to a larger volume . without a sufficiently high pressure or some other action , fluid within well 56 does not flow from sample outlet 58 . an electrode 66 is positioned within sample outlet 58 . electrode 66 is illustrated as a ring electrode positioned at opening 60 . the shape of electrode 66 , however , may vary depending on the application . electrode 66 in any form should be capable of inducing a charge on fluid at outlet 58 . referring now to fig6 electrode 66 ′ may be positioned at entrance 62 to sample outlet 58 . it has been experimentally found that the position of electrodes 66 , 66 ′ in sample outlet 58 has little affect on the operation of fluid transportation system 30 . a nozzle 68 may also be used to extend sample outlet 58 at opening 60 . as shown , nozzle 68 forms a slight mesa that extends from the . bottom of well plate 54 . for most fluids , the formation of nozzle 68 has little affect on the operation of fluid transportation system 30 . referring now to fig7 a three layer microfluidic device 10 is illustrated . fluid transportation system may be incorporated within a microfluidic device 10 for providing fluid to various locations within microfluidic device . if accurate pumps or feedback systems are used , the amounts of fluid may be metered precisely . microfluidic device may , for example , have a top layer 70 , a middle layer 72 , and a bottom layer 74 . of course , the device illustrated in fig7 is only a portion of a microfluidic device 10 . microfluidic device 10 may , for example , have a number of layers incorporated therein . in the present example , a capillary channel 76 is formed between top layer 70 and middle layer 72 . capillary channel 76 is ultimately coupled to a fluid reservoir such as that described above with respect to fig3 . capillary channel 76 may feed an intermediate well 78 within microfluidic device 10 . electrodes 80 may be incorporated into microfluidic device to control the operation of fluid delivery as will be further described below . referring now to fig8 and 9 , a droplet 82 is formed at opening 60 of sample outlet 58 . the volume of droplet 82 may be precisely controlled by pump 42 and controller 48 of fig3 . once a droplet 82 having a desired volume is formed , power supply provides a potential difference between contact 66 and target 52 . depending on the viscosity of the fluid and other characteristics , when a sufficient potential difference is applied between contact 66 and target 52 , droplet 82 is formed into fluid delivery 34 . the type or fluid delivery 34 may include a cone 84 as illustrated in fig9 . a cone is formed by charged particles 86 of droplet 82 . referring now to fig1 , charged particles 86 may also form a stream between opening 60 and target 52 . a stream is formed when a relatively medium voltage potential is applied between electrode 66 and target 52 . the type of fluid delivery 34 obtained is dependent upon the voltage . for example , voltage in the range between 500 volts and 3 kilovolts may be used . referring now to fig1 , an alternative microfluidic device 10 ′ is illustrated having a first well 56 ′ and a second well 56 ″. each well has a sample outlet 58 ′ and 58 ″. wells 56 ′, 56 ″ may be coupled to the same fluids . in the preferred embodiment , however , wells 56 ′, 56 ″ are coupled to two different fluids . that is , wells 56 ′, 56 ″ may be coupled to two separate fluid reservoir / pump combinations . as described above , electrodes 66 ′ and 66 ″ are located within sample outlets 58 ′, 58 ″. when a droplet is formed in openings 60 ′ and 60 ″, and a voltage potential is applied between contact 60 ′, 60 ″ and target 52 , the droplets form fluid deliveries 34 ′, 34 ″. in this manner , a mixing region 90 is formed by the combination of the fluid deliveries 34 ′, 34 ″. target 52 may be incorporated within a receiver plate or within a mass spectrometer . it is believed that mixing region 90 provides superior distribution of fluid deliveries 34 ′, 34 ″ for use with a mass spectrometer . referring now to fig1 , yet another alternative microfluidic device 10 ″ is illustrated . microfluidic device 10 ″ has a well 56 ′″ having a capillary channel 92 extending therefrom . capillary channel 92 has a sample outlet 58 ′″. capillary channel 92 is also illustrative of the fact that well 56 ′″ may be located a distance from an opening 60 ′″ in sample outlet 58 ′″. a nozzle 68 ′″ may also be incorporated near opening 60 ′″. when dispensing liquid from microfluidic device 10 ″, a receiver plate 94 may be positioned adjacent to microfluidic device 10 ″. receiver plate 94 has a receiving well 96 that may be used to transport samples of the solution formed in well 56 ′″. receiving well 96 may have an electrode 98 coupled thereto . electrode 98 in combination with electrode 66 ′″ has an electrical potential difference . the potential difference allows fluid to be dispensed from sample outlet 58 ′″. referring now to fig1 , a microfluidic device 10 ′″ is illustrated similar to that of microfluidic device 10 ″ except having a multiple number of wells 56 a through 56 e . wells 56 a through 56 e may each have different solutions therein . microfluidic device 10 ′″ may be used for mixing or dispensing solutions from wells 56 a through 56 e . in operation , when fluid is to be transferred within or from a microfluidic device , a droplet is formed at an opening . when a desired volume droplet is formed , a spray voltage is applied to an electrode within the fluid outlet . the application of voltage causes the droplet to be drawn towards an oppositely charged or grounded target . the particles of fluid or charge particles are attracted to the oppositely charged target . charge particles may form a fluid delivery shaped as a cone or as a stream or as a number of droplets . depending on the voltage , the characteristics of the fluid delivery may be changed . one skilled in the art would recognize that a relatively low voltage may be maintained and when a fluid delivery is desired , the voltage may be increased to the desired level to obtain the desired fluid delivery characteristic . while particular embodiments of the invention have been shown and described , numerous variations and alternate embodiments will occur to those skilled in the art . accordingly , it is intended that the invention be limited only in terms of the appended claims .
| 1 |
fig1 depicts a conceptual diagram with an exemplary embodiment of the present invention . the arrangement of fig1 includes a computer system 100 that comprises at least an application server 107 and database server 108 . not shown in fig1 are optional local client pcs or terminals which may connect with the application server to execute one or more applications . it is noted that the arrangement in fig1 also does not show a variety of other computers and terminals that may be connected to the database server 108 . the arrangement of fig1 is exemplary only , and is not intended to limit the nearly infinite variety of computer networks that may be configured to implement the same functionality . each of the database server and application server may be distributed among plural computers . moreover , the application and database server may be implemented on the same or different computers . in operation , an exemplary application represented by block 110 executes on the application server 107 . when the application requires a particular parameter , the application first checks cache memory 103 if the parameter is found in cache memory 103 , and if the cache is deemed current enough to be useful , the application 110 simply utilizes the parameter from cache . whether or not a parameter in cache is deemed current enough may vary by parameter . specifically , the system designed and typically knows in advance approximately how often the cache memory should be updated with a new value . the value that is to replace the cache value comes from another source , for example , database 102 . thus , if the desired parameter is either not found in cache memory 103 , or the application determines that , although the parameter is found in cache memory 103 , it has timed out , the next step described below is executed . if either the parameter has timed out in cache , or if it is not present at all in cache , then an additional source such as database 102 ( or other file ) is checked for a current version of the necessary parameter . database 102 is preferably , but not necessarily , a database and is also preferably implemented on a separate database server as shown in fig1 . by implementing database 102 on a separate server 108 , new data can be populated into the database without taking down the system , and this data will find its way into the cache as a result of the methodology described herein . moreover , if the database is not operable , the system can simply move to the next step shown in fig1 , just the same as if it did not find the data in database 102 . if the required parameter is located in database 102 , it is written to cache memory 103 and also utilized by application 1 10 . however , if the parameter is not found in database 102 , the flat file 104 is then checked , and the data presumably located . in all events , however , the value of the parameter is retrieved at block 105 and placed into cache memory 103 for subsequent use . fig2 depicts and additional embodiment of the present invention in which the application server includes plural terminals 205 - 207 , and two database servers 209 and 108 . in such a case , a parameter in cache memory may also specify , in the cache , which of the database servers the 209 or 108 to use for the updated parameter . in this manner , if the needed parameter is not in the cache at all , the next step would be to check the database servers 108 and / or 109 . these two servers may represent one live and one backup , or , they may represent multiple servers for storing a large amount of data , such that the database is implemented between the two of them . alternatively , if the parameter is in cache 103 but has time out , the cache version could include a pointer to the specific database server to check , thereby eliminating the need to check plural servers . preferably , the system designer will ascertain in advance which of numerous software parameters change often enough to use the database or other file 102 , and which do not change so frequently . thus , for parameters like passwords , for example , which users tend to maintain long term , the flat file or hard coding can be used . for parameters such as a customer balance in an account , the database server 108 and database 102 can be used as the source of these . thus , all parameters will gradually be moved into cache as the software application ( s ) that need them are run on the application server 107 , and the cache will by kept up to date using the timeout features described above . in one embodiment , all parameters that may be used by the software application and which vary are divided into groups in advance of use . parameters expected to be updated more frequently than the predetermined threshold are placed into the database 102 , whereas , parameters expected to be updated less frequently than the predetermined threshold are placed into the flat file . in this manner , once the application ( s ) are up and running , the parameters gradually migrate into cache , and the ones that need to be updated more frequently than the the threshold can be changed while the software applications using them are “ live ”. notably , parameters in the flat file 104 can also be put into the database file 102 . such a situation will arise when a parameter was previously selected for the flat file , but the developer wishes to override the value . rather than have to take the application out of service to update the flat file , the parameter can just be put into the database 102 . due to the order in which the sources for the parameter are checked , as described above , the system will continue to operate , but the database file will trump the flat file because it is checked first . the above technique can also be used to allow a parameter in the flat file , and which can thus be accessed very quickly by the software application , to be altered without having to take down a software application using those parameters . specifically , consider the case where the desired parameter is one that does not vary all that often , so it is placed in flat file 104 . if a time comes that such a parameter must be changed , the system can then change it by placing the parameter in database 102 , even though it is not normally kept there . due to the order in which the software application checks for sources of the parameter ( described above ), the software application will continue operating , however , it will do so using the new value of the parameter in database 102 . then , if it is desired to permit even faster access by placing the parameter in flat file 104 , at least two methodologies can be utilized . first , the flat filed can be updated with the new value at a time when the application is not used , or at least less critical ( e . g . ; overnight ). alternatively , the software itself can be programmed , and the parameter in database 102 tagged , so that the software itself is instructed to place the new parameter into the flat file after it is first read into cache from the database 102 . the system may also keep track of the number of times a parameter is replaced with information from the database . in this manner , if a parameter was designated by the developer for the flat file , but the system detects that it is changing too often , it can alert the developer to reallocate such parameter to the database file 102 . while the above describes the preferred embodiment of the present invention , various other modifications can be implemented without departing the spirit and scope of the invention .
| 6 |
fig1 illustrates a block diagram of a memory system designated generally at 10 and according to the preferred embodiments . in one preferred embodiment , system 10 is constructed using a single integrated circuit and , indeed , additional circuitry is likely included within such an integrated circuit . however , to simplify the present illustration and discussion , such additional circuitry is neither shown nor described . moreover , system 10 may be implemented in connection with numerous digital data systems , as ascertainable by one skilled in the art . looking to the blocks in system 10 , system 10 includes various items which in general are also known in the prior art , but additional control and operation as detailed later distinguishes the overall system . looking by way of introduction to some of the blocks that are comparable to the prior art , they include an sram array 12 . sram array 12 is intended to demonstrate a collection of sram memory cells that are typically aligned in an array fashion , that is , to include either or both a physical and logical orientation wherein the memory cells are addressed according to a number r of rows and a number c of columns . the values of r and c may vary widely based on implementations . each of the r × c memory cells may be constructed according to various techniques known to or ascertainable by one skilled in the art . an address signal is coupled to a row access circuit 14 and a column access circuit 16 . collectively , row access circuit 14 and column access circuit 16 facilitate the reading and writing of cells in sram array 12 , where the particular cells accessed in a given cycle are determined by the address . the manner in which a row or rows , and some or all of the columns in a row or rows , are accessed in a given cycle also may vary . in any event , addressed cells are either written or read as indicated at the data input / output 10 i / o of fig1 , where typically such i / o is provided in connection with the column access of the array . turning now to an inventive aspect of fig1 and which also combines with system 10 so as to provide an overall novel and improved system , system 10 includes an array voltage supply block 18 . in the preferred embodiment , array voltage supply block 18 provides one or more array voltages to the data storage cells of sram array 12 , where by way of a preferred example , three such system voltages are shown in fig1 . these three voltages include the array high supply voltage v dda , the array low supply voltage v ssa , and an array back bias voltage v bba . as known in the art , the array high and low supply voltages , v dda and v ssa , respectively , may be connected to various devices , such as selected source , drain , and / or gate nodes of various transistors within sram array 12 , as may the low supply voltage , v ssa . further , the array back bias voltage v bba , may connect to the backgates or other appropriate threshold voltage connections of at least some of the transistors in sram array 12 . further in this regard , while a single back bias voltage , v bba , is shown in fig1 , in one preferred embodiment two separate back bias voltages are provided , one for p - channel transistors and one for n - channel transistors , where as known in the art a different back bias voltage is generally applied to p - channel transistors compared to the back bias voltage applied to n - channel transistors , and a different amount of voltage adjustment is required to cause an equal change in the threshold voltage of these different conductivity type devices . in an alternative embodiment , v bba may be adjusted with respect to p - channel transistors while an increase in v ssa relative to substrate voltage may be used to increase a back bias on n - channel transistors so as to increase the threshold voltage of those transistors . lastly , and for reasons evident below , array voltage supply block 18 also includes an input 18 s for receiving a sleep signal . the particular operation of array voltage supply block 18 is now explored and provides an inventive aspect as will be appreciate by one skilled in the art . specifically , during data access operation of system 10 , array voltage supply block 18 may provide the array voltages , v dda , v ssa , and v bba , according to techniques and methodologies as known in the art . however , the preferred embodiments contemplate that the sleep signal is asserted when it is desired for system 10 to enter into a sleep mode of operation , that is , a period of time where it is known that the data cells in sram array 12 will not be accessed ( i . e ., either read or written ), but where it is required that each cell maintain its valid data state . the assertion of the sleep signal in this manner may be performed according to the art . in response to asserted sleep signal , array voltage supply 18 adjusts one or more of the array voltages , v dda , v ssa , and v bba , so as to reduce current consumption of the cells in sram array 12 during the corresponding period of standby operation . for example , v dda may be decreased and / or v ssa may be increased to the cells . as another example , v bba may be adjusted so as to increase the threshold voltage of the transistor ( s ) in each sram cell , where , for example , increasing v bba of a p - channel transistor will increase its threshold voltage . importantly , however , also in the preferred embodiment , any one or more of v dda , v ssa , and v bba are further adjusted according to the temperature experienced by system 10 . in other words , and as further appreciated below from one preferred embodiment approach , array voltage supply 18 operates in a fashion that is deliberately temperature - dependent such that any of v dda , v ssa , or v bba may be altered in response to temperature . for sleep mode , the applied voltages must be set at values that will allow retention of the data while preferably reducing iddq . since transistor characteristics change with temperature , the voltages required for data retention may change with temperature , and iddq may change with temperature . a larger voltage across the cell ( v dda - v ssa ) may be required for data retention at lower temperature than at higher temperature . also , for a given set of voltages , iddq may be higher at higher temperature than at lower temperature . thus , these voltage alterations may be constructed so that when temperature decreases , the net voltage , v dda - v ssa , applied to sram array 12 is increased , where in contrast when temperature increases , that net voltage , v dda - v ssa , applied to sram array 12 is decreased . additionally , as temperature increases , the threshold voltage of data cell transistors may decrease for a given back bias . thus the applied back bias voltage may be adjusted to increase the threshold voltage at higher temperature and to decrease the threshold voltage at lower temperature . note that these net voltage adjustments are such that when temperature decreases , the voltage across the cell is increased so as to maintain the valid data state in cells of sram array 12 ; however , as a benefit , when temperature increases , the net voltage is decreased and / or the threshold voltage is increased with a corresponding reduction in leakage current as compared to that which would occur if the voltage remained the same as it was at lower temperatures . therefore , during the sleep mode of operation , array voltage supply block 18 provides a first set of voltage levels to sram array 12 for a first temperature , and array voltage supply block 18 provides a second set of voltage levels to sram array 12 for a second temperature , where the first set of voltages has at least one voltage that differs from the comparable voltage in the second set of voltages , and where the first temperature differs from the second temperature . fig2 illustrates a schematic of one preferred embodiment for implementing a portion of voltage supply block 18 for sake of generating the array high supply voltage v dda and which is designated as system 18 ′. by way of introduction , system 18 ′ is such that the voltage v dda it outputs decreases with an increase in temperature and such that this voltage increases with a decrease in temperature , consistent with the above teachings and for use when the sleep signal is asserted to supply 18 in fig1 . looking to the connectivity of the schematic , it includes a node 30 coupled to receive a supply voltage v cc that preferably does not vary significantly with temperature , as may be produced by various voltage supply circuits known in the art . looking to the left of the schematic , in general a subsystem sb 1 is generally segregated for sake of illustration and later functional description , and is as follows . node 30 is connected to the source and backgate of a p - channel transistor 32 , which has its gate connected to a node 34 and its drain connected to a node 36 . node 34 in the illustrated embodiment is connected to ground . node 36 is further connected to the base and collector of a bi - polar junction transistor (“ bjt ”) 38 , which has its emitter connected to a base and collector of a bjt 40 . the emitter of bjt 40 is connected to node 34 . returning to node 30 , it is also connected to the source and backgate of a p - channel transistor 42 , which has its gate connected to its drain and also to the gate of a p - channel transistor 44 . the drain of p - channel transistor 42 is also connected to the collector of a bjt 46 , which has its base connected to node 36 and its emitter connected to a first terminal ( or node ) 48 of a resistor 50 , and where a second terminal 52 of resistor 50 is connected to node 34 . continuing with fig2 , system 18 ′ includes another subsystem sb 2 , also segregated for sake of illustration and later functional description . in subsystem sb 2 , node 30 is connected to the backgate of p - channel transistor 44 and also to the backgate of a p - channel transistor 54 . the drain of p - channel transistor 44 is connected to a node 56 , which as detailed later provides the temperature - dependent voltage , v dda . the drain of p - channel transistor 54 is connected to a node 58 and the gate of that p - channel transistor 54 is connected to a node 60 , which is connected to the drain of a p - channel transistor 62 and the drain of an n - channel transistor 64 . p - channel transistor 62 has its source and backgate connected to node 30 , and its gate connected to a node 66 . the gate of n - channel transistor 64 is connected to node 30 and its source and backgate are connected to node 34 . node 66 is also connected to the drain and gate of a p - channel transistor 68 , having its source and backgate connected to node 30 . node 66 is also connected to the gate and drain of a p - channel transistor 70 , having its source and backgate connected to node 30 . node 66 is also connected to the gate of a p - channel transistor 72 , having its source and backgate connected to node 30 and its drain connected to node 56 . node 66 is also connected to the collector of a bjt 74 , having its base connected to node 58 and its emitter connected to a terminal 76 of a resistor 78 . another terminal 80 of resistor 78 is connected to node 34 . returning to p - channel transistor 70 , its drain is connected to the base and collector of a bjt 82 , which has its emitter connected to node 34 . finally , node 56 is also connected to a terminal 84 of a resistor 86 , which has another terminal 88 connected to node 34 . the operation of system 18 ′ is now discussed , and may be appreciated by first turning to sub - system sb 2 . in general , sub - system sb 2 operates as a bandgap subcircuit to provide a current that has a known dependency with temperature . specifically , in the preferred embodiment , bjt 74 is on the order of four times the physical size of bjt 82 . however , due to the current mirror produced by p - channel transistors 68 and 70 , each of bjts 74 and 82 has a same amount of current passing through the collector - emitter paths of those devices . the result of this equivalent current flow is that the base - to - emitter voltage (“ vbe ”) is reduced through bjt 74 relative to bjt 82 , since the current through bjt 74 per unit area is one - fourth that through bjt 82 . thus , there is a δv be between ground at node 34 and terminal 76 of resistor 78 ; this δv be may be in a slight sense temperature dependent , but may be assumed to be temperature independent at least to a first order of approximation . given the preceding , the amount of resistance provided by resistor 78 defines the amount of current through subsystem sb 2 , that is , the mirrored current through p - channel transistors 68 and 70 . the current through resistor 78 is also mirrored through resistor 86 ; also , note that resistors 78 and 86 are preferably matched in terms of fabrication , but in terms of resistance one may be a multiple of the other . likewise , therefore , the current mirrored through resistor 78 and resistor 86 may be the same or one may be a multiple of the other . in any event , therefore , subsystem sb 2 primarily contributes a temperature - dependent current through resistor 86 , which is inversely proportional to its resistance , thereby providing v dda in this respect as a temperature - independent voltage . thus , subsystem sb 2 may be provided so as to provide a substantially temperature - independent v dda over a certain range of temperatures , such as for higher operating temperatures of memory system 10 . continuing with the operation of system 18 ′, attention is now directed to sub - system sb 1 . in general and as further detailed below , sub - system sb 1 operates to contribute to system 18 ′ a characteristic of a voltage that is temperature - dependent so that this element may be used to include temperature dependence into v dda below a certain desirable temperature threshold . with this inclusion , therefore , v dda may be increased either linearly or otherwise below the desired temperature threshold during the standby mode of system 10 , thereby providing sufficient voltage to maintain data in sram array 12 during that mode , whereas when the temperature increases above the desirable temperature threshold during the standby mode , the effect of sub - system sb 1 is minimized or avoided , thereby leaving the reduced and relatively fixed or temperature - independent characteristic of v dda as provided by sub - system sb 2 so as to also maintain state in sram array 12 while also decreasing leakage current as compared to that which would occur if the voltage were left at a higher range as is provided with the inclusion of the characteristic of sub - system sb 1 at lower temperatures . the details of such operation of subsystem sb 1 are further appreciated below . looking now in greater detail to the operation of subsystem sb 1 , a current is generated through p - channel transistor 32 , and this current is mirrored through bjts 38 and 46 , thereby providing a same voltage at the emitter of each of bjts 38 and 46 . thus , the voltage across resistor 50 is the same as a v be across bjt 40 . note , however , that the temperature coefficient of the v be across bjt 40 will vary considerably with temperature . for example , the v be may be 0 . 9 volts at − 40 degrees celsius and 0 . 4 volts at 150 degrees celsius . further , the resistance of resistor 50 increases with temperature . thus , at lower temperatures , these factors combine to produce more current in the current mirror output that includes p - channel transistors 42 and 44 . this current may be scaled and is added to the current from p - channel transistor 72 ( in subsystem sb 2 ), and this combined current passes through resistor 86 , thereby contributing to the voltage , v dda , across that resistor 86 . thus , the temperature dependence of subsystem sb 1 combines with the relative temperature independence of subsystem sb 2 . accordingly , a characteristic of v dda may have the shape as shown as a simplified example in fig3 a . particularly , fig3 a plots v dda with respect to temperature , as produced by system 18 ′. as seen , below a temperature threshold thr 1 , v dda is fairly linear along a first line l 1 , and that line indicates that v dda increases with a decrease in temperature , as achieved through the added functionality provided by subsystem sb 1 . above voltage threshold thr 1 , v dda is also linear , but along a second and different line l 2 . also , while not shown , the transition between lines l 1 and l 2 may include a curved transition . in any event , v dda along line l 2 is fairly temperature - independent , as provided by subsystem sb 2 , in a range of temperature above thr 1 where the effect of subsystem sb 1 is substantially reduced or eliminated . in other words , fig3 a illustrates that for system 18 ′, v dda is generated by the adding of a constant current and a temperature - dependent current through resistor 86 . in the low temperature region below threshold thr 1 , the temperature - dependent current is larger and predominantly determines the voltage , thereby increasing v dda as temperature decreases below threshold thr 1 . in the high temperature region , the constant current is larger and predominantly determines the voltage , thereby maintaining v dda as a relative constant above threshold thr 1 . at the transition region between lines l 1 and l 2 , the two currents are of comparable magnitude . in all events , it may be seen that lines l 1 and l 2 provide a range for v dda , whereby generally at lower temperatures the provided voltage is greater than that at higher temperatures , thereby providing the operation and benefits described above . in addition to the preceding , note further that in the preferred embodiments v dda may be supplied relative to v ssa . thus the voltage across the cell may be increased at lower temperature by increasing v dda as shown in fig3 a , or by lowering v ssa while holding v dda constant . any combination of raising or lowering v dda and raising or lowering v ssa may be used to obtain the desired voltage across the cell as a function of temperature . this may be done in conjunction with adjustment of back bias voltages or with constant back bias voltages to adjust the threshold voltages of the n - channel and p - channel transistors . for example , for a given v bba applied as back bias to the p - channel transistors and a given substrate voltage applied to the n - channel transistors , raising v dda and v ssa together will lower the magnitude of the p - channel transistor threshold voltage and increase the magnitude of the n - channel transistor threshold voltage . still further , note that the preceding techniques , with respect to v dda , v ssa , and / or v bba , may be applied based on other plots of voltage change with temperature . for example , fig3 b and 3 c illustrate alternative plots demonstrating temperature - dependent voltage that may be provided to the sram array of fig1 during the sleep mode . briefly , therefore , fig3 b illustrates a first range of temperature below a threshold thr 2 wherein v dda is constant , and it further illustrates a second range of temperature above threshold thr 2 wherein v dda decreases linearly with temperature . as another alternative , fig3 c illustrates different voltage characteristics across three temperature ranges . in a first range of temperature below a threshold thr 3 , v dda is constant , and in a second range of temperature above a threshold thr 4 , v dda is also constant . however , between temperatures thr 3 and thr 4 is a third range of temperature wherein v dda decreases linearly with temperature . from the above , it may be appreciated that the above embodiments provide an sram with a temperature - dependent voltage control in its sleep mode . the sram provides particular benefits over the prior art . for example , current consumption during the sleep mode is reduced as compared to the prior art . this reduction leads to corresponding benefits , such as reduced power consumption and reduced cost of operation . these benefits may be particularly advantageous in battery - operated applications , which are quite common in contemporary applications . as another benefit , the present inventive teachings may be applied to numerous forms of srams and in the numerous devices into which such srams are included . as yet another benefit , while fig2 illustrates one approach to providing a temperature - dependent form of v dda , one skilled in the art may ascertain other approaches as well as circuits for providing a temperature - dependent form of v ssa and / or v bba . still further , rather than using current sources to provide a temperature - dependent form for any one or more of v dda , v ssa , and v bba , such a voltage or voltages may be provided by a number of voltage sources , where different ones of the voltage sources have different temperature dependencies . thus , these benefits further demonstrates the flexibility of the preferred embodiments , and further demonstrate that while the present embodiments have been described in detail , various substitutions , modifications or alterations could be made to the descriptions set forth above without departing from the inventive scope which is defined by the following claims .
| 6 |
surprisingly , it has been found that the problem underlying the invention can be solved by the addition of tertiary amine to the reaction mixture . characterized in that the reaction is conducted in the presence of a tertiary amine . in a particularly preferred process , the hydrogenation is carried out in a temperature range from 0 ° c . to 100 ° c ., preferably from 10 ° c . to 80 ° c ., particularly from 20 ° c . to 60 ° c . also preferred is a process wherein the hydrogenation is carried out under a pressure of more than 0 . 5 bar to 25 bar , preferably under a pressure of 1 bar to 8 bar , particularly at about 2 - 6 bar . the solvents preferably used within the process according to the invention may be both protic solvents — such as e . g . alcohols , carboxylic acids and / or water — or aprotic polar solvents such as e . g . ethers , esters , amides or lactams and / or mixtures thereof . water may optionally be added to all the solvents . preferred protic solvents used are branched or unbranched c 1 - c 8 alkanols , c 1 - c 3 carboxylic acids or mixtures thereof . particularly preferably , lower alcohols such as methanol , ethanol , n - propanol and isopropanol , carboxylic acids such as formic acid , acetic acid and propionic acid or mixtures thereof are used . preferred aprotic solvents are polar ethers such as for example tetrahydrofuran or dimethoxyethylether , amides such as for example dimethylformamide , lactams such as for example n - methylpyrrolidone or esters like for instance ethyl acetate . most preferred solvent according to the invention is ethyl acetate . suitable hydrogenation catalysts are generally transition metals such as for example nickel , platinum or palladium or the salts or oxides thereof . raney nickel , platinum oxide and palladium on an inert carrier material , particularly palladium on activated charcoal ( pd / c ), are preferred . the tertiary amine is preferably selected from among trimethylamine , triethylamine , diisopropylethylamine and dbu ( diazabicycloundecene ). most preferred amine is triethylamine . the amount of tertiary amine used within the scope of the invention is based on the amount of starting material 2 in the range of 0 , 05 to 10 %, preferably 0 , 5 - 7 %, most preferred 2 - 6 %. the foregoing amount is indicated in weight percentage relative to starting material 2 . in the following examples the same compound 2 batch was used as the starting material . prior to the experiments it was determined that the batch contained about 380 ppm of sulfur impurities . under inert atmosphere ( n 2 ) an autoclave is charged with 150 g of compound 2 , 6 g of a 10 % palladium on charcoal catalyst , 7 ml of triethylamine and 630 ml of ethyl acetate . the autoclave is heated to 30 ° c . and hydrogen added until a pressure of 4 bars is observed . then the temperature is adjusted to 50 ° c . the usual time for complete conversion of the starting material is 1 to 2 h . the autoclave is then allowed to cool and the suspension filtered to remove the catalyst . the organic filtrate is concentrated on a rotary evaporator and diluted with 350 ml of either isopropanol or toluene . again the solution is concentrated using mild vacuum and 400 ml of either isopropanol or toluene are added . the solution is cooled to 10 ° c . to allow crystallisation of the product . the crude product is isolated by filtration and dried under vacuum to yield 123 g ( 90 % of theoretical yield ) of compound 1 . under inert atmosphere ( n 2 ) an autoclave is charged with 150 g of compound 2 , 6 g of a 10 % palladium on charcoal catalyst and 630 ml of ethyl acetate . the autoclave is heated to 30 ° c . and hydrogen added until a pressure of 4 bars is observed . then the temperature is adjusted to 50 ° c . if hydrogen uptake ceases or is slow , the autoclave is flushed with nitrogen and additional catalyst is added ( appr . 50 % of the original amount ), then new hydrogen is added and hydrogenation continued . the usual time for complete conversion of the starting material is approximately 4 hours . the autoclave is then allowed to cool and the suspension filtered to remove the catalyst . the organic filtrate is concentrated on a rotary evaporator and diluted with 350 ml of either isopropanol or toluene . again the solution is concentrated using mild vacuum and 400 ml of either isopropanol or toluene are added . the solution is cooled to 10 ° c . to allow crystallisation of the product . the crude product is isolated by filtration and dried under vacuum to yield 116 g ( 85 % of theoretical yield ) of 1 .
| 2 |
in the following description , for purposes of explanation , specific nomenclature is set forth to provide a thorough understanding of the various inventive concepts disclosed herein . however , it will be apparent to one skilled in the art that these specific details are not required in order to practice the various inventive concepts disclosed herein . fig1 depicts the garment rack in its erected configuration . the garment rack comprises a tray 1 , a cover 2 , a pair of arms 3 a - b , a hanger pole 4 , and a set of casters 5 a - d . in the preferred embodiment , the tray 1 is rectangular having two short parallel sides and two long parallel sides . the arms 3 a and 3 b are attached to the tray 1 along the short parallel sides with a set of hinges 6 a - d positioned such that the arms collapse towards the center of the tray 1 . also attached to the inside face of the short parallel sides of tray 1 is a set of hanger saddles 7 a - b which are used to store the hanger pole 4 when the garment rack is in its collapsed configuration . in the collapsed configuration , shown in fig2 , the hanger pole 4 is stored on one side of the tray 1 adjacent to one of the long parallel sides of the tray . in some embodiments , the empty spaces of tray 1 that are not used for storing the hanger pole or collapsed arms 3 a - b can be partitioned into boxes or storage containers for storing additional merchandise or detachable parts of the garment rack . a handle 8 is attached to the exterior surface of tray 1 so that the user can pull the garment rack while it is collapsed as shown in fig3 . arms 3 a - b of the present invention are designed so they can be easily collapsed and stored within the tray 1 and erected to securely support hanger pole 4 . in one embodiment , each arm comprises a base board 9 a - b . the bottom portion of the base board 9 a is hingedly attached to the top surface of a side of tray 1 and the bottom portion of base board 9 b is hingedly attached to the opposite top surface of tray 1 . in the present embodiment , the attachment is accomplished by using a set of hinges 6 a - d , however , other fasteners that allow the arm to fold into the tray could be used such as a pivot joint . the top portion of base board 9 a is hingedly attached to the bottom portion of the top board 10 a . in the present embodiment , the attachment is accomplished using a set of hinges 11 a - b , however , other fasteners that allow the arm to fold into itself could be used such as a pivot joint . similarly , the top portion of base board 9 b is hingedly attached to the bottom portion of top board 10 b ; also using a set of hinges 11 c - d . at the bottom of each top board 10 a - b are a set of channel locks 12 a - d which are used to rigidly secure the top board to the base board when the garment rack is in its erected configuration . although channel locks are disclosed , it should be understood that other locks known in the art can be used to secure the top board and base board such as cam locks , slide locks , clamp locks , etc . the top board 10 a - b also comprises an extension track 13 a - b for receiving an extension board 14 a - b . the extension track 13 a - b and extension board 14 a - b allow the height of the garment rack to be adjusted using knob and nut assembly 15 a - d . when the garment rack is in its collapsed configuration , the knob and nut assembly 15 a - d can be stored in a side compartment 18 located in the tray 1 . at the top of the extension track 13 a - b is a hanger saddle 7 c - d which is used to secure and support the hanger pole 4 . in an alternative embodiment , the bottom board 9 a - b and top board 10 a - b are not hingedly attached , but instead are slidably attached such that the top board 10 a - b slides into a track found in the bottom board 9 a - b ( not depicted ), similar to the way the extension board 14 a - b is attached to the top board 10 a - b in the depicted embodiment . this arrangement would also allow for the garment rack to be easily erected and collapsed . a shoe rack 16 is attached between the arms 3 a - b at the lower portion of the base board 9 a - b with a set of swing levers 17 a - d . the shoe rack 16 is used for displaying shoes in an elevated platform when the garment rack is in its erected configuration . casters are attached to the bottom of the tray 1 . in the preferred embodiment , swivel casters 5 a - b are attached to the base of the tray 1 at the same end that the handle 8 is attached while stationary casters 5 c - d are attached to the opposite end . this allows the garment rack to be pushed around and easily maneuvered in its erected configuration and collapsed configuration . fig3 shows the garment rack being pulled by a user by the handle in an elevated angle such that only the stationary casters 5 c - d are being engaged . the swivel casters 5 a - b also have locking latches that can be engaged to lock the casters in place . the garment rack is designed to enable two configurations ( 1 ) a collapsed configuration and ( 2 ) an erected configuration . in the collapsed configuration , the entire garment rack is enclosed within the tray 1 and cover 2 . to transition the garment rack to the erected configuration from the collapsed configuration , the user must remove the cover 2 by unlocking the latches 19 a - d found along the side of tray 1 . the base board 9 a - b of arms 3 a - b are then folded outwards to stand vertically from the collapsed horizontal configuration . when the two base boards 9 a - b are folded outwards , the shoe rack 16 automatically lifts into position by virtue of swing levers 17 a - d attached to the base boards 9 a - b and the shoe rack 16 . the top board 10 a - b of arms 3 a - b are then folded such that they form a long vertical upright board with the base board 9 a - b . channel locks 12 a - d can then be slid downwards to lock the bottom board 9 a - b and top board 10 a - b into a long vertical upright board . the hanger pole is removed from the hanger saddles 7 a - b located in the tray 1 and placed on the hanger saddles 7 c - d located on the extension boards 14 a - b . the nut and knob assemblies 15 a - d are removed from their compartment 18 in tray 1 and attached to extension boards 14 a - b . the height of the extension boards 14 a - b can be adjusted and secured using the nut and knob assemblies 15 a - d . once the garment rack is secured in the erected configuration , garments can be hung along the hanger pole 4 and shoes can be placed on the shoe rack 16 for display . when the garment rack is used in retail settings , it can also be decorated along the arms 3 and sides of the tray 1 to attract customers . decorations may include banners and sales advertisements , bold color schemes , jewels , molding , and other adornments to signal a retail setting . the garment rack can also be used with a garment transport system which comprises a garment transport bag 20 for storing garments that is adapted to be securely attached to the top of the cover 2 . the garment transport bag 20 is used to store garments and other merchandise for transport with the garment rack . the garment transport bag 20 may be a duffle bag , luggage , suit case , or any other type of garment bag that is known in the art . the garment transport bag 20 may be adapted to be attached to the top of the garment rack cover 2 using either hook and loop fasteners , clamps , locks , snaps , etc . using the garment transport system , a single retailer can set up a mobile storefront at any location . the garment transport system transports the garment rack , garments , and other merchandise as a single unit that can be quickly set up at a temporary retail location . ideally this would be used for settings such as a flea market where transportation of garments , merchandise , and display equipment needs to be done in a quick and efficient manner . additionally , the flat panels of the garment rack arms 3 a - b and tray 1 can decorated with designs , advertisements , gems , or mirrors to attract potential customers as well as provide functionality for the mobile retail location . in an alternative embodiment , the boards 9 a - b and 10 a - b can be fitted with attachments for securing additional shelving for display of merchandise or storage of retail equipment .
| 1 |
hereinafter , embodiments of the present invention will be described with reference to the attached drawings . fig1 ( a ) discloses a protective cushion 30 for protection of vehicle occupant &# 39 ; s head according to an embodiment of the present invention . the cushion includes a protective cushion element 31 , and outer shell fabrics 51 , 52 superposed on the both side surfaces of the protective cushion element 31 , as shown in fig1 ( b ). also in this exemplary embodiment of the present invention , the protective cushion element 31 comprises a cabin - side base fabric or sheet 32 and a window - side base fabric or sheet 33 which are sewn to each other by sewing yarns in order to form a chamber 34 between the base fabrics 32 and 33 . the base fabrics 32 , 33 are joined to each other by joints or seams formed with sewing yarns including a line - shaped joint 40 extending around the peripheries of the base fabrics ( with some parts thereof extending inward of the base fabrics 32 , 33 ), line - shaped joints 41 , 42 , 43 , 44 for subdividing the chamber 34 and for restraining the thickness of the cushion by a predetermined amount , and circular joints 45 for reinforcing areas around ends of the line - shaped joints 41 - 44 . according to this embodiment of the present invention , the cabin - side base fabric 32 and the window - side base fabric 33 are bonded to each other by adhesive 39 . following the bonding with adhesive , the fabrics are sewn together by sewing yarns . the protective cushion element 31 is provided at the rear end thereof with a gas inlet 35 for introduction of gas from an inflator ( not shown ). the protective cushion element 31 is provided along the upper edge thereof with a plurality of projections 36 for installation of the protective cushion 30 to a vehicle body such as a roof side rail . the projections 36 are formed with holes for insertion of bolts , respectively . the protective cushion element 31 is provided at the front end thereof with holes 37 for installation to an a - pillar . the outer shell fabrics 51 , 52 may have a rectangular shape different from the shape of the cabin - side base fabric 32 and the window - side base fabric 33 as main parts . the shape of the outer shell fabrics 51 , 52 may include any shape in which the outer shell fabric is capable of substantially entirely covering depressed portions c ( which are described further below ). the outer shell fabrics 51 , 52 may include any shape in which the outer shell fabric is capable of substantially corresponding to the shape of the window - side base fabric 33 or the cabin - side base fabric 32 . the outer shell fabrics 51 , 52 may be made of the same fabric of the protective cushion element 31 and are preferably made of relatively thin fabric of , for example , 70 - 210 deniers in order to reduce the volume of the folded cushion as small as possible . the outer shell fabrics 51 , 52 may be bonded to the protective cushion element 31 by adhesives 55 . in the exemplary embodiment of the present invention shown in fig1 ( a )- 1 ( c ), the adhesives 55 are applied to the outer surfaces of the protective cushion element 31 into a narrow band shape along the line - shaped joint 40 at the front end and the rear end of the cushion . the adhesives 55 are spaced from the position of the line - shaped joint 40 . in this embodiment , the adhesives 55 are located on the outside of the line - shaped joint 40 of the protective cushion element 31 . the protective cushion 30 for protection of vehicle occupant &# 39 ; s head is fixed to the vehicle body in the folded state by the holes of the projections 36 and the hole 37 at the front end . the protective cushion 30 for protection of vehicle occupant &# 39 ; s head is covered by a cover ( not shown ). the cover is adapted to be torn or opened when the protective cushion 30 is inflated . the cover may be a roof garnish or decoration for the vehicle . when the vehicle suffers a side impact collision or roll - over , the inflator is actuated , gas flows into the chamber 34 through the gas inlet 35 so that the cushion 30 is inflated and deployed downwardly along the side surface of the vehicle cabin , thereby protecting the head of the occupant . during the deployment of the cushion or side airbag , since the line - shaped joints 40 - 44 and circular joints 45 join the cabin - side base fabric 32 and the window - side base fabric 33 , the thickness of portions around the joints 40 - 44 and 45 of the protective cushion element 31 is smaller than that of the other portions . accordingly , depressed portions c ( c 1 , c 2 , c 3 ) recessed from the outer surfaces of the protective cushion 31 are created at and around the joints 40 - 44 and 45 . the outer shall fabrics 51 , 52 cover the depressed portions c . since the outer shell fabrics 51 , 52 are bonded at their ends to the protective cushion element 31 by the adhesives 55 , the outer shell fabrics 51 , 52 are tightly stretched over the outer surfaces of the inflated protective cushion element 31 so that the depressed portions c are covered by the outer shell fabrics 51 , 52 just like lids . therefore , when the occupant &# 39 ; s head plunges into the cushion toward the depressed portion c , the occupant &# 39 ; s head can be received by the outer shell fabrics 51 , 52 . as a result , the impact of the occupant &# 39 ; s head can be absorbed by a region including the depressed portion c and the outer shell fabric covering the depressed portion c , thereby increasing the absorbing amount . in this embodiment , the inflated protective cushion element 31 is prevented from being damaged by fragments of window glasses because the inflatable portion of the cushion element 31 is entirely shielded by the outer shell fabrics 51 , 52 . though the adhesives 55 are only applied to the portions at the both ends in the longitudinal direction of the protective cushion element 31 in the aforementioned embodiment , the adhesives 55 may also be applied to portions along the upper and lower edges of the protective cushion element , as shown in the alternative embodiment of the present invention disclosed in fig4 , in order to join the protective cushion element 31 and the outer shell fabrics 51 , 52 at these portions . further , the adhesives 55 may be applied to the entire periphery of the protective cushion element . the application of the adhesives 55 increases the volume of the protective cushion when folded . therefore , it is preferable to apply the adhesives 55 only at the both ends or along the upper and lower edges of the cushion . in order to reduce the volume of the cushion when folded , the adhesives 55 and the adhesive 39 are preferably arranged to not be superposed on each other like the illustrated embodiment . though the outer shell fabrics 51 , 52 are separate pieces in the aforementioned embodiment , the outer shell fabrics may be outer shell fabrics 51 a , 52 a composed of one continuous piece as shown in fig5 ( a ), 5 ( b ). the piece for the outer shell fabrics 51 a , 52 a is folded double along the center line l and is superposed on and bonded to the protective cushion element 31 by the adhesive as shown in fig5 ( a ). though the adhesives 55 are applied to be positioned on the outside of the line - shaped joint 40 in the aforementioned embodiments , the adhesives 55 may also or alternatively be positioned on the inside of the line - shaped joint 40 of the protective cushion element 31 . though the outer shell fabrics 51 , 52 are arranged on both the cabin - side and window - side of the protective cushion element 31 in the aforementioned embodiments , the outer shell fabric 51 may be arranged on the cabin - side only . according to this arrangement , the protective cushion 30 may warp toward the inside of the cabin when the protective cushion 30 is inflated . therefore , it is preferable that the outer shell fabrics 51 , 52 are arranged on both sides . as the outer shell fabrics 51 , 52 are arranged on both sides , the protective cushion 30 never warps and is inflated into a symmetrical configuration relative to the cabin - side and the window - side . the protective cushion element and the outer shell fabrics may be fixed by sewing instead of adhesive . in this case , the outer shell fabrics may be sewn to the protective cushion element at the same time as sewing the outer periphery of the protective cushion element , thereby reducing the number of manufacturing steps . the outer shell fabric may be fixed to the window - side fabric and cabin - side fabric so that the connecting joints that connect the outer shell fabric to the cabin - side fabric are not symmetrical to the connecting joints connecting the outer shell fabric to the window - side fabric about a line dividing the section of the outer shell fabric covering the cabin - side fabric from the section of the outer shell fabric covering the window - side fabric . it should be understood that the present invention is not limited to the illustrated embodiments and may take another configuration than the illustrated ones . as described above , the present invention can provide a protective cushion for head protection which can sufficiently absorb the impact even with portions at / around the depressed portions of the protective cushion element . given the disclosure of the present invention , one versed in the art would appreciate that there may be other embodiments and modifications within the scope and spirit of the invention . for example , in one embodiment of the present invention the outer shell fabric may only be placed on the side of the cushion facing the passenger . accordingly , all modifications attainable by one versed in the art from the present disclosure within the scope and spirit of the present invention are to be included as further embodiments of the present invention . the scope of the present invention is to be defined as set forth in the following claims .
| 1 |
the invention of the present invention comprises a trailer 10 having a frame not shown on which is mounted a trailer box defined by a floor 11 side walls 12 and a roof 13 . these provide an open rear 14 which can be closed by suitable doors as is well known . the trailer includes a hitch arrangement at the forward end and ground wheels 15 for transporting the trailer . particularly the trailer is a semi - trailer so that the hitch forward end provides a king pin arrangement for attachment to a highway tractor . in general the transport arrangement of the trailer includes a first row 16 for receiving the vehicles to be transported on the floor 11 and a second row 17 for receiving a further number of the vehicles to be transported carried on a support surface 18 defined by a plurality of panels 19 . in addition the system comprises a loading ramp assembly 20 defined by a front ramp section 21 , a rear ramp section 22 and a centre stabilizer stanchion 23 . in fig1 it will be noted that the ramp assembly is arranged for loading the vehicles onto the upper row 17 . in fig2 the ramp assembly 20 is arranged for loading the vehicles onto the lower row 16 that is onto the floor 11 . this adjustment is obtained by moving a forward end 24 of the front ramp section from a rear cross member 25 at the floor to a rear beam 26 at the support 18 . as shown in fig4 and 5 , the upper support 18 is defined by panels 19 each of which has an outer edge 27 connected to the side wall 12 of the truck body by a hinge 28 . the hinge 28 allows the panel to move from the horizontal position shown in fig5 to a vertical raised position shown in fig4 . in the raised position the panel stands along the side wall of the truck body to a position closely adjacent the roof 13 . the panel includes a spring latch 29 with a pin 30 which engages into a hole in a flange 31 attached to the side wall 12 adjacent the roof 13 . the spring latch 29 is on the underside of the panel . the panels are conventional plywood sheeting of dimensions 4 feet by 8 feet so that an inner edge 32 of the panel 19 lies closely adjacent or meets an inner edge 32 of an opposed panel 19 a at the opposite side wall 12 a . the panels remain in place in the horizontal position simply by gravity and the latches 29 are not used in the lowered operating position shown in fig5 . the panels are carried on a series of transverse beams 33 at spaced positions along the truck body . each of these beams spans across the width of the truck body and is supported at its ends on a plurality of logistics posts 34 also at spaced positions along the truck body . such logistic posts are well known in the trucking industry and trucks are suitably supplied when required containing the logistics posts . these posts are structural members which provide a supporting structure for attachment of transverse beams or bars which can be located at various heights along the posts . these are conventionally used to engage or locate cargo within the truck box . thus the posts each have a series of slots or holes into which the ends of the beams can be engaged to support the beam at a required height . in this embodiment the beams 33 are located approximately at mid height of the truck box and a full set of beams is provided which extends across each of the pairs of posts along the length of the truck body . with the beams in place , the panels 19 can be pivoted simply downwardly to lie over the beams and they are supported thereby to form a subsidiary floor or support surface at a raised position relative to the floor 11 . a plan view of the subsidiary floor is shown in fig1 where the transverse beams 33 can be seen attached to the logistics posts 34 in the side walls 12 and 12 a . the ramp assembly best visible in fig7 , 8 and 9 comprises an upper ramp section 21 defined by a pair of ramp members 40 and 41 . the lower ramp section 22 is also defined by a pair of ramp members 43 and 44 . each of the ramp members is of a conventional construction defined by side beams 45 and 46 together with a plurality of transverse slats 47 . the width of the ramp members is sufficient to receive the wheel of the vehicle to be loaded . the spacing 48 between the ramp members of the upper and lower sections can be adjusted by moving the ramp members inwardly and outwardly across the central stabilizer stanchion 23 and across the rear of the truck body . the central stanchion 23 comprises a base 49 for resting on a suitable floor surface together with a pair of upstanding legs 50 at spaced positions across the base 49 . each of the legs 50 is braced by front and rear braces 51 , 52 so as to be supported in vertical position when the base 49 sits in horizontal position on the ground . the height of the stanchion can be adjusted by sliding an inner tube 53 upwardly and downwardly with respect to the leg 50 and by locking the tube 53 at a required height 55 within the tube defined by the leg . thus an upper transverse beam 56 of the stanchion is supported at a required height relative to the ground . as best shown in fig7 , the upper end of the lower ramp member 43 carries a flange 57 for engagement with a receptacle 58 on the rear side of the beam 56 . symmetrically a receptacle 59 is provided on the upper side of the beam 56 for receiving a flange 60 of the upper ramp member 40 . the flanges 57 and 60 carry a tubular receiving portion 61 , 62 into which a respective pin 63 , 64 can be received acting to lock the respective flange to the respective receptacle 58 and 59 . thus when the pins 63 , 64 are inserted , the ramp members are fixed to the stanchion and are prevented against falling from the stanchion . as shown in fig1 and 2 , the stanchion is adjusted in height so that the first ramp section at the lower end extends from the ground to a height approximately equal to the floor 11 . the upper ramp section then extends from the stanchion to the truck and in the loading position where it is loading the floor , the upper ramp section is generally horizontal . this allows the upper ramp section to be inclined upwardly to the upper loading row from the top of the stanchion 23 at an angle which is approximately equal to the angle of the lower ramp section . as shown in fig1 and 12 a symmetrical latching arrangement is provided at the rear of the truck relative to the latching arrangement at the top of the stanchion 23 . thus the upper end of the upper ramp member 40 has also a flange 66 symmetrical to the flange 60 together with a receiving portion 67 symmetrical to the receiving portion 62 . this allows a pin 68 to engage through the receiving portion from the receptacle 69 on the rear most one of the beams 33 as indicated at 33 a . thus again the receiving portion 67 sits in the receptacle 69 and is latched in place by the transverse pin 68 . in this way the spacing between the ramp members can be adjusted by sliding the ramp members horizontally across the stanchion and across the rear beam of the truck . the width of the pin and the width of the receptacle is such that the movement across the width of the truck is sufficient to accommodate the difference in wheel spacing of the various vehicles to be loaded . although not shown , a symmetrical mounting arrangement is provided on the rear cross member 25 at the floor of the truck . turning now to fig6 , each of the four ramp members 40 , 41 , 43 and 44 if carried in a rack 70 defined by front and rear rack members 71 and 72 . the ramp members are carried in vertical orientation so that the slats 47 stand vertically with the side beams 45 and 46 at top and bottom respectively of the slats . the rack defines a receiving area equal to the dimensions of the four rack members arranged side by side . a front cover portion 75 is inserted over the rack members when they are mounted in place on a bottom horizontal receiving rail 76 and confined by a top receiving rail 77 . thus the racks ramp members are held fixed in place within the rack and clamped in position by the front cover 75 so that they extend along one side of the truck body underneath the frame of the truck body and underneath the floor 11 with the ramp members extending partly along the side of the truck body . the stanchion 23 after the ramp members have been removed can simply be stored inside the truck box alongside the vehicles stored therein . while the truck body is thus suitably configured to transport two rows of the vehicles , it can simply and quickly be modified to transport conventional cargo by lifting the panels 19 to the upward stored position alongside the side walls and removing those of the transverse beams 33 that are required to allow the insertion and placement of the cargo to be transported . in the event that all of the beams are to be removed , the total number of beams can be stored simply within the interior of the truck body with the stanchion . when thus stored , preferably at the forward end of the truck , the remaining open area of the truck body is available substantially wholly between the side walls and between the floor and the ceiling for receiving the conventional cargo to be transported . since various modifications can be made in my invention as herein above described , and many apparently widely different embodiments of same made within the spirit and scope of the claims without department from such spirit and scope , it is intended that all matter contained in the accompanying specification shall be interpreted as illustrative only and not in a limiting sense .
| 1 |
fig1 is a general view showing a catheter assembly , generally designated ( 11 ), that includes the invention catheter ( 12 ) in combination with a guidewire ( 13 ). the details of the catheter construction that distinguish it from prior structures are not shown in fig1 . the assembly includes a standard fitting ( 14 ) through which the guidewire is received and to which the proximal end ( 15 ) of the catheter is removably attached . as depicted , the catheter is a continuous tubular body that extends from proximal end ( 15 ) to distal end ( 16 ) and through which the guidewire extends . the distal end of the guidewire extends outwardly of the distal end ( 16 ) of the catheter . the distal region of the catheter typically carries one or more radiopaque bands ( 17 ) so that the location of the distal region of the catheter within the vessel may be visualized radiographically . details of the structure of catheter ( 12 ) are shown in fig2 . it is composed of an outer tube ( 18 ) and two or more inner coaxial tubular sections ( 19 ) and ( 20 ). as shown , the two inner coaxial tubular sections are disposed in tandem within the outer tube and are contiguous to each other ( i . e . their respective ends abut each other ). the outer tube ( 18 ) extends continuously over the entire length of the catheter , which typically will be over 50 to 210 cm , more usually 60 to 150 cm . the outer diameter of tube ( 18 ) ( as measured at proximal end ( 15 )) will normally be 0 . 75 to 2 . 00 mm , preferably 0 . 85 to 1 . 30 mm . as seen in fig2 the outer tube may neck down at its distal end ( 16 ) and its outer diameter at the distal end may be slightly smaller than at its proximal end . the outer tube will normally have a wall thickness of about 0 . 08 to 0 . 16 mm , preferably about 0 . 10 to 0 . 13 mm . it is made from a polymer having a flexural modulus ( as measured by astm d - 790 ) of about 5 , 000 to 30 , 000 psi ( 35 , 000 to 210 , 000 kpa ), such as low density polyethylene . the proximal inner tubular segment extends from the proximal end ( 15 ) of the catheter to junction ( 22 ). this distance will normally be 60 to 150 cm , more usually 40 to 120 cm , and preferably about 100 cm . its wall thickness is about 0 . 08 to 0 . 18 mm , preferably about 0 . 10 to 0 . 13 mm , an it is made of a polymer having a flexural modulus of about 220 , 000 to 260 , 000 psi ( 1 , 500 , 000 to 1 , 800 , 000 kpa ) such as polypropylene . the portion of the catheter from proximal end ( 15 ) to junction ( 22 ) is thus the stiffest portion of the catheter . the inner diameter of section ( 19 ) will normally be 0 . 45 to 0 . 75 mm . distal inner tubular section ( 20 ) extends from the distal end of section ( 19 ) ( junction ( 22 )) to junction ( 23 ). that distance will normally be 1 to 30 cm , more normally 1 to 20 cm , preferably about 10 cm . this section is less stiff than section ( 19 ). accordingly , its wall thickness is less than section ( 19 ) and / or it is made of a polymer with a lower flexural modulus than the polymer forming section ( 19 ). in a preferred embodiment , it is made of a continuous length of tubing having an appropriately tapered outer diameter . typically , the flexural modulus of the polymer forming section ( 20 ) will be 20 , 000 to 50 , 000 psi ( 140 , 000 to 350 , 000 kpa ) more usually 30 , 000 to 40 , 000 psi ( 210 , 000 to 280 , 000 kpa ). the wall thickness of section ( 20 ) will normally be 0 . 05 to 0 . 10 mm , preferably 0 . 06 to 0 . 09 mm . the inner diameter of section ( 20 ) is preferably substantially the same as that of section ( 19 ). the distal section ( 21 ) of the outer coaxial tube ( 18 ) extends from the distal end of section ( 20 ) ( junction ( 23 )) to the balloon portion of the catheter . the distance from junction ( 23 ) to the balloon will usually be 1 to 20 cm , more usually 1 to 10 cm , preferably about 5 cm . the distance from proximal end ( 15 ) to junction ( 22 ) will be greater than about 50 % of the entire length of catheter ( 12 ), more usually greater than about 75 % of the entire catheter length . although joint ( 22 ) is depicted as a butt joint in the drawing , the joint may be an overlap joint . the invention catheter thus has three sections of different flexibility / stiffness and becomes increasingly flexible from segment - to - segment distally . the axial flexibility / stiffness gradient of the invention is thus more gradual than in the two - segment embodiment of u . s . pat . no . 4 , 739 , 768 and the change in flexibility stiffness between segments is not as great as in a two segment embodiment . in particular , the inclusion of section ( 20 ) allows the distal end of the catheter to be tracked around sharp bends with less likelihood of kinking occurring at the transition between the outer tube and the distal end of the inner coaxial tubing . further , the structure reduces the likelihood of fatigue stress failure , delamination , or other structural failure at the transition . the balloon ( 24 ) of the catheter is defined by a portion of the thin - walled distal segment of the catheter tube . in its deflated configuration , it has a diameter that approximates the diameter of the tube proximal to it . it will normally be inflatable to a maximum diameter with a range of sizes 1 . 5 , 2 . 0 , 2 . 5 , 3 . 0 , 3 . 5 and 4 . 0 mm . the valve portion ( 30 ) of the catheter assembly is preferably inserted into the portion of the balloon having relatively constant inner diameter . it is held in place by heat welding or gluing or other suitable process . the valve may be made up of a simple tube having a metal band so as to form a valve surface proximally of the metal band on the interior of the lumen and a valve surface proximally or distally of the band . the guidewire contains the valve plug , the shape of which is relatively unimportant so long as it meshes adequately with the valve surfaces formed in the valve region . fig3 shows the guidewire ( 35 ) with a plug ( 40 ) that seats on the proximal side of the valve portion ( 30 ). in such a configuration , the guidewire ( 35 ) can be removed once the procedure is completed . fig4 shows the guidewire ( 35 ) with a plug ( 50 ) that seats on the distal side of the valve portion ( 30 ). accordingly , the guidewire ( 35 ) can only be withdrawn when the catheter is withdrawn . the catheter assembly of the invention is operated in similar fashion to other valve balloon catheters . in such operation , the guidewire is advanced into the vasculature to a desired site , and the catheter body is tracked over the guidewire . the location of the guidewire and the balloon within the vessel may be determined by conventional radiology techniques . once the balloon is at the desired site within the vessel , the catheter lumen is flushed by injecting fluid through the catheter lumen , the valve plug is seated against the distal valve surface or the proximal valve surface , depending upon the end from which the guidewire was introduced , by axially manipulating the guidewire . the valve plug blocks the distal opening of the catheter tube . the balloon is then inflated by injecting fluid through the catheter lumen . if desired , controlled distal leakage of the fluid from the catheter tip may be achieved by a slight adjustment in the tightness of the seating between the valve plug and the respective seating areas . the balloon may be deflated by withdrawing fluid from the catheter lumen . modifications of the above - described embodiments of the catheter and catheter assembly that are obvious to those of skill in the fields of catheter design and manufacture , materials science and related fields are intended to be within the scope of the following claims .
| 0 |
before explaining the disclosed embodiments of the present invention in detail it is to be understood that the invention is not limited in its applications to the details of the particular arrangements shown since the invention is capable of other embodiments . also , the terminology used herein is for the purpose of description and not of limitation . 10 . large panel . 20 . mid - sized panel . 30 . small panel . 40 . routed scores in panel . 50 . large cabinet . 60 . mid - sized cabinet . 70 . small cabinet . 80 . “ strike on scores ” label . 90 . striking tool . 100 . shattered panel pieces . 110 . fire extinguisher . 120 . pliers . 130 . resized panel . 140 . broken off pieces of panel after resizing . the novel panels can be formed from a translucent acrylic plastic panel such as plaskolite ® by the plaskolite , inc . corporation of columbus , ohio . the panels can have a plurality of vertical and horizontal scored routed lines , each having score lines . a preferred embodiment of the panel can have a thickness of approximately 0 . 080 inches , and each of the scored lines can have a depth of approximately 0 . 045 inches . each routed score can have a convex round shape with a radius of 0 . 10 inches . the scored lines are on the inside of the panels . fig1 shows a perspective front view of a large breakaway panel 10 of the invention . fig2 is an inside planar rear view of the large panel 10 of fig1 . fig2 a is an enlarged cross - sectional view . fig3 is an outside planar front view of the large panel of fig1 . referring to fig1 , 2 and 2 a , the novel large breakaway panel 10 , can have an overall height of approximately 27 . 69 inches and an overall width of approximately 10 . 63 inches . the panel 10 can have a plurality of vertical parallel scored lines ( routed scores ) 40 , and a plurality of horizontal scored lines ( routed scores ) 40 . the vertical columns can include a middle column having a width of 3 . 55 inches . the novel panel 10 can have four large row sections , each having a height of approximately 6 . 92 inches . the top and bottom large row sections can each have seven additional scored lines that are each approximately 0 . 50 inches from each other , with each of the outer scored lines being approximately 2 inches from the upper and lower edges of the panel 10 . the two middle large row sections having no additional scored lines therein . the novel panel 10 can have three large width vertical columns each having a width of approximately 3 . 55 inches . the left most vertical column and the right most vertical column each have additional five scored lines . the outer first scored line is approximately 0 . 50 inches from the left and right side edges . the next two scored lines ( 2nd and 3rd ) are spaced apart from one another approximately 0 . 38 inches . the fourth scored line is approximately 2 . 01 inches from the left and right side edges , and the fifth scored line being approximately 2 . 51 inches from the left and right side edges . the middle large vertical column has no additional scored lines . the outer four corners of the panel 10 can be convex rounded . fig4 is an inside perspective rear view of a mid - size break away panel 20 . fig5 is an inside planar view of the mid - size panel 20 of fig4 . fig6 is an outside planar front view of the mid - size panel 40 of fig4 . referring to fig4 - 6 , the mid size panel 20 can have an overall height of approximately 22 . 63 inches and an overall width of approximately 8 . 63 inches . the panel 20 can have a plurality of vertical parallel scored lines ( routed scores ) 40 , and a plurality of horizontal scored lines ( routed scores ) 40 . the vertical columns can include a middle column having a width of 2 . 88 inches . the novel panel 20 can have four large row sections , each having a height of approximately 5 . 66 inches . the top and bottom large row sections can each have six additional scored lines that are each approximately 0 . 25 inches from each other , with each of the outer scored lines being approximately 0 . 50 inches from the upper and lower edges of the panel 20 . the two middle large row sections have no additional scored lines therein . the novel panel 20 can have three large width vertical columns each having a width of approximately 2 . 88 inches . the left most vertical column and the right most vertical column each have additional four scored lines . the outer first scored line is approximately 0 . 50 inches from the left and right side edges . the next two scored lines ( 2nd and 3rd ) are spaced apart from one another approximately 0 . 25 inches . the fourth scored line is approximately 1 . 50 inches from the left and right side edges . the middle large vertical column has no additional scored lines . the outer four corners of the panel 20 can be convex rounded . fig7 is an inside perspective rear view of a small break away panel 30 . fig8 is an inside planar rear view of the small panel 30 of fig7 . fig9 is an outside planar front view of the small panel 30 of fig7 . referring to fig7 - 9 , the small panel 30 can have an overall height of approximately 18 . 69 inches and an overall width of approximately 7 . 63 inches . the panel 30 can have a plurality of vertical parallel scored lines ( routed scores ) 40 , and a plurality of horizontal scored lines ( routed scores ) 40 . the vertical columns can include a middle column having a width of 2 . 53 inches . the novel panel 30 can have four large row sections , each having a height of approximately 4 . 82 inches . the top and bottom large row sections can each have two additional scored lines that are each approximately 0 . 50 inches from each other , with each of the outer scored lines being approximately 0 . 25 inches from the upper and lower edges of the panel 30 . the two middle large row sections have no additional scored lines therein . the novel panel 30 can have three large width vertical columns each having a width of approximately 2 . 53 inches . the left most vertical column and the right most vertical column each have an additional two scored lines . the outer first scored line is approximately 0 . 25 inches from the left and right side edges . the next scored line is spaced inwardly another 0 . 50 inches . the middle large vertical column has no additional scored lines . the outer four corners of the panel 30 can be convex rounded . fig1 is a front perspective view of large prior art cabinet 50 with the novel large panel 10 with routed vertical and horizontal scored lines 40 of fig1 - 3 installed . the scored lines 40 are on the inside of the panels . fig1 is a front perspective view of a mid - size prior art cabinet 60 with the novel mid - size panel 20 with routed vertical and horizontal scored lines 40 of fig4 - 6 installed . the scored lines 40 are on the inside of the panels . fig1 is a front perspective view of small prior art cabinet 70 with the small panel 30 with routed vertical and horizontal scored lines 40 of fig7 - 9 installed . the scored lines 40 are on the inside of the panels . fig1 is a front view of the small prior art cabinet 70 with the novel small panel 30 with routed vertical and horizontal scored lines 40 installed of fig1 and “ break panel ” label 80 applied to panel . fig1 a is an enlarged view of the “ break panel ” label of fig1 . referring to fig1 and 13a , the label 80 must be located on an entire rectangular section and cannot overlay a scored line . the label 80 indicates that the user is directed break the panel 30 by striking an area directly on one of the scored lines 40 . it is easier to break the panel 30 in areas where the fire extinguisher is not located . fig1 is a perspective view of the small cabinet 70 with installed novel small panel 30 of fig1 , with a striking tool 90 striking the panel 30 into break away parts . although a hammer 90 is shown , the striking device can be a small rod , or can be fist of the user . the user can strike the panel 30 along one of the scored lines to gain access to the fire extinguisher . the breakaway sections 100 are easy to remove since the scored lines 40 are on the inside of the panel 30 so that the shattered panel pieces 100 . fig1 is another perspective view of the small cabinet of fig1 with the panel 30 substantially broken out exposing a fire extinguisher 110 . here , the user can then retrieve the fire extinguisher 110 without being harmed by broken glass that is often used in the prior art . fig1 is a perspective front view of the large breakaway panel 10 of fig1 with pliers 120 being used to resize the panel 10 as needed . although , pliers 120 are shown , a user can use other tools such as a needle - nose pliers , which makes breaking off the pieces extremely easy . in addition , the scored pieces can be broken off just using one &# 39 ; s fingers . the installer such as a fire extinguisher technician can change out most glass panels in all fire extinguisher cabinets by only transporting three types of panels ( large panel 10 , mid - size panel 20 and small panel 30 ). the installer can then size the replacement panel by using any one of the three panels 10 , 20 , 30 or alternatively breaking off scored pieces to correctly size the respective panel to the respective cabinet . again , unlike glass , the novel panels cannot cause harm to the installer or the ultimate user that breaks the breakaway panels to access the fire extinguisher . fig1 is another perspective view of the large breakaway panel 10 of fig1 with top , bottom , left and right break away edges 40 removed , so that a resized panel 130 is formed that can be used in a cabinet having an opening sized for the resized panel 130 . while the invention is described by scoring ( routing ) lines into the panels , both the scoring and the panel itself can be done by injection molding . so that the entire part can be formed from injection molding . fig1 is a perspective view of another embodiment of the breakaway panel that can be formed injection molding . this panel can have a width of approximately 10 . 63 inches and a length of approximately 27 . 69 inches . the panel can have four large rows that each have a height of approximately 6 . 92 inches . the panel can be formed with small square shaped scoring lines , with each square having a length and width of approximately 0 . 50 inches . the panel can have a central rectangular section down the middle of the panel having large rectangular scored lines , wherein the large rectangular scored lines spaced substantially apart from the square shaped patterns of scored lines . the panel can have a perimeter small rectangular patterns of scored lines about each of the four sides of the panel , the small rectangular patterns being smaller than the square shaped patterns of scored lines . with the injection molded panel , the depth of scoring from injection molding can be 0 . 050 inches which is deeper than scoring done by routing . the injection molded panels can have a thickness of 0 . 095 inches . additionally , the injection molded panel can be sized for small , mid sized and large breakaway panels . the dimensions described in the patent application that are a preferred embodiment , and the label of “ approximately ” allows for a 10 % ( ten percent ) deviation . although the invention references the panels for being used with fire extinguisher cabinets , the novel invention panels can be used for other types of cabinets , and the like . while the invention has been described , disclosed , illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended .
| 0 |
the new modification has a distinct crystal phase but its precise definition is difficult . the particle size of the dried modified material makes it difficult to obtain a sharp debye - scherrer x - ray diffraction pattern . thus , the precise location of some of the stronger peaks and the existence of some of the weaker peaks are difficult to ascertain . however , on x - ray analyses of different samples , a clearly recognizable pattern is obtained . the new modification is also characterized by its coloration both upon drying and upon subsequent slurrying and redrying . this modification will give an essentially white powder if it is dried at temperatures between 60 ° and 70 ° c . at drying temperatures of about 110 ° c . it gives a yellow colored powder . however , if material initially dried at between 60 ° and 70 ° c . is reslurried and then dried at 110 ° c . it remains white . on the other hand , if material initially dried at 110 ° c . is reslurried and then dried at 60 ° to 70 ° c . it yields a white powder . the new modification does not cause discoloration of dry detergent compositions prepared by slurrying the components in water and drying . in particular , if optical brightener dried to either a yellow or a white powder is slurried at a ratio of 1 part by weight to 200 parts by weight of detergent in water and dried at 85 ° to 90 ° c . the color is indistinguishable from a dried slurry of detergent alone . the optical brightener modification of the present invention may be obtained by heating an aqueous slurry of the sodium salt form of this bis - triazinyl amino stilbene compound to a temperature in excess of 65 ° c ., preferably in excess of 90 ° c . the slurry should be held at temperature for a period sufficient to convert all the undissolved brightener to the new crystal form . a period of four hours at temperature is usually more than adequate . the ph of the aqueous slurry should be controlled to be no less than neutral . otherwise some of the sulphonate groups of the brightener may revert to their free acid form . it is preferred to keep the ph alkaline and a ph in excess of about 10 . 5 is especially preferred . this process does not require the presence of any organic solvents or the use of elevated pressures . thus , the modified brightener may be recovered directly from the treatment bath by spray drying without posing an explosion risk . the treatment itself may be conducted in conventional equipment at atmospheric pressure . the brightener may be conveniently heated in an aqueous solution of an electrolyte . sufficient electrolyte should be included to prevent the complete dissolution of the brightener at the treatment temperature . any electrolyte which will not adversely effect the brightener may be used . in order to avoid the possibility of changing the nature of the counter ion to the brightener &# 39 ; s sulfonic acid groups sodium based electrolytes are preferred . the sodium salts of the mineral acids are particularly preferred . trisodium phosphate is an especially preferred electrolyte . if an aqueous slurry containing about 33 % of optical brightener is to be treated , the addition of at least about 10 wt . % of electrolyte based on the weight of the slurry has been found to give good results . the treatment bath may also contain a dedusting agent . between about 2 and 6 wt . %, based on the weight of optical brightener , may be conveniently used . in a preferred embodiment the new modification optical brightener is recovered by spray drying . the treatment slurry including the electrolyte is fed to a spray dryer after being held at the treatment temperature for a sufficient time to obtain the new modification . the spray dryer may have any convenient inlet temperature and temperatures between about 220 ° and 370 ° c . were found suitable . however , if an initially white product is desired , the outlet temperature should be kept at below about 80 ° c ., preferably below about 75 ° c . depending on the particular equipment used this outlet temperature requirement will limit the maximum inlet temperature ; the faster the feed rate which can be sustained , the greater the spread between inlet and outlet temperature may be . this procedure provides a high yield of the rather strongly water soluble sodium salt and at the same time it provides an already standardized product . the recovery of this sodium salt by filtration has been found to result in yield losses of as much as 10 %. the electrolyte to optical brightener ratio established in the treatment bath will be retained after spray drying so the concentration of active ingredient in the spray dried product can be readily controlled . further , the amount of electrolyte added to the bath may be adjusted in accordance with the spectral strength of the optical brightener being converted ; the crystal modification obviously does not effect its properties in solution . the following examples illustrate the invention without limiting it in any way . a sufficient amount of the presscake of 4 , 4 &# 39 ;- bis -[ 2 - methylamino - 4 - phenylamino - 1 , 3 , 5 - triazinyl -( 6 )- amino ]- stilbene - 2 , 2 &# 39 ;- disulphonic acid and water were charged to a vessel to give a slurry with a solids concentration of 33 %. this slurry was heated to 70 ° to 75 ° c . sufficient 50 % naoh solution was added to adjust the ph to between 11 and 11 . 5 at a rate slow enough to avoid the formation of lumps . the presscake solids went into solution . the solution of the disodium salt was heated to between 90 ° and 95 ° c . over a period of two hours holding the ph constant . then 0 . 382 parts of trisodium phosphate per part of presscake solids were added over a period of two hours . as this electrolyte was added a brown , sticky scum formed which then dissolved . the bath was held at 90 ° to 95 ° c . for a period of four hours during which the optical brightener crystallized and formed a white slurry . the new modification was recovered in four different manners . in two cases it was fed to a spray dryer and in two cases it was trapped on a filter and vacuum dried . a combination of 3 . 1 parts of white mineral oil and 1 . 5 parts of sulphonated mineral oil per 100 parts of presscake solids were added to the spray drier feed line as a dedusting package . the resulting powders had the following appearances : ______________________________________spray driedoutlet temp . outlet temp . vacuum driedof 75 ° c . of 110 ° c . 60 ° c . 110 ° c . ______________________________________white or ivory canary yellow white yellowish______________________________________ all four of these materials had essentially the same debye - scherrer x - ray diffraction pattern using a copper k alpha radiation . furthermore , all four of these materials caused no discoloration when slurried with detergent at a weight ratio of 1 part to 200 parts detergent and then dried at 85 ° to 90 ° c . a reaction slurry obtained from the commercial synthesis of the free acid form of the optical brightener of the present invention and having a solids content of about 11 % was treated in the same manner as the presscake slurry of example i except that it was only recovered by spray dyring with an outlet temperature of 75 ° c . a white powder was obtained . a 33 % slurry of the free acid form of the optical brightener was prepared and neutralized as in example i . the trisodium phosphate , 0 . 382 parts per part of presscake solids , was added at 70 ° c . the bath was held at this temperature for six hours . the compound was all converted to the new crystalline form . the slurry was then spray dried using an outlet temperature of 75 ° c . a trace yellow powder was obtained . although the invention has been described in detail in the foregoing for the purpose of illustration , it is to be understood that such detail is solely for that purpose and that variations can be made therein by those skilled in the art without departing from the spirit and scope of the invention except as it may be limited by the claims .
| 2 |
the rigid polyurethane foams which are the subject matter of this invention are prepared by reacting a mixture of ( b ) an ethylene oxide , and / or propylene oxide adduct of ethylenediamine having a molecular weight range from about 200 to about 500 , the ratio of polyether polyol to the adduct of ethylenediamine is from about 2 . 5 : 1 to about 1 : 1 . 5 , preferably 1 : 1 . the polyoxyalkylene polyether polyol or polyether blend which are employed in the subject invention are well known in the art and are generally referred to as polyoxyalkylene polyether polyols . these polyols are prepared by the reaction of an alkylene oxide with a polyhydric compound . alkylene oxides which may be employed in the preparation of the polyols of the present invention include ethylene oxide , propylene oxide , the isomeric normal butylene oxides , hexylene oxide , octylene oxide , dodecene oxide , methoxy and other alkoxy propylene oxides , and cyclohexene oxide . styrene oxide may also be employed . halogenated alkylene oxides may also be used , such as epichlorohydrin , epiiodohydrin , epibromohydrin , 3 , 3 - dichloropropylene oxide , 3 - chloro - 1 , 2 - epoxypropane , 3 - chloro - 1 , 2 - epoxybutane , 1 - chloro - 2 , 3 - epoxybutane , 3 , 4 - dichloro - 1 , 2 - epoxybutane , 1 , 4 - dichloro - 2 , 3 - epoxybutane , 1 - chloro - 2 , 3 - epoxybutane , and 3 , 3 , 3 - trichloropropylene oxide . mixtures of any of the above alkylene oxides may also be employed . the polyoxyalkylene polyether polyols may have either primary or secondary hydroxyl groups and preferably are prepared from alkylene oxides having from 2 to 8 carbon atoms and may have molecular weights from about 400 to about 10 , 000 . the polyoxyalkylene polyether glycol may be prepared by any known process such as , for example , the process disclosed by wurtz in 1859 and encyclopedia of chemical technology , vol . 7 , pages 257 - 262 , published by interscience publishers , inc . ( 1951 ) or in u . s . pat . no . 1 , 922 , 459 . polyhydric compounds which may be reacted with the alkylene oxides to prepare the polyalkylene ether polyols employed in the subject ivention include ethylene glycol , propylene glycol , diethylene glycol , dipropylene glycol , the isomeric butylene glycols , 1 , 5 - pentane diol , 1 , 6 - hexanediol , glycerol , trimethylolpropane , 1 , 2 , 6 - hexanetriol , pentaerythritol , sorbitol , sucrose and alpha - methyl glycoside . the alkylene oxide adduct of ethylenediamine is prepared by reacting ethylene oxide and / or propylene oxide with ethylenediamine , possibly in the presence of an alkaline catalyst . this catalyst may be potassium hydroxide , sodium hydroxide , sodium and potassium methylate and other catalyst well known to those skilled in the art . the quantity of ethylene and propylene oxide employed is such that the molecular weight of the adduct may vary from about 200 to about 500 . the ethylene oxide content may range from about 0 percent to about 90 percent based on the total weight of the adduct . the mixture of polyoxyalkylene polyether polyol and ethylenediamine adduct is reacted with an organic polyisocyanate such that the ratio of isocyanate groups of the polyisocyanate to the hydroxyl groups of the polyether polyol is 1 . 0 : 1 to 1 . 3 : 1 . polyisocyanates which may be used include aromatic , aliphatic , and cycloaliphatic polyisocyanates and combinations thereof . representative examples are diisocyanates such a m - phenylene diisocyanate , 2 , 4 - toluenediisocyanate , 2 , 6 - toluenediisocyanate , mixtures of 2 , 4 - toluenediisocyanate and 2 , 6 - toluenediisocyanate , hexamethylene diisocyanate , tetramethylene diisocyanate , 1 , 4 - cyclohexane diisocyanate , hexahydrotoluene diisocyanate , 1 , 5 - naphthalene diisocyanate , 1 - methyoxy - 2 , 4 - phenylene diisocyanate , 4 , 4 &# 39 ;- diphenylmethane diisocyanate , 4 , 4 &# 39 ;- biphenylene diisocyanate , 3 , 3 &# 39 ;- dimethoxy - 4 , 4 &# 39 ;- biphenyl diisocyanate , 3 , 3 &# 39 ;- dimethyl - 4 , 4 &# 39 ;- biphenyl diisocyanate , and 3 , 3 &# 39 ;- dimethyl - 4 , 4 &# 39 ;- diphenylmethane diisocyanate ; the triisocyanates such as 4 , 4 &# 39 ; 4 &# 34 ;- triphenylmethane triisocyanate polymethylene polyphenylene polyisocyanate and 2 , 4 , 6 - toluene triisocyanate ; and the tetraisocyanates such as 4 , 4 &# 39 ;- dimethyl - 2 , 2 &# 39 ;, 5 , 5 &# 39 ;- diphenylmethane tetraisocyanate . especially useful due to their availability and properties are toluene diisocyanate , 4 , 4 &# 39 ;- diphenylmethane diisocyanate and polymethylene polyphenylene polyisocyanate . polymethylene polyphenylene polyisocyanate , which is most preferred , is a product which results from the phosgenation of an aniline - formaldehyde condensation product ; it is sometimes called &# 34 ; crude mdi .&# 34 ; as was previously mentioned , catalysts may be used to increase the reaction rate . if catalysts are used , they are added to the mixture of the polyether polyol and ethylenediamine adduct blend before the reaction of the mixture with the polyisocyanate . urethane catalysts which may be employed in the present invention are well known in the art and include the metal or organometallic salts of carboxylic acid and tertiary amines . representative of such compounds are : dibutyltin dilaurate , dibutyltin diacetate , stannous octoate , lead octoate , cobalt naphthenate , and other metal or organometallic salts of carboxylic acids in which the metal is bismuth , titanium , iron , antimony , uranium , cadmium , aluminum , mercury , zinc , or nickel as well as other organometallic compounds such as are disclosed in u . s . pat . no . 2 , 846 , 408 . tertiary amines such as triethylenediamine , triethylamine , diethylcyclohexylamine , n - ethylmorpholine and diethylethanolamine may also be employed as well as mixtures of any of the above . generally , the amount of urethane - promoting catalyst employed will be from 0 . 01 percent to 10 percent by weight based on the weight of the polyether polyol . the polyurethane foams employed in the present invention are generally prepared by the reaction of the polyol mixture with an organic polyisocyanate in the presence of a blowing agent and optionally in the presence of additional polyhydroxyl - containing components , chain - extending agents ; catalysts , surface - active agents , stabilizers , dyes , fillers and pigments . suitable processes for the preparation of cellular polyurethane plastics are disclosed in u . s . pat . no . re . 24 , 514 together with suitable machinery to be used in conjunction therewith . when water is added as the blowing agent , corresponding quantities of excess isocyanate to react with the water and produce carbon dioxide may be used . it is possible to proceed with the preparation of the polyurethane plastics by a prepolymer technique wherein an excess of organic polyisocyanate is reacted in a first step with the polyol of the present invention to prepare a prepolymer having free isocyanate groups which is then reacted in a second step with water and / or additional polyol to prepare a foam . alternatively , the components may be reacted in a single working step commonly known as the &# 34 ; one - shot &# 34 ; technique of preparing polyurethanes . furthermore , instead of water , low boiling hydrocarbons such as pentane , hexane , heptane , pentene , and heptene ; azo compounds such as azohexahydrobenzodinitrile ; halogenated hydrocarbons such as dichlorodifluoromethane , trichloromethane , dichlorodifluoroethane , vinylidene chloride , and methylene chloride may be used as blowing agents . a surface - active agent is generally necessary for production of high grade polyurethane foam according to the present invention , since in the absence of same , the foams collapse or contain very large uneven cells . numerous surface - active agents have been found satisfactory . nonionic surface - active and wetting agents are preferred . of these , the nonionic surface - active agents prepared by the sequential addition of propylene oxide and then ethylene oxide to propylene glycol and the solid or liquid organosilicones have been found particularly desirable . other surface - active agents which are operative , although not preferred , include polyethylene glycol ethers of long chain alcohols , tertiary amine or alkanolamine salts of long chain alkylacid sulfate esters , alkyl sulfonic esters , and alkyl arysulfonic acids . the following examples illustrate the nature of the invention . all parts are by weight unless otherwise stated . the k - factors were determined employing astm method c - 518 . polyol a is a propylene oxide adduct of a mixture of sucrose and propylene glycol , having a hydroxyl number of about 563 . polyol b is propylene oxide ethylene oxide adduct of ethylenediamine having a hydroxyl number of about 450 and containing 8 . 8 percent ethylene oxide . polyol c is a propylene oxide adduct of ethylenediamine having a hydroxyl number of about 489 . polyol d is a propylene oxide ethylene oxide adduct of ethylenediamine having a hydroxyl number of about 488 and containing 28 . 2 percent ethylene oxide . polyol e is a propylene oxide ethylene oxide adduct of ethylenediamine having a hydroxyl number of about 489 and containing 31 . 4 percent ethylene oxide . polyol f is a propylene oxide ethylene oxide adduct of ethylenediamine having a hydroxyl number of about 504 and containing 19 . 8 percent ethylene oxide . polyol g is a propylene oxide ethylene oxide adduct of toluenediamine , 90 percent vicinal isomers having a hydroxyl number of 443 and containing 65 . 7 percent ethylene oxide . polyol h is a propylene oxide ethylene oxide adduct of ethylenediamine having a hydroxyl number of about 492 and containing 9 . 4 percent ethylene oxide . polyol i is a propylene oxide ethylene oxide adduct of ethylenediamine having a hydroxyl number of about 494 and containing 18 . 8 percent ethylene oxide . polyol j is a propylene oxide ethylene oxide adduct of ethylenediamine having a hydroxyl number of about 486 and containing 37 . 6 percent ethylene oxide . polyol k is a propylene oxide ethylene oxide adduct of ethylenediamine having a hydroxyl number of about 498 and containing 40 . 1 percent ethylene oxide . polyol l is a propylene oxide ethylene oxide adduct of ethylenediamine having a hydroxyl number of about 495 and containing 34 . 9 percent ethylene oxide . polyol m is a propylene oxide ethylene oxide adduct of ethylenediamine having a hydroxyl number of about 489 and containing 60 . 9 percent ethylene oxide . polyol n is a propylene oxide adduct of a mixture of sucrose and propylene glycol having a hydroxyl number of 507 . polycat 8 is an amine catalyst sold by abbott laboratories , inc . the polyols in the amounts as tabulated in table i were prepared by charging a container with a suitable quantity of the reactants with the exception of the isocyanate as tabulated . the mixture was stirred for about 30 seconds and allowed to set until the air bubbles had dissipated . the calculated amount of polyisocyanate was added to the container , and the resulting mixture was stirred for about 35 seconds , and the foam was allowed to rise therein . after the foam rise was completed , the resulting foam was cured for about 48 hours at room temperature . the k - factors were then determined . table i__________________________________________________________________________ example 1 2 3 4 5 6 7 8 9 10 11 12 13 14__________________________________________________________________________formulation , pbwpolyola 40 40 40 40 40 -- -- -- -- -- -- -- -- -- b 60 -- -- -- -- -- -- -- -- -- -- -- -- -- c -- 60 -- -- -- -- -- -- -- -- -- -- -- -- d -- -- 60 -- -- -- -- 30 -- -- -- -- -- -- e -- -- -- 60 -- -- -- -- 30 -- -- -- -- -- f -- -- -- -- 60 -- -- -- -- -- 30 -- -- -- g -- -- -- -- -- 10 10 10 10 10 10 10 10 10h -- -- -- -- -- 30 -- -- -- -- -- -- -- -- i -- -- -- -- -- -- 30 -- -- -- -- -- -- -- j -- -- -- -- -- -- -- -- -- 30 -- -- -- -- k -- -- -- -- -- -- -- -- -- -- -- 30 -- -- l -- -- -- -- -- -- -- -- -- -- -- -- 30 -- m -- -- -- -- -- -- -- -- -- -- -- -- -- 30n -- -- -- -- -- 60 60 60 60 60 60 60 60 60dc - 193 1 . 5 1 . 5polycat 8 1 . 0 1 . 0f - 11 - a 38 . 6 39 . 7 39 . 7 39 . 7 40 . 1 38 . 8 38 . 8 38 . 7 38 . 7 38 . 7 38 . 9 38 . 9 38 . 8 38 . 7isocyanate a 125 . 1 131 . 6 131 . 5 131 . 6 133 . 9 126 . 1 126 . 3 125 . 8 125 . 9 125 . 7 128 . 0 126 . 6 126 . 4 125 . 9k - factor . 145 . 141 . 145 . 146 . 144 . 144 . 143 . 143 . 143 . 143 . 142 . 146 . 146 . 146__________________________________________________________________________
| 2 |
as best seen in fig3 - 5 , the non - penetrating deep sclerectomy / canalostomy surgical procedure involved with implant 10 of the present invention involves creating a scleral cavity or pocket into which implant 10 is placed . initially , superficial scleral flap 100 is formed in eye 200 . flap 100 is generally less than one - third of the scleral thick and can extend up to two millimeters into the clear cornea . flap 100 may be generally 5 millimeters by 6 millimeters but can be made larger or smaller depending upon factors such as the size of the eye or the desired size of implant 10 . the sclera is further dissected to remove deep portion of sclera 110 to expose descemet &# 39 ; s membrane 130 leaving a thin layer of deep sclera over the choroid posteriorly . anteriorly , the dissection is done reaching schlemm &# 39 ; s canal 120 ( which is unroofed ) and continuing further into corneal stromal tissue to the level of descemet &# 39 ; s membrane 130 . the removal of the inner endothelium of schlemm &# 39 ; s canal 120 and juxta - canalicular trabecula can also be performed at this stage using a fine forceps ( not shown ). the aqueous percolation into the achieved scleral cavity will thus be established . deep scleral portion 110 can be of any size suitable to allow for implantation of implant 10 , but generally will be approximately 4 millimeters by 5 millimeters , but can be made larger or smaller depending upon factors such as the size of the eye or the size of flap 100 . as best seen in fig1 - 2 , implant 10 of the present invention is designed to be implanted within a void formed in the sclera during non - penetrating deep sclerectomy / canalostomy surgery by the removal of deep sclera portion 110 and includes body 12 and tubular elements 14 . implant 10 preferably is made in multiple components from any suitable biocompatible material , such as polymethylmethacrylate ( pmma ), polycarbonate , polyurethane , polyamide , polypropylene , silicone , soft acrylic , hydrogel , stainless steel or titanium . implant 10 may be coated with any suitable coating to enhance biocompatibility or to help prevent implant 10 from fouling or become clogging with fibrotic growth , such as heparin , mytomycin , 5 - fu or other suitable coatings well - known in the art . body 12 is generally flat or slightly curved to approximate the curvature of the sclera and contains sidewalls 16 that form hollow interior 18 . body 12 may be of any suitable size and shape , such as rectangular , semi - circular or elliptical and between 4 millimeter and 5 millimeters across , but can be made larger or smaller depending upon factors such as the size of the eye or the size of deep scleral portion 110 . body 12 may contain port 17 that communicates with hollow interior 18 . sidewalls 16 preferably are between 100 microns and 200 microns tall . tubes 14 may have tapered ends 15 and preferably are sized and shaped to fit snugly within the openings in the unexcised portions of schlemm &# 39 ; s canal and contains bores 20 that communicate with hollow interior 18 . tubes 14 may be made adjustable to address the need of variable and unpredictable anatomical location of schlemm &# 39 ; s canal 120 from patient to patient . implant 10 may also contain bottom plate 50 having a similar construction as body 12 and containing a circumferential groove 52 sized and shaped so as to allow plate 50 to securely fit onto and be held by sidewalls 16 on body 12 . plate 50 has outwardly tapering fitting 54 having a port 56 that communicates with hollow interior 18 of body 12 when plate 50 is attached to body 12 . in use during non - penetrating deep sclerectomy / canalostomy surgery , void 140 is created in the sclera that exposes descemet &# 39 ; s membrane 130 and schlemm &# 39 ; s canal 120 in the manner described above . body 12 is place in void 140 so that sidewalls 16 lay perpendicularly to descemet &# 39 ; s membrane 130 and hollow interior 18 is exposed to descemet &# 39 ; s membrane 130 . if desired , body 12 may be filled with a viscoelastic substance , such substances being well - known in the art , to help minimize fibrotic adhesions . in addition , the viscoelastic agent may contain a antimetabolite , such as mytomycin or 5 - fu . tapered ends 15 of tubular elements 14 are inserted into the openings in the unexcised portions of schlemm &# 39 ; s canal 120 . if desired , the openings in the unexcised portions of schlemm &# 39 ; s canal 120 may be enlarged slightly by the introduction of a viscoelastic substance , such substances being well - known in the art in order to facilitate the introduction of tapered ends 15 into the openings in the unexcised portions of schlemm &# 39 ; s canal 120 . flap 100 is placed over implant 100 and sutured in place . port 17 in body 12 normally will be sealed by plug 19 so that any fluid entering hollow interior 18 will be contained within body 12 . in this manner , aqueous fluid may percolate through descemet &# 39 ; s membrane 130 and enter the openings in the unexcised portions of schlemm &# 39 ; s canal 120 through hollow interior 18 , ports 20 in tubular arms 15 . in the event that schlemm &# 39 ; s canal 120 can not be found and / or tubes 14 can not be placed in the openings in the unexcised portions of schlemm &# 39 ; s canal 120 , flap 100 will be not tightly closed and plug 19 may be removed from body 12 thus allowing passage through port 17 , causing subconjunctival outflow with bleb formation similar to the deep sclerectomy surgery . if inadequate bleb formation occurs , then flap 100 may be opened and plug 19 may be removed from port 17 and replaced with piercing plug 21 and flap 100 replaced . alternatively , even with successful placement of tubes 14 into the openings in the unexcised portions of schlemm &# 39 ; s canal 120 , in the event that outflow from interior 18 through ports 20 and into the openings in the unexcised portions of schlemm &# 39 ; s canal 120 becomes blocked or is insufficient to reduce intraocular pressure a sufficient amount , flap 100 may be opened and plug 19 may be removed from port 17 and replaced with piercing plug 21 and flap 100 replaced . plug 21 allows excess aqueous fluid to exit interior 18 through flap 100 and into the subconjunctival space between the scleral and conjunctiva , thereby forming a subconjunctival bleb . in the event that percolation through descemet &# 39 ; s membrane 130 is insufficient to relieve the excess intraocular pressure , plate 50 may be used by attaching plate 50 to body 12 and placing the combination of body 12 and plate 50 in void 140 so that fitting 54 punctures descemet &# 39 ; s membrane 130 and projects downwardly into the anterior chamber of eye 200 . port 56 allows for more positive drainage of aqueous fluid from the anterior chamber into hollow interior 18 and out through ports 20 into the openings in the unexcised portions of schlemm &# 39 ; s canal 120 . in the event that outflow from interior 18 through ports 20 and into the openings in the unexcised portions of schlemm &# 39 ; s canal 120 becomes blocked or is insufficient to reduce intraocular pressure a sufficient amount , plug 19 may be removed from port 17 and replaced with plug 21 . plug 21 allows excess aqueous fluid to exit interior 18 through flap 100 and into the subconjunctival space between the scleral and conjunctiva , thereby forming a subconjunctival bleb . this description is given for purposes of illustration and explanation . it will be apparent to those skilled in the relevant art that changes and modifications may be made to the invention described above without departing from its scope or spirit .
| 0 |
reference will now be made in detail to various embodiments of the present invention ( s ), examples of which are illustrated in the accompanying drawings and described below . while the invention ( s ) will be described in conjunction with exemplary embodiments , it will be understood that present description is not intended to limit the invention ( s ) to those exemplary embodiments . on the contrary , the invention ( s ) is / are intended to cover not only the exemplary embodiments , but also various alternatives , modifications , equivalents and other embodiments , which may be included within the spirit and scope of the invention as defined by the appended claims . fig1 is a schematic perspective view illustrating an impulse charger for motor vehicle engines according to an exemplary embodiment of the present invention . fig2 ( a ) and 2 ( b ) are a cross - sectional views taken along the lines a - a and b - b of fig1 , respectively . as illustrated in fig1 , the impulse charger for motor vehicle engines according to an exemplary embodiment of the present invention includes an impulse block 10 through which intake holes 11 pass so as to communicate with intake runners ( not shown ) of the motor vehicle engine , an impulse valve 20 that opens or closes the intake holes 11 , a driving apparatus 30 ( see fig3 ) that drives the impulse valve 20 , and at least one link unit 40 that is connected by at least one link member and transmits a driving force from the driving apparatus 30 to the impulse valve 20 . the driving apparatus 30 ( see fig3 ) generates a continuous driving force in order to drive the impulse valve 20 . this continuous driving force is transferred through the link unit 40 , and then is transmitted to the impulse valve 20 such that the impulse valve 20 is opened or closed at predetermined periods . specifically , the driving apparatus 30 continuously generates a predetermined rotating force using , for instance , a motor . this continuous rotating force is transferred through the link unit 40 connected by at least one link member , and then is transmitted to the impulse valve 20 . thereby , the impulse valve 20 is operated at predetermined periods . thus , the impulse charger for motor vehicle engines according to various embodiments of the present invention is not driven in a manner such that the impulse valve 20 is opened or closed at opening or closing points of time by repeatedly transmitting a driving force using motors or electromagnets , but in a manner such that the impulse valve 20 is opened or closed by constantly continuously generating a driving force and by transmitting this continuous driving force to the impulse valve 20 through the link unit 40 at predetermined periods . at this time , according to magnitude of the driving force , for example , according to magnitude of a rotating speed of the motor , the period at which the impulse valve 20 is opened or closed through the link unit 40 may be changed . thus , the impulse charger for motor vehicle engines according to various embodiments of the present invention is operated with low noise , and is easily manufactured and mounted due to reduction of necessary components and simplification of control logic . meanwhile , as illustrated in fig1 and 2 , the impulse valve 20 includes valve rotating shafts 21 that are rotatably coupled to the impulse block 10 across the intake holes 11 , and baffles 22 that are mounted on outer circumferences of the valve rotating shafts 21 in a direction perpendicular to the axis of each valve rotating shaft 21 . at this time , the baffles 22 are shaped corresponding to a cross - sectional shape of each intake hole 11 . as the valve rotating shafts 21 rotate , the baffles 22 serve to open or close the intake holes 11 . according to the structure of the impulse valve 20 , the driving force generated by the driving apparatus 30 can be transmitted to the valve rotating shafts 21 through the link unit 40 , thereby generating the rotating force from the valve rotating shafts 21 . further , in this structure of the impulse valve 20 , the link unit 40 can be configured so that the driving apparatus 30 generates a rotating force in a one - way direction , and so that this one - way rotating force generated by the driving apparatus 30 is transmitted as a reciprocating - rotating force to the valve rotating shafts 21 . thus , when the reciprocating - rotating force is generated by the driving apparatus 30 , the valve rotating shafts 21 are alternately rotated at predetermined periods by the link unit 40 , and thus the impulse valve 20 is operated so as to open or close the intake holes 11 . meanwhile , as illustrated in fig1 , the impulse block 10 has the plurality of intake holes 11 so as to correspond to the intake runners according a type of the motor vehicle engine . in an exemplary embodiment of the present invention as shown in fig1 , the impulse block 10 is applied to a four - cylinder engine , and thus has four intake holes 11 . all of the intake holes 11 are not simultaneously opened or closed . specifically , the intake holes 11 are opened or closed at the same periods as that at which the pistons of the engine are reciprocated . from the viewpoint of characteristics of the motor vehicle engine , the intake holes 11 are generally designed in a manner so that two of them are simultaneously opened or closed in a pair . in this manner , when a plurality of the intake holes 11 are formed , a plurality of the valve rotating shafts 21 are also mounted , and are preferably configured so that the paired intake holes 11 can be opened or closed through the respective valve rotating shafts 21 . in other words , the valve rotating shafts 21 are mounted corresponding to the number obtained by dividing the total number of intake holes 11 by the number of paired intake holes that are opened or closed at the same time . the valve rotating shafts 21 are preferably provided with the respective baffles 22 capable of opening or closing the intake holes 11 that are simultaneously opened or closed . in detail , the intake holes 11 illustrated in fig1 includes first , second , third and fourth intake holes 11 a , 11 b , 11 c and 11 d , which are sequentially disposed from the left - hand side . the first and fourth intake holes 11 a and 11 d are simultaneously opened or closed , and the second and third intake holes 11 b and 11 c are simultaneously opened or closed . thus , the valve rotating shafts 21 includes two ones that correspond to the number obtained by dividing the total number of intake holes 11 by the number of paired intake holes that are simultaneously opened or closed , namely first and second valve rotating shafts 21 a and 12 b that are sequentially mounted from the top . at this time , as illustrated in fig1 and 2 , these valve rotating shafts 21 are preferably mounted in parallel to a horizontal plane in order to minimize a mounting space . furthermore , the valve rotating shafts 21 are preferably spaced apart from each other in a predetermined distance such that they do not cause interference with the respective baffles 22 when the baffles 22 are rotated . further , the baffles 22 b and 22 c for the first valve rotating shaft 21 a can be installed at a predetermined angle including a right angle with respect to each other such that the corresponding intake holes 11 are opened or closed at different points of time , as illustrated in fig1 and 2 . this is equally applied to the baffles 22 a and 22 d for the second valve rotating shaft 21 b . in this case , the link units 40 are provided corresponding to the mounted valve rotating shafts 21 as illustrated in fig1 . preferably , the driving force of the driving apparatus 30 is transmitted to the valve rotating shafts 21 through the respective link units 40 . as described above , the baffles 22 for the valve rotating shafts 21 are shaped corresponding to the cross - sectional shapes of the intake holes 11 . here , for the case in which the intake holes 11 are closed by the baffles 22 , each intake hole 11 is preferably provided with a recess 12 in the inner circumference thereof which is dented along a rotational path of the corresponding baffle 22 such that inhaled air is prevented from leaking out through the intake hole 11 , as illustrated in fig2 ( a ) and 2 ( b ). fig3 is an exploded perspective view illustrating the structure of a link unit according to an exemplary embodiment of the present invention . fig4 ( a ) to 4 ( l ) are an operational diagram explaining the operational principle of a link unit according to various embodiments of the present invention . as illustrated in fig3 and 4 , the link unit according to an exemplary embodiment of the present invention is made up of a six - bar linkage , which includes a driving link 42 , a driven link 44 , an output link 46 , and first and second link plates 47 a and 47 b . one will appreciate that other suitable configurations may be utilized . the driving link 42 and the output link 46 are mounted to a driving shaft 41 and an output shaft 45 so as to be able to be rotated around the driving shaft 41 and the output shaft 45 , respectively . at this time , the driving shaft 41 and the output shaft 45 are rotatably fixed . the driven link 44 is mounted to a driven shaft 43 , which is rotatably fixed , so as to be able to rotate around the driven shaft 43 . further , the driving link 42 and the driven link 44 are rotatably connected to the first link plate 47 a at first ends thereof through link pins 48 , and the driven link 44 and the output link 46 are rotatably connected to the second link plate 47 b at first ends thereof through link pins 48 . in this state , when the driving shaft 41 rotates , the driving link 42 rotates . then , the driven link 44 connected to the driving link 42 through the first link plate 47 a rotates . in this manner , when the driven link 44 rotates , the output link 46 connected to the driven link 44 through the second link plate 47 b rotates . at this time , rotational speed and angle of each link are determined by a length of each link , a position of each rotating shaft , etc . so as to generate various trajectories . according to this exemplary embodiment and various embodiments of the present invention , preferably , when the driving link 42 rotates at a constant speed in one direction , the driven link 44 performs rotation and reciprocation with acceleration within a predetermined section , and the output link 46 rotates and reciprocates with greater acceleration within a predetermined section compared to the driven link 44 . this operation will be described in greater detail with reference to fig4 ( a ) to 4 ( l ), which sequentially illustrate motions of a link unit according to various embodiments of the present invention . while the driving link 42 gradually rotates within a rotational section from the state ( a ) to the state ( g ), the rotational angle of the output link 46 is little changed as indicated by arrow . while the driving link 42 rotates within a rotational section from the state ( g ) to the state ( h ), the output link 46 rapidly rotates in the same direction . in other words , the output link 46 rotates with very great acceleration within the rotational section from the state ( g ) to the state ( h ). similarly , while the driving link 42 rotates within a rotational section from the state ( k ) to the state ( l ), the output link 46 rapidly rotates in an opposite direction . thus , the impulse charger according to this exemplary embodiment and various embodiments of the present invention is preferably designed to couple each valve rotating shafts 21 to the corresponding output shaft 45 , which rotates together with the output link 46 , so as to rotate together with the output shaft 45 . thereby , a function of the impulse valve 20 required for an instantaneous rapid lift time that is a characteristic of the impulse charger can be smoothly performed . as illustrated in fig3 , the link unit 40 can be configured on the basis of this principle . in the case in which the number of valve rotating shafts 21 is at least two , the link units 40 , the number of which is equal to the number of valve rotating shafts 21 , are preferably mounted such that they can be connected to the respective valve rotating shafts 21 . further , as illustrated in fig3 , these link units 40 are preferably configured to be able to be simultaneously driven by a single driving wheel 31 , which is driven by one driving apparatus 30 . at this time , each link unit 40 can be driven with a phase difference according to the period at which the intake holes 11 are opened or closed . preferably , the driving shaft 41 of each link unit 40 is simultaneously driven by the driving wheel 31 such that each link unit 40 is driven . fig5 and 6 are top and bottom perspective views illustrating an impulse charger according to various embodiments of the present invention . fig7 and 8 are a top plan view and a front view of the impulse charger of fig5 and 6 , respectively . fig9 and 10 are perspective views of a link unit and a lever unit of the impulse charger of fig5 and 6 . fig1 and 12 are operational diagrams illustrating the impulse charger of fig5 and 6 . as illustrated in fig5 through 10 , the impulse charger for motor vehicle engines according to this exemplary embodiment of the present invention is configured so that a mounting frame 300 is fixedly installed on one side of a cylinder head ( not shown ) corresponding to one side of an impulse block 100 . the mounting frame 300 includes an outer frame f 1 and an inner frame f 2 . the mounting frame 300 is equipped with a link unit 500 according to other various embodiments of the present invention . the link unit 500 includes a driving shaft s 1 installed on the outer frame f 1 , and a driven shaft s 2 and first and second output shafts s 3 and s 4 installed on the inner frame f 2 . further , the link unit 500 includes a plurality of links , which is interconnected through the driving and driven shafts s 1 and s 2 and through the first and second output shafts s 3 and s 4 , and outputs a rotating force of the driving shaft s 1 driven by a driving apparatus ( not shown ) as lateral force ( applied in forward and backward directions ) through a slide bar 110 . in detail , the link unit 500 is configured so that the driving shaft s 1 is mounted on one side of the outer frame f 1 of the mounting frame 300 , that the driven shaft s 2 is mounted on one side , i . e . an inner sidewall , of the inner frame f 2 of the mounting frame 300 , and that the first output shaft s 3 and the second output shaft s 4 are mounted on an outer sidewall of the inner frame f 2 so as to be opposite each other . a driving wheel 130 is mounted on the driving shaft s 1 so as to face an outer sidewall of the outer frame f 1 . this driving wheel 130 is configured to receive the rotating force of a camshaft ( not shown ) as a driving apparatus through a timing belt ( not shown ). a first link l 1 is fixedly mounted to the driving shaft s 1 at one end thereof so as to face the inner sidewall of the outer frame f 1 , and a second link l 2 is rotatably mounted to the other end of the first link l 1 through a link pin p at one end thereof . a third link l 3 is rotatably mounted to the outer frame f 1 through the driven shaft s 2 at one end thereof so as to face the inner sidewall of the outer frame f 1 , and the other end of the third link l 3 is connected with the other end of the second link l 2 through the link pin p . a fourth link l 4 is rotatably connected to the link pin p , through which the other ends of the second and third links l 2 and l 3 are connected to each other , at one end thereof . the link unit 500 includes a fifth link l 5 having a “ c ” or “ u ” shape . one end of the fifth link l 5 is rotatably connected to the other end of the fourth link l 4 through another link pin p , and the other end of the fifth link l 5 is rotatably connected to the inner frame f 2 through the first output shaft s 3 so as to face the outer sidewall of the inner frame f 2 . further , a sixth link l 6 is rotatably connected to the inner frame f 2 through the second output shaft s 4 at one end thereof so as to face the outer sidewall of the inner frame f 2 . one end of the fifth link l 5 and the other end of the sixth link l 6 are connected to respective opposite ends of a connecting link l 7 through link pins p . the connecting link l 7 is integrally coupled with the slide bar 110 substantially in the middle of the top face thereof . thereby , the above - mentioned link unit 500 is configured . meanwhile , the impulse block 100 is provided with intake holes r , in each of which an impulse valve 900 is rotatably mounted , wherein the impulse valve 900 includes a valve rotating shaft s and a baffle b capable of opening or closing the corresponding intake hole r by means of rotation of the valve rotating shaft s . the impulse block 100 is equipped with a lever unit 700 on an upper portion thereof the lever unit 700 is coupled to the valve rotating shafts s of the impulse valves 900 , and opens or closes the impulse valves 900 by using the lateral force of the slide bar 100 . in detail , the lever unit 700 installed on the upper portion of the impulse block 100 is configured so that the valve rotating shafts s of the impulse valves 900 are coupled to the middles of respective link levers 210 , and that the link levers 210 are coupled to the connecting levers 230 disposed in parallel to each other through hinge pins h at opposite ends thereof . an operating lever 250 is disposed between the right - hand one of the link levers 210 and the slide bar 110 . the operating lever 250 is connected to right - hand ends of the opposite connecting levers 230 via the right - hand link lever 210 at one end thereof in the state in which the valve rotating shaft s of the impulse valve 900 is mounted on the middle of the right - hand link lever 210 . further , the other end of the operating lever 250 is provided with a slot 270 , into which the slide bar 110 is fitted . thus , as for the operation of the impulse charger for motor vehicle engines having the aforementioned configuration , as illustrated in fig1 and 12 , the rotating force of the camshaft ( not shown ) which is transmitted through the driving wheel 130 is transmitted as the lateral force to the lever unit 700 through the link unit 500 . the lateral force transmitted to the lever unit 700 is again transmitted as the rotating force to the valve rotating shafts s of the impulse valves 900 . thereby , the impulse valves 900 control the opening or closing of the respective intake holes r according to the rotational timing of the camshaft ( not shown ), thereby improving volume efficiency of the intake holes r . in other words , the link unit 500 is operated in a manner such that , when the rotating force of the camshaft is transmitted to the driving shaft s 1 through the driving wheel 130 , the driving shaft s 1 rotates the first link l 1 . then , the second link l 2 rotates around the driving shaft s 1 between the first link l 1 and the third link l 3 , and thereby rotates the fourth link l 4 coupled through the link pin p connecting the second link l 2 and the third link l 3 . thus , the fifth link l 5 rotates around the first output shaft s 3 at a predetermined angle in the state in which it is connected with the fourth link l 4 , and thus transmits the lateral force to the connecting link l 7 coupled to the sixth link l 6 . at this time , the lateral force of the connecting link l 7 is transmitted as the rotating force to the operating lever 250 of the lever unit 700 through the slide bar 110 within a predetermined section . as the operating lever 250 is repeatedly pivoted , the link levers 210 coupled by the connecting levers 230 repeatedly pivot within a predetermined angle . then , the impulse valves 900 , which are coupled to the respective link levers 210 through the corresponding valve rotating shafts s , repeatedly rotate in the respective intake holes r , thereby controlling the opening or closing of the respective intake holes r . thus , the impulse charger of the present invention is expected that it will exert a remarkable effect on low - speed and middle - speed performances in a natural intake system . the impulse charger reinforces fluidity in a combustion chamber due to a sharp increase in the flow rate of inhaled air when the impulse valves 900 are opened , so that it is advantageous to improve combustion characteristics that cause trouble at low speed and high speed ( e . g . knocking in fast burn ). if an existing device such as a continuous variable valve timing ( cvvt ) mechanism is mounted on the driving apparatus , thereby optimizes the lift time of the valve , the volume efficiency can be improved up to maximum 15 %. further , the impulse charger is designed so as to avoid direct friction between the impulse valves 900 and the inner walls of the intake holes r , so that it is advantageous in the light of noise or durability . for convenience in explanation and accurate definition in the appended claims , the terms “ upper ”, “ front ”, and etc . are used to describe features of the exemplary embodiments with reference to the positions of such features as displayed in the figures . the foregoing descriptions of specific exemplary embodiments of the present invention have been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teachings . the exemplary embodiments were chosen and described in order to explain certain principles of the invention and their practical application , to thereby enable others skilled in the art to make and utilize various exemplary embodiments of the present invention , as well as various alternatives and modifications thereof . it is intended that the scope of the invention be defined by the claims appended hereto and their equivalents .
| 8 |
turning now descriptively to the drawings , in which similar reference characters denote similar elements throughout the several views , the attached figures illustrate an adjustable height bed side guard device intended for placement between a mattress and fitted bed sheet comprising a bolster created from multiple interlocking or self - adhering components or “ layers ” ( each component can be considered as a “ layer ” of the bolster ), which act as a physical barrier at or near the edge of a mattress . when interlocked together they form a safety barrier that when installed properly can help prevent a child from falling out of bed . by removing layers the barrier height may be reduced ; by adding layers height may be increased . the bed side guard will ideally be made from material such as polyurethane foam to allow it to be placed between a fitted bed sheet and a mattress where it will remain in operable position and therefore not require a strap or other means of securing it to the bed . each layer of the bed side guard is comprised ideally of firm but not rigid , washable , non - allergenic and flame retardant material , such as treated polyurethane foam , but could be of many different child - safe materials that are able to hold the proper form . each layer is ideally of the same length and width , but height may vary . length of each layer would ideally be four feet or more to match or exceed the height of a child . additionally , each layer would ideally be about one and a half to two inches in height and six inches deep ( front to back ) to form a bolster with sufficient height and thickness to be effective as a bed side guard as well as have enough depth and surface area contact with the mattress and fitted bed sheet to remain operable position and avoid slipping . as shown in fig1 , the top layer 10 interconnects with middle layer 11 , which interconnects with the bottom layer 12 to form a variable height bolster , which acts as a bed side guard when placed between a mattress or mattress pad and a fitted bed sheet . the long , inner side of the bed side guard is intended to face the child sleeping in the bed and form a flat , vertical edge to act as a safety barrier . to create a more attractive look and be less noticeable under a fitted bed sheet , the top side of the top layer 10 should resemble the top side of an airplane wing : the top side of the top layer 10 would ideally have one long edge ( the inner edge that faces toward the child ) with slight rounding for a smoother and less obvious appearance under the fitted bed sheet , like the leading edge of a wing . the outer edge of the top side of the top layer 10 ( which faces away from the child and toward the mattress edge ) should be more streamlined , like the trailing edge of a wing , with a downward angled convex slope . the bottom side of the top layer 10 could have a female interlocking feature 15 to interconnect to a male interlocking feature 16 of another layer ( e . g . male to female connection to middle layer 11 or bottom layer 12 ). the top and bottom sides of middle layer 11 would have male / female interlocking features to interconnect with the top 10 and bottom 12 layers . the top of bottom layer 12 would have a male interlocking feature to interconnect with top 10 or middle 11 layers . the bottom side of bottom layer 12 would be flat , with no interlocking feature . for illustrative purposes three layers have been described as forming a functioning device . however , the device could comprise only two layers , or more than three layers , necessitating more or fewer middle layers . further , the child &# 39 ; s bed is assumed to be either tightly against a wall ( forming a barrier ) with the device placed on the non - wall side , or if not against a wall , two devices could be used to form barriers , one along either long side of the mattress , finally , an additional number of devices could be employed to effectively surround the child . normal use would start with all layers interconnected , as shown in fig1 , forming a full height of perhaps but not limited to 4 . 5 to 6 inches ( as shown in fig6 this device would ideally be placed under the fitted bed sheet 20 and above the mattress or mattress pad ). the child would begin use with the device at full height and use it for a period of time , perhaps 1 month or more , as they gain confidence in the bed . this not only reduces the risk of falling out of bed but also helps them become acclimated and familiar , both consciously and subconsciously , with where the edge of the bed is located . after a period of time , perhaps 1 month or more , the middle layer 11 could be disconnected and removed from the top layer 10 and bottom layer 12 and the top 10 and bottom 12 layers could be manually interconnected to form a bolster with a lower height and placed back between the mattress or mattress pad and fitted bed sheet . the device is now reduced in height and therefore offers a lower safety barrier , but still aids in preventing the child falling out of bed . this continues to help them become acclimated and familiar with where the edge of the bed is located . after an additional period of time , perhaps 1 month or more , the bottom layer 12 could be disconnected from the top layer 10 to form a bolster with lowest height , and only the top layer 10 would remain . it would be placed back between the mattress or mattress pad and fitted bed sheet . the device is now reduced to its “ minimal height ” and therefore the barrier is lower , but still aids in preventing the child falling out of bed . this continues to help them become acclimated and familiar with where the edge of the bed is located . after a final period of time , perhaps 1 month or more the top layer 10 could be removed , and therefore no layers would remain and the bed side guard device would be completely removed from the bed at this point . ideally by this time the child has become effectively weaned off the bed side guard , is acclimated and familiar with where the edge of the bed is located and has gained confidence to sleep in the bed without a bed side guard . the bed side guard device or its components could be constructed of myriad materials that are able to take the proper shape of the bolster and have appropriate firmness to perform the task . the device could also be covered in myriad materials known in the arts to facilitate or improve connection to other layers or provide natural adhesion / non - slipping with fitted bed sheet , mattress pad or mattress . materials used could also provide greater aesthetics , fire retardation or other safety features , alternate variations of connecting or interlocking technique could be used rather than those described , herein . for example , a single and separate interlocking piece 31 such as shown in fig7 , could be used to connect a top layer 32 and bottom layer 33 . alternate methods to keep the layers together could be used by various means of adhesion ( e . g ., velcro , non - permanent sticking various glues , etc . ), which would avoid use of interlocking male / female structural features . in addition , the ends of the device could comprise features to interconnect or adhere to the ends of additional devices to create a geometrically shaped enclosure and effectively surround a child . alternative variations of the device could comprise a single bolster , perhaps 4 . 5 to 6 inches thick , with perforated lateral layers that could be peeled away to reduce the height of the safety barrier . instead of creating the bolster layers from material that naturally adheres to mattress and bed sheet materials , such as polyurethane foam , the entire device could be secured to the mattress , above or below the fitted bed sheet , using conventional means known in the arts , such as straps . instead of using multiple interlocking layers to achieve various adjustable heights alternate variations of the device could be constructed differently , such as using an inflatable bed side guard with multiple air chambers ( all chambers inflated for max height , fewer for lower height ) or perhaps one air chamber that self adjusts in height when inflated with more or less air . the described device is an adjustable bed side guard comprised of 3 interlocking pieces , which allow the user to set the height of the bed side guard . ideally , to use the invention , it would be used on a standard bed , with mattress , mattress pad , and fitted bed sheet . it would be placed between the mattress pad ( which is above the mattress but below the sheet ) and fitted bed sheet . as it is ideally constructed of material that naturally adheres to common fabrics used in bed sheet or mattress construction and so is slip resistant , it will stay in operable position without the use of straps or other means . to set the bed side guard at its highest level , all 3 pieces would be interlocked or fitted together . to reduce the height , one or more layers could be removed . to re - raise the height , one or more layers could be added . as to a further discussion of the manner of usage and operation of the present invention , the same should be apparent from the above description . accordingly , no further discussion relating to the manner of usage and operation will be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .
| 8 |
writes to anything larger than a sector may not be atomic . for example , a stripe may consist of a page from each of disks a , b & amp ; c , with c storing the contents of a xor b . for reliability , a stripe should consist of no more than one page from each disk . a stripe may vary in size depending on the amount of data the parity is computed over . as illustrated in fig2 , we organize disk storage into a large log . the log consists of a sequence of segments . the segments on a disk are organized contiguously , but the order of segments in the log does not have to be contiguous . segments consist of a sequence of variable length stripes . the stripes consist of a sequence of pages . pages consist of a sequence of contiguous sectors . for reliability , each page in the same segment is located on a different disk . all updates append sequentially to the log . these results in very high write throughput even for small random writes , which is a weak point for conventional raid 5 implementations . free storage is reclaimed by garbage collecting segments that contain overwritten , no longer needed data . in addition to achieving very high performance , the raid system described herein provides several other useful functions . for example , all physical disk storage is organized into a common disk pool . users may create and destroy virtual disks on demand without worrying about which physical resources to allocate to these virtual disks . an administrator need only periodically monitor the total amount of free space remaining in the system . the performance of the system should be similar to that of hardware raid 5 controllers , and should not consume much cpu cycles . in particular , the throughput of the system should achieve many tens of mb / s in throughput , particularly for write operations . we assume that disk sectors are always written atomically or generate an error when read back , but anything larger than a sector may we assume that disks may reorder write operations . this is particularly true of ata disks with write back caching enabled . ( this is unimportant assumption that can help us achieve significantly higher performance .) in the ideal case , appending to a log should require only a single synchronous disk write operation . also , we must be able to reliably identify the end of a log during crash recovery . one approach uses a separate sector to store a pointer to the end of the log . with this approach , data is first written to the end of the log and then the pointer is updated to point to the new end of the log . the problem with this approach is that it requires two synchronous disk operations . a second approach is to include a sequence number in every sector that is written to the log . the sequence number is incremented each time that the log wraps around . during recovery , the log is scanned forwards until the sequence number decreases , indicating the end of the log . this approach requires only a single sequential write operation to append to the log ; however , it requires initializing all sectors in the log to a known value before using the log and a few bytes must be reserved from each sector to store the sequence number . the sequence number must be stored in each sector rather than , for example , each page because only sector rights are guaranteed to the atomic . when a page write is interrupted , some sectors of the page may make it to disk while others sectors may not . there is also no guarantee as to what order in which the sectors will be written to disk . we will be using the second approach to ensure that any write to a virtual disk incurs at most a single synchronous disk latency . when a full stripe , a stripe that spans the maximum allowed number of disks , is written , it incurs the minimum capacity overhead due to the parity overhead . often , however , we will want to write stripes incrementally without waiting for a full stripe &# 39 ; s worth of data to accumulate , such as when a small amount of data is written followed by a long pause . in general , we want to write the data to stable storage as soon as possible without waiting for the rest of the stripe to fill up ; however , this incurs a higher parity capacity overhead . fortunately , the excess storage can be easily removed when the segment is garbage collected . fig3 shows the process of appending to a log of stripes with varying sizes . stripe 311 is made up of data page 301 and 302 and parity page 303 . stripe 321 is made up of data page 304 , 305 and 306 , and parity page 307 . stripe 331 is the shortest possible stripe , with one data page 308 and one parity page 309 . this method of writing out a non - full stripe is a key part of this invention . traditional raid5 implementation requires a full stripe before data is written out to disk . as such , a simple arithmetic formula is used in traditional raid5 implementation to calculate the mapping between a logical and physical address . in this invention , a flexible table - look - up method is used to flexible convert between logical and physical address . eventually , the log will fill up and free storage must be reclaimed . garbage collection is used to reclaim storage from pages that have been overwritten and are no longer needed . a garbage collector process periodically scans segments , throws away the overwritten pages , collects together the pages still in use , and appends the live pages to the current end of the log , creating free segments in the process . in fig4 , garbage collection eliminates the data blocks d 3 and d 5 ( marked 401 and 402 on the figure ) that have been overwritten and are no longer needed . also , the stripes after garbage collection are longer , requiring only a single parity block ( marked 403 ). in actuality , there are two garbage collectors : a short - term collector and a long - term collector . the short - term garbage collector is responsible for ensuring that there are always a certain number of free segments . the short - term collector always collects segments that have the most amount of overwritten , and therefore free , space . this generates the most amount of free space for the least amount of work invested . if we only had a short - term collector , free space would slowly accumulate in segments with otherwise “ cold ” data , reducing the amount of space available to the short - term collector to “ age ” recently written date . this would force the short - term collector to run increasingly more frequently on segments with less and less free space . the job of the long - term collector is to collect free space in these code segments , so that the short - term collector has more space to play with , and therefore wait longer , allowing more data to be overwritten , before garbage collecting a particular segment . in effect , the long - term collector can be viewed as a type of defragmenter . from this discussion , it becomes evident that it is desirable to separate cold data from hot data since a segment containing mostly hot data will contain a large amount of free space and , therefore , require little work to garbage collect . to ensure this , the garbage collectors write surviving data into a separate “ cold ” log rather than appending it to the end of the same log that receives user requests . this prevents the hot and cold data from intermixing with each other . this method can be easily generalized to a hierarchy of logs containing ever colder data . our raid 5 implementation requires various types of metadata that are used for a range of tasks from mapping virtual disk addresses to physical disk addresses to keeping track of the amount of overwritten data in each segment . this metadata information must be recovered after a system crash . to bound the recovery time , it is necessary to periodically checkpoint the metadata to disk . we do this by periodically writing checkpoints to the end of a specially designated metadata log . using a separate log for checkpoints prevents the metadata , from mixing with user data . since the checkpoints are of a fixed size , the metadata log requires only a small fixed amount of disk space . when the system is restarted after a crash , we first scan the metadata log to find the most recent checkpoint . the other logs containing the user data are then scanned forward from the points indicated in the checkpoint onto all logs have been processed . the system can then resume operation . note that in some cases , there may be dependencies in the order in which log entries in the various logs must be processed . these cross - log dependencies are explicitly noted as log entries in the logs themselves and are observed during recovery . in fig5 , entries after the point marked 502 in log 2 , cannot be processed until after log 1 has been processed to the point marked 501 . processing of logs essentially performs a topological sorting of the entries in the logs . this mechanism for supporting multiple logs will also be used for future distributed versions of the system which allow multiple computing nodes connected over a network to share and access the same pool of disk storage when a disk fails , the stripes that span the failed disk are read and the data contained within those stripes are appended to the end of an appropriate log . for example , if a system originally has 6 disks , the maximum stripe width is 6 . if a disk fails , the system will immediately switch to work with a maximum stripe width of 5 : all new writes will be written with maximum stripe width of 5 , and , all existing data can be read and re - written with a stripe width of 5 . after this rebuilding process is completed , the system will continue to tolerate single disk failure , without the need for a replacement disk to be put in place . when the failed disk has been replaced , the system can switch dynamically back to work with a larger maximum stripe width . in the previous example , the system will switch back to use a maximum stripe width of 6 from a maximum stripe width of 5 . when a disk is added , it simply increases the number of disks available for striping data . as a part of its normal process for garbage collection , the long - term collector will read the existing data and rewrite the data to span the new disk . if a disk is about to be removed , then the disk is treated as if it had failed and the standard disk failure recovery mechanism is applied . one difference from the failed case is that a disk that is about to be removed may continue to service read requests . once all data on the disk has been recovered , the disk is mapped out of the system and may be physically removed . the log structured raid approach in this invention also leads to several benefits and features not present in existing raid solutions : the system does not require the use of dedicated “ spare ” disks . any data stored on a failed disk will automatically be recovered to spare capacity on the remaining disks . therefore , all disks contribute to the performance of the system . because a stripe may vary in the number of disks that it spans , when a disk fails , the width of the parity stripe can be narrowed rather than waiting for a new disk to be added to the system to restore full redundancy . because data is written to a log , we can configure the system such that data that has been written within the last n time units will not be overwritten is never overwritten . this allows us to travel backward to any point in time within the last n time units . this offers continuous time snapshots of the underlying storage system : in the context of using the storage system for file system , a continuous - time snapshot of the file system becomes available . in fig6 , 601 represents the state of the file system up to stripe 3 ( hypothetically 43 min and 25 sec ago ), and 602 represents the current state of the file system , which is up to stripe n . the non - overriding behavior of a log - structured data layout also simplifies the implementation of more traditional snapshot mechanisms where snapshots are created explicitly by a user . the system is easy to expand to networked storage systems where disks may be accessed remotely over a network . in such systems , it is important to tolerate the temporary failure of a node that makes a disk inaccessible for a short period of time . in our system , if a disk becomes inaccessible we simply skip writing to the disk and initiate the recovery of data stored on that disk to protect against the event that the node does not recover . when the disk recovers , we can simply include the recovered disk in any new writes . any data on that disk and before it became unavailable and has not yet been recovered it is still completely usable . the ability to handle transient failure , i . e ., the graceful , incremental handling of disk failures is in sharp contrast to other types of networked or distributed storage systems in which a disk failure triggers the wholesale migration of data from the failed disk , with potentially a time - consuming recovery process if the disk recovers and becomes available again . because the log automatically captures causal dependencies between requests , high - performance remote mirroring is greatly simplified . data in the log can simply be copied in any order as they are written to the log without worrying about sequencing the actual user requests . in fig7 , stripe 1 701 is replicated to remote site as strip 1 711 , 702 replicated to 712 , 703 to 713 and so on . this is particularly important for distributed storage systems , where there is usually no single central point that knows all of the causal dependencies between user requests . this invention also supports generalized raid that can tolerate k disk failures . raid5 tolerates only one disk failure . when one disk fails , an expensive rebuild process has to be started immediately to guard against additional disk failure . with generalized raid that tolerates k ( k & gt ; 1 ) disk failures , the rebuild process can be deferred to some later time , such as during midnight when the system load is much smaller . implementing a raid system that tolerates k disk failure using traditional approach will incur significant disk latency in the read - modify - write process . for example , if it is desired to tolerate 2 - disk failure , then there will be at least 3 reads and 3 writes in the read - modify - write process . using the log - structure method in this invention , only one synchronous disk writes are needed regardless of the value of k . the methods described above can be stored in the memory of a computer system ( e . g ., set top box , video recorders , etc .) as a set of instructions to be executed . in addition , the instructions to perform the method described above could alternatively be stored on other forms of machine - readable media , including magnetic and optical disks . for example , the method of the present invention could be stored on machine - readable media , such as magnetic disks or optical disks , which are accessible via a disk drive ( or computer - readable medium drive ). further , the instructions can be downloaded into a computing device over a data network in a form of compiled and linked version . alternatively , the logic to perform the methods as discussed above , could be implemented in additional computer and / or machine readable media , such as discrete hardware components as large - scale integrated circuits ( lsi &# 39 ; s ), application - specific integrated circuits ( asic &# 39 ; s ), firmware such as electrically erasable programmable read - only memory ( eeprom &# 39 ; s ); and electrical , optical , acoustical and other forms of propagated signals ( e . g ., carrier waves , infrared signals , digital signals , etc . ); etc . although the present invention has been described with reference to specific exemplary embodiments , it will be evident that various modifications and changes may be made to these embodiments without departing from the broader spirit and scope of the invention . accordingly , the specification and drawings are to be regarded in an illustrative rather than a restrictive sense .
| 8 |
the wide proliferation of online communication , by its nature , creates many channels for advertising , communications about goods and services , and transactions for goods and services . such proliferation also magnifies the opportunities for unauthorized digital communications , including unauthorized digital communications about goods and services that may be referred to as online fraud , whether in the form of communications regarding grey market or black market goods , or simply unauthorized digital communications relating to the sale of otherwise authentic goods and services . a chasm has emerged between the capacity of business and legal systems to identify and correct these problems , thus reducing the effective return of online markets to participant manufacturers and service providers . the present disclosure proposes to engage as subscribers the manufacturers of goods sold online , and to automate the detection and handling of unauthorized digital communications for these subscribers to help reduce the impact of fraud . while the present disclosure refers to “ manufacturers ” and “ products ” for ease of discussion , one of skill in the art will recognize that “ manufacturers ” include any individual or entity that authorizes communications relating to a source of goods to the market , and “ products ” may include any goods and / or services that may be offered for sale online , such as those provided by manufacturers of goods , authorized distributors of goods , providers of services , authors or distributors of copyrighted materials , individuals , and / or the like . in some embodiments of the present disclosure , sources of information are actively audited for potential online fraud and its contact points with consumers , such as via web pages , e - mail , online advertisements and e - coupons , and so forth . in such embodiments the discovery and investigation of unauthorized communications may be automated using techniques such as comparative pricing systems , information on known sources of goods from the manufacturers , access to spam and virus reporting systems , crowd - sourced information such as product and service reviews , and / or the like . some embodiments of the present disclosure may also identify — by specification or policy — thresholds for action by authorities such as manufacturers , e - commerce sites , or civil and police authorities ; provide concise , accurate information supporting a decision framework for selecting an appropriate response by those authorities ; provide consumers with information to avoid fraudulent sources and counterfeit goods by aggregating data and recommendations , or by certifying sources as approved by manufacturers and operating within limits of approval of transactions and satisfaction of customers established , by contract or policy , between the manufacturer of a product and its distributors ; and / or the like . the following description describes exemplary sources of information for evaluating online communications and identifying unauthorized communications relating to fraud ; exemplary decision metrics and frameworks usable to establish policy for action when fraud is reported or detected ; exemplary triggers for taking action on such fraud ; and exemplary workflow methods for automating the delivery of information to those parties or authorities best suited to eliminate or deter such fraud . fig1 is a schematic diagram that illustrates an overview of an exemplary embodiment of an approach to combating unauthorized online communications according to various aspects of the present disclosure . as the internet matures , manufacturers and distributors alike have deployed multiple ways to make products and information available to consumers . such a set of online information resources is illustrated as being made available on the internet 90 . manually searching all of the sources on the internet 90 may not be practical , and may not provide assurance respecting the source of goods offered for sale . for example , searching on a web site of a merchant that sources goods from reputable distributors ( e . g ., the web site of a brick - and - mortar retailer such as best buy ®, macy &# 39 ; s , and / or the like ) provides some assurance as to the source of goods and reliability of the distributor , based on the reputation , service quality , and goodwill established by such merchants . however , searches of information resources that provide less controlled access to sellers ( such as amazon . com , shopping search engines , and / or the like ) will likely yield wider sources for a product but will not provide reliable information about those who supply the goods . accordingly , certain types of information resources may provide a greater risk of encountering counterfeits , unlicensed distributors , and / or other types of unauthorized communications , and may make it difficult to identify or shut down such communications . as illustrated , information resources may , without limitation , include business - to - business ( b2b ) information resources 102 , marketplace web sites 104 , custom retail web sites 106 , user group information resources 108 , comparison shopping web sites 110 , coupon web sites 112 , email information resources 114 , and affiliate network information resources 116 . while many communications through such information resources are legitimate , each type of information resource is vulnerable for exploitation by parties attempting to distribute products or otherwise communicate without the authorization of the manufacturer . each type of information resource may present products and / or product information in a different way , and may pose different challenges for monitoring for problematic product sales and / or communications . a b2b information resource 102 may enable domestic companies to participate in international trade with a minimal investment . examples of a b2b information resource 102 include , but are not limited to , alibaba . com ®, dhgate . com , made - in - china . com , and the like . a b2b information resource 102 typically arranges sales of new goods from a foreign producer to a domestic reseller . b2b information resources 102 may provide a convenient way for international counterfeiters to export large volumes of product . a marketplace web site 104 may allow companies and individuals to market and sell products without developing their own separate web presence . examples of marketplace web sites 104 include , but are not limited to , amazon . com , ebay , and the like . a marketplace web site 104 typically enables an indirect purchase where the marketplace web site 104 acts as a middle man that handles payments for new and / or used items . the marketplace web site 104 or the product source itself may ship the product to the customer . a custom retail web site 106 that only offers communications regarding a few products ( or even a single product ) may be created by a product source . temporarily creating and subsequently moving or removing a custom retail web site 106 is relatively easy for an unscrupulous product source to do , and because of this transient nature , custom retail web sites 106 are often difficult to track . customers of such a web site may be unaware of where the custom retail web site 106 or associated product source is located . landing pages and links in advertising may be changed rapidly , leaving customers without the purchased products or without other follow - up services . some examples of legitimate custom retail web sites 106 include , but are not limited to , www . shavematetv . com , www . spacebag . com , and the like . typical sales transactions with a custom retail web site 106 include a direct credit card purchase of new or refurbished items from the custom retail web site 106 by the customer . user group information resources 108 often allow individuals with a common interest to share personal experiences in forums , blogs , and / or the like . while user group information resources 108 may not traditionally be thought of as online marketplaces , unscrupulous product sources may nevertheless target or use user group information resources 108 to drive unauthorized sales of products . some examples of user group information resources 108 include , but are not limited to , bicycle clubs such as the seattle bicycle club ( www . seattlebicycleclub . org ), wine clubs such as the seattle uncorked wine club ( seattleuncorked . com ), and the like . typically , a product source may direct unadvertised offers to users of the user group information resources 108 , such as through forum posts , blog comments , and / or the like . the product source may offer new or refurbished items . comparison shopping web sites 110 and coupon web sites 112 encourage price comparisons and provide discounts . these sites often do not themselves offer products for sale , but instead aggregate search results from other product sources to provide communications regarding product price information from multiple sources to users , who may then purchase the products from the product sources . some examples of comparison shopping web sites 110 include , but are not limited to , pricegrabber . com , google shopping , shopzilla , and / or the like . some examples of coupon web sites 112 include , but are not limited to , groupon , bloomspot , livingsocial , and / or the like . sometimes , unscrupulous product sources may be found and suggested to users by the comparison shopping web sites 110 due to their lower prices . email information resources 114 are often used to direct traffic to unscrupulous product sources . such product sources often send mass amounts of unsolicited commercial email to potential customers to drive traffic to sources from which products may be obtained . email information resources 114 may include the emails themselves , may include collections of customer inquiries related to or samples of unsolicited commercial emails , and / or may include data obtained by spam email analysis services . affiliate network information resources 116 utilize private websites to advertise products for other companies . affiliate network information resources 116 often specialize in particular product categories . for example , an affiliate network may offer a product source an avenue to distribute advertising to websites , while the affiliate network may offer websites compensation for displaying the advertising of the product source when a purchaser completes a specific action ( such as completing a purchase and / or the like ). examples of affiliate network information resources 116 include , but are not limited to , click2sell , clickbooth , and / or the like . a simple model for affiliate advertising networks involves product sources posting product or service information , and affiliates advertising those postings through other sites , banner ad placements , keyword - based search engine advertising , email campaigns , and / or the like . the affiliate network , acting as an intermediary , allows the product source and the affiliate to track click rates and / or purchases , and to share revenue from sales . the extra layer of abstraction between the customer and the product source make it difficult for the customer to identify counterfeits . unscrupulous product sources may often exploit affiliate network information resources 116 using spam emails , banner advertising , and / or the like to direct traffic to their affiliate pages , and may leave customers without the purchased products or without follow - up services . one of ordinary skill in the art will recognize that more types of information resources may be available on the internet 90 or elsewhere , and also that techniques similar to those described herein with respect to the illustrated types of information resources may also be used with respect to information resource types that are not explicitly illustrated or described herein . in some embodiments of the present disclosure , a communication protection system 118 is provided . the communication protection system 118 is configured to search and analyze the information resources on the internet 90 in an automated matter in order to monitor all online sources for product sale offerings . the communication protection system 118 may be configured to automatically categorize product sources on the internet 90 into approved product sources 120 and unapproved product sources 122 . depending on a type of an unapproved product source 122 , the communication protection system 118 may flag the product source for additional monitoring , may transmit a notification to the manufacturer , may perform automated actions to shut down the product source , and / or the like . such actions may be taken by the communication protection system 118 in response to detecting a pattern of online communication for a product that triggers an alert or matches thresholds established by the manufacturer , such as the detection of an unlicensed distributor , the detection of irregular transactions , the detection of counterfeit advertising , and / or the like . in some embodiments , the communication protection system 118 may use data mining techniques and secure access to information respecting online communications to provide coverage of potential counterfeit channels in advance of illegal or unwanted communication activity . in some embodiments , the communication protection system 118 may provide information to the manufacturer and / or the product source for the efficient negotiation of commercially acceptable terms , for informed civil or criminal prosecution , or for the regular enforcement of manufacturer policies for communication regarding its products online . fig2 is a block diagram that illustrates components of an exemplary embodiment of a communication protection system 200 according to various aspects of the present disclosure . as illustrated , the communication protection system 202 includes an information resource definition data store 202 , a product data store 204 , a gathered resource data store 206 , and a source profile data store 216 . as understood by one of ordinary skill in the art , a “ data store ” as described herein may include any suitable device configured to store data for access by a computing device . one example of a data store is a highly reliable , high - speed relational database management system ( dbms ) executing on one or more computing devices and accessible over a high - speed packet switched network . however , any other suitable storage technique and / or device capable of quickly and reliably providing the stored data in response to queries may be used , and the computing device may be accessible locally instead of over a network , or may be accessible over some other type of suitable network or provided as a cloud - based service . a data store may also include data stored in an organized manner on a storage medium 608 , as described further below . one of ordinary skill in the art will recognize that separate data stores described herein may be combined into a single data store , and / or a single data store described herein may be separated into multiple data stores , without departing from the scope of the present disclosure . in some embodiments , the information resource definition data store 202 includes a plurality of definition records associated with a plurality of information resources . in some embodiments , the definition records may include a definition of an information resource , including an indication of the type of the information resource , a name of the information resource , contact information associated with the information resource , information regarding how to extract product information from the information resource , and / or the like . in some embodiments , the product data store 204 may include a plurality of records associated with products to be monitored by the communication protection system 200 . the product records may include information provided by the product manufacturers to help monitor information resources for sales of the products , including product names , search terms likely to find instances of communications regarding the products , pricing information associated with the products , sales volume information associated with the products , and / or the like . in some embodiments , the gathered resource data store 206 may include a plurality of gathered resource records that indicate sales or other online communication activities associated with the products as detected by the communication protection system 200 . in some embodiments , the source profile data store 216 may include a plurality of source profiles that store information about each of the detected product sources and analysis thereof performed by the communication protection system . the analysis may include , without limitation , authenticating licensed distributors , identifying unknown distributors , examining trademark usage and branding , evaluating pricing , and / or the like . the source profiles and the analysis thereof are discussed further below . as illustrated , the communication protection system 200 also includes a research engine 208 , a price evaluation engine 210 , a profile generation engine 212 , a magnitude evaluation engine 214 , a profile categorization engine 218 , a presentation evaluation engine 220 , an automated remediation engine 222 , and a user interface engine 224 . in general , the word “ engine ” as used herein , refers to logic embodied in hardware or software instructions . the instructions may be written in an object oriented programming language , such as c ++, java ™, c #, and / or the like ; procedural programming languages , such as c , pascal , ada , modula , and / or the like ; functional programming languages , such as ml , lisp , scheme , and the like ; scripting languages such as perl , ruby , python , javascript , vbscript , and the like , declarative programming languages such as sql , prolog , and / or the like ; or in any other type of programming language . an engine may be compiled into executable programs or executed as an interpreted programming language . engines may be callable from other engines or from themselves . generally , the engines or applications described herein refer to logical modules that can be merged with other engines or applications , or can be divided into sub - engines . the engines can be stored in any type of computer - readable medium or computer storage device and be stored on and executed by one or more general purpose computers , thus creating a special purpose computer configured to provide the engine . a single computing device may be configured to perform the functionality described in one or more engines , and / or the functionality of one or more engines may be split between multiple computing devices using any one of a variety of structuring techniques known in the art , including without limitation multiprocessing , client - server processing , peer - to - peer processing , grid - based processing , cloud - based processing , and / or the like . in some embodiments , the research engine 208 is configured to build queries for product sources based on product records from the product data store 204 , and to store raw gathered resources in the gathered resource data store 206 . in some embodiments , the profile generation engine 218 is configured to process the gathered resources from the gathered resource data store 206 to create profiles of detected product sources , and to store the profiles in the source profile data store 216 . in some embodiments , the price evaluation engine 210 , the magnitude evaluation engine 214 , and the presentation evaluation engine 220 are configured to review the source profiles in the source profile data store 216 , and to analyze pricing information , sales volume information , and product presentation information , respectively . in some embodiments , the profile categorization engine 218 is configured to review the analysis of the source profiles , and to assign categories to each source profile that determine further actions to be taken with respect to each source profile . in some embodiments , the automated remediation engine 222 is configured to take automatic actions with respect to particular categories of source profiles to help remediate unauthorized product sources in those particular categories . in some embodiments , the user interface engine 224 is configured to provide one or more user interfaces for interacting with the communication protection system 200 , including at least one interface configured to allow product manufacturers to specify products to be monitored , to review product presentation information , to take manual remediation actions with respect to particular categories of source profiles , and to view aggregated information collected by the communication protection system 200 about the overall market for products . in some embodiments , the user interface engine 224 may also be configured to provide one or more application programming interfaces ( apis ) for providing programmatic access to functionality of the communication protection system 200 . further details of the configurations of each of these engines are described below . one of ordinary skill in the art will recognize that the components of the communication protection system 200 illustrated and described herein are exemplary only , and that in some embodiments , more or fewer components may be included , and / or the functionality described as associated with a given component may be provided by a different component or in conjunction with a different component . one of ordinary skill in the art will also recognize that the functionality of the communication protection system 200 may be provided by a single computing device or multiple computing devices communicatively coupled to each other via a local area network , a wide area network , or using any other suitable technology . fig3 a - 3e include a flowchart that illustrates an exemplary embodiment of a method 300 of monitoring online communication related to a product for potential fraud , according to various aspects of the present disclosure . the method 300 is illustrated and described herein as relating to monitoring of communication related to a single product provided by a single manufacturer for ease of discussion . one of ordinary skill in the art will recognize that , in some embodiments , the method 300 may be performed for a plurality of related or unrelated products , from a plurality of related or unrelated manufacturers , without departing from the scope of the present disclosure . from a start block , the method 300 proceeds to a set of method steps 302 defined between a start terminal (“ terminal a ”) and an exit terminal (“ terminal b ”) wherein a communication protection system 200 builds a set of source profiles . from terminal a ( fig3 b ), the method 300 proceeds to block 308 , where a research engine 208 of the communication protection system 200 retrieves a product definition associated with a product to be monitored from the product data store 204 . in some embodiments , the product definition is created by the manufacturer via an interface generated by the user interface engine 224 , and includes information usable by the communication protection system 200 to determine how to monitor the product . in some embodiments , the product definition may also include one or more preferences regarding product sources to monitor , whitelist / greylist / blacklist information for categorizing previously identified product sources , preferences relating to automated remediation steps to be taken by the communication protection system 200 , expected pricing and volume information , and / or the like . next , at block 310 , the research engine 208 generates a set of queries for finding information regarding offers for sale of the product , the set of queries based on the product definition . in some embodiments , the queries may be stored in the product definition , and retrieved by the research engine 208 . in some embodiments , the research engine 208 may automatically generate queries for one or more search engines based on the information stored in the product definition ( such as product or manufacturer names , associated trademarks or brand names , model numbers , product images , relevant date ranges , and / or the like ). at block 312 , the research engine 208 executes the set of queries using one or more search engines to obtain a set of gathered results . one of ordinary skill in the art will recognize that the one or more search engines may include general search engines such as bing ( provided by microsoft corporation ), google ( provided by google , inc . ), and / or the like ; search engines integrated into information resources ( such as search functionality provided within amazon . com , alibaba . com , and / or the like ); or any other type of search engine . in some embodiments , the research engine 208 may obtain gathered results from sources not traditionally thought of as search engines as discussed above but that are nevertheless usable to retrieve gathered results , including , but not limited to , web service apis ( e . g ., to access information about merchant and user activity on amazon services and / or the like ), automated direct inspection of web sites ( such as web crawler or spider programs that navigate a site automatically to copy or extract information and / or the like ), archives of specific user activity ( such as databases of ad banners or unsolicited bulk commercial email (“ spam ”)), and / or the like . the set of queries may be executed by the research engine 208 in series , in parallel , or in any other suitable manner . next , at block 314 , the research engine stores the set of gathered resources in a gathered resource data store 206 . in some embodiments , each gathered resource may be a search result from a query , without having undergone further processing by the research engine 208 . in some embodiments , each gathered resource may be a retrieved copy of the resource referenced by a search result from a query , without having undergone further processing by the research engine 208 . the method 300 then proceeds to block 316 , where a profile generation engine 212 processes the set of gathered resources from the gathered resource data store 206 to determine a set of product sources . in some embodiments , each product source may correspond to an information resource offering the product for sale . in some embodiments , multiple product sources may be associated with a single information resource . for example , separate product sources may be determined for each distributor offering the product for sale on alibaba . com or amazon . com . at block 318 , the profile generation engine 212 creates a set of source profiles corresponding to the set of product sources , and stores the set of source profiles in a source profile data store 216 . one of ordinary skill in the art will recognize that , in some embodiments , the actions described with respect to block 314 may be optional , and the source profiles may be determined by the profile generation engine 212 directly from the resources gathered by the research engine 208 without the intermediate step of storing the gathered resources in the gathered resource data store 206 . the method 300 then proceeds to terminal b . from terminal b ( fig3 a ), the method 300 proceeds to a set of method steps 304 defined between a start terminal (“ terminal c ”) and an exit terminal (“ terminal d ”), wherein the communication protection system 200 enhances the set of source profiles . from terminal c ( fig3 c ), the method 300 proceeds to a for loop start block 320 . the method 300 loops between the for loop start block 320 and a for loop end block 338 ( fig3 d ) to repeat the steps included therebetween for each source profile stored in the source profile data store 216 . the “ for loop ” construct is used herein for ease of discussion only . one of ordinary skill in the art will recognize that , in some embodiments , the method 300 may process less than all of the source profiles stored in the source profile data store 216 . for example , the method 300 may only process a set of source profiles stored in the source profile data store 216 that have been changed since a previous execution of some portion of the method 300 . as another example , the method 300 may process any other subset of source profiles stored in the source profile data store 216 , chosen for any reason . one of ordinary skill in the art will also recognize that , in some embodiments , a logic construct other than a “ for loop ” may be used to process the source profiles . from the for loop start block 320 , the method 300 proceeds to block 322 , where the profile generation engine 212 determines whether the source associated with the source profile corresponds to an information resource definition in an information resource definition data store 202 . at decision block 323 , a test is performed based on the determination whether the source associated with the source profile corresponds to an information resource definition , and is therefore defined . if the answer to the test at decision block 323 is yes , the method 300 proceeds to block 324 , where the profile generation engine 212 updates the source profile by retrieving data from the associated gathered resources using the definition of the information resource . in some embodiments , the definition of the information resource includes instructions for obtaining particular pieces of information from the associated gathered resources , such as pricing information , volume information , distributor names , product images , product descriptions , titles , contact information , advertised payment methods , and / or the like . in some embodiments , the definition of the information resource may include parsing rules that describe the expected format of the associated gathered resources and / or otherwise enable the profile generation engine 212 to obtain the particular pieces of information from the associated gathered resources . in some embodiments , the profile generation engine 212 may be configured to retrieve particular pieces of information without the benefit of parsing rules , such as by using default assumptions for particular types of content ( e . g ., larger than normal text may be considered a title , numeric strings with currency characters (“$”, “ ”, “£”, “¥”, etc .) may be considered pricing information , and / or the like ). however , if parsing rules are included in the definition of the information resource , it may provide greater confidence in the accuracy of the data retrieved from the associated gathered resources . from block 324 , the method 300 proceeds to a continuation terminal (“ terminal c 1 ”). otherwise , if the result of the test at decision block 323 is no , then the method 300 proceeds to block 326 , where the profile generation engine 212 creates a new information resource definition in the information resource definition data store . at block 328 , the profile generation engine 212 analyzes the gathered resources using default parsing rules to look for information in the gathered resources such as pricing information , volume information , distributor names , product images , and / or the like . the profile generation engine 212 then updates the source profile with the information obtained by the default parsing rules . in some embodiments , the new information resource definition may be flagged for review by an administrator , so that for future executions of the method 300 , parsing rules may be created for more reliable collection of data from the information resource . the method 300 then proceeds to a continuation terminal (“ terminal c 1 ”). from terminal c 1 ( fig3 d ), the method 300 proceeds to block 330 , where a profile categorization engine 218 determines a category for the source profile and updates the source profile with its assigned category . categories may be based on categorization information included in the product definition , such as the whitelist / greylist / blacklist information described above . these lists may specify product sources based on a distributor associated with the product source , a combination of a distributor associated with the product source and an information resource ( or information resource type ) associated with the product source , and / or by any other suitable means . for example , assignment to the whitelist may be based on known distributors ( the distributor information is available in the source profile ), sale of original goods , pricing within an allowable range , a manufacturer approved market , and / or the like . as another example , assignment to the greylist may be based on a lack of distributor information in the source profile ), a lack of manufacturing source information in the source profile , pricing outside of the allowable range , a lack of information regarding the identity of the source of payment processing or order fulfillment , a detection of counterfeit goods in mainstream commerce , a distributor or seller that is known to not be authorized to distribute or sell a product , a detection of stolen or overrun goods in the market , and / or the like . categorization of a source profile on the whitelist may indicate that the source profile is associated with a legitimate source of the product . categorization of a source profile on the greylist , the blacklist , or an unknown list may indicate that the source profile should be analyzed further by the system to determine whether it is associated with a legitimate source or an illegitimate source for the product . in some embodiments , assignment to a whitelist category may allow a product source to be identified with a certification mark or other indicator associated with the communication protection system 200 . the indicator may be added to information resources advertising or listing products , such as advertisements , affiliate listings , e - commerce catalog pages , shopping carts , electronic coupons , and / or the like , indicating that a product is from a product source known and approved by the manufacturer ( e . g ., a licensed distributor ). in some embodiments , indicators may also be provided to indicate that a product source is associated with the greylist category , the blacklist category , or an unknown category . the indicator may be provided to a customer by the communication protection system 200 without involvement of the associated information resource , in order to provide security , authority , and reliability to the indicator . at block 332 , a price evaluation engine 210 analyzes pricing information of the source profile , and assigns a pricing assessment score to the source profile . in some embodiments , the pricing assessment score may be based on a simple comparison of price information in the product definition to price information associated with the source profile . for example , the source profile may indicate that the product is being offered for sale at $ 10 / unit . the product definition may indicate that the minimum advertised price for the product is $ 20 / unit . the pricing assessment score may be based on this difference between the offer price and the minimum advertised price . in some embodiments , the price evaluation engine 210 may perform further analysis of the total market for the product to determine the pricing assessment score , instead of simply comparing the price information to expected price information . for example , the price evaluation engine 210 may determine the pricing assessment score based on a magnitude of a deviation of an offer price associated with the source profile from a price basis determined for the overall market . the price evaluation engine 210 may determine the price basis based on one or more of a statistical measure ( such as a mean , median , or mode of prices from all source profiles ), a comparison to a minimum advertised price specified in the product definition , a comparison to a recommended retail price specified in the product definition , a comparison to a custom target price , and / or any other value suitable for use as a price basis . the price evaluation engine 210 may determine the size of the deviation based on one or more of a statistical measure ( such as a standard deviation , an average absolute deviation , and / or the like ), a price difference ( such as a percentage difference from the price basis , an absolute difference from the price basis , and / or the like ), and / or any other comparison suitable for determining the size of the deviation . the pricing assessment score will then be assigned based on this comparison . the use of pricing assessment scores instead of explicit price comparisons or thresholds may be beneficial , at least because the price evaluation engine 210 may use different characteristics , different thresholds , and / or different comparisons for each source profile , but will nevertheless be able to compare the pricing assessment scores of source profiles even if they were not evaluated in the same way . at block 334 , a magnitude evaluation engine 214 analyzes sales volume information of the source profile , and assigns a magnitude assessment score to the source profile . the magnitude assessment score assigned by the magnitude evaluation engine 214 represents possible volume impact associated with the source profile on the overall market for the product . the magnitude evaluation engine 214 may consider availability for purchase ( e . g ., whether the product is indicated as being in stock , how many units are indicated as being in stock , and / or the like ), minimum purchase required , and / or other factors in determining the magnitude assessment score . in some embodiments , the magnitude evaluation engine 214 may consider historical information stored within the source profile to consider volume and / or pricing information for the product source over time when determining the magnitude assessment score . in some embodiments , the magnitude evaluation engine 214 may be configured to consider more than one source profile at a time when determining the magnitude assessment score . for example , the magnitude evaluation engine 214 may consider multiple source profiles associated with a single seller — such as a source profile for an amazon marketplace page , a separate source profile for an alibaba product page , and another separate source profile for a custom web site — to determine the possible volume impact of the seller regardless of the particular source profile being evaluated . accordingly , the magnitude assessment score for a given source profile may show a greater severity of impact than would otherwise be determined by its contents alone if other source profiles show that a seller associated with the given source profile has an impact on the overall market from multiple information resources . in some embodiments , the magnitude evaluation engine 214 may infer sales volumes for a product source based on other available information when sales volume information is not directly available . for example , the magnitude evaluation engine 214 may infer a sales volume based on a number of product reviews posted on a product detail page . at block 336 , a presentation evaluation engine 220 analyzes presentation of the product in the gathered resources , and assigns a product presentation score to the source profile . in some embodiments , the presentation evaluation engine 220 may perform automated analysis of how the product is presented by the product source . in some embodiments , the presentation evaluation engine 220 may cause the user interface engine 224 to present an interface to a user to manually review the presentation of the product by the product source . in some embodiments , the analysis performed by the presentation evaluation may include comparison of images of the product to a set of approved images ; presence or absence of taglines or other promotional copy ; presence or absence of trademarks associated with the product or manufacturer ; quality of presentation ( e . g ., misspellings , font choices , and / or the like ); colors ; placement of promotional text , taglines , trademarks , and / or the like ; presence of look - alike products ; and / or any other suitable aspect of the presentation of the product . the determined product presentation score may then indicate whether the product is being presented properly ( and is therefore more likely to be associated with a legitimate product source ), or whether the product is being presented improperly ( and is therefore more likely to be associated with an illegitimate product source ). the method 300 then proceeds to the for loop end block 338 . if there are further source profiles to be processed , the method 300 returns to the for loop start block 320 . otherwise , the method 300 proceeds to a continuation terminal (“ terminal d ”). from terminal d ( fig3 a ), the method 300 proceeds to a set of method steps 306 defined between a start terminal (“ terminal e ”) and an exit terminal (“ terminal f ”), wherein the communication protection system 200 performs fraud remediation . from terminal e ( fig3 e ), the method 300 proceeds to a for loop start block 340 . the method 300 loops between the for loop start block 340 and a for loop end block 352 to repeat the steps included therebetween for each source profile stored in the source profile data store 216 . as with the previously illustrated “ for loop ,” the “ for loop ” construct is used herein for ease of discussion only . one of ordinary skill in the art will recognize that , in some embodiments , the method 300 may process less than all of the source profiles stored in the source profile data store 216 . for example , the method 300 may only process a set of source profiles stored in the source profile data store 216 that have been changed since a previous execution of some portion of the method 300 , or a set of source profiles stored in the source profile data store 216 in a particular category as assigned by the profile categorization engine 218 , or meeting particular thresholds for one or more of the pricing assessment score , the magnitude assessment score , or the presentation assessment score . as another example , the method 300 may process any other subset of source profiles stored in the source profile data store 216 , chosen for any reason . one of ordinary skill in the art will also recognize that , in some embodiments , a logic construct other than a “ for loop ” may be used to process the source profiles . from the for loop start block 340 , the method 300 proceeds to block 342 , where an automated remediation engine 222 determines whether the source profile meets one or more conditions for further action . in some embodiments , the conditions for further action may include individual trigger controls and / or combined threat assessments . individual trigger controls may be configurable to cause further action based on particular conditions . one example of an individual trigger control may cause further action based on a category assigned to the source profile . for example , such an individual trigger control may cause further action for source profiles categorized in a blacklist , while ignoring source profiles categorized in a greylist or a whitelist . another example of an individual trigger control may cause further action based on a threshold for one or more values in the source profile . for example , such an individual trigger control may cause further action if a pricing assessment score is greater than or less than a predetermined value , if the magnitude assessment score is greater than or less than a predetermined value , if the presentation assessment score is greater than or less than a predetermined value , or any other suitable threshold for any other suitable value or combinations of values . such thresholds may be configurable based on different types of product sources , and / or may be configurable based on particular information resources . for example , a pricing assessment threshold that causes further action may be higher for a generally more reputable information resource ( e . g ., amazon . com ) than for a generally less reputable information resource ( e . g ., ebay or craigslist ), even though both may be the same type of information resource . likewise , such thresholds may be configurable for different categories of source profiles and / or for any other suitable reason . as stated above , the conditions for further action may include combined threat assessments . in some embodiments , a combined threat assessment may be a combined score that helps to measure the overall scope of illegitimate products in the supply chain . this scope may be determined using information from a combination of information used within the individual trigger controls described above . for example , a given product source may have a pricing assessment score that is slightly high , a magnitude assessment score that is slightly high , and a presentation assessment score that is slightly high . none of these scores may individually be high enough to trigger any of the individual trigger controls , but the scores may be combined to show an overall threat assessment that warrants further action . the method 300 then proceeds to a decision block 344 , where a test is performed to determine whether one or more of the conditions for further action have been met . if the result of the test at decision block 344 is no , then the method 300 proceeds to the for loop end block 352 . otherwise , if the result of the test at decision block 344 is yes , then the method 300 proceeds to block 346 , where the automated remediation engine 346 creates a remediation workflow associated with the source profile . data representing the created remediation workflow may be stored within the source profile itself , elsewhere in the source profile data store 216 , or in any other suitable location . at block 348 , the automated remediation engine 222 adds a set of remediation actions to the remediation workflow based on the conditions for further action . remediation actions may include , but are not limited to , sending of notifications , establishing watch conditions , presenting data for legal action , and presenting assessment reports . notifications may include email notifications to the product source or information resource that include notice of the illicit communication and / or request further information . notifications may also include legal letters . many types of legal action and related communications may be possible . the particular type of legal action added to the remediation workflow may be determined based on the severity of the impact of the product source on the market for the product . watch conditions may include performing test purchases to help reveal payment sources , reveal party information , enable inspection of goods , establish venue , and / or the like . watch conditions may also include determining a new whitelist / greylist / blacklist category for the product source . when collecting and / or presenting data for legal action , the automated remediation engine 222 may collect or provide sample communications , exhibits of the actual product , exhibits of standard advertising vs . advertising by the product source , exhibits of the party communication , exhibits of standard pricing vs . pricing by the product source , and / or the like . assessment reports may include charts of where the analyzed source profile falls with respect to pricing , magnitude , and / or the like with respect to other legitimate or illegitimate source profiles . fig4 illustrates an exemplary letter template that may be utilized by the automated remediation engine 222 as part of a remediation action according to various aspects of the present disclosure . the exemplary letter template 400 may be used upon the detection of communication related to goods being distributed under a brand confusingly similar to a monitored trademark . the letter template 400 includes a set of variable values ( indicated in the drawing as delimited by angle brackets and in all caps , such as & lt ;& lt ; target_name & gt ;& gt ;, & lt ;& lt ; target_address & gt ;& gt ;, & lt ;& lt ; target_urls & gt ;& gt ;, etc .) to be merged or otherwise automatically completed with appropriate values by the automated remediation engine 222 based on the results of investigation and automated data mining . a letter automatically created based on the letter template 400 may be reviewed and approved for delivery by counsel or the manufacturer via an interface provided by the user interface engine 224 . similar letter templates may be prepared and letters automatically generated to provide notification of copyright infringement , trademark / branding infringement or misuse , patent infringement , violation of distribution agreements , and / or any other suitable notification . in some embodiments , reports providing factual bases for legal pleadings ( or the legal pleadings themselves ) may be generated by the automated remediation engine 222 in a similar manner . various software tools or engines for creating the merged documents based on such templates are available in the art , including , but not limited to , word processor merge features , web form merges , pdf form merges , variable data printing , email merge , database report generators , and / or the like . in some embodiments , the automated remediation engine 222 may similarly create and transmit notices to e - commerce providers , online payment providers , affiliate networks , and / or the like , respecting detected fraudulent activity on the part of a user of or participant in such information resources . in some embodiments , the conditions for further action may be used to determine the severity of the remediation actions added to the remediation workflow . for example , if a threshold based on the pricing assessment score was crossed but a threshold based on the magnitude assessment score was not crossed , the automated remediation engine 222 may add a remediation action that includes sending a notification to the manufacturer to indicate that the manufacturer may wish to investigate the product source further , or a remediation action that includes further automatic investigation such as performing test purchases and / or the like . as another example , if the threshold based on the pricing assessment score was crossed and the threshold based on the magnitude assessment score was also crossed , the automated remediation engine 222 may add a remediation action that includes automatically sending a takedown notice , automatically generating documents to be transmitted to the relevant authorities , and / or the like . at block 350 , the automated remediation engine 222 starts the remediation workflow and tracks the execution of each remediation action of the set of remediation actions . in some embodiments , the remediation actions may be performed by the automated remediation engine 222 itself ( such as automatically transmitting takedown requests , automatically generating legal documents , and / or the like ). in some embodiments , the remediation actions may be enabled by the automated remediation engine 222 , but may be performed or completed manually . for example , the automated remediation engine 222 may flag a source profile for review , and may then present the source profile to the manufacturer via an interface generated by the user interface engine 224 for further manual review . as another example , the automated remediation engine 222 may create assessment reports relating to the source profile , and may then present the assessment reports to the manufacturer via an interface generated by the user interface engine 224 for further manual review . the remediation workflow may continue until the product source is effectively remediated , until all workflow actions have been completed regardless of whether the product source has been effectively remediated , or until any other suitable end point . the method 300 then proceeds to the for loop end block 352 . if there are further source profiles to be processed , the method 300 returns to the for loop start block 340 . otherwise , the method 300 proceeds to a continuation terminal (“ terminal f ”). from terminal f ( fig3 a ), the method 300 proceeds to an end block and terminates . as will be appreciated by one skilled in the art , the specific routines described above in the flowcharts may represent one or more of any number of processing strategies such as event - driven , interrupt - driven , multi - tasking , multi - threading , and the like . as such , various acts or functions illustrated may be performed in the sequence illustrated , in parallel , or in some cases omitted . likewise , the order of processing is not necessarily required to achieve the features and advantages , but is provided for ease of illustration and description . although not explicitly illustrated , one or more of the illustrated acts or functions may be repeatedly performed depending on the particular strategy being used . further , these figures may graphically represent code to be programmed into a computer readable storage medium associated with a computing device . fig5 a - 5c illustrate portions of an exemplary product definition usable by various components of the communication protection system 200 , according to various aspects of the present disclosure . the product definitions relate to an exemplary product , “ hairbegone ,” a beauty supply device that is used for hair removal , and that is marketed and sold to the public via various channels . the “ hairbegone ” is produced by a single manufacturer , so all authorized distributors and resellers should be known to the manufacturer , and should be selling the hairbegone product as agreed with the manufacturer . one of ordinary skill in the art will recognize that the contents of the product definition have been illustrated as xml - formatted text for ease of discussion . in some embodiments , the contents of the product definition may be stored in a less human - accessible format , such as a serialized data structure , one or more database entries , and / or any other suitable format . fig5 a illustrates a portion of an exemplary product definition 502 for analyzing b2b information resources 102 found to be offering the hairbegone for sale . b2b information resources may be ripe for illicit sales or other unauthorized communication relating to the hairbegone product . often , known distributors from other parts of the world , who can obtain goods cheaper than sources in the united states , may seek to distribute their goods within the u . s . via resellers without informing the manufacturer . b2b information resources 102 may also be a common outlet for sales of counterfeit or knock - off products . normally , this counterfeiting activity is very difficult for manufacturers to learn about . as illustrated , the product definition 502 includes information for analyzing a product source on a b2b information resource 102 that includes categories , volume thresholds , price thresholds , and presentation thresholds . upon the creation of a source profile , the various analysis components of the communication protection system 200 may use corresponding portions of the product definition 502 to analyze the source profile . one of ordinary skill in the art will recognize that the use of xml ( or any other configurable data representation ) to define the thresholds may allow a variety of different types of comparisons to be used in order to trigger the thresholds . the specification of severities within the xml representation allows different elements to be given differing amounts of weight . for example , violating a volume threshold may cause a harsher response than violating a price or presentation threshold due to a greater severity value , and / or the like . one of ordinary skill in the art will recognize that , in some embodiments , severities may be calculated based on more than one test and / or may be dynamically determined instead of being specified directly in the product definition . in the illustrated embodiment , the category element includes a whitelist element that indicates that the sellerworld distributor is expected to use the b2b information resources alibaba . com and made - in - china . com , and the supersource distributor is expected to use the b2b information resource alibaba . com . if an analyzed product source matches either of these elements , the profile categorization engine 218 will categorize the product source as belonging to the whitelist . otherwise , the profile categorization engine 218 may assign the product source to a more suspicious “ unknown ” category . the magnitude evaluation engine 214 may use the threshold elements contained within the volume element as settings for determining the magnitude assessment score . as illustrated , the magnitude evaluation engine 214 may assign a magnitude assessment score of “ 5 ” if it is determined that a minimum purchase quantity is greater than a value of “ 25 ,” otherwise , the magnitude assessment score may remain at “ 0 .” this configuration may allow low volume sources to be ignored by the communication protection system 200 in order to focus enforcement efforts on higher volume sources . the use of a severity element to provide the value for the magnitude assessment score may allow the weight given to failure of any particular threshold to be configurable on a case - by - case basis . the price evaluation engine 210 may use the threshold elements contained within the price element as settings for determining the pricing assessment score . as illustrated , the price listed in the product source is compared to a suggested retail price of $ 250 . if the price listed in the product source is less than the suggested retail price , the threshold is triggered and a pricing assessment score may be set to the value indicated in the severity element . the low price may indicate an attempt to undercut legitimate product sources , and therefore warrants further attention . the presentation evaluation engine 220 may use the check for elements contained within the presentation element as settings for determining features to check for within the presentation of the product by the product source . as illustrated , the check for elements instruct the presentation evaluation engine 220 to check the product source for the presence of a product image that is smaller than 32px by 32px , and the presence of a tagline . if either element is missing , the presentation evaluation engine 220 may increment the product presentation score by the amount indicated in the corresponding severity element . as illegitimate sources are more likely to be in conflict with branding guidelines established by the manufacturer , failing to include these expected elements may indicate that a product source warrants further attention . the automated remediation engine 222 may use the workflow element as settings for determining when to add particular actions to a workflow . as illustrated , the workflow element includes several score elements . the score elements specify score ranges within which a combined threat assessment score ( a combination of the category threat value , the magnitude assessment score , the pricing assessment score , and the presentation assessment score ) should fall for action elements included within the score elements to be processed . as illustrated , the elements cause an action to be added to the workflow to send a friendly notice to the distributor upon determining a low combined threat assessment score . the friendly notice may simply warn the distributor that further violations of the manufacturer &# 39 ; s intellectual property rights and / or distribution rights will not be tolerated . in many cases , such a warning may be sufficient to curtail the unwanted activity . upon determining a higher combined threat assessment score , the elements cause three actions to be added to the workflow : the sending of a stern notice to the distributor , the sending of a takedown notice to the b2b information resource 202 , and the generation of a pleading for review by the manufacturer , the manufacturer &# 39 ; s legal counsel , or another user acting on the manufacturer &# 39 ; s behalf . these harsher actions may be chosen to take advantage of all possible options to stop the harmful activity . in other embodiments , the score elements may specify score ranges in different ways , or may specify individual assessment scores as a triggering element . fig5 b illustrates a portion of an exemplary product definition 504 for analyzing a marketplace web site 104 found to be offering the hairbegone for sale . marketplace web sites 104 are also ripe for grey market or black market product distribution or other unauthorized communication , because the marketplace web sites 104 allow distribution directly to retail customers instead of through middlemen . while the ultimate source of products distributed through marketplace web sites 104 is generally unknown , the distributor is often identifiable , and so the communication protection system 200 may be able to contact the distributor directly upon the discovery of questionable offers for sale . the product definition portion 504 is similar to the product definition 502 illustrated in fig5 a , but is adapted to monitor activity on marketplace web sites 104 . while certain differences between the product definition portion 504 and the product definition portion 502 are described below , other differences in information and functionality may exist between the two product definitions that have not been described in detail for the sake of brevity . such differences would be easily understood from the drawings by one of ordinary skill in the art . instead of only a whitelist category , the product definition 502 includes a greylist category and a blacklist category . the whitelist category indicates two sources that are known to be legitimate : the distributor sellerworld offering the product through amazon . com , and the distributor sellerworld offering the product through ebay . the greylist category indicates that any product source with an identified distributor ( other than sellerworld ) found to be distributing the product on amazon . com is added to the greylist . the blacklist category indicates that any product source with an unidentified distributor on any site is added to the blacklist , as the attempt to hide the distributor is likely to indicate the presence of fraud . an unknown category is also specified for product sources that are on marketplace web sites 104 but that don &# 39 ; t fall into any of the other categories . the volume threshold and price threshold are similar to those illustrated and described above in fig5 a , though they show additional features . for example , the volume threshold in the product definition 504 instructs the magnitude evaluation engine 214 to consider the number of product reviews available on the marketplace web site 104 , as opposed to the minimum order size . as another example , instead of setting a hard price limit , the price threshold instructs the price evaluation engine 210 to compare the price to an average of prices for the product , and to trigger the threshold if the price is greater than one standard deviation from the average . the presentation threshold in the product definition 504 also shows an additional feature . the test order element indicates that the presentation evaluation engine 220 should cause an order for the product to be placed through the product source . this may include manual interaction with an interface provided by the user interface engine 224 once the ordered product is received in order to complete the analysis of the presentation evaluation engine 220 . if the received product is determined to be a counterfeit or knock - off , the test order element may cause the associated severity to be incorporated into the presentation assessment score . the workflow element in the product definition 504 is similar to that illustrated and described with respect to fig5 a . one example of a difference is that if a category score indicates that the product source has been assigned to the blacklist category , harsher actions may be added to the workflow regardless of the value of any other assessment score . fig5 c illustrates a portion of an exemplary product definition 506 for analyzing a custom retail web site 106 found to be offering the hairbegone for sale . custom retail web sites 106 may be a particularly difficult form of product source to fight , due to their transient nature . however , the communication protection system 200 is likely to be able to automatically find such product sources shortly after they are made accessible to the public via search engines , and can take automated steps to shut them down . the product definition portion 506 is again similar to the product definition portions 502 , 504 illustrated and described above , but is adapted to monitor activity on custom retail web sites 106 . while certain differences between the product definition portion 506 and the product definition portions 502 , 504 are described below , other differences in information and functionality may exist between the product definitions that have not been described in detail for the sake of brevity . such differences would be easily understood from the drawings by one of ordinary skill in the art . the category element of the product definition portion 506 indicates only a single legitimate web site source for presence in the whitelist category . any other custom retail web site 106 is assigned to the greylist category . when comparing the severity assigned to the greylist category to the thresholds for the workflow scores , one will notice that being assigned to the greylist alone is insufficient to trigger the workflow . instead , another scoring threshold would have to be crossed in order to trigger the workflow . this may help avoid taking action against custom retail web sites 106 that are not actually offering the product for sale , or are offering the product for sale in an authorized manner but have been inadvertently omitted from the whitelist . one of ordinary skill in the art will recognize that the product definition portions illustrated in fig5 a - 5c are exemplary only , and that product definitions with other values or for other types of information resources may be used . in some embodiments , each of the exemplary product definition portions illustrated and described above may be combined into a single product definition , such that the communication protection system 200 may analyze multiple types of information resources for the same product . in some embodiments , gathered resources that are associated with a product but that do not match any of the types of product definitions ( such as a comparison shopping web site 110 found to be offering the hairbegone , if the product definitions illustrated in fig5 a - 5c are the only product definition portions for the hairbegone ) may be treated as unexpected product sources , and may be flagged for additional review . fig6 illustrates aspects of an exemplary computing device 600 appropriate for use with embodiments of the present disclosure . while fig6 is described with reference to a computing device that is implemented as a device on a network , the description below is applicable to servers , personal computers , mobile phones , smart phones , tablet computers , embedded computing devices , and other devices that may be used to implement portions of embodiments of the present disclosure . moreover , those of ordinary skill in the art and others will recognize that the computing device 600 may be any one of any number of currently available or yet to be developed devices . in its most basic configuration , the computing device 600 includes at least one processor 602 and a system memory 604 connected by a communication bus 606 . depending on the exact configuration and type of device , the system memory 604 may include volatile or nonvolatile memory , such as read only memory (“ rom ”), random access memory (“ ram ”), eeprom , flash memory , or similar memory technology . those of ordinary skill in the art and others will recognize that system memory 604 typically stores data and / or program modules that are immediately accessible to and / or currently being operated on by the processor 602 . in this regard , the processor 602 may serve as a computational center of the computing device 600 by supporting the execution of instructions . as further illustrated in fig6 , the computing device 600 may include a network interface 610 comprising one or more components for communicating with other devices over a network . embodiments of the present disclosure may access basic services that utilize the network interface 610 to perform communications using common network protocols such as tcp / ip , udp , ethernet , token ring , and / or the like . the network interface 610 may also include a wireless network interface configured to communicate via one or more wireless communication protocols , such as wifi , 2g , 3g , lte , wimax , bluetooth , and / or the like . in the exemplary embodiment depicted in fig6 , the computing device 600 also includes a storage medium 608 . however , services may be accessed using a computing device that does not include means for persisting data to a local storage medium . therefore , the storage medium 608 depicted in fig6 is represented with a dashed line to indicate that the storage medium 608 is optional . in any event , the storage medium 608 may be volatile or nonvolatile , removable or nonremovable , implemented using any technology capable of storing information such as , but not limited to , a hard drive , solid state drive , cd rom , dvd , or other disk storage , magnetic cassettes , magnetic tape , magnetic disk storage , and / or the like . as used herein , the term “ computer - readable medium ” includes volatile and non - volatile and removable and non - removable media implemented in any method or technology capable of storing information , such as computer readable instructions , data structures , program modules , or other data . in this regard , the system memory 604 and storage medium 608 depicted in fig6 are merely examples of computer - readable media . suitable implementations of computing devices that include a processor 602 , system memory 604 , communication bus 606 , storage medium 608 , and network interface 610 are known and commercially available . for ease of illustration and because it is not important for an understanding of the claimed subject matter , fig6 does not show some of the typical components of many computing devices . in this regard , the computing device 600 may include input devices , such as a keyboard , keypad , mouse , microphone , touch input device , touch screen , tablet , and / or the like . such input devices may be coupled to the computing device 600 by wired or wireless connections including rf , infrared , serial , parallel , bluetooth , usb , or other suitable connections protocols using wireless or physical connections . similarly , the computing device 600 may also include output devices such as a display , speakers , printer , etc . since these devices are well known in the art , they are not illustrated or described further herein . while illustrative embodiments have been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the claims .
| 6 |
fig1 shows a diagrammatic oblique microsection through a diffusion solder position 2 of a first embodiment of the invention . reference numeral 3 denotes a first part , which is electrically and mechanically connected to a second part 4 via the diffusion solder position 2 . reference numeral 5 denotes a first solder component . the melting point of the first solder component is lower than the melting point of the second solder component 6 . the second solder component 6 has a melting point which is higher than the melting point of the intermetallic phases , which form from the two solder components 5 and 6 . the melting point of the second solder component 6 is also higher than the soldering temperature at which the two parts 3 and 4 are joined together with the aid of the diffusion solder position 2 . of the material of the second solder component 6 with a high melting point , a proportion , which corresponds to the saturation limit for the second solder component 6 in the melt of the first solder component 5 , diffuses into the diffusion region 7 of the diffusion solder position 2 . therefore , a diffusion solder position 2 includes an undissolved residual region of the second solder component 6 in the oblique microsection . nanoparticles 8 are initially distributed homogeneously in the molten region of the first solder component 5 , and as the formation of intermetallic phases increases in the diffusion solder position 2 , may become distributed inhomogeneously , as shown in fig1 , i . e ., a higher concentration of nanoparticles 8 may occur in the region of the intermetallic phases . this inhomogeneity may be partially caused by convection phenomena in the molten first solder component 5 . accumulation of the nanoparticles 8 in the vicinity of the phase transition from the first solder component 5 to the undissolved part of the second solder component 6 is a feature of this particular type of diffusion solder position 2 . in this first embodiment of the invention , the first part 3 is a semiconductor chip 9 with a lower coefficient of thermal expansion than the second part 4 , which forms part of a metallic leadframe 10 . this leadframe 10 is connected to the back surface 22 of the semiconductor chip over a large area via the diffusion solder position 2 . the nanoparticles 8 prevent the formation and propagation of microcracks within the diffusion solder position 2 at the brittle intermetallic phases formed during the diffusion soldering . since the second part 4 includes a leadframe 10 , which includes a copper alloy and therefore has a significantly higher coefficient of thermal expansion than the first part 3 . the leadframe includes a semiconductor chip . the expansion coefficient of the nanoparticles is set within a range between the values for the expansion coefficients of the first part 3 and the second part 4 . the coefficient of thermal expansion of the nanoparticles can be matched to the coefficients of thermal expansion of the first part 3 and the second part 4 by use of suitable amorphous silicates . amorphous silicates of this type may be borosilicates or phosphosilicates . part of the high - melting second solder component 6 outside the diffusion region 7 remains free of nanoparticles , since the second solder component 6 is not completely consumed during the melting and diffusing into the melt of the first solder component 5 . a diffusion solder position 2 of this type provides thermal stress compensation between the first of the two parts and the second of the two parts 3 and 4 . in this first embodiment of the invention , as mentioned above , the diffusion solder position 2 may , as the first part 3 , include a semiconductor chip and , as the second part 4 , may include a metallic leadframe having a semiconductor chip island 11 which serves as source contact 12 for a power component . therefore , the entire source current of a power component of this type can be fed to the semiconductor material 9 via the chip island 11 . fig2 shows a diagrammatic oblique microsection through parts 3 , 4 , which are to be connected to one another via a diffusion solder position 2 . components which have the same functions as in fig1 are denoted by identical reference numerals and are not explained once again . for this purpose , the first part 3 , namely , a semiconductor chip 9 , is coated on its back surface 22 with a low - melting first solder component 5 , to which nanoparticles 8 have been applied . this application can be effected by rolling or stamping in the nanoparticles 8 on the top surface of the first solder component 5 , which melts at a low temperature . another option is for the first solder component 5 to be electrodeposited on the back surface of the semiconductor chip in an electrolyte bath , which at the same time contains nanoparticles 8 . in this case , the nanoparticles 8 are incorporated in a uniform and homogeneous distribution in the solder component 5 . the lower part of fig2 shows an outline of an oblique microsection through a second part 4 , which bears a second solder component 6 on its top surface . this solder component 6 is a high - melting solder component 6 , and therefore , has a higher melting point than the low - melting solder component 5 on the first part 3 . this high - melting solder component may also include a multilayer arrangement that includes gold , silver , nickel , and / or alloys thereof . the top layer is involved in the diffusion soldering and forming intermetallic phases with the low - melting solder component 5 . when the two parts 3 , 4 are moved together in the direction indicated by arrow a at a temperature at which at least the low - melting solder component 5 is molten and the nanoparticles 8 are distributed uniformly in the melt , the high - melting component 6 will partially diffuse into the low - melting component 5 and will form intermetallic phases in the diffusion region . during cooling of the diffusion solder position 2 , an inhomogeneous distribution of the nanoparticles 8 may be established within the diffusion region . in the diffusion region of a diffusion solder position , these nanoparticles 8 prevent propagation of microcracks caused by intermetallic phases . for this purpose , the low - melting solder component 5 may include tin or a tin alloy , while the second , high - melting solder component 6 includes silver , gold , copper , or alloys thereof . fig3 shows a diagrammatic cross section through an electronic component 30 for a power module which includes a plurality of diffusion solder positions 2 . components which have the same functions as in the previous figures are denoted by the same reference numerals and are not explained once again . reference numeral 10 denotes a leadframe , reference numeral 11 denotes a semiconductor chip island of the leadframe , and reference numeral 12 denotes a source contact of the electronic power component 30 . reference numeral 13 denotes a large - area flat conductor which contact - connects the parallel - connected drain contacts on the top surface of the power component 30 . reference numeral 14 denotes a flat conductor which produces a gate contact 16 for the top surface of the semiconductor chip . the electronic power component 30 includes several hundred thousand mos transistors 21 connected in parallel , which are arranged in the region of the active top surface 20 of the semiconductor chip . the active region of the top surface 20 is marked by a dashed line 23 . whereas the common source region can be contact - connected over a large area by the back surface 22 of the semiconductor chip 9 by the chip islands 11 being electrically and mechanically connected to the back surface 22 of the semiconductor chip 9 with the aid of a diffusion solder position 2 , the several hundred thousand gate electrodes are combined to form a gate contact 16 which can be connected to a higher - level circuit via the flat conductor 14 . the flat conductor 14 for the gate contact 16 is connected to the parallel - connected gate electrodes of the electronic power component 30 via a diffusion solder position 2 . a third diffusion solder position 2 includes the electrical and mechanical connection of the flat conductor 13 to the drain connection comprising several hundred thousand electrodes connected in parallel . to connect the flat conductors 13 and 14 , which includes a metal , and the chip islands 11 of the leadframe 10 , which include a metal plate , to the individual components of the semiconductor chip 9 with the aid of diffusion solder positions 2 , the first , low - melting solder component 5 is applied to the electrodes of the semiconductor web 9 , so that the semiconductor 9 forms the first part 3 of the diffusion solder position . the metallic parts , which are to be connected to the semiconductor include flat conductors 13 and 15 and chip island 11 , are first surface - treated in order to prevent premature diffusion of the flat conductor metal or of the metal of the semiconductor chip island 11 to the diffusion solder position . whereas the metal of the flat conductors 13 and 14 and of the chip island 11 is substantially a copper alloy , the diffusion position coating may be a nickel alloy . the second high - melting solder component 6 may be formed by a gold or silver alloy . the overall structure can be made ready for a diffusion furnace , and the diffusion soldering can be carried out in the diffusion furnace . for this purpose , in this embodiment of the invention , the low - melting solder component 5 , which has been applied to the surfaces of the semiconductor chip , is mixed with nanoparticles of silicates . if the second solder component 6 is completely consumed in the diffusion region during the diffusion soldering , at least one diffusion - inhibiting layer 24 remains between the diffusion region 7 and the metallic components , such as flat conductors 13 , 14 and chip island 11 . fig4 to 8 show diagrammatic cross sections through a semiconductor wafer 19 for fabricating a plurality of electronic power components 30 , which have diffusion solder positions . components which have the same functions in the following fig4 to 8 as in the previous figures are denoted by the same reference numerals and are not explained once again . fig4 shows a diagrammatic cross section through a semiconductor wafer 19 . on its active top surface 18 , in a region , which is delimited by a dashed line 23 , this semiconductor wafer has mos transistors , which are connected in parallel by their several hundred thousand gate connections and are connected in parallel by their several hundred thousand drain electrodes on the top surface 18 of the semiconductor wafer 19 . the back surface 22 is used as a source region for a plurality of electronic power components . fig5 shows a diagrammatic cross section through a semiconductor wafer 19 following application of a first solder component 5 to its back surface 22 . this solder component 5 on the back surface 22 is a metallic covering of the back surface with a first solder component 5 , which has a lower melting point than a second solder component 6 , which can form intermetallic phases with the first solder component 5 during diffusion soldering . this first solder component 5 may be tin or a tin alloy . by dipping the semiconductor wafer 19 into a suitable tin bath , it can be applied to both the back surface 22 of the semiconductor wafer 19 and the active top surface 18 of the semiconductor wafer 19 , or in two separate steps , it can be applied first to the back surface 22 , as shown in fig5 , and then to the active top surface 18 , as shown in fig6 . fig6 shows a diagrammatic cross section through a semiconductor wafer 19 following application of a first solder component 5 to its active top surface 18 . this top surface 18 is also covered with a level metal surface including the low - melting solder component 5 and is patterned in a subsequent step . fig7 shows a diagrammatic cross section through a semiconductor wafer 19 after patterning of the first solder component 5 on the active top surface 18 of the semiconductor wafer 19 . the patterning of the solder component 5 on the active top surface 18 of the semiconductor wafer 19 is necessary in order to prepare a common , parallel - connecting gate connection 16 for each semiconductor chip of the semiconductor wafer 19 and in order to create a large - area contact for the parallel - connected drain electrodes using a drain contact 15 . after this step , the entire semiconductor wafer 19 can be dusted with nanoparticles 8 including a silicate , which are then stamped into the coating formed by the first solder component 5 under pressure . alternatively , the solder component 5 may be printed onto the active top surface of the semiconductor wafer 19 in patterned form by a solder paste which contains the nanoparticles 8 . a level metal surface formed from the first solder component 5 may also be electrodeposited on the active top surface of the semiconductor chip 19 . nanoparticles 8 are distributed in the electrolyte bath so that the nanoparticles 8 are incorporated in homogeneously distributed form in the solder component 5 on the active top surface of the semiconductor wafer . since the nanoparticles 8 are non - conductive silicates , for example , borosilicate or phosphosilicate , the entire active surface 18 can be provided with a layer of nanoparticles without short - circuiting the electronic structures on the active top surface 18 of the semiconductor wafer 19 . fig9 shows a diagrammatic cross section through a semiconductor chip 9 for a semiconductor component with diffusion solder positions 2 . components with the same functions as in the previous figures are denoted by identical reference numerals and are not explained once again . the semiconductor wafer was sawed open along the parting lines indicated in fig4 to 8 , resulting in the cross section through the semiconductor chip illustrated in fig9 . these cross sections are only diagrammatic and are not to scale . in reality , the thickness d of a semiconductor chip 9 of this type is between 50 μm and 750 μm , whereas the width b of a semiconductor chip 9 of this type may be several centimeters . to fabricate an electronic power component from this semiconductor chip 9 , fig1 to 12 show diagrammatic cross sections through parts 3 , 4 which have been connected to one another to form a component with diffusion solder positions 2 . components with the same functions as in the previous figures are denoted by the same reference numerals and are not explained once again for fig1 to 12 . fig1 shows a diagrammatic cross section through a flat conductor frame 26 which bears flat conductors 13 for a common drain contact 15 and flat conductors 14 for a common gate contact 16 . the respective end regions 27 and 28 of the flat conductors 13 , 14 , respectively , which are to be connected to the drain electrodes and to the gate electrodes running parallel , are coated with a second soldering component 6 . this soldering component 6 may include a plurality of metal layers , which on the one hand prevent diffusion of the flat conductor material into the diffusion solder position 2 and on the other hand provide a diffusion solder material which can diffuse into the molten solder of the first solder component 5 . since these flat conductors 13 , 14 are to be placed onto the active top surface of the semiconductor chip 9 , no nanoparticles 8 are incorporated into the second solder component 6 , especially since the first solder component on the semiconductor chip 9 , as shown in fig1 , already includes nanoparticles . fig1 shows a diagrammatic cross section through a semiconductor chip 9 with coatings of a first solder component on the top surface 18 and on the back surface 22 , the cross section shown in fig1 corresponding to the cross section shown in fig9 . consequently , there is no need to interpret or explain fig1 . fig1 shows a further part of the flat conductor frame 26 , which bears a chip island 11 , which for its part is coated with a second solder component 6 and to which a layer of nanoparticles 8 has been applied . this layer of nanoparticles may be incorporated into the solder component 6 as early as during electrodeposition of the solder component 6 . fig1 shows a diagrammatic cross section through an electronic component with diffusion solder positions 2 before the flat conductors 13 , 14 are bent over to form external connections . both the chip island 11 and the flat conductors 13 , 14 are connected to one another on a common flat conductor frame , the flat conductor frame having two levels , namely a level for the back surface 22 of the semiconductor chip 9 with a semiconductor chip island 11 and a further level for the active top surface 18 of the semiconductor chip 9 with the corresponding flat conductors 13 , 14 . after these components have been brought together , as shown in fig1 , and diffusion soldering has been carried out , the result is the outline cross section shown in fig1 , i . e ., the nanoparticles 8 are substantially distributed within the solder component 5 , whereas a remainder of the solder component 6 has been retained in unchanged form , or at least there remains a layer of a diffusion - inhibiting metal alloy to prevent the material of the leadframe from being able to diffuse into the diffusion solder position 2 during the diffusion soldering . after the basic component shown in fig1 has been completed with a diffusion - soldered common gate contact 16 , a common drain contact 15 , and common source contact 12 , to complete the electronic power component the flat conductors 13 , 14 can be bent over to the level of the chip island . the entire component can be packaged in a plastic housing ( not shown ). the end result is in this case an electronic power component 30 as shown in fig3 . the above description of the exemplary embodiments in line with the present invention serves merely for illustrative purposes and not to limit the invention . the invention allows various changes and modifications without departing from the scope of the invention and its equivalents .
| 7 |
referring again to the drawings , and particularly referring to fig1 thereof , there is generally illustrated a cleaning machine , designated generally at 2 , such as an automatic scrubber . as known in the art , such scrubber apparatus includes a plurality of spindles for detachably mounting a corresponding number of brushes . in the present invention , there is provided a new and novel construction for a mounting device , designated generally at 4 , which is detachably connected via a conventional type mounting plate 6 to the drive spindle 8 of the apparatus 2 . the plate 6 is provided with conventional type key - way slot arrangement 10 for detachably connecting the device 4 to the spindle 8 . as forementioned , this illustrates generally one form of the invention which is particularly adapted for use with a multi - brush scrubber apparatus and / or with a single brush - type apparatus . preferable , the mounting device of the invention has particular application in respect to multi - type brush scrubber machines in relation to the ease of interchangeability , flexibility in use and efficiency in use , as aforesaid . as best illustrated in fig2 , 4 and 5 , the mounting device 4 of the present invention comprises a body member 12 of generally circular configuration ( fig3 ) defined by planar surfaces 14 and 16 . it is to be understood , however , that the base member 12 may be of any other non - circular configuration , as desired . for example , the configuration may include polygonal configurations , such as hexagonal , octagonal , and other shapes having an included angle . also , it should be clearly understood that the base member may comprise other symmetrical configurations , such as square , rectangular , as well as other non - circular configurations which are not readily definable by mathematical calculation . as best illustrated in fig2 and 4 , the mounting device 4 is preferably of a generally circular configuration defined by an endless , outer peripheral edge 18 ( fig3 ) defining the configuration thereof . in the embodiment shown , the body member 12 includes a plurality of symmetrically disposed rings of filament bundles designated generally at 20 . in the invention , the filament bundles 20 are arranged in concentric arrangement so as to define a plurality of circles , as at 22 , in relation to a bore 24 , provided in the center thereof for detachable connection ( fig1 ) with the machine spindle 8 . accordingly , any number of circles of filaments may be provided , dependent upon shape of the mounting device for a particular application . for example , in the embodiment shown , four concentric circles of filaments are illustrated for use with a base member 12 having a diameter of approximately 10 inches . in such cases , the individual bundles of filaments may be spaced approximately 1 / 2 inch apart in a radial direction and between about 5 / 8 inch to 7 / 8 inch apart in arcuate ( i . e ., circular ) direction . in such case , the measurements are taken in respect to the geometric centers of the respective bundles . further , the outermost concentric circle of bundles is preferably spaced approximately between 1 / 4 inch and 3 / 8 inch from the outer peripheral edge 18 of the base 12 . in the invention , the individual bundles 20 may be disposed in any pattern so as to provide an effective mechanical gripping coacting engagement with a resilient pad element p such as a cleaning , stripping , scrubbing , polishing or similar type pad . accordingly , the filament bundles 20 may be symmetrically arranged and / or randomly arranged in any pattern , as desired . for example , the filament bundles may have the aforesaid type of special relationship with the number of filament bundles decreasing in number in a direction from the outer edge 14 toward the center of the bore 24 . for example , with a 10 inch diameter base member 12 , the inside circle may have 28 bundles with a 3 / 16 inch diameter , the second circle may have 36 bundles with a 3 / 16 inch diameter , the third circle may have 40 bundles with a 3 / 16 inch diameter , the second circle may have 36 bundles with a 3 / 16 inch diameter , the third circle may have 40 bundles with a 3 / 16 inch diameter and the outer circle 52 bundles with a 3 / 16 inch diameter . in another arrangement , the filament bundles may be set so that each pair of outer bundles is disposed opposite a corresponding inner bundle so as to provide a generally triangular pattern with the rows , in effect , being disposed in a staggered or off - set relationship . in this form of the invention , the individual filament bundles 20 may be mounted in the base member 12 by any conventional means , such as by staple - set , epoxy - set , crimped wire , wire - drawn , or the like , as known in the art . the staple - set is preferred . this utilizes a bore of approximately 3 / 16 inch filled with a 3 / 16 inch diameter bundle having a step , clipper trim . this trim shape has 3 to 6 filaments per hole producing 6 to 12 ends with approximately one - half the ends cut at 1 / 2 inch and with the other one - half cut at random lengths from 174 inch to 7 / 16 inch . in this embodiment , the filaments preferably project approximately 1 / 2 inch outwardly from the confronting surface 16 of the base 12 . the filaments are preferably made from a resilient , high strength material having good abrasive and wear characteristics , such as plastic or impregnated plastic material . a preferred material is a polypropylene material made commercially available under the trade mark name prostan from the e . b . & amp ; a . c . whiting company . also , the filaments may be made of other materials , such as metal , natural fibers . in the embodiment illustrated , an inner retention means , designated generally at 26 , is provided to prevent lateral shifting movement of the pad p . as shown , retention means 26 includes an annular ring - like collar member 28 defined by a bore 30 ( fig5 ) corresponding generally in diameter to the bore 24 in the base 12 . this collar 28 may be provided with one or more rings of filament bundles 32 which may be similarly attached , such as by staple - set or the like , within bores 34 provided in the collar 28 . in this form , the bores may be approximately 3 / 16 inch diameter on 1 inch centers . in this case , the collar 28 preferably has a height of approximately 3 / 4 inch with each filament bundle 32 being spaced approximately 1 / 4 inch from the top or outer surface 31 of the collar . by this arrangement , the geometric center - line c of the respective filament bundle 32 is preferably disposed in the same general plane , as defined by the terminal ends of the filament bundles 20 in the base member 12 , as best seen in fig5 . this arrangement provides an effective optimum gripping engagement with the interior confronting surface of the pad p , as at 36 ( fig3 ) to prevent lateral shifting and rotational movement of the pad p relative to the base member 12 . it will be appreciated , however , that any number of filament bundles and / or number of circles of filament bundles may be provided throughout the axial extent ( length ) of the collar 28 to insure the desired positive gripping action . in such case , for example , it is believed that a three - point engagement utilizing 3 filament bundles equally space would provide satisfactory results while only 2 filament bundles would be unsatisfactory . similarly , there would be provided one or more continuous rows of filaments rather than a plurality of spaced bundles and / or incremental circles of bundles achieved , such as by a metal strip ( not shown ) disposed in a corresponding recess ( not shown ) provided in the collar . in this form , for a ten inch diameter base , the filament bundles 20 preferably have a height between approximately 3 / 4 inch and 1 / 2 inch with the other filament bundles 32 having a length of approximately 1 / 4 inch . with this right angular , perpendicular relationship between the filament bundles 22 and 32 , the filament bundles 32 preferably have a flat , trim shape , whereas , the filament bundles 22 have a clipped , step trim shape with the step portion thereof oriented inwardly . it is to be understood , however , that the step trim could be oriented outwardly , as desired . in the invention , a protective cover 36 is secured , such as by an adhesive or the like , to the upper exposed surface 34 of the collar 28 to reduce and / or prevent accidental damage to the surface to be cleaned . this cover 36 may be made from any suitable material and is preferably an interwoven polymeric material commercially available under the trade name scotch - brite from the 3m company . in fig6 and 7 , there is illustrated another embodiment which is of generally identical construction , except for the annular orientation of the filament bundles and a modification in respect to the structure of the inner retention means . in this form , the filament bundles 40 in the base 12 are preferably angularly disposed so as to flare outwardly in a direction away from the bore 24 ( fig6 ) toward the outer peripheral edge 16 , of the base . in such case , the angular orientation may be from 0 ° ( i . e . 90 °) to approximately 50 ° so as to define an acute angle with respect to the base 12 . in a preferred range , the angular orientation is from 0 ° ( i . e . 90 °) to 35 ° and with the most preferred orientation being from 0 ° to 20 °. this angular orientation in respect to the filament bundles is for base members having a diameter in the range from 7 inches to 23 inches . it has been found that with small diameter size base members , such as 7 inches to 13 inches , that the optimum angular orientation of the filament bundles is approximately 10 ° to 13 °. in the invention , the bundles may be disposed at the same degree of inclination , or certain circles of filament bundles may be disposed at progressively increased angles , as desired . for example , with four concentric circles of filament bundles , the innermost circle may be disposed at 5 °, the second circle at 10 °, the third circle at 15 °, and the fourth or outer circle at 20 °. in each case , it is preferred that each circle have an increased angular orientation of from 2 ° to 5 ° in relation to the proceeding circle so as to progressively increases in a direction toward the outer edge of the base . by this arrangement , it has been found that the angular disposition of the filament bundles effectively acts to provide a positive gripping engagement with the pad p and prevents shrinkage thereof , as aforesaid . in this embodiment , there is illustrated a modification ( fig6 ) of the inner retention means , designated generally at 42 . in this case , the retention means comprises an inner circle of filament bundles 44 which are disposed at an acute angle relative to the base 12 . in this case , the filament bundles may be disposed at an angle ( a ) from 15 ° to approximately 60 ° with the preferred inclination being 45 °. in such case , the filament bundles 44 extend between approximately 1 / 8 inch and 1 / 4 inch above the general plane of the terminal ends of the filament bundles 40 to provide an interlocking gripping engagement with the confronting interior surface 36 ( fig3 ) of the pad p . in this form , the filament bundles have a generally flat trim configuration . here again , the filament bundles may be on one inch spaced centers for a 10 inch diameter base member 12 . again , it is to be understood that any number of filament bundles may be employed , such as from three or more . further , a continuous circle of filaments , such as provided by a metal strip insert or the like , may be utilized . in fig8 there is illustrated a further modification of the invention which is generally the same as that of fig7 except that additional filament bundles 52 with the step trim are disposed inwardly of the outer filament bundles 40 . in this case , the inner circles of filament bundles 52 are oriented at an acute angle different from that of the outer bundles 40 . preferably , the bundles 52 are disposed at an acute angle from 0 ° ( i . e . 90 °) to 30 ° with most preferred being from 0 ° ( i . e . 90 °) to 30 °. here , the first or central circle 50 is disposed at the 0 ° or 90 ° angle between the filament bundles 52 and 40 . in the invention , it has been found that the most preferred form of the mounting device 4 comprises the filament bundles 40 which are disposed at an acute angle in respect to the base when utilized in conjunction with the retention means 26 ( fig3 ) which embodies the collar 28 mounting filament bundles 20 . most preferably , the filament bundles 40 are disposed at an acute angle which progressively increases in a direction away from the geometric center of the base 12 toward the outer periphery thereof . from the foregoing description , the accompanying drawings , and the following claims , it will be seen that the present invention provides a new and novel construction for a brush - like mounting device which may be quickly and easily applied for use in detachably mounting a cleaning , stripping , scrubbing , polishing or the like type pad element for use with single and / or multiple cleaning machines or the manual or automatic types . specifically , the invention provides a new and novel structural arrangement which utilizes a first resilient , high strength filament retention means disposed in predetermined angular relationship with a second resilient , high strength filament retention which frictionally and mechanically coact for gripping engagement with the fibers and / or strands of a pad element to prevent lateral , rotational , and / or shrinking movement of the pad during normal usage thereof .
| 0 |
in the following description , like reference numerals indicate like components to enhance the understanding of the invention through the description of the drawings . also , although specific features , configurations , arrangements and steps are discussed below , it should be understood that such specificity is for illustrative purposes only . a person skilled in the relevant art will recognize that other features , configurations , arrangements and steps are useful without departing from the spirit and scope of the invention . as illustrated in fig1 , a pointing device 10 in accordance with an exemplary embodiment of the invention includes a base 12 , a puck 14 , a first magnet system 16 , and a second magnet system 18 . base 12 can be part of the case or other sub - assembly of a host device , such as a laptop computer , personal digital assistant ( pda ), cellular telephone , or hybrid thereof , or it can be a separate element . in the exemplary embodiment , base 12 has a lower portion 20 and an upper portion 22 , but in other embodiments it can comprise fewer elements or more elements and have any other suitable structure . first magnet system 16 comprises an annular magnet mounted in puck 14 , and second magnet system 18 comprises an annular magnet mounted in base 12 . although in the exemplary embodiment of the invention , first and second magnet systems 16 and 18 each comprises a single annular permanent magnet , in other embodiments each can comprise one or more magnets of any suitable shape and type arranged in any suitable manner . one or more of the magnets can be permanent magnets as in the exemplary embodiment , or one or more can be electromagnets , as indicated in generalized form in fig6 . still other magnet system combinations and variations will occur to persons skilled in the art to which the invention relates in view of the teachings herein . similarly , although puck 14 and first and second magnet systems 16 and 18 are shown recessed within an area of base 12 in the exemplary embodiment , with the magnets enclosed or covered by portions of puck 14 and base 12 ( as indicated by dashed line in fig1 ), in other embodiments the puck and the magnet systems can be disposed in or on the base , enclosed or exposed in whole or part , in any other suitable manner . in this context , the terms “ in ” and “ on ” as used herein are intended to be synonymous . a user can move puck 14 ( typically using his or her finger , as indicated in dashed line in fig2 ) by applying a lateral force , i . e ., a force in any direction substantially perpendicular to an axis 24 that is normal to a planar region in which puck 14 is movable . in the illustrated embodiment of the invention , the planar region is defined by a planar surface of base 12 on which puck 14 slides . ( indeed , although not shown for purposes of clarity , to minimize the sliding friction in such embodiments , one or both of the surfaces of puck 14 and base 12 in contact with each other can include teflon or other low - friction material .) nevertheless , in other embodiments , any other means for facilitating movement of the puck within a planar region can be used . the force that the user applies in the lateral direction slides puck 14 in that direction , as indicated by the arrows in fig3 - 4 . in this manner , a user can move puck 14 anywhere within the circular area of base 12 enclosed by the annular magnet of second magnet system 18 . it should be noted that fig1 - 4 are not to scale , and the user may need only a relatively small area in which to move puck 14 ; the distance a user moves puck 14 can be , for example , on the same order as that in which a user moves a conventional joystick , ibm trackpoint ™, or similar compact pointing device . also , although puck 14 is disc - shaped or puck - shaped in the exemplary embodiment and laterally suspended within the circular area solely by magnetic force , in other embodiments the puck can have any suitable shape and structure , can be a part of some other assembly or mechanism , and can move in other dimensions and be used in other manners in addition to what is described herein . the term “ puck ” is therefore intended to include within its scope of meaning all such structures . pointing device 10 further includes a transducer system having electrode pads 26 , 28 , 30 and 32 , which are electrically insulated from one another and from puck 14 . although illustrated for purposes of clarity as squares embedded or patterned in an upper surface of portion 22 of base 12 , in other embodiments they can have any other suitable structure , shape and arrangement . for example , they can be patterned on the reverse surface of portion 22 . four capacitances are defined by the amount that puck 14 overlaps each of electrode pads 26 , 28 , 30 and 32 . these capacitances change as puck 14 moves over electrode pads 26 , 28 , 30 and 32 . as illustrated in fig8 , an electronic controller 34 can determine the position or direction of movement of puck 14 from the changes in relative capacitance . puck 14 can also include a suitable sensor ( not shown for purposes of clarity ) that detects the presence of the user &# 39 ; s finger , i . e ., detects a downward force along axis 24 . the position or direction of movement of puck 14 is transmitted to the host device ( e . g ., laptop computer , pda , etc .) in response to detection of such a force . the host device typically uses this information to control the position and movement of a cursor displayed on a screen ( not shown ). with puck 14 offset from the center of the circular area in which it is movable ( e . g ., as shown in fig3 ), when the user lifts his or her finger , the magnetic force re - centers puck 14 in that area . also , when the user lifts his or her finger from puck 14 , the position or direction of movement of puck 14 is not transmitted to the host device ( or , alternatively , the host device is caused to ignore any position or direction information that may be transmitted ). thus , as with conventional pointing devices that re - center themselves , re - centering pointing device 10 does not affect the cursor position . the magnetic interaction that causes the above - described re - centering can readily be understood with further reference to fig5 . in the illustrated embodiment of the invention , surfaces of first magnet system 16 and second magnet system 18 that face or oppose each other have the same polarizations , thereby causing them to repel each other . thus , in this concentric magnet embodiment , the exterior annular surface of first magnet system 16 and the interior annular surface of second magnet system 18 can each have a “ south ” (“ s ”) polarization as shown or , alternatively , they can each have a “ north ” polarization . in other embodiments of the invention , the polarizations will depend upon the shape and arrangement of the magnets . note that when puck 14 is centered , as shown in fig1 , the repulsive magnetic forces act equally in all of the various lateral directions about puck 14 , with forces in opposing directions canceling each other . the resultant of these forces exerted upon puck 14 in all of the various directions is zero , and puck 14 remains centered with respect to base 12 . when the user moves puck 14 off center , the resultant force is no longer zero , and a force is exerted upon puck 14 in a direction toward the center . if the user then lifts his or her finger , the force moves puck 14 in that direction until it is re - centered . as illustrated in fig6 , in another embodiment of the invention , one or both of the magnet systems 36 and 38 can comprise an electromagnet ( as indicated by the windings depicted in generalized form around an annular core ). as noted above , one or both of the magnet systems can have any suitable number , combination and arrangement of permanent magnets , electromagnets and similar magnetic elements . as illustrated in fig7 , in still another embodiment of the invention , the second magnet system 39 comprises not only an annular magnet 40 but also another ( in this case , disc - shaped ) magnet 42 that at least to some extent levitates or supports the puck to counteract friction between the puck and the base . in other words , the resultant force exerted upon the puck by the magnetic repulsion between the second and first magnet systems 38 and 44 , respectively , has components in both lateral and axial directions , with the axial force opposing the weight of the puck . a similar effect could be obtained with a magnet that generates a field having an uncommon shape such that it exerts a force upon the puck having components in both the lateral and axial directions . counteracting frictional forces in this manner enables the puck to slide more smoothly over the base . it will be apparent to those skilled in the art that various modifications and variations can be made to this invention without departing from the spirit or scope of the invention . thus , it is intended that the present invention cover the modifications and variations of this invention provided that they come within the scope of any claims and their equivalents . with regard to the claims , no claim is intended to invoke the sixth paragraph of 35 u . s . c . section 112 unless it includes the term “ means for ” followed by a participle .
| 6 |
the load management control system 10 will now be described with reference to fig1 - 3 , which are schematic diagrams of the components of the system 10 , according to the present invention . the system 10 includes a conventional indoor temperature sensor 12 , which is a solid state transducer that provides an output voltage proportionate to temperature . in the illustrated embodiment , a national semiconductor lm335 precision temperature sensor is used having a calibration potentiometer ( r2 ). however , other sensors that produce a linear output voltage with respect to temperature may be used , such as thermistors . the sensor 12 should preferably be calibrated to an accuracy of 0 . 15 degrees fahrenheit or better when operated with a mid - scale voltage output of approximately 5 volts . in the illustrated embodiment ( fig2 ), the indoor temperature sensor 12 is connected to the air conditioner load control circuit 52 by a twisted wire pair 16 . no external power wiring is required . the sensor 12 can be mounted in an enclosure and sized smaller than a typical household thermostat . an outdoor temperature sensor 18 is provided outside the enclosure to be air - conditioned . the outdoor temperature sensor 18 is electrically identical to the indoor temperature sensor 12 . in the illustrated embodiment , a second lm335 precision temperature sensor is used having a calibration potentiometer ( r1 ). the outdoor sensor 18 is preferably encapsulated in a waterproof module ( not shown ) and mounted in a small vented outdoor box . the outdoor temperature sensor 18 is also electrically connected to the air conditioning load control circuit 52 by a twisted wire pair 16 . a differential amplifier circuit 20 is provided which produces a voltage level corresponding to the difference in output of the indoor sensor 12 and outdoor sensor 18 . in the illustrated embodiment , differential amplifier circuit 20 is a conventional operational amplifier such as national semiconductor lm324 or a generic 741 operational amplifier . the output of amplifier 20 is sent to set point level control 22 via line 21 . as shown in fig3 the differential amplifier circuit components include an operational amplifier 23 , resistors r3 , r4 , r5 , r6 , r7 , r8 , r9 and capacitor c1 . the set point control 22 is built around a second operational amplifier 33 integrated circuit . when the input received from differential amplifier circuit 20 exceeds a certain fixed voltage , such as 0 to 1 volts with reference to a midpoint voltage reference ( used as a center reference which is exactly half of the power supply voltage ), supplied from adjustable reference voltage source 24 ( shown as r12 in fig3 ), the set point control 22 generates a positive voltage level at the input of the control logic 26 ( fig1 ). this will initiate load control until the inside temperature raises to a point where the input voltage drops below the set point value if a closed circuit is present across external contact control input 32 . the set point can be field adjusted to a predetermined temperature differential before the system 10 begins shedding load . the system may have more than one set point , any of which can be selected by external contacts . fig3 shows a single adjustable set point using potentiometer r12 to calibrate the single value . in the alternative , fig7 shows selection of fixed points approximately 4 degrees apart using switch s1 . a series of fixed resisters replaces potentiometer r12 . with this arrangement , various temperature differential arrangements can be selected by closing the appropriate contact as required for prevailing conditions . for example , load management may be required during moderately warm outdoor temperatures . selection of a lower temperature differential will make the device more effective under these operating conditions . switch s1 may be replaced with external contacts to permit remote selection . in the illustrated embodiment , the adjustable reference voltage source 24 is developed by using precision resistors across a regulated voltage power supply . as shown in fig3 the adjustable reference voltage source 24 includes resistors r11 , r12 , r13 and r14 , and the set point control 22 includes an operational amplifier 33 , r10 , and r15 . as shown in fig1 an external control input circuit 30 is used to determine when to enable or disable the function of the control via a remote control device 32 . in the preferred embodiment , a preferably optically isolated input circuit is used to detect a dry contact closure for initiating load control . the load management control system 10 is intended for interfacing with existing conventional load management systems . existing load management systems use the opening ( or closing ) of a contact to perform control functions . this contact is typically electrically isolated to permit it to be placed in the circuits of the user equipment which supply operating voltages . the dry contact design is preferable since it enables easy connection to these devices . however , any type of input , for example , logic levels from a microprocessor or decoder may be used provided the proper interface circuitry is present . as shown in fig3 the control contact of the remote control device 32 is connected in series with the output control relay 34 . if no external load controller 14 is available , additional circuitry can be added to permit the circuit to function with components of basic communication subsystems , such as paging radios or telephone communications that are capable of providing logic output based on received signals . the load management system can be modified to operate from any such communication subsystem by obtaining a subsystem that produces unique logic levels for enabling and disabling the control , based on received signals and developing interface circuitry to translate output from the communication subsystem into logic levels for enabling and disabling the load management control . fig8 shows an example of a relay driver circuit for such purpose . the control logic circuit 26 receives the input from the set point control 22 and the external control input circuit 30 to determine when to open output relay contacts 34 . preferably , the control logic circuit 26 also contains circuitry necessary to drive the output relay 34 . if the allowable temperature differential is exceeded while the control contact of the remote control device 32 is closed , the control logic circuit 26 will open the contact 34 and interrupt the air conditioner compressor control circuit 36 . the output relay 34 provides a contact that is connected in series with the air conditioner compressor control leads to turn off the unit during periods when load management is required . as shown , the outside temperature is tracked by the inside temperature . the system 10 interrupts the control circuit of the compressor 36 when the outside temperature exceeds the inside temperature by a set differential . the system provides for automatic load shedding and restoration . as the outside temperature increases , the constant differential causes the indoor temperature to track the outdoor temperature resulting in a proportionate shedding of load . load restoration automatically occurs when the outside temperature falls to a point where it is less than the established differential plus the indoor temperature . consequently , no special algorithms are required in the system to deliver smooth load shedding restoration . an optional high indoor temperature limit control may be provided in the system 10 to keep the indoor temperature from exceeding a preset value . this feature can be used to limit customer discomfort should the outdoor temperature rise to a level where the inside temperature becomes excessive . as shown in fig1 , the set point may be set at a value ( i . e ., 83 ° f .) which permits some cooling while providing load reduction . this feature makes the placement of the outdoor temperature sensor less critical . as shown in fig4 an optional differential amplifier circuit , indicated at 40 , is provided when high limit indoor temperature control is desired . this circuit compares the inside temperature to a fixed reference 42 . the output is used to determine whether the inside temperature has exceeded a preset limit by the set point control 44 . an operational amplifier , similar to operational amplifier 23 is used for this comparison function . this circuit is not required if high limit indoor temperature control is not required . the output of the fixed reference 42 is used by the differential amplifier circuit 40 for comparison with the voltage of the input temperature sensor to determine when the high level limit has been exceeded . this circuit can be adjustable , allowing calibration of the high indoor temperature limit . the set point control 44 uses an operational amplifier to generate a voltage , should the high temperature limit be exceeded by the indoor temperature . the set point control 44 is determined by comparing the output of differential amplifier circuit 40 to adjustable reference 46 . the output of the set point control 44 is sent to the control logic circuit 26 and when the set point is exceeded , the control logic circuit will block control of the air conditioner compressor . digital system control may also provide the same function as the above analog control by using microprocessor based functions . with reference to fig5 and 6 , a digital load management control system 110 is shown . an indoor temperature sensor 112 and an outdoor temperature sensor 118 are provided each which produce an output voltage proportionate to temperature being sensed at any given point in time . these temperature sensors are substantially similar to those discussed above at 12 and 18 . the output of the temperature sensors 112 , 118 is sent to conventional analog to digital converters 120 to convert the analog voltages into digital representations , which can be used by the microprocessor 126 . latch circuits 122 are provided to interface the digital outputs of the analog to digital converters 120 to the microprocessor 126 as well as the remote control input and relay control output of the control system . the external remote control input is interfaced to the latch circuit 122 by interface circuit 124 to provide proper signal conversion and protection against abnormal conditions such as surges . the latch circuits 122 permit the microprocessor 126 to read and store data until it is ready for processing or a change of state . as shown in fig5 an external remote control input 130 is provided to permit an external remote control system to enable or disable the function of load management control , which is similar to the analog control input 30 . a relay driver 132 is used to develop adequate power from the output latch circuitry to drive the output relay 134 . the output relay 134 serves the same function as the output relay of the analog system discussed above . a conventional microprocessor 126 controls all operations of the digital load management control system 110 including data acquisition from input devices and control of the output relay 134 , based on instructions in a control program . the microprocessor 126 preferably includes the ability to perform analog to digital conversion as well as digital processing functions . as an alternative to the circuit of fig5 fig9 shows a microcontrol unit 140 ( motorola mc68hc11eo or equivalent ) which includes the microprocessor 126 . a read only memory ( rom ) device 136 is also provided . physical storage of the control program is implemented in the read only memory or other non - volatile storage media in order to avoid corruption by abnormal operating conditions . as shown in fig6 the control program contains routines for performing calculations and logic functions implemented by hardware in the analog control . these functions include : ( d ) monitoring of the remote control input to determine if the load management function should be active or inactive ; and ( e ) generating a control output based upon the values from the set point control function and remote control input . multiple fixed settings can be provided for the digital system by using several inputs for remote control and programming the system to produce various temperature differential settings , depending on which input receives a control signal . microprocessor based digital air conditioning load management control offers significant flexibility over analog design for the support of optional features . the high temperature set point can be implemented in the program by comparing the value of the inside temperature to a set value in program memory and limiting load reduction to the predefined maximum value . a microprocessor based control will also permit ramping of inside temperature changes so they cannot take place faster than a predetermined rate . this feature is beneficial in limiting the rate of change for inside temperatures in the event of sudden weather changes . a sudden drop in outside temperature could result in a corresponding drop in the differential between inside and outside temperatures causing the air conditioning system to operate continuously until either the thermostat is satisfied or the temperature differential is reestablished . the use of a ramping function to gradually decrease the inside temperature under these conditions will maintain the effectiveness of the load control until normal operating conditions are established after a sudden weather change . this function can be implemented in software by dropping the inside temperature in small increments that are timed to slow the drop of the inside temperature . this feature is shown in fig1 below . thus , either an analog or digital approach to provide load management produces the same result . the system 10 is remotely controlled to provide load control when required . this is accomplished by controlling a contact closure from an existing load management controller 14 . the illustrated embodiment is for a dry contact external control . however , as stated above , the load management control system can operate from other types of input if proper interface circuits are included . as discussed above , additional circuitry may permit the system 10 to be integrated into other systems such as radio paging . since the system 10 has the ability to control through an entire load shed cycle with only one command , the system 10 may share communication facilities with other applications without significant performance degradation . referring to fig2 the installation of the load control management system is shown . the air conditioner load control circuit 52 , which includes the integrated circuit , is installed adjacent to or inside of the load management controller 14 . the air conditioner load control circuit is connected to the controller 14 . the outdoor temperature sensor 18 is preferably installed on the north side of the building and is connected to the air conditioner load control circuit 52 directly . the indoor temperature sensor 12 is installed on the inside wall of the building using the same general guidelines for installing a thermostat . a location close to the outdoor temperature sensor is preferred to limit the amount of wiring required . the indoor temperature sensor is also connected to the air conditioner load control circuit . the output relay 34 is then connected in series with 24 volt compressor control circuit . once installed , the system 10 can provide approximately 30 percent reduction in air conditioning load based upon an indoor temperature rise from 75 degrees to 83 degrees fahrenheit for an outside temperature rise of 100 degrees fahrenheit . it can be seen that the system 10 of the present invention provides an effective means of reducing air conditioner load requirements during peak periods without the use of complicated algorithms or the need to address the specific building characteristics when the system is installed . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is understood that the invention is not limited to the disclosed embodiment but , on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims .
| 8 |
an embodiment of the present invention will now be described in detail in conjunction with the drawings . fig4 and 5 are perspective views of tapered shapes to which the present invention appertains . both of the figures show the distances ( referred to as machining distances ) from the cutting starting points to the cutting end points on the upper guide path , lower guide path and on the cut surface , these distances being different from one another . fig4 is a perspective view showing linear machining , and fig5 is a perspective view showing circular machining . in the figures , wk represents a workpiece , ugp the path of the upper guide ug , dgp the path of the lower guide dg , and plp the programmed profile of the lower surface of the workpiece wk . in fig4 the illustrated tapered shape has a taper angle a 1 at the cutting starting position , and a taper angle a 2 at the cutting end position , a 1 and a 2 differing from each other . a tapered surface tp whose taper angle varies gradually from a 1 to a 2 in continuous fashion is cut by continuously controlling the movement of the upper guide ug in accordance with the progress of the cutting work . the distance lu of movement of the upper guide path ugp , the distance ld of movement of the lower guide path dgp , and the machining distance lw of the programmed path differ from each other . fig5 illustrates a tapered shape in which the programmed path is an arc , and the angle b 1 of arc of the upper guide path ugp and the angle b 2 of arc of the lower guide path dgp differ from each other . also different from one another are the distance lu of movement of the path ugp of the upper guide ug , the distance ld of movement of the path dgp of the lower guide dg , and the machining distance lw of the programmed path . described next will be the taper cutting method of the invention for a case where the tapered shape shown in fig5 is to be cut . fig6 is a plan view of each of the paths and is useful in describing the present invention for a case where the tapered angle shown in fig5 is to be cut . portions which are the same as those shown in fig5 are designated by like reference characters and are not described in detail . in the fig6 the arc awbw is the workpiece surface ( programmed path plp ). the feed speed fw along the arc awbw enters as a command from a separately provided paper tape or the like . the arc aubu is the path ugp of the upper guide ug , and the arc adbd is the path dgp of the lower guide dg . aw and bw are points predetermined during the design of the workpiece to be machined and are stored in the numerical control unit . the inclination angle a ( see fig2 ) is also predetermined . the heights au and ad are also predetermined by the positions of the upper and lower guides . using a transformation by the angle a , it is possible to determine the coordinates of bu and bd . from the coordinates of the points and the angle a traversed , it is possible to calculate the length of the arcs lu , lw and ld . letting lw , lu , ld be the distances on the programmed path plp , the path ugp of the upper guide ug , and the path dgp of the lower guide dg , and letting t be the time required for movement from the cutting starting point aw to the cutting end point bw , the time t may be written : in order to start and terminate the movement of the upper guide ug and the movement of the workpiece wk relative to the wire wr at the same time ( to simplify the explanation , it will be assumed hereinafter that the workpiece is fixed and that only the upper and lower guides are moved ), the upper guide ug need only be moved from point au to point bu in time t and , likewise , the lower guide dg need only be moved from point ad to point bd in time t . thus , if the upper guide ug is moved at speed fu , given by the following equation : ## equ2 ## and the lower guide dg is moved at speed fd : ## equ3 ## then the movement of the upper guide ug and the movement of the workpiece we relative to the wire wr ( movement of the lower guide dg ) will end simultaneously . accordingly , the movement of the upper guide ug and lower guide dg may be started simultaneously and ended simultaneously by providing independent circular interpolators for moving the upper and lower guides , computing the distances lw , lu , ld from the programmed shape data , then computing the feed speeds of the upper and lower guides ug , dg from equations ( 4 ) and ( 5 ), and finally executing an interpolation from point au to point bu by the circular interpolator for the upper guide , and simultaneously from point ad to point bd by the circular interpolator for the lower guide , in such a manner that the feed speeds are attained , the upper and lower guides ug , dg being moved by the interpolation pulses . as a result , a special electric discharge machining process as shown in fig9 can be carried out according to the present invention . fig9 shows machined paths on a machined workpiece as viewed in the direction of the z - axis . the machined path on the upper surface of the workpiece is represented by a - b - c - d , whereas the machined path on the lower surface of the workpiece is indicated by p - q - r - s . the machined paths ab , pq , cd , and qs are not parallel to each other as viewed in the direction of the z - axis , providing twisted taper surfaces tp1 and tp2 . the arcuate machined paths bc , qr have different lengths of arcs , and hence their angles of arc are different from each other . for machining the workpiece to contour as shown in fig9 the wire electrode starts moving from the points a and p simultaneously and reaches the points b and q simultaneously . then , the wire electrode starts moving along arcs toward the points c and r and reaches these points c and r simultaneously . the wire electrode thereafter moves toward the points d and s and arrives at these points d and s simultaneously , whereupon the electric discharging machining is completed . according to the present invention , workpieces can be machined to such complex configurations , which could not be achieved by the apparatus and method disclosed in u . s . pat . no . 4 , 355 , 223 . fig7 is a circuit block diagram illustrating an embodiment of the present invention . in the figure , ptp denotes a paper tape in which are punched programmed path data ( end point coordinates and circle radius ), feed speed fw , taper angle a , the distance h between the upper guide ug and lower guide dg , the vertical distance h between the lower surface of the workpiece wk and the lower guide dg , and the like . opct represents an arithmetic and control circuit for performing the following arithmetic and control operations ( 1 ) through ( 5 ): ( 1 ) using the commanded values from the paper tape , offset quantities are computed by performing the operations specified by eqs . ( 1 ) and ( 2 ). positional information ( end point coordinates , circle radius etc .) concerning the paths of the upper and lower guides ug , dg is found from the offset quantities and from the programmed path data ( end point , circle radius etc .). ( 2 ) lu / lw and ld / lw are computed from each item of path data and from the path positional information , and output signals indicative of the results are produced . ( 3 ) the items of positional information relating to the upper and lower guide paths computed in ( 1 ) are set in the interpolators for the upper and lower guides , to be described below . ( 5 ) numerical control processing is carried out in addition to the foregoing operations . the arithmetic and control circuit opct may be an arithmetic circuit and pulse generating circuit . ufo , dfo represent feed speed arithmetic circuits for the upper and lower guides , respectively . both circuits are arranged as linear interpolators of dda - type ( digital differential analyzer ), and include respective registers rgu , rgd in which lu / lw and ld / lw , computed by the arithmetic and control circuit opct , are set or loaded , respectively , as well as accumulators acu , acd , and adders adu , add . the adder adu adds the contents of register rgu and the contents of accumulator acu each time a pulse pw of speed fw is generated , and stores the result of the addition operation in the accumulator acu . likewise , the adder add adds the contents of register rgd and the content of accumulator acd each time the pulse pw of speed fw is generated , and sets the result of the addition operation in the accumulator acd . if we assume that the accumulators have n - number of bits ( a capacity of 2 n ), then the accumulators acu , acd generate the respective pulse trains pu , pd whose frequencies are given by : ## equ4 ## respectively . accordingly , if 2 n . lu / lw , 2 n . ld / lw are set in the respective registers rgu , rgd instead of lu / lw , ld / lw , then the generated pulse trains pu , pd will have the frequencies fu , fd expressed by eqs . ( 4 ), ( 5 ), respectively . uint , dint represent circular interpolators for the upper and lower guides , respectively . these may , for example , be arranged as well - known dda - type circular interpolators . they are adapted to generate circular interpolation pulses up , vp , xp , and yp . dvu , dvv , dvx , dvy represent servo control circuits for the upper guide ( u - axis , v - axis ) and for the lower guide ( x - axis , y - axis ), respectively . mu , mv , mx , my are servo motors for each of these axes . when numerical control information relating to the tapered shape of fig4 is read from the paper tape ptp , the arithmetic and control circuit opct executes the abovementioned operations ( 1 ) through ( 4 ), sets 2 n . lu / lw , 2 n . ld / lw in the respective registers rgu , rgd , and generates the pulse train pw of frequency fw on line ln . as a result , the feed speed arithmetic circuits ufo , dfo for the upper and lower guides supply the interpolators uint , dint with pulse trains pu , pd of frequencies fu , fd , respectively . since the positional information relating to the paths of the upper and lower guides , found from ( 1 ) above , has already been set in the interpolators uint , dint by the arithmetic and control circuit opct , the interpolator uint for the upper guide executes interpolation along the arc aubu ( fig6 ), for example and the interpolator dint for the lower guide simultaneously executes interpolation along the arc adbd ( fig6 ), for example each time the respective pulses pu , pd are generated . the interpolation pulses up , vp , xp , yp generated by the interpolation operation are applied to the respective servo control circuit svu , svv , svx , svy . the servo control circuits , upon receiving these pulses , execute a well - known servo control operation to rotate the respective servo motors mu , mv , mx , my , thereby moving the upper and lower guides as illustrated by the wire - cut electric discharge machine of fig8 . as a result , the upper and lower guides are moved along the arcs aubu , adbd for example , and reach the arc end points bu , bd simultaneously where they are brought to a stop , also simultaneously . to facilitate the description , it has been described above that the workpiece is fixed , while the upper and lower guides are moved by four - axis control . the present invention is not limited to a case where the workpiece is fixed , however , and can be applied to a situation where the movement of the upper guide and workpiece are controlled along four axes simultaneously . also , in a computerized numerical control device which incorporates a well - known microcomputer , the operations of the feed speed arithmetic circuits ufo , dfo , interpolators uint , dint and arithmetic and control circuit opct , shown in fig7 can be executed under the control of a program . according to the present invention , the cutting speed at a cut surface can be brought into agreement with a commanded speed , and the movement of the upper and lower guides can be started simultaneously and halted simultaneously , through a simple method . it is therefore possible to enhance the performance of the electric discharge machine and to perform cutting at a high level of accuracy .
| 1 |
fig1 illustrates a process 100 incorporating a set of procedures that enables a user to predict the source of deviation of parts by checking the part recipes and spc charts . the method unifies the way in which users can monitor and track production parameters in a way that allows for automated monitoring . at block 110 , a user selects one or more charts from a plurality of charts to be examined . at block 120 , a user defines a number of chart parameters and associated known tolerance values . conventionally , these tolerance values are determined from previous experience of prior production processes of the same or substantially similar parts . at block 130 , a user defines the selected chart &# 39 ; s recipes . at block 140 , a user defines the project steps in which the selected charts , selected recipes and selected parameters are combined for use in a production run . the relation between chart , recipe and parameter may also be amended to meet desired user or customer criteria . at block 150 , the production process is monitored with regard to the selected charts and parameters . at block 160 , a user may review selected chart parameters with regard to the production process . at block 170 , a user may review the number and type of part deviations and associated process steps that contribute to the part deviation in order to identify the source of the part deviation . at block 180 , a user is able to review the process recipes . and , at block 190 , a user is able to confirm the results of the manufacturing process . it will be recognized by those skilled in the art that the processing shown in blocks 110 - 150 may be performed before each step in the manufacture of a specific product or product lot . in another aspect of the invention , the operations of block 110 - 140 may be predetermined and repeated between different product runs or product lot runs . hence , a database of chart , parameter and recipe definitions may be developed and relied upon for future production runs . the operations of blocks 150 - 190 are representative of tasks performed by a monitoring system based upon the inputs provided by blocks 110 - 140 . thus , future production runs may , for example , begin from block 150 or may only require some of the steps described in steps 110 - 140 . a more detailed explanation of each of the process steps is set forth as follows . at block 110 , a user or engineer defines one or more charts that need to be monitored . a list of charts is provided or made available from which engineers may select one or more desired charts associated with the current production run for the desired part . the charts may be pre - determined and stored in a manufacturing execution system ( mes ). mes programs are well known in the art . for example , promis is a commercial software mes program that combines planning , costing , document control , spc , production and performance management in one comprehensive package . promis is a registered trademark of brooks automation , inc ., chelmsford , mass ., 01824 from the provided list of charts , a user may select one or more charts suitable for the current operation or production run . the selected charts are referred to hereinafter as the monitored charts . the monitored charts may then be stored in a database for subsequent operation . the database may be a commercial database , such as oracle , or a self - developed or home - grown database . in a preferred embodiment , a commercial database is selected . at block 120 , the user is provided with a list of production parameters to select part parameters that relate to the “ monitored charts .” parameters may be selected from , but not limited to , the group consisting of thickness , uniformity of thickness , sputter rate , uniformity of sputter rate , deposition / sputter ( d / s ), uniformity of d / s , refractive index ( ri ), and stress . the user may pick or select one or more of these part parameters for each selected chart . following the selection of the part parameters , the part parameters are stored in relation to the monitored chart for which they were selected . at block 130 , the user may select recipes associated with each monitored chart for fabricating the part or parts . the user may be provided with a list of known fabrication recipes for review . the user may select one or more of the recipes for each monitored chart . it will be appreciated that more complex parts may require a greater combination of recipes . once the recipes have been selected they are stored in the database . recipes are preferably stored in one or more databases , conventionally referred to as recipe databases . in some aspects , recipe databases may be commercial software databases that include information that is proprietary to the manufacturer or foundry . it will be appreciated by those skilled in the art that any recipe database may be easily adapted for use with the presently described invention . recipes associated with methods for fabrication of integrated circuits are known in the art . in some cases , the recipes may be held as trade secrets that provide a commercial advantage to the owner of the recipe . details of individual recipes are not discussed further herein as individual recipes are not relevant to the invention disclosed . at block 140 , a user may define the recipe &# 39 ; s steps and parts parameters as they relate to each of the monitored charts . thus the user may tailor the production process for the part or parts to be made . as each recipe may contribute some element of the process step , one skilled in the art would appreciate that a processing step may require one or more recipes to complete the desired process step . at block 150 , the user defines the monitoring criteria for each of the monitored charts . in this case , the user is provided with a list of predetermined rules from which monitoring parts parameters may be checked and validated . the rules may be determined in part on the tolerance values desired , other parameters of the part and the history of generating the desired part . fig2 illustrates an exemplary relation , similar to that used in block 150 of fig1 , between parameters and processes to determine the process or processes that may contribute to part deviation . in this exemplary parameter / process relation , parameters may be selected from a group of part parameters such as thickness 205 , uniformity of thickness 210 , sputter rate 215 , dispersion / sputter ( d / s ) 225 , uniformity of d / s 230 , ri 235 and stress 240 , while processes that may contribute to deviations in the parts parameters may , for example , be selected from , but not limited to , the group consisting of oxygen ( o 2 ) seal 240 , rf 245 , ar - top 250 , o 2 nozzle 260 , o 2 top 265 , o 2 side 270 , sih 4 - nozzle 275 , sih 4 top 280 , sih 4 side 285 and pressure 290 . thus , for the exemplary relation shown , deviation of a part thickness may be caused by errors in either rf process 245 , ar - side process 255 , sih 4 side process 285 , or pressure 290 and combinations thereof . similarly , deviation in part parameter d / s 225 may be caused by errors in one or more of ar - side process 255 , sih 4 - side 285 and / or pressure 290 . fig3 illustrates a flow chart for an exemplary process 300 for reviewing chart parameters identified in block 160 of fig1 . in the illustrative process 300 , the selected monitored charts are retrieved at block 305 . at block 310 , criteria associated with the selected monitored charts are obtained . at block 315 , one of the monitored charts is selected . at block 320 , a recent value associated with the parameters of the selected chart is obtained . at block 325 , the criteria , i . e ., trend tolerance values , associated with the parameters in the selected chart are obtained . in this illustrated case , three trend tolerance values are selected . at block 330 , a determination is made whether the recent value of the parameter is within the first of the associated trend tolerance values . if the answer is in the affirmative , then processing continues at block 345 . however , if the answer is negative , then a determination is made whether the recent value is within the second of the associated trend tolerance values . if the answer is in the affirmative , then processing continues at block 345 . however , if the answer is negative , then a determination is made whether the recent parameter value is within the third of the associated trend tolerance values . if the answer is in the affirmative , then processing continues at block 345 . however , if the answer is in the negative , then the selected chart is marked to preclude its subsequent use . at block 345 the selected chart is included in a list of charts wherein the monitored parameters are within at least one tolerance value . in a preferred embodiment , the trend tolerance values are selected to be 3 , 5 and 10 units of a measure of the part parameter tested . in this preferred embodiment , the trend of the deviation is compared to the tolerances established . fig4 illustrates a flow chart for an exemplary process 400 for selecting charts marked at block 345 of fig3 . in this exemplary process 400 , a list of checked charts is displayed at block 410 . at block 420 , one of the displayed charts is selected . at block 430 , the parameters associated with the selected chart are obtained . as previously discussed , the parameters associated with a chart are stored in a database . fig5 illustrates a flow chart of a process 500 for associating parameters with processes contributing to part deviation in accordance with the principles of the invention . in this exemplary process , at block 505 a determination is made whether the tolerances associated with the thickness parameters have been exceeded . if the answer is in the affirmative , then the processes associated with thickness parameters are marked at block 510 . at block 515 a determination is made whether the tolerance associated with the uniformity of thickness parameters has been exceeded . if the answer is in the affirmative , then the processes associated with uniformity of thickness parameters are marked at block 520 . at block 525 a determination is made whether the tolerance associated with the sputter rate parameters has been exceeded . if the answer is in the affirmative , then the processes associated with sputter rate parameters are marked at block 530 . at block 535 a determination is made whether the tolerance associated with the uniformity of sputter rate parameters has been exceeded . if the answer is in the affirmative , then the processes associated with uniformity of sputter rate parameters are marked at block 540 . at block 545 a determination is made whether the tolerance associated with the d / s parameters have been exceeded . if the answer is in the affirmative , then the processes associated with d / s parameters are marked at block 550 . at block 555 a determination is made whether the tolerance associated with the uniformity of d / s parameters has been exceeded . if the answer is in the affirmative , then the processes associated with uniformity of d / s parameters are marked at block 560 . at block 565 a determination is made whether the tolerance associated with the ri parameters has been exceeded . if the answer is in the affirmative , then the processes associated with ri parameters are marked at block 570 . at block 575 a determination is made whether the tolerance associated with the stress parameters has been exceeded . if the answer is in the affirmative , then the processes associated with stress parameters are marked at block 580 . at block 585 , a display of each of the marked processes is made available to the user . in one aspect of the invention the display may include a histogram of processes to determine the process common to the deviation part . although fig5 illustrates a process wherein each of the exemplary part parameters is tested for deviations , it would be well within the skill of those in the art to develop a similar process using fewer or more part parameter tests or to devise means not to perform certain tests when a particular parameter is not selected . such aspects of the invention , although not shown , are contemplated to be within the scope of the invention . fig6 illustrates a flow chart of a process 600 for reviewing the processes associated with reviewing and predicting deviation parts , as shown at block 170 of fig1 . in this exemplary process , recipes associated with the selected chart are obtained at block 610 . at block 620 , versions of the selected recipes are obtained . at block 630 the steps and processes associated with each of the retrieved recipes are obtained . at block 640 , the steps and processes of the retrieved recipes are compared for differences . at block 650 , the results of the comparison are made available to the user . although the invention has been described in terms of exemplary embodiments , it is not limited thereto . for example , although the present invention has been described with regard to a fixed number of parameters , it would be recognized by those skilled the art that the invention may be applied to less than or more than the parameters discussed herein . similarly , the present invention may be used with one or more of the trend rules discussed herein . accordingly , the appended claims should be construed broadly , to include other variants and embodiments of the invention , which may be made by those skilled in the art without departing from the scope and range of equivalents of the invention .
| 7 |
preferred embodiments in accordance with the present invention will be explained hereinbelow with reference to drawings . referring now to fig2 there is schematically illustrated in the form of a block diagram of a mobile telephone in accordance with the first embodiment of the present invention . as illustrated in fig2 the mobile telephone 10 in accordance with the first embodiment is comprised of an antenna 11 , a radio transmission / reception circuit 12 connected to the antenna 11 , a control circuit 13 , a voice signal processing circuit 14 , a microphone 15 , a receiver 16 , key switches 17 , rom 18 , ram 19 , a real - time clock circuit 20 , a voice recognition circuit 21 , and lcd 22 . the radio transmission / reception circuit 12 , the voice signal processing circuit 14 , the key switches 17 , rom 18 , ram 19 , the real - time clock circuit 20 , the voice recognition circuit 21 , and lcd 22 are all electrically connected to the control circuit 13 . the microphone 15 , the receiver 16 , and the voice recognition circuit 21 are all electrically connected to the voice signal processing circuit 14 . the antenna 11 receives a radio signal from a base station ( not illustrated ), and feeds the thus received radio signal to the radio transmission / reception circuit 12 . the antenna 11 receives also a signal transmitted from the radio transmission / reception circuit 12 , and transmits it to the base station . the radio transmission / reception circuit 12 is comprised mainly of a reception circuit and a transmission circuit . when a call arrives at the mobile telephone 10 , the radio transmission / reception circuit 12 receives a call signal from the antenna 11 , and transmits it to the control circuit 13 . the control circuit 13 stores the thus received call signal into ram 19 as a reception history data . on the other hand , when a user makes a call by operating the key switches 17 , the control circuit 13 provides a transmission signal to the radio transmission / reception circuit 12 , which transmits the thus received transmission signal to the base station via the antenna 11 . the control circuit 13 stores the transmission signal into ram 19 as a transmission history data . the control circuit 13 is connected to the real - time clock circuit 20 , which informs the control circuit 13 of time - wise information including a year , a month , a day , a time , and the like . when storing the reception or transmission history into ram 19 , the control circuit 13 adds the time - wise information supplied from the real - time clock circuit 20 , to the reception or transmission history . that is , a caller &# 39 ; s phone number or destination phone number is stored into ram 19 , along with the time - wise information including a year , a month , a day and a time at which the information is stored , as reception / transmission history data . when the key switches 17 are operated by a user to thereby put the mobile telephone 10 in a condition in which voice entry can be carried out , the control circuit 13 supplies voice data to be used for voice recognition , stored in rom 18 , to the voice recognition circuit 21 . then , when a user speaks to the microphone 15 to make entry of voice data , the voice signal processing circuit 14 converts the entered voice data to a digital signal , and supplies the thus converted digital signal to the voice recognition circuit 21 . the voice recognition circuit 21 compares the voice data supplied from rom 18 and the data supplied from the voice signal processing circuit 14 with each other to thereby judge what is meant by the voice data entered through the microphone 15 . when the voice recognition circuit 21 completes the judgment , the voice recognition circuit 21 gives an instruction to the control circuit 13 to both receive response voice data stored in rom 18 for noticing a result of the judgment and display the judgment result on lcd 22 . the control circuit 13 reads out the response voice data transmitted from rom 18 , and supplies the thus read out response voice data to the voice signal processing circuit 14 , while displaying the judgment result on lcd 22 . the voice signal processing circuit 14 converts the supplied response voice data into a voice signal , and transmits the thus converted signal through the receiver 16 . hereinbelow is explained an operation of the mobile telephone 10 in accordance with the first embodiment . fig3 is a flow chart of an operation of the mobile telephone 10 in accordance with the first embodiment of the present invention . first , an initial value n is set to be equal to zero ( n = 0 ) in step s 21 . this initial value constitutes a memory location number of reception or transmission history data of which the date and time are nearest to a current date and time . a memory such as ram 19 can store a maximum number n of reception and transmission history data . namely , the reception or transmission history data is numbered as n = 0 , 1 , 2 , . . . , n − 2 , n − 1 and n in a direction from the oldest to newest ones . the key switches are operated to thereby start up the voice recognition procedure for accepting a voice input , in step s 22 . when no voice input is entered for a certain period of time starting from step s 22 , the control circuit 13 terminates the voice recognition procedure , and waits again for restarting the voice recognition procedure . if a voice is entered and recognized in step s 24 , and judged in step s 25 to be a voice requiring to evoke reception history , the n - th data is displayed , in step s 26 . herein , the date and time of the n - th data are nearest to the current date and time . at this time , if a voice - response mode is set , the result of the voice recognition is output through the receiver 16 as well . then , the initial value n is changed to n = n + 1 in step s 27 , and the control circuit 13 waits for a next operation to be carried out by a user of the mobile telephone . if the voice recognition is ended in step s 28 , the reception history display and the voice recognition procedure are terminated in step s 29 ( yes in step s 28 ). if the reception history display and the voice recognition procedure are continued in step s 28 ( no in step s 28 ), the reception history flag is turned on in order to recognize that the reception history is currently evoked , in step s 30 . at this time , if a voice for prompting to display a next data , such as “ next display ”, for example , is entered , the voice recognition is carried out again , and the n - th data ( of which the date and time are nearest to the current ones ) is displayed . herein , the date and time of the n - th data is older than the previous data , but is newest among the rest . at this time , if the voice - response mode is set , the result of the voice recognition is output through the receiver 16 . the continuation of the voice recognition procedure enables to display the reception history data beginning with the oldest one stored in ram 19 in the mobile telephone . on the other hand , if the voice input is judged to be a voice requiring to evoke transmission history in step s 25 , the n - th data is displayed in step s 31 . herein , the date and time of the n - th data are nearest to the current date and time . at this time , if the voice - response mode is set , the result of the voice recognition procedure is output through the receiver 16 as well . then , the initial value n is changed to n = n + 1 in step s 32 , and the control circuit 13 waits for a next operation . when the voice recognition is forced to end in step s 33 , the transmission history display and the voice recognition procedure are ended in step s 34 . if the transmission history display and the voice recognition procedure are continued to be carried out , the transmission history flag is turned on in step s 35 in order to recognize that the transmission history is currently evoked . at this time , if a voice for prompting to display a next data , such as “ next display ”, for example , is entered , the voice recognition procedure is carried out again , and the n - th data is displayed . herein , the date and time of the n - th data is older than the previous data , but is newest among the rest . if a voice - response mode is set , the voice recognition result is output through the receiver 16 . this continuation of the voice recognition procedure enables to display the transmission history data beginning with the oldest one stored in ram 19 in the mobile telephone . the mobile telephone in accordance with the second embodiment is described hereinbelow . in the above - mentioned first embodiment , transmission or reception history is first evoked , and then a voice is entered , resulting in that the transmission or reception history data can be evoked one after another . each of the transmission and reception history data is stored in ram 19 , including time - wise information added thereto by means of the real - time clock circuit 20 . hence , by making entry of a voice together with time - wise information , reception or transmission history data associated with the time - wise information can be evoked . the second embodiment is explained hereinbelow with reference to fig4 which is a flow chart of an operation to be carried out in the second embodiment . first , an initial value n is set to be equal to zero ( n = 0 ) in step s 40 . this initial value constitutes a memory location number of reception or transmission history data of which the date and time are nearest to a current date and time . a memory such as ram 19 can store a maximum number n of reception and transmission history data . namely , the reception or transmission history data is numbered as n = 0 , 1 , 2 , . . . , n − 2 , n − 1 and n in a direction from the oldest to newest ones . the key switches are operated to thereby start up the voice recognition procedure for accepting a voice input , in step s 41 . when no voice input is entered for a certain period of time starting from step s 41 , the control circuit 13 terminates the voice recognition procedure , and waits again for restarting the voice recognition procedure . if a voice is entered and recognized in step s 42 , and judged in step s 43 to be a voice requiring to evoke reception history , the control circuit 13 proceeds to an operation for displaying the reception history data . if it is judged in step s 45 that a voice input includes calendar information such as date and time like “ reception history dated january 3 ”, for example , and is actually judged to include such calendar information in the result of voice recognition , reception history data stored at a corresponding x - th memory is retrieved and evoked for display on lcd 22 , in step s 46 . at this time , if the voice - response mode is set , the recognition result is output through the receiver 16 as well . then , the initial value n is changed to n = n + x in step s 47 , and the control circuit 13 waits for a next operation to be carried out by a user of the mobile telephone . it should be noted that if the result of the retrieval shows that there exists no data at the indicated date , namely , the january 3 , an x - th reception history data having the date nearest to the retrieval date is displayed in step s 46 . if it is judged in step s 45 that no calendar information such as date and time is added to the voice input , an n - th data is displayed in step s 48 . herein , the date and time of the n - th data is nearest to the current date and time . at this time , if the voice - response mode is set , the result of the voice recognition is output through the receiver 16 as well . then , the initial value n is changed into n = n + 1 in step s 49 , and the control circuit 13 waits for a next operation . if the voice recognition is forced to end in step s 50 , the reception history display and the voice recognition procedure are terminated in step s 51 . if the recognition is continued in step s 50 , the reception history flag is turned on in step s 52 in order to recognize that the reception history is currently evoked . at this time , if a prompting voice to display a next data , such as “ next display ”, for example , is entered , the voice recognition is carried out , and the n - th data is displayed . herein , the n - th data is just older than the previous data by only one . if the voice - response mode is set , the recognition result is output through the receiver 16 . the continuation of the recognition enables to display the reception history data beginning with the oldest one stored in ram 19 in the mobile telephone . if time - wise information like “ december 25 ”, for example , is made entry again during entry of a voice , reception history data associated with the indicated date can be retrieved to display a corresponding x - th data . if the entered voice is judged in step s 44 to be a voice requiring to evoke transmission history , the control circuit 13 proceeds to an operation for displaying the transmission history . if it is judged in step s 53 that a voice input includes calendar information such as date and time like “ transmission history dated january 3 ”, for example , and is actually judged to include such calendar information in the result of voice recognition , transmission history data stored at a corresponding x - th memory is retrieved and evoked for display on lcd 22 , in step s 54 . at this time , if the voice - response mode is set , the recognition result is output through the receiver 16 as well . then , the initial value n is changed to n = n + x in step s 55 , and the control circuit 13 waits for a next operation to be carried out by a user of the mobile telephone . it should be noted that if the result of the retrieval shows that there exists no data at the indicated date , namely , the january 3 , an x - th transmission history data having the date nearest to the retrieval date is displayed in step s 54 . if it is judged in step s 53 that no calendar information such as date and time is added to the voice input , an n - th data is displayed in step s 56 . herein , the date and time of the n - th data is nearest to the current date and time . at this time , if the voice - response mode is set , the result of the voice recognition is output through the receiver 16 as well . then , the initial value n is changed into n = n + 1 in step s 57 , and the control circuit 13 waits for a next operation . if the voice recognition is forced to end in step s 58 , the transmission history display and the voice recognition procedure are terminated in step s 59 . if the recognition is continued in step s 58 , the transmission history flag is turned on in step s 60 in order to recognize that the transmission history is currently evoked . at this time , if a prompting voice to display a next data , such as “ next display ”, for example , is entered , the voice recognition is carried out , and the n - th data is displayed . herein , the n - th data is just older than the previous data by only one . if the voice - response mode is set , the recognition result is output through the receiver 16 . the continuation of the recognition enables to display the transmission history data beginning with the oldest one stored in ram 19 in the mobile telephone . if time - wise information like “ december 25 ”, for example , is made entry again during entry of a voice , transmission history data associated with the indicated date can be retrieved to display a corresponding x - th data . hereinbelow is explained the mobile telephone in accordance with the third embodiment of the present invention . in the first and second embodiments having been described with reference to fig3 and 4 , the voice recognition procedure is always in operation while reception or transmission history data is being evoked . however , the prevent invention can be applied to a mobile telephone having an independent voice recognition function , that is , a mobile telephone in which the voice recognition procedure is automatically terminated upon delivery of a recognition result . the third embodiment of the present invention is explained hereinbelow with reference to fig5 which is a flow chart of an operation to be carried out in the third embodiment . first , an initial value n is set to be equal to zero ( n = 0 ) in step s 70 . this initial value constitutes a memory location number of reception or transmission history data of which the date and time are nearest to a current date and time . a memory such as ram 19 can store a maximum number n of reception and transmission history data . namely , the reception or transmission history data is numbered as n = 0 , 1 , 2 , . . . , n − 2 , n − 1 and n in a direction from the oldest to newest ones . the key switches are operated to thereby start up the voice recognition procedure for accepting a voice input , in step s 71 . in step s 72 , it is checked as to whether any history is currently displayed on lcd screen 22 . if no history is displayed ( no in step s 72 ), there is conducted the same procedure as the procedure starting from the marking aa to the marking bb in fig3 . the procedure will not be discussed any longer . it is now assumed that the voice recognition is ended , and a result of the recognition is transmitted to the control circuit 13 to thereby terminate the voice recognition procedure . if it is ascertained in step s 72 that any history data is displayed on lcd 22 , it is checked in step s 73 as to which history is being displayed on lcd 22 , reception or transmission history . depending upon the history being displayed on lcd 22 , the corresponding history flag is turned on . the control circuit 13 waits for a voice to be entered . if no voice is made entry ( no in step s 74 ), the voice recognition procedure is terminated , and the control circuit 13 is put in a waiting condition again until the voice recognition is restarted . if a voice is entered ( yes in step s 74 ), the control circuit 13 proceeds to a voice recognition procedure in step s 75 . at this time , if it is judged that a prompting voice to display a next reception history data , such as “ reception history ” or “ next display ”, for example , has been entered while reception history , for example , is being displayed , the judgement result is transmitted to the control circuit 13 , which terminates the voice recognition procedure . receiving the judgement result , the control circuit 13 displays an n - th data on lcd 22 , in step s 77 . at this time , if the voice - response mode is set , the recognition result is output through the receiver 16 as well . then , the initial value n is changed into n = n + 1 in step s 78 , and the control circuit 13 terminates the voice recognition procedure in step s 79 . then , the control circuit 13 waits for a next operation , that is , an operation for restarting the voice recognition procedure . while the present invention has been described in connection with certain preferred embodiments , it is to be understood that the subject matter encompassed by way of the present invention is not to be limited to those specific embodiments . on the contrary , it is intended for the subject matter of the invention to include all alternatives , modifications and equivalents as can be included within the spirit and scope of the following claims . the entire disclosure of japanese patent application no . 10 - 75412 filed on mar . 24 , 1998 including specification , claims , drawings and summary is incorporated herein by reference in its entirety .
| 7 |
the block diagram of the auto - sequenced state machine ( 20 ) according to the present invention is shown in fig2 . the state machine comprises the basic elements of the moore state machine which are the combinational circuit ( 1 ) receiving the inputs x and generating the next state d ( t ) ( 6 ) according to the current state signal q ( t ) ( 5 ). the latches ( 2 ) receives the data signals d ( t ) and generates the current state signals q ( t ) to the output decode ( 9 ) which decodes those signals to output the signals ( z ) to the down - ward circuit . the sequencer ( 16 ) according to the present invention receives the current state signals q ( t ) from the moore state machine in order to generate an asynchronous clock signal referred to the system clock . the sequencer ( 16 ) comprises : a current state decoder ( 15 ) which decodes the current state signals q ( t ) that it receives from the moore state machine in order to select one of the biphase state timers ( 13 ). a plurality of state timing programming circuits ( 12 ), and in the preferred embodiment , there are 6 state timing values ( s0 , s1 , s2r , s2m , s2w , and s3 ) which correspond to the number of biphase state timers ; the user programs those state timing programming circuits to a number of clock cycles which is required by the enviromnent in which the auto - sequenced state machine is to be used , for example by the memory to which the auto - sequenced state machine is connected ; those state timing programming circuits decode and select the different terminal counts that are to be generated by the biphase state timers . a plurality of biphase state timers ( 13 ), and in the preferred embodiment , there are 6 biphase state timers ( 13 - 1 , . . . , 13 - 6 ), wherein each one receives 2 system clocks ( clkl and bar - clkl which is the opposite phase of clkl ) in order to generate the different terminal count clocks defined later on , and an or circuit ( 11 ) which receives the terminal counts from the current selected biphase state timer , and finally generates the current terminal count used by the moore state machine . fig3 shows the environment in which the auto - sequenced state machine of the present invention is implemented . the auto sequenced state machine ( 20 ) is included in a dram memory controller ( 30 ) which centralizes all the access to a dram memory ( 31 ) requested by the different users ( 32 ) to which it is connected . this dram memory ( 31 ) is shared by those users which may have their own clock frequencies . the auto - sequenced state machine is the interface between the control memory and the memory and it enables to access to the shared memory thanks to a unidirectional address bus ( 36 ), a bidirectional data bus ( 37 ) for the data transmission and reception , and control lines ( 35 ). the data bus ( 37 ) has its own clock signal whose frequency may be different from the users clock frequency . the control lines ( 35 ) contain different signal transmissions ( refer to fig4 ) to be received by the shared memory in order to perform the read or write operations . but , before reading or writing in the memory which may be represented as a two - dimensions array ( rows and columns ), the state machine has to locate the exact place in the storage by indicating firstly the row and afterwards the column . the control lines ( 35 ) should carry therefore the following signals : (- ras ): row address strobe which indicates the row of the memory is selected ( active at low position ), (- cas ): column address strobe which indicates the column of the memory is selected ( active at low position ), (- w / r ): indicates the write and read input ( write input being at a low position ), and (- oe ): indicates the data outputs enabled ( active at a low position ) in order to transmit the data read from the memory . according to the state of the ras and cas , the row address and the column address are sent on mux add ( row / column inputs ). and according to the state of the control lines ( 35 ) and the address of the memory location ( mux add ), the signal din / out ( bidirectional data in / data out ) will enables to transmit or to receive the data in the memory for the write or read operation . fig4 represents an example of use of the programmable states according to the states of the control signals issued by the auto - sequenced state machine . in the preferred embodiment , there are six different states , but the present implementation may be used for as many states as necessary . the state s0 is the idle state of the memory where the (- ras ) signal ( 42 ), (- cas ) signal ( 43 ), the (- write /+ read ) signal ( 44 ) and the oe signal are at their idle state which is the high level . the state s1 starts when the row address is presented by activating the (- ras ) signal ( 42 ) to the low level while the (- cas ), (- w / r ) and (- oe ) are still idle ( high level ). in this example , at time t0 , the state s1 starts at the rising or falling edge of the functional clock signal ( 41 ) and when the row address is sent on the address bus . the state s2 corresponds to three different operations of reading ( s2r ), modifying ( s2m ) or writing ( s2w ) the data in the memory . each one of the three state may start whenever the clock signals ( 41 ) is at the rising or falling edge , but in case a modifying operation is required , the state s2m is always preceded by the state of reading ( s2r ) and followed by the state of writing ( s2w ), refer to the table 1 shown below . the state ( s2r ) starts when the column address is presented by activating the (- cas ) signals ( 43 ) and the (- oe ) to their low level while the (- ras ) signal is kept at the low level and also while the (- w / r ) is kept at its high level . the state ( s2m ) starts when the (- oe ) becomes idle ( high level ) while the (- ras ) and (- cas ) are kept at their low level , and while the (- w / r ) is kept idle . the state ( s2w ) starts when the (- w / r ) signal is activated to its low level for the write operation while the (- ras ) and (- cas ) are at their low level and the (- oe ) at his high level . in the example shown in fig4 at time t1 , the state s2 ( s2r or s2m or s2w ) starts whenever it is at the rising or falling edge of the clock signal and when the column address is presented by activating the (- cas ) signal ( 43 ) to the low level while the (- ras ) signal is kept at the low level . the state s3 starts when all the signals (- ras ), (- cas ), (- w / r ) and (- oe ) becomes idle whenever the clock signal ( 41 ) is at the rising or falling edge . then , at time t2 , the state s3 starts when the signals (- ras ), (- cas ), (- write /+ read ) and (- oe ) returns to their idle state which is the high level . this state represents the pre - charge necessary to access once again the memory at a new row address . the following table represents the transition table of the state machine in the preferred embodiment , i . e the logical conditions which have to be satisfied to change from one state to another . the state transitions depend on the external events which are the variables : + miw pending : memory instruction word pending which is set to 1 when an instruction is awaited , + sr /- nr : same row / new row which is set to 1 when the reading or writing operation is performed on the same row of the memory , as was previously said , the state machine perform three kinds of operations ( read , write and modify ) which corresponds to the states s2r , s2w and s2m . the memory is 32 - bits wide and is divided into 4 bytes ( b1 , b2 , b3 and b4 ), each byte storing 8 bits . * for a simple read operation , the state machine reads the 4 bytes b1b2b3b4 at the same time , * for a simple write operation , the state machine writes the 4 bytes b1b2b3b4 at the same time , * for a modify operation , the state machine has to read first , to modify and then to write . for instance , when the state machine has to modify b2b3 which are the byte enabled , the state machine has to perform the 3 following steps : + all byte enabled ( for the present state ) which is set to 1 when it is a full write operation ( the state will go the state s2w ), and it is set to 0 for a partial write operation ( in case of a modify operation ), + all byte enabled ( previous state ) which is set to 1 when for the previous access has been performed on full word , it is set to 0 to indicate that only half a word has been enabled . ______________________________________states of ` inbus ` + all byti en - n f + all abledd r + miw byt . ( pre - e o t pend - + sr / - w / en - viousx m o ing - nr + r abled state ) ______________________________________0 s0 s0 0 x x x x1 s0 s1 1 x x x x2 s1 s2r 1 x 1 x x 1 x 0 0 x3 s1 s2w 1 x 0 1 x4 * s1 s0 0 x x x x5 s2r s2r 1 1 1 x x 1 1 0 0 16 s2r s2w 1 1 0 1 x7 s2r s2m 1 x 0 0 08 s2r s3 1 0 x x 1 0 x x x x9 * s2r s0 1 0 0 1 0 1 0 1 x 010 s2w s2r 1 1 1 x x 1 1 0 0 x11 s2w s2w 1 1 0 1 x12 s2w s3 1 0 x x x 0 x x x x13 s2m s2w x x x x x14 s3 s1 1 x x x x15 s3 s0 0 x x x x______________________________________ all the state timers mentioned above ( s1 , . . . , s3 ) may have different numbers of clock cycles ( 1 clock cycle , 1 . 5 , 2 or 2 . 5 clock cycles ). fig5 shows the implementation of the biphase state timer of the auto - sequenced state machine according to the present invention . the biphase state timer ( 13 ) is composed of three counters ( 50 - 1 , 50 - 2 , 50 - 3 ) and a selector ( 51 ) which selects the counter one after another . as each state may be repeated , it is necessary to use three counters because a counter is not immediately reusable once it has emitted its terminal count ( tc ), its reset is not instantaneous . the selector will select therefore the next counter in order to let the previous counter reset itself . the selector comprises three cascading pointers ( 51 - 1 , 51 - 2 , 51 - 3 ) which enables to select the corresponding counter ( 50 - 1 , 50 - 2 or 50 - 3 ). each counter ( 50 - 1 ) comprises two pairs of cascading flip / flop latches ( 55 - a , 55 - b and 56 - a , 56 - b ). the first flip - flop latch ( 55 - a ) is clocked by the clock signal clkl whereas the second flip - flop latch ( 55 - b ) is clocked by the clock signal barclkl which is in opposite phase . both pairs of latches ( 55 - a , 55 - b and 56 - a , 56 - b ) are connected in the same way , except that the second pairs of latches ( 56 - a and 56 - b ) are respectively clocked by the clock signal barclkl and the clock signal clkl . this enables counting of half a cycle of the reference clock ( clkl ), doubling the clock rate . only the first pair will be described in detail and one may generalize the connection to the pair of latches ( 56 - a and 56 - b ) and the four pairs of cascading latches in the counters ( 50 - 2 and 50 - 3 ). the first pointer ( 51 - 1 ) is connected to the first and second pairs ( 55 - a , 55 - b and 56 - a , 56 - b ) of cascading latches through a and gate ( 54 ) which also receives the signal of the state selected ( 52 ) fed from the current state decoder ( 15 ) and the signal ( bar - b1 - 1 ) of the second flip - flop latch ( 55 - b ). this and gate ( 54 ) is then connected to the first flip - flop latch ( 55 - a ) which generates an output signal ( a1 - 1 ) which is also received by the second latch ( 55 - b ). therefore , this first counter ( 50 - 1 ) issues four output signals ( a1 - 1 , b1 - 1 , a2 - 1 and b2 - 1 ) from the first and the second pairs of cascading flip - flop latches . the second and third pointers ( 51 - 2 and 51 - 3 ) are respectively dedicated to the second and the third counters ( 50 - 2 and 50 - 3 ) which also contain two pairs of cascading latches . the selector circulates a valid pointer at each final terminal count , then a counter ( 50 - 1 ) is enabled when the corresponding state is selected , the corresponding pointer is valid and the counter is reset ( and gate ( 54 ) set to 1 ). fig6 shows the complete implementation of the biphase state timer comprising the three counters ( 50 - 1 , 50 - 2 and 50 - 3 ), each one issuing four output signals . the first counter ( 50 - 1 ) issues the outputs signals ( b1 - 1 , a1 - 1 , b2 - 1 , a2 - 1 ) to a decode circuit ( 60 - 1 ) which enables to isolate the different terminal counts ( tc1 , tc1 . 5 , tc2 , etc . . . ) transmitted from the counter . each terminal count is then respectively transmitted to an or gate . the terminal count tc1 is received by an or gate ( 61 ), the terminal count tc1 . 5 is then received by another or gate ( 62 ) and so on for the terminal counts tc2 and tc2 . 5 . the second and third counters ( 50 - 2 , 50 - 3 ) respectively issue four outputs to the decode circuits ( 60 - 2 , 60 - 3 ) which also isolate the different terminal counts . in the preferred implementation , there are four terminal counts ( tc1 , tc1 . 5 , tc2 , and tc2 . 5 ). when tc1 is set , it generates a pulse of half - cycle one cycle after the previous tc clock . in the same way , when tc2 . 5 is set , it generates a pulse of half - cycle two and a half cycles after the previous tc clock . for instance , in the case of a reading sequence of a plurality of words in the memory : the biphase state timer ( s2r ) is used . on the first read , the selector ( 51 ) is ready to operate with its first valid pointer . on the second read , the selector circulates the valid pointer to the second latch , and on the third read , to the third latch . for the fourth read , the valid pointer is again the first latch , and so forth . . . the final terminal count of ( tc1 , tc1 . 5 , tc2 , tc2 . 5 ) will be simply an or gate ( 61 ) of the terminal counts corresponding to each counter . each or gate ( 61 , 62 , 63 , 64 ) respectively receives the terminal counts tc1 , tc1 . 5 , tc2 , and tc2 . 5 from the three decode circuits ( 60 - 1 , 60 - 2 and 60 - 3 ). when the biphase state timer arrives to the terminal count chosen by the program , the pulse is sent immediately as an asynchronous clock signal to increment the state machine . in a special application , let &# 39 ; s assume that the memory demands 45 nanoseconds for a read operation and that the clock cycle of the system is 40 nanoseconds , the user will program the state timer s2r for a cycle and a half ( 60 nanoseconds ) by selecting the terminal count tc1 . 5 of the state timer s2r . this implementation improves the performance by enabling to change the timing of each state according to the memory used and also to fit the timing to half a clock cycle . to refer to the previous example , the read operation will be performed for 60 nanoseconds whereas a usual state machine would used 80 nanoseconds . besides , this setting may be dynamic , i . e the timing be changed while the state machine is operating : the new setting is taken into account by the biphase state timer as soon as it goes to its idle state . the above example for the s2r may be also used for the other state timer s1 , s2w , s2m and s3 . fig7 gives an example of a timing schedule for a read operation requested by a user and performed by the auto - sequenced state machine according to the present invention . in this example , the state so is programmed for a terminal count whose value is 1 clock cycle , the state s1 is programmed for a terminal count whose value is 1 . 5 clock cycle , the state s2r is programmed for a terminal count whose value is 2 clock cycles , and the state s3 is programmed for a terminal count whose value is 2 . 5 clock cycles . to each pulse of the terminal count corresponds a state ( s0 , s1 , s2r , . . . , s3 ) of the auto - sequenced state machine . the pulse of the state machine may occur whenever during the functional clock , it is not necessary that it occurs on the rising or falling edge of the functional clock signal ( 71 ), as is represented in this example . at time t0 , the counter which is dedicated to the program of the state s0 , in the present case the first counter which is pointed by the selector , emits a pulse . and at time t0 &# 39 ;, the second counter pointed in its turn by the selector will emit a pulse , one clock cycle after the first pulse mentioned above . the terminal count signal tcs0 ( 72 ) represents therefore two pulses on the timing schedule separated by a clock cycle . the second pulse emitted corresponds then to the beginning of the state s1 . at time t1 , the counter which is dedicated to the state s1 , in the present case the second counter which is idle , emits a pulse one clock cycle and a half after t0 &# 39 ; on the terminal count signal tcs1 ( 73 ). this pulse corresponds in this example to the beginning of the state s2r . at time t2 , the counter dedicated to the state s2 , in the present case the second counter which is idle , emits a pulse two clock cycles after t1 on the terminal count signal tcs2r ( 74 ) to indicate that the read operation has to be iterated . therefore , the read operation will be performed again by the state machine . and at time t2 &# 39 ; two clock cycles after t2 , the third counter dedicated to the state s2 emits a pulse to indicate that the state s3 may start . therefore , the timing schedule of the terminal count signal tcs2r will represent two pulse separated by two clock cycles . at time t3 , the first counter dedicated to the state s3 emits a pulse on the terminal count signal tcs3 ( 75 ), two and a half clock cycles after time t2 &# 39 ;. this pulse indicates then the beginning of the state s0 . at the new time t0 , the third counter dedicated to the state s0 emits again a pulse to indicate that the biphase state timer is kept to its idle state which corresponds to the state s0 . in the same way , at time t0 &# 39 ;, a clock cycle after the previous t0 , the first counter dedicated to the state s0 emits a pulse to keep the biphase state timer to its idle state . fig8 gives an example of a static column mode read and write cycle requested by a user . in this example , the number of cycles required for the state s1 is 1 clock cycle , for the states s2r and s2w is 1 . 5 clock cycles and for the state s3 is 2 clock cycles . even though in the shown example , the control signals occur at the rising or falling edges , in fact the system may function whenever the control signals occur and the delays of the 1 , 1 . 5 or 2 cycles are respected , as was described in the previous fig7 . in the example , the control signals ( ras , cas , w / r and oe ) determine the different states of s0 , s1 , s2r , s2w and s3 . before time t0 , the state machine is at its idle state s0 . at time t0 , the - ras signal ( 81 ) is activated , therefore the row address ( row0 ) is presented on the address bus ( 85 ), and the state s1 may start . as is said , the number of cycles of the present state s1 is 1 clock cycle . then at the next rising edge of the functional clock ( 80 ), at time t1 , the - cas signal ( 82 ) is activated and the column address ( col0 ) is presented on the address bus ( 85 ) while the - oe signal is activated to enable the reading operation to be performed , which enables the data ( d0 ) to be loaded ( 86 ) for the transmission to the user that has requested this operation . the state s2r of the reading operation is then achieved . at time t2 , one and a half clock cycle of the functional clock ( 80 ) after t1 , the address of a new column ( col1 ) is presented on the address bus ( 85 ) while the row address remains the same . the oe signal is by the way also inactivated at that time . and at time t2 &# 39 ;, the - w / r signal is activated when the write operation is ready , then the data ( d1 ) which are received are written in the memory as is shown on the signal din / out ( 86 ). at time t2 &# 34 ;, one and a half clock cycle after t2 , when the write operation has ended , the - w / r signal becomes inactive ( the signal is reset to its default state which is the reading state ), then the column ( col2 ) is presented on the address bus ( 85 ) while the - oe signal becomes active to enable the data ( d2 ) to be read and to be loaded for the transmission to the user that has requested this operation . the writing operation ( s2w ) is then achieved . at time t2 &# 34 ;&# 39 ;, one and a half clock cycle after t2 &# 34 ;, the - ras , - cas and - oe signals become inactive . the state of pre - charge of the memory after an access ( s3 ) begins . fig9 gives an example of a static column mode read modify write cycle requested by a user . also in this example , the number of cycles required for the state s1 is 1 clock cycle , for the states s2r , s2m and s2w is 1 . 5 clock cycles , and for the state s3 is 2 clock cycles . before time t0 , the state machine is at its idle state s0 . at time t0 , the - ras signal ( 91 ) is activated , therefore the row address ( row0 ) is presented on the address bus ( 95 ), and the state s1 may start . as is said , the number of cycles of the present state s1 is clock cycle . then , at the next rising edge of the functional clock ( 90 ), at time t1 , the - cas signal ( 92 ) is activated and the column address ( col0 ) is presented on the address bus ( 95 ) while the - oe signal is activated to enable the reading operation to be performed , which enables the data ( d0 ) to be loaded ( 96 ) for the transmission to the user that has requested this operation . the state s2r of the reading operation is then achieved . at time t2 , one and a half clock cycle of the functional clock ( 90 ) after t1 , the - oe signal ( 94 ) becomes inactive to indicate that the data will be modified , the state ( s2m ) may then start by a writing operation that will follow . at time t2 &# 39 ;, one and a half clock cycle after time t2 , the state machine keeps the same column ( col0 ) in order to modify the data read previously , and at time t2 &# 34 ;, the - w / r signal is activated when the write operation is ready , then the data ( d1 ) to be substituted to the old data and which are received are written in the memory as is shown on the signal din / out ( 96 ). the state ( s2w ) is then achieved . at time t2 &# 34 ;&# 39 ;, one and a half clock cycle after t2 &# 39 ;, the - ras , - cas and - oe signals become inactive . the state of pre - charge of the memory after an access ( s3 ) begins before the state machine goes to its idle state ( s0 ).
| 6 |
the subject matter of select embodiments of the invention is described with specificity herein to meet statutory requirements . but the description itself is not intended to necessarily limit the scope of claims . rather , the claimed subject matter might be embodied in other ways to include different components , steps , or combinations thereof similar to the ones described in this document , in conjunction with other present or future technologies . terms should not be interpreted as implying any particular order among or between various steps herein disclosed unless and except when the order of individual steps is explicitly described . embodiments of the invention are described herein with respect to the drawings in which reference numerals are employed to identify particular components or features . similar elements in the various embodiments depicted are provided with reference numerals having matching second and third digits but with differing first digits , e . g . element 10 is similar to elements 110 , 210 , etc . such is provided to avoid redundant description of similar features of the elements but is not intended to indicate the features or elements are necessarily the same . four - digit reference numerals are reserved for description of method steps and do not correlate with the three - digit reference numerals used herein . embodiments of the invention are described herein with respect to delivery of ballast material , or simply “ ballast ,” at a desired location along a railway or rail system . however , such is not intended to limit the type of material or applications in which embodiments of the invention might be employed . terms of relativity , such as forward , rearward , aft , above , below , top , and bottom are used relative to the orientation of the objects included in the drawings and with respect to a forward direction of conveying being from right to left in fig1 of the drawings . material is generally described as being conveyed from a rear end or receiving end of a car or conveyor to a forward end or discharge end of a car or conveyor . it is also to be understood that the material distribution consist of embodiments of the invention described herein may travel in either direction . with reference now to fig1 and 2 , a material distribution consist 100 is described in accordance with an embodiment of the invention . the material distribution consist 100 includes an offloading car 102 , a plurality of hopper cars 104 , one or more generator / transfer cars 206 , and may include one or more generator cars 106 . the consist 100 may include one or more power or drive cars or locomotives ( not shown ) that couple to the consist 100 to propel the consist 100 along a rail system or one or more of the cars 102 , 104 , 106 may be provided with or include a propulsion system for driving the consist 100 along the rail system . the offloading car 102 includes an operator &# 39 ; s station 108 , a primary conveyor 110 , an offloading conveyor 112 , a generator 114 , and a hydraulic pump 116 . the operator &# 39 ; s station 108 includes one or more control surfaces , computers , displays , and the like to enable an operator to control operation of components disposed on the offloading car 102 as well as the hopper cars 104 and the generator car 106 . the primary conveyor 110 is positioned near a rearward end of the offloading car 102 and extends at an upward angle toward the forward end of the car 102 . the rear end of the primary conveyor 110 is configured to be at least partially longitudinally overlapped by a hopper conveyor 118 disposed on the hopper car 104 located immediately aft of the offloading car 102 and may extend beyond the rear end of the car 102 . a scale 120 or other weighing device may be disposed on or integrated with the primary conveyor 110 to measure the weight of ballast materials being transported thereby . the forward end of the primary conveyor 110 is supported above an intake end of the offloading conveyor 112 . a chute 122 or other housing may be provided at the forward end of the primary conveyor 110 to direct the ballast materials thereon onto the underlying offloading conveyor 112 . the offloading conveyor 112 is rotatably and pivotably mounted on the offloading car 102 . the intake end of the offloading conveyor 112 is coupled to a rotatable support structure 124 located generally centrally along the length of the offloading car 102 . the support structure 124 is rotatable or pivotable preferably about 180 ° side - to - side to enable offloading of ballast materials on either side of the offloading car 102 , as shown in fig5 ; greater or lesser amounts of rotation may be provided . the terms “ about ” or “ approximately ” as used herein denote deviations from the exact value by +/− 10 %, preferably by +/− 5 % and / or deviations in the form of changes that are insignificant to the function . the offloading conveyor 112 may also be positioned to offload materials in front of the consist 100 or at any desired angle to either side of the consist 100 . the offloading conveyor 112 extends from the support structure 124 in a cantilevered fashion and may be at least partially vertically pivotable about the coupling with the support structure 124 to enable raising / lowering of the discharge end of the conveyor 112 . the generator 114 comprises an available generator technology and may be included on the offloading car 102 to provide electrical power for operation of the controls in the operator &# 39 ; s station 108 , operation of the primary and offloading conveyors 110 , 112 , and / or operation of the hydraulic pump 116 . in another embodiment , the generator 114 is omitted and electrical energy is provided to the offloading car 102 from the generator / transfer car 206 or the generator car 106 , as described more fully below . the hydraulic pump 116 comprises an available hydraulic pump or hydraulic pressure generation system . the hydraulic pump 116 is configured to provide sufficient hydraulic pressure for operation of actuators included on the offloading car 102 as well as those disposed on the hopper cars 104 and / or the generator car 106 . for example , actuators on the offloading car 102 may function to rotate and pivot the offloading conveyor 112 and actuators on the hopper cars 104 may function to open / close gates , as described below . although the pump 116 and associated actuators and systems described herein are termed hydraulic , other systems , such as electronic , mechanical , and pneumatic , among others can be employed . in another embodiment , the hydraulic pump 116 is disposed on the generator / transfer car 206 , the generator car 106 or on another car in the consist 100 . appropriate connections are provided between the offloading car 102 , the hopper cars 104 , the generator / transfer car 206 , and the generator car 106 to conduct electricity , hydraulic fluids / pressure , and communications between the cars . as depicted in fig1 and 2 , each hopper car 104 comprises a car frame 126 supported on trucks 127 and a car body 128 disposed thereon . the car body 128 includes an outer wall 130 substantially enclosing a hopper 132 and the hopper conveyor 118 therein . the outer wall 130 may form a portion of the walls of the hopper 128 and may aid to contain dust and debris produced by the offloading process and / or to protect the components from the environment . in another embodiment , the hopper car 104 is constructed without the outer wall 130 . in one embodiment , the hopper car 104 is constructed by retrofitting existing bulk freight rail cars , such as open - wagons , box cars , or the like . the hopper conveyor 118 is disposed on the car frame 126 between the car frame 126 and the hopper 132 . the hopper conveyor 118 extends the length of the hopper car 104 and preferably extends a distance beyond each end of the car 104 so as to overlap with conveyors disposed on adjacent hopper cars 104 , the offloading car 102 , or the generator / transfer car 206 described more fully below . in some embodiments , a dedicated end car 104 ′ is provided as depicted in fig2 . the end car 104 ′ is identical to the hopper cars 104 , but the conveyor 118 disposed therein does not extend beyond a rearward end of the end car 104 ′. as such , the conveyor 118 in the end car 104 ′ will not interfere with or contact other cars coupled to the end car 104 ′; the conveyor 118 in the hopper cars 104 may obstruct coupling with other cars . as shown in fig5 , the hopper conveyor 118 extends substantially horizontally from the rear end of the hopper car 104 toward the forward end and includes an upwardly angled portion 134 near the forward end of the hopper car 104 . the upward angle and the length of the portion 134 are sufficient to position the forward end of the hopper conveyor 118 above and overlapping with the rearward end of the conveyor on the next adjacent car 102 , 104 , 206 as shown in fig1 and 2 . the hopper conveyor 118 is preferably a trough - style conveyor in which rollers are provided between upper and lower runs of a conveyor belt 135 to support the upper run of the belt 135 in a generally u - shaped configuration , as shown in fig1 and 15 . each set of rollers generally includes a horizontally extending central roller 139 and two side rollers 141 angled upward and outward from opposite ends of the central roller 139 . it is to be understood that other forms of conveyors are useable in alternative embodiments of the invention . for example , a flat belt conveyor might be employed with sidewalls / guides provided to retain the ballast materials on the belt . referring to fig4 , the hopper conveyor 118 includes an electric drive motor 136 drivingly coupled to a drive roller or head roller 137 . rotation of drive roller 137 rotates the conveyor belt 135 . in some embodiments , the drive motor 136 is configured to enable variable speed operation of the conveyor belt 135 . one or more sensors may be included or associated with the motor 136 and the hopper conveyor 118 generally to monitor one or more characteristics of the conveyor &# 39 ; s operation . for example , sensors in the motor 136 may monitor the amperage drawn by the motor 136 or other electrical characteristics of the motor &# 39 ; s operation . another sensor 138 may monitor the speed of the conveyor belt 135 while other sensors might be included to monitor characteristics like the weight of material on the conveyor belt 135 , or a profile of the material on top of the conveyor belt 135 , among a variety of other characteristics . the rear end of the hopper conveyor 118 includes an idler roller 139 around which the conveyor belt 135 rotates and may include an intake guide 140 . as best seen in fig1 and 18 , the intake guide 140 is configured to guide ballast received from another conveyor onto the hopper conveyor 118 for transport by the conveyor belt 135 toward the forward end of the hopper car 104 . the intake guide 140 can take a wide variety of configurations , but generally extends a distance laterally beyond the edges of the conveyor belt 135 and may extend a distance longitudinally beyond the end of the conveyor belt 135 . the walls of the intake guide 140 generally slope downwardly toward the upper run of conveyor belt 135 to direct ballast materials toward the center of the belt 135 . the configuration of the forward and rear ends of the hopper conveyor 118 enable transfer of ballast between adjacent hopper cars 104 , and / or to or from other cars 102 , 206 while the consist 100 is located on a curved section of a rail system , as depicted in fig1 and 18 . the hopper conveyor 118 enables transfer of ballast between cars 102 , 104 , 206 when positioned on curves in which the heading of immediately adjacent cars 102 , 104 , 206 varies by greater than 10 ° or as much as approximately 20 ° or more , as depicted by the angle ( i ) shown in fig1 , e . g . greater than a 10 ° curve in the railway . in one embodiment , the hopper conveyor 118 is configured to accommodate curves of up to approximately 13 °. the hopper 132 comprises an open space in the upper portion of the hopper car 104 which may be enclosed or open to the environment above the hopper car 104 . the perimeter of an upper part of the hopper 132 is defined by the outer walls 130 of the car 104 . a lower part of the hopper 132 includes inwardly angled sidewalls 142 and a plurality of transverse dividers 144 . the transverse dividers 144 extend between the angled sidewalls 142 and include a pair of sloped faces facing longitudinally forward and rearward and at angles similar to those of angled sidewalls 142 . preferably the sidewalls 142 and the sloped faces of the dividers 144 are sloped at a downward angle of at least approximately 40 ° from the horizontal or more preferably between about 50 ° and about 60 °, or about 57 °. the downward angle of the sidewalls 142 and the dividers 144 is sufficient to cause the ballast material to flow downward without hanging or collecting on the sidewalls 142 or dividers 144 . together the angled sidewalls 142 and the transverse dividers 144 divide the lower part of the hopper 132 into a plurality of chutes 146 . each chute 146 may also be referred to as a hopper such that each hopper car includes a plurality of hoppers . the chutes 146 are generally centrally aligned to overlie the center of the hopper conveyor 118 . each of the chutes 146 terminates at a lower end to form an aperture or opening 147 through which ballast materials flow . as shown in fig4 and 5 , the hopper car 104 includes six chutes 146 although any number of chutes 146 may be included . in the embodiment shown five of the chutes 146 overlie the horizontal portion of the hopper conveyor 118 and are generally aligned within a horizontal plane above the hopper conveyor 118 to place the openings 147 generally within a single horizontal plane . a sixth chute 146 overlies the angled portion 134 of the hopper conveyor 118 and is configured to provide an opening 147 that is inclined to lie in a plane that is substantially parallel to the angled portion 134 of the hopper conveyor 118 . a hopper gate 148 is disposed in or across each of the openings 147 to control the flow of ballast through the respective chute 146 . with additional reference to fig5 - 10 , a hopper gate 148 is described in accordance with an embodiment of the invention . fig1 depicts a hopper gate 248 configured similarly to the hopper gate 148 but for installation in the angled sixth chute 146 located at the forward end of the hopper car 104 . the features of the hopper gate 248 are thus not described again in detail herein . the hopper gate 148 is formed on a lower end of a chute extension 150 and includes a base frame 152 and a slide plate 154 . the chute extension 150 includes panels 150 s ( side ), 150 f ( front ), 150 r ( rear ) configured to couple to and extend from the respective angled sidewalls 142 and transverse dividers 144 of the chute 146 within which the hopper gate 148 is disposed . the panels 150 s , 150 f and 150 r of the chute extension 150 are preferably disposed at similar angles to that of the sidewalls 142 and dividers 144 but may be provided at one or more steeper or shallower angles . in one embodiment , the base frame 152 of the hopper gate 148 couples directly to the sidewalls 142 and dividers 144 of the chute 146 without the use of the chute extension 150 . as shown in fig1 , the hopper gate 248 disposed in the forward angled chute 146 of the hopper car 104 includes a chute extension 250 adapted to install the hopper gate 248 in a non - horizontal position . in one embodiment , one or more of the panels 150 s and / or 150 f include a flexible or resilient flange ( not shown ) coupled to a bottom edge thereof . the resilient flange may aid to better seal between the slide plate 154 and the panels 150 s and / or 150 f to resist material and dust traveling therebetween . the resilient flange may also aid to divert ballast materials flowing therethrough toward the center of the gate opening 160 and thus toward the center of the underlying hopper conveyor 118 . the rear chute extension panel 150 r includes a resilient panel or flange 156 coupled beneath a bottom edge thereof . the resilient panel 156 may be coupled to the rear chute extension panel 150 r or to another member provided by the chute extension 150 or the base frame 152 . the resilient panel 156 is rigidly coupled along a top edge thereof to provide a free hanging bottom edge that can be at least partially flexed in the longitudinal direction of the hopper car 104 . the resilient panel 156 may comprise a rubber , plastic , vinyl , composite , or similar resilient material that is at least partially flexible about a rigid coupling . in another embodiment , the resilient panel 156 is pivotably coupled to the hopper gate 148 and may comprise a rigid plate or sheet of material , e . g . the resilient panel 156 may pivot about its coupling with the gate 148 instead of or in addition to flexing . the base frame 152 is coupled about the lower end of the chute extension 150 and supports the slide plate 154 and one or more actuators 158 for moving the slide plate 154 between closed ( fig7 a - b ) and open ( fig8 a - b ) positions relative to a gate opening 160 formed by the chute extension 150 . the slide plate 154 comprises a generally planar section of rigid material dimensioned to fully close off the gate opening 160 . the slide plate 154 is preferably formed from a material of sufficient strength and durability to support and resist damage from bulky ballast materials during dumping into the hopper car 104 and storage therein . for example , the slide plate 154 may comprise a plate of 0 . 5 inch thick steel , among a variety of other material options . the base frame 152 is configured to support the slide plate 154 in both the open and closed positions and during movement therebetween . such configurations accommodate slide plates 154 produced from very heavy , stout , and durable materials , such as heavy gage steel plate , and against very heavy loads produced by large , bulky ballast materials carried by the hopper car 104 . the base frame 152 includes frame members 162 s ( side ), 162 f ( front ) that extend about the lateral sides and longitudinal front side of the lower perimeter of the chute extension 150 . the front frame member 162 f extends between the side frame members 162 s along the front side of the chute extension 150 and overlies the slide plate 154 . the side frame members 162 s have a height sufficient to extend below the slide plate 154 and include a pair of spanning members 164 that extend transversely between the side frame members 162 s and beneath the slide plate 154 . the spanning members 164 are located forward and rearward of the gate opening 160 so as not to obstruct ballast flowing therethrough . the spanning members 164 support guide rods 166 that extend between the spanning members 164 . guide rod extensions 168 are coupled to the forwardly located spanning member 164 and in alignment with the guide rods 166 to operatively extend the guide rods 166 a distance beyond the base frame 152 . opposite ends of the guide rod extensions 168 are coupled to the structure of the hopper car 104 or to the rearwardly located spanning member 164 of a longitudinally adjacent hopper gate 148 . in one embodiment , the guide rods 166 are continuous and extend beyond the forwardly located spanning member 164 and the guide rod extensions 168 are omitted . as shown in fig5 - 10 , three guide rods 166 and guide rod extensions 168 are provided . it is understood that any number of guide rods 166 and extensions 168 may be employed in embodiments of the invention . also as shown in fig5 - 10 , the central guide rod 166 extends across the gate opening 160 . accordingly , the central guide rod 166 can provide additional support to the slide plate 154 to resist flexing or damage caused by heavy loads placed thereon by overlying ballast materials in the hopper car 104 . referring to fig9 , the slide plate 154 includes followers or glides 170 coupled to a bottom surface thereof in alignment with the respective guide rods 166 and guide rod extensions 168 . the glides 170 include a follower surface 172 that is contoured to match the contour of the guide rod 166 and guide rod extension 168 and to be slideable therealong . the glides 170 preferably comprise a low - friction material or wear plate , such as a nylon , plastic , brass , or bronze , among others . the glides 170 thus aid the slide plate 154 to slide along the guide bars 166 and extensions 168 between the open and closed positions . in another embodiment , the glides 170 comprise wheels , bearings , or similar components configured to follow the guide bars 166 and extensions 168 and aid movement of the slide plate 154 therealong . the slide plate 154 also includes a drive bar 175 coupled to a trailing edge to extend transversely across the slide plate 154 and beyond the lateral edges thereof . the trailing edge is defined relative to movement of the slide plate 154 toward the closed position with the opposite edge being identified as the leading edge . the actuators 158 each couple between a respective end of the drive bar 175 and a respective side frame member 162 s . the actuators 158 can thus be actuated to move the slide plate 154 along the guide bars 166 and extensions 168 between the open and closed positions . when moved to the closed position , the leading edge of the slide plate 154 contacts the lower edge of the resilient panel 156 or moves beneath the lower edge in close proximity thereto . when contacted , the resilient panel 156 may be at least partially flexed in the direction of movement of the slide plate 154 to allow the slide plate 154 to reach the fully closed position . in either configuration , the flexure of the resilient panel 156 enables the slide plate 154 to reach the fully closed position even when ballast materials are present on a top surface of the slide plate 154 and / or attempting to exit through the gate opening 160 . unlike known systems in which the ballast materials may become pinched , trapped , or crushed between doors of a gate and / or the sidewalls of the chute thus preventing the doors from achieving full closure , the resilient panel 156 allows flexure between the slide plate 154 and the chute extension 150 . ballast materials captured between the leading edge of the slide plate 154 and the resilient panel 156 cause the resilient panel 156 to flex or bend outward but do not prevent the slide plate 154 from moving to the closed position . the trapped materials may be retained in position by the force applied by the resilient plate &# 39 ; s bias against flexure , may fall out of the hopper 132 onto the hopper conveyor 118 , or may be forced back into the hopper 132 by the resilient plate &# 39 ; s bias . the resilient panel 156 resists substantial further exit of ballast materials from the hopper 132 . the resilient panel 156 thus resists the ballast materials from exiting the hopper 132 when the slide plate 154 is in the closed position while also allowing the slide plate 154 to move to the closed position without binding on the ballast materials . as shown in fig5 , the hopper car 104 includes a control device 173 , such as a computer , programmable logic controller , or similar programmable control unit . the control device 173 may be in electrical communication with control systems housed in the operator &# 39 ; s station 108 on the offloading car 102 and may receive commands therefrom . the control device 173 is configured to monitor the operation of the hopper conveyor 118 and the hopper gates 148 , 248 on the respective hopper car 104 . a control device 173 is preferably provided on each hopper car 104 for control of the individual operations thereof . in another embodiment , control systems may be provided elsewhere on the consist 100 and configured to monitor the operation of each individual hopper car 104 . dedicated control devices 173 on each hopper car 104 may provide additional fail - safes and more reliable control of the operations of the hopper car 104 due to potential communication issues that may arise between cars 102 , 104 , 106 , 206 . operation of the hopper car 104 and control device 173 is described more fully below . the generator car 106 includes one or more generators 174 and may include a storage bin 176 . the generator ( s ) 174 are configured to produce sufficient electrical energy for powering the hopper conveyors 118 on the hopper cars 104 among other components disposed on the material distribution consist 100 . the storage bin 176 comprises a structure configured to house tools , equipment , crew quarters , or other desired gear that may be needed or used by the operator of the consist 100 . as shown in fig2 , the generator car 106 may be positioned at the trailing end of the consist 100 so as not to interrupt the transport of ballast materials along the length of the consist 100 . in another embodiment shown in fig1 and 2 , a generator / transport car 206 may be provided . the generator / transport car 206 is configured similarly to the generator car 106 but includes a conveyor 178 similar to the hopper conveyors 118 . the conveyor 178 is configured to pass beneath the generator 174 or might be configured to pass alongside or over the generator 174 to transport ballast materials received from the hopper car 104 located rearward of the generator / transport car 206 to the hopper car 104 located forward of the generator / transport car 206 . the generator 174 and the storage bin 176 ( if included ) may be raised or suspended above the conveyor 178 . the generator / transport car 206 may also include additional hydraulic pumps or the like as necessary to operate the associated systems of the consist 100 . in an embodiment , the generators 174 are configured to provide sufficient electrical power for up to a predetermined number of hopper cars 104 . for example , the generator 174 might be configured to power up to thirty hopper cars 104 . as such , additional generator cars 106 or generator / transport cars 206 are added to the consist 100 for each additional set of up to thirty hopper cars 104 ; each additional set of hopper cars 104 being coupled to the rear end of the consist 100 . preferably , the hopper cars 104 are arranged in sets of thirty hopper cars 104 with a generator / transport car 206 disposed halfway through the set , e . g . fifteen hopper cars 104 followed by a generator / transport car 206 followed by another fifteen hopper cars 104 . additional sets of hopper cars 104 and generator / transport cars 206 can then be coupled to the end thereof . it is understood , that other numbers of hopper cars 104 and generator / transport cars 206 may be combined without departing from the scope of embodiments of the invention described herein . accordingly , the number of hopper cars 104 , and thus the capacity , of the consist 100 can be customized to a given application as desired . fig1 , 15 , 16 depict a guide - roller assembly 184 configured to enable operation of the hopper conveyor 118 for offloading of ballast materials while one or more of the hopper cars 104 are parked or positioned on a banked curve in the railway . due to the banking of the curve , the rails and thus the hopper car 104 may lean or tilt to one side at an angle θ relative to the horizontal . the tilting of the hopper car 104 also tilts the hopper conveyor 118 to the side and may create a bias due to gravity on the conveyor belt 135 to move toward the downslope side of the hopper car 104 when moving about the hopper conveyor 118 . the guide - roller assembly 184 includes a plurality of feed run guide - rollers 185 and a plurality of return run guide - rollers 186 that retain the conveyor belt 135 in a desired operational position on the hopper conveyor 118 . the feed run and return run guide - rollers 185 , 186 may be disposed in sufficient numbers and at selected positions along the length of the hopper conveyor 118 as necessary to sufficiently retain the conveyor belt 135 in the operational position . the guide - rollers 185 , 186 may be evenly spaced along the length of the conveyor belt 135 , clustered in problem areas , or otherwise arranged . the position of the feed run guide - rollers 185 may correspond with that of the return run guide - rollers 186 or may differ . fig1 depicts one exemplary configuration of the guide - rollers 185 , 186 on the hopper conveyor 118 . as shown , the feed run guide rollers 185 are generally evenly spaced in pairs along the length of the central portion of the hopper conveyor 118 . a cluster of four feed run guide - rollers 185 is disposed along the angled section 135 of the conveyor 118 and a cluster of three guide - rollers 185 is disposed adjacent an opposite intake end of the conveyor 118 . the return run guide - rollers 186 are more sporadically spaced along the return run of the conveyor belt 135 ; a cluster of three guide - rollers 186 are disposed adjacent the intake end of the conveyor 118 , with two single guide - rollers 186 spaced apart and away from the intake end , and two pairs of guide - rollers 186 spaced further along the length of the hopper conveyor 118 . as depicted in fig1 and 15 , the feed and return run guide - rollers 185 , 186 include a roller body 187 with an axle 188 extending from one end thereof coaxially with the axis of rotation of the roller body 187 . a bearing assembly ( not shown ) is disposed within the roller body 187 to enable rotational motion of the roller body 187 relative to the axle 188 . in another embodiment , the axle 188 is rotationally fixed relative to the roller body 187 and may be coupled to a bearing assembly ( not shown ) disposed on the hopper conveyor 118 to enable rotational motion of the axle 188 relative to the hopper conveyor 118 . the roller body 187 includes an hourglass shape in which a sidewall 189 thereof is inwardly recessed to form a circumferentially extending groove . it is understood that other roller configurations may be employed without departing from the scope of embodiments of the invention . the guide - roller assembly 184 includes upper and lower mounting assemblies 190 , 191 that couple the feed run and return run guide - rollers 185 , 186 respectively to the hopper conveyor 118 . the mounting assemblies 190 , 191 preferably couple to support members 192 that support one or more rollers , e . g . the side rollers 141 and central rollers 139 , of the hopper conveyor 118 . or the mounting assemblies 190 , 191 may couple to the frame of the hopper conveyor 118 or of the hopper car 104 . the mounting assemblies 190 , 191 enable adjustment of the position of the feed run and return run guide - rollers 185 , 186 in at least one direction . for example , the mounting assemblies 190 , 191 may enable adjustment of the position of the guide - rollers 185 , 186 in an axial direction , or longitudinally or laterally relative to the hopper conveyor 118 . the guide - rollers 185 , 186 are preferably positioned to contact an edge of the conveyor belt 135 at a location generally centrally within the groove in the sidewall 189 . the guide - rollers 185 , 186 may be in constant contact with the conveyor belt 135 or may only contact the conveyor belt 135 when the belt 135 drifts away from a normal position . accordingly , when the hopper car 104 is tilted at the angle θ , the conveyor belt 135 may tend to drift toward the downslope side of the hopper car 104 . the edge of the conveyor belt 135 may thus come into contact with the feed run and / or return run guide - rollers 185 , 186 and be prevented from drifting out of an operational position by the guide - rollers 185 , 186 . the feed run guide - rollers 185 and the return run guide - rollers 186 can be similarly positioned to define an operational position window in which the conveyor belt 135 is retained . or one or more of the feed run or return run guide - rollers 185 , 186 may be positioned to train the conveyor belt 135 or bias the conveyor belt 135 toward a desired operational position . in one embodiment , the feed run guide - rollers 185 are positioned to define a maximum operational position window in which the conveyor belt 135 shall be operated while the return run guide - rollers 186 are positioned closer to the edges of the conveyor belt 135 to guide the belt 135 into a more specific operational position . training or realigning the conveyor belt 135 is preferably completed on the return run using the return run guide - rollers 186 because the belt 135 is not loaded with material and is in a generally flat state , e . g . not a trough , and is thus more easily urged toward the desired operational position . for example , the configuration of the guide - rollers 185 , 186 depicted in fig1 provides sufficient control of the feed run of the conveyor belt 135 to maintain the belt 135 in an operational position when unloading materials while the hopper car 104 is on a banked curve and enables realignment of the conveyor belt 135 on the return run by the return run guide - rollers 186 . with reference now to fig1 , operation and control of the material distribution consist 100 is described in accordance with an embodiment of the invention . a consist control system 180 is provided , such as in the operator &# 39 ; s station 108 to provide overall control of operations of the consist 100 . the consist control system 180 may include one or more computing devices , programmable logic controllers , or other devices suitable to execute routines , provide commands , monitor conditions , operate machines , and otherwise oversee and control operations of the consist 100 and the components thereon . as described previously , each hopper car 104 includes a control device 173 disposed thereon . the control device 173 is in communication with or is operable to control the conveyor drive motor 136 and each of the hopper gates 148 individually . one or more sensors 182 associated with the hopper conveyor 118 and / or the hopper gates 148 provide signals to the control device 173 indicating state and / or operating conditions of the respective conveyor 118 or hopper gate 148 . additionally , the belt sensor 138 associated with the hopper conveyor 118 provides a signal to the control device 173 indicating the speed or movement of the conveyor belt 135 . the control device 173 may also be in communication with one or more of the other control devices 173 of each of the other hopper cars 104 . communications between control devices 173 may be direct or may be routed through the consist control system 180 . the control device 173 may control operation of the hopper conveyor 118 in a master - slave fashion as instructed by the consist control unit 180 . however , the control device 173 may be authorized to act independently and / or to supersede commands from the consist control system 180 when a fault condition occurs . in such a condition , the control device 173 of a first hopper car 104 , e . g . hopper car # 1 , may operate as an interlock or fail - safe to restrict or control operations of one or more hopper cars 104 positioned further up the path of material flow , e . g . hopper car #&# 39 ; s 2 through n . accordingly , when the control device 173 of hopper car # 1 senses a fault condition , the control device 173 of hopper car # 1 can stop operations thereon and can signal to hopper cars # 2 - n to stop operations as well . in one exemplary instance , ballast material is being transported from hopper car # 2 to hopper car # 1 and on to the offloading car 102 along the respective hopper conveyors 118 . the control device 173 on hopper car # 1 determines that the conveyor motor 136 on hopper car # 1 is operating at the desired speed as indicated by the sensor 182 but that the speed of the conveyor belt 135 is indicated to be zero feet / second by the belt sensor 138 . such a condition may be present when the belt 135 has broken and is thus no longer moving but the motor continues to turn or when the belt 135 has been overloaded and the drive wheel of the conveyor motor 136 is slipping . the control device 173 of hopper car # 1 identifies this condition as a fault condition and immediately stops operation of the hopper conveyor 118 on hopper car # 1 and may close any hopper gates 148 to restrict further ballast material from flowing therefrom . the control device 173 of hopper car # 1 also signals the control device 173 of hopper car # 2 to indicate the fault condition and cause operations of the conveyor 118 on hopper car # 2 to be halted and the gates 148 to close . the operation of the conveyors 118 of each successive hopper car 104 are then halted and the gates 148 closed in a cascading fashion . as such , the overall operation of multiple , successive hopper cars 104 can be halted by the control device 173 of hopper car # 1 and a pileup of materials between successive hopper cars 140 can be avoided . referring now to fig1 , a method 1300 for operating the consist 100 is shown and described in accordance with an embodiment of the invention . the consist 100 is typically first loaded and transported to a location at which a desired amount of ballast materials are to be offloaded . the ballast materials may be offloaded while the consist 100 is stopped or while the consist 100 is in transit along the tracks . the ballast materials are offloaded alongside the rails for later distribution or installation by a rail maintenance crew . for example , the crew may replace ballast materials under the tracks , dump new or additional ballast on an embankment , or line a drainage system with new materials . the ballast materials might also be offloaded in front of the consist 100 or behind the consist 100 depending on the direction of travel thereof . a plow may be provided to aid movement of the offloaded ballast materials to a desired location or depth and / or to ensure the rails are clear for travel of the consist 100 when offloading in front of the consist 100 . once on location , one or more of the hopper conveyors 118 , the primary conveyor 110 , and the offloading conveyor 112 are started . depending on the sequence by which the hopper cars 104 are to be unloaded , the conveyors 118 on all or only a portion of the hopper cars 104 may be started . for example , if the hopper cars 104 are to be unloaded from the front of the consist 100 to the rear , then only the conveyor 118 of the first hopper car 104 need be started . the operator in the operator &# 39 ; s station 108 controls the offloading process via the consist control system 180 . the operator may provide one or more inputs to the system 180 indicating how much ballast material is to be offloaded , an offloading run - time , a number of hopper cars 104 to be offloaded , among a variety of other inputs . in one embodiment , the consist control system 180 is provided with a total weight or mass of ballast material to be offloaded . the consist control system 180 may calculate appropriate offloading characteristics to ensure the proper amount of ballast material is offloaded . for example , the system 180 may be provided with an amount of ballast material in each hopper car 104 or an amount of time required to offload a particular amount of ballast among other data upon which to calculate the offloading parameters . in one embodiment , the system 180 employs the scale 120 in the primary conveyor to aid in determining the amount of ballast material that has been offloaded . the consist control system 180 may also track or identify the amount of ballast material residing on the conveyors 110 , 112 , 118 at a given time in order to determine when to close the hopper gates 148 so as to offload the desired amount of ballast while also finishing the process with the conveyors 110 , 112 , 118 being empty . a first hopper gate 148 is at least partially opened at step 1304 . the consist control system 180 can cause the gate 148 to be opened directly or the system 180 may instruct the control unit 173 on the respective hopper car 104 to open the gate 148 . the hopper gate 148 is preferably only partially opened . in one instance , the actuators 158 are operated for a predetermined time that corresponds to movement of the slide plate 154 a given predetermined distance . a predetermined time delay is then observed to allow ballast materials to flow from the hopper 132 onto the hopper conveyor 118 , as indicated at step 1306 . at step 1308 , one or more characteristics of the operation of the hopper conveyor 118 are identified . for example , the conveyor operation sensors 182 may sense an amperage drawn by the conveyor motor 136 . the amperage drawn by the motor 136 may be indicative of a load placed on the motor 136 and thus an amount of ballast material that has been deposited on the conveyor belt 135 . if the identified characteristic of the conveyor motor 136 indicates that the conveyor 118 is fully loaded or is loaded within a desired level ( step 1310 ), e . g . the amperage drawn is greater than a specified amount , then the method returns to step 1306 and an additional time delay is observed . the additional time delay may be of the same or different duration to the initial time delay . if the characteristic shows that the conveyor 118 is not loaded to a desired level ( step 1310 ), e . g . the amperage drawn is less than a specified amount , and the hopper gate 148 is not in a fully opened state ( step 1312 ) then the hopper gate 148 is opened by an additional increment , as indicated at step 1314 . the additional increment may be based on an additional energizing of the actuators 158 for a given time or a movement of the slide plate 154 a predetermined distance . the method then returns to step 1306 . alternatively , if the characteristic shows that the conveyor 118 is overloaded , e . g . the amperage drawn is greater than a predetermined level , then the hopper gate 148 may be closed by a predetermined increment , as indicated at step 1316 . the increment can be the same or different than the increments by which the gate 148 is opened . the method then again returns to step 1306 . if the hopper gate 148 is in a fully opened state ( step 1312 ) then the process begins again with the next hopper gate 148 to be unloaded , as indicated at step 1318 . the hopper gates 148 may be opened one - at - a - time or multiples - at - a - time on the same or on multiple hopper cars 104 . the gates 148 can be opened in sequence from front to back of the consist 100 , in the reverse , or at various intermittent locations along the consist 100 as desired . additionally , the hopper gates 148 may be closed following step 1316 or may remain open . in one embodiment , the gates 148 remain open until the hopper car 104 is determined to be empty or until the consist 100 is determined to be empty . at any point in the method 1300 , the consist control system 180 may determine that the desired quantity of ballast materials have been released from the hoppers 132 , e . g . the quantity of ballast materials offloaded by the offloading car 102 and present on the conveyors 118 is equal to or greater than the desired quantity . the system 180 may thus instruct any open hopper gates 148 to be closed to stop the flow of ballast materials onto the conveyors 118 . the control devices 173 of the respective hopper cars 104 may thus cause the hopper gates 148 to be closed by actuating the actuators 158 to move the slide plates 154 to the closed position . in doing so , the resilient panels 156 enable the slide plates 154 to move to the closed position to stop the flow of ballast materials without binding or crushing the ballast materials between the leading edge of the slide plate 154 and the chute extension 150 as described previously above . many different arrangements of the various components depicted , as well as components not shown , are possible without departing from the scope of the claims below . embodiments of the technology have been described with the intent to be illustrative rather than restrictive . alternative embodiments will become apparent to readers of this disclosure after and because of reading it . alternative means of implementing the aforementioned can be completed without departing from the scope of the claims below . identification of structures as being configured to perform a particular function in this disclosure and in the claims below is intended to be inclusive of structures and arrangements or designs thereof that are within the scope of this disclosure and readily identifiable by one of skill in the art and that can perform the particular function in a similar way . certain features and sub - combinations are of utility and may be employed without reference to other features and sub - combinations and are contemplated within the scope of the claims .
| 4 |
for purposes of disclosure , the three following co - pending u . s . utility applications , which are owned by the same assignee as in this case , are hereby incorporated by references , as if fully set forth herein : ( a ) pending u . s . utility application ser . no . 12 / 589 , 277 , entitled “ interactive and 3 - d multi - sensor touch selection interface for an automated retail store , vending machine , digital sign , or retail display ,” filed oct . 21 , 2009 , by coinventors mara segal , darrell mockus , and russell greenberg , that was based upon a prior pending u . s . provisional application ser . no . 61 / 107 , 829 , filed oct . 23 , 2008 , and entitled “ interactive and 3 - d multi - sensor touch selection interface for an automated retail store , vending machine , digital sign , or retail display ”; ( b ) pending u . s . utility application ser . no . 12 / 589 , 164 , entitled “ vending machines with lighting interactivity and item - based lighting systems for retail display and automated retail stores ,” filed oct . 19 , 2009 by coinventors mara segal , darrell mockus , and russell greenberg , that was based upon a prior pending u . s . provisional application ser . no . 61 / 106 , 952 , filed oct . 20 , 2008 , and entitled “ lighting interactivity and item - based lighting systems in retail display , automated retail stores and vending machines ,” by the same coinventors ; and , ( c ) pending u . s . utility application ser . no . 12 / 798 , 803 , entitled “ customer retention system and process in a vending unit , retail display or automated retail store ” filed apr . 12 , 2010 , by coinventors mara segal , darrell mockus , and russell greenberg , that was based upon a prior pending u . s . provisional application ser . no . 61 / 168 , 838 filed apr . 13 , 2009 , and entitled “ customer retention system and automated retail store ( kiosk , vending unit , automated retail display and point - of - sale )”, by coinventors darrell scott mockus , mara segal and russell greenberg . with initial reference directed to fig1 a - 1e of the appended drawings , a robotized gantry 100 is adapted to be integrated into a multiple - module vending machine or automated retail store . gantry 100 comprises a rigid , upright frame consisting of an upper square portion 101 , supported by vertical upright c - channel support beams 102 attached to a gantry base 110 . an internal elevator comprises a transverse conveyor 105 resting upon an elevator conveyor tray 107 within the gantry 100 . conveyor 105 comprises a flexible sheet looped and entrained about a pair of spaced apart rollers 105 b that are journalled in the frame at 120 ( fig1 d ). the elevator is supported by two brackets 109 disposed on opposite ends of conveyor tray 107 . the elevator , and thus conveyor 105 and tray 107 can be raised or lowered using pulleys 103 ( fig1 a ) that are attached atop the vertical support beams 102 and which entrain 9 mm wide and 3605 mm long belts 104 . preferably conveyor tray 107 has a pair of retractable , product collection wings 106 that open in response to wing hinge assembly 108 when the elevator is in place to collect items that are dispensed from inventory area ( s ) in modules placed on either side of the dispensing gantry 100 . wings 106 span the distance between the conveyor and the inventory shelves caused by the necessary existence of the frame structure to support the conveyor elevator . fig1 c and 1d clarify how gantry components are driven . the conveyor belt 105 is driven by a conveyor stepper motor 111 that uses a 9 mm . wide belt 121 ( fig1 e ) to power a drive pulley connected to a roller bar 112 and feeds the conveyor belt around the conveyor rollers 105 b that are journalled at 120 . the flexible conveyor fabric is wrapped around the conveyor drive roller 112 and the rollers 105 b . the generally rectangular product collection wings 106 are disposed on either side of the conveyor 105 to direct selected products upon the conveyor to deliver a vend . the retractable wings 106 are actuated by the wing motor 113 ( 514 fig5 ) connected to the wing hinge assembly 108 ( fig1 a ) which comprises a wing drive shaft 114 that distributes power from the motor to a series of levers 115 that are connected to hinges 116 secured to the product collection wings 106 . as the motor turns from the closed position , the support levers 115 are pulled downwardly , causing the upper portion of the levers 115 to slide within stabilizer follower slots ( fig1 b ) in hinges 116 . this opens the collection wings 106 to a predetermined width that allows the conveyor 105 to collect products from inventory areas attached to either side of the central gantry dispensing assembly 100 . the motor can be reversed to close the product collection wings . the elevator motor 117 ( 507 fig5 ) is connected to a pulley wheel and uses a 9 mm . wide belt to drive the elevator drive shaft 118 turning two pulleys 119 mounted on either side of the subassembly that drives the elevator belt 104 which loops around the top pulleys 103 thereby raising or lowering the elevator . after a product is collected from the inventory shelf , the elevator is aligned with the collection area compartment behind the collection area opening 204 ( fig2 a ) in the totem door 211 ( fig2 a ). fig1 e provides additional reference for fig1 a through 1d . in this view , the belt 121 that drives the roller bar 112 that moves the conveyor 105 can be seen . with additional reference directed to fig2 a and 2b , a vending machine constructed in accordance with the best mode of the invention has been generally designated by the reference numeral 200 ( fig2 a ). much of the hardware details are explained in the aforementioned pending applications that have been incorporated by reference herein . display module 210 can be attached with a hinge to an inventory area covered by control panel 211 , comprised of a rigid upright cabinet , or the module 210 can be mounted to a solid structure as a stand - alone retail display . the display module 210 forms a door hinged to an adjacent cabinet such as an inventory cabinet 212 a adjacent gantry 100 which is covered by control column 211 . a variety of door configurations known in the art can be employed . for example , the display doors can be smaller or larger , and they can be located on one or both sides of the control column 211 . the display doors can have multiple square , oval , circular , diamond - shaped , rectangular or any other geometrically shaped windows . alternatively , the display area can have one large display window with shelves inside . a customizable , lighted logo area 201 ( fig2 a ) is disposed at the top of column 211 . touch screen display 202 is located below area 201 . panel 203 locates the machine payment system , coin acceptor machine or the like . additionally panel 203 can secure a receipt printer , keypad , headphone jack , fingerprint scanner or other access device . the product retrieval area 204 is disposed beneath the console 211 in a conventional collection area compartment ( not shown ). a key lock 205 , which can be mechanical or electrical such as a punch - key lock , is disposed beneath the face of the module 210 . one or more motion sensors 214 are disposed within smaller display tubes within the console interior . a plurality of generally circular product viewing areas 207 and a plurality of generally diamond shaped viewing areas 206 are defined upon the outer the face of the casing 208 that are aligned with internal display tubes behind the product viewing surface areas , though the shape of the viewing areas may alter with various merchandising concepts . however , the convention of framing merchandising offerings is consistent to enable intuitive interfacing whether a physical or virtual representation of the merchandise display . the reference numeral 209 designates an exterior antenna that connects to a wireless modem inside the machine providing connectivity . 213 shows inventory shelves which may be mounted in the inventory cabinet 212 . these inventory shelves may contain any mechanism such as conveyors or spiral vending systems as long as they can push a product off the edge of the inventory tray . speakers 215 are mounted in the column 211 . a camera 216 capable of capturing video and still images is also mounted in the column 211 . the machine components are set on casters 217 with feet that can be retracted for moving or lowered to position a machine in a deployed location . fig2 b shows a standard configuration of the assembly . the robotized modular gantry 100 is shown connected to an inventory cabinet 212 a by bolting the upright c - channel structures 102 of the modular gantry 100 to upright c - channel beams 219 which are then affixed to the upright c - channel structures 220 of the inventory cabinet using additional bolts . power and controls are routed to the modular gantry via a wiring harness ( not depicted ) located on the bottom of the modular gantry . the cpu and power supplies ( detailed in fig4 and 5 ) are located in the bottom of the main inventory cabinet that is attached to a modular gantry . a second inventory cabinet 212 b can also be attached to the other side of the robotized modular gantry 100 using the same method of bolting the upright supports of the inventory cabinets 220 and the upright supports of the gantry 102 to a common upright c - channel support 219 . display doors 210 can be attached to the inventory cabinets via a piano hinge 218 running the full height of the door . the necessary electrical and control wiring connects via a wiring harness 221 located on the interior of the inventory cabinet near the hinge connection . these piano style hinges are located on the exterior corners of the inventory cabinets . they are covered with simple metal paneling if they are not in use . the totem doors 211 are attached in a similar manner using a piano hinge 218 . the necessary electrical and control wiring connect to a wiring harness located in the interior of the totem door ( wiring harness not depicted ). with primary reference directed to fig3 , a system consisting of a plurality of automated retail machines connected via a data connection to a centralized , backend operations center system has been designated by the reference numeral 300 . at least one automated retail machine 301 is deployed in a physical environment accessible by a consumer who can interact with the machine 301 directly . there can be any number of machines 301 , all connected to a single , remote logical operations center 330 via the internet 320 ( or a private network ). the operations center 330 can physically reside in a number of locations to meet redundancy and scaling requirements . the machine software is composed of a number of segments that all work in concert to provide an integrated system . logical area 302 provides the interface to deal with all of the machine &# 39 ; s peripherals such as sensors , keypads , printers and touch screen . area 303 handles the monitoring of the machine and the notifications the machine provides to administrative users when their attention is required . area 304 controls the reporting and logging on the machine . all events on the machine are logged and recorded so they can be analyzed later for marketing , sales and troubleshooting analysis . logical area 305 is responsible for handling the machine &# 39 ; s lighting controls . logical area 306 is the inventory management application . it allows administrative users on location to manage the inventory . this includes restocking the machine with replacement merchandise and changing the merchandise that is sold inside the machine . administrative users can set the location of stored merchandise and the quantity . logical area 307 is the retail store application . it is the primary area that consumers use to interface with the system . logical area 308 handles the controls required to physically dispense items that are purchased on the machine or physically dispense samples that are requested by a consumer . this area reads the data files that tell the machine how many and what types of inventory systems are connected to the machine . logical area 309 controls the inventory management system allowing authorized administrative users to configure and manage the physical inventory in the machine . area 310 controls the payment processing on the machine . it manages the communication from the machine to external systems that authorize and process payments made on the machine . area 311 is an administrative system that allows an authorized user to manage the content on the machine . this logical area handles the virtual administrative user interface described previously . the content can consist of text , images , video and any configuration files that determine the user &# 39 ; s interaction with the machine . the latter applications interface with the system through an application layer designated in fig3 by the reference numeral 312 . this application layer 312 handles the communication between all of these routines and the computer &# 39 ; s operating system 313 . layer 312 provides security and lower level messaging capabilities . it also provides stability in monitoring the processes , ensuring they are active and properly functioning . logical area 331 is the user database repository that resides in the operations center 330 . this repository is responsible for storing all of the registered user data that is described in the following figures . it is logically a single repository but physically can represent numerous hardware machines that run an integrated database . the campaign and promotions database and repository 332 stores all of the sales , promotions , specials , campaigns and deals that are executed on the system . both of these databases directly interface with the real - time management system 333 that handles real - time requests described in later figures . logical area 334 aggregates data across all of the databases and data repositories to perform inventory and sales reporting . the marketing management system 335 is used by administrative marketing personnel to manage the marketing messaging that occurs on the system ; messages are deployed either to machines or to any e - commerce or digital portals . logical area 336 monitors the deployed machines described in fig2 , and provides the tools to observe current status , troubleshoot errors and make remote fixes . logical area 337 represents the general user interface portion of the system . this area has web tools that allow users to manage their profiles and purchase products , items and services . the content repository database 338 contains all of the content displayed on the machines and in the web portal . logical area 339 is an aggregate of current and historical sales and usage databases comprised of the logs and reports produced by all of the machines in the field and the web portals . fig4 and 5 illustrate system wiring to interconnect with a computer 450 such as advantech &# 39 ; s computer engine with a 3 ghz cpu , 1 gb of ram memory , 320 gb 7200 rpm hard disk drive , twelve usb ports , at least one serial port , and an audio output and microphone input . the computer 450 ( fig4 , 5 ) communicates to the lighting system network controller via line 479 . through these connections , the lighting system is integrated to the rest of system . power is supplied through a plug 452 that powers an outlet 453 , which in turn powers a ups 454 such as triplite &# 39 ; s ups ( 900w , 15va ) ( part number smart1500lcd ) that conditions source power , which is applied to input 455 via line 456 . power is available to accessories through outlet 453 and ups 454 . computer 450 ( fig4 ) is interconnected with a conventional payment reader 458 via cabling 459 . a pin pad 485 such as sagem denmark int1315 - 4240 is connected to the cpu 450 via a usb cable . an optional web - accessing camera 461 such as a logitech webcam ( part number 961398 - 0403 ) connects to computer 450 via cabling 462 . audio is provided by transducers 464 such as happ controls four - inch speakers ( part number 49 - 0228 - 00r ) driven by audio amplifier 465 such a happ controls kiosk 2 - channel amplifier with enclosure ( part number 49 - 5140 - 100 ) with approximately 8 watts rms per channel at 10 % thd with an audio input though a 3 . 5 mm . stereo jack connected to computer 450 . a receipt printer 466 such as epson &# 39 ; s eu - t300 thermal printer connects to the computer 450 via cabling 467 . the printer is powered by a low voltage power supply such as epson &# 39 ; s 24vdc power supply ( part number ps - 180 ). a remote connection with the computer 450 is enabled by a cellular link 470 such as multitech &# 39 ; s verizon cdma cellular modem ( part number mtcba - c - ip - n3 - nam ) powered by low voltage power supply 472 . the cellular link 470 is connected to an exterior antenna 209 . a touch enabled liquid crystal display 474 such as a ceronix 22 ″ widescreen ( 16 : 10 ) touch monitor for computer operation also connects to computer 450 . a bluetooth adapter 487 such as d - link &# 39 ; s dbt - 120 wireless bluetooth 2 . 0 usb adapter is attached to the cpu allowing it to send and receive bluetooth communication . a wireless router 488 such as cisco - linksys &# 39 ; wrt610n simultaneous dual - n band wireless router is connected to the cpu to allow users to connect to the machine via a private network created by the router . digital connections are seen on the right of fig4 . gantry - y ( conveyor elevator ), stepper motor controller such as the arcus advanced motion driver + controller usb / rs485 ( part number arcus ace - sde ) connection is designated by the reference numerals 476 . 477 connects to the conveyor motor controller which can also be something similar to an arcus advanced motion driver + controller usb / rs485 ( part number arcus ace - sde ). dispenser control output is designated by the reference numeral 478 which operates the product collection wings motor 113 ( fig1 b ). the led lighting control signals communicate through usb cabling to a dmx controller 479 that transmits digital lighting control signals in the rs - 485 protocol to the display tube lighting circuit board arrays . an enttec - brand , model dmx usb pro 512 i / f controller is suitable . cabling 480 leads to vending control . one or more inventory systems can be connected to the vending control depending on the configuration . dispenser door control is effectuated via cabling 481 . façade touch sensor inputs arrive through interconnection 482 . motion sensor inputs from a motion sensor such as digi &# 39 ; s watchport / d ( part number watchport / d 301 - 1146 - 01 ) are received through connection 483 . a usb connection connects the product weight sensor 484 such as sartorius ( part number ff03 vf3959 ) that is located in the collection area to determine the presence of a dispensed item . fig5 illustrates a detailed power distribution arrangement 500 . because of the various components needed , power has to be converted to different voltages and currents throughout the entire system . the system is wired so that it can run from standard 110 v . a . c . power used in north america . it can be converted to run from 220 v . a . c . for deployments where necessary . power from line - in 455 supplied through plug 452 ( fig4 ) powers a main junction box 453 with multiple outlets ( fig4 , 5 ) that powers ups 454 which conditions source power , and outputs to computer 450 line 456 . power is available to accessories through main junction box 453 and ground - fault current interrupt ac line - in 455 . an additional ac outlet strip 501 such as triplite &# 39 ; s six position power strip ( part number tlm606nc ) powers led lighting circuits 502 and a touch system 503 . power is first converted to 5 volts to run the lighting board logic using a converter 540 . another converter , 541 , converts the ac into 24 volt power to run the lights and touch system . an open frame power supply 505 ( fig5 ) provides 24vdc , 6 . 3a , at 150 watts . power supply 505 powers y - controller 506 such as the arcus advanced motion driver + controller usb / rs485 ( part number arcus ace - sde ), that connects to y axis stepper motor 507 ( 117 fig1 c & amp ; 1d ). a suitable stepper 507 can be a moons - brand stepper motor ( part number moons p / n 24hs5403 - 01n ). power supply 505 also connects to a conveyor controller 508 , which can be an arcus - brand advanced motion driver + controller usb / rs485 ( part number arcus ace - sde ), that connects to a conveyor stepper 509 ( 111 in fig1 c & amp ; fig1 d ). a moons - brand stepper motor ( part number moons p / n 24hs5403 - 01n ) is suitable for stepper 509 . power supply 505 ( fig5 ) also powers dispenser controller 510 , dispenser door control 511 , and vending controller 512 . controller 510 powers collection wing motor 514 ( 113 fig1 c & amp ; 1d ) and door motor 515 . motors 514 and 515 can be canon - brand dc gear motors ( part number 05s026 - dg16 ). controller 512 operates conveyor motors 516 such as micro - drives dc gear motor ( part number m32p0264ysgt4 ). the logo space 201 ( fig2 ) is illuminated by lighting 518 ( fig5 ) powered by supply 505 . supply 505 also powers lcd touch screen block 520 ( fig5 ) such as a kristel 22 ″ widescreen ( 16 : 10 ) lcd touch monitor with usb connection for the touch panel . ups 454 ( fig5 ) also powers an ac outlet strip 522 that in turn powers a receipt printer power supply 523 such as epson &# 39 ; s 24vdc power supply ( part number ps - 180 ) that energizes receipt printer 524 such as epson &# 39 ; s eu - t300 thermal printer , an audio power supply that powers audio amplifier 527 such a happ controls kiosk 2 - channel amplifier with enclosure ( part number 49 - 5140 - 100 ), and a low voltage cell modem power supply 530 that runs cellular modem 531 such as multitech &# 39 ; s verizon cdma cellular modem ( part number mtcba - c - ip - n3 - nam ). a proximity sensor 214 ( fig2 ) such as a digi watchport / d part number 301 - 1146 - 01 is connected to the cpu 450 . 532 is a door sensor and actuator such as hamlin &# 39 ; s position and movement sensor ( part 59125 ) and actuator ( part 57125 ) which are connected to the cpu 450 . subroutine 600 ( fig6 ) illustrates the preferred method of initializing the machine and inventory and dispensing system at system runtime . the process begins at step 601 when the system application is launched . step 602 reads in and parses the lighting xml file 603 . the lighting file contains a sequence of lighting sequences to be performed for various user actions on the system such as selecting a product or category , adding to the virtual shopping bag and removing it from the shopping bag . these lighting sequences dictate both the onscreen coloring of products in the virtual display and the lighting of products in the physical display . these values are cached in local memory as an application variable . step 604 checks if there are any fatal errors . fatal errors are ones that prevent the system from allowing a user to complete a transaction . all errors are logged using the reporting and logging system 303 ( fig3 ). non - fatal errors are noted in the log file so they can be examined later to correct the issue . if the error is fatal , the process goes to step 605 where the user is notified of an error and given customer support information and an alert notification is sent out to the notification system 303 ( fig3 ). the system is placed in an idle state where the touch screen will display a message noting that the machine is currently not in service . the system will attempt to recover in step 606 by attempting to start the application process again and reinitialize the system . if there are no fatal errors , the process continues to step 607 that reads in and parses the planogram file 608 . the planogram file contains the product identification number , or item identification number , a product name and a boolean value if it is active or not for each display slot number . these values are cached in local memory as an application variable . step 609 checks if there are any fatal errors . if there are fatal errors , it routes to step 605 , otherwise the process continues at step 610 . step 610 reads in all of the inventory xml files . these files instruct the system on what inventory cabinets are attached to the machine and what inventory is in what inventory slots . each inventory slot is designated by the cabinet it is located in , the shelf it is on , the size of the inventory slot and the motors that drive the dispensing mechanism . using this information , the application can determine the shelf location ( height ). the xml file information is cached and then accessed during product dispensing to guide the robotic gantry elevator to the correct shelf height to collect a product . the dispensing motor information is used by the dispenser control to turn on the motor that dispenses the product until a mechanical switch is activated determining the product has been dispensed to the gantry elevator . because of the centralized layout of the robotic gantry , it does not matter which inventory system is connected or even what side from which the product is being dispensed . it only matters what shelf the product is on so the elevator can move to the correct height to collect the product . step 610 reads in all of the screen templates 611 that determine the layout of the visual selection interface . step 612 checks if there are any fatal errors . if there are fatal errors , it routes to step 605 , otherwise the process continues at step 613 . step 613 reads in all of the screen templates 611 that determine the layout of the user interface and all of the screen asset files 614 associated with the screen templates 611 . these asset files can be images or extended markup files that represent buttons , header banners graphics that fit into header areas , directions or instructions that are displayed in designated areas , image map files that determine which area on an image corresponds represents which area on the physical facade or images representing the physical façade . these assets are cached into local memory in the application . step 615 checks if there are any fatal errors . if there are fatal errors , it routes to step 605 , otherwise the process continues at step 616 . step 616 reads and parses the product catalog files 617 . the product catalog stores all of information , graphics , specifications , prices and rich media elements ( e . g . video , audio , etc .) for each item or product in the system . each element is organized according to its identification number . these elements can be stored in a database or organized in a file folder system . these items are cached in application memory . step 618 checks if there are any fatal errors . if there are fatal errors , it routes to step 605 , otherwise the process continues at step 619 . step 619 reads in all of the system audio files 620 and the file that the stores the actions with which each audio file is associated . audio files can be of any format , compressed or uncompressed such as wav , aiff , mpeg , etc . an xml file stores the name of the application event and the sound file name and location . step 621 checks if there are any fatal errors . if there are fatal errors , it routes to step 905 , otherwise the process continues at step 622 . step 622 does a system wide hardware check by communicating with the system peripherals and controllers 302 and 308 ( fig3 ). step 623 checks if there are any fatal errors . if there are fatal errors , it routes to step 605 , otherwise the process continues at step 624 . step 624 launches the application display on the touch screen interface . the system then waits for user input 625 . subroutine 700 ( fig7 ) illustrates the preferred runtime method the machine uses to dispense items to an end user during a user session . the process begins at step 701 after a user completed a transaction that purchases the merchandise about to be vended . this process assumes that a separate process has already checked that the inventory is available for vending and it has been paid for . the routine is passed a list of items to be dispensed . for items that have multiple quantities , each item is listed as a separate item . step 702 reads this list into the process memory . step 703 determines if the dispensing system is busy processing another request . if the dispensing system is busy for any reason , step 704 pings the resource until it is free and then directs the process to step 708 where the first ( or next ) item in the list is read . step 705 is a timer that monitors step 704 to determine if the wait for the resource times out to a preset time . if it does , the process is considered to have an error and it directs control to step 706 that sends out an alert using the notification system designated by 303 ( fig3 ). step 707 attempts the recovery of the system by running any preprogrammed diagnostics and self repairing routines that check and restart power and communication links to the system . if the system cannot automatically recover , the machines goes into an idle state and a message is displayed on the main screen indicating the machine is currently out of service preventing users from using the system . if the system resources are free , step 708 reads the next item to be vended from the list and retrieves its associative information into memory . this information was originally loaded into the system as the inventory xml file 611 ( fig6 ) read into memory in step 610 . the item , or product id is used to retrieve this information . information associated with the identification number includes the items location in the inventory system ( shelf height and corresponding elevator position represented as the position the elevator needs to be in to properly collect the dispensed product ), the dispensing motors associated with vending the item from the inventory shelf and item details such as its name to prompt the user and its weight and dimensions which is used in conjunction with the product weight sensor 484 ( fig6 ) to determine a successful vend . step 709 uses this information to move the elevator tray assembly 107 ( fig1 a ) to the correct shelf height for the current item being vended . the elevator height is determined by preset position values that tell the stepper motor where to position itself on the vertical aspect of the gantry . the stepper motor has an encoder that communicates with the controller to verify the position . this combination of hardware allows the software to set a height value and have the stepper motor and the stepper controller ensure the correct position is attained . if there is a detectable error with the elevator mechanics , an error message is generated and sent out by step 706 . step 707 will again try to recover if possible . if the elevator assembly reaches the correct height and position as designated by the product information record , the product collection wings 106 ( fig1 a and 1b ) are expanded to create an extended landing area that will catch products coming off the inventory trays 213 ( fig2 ). if an error in this process is detected , an error message is generated and step 706 will send out an alert . otherwise , if the elevator is in position and the production collection wings are extended , step 711 will use the information retrieved in the product record to activate the motor ( s ) associated with that item of inventory . a mechanical switch is used to indicate that the motor has revolved enough times to properly dispense the product or item off the shelf at which point it falls on to the product collection wings and into the conveyor 105 ( fig1 a and 1b ). errors are again detected if present and routed to the notification system in step 706 . step 712 retracts the product collection wings so the elevator can freely move up and down in the dispensing assembly . this step also assists positioning the product on the conveyor where it can be delivered to the user later in the process . any detected errors in this step are routed to step 706 . if there are no errors , step 713 moved the elevator gantry to the user collection area . the movement of the elevator mechanically opens up the product collection area by activating levers that open the top and back of the area . if no errors are detected , step 714 notes which control activated the dispensing process . this is only relevant when the machine is configured for dual sided vending ( see fig9 and 11 ). step 715 then spins the conveyor in the direction of the user that initiated the dispensing process . if no errors were detected , step 716 repositions the elevator that reverses the mechanical operation that opened the back of the collection area and closed it sealing off the internal components of the machine from the user . if no errors were detected , step 717 turns on the lights in the collection area 204 ( fig2 ) and opens the exterior collection area door . step 718 prompts the user on the screen 202 ( fig2 ) to collect their product . step 719 monitors signals from the product weight sensor 484 ( fig4 ) records the weight and matches it against the product weight information stored in the inventory xml file 611 ( fig6 ). this sensor could also be a motion or light curtain sensor . if the item was not removed for a preset amount of time , the user is prompted again to collect their item in step 718 . if user does not collect their product after a set number of attempts , an error is generated . if the sensor determines the user has removed their item , the process continues to step 720 where the exterior door is closed and the product collection area lights are turned off . the system again monitors for any mechanical errors in this process ( line to step 706 not shown ). step 721 determines if there are any additional items in the list of items to be vended . if there are additional items to be vended , the process routes back to step 703 where it begins again for the next item . if there are no more items to be vended , the process ends at step 722 . with reference directed to fig8 , an alternative vending machine 800 constructed in accordance with the best mode of the invention incorporates a variant on the display module designated as 210 in fig2 a . in this version the display module has a plurality of generally square product viewing areas 801 that present an alternative display , different from the diamond and circle display windows designated at 206 and 207 respectively in fig2 a . with reference directed to fig9 , an alternative 900 ( fig9 ) shows an alternative configuration of the machine where it has been outfitted to dispense merchandise out of both the front and back of the machine . this machine has display modules 210 affixed to both sides of the inventory cabinet 212 . it also has a vertical control column 211 affixed to both sides of the central robotic gantry 100 . this configuration allows the unit to serve two people at the same time . with reference directed to fig1 , alternative machine 1000 represents a similar configuration but with only one inventory cabinet 212 and display module 210 . these are once again attached to the common centralized robotic dispensing gantry 100 . in this configuration a simple metal plate 1001 ( not shown ) cut the size of the dispensing system tower is affixed to the side where the inventory cabinet was attached in fig8 using the same bolts to secure the system . with reference directed to fig1 , another configuration of a vending machine 1100 utilizes the centralized robotic dispensing gantry 100 with one inventory cabinet and two display modules 210 and two vertical control columns 211 . as in fig9 , this configuration allows for two users to simultaneously interact with the machine while using only one robotic dispensing mechanim and sharing a common inventory cabinet .
| 6 |
in fig1 there is shown the lower part of a conventional snow discharge spout pipe 20 , forming part of a motor engine snow blower truck ( not shown ). this spout pipe lower part 20 is generally vertical , and is directly secured to and in communication with the interior of a snow receiving , ground skimming , open casing ( not shown ), usually mounted ahead of the snow truck . this snow casing includes the standard , transverse , high speed rotating worm screw , which collects and crushes ground packed snow and ejects same under centrifugal force through a snow outlet in the casing in open register with the bottom inner end of spout pipe 20 . the spout pipe 20 is elongated and curved away from its generally vertical base portion , so as to be able to discharge at a distance from the snow blower truck ( e . g . over the bed of a proximate snow transport truck ) the ground snow collected by the front loaded casing of the snow blower truck . the spout pipe 20 carries at its upper outer end a number of hingedly mounted telescopic spout pipe extensions ( not shown ), which will extend theoverall radius of curvature of the spout pipe to provide improved control as to the total lateral distance from the snow blower truck the snow can be ejected . these telescopic spout pipe extensions are e . g . of the type illustrated in u . s . pat . no . 3 , 075 , 813 issued in 1963 to the father of the present inventor . according to the invention , the telescopic spout pipe extensions are pivotable about a pitch axis relative to the spout pipe proper 20 , by control rod linkages 22 , only the lower portion of which is illustrated in fig1 - 2 . this lower portion of the control rod linkages 22 includes a lowermost , elongated , lead lever 24 , an upper , shorter lever 26 , and a link bar 28 pivotally interconnected at first pivot means 30 to both levers 24 and 26 . the lower end of lead lever 24 is pivotally interconnected at second pivot means 32 to a triangular plate 34 . plate 34 is provided with a vertical rail 36 slidingly mounted into the grooves of guide blocks 38 , the latter being anchored to the flat wall 40 of the lower portion of cross - sectionally quadrangular spout pipe 20 , in vertically spaced fashion . plate 34 is vertically movable relative to spout pipe 20 , in the same way as disclosed in aforementioned u . s . pat . no . 3 , 075 , 813 . short lever 26 is pivotally mounted to spout pipe flat wall 40 , about third pivot means 42 . pivot means 42 is located above pivot means 32 , and , relative to the radius of curvature of spout pipe 20 , is further located inwardly of a vertical plane orthogonally intersecting the spout pipe flat wall 40 at the location of pivot means 32 . the pivotal axes of pivot means 30 , 32 , 42 , remain parallel to one another , as well as orthogonal to the same one flat wall 40 from the four side walls of the cross - sectionally quadrangular snow chute 20 , at the pivotal engagement loci of pivot means 30 , 32 , 42 . as illustrated in fig3 - 4 , each elongated lever 24 , 26 , and link 28 includes a pair of socket joints 44 , 44 &# 39 ;, at opposite ends thereof . each joint 44 or 44 &# 39 ; pivotally carries a corresponding pivot means 30 , 32 , 42 . a socket joint 44 , illustrated in fig5 is mounted in a collar 48 having opposite flat faces 49 surrounding a large circular bore 46 . collars 48 are integrally formed , one at each end of levers 24 , 26 , 28 . socket joint 44 includes a pair of complementary , similar seating rings 50 , 50 &# 39 ;, which are fitted inside each bore 46 in opposite relation . each ring 50 ( 50 &# 39 ;) defines a diametrally smaller cylindrical body part 50a , snugly engaging a fraction of the bore 46 of collar 48 , and a diametrally larger shoulder part 50b , snugly overlapping most of the faces 49 of collar 48 . the two rings have at their inner axial end a precisely machined inner radial face 51 , both faces 51 being in mutual contact . when the two rings are thus in mutual contact , their radial shoulder face 53 makes a small clearance with the registering face 49 of collar 48 . the two rings shoulder parts 50b , 50 &# 39 ; b , are welded at their radially outermost edge , w , to the collar 48 . each ring 50 ( 50 &# 39 ;) further defines a radially inner , segmental , spherical , seating surface 50c ( 50 &# 39 ; c ), whereby both surfaces 50c , ( 50 &# 39 ; c ) form a spherical seat for a spherical ball . a rigid ( preferably metallic ) spherical ball 52 is seated in the seating rings 50 on the segmental spherical surfaces thereof 50c . the required precise clearance between the seating faces 50c , 50 &# 39 ; c of rings 50 , 50 &# 39 ; and ball 52 is automatically obtained when faces 51 are in contact . a ball and socket joint 44 , 44 &# 39 ;, is thus obtained , i . e . the ball 52 is freely rotatable and tiltable into the socket defined by the two seating rings 50 , 50 &# 39 ;, yet without play . the metal ball 52 has a cylindrical axial bore 54 , extending centrally through ball 52 and opening at opposite parallel flat faces 54a , 54b of ball 52 . the radially outward face of ball 52 is grooved at an intermediate section thereof to form a peripheral annular groove 56 . annular groove 56 communicates with bore 54 through a few small radial passages 58 , made in spheroid ball 52 . annular groove 56 is in turn in direct communication with the internal seating surfaces 50c , 50 &# 39 ; c , of rings 50 , 50 &# 39 ;. lubricating fluid is to be fed into the ball through bore 54 , and then through radial channels 58 into the annular groove 56 at the periphery of ball 52 . as spherical ball 52 is rotated , the lubricating fluid in groove 56 will spread over the interior surfaces 50c , 50 &# 39 ; c of the seating rings 50 , 50 &# 39 ;, with which it will eventually come in contact . this will allow continuous lubrication of the ball and socket joint 44 , 44 &# 39 ; as the levers 24 - 28 are pivoted during actuation of the control rod linkage 22 , since the ball 52 will be able to both rotate and tilt in all planes relative to the collar 48 . an elongated pivot shank or shoulder bolt 60 ( fig8 ) is engaged through axial bore 54 of metal ball 52 . shank 60 includes an intermediate , enlarged , cylindrical bearing part 62 , snugly engaged into the hollow ball axial bore 54 , while threaded part 64 and head part 66 of shank 60 project outwardly from spherical ball 52 on opposite sides thereof . an axial channel 68 opens at the end of threaded part 64 and into at least one ( and preferably a few ) radial channel ( s ) 70 , made within bearing part 52 . radial channel 70 in turn opens into an annular groove 72 made on the radially outer surface of bearing cylindrical part 62 . groove 72 of shank 60 is to come in continuous register with the fluid intake port ( the radially inner mouth of radial channel 58 ) of metal ball 52 . axial channel 68 outwardly opens within an enlarged mouth 64a . a lubricating fluid valve 74 is threadingly fitted into the enlarged mouth . valve 74 may be of the type known under the trade name zerk . valve 74 is periodically fed manually with lubricating fluid , to incrementally fill up the lubricating fluid inside axial channel 68 and radial channel 70 . channels 58 , 68 , 70 , and annular grooves , 56 , 72 ,-- which are in communication with one another -- in turn constitute a reservoir of lubricating fluid , wherein continuous feeding of the latter to the interface between ball 52 and socket 50 , 50 &# 39 ;, can be achieved during joint rotation . the external surface diameter of the shank intermediate bearing part 62 should be substantially equal to the diameter of the spherical ball axial bore 54 , so that shank part 62 engages with a friction fit . head part 66 is tightened against one flat face 54a or 54b of ball 52 by a self - locking nut 55 , screwed on bolt threaded part 64 , and abutting against the other flat face 54b or 54a . diametrally largest head part 66 of shank 60 is to abut flatly against the exterior lateral side surface of wall 40 of snow chute 20 , and to be welded in position by weld means w . according to an important feature of the invention , the flat outer free surface 66a of head part 66 axially carries a sharp , conical marker tip 76 , projecting outwardly from the plane of surface 66a orthogonally thereof . marker tip 76 , which is made of hardened steel as is shoulder bolt 60 , is to be driven into the outer surface 40a of the snowblower casing wall 40 , thus defining a v - shape cavity 40b , through a fraction of the thickness of metal casing 40 , as suggested in fig6 to therefore precisely position shank 60 during welding to casing 40 by weld means w . hammer blows are applied axially against the free end of the shank opposite end part 64 , with the zerk valve 74 being previously removed . marker tip 76 is advantageous during installation of the control rod linkages 22 to the snow blower chute 20 , since it enables precise spatial positioning of the pivot means 42 relative to the casing wall 40 , as well as corresponding precise spatial positioning of the pivot means 32 on the triangular plate 34 . marker tip 76 is especially useful when restoration work is effected on a used snow blower chute wherein the old pivot pins welded to the casing walls 40 are cut off and the shoulder bolts 60 welded to walls 40 at the old pivot pin positions . it is understood from fig2 that pivot means 30 consists of a single shank 60 &# 39 ; which is free of casing 40 , and which extends through three sets of ball and socket joints 50 , 52 , at the corresponding transversely registering ends of link bars 24 , 26 , 28 . the shank 60 of pivot means 42 is anchored directly to casing wall 40 , clearing the top edge of triangular plate 34 but in spaced substantially overlying register . the shank 60 of pivot means 32 is also secured to casing 40 ( albeit indirectly , through elements 34 , 36 , 38 ,) and is outwardly offset from said casing wall 40 relative to the vertical plane intersecting said pivot means 42 . hence , the effective operation of the control rod linkages 22 will be very long lasting , because the pivot joints 30 , 32 , 42 , will adapt to accidental twisting of one of the link arms 24 , 26 or 28 due to bending of the discharge spout 20 or discharge pipe extension parts under time - induced wear . indeed , link arms 24 - 28 are originally exactly parallel to one another , but after a certain time in use , the snow chute 20 may become damaged under repeated impacts from hard materials collected with the snow during snow removal , and this damage to the snow chute may in turn tilt the link arms from the control rod linkages . with the present link arm joint , such tilting will not affect the relative pivotal motion capability of the link arms 24 , 26 , 28 . in the alternate embodiment of shank member illustrated as 60 &# 34 ; in fig8 - 9 , the sharpened tip 76 at the central portion of the free face 66a of cylindrical part 66 , is made bigger as shown at 76a and is associated with a sharpened ring 176 protruding from the peripheral section of the free circular face 66a &# 39 ; of head part 66 &# 39 ;. hence , beside making a central hole 40b into wall 40 , as in the first embodiment of shank 60 at fig6 an annular groove ( not shown ) is also made into surface 40a of wall 40 by knife ring 176 . such a double marking means 76a , 176 , on shank 60 &# 34 ;, is at least as efficient as the single tip of the first embodiment of shank 60 . if desired only knife ring 176 can be used .
| 8 |
in its broadest sense , the invention comprises the use of a polymer or chromophore with luminescent properties that are either enabled ( in the case of the chromophore ) or disabled ( in the case of the polymer ) in the presence of a compound to be detected , and methods of using said polymer and / or chromophore to detect such compounds . in addition , the invention includes a method of producing the polymer and chromophore . in a preferred embodiment , a polymer is produced that ceases to fluoresce when contacted with an organophosphate , neurotoxin , pesticide , metal ion , biological agent ( or combinations thereof ) or other types of compounds containing at least one halogenated group . specific examples of halogenated neurotoxins include sarin , soman , gf , and dfp . while the present invention specifically refers to the use of detection agents for use in detecting neurotoxins , it is to be understood that the present invention is useful for detection of numerous compounds that contain one or more of the functional groups of interest . in contrast to the polymer , the chromophore of the present invention fluoresces when contacted with an organophosphate , neurotoxin , pesticide , metal ion , biological and / or other types of compounds containing either a halogenated or methoxy - functional group . the respective modes of detection of the polymer and the chromophore allow an effective dual means of detecting and identifying various compounds containing a halogenated and / or methoxy group . for instance , the chromophore can be used to generally detect the presence of a neurotoxin . once a neurotoxin is detected , the polymer can be used to more specifically identify whether the neurotoxin is one containing a halogenated group . alternatively , the polymer and chromophore can also be used individually to detect the presence of various halogenated and / or methoxylated neurotoxins . the backbone of the polymer is generally made up of some combination of at least one of aminopyrazines , pyrazine , aminopyridine , or any amine containing an aromatic moiety ; one or more of thiophene , pyridine , bipyridine , quinoline , isoquinoline , paraphenylene , hydroxyl paraphenylene , a phenyl group , or any hetero aromatic system . the backbone has a total number of between 1 and 100 units , with about 5 - 20 being preferred . the backbone preferably consists of pyrazine , aminopyridine , or aminopyrazine , with aminopyrazine being most preferred . wherein r 1 is h , alkyl , cycloalkyl , benzyl , or any aromatic , heteroaromatic , or heterocyclic group ; and n is an integer between 1 and 100 ; and r 2 is a c 6 - c 15 alkyl chain . again , n is preferably 5 - 20 . most preferred polymers of this invention have the following general formula : wherein r 1 is h , alkyl , cycloalkyl , benzyl , or any aromatic , heteroaromatic , or heterocyclic group ; and n is an integer between 1 and 100 , with 5 - 20 being preferred . the chromophore of the present invention has the following general formula : wherein r is h , nh 2 , an aliphatic chain , or an aromatic group . the aliphatic chain is preferably c 1 - c 8 . preferred chromophores of the invention have one of the following formulas shown below : the chromophore and polymer are generally prepared by suzuki coupling reactions . such reactions are well known and understood in the art . in general , an organoborane is reacted with an organic halide in an organic solvent , such as tetrahydrofuran ( thf ) and ethers . this reaction preferably occurs in a nitrogen atmosphere with vigorous stirring at a temperature between 90 - 110 ° c . however , other temperatures , atmospheres , and reaction conditions are also appropriate , as would be understood to persons skilled in the art . the use of a palladium catalyst is also preferred . once the reaction is complete , the organic phase is separated and the polymer precipitated therefrom . the precipitated polymer is then separated and dried using conventional means or can be retained in solution . in the absence of neurotoxins , the polymer fluoresces in the presence of ultraviolet light . however , upon contact with the halogenated phosphate esters of neurotoxins , the polymer quenches the fluorescence of the neurotoxin , thereby facilitating its detection . this fluorescence quenching is the result of the nh 2 group of the conducting polymer hydrolyzing the halogenated phosphate ester and releasing acid which in turn oxidizes the polymer . the detection of the organophosphate molecule by the change in fluorescence characteristics of the polymer occurs quite rapidly , typically in less than three seconds . given this fast response time , the polymer is particularly suited for use in optoelectronic sensors . in addition to the above - described polymer , a non - polymeric chromophore may also be used to detect the presence of the organophosphates and other biological agents already described above . the chromophore has the reverse fluorescence characteristics as the polymer , meaning that in the absence of organophosphate molecules , the chromophore does not fluoresce in the presence of ultraviolet light . the chromophore gains its fluorescence under ultraviolet light when a neurotoxin containing either a methoxy or halogenated group is present . the fluorescence is the result of the reaction of the oh of the chromophore with these functional groups . the chromophore and polymer have different mechanisms of action to detect the presence of organophosphates or other compounds . generally , the polymer hydrolyzes the halogenated phosphate ester of the organophosphate molecule and releases acid , which in turn oxidizes the polymer . this leads to formation of imine form of the polymer , which is not fluorescent after binding with the organophosphate . this imine form is depicted below : cyclic voltammetry shows that the polymer is oxidized in two steps , and the eis measurement shows an increase in resistivity with oxidation . it is the increase in resistivity that explains the quenching of the fluorescence in response to the presence of organophosphate or other molecules capable of detection . fig3 illustrates the intensity of fluorescence of unbound polymer compared to polymer bound to dmcp . fig4 illustrates that polymer bound to dimethylmethylchlorophosphonate ( a non - halogenated neurotoxin ) has the same intensity of fluorescence as unbound polymer . as noted , the chromophore detects the presence of organophosphates or other detectable molecules by interaction between the hydroxyl group and the methoxy or halogenated group of the neurotoxin molecule . this leads to a cyclization reaction which in turn produces the fluorescent molecule depicted below . the overall reaction is also shown : where a − is po 2 ( och 3 ) 2 − . fig1 is a graph showing the emission spectra of the most preferred chromophore of the present invention ( as shown above ) with dimethylchlorophosphonate ( dmcp ). based on the above - described mechanisms of action , the chromophore and polymer described are able to detect a wide variety of compounds . the chromophore can detect any neurotoxin having a methoxy or halogenated group , and the polymer will detect halogenated neurotoxins specifically . detectable compounds include organophosphates having the requisite halogen or methoxy group , such as sarin , cyclosarin , soman , tabun , diisopropylfluorophosphate , diethylchlorophosphate , ve , vg , vm , vx , metrifionate , pyridostigmine , and physostigmine ; explosives such as plastic explosive or trinitrotoluene ; and metal ions , such as iron , cobalt , nickel , copper , a transition metal ion , or a main group metal ion . for years military force have used detection devices to identify these same materials but even today &# 39 ; s best detection measures may require minutes for the user to receive an accurate alert to a potential hazard . some detectors are quicker but they also provide more false alerts . the polymer and chromophore of the present invention can accurately identify trace amounts of poisons or explosives having halogen and / or methoxy functional groups in seconds . these detection molecules can detect leaks in shipping containers of certain industrial chemicals , detect certain explosive compounds and detect an entire family of neurotoxins . in addition to giving advanced notice to the presence of hazards , the detection molecules can be used to authenticate the elimination of chemical agents or toxic substances during an investigation or clean - up operation . the polymers of the present invention notify users via multiple feedback methods . they can be set to fluoresce in ultraviolet light yet remain clear in visible light . when in this mode , the fluorescence will quench as a toxic substance or explosive compound comes into contact it . alternatively , the chromophore can provide no initial ultraviolet fluorescence , but fluoresces upon exposure to a toxic substance or explosive compounds . the detection molecules of this invention also have the unique property of providing enough electrical activity upon coming into contact with a hazardous substance so that it can be integrated into many of today &# 39 ; s existing electrical sensors . rapid alert notification to the presence of a fast acting neurotoxin is extremely important . many chemical agents cause injury or death in less than a minute . speed is also essential when multiple yet rapid and economical detections must be made ( for example , hand screening of luggage ). the detection molecules of the present invention provide accurate detection within 2 to 3 seconds of contact with a target substance as compared to minutes with similar technologies . these unique molecules are designed to detect trace amounts of : the entire family of halogenated chemical compounds with very high selectivity ; the chemical warfare agents vx , gf , gb ( sarin ), gd , ( soman ) and ga ( tabun ); explosives ( various plastic explosives and tnt ); and pesticides ( organo - phosphonates like dfp and dmmp ). the detection molecules need only be applied in strengths ranging from parts - per - millions to part - per - billions . further , under certain circumstances , the molecules can be reconditioned for repetitive use . the detection molecules of the instant invention can be applied separately or together , and as an individual coating or mixed with other coatings . they can be sprayed or painted on to a surface , and can be applied to such simple materials a tape or cloth swabs , or applied to much more complex devices such as electronic sensors or electronic noses . sensors incorporating either or both of the chromophore and / or polymer can be easily used in any location in which fast detection of neurotoxins is desired . examples might include potential targets for terrorist attacks , such as subways , airports , aircraft , or government buildings . the basic performance and functionality of these molecules in detecting neurotoxins have been verified with fluorescence measurements , impedance testing and cyclic voltammetry . in addition to being used to detect neurotoxins in the context of terrorism or chemical warfare , the polymer and chromophore described can also be used to detect the presence of organophosphates in the context of medical diagnosis or treatment monitoring . in fact , the polymer and chromophore may be used to detect neurotoxins in virtually any desired application . the following examples are offered to illustrate but not limit the invention . thus , they are presented with the understanding that various formulation modifications as well as method of delivery modifications may be made and still be within the spirit of the invention . a preferred polymer of the present invention was prepared by the following method : 2 , 5 - dibromohydroquinone 3 ( 40 . 2 g , 0 . 15 mol ) was dissolved in a solution of sodium hydroxide ( 9 . 2 g , 0 . 23 mol ) in 1 . 5 l of absolute ethanol at room temperature under nitrogen atmosphere . the reaction mixture was warmed to 50 - 60 ° c . with constant stirring . the dodecylbromide ( 36 ml , 0 . 15 mol ) was added drop wise to the above reaction mixture at 60 ° c . after 10 h of stirring under nitrogen atmosphere , the reaction mixture was cooled and the precipitate formed was filtered and washed with methanol . this precipitate was identified as dialleylated - 2 , 5 - dibromohydroquinone as a side product . the filtrate was evaporated to remove the solvent . 2 l of distilled water was added to the residue and the mixture was acidified with 36 % hcl , boiled gently for 1 h and cooled . the resulting precipitate was collected by filtration , washed with water and dried in vacuo . the crude product was purified by column chromatography using a mixture of solvents ( ch 2 cl 2 : hexanes , 4 : 6 ) to get the pure product in 60 % yield . 1 h nmr , ( cdcl 3 , δ ppm ): 7 . 25 ( s , 1h ,), 6 . 97 ( s , 1h ), 5 . 16 ( s , 1h ), 3 . 92 ( t , 2h ), 1 . 62 ( q , 2h ), 1 . 4 ( m , 18h ); 0 . 88 ( t , 3h ). 1 h nmr ( cdcl 3 , δ ppm ): 7 . 25 ( s , 1h ), 6 . 97 ( s , 1h ), 3 . 92 ( t , 2h ), 1 . 80 ( q , 2h ), 1 . 4 ( m , 18h ); 0 . 87 ( t , 3h ). 13 c nmr ( cdcl 3 , δ ppm ): 149 . 95 , 146 . 64 , 120 . 16 , 116 . 49 , 112 . 34 , 108 . 26 , 70 . 25 , 31 . 81 , 29 . 55 , 29 . 47 , 29 . 26 , 29 . 20 , 28 . 97 , 25 . 82 , 22 . 60 , 14 . 04 . benzyl bromide ( 3 . 8 ml , 0 . 031 mol ) was added drop wise to a stirred solution of 2 , 5 - dibromo - 4 - dodecyloxy phenol ( a ) ( 6 . 95 g , 0 . 015 mol ) and anhydrous k 2 co 3 ( 3 . 28 g , 0 . 023 mol ) in 700 ml of absolute ethanol at 40 - 50 ° c . the reaction mixture was stirred for 10 h at 50 ° c ., progress of the reaction was monitored using tlc , cooled to rt and evaporated to remove the solvent . an equal volume of distilled water was added to the residue and the mixture was stirred for one hour at 0 ° c . the resulting precipitate was collected by filtration , washed with water , and dried in vacuum . recrystallization was done in methanol to get 80 % yield . 1 h nmr ( cdcl 3 , δ ppm ): 7 . 46 ( m , 5h ), 7 . 21 ( s , 1h ), 7 . 15 ( s , 1h ), 5 . 11 ( s , 2h ), 3 . 99 ( t , 2h ), 1 . 85 ( q , 2h ), 1 . 32 ( m , 18h ), 0 . 95 ( t , 3h ). 13 c nmr ( cdcl 3 , δ ppm ): 150 . 51 , 149 . 49 , 136 . 16 , 128 . 50 , 128 . 10 , 127 . 17 , 119 . 32 , 118 . 31 , 111 . 53 , 111 . 01 , 71 . 99 , 70 . 19 , 31 . 83 , 29 . 56 , 25 . 84 , 22 . 60 , 14 . 02 1 . 6 m solution of butyl lithium in hexanes ( 55 ml , 0 . 088 mol ) was added slowly to a solution of dibromide b ( 11 . 57 g , 0 . 022 mol ) in a mixture of solvents diethyl ether ( 150 ml ) and thf ( 150 ml ) under nitrogen atmosphere at − 78 ° c . the solution was warmed to rt and cooled again to − 78 ° c . triisopropyl borate ( 51 ml ) was added drop wise within 2 h . after complete addition , the mixture was warmed to rt and stirred overnight . water was added and the mixture stirred for 24 h . the crystalline mass was recovered by filtration . the product was re crystallized from acetone in 80 % yield . 1 h nmr ( dmso - d 6 , δ ppm ): 7 . 80 ( s , 2h ), 7 . 75 ( s , 2h ), 7 . 46 ( m , 5h ), 7 . 29 ( s , 1h ), 7 . 17 ( s , 1h ), 5 . 11 ( s , 2h ), 3 . 99 ( t , 2h ), 1 . 73 ( q , 2h ), 1 . 24 ( m , 18h ), 0 . 85 ( t , j = 6 hz , 3h ). 13 c nmr ( dmso - d 6 , δ ppm ): 157 . 00 , 156 . 22 , 137 . 16 , 128 . 38 , 127 . 77 , 127 . 52 , 118 . 28 , 117 . 70 , 70 . 05 , 68 . 30 , 31 . 2 , 28 . 89 , 25 . 38 , 22 . 00 , 13 . 87 . diboronic acid c ( 8 . 2 g , 0 . 018 mol ) and trimethylene glycol ( 5 . 2 in ], 0 . 072 mol ) were added to toluene ( 150 ml ) at rt . then the reaction mixture was refluxed for 3 h . the solvent was removed by rotovap . the residue was dissolved in chcl 3 , dried over sodium sulfate and filtered . the solution was evaporated and the residue was re crystallized from hexanes . the recrystallized product was used without further purification for polymerization . 1 h nmr ( cdcl 3 , δ ppm ): 7 . 35 ( m , 5h ), 5 . 05 ( s , 2h ), 4 . 16 ( d , 8h ), 3 . 85 ( t , 3h ), 2 . 02 ( m , 4h ), 1 . 57 ( m , 2h ), 1 . 27 ( m , 18h ), 0 . 88 ( t , 3h ). 13 c nmr ( cdcl 3 , δ ppm ): 157 . 73 , 156 . 92 , 138 . 28 , 128 . 06 , 127 . 00 , 120 . 42 , 119 . 79 , 71 . 70 , 69 . 70 , 61 . 91 , 31 . 81 , 29 . 55 , 27 . 22 , 25 . 98 , 22 . 57 , 14 . 01 . under absence of light and at 0 ° c ., n - bromosuccinimide ( 15 . 68 g , 88 . 1 mmol ) was added to a solution of 2 - aminopyrazine ( 4 . 19 g , 44 . 06 mmol ) in dry dichloromethane ( 250 ml ). the mixture was stirred for 20 h at 4 ° c . and then washed with four 40 ml portions of a saturated sodium carbonate solution in water . the organic layer was dried ( mgso4 ) and evaporated under reduced pressure , affording the title compound as 12 . 8 g of a light brown solid . column chromatography , using silica and a dichloromethane / ethyl acetate ( 3 / 1 ) mixture as the eluent , yielded pure 2 - amino - 3 , 5 - dibromopyrazine as 5 . 00 g ( 65 %) of a light yellow solid . 1h - nmr ( cdcl 3 , 400 mhz ): 8 . 09 ( s , 1h ), 4 . 95 ( 211 , nh ) ppm . 13c - nmr ( cdcl 3 ): 153 . 5 ( c - 2 ), 144 . 3 , 31 . 9 , 126 . 8 ppm diboronic ester d ( 0 . 97 g , 0 . 186 mmol ) and dibromo aminopyrazine e ( 0 . 458 , 0 . 186 mmol ) were added to dry thf ( 10 ml ) under nitrogen atmosphere . 2m na 2 co 3 ( 15 ml ) was added to this followed by palladium catalyst tetrakis ( triphenylphosphino ) palladium ( 1 . 5 mol % with respect to monomer d ). the mixture was then heated to 100 ° c . for 72 h in a flask with vigorous stirring . after the reaction , the organic phase was separated and the polymer precipitated from hexane . the precipitated polymer was separated and dried to yield 0 . 5 g of polymer ( yield = 60 %). gpc analysis showed a number average molecular weight of 5300 . a ) benzyl bromide ( 7 ml , 0 . 05 mol ) was added drop wise to a stirred solution 2 bromo phenethyl alcohol ( 10 g , 0 . 0496 mol ) and anhydrous nah ( 2 . 28 g , 0 . 05 mol ) in 100 ml of dry thf at 40 - 50 ° c . the reaction mixture was stirred for 10 h at 50 ° c ., progress of the reaction was monitored using tlc , cooled to rt and evaporated to remove the solvent . an equal volume of distilled water was added to the residue and the mixture was stirred for one hour at ambient . the organic layer was separated , dried and evaporated . to the resulting liquid 100 ml of 5 % ethanolic solution of naoh was added and refluxed for 3 hr . the resulting solution was evaporated and extracted with ether to give the benzyl protected phenethyl alcohol as a clear liquid at 80 % yield . 1h - nmr ( cdcl3 , 400 mhz ): 7 . 5 ( d , 1h ), 7 . 3 ( m , 7h ), 7 . 08 ( d , 1h ), 4 . 53 ( s , 2h ), 3 . 7 ( t , 2h ), 3 . 07 ( t , 2h ) ppm . 13c - nmr ( cdcl3 , 100 mhz ): 138 . 43 , 132 . 96 , 131 . 37 , 129 . 01 , 128 . 58 , 128 . 20 , 127 . 78 , 127 . 76 , 127 . 57 , 124 . 87 , 73 . 12 , 69 . 56 , 36 . 71 ppm . b ) 1 . 6 m solution of butyl lithium in hexanes ( 66 ml , 0 . 1 mol ) was added slowly to a solution of 2 - bromo o - benzyl phenethyl alcohol ( 9 . 7 g , 0 . 033 mol ) in a mixture of solvents diethyl ether ( 150 nil ) and thf ( 150 ml ) under nitrogen atmosphere at − 78 ° c . the solution was warmed to rt and recooled to − 78 ° c . triisopropylborate ( 23 . 1 ml ) was added drop wise within 2 h . after complete addition , the mixture was warmed to rt and stirred overnight . water was added and the mixture stirred for 24 h . the organic phase was separated and column chromatography of the resulting viscous liquid using dichloromethane as the eluent gave the boronic acid as white crystalline solid in 65 % yield . 1h - nmr ( cdcl3 , 400 mhz ): 7 . 8 ( d , 1h ), 7 . 4 ( t , 2h ), 7 . 3 ( m , 4h ), 7 . 2 ( d , 1h ), 7 . 1 ( d , 1h ) 4 . 53 ( s , 2h ), 3 . 75 ( t , 2h ), 3 . 07 ( t , 2h ) ppm . 13c - nmr ( cdcl3 , 100 mhz ): 143 . 78 , 136 . 79 , 134 . 15 , 130 . 44 , 129 . 32 , 128 . 69 , 128 . 20 , 127 . 95 , 126 . 13 , 73 . 74 , 72 . 47 , 36 . 89 ppm . c ) under absence of light and at 0 ° c ., n - bromosuccinimide ( 7 . 84 g , 44 . 05 mmol ) was added to a solution of 2 - aminopyrazine ( 4 . 19 g , 44 . 06 mmol ) in dry dichloromethane ( 250 ml ). the mixture was stirred for 20 h at 4 ° c . and then washed with four 40 ml portions of a saturated sodium carbonate solution in water . the organic layer was dried ( mgso4 ) and evaporated under reduced pressure , affording the title compound as 5 . 90 g of a light brown solid . column chromatography , using silica and a dichloromethane / ethyl acetate ( 3 / 1 ) mixture as the eluent , yielded pure 2 - bromo - 5 - aminopyrazine as 5 . 00 g ( 65 %) of a light yellow solid . 1h - nmr ( cdcl3 , 400 mhz ): 8 . 09 ( s , 1h , h - 6 ), 7 . 77 ( s , 1h , h - 3 ), 4 . 65 ( bs , 2h , nh ) ppm . 13c - nmr ( cdcl3 , 100 mhz ): 153 . 5 ( c - 2 ), 144 . 3 ( c - 6 ), 131 . 9 ( c - 3 ), 126 . 8 ( c - 5 ) ppm . d ) the boronic acid ( 0 . 8 g , 3 . 26 mmol ) and bromo pyrazine ( 0 . 56 g , 3 . 26 mmol ) were added to dry toluene ( 20 ml ) under nitrogen atmosphere . 2m na 2 co 3 ( 15 ml ) was added to this followed by palladium catalyst tetrakis ( triphenylphosphino ) palladium ( 1 . 5 mol % with respect to boronic acid ). the mixture was then heated to 80 ° c . for 48 h with vigorous stirring . the reaction mixture was evaporated , washed with water and the organic phase was separated . column chromatography of the compound using 1 : 1 ethyl acetate / hexane mixture gave 60 % of the required product . 1h - nmr ( cdcl3 , 400 mhz ): 8 . 15 ( s , 1h ), 8 . 01 ( s , 1h ), 7 . 25 ( m , 9h ), 4 . 58 ( s , 2h , — nh ), 4 . 6 ( s , 2h ), 3 . 6 ( t , 2h ), 3 . 01 ( t , 2h ) ppm . 13c - nmr ( cdcl3 , 100 mhz ): 152 . 95 , 145 . 20 , 141 . 98 , 138 . 65 , 137 . 71 , 137 . 33 , 131 . 28 , 130 . 85 , 130 . 10 , 128 . 56 , 127 . 80 , 127 . 71 , 126 . 73 , 72 . 97 , 71 . 20 , 33 . 64 . e ) the o - benzyl protected compound was dissolved in a mixture of dry thf ( 50 ml ) and absolute ethanol ( 50 ml ) at rt . 10 % pd / c ( 3 g ) was added to the above solution . the mixture was flushed with nitrogen gas three times . two to three drops of conc . hcl was added to enhance the debenzylation . the reaction was carried out at rt under positive pressure of hydrogen for 24 h with constant stirring . the reaction mixture was filtered through celite powder and the precipitate was washed with absolute ethanol . the filtrate was evaporated and dried in vacuum to yield the desired chromophore at 50 % yield . ih - nmr ( cdcl3 , 400 mhz ): 8 . 19 ( s , 1h ), 8 . 06 ( s , 1h ), 7 . 30 ( m , 4h ), 4 . 78 ( s , 2h , — nh ), 3 . 6 ( t , 2h ), 3 . 05 ( t , 2h ) ppm . 13c - nmr ( cdcl3 , 100 mhz ): 153 . 08 , 145 . 20 , 141 . 98 , 138 . 65 , 137 . 71 , 131 . 28 , 130 . 85 , 128 . 56 , 126 . 73 , 64 . 26 , 33 . 64 . having described the invention with reference to particular compositions , theories of effectiveness , and the like , it will be apparent to those of skill in the art that it is not intended that the invention be limited by such illustrative embodiments or mechanisms , and that modifications can be made without departing from the scope or spirit of the invention , as defined by the appended claims . it is intended that all such obvious modifications and variations be included within the scope of the present invention as defined in the appended claims . the claims are meant to cover the claimed components and steps in any sequence which is effective to meet the objectives there intended , unless the context specifically indicates to the contrary .
| 6 |
[ 0047 ] fig1 is a schematic of the major components of the drive system . from the stirrup ( a ), the drive line ( b ) is pulled downward , first through the initial drive pulley ( c ), which is located so as to provide an unobstructed path for the operator &# 39 ; s leg , then through routing pulley ( s ) ( d ) to moveable pulley ( s ) ( e ), and finally to drive spool ( f ), which drives the hub of the rear wheel . [ 0048 ] fig2 illustrates the spiral cone configuration of the drive spool , which , in conjunction with the moveable pulley ( s ) ( fig1 e ), allows for drive - ratio variation . [ 0049 ] fig3 is a schematic illustrating the action of the operator &# 39 ; s leg when driving the system . in fig3 a , b , and c , the leg is shown at three positions : a : fully retracted at top of stroke ; b : at mid - point of stroke ; and c : fully extended at bottom of stroke . subordinate numbering in all three views ( a , b , and c ) refers as follows : 1 : center of hip joint ; 2 : center of knee joint ; 3 : center of ankle joint ; and 4 : center of “ ball ” of foot . fig3 d shows the location of the initial drive pulley , which is critical both to establishing the desired path of travel for the leg and to providing clearance between itself and the shin portion of the leg . fig3 e incorporates fig3 a , b , and c to demonstrate the action of the operator &# 39 ; s leg when operating the system . the path of travel ( the line established in fig3 a , b , and c by points 1 and 4 ) is actually determined by point 1 and by the point on the initial drive pulley d at which the drive line emerges therefrom toward the stirrup at point 4 . this path will automatically be sought by the operator &# 39 ; s leg as it is extended against the resistance provided by the work of driving the system ; thus , deliberate control by the operator of the leg &# 39 ; s path of travel is required only on the return , or retraction , stroke . [ 0051 ] fig4 and 5 comprise a top - view schematic of the entire system as employed in the preferred embodiment , which is an upright bicycle . in addition to the elements already discussed , this figure also demonstrates the design and function of the system for rewinding of the drive spools . for the purpose of clarity , only one drive line is shown in these figures , this being the line n driving spool e from initial pulley a , which , along with initial pulley f and routing pulleys b and g , is mounted to frame crossmember m . an identical and separate drive line , not shown in the figures , drives spool k from initial pulley f in a manner identical to that of drive line n . [ 0052 ] fig6 is an end view of the positioning of the moveable drive - line routing pulleys ( c and d for drive line n ; h and j for drive line not shown ) on the shifter ( fig5 v ). the mounting of rewind - system pulleys ( fig5 r and t ) is not shown because , due to the much lower tension of the rewind system , the location of these pulleys is critical only in ensuring non - interference with the drive lines . drive line n follows a diagonal path through the frame as it passes around pulleys c and d ( routing pulley [ fig4 b ] aligns drive line n for proper entry into the shifter ); emerging from the shifter at pulley d , it travels directly to drive spool ( fig4 e ), to whose small - diameter end it is anchored . the other drive line ( not shown ), which travels from initial pulley f , through routing pulley g , then through shifter pulleys h and j to drive spool k , is prevented from interfering with drive line n by positioning one diagonally - opposed pair of shift pulleys ( e . g ., h and j ) slightly forward of the other pair ( e . g ., c and d ). this diagonal routing of the drive lines through the shifter and frame neutralizes lateral forces exerted on the shifter body and on the frame segment on which it slides . this important neutralizing balance is further ensured by ( 1 ) maintaining straightness in the entire frame segment shown as fig4 and 5l such that the shifter travels along a line which , if extended rearward , will intersect the center of the hub ; ( 2 ) locating the drive - line routing pulleys on the shifter so as to align properly with the drive spools at the hub ; and ( 3 ) aligning routing pulleys ( fig4 b and g ) properly with the shifter . each drive line is anchored to its respective drive spool at the spool &# 39 ; s small - diameter ( app . 1¼ ″) end ; at the drive - ratio setting illustrated in fig4 it engages the whole of the spool &# 39 ; s spiral groove , emerging at the large - diameter ( app . 2½ ″) end . when the line is pulled downward by the stirrup , it will drive its spool at a relatively high drive - to - driven ratio , or what is normally referred to as a “ low gear ”. each such downward stroke will rotate the spool approximately 1½ turns , so that only the large - diameter segment of the spool is actually being employed to drive the hub . when the shifter ( fig5 v ) is moved along the frame ( fig5 l ) in the direction away from the hub , some of the drive line will be unwound from each spool such that a downward stroke with the shifter in this forward position will drive the spool in “ high gear ”. since there is no inherent limit to the number of locating positions possible for the shifter within its range of travel , this system provides infinite variability of drive ratio within its limits . furthermore , since the diameter of the spool &# 39 ; s spiral groove is not constant at any point , the drive ratio will decrease incrementally ( toward a “ higher gear ”) during every downward stroke . due to the fact that the strength of the operator &# 39 ; s leg increases as it is extended , this phenomenon represents an added advantage to this system . rewinding of the drive lines onto the drive spools during the return stroke is accomplished by a separate rewinding line ( fig4 ). this single line , with its ends anchored to both drive spools at their large - diameter ends , uses the forward rotation of the spool being driven at any given moment to rewind the other spool . the line , routed from one spool to the other around the front of the frame , must also be routed through the shifter in the direction opposite to that of the drive lines in order to accommodate the simultaneous same - direction rotation of the spools during shifting . furthermore , since both of the drive lines are rewound by one rewind line , the rewind line must be routed twice through the shifter in order to establish an equality of alteration of the effective length of the respective lines . routing pulleys ( fig5 p , s , and u ), which are located at the front of the frame , and moveable pulleys ( fig5 r and t ), which are mounted to the shifter , accomplish the necessary routing . the rewind line utilizes the same spiral groove in the drive spools as do the drive lines . since the rewind line anchors to the end of each spool opposite to that at which the drive line is anchored , and since the action of the relative lines is opposed as well , no infringement occurs ; the rewind line is never closer than a half - turn of the spool to either drive line . a tensioner operating on the rewind line maintains tautness throughout not only the rewind system but both drive systems as well , due to the ability of the drive spools to rotate freely at all times in the rewinding direction . in the preferred embodiment , rewind pulleys ( fig4 p and u ) are mounted to a spring - loaded swingarm which has an operational range sufficient not only for rewinding during normal system operation but also for simultaneous rewinding of both drive spools so that both drive lines will retract fully to the initial drive pulleys when the stirrups are disengaged from the drive lines . this swingarm is not depicted in the drawings because the specific location and design of the tensioner are not critical to the system &# 39 ; s function and thus are not claimed by the inventor . also not claimed is the specific design of the stirrup ( s ), which will likely be incorporated into a specially constructed shoe with a hook at the top to facilitate engagement of the shoe - stirrup unit with its drive line . with the exception of the drive spools , all pulleys used are standard ball - bearing pulleys . the drive spools are preferably manufactured of aluminum and can be either machined or cast . they measure approximately 1½ ″ in width ; their diameter ranges from approximately 1¼ ″ to 2½ ″; and their spiral groove , whose width is ⅛ ″, runs approximately ten circuits around them . they contain press - fitted one - way roller clutches which drive the rear - wheel hub . the drive line utilizes a woven dacron material which is manufactured and marketed for use as parachute brake and steering line . this line is flexible and non - stretch , is ⅛ ″ in thickness , and possesses a breaking strength of 700 lbs . the rewind line , which is subjected only to the tension placed upon it by the tensioner , utilizes woven fishing line . in the preferred embodiment as an upright bicycle , only the lower frame segment and the drive / rewind system itself present any variation from standard bicycle layout and construction .
| 1 |
hereinafter reference is firstly made to fig1 to describe the basic concept of the disclosure via a diagrammatic view of a measurement arrangement according to the disclosure in a first embodiment . in fig1 references 110 and 120 denote portions of euv mirrors of a projection objective of a microlithographic projection exposure apparatus , wherein for the sake of simplicity hereinafter those portions are equated directly with the euv mirrors . in addition references 131 - 136 denote measurement sections or light channels , within which the light passes between the first euv mirror 110 ( the upper one in fig1 ) and the second euv mirror 120 ( the lower one in fig1 ). in that respect the beginning of each measurement section 131 - 136 or each light channel lies on one of the euv mirrors 110 , 120 and the respective end is on the other of the euv mirrors 120 , 110 . measurement sections or light channels 131 - 136 are designed so that they allow the relative position of the second euv mirror 120 with respect to the first euv mirror 110 to be determined in ( all ) six degrees of freedom . in that respect ultimately these six degrees of freedom include in the usual way three space co - ordinates and three angle co - ordinates for defining the unique relative position , but in accordance with the disclosure are ascertained by way of six length measurements along the measurement sections 131 - 136 . what is important in that respect is that those measurement sections 131 - 136 are sufficiently independent of each other or different from each other so that by virtue of the length measurements it is also actually possible to conclude all of the above - mentioned six degrees of freedom , in mathematically clearly resolvable fashion . the arrangement of the measurement sections or light channels 131 - 136 in fig1 corresponds to the geometry of a so - called stewart - gough platform ( also referred to as the ‘ stewart platform ’ or hexapod , see d stewart : ‘ a platform with six degrees of freedom ’, uk institution of mechanical engineers proceedings 1965 - 66 , vol 180 , pt 1 , no 15 ), in which respect however the ‘ legs ’ of the hexapod , that are usually implemented in corporeal fashion , are in the form of non - corporeal measurement sections . for explanatory purposes fig1 firstly shows a per se known hexapod with two plates 10 , 20 which are connected together by way of six ‘ legs ’ 31 - 36 and are movable relative to each other . in that respect in the illustrated situation ( with one concrete arrangement both of the legs 31 - 36 and also the plates 10 , 20 relative to each other ), taking the length of the connections or legs 31 - 36 between the two plates 10 , 20 , it is possible to calculate the position of the one (‘ moved ’) plate relative to the other (‘ base ’) plate , with respect to all six degrees of freedom . the equations to describe the geometrical relationship between the two plates / euv mirrors are polynomials . in that respect each degree of freedom x , y , z , rx , ry , rz can be described with a polynomial . the mathematical properties of the resulting equation systems , the question of resolvability and optionally the construction of equations are discussed for example in andrew j sommerse , charles w wamper : ‘ the numerical solution of systems of polynomials ’, word scientific publishing , singapore , 2005 , and are well - known to those skilled in the art . it is to be noted that positions of the legs or plates are possible , which are singular , which for the familiar mechanical stewart - gough platform as shown in fig1 signifies that the plates 10 , 20 can no longer be moved out of that position via changes in length of the legs 31 - 36 , that is to say the platform is blocked in itself . for the concept of the present disclosure , with respect to which the ‘ legs ’ of the hexapod are in the form of non - corporeal measurement sections , the consequence of such an arrangement is that the equation system either becomes insoluble or has many solutions . in addition , it is possible to specify arrangements of the legs 31 - 36 in which the plates 10 , 20 can no longer be moved in all degrees of freedom ( if for example all six legs 31 - 36 are arranged parallel to each other and perpendicular to the plates 10 , 20 , in which case the plate 10 can no longer be displaced in the x - y plane or rotated about the z - axis ). in general it can be established that such arrangements of the legs 31 - 36 in fig1 , which do not lead to equation systems that can be solved , upon being transferred to the measurement sections according to the disclosure , have the consequence that the position of the two objects or mirrors relative to each other cannot be determined from the measurements . the present application sets forth examples of the available , possible or meaningful — as they can always be uniquely solved — arrangements of the legs or measurement sections . a substantial advantage of the arrangement according to the disclosure of six different measurement sections between the first euv mirror 110 and the second euv mirror 120 is that to a certain extent flexible adaptation of the levels of sensitivity occurring in the respective degrees of freedom ( that is to say in the respective spatial directions or angles ) to the specific factors or desired properties , in particular of the optical design , is possible to a certain extent . thus for example a suitable arrangement of the measurement sections 131 - 136 makes it possible to achieve more sensitive measurement for those degrees of freedom or directions in which relative positional determination in the specific optical system is of greater importance than in other directions or degrees of freedom . fig2 shows an alternative configuration , wherein elements which are similar to each other or which involve substantially the same function are referred to by references increased by ‘ 100 ’. in the fig2 embodiment two respective measurement sections cross or intersect in paired relationship . as is readily apparent from fig2 improved utilisation of the available structural space can be achieved by that overlapping or crossing relationship . on the other hand — as a consequence of the more pronounced inclined positioning of the measurement sections , that the overlapping relationship involves — the measurement arrangement enjoys greater sensitivity in certain spatial directions or in relation to given relative changes in position of the euv mirrors , wherein those spatial directions can in turn be precisely so selected that in the specific optical system involved they correspond to particularly important spatial directions . the orientation and precise arrangement of the measurement sections are therefore preferably so effected as to also give the maximum sensitivity for the degrees of freedom which are to be determined as accurately as possible . thus for example to achieve a comparatively high level of sensitivity in the z - direction , the measurement sections 131 - 136 and 231 - 236 respectively can substantially also preferably be arranged in the z - direction whereas the measurement sections 131 - 136 and 231 - 236 can be arranged in an inclined position to achieve a comparatively high level of sensitivity in the y - direction . fig9 shows an arrangement of measurement sections 931 - 936 in which three measurement sections , namely the measurement sections 932 , 934 and 936 , are parallel to each other . particularly small measurement uncertainties are achieved by that arrangement in the z - direction ( as the arrangement is particularly ‘ stiff ’ in the z - direction ). without the disclosure being limited thereto the measurement sections can be for example in the form of interferometric measurement sections both in the structure in fig1 and also in the structures in fig2 or fig9 . light coupling - in and light coupling - out is then preferably effected in the above - described embodiments using optical waveguides which are not shown in fig1 , 2 and 9 and which preferably respectively end at the beginning and the end of each measurement section ( for example the measurement sections 131 - 136 in fig1 ) and respectively pass light of a light source ( typically in particular a laser ) to the measurement section and couple the light into and couple it out of the respective light channel 131 - 136 , as is described in greater detail hereinafter . such coupling - in and coupling - out can be effected in spaced relationship , that is to say without mechanical contact with respect to the optical waveguides with the measurement sections and in particular the optical system . in that way , no forces or moments are applied to the optical system by the connection of the optical waveguides . in particular the arrangement can involve interferometric measurement sections with termination by triple prisms as shown in fig3 . in that case a beam splitter cube 341 with triple prism 342 which together form an interferometer 340 can be arranged at one of the euv mirrors 110 and a further triple prism 360 forming a retroreflector can be arranged at the other of the euv mirrors 120 , wherein the light channel extending therebetween , that is to say the actual measurement section , is denoted by reference 331 in fig3 . in regard to the arrangement of those interferometers it is for example possible for all of the total of six interferometers 340 to be arranged on the same euv mirror and for the retroreflectors 342 to be arranged on the other euv mirror . in alternative embodiments any smaller number of interferometers 340 can also be arranged at one of the euv mirrors 110 and the other interferometers can be arranged at the respective other one of the euv mirrors 120 , in which case again associated with each of the interferometers on an euv mirror is a retroreflector on the respective other euv mirror . although the disclosure can be implemented using interferometers with triple prisms as shown in fig3 a further possible embodiment is described hereinafter with reference to fig4 , using plane mirror interferometers . with such a plane mirror interferometer which in a basically known structure has in particular a beam splitter cube 441 and lambda / 4 plates 445 , 446 by which the light is deflected to a first plane mirror 460 and a second plane mirror 470 , the relative position of the second plane mirror 470 relative to the first plane mirror 460 can be measured in per se known manner . in that case the plane mirrors 460 , 470 can be arranged on the respective euv mirrors of the projection objective ( that is to say for example on the euv mirrors 110 , 120 in fig1 ), whereas the actual interferometer 440 ( indicated by the dotted region ) is disposed on the load - bearing structure ( frame ) of the projection objective . in addition it is also possible for the interferometer 440 together with the first plane mirror 460 to be arranged on one of the euv mirrors ( that is to say for example the euv mirror 110 of fig1 ) with the second plane mirror 470 arranged on the other euv mirror ( that is to say for example the other euv mirror 120 in fig1 ). referring to fig5 , deflection of the light incident in the interferometer 540 , that is involved with respect to the arrangement defined according to the disclosure of the measurement sections , can be effected by deflection mirrors 580 , as is indicated in fig5 . when designing the measurement sections 131 - 136 and 231 - 236 in the form of interferometric measurement sections , care is to be taken to ensure that the beams passing into the respective interferometer are already coupled in , in the respectively required direction . as that can be effected only with difficulty or at a level of complication and expenditure that is no longer acceptable , via a beam distributor optical system for dividing the laser beam in the different directions of the individual measurement sections , light coupling - in and light coupling - out are preferably effected using optical waveguides which respectively end directly at the beginning and the end respectively of each measurement section and which respectively feed light from a light source ( in particular a laser light source ) to the measurement section and couple it into and out of the respective light channel 131 - 136 . then the interferometers used are preferably those with optical - fiber beam input and output , as are commercially available for example from renishaw . in accordance with further embodiments , suitable reference elements in the form of ( partially ) reflecting optical elements can also be disposed at the optical components or euv mirrors which are measured in accordance with the disclosure with respect to their relative position , as is described hereinafter with reference to fig6 - 8 . as shown in fig6 a partially reflecting first reference element 611 can be disposed for example at a first euv mirror 610 and a further ( either partially or completely ) reflecting second reference element 621 can be disposed at a second euv mirror 620 . for travel length measurement , a short - coherent interferometer 640 is used , wherein coupling - in and coupling - out of the light used for the measurement operation are effected by way of optical - fiber elements or optical waveguides 635 . as diagrammatically shown in fig6 a part of the incident light is reflected back in the direction of incidence at the partially reflecting first reference element 611 and a further part is reflected in the direction towards the ( partially or completely ) reflecting second reference element 621 at the second euv mirror 620 , wherein the last - mentioned part is reflected and passes back to the short - coherent interferometer 640 by at least partial reflection at the first reference element 611 . the partially reflecting property of the first reference element 611 can be implemented for example by adjacent mirror elements of different orientation , wherein mirror elements having a first orientation reflect or send the incident beam back in itself and mirror elements involving a second orientation provide for passing the light further in a direction towards the second reference element 621 . the accuracy of the relative orientation between the euv mirrors 610 and 620 is determined by the adjustment or identification both of the angle between the two above - described orientations ( that is to say the first and second orientations ) and also the angle between the second reference element 621 and the second euv mirror 620 . detection of the angle between the first and second orientations can be effected for example on an angle measurement station with a turntable , wherein typical measurement uncertainties can occur in the range of 1 / 10 through 1 / 100 seconds of arc ( 1 second of arc = 50 nrad ), or even below that with an improvement in the angle measurement technology involved . detection of the angle between the second reference element 621 and the second euv mirror 620 can be effected in the course of direct incorporation of the reference element 621 into the mirror main body and integration of a recording technology which can be qualified with respect to position and angle into the arrangement or arrangements for mirror matching checking in a further embodiment the reference elements on the optical components or euv mirrors to be measured with respect to their relative position can also be in the form of so - called littrow gratings . referring to fig7 a first reference element in the form of a littrow grating 711 , for incident light from the interferometer 740 , provides on the one hand for partial retroreflection and on the other hand ( in the zero diffraction order ) reflection in the direction towards the second reference element 721 on the second euv mirror 720 by which the light is reflected back and passes back into the interferometer 740 by way of the first reference element or littrow grating 711 . in that case preferably an amplitude grating is used as the grating as phase gratings have a comparatively great groove depth which is greater than the positional measurement uncertainty . identification of the angle between the optically effective planar surface of the second reference element 721 and the second euv mirror 720 can again be effected in the course of direct incorporation of the reference element 721 into the mirror main body and integration of a recording technology which can be qualified with respect to position and angle in the arrangement or arrangements for mirror matching checking in accordance with a further embodiment shown in fig8 in addition planar surfaces serving for reflection can be provided directly at the optical components or euv mirrors which are to be measured with respect to their relative position or integrated in the respective substrate or main body respectively . for that purpose provided in fig8 is a first planar surface 811 on a first euv mirror 810 and provided at a second euv mirror 820 is a second planar surface 821 . the second euv mirror 820 also has a third planar surface 822 serving for referencing with respect to the mirror surface . the disclosure is not limited to interferometric measurement sections but also embraces implementations other contactless measurement principles such as for example capacitive measurement sections , inductive measurement sections or also the use of measuring scales which can be read off by suitable reading devices . as is only diagrammatically illustrated in fig1 for example a mechanical standard spacer gauge 50 of defined length which can be made for example from zerodur ®, invar ® or ule ° can be arranged between two reference surfaces 51 , 52 or mirror surfaces to be measured and used for length measurement . so that the standard spacer gauge 50 can be removed without any problem the mirrors having the reference surfaces 51 , 52 can be moved back definedly after the mirror mounting operation by way of their associated actuators . in addition gaps 53 , 54 remaining between the standard spacer gauge 50 and the reference surfaces 51 , 52 can also be capacitively measured if the reference surfaces 51 , 52 and the end faces of the gauge 50 , that face towards the reference surfaces , are at least region - wise of an electrically conducting nature . if those electrically conducting surfaces are provided for example in four quadrants , orientation of the gauge 50 with respect to the respective reference surface 51 , 52 can also be determined . as shown in fig1 a catoptric projection objective is provided for microlithography 1000 . six mirrors 1001 - 1006 of the projection objective are fixed via holders 1011 - 1016 to an outer carrier structure 1100 , 1101 of invar ®. all those mirrors or at least a part thereof are movable in six degrees of freedom and for that purpose are provided with manipulators ( not shown here ). the solid line 1020 denotes the projection beam path used for imaging the reticle ( not shown here ) on to the wafer ( not shown here ). the mirrors 1001 - 1006 are measured in paired relationship by five measurement section pairs 1021 - 1025 relative to each other with respect to their position . for the sake of clarity of the drawing only two respective measurement sections per pair of mirrors are illustrated . both non - penetrating measurement sections 1023 and also penetrating measurement sections 1022 are used as the measurement sections . even if the disclosure has been described by reference to specific embodiments numerous variations and alternative embodiments will be apparent to the man skilled in the art , for example by combination and / or exchange of features of individual embodiments . accordingly it will be appreciated by the man skilled in the art that such variations and alternative embodiments are also embraced by the present disclosure and the scope of the disclosure is limited only in the sense of the accompanying claims and equivalents thereof .
| 6 |
the following detailed description is made with reference to the figures . preferred embodiments are described to illustrate the present invention , not to limit its scope , which is defined by the claims . those of ordinary skill in the art will recognize a variety of equivalent variations on the description that follows . further , the preferred embodiments are described with reference to a laser scanning pattern generator . it will be obvious to one with ordinary skill in the art that any exposure means may be equally applicable , such as light from ir to euv , x - ray or particle beams such as electron , ion or atom beams . the invention is further described with reference to the production of a mask or reticle for the production of a cyclic pattern on for instance a display . it will be obvious to one with ordinary skill in the art that the inventive method and apparatus is equally applicable in the direct writing of such cyclic patterns in displays or other semiconductor components . fig4 shows an embodiment of a laser pattern generator according to prior art . in this embodiment , a support structure 13 is carrying the workpiece 10 . a writing head comprising an optical system 2 for generating object pixels on said workpiece 10 and a final lens 3 is placed on a carriage 14 that slides along a guiding rail 16 essentially along a direction x 15 . the parts moving with the carriage 14 are shown hatched in fig1 . the guiding rail 16 moves essentially along a direction y 9 . in one embodiment said guiding rail is moved in a stepwise fashion and said carriage 14 is moving in a continuous fashion , where a stepwise movement corresponds to a slow direction and a continuous motion corresponds to a fast movement . in another embodiment said guiding rail 16 is moved in a continuous fashion and said carriage 14 is moving in a stepwise fashion . in still another embodiment said guiding rail 16 is moved in a continuous fashion and said carriage 14 is also moving in a continuous fashion . in the embodiments described the workpiece 10 is kept in a fixed position while patterning the same . the support structure 13 may be arranged on a vibration damping structure 18 . said vibration damping structure is preferably made of a high density material and may in turn be supported by an air cushion for further damping vibrations . in fig4 a far end leg of the guiding rail is omitted for visibility . the optical system 2 generates a scan line , i . e . typically several hundred pixels are written in the y direction for each x position along the guiding rail . numerous scan lines will form a strip . a complete pattern comprises numerous strips partly overlapping each other or non - overlapping each other , depending on the writing strategy chosen . said optical system comprises in one embodiment , a modulator 138 , a collimator lens assembly 144 and a deflector 139 , see fig1 . the modulator 138 is used to either change the period of illumination time and / or intensity of the electromagnetic radiation from the source 17 . said modulator 138 may for instance be a conventional acousto optical modulator or any other modulator with essentially the same functionality . the deflector is used to deflect the beam of radiation for creating said scan lines . the deflector may be an acousto optical deflector . a clock generator is connectable to the modulator may use a 50 mhz frequency . a length of the scan line , i . e ., a width of a strip may be 200 μm . said scan line may comprise about 800 pixels . in another embodiment said optical head 2 only comprises said deflector 139 . in said embodiment the modulator 138 is arranged at a fixed position from the laser source 17 . the radiation may be generated by a laser source 17 either fixedly mounted on the guiding rail or separated from said guiding rail . the radiation is expanded , collimated , homogenized and launched by a optical system 19 in a direction parallel to the guiding rail 16 , so that it hits pick up optics 21 on the carriage 14 , with virtually unchanging lateral position , angle and cross section during movement along the rail . the laser source may be a continuous or pulsed laser source . the wavelength of the laser may for instance be 413 nm . alignment of the guiding rail 16 with the workpiece could be performed by using interferometers in a conventional manner , see for instance u . s . pat . no . 5 , 635 , 976 assigned to the same applicant as the present invention . in short , a control unit , not shown in the present figures , is initiating the operation of reading pattern data from a storage device and is sending instructions or command signals to servo units for controlling the movement of the guiding rail 16 . the clock generator is generating a clock signal , which synchronizes operation of data delivery device , the modulator 138 and the deflector 139 . the control unit provides for accurate positioning of the guiding rail with respect to the workpiece 10 . the modulator 138 and the deflector may be driven by the same clock signal , which provides for high degree of accuracy . position monitoring devices , such as interferometer , detector and a mirror attached to the moving device ( here the guiding rail 16 , is monitoring the position of the guiding rail 16 relative to the workpiece 10 and the final lens 3 . together with electric motors , which are moving the guiding rail 16 , said position monitoring devices form a servo - mechanism , which produces a precisely controlled movement of the guiding rail 16 . the clock generator with a certain frequency together with the interferometers with a certain wavelength , are defining the initial system grid . by changing the frequency of one of the interferometers , or if one interferometer is used with a beam splitter to create two branches of said laser beams for positioning control in two directions , only changing the wavelength in one branch or rescaling an initial scale with a certain factor , which interferometer is controlling the position in x - direction or y - direction , the scale in x - direction or y - direction may be changed up or down . this may be used for changing the initial system pitch . the workpiece 10 may be translated in an appropriate manner , for example with piezo - electrical actuators arranged on at least one end of said support structure 13 . in the illustrated embodiment in fig4 said workpiece 10 is essentially arranged in parallel with an x - y plane . this x - y plane could be a horizontal plane or a vertical plane . with said x - y plane in parallel with a vertical plane said workpiece is said to be a standing substrate . an apparatus with a standing substrate requires an essentially smaller clean room area , footprint , than a machine having a horizontal substrate , however , both embodiments require smaller clean room area than conventionally used machines . with a standing substrate 10 , said substrate is less sensitive to contamination , since the exposed area for particles falling down is drastically reduced compared to a substrate in parallel with a horizontal plane . in another embodiment said substrate is inclined at any angle between 0 - 90 ° from the horizontal plane . another feature with a standing substrate is that so - called sag , which is more or less inevitable when having the substrate in parallel with a horizontal plane , could be more or less eliminated with a substrate essentially parallel with the vertical plane . sag is defined as a deformation of the workpiece due to its weight . a pattern of sag depends on the type of support structures for the substrate , the number of support structures and the size and geometry of said substrate itself . a stepping motor or the linear motor may move the guiding rail . the guiding rail may slide on air bearings . there may be one air bearing under each leg of the guiding rail 16 . in another embodiment said legs of said guiding rail is coupled to each other , thereby forming a frame structure comprising an upper part on which said carriage is moving in the x direction and a lower part comprising the air bearings along the y direction . said lower part is below said vibration damping structure 18 , i . e ., a hollow part of said frame structure will move over the workpiece having the upper part above said workpiece and the lower part below said workpiece . fine positioning may exist on said guiding rail or said support structure 13 . said fine positioning may be in the form of mechanical and electronic servos . in one embodiment there is two linear motors operating on said guiding rail for performing said movement in the y direction . said linear motors may perform said fine positioning by operating them in such a manner so as to rotate the guiding rail . the rotation may be limited by the air bearing ( s ) attached to said guiding rail for said movement in said y direction . at an end support of the support structure 13 there may be attached piezoelectric actuators displacing the support structure 13 in the y direction . said actuators may be driven by analog voltages from a control system including said interferometers , detectors and mirrors and a feed back circuit sensing the position of the support structure 13 relative to that of the guiding rail 16 . together the actuators may correct for the limited resolution in the stepping motor and for non - straight travel of the guiding rail 16 . each actuator may have a movement range of 100 μm . instead of compensating said non straight travel of the guiding rail by actuators attached to said support structure 13 , said guiding rail itself may be adjusted so that the limited resolution of said stepping or linear motor can be compensated for . in a similar manner actuators may be attached to said guiding rail and by interferometry the position of the support structure relative to the guiding rail may be constantly monitored . the carriage 14 slides in the embodiments as illustrated in fig4 on air bearings 22 along the guiding rail 16 . it may be driven by a linear electric motor 23 and except for electric cables and air supply tubes there is no physical contact between the rail 16 and the carriage 14 . the only forces acting on it are from the contact - less motor 23 and from inertia . in order to compensate for errors concerning the straightness of the guiding rail 16 a calibration is possible . after the machine is assembled one has to write test plate and measure the writing errors . the errors are stored in a calibration file and fed to the control system as compensation during subsequent writing . said acoustooptical deflector in said optical system 2 mounted immediately above said final lens 3 may form the scan lines . pixels may be 300 × 300 nm and each scan line may be 200 μm wide . the lens may be an na = 0 . 5 flat field corrected lens with 4 mm focal length . fine positioning in x - direction may be based on the timing of the start - of - scan pulse when the final lens 3 is at its correct position . in y direction the mechanical servos described above may be supplemented by a data - delay feature , which moves the data along the acoustooptical scan as described in de 40 22 732 a1 . this is equivalent to an inertia free feed forward control system raising the bandwidth of the position control to above 100 hz . allowable angle deviations from stroke to stroke of said carriage are less than 10 micro radians , and there must not be any focus shift along said stroke . this may be solved in a number of ways . first , the carriage 14 runs on air bearings preloaded to high stiffness , so that a position of the carriage 14 relative to the guiding rail 16 is well defined and independent of external air pressure and temperature . a non - perfect guiding rail may give a writing error along the scan line . however , this error can be measured during calibration , stored as a correction curve and fed to the position feed back system for compensation during writing . focus may be kept constant by manipulating the laser beam by collimating and beam shaping optics 19 . referring now to fig1 , a multi beam optical system for patterning a workpiece 100 is one example of a system that can benefit from the present invention . the multi beam optical system comprises a laser source 17 a laser beam 101 , a diffractive optical element ( doe ) 128 , modulator lens assembly 130 , a modulator 138 , collimator lens assembly 144 , a prism 124 , an acoustooptical deflector 139 , a final lens 3 and a workpiece 150 . the laser source 17 may have an output wavelength at 413 nm , however other wavelengths may be used . the laser source outputs the laser radiation continuously or in a pulsed fashion . the diffraction optical element doe 128 , is separating the single laser beam into a plurality of laser beams , for instance 3 , 5 or 9 beams , however any number of laser beams is possible to create by inserting one or a plurality of does 128 . the modulator lens assembly 130 is focusing each individual laser beam into the modulator 138 . the modulator 138 is modulating the incoming focused plurality of laser beams . the modulator 138 may be an acoustooptical modulator . the prism 124 is inserted in this setup only for compressing the extension of the optical path of the laser beam . the collimator lens assembly 144 is collimating each individual divergent laser beam coming from the modulator . the collimator lens assembly is one feature in this setup , which is providing for the correct separation of the laser beams on the workpiece 150 , 10 . the acoustooptical deflector deflects the laser beams onto the workpiece 10 to form said scan lines . the final lens is focusing the plurality of laser beams onto the workpiece 150 , 10 . the final lens 3 and the modulator 138 are arranged at a fixed distance between each other . the collimator lens assembly 144 , comprising at least two lenses , may be arranged on motorized rails or may have its internal position changed or its absolute position changed by other suitable means , such as piezo electrical movement . changing the distance of the collimator lens assembly from the workpiece 150 and changing a focal length of said collimator lens assembly will change the separation of the laser beams on the workpiece 10 . another way of changing the separation of the individual laser beams on the workpiece 10 is to adjust the modulator lens assembly , so that the separation between the individual laser beams will be changed in the modulator . still another way of changing the separation of the individual laser beams on the workpiece is to mechanically stretch the doe 128 , thereby changing a pitch of the diffractive lattice , which will result in the desired change in beam separation on the workpiece . fig2 depicts an enlarged picture of the optical system 2 comprising the aod 139 and the final lens 3 together with the initial separation between the individual laser beams 101 a , 101 b , and 101 c . here three laser beams are used and the separation between two adjacent laser beams , denoted in fig2 with a or b , is 9 . 75 μm and the separation between two non adjacent laser beams , i . e ., a left most laser beam 101 a and a right most beam 101 c , denoted in fig2 with b , is 19 . 5 μm . the separation of the beams is perpendicular to a direction of sweeping the beams by means of said aod 139 , i . e ., if said separation is extending in an x - direction , the sweep of said laser beams is extending in a y - direction , which means the scan lines are extending in y - direction and strips in x - direction . in a multi beam writing strategy the initial separation between individual laser beams or exposure beams is exact or close to exact to an integer multiple of a system pitch in x - direction . if the separation in x - direction between individual laser beams is not an integer multiple of said system pitch size in x - direction , edge roughness and pattern dependent cd ( critical dimension ) variations will appear in the pattern . scaling is one method for compensation of defects in the pattern on the workpiece 10 , 150 . in this method the system pitch in for instance the x - direction is changed in size when writing the pattern . since the nominal separation between individual laser beams is tuned to an integer multiple of the initial system pitch in x - direction , the result will be edge roughness and pattern dependent cd variations in said pattern . in fig3 a it is depicted a repeatable pattern of features 310 a , 310 b in a grid of system pitches in x and y . here the system pitches in x and y are equal , thereby forming a grid of squares . from fig3 a one can see that said repeatable pattern do not start at equal grid positions . feature 310 a has a left most feature edge 312 a starting at a start point of said system pitch in x - direction , whilst a leftmost feature feature edge 312 b of feature 310 b do not start at a start point of said system pitch in x - direction . the features 310 a and 310 b has a pitch in x - direction , which is not an integer multiple of a system pitch in x - direction . most probably this mismatch in pitches will cause intensity variations in the pattern , i . e ., stripes . in fig3 b a scale of an initial dimension of the pattern in x - direction has been performed in order to match the pattern pitch in x - direction to system pitch in x - direction . as can be seen in fig3 b , the leftmost feature edge 312 a of feature 310 a coincides with the start of a system pitch , which is also true for the left most feature edge 312 b of feature 310 b . the scale of the pattern is performed in pattern data by for instance applying a constant to features in one direction . in fig3 b there will most probably not be any intensity variations detected . if the pattern would have been written as it is illustrated in fig3 b , the features would appear too small compared to an original and intended design . therefore , in fig3 c the system pitch in x - direction is increased so that features 310 a and 310 b will be written with correct dimensions . a square 320 in fig3 a and 3 b represents the equal size of system pitch in x - direction and y - direction . a rectangle 330 in fig3 c is a factor f larger in x - direction than said squares in fig3 a and fig3 b . the factor f is the same factor that the pattern was adjusted or rescaled with in x - direction in order to fit with the system pitch in x - direction in fig3 b . the system pitch may be changed in a direction perpendicular to the scan direction by means of , as mentioned above , changing the wavelength of the interferometer or rescaling the initial interferometer scale by a suitable factor , which interferometer is controlling the position in said direction . the pattern in fig3 c is most probably free of any intensity variations in both x - direction and y direction , but suffers from cd - errors due to the fact that the system pitch no longer is an integer multiple of the separation between individual laser beams . in the inventive method said separation between individual laser beams is adjusted to eliminate or at least reduce said cd - error . for instance , as disclosed above , the focal length and position of the collimator lens system may be used to adjust the separation of the laser beams on the workpiece so that said cd - error is reduced or eliminated . assuming know that the system pitch is 0 . 75 μm , that the multi beam pitch ( for three beams ) is 2 . 251 μm , that the separation between two individual laser beams is 9750 nm , as indicated in fig2 , and that the pattern pitch is 100 μm . this size of the pattern pitch is not an even multiple of the multi beam pitch : 100 / 2 . 25 = 44 . 44 . if a scaling is done in x - direction , so that 44 multi beam pitches are used and thereafter a rescale back to correct size by adjusting the system pitch , there will be no intensity variations in the pattern . the intermediate pattern pitch is in this case 99 μm , which is an even number of the system pitch . a rescale back from 99 μm to 100 μm in pattern pitch , requires that the system pitch is increased with 100 / 99 = 1 . 010101010 . this corresponds to an error in the separation between two laser beams of 1 . 010101010 * 9750 − 9750 = 98 nm . most probably , such an error in the separation between two laser beams will result in cd - errors in the pattern . while the present invention is disclosed by reference to the preferred embodiments and examples detailed above , it is understood that these examples are intended in an illustrative rather than in a limiting sense . it is contemplated that modifications and combinations will readily occur to those skilled in the art , which modifications and combinations will be within the spirit of the invention and the scope of the following claims . for instance may the support structure be moving in one direction and the optical system in a perpendicular direction with the guiding rail at a fixed position as disclosed in u . s . pat . no . 5 , 635 , 976 .
| 8 |
fig2 illustrates an exemplary system 200 to reduce moiré patterns . the system 200 includes illustrated content 202 , an image processing module 204 and processed illustrated content 212 . the illustrated content 202 can be any appropriate type of digitized content that includes illustrations or graphics . for example , the illustrated content 202 can be a comic book or magazine that has been scanned and can include halftone artwork / images ( e . g ., pictures that include a halftone image similar to halftone gradient pattern 102 ). in addition , the illustrated content 202 can include digital publications ( e . g ., a comic book , a magazine , a newspaper , or other publication that originates in an electronic format ) that include halftone artwork / images . the illustrated content 202 can also include text . in some implementations , the illustrated content 202 includes black and white manga - style comic books ( e . g ., black and white comic books using sequential art ). fig3 a illustrates a portion 300 of an example black and white manga - style comic book . the portion 300 includes black and white artwork and text . the portion 300 also includes a region of the image 350 that is susceptible to the moiré pattern . the illustrated content 202 is preferably scanned and stored in a high - resolution uncompressed format ( e . g ., tiff format , a bmp format , etc .). the illustrated content 202 can be stored in a database or other appropriate type of memory . the illustrated content 202 can also include information that describes the illustrated content 202 . for example , the illustrated content can include metadata that describes the height and width of the illustrated content 202 ( e . g ., a source height and a source width ) and a height and width of the processed illustrated content 212 ( e . g ., a target height and a target width ). the image processing module 204 can be associated with a publisher ( e . g ., the publisher of the illustrated content 202 ) or a content producer and can be used to reduce or remove moiré patterns . the image processing module 204 includes a text processing module 206 , a scaling module 208 and a blurring module 210 . the text processing module 206 can receive the illustrated content 202 and create a copy of the illustrated content 202 . the copy of the illustrated content can be in a bitmap format or other image / video format . the copy of the illustrated content can include the metadata associated with the illustrated content 202 . the text processing module 206 can remove text from the copy of the illustrated content . for example , a user of the image processing module 204 or a user associated with the illustrated content 202 can interact with the text processing module 206 to identify text included in the illustrated content 202 or identify regions of text included in the illustrated content 202 . the user can mark the text or regions of text such that the image processing 204 removes the text from the copy of the illustrated content 202 . in some implementations , the text processing module 206 can use a filter or mask to remove the text from the copy of the illustrated content . for example , the text processing module 206 can apply a filter that identifies text or regions of text in the copy of the illustrated content and can remove the text or region of text . if the illustrated content 202 includes a text layer ( e . g ., image data associated with an image is stored in a layer and picture data associated with an image is stored in a different layer ), the text processing module 206 can remove the text by removing the text layer . the removed text can be stored in an image text file that includes the removed text but does not include graphics or images associated with the illustrated content 202 . in addition to removing the text from the illustrated content 202 , the text processing module 206 can insert the text into the processed illustrated content 212 ( e . g ., the illustrated content after the moiré pattern is reduced or eliminated ). for example , after the illustrated content 202 is processed to reduce the moiré patterns , which is described below , the text processing module 206 can insert the text that was removed from the illustrated content 202 into the blurred and downscaled illustrated content . in some implementations , text processing module composites the image text file ( after it has been downscaled by the scaling module 208 ) with the blurred and downscaled illustrated content to insert the text . in some implementations where the illustrated content 202 includes black text on a white background , the text can be inserted into the blurred and downscaled illustrated content by multiplying the two images ( e . g ., illustrated content 202 * blurred and downscaled illustrated content ). the scaling module 208 can receive the copy of the illustrated content and determine a scaling factor . for example , the scaling module can use the source height and the target height to calculate a vertical scaling factor ( vsf ). in some implementations , the vertical scaling factor can be equal to the target height / source height ( e . g ., vsf = target height / source height ). the scaling module 208 can analyze the vertical scaling factor to determine whether the vertical scaling factor is appropriate given the target width and the aspect ratio of the illustrated content ( e . g ., source width / source height ). for example , the scaling module 208 can analyze the vertical scaling factor to determine whether the scaled width ( i . e ., source width * vsf ) is less than or equal to the target width . if the scaled width is less than the target width , then the scaling module 208 can set the scaling factor to be equal to the vertical scaling factor ( i . e ., sf = vsf ). otherwise , the scaling module 208 can set the overall scaling factor to be equal to the horizontal scaling factor , which is equal to target width / source width ( i . e ., sf = target width / source width ). the overall scaling factor can be used to scale the illustrated content 202 and / or the copy of the illustrated content . the blurring module 210 can receive the copy of the illustrated content and blur the illustrated content . for example , the blurring module 210 can calculate a blurring radius and apply a gaussian blur to the copy of the illustrated content . other blurring algorithms can be used ( e . g ., a box blur , etc .). the blurring radius can be calculated from the source height and the target height . for example , the blurring radius can be equal to source height / target height / user defined parameter . the user defined parameter can be a blur - scaling factor used to adjust the blurring radius or the amount of blurring . the user defined parameter can be any number larger than zero . for example , the user defined parameter can be set to have a value of 4 . 0 and / or can be varied between approximately 3 . 0 to 4 . 4 . the user defined parameter can be chosen based on the appearance of the processed illustrated content 212 . for example , a user of the image processing module 204 can inspect the processed illustrated content 212 and determine whether the moiré pattern is sufficiently reduced or eliminated . if the user is not satisfied with the processed illustrated content 212 , the user can adjust ( e . g ., increasing or decreasing ) the parameter and process the illustrated content 202 again . in some implementations , the value of the user defined parameter can be varied using a slider or other user interface tool . the blurring module 210 can also crop the blurred illustrated content . for example , the blurring module 210 can calculate a crop region and use the crop region to crop the blurred illustrated content . in some implementations , the crop region is determined based on the value of the blur radius . in some implementations , the blurring algorithm can cause the blurred illustrated content to be larger than the copied illustrated content because of the inclusion of faded edges that are artifacts created by the blurring algorithm . the blurring module 210 can crop the blurred illustrated content to remove the faded edges . the image processing module 204 can output the processed illustrated content 212 ( e . g ., the illustrated content after reducing / removing the moiré pattern ). fig3 b illustrates the portion of the example black and white manga - style comic book after the portion 300 of fig3 a has been processed . as seen in fig3 b , the processed illustrated content 212 is similar to the original illustrated content 202 and does not include a moiré pattern in the region 350 . the processed illustrated content 212 can be stored in various uncompressed image formats ( e . g ., tiff format , bmp format , etc .) or compressed image formats ( e . g ., png or jpeg ). the processed illustrated content 212 can be stored in a database , memory or other storage medium and / or provided to a user / viewer . the processed illustrated content 212 can be viewed by a user using a digital processing apparatus ( e . g ., a computer , a tablet computer , a laptop , a smart phone , etc .). fig4 is a flowchart of an exemplary process 400 to reduce or eliminate moiré patterns . process 400 begins by receiving illustrated content ( at 402 ). for example , the image processing module 204 can receive illustrated content 202 from a database or from a network connection . the illustrated content 202 can be an electronic copy of a comic book or printed publication that includes halftone artwork / images . the illustrated content can be similar to the portion 300 of the manga comic book shown in fig3 a . the illustrated content 202 can be stored in various formats . for example , the illustrated content 202 can be stored in a high - resolution uncompressed format ( e . g ., tiff format , bmp format , etc ). the illustrated content 202 can include for example and without limitation metadata that describes the dimensions of the illustrated content 202 ( e . g ., a source width and a source height ) and metadata that describes the dimensions of the processed illustrated content 212 ( e . g ., a target width and a target height ). the illustrated content can be copied and the text can be removed from the copied illustrated content ( at 404 ). for example , the text processing module 206 can create a copy of the illustrated content 202 and apply a filter or masking algorithm to remove the text from the copied illustrated content . in some implementations , a user of the text processing module 206 can identify text or regions of text such that the text processing module 206 removes the text from the copied illustrated content . the removed text can be stored in a separate image text file . a scaling factor is then determined ( at 406 ). for example , the scaling module 208 can analyze the metadata included in the illustrated content 202 to determine the overall scaling factor . for example , the scaling module 208 can use the source height and the target height to calculate a vertical scaling factor ( e . g ., vsf = target height / source height ). the scaling module 208 can analyze the vertical scaling factor to determine whether the scaled width ( i . e ., source width * vsf ) is less than or equal to the target width . if the scaled width is less than the target width , then the scaling module 208 can set the overall scaling factor ( sf ) to be equal to the vertical scaling factor ( i . e ., sf = vsf ). otherwise , the scaling module 208 can set the overall scaling factor to be equal to the horizontal scaling factor , which is equal to target width / source width ( i . e ., sf = target width / source width ). after the scaling factor is determined , the dimensions of the processed illustrated content can be determined ( at 408 ). for example , the scaling module 208 can recalculate the target width and target height using the overall scaling factor ( e . g ., target width = sf * source width ; target height = sf * source height ). the process 400 can continue by blurring the copied content ( at 410 ). for example , the blurring module 210 can calculate a blurring radius using the dimensions of the copied illustrated content and the target dimensions and apply a blurring algorithm ( e . g ., a gaussian blur algorithm , a box blur , etc .) to blur the copied content . in some implementations , the blurring radius is equal to source height / target height / user defined parameter . the user defined parameter can be set to have a value of 4 . 0 but can be changed be varied between approximately 3 . 0 to 4 . 4 . the user defined parameter can be chosen based on the appearance of the processed illustrated content 212 . after blurring the copied illustrated content , the blurred content can be post - processed ( at 412 ). for example , because the blurring algorithm can cause the fading of the pixels near the edges of the blurred content , the blurring module can crop the blurred content . in some implementations , the dimensions of the blurred content and the blur radius can be used to determine the crop region ( e . g ., the portion of the blurred content that should remain after the cropping ). for example , fig5 illustrates a process 500 to calculate the cropped region of the blurred image . process 500 begins by determining the bounding box of the blurred illustrated content ( at 502 ). for example , the bounding box can be a rectangle having an upper left corner at coordinates ( 0 , 0 ) and a height ( bb_height ) and width ( bb_width ) equal to the dimensions of the blurred content . in some implementations , the height and width of the blurred content can be determined by counting the number of vertical and horizontal pixels in the blurred content . a crop factor ( e . g ., a multiplier representing how much of the blurred content should be cropped ) can be determined based on the dimensions of the blurred content ( at 504 ). for example , the crop factor ( cf ) can be equal to : using the crop factor , the dimensions of the crop region can be determined ( at 506 ). for example , the height and width of the crop region can be equal to : the coordinates of the crop region can be calculated based on the dimensions of the crop region and the blurred content ( at 508 ). for example , the upper left coordinates of the crop region can be equal to : the blurred content is then cropped ( at 510 ). for example , the blurred content can be cropped using the crop region such that the image data outside of the crop region is deleted . the remaining illustrated content is approximately the same size as the received illustrated content 212 . returning to fig4 , in addition to cropping the illustrated content , the illustrated content can be downscaled to the target height and target width ( at 412 ). for example , the scaling module 208 can scale the cropped illustrated content to have dimensions equal to the target height and the target width . in some implementations , the received illustrated content 202 is downscaled by a factor of two or more ( e . g ., the illustrated content 202 is at least twice as large as the scaled illustrated content ). in some implementations , the amount of downscaling can be based on the dimensions of the illustrated content 202 and the desired dimensions of the processed illustrated content 212 . in addition , the amount of downscaling can be based on the aspect ratio of the illustrated content 202 or the processed illustrated content 212 . after the post processing is completed ( at 412 ), the text from the received illustrated content can be added to the blurred illustrated content . for example , the text module 206 can scale the image text file storing the text removed from the illustrated content 202 to have the same dimensions as the target height and the target width and then composite the scaled illustrated content 202 with the blurred illustrated content to add the text to the blurred illustrated content to generate the processed illustrated content 212 . in some implementations , the processed illustrated content 212 is stored as a jpg or png image . the processed illustrated content 212 can be provided to a user or stored in a database or other storage medium . an illustrative example is provided in fig6 a - 6c . fig6 a illustrates an example illustrated content 600 a that is received by the image processing module 204 . as shown in fig6 a , the illustrated content 600 a is a portion of a black and white comic book that includes a region of halftone artwork / images 602 that is susceptible to moiré patterns . for illustrative purposes , fig6 b illustrates the illustrated content 600 b with the moiré pattern in the region 602 . the illustrated content 600 a can be received by the text processing module 206 and produce a copied illustrated content . the text processing module 206 can remove the text from the copied illustrated content . the blurring module 210 can receive the copied illustrated content and process the copied illustrated content to produce the blurred content 600 c , shown in fig6 c . for example , the blurring module 210 can apply a gaussian blur to the copied illustrated content 600 b to produce the blurred content 600 c . the blurring module 210 can crop the blurred illustrated content 600 c to remove faded edges and / or artifacts created by the blurring algorithm to produce a blurred content . in addition , the blurred content 600 c can be downscaled by the scaling module 208 . the text processing module 206 can insert the text removed from the illustrated content 600 a into the cropped and blurred content to produce the processed illustrated content 600 d , shown in fig6 d . as seen in fig6 d , the processed illustrated content 600 d does not include a moiré pattern . fig7 is an exemplary system 700 to reduce moiré patterns . the example system 700 can include illustrated content 702 , a publisher 704 , a network 706 , and a user device 707 . the user device 707 can include an image processing module 708 and an output device 710 . the illustrated content 702 can be similar to the illustrated content 202 described above in connection with fig2 and 3a and 3 b . in addition , the illustrated content 702 can include video content ( e . g ., television programming , streaming video content , etc . ), website content or other content that is susceptible to moiré patterns . the illustrated content 702 can be provided by an appropriate content provider 704 . for example , the illustrated content 702 can be provided by a comic book publisher , a television network , a cable provider and / or a streaming video / internet video provider . the content provider 704 can provide the illustrated content 702 to the user device 707 via the network 706 . the network 706 can be any type of network such as a local area network ( lan ), wide area network ( wan ), the internet , or a combination thereof . the network 707 facilitates connectivity between the user device 707 and the publisher 704 . the user device 707 can be any appropriate type of data processing apparatus . for example , the user device 707 can be a computer , a laptop , a cable set top box , a tablet computer and / or a network accessible smart phone . the user device 707 can include an image processing module 708 and an output device 710 . the image processing module 710 can be similar to the image processing module 204 described above in connection with fig2 and 4 . the image processing module 710 can be configured to reduce or eliminate the moiré pattern in real - time . for example , the illustrated content 702 can be received at the user device 707 and the image processing module 708 can process the illustrated content 702 immediately before displaying or as the illustrated content 702 is rendered for display on the output device 710 . the output device 710 can be any type of visual display capable of displaying the illustrated content 702 ( e . g ., a monitor , a television , an lcd screen ). fig8 is a flowchart of an exemplary process 800 to reduce moiré patterns . process 800 is similar to process 400 , described above in connection with fig4 . process begins by receiving illustrated content ( at 802 ). for example , the image processing module 708 can receive illustrated content 702 from a network connection 706 or from a stored file . the illustrated content 702 can be an electronic copy a printed publication that includes halftone artwork / images or video content that includes high - contrast alternating color lines . the illustrated content 702 can include metadata that describes the dimensions of the illustrated content 702 ( e . g ., a source width and a source height ) and metadata that describes the dimensions of the processed illustrated content ( e . g ., a target width and a target height ). in some implementations , the illustrated content 702 includes metadata to indicate that it includes halftone artwork / images and / or to indicate the location of the halftone artwork / images in the illustrated content ( e . g ., metadata that indicates the pixel coordinates of the illustrated content ). in some implementations , the illustrated content 702 includes a flag , similar to an html tag that indicates halftone artwork or content . process 800 continues by determining whether the illustrated content 702 includes halftone content ( e . g ., artwork ) ( at 803 ). in some implementations , the image processing module 708 analyzes the illustrated content to determine whether the metadata or flags indicate that the illustrated content 702 includes halftone content . in some implementations , the image processing module 708 can automatically detect the presence of halftone content by analyzing the pixels . for example , a noise estimation algorithm can be used to detect the presence of halftone content . in some implementations , a two dimensional gabor filter could be used to detect the presence of the halftone content . if the illustrated content does not include halftone content or other content that is susceptible to moiré effects , the illustrated content is displayed ( at 816 ). if the illustrated content 702 includes halftone artwork or other content that is susceptible to a moiré effect , the process continues by processing the illustrated content to reduce or eliminate the moiré pattern ( at 804 - 814 ) as described above in connection with fig4 . fig9 is block diagram of an exemplary computer system 900 that can be used to implement the image processing modules 204 and / or user device 707 . the system 900 includes a processor 910 , a memory 920 , a storage device 930 , and an input / output device 940 . each of the components 910 , 920 , 930 , and 940 can be interconnected , for example , using a system bus 950 . the processor 910 is capable of processing instructions for execution within the system 900 . in one implementation , the processor 910 is a single - threaded processor . in another implementation , the processor 910 is a multi - threaded processor . the processor 910 is capable of processing instructions stored in the memory 920 or on the storage device 930 . the memory 920 stores information within the system 900 . in one implementation , the memory 920 is a computer - readable medium . in one implementation , the memory 920 is a volatile memory unit . in another implementation , the memory 920 is a non - volatile memory unit . the storage device 930 is capable of providing mass storage for the system 900 . in one implementation , the storage device 930 is a computer - readable medium . in various different implementations , the storage device 930 can include , for example , a hard disk device , an optical disk device , or some other large capacity storage device . the input / output device 940 provides input / output operations for the system 900 . in one implementation , the input / output device 940 can include one or more of a network interface device , e . g ., an ethernet card , a serial communication device , e . g ., and rs - 232 port , and / or a wireless interface device , e . g ., an ieee 802 . 11 card . in another implementation , the input / output device can include driver devices configured to receive input data and send output data to other input / output devices , e . g ., keyboard , printer and display devices 960 . other implementations , however , can also be used , such as mobile computing devices , mobile communication devices , set - top box television client devices , etc . the various functions of the image processing module 204 and / or user device 607 can be realized by instructions that upon execution cause one or more processing devices to carry out the processes and functions described above . such instructions can comprise , for example , interpreted instructions , such as script instructions , e . g ., javascript ™ or ecmascript instructions , or executable code , or other instructions stored in a computer readable medium . the image processing module 204 and / or user device 707 can be distributively implemented over a network , such as a server farm , or can be implemented in a single computer device . although an example processing system has been described in fig9 , implementations of the subject matter and the functional operations described in this specification can be implemented in other types of digital electronic circuitry , or in computer software , firmware , or hardware , including the structures disclosed in this specification and their structural equivalents , or in combinations of one or more of them . implementations of the subject matter described in this specification can be implemented as one or more computer program products , i . e ., one or more modules of computer program instructions encoded on a tangible program carrier for execution by , or to control the operation of , a processing system . the computer readable medium can be a machine readable storage device , a machine readable storage substrate , a memory device , a composition of matter effecting a machine readable propagated signal , or a combination of one or more of them . implementations of the subject matter and the operations described in this specification can be implemented in digital electronic circuitry , or in computer software , firmware , or hardware , including the structures disclosed in this specification and their structural equivalents , or in combinations of one or more of them . implementations of the subject matter described in this specification can be implemented as one or more computer programs , i . e ., one or more modules of computer program instructions , encoded on a computer storage medium for execution by , or to control the operation of , data processing apparatus . alternatively or in addition , the program instructions can be encoded on an artificially generated propagated signal , e . g ., a machine - generated electrical , optical , or electromagnetic signal that is generated to encode information for transmission to suitable receiver apparatus for execution by a data processing apparatus . a computer storage medium can be , or be included in , a computer - readable storage device , a computer - readable storage substrate , a random or serial access memory array or device , or a combination of one or more of them . moreover , while a computer storage medium is not a propagated signal , a computer storage medium can be a source or destination of computer program instructions encoded in an artificially - generated propagated signal . the computer storage medium can also be , or be included in , one or more separate physical components or media ( e . g ., multiple cds , disks , or other storage devices ). the operations described in this specification can be implemented as operations performed by a data processing apparatus on data stored on one or more computer - readable storage devices or received from other sources . the term “ data processing apparatus ” encompasses all kinds of apparatus , devices , and machines for processing data , including by way of example a programmable processor , a computer , a system on a chip , or multiple ones , or combinations , of the foregoing . the apparatus can include special purpose logic circuitry , e . g ., an fpga ( field programmable gate array ) or an asic ( application specific integrated circuit ). the apparatus can also include , in addition to hardware , code that creates an execution environment for the computer program in question , e . g ., code that constitutes processor firmware , a protocol stack , a database management system , an operating system , a cross - platform runtime environment , a virtual machine , or a combination of one or more of them . the apparatus and execution environment can realize various different computing model infrastructures , such as web services , distributed computing and grid computing infrastructures . a computer program ( also known as a program , software , software application , script , or code ) can be written in any form of programming language , including compiled or interpreted languages , declarative or procedural languages , and it can be deployed in any form , including as a stand alone program or as a module , component , subroutine , object , or other unit suitable for use in a computing environment . a computer program may , but need not , correspond to a file in a file system . a program can be stored in a portion of a file that holds other programs or data ( e . g ., one or more scripts stored in a markup language document ), in a single file dedicated to the program in question , or in multiple coordinated files ( e . g ., files that store one or more modules , sub programs , or portions of code ). a computer program can be deployed to be executed on one computer or on multiple computers that are located at one site or distributed across multiple sites and interconnected by a communication network . the processes and logic flows described in this specification can be performed by one or more programmable processors executing one or more computer programs to perform actions by operating on input data and generating output . the processes and logic flows can also be performed by , and apparatus can also be implemented as , special purpose logic circuitry , e . g ., an fpga ( field programmable gate array ) or an asic ( application specific integrated circuit ). processors suitable for the execution of a computer program include , by way of example , both general and special purpose microprocessors , and any one or more processors of any kind of digital computer . generally , a processor will receive instructions and data from a read only memory or a random access memory or both . the essential elements of a computer are a processor for performing actions in accordance with instructions and one or more memory devices for storing instructions and data . generally , a computer will also include , or be operatively coupled to receive data from or transfer data to , or both , one or more mass storage devices for storing data , e . g ., magnetic , magneto optical disks , or optical disks . however , a computer need not have such devices . moreover , a computer can be embedded in another device , e . g ., a mobile telephone , a personal digital assistant ( pda ), a mobile audio or video player , a game console , a global positioning system ( gps ) receiver , or a portable storage device ( e . g ., a universal serial bus ( usb ) flash drive ), to name just a few . devices suitable for storing computer program instructions and data include all forms of non volatile memory , media and memory devices , including by way of example semiconductor memory devices , e . g ., eprom , eeprom , and flash memory devices ; magnetic disks , e . g ., internal hard disks or removable disks ; magneto optical disks ; and cd rom and dvd - rom disks . the processor and the memory can be supplemented by , or incorporated in , special purpose logic circuitry . to provide for interaction with a user , implementations of the subject matter described in this specification can be implemented on a computer having a display device , e . g ., a crt ( cathode ray tube ) or lcd ( liquid crystal display ) monitor , for displaying information to the user and a keyboard and a pointing device , e . g ., a mouse or a trackball , by which the user can provide input to the computer . other kinds of devices can be used to provide for interaction with a user as well ; for example , feedback provided to the user can be any form of sensory feedback , e . g ., visual feedback , auditory feedback , or tactile feedback ; and input from the user can be received in any form , including acoustic , speech , or tactile input . in addition , a computer can interact with a user by sending documents to and receiving documents from a device that is used by the user ; for example , by sending web pages to a web browser on a user &# 39 ; s client device in response to requests received from the web browser . implementations of the subject matter described in this specification can be implemented in a computing system that includes a back end component , e . g ., as a data server , or that includes a middleware component , e . g ., an application server , or that includes a front end component , e . g ., a client computer having a graphical user interface or a web browser through which a user can interact with an implementation of the subject matter described in this specification , or any combination of one or more such back end , middleware , or front end components . the components of the system can be interconnected by any form or medium of digital data communication , e . g ., a communication network . examples of communication networks include a local area network (“ lan ”) and a wide area network (“ wan ”), an inter - network ( e . g ., the internet ), and peer - to - peer networks ( e . g ., ad hoc peer - to - peer networks ). the computing system can include clients and servers . a client and server are generally remote from each other and typically interact through a communication network . the relationship of client and server arises by virtue of computer programs running on the respective computers and having a client - server relationship to each other . in some implementations , a server transmits data ( e . g ., an html page ) to a client device ( e . g ., for purposes of displaying data to and receiving user input from a user interacting with the client device ). data generated at the client device ( e . g ., a result of the user interaction ) can be received from the client device at the server . while this specification contains many specific implementation details , these should not be construed as limitations on the scope of the invention or of what may be claimed , but rather as descriptions of features specific to particular implementations of the invention . certain features that are described in this specification in the context of separate implementations can also be implemented in combination in a single implementation . conversely , various features that are described in the context of a single implementation can also be implemented in multiple implementations separately or in any suitable subcombination . moreover , although features may be described above as acting in certain combinations and even initially claimed as such , one or more features from a claimed combination can in some cases be excised from the combination , and the claimed combination may be directed to a subcombination or variation of a subcombination . similarly , while operations are depicted in the drawings in a particular order , this should not be understood as requiring that such operations be performed in the particular order shown or in sequential order , or that all illustrated operations be performed , to achieve desirable results . in certain circumstances , multitasking and parallel processing may be advantageous . moreover , the separation of various system components in the implementations described above should not be understood as requiring such separation in all implementations , and it should be understood that the described program components and systems can generally be integrated together in a single software product or packaged into multiple software products . although a few implementations have been described in detail above , other modifications are possible . for example , in some situations , different amounts of blurring can be applied to the illustrated content . for example , a first blurring radius or a first amount of blur can be applied to a first portion of the illustrated content and a second blurring radius or a second amount of blur can be applied to a second portion of the illustrated content . in addition , the logic flows depicted in the figures do not require the particular order shown , or sequential order , to achieve desirable results . other steps may be provided , or steps may be eliminated , from the described flows , and other components may be added to , or removed from , the described systems . accordingly , other implementations are within the scope of the following claims .
| 7 |
it is an object of the present invention to provide a new and improved shaping process through peening shot beams , and affecting planar parts to obtain a curved contour with curvatures obtaining in two different axes and , possibly the blank parts exhibit variation in thicknesses , even in a steplike fashion . in accordance with the preferred embodiment of the present invention it is suggested to proceed for purposes of obtaining such curving as follows . the elastic part is tensioned into a concave position . the thusly positioned and tensioned part is subjected to a beam of peening shots whereby as a part of this treatment , the peening shot beam is guided along a track , which as far as the part to be deformed is concerned , will follow lines of similar , or at least almost similar , strain . the shot beam energy is reduced from a maximum when affecting a central part , towards outer contours or peripheral contours of the part being deformed . subsequently the part is additionally subjected to a similar peening shot treatment from the other ( usually the convex ) side while edge portions are still separately treated as desired in accordance with particular requirements . the energy distribution is selected to change the ratio of longitudinal curvature to transverse curvature with a coverage degree between 10 % and most of the entire surface of the part being treated . the energy gradient itself should preferably also decline from inner parts to edged portions . the inventive method , therefore , begins in fact with the deformation of a planar part in a two axes type configuration as far as curvature is used , and uses by and in itself the known peening shot deformation method . the beam and its intensity in energy is preferably computer controlled under matching of direction and strength of peening shot impacting being controlled in dependence upon the dimensions of the part , particularly the lateral dimensions and the thickness possibly under consideration of variations of wall thickness and changes over the extension of the part , and with emphasis on parts which obtain similar extension as a result of the method . a particular advantage of the invention is to be seen in that the thickness changes such as steps can be provided for in the part to be deformed prior to the application of the curving and deforming method the requisite thickness dimensions are obtained through suitable milling . another advantage is to be seen in that parts as far as the blanks are concerned , are already hardened which means that subsequently no thermal treatement is necessary . avoiding any heat application is an advantage since texture distortions in the material and , therefor , contour distortions are thus avoided . also it was found that on practicing the invention the number of steps is reduced while reproducibility owing to accurate control of the peening shot intensity ensures that there is uniformity in the parts being made , which is of course a highly desirable feature . owing to the method as suggested the working of the method is self adapting to changes on one hand in the thickness of the material and in the changes in material properties . while the specification concludes with claims particularly pointing out and distinctly claiming the subject matter which is regarded as the invention , it is believed that the invention , the objects and features of the invention and further objects , features and advantages thereof will be better understood from the following description taken in connection with the accompanying drawings whereby particularly an example is followed through step by step having to do with segmentized sheet metal parts . fig1 is a somewhat schematic top view of a spherical calotte shaped bottom part to be made out of the plural segments i . e . that botom is composed of a plurality of individual segments each of which has been deformed by the method of the invention a preferred embodiment in at best mode configuration ; fig2 is a side view of the this composite part shown in fig1 ; fig3 is a side and perspective view of an element or segment ( fig1 ) that has been made in accordance with the preferred embodiment of the present invention ; fig4 is a top elevation of the particular part shown in fig3 ; and fig5 illustrates a clamping frame and support for fixing and elastically biasing the part as it is being made . proceeding now to the detailed description of the drawings , fig1 and 2 show a particular component 1 which ultimately is a spherically calotte shaped bottom part of a container or the like . that part 1 is composed of plural individual segments 3 which when projected into a plane and which as far as the original blank 4 from which they have been made is concerned is a truncated pie or sector element . since part 3 is to be a part of the spherical surface , a curving or the obtaining of curvatures in two axes is therefore required . fig3 generally permits the conclusion that in fact there are involved two axes of curving . originally of course such a segment 3 is planar and along its outer contour it has a thicker rim or ridge whereby outer ridge 5 is e . g . 4 . 5 mm thick , bounding an inner ridge or rim portion 6 of about 3 . 5 mm thickness , while the remainder of the panel is about 2 . 6 mm thick . the thicker edge parts are of course provided for accommodating the assembly of plural panels or segments into the overall component 1 . the thickness differences have resulted from mechanical milling of an originally uniformly thick panel part , and this milling is carried out on the plane part prior to the curving . the originally plane segment 3 is deformed thereafter through peening shot to impart a two axes curvature configuration upon it . this is generally obtained by placing the part 3 in a manner that will be described more fully below and impacting it by means of peening shot beams covering the entire surface of the panel 3 from both sides and through utilization and possibly variation of the peening shot beam parameter . in accordance with preplanned treatment strategy one obtains a gradual change in contour . hereby one will usually run beam tracks in a polygonlike pattern corresponding to the overall geometry of the part 3 which is , as state , a truncated pie shaped segment . part 3 has in longitudinal direction an upper and a lower contour surface 8 and 8 &# 39 ; respectively sides 9 whereby the center and middle part of the concave panel 10 itself and to be covered is designated by the letter m . peening shot beam producing device is positioned above the side 10 facing that surface 10 from what will become the concave side of the part being made . the right hand portion of fig4 shows these tracks 11 which the peening shot beam follows . these are of course hypothetical tracks and result from computer control of the beam producing device . these lines , owing to the particular contour , follow broadly speaking the rule that they are at least approximately equitensional or equistrain lines . these lines of course depend on the overall geometry of the part that is being deformed . in addition of course one has to consider where the largest strain is supposed to occur which in this instance is the middle part around the center m . this as well as the outer contour of the part which will undergo minimal strain determines the pattern of the tracks 11 . in order to work in an appropriate and desired fashion the original planar part is tensioned onto a frame shown in fig5 . the frame includes a base 16 which includes a frame 17 and carries along its periphery support posts 18 . the part 3 is originally a planar part , in this case a segment as described , and through suspensions on the rods or posts 18 and further under utilization of clamping devices 20 , the part 3 is elastically curved around two axes and tensioned in that position to assume within that tool holder the contour desired to be maintained . practicing the peening shot method means the providing of a plastic deformation to eliminate elastic tension and stress so that the curved contour is retained following removal from the tool . generally speaking , the device of fig5 will hold the part to be made initially in the concave configuration , also as illustrated in fig5 and thereafter the shot peening is carried from the top that means the shot impinges upon the concave side , using accelerated peening shot made of steel balls . thereafter the part 3 is turned around and treated from the convex side . however it was found that one can proceed differently in treating first that side which will become permanently convex , turned around and finished by deforming now from the concave side . the concave and convex contours are so to speak gradually fixed in that the plastic deformation obtained by the peening shot follows the contour lines 11 as shown in fig4 . the kinetic energy of the peening shot as applied will vary whereby the peening intensity declines from the inner to the outer portions i . e . from the region around the center m towards the periphery 8 and 9 . owing to the particular energy distribution of the peening shot one can also change the ratio of longitudinal curving to transverse curving . the degree of coverage varies between 10 % and most of the entire surface 10 of this part . the thickness steps as resulting from the various thickness zones 5 , 6 , 7 will be treated in accordance with the matched parameter and parameter selection as far as the shot energy is concerned . the invention is not limited to the embodiments described above but all changes and modifications thereof , not constituting departures from the spirit and scope of the invention , are intended to be included .
| 1 |
the drawings show a toilet of the same general form as that shown in the &# 39 ; 988 stewart patent ( supra ). referring first to fig1 the toilet includes a first plastic moulding 20 that is shaped to define a waste receiving bowl 22 of the toilet , and a second plastic moulding 24 that forms a shell or outer housing in which the bowl is supported . in fig1 the first moulding 20 and associated components are shown in an exploded position above moulding 24 . the two mouldings are designed to fit together in the assembled toilet so that the moulding 20 is supported on moulding 24 as best shown in fig2 and 3 . moulding 24 includes various support posts 24a ( fig1 ) which assist in supporting the weight of a person seated on moulding 20 . typically , moulding 20 will be fitted with at least a lid and possibly also a lift - up seat ( not shown in the drawings ). fig3 best shows the bowl 22 as seen in section . the bowl has a rim 26 from which water is dispensed when the toilet is flushed ( to be described ), and a waste outlet 28 at its lower end , which is controlled by a valve comprising a bowl seal member 30 . the housing formed by moulding 24 defines an internal space 32 in which the bowl outlet 28 is located , and has a main outlet 34 from the toilet below the bowl outlet so that waste from the bowl passes by gravity to the main waste outlet . surrounding outlet 34 is a recess 36 for receiving the usual gasket for sealing with a waste discharge conduit in a recreational vehicle . provision is made for securing the toilet over an inlet flange to the conduit in conventional fashion ; for convenience , the securing means have not been shown . in accordance with the invention , the toilet is provided with both a bowl rinsing nozzle 38 adjacent the rim 26 of the toilet bowl 22 , for rinsing waste from the surface of the bowl towards outlet 28 , and an internal rinse nozzle 40 within the internal space 32 of moulding 24 , for rinsing waste that may tend to accumulate in that space when the toilet is in use . as best seen in fig4 the toilet has a main inlet pipe 42 , which communicates with the two nozzles 38 and 40 respectively by way of a water valve 44 and a diffuser chamber 46 downstream of the valve . chamber 46 has a single inlet 48 which communicates with valve 44 by way of a pipe 50 , and two outlet openings 52 and 54 which communicate respectively with the bowl rinse nozzle 38 and the internal rinse nozzle 40 . fig4 and 5 show that the first chamber outlet opening 52 ( communicating with the bowl rinse nozzle 38 ) is of larger diameter than the second outlet 54 opening ( communicating with the internal rinse nozzle 40 ). pipes 56 and 58 of corresponding respective diameters connect the two outlet openings with the respective nozzles . in this embodiment , a corrugated pipe 56 is used to connect to the bowl rinse nozzle 38 while a straight generally upright pipe 58 is used to connect to the internal rinse nozzle . it will also be noted that a so - called &# 34 ; goose neck &# 34 ; or s - trap 60 is used between pipe 58 and chamber 46 . in the embodiment , the trap is formed as part of chamber 46 ( e . g . as a one - piece plastic moulding ). however , this is not essential ; the trap may be located at any convenient point between the diffuser and nozzle 40 . fig5 a and 5b show the diffuser chamber 46 in vertical section . as seen in fig5 a , flush valve 44 ( fig4 ) has been opened , allowing water to flow under pressure into chamber 46 , completely filling the diffuser chamber 46 and flowing into both of the pipes 56 and 58 . inlet 48 is located opposite to and generally in line with outlet 54 so that the pressure of the incoming water is communicated directly to internal rinse nozzle 40 . at the same time , the volume of water entering chamber 46 is such as to overwhelm the chamber and almost instantly fill pipe 56 . fig5 a illustrates the size differential between the two outlets 52 and 54 . pipe 56 ( and hence the bowl rinse nozzle 38 ) will receive a relatively high volume of water compared with the volume of water that enters pipe 58 and flows to nozzle 40 . accordingly , a relatively large volume of water will be discharged from nozzle 38 ( fig3 ) for flushing the toilet bowl . at the same time , a relatively strong jet or jets of water ( but of lower total volume ) will be discharged by the internal rinse nozzle 40 for flushing accumulated waste and other debris within the internal space 32 of the toilet housing . in fig2 and 3 , the arrows denoted 63 illustrate the fact that nozzle 40 is designed to direct a relatively broad fan - shaped spray towards and beyond the bowl seal 30 of the toilet so as to promote good rinsing of both the seal and of the internal surfaces of the toilet housing . fig2 a shows the internal rinse nozzle 40 is some detail . it will be seen that the nozzle includes a cylindrical sleeve 40a which is push - fitted within the lower end of pipe 58 in the assembled toilet , and secured with hose - clamp ( not shown ). disposed at the lower end of and extending transversely with respect to the longitudinal axis of sleeve 40a is an end plate 40b which is generally disc - shaped but positioned offset with respect to sleeve 40a to the left as seen in fig2 a , i . e . so that more of plate 40a extends outwardly beyond sleeve 40a at one side than the other . the nozzle is positioned with this side facing in the forward direction of the toilet , i . e . to the left in fig2 and 3 . a transverse spacer element 40c extends between the sleeve 40a and the plate 40b and maintains the lower end of the sleeve at a spacing above the plate so that , in effect , a slot of almost 360 ° extent is provided between the sleeve and the plate . accordingly , water that enters sleeve 40a from pipe 58 impinges against the top surface of plate 40b and is deflected laterally outwardly in a spray pattern of almost 360 ° around nozzle 40 . spacer element 40c is in fact offset to the right as seen in fig2 a so that a smaller water outlet gap exists at the rear of the nozzle ( to the right in fig2 a ) than to the front ( the left ). accordingly , a greater volume of water will be directed forwardly in the direction of the arrow 63 although some water will be directed rearwardly against the rear surface of shell 24 . the bowl rinsing nozzle 38 may be arranged to discharge multiple streams , for example in a &# 34 ; fan pattern &# 34 ; for good rinsing of the bowl . in an alternative embodiment , multiple bowl rinsing nozzles or a ring having multiple discharge apertures may be provided , as is known in the art . fig . 5b shows the diffuser chamber 56 after water valve 44 has been closed . it will be seen that a residual body 62 &# 39 ; of rinse water will remain in trap 60 . this prevents backflow of odours from the interior of the toilet . reverting to fig2 and 3 , the precise form of bowl seal member 30 is not significant . a number of different types of seals or valves are known in the art . in this particular embodiment , the seal member is in the form of a plate 64 which is pivotally suspended from the toilet bowl 22 by respective pairs of links at opposite sides of the bowl , one pair of which is visible in fig1 and 3 , the individual links being denoted 66 and 68 . the links in each pair are of unequal lengths and are coupled to respective pivot points 70 and 72 on the bowl and 74 and 76 on plate 64 . the respective lengths of the links and their pivot points are arranged so that plate 64 can swing between a position which is clear of bowl outlet 28 ( as shown in fig2 ) and a position in which the plate moves upwardly into contact with and fits snugly against the mouth of bowl outlet 28 ( as seen in fig3 ). this upward motion ensures good sealing without causing abrasion such as would occur if the bowl seal member were to be moved purely laterally while in contact with the bowl outlet . a tension spring 78 extends between link 68 and a fixed point within the toilet housing to spring bias the plate 64 to the bowl closing position ( fig3 ). the valve can be opened by a yoke 80 ( see fig1 ) which engages link 68 at a pivot point 82 . yoke 80 extends towards the left ( front ) of the toilet as seen in fig2 and 3 and is coupled to a cable 84 at a fitment 86 which is fixed within the toilet housing . cable 84 then extends to a suitable actuating member such as a foot pedal or a handle , operation of which will cause cable 84 to be pulled , for opening valve 30 against the action of spring 78 . release of the actuating member will allow the valve to close under the influence of spring 78 . as indicated above , the precise structure of bowl seal 30 and its manner of actuation do not form part of the invention and can be accomplished in any of a number of ways known per se in the art . typically , the water valve 44 will also be cable - operated from the same actuating member , also as well - known in the art . referring to foot pedal actuation by way of example , the arrangement is preferably such that water valve 44 is opened initially upon operation of the foot pedal , initiating discharge of water from the bowl rinse nozzle 38 and from the internal rinse nozzle 40 . continued depression of the foot pedal opens valve 30 so that the contents of the bowl are discharged . conversely , as the pedal is released , valve 30 closes first , followed by the water valve 44 . in this way , water continues to discharge from nozzle 38 after valve 30 has closed , so that a body of water remains in the lower portion of the bowl ready for the next the toilet is used . a suitable foot pedal actuator is disclosed in the &# 39 ; 988 stewart patent . it will of course be appreciated that the preceding description relates to a particular preferred embodiment of the invention only and that many modifications are possible within the broad scope of the claims . some of those modifications have been mentioned previously and others will be apparent to a person skilled in the art . other possible modifications include , for example , the use of multiple internal rinse nozzles in place of the single nozzle 40 referred to previously , or a different location of the nozzle within space 32 ( as shown , nozzle 40 is located at the rear of the toilet and is directed forwardly ). a single nozzle could be centrally located within space 32 ( e . g . just to the left of the bowl outlet in fig2 and 3 ) and provided with water openings for providing a 360 ° spray pattern . referring to fig4 an appropriately sized y connector could be used as a diffuser means in place of chamber 46 .
| 4 |
the catalysts used in the process of the present invention can be iron family elements , copper family elements , oxides thereof and copper chromite . the catalysts are suitable for the hydrogenation cleavage of the -- o -- n bond under remaining the unsaturated bonds . suitable catalysts include raney catalysts obtained by the raney development of aluminum alloy containing ni , co , fe or cu ; urushibara nickel catalysts having similar characteristics of raney nickel , the reduced ni , co , fe or cu catalysts obtained by reducing a metal oxide prepared by a precipitation method from a water soluble metal salt with hydrogen , etc . the oxide of ni , co , fe or cu can be also used as the catalysts for the hydrogenation cleavage of o -- n bond . the copper chromite catalysts ( cu - cr catalyst ; copper oxide - chromium oxide catalyst or adkins catalyst ) can be also used . the catalysts suitable for the hydrogenation cleavage of o -- n bond are used in various forms such as the suspension , the fixed bed , and others . the amount of the catalyst is dependent upon the reaction activity of the catalyst and the starting material , the reaction temperature , hydrogen pressure , the form of the catalyst and the concentration of the starting material in the reaction system . in order to attain the hydrogenation cleavage of o -- n bond in the presence of the catalyst , it is preferable to use a solvent which dissolves the starting material of the n , n - dialkyl hydroxylamine and the product of the chain terpene alcohol , such as alcohols , ethers , hydrocarbons , etc . however , the reaction can be attained without a solvent . the pressure of hydrogen and the reaction temperature in the hydrogenation are dependent upon the kinds of the catalysts . when a nickel type catalyst is used , it is possible to hydrogenate at relatively low temperature such as 25 ° to 130 ° c , under relatively low pressure such as the atmospheric pressure to 70 kg / cm 2 g . when the pressure and the temperature are too high , the double bond is hydrogenated to increase citronellol and dimethyl octanol , etc . when a copper type catalyst or a copper - chromite type catalyst is used , the velocity of hydrogenation is relatively slow and it is preferable to hydrogenate at relatively high temperature such as 50 ° to 150 ° c , under relatively high pressure such as 30 to 150 kg / cm 2 g . even though the temperature and the hydrogen pressure are relatively high , the hydrogenation of the double bond is slight to form only small amount of citronellol and dimethyl octanol . the cobalt type catalysts have catalytic activity in the middle of those of the nickel type catalyst and the copper type catalyst . the iron type catalysts have lower catalytic activity . the temperature and the pressure are considered depending upon the catalytic activity . after the hydrogenation cleavage , the catalyst is separated by a filteration etc . and the solvent and the by - product of dialkylamine are separated by a distillation and the unreacted n , n - dialkyl hydroxylamine and the object chain terpene alcohol are distilled out and are purified by a chromatography or other means in the batch system . the resulting chain terpene alcohol can be further separated by means of fine distillation if necessary . the by - product of dialkylamine can be used for the preparation of the n , n - dialkyl hydroxylamine or a solvent . the n , n - dialkyl hydroxylamine can be used for the hydrogenation . the catalyst can be also reused . thus , the chain terpene alcohols obtained by the present invention are geraniol , nerol , citronellol , hydroxygeraniol , hydroxynerol , hydroxycitronellol as the main components . the n , n - dialkyl hydroxylamines having the formula ( iii ) or ( iv ) can be obtained by a thermal rearrangement of the compound ## str8 ## for example , o -( 3 , 7 - dimethyl - 2 , 6 - octadienyl )- n , n - dialkyl hydroxylamine or o -( 3 , 7 - dimethyl - 7 - hydroxy - 2 - octenyl )- n , n - dialkyl hydroxylamine can be prepared by various processes . the process for producing them by using isoprene and an alkylamine is especially advantageous . that is , o -( 3 , 7 - dimethyl - 2 , 6 - octadienyl )- n , n - dialkyl hydroxylamine can be obtained by reacting isoprene with a dialkylamine in the presence of a lithium catalyst such as metallic lithium or an organo - lithium compound to produce n , n - dialkyl - 3 , 7 - dimethyl - 2 , 6 - octadienylamine ( mainly dialkyl neryl amine ) and oxidizing it to produce n , n - dialkyl - 3 , 7 - dimethyl - 2 , 6 - octadienyl - amine oxide with a peroxide and heating it at 90 ° to 200 ° c to produce o -( 3 , 7 - dimethyl - 2 , 6 - octadienyl )- n , n - dialkyl hydroxylamine . the n , n - dialkyl - 3 , 7 - dimethyl - 2 , 6 - octadienylamine can be also obtained by reacting myrcene with a dialkylamine in the presence of a catalyst of sodium , potassium or lithium . o -( 3 , 7 - dimethyl - 7 - hydroxy - 2 - octenyl )- n , n - dialkyl hydroxylamine can be obtained by hydrolyzing n , n - dialkyl - 3 , 7 - dimethyl - 2 , 6 - octadienylamine ( mainly dialkyl nerylamine ) in the presence of hydrochloric acid or sulfuric acid to produce n , n - dialkyl ( 3 , 7 - dimethyl - 7 - hydroxy - 2 - octene ) amine and oxidizing it to produce n , n - dialkyl ( 3 , 7 - dimethyl - 7 - hydroxy - 2 - octene ) amineoxide and heating it at 90 ° to 200 ° c to produce o -( 3 , 7 - dimethyl - 7 - hydroxy - 2 - octenyl )- n , n - dialkyl hydroxylamine . in a glass reactor ( 100 cc ) purged with nitrogen , 0 . 25 mole of isoprene , 0 . 05 mole of diethylamine , 0 . 005 mole of n - bu - li and 15 g of benzene were charged and the mixture was stirrier at 65 ° c for 8 hours to react them . after the reaction , a small amount of ethanol was added to cease the reaction . the reaction products were measured by a gas chromatography . as the result , the yield of n , n - diethyl nerylamine was 32 . 3 % ( based on isoprene ) or 80 . 7 % ( based on diethylamine ). the conversion of isoprene was 38 . 5 % and the selectivity of isoprene to n , n - diethyl nerylamine was 83 . 8 %. in accordance with the process of preparation 1 except using 0 . 25 mole of isoprene , 0 . 05 mole of diethylamine , 0 . 01 mole of metallic lithium and 15 g of benzene , the reaction was carried out at 65 ° c for 8 hours . after the reaction , the reaction mixture was distilled to obtain the yield of 75 . 6 % based on diethylamine . ( conversion of isoprene : 42 . 5 %; selectivity of isoprene : 71 . 1 %). n , n - diethyl nerylamine oxide was obtained by adding 19 . 2 ml of 30 % hydrogen peroxide and 24 ml of methanol to 7 . 44 g of n , n - diethyl nerylamine of preparation 1 . ( reaction at 65 ° c for 4 hours ) a 2 . 4 g of n , n - diethyl nerylamine oxide was mixed with 10 ml of benzene and the mixture was heated at 115 ° to 125 ° c for 3 hours and the reaction mixture was distilled to obtain hydroxylamine mixture ( ha ) of 68 mole % of o - geranyl - n , n - diethyl hydroxylamine ( gha ) and 32 mole % of o - neryl - n , n - diethyl hydroxylamine ( nha ) in the yield of 81 % based on n , n - diethyl nerylamine . in accordance with the process of preparation 1 , except using 9 . 9 g of myrcene , 3 . 6 g of diethylamine and 0 . 1 g of metallic sodium , the reaction was carried out at 40 ° c for 3 hours . after the reaction , the reaction mixture was distilled to obtain 7 . 7 g of n , n - diethyl geranylamine ( boiling point : 85 ° to 87 ° c / 2 mmhg ). in accordance with the preparations 2 and 3 , n , n - diethyl geranylamine was oxidized and rearranged to obtain o - neryl - n , n - diethyl hydroxylamine and o - geranyl - n , n - diethyl hydroxylamine . in 100 cc autoclave made of stainless steel ( under pressure ) or 100 cc glass flask ( atmospheric pressure ) as the reactor , a mixture of o - geranyl - n , n - diethyl hydroxylamine and o - neryl - n , n - diethyl hydroxylamine which was obtained in preparation 3 was hydrogenated with hydrogen in a solvent of ethyl alcohol in the conditions of table 1 with stirring . after the reaction , each reaction mixture was filtered and distilled to separate the catalyst and the solvent . the unreacted hydroxylamine , geraniol , nerol and citronellol and the others in the reaction product were measured by a gas chromatography in the standardization ( 20 % peg 20 m , 1 m glass column , 100 → 180 ° c : 4 ° c / min . ; 50 ml he / min .). each alloy of aluminum and other metal was developed with a base by the conventional method ( w - 4 ) and the product was washed and stored in ethanol . table 1______________________________________ h . sub . 2 pres - amount sure of amount ( kg / temp . time solventno . catalyst ○ 1 cm . sup . 2 g ) (° c ) ( hr .) ○ 2______________________________________1 raney ni 0 . 20 np 25 8 . 5 0 . 072 &# 34 ; 0 . 062 np 60 3 0 . 073 reduced ni 0 . 15 10 115 1 0 . 054 raney co 0 . 2 30 80 8 0 . 055 &# 34 ; 0 . 44 50 50 - 80 4 . 5 0 . 026 reduced co 0 . 44 50 80 6 0 . 027 raney fe 1 . 1 50 80 5 0 . 028 raney cu 0 . 44 50 80 5 0 . 029 reduced fe 2 . 0 50 120 7 0 . 0210 reduced cu 0 . 2 50 100 1 0 . 0411 oxidized cu 0 . 5 50 105 3 0 . 02512 cu chromite 0 . 44 50 80 3 0 . 0213 &# 34 ; 0 . 1 70 120 1 . 5 0 . 03314 &# 34 ; 0 . 1 80 120 1 . 0 0 . 0315 raney cu 0 . 44 50 80 4 . 5 0 . 0216 raney cu 0 . 44 50 80 4 . 5 0 . 0217 cu chromite 0 . 25 50 110 2 . 0 0 . 318 raney ni 0 . 1 30 80 4 -- 19 cu chromite 0 . 1 70 120 6 . 5 -- 20 &# 34 ; 0 . 25 50 115 1 . 5 0 . 3ref . 1 pt2 %/ al . sub . 2 o . sub . 3 0 . 3 50 80 7 . 5 0 . 02ref . 2 &# 34 ; 1 . 1 50 80 5 . 5 0 . 02ref . 3 pd5 %/ c 0 . 044 50 80 1 0 . 02ref . 4 pd5 %/ al . sub . 2 o . sub . 3 0 . 58 50 80 3 0 . 02ref . 5 pd5 %/ c 0 . 89 50 80 5 0 . 02ref . 6 rh5 %/ c 0 . 67 50 80 4 0 . 02______________________________________ np = normal pressure table 1 &# 39 ; __________________________________________________________________________conver - terpene alcohol selec - by - productsion yield ( mole %) tivity other ○ 3 n . oh g . oh c . oh ○ 7 i ii amineno . ( mole %) ○ 4 ○ 5 ○ 6 total (%) ○ 8 ○ 9 ○ 10 remarks__________________________________________________________________________ 1 80 23 50 6 79 98 -- -- -- 2 43 11 30 1 42 98 -- -- -- 3 95 28 55 12 95 100 -- -- -- 4 50 9 19 20 48 96 -- -- -- 5 76 5 11 42 58 76 -- * 1 : 1 6 50 10 23 11 44 90 -- -- -- 7 100 27 56 12 95 95 -- -- -- 8 70 20 43 2 65 92 -- -- -- 9 10 3 7 -- 10 100 -- -- -- 10 92 30 61 1 92 100 -- -- -- 11 100 31 61 6 98 98 -- -- -- 12 96 36 57 5 96 100 -- -- -- 13 96 34 60 2 96 100 -- -- -- 14 94 34 57 0 . 25 92 98 -- -- -- * 515 10 3 7 -- 10 100 -- -- -- * 616 21 7 12 2 21 100 -- -- -- * 717 97 30 60 3 . 2 93 96 -- -- -- * 818 65 19 32 14 65 100 -- -- -- * 919 44 15 28 1 44 100 -- -- -- * 920 97 29 57 6 . 7 90 . 7 95 -- -- -- * 10ref . 110 - 20 ˜ 3 ˜ 7 ˜ 5 ˜ 15 -- -- -- * 1ref . 280 - 90 -- -- -- -- -- * 1 * 1 * 2ref . 3100 -- -- -- -- -- * 4 * 2 * 1ref . 420 - 30 -- -- -- -- -- -- * 1 * 1ref . 5100 -- -- -- -- -- * 2 * 1 * 4ref . 6100 -- -- -- -- -- * 2 * 3 * 1__________________________________________________________________________ * 1 the by - product was found ? * 2 the by - product was main component * 3 the by - product was found in high ratio * 4 the by - product was found in low ratio * 5 r . sub . 3 : methyl group * 6 solvent : dioxane * 7 solvent : cyclohexane * 8 solvent : isostearyl alcohol * 9 any solvent was not used * 10 solvent : benzene note : 1 ) scale nha + gha 0 . 89 g ( nha / gha = 1 / 2 . 08 ) 2 ) catalysts of ref . 1 , 2 , 5 , 6 manufactured by nippon engelhard k . k . 3 ) ○ 1 ## str9 ## ○ 2 ## str10 ## ○ 3 ## str11 ## ○ 4 nerol ○ 5 geraniol ○ 6 citronellol ○ 7 ## str12 ## ## str13 ## ## str14 ## ○ 10 components extracted with 2nhcl nha : o - neryl - n , n - diethyl hdyroxylamine gha : o - geranyl - n , n - diethyl hydroxylamine ha : total hydroxylamines in a glass reactor ( 100 cc ) purged with nitrogen , 0 . 5 mole of isoprene , 0 . 1 mole of diethylamine , 0 . 01 mole of n - bu - li and 30 g of benzene were charged and the reaction was carried out at 65 ° c for 8 hours with stirring . after the reaction , a small amount of ethanol was added to cause the reaction . the reaction products were measured by a gas chromatography . as a result , the yield of n , n - diethyl nerylamine was 80 . 7 % based on diethylamine . a 15 g of n , n - diethyl nerylamine was mixed with 80 cc of 3n - hcl , and the reaction was carried out at 45 ° c for 5 hours with stirring to obtain n , n - diethyl ( 3 , 7 - dimethyl - 7 - hydroxy - 2 - octenyl ) amine ( boiling point 115 ° to 117 ° c / 3 mmhg ) in the yield of 95 %. n , n - diethyl ( 3 , 7 - dimethyl - 7 - hydroxy - 2 - octenyl ) amine oxide was obtained by adding 20 cc of 35 % hydrogen peroxide and 30 cc of methanol to 13 g of n , n - diethyl ( 3 , 7 - dimethyl - 7 - hydroxy - 2 - octenyl ) amine of preparation 6 . ( reaction at 65 ° c for 4 hours ) a 13 g of n , n - diethyl ( 3 , 7 - dimethyl - 7 - hydroxy - 2 - octenyl ) amine oxide was mixed with 70 cc of toluene and the mixture was stirred at 115 ° c for 4 hours and the reaction mixture was distilled to obtain o -( 3 , 7 - dimethyl - 7 - hydroxy - 2 - octene ) n , n - diethyl hydroxylamine ( boiling point : 120 ° to 125 ° c / 1 . 5 mmhg ) in the yield of 80 %. in 100 cc autoclave made of stainless steel , 1 . 0 g of o -( 3 , 7 - dimethyl - 7 - hydroxy - 2 - octene ) n , n - diethyl hydroxylamine of preparation 7 , 0 . 3 g of raney nickel and 40 g of ethanol were charged and a hydrogenation was carried out at an initial pressure of hydrogen of 5 kg / cm 2 for 3 hours . the catalyst was separated and the reaction mixture was distilled to obtain 3 , 7 - dimethyl - 2 - octene - 1 , 7 - diol ( boiling point : 105 ° to 109 ° c / 0 . 45 mmhg ) in the yield of 89 mole % and 3 , 7 - dimethyl octane - 1 , 7 - diol ( boiling point : 102 ° to 105 ° c / 0 . 45 mmhg ) in the yield of 8 mole %. according to a gas chromatography analysis of the former product , it was found that the product was a mixture of hydroxy geraniol and hydroxy nerol at a ratio of 2 : 1 . in accordance with the process of preparation 8 , except using various catalysts instead of raney nickel , each hydrogenation of o -( 3 , 7 - dimethyl - 7 - hydroxy - 2 - octene ) n , n - diethyl hydroxylamine of preparation 7 was carried out in the conditions shown in table 2 . table 2__________________________________________________________________________ yield ( mole %) amount of hydroxy yield catalyst h . sub . 2 tempera - conver - geraniol ( mole %) (%) pressure ture time sion hydroxy hydroxypreparation catalyst ** ( kg / cm . sup . 2 g ) (° c ) ( hr .) ( mole %) nerol citronellol__________________________________________________________________________9 - 1 raney - co 50 30 100 10 80 46 349 - 2 raney - fe 100 50 80 5 90 75 119 - 3 reduced ni 30 10 115 1 97 80 79 - 4 oxidized cu 20 50 115 1 . 5 97 90 39 - 5 cu chromite 20 50 115 1 98 71 109 - 6 *( non - solvent ) 20 50 115 6 40 38 19 - 7 pd / af . sub . 2 o . sub . 3 2 10 115 2 100 8 14__________________________________________________________________________ note : 1 ) * 9 - 6 : none solvent others : 40 g of ethanol per 1 g of starting material . 2 ) catalyst : pd / al . sub . 2 o . sub . 3 : 5 % pd on γ - al . sub . 2 o . sub . 3 manufactured by nippon engelhard k . k . others are the same with those of preparation 5 . ** ## str15 ##
| 2 |
referring now more specifically to the drawings , fig1 shows the sample merchandise display and distribution device 1 of the present invention before it is attached to the product 3 or the sample 2 to be displayed and distributed . fig2 shows how the sample merchandise display and distribution device 1 appears during its intended use . fig3 is a cross - sectional side view and fig4 is a perspective view of the sample merchandise and distribution device 1 constructed in accordance with the invention . as shown in fig3 and 4 , the sample merchandise display and distribution device 1 of the present invention comprises four side walls 6 &# 39 ;, 7 &# 39 ;, 8 &# 39 ; and 9 &# 39 ; and an internal support wall 37 defining a first longitudinal aperture 38 and a second longitudinal aperture 39 . the first longitudinal aperture 38 is sized and adapted to receive and retain a container 3 housing a retail consumer product . the second longitudinal aperture 39 is sized and adapted to receive , retain , and display a merchandise sample 2 . the product 3 and the sample 2 may be secured in longitudinal openings 38 and 39 in a wide variety of ways well known to those skilled in the art as suitable for this purpose , e . g ., glue , tape , interlocking tabs , etc ., however in a preferred embodiment a frictional engagement is preferred because of the reduced manufacturing costs and the economy of materials and labor utilized in erecting the display . a frictional engagement also allows the consumer to more conveniently remove both the sample 2 and the product 3 and conserves natural resources . the sample display and distribution device 1 may be manufactured from a variety of materials well known to those skilled in the art as suitable for this purpose , e . g ., plastic , styrofoam , and paper . corrugate of various mediums may also be utilized . in a preferred embodiment , solid unbleached sulphate ( sus ) paper , solid bleached sulphate ( sbs ) paper , or clay coated new board ( ccnb ) paper is utilized . as shown in fig4 and 5 , the internal support wall 37 is comprised of a plurality of interlocking support panel members adapted for selective engagement and disengagement with each other . the interlocking panels impart support and rigidity in the erected condition and are adapted for selective disengagement with each other to allow the sample merchandise display and distribution device 1 to be folded flat , as shown in fig6 and 7 , thus , significantly reducing its volume and shipping costs . in a preferred embodiment , the display and distribution device 1 is constructed from a single die - cut blank 19 having a first major surface as shown in fig8 a and a second major surface as shown in fig8 b . the blank 19 shown in fig8 a includes a first wall panel 4 , a second wall panel 5 , a third wall panel 6 , a fourth wall panel 7 , a first central panel 8 , a second central panel 9 , a third central panel 10 , a fourth central panel 11 , a first support panel member 12 , a second support panel member 13 , a third support panel member 14 , a fourth support panel member 15 , a first securing tab 16 , a second securing tab 17 , a first interlock notch 20 , a second interlock notch 21 , and a flap 18 . the central panels 8 , 9 , 10 , and 11 , the wall panels 4 , 5 , 6 , and 7 , the support panel members 12 , 13 , 14 , and 15 , and securing tabs 16 and 17 are all in the same plane . for purposes of description , and with reference to the die - cut blank 19 shown in fig8 a ., the first wall panel 4 projects vertically above the first central panel 8 with the integral adjacent edges defined by a full width fold line 27 . the second wall panel 5 projects vertically above the second central panel 9 with the integral adjacent edges defined by a full width fold line 28 . the third wall panel 6 projects vertically above the third central panel 10 with the integral adjacent edges defined by a full width fold line 29 . the fourth wall panel 7 projects vertically above the fourth central panel 11 with the integral adjacent edges defined by a full width fold line 30 . first support panel member 12 extends vertically and below first central panel 8 with the integral adjacent edges defined by a full width fold line 31 . second support panel member 13 extends vertically and below second central panel 9 with the integral adjacent edges defined by a full width fold line 32 . third support panel member 14 extends vertically and below third central panel 10 with the integral adjacent edges defined by a full width fold line 33 . fourth support panel 15 extends vertically and below fourth central panel 11 with the integral adjacent edges defined by a full width fold line 34 . first securing tab 16 is attached to first support panel member 12 with the integral edges defined by a full width fold line 35 . second securing tab 17 is attached to third support panel member 14 with the integral edges defined by a full width fold line 36 . the second wall panel 5 projects laterally to the right of first wall panel 4 and is hingedly integral therewith along a full fold or crease line 22 . the third wall panel 6 projects laterally to the right of second wall panel 5 and is hingedly integral therewith along a full fold or crease line 23 . the fourth wall panel 7 projects laterally to the right of third wall panel 6 and is hingedly integral therewith along a full fold or crease line 24 . the second central panel 9 projects laterally to the right of first central panel 8 and is hingedly integral therewith along a fold or crease line 25 . the third central panel 10 projects laterally to the right of second central panel 9 and is hingedly integral therewith along a fold or crease line 26 . the fourth central panel 11 projects laterally to the right of third central panel 10 and is hingedly integral therewith along a fold or crease line 27 . fig8 b shows the second major surface , i . e ., the opposite side , of the die - cut blank shown in fig8 a . the blank 19 shown in fig8 b includes a first wall panel 4 &# 39 ;, a second wall panel 5 &# 39 ;, a third wall panel 6 &# 39 ;, a fourth wall panel 7 &# 39 ;, a first central panel 8 &# 39 ;, a second central panel 9 &# 39 ;, a third central panel 10 &# 39 ;, a fourth central panel 11 &# 39 ;, a first support panel member 12 &# 39 ;, a second support panel member 13 &# 39 ;, a third support panel member 14 &# 39 ;, a fourth support panel member 15 &# 39 ;, a first securing tab 16 &# 39 ;, a second securing tab 17 &# 39 ;, and a flap 18 &# 39 ;. to prepare the sample merchandise display and distribution device 1 , the die - cut blank 19 is folded as shown in fig9 so that first central panel 8 and first support panel member 12 are in contact with first wall panel 4 , second central panel 9 and second support panel member 13 are in contact with second wall panel 5 , third central panel 10 and third support panel member 14 are in contact with third wall panel 6 , and fourth central panel 11 and fourth support panel member 15 are in contact with fourth wall panel 7 . as shown in fig9 folding the blank in this manner exposes to the viewer support panel member surfaces 12 &# 39 ;, 13 &# 39 ;, 14 &# 39 ;, and 15 &# 39 ; and central panel surfaces 8 &# 39 ;, 9 &# 39 ;, 10 &# 39 ;, and 11 &# 39 ;. as shown in fig1 and 11 and 12 , support panel members 12 &# 39 ;, 13 &# 39 ;, 14 &# 39 ;, and 15 &# 39 ; are then folded in a direction away from wall panels 4 , 5 , 6 , and 7 to an angle substantially perpendicular to wall panels 4 , 5 , 6 , and 7 . fig1 is a side view of fig1 and fig1 is an end view of fig1 . the blank 19 depicted in fig1 , 11 , and 12 is then folded so that surfaces 11 &# 39 ; and 7 &# 39 ; are substantially perpendicular to surfaces 10 &# 39 ; and 6 &# 39 ; and surfaces 8 &# 39 ; and 4 &# 39 ; are substantially perpendicular to surfaces 9 &# 39 ; and 5 &# 39 ; as shown in fig1 . surfaces 11 &# 39 ; and 7 &# 39 ; are folded to a position substantially perpendicular with surfaces 8 &# 39 ; and 4 &# 39 ; and surfaces 10 &# 39 ; and 6 &# 39 ; are folded to a position substantially perpendicular to surfaces 9 &# 39 ; and 5 &# 39 ; resulting in the sample display and distribution device as shown in fig5 . flap surface 18 is folded and secured to surface 7 &# 39 ; to maintain the configuration of the sleeve . the flap surface 18 may be secured in a variety of ways well known to those skilled in the art as suitable for this purpose , e . g ., stapling , taping , crimping , etc ., however in a preferred embodiment , an adhesive is utilized . the support panel members 12 &# 39 ;, 13 &# 39 ;, 14 &# 39 ;, and 15 &# 39 ; are then engaged and interlocked to form the internal support wall 37 . in an especially preferred embodiment , first securing tab surface 16 is secured to second support panel surface 13 &# 39 ; and second securing tab surface 17 is secured to fourth support panel member surface 15 &# 39 ;. the securing tabs 16 and 17 may be secured in a variety of ways well known to those skilled in the art as suitable for this purpose , e . g ., stapling , taping , crimping , etc ., however in a preferred embodiment , an adhesive is utilized . fig1 b is a side view of fig1 a and shows wall panel 5 &# 39 ;, central panel 9 &# 39 ;, support panel member 13 &# 39 ;, wall panel 7 &# 39 ;, central panel 11 &# 39 ; and support panel member 15 &# 39 ;. the central panels 9 &# 39 ; and 11 &# 39 ; cooperate with wall panels 5 &# 39 ; and 7 &# 39 ; to form a double wall . this double wall provides additional protection and crush resistance to a sample 2 inserted into the opening 39 because the double wall resists compressive forces applied along the longitudinal and transverse axes of the sample merchandise display and distribution device 1 . in an alternative embodiment , shown in fig1 and 16 , the walls defining the second longitudinal opening 39 are provided with one or more viewing apertures 40 to allow the sample 2 to be viewed from the side when the sample 2 is inserted into second longitudinal opening 39 . the exterior of the sample merchandise and distribution device 1 may also be marked with indicia corresponding to and sized and positioned to be in registry with the external markings on the package 3 when it is inserted into first longitudinal opening 38 so as to provide a neat and attractive appearance as shown in fig1 and 16 . in a preferred embodiment , the assembled apparatus is provided with an external wrapping to provide additional rigidity , stability , and protection to the product and the sample . fig1 shows the apparatus of fig1 with a transparent external wrapping 40 applied . the wrapping 40 may be chosen from a variety of wrappings well known to those skilled in the art as suitable for this purpose , however , in an especially preferred embodiment a heat shrinkable wrapping film is utilized . the external wrapping 40 may be opaque , translucent or transparent and may be provided with decorative indicia or markings . while particular embodiments of this invention have been shown in the drawings and described above , it will be apparent that many changes may be made in the form , arrangement , and positioning of the various elements of the combination . in consideration thereof , it should be understood that preferred embodiments of this invention disclosed herein are intended to be illustrative only and not intended to limit the scope of the invention .
| 0 |
one embodiment of an exemplary device in accordance with the present invention for mobile computing , communication and entertainment is illustrated in fig1 - 4 and generally indicated by the numeral 10 . device 10 includes a detachable portable unit 20 and a docking display unit 30 . detachable portable unit 20 may also include an electrical connector 23 that carries signals from the central processor 11 through video interface 15 , keyboard interface 16 , communication interface 17 , pen - input interface 51 , audio interface 29 , and power supply 14 . as seen in fig3 , the docking display unit 30 does not include a central processor , and one or more of the circuits of the docking display are operated by the central processor 11 of the detachable portable unit . mating electrical connector 36 in docking display unit 30 may therefore connect these signals to auxiliary display 31 , auxiliary keyboard 32 , wired communication circuit 33 , auxiliary pen - input panel 44 , speakers 42 and microphone 43 , and power jack 35 . communication circuit 33 is connected to communication jack 34 for further connection to communication lines such as the public switched telephone network or cell or other wireless network . docking display unit 30 includes a recessed platform 38 , with an electrical connector 36 , a fixed tab 39 and a movable tab 41 , retractable by latch 37 . to dock detachable portable unit 20 into docking display unit 30 , fixed tab 39 is slid into slot 24 with the front side of detachable portable unit 20 facing platform 38 . the other end of detachable portable unit 20 is brought down to have connector 23 on detachable portable unit 20 mate with connector 36 of docking display unit 30 . tab 41 is slid into slot 25 to secure detachable portable unit 20 in place . docking display unit 30 is shown as a portable clamshell style unit , including an auxiliary display 31 , in the lid portion and an auxiliary keyboard 32 in the base portion , facing each other in the closed position . the lid of docking display unit 30 also contains a communication jack 34 , such as a standard rj - style telephone jack , and a power jack 35 , such as an ac adapter / charger jack . the block diagram in fig3 shows detachable portable unit 20 including a central processor 11 , and the circuits supported and / or controlled by it , namely program memory 112 , at memory 13 , power supply 14 , video interface 15 , keyboard interface 16 , communication interface 17 , pen - input interface 51 , and audio interface 29 . in turn , video interface 15 drives display 18 , the keyboard interface 16 drives the keypad 19 , communication interface 17 drives wireless communication circuit 21 , pen - input interface 51 drives the pen - input panel 52 , and audio interface 29 drives microphone 26 and speaker 27 , and connects to the headphone jack 28 . wireless communication circuit 21 is connected to the antenna 22 . gps receiver 58 , such as that supplied by sirf technology of san jose , calif ., is also connected to central processor 11 . detachable portable unit 20 also includes an electrical connector 23 that carries signals from the central processor 11 through video interface 15 , keyboard interface 16 , communication interface 17 , pen - input interface 51 , audio interface 29 , and power supply 14 . mating electrical connector 36 in docking display unit 30 connects these signals to auxiliary display 31 , auxiliary keyboard 32 , wired communication circuit 33 , auxiliary pen - input panel 44 , speakers 42 and microphone 43 , and power jack 35 . wired communication circuit 33 is connected to communication jack 34 for further connection to external wired communication lines such as the public switched telephone network . detachable portable unit 20 may also contain an optical transmitter 54 for transmission of remote control signals to tv , vcr , etc . alternately , it may be equipped with an optical transceiver 53 for optical communication with other compatible devices , such as laptop computers , printers and network interfaces . in another variation of the above embodiment , the interface signals connecting the circuitry carried in detachable portable unit 20 and docking display unit 30 may be multiplexed using conventional multiplexing circuits in order to reduce the number of interconnect signals and hence reducing the size of connectors 23 and 36 . in another variation of the above embodiments , detachable portable unit 20 may contain no display at all , like conventional cordless handsets . in this case central processor 11 will still drive the auxiliary display 31 through the video interface 15 , and video interface 15 may be housed in docking display unit 30 , further reducing the size of detachable portable unit 20 . fig5 shows docking display unit 30 mounted on the floor of a vehicle 70 . the bottom end of a pedestal 60 is attached to the vehicle floor 70 . clamps 61 are attached to the top end of pedestal 60 . docking display unit 30 can be removably mounted on pedestal 60 by using bolts or other conventional methods . detachable portable unit 20 can then be docked in docking display unit 30 in the same manner as in the other applications described hereinbefore . the ordinarily skilled artisan should now appreciate that in this way a portable device for computing , communication and / or entertainment device , can be created that has a detachable portable unit . when mated with a docking display unit , the detachable portable unit becomes the controller for the entire portable computing , communication and entertainment device . the detachable portable unit is in a smaller housing that is dimensioned for handheld grasping and is sized to be carried in a pocket like an average cell phone . the docking display unit carries an auxiliary , larger display and other components . the central processor , carried in the detachable portable unit , and being used to operate the docking display unit , must have enough processing power to adequately perform functions of an entire portable computing , communication and entertainment device , and not just the functions of a wireless phone . examples of commercially available processors adequate for this task include the intel strongarm processor , the models sh - 3 and sh - 4 processors from hitachie american , ltd . of brisbane , calif ., and the model 4100 risc processor from nec american , inc . of irving , calif . as technology advances in the future , the pentium processor from intel , used in most laptop computers , may be used in other embodiments of the current invention . the other components used in device 10 can be similar to those employed by traditional computing devices , communication devices and entertainment devices . typical of these other components are : liquid crystal display of small and large sizes from optrex america inc . of detroit , mich ., and seiko instruments usa , incorporated of torrance , calif . ; memory chips from micron technologies , inc . of boise , id ., vlsi technologies wireless communication chips available from philips north american in atlanta , ga ., power supply chips from analog devices inc . of norwood , mass ., and pen - input panels from microtouch systems , inc . of methuen , mass . device 10 as described hereinbefore will require operating system software such as microsoft windows or windowsce . off - the - shelf application software such as microsoft outlook , pocketword , etc . can be used for various tasks . alternately , the java software platform from sun microsystems , inc . of palo alto , calif ., can be implemented in device 10 . in this instance , java applets can be downloaded into device 10 from the internet via wireless communication circuit 21 or via wired communication circuit 33 . inasmuch as the present invention is subject to variations , modifications and changes in detail , some of which have been expressly stated herein , it is intended that all matter described throughout this entire specification or shown in the accompanying drawings be interpreted as illustrative and not in a limiting sense . it should thus be evident that a device constructed according to the concept of the present invention , and reasonably equivalent thereto , will accomplish the objects of the present invention and otherwise substantially improve the art of devices for mobile computing , communication and entertainment . in the foregoing description , certain terms have been used for brevity , clearness , and understanding . no unnecessary limitations are to be implied therefrom beyond the requirement of the prior art because such terms are used for descriptive purposes and are intended to be broadly construed . moreover , the description and illustration of the invention are an example and the invention is not limited to the exact details shown or described .
| 7 |
in fig1 , a block diagram shows that a technical process tp is controlled by the run time system rts of an industrial controller . the connection between the run time system rts and the controller , and the technical process tp , is bi - directional over the input / output ea . programming of the controller and , thus , the specification of the behavior of the run time system rts takes place in the engineering system es . the engineering system es contains tools for configuring , designing and programming machines , and for the control of technical processes . the programs generated in the engineering system are sent to the run time system rts of the controller over information path i 1 . with regard to its hardware equipment , an engineering system es usually comprises of a computer system with a graphical display screen ( e . g ., a video display unit ), input means ( e . g ., a keyboard and mouse ), a processor , working memory and secondary memory , a device for accommodating computer readable media ( e . g ., diskettes , cds ) and connection units for data exchange with other systems ( e . g ., other computer systems , controllers for technical processes ) or media ( e . g ., the internet ). a controller usually comprises input and output units as well as a processor and program memory . in fig2 , elements of the engineering system and the controller and their interaction are illustrated in the form of a survey diagram , where the individual elements are represented in the form of rectangles , and the data storage contained in the engineering system is represented in the form of a cylinder . arrows ( unidirectional or bidirectional ) indicate the logical relationships among the elements in terms of data and sequence . the top half of fig2 shows the elements of the engineering system , namely , the motion control chart ( mcc ) editor , the structured text ( st ) compiler with programming environment , the configuration server ks and the machine design as well as a data storage . the fact that these elements belong to the engineering system is indicated by the border around them . the controller contains the code converter and program processing . the elements of the controller , which are in the lower section in fig2 , are outlined . both the engineering system and the controller may also contain other elements , but , for simplicity , these are not shown . the graphical program sequences are generated in the mcc editor . the language elements of the editor , i . e ., the icons , can be generated and represented by means of a command bar on the display screen , which is operated with the help of a mouse or other possible input means . with the help of the mcc editor , a user can link function blocks ( icons ) and control structures to form a flowchart , that is , the mcc editor can be used as a graphical programming tool for generating programs for motion controls and / or process controls . a text program and a textual language ( usually structured text according to iec 6 - 1131 ) are generated from the flowchart . this structured text code ( st code ) is converted by the structured text converter ( st compiler ), which is part of the programming environment in a processor - independent pseudo - code . this pseudo - code is loaded onto the controller where it is converted to executable processor code by the code converter . this process code is executed by the program processor within the controller . the unidirectional arrows in the left section of fig2 represent the steps in code conversion or program conversion . in parallel with the three unidirectional arrows running from top to bottom representing this conversion , three bi - directional arrows , representing debugging interfaces and the possibility of program observation , run between the following elements : the mcc editor , the st compiler , the code converter and the program processing . between the program processing and code converter is a debugging interface on the processor code level , i . e ., on the object code level , and another debugging interface is placed between the code converter and the st compiler . this debugging interface is on the pseudo - code level . between the st compiler and the mcc editor there is another debugging interface or program observation interface at the structured text level ( st code ). as additional elements of the engineering system , fig2 shows the machine design and a configuration server ks . in the machine design , the design of the hardware or the underlying machine is completed with the help of suitable tools , in other words , e . g . the types of axes present and the quantity specified in the machine design . this information is fed into the mcc editor through the configuration server ks . the transfer of this information is represented by the unidirectional arrows 12 and 13 . in addition , the configuration server ks also contains other relevant configuration information for the system , which can also be used , for example , for licensing the respective software components . the data storage da , represented by a cylinder , contains three things : first , the object model generated by the mcc editor for a flowchart ; second , the respective structured text ; and third , the content of the data storage da , which is the pseudo - code generated from the structured text . the data storage da is in bidirectional connection with the mcc editor and the st compiler , represented by the bidirectional information arrows 14 and 15 . fig3 shows the existing abstraction levels from the standpoint of the program code as a survey diagram . the different program code levels are illustrated as rectangles . the top level is the mcc level , where the flowchart programs are generated . the next lower code level is the structured text level st . one reaches the st level from the mcc level by a corresponding code generation as represented by an arrow from the mcc block to the st block . beneath the structured text level st is the pseudo - code level . a processor - independent pseudo - code is converted by a converter from the structured text program , as represented by the arrow from the st block to the block bearing the name “ pseudo - code ”. beneath the pseudo - code level is the lowest code level , namely , the object code level which contains the processor code that can be executed . the object code is generated from the pseudo - code by a converter , also represented by an arrow from the pseudo - code block to the object code block . arrows bent at a right angle lead away from the object code level back to the structured text code level st and to the flowchart level mcc . this indicates that test activities and program tracking activities can take place on these levels on the basis of the object code . the bold double arrow between the mcc level and the st level indicates that calls , task control commands and variable exchange functions can be sent between these two levels . the dotted line in fig3 shows the borderline between the engineering system es and the run time system rts of the controller ( s ; fig2 ). this borderline runs through the pseudo - code level , and everything above the dotted line belongs to the engineering system es , while everything below the dotted line belongs to the run time system rts . in addition , fig3 shows how a programmer or a user ( represented by a stylized stick figure at the left edge of the figure ) can introduce entries into the engineering system es . the user can generate flowcharts on the mcc level with the help of graphical programming , or generate programs on the structured text level st by text programming . both input options are represented by arrows leading from the stick figure to the mcc block or to the st block . the diagram according to fig4 shows a simple program sequence for programming axial motions . each flowchart begins with a start node and ends with an end node . these program limiting symbols bear the designations “ start ” and “ end ,” respectively . start symbols and end symbols are each represented by a rectangle with the end faces designed as semicircles . the program commands are represented by rectangles which contain a written command and a graphical symbol representing the stored command . the flowchart symbols are usually generated by using an input bar with the help of a mouse in the flowchart editor , but other input means such as a touch pad are also conceivable . alternatively , the system might be operated by means of a keyboard , with or without a mouse . as the default , the flowchart symbols are directed at one another by the flowchart editor and are linked together by a line . a synchronous axis is enabled after the start , and then the system waits for a synchronization signal , and as the next and final command of the flowchart , a cam plate , is turned on for the synchronous axis . the command sequence of fig4 is terminated by the end symbol . the diagram of fig5 shows a complex flowchart with control structures for a while loop and for the if statement . the while and the if statements are each represented by hexagonal honeycomb - shaped symbols . otherwise , the same types of symbols as those already known from fig4 are used in the program run as illustrated in fig5 . the flowchart begins with the start symbol and ends with the end symbol . immediately after the start node , there is a command which starts the task “ motion_ 3 .” this command is of the “ start task ” type . therefore , the rectangle for this command also contains the respective corresponding symbol representing the starting of a task . the hexagonal honeycomb - shaped while statement follows next in the program sequence . as long as the condition indicated in the while statement is true , the commands following the while statement are executed cyclically in succession . the end of the command sequence of a while loop is represented by an angled arrow leading down from the last symbol of the while statement ( this is the command of the type “ gear synchronization off ” based on a synchronous axis ) and leading back to the while statement on the left side of the figure . if the condition in the while statement is no longer met , then the command sequence belonging to the statement is no longer executed . this is illustrated by a rectangular connecting line leaving the while symbol on the right side and bypassing the sequence of symbol commands belonging to the while symbol on the right side and opening into the symbol directly following this command sequence , which is the end symbol . however , if the while condition is met , the following command sequence is processed : immediately after the while statement follows a command which represents waiting for a condition . this command also contains a corresponding mnemonic graphical signal representing the waiting process graphically . this is followed by a command which starts the “ motion_ 2 ” task . this command is also of the “ start task ” type and contains the corresponding graphical symbol . this command is followed by the if statement , which is illustrated similarly to the while statement by a hexagonal honeycomb - shaped symbol . if the if condition is met ( represented by “ error & lt ; & gt ; zero ”), then the command sequence is further processed in the true branch . otherwise , if the condition is not met , the command sequence in the false branch is processed further . the next command in the true branch of the if condition is a command that stops the “ motion_ 2 ” task . this command is of the “ stop task ” type . it is followed by a command that stops the “ motion_ 3 ” task . this command is also of the “ stop task ” type . these commands are also represented by respective corresponding symbols . next in the command sequence are two “ stop axis ” commands . in the first such command , a rotational speed axis is stopped , and in the following command a positioning axis is stopped . these “ stop axis ” commands are also represented by corresponding graphical symbols . the next and last command relates to an axis with the name “ synchronous axis ”, namely , the disconnection of the gear synchronization (“ gear synchronization off ”). the symbols of the flowchart are connected by lines , thus , representing the program sequence . an arrow bent at a right angle leads away from this command , representing the last command in the while statement , and goes back to this while statement . this represents the cyclic processing of the command sequence . in the while statement , a check is performed to determine whether the condition is met . if it has been met or continues to be met , the command sequence is run once again . if it has not been met , the program leaves the while statement and continues with the end symbol , i . e ., the program run represented by the flowchart is ended . fig6 shows a complex diagram in flowchart representation with the parallel branching language construction ( sync ). the start symbol is followed by a command that relates to a rotational speed axis , namely , “ switch axis release .” for this command , a graphical symbol representing this command is also shown in the command rectangle . this is again followed by a command of the type “ switch axis release ”, but this time it relates to a positioning axis ; here again , the respective corresponding symbol is given . the following command is a synchronization command “ wait for signal ”, designated as “ auto ” and provided with the corresponding symbol . the symbol for the parallel branch ( sync ) follows as the next symbol . this symbol , like the while and the if statements , is also represented by a hexagonal honeycomb - shaped graphical element . all the commands arranged in the sector directly beneath the symbol for the parallel branch start in the same interpolator cycle . this includes the “ position axis ” command , based on a positioning axis ( this type of command also includes the respective corresponding graphical symbol ) and a command of the “ set output ” type . the “ set output ” type of command is also illustrated by a rectangle , this rectangle containing the address of the output (% qb40 ) and the corresponding symbol for this set command ( s stands for set ). the commands belonging to a parallel branch symbol , that is , the commands that start within the same interpolator cycle , are connected with a line upward to the parallel branch symbol and at the bottom they are connected by a double line . this horizontal double line indicates that parallel processing has been stopped again and a program will wait to process the following command until all the actions in the parallel branch are concluded . thus , this is also the end symbol of the parallel branch construction . this is followed next by a command of the “ rotational speed set - point ” type , which relates to a rotational speed axis . this is followed by two commands of the “ position axis ” type , each based on positioning axes . this is again followed by a command of the “ stop axis ” type , which relates to a rotational speed axis . the rectangle representing these commands , also contains the corresponding respective graphical symbols . after a command of the “ stop axis - type which relates to the aforementioned rotational speed axis , follows the end symbol . the type of flowchart programming shown here supports different types of programming . first , a more or less true parallelism is achieved through the parallel branch symbol with the start of the respective commands in an interpolator cycle , that is , programming of parallel threads is supported and the respective processing is enabled . secondly , cyclic programming and cyclic program processing is supported . this means that it is possible to show that only successive commands are initiated , and that it is not necessary to wait for processing of the preceding command . it would also be possible to program and illustrate such sequential processes , namely , on initiation of a command to wait for processing of this command until the next command is initiated and processed . the flowchart programming presented here is , thus , flexible in the way it can be applied by a user and used for different applications . fig7 shows a mask for setting parameters for the “ position axis ” flowchart command . the designation of the corresponding command , namely , “ position axis ” in this case , is located in the upper left of the upper bar of the mask . the upper bar also contains two switches on its right side . the switch with a question mark provides online help , and the second switch ( which is labeled with an x ) is used for closing the mask . the mask with which parameters are set ( the parameterization mask ) includes different input sectors . in the top input sector , the corresponding axis can be selected . with the help of an input menu ( represented by an input button with a small , upside - down triangle ), the corresponding axes can be selected in the input window . at the upper left of this top sector is the graphical symbol belonging to this command , an upside - down triangle with a dark horizontal line at the center , and other small lines angled downward at each end of this line . the next and largest sector of the parameterization mask represents the possibility of parameter input . the parameters differ according to the command . they are sorted logically by means of task bar options which are arranged on a task bar , as is customary in the conventional program interfaces . the first page ( in fig7 this page can be shown by selecting the task bar option “ parameter ”) usually contains the parameters which absolutely must be indicated for setting of parameters of the command . an unconditional parameter for the “ position axis ” command would be , for example , the target position of an axial motion . the number and significance of the task bar options also varies according to the command . it can be seen in fig7 that a “ dynamic ” task bar option is also present for the “ position axis ” command in addition to the “ parameter ” task bar option . with this task bar option , entries regarding the rate of change and acceleration as well as the velocity profile can be made for the description of the dynamic behavior . these inputs can be made through input fields and the respective menus . in this case , the trapezoidal shape was selected as the velocity profile . this shape has also been represented graphically in a stylized manner at the center of this input sector . in the lower input sector of the parameterization mask which follows this , additional inputs , e . g ., for the transitional behavior , can be made . in this case , “ detaching ” was entered for the transitional behavior . in addition , waiting conditions can be entered by putting a check in the “ wait ” box . additional entries for this synchronization can be made in a respective input window . in the example in fig7 , “ position window reached ” has been entered for this item . the entries are also supported by axial profiles which are represented in a stylized manner . the lower end of the parameterization axis consists of four input buttons , namely , an “ okay ” button , a “ terminate ” button , an “ accept ” button and a “ help ” button . by using these input buttons , users may either accept the entries , confirm them , discard them or call up input help . with the help of the waiting conditions , so - called step enabling conditions can be specified by a user to synchronize the functions ( e . g ., reference point approach or axial positioning ) or their interaction . there are particular parameterization masks for commands that can be entered and processed with the help of the flowchart editor . thus , the user is supported in programming motion and control sequences with the help of these parameterization masks in a context sensitive manner . fig8 shows in a survey diagram how the flowchart editor library of icons fev of the flowchart editor fe is expanded . at the outset , the graphical elements e 1 to em of flowchart editor fe are available to the user a 1 ( represented by a stick figure ). the flowchart editor fe is represented as a rectangle containing the graphical elements indicated at the upper left of the figure . the flowchart editor fe is part of an engineering system es 1 , represented by a dotted line . the engineering system es 1 also contains other elements , but , for simplicity , these are not shown here . the library of icons fev of the flowchart editor fe , which contains the graphical elements e 1 to em at the outset , is shown as a rectangle at the upper right of the figure . the lower half of fig8 shows a user a 2 ( also represented by a stick figure ) who is working with an engineering system es 2 on the structured text level ( st ; fig3 ). at the structured text level , the structured textual language elements ste 1 through sten representing the structured text library of icons stedv of the structured text editor are available to the user a 2 within the structured text editor sted . the structured text library of icons stedv of the structured text editor sted is also represented as a rectangle . with the help of the structured text language elements ste 1 through sten , the user a 2 can create structured text subprograms stup in the structured text editor sted . these subprograms stup are converted to graphical language elements of the flowchart editor fe by a converter ( e . g ., a compiler c .) the lower left section of fig8 shows in diagram form how these graphical elements are generated . the conversion takes place within the engineering system es 2 as an example . the structured text subprogram stup ( indicated schematically by a sequence of structured text elements from the library of icons stedv of the structured text editor ) is converted by the compiler c ( represented by a rectangle with a diagonal line ) to the graphical element en , which also contains the function interface of the original structured text subprogram . the conversion process ( structured text editor | compiler | graphical element ) is indicated schematically by two horizontal arrows . the allocation arrow zp indicates that the newly generated graphical element en expands the library of icons fev of the flowchart editor fe and is available to the user a 1 for flowchart programming . the engineering system es 2 also contains additional elements , but , for simplicity , these are not shown . in the mechanism described here , functions of the engineering systems es 1 and es 2 may be contained in a single engineering system . the two users a 1 and a 2 may also be represented by a single person . the diagram according to fig9 shows a selection of language elements ( icons ) of the flowchart editor . these language elements represent commands that can be used for graphical programming using the flowchart editor . the motion control flowchart editor supports the following classes of commands and makes available appropriate symbols for the individual commands of the following classes : start commands , stop commands , positioning commands , synchronous and cam plate commands , probe commands , and software cam commands , wait commands , task control commands , commands for manipulation of variables and other general commands . in addition , the motion control flowchart editor makes available additional graphical control structures for the graphical program execution .
| 8 |
in the following description , numerous details are set forth to provide an understanding of the present invention . however , it will be understood by those skilled in the art that the present invention may be practiced without these details and that numerous variations or modifications from the described embodiments may be possible . all phrases , derivations , collocations and multiword expressions used herein , in particular in the claims that follow , are expressly not limited to nouns and verbs . it is apparent that meanings are not just expressed by nouns and verbs or single words . languages use a variety of ways to express content . the existence of inventive concepts and the ways in which these are expressed varies in language - cultures . for example , many lexicalized compounds in germanic languages are often expressed as adjective - noun combinations , noun - preposition - noun combinations or derivations in romanic languages . the possibility to include phrases , derivations and collocations in the claims is essential for high - quality patents , making it possible to reduce expressions to their conceptual content , and all possible conceptual combinations of words that are compatible with such content ( either within a language or across languages ) are intended to be included in the used phrases . the present invention describes apparatus , systems , and methods to determine position of seabed seismic cables , as well as sound velocity profile of a fluid . the conventional way of determining the position of seabed seismic receiver cables is by use of usbl systems that are commercially available ; however , usbl systems are not known to be used for estimating or calculating sound velocity profile of a fluid . the main drawbacks with usbl systems in position determination are that they require transmitters to be mounted on the cable for every point to be tracked . this is a safety hazard for personnel working on the back deck on the deployment vessel , and it also reduces the maximum feasible speed of cable deployment and recovery . it is thus an economically impaired technique . compared to the proposed technique it is also less efficient in that the number of transmitters it is possible to fit on the cable is a number far less than the number of seismic receivers . the positions provided by the usbl system will only be at selected intervals and they do not coincide with the seismic receiver positions so that one must interpolate based on the transmitter positions . sbl systems generally utilize a transmitter mounted on the remote target , and the accuracy of the angular measurement provided comes from the use of sophisticated techniques for correlation of the observed signal at receivers located with a short baseline separation . the correlation aims at determining the difference in time of reception between pairs of receivers . the idea is that the signals observed at the two locations have the same source and are distorted in a similar way so that a good correlation can be found . the fact that the signal gets transmitted into the noisy area around the vessel hull is a disadvantage of this method as it poses further challenges on the sensing and processing of the signal . this is fundamentally different from the inventive apparatus , systems , and methods , where the transmitters are located in the noisy area and sends signals into a quiet area where the receivers are located . fig1 illustrates an apparatus , system , and method of the invention to determine an accurate position of receivers 2 in a seabed cable 4 being deployed onto or retrieved from a seabed 6 . two or more acoustic transmitters 1 are fitted onto the hull of the cable deployment vessel 3 riding on sea surface 5 . as stated earlier , transmitters 1 may be mounted on retractable poles or similar devices , not shown , in order to get the transmitters positioned at the optimum depth for the transducer operation . the positions of transmitters 1 need to be known in the vessel body referenced coordinate system , and they may be arranged to form a line , a plane when three transmitters 1 are used , or a volume when three or more transmitters are used . if they are arranged in a straight line , as when two transmitters 1 are used , it is not possible to do positioning without auxiliary sensor measurements , such as pressure sensors to measure pressure , and thus depth . if three or more transmitters 1 are arranged in a plane , receivers 2 to be positioned have to be outside this plane or its extension . this can be ensured by planning the transmitter locations so that the plane tilts away from cable 4 axis as much as possible . seabed seismic receiver cable 4 is fitted with a number of seismic receivers 2 that are adapted to be used for sensing of seismic signals . the same receivers may also be capable of receiving the signals sent by transmitters 1 to be used for the positioning purpose . alternatively , dedicated positioning receivers may be used as well as dedicated seismic receivers , but this may result in more expensive equipment , and is therefore not desired as much as the dual function receivers . when the system is operated , transmitters 1 send synchronized broad spectrum and coded signals , as further described herein . the signals from transmitters 1 are received by all receivers 2 and processed to determine the signal travel time and the travel time differences . when knowing or estimating the sound velocity the travel time can be converted to a distance and the travel time difference to a distance difference . the difference needs to be established with a higher accuracy than the distance for a short baseline system to work well . conventional systems ensure that by transmitting one signal that is received by two or more receivers where the difference in reception time can be established through autocorrelation of the recordings between pairs of receivers . in the inventive apparatus , system , and method depicted in fig1 , where there is a multitude of transmitters 1 sending different signals that are received by one or more receivers 2 at unknown distance , the same approach is not possible . when using broad spectrum , encoded signals , the correlation results from the travel time detection can be further used to establish an accurate time difference . as an alternative , a conventional usbl receiver group positioned on the vessel hull could be used to establish the sound velocity profile from known distances between seismic receivers on or in the cable . in this alternative embodiment of the invention , the seismic receivers on or in the cable must be transponders or transducers capable of receiving and transmitting acoustic signals . the position and attitude of vessel 3 at the synchronized time event when transmitters 1 send the signal can be determined for instance by using gps or other positioning system . this information combined with the vessel body frame coordinates of transmitters 1 is sufficient to calculate the positions of transmitters 1 at the time of measurement . by further using the information about the measured distances and differences it is possible to calculate the position of each receiver 2 that has received the signals . all receivers 2 in or on cable 4 can this way be tracked for the purpose of deployment precision , increased operational safety , and increased efficiency . the positioning system may also be augmented with additional sensors for increased robustness of the system . such devices are for instance , but not limited to , inclinometers , pressure gauges , compasses and inertial sensors integrated in or placed on cable 4 , and further acoustic measurements provided by transmitters located on buoys or other vessels . in three dimensional cable and streamer positioning under water , the third component , depth , is often difficult or expensive to estimate with acoustic measuring devices alone . this may be due to the cost of obtaining a geometry that will give a well - separated vertical component for the target being positioned . for example , in seabed cable deployment , the deploying vessel travels horizontally away from cable being laid on the sea bottom . as the cable moves through the water column , its depth is dependent on factors not easily measurable , including cable buoyancy due to varying water density layers and currents with a vertical component , especially upward . in order to establish the depth through acoustics , the acoustic distances and distance differences measured need to have position fixing geometry strong enough to separate it from the horizontal components . with measurement information all or mostly in the same plane , the number of positions that will fit the measurements is large , each with a different distance out of the plane . to obtain this requires one or more separate transmitter units deployed on platforms different from the deploying vessel , the number of such units being dependent on the depth of the water column , and thus the horizontal extent of the cable in the water column during a deployment or along the cable length on the bottom after deployment . especially in the context of time laps survey requirements , ( but also for the purpose of establishing and confirming the vertical component of position in conventional seismic surveying ), deploying the cable to a predetermined point on the seafloor can best be done if the position of the cable is known during it &# 39 ; s descent . this information will allow the deploying vessel to maneuver in a way that will influence the final resting place of the cable on the seafloor . two towed marine applications are over / under surveys and surveys employing a positioning streamer . in these towed marine application , acoustic ranging may occur between streamers at different depths , and determining depth other than by acoustics is useful . in certain embodiments of the present invention , it would be useful to employ a depth - measuring unit integrated into or attached to the cable at regular intervals that does not employ acoustic ranging from a known point , but instead determines depth by measuring pressure . knowing this component of the three dimensional coordinates will constrain the points that are available for the measurements to fit into a horizontal plane and thus allow a better estimate of cable position with less effort than required with acoustics only . apparatus , systems , and methods of the invention using a seabed cable being deployed , retrieved , or resting on the seafloor , so - called short - baseline systems and methods , may particularly benefit from using pressure measurements to determine depth . some of the advantages of the apparatus , systems , and methods illustrated in fig1 and other embodiments are that they may easily be fully automated using a computer to control and do the necessary computations ; there is no need to attach or detach any equipment to and from the cables during deployment and retrieval ; there is consequently no need for manual work on the back deck of the deployment vessel giving a big safety advantage ; full automation , if provided , allows faster cable operation and high operational efficiency ; the systems and methods do not require additional vessels , buoys or other devices on the water to facilitate the positioning with further added safety and efficiency benefits , although they may be employed if desired ; and the systems and methods may directly provide positions “ as deployed ” for the seismic receivers . useful transmitters 1 are those able to transmit spread spectrum signals that are unique acoustic signals lying within a frequency band that receivers 2 ( hydrophones ) are capable of detecting . the signals may be intercepted by conventional seismic receivers 2 , which are already located in cables 4 , or in the streamers or in the gun array cables . by using the existing receivers in the seabed cables and streamers a far better spatial resolution along the cable will be obtained than that achieved by means of the prior art . in use , transmitters 1 may transmit a signal on command . receivers 2 will intercept the signal and transmit it on board the vessel for processing and storing . there is no rule governing when the codes from the spread spectrum transmitters should be transmitted or recorded . transmission may be simultaneous and recording may be done during the normal recording time for a shot or also between each shotpoint . seismic signals are normally recorded and stored during a period of 4 to 12 seconds after a shot has been fired . the signals from transmitters 1 can be recorded when wished , since there is no correlation between the seismic signal and the spread spectrum codes , i . e . it is not possible to confuse a seismic signal from a seismic source ( not shown ) with a spread spectrum signal transmitted from a transmitter 1 . had a transmitter been used which transmitted signals on a specific frequency , this would cause them to be confused with seismic signals on the same frequency . due to the signal - to - noise ratio , the normal procedure may be to time the transmission to maximize the offset in time between the seismic and positioning acoustic events and record the signals once per shot . the signals that are transmitted from transmitters 1 in accordance with this aspect of the present invention are so - called orthogonal spread spectrum signals . spread spectrum techniques are described in the literature and well known by those skilled in the art . an ordinary modulation technique is based on the fact that the transmitted signal uses a certain part of the frequency band in a communication channel , e . g . by means of frequency modulation ( fm ) or amplitude modulation ( am ). as distinct from this , in spread spectrum modulation the entire bandwidth in a communication channel will be used and split up a transmitted signal frequency , the individual parts being transferred on several different frequencies . only the receivers will know which frequency and phase combination the incoming information will have . the receivers know a transmitter &# 39 ; s individual code . by cross - correlating the incoming signals ( y ( n )) with a transmitter &# 39 ; s individual code ( x ( n )), a receiver will be able to extract the unambiguous spread spectrum signal from the range of other signals . an n = ∞ cross - correlation function will be in the form : when a sequence is cross - correlated with itself the process is called autocorrelation . the autocorrelation function of a series x ( n ) will always have a certain top value for τ = 0 . it is desirable for spread spectrum sequences which are used for positioning of seismic equipment to have an autocorrelation function which represents a “ white noise ” pattern apart from τ = 0 . in order to avoid false detection of , e . g ., signals that are recorded by the same receiver use the same communication line , the cross - correlation function between the codes must have a top value that is as low as possible , which is the definition of orthogonal . the transmission pulse comprises a set of orthogonal pulses with an unambiguous top in their respective autocorrelation functions . several conventional methods of generating such functions can be mentioned . perhaps the most common method uses random sequence codes called gold codes . this method provides a selection of codes that give low values in the cross - correlation function . these are generated by the use of shift registers of variable length with a special feedback pattern . when used in the present invention a register of this kind will normally look like that illustrated in fig2 . the figure is a representation of a gold code [ 5 , 4 , 3 , 2 ]. the figure illustrates an eight bit serial shift register which will give a 2 8 = 256 bit long sequence . there are several methods for generating pseudorandom sequences , e . g . frequency hopping , frequency shift coding or phase coding . regardless of which pseudorandom sequence is chosen , it is important for its autocorrelation function to have a distinct top value and for the cross - correlation to be as low as possible . even with signal amplitudes down towards the signal amplitude for sea noise it will be possible to extract a correlation &# 39 ; s top . even calculation of positions for the seismic equipment or the sensors can be performed in countless different and conventional ways depending on which parameters are known for the system and how the system is configured . the common feature of all methods of this aspect of the invention , however , is that the received signals have to be cross - correlated with the transmitting signal signature of the specific transmitters to which the absolute or relative distance is required to be determined . further processing of data is performed according to the prior art . note that in certain towed marine spreads there may not be enough unique codes for each transmitter . to work around this limit transmitters with the same code may be separated in space so they do not interfere with one another . the simplest case comprises a transmitter and a receiver where the system is designed in such a manner that accurate information is available as to when the transmitter transmits in relation to the receivers sampling points . after the above - mentioned cross - correlation a maximum value will be found in the cross - correlation function that indicates the absolute time difference between transmitter and receiver . it will be possible to develop this technique used on a seabed cable or streamer with several sensors in order to obtain an unambiguous geometrical network of distances and relative positions . the invention also describes apparatus , systems , and methods to determine the accurate velocity of sound through the water column . it is particularly well adapted to , but not limited to , seabed seismic data acquisition , where a cable containing seismic receivers is deployed on to the seabed from a surface vessel . in some embodiments , one or more towed streamer cable may be used in the sound velocity profile determination and positioning aspects of the invention . in any case , the seismic operation needs accurate position determination of the receivers in the cable , and the typically used method for positioning is based on underwater acoustic ranging . a system for hydro - acoustic ranging , for example , intrinsic ranging by modulated acoustics , comprises transmitters that generate an acoustic signal and hydrophones that can receive the signal . the transmitters and the receivers are synchronized so that the transmission delay between a transmitter and a receiver can be measured . if the velocity of sound through the water media is known it is possible to convert the measured delay into distances that are the data of prime interest for position determination . less than perfect knowledge of the sound velocity may result in positioning errors and this is in many cases the single limiting factor in obtaining high accuracy . the present invention reduces or overcomes problems with previous apparatus , systems , and methods by measuring the sound velocity through the water column . the cable being deployed or retrieved has receivers at known positions meaning that the exact intervals between them are known . for convenience we will discuss deployment of receiver cables on a seabed , but the invention is not so limited . the deployment vessel may carry a transmitter that sends acoustic signals toward the cable , and the receivers in the cable are picking up this signal . different time delays may be measured along the cable , which may be from very near the vessel , to a portion of the distance to the seabed , or all the way down to the seabed . the combination of the known cable length and the measured time delays can give information about the sound propagation speed by utilizing the fact that the acoustic signal propagation may be substantially parallel to the cable . combining the information from pressure depth sensors with knowledge of the separation between receivers along the cable can further strengthen the vertical acoustic propagation speed estimate , ( i . e ., sound velocity profile ), by better establishing the vertical component of the distance measurements , and thus cable dip . differencing the two depth measurements to eliminate any common error due to inaccurate water density or atmospheric pressure assumptions can reduce inaccuracies in pressure measurement . the depth measurement difference gives the vertical separation between the two receivers , and thus the vertical difference of the range difference measurement . a single measurement may not give very accurate information , but repeated measurements as the cable is deployed or retrieved may improve the determination . referring now to fig3 - 8 , fig3 illustrates schematically and not to scale an apparatus , system , and method of the invention for determining sound velocity profile , including a transmitter 1 mounted on a deployment vessel 3 in combination with a seabed cable 4 and its receivers 2 , however , the invention is not so limited , as will become apparent . seabed cable 4 containing seismic receivers 2 is illustrated being deployed on to the seabed 5 from a surface cable deployment vessel 3 , although the vessel could be retrieving the cable . receivers 2 pick up under water acoustic signals , and may be of a combined type that can record both the low frequency seismic signals and the higher frequency signals normally used for positioning purposes , or they can be dedicated to the positioning signals only . receivers 2 may be built into cable 4 at known positions or they may be attached to the cable at known intervals so that the exact distance between the receivers are known . receivers 2 may be part of a system for hydro - acoustic ranging , for example intrinsic ranging by modulated acoustics , as described in u . s . pat . no . 5 , 668 , 775 , assigned to westemgeco llc , houston , tex ., which also comprises transmitters that generate the acoustic signal . the transmitters and the receivers may be synchronized so that the transmission delay between a transmitter and a receiver can be measured . the approximate positions of receivers 2 may be determined by use of an under water positioning system , for instance an ultra short baseline ( usbl ) acoustic system or a short baseline ( sbl ) acoustic system , and the position of transmitter 1 is known from a predetermined offset from the vessel &# 39 ; s reference point or the origin of the vessel &# 39 ; s body coordinate frame . the approximate position of the cable is given by receiver 2 positions . transmitter 1 is positioned so its emitted acoustic signals travel substantially parallel to cable 4 or its extension . a geometric compensation of the measurements may become necessary if transmitter 1 is weakly lined up with cable 4 . the compensation requires knowledge of the relative positions of transmitter 1 , receivers 2 and cable 4 , and their required accuracy will increase with the deviation from the line . given the embodiment described in fig3 it is possible to measure the transmission delay of under water acoustic signals from transmitter 1 to each of receivers 2 , and use the differences in time delay to each receiver to cancel most of the errors in approximating the position . in previously known methods , an estimate of the under water sound velocity was computed as the ratio between the calculated distance between transmitter 1 and one of the receivers 2 and the corresponding transmission delay measured . however , the limitation in that approach is that this will only have an accuracy comparable to the accuracy of the positioning system used to determine positions of receivers 2 . fig4 - 8 illustrate five other embodiments for determining sound velocity profile in accordance with the invention . fig4 illustrates an embodiment of the invention wherein the transmitter is not mounted on the vessel 3 , but rather on a mobile underwater device 7 having a transmitter 1 , which follows deployment or retrieval of seabed cable 4 . device 7 may either be a manned vehicle or unmanned vehicle , and may be operated remotely through wireless transmission , or through an umbilical to vessel 3 or another vessel . transmitter 1 transmits acoustic signals substantially parallel to cable 4 , which are received at receivers 2 at slightly different times indicative of their distance from transmitter 1 . fig5 represents another embodiment , wherein some receivers 2 on a streamer cable 11 are employed . streamer cable 11 may include any number of steerable birds 12 , and may include a steerable tail buoy 13 . in operation , some receivers 2 on the downward slope of steamer cable 11 are used which are capable of receiving acoustic signals at least at the frequency transmitted by transmitter 1 . as with previous embodiments , this allows sound velocity to be estimated at least in the vicinity of each receiver 2 on the downward slope , and thus a sound velocity profile for that portion of the fluid . note that steerable bird 12 may be used to temporarily move one or more receivers , normally horizontally spaced , in line with the non - horizontal receivers , for example if more data is needed to compute the sound velocity profile . another option ( not shown ) would be to tow a streamer or spread of streamers at different depths and obtain sound velocity at each depth . the sound velocity at each depth could be useful as a less precise , or first estimate of the sound velocity profile . in some instances , streamers are known to “ fail ”, that is , for some reason become not useable from a seismic data acquisition standpoint ; a failed streamer for seismic purposes ( but with sufficient acoustic receivers ) could be positioned with weights or ballast , or steered using birds or other devices , to extend from the tow vessel to some distance below the sea surface , and perhaps very close to the seabed . fig6 illustrates another embodiment of the invention , wherein two identical seismic seabed cables 4 and 4 a are being deployed , each having a plurality of receivers 2 and 2 a , respectively . this embodiment may have advantages such as providing more sound velocity data points for the sound velocity profile , since the cables may be deployed such that receivers 2 a are at distances mid - way or near mid - way between receivers 2 . more than two cables could be deployed in this fashion . an alternative might be to deploy cables that are not identical . for example , cable 4 might have twice the receivers that cable 4 a has , or vice versa . in this case the sound velocity profile calculated using receivers 2 might be checked using receivers 2 a . fig7 illustrates another embodiment of the invention , wherein vessel 3 makes use of a companion vessel 3 a anchored by an anchor 8 or some other feature on seabed 6 . vessel 3 a employs a simple rope or cable 44 on which has been placed or attached receivers 2 in known or well - approximated distances from vessel 3 a . vessel 3 may then be maneuvered so that transmitter 1 is substantially in - line with receivers 2 . fig8 illustrates an embodiment wherein neither a surface vessel nor a seabed cable is used . rather , a vehicle 33 traverses seabed 6 , vehicle 33 having a transmitter 11 , and optionally one receiver 2 . the remaining receivers are attached to a cable or rope 46 a at known distances form vehicle 33 . a float 23 maintains cable 46 a substantially taught . in all embodiments of the invention , receivers 2 need not be exactly in line ; they may be centered about an average line . seabed seismic sensors and their support cables ( herein referred to collectively as seabed cables ) useful in the invention include those described in the article “ shear waves shine brightly ”, oilfield review , pages 2 - 15 ( 1999 ), and typically comprise an instrumented cable packed with receivers , similar to the streamers that are towed in conventional marine surveys , but designed to operate on the seafloor . one seabed cable , known under the trade designation “ nessie 4c ”, contains multiple sensing units each containing one hydrophone and three orthogonally oriented geophones inside the cable , distributing their weight for optimal coupling to the seafloor . each cable may house hundreds of four - component sensors . full particle - motion vector recording of all p and s wavefronts may be achieved , along with the pressure wavefront familiar from towed streamers . this design was an improvement over conventional ocean bottom cables , which may be employed in the present invention as well , comprising only a hydrophone and a vertically oriented geophone strapped to the outside ; however , this arrangement is incapable of recording the full particle - motion vector and may not couple adequately to the seafloor . published patent cooperation treaty application no . wo 02 / 14905 a1 , published feb . 21 , 2002 , assigned to westemgeco llc , houston , tex . describes a seabed sensor unit and support cable that may have improve coupling to the seabed . the sensor unit comprises a one or more sensing elements disposed within a protective housing having a flat base . a flat base ensures that there is an adequate contact area between the sensor housing and the earth &# 39 ; s surface , so that there is good acoustic coupling to the sensing element ( s ) mounted within the sensor housing . the housing is attached to a support cable . furthermore , the dimensions of the base of the housing may be chosen so that the extent of the base in a direction parallel to the cable is similar to the extent of the base in a direction perpendicular to the cable , which may minimize the dependence of the acoustic coupling to the sensor housing , and thus to sensing elements within the housing , on the angle between the incident seismic energy and the cable . another seabed cable useful in the invention is described in u . s . pat . no . 6 , 021 , 091 , also assigned to westemgeco , llc , which describes an elongated ocean - bottom seismic cable section of a desired length manufactured by assembling a stress member in combination with a plurality of signal communication channels . a plurality of receiver clusters is fastened to the assembly at desired intervals . each cluster includes at least two multi - axial , gimbal - supported seismic receivers that are symmetrically mounted about the axis of the cable assembly . output signals from the common axes of the respective multi - axis receivers of each cluster are coupled with each other through a suitable filter and linked to corresponding signal communication channels . the cable section is terminated by connectors for providing mechanical and communication linkage to other sections and eventually to signal - processing instrumentation . streamers useful in the invention have well - known constructions , and may comprise a large number of similar 100 meter streamer , or different length sections connected end - to - end , each section comprising a substantially cylindrical outer skin containing a pair of longitudinally extending strength members to bear the towing forces . acoustic transmitters and receivers may be substantially uniformly distributed along the length of the streamer section another streamer construction comprises an elongate substantially solid core , at least one longitudinally extending strength member and a plurality of acoustic transmitters and receivers embedded in the core , a polymeric outer skin surrounding the core and defining there around an annular space , and polymeric foam material adapted to be substantially saturated with liquid and substantially filling the annular space . seismic streamers may normally be towed at depths ranging from about 3 to 20 meters below the surface of the water by means of a “ lead - in ”, a reinforced electro - optical cable via which power and control signals are supplied to the streamer and seismic data signals are transmitted from the streamer back to the vessel , the vertical and / or horizontal position of the streamers being controlled by orientation members , or steerable “ birds ” distributed along the length of the streamer . typically , the front end of the streamer is mechanically coupled to the lead - in by at least one vibration - isolating section ( or “ stretch section ”), while the rear end is coupled to a tail buoy incorporating a gps position measuring system , typically via another “ stretch section ”. in accordance with one embodiment of the invention , a streamer or spread of streamers may alternately be towed at a variety of depths to obtain some knowledge at those depths . alternatively , a failed streamer , ( failed in the sense that it is disabled and cannot be used for some reason for seismic data acquisition ) may be used , as discussed herein . the following non - limiting example referring to fig3 will further illustrate determination of sound velocity profile in accordance with the invention in operation . cable 4 with receivers 2 is first deployed from vessel 3 and arranged as described above . an acoustic signal is transmitted from transmitter 1 . the same acoustic signal is detected by each of the receivers 2 and the apparent transmission delay at each of them is recorded . a geometric correction may be applied to all the measured transmission delays so that they correspond to a measurement taken exactly in the longitudinal direction of cable 4 . for the best precision this correction should take into account the shape of the sonic rays , for instance using a system such as described in u . s . pat . no . 6 , 388 , 948 , which utilizes a device such as a computer or microprocessor for determining the effective sound velocity between underwater points . the following information is fed into the device : ( i ) an estimate of the sound velocity profile from a source of sound energy located at an initial depth to a predetermined final target depth , ( ii ) a predetermined set of grazing angles , ( iii ) a predetermined number of target depths between the initial depth and the final target depth , and ( iv ) a predetermined uniform set of elevation angles . a corresponding elevation angle and an effective sound velocity value is calculated for each grazing angle and target depth . the calculated elevation angles are scanned to locate a pair of calculated elevation angles which correspond to a pair of successive grazing angles and a particular target depth wherein the particular elevation angle of the uniform set is between the pair of calculated elevation angles . the calculated effective sound velocity values corresponding to each elevation angle of the pair of calculated elevation angles are interpolated to produce an interpolated effective sound velocity . the measured delay is differenced against the adjacent receiver &# 39 ; s measurement . the differences can in principle be formed in any combination , but for the maximum resolution of the determination of the sound velocity profile it will be preferable to difference adjacent measurements . the distances between adjacent receivers 2 can be calculated from the known position of them in the cable 4 . the principles of the invention may be used in deep waters where the sound velocity profile is the most difficult to determine by conventional means and the accuracy of the sound velocity is the most critical for precise positioning near the seabed . if the vessel speed and cable deployment rate are synchronized or nearly so , the cable tension may be close to zero , and then the cable will in an ideal case form a straight line . in certain embodiments the surface end of the cable may be under relatively high tension because of the weight of cable 4 , and it may be stretched accordingly . in order to compensate for this effect it is desirable to know the stretch coefficient of cable 4 , together with the cable tension , otherwise results may be biased estimates . the stretch coefficient can be measured in advance and the tension can either be measured at vessel 3 or estimated using a hydrodynamic model taking into account vessel 3 speed and cable 4 deployment rate . knowing the depth difference and the dip angle ( using one or more inclinometers , for example ) gives an angle and side of a triangle . it this information was precise enough , it could be used to calculate stretch , or calibrate a stretch model . for each receiver interval there can then be made an estimate of the sound velocity as the ratio between the calculated receiver interval and the correspondingly differenced delay measurement . cable 4 reaches all the way from the vessel 3 at the surface down to seabed 5 , thus providing sound velocity estimates at each receiver interval through the water column . the sound velocity determined for each interval this way refers to a signal traveling at the dip angle of cable 4 . to make this useful also at other dip angles a mapping function is needed . this can be performed for instance by the method of sonic ray tracing . the accuracy of each estimate of the sound velocity is limited by the precision of the acoustic signal detection . in order to get a sound velocity profile with a useful accuracy it may be necessary to do more measurements and accumulate them in a statistically meaningful fashion . seismic cable 4 is typically several kilometers long and receiver intervals as small as 25 meters or less . this gives room for many measurements to be taken and cancellation of random errors . the sound velocity profile may then be determined in the form of a table using the statistics from results within certain depth intervals , or it may be determined by using a parameterized model where all the results are used to estimate the unknown parameters . a second approach would be able to take advantage of the fact that cable 4 is moving ( continuously down during deployment , continuously up through retrieval ) through the water column while the measurements are taken thus providing almost continuous information . some of this detail may get lost when estimating the sound velocity layer by layer using previous methods . the conventional ways of determining the sound velocity profile are time consuming and cannot in practice be repeated very often . the apparatus , systems , and methods of the invention do not require any stop of operation or alteration of the production procedures as the measurements can be taken automatically when seismic cable 4 is deployed on the seabed 5 , or retrieved there from . the algorithm for determination of the sound velocity can be programmed into a computer that can calculate it automatically . the process can essentially be run at all times when deploying or retrieving a cable . a typical use of the techniques of obtaining sound velocity of this invention will be to determine sound velocity while deploying a seismic seabed cable . the so - called long baseline method may be used to compute distances between receivers , and ultimately positions of the receivers . the receiver positions may be established by measuring transmission delays of acoustic signals from known locations near the sea surface to the cable at the bottom . although only a few exemplary embodiments of this invention have been described in detail above , those skilled in the art will readily appreciate that many modifications are possible in the exemplary embodiments without materially departing from the novel teachings and advantages of this invention . accordingly , all such modifications are intended to be included within the scope of this invention as defined in the following claims . in the claims , no clauses are intended to be in the means - plus - function format allowed by 35 u . s . c . § 112 , paragraph 6 unless “ means for ” is explicitly recited together with an associated function . “ means for ” clauses are intended to cover the structures described herein as performing the recited function and not only structural equivalents , but also equivalent structures .
| 6 |
generally , when the ground is illuminated by a planar electromagnetic wave arriving under the incidence angle ψ , the incident wave is characterized by its electric field e and its magnetic field h , perpendicular to one another , in phase , and in the ratio : ( e / h )= 120π ( ω ). it is assumed that the ground has a uniform conductivity σ , a relative dielectric constant ε r , a magnetic permeability μ o , and an infinite extension in the direction oy and oz ( at the surface ), and ox ( in depth ) it is always possible to decompose the incident wave according to the two elementary polarizations : it is known that impedance difference between ground and air imposes respect of boundary conditions on waves propagating in both media . boundary conditions for the tangential components of e and h therefore entails the existence in air of a planar reflected wave the propagation vector k of which makes with axis oy the same angle ψ as the incident wave . in any point on the surface of the ground the reflected field e r is also bound to the incident field e i and to the radian frequency ω through the relation : r then has the two following forms r h , r v , respectively corresponding to the horizontal polarization and the vertical polarization : ## equ1 ## it is to be noted that the quantity ## equ2 ## often designated as the &# 34 ; complex dielectric constant &# 34 ; of the ground , is often met with in the literature in the form ## equ3 ## the sign - must be associated with fields of the form e e + j ωt , and the sign + with the fields of the form e e - j ωt . the resulting fields at the ground are the vectorial sum of the incident field and the reflected field . in any point lying above the ground at an altitude a the incident and reflected fields interfere in the same way as before with however a delay resulting from the difference in travel between the direct ray and the reflected ray reaching that point , as shown in fig5 where it can be seen that at point m the difference of course between the direct and reflected rays is equal to om - km , i . e . : ## equ4 ## hence ## equ5 ## the delay between both waves is therefore ## equ6 ## with c being the propagation speed of the light in vacuum . therefore , it will be sufficient to take again the formulae of composition of the fields established above , by assigning the quantity ## equ7 ## at radian frequency ω , to coefficients r v or r h . for a continuous wave of radian frequency ω , into a supplementary phase shift between incident wave and reflected wave , for a pulse wave e ( t ) or h ( t ), into a delay between arrivals of incident wave and reflected wave . reflection at the surface of the ground is accompanied by the transmission of a wave into the ground . such wave propagates into two directions o x and o y , with differing characteristics , i . e . : ## equ8 ## where the complex number e j ( ωt - k . sbsp . x x - k . sbsp . y y ) can be defined as a transmission ratio t , the wave vectors k x and k y being defined as : ## equ9 ## therefore , there is attenuation of the wave in the direction o x . if only the propagation according to o x is interesting , one can write the following : ## equ10 ## the fields e ( x = o ) and h ( x = o ) have been obtained above as the algebraic sums of the incident and reflected fields at the separation surface . it must be noted that fields e and h ( both at the surface and in depth ) are no longer in phase , nor are they in the ratio z o = 120π ; on the contrary , if the tangential components e t / h t both in horizontal and vertical polarizations are interesting , one will obtain : the fields e t and h t are therefore in the following ratio : ## equ13 ## representing the impedance of the medium constituted by the ground , and there will be in horizontal polarization : the form of the expressions r v and r h shows that two asymptotic cases can be envisaged for : ## equ14 ## and r v and r h depend only upon ψ and ε r ; the ground behaves like a dielectric ; typical curves such as r v = f ( ω ) and r h = f ( ω ) can be plotted with different values of the incident angle , such that r v = f ( ψ ) and r h = f ( ψ ), for different values of the frequency of the radian frequency , and this for given values of the dielectric constant ε r and conductivity σ . it is also possible to plot typical curves such as that of the ratio of the incident field to the total field at the measurement point in case of reflection measurements or that of the ratio of transmitted field to incident field as a function of the depth in case of measurement by transmission , for different values of ε r , σ , ψ , ω , etc . finally , it is possible to calculate for a - priori given ε r , ψ and ω values , typical curves showing the form versus time of the electric or magnetic fields above the ground or therein , for a given form of incident field . such typical curves being calculated , it is possible to use them with a view to identifying a detected wave and calculating the dielectric constant and the conductivity . it is to be noted that the reflective phenomena are fundamentally different according to whether the wave is of horizontal or vertical polarization . practically , the problem can be exposed by considering that it is desired for simulating a planar wave to realize electromagnetic illumination of any ground by means of a &# 34 ; guided wave &# 34 ; simulator so as to determine : the characteristics of the local wave in the neighbourhood of the ground ( in air or in the ground ), the characteristics of the ground ( ε r , σ ) deducted from local phenomena . it is possible to use a simulator in accordance with the invention on which such phenomena are easily interpretable . such a simulator with guided waves can be represented by thinking of two metallized equipotential surfaces accompanying a planar or spherical wave radiated into the free space . the limiting conditions being respected , the physical phenomena remain what they were . to limit the longitudinal dimension of such a simulator , both metallized layers are closed by a matching impedance at a finite distance from the source so that no reflection comes to interfere with the incident wave , thereby leading to the various cases shown in fig6 to 9 . thus , in the ideal case of a planar wave propagating in free space ( fig6 ), the direction of propagation being shown by the arrow a , in cross - section , the fronts of wave b are straight lines perpendicular to the direction a and the equipotential lines c are straight lines cutting them normally . in the ideal case of the spherical wave propagating in free space ( fig7 ), from a source s , in cross - section , the fronts of wave b are circumferences centered on source s and the equipotential lines are straight half - lines c cutting them normally . in the derived case with a simulator having a spherical guided wave of infinite length in which the propagation zone is limited by metallized layers d represented in cross - section by straight half - lines ( fig8 ), the fronts of wave b are represented by circumferential arcs centered at the source s . in an another derived case , with a simulator having guided spherical wave of finite length in which the propagation zone is limited by metallized layers d of finite length connected at the opposite from the source by a load impedance z , for example , the characteristic impedance z o ( fig9 ), the fronts of wave b are also shown by circumferential arcs centered at source s . let us assume that a planar or spherical wave hits the ground ( under normal incidence to simplify the problem ). the wave which was propagating in air with the vacuum impedance ( z o = 120π ω ) meets a medium having a smaller impedance z such that : ## equ17 ## referring to the preceding paragraph , it appears that one can simulate the incident wave by means of a simulator having a guided wave of infinite length . the complex medium constituted by the ground will fill the interelectrode space from an abscissa plane x = h , without limits . in fact , things are quite different , and the length of the layers penetrating the ground is obligatorily finite . there results a difference between simulation and reality which must be assessed . to this end , let us consider two asymptotic cases , reasoning on the base of the sectional representation of fig1 . in this figure , the source is disposed at a point o remote from the ground by a distance h , and the metallized layers d penetrate the ground to a depth l ; the reference axes are ox ( bissectrix of the angle delimited by the metallized layers ) and y &# 39 ; y ( ground line ), and the currents generated in the ground are denoted j y . in high frequencies , the currents j y induced into the ground by the electric or magnetic fields in the surface weaken exponentially in the direction ox . as long as depth l of the layers within the ground is much higher than the depth of penetration of those currents , the currents j y ( for x = h + l ), at the end of the conductive layers are very small ; interruption of said layers at the abscissa x = l + h , has therefore no noticeable influence . it must be noted that the depth of penetration depends on the frequency ## equ18 ## and that if excitation is impulsional the phenomena will be correctly rendered for the portion of the spectrum such that δ & lt ;& lt ; l . the penetration depth increases when the frequency decreases . the impedance included between the two layers diminishes accordingly . if the layers are stopped to a depth l the phenomena will be distorted when δ ≃ l . in other words , when the frequency tends towards 0 the ground impedance as seen between the layers should normally tend towards 0 ; with truncated layers , it will tend towards the quantity : ## equ19 ## with therefore one can foresee that with a guided wave simulator having layers of finite length , the long term effects will not be correctly rendered , and that , in particular , the tangential field in the neighbourhood of the ground will be higher than presupposed by theory . this fact is illustrated in fig1 showing development of the field as function of time , wherein in reply to a level of incident field e i and after rapid growth , the total field obtained e r decreases well but without reaching the little value of the theoretical field e t . only the elongation of the buried portion of the metallic layers could improve such a point as shown in an exemplifying way in fig1 . it is to be noted that due to the fact that a pulse is used , rather than a wave train of a single frequency , there is obtained a large spectrum width extending as low as desired toward the low frequencies and which may reach several tens of megahertz depending on the characteristics of the chosen pulse . consequently , there is a great abundance of results , possibilities of investigation in a great number of directions and the faculty of making very interesting crosschecking of the results , contrary to the known cases where the tests of a connected type give very limited results and therefore require a great number of measurements at different frequencies by means of distinct equipments to be adapted to the respective frequency of the sinusoidal wave used for the investigations . the aerial simulator 1 , in accordance with the invention , which is shown schematically in fig1 is disposed vertically on the surface of the ground 2 . it comprises a propagation zone 3 limited by two metallic or metallized layers 4 , for example two layers of conductive wires delimiting a dihedron of angle 2θ ; these two layers 4 form a horn and are connected to the apex of the dihedron by an input connector 5 joined to a suitable generator of electromagnetic wave ( not shown ), with impedances being matched . the coupling to the ground is ensured at the opposite of the apex of the dihedron by a buried structure , for example , two horizontal conductive metallic wire netted layers 6 ( or lattice works ) buried in the ground , here at a little depth , through layers or stakes 7 of length l buried vertically into the ground , with predetermined spacings or penetration depths or else with a combination of both configurations as in fig1 ; thus , the layers ( here two in number ) define on the ground a polygon ( here , a square ) outside of which the wire netting layers buried in the ground can extend . excitation of the horn simulator 1 described above can be effected through a generator of suitable pulses having an impedance of 50ω connected to the simulator by a cable having an impedance of about 50ω . to prevent unwanted reflections a resistive bidirectional adaptation 50ω / 120ω is realized at the input connector to the simulator . fig1 shows a schematic diagram wherein the field reflected from the ground is absorbed by a horn impedance adaptor and does not distort the observed signal . the simulator 1 having an impedance z c here equal to 120ω , is provided at its summit ( at its input connector 5 ) with an adapter 50ω / 120ω denoted 8 , connected through a line to the generator 9 joined through a line to a control device not shown ; the adapter 8 is also connected to measurement devices in particular to an oscilloscope 10 for checking the signal , for example by displaying a level applied thereto , on the one hand , and on the other hand , to a measurement oscilloscope 11 to synchronize the signal . on the ground 2 in the illumination area there is disposed a support 12 for a field sensor 13 for measurement of a value representing the magnetic or electric field reflected from the ground . the sensor 13 has preferably an opto - electronic interface which is connected through an optic fiber cable 14 to a receiver 15 used as an opto - electronic transducer having an output applied through an electric cable to the input to the oscilloscope 11 synchronized by the input signal . the reflected field from the ground is absorbed by the impedance adapter so that no parasite reflection may distort the observed signal . the sensor 13 is mounted here at the bottom of the simulator , level with the ground , and the local field tangential to the ground level is simply observed ; the sensor can also be at the top of the simulator and the transmission aerial is then used also for reception ; one can then observe the pulse of incident field reflected from the ground and returned to the sensor after a delay of several nanoseconds . the sensor used is of the asymmetric type such as a capacitive electric field probe or a magnetic field loop . its reference electrode is secured to the wall of the simulator in electric continuity therewith . the generated field pulse is of rectangular shape having a rising time in the order of a few nanoseconds . its width is set to a few microseconds , which in view of the speed of observation on the oscilloscope ( 10 × 50 or 10 × 100 ns ), can relate it to a step of infinite duration . therefore , we are dealing with a &# 34 ; pulse &# 34 ; in the electronic sense , and not with a sinusoidal wave train , for example , in u . h . f . the envelope of which would have the characteristics just mentioned above . after field measurements the characteristics ε r and σ of the ground can be calculated according to the following procedure : the shape of the fields in the neighbourhood of the ground is observed in respect to the incident field and / or the voltage versus current in the simulator . the theoretical study exposed above shows that if the ground is homogeneous , there will be : a peak value of the total field having a ratio : ## equ20 ## with the incident field . a limit to such decrease having a constant value depending on the ground contacting efficiency of the simulator electrodes in the ground . if z c is the simulator impedance , the residual level of the long - term tangential electric field ought to be in the order of : ## equ21 ## the simulator horn essentially consisting of conductors united , after grouping thereof , to an input connector 5 connected to an adapter 8 and to a generator 9 , on the one hand , and on the other hand , to buried electrodes 6 , 7 , can be of the vertical or slanted type with an angle ψ . moreover , the angle of the dihedron 2θconditions adaptation of the horn as will be demonstrated hereinafter . if the angle 2θof the dihedron of the line is small and if the stakes 7 are e . g . sufficiently long , the propagation conditions of an e . m . i . wave in the line , in the direction of the ground , are rigourously identical to those met with by a free space wave hitting the ground under normal incidence : the effect of the incident wave is only limited to the cross - section in the established line . if ψ is the incidence angle , ε r and σ the ground dielectric and conductive characteristics , it can be demonstrated without difficulty that the reflective coefficient of an infinite homogeneous medium separated from air by a plane is : in low frequencies : ## equ26 ## and the ground totally reflects the incident field . if the incident field consists of a level of electric and magnetic planar wave , the properties of the reflective coefficient are translated in the way shown in fig1 a to 14f . thus , the electric incident field e i of the level + 1 , in fig1 a , and the reflected electric field e r ending to the level - 1 , after passing an angular point e a of the level ## equ27 ## in fig1 b , add themselves to give the total electric field on the ground e t having a maximum e m at the level ## equ28 ## of fig1 c . similarly , the incident magnetic field h i of the level 30 1 in fig1 d and the reflected magnetic field h r ending to the level + 1 after passing an angular point h a of the level ## equ29 ## in fig1 e , add themselves to give the total magnetic field on the ground h t ending to the level + 2 of fig1 f . finally , a portion of the incident field penetrates the ground where it is progressively attenuated due to dissipation of energy in the resisitive portion of the ground impedance . the attenuation is therefore selective as a function of the frequency , and the signal in depth is progressively integrated , with the high frequencies being attenuated more quickly than the low frequencies . according to a form of embodiment of the invention shown in fig1 a and 15b , the horn simulator comprises : two layers 4 of conductive wires connected to the adapter 8 and to the electrodes in form of stakes 7 in the figure , a ground area cleared under the simulator , of height h ≃ 10 m , two rows of metallic vertical stakes 7 of length l ≃ 4 m , buried in the ground according to a wire netting which will be called &# 34 ; test zone &# 34 ;. these stakes can advantageously be united to a horizontal conductive strapwork 17 to which the conductor layers constituting the tested aerial are connected . such simulator has a vertical axis and the connecting element in which the layers end is therefore substantially plumb with the center of the basic square . in the center of the test and illumination zone , a well or cavity 18 permits depth measurements in the ground by means of the sensor 13 . the measuring circuitries can have alternative forms of embodiment and although the general schematic diagram is that of fig1 , the practical realizations shown in fig1 and 17 can be used . measurements are effected by means of assemblies e or h comprising , apart from the optic sensor 13 , an opto - electronic transducer connected to the sensor through an optical fiber cable 14 and the results are recorded on an oscilloscope 11 ( not shown in fig1 and 17 ). the generator used is a suitable one 9 that can be provided with a relay having a mercury switch with elastic blades , and mounted at the output of a coaxial line of 50ω to permit supply of pulses having a voltage equal to or lower than 500 v on 50ω , with a rising time of the assembly comprising wirings , generator , sensors e or h , optical connection , oscilloscope , of 4 ns . reflectometry measurements are effected on the lines in two different ways depending on whether they are made by means of the circuitry of fig1 or that of fig1 : with respect to 50ω , by measuring the output voltage from generator 9 with a probe 19 of impedance 1mω , applied to the oscilloscope 10 through a connection cable ; with respect to the characteristic impedance of the realized simulator , itself determined in a first step with respect to 50ω . there is then inserted at the level of the input connector to the simulator a bidirectional impedance adapter 8 so that the generator sees 50ω and that the simulator ( of characteristic impedance z c ) sees z c . such adapter 8 comprises an adaptive divider 1 / 10 permitting observation on the oscilloscope 10 of the corresponding fraction of the voltage at the input to the simulator , by means of a connection cable . according to another form of embodiment of the invention shown in fig1 a and 18b , where the same reference numerals denote the same elements as in the preceding drawings , the horn simulator excites under an average incidence angle ψ of 45 ° ( axial inclination with respect to the center of the square ) the test zone in which a ditch 20 was hollowed out to plant a metallic model simulating a buried building was planted . under those conditions , the plotting of the field at the ground may show the presence of the horizontal component of the electric field e y and of the component of magnetic field h z according to fig1 a ; only the component h z is shown in fig2 a to 20d . as one gets nearer to the more inclined layer a progressive decrease in the amplitude of the tangential electric field in a ratio close to 2 can be observed . fig2 a shows the component h z at the level of ground and fig2 b to 20d the measurement results obtained from a parallelepipedic model 21 of metal . such model is only used for simulating a hypothetical conductive buried structure but does not represent an actual case . disposed on the ground out of the ditch , with the longitudinal axis being aligned with the direction oy ( direction perpendicular to the layers of the simulator ), according to fig1 b , in the ditch , the bottom lying on the ground according to fig1 d . there has been measured by means of a sensor 13 and the optical fiber cable 14 : the magnetic field h z on the ground , at the edge of the ditch ( fig2 a ), the magnetic field h z on the front wall of the model ( fig2 b to 20d ), for an applied voltage of 150 v ( calibration : 300 mv d . c .). it is observed that the model is excited by the magnetic field according to mode 1 ( surface current rotating about the direction oz ). the field h z on the forward face substantially copies back the excitation field . in conclusion , from the tests made on both forms of embodiment described above and from the enunciated theoretical considerations , it becomes possible to approach with acceptable precision the physic phenomena on the surface and at a little depth by means of simulator structures propagating a wave proximate to the planar wave with a steep rising front . the reflective conditions of such wave from the ground are respected and thus electromagnetic fields are locally generated , said fields no longer being bound by the relations of the planar wave but respecting the reality of physics , in all the spectrum of useful frequencies ( moreover , there can be obtained by a single pulse investigations at all the frequencies in the spectrum thereof ). these fields propagate in depth into the ground and become attenuated , the currents tending toward uniform distribution in the long run . to the mind , the simulator as conceived is very satisfactory . indicatively , fig2 shows the amplitude of the electric field ( therefore , the current density ) transmitted into the ground , versus that of the incident field for different values of conductivity σ and of the dielectric constant ε r , more particularly for σ = 10 - 3 ; 3 . 10 - 3 ; 10 - 2 ; 3 . 10 - 2 ; when ε r = 5 and when ε r = 10 . it can be noted that for low conductivity values the decrease is slow ( e / e i = 0 . 18 for ×= 15 m if σ = 10 - 3 mho / m , corresponding to point m on the graph ). the curves of fig2 have been plotted for an incidence angle ψ equal to 90 °. it will be understood that the invention is not limited to the modes and forms of embodiment as described and represented above , and that other modes and forms of embodiment can be devised without departing from the scope of the invention .
| 6 |
referring to fig3 according to the present invention , when a caller calls into the hardware gateway 16 , the call is connected via connection 18 ′ to the communication carrier 4 . as in the prior art method described previously , the caller may request services which can be provided by the application server 14 . for example , the caller may request banking services from a particular bank . next , the communication carrier transmits the required state information , together with an augmenting grammar set , to the application server 14 over control connection 20 . the augmenting grammar set includes certain grammars which the communication carrier 4 is directing the application server 14 to recognize on its behalf . the augmenting grammar set is combined with the application server &# 39 ; s recognition grammar set to form an augmented grammar set . both the communication carrier 4 and the application server 14 contain speech recognizers , 8 and 15 respectively . the speech recognizers 8 , 15 are programmed to recognize sets of commands called grammars . the grammar specifies every possible combination of words which may be spoken by the user . the process of augmenting grammars is known in the art and will be explained herein with reference to two grammar specification languages : jsgf ( java speech grammar format ) and gsl ( grammar specification language ). if the speech recognizer 15 uses jsgf and the communication carrier 4 has requested that the application server 14 recognize a jsgf grammar β . as an example , β might be “ browser | telago | send my credit card number .” next , assuming that the application server 14 recognizes a sequence of jsgf grammars { α 1 , α 2 , . . . , α n }. for example , α i might be “ checking | savings | four oh one kay .” to recognize the communication carrier &# 39 ; s grammar , the application server 14 would use the | operator to “ or ” the communication carrier &# 39 ; s grammar into each application server &# 39 ; s grammar , giving the sequence { α 1 | β , α 2 | β , . . . , α n | β }. using the example grammars , α 1 | β would be “ browser | telago | send my credit card number )|( checking | savings | four oh one kay .” if the speech recognizer 15 uses gsl grammar [ β ]. as an example , β might be “( browser )( telago )( send my credit card number ),” giving the gsl grammar [( browser )( telago ) ( send my credit card number )]. assuming that the application server 14 recognizes a sequence of gsl grammars {[ α 1 ], [ α 2 ], . . . , [ α n ]}. for example , α i might be “( checking )( savings )( four oh one kay ).” to recognize the communication carrier &# 39 ; s grammar the application server would use the juxtaposition operator to “ or ” the communication carrier &# 39 ; s grammar into each application server &# 39 ; s grammar , giving the sequence {[ α 1 β ], [ α 2 β ], . . . , [ α n β ]}. using the example grammars , [ α i β ] would be [( browser )( telago )( send my credit card number )( checking )( savings )( four oh one kay )]. many speech recognizers provide some method of filling in parts of a grammar at run - time . the application can leave a slot for a run - time grammar , sometimes called a run - time non - terminal . an alternate implementation , using run - time non - terminals would be as follows : let “$ b ” be a run - time non - terminal . now , rather than having the application server 14 recognize the sequence of grammars { α 1 | β , α 2 | β , . . . , α n | β }, we would recognize { α 1 |$ b , α 2 |$ b , . . . , α n |$ b }. when the application begins , $ b is set to equal β , thereby inserting the communication carrier &# 39 ; s grammar without having to recompile all of the application grammars ( α 1 ). instead , the application server &# 39 ; s grammar set is compiled once and for all , and then the communication carrier &# 39 ; s grammar is compiled at the start of each application session and inserted into the run - time non - terminal reserved for it in the application server &# 39 ; s grammar . the operation of the voice browsing method is similar to the prior art except that once the connection 22 from the gateway 16 to the application server 14 is made , the connection 18 ′ between the gateway 16 and the communication carrier 4 is broken . thus , while the caller is interacting with the application , no bandwidth is required between the gateway and the carrier , and no recognition resources are required at the carrier &# 39 ; s site . meanwhile , the connection 20 between the application server 14 and the communication carrier 4 is maintained . in addition , since connection 18 ′ is broken during the time when control of the call resides with the application server 14 , the resources of the speech recognizer 8 of the communication carrier 4 are freed until the remote application server 14 notifies the communication carrier 4 that it has recognized an utterance belonging to the augmenting grammar set which has been transmitted from the communication carrier 4 to the remote application server 14 . [ 0033 ] fig4 is a flow chart showing a process according to the present invention . referring to fig3 in operation 102 a caller places a call to the communication carrier 4 . at some point during the call , the caller requests access to an application which resides at a remote application server in operation 104 . for example , during the user wishes to make reservations to rent a car at hertz ™. thus , for example , the user utters the phrase “ go to hertz ”. then , in operation 106 , the communication carrier transmits an augmenting grammar set to the remote application server 14 . in operation 108 , the caller is connected to the remote application server , i . e ., hertz , and the caller conducts desired transactions with the remote application server system in operation 110 . for example , the caller may make reservations to rent a car , etc . at this time , temporary control of the call is transferred to the remote application server system . in addition to recognizing the grammars necessary to conduct its business , the remote application server 14 is now capable of recognizing the augmenting grammars transmitted thereto by the communication carrier 4 . if at any time the caller utters a word or phrase belonging to the augmenting grammar set , this utterance is recognized by the remote application server 14 as belonging to the augmenting grammar set ( operation 112 ). for example , if the user utters the phrase “ browser ”, the application server 14 recognizes this phrase as belonging to the augmenting grammar set and notifies the communication carrier 4 that this phrase has been uttered in operation 112 . in operation 114 , this utterance is transmitted to the communication carrier 4 to be recognized by the speech recognizer 8 of the communication carrier 4 . thus , according to the above example , the phrase “ browser ” is transmitted to the communication carrier 4 and recognized therein . the communication carrier 4 recognizes this as a command which requires the communication carrier 4 to take back control of the call from the remote application server system . in other words , to again establish connection 18 as shown in fig2 . thus , in operation 116 , the communication carrier 4 takes control of the call . depending on the command which is uttered by the caller , it is possible that the caller will again be connected to the remote application server 14 in operation 118 and control will be returned to the remote application server 14 . according to the invention , since the call is transferred to the remote application server 14 , the communication carrier &# 39 ; s speech recognition resources are made available to handle other callers . further , since the grammar set of the remote application server 14 is augmented by the communication carrier 4 , the grammar set of each system can be kept relatively small . beyond simply specifying grammars for the application to recognize on behalf of the communication carrier 4 , according to the invention it is possible to have actions to be performed by the communication carrier 4 associated with each grammar element . specifically , one of a fixed , small set of actions can be associated with each grammar element . for example , this set may be { disconnect , hold / transfer , continue }. the communication carrier 4 could then specify , for each grammar element , whether the application should disconnect ( terminate the session with the caller ), hold / transfer ( suspend state and allow the browser to interact with the caller ), or continue ( ignore the grammar and continue interacting with the caller ). as an example , communication carrier 4 might specify the following annotated grammar : ( terminate { disconnect }| telago { hold }). this would instruct the application to disconnect the caller and return control to the communication carrier 4 if the caller said “ terminate ”. if the user said “ telago ”, the application would temporarily return control to the communication carrier 4 so the caller could interact with the communication carrier 4 for some period of time , and then resume interaction with the remote application server 14 . it is also within the scope of the invention to allow somewhat more generality in the actions , for example , allowing the actions to take parameters . for example , a “ transfer ” action could be included . thereby , the caller could specify a url of an entirely different application , such as american airlines ™, in which to transfer the caller . therefore , if the caller utters the phrase “ american airlines ”, the caller would be transferred to the application server of american airlines ™, for example . finally , it is also within the scope of the invention to allow arbitrary actions to be executed on the communication carrier &# 39 ; s behalf by the application server 14 when the caller says various things . for example , an arbitrary javascript would be allowed to be executed by the application server 14 for each grammar element . this gives potentially unlimited power to the communication carrier 4 in controlling the application server &# 39 ; s behavior when the application was invoked through that communication carrier 4 . although the embodiments of the present invention have been described herein with reference to voice based grammars , it should also be understood that it is within the scope of the present invention to augment dtmf grammars wherein both the communications carrier and the application server may be capable of recognizing dtmf or voice based inputs from the caller . the many features and advantages of the invention are apparent from the detailed specification and , thus , it is intended by the appended claims to cover all such features and advantages of the invention which fall within the true spirit and scope of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation illustrated and described , and accordingly all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .
| 7 |
fig1 is an assembly view of a linear guide way of the present invention , as shown in fig1 it comprises a rail 1 and a sliding body assembly which is composed of a sliding block 2 , two end caps 3 , two guide plates 4 , two oil scrapers 5 , two ball holders 7 , and two spring strips 8 embracing the sliding block 2 from its front and rear ends to conjoin related component parts together . several attachment holes 12 and several screw holes 22 are respectively formed on the rail 1 and the sliding block 2 . the attachment holes 12 are for fixing the rail 1 on the structural framework of the linear guide way , while the screw holes 22 are for attaching the sliding block 2 thereon . a ball circulation groove 11 is formed longitudinally along each side of the rail 1 , on the other hand , another ball groove 21 coupling with its corresponding groove 11 is formed at each inner side of the sliding body 2 . the cavity formed between the grooves 111 and 21 contains a plurality of steel balls 9 which are used to minimize frictional resistance between the moving sliding block 2 and the stationary rail 1 . the guide plate 4 is installed at each end of the sliding block 2 for guiding the steel balls to circulate smoothly and orderly along the circulation pathway . the end cap 3 enclosing the guide plate 4 , is attached to each end of the sliding block 2 , and a ball circulation groove 32 is formed on each end cap 3 . the ball circulation groove 32 and the guide plate 4 are combined to form a smooth circulation pathway for the steel balls . an oil nozzle fixing screw hole 33 for fixing an oil nozzle on the sliding block 2 and an oil way 34 for distributing lubricating oil appropriately to the sliding block 2 are formed on the end cap 3 . in order to facilitate installation of the oil nozzle , a circular hole 51 is provided on the oil scraper 5 so that the oil nozzle is able to tunnel through the circular hole 51 and engaged to the screw hole 33 . for carrying out screw less engagement , positioning flanges 37 are provided for the end cap 3 to determine an accurate position for assembling the oil scraper 5 with the end cap 3 . the end cap 3 and the oil scraper 5 are coupled together by mating two tenons 35 and 36 formed on the end cap 3 to the corresponding mortise eyes 52 and 53 provided on the oil scraper 5 . engagement force between the tenons 35 , 36 and the mortise eyes 52 , 53 are sufficient to fix the oil scraper 5 at its position because it has only to withstand a force of scrabbing away wasted oil scale and dust remained on the rail 1 . furthermore , each side of the end cap 3 has an extension arm 38 equipped with a male protuberance 381 , on the other hand , a corresponding female recess 382 is formed on the other end cap 3 . when assembling the structure , the male protuberance 381 on one end cap 3 is mated with the female recess 382 of the other end cap 3 . in order to show clearly the construction of the present invention , the right portion of the slide block 2 in the front view shown in fig2 is expressed in a cross sectional view . as shown in the cross sectional view , the guide plate 4 is enclosed by the sliding block 2 and the end cap 3 ; and the ball circulation groove 32 on the end cap 3 and the guide plate 4 are combined to form a u shaped circulation pathway for the steel balls ; the attachment of the oil scraper 5 to the end cap 3 is performed by the positioning flange 37 ; the end cap 3 and the oil scraper 5 are conjoined together by the tenon 35 mated with the mortise eye 52 . besides , additional positioning flanges 24 and 25 are formed on the sliding body 2 for aligning the mutual positions accurately when assembling the sliding block 2 , the end caps 3 and the guide plates 4 together . fig3 is a cross sectional view cut along line a — a of fig2 wherein the construction of the ball grooves 11 and 21 is illustrated in the above description . there is further an asylum groove 13 formed at the bottom portion of the ball groove 11 , the ball holder 7 is installed amidst of the asylum groove 13 . when the sliding body assembly is separated from the rail 1 , the steel balls 9 are also released from the ball groove 11 . however , the balls 9 do not drop out from the sliding body assembly since they are confined by the asylum groove 13 and the holder 7 . a ball circulation groove 26 is formed on the outer side of the sliding block 2 . the ball circulation groove 26 and the extension arm 38 of the end cap 3 combine to provide a pathway for ball circulation . the spring strips 8 installed closely at the outer sides of the extension arms 38 have a greater mechanical strength than that of plastic so that they are able to forcibly attach the extension arms 38 on the sliding block 2 thereby preventing the extension arms 38 to flex in the horizontal direction with respect to fig3 . although the extension arm 38 has a greater sectional area in the vertical direction with respect to fig3 so that the extension arm 38 is not susceptible to flexing in this direction . however , in order to intensify the mechanical strength of the extension arm 38 in this direction , an additional flange 23 can be formed on the sliding block 2 . meanwhile , in a small sized structure , this flange 23 is preferably omitted for saving space and facilitating production process since the relatively short extension arm 38 is not susceptible to flexing . fig4 is a cross sectional view cut along line b — b of fig3 . as shown in fig4 the ball circulation grooves 32 on the end cap 3 and the guide plate 4 are combined to form an arcuate pathway for the steel balls 9 to change the marching direction . if the size of the linear guide way is very small , the filleted corner of the pathway may function as the guide plate 4 so that the guide plate 4 may be omitted to save available space and facilitate production process . a gripping fissure 39 is formed in each end cap 3 for inserting the two flexed ends of the spring strip 8 so that the sliding block 2 , end caps 3 , and the guide plates 4 are forcibly and reliably combined together by the resilient force of the spring strips 8 . the two ends of the ball holder 7 are fixed at each holding slot 30 . fig5 is a front view of the spring strip 8 . the two ends of the string strip 8 are flexed to form a gripping angle α and a guide angle β . the angle α can provide a resilient force to engage the end cap 3 and the sliding body 2 together , and prevent occurrence of clearance therebetween . on the other hand , the angle β is for guiding the ends of the spring strip 8 to be forcibly pressed into the gripping fissures 39 formed in the two end caps 3 fixing them . the angle α also has a guiding effect to release the end of the spring strip 8 in the case of detaching the structure . the spring strip 8 can be easily dug up from the gripping fissures 38 by inserting a common screw driver between the spring strip 8 and the sliding block 2 when detaching the structure . those who are skilled in the art will readily perceive how to modify the invention . therefore , the appended claims are to be construed to cover all equivalent structures which fall within the true scope and spring of the invention .
| 5 |
several illustrative embodiments of the invention will now be described more in detail with reference to fig1 to 12 . the liquid friction coupling in accordance with the invention is incorporated , e . g ., in a differential gear train provided between two driven axles of a vehicle . one part of the coupling comprises a housing 1 , which is rotatably mounted on a tubular shaft 2 , which is included in a second part of the coupling . a set of outer disks 3 extend in the housing 1 and are non - rotatably connected thereto and interdigitate with inner disks 4 , which constitute a second set of disks and are non - rotatably connected to the tubular shaft 2 . the disks 3 and 4 are only schematically shown in fig1 and their design in accordance with the invention and parts associated with them will be described more in detail hereinafter . four outer disks 3 and four inner disks 4 are shown in fig1 but it will be understood that the coupling may comprise any desired number of pairs of disks , which have the same design and consist each of an outer disk and an inner disk . the housing 1 defines an interior space 5 , in which the disks 3 and 4 extend and which is filled with a viscous liquid , which has been introduced through ports , which are sealed by removable plugs 17 . fig2 and all analogous radial sectional views show the housing 1 to be provided with suitable internal splines 7 , which cooperate with mating external splines 15 of the outer disks 3 so that the latter are non - rotatably connected to the housing 1 . similarly , the tubular shaft 2 is provided with external splines 6 in mesh with mating internal splines 16 of each inner disk 4 so that the latter is non - rotatably connected to the shaft 2 . the design of the internal splines 6 may freely be selected , provided that they permit a transmission of torque by and slight axial displacements of the disks . the disks 3 and 4 constitute a pair of disks . the number of such identical pairs of disks in the coupling will be determined by the designer of the coupling . the inner disk of a pair of disks which are adjacent to the disk 4 is designated 3 &# 39 ;. in a preferred embodiment shown in fig2 to 5 the inner disk 4 tends to exhibit a thermal deformation in an axial direction . to that end , it may consist of an alloy which has a shape memory ( such an inner disk is not shown ) or may consist of firmly joined bimetal plates 9 , 10 . for instance , the plate 9 may consist of iron and the plate 10 may consist of aluminum . the two outer disks 3 , 3 &# 39 ; consist of conventional material . fig2 and 3 show that embodiment in a state assumed at ambient temperature so that the inner disk 4 is curved in an axial direction , as shown . if the inner disks consist of bimetal , that shape will be assumed by the disk if the materials and thicknesses of the plates 9 and 10 of the bimetal disk are properly selected and the plates 9 and 10 have been joined when they are at a suitable temperature . a disk made of an alloy having a shape memory will assume that shape if the disk has suitably been shaped at a suitable temperature . as is shown in fig3 each inner disk 4 may be divided into sectors by radial slots 14 having open outer ends so that an axial deformation will not be restricted by peripheral stresses . fig2 and 3 illustrate the state which is assumed at a low temperature and involves liquid friction and the gap widths z1 and z2 are apparent on the left and right of the inner disk . said gap widths change along the radius . owing to the approximately hyperbolic relation which is known to exist between the torque being transmitted and the ratio of the gap widths z1 to z2 when a constant spacing z is maintained between two adjacent outer disks 3 and 3 &# 39 ;, only a small low torque will be transmitted in that state . it must be borne in mind that the outer zone in which the gap z2 has the largest width makes a larger contribution to the torque being transmitted than the inner zone . it is also apparent from fig3 that in an inner disk 4 in which each sector is curved also in a peripheral sectional view the disk 4 will have a concavely curved surface 12 facing the outer disk 3 of the same pair of disks . the presence of that concave curvature will result in a hydrodynamic action , which tends to increase the width of the gap z2 . it will be understood that concavely curved surface will not be provided unless the inner disk 4 is divided into sectors by radial slots 14 . if the temperature rises due to slippage losses , the inner disk will flatten so that the gap width z2 will slowly decrease to an extent which increases in an outward direction and the average gap width and the torque being transmitted will thus gradually be increased . by that action the fact that the torque being transmitted decreases owing to the decrease of viscosity during a temperature rise will be offset . in dependence of the design of the thermally responsive inner disk 4 it is thus possible to achieve a torque characteristic which is entirely independent of temperature or to achieve even a slight torque rise in response to a temperature rise . as soon as the temperature at which solid - to - solid friction is to be initiated has been reached , the inner disk will be almost straight in the radial sectional view shown in fig4 and will move into contact with the outer disk of the same pair of disks easily and without a delay . that fast movement into contact with the outer disk of the same pair of disks will be promoted by the distribution of pressure adjacent to the inner disk . that distribution of pressure is due to the fact that the higher internal pressure is applied only to the outer portion of that surface with which the inner disk faces the other disk of the same pair of disks but will be applied to the entire surface with which the inner disk faces away from the outer disk of the same pair of disks . owing to the thermal deformation the curvature of each sector of the inner disk in a peripheral sectional view will be changed from a convex curvature to a concave one in response to the temperature rise so that scraping edges 13 will be formed , which will effect a sudden and complete change to a state which involves solid - to - solid friction . fig2 and 4 show also that a spacer ring 8 , which is provided between the inner disk and the outer disk 3 &# 39 ;, which does not cooperate with the inner disk 4 but belongs to an adjacent pair of disks , defines the distance between the inner disk 4 and the outer disk 3 &# 39 ;. in the prior art , spacers are used to define the distance between similar disks of adjacent pairs of disks . because the spacer rings 8 tend to maintain uniform distances between each inner disk 4 and the outer disk 3 &# 39 ; of the next adjacent pair of disks , the wear of the disks during an operation involving liquid friction will be reduced and the simultaneous initiation of a state involving solid - to - solid friction in all pairs of disks will be promoted . the hydrodynamic action of the spacer ring is due to a hydrodynamic lubrication and to the fact that the spacer ring is provided at the inner periphery of the outer disk 3 &# 39 ;. that lubrication is desirably achieved even when the slip is still very small , i . e ., when there is only a small difference between the velocities of the contacting surfaces of the spacer ring 8 and the outer disk 3 &# 39 ;. to that end the spacer ring may be formed with lubricating pockets ( such as are indicated at 33 in fig9 ) or may consist of a corrugated ring ( see fig1 ). another embodiment of the invention is shown in fig6 and 7 and differs from the embodiment shown in fig2 to 5 in that the inner disks 4 are made of a conventional material and the outer disks 3 are made of a thermally responsive material . the action is the same as described hereinbefore but in this case the external splines 15 of the outer disk will be displaced in the internal splines 7 of the housing 1 during a flattening of the outer disks in response to a temperature rise . the embodiments shown in fig8 and 9 differ from the one shown in fig2 to 5 in that a loose spacer ring 8 is not provided but the inner portion of each inner disk 4 ( or the inner portion of each outer disk 3 ) is designed to constitute a spacer . in the embodiment shown in fig8 the inner portion 34 is given a concave shape in the same operation in which the inner disk 4 is shaped or preshaped . in the embodiment shown in fig9 the bimetal disk 4 has a portion 30 , which constitutes a spacer 32 , which may optionally be formed with lubricating pockets 33 , which just as the spacer 34 shown in fig8 may be formed in the operation by which the inner disk is shaped or preshaped . in a modification of the invention , illustrated in fig1 and 11 , each inner disk 4 and a portion of each outer disk 3 are made of a conventional material . each outer disk 3 consists of an annular portion 40 , which is not thermally responsive and which is adjoined by an inner annular portion 42 , which comprises a matrix of plastic , preferably ptfe ( polytetrafluoroethylene ), and a metal ring 41 , which is preferably radially slit ( not shown ) and is embedded in said plastic matrix and spaced from the radial and peripheral plane of symmetry of the annular portion 42 . the different coefficients of thermal expansion of the plastic and metal will result in a thermal deformation like that exhibited by a bimetal . the annular portion 42 is shaped to have at its inside periphery a spacing bead 43 bearing on the inner disk 4 &# 39 ; of the adjacent pair of disks . the position illustrated in fig1 will be assumed when the coupling is at room temperature in a state involving liquid friction . the two gaps z1 and z2 then have the same width so that a very low torque is being transmitted . in response to a temperature rise the metal ring 41 will cause the annular portion 42 to wrap so that the engagement of the spacing bead 43 on the left - hand inner disk 4 &# 39 ; will cause the plate 40 of the outer disk 3 to move to the right . as a result , the gap width z2 will decrease and a higher torque will be transmitted until a state involving solid - to - solid friction between the disks 3 and 4 of the same pair of disks is assumed . in the embodiments shown in fig1 and 11 the change to a state involving solid - to - solid friction may also be accelerated by the provision of scraping edges . in any case the sudden movement of the two disks of the same pair of disks to contact each other throughout their confronting surfaces will result in a particularly steep rise of the torque . when that torque rise has produced the desired result , e . g ., has caused the obstacle off the road to be overcome , the state involving solid - to - solid friction will be abandoned because the temperature in the coupling will drop and the thermally responsive annular portion 42 will warp in response to such temperature drop so that the plate 40 will move to the left until the gap widths z1 and z2 are equal . that embodiment provides for a particularly wide control range from the transmission of a very low torque to the transmission of a fairly high torque , whereafter the torque will rise quickly to the high hump torque . in conclusion it is stated that various embodiments have been described hereinbefore only by way of example and that various features of such embodiments may be embodied in other combinations within the scope of the invention . for instance , the annular portion 42 might consist of a bimetal or of an alloy having a shape memory or the annular portion 42 may be joined to the plate 40 in any desired manner .
| 5 |
an embodiment of a packet switching system according to the invention is described with reference to associated drawings . fig3 schematically describes the overall configuration of the packet switching system according to the embodiment of the invention . here , a routing of a packet from a client terminal 1 to a destination client terminal 2 via a route ( 1 ) through ( 7 ) on a packet switching network 100 will be described as a typical example . as shown in fig3 , the packet switching network 100 is configured by interconnecting routing domains 10 , 20 , 30 and 40 . each routing domain is configured by routers . in fig3 , the routing domain 10 is configured by routers 11 through 13 , the routing domain 20 is configured by routers 21 and 22 , the routing domain 30 is configured by routers 31 through 34 , and the routing domain 40 is configured by routers 41 through 43 , respectively . the routing domains are interconnected via border routers 21 , 31 and 41 . a network management apparatus 3 manages network elements , e . g ., routers , on the packet switching network 100 . in this embodiment , a packet transferred on the packet switching network 100 has an identifier ( routing table identifier , hereinafter referred to as rti ) for selecting an appropriate routing table from the plural routing tables (# 0 , # 1 , # 2 . . . ) that are stored in the routers ( 11 - 13 , 21 , 22 , 31 - 34 , 41 - 43 ). the rti is inserted in the packet and a value of the rti can be changed within the packet switching network 100 according to the routing policy utilized in the routing domain to which the packet is to be transferred . further , as the status of traffic on the packet switching network 100 varies , the value of rti can be changed . in this embodiment , the rti is inserted in the packet header field , e . g ., a flow - label field in a header of ipv6 and the other field in the header . the rti may be inserted at the border router on the packet switching network 100 . the value of rti is changed for a unit according to the prescribed number of packets , e . g ., flow of packets , input interface , all the incoming traffic and specific information contained in the packet . the “ specific information ” means , for example , a port number , tos field , a source address and so on . the client terminal 1 is connected to the routing domain 10 via an edge router 11 . the destination client terminal 2 is connected to the routing domain 30 via an edge router 33 . as shown in fig4 , routers 11 through 13 , 21 , 22 , 31 through 34 , and 41 through 43 have the plural routing tables (# 0 , # 1 , # 2 . . . ), respectively , and the router selects one routing table from these tables according to the value of the rti . the router then decides on a router to which the packet is to be transferred by referring to a destination address indicated on the selected routing table so as to transfer packets continuously . the routing tables (# 0 , # 1 , # 2 . . . ) are generated based on respective routing policies and one of the routing tables is specified by the value of rti , which is called a routing table id ( rti : xi ). the routing tables are utilized to search an address of a next hop router ( ipy 0 - ipy 2 ) that corresponds with a destination address ( ipx ). in this embodiment , the routing tables (# 0 , # 1 , # 2 . . . ) contain a network prefix of a destination ip address as well as an ip address of the next hop router , and are generated by rip or ospf routing protocol and so on . it is also accepted that the routing table utilized in this embodiment specifies the ip address of the next hop router for all the destination ip addresses , and the routing table is generated by a newly created routing algorithm . further , the routing table can be configured and the ip address of next hop router can be set taking various information into account , e . g ., value of tos field , port number and flow - label of ipv6 header , which are contained in the packet including a packet header , additional information in the router , e . g ., the number of packets per input interface , the status of network resources and all the incoming packets at the router . in this embodiment , the border router 21 , 31 , 41 as well as the edge router 11 , 33 have a function of adding and changing the id of the rti that is inserted in the packet . fig5 is a block diagram showing an internal configuration of the border router that has a function of adding and changing the id of the rti . as shown in fig5 , the border router is configured with an input interface 111 , a packet forwarder 112 , an output interface 113 , a routing protocol processor 203 a / 203 b / 203 c , a network monitor 204 , and a routing policy receiver 205 . the input interface 111 has a packet receiver 114 for receiving the packet , a routing table searcher 115 for searching for a routing table , a rti receiver 201 for receiving the rti , and a routing table cache 202 a / 202 b / 202 c for storing the routing table . the packet forwarder 112 decides on an address of the next hop router , which the packet to be transferred , based on a routing table searched by the routing table searcher 115 , and then sends an instruction to the output interface 113 to transfer the packet to the address . the routing protocol processor 203 a / 203 b / 203 c updates the routing table (# 0 , # 1 , # 2 . . . ) according to a routing protocol (# 0 ′, # 1 ′, # 2 ′ . . . ) which is selected based on the value of the rti informed by the rti receiver 201 . the updated routing tables (# 0 , # 1 , # 2 . . . ) are stored in the routing table cache 202 a / 202 b / 202 c , respectively . the output interface 113 has a packet transmitter 117 and a rti changing processor 206 . the packet transmitter 117 transmits the packet according to an instruction sent by the packet forwarder 112 . the rti changing processor 206 changes the id ( value ) of the rti in the packet to be transferred according to an instruction from the network monitor 204 and the routing policy receiver 205 . the id of the rti is properly decided taking into account the static status of the edge routers as well as the border routers ( e . g ., the situation of traffic , priority of the routing policies , ip address of the packet to be transferred , port number , type of an application contained in the packet and so on ) and an instruction is dynamically sent by the network management apparatus 3 . further , if the conventional router , which has no function of adding / changing / deleting of the rti or has no capability of storing the plural routing tables , exists on the network , the routers in this embodiment ignore the id of the rti ( or it is handled as “ 0 ”, which is the default value ), and perform routing by a routing table generated by rip , ospf , etc . this maintains connectivity to the conventional packet switching network . the network monitor 204 measures the existing priority of the routing policies in the routing domain , the status of traffic on the network , the usage of network resources , throughput and supported routing protocols , in order to analyze the load on the network , and determines the priority of routing policies accordingly . the routing policy receiver 205 is connected to the other apparatuses , e . g ., the network management apparatus 3 and sends a changing instruction to the rti changing processor 206 based on a request from the other apparatuses . the request from the other apparatuses means a signal informed by a network management layer including the network management apparatus 3 ( e . g ., an instruction by a specific address , input interface , port number , flow - label of ipv6 or value of tos field ), negotiation with the other routers and so on . the rti changing processor 206 has a routing policy table t 1 and performs a process of changing the id of the rti when it receives the changing instruction from the network monitor 204 or the routing policy receiver 205 . fig6 illustrates the content of the routing policy table t 1 in this embodiment . the routing policy table t 1 indicates a relationship between the rti , the routing policy and the routing table in order to discriminate which routing table is generated by which routing policy , i . e ., the routing protocol . specifically , as shown in fig6 , the routing policy table t 1 is configured with a routing table id , a routing policy id and the rti . the routing policy table t 1 may include additional information other than these ids . the routing table id is an identifier specifying routing tables that is stored in the border router , the edge router and the client terminal , etc . the routing policy id is an identifier specifying the routing protocol as well as the various controlling protocols so as to generate the routing tables , or for specifying the static status based on a certain routing policy . the rti is inserted in the packet , and is an identifier for specifying a routing table to be referred . in this embodiment , the same number is utilized between the routing table id and the rti for specifying the routing table . incidentally , the routing policy table t 1 may commonly be utilized among all the routers on the packet switching network . it is not necessary to utilize the same routing policy table t 1 commonly on the packet switching network if a certain routing domain cannot support the specific routing protocol , and a different routing policy table may also be utilized within the respective routing domains . on the packet switching network 100 which has the above described functions , the edge router 11 first recognizes the rti and the destination address ( da ) of the received packet when the packet is transmitted from the client terminal 1 to the destination client terminal 2 ( refer to ( 1 ) in fig3 ). the edge router 11 then specifies a routing policy to be utilized in the routing domain 10 based on the recognized rti and the da . at this point in time , the edge router 11 inserts the rti in the packet according to the default routing policy utilized in the routing domain 10 if the rti is not inserted in the packet or value of the rti is “ 0 ” (“ 1 ” is inserted as the value of rti in fig3 ). further , the edge router 11 forwards the packet to the next hop router ( the router 13 in fig3 ) by referring to the routing table , by which the specified routing policy has been generated . the router 13 in the routing domain 10 similarly selects the routing table by referring the rti of received packet ( refer to ( 2 ) in fig3 ) and transfers the packet to the next hop router ( the border router 21 in the fig3 ). the border router 21 decides on a routing policy to be utilized in the routing domain 20 based on the rti of the received packet , and if the routing policy in the routing domain 20 differs from the routing domain 10 , the border router 21 changes the value of the rti ( refer to ( 3 ) in fig3 ). the border router 21 then transfers the packet to the next hop router ( the router 22 in fig3 ). on the packet switching network 100 , the above described process is performed repeatedly and the packet is transferred via routes ( 4 ) through ( 7 ) shown in fig3 . in this embodiment , the edge router 33 may delete the rti when the packet is transferred to the destination client terminal 2 . as will be seen from the foregoing description , flexible and highly functional routing is achieved by the simultaneous use of the plural routing policies on the packet switching network . in other words , according to the invention , routing a specific packet to a specific router on the network when the routers receive a certain signal without the knowledge of such routing process of the client terminal , the dynamic use of the plural routing policies , the simultaneous use of more than one route for the same ip address , etc . are achieved and thus a routing control can be highly fictionalized . moreover , various applications are feasible by using the invention and the invention is able to cover all the routing control systems to which the invention is applied . the invention has been described in detail by referring to the embodiments . it is obvious to those skilled in art that the invention is not restricted to the embodiments mentioned above . the invention may be carried out as a corrected or modified embodiment not departing from the gist and scope specified by the scope of the claims of a patent . therefore , the description of this specification aims at the representation of examples but does not have any limitation on the present invention .
| 7 |
fig1 is a top plan view of an illustrative embodiment of an inductor 10 in which the benefits of the invention are demonstrated . it is recognized , however , that inductor 10 is but one type of electrical component in which the benefits of the invention may be appreciated . thus , the description set forth below is for illustrative purposes only , and it is contemplated that benefits of the invention accrue to other sizes and types of inductors as well as other passive electronic components . therefore , there is no intention to limit practice of the inventive concepts herein solely to the illustrative embodiment described , that is inductor 10 . inductor 10 includes a core 12 , sometimes referred to as a drum , and a shield 14 . a coil of conductive wire ( not shown ) is wound onto core 12 , and the coil and core 12 are disposed within a protective shield 14 . the coil includes a number of turns of conductive wire in order to achieve a desired inductance value for a selected end application of inductor 10 . as those in the art will recognize , an inductance value of inductor 10 , in part , depends upon wire type , a number of turns of wire in the coil , and wire diameter . as such , inductance ratings of inductor 10 may be varied considerably for different applications shield 14 , in one embodiment , is fabricated from a magnetic material to provide both a magnetic path and mechanical protection for the coil of inductor 10 both mechanically and electrically . shield 14 includes a bore for receiving core 12 therein , and serves to provide a path for concentrating the magnetic field between ends of coil 10 , thus containing the magnetic field to strengthen the field around the coil and reduce the effect of the field on the ambient environment . in the embodiment illustrated in fig1 shield 14 includes an eight sided polygonal outer perimeter , but in alternative embodiments it is recognized that greater or fewer perimeter sides , including one or more curved sides , could likewise be used in alternative embodiments without departing from the scope of the present invention . core 12 in an illustrative embodiment is fabricated from a low loss powdered iron or other iron based ceramic material , although in other embodiments other known suitable materials may be employed . in a further embodiment , core 12 is spool shaped and includes a generally cylindrically , elongated inner circumference section ( not shown ) of a first diameter disposed between two generally flat disk - like outer circumference sections 16 ( only one of which is shown in fig1 ) of a larger diameter than the inner circumference section first diameter . outer circumference sections extend from opposing ends of the inner circumference section , and as shown in the fig1 outer circumference sections 16 each include a plurality of indentations or guides 18 which are configured for guiding and retaining leads ( not shown ) of a conductive wire coil wound about the inner circumference section of core 12 as the leads extend from the inner circumference section of core 12 . centering of core 12 and the associated coil within shield 14 maintains a desired open circuit inductance and a selected inductor bias ( open circuit inductance with dc current ). coil leads extend through guides 18 for attachment to a circuit ( typically a circuit board ), or , in an alternative embodiment , the leads are connected to insulated posts 20 located on and extending from opposing sides of the outer perimeter of shield 14 for surface mounting of inductor 10 on a printed circuit board ( not shown ) according to known techniques when core 12 is properly centered within shield 14 , a uniform gap or clearance 22 is maintained about the circumference of the coil and core 12 . in one embodiment , clearance 22 is approximately 0 . 004 inches to about 0 . 005 inches wide , although in alternative embodiments greater or lesser clearances may be employed . fig2 and 3 are a top plan view and cross sectional view , respectively , of one embodiment of an epoxy tape 40 for use in constructing inductor 10 in an exemplary embodiment of the present invention . epoxy tape 40 includes a first layer for affixing to the core , and a second layer for forming a bond with shield 14 . more specifically , tape 40 includes a structural adhesive film 42 and a laminating adhesive 44 . in one exemplary embodiment , structural adhesive film 42 includes an epoxy base resin , such as an “ af42 ” bonding film available from minnesota mining and manufacturing company ( 3m ™) of st . paul , minn ., and laminating adhesive 44 is a solvent - free acrylic adhesive , such as “ 467mp ” roll laminating adhesive , also available from minnesota mining and manufacturing company ( 3m ™) of st . paul , minn . as such , structural adhesive film 42 has adequate heat resistance and structural bond properties for the operating environment of inductor 10 , and laminating adhesive 44 exhibits sufficient humidity resistance , u . v . resistance , water resistance , chemical resistance and shear strength to withstand manufacturing , assembly , and operating environments of inductor 10 . in alternative embodiments , other known materials having similar properties and characteristics may be employed to fabricate tape 40 fur use in inductor 10 as described below . in one exemplary embodiment for fabrication of an inductor , such as inductor 10 , tape 40 has a length l of approximately 12 millimeters and a width w of about 1 . 6 millimeters . further , structural adhesive film 42 has a thickness t 1 of about 3 mils and laminating adhesive 44 has a thickness t 2 of about 2 mils . it is recognized that this is but one exemplary embodiment with exemplary dimensions , and that other dimensions both smaller and larger may be used in alternative embodiments within the scope of the present invention . a bottom surface 46 of structural adhesive film 42 is gummy or tacky and is affixed to the perimeter of core 12 after the conductive wire coil is wound therein , such that epoxy tape 40 substantially occupies clearance 22 ( shown in fig1 ) when core 12 ( shown in fig1 ) is inserted into shield 14 . once located in clearance 22 after structural adhesive film 42 is bonded to the outer circumference of core 14 , epoxy tape 40 , and more specifically , laminating adhesive 44 , is bonded to an inner circumference of shield 14 using a heating and curing process . the heating and curing process is sometimes referred to as a reflow process via heating of laminating adhesive 44 to a transition temperature that causes the adhesive to melt and “ flow ” within clearance 22 , and then curing laminating adhesive back to a solid state . as such , laminating adhesive 44 uniformly forms a mechanical bond between core 12 and shield 14 , and more specifically between shield 14 and structural adhesive film 42 . it is believed that those in the art could accomplish this type of heating and curing process without further description or explanation . in one embodiment , both structural adhesive film 42 and laminating adhesive 44 are translucent so that a proper positioning of core 12 within shield 14 may be optically confirmed . in an alternative embodiment , epoxy tape 40 is fabricated from opaque materials . it is contemplated , however , that visual or optic assurance of proper positioning of shield 14 with respect to core 12 could be accomplished with opaque materials as well , including but not limited to selection of appropriate color combinations of tape 40 , shield 14 and core 12 to facilitate visual confirmation of spacing between core 12 and shield 14 . fig4 is a side view of inductor core 12 at a first stage of manufacture wherein the conductive coil ( not shown ) is wrapped around the inner circumference of core 12 and epoxy tape 40 is wrapped around an outer circumference of core 12 . tape bottom surface 46 ( shown in fig3 ) is affixed to outer circumference sections 16 ( also shown in fig1 ) of the outer perimeter of core 12 , or in other words , tape bottom surface 46 is adhered to core 12 such that laminating adhesive 44 is “ face up ” on the external surface of core 12 when tape 40 is attached to core . as shown in fig4 laminating adhesive 44 of epoxy tape 40 is exposed when tape 40 has been affixed to outer circumference sections 16 of core 12 . fig5 illustrates core 12 with tape 40 affixed thereto and circumscribing core 12 in a substantially uniform fashion . in an illustrative embodiment , tape 40 retains leads ( not shown ) of the conductive coil wound into core 12 and extending from the coil through guides 18 . in various embodiment , tape 40 is wrapped around the outer perimeter of the core one or more times to form a wrapping thickness t 3 sufficient to fill clearance 22 ( shown in fig1 ) when tape 40 is reflowed to bond core 12 to shield 14 . fig6 illustrates inductor 10 at a second stage of manufacture after tape 40 is reflowed and cured to solid form to form a strong bond between core 12 and shield 14 . unlike conventional manufacturing methods including application of external epoxy glue to bond core 12 to shield 14 , reflowed tape 40 provides optimal uniform spacing and bonding between core 12 and shield 14 about substantially an entire outer surface of wrapped core 12 . coil leads ( not shown ) are extend through guides 18 for attachment to insulated posts 20 extending from shield 14 for electrical connection to a circuit or a circuit board according to known methods and techniques . use of reflowing epoxy tape 40 removes conventional liquid adhesive dispensing process and associated costs , as well as eliminates potential quality issues from associated incomplete or inadequate bonds . further , elimination of the dispensing process allows improvements in the consistency of the bond between core 12 and shield 14 , thereby allowing for reductions in physical size of inductor 10 while maintaining comparable power ratings in comparison to conventionally manufactured inductors . while the invention has been described in terms of various specific embodiments , those skilled in the art will recognize that the invention can be practiced with modification within the spirit and scope of the claims .
| 8 |
the flavour precursors of the present invention are derived from a furenidone and a carbonyl compound , both of which possess valuable flavouring properties . the nature of the carbonyl compound determines whether the precursor reverts under mild or under more severe conditions to the flavouring furenidone . under acid or neutral reaction conditions the following addition reaction of the furenidone takes place : ## equ1 ## in this general formula r 1 and r 2 represent a lower c 1 - c 4 alkyl group , preferably methyl or ethyl , while r 3 represents hydrogen or a methyl group and r 4 represents hydrogen or an organic radical consisting of 1 - 14 carbon atoms , hydrogen and 0 - 2 oxygen atoms , preferably a hydrocarbyl , more in particular an alkyl group or alkenyl group containing 2 - 10 carbon atoms . furthermore , in case r 3 represents a methyl group , r 4 should not contain more than 4 carbon atoms . these novel carbonyl addition compounds occur in two stereoisomeric forms in case r 3 and r 4 represent different groups and both forms are suitable flavour precursors for the purpose of this invention . particularly preferred carbonyl compounds which can be added to the furenidone are aliphatic saturated and unsaturated aldehydes and methyl - ketones such as acetaldehyde propanal , octanal , acetone , methylethylketone , cis - 3 - hexenal and cis - 4 - heptenal . aromatic and heterocyclic aldehydes such as phenylacetaldehyde , benzaldehyde , furfuraldehyde , methylfurfuraldehyde and hydroxymethylfurfuraldehyde , can also be used . carbonyl compounds containing 6 - 8 carbon atoms are preferred . the addition reaction takes place smoothly in a suitable polar solvent such as water in the presence of an acid - base catalyst under neutral or acid conditions at room temperature although higher - up to 100 ° c - and lower temperatures , above 5 ° c , can also be used . atmospheric pressures are suitably employed . however , too high temperatures favour reversion . the novel addition compounds of the alkyl substituted furenidones can be isolated without undue difficulties and may be used according to the present invention for incorporation into foodstuffs , in particular in foodstuffs which are heated to temperatures over 100 ° c when being prepared for consumption . such foodstuffs are e . g . shortenings , fats , margarines , especially bakery frying margarines , dried sterilised or deepfrozen soups , meat products , meatballs , ready - made meals , meat imitating products such as those known as texturised vegetable protein , mesophase , and various products used in bakeries , e . g . reinforced flour , baking aids etc . the amount of addition compound incorporated into the foodstuff ranges from 0 . 1 - 500 parts per million , dependent on the particular precursor and foodstuff , preferably 1 - 100 ppm . incorporation into the product may take place by adding the addition compound to the ingredients , spraying over the formed products etc . the addition compounds are usually used in conjunction with further flavouring agents or precursors thereof , such as e . g . amino acids , nucleotides , carboxylic acids , sweetening substances , etc . of course the actual combination is determined by the type of product . by way of illustration the following examples are given to elucidate the invention : in a round - bottomed flask equipped with a stirrer and a condensor , 12 . 8 g ( 0 . 1 mole ) of 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone and 44 g ( 1 . 0 mole ) of acetaldehyde were introduced into a solution of 3 . 0 g of oxalic acid in 100 ml of water . the mixture was stirred and refluxed for 1 hour . after cooling , the mixture was extracted 5 times with 25 ml portions of chloroform and the organic solvent was evaporated off . the residue was purified by chromatography on 50 g of polyamide . after elution by means of a 50 / 50 mixture of ether and petroleum ether , 9 . 4 g of the title compound was obtained ( which corresponds to a yield of 54 %). recrystallization from ether gave the pure product with m . p . 112 - 114 ° c ). infrared absorptions ( in kbr disc .) were at 3400 , 3200 , 1697 , 1610 , 1450 , 1370 , 1250 , 1072 , 1066 , 1005 and 924 cm . sup . - 1 . the nmr spectrum [ in cdcl 3 , internal standard si ( ch 3 ) 4 ] had signals at δ = 1 . 17 ( doublet ), δ = 1 . 41 ( singlet ), δ = 2 . 27 ( singlet ), δ = 3 . 81 ( quartet ), 4 . 3 - 5 . 7 ( broad peak ). the mass spectrum showed peaks at m / e 172 , 157 , 155 , 154 , 128 , 101 , 85 , 83 , 72 , 45 , 43 . 50 mg of the compound thus obtained was heated in 0 . 5 ml of water to a temperature of 100 ° c . the breakdown of the compound into 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone and acetaldehyde was followed by investigating the n . m . r . signals at intervals . in particular the diminishing signal of the starting compound at 0 . 99 ppm ( with respect to dimethylsulfoxide ) and the increasing signals of 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone at 1 . 25 and 2 . 08 ppm were followed . the other signals present in the spectrum recorded in cdcl 3 solution are obscured by the water signal . from the change in signals it was deduced that after about 48 hours 50 % of the starting material had been converted into the 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone . in an aprotic solvent 50 % was converted within a fraction of an hour to 24 hours , as a similar experiment showed , whereas at 160 ° c 50 % was converted in 1 / 4 hour . a mixture of 5 g of 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone and 10 . 6 g of benzaldehyde was added to a mixture of 20 ml of water , 20 ml of dioxan and 0 . 5 g of oxalic acid . the mixture was then refluxed for 4 hours , cooled and extracted with chloroform . the chloroform extract was evaporated and the residue purified by column chromatography over polyamide using ether - light petroleum 50 / 50 as the eluent ; 2 . 7 g ( 30 % yield ) of the title compound was obtained which was recrystallized from chloroform , m . p . = 122 °- 124 ° c . infrared absorptions ( kbr disc .) were at 3400 , 1715 , 1635 , 1455 , 1370 , 1240 , 1096 , 1080 , 1042 , 1010 , 910 and 705 cm . sup . - 1 . the nmr spectrum [ solvent cdcl 3 , internal standard si ( ch 3 ) 4 ] had signals at δ = 1 . 22 ( singlet ), δ = 2 . 17 ( singlet ), δ = 4 . 73 ( singlet ), δ = 4 . 9 - 5 . 6 ( broad peak ), δ = 7 . 15 ( singlet ). the mass spectrum showed peaks at m / e 234 , 128 , 107 , 106 , 105 , 85 , 77 , 57 , 55 , 52 , 51 , 50 , 45 , 43 . to a mixture of 6 g ( 0 . 05 mole ) phenylacetaldehyde and 1 . 28 g ( 0 . 01 mole ) of 2 . 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone was added 60 mg of boric acid and the mixture was stirred at 80 ° c for 3 hours . after working up the reaction mixture as described earlier , 0 . 57 g ( 23 %) of the title compound was obtained , with melting point 157 . 5 °- 159 ° c . infrared absorptions ( kbr disc .) were at 3500 , 3240 , 1697 , 1616 , 1447 , 1298 , 1240 , 1097 , 1058 , 746 and 703 cm . sup . - 1 . the nmr spectrum [ solvent dmso - d6 + cdcl 3 ( 3 : 2 ), internal standard si ( ch 3 ) 4 ] had signals at δ = 1 . 32 ( singlet ), δ = 2 . 15 ( singlet ), δ = 2 . 35 - 2 . 62 ( multiplet ), δ = 3 . 60 ( multiplet ), δ = 5 . 00 ( doublet ), δ = 7 . 00 ( singlet ), δ = 7 . 98 ( singlet ). the mass spectrum showed peaks at m / e 248 , 230 , 205 , 157 , 128 , 121 , 120 , 111 , 103 , 101 , 91 , 77 , 43 . the addition compound in an aprotic solvent was converted for 50 % to 2 . 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone after heating for 1 / 3 hour at 160 ° c . 0 . 3 g of 2 -( 1 - hydroxyethyl )- 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone was added to 1000 g of unflavoured margarine and the mixture then heated in a pan for 5 minutes at 160 °- 170 ° c . this flavoured fried margarine was preferred to a fried margarine without addition by 8 out of 11 tasters , who mentioned particularly its sweet , caramel - like aroma . to 100 g of hardened fat 5 mg of 2 -( 1 - hydroxyethyl )- 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone was added and the mixture was then heated for 5 minutes at 150 ° c . this fat was preferred to a fat without addition by 9 out of 10 tasters who mentioned particularly its mild fruity aroma . a basis for canned beef soup was prepared by adding the following ingredients to 4 liters of water : gramsnoodles 160herb and spices 1 . 6tallow 80vegetables 400monosodium glutamate 16protein hydrolysate 16meat extract 16salt 64raw meat 400 the total amount was divided into two portions of each 2 liters ; 0 . 08 g of 2 -( 1 - hydroxyethyl )- 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone was added to one of the portions . the second portion , which was used without further addition , served as a comparative example . the mixtures thus obtained were canned in half liter tins and sterilised in an autoclave for 1 hour at 120 ° c . a soup ready for consumption was prepared by adding an equal volume of water to the contents of each tin . after heating the soups were tested and a majority of the flavour evaluation panel preferred the soup with the added flavour precursor because of its more pronounced meaty flavour . grams flour 450 sugar 225 fat 250 water 65 salt 5 baking powder 3 the fat and the sugar were mixed in a hobart mixer ( type : ce 100 ) for 3 minutes at speed 2 . after adding the water , mixing proceeded for another 2 minutes . subsequently the flour , the salt and the baking powder were added , after which the composition was mixed for 10 minutes . the dough was spouted on baking trays in the shape of piped shortcakes and baked for 20 minutes at 180 ° c . in an analogous way piped shortcakes were prepared in which , however , 20 mg of 2 -( 1 - hydroxy - 2 - phenylethyl - 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone were added to the dough . the shortcakes thus prepared were evaluated by a panel in a pair test . the shortcakes to which 2 -( 1 - hydroxy - 2 - phenylethyl - 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone had been added were generally preferred by the members of the panel . a mixture of 10 g of 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone , 20 ml of a 37 % formaldehyde aqueous solution , 50 ml of water and 0 . 7 g of oxalic acid was stirred for 18 hours at room temperature . after working up the reaction mixture , the crude reaction product was purified by column chromatography over polyamide . elution with pentane - dichloromethane 80 / 20 yielded the pure 2 - hydroxymethyl - 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone , which was recrystallized from ethyllactate ; m . p . 124 °- 125 ° c . infrared absorptions ( kbr disc .) were at 3360 , 3170 , 1693 , 1675 , 1607 , 1596 , 1465 , 1300 , 1280 , 1236 , 1220 , 1160 , 1085 , 1050 , 1000 , 950 , 905 , 850 , 770 , 605 , 552 , 506 and 397 cm . sup . - 1 . nmr spectrum [ dmso - d6 ( dimethylsulfoxide , containing 6 deuterium atoms instead of hydrogen ), internal standard si ( ch 3 ) 4 ] had signals at δ = 1 . 25 ( singlet ), δ = 2 . 13 ( singlet ), δ = 3 . 42 ( broad signal ), δ = 5 . 0 ( broad signal ), δ = 8 . 1 ( broad signal ). the mass spectrum showed peaks at m / e 158 , 141 , 140 , 128 , 127 , 115 , 101 , 97 , 85 , 69 , 43 . to a mixture of 1 . 0 g of 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone , 5 g of propanal and 20 ml of water were added 0 . 2 g of oxalic acid and the mixture was stirred at room temperature for 25 hours and then extracted three times with chloroform . the chloroform extract was evaporated and the residue purified by column chromatography on polyamide using ether - pentane 10 / 90 as the eluent . pure 2 -( 1 - hydroxypropyl )- 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone was obtained , which was recrystallized from ether - pentane 50 / 50 ; solid mass at room temperature . infrared absorptions ( kbr disc .) were at 3380 , 3200 , 1695 , 1617 , 1460 , 1440 , 1380 , 1370 , 1365 , 1295 , 1254 , 1215 , 1084 , 1078 , 1009 , 973 , 948 , 731 and 570 cm - 1 . nmr spectrum [ dmso - d6 , internal standard si ( ch 3 ) 4 ] had signals at δ = 1 . 25 ( singlet ), δ = 2 . 10 ( singlet ), δ = 3 . 26 ( multiplet ), δ = 4 . 92 ( doublet ), δ = 8 . 03 ( singlet ), δ = 1 . 25 ( multiplet ), δ = 0 . 90 ( multiplet ). the mass spectrum showed peaks at m / e 186 , 157 , 128 , 101 , 97 , 85 , 69 , 57 , 43 . example ix was repeated except that in this instance the propanal was replaced by 5 g of butanal . from the reaction mixture 2 -( 1 - hydroxybutyl )- 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone was isolated with m . p . 103 °- 104 . 5 ° c . infrared absorptions ( kbr disc .) were at : 3490 , 3150 , 1690 , 1618 ( sh ), 1609 , 1462 , 1435 , 1365 , 1340 , 1272 , 1245 , 1222 , 1090 ( sh ), 1075 , 1050 , 1005 , 982 , 948 , 855 , 760 , 745 , 720 , 689 , 607 , 595 and 586 cm . sup . - 1 . nmr spectrum [ dmso - d6 , internal standard si ( ch 3 ) 4 ] had signals at : δ = 1 . 20 ( singlet ), δ = 2 . 05 ( singlet ), δ = 3 . 30 ( multiplet ), δ = 4 . 82 ( doublet ), δ = 7 . 85 ( singlet ), δ = 1 . 0 - 1 . 5 ( multiplet ), δ = 0 . 80 ( triplet ). the mass spectrum showed peaks at m / e 200 , 157 , 139 , 128 , 111 , 101 , 85 , 72 , 71 , 57 , 43 . example ix was repeated , except that in this instance the propanal was replaced by 6 g of octanal . from the reaction mixture 2 -( 1 - hydroxyoctyl )- 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone was isolated with melting point 97 °- 98 ° c . infrared absorptions were at ( kbr disc . ): 3495 , 3180 , 2960 , 2920 , 2860 , 1690 , 1618 , 1610 , 1460 , 1436 , 1365 , 1335 , 1260 , 1245 , 1205 , 1070 , 1005 , 972 , 945 , 760 , 722 and 578 cm . sup . - 1 . nmr spectrum [ solvent dmso - d6 , internal standard si ( ch 3 ) 4 ] had signals at : δ = 1 . 25 ( singlet ), δ = 2 . 10 ( singlet ), δ = 3 . 30 ( multiplet ), δ = 4 . 93 ( doublet ), δ = 8 . 00 ( singlet ), δ = 1 . 20 ( multiplet ), δ = 0 . 85 ( triplet ). the mass spectrum showed peaks at m / e 256 , 195 , 167 , 130 , 129 , 128 , 85 , 84 , 82 , 81 , 57 , 43 . example ix was repeated , except that in this case the propanal was replaced by 4 g of cis - 4 - heptenal . after column chromatography of the reaction mixture the pure 2 -( 1 - hydroxy - 4 - cis - heptenyl )- 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone was isolated . infrared absorptions ( kbr disc .) at : 3480 , 3200 , 3005 , 1695 , 1615 , 1458 , 1435 , 1370 , 1336 , 1249 , 1240 , 1083 , 1070 , 1004 , 935 , 760 , 720 , 685 and 575 cm . sup . - 1 . nmr spectrum [ solvent dmso - d6 , internal standard si ( ch 3 ) 4 ] had signals at : δ = 1 . 21 ( singlet ), δ = 2 . 05 ( singlet ), δ = 3 . 40 ( multiplet ), δ = 4 . 90 ( broad signal ), δ = 7 . 90 ( broad signal ), δ = 1 . 2 - 1 . 5 ( multiplet ), δ = 1 . 7 - 2 . 2 ( multiplet ), δ = 5 . 15 ( multiplet ), δ = 0 . 89 ( triplet ). the mass spectrum showed peaks at m / e 240 , 222 , 179 , 151 , 129 , 128 , 95 , 85 , 84 , 83 , 69 , 68 , 57 , 55 , 43 . example ix was repeated , except that in this instance the propanal was replaced by 5 g of furfural . from the reaction mixture 2 -( 1 - hydroxymethylfuran )- 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone was isolated by column chromatography as a mixture of two dia stereoisomers in the form of a semi - solid mass at room temperature . infrared absorptions ( kbr disc .) were at : 3440 , 3200 , 1700 , 1617 , 1500 , 1450 , 1370 , 1239 , 1145 , 1074 , 1050 , 1005 and 740 cm . sup . - 1 . nmr spectrum [ solvent dmso - d6 , internal standard si ( ch 3 ) 4 ] had signals at : δ = 1 . 05 and 1 . 35 ( singlet ), δ = 2 . 02 and 2 . 14 ( singlet ), δ = 4 . 52 and 4 . 57 ( singlet ), δ = 5 . 50 and 5 . 80 ( broad signal ), δ = 8 . 00 ( broad signal ), δ = 6 . 1 - 6 . 4 ( multiplet ), δ = 7 . 35 and 7 . 50 ( quartet ). the mass spectrum showed peaks at m / e 224 , 128 , 127 , 97 , 96 , 95 , 85 , 57 , 43 . a mixture of 2 . 0 g of 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone , 10 ml of acetone and 25 ml of 6n hydrochloric acid was stirred at room temperature for 48 hours . after working up the reaction mixture , the crude reaction product was purified by column chromatography . elution with pentane - ether 90 / 10 yielded pure 2 -( 2 - hydroxy - 2 - propyl )- 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone . infrared absorptions were at ( kbr disc . ): 3480 , 3380 , 1700 , 1686 , 1620 ( sh ), 1610 , 1470 , 1460 , 1445 , 1383 , 1370 , 1256 , 1210 , 1182 , 1118 , 1080 , 1075 , 1003 , 969 , 902 , 860 , 794 , 750 , 565 , 325 and 318 cm . sup . - 1 . nmr spectrum [ solvent dmso - d6 , internal standard si ( ch 3 ) 4 ] had signals at : δ = 0 . 99 ( singlet ), δ = 1 . 12 ( singlet ), δ = 1 . 18 ( singlet ), δ = 2 . 05 ( singlet ), δ = 4 . 32 ( singlet ), δ = 7 . 80 ( broad signal ). the mass spectrum showed peaks at m / e 186 , 171 , 129 , 127 , 101 , 97 , 85 , 71 , 59 , 58 , 57 , 43 . in an aprotic solvent the compound was fully converted to the furenidone upon heating at 160 ° c for 8 minutes . to 200 g or a commercial available frying fat were added 15 mg of 2 -( 1 - hydroxy - 4 - cis - heptenyl )- 2 , 5 - dimethyl - 4 - hydroxy - 3 -( 2h )- furanone and the mixture was heated for 5 minutes at 150 ° c . this fat was unanimously preferred to the fat without addition by the flavour evaluation panel , because of its more sweet , butterlike character .
| 0 |
referring to fig1 the gas reformer 10 includes an impervious shell 12 formed of a shell bottom plate 14 , a cylindrical shell housing 16 and a shell head 18 . these are welded or bolted together at flanged connections and the shell functions to contain the combustion products from burner 20 . this burner has a fuel inlet 22 and an air inlet 24 and is centrally supported from the bottom plate 14 . combustion products pass to the top of the shell through liner 26 and outwardly as shown by arrows 28 from the top of the burner tube . a plurality of bayonet type reactors 30 are located within the shell , the annular arrangement of these being best seen in fig2 . each reactor has a central tube 32 for the downflow 34 of reformer gas . an outer casing 36 forms an annular space 38 for the upflow of reformer gas . plate 37 supports the catalyst . an outlet tube extension 40 carries the reformer gas to a reformer gas outlet header 42 located below and passing beneath all of reactors 30 . this outlet tube extension is directly connected to the outlet header and supports the reactors from the outlet header . a sleeve 44 surrounds the lower portion of each reactor for the purpose of confining the flow of combustion products to the annular space 46 . this space includes spiral rods to facilitate the mixing of the combustion products and to increase the heat transfer coefficient . this sleeve cooperating with baffle or seal plate 48 forces the combustion products to pass from gas plenum 58 to the outlet plenum 60 through the annular space 46 . as shown in more detail in fig3 support leg 62 on each reactor supports the horizontal portion 64 of the seal plate . this seal plate in turn supports the sleeves 44 as well as loose fill insulation 66 . shell bottom plate 14 is protected from the 770 f . gas in outlet plenum 60 by blanket insulation 68 . the cylindrical shell housing 16 and head 18 are protected from the interior gases by insulation 70 and 72 . ceramic board insulation 72 protects head 18 . three outlet header support members 74 , 76 and 78 support the outlet header 42 and pass directly down to bottom plate 14 where they are welded to the plate through thermal sleeves 80 . these thermal sleeves accommodate the local differential expansion between the support member and the bottom plate and provide a gradual thermal gradient . they also provide some flexibility for relative horizontal movement of the support members with respect to the bottom plate . they are , however , stiff in the vertical direction so that they transmit load in this direction between the support members 74 , 76 and 78 and the bottom plate 14 . outlet header support continuation members 82 , 84 and 86 extend directly downwardly from the outlet header support members to a ground support location 88 . one of the support members 78 and 86 comprises a reformer gas outlet from the outlet header which permits the reformer gas outlet line to not only accomplish the shell penetration , but also act as a mutual support between the internal pressure parts and the shell as well as a support from the ground . a second support member 76 and 84 comprises the combustion gas product outlet from outlet plenum 60 . a third leg 74 and 82 is free of all gas products . preferably the outlet header 42 is arranged to slide on the support connections 76 and 74 with its relative location dictated by the direct connection of the support leg 78 . it can be seen that the joint between the support structure and the bottom plate permits the internal pressure parts including the reactors 30 to move up and down relative to the shell 12 . horizontal movement caused by expansion is a function not of the temperatures within the shell nor of the outlet header , but only the differential between the bottom plate 14 and the ground . this nominal differential expansion can readily be accepted by the thermal sleeves 80 . the combination of the required gas flow penetrations with the structural support simplifies the construction . while more than three supports could be used , the use of only three supports is preferred because of the potential temperature differentials , particularly during transients . the use of three supports permits predictable load distribution .
| 2 |
many aspects of the invention can be better understood with the references made to the drawings below . the components in the drawings are not necessarily drawn to scale . instead , emphasis is placed upon clearly illustrating the components of the present invention . moreover , like reference numerals designate corresponding parts through the several views in the drawings . one embodiment of the current invention is a skateboard truck assembly that has some combination of wheels and casters resulting in at least three round items capable of moving ( in combination with at least one other skateboard truck ) a skateboard across the ground . there are two skateboard wheels suspended on hangers or axles , with one caster , which sits in a caster bracket . a goal behind the invention is to provide a skateboarder with an improved “ sliding ” or “ drifting ” ability , along with increased stability , improved maneuverability , and a lighter weight . in a particular embodiment , the skateboard truck includes a set of independent hangers with integrated gears that mate with a caster displacement system , or more specifically a modified planetary gearing system . modified planetary gearing system links each hanger with the displacement of the caster . such a gearing system allows both wheels and a caster to remain on the ground when in a neutral state as well as to raise one of the two wheels while leaving the other wheel and castor in contact with the ground when in a modified state . a modified state occurs when a rider places an unequal force about the centerline of the skateboard , such as when the rider leans on one side of the skateboard . with two such skateboard trucks on each end of a skateboard , the rider can have a total of six wheels on the ground simultaneously while skateboarding . when the rider leans a sufficient amount to displace the center wheel , or caster , from the centerline of the skateboard , the rider will have a total of four wheels on the ground and the configuration of the skateboard truck forces the “ downhill ” wheels away from the ground and far enough in the air to avoid catching on street irregularities . the function of the skateboard truck proceeds as follows . when the skateboard is in a neutral state , the caster wheels support a majority , if not all , of the weight of the rider . each hanger is approximately the same distance from the deck of the skateboard . the caster wheel rotates in the same direction as the wheels secured to the hangers . as the rider of the skateboard leans on one side of the skateboard , the wheel on that side is displaced towards the deck of the skateboard . this movement is transferred to the hanger , which rotates about the kingpin . a toothed portion , or bevel gear , on the hanger then rotates a ring gear , which in turn rotates a planet gear , which then rotate the sun gear . the rotation of the sun gear is linked to the caster thereby causing the caster wheel to be displaced about the same axis as the sun gear . the caster wheel is free to function as any normal caster wheel , wherein it may rotate to match the appropriate direction of travel . the opposite hanger ( the one not displaced towards the deck of the skateboard ) does not move relative to the skateboard deck , but does move away from the ground . ring stops , discussed in more detail below , prevent each hanger from rotating below its neutral state ( away from the deck of the skateboard ) or more than a defined angle above its neutral state ( towards the deck of the skateboard ). since each hanger is independent of the other and not molded from the same piece of metal as are traditional hangers , both wheels and the caster can remain on the ground simultaneously when the user is travelling along a path that is substantially parallel to the centerline of the skateboard . furthermore , as the rider applies pressure on one side of the board and angles the deck , the wheels on the opposite edge of the board lift off of the ground . should the rider continue to put pressure on one side of the board , the base of the caster will displace from the centerline of the skateboard , where the caster is free to rotate in the direction of the rider &# 39 ; s choosing . however , the castor does not offset given any torque applied directly to the sun gear , such as when a lateral force is applied directly to the caster wheel in a direct attempt to offset the caster from the centerline of the skateboard . this is achieved through the geometry of the gearing system , particularly through the planet gears . it should be noted that there are two important axes of rotation . one axis is the axis that is shared by the bracket for the caster wheel and the sun gear . it is assembled with thrust bearings , washers , and a rivet . the caster wheel is free to rotate about this axis . the second important axis is the axis shared by the sun gear , both ring gears or annulus , and the baseplate . it is assembled with a rivet . as the baseplate remains stationary , the rotation of a ring gear and the sun gear ( or cover ) is governed by one of the hangers . the rotation of the other ring gear and again , the cover , is governed by the other hanger . this short summary of the invention will be further explained below . it is important to note that the hanger gear is shown in these illustrations with teeth that engage teeth in the ring gear , but it is contemplated that gearing other than through the use of teeth is possible . fig1 is a top perspective view of a skateboard according to selected embodiments of the current disclosure . the skateboard includes a skateboard deck 20 with two skateboard trucks attached thereto , better viewed in fig2 . each skateboard truck includes two wheels 12 and a castor wheel 14 . fig2 is a bottom perspective view of a skateboard according to selected embodiments of the current disclosure . each skateboard truck 10 is secured to one end of the skateboard deck 20 , usually by means of screws . as stated above , each skateboard truck 10 includes two wheels 12 and a castor wheel 14 . fig3 is an exploded perspective view of a skateboard truck according to selected embodiments of the current disclosure . the skateboard truck 10 includes a baseplate 22 that is used to secure the skateboard truck to the skateboard deck . a bottom hanger 16 and a top hanger 18 are secured to the baseplate 22 by means of a kingpin 30 . the bottom hanger 16 and the top hanger 18 each have a wheel 12 secured thereto . the bottom hanger 16 and top hanger 18 are allowed to move relative to each other . however , there is a spring 17 ( or a compressible and resilient bushing ) located therebetween that applies a force to each of the hangers that , if left unrestrained , would push the wheels 12 away from the deck of a skateboard . ring stops , discussed in more detail below , prevent the hangers from rotating down from their neutral state . each hanger also has a tooth portion ( shown in more detail in fig7 ) that engages a ring gear ( annulus ), wherein the top hanger 18 mates with the top ring gear 26 and the bottom hanger 16 mates with the bottom ring gear 24 . the ring gears are secured between the base plate 22 and a sun gear 28 . a plurality of planet gears 32 are also situated between the base plate 22 and the sun gear 28 as well as within the ring gears . a caster wheel 14 is secured to a caster bracket 15 , which in turn is secured to the sun gear 28 . the rivet 34 is used to secure the caster bracket 15 to the sun gear 28 , with thrust bearings and washers in between . this configuration allows for the caster wheel 14 to rotate freely about an axis along the length of the rivet 34 while at the same time rotating about the axis of the sun gear 28 . fig4 is a front view of a skateboard according to selected embodiments of the current disclosure . in this view , the skateboard is in a neutral configuration , as if the rider were travelling along a straight line that extends down a lengthwise axis ( centerline ) of the skateboard . all three wheels , including wheels 12 and castor wheel 14 are in contact with the ground 40 and pointed in the same direction . top hanger 18 and bottom hanger 16 are in a neutral position , where each is approximately the same distance from the skateboard deck 20 . fig5 is bottom perspective view of a skateboard truck according to selected embodiments of the current disclosure . when a rider applies a force to one side of the skateboard and not the other , the skateboard deck 20 moves closer to the wheel on the side on which the force is applied . in this figure , the arrows show a direction of movement of the wheel when such a force is applied . fig6 is a cut - away view of the gearing assembly of a skateboard truck according to selected embodiments of the current disclosure . this figure includes an arrow showing the rotational movement of the top hanger 18 and top ring gear 26 when the wheel of the top hanger 18 rotates as shown in fig5 . top hanger 18 has a toothed portion , or bevel gear , that engages top ring gear 26 , which in turn engages planet gear 32 . furthermore , planet gear 32 engages sun gear 28 . therefore , the caster , which is secured to the sun gear by rivet 34 , is indirectly connected by means of multiple gears to the top hanger 18 . fig7 is a cut - away view of the gearing assembly of a skateboard truck showing directions of rotation of a top ring gear and a top hanger according to selected embodiments of the current disclosure . as top hanger 18 rotates in a counter - clockwise direction , top ring gear 26 rotates in a clockwise direction . fig8 is a cut - away view of the gearing assembly of a skateboard truck showing directions of rotation of a top ring gear and a planet gear according to selected embodiments of the current disclosure . as top ring gear 34 rotates in a clockwise direction , planet gear 32 rotates in a clockwise direction . fig9 is a cut - away view of the gearing assembly of a skateboard truck showing a rotated planet gear and corresponding sun gear according to selected embodiments of the current disclosure . as planet gear 32 rotates in a clockwise direction , sun gear 28 rotates in a counter - clockwise direction . fig1 is a cut - away view of the gearing assembly of a skateboard truck showing a rotated sun gear and corresponding rotational movement of a rivet according to selected embodiments of the current disclosure . as planet gear 32 rotates in a clockwise direction , sun gear 28 rotates in a counter - clockwise direction . since the caster wheel , via the caster bracket and rivet 34 , is connected to the sun gear 28 , it moves in a similar direction . thus , when top ring gear 26 rotates in a clockwise direction , so does the caster . it must be appreciated that the same events occur with the bottom hanger as they do with the top hanger , but in reverse . thus , when the bottom ring gear rotates counter - clockwise , so does the caster . however , while each hanger may cause the caster to move in a particular direction , the gearing is such that the movement of one hanger does not necessitate the movement of the other hanger , as doing so would attempt to force the caster in opposing directions . fig1 is a front perspective view of a skateboard in a turn with the downhill wheel raised according to selected embodiments of the current disclosure . a force is applied to the skateboard deck 20 to cause the top hanger 18 and the wheel 12 secured thereto to move towards the skateboard deck . doing so causes the caster wheel 14 to move away from the side of the skateboard with the top hanger 18 . this movement , combined with the angling of the skateboard deck 20 causes the other hanger , the bottom hanger 16 and the wheel 12 secured thereto , to move away from the ground such that the wheel lifts off of the ground . fig1 is a bottom perspective view of a skateboard truck showing displacement and rotation of the castor from the centerline according to selected embodiments of the current disclosure . the caster wheel 14 has moved a distance ad away from top hanger 18 and towards bottom hanger 16 because of the rotation of caster bracket 15 with sun gear 28 . fig1 is a cut - away view of the gearing assembly of a skateboard truck showing the displacement of the rivet relative to the centerline according to selected embodiments of the current disclosure . the rivet 34 , to which the caster wheel is connected via the caster bracket ( both not shown in this figure ), rotates with the sun gear 28 . the sun gear 28 is rotated due to the movement of top hanger 18 . the rivet 34 is displaced a distance δd relative to its neutral state . fig1 is a front perspective view of a skateboard with the downhill wheel raised and the castor wheel rotated perpendicular to the centerline of the skateboard according to selected embodiments of the current disclosure . similar to fig1 , this figure shows the bottom hanger 16 and the wheel 12 secured thereto displaced away from the ground such that the wheel lifts off of the ground , while the top hanger 18 and the wheel secured thereto remain in contact with the ground . this configuration is used when the skateboard moves laterally . fig1 is a bottom perspective view of a skateboard truck showing displacement and approximately ninety - degree rotation of the castor from the centerline according to selected embodiments of the current disclosure . the caster wheel 14 is shown displaced a distance ad from the centerline of the skateboard truck . sun gear 28 has been rotated according to directional arrows located thereon by the angular displacement of top hanger 18 . the caster wheel is also rotated perpendicular to the centerline of the skateboard . this enables a rider to more easily ride a skateboard in a perpendicular direction to the centerline of the skateboard . fig1 is a cut - away view of the gearing assembly of a skateboard truck showing the displacement of the rivet relative to the centerline according to selected embodiments of the current disclosure . rivet 34 , to which the caster wheel is connected via the caster bracket ( both not shown in this figure ), is displaced a distance ad from the centerline of the skateboard truck ( and thus skateboard ). top hanger 18 rotates top ring gear 26 , which in turn causes planet gears 32 and sun gear 28 to rotate according to directional arrows located thereon . rivet 34 , being secured to sun gear 28 , is therefore displaced a distance δd . fig1 is a bottom perspective view of a skateboard truck with the sun gear partially removed and an angular displacement of the top hanger and top ring gear . top hanger 18 is displaced an angle δθ about kingpin 30 . at the same time , bottom hanger 16 remains in its neutral state . rotation of top hanger 18 causes top ring gear 26 to rotate an angle δa . in a particular embodiment , the maximum angle of rotation δa of top ring gear 26 is sixteen degrees . further rotation of the top ring gear 26 is resisted by top ring stops 21 , 23 , and 25 ( ring stop 25 is more clearly shown in fig1 ). ring stop 21 is a protrusion that is incorporated into baseplate 22 . ring stops 23 and 25 are an internal gear and protrusion , respectively , that are incorporated into bottom ring gear 24 . corresponding protrusions in top ring gear 26 mate with the ring stops 21 , 23 , and 25 when it has reached its maximum rotational angle , whereby further rotation is resisted . fig1 is a cut - away view of the gearing assembly of a skateboard truck showing the angular displacement present in fig1 . ring stops 21 , 23 , and 25 are used to prevent top ring gear 26 from rotating beyond a desired angle , in this embodiment sixteen degrees . as top ring gear 26 rotates , a portion of top ring gear 26 will eventually come in contact with ring stops 21 , 23 , and 25 , which then prevents further rotation . at the same time , downward rotation of the opposing bottom hanger 16 is resisted by the rotational limits of bottom ring gear 24 , whose further rotation is prevented by ring stops 21 , 31 , and 41 . this causes the bottom hanger 16 to remain in its neutral state relative to the skateboard deck and rise off of the ground when the user leans to the top hanger 18 side . fig1 is a bottom perspective view of a skateboard truck with the sun gear partially removed and an angular displacement of the bottom hanger and bottom ring gear . bottom hanger 16 is displaced an angle δθ about kingpin 30 . at the same time , top hanger 18 remains in its neutral state . rotation of bottom hanger 16 causes bottom ring gear 24 to rotate an angle δa . in a particular embodiment , the maximum angle of rotation δa of bottom ring gear 24 is sixteen degrees . further rotation of the bottom ring gear 24 is resisted by bottom ring stops 31 , 33 , and 35 . ring stop 31 is a protrusion that is incorporated into baseplate 22 . ring stops 33 and 35 are an internal gear and protrusion , respectively , that are incorporated into the top ring gear 26 . corresponding protrusions in bottom ring gear 24 mate with the ring stops 31 , 33 , and 35 when it has reached its maximum rotational angle , whereby further rotation is resisted . fig2 is a cut - away view of the gearing assembly of a skateboard truck showing the angular displacement present in fig1 . ring stops 31 , 33 , and 35 are used to prevent bottom ring gear 24 from rotating beyond a desired angle , in this embodiment sixteen degrees . as bottom ring gear 24 rotates , a portion of bottom ring gear 24 will eventually come in contact with ring stops 31 , 33 , and 35 , which then prevents further rotation . at the same time , downward rotation of the opposing top hanger 18 is resisted by the rotational limitations of the top ring gear 26 , whose further rotation is prevented by ring stops 21 , 31 , and 41 . this causes the top hanger 18 to rise off of the ground when the user leans to the bottom hanger 16 side . various different materials can be used for the gears , hangers , wheels , and other various components of the skateboard truck . for example , the gears may be manufactured from stainless steel , titanium , or aluminum . in a particular embodiment , the wheels are made from polyurethane . other gear configurations may be implemented as well to achieve the same desired outcomes of the current invention . more or fewer gears may be used so long as each hanger displaces the caster wheel from the centerline of the skateboard . in fact , mechanisms other than gearing may be used to achieve the same outcome . for example , a pulley system may be used wherein angular displacement of the hanger moves the caster wheel through a series of pulleys . alternatively , angular displacement of the hangers may be read in by an electronic sensor , which in turn causes an electric motor to displace the caster wheel from the centerline of the skateboard . it should be understood that while the preferred embodiments of the invention are described in some detail herein , the present disclosure is made by way of example only and that variations and changes thereto are possible without departing from the subject matter coming within the scope of the following claims , and a reasonable equivalency thereof , which claims i regard as my invention . all of the material in this patent document is subject to copyright protection under the copyright laws of the united states and other countries . the copyright owner has no objection to the facsimile reproduction by anyone of the patent document or the patent disclosure , as it appears in official governmental records but , otherwise , all other copyright rights whatsoever are reserved .
| 0 |
in all of the following figures , the same reference numbers have been used for the same elements throughout , so that in the explanations of the individual figures , the corresponding parts will not be listed again . the meanings are as follows : fig1 a and 1b show a first embodiment of the invention in which the collar is &# 34 ; formed &# 34 ; from the same metallic material , for example a steel alloy as container lid 1 , and in which locking element 21 on collar 2 is an external thread provided therein , into which an internal thread 31 provided on plug 3 is screwed . in addition , collar 2 has a crimp - like elevation 2 &# 39 ; which serves to reinforce the plug area as well as for improved draining of the container . the designs shown in fig1 a and 1b ) differ in the arrangement of sealing surfaces 62 and 63 provided on collar 2 and of sealing elements 6 made in the form of o - rings . in the design shown in fig1 a , o - ring 3 is located &# 34 ; inside &# 34 ; so that the screw connection remains &# 34 ; dry &# 34 ; while in the design shown in fig1 b o - ring 6 rests on crimp - type elevation 1 &# 39 ;. regardless of the different arrangement of sealing surfaces 62 and 63 as well as sealing element 6 , the sealing function in the two designs is ensured regardless of the tightness of the threaded connection . fig2 a and 2b show a second embodiment of the invention in which collar 2 , as a locking element , has an internal thread 21 and an external thread 31 , corresponding to plug 3 as a matching element . collar 2 is not formed from container lid 1 , but is produced by pinching the material of container lid 1 . the designs shown in fig2 a and 2b differ in the arrangement of sealing element 6 , once again in the form of an 0 - ring , as well as sealing surfaces 62 and 63 on collar 2 and on plug 3 . the reader is expressly referred to the drawing with respect to the exact design of the sealing surfaces . the design shown in fig2 a has the advantage that , when the shape and line thickness of o - rings 6 are suitable , the complementary convexity of collar 1 produces a comparatively large contact surface , while the design shown in fig2 b has the advantage that o - ring 6 is guided in a groove in plug 3 . fig3 a to 3h show a third embodiment of the invention in which collar 2 , as in the embodiment according to fig1 a and 1b , is formed by crimping , deep - drawing , pressing , etc . from the material making up container lid 1 . in contrast to the embodiment shown in fig1 a and 1b , collar 2 however has an internal thread 21 as a locking element which engages a matching external thread 31 on plug 3 . the designs shown in fig3 a to 3h differ in the arrangement of the sealing element once again in the form of an o - ring 6 as well as the matching sealing surfaces 62 ( on collar 2 ) and sealing surfaces 63 ( on plug 3 ). the reader is expressly referred to the drawing with regard to the various possible designs . once again the various designs differ from one another in the design of the collar , which has partially crimp - shaped reinforcements , while in other designs on the other hand it is made as simple as possible to simplify manufacture . the designs shown in fig3 b and 3c have the advantage that standard plugs 3 with standard threads ( 2 inches and / or 3 / 4 inch ) can be used . in the designs shown in fig3 a to 3c , which permit the use of standard plugs 3 , the sealing element is located at the outermost end of the threaded connection . the designs shown in fig3 d to 3f likewise have an external sealing element 6 . however , sealing element 6 and sealing surfaces 61 and 62 are arranged so that the sealing function is ensured independently of the threaded connection . the individual designs differ from one another only in the shape of collar 2 and plug 3 . in the designs shown in fig3 g and 3h , the collar has a base , a neck , and a lip . an o - ring 6 is located &# 34 ; in front of &# 34 ; the threaded connection so that the latter remains &# 34 ; dry &# 34 ;. fig4 a and 4b show a fourth embodiment of the invention in which collar 2 is provided not extending outward but inward in the form of a &# 34 ; u &# 34 ;. once again , the collar has as a locking element an internal thread 21 for which a matching external thread 31 is provided on plug 3 . in addition , holes 22 are provided in collar 2 , said holes ensuring complete drainability of the container . the design shown in fig4 b differs from the design in fig4 a in that a flat contact surface 62 is provided on collar 2 . in the embodiments described above , threads are used exclusively as locking elements 21 on the collar at 2 and as locking matching elements 31 on plug 3 . of course , it is also possible instead of threads to use different locking connections , for example a bayonet connection mechanism . fig5 ( a to c ), 6 ( a to c ) and 7 ( a to c ) show three versions of a bayonet locking mechanism . in partial fig5 a to 7a , we have a top view of the hole area and in partial fig5 b to 7b and 5c to 7c cross sections at b - b and a - a in partial fig5 a to 7a . fig5 ( a to c ) shows a design for a bayonet locking mechanism with an externally gripping connection for plug 3 with collar 2 . both collar 2 and plug 3 have suitable locking elements 21 and 31 respectively , shown in the drawing . the arrangement of the sealing element , again in the form of an o - ring 6 , is selected so that it cannot be displaced by internal or external pressure . tabs 32 are provided on plug 3 to prevent it from being turned too far . the embodiment shown in fig6 ( a to c ) differs from the embodiment shown in fig5 ( a to c ) in that the connection of plug 3 to collar 2 is internal . the position of sealing element 6 once again is made such that it cannot be displaced by the contents . in the same manner as in the fifth embodiment , tabs 32 are provided to protect against overtightening . the embodiment shown in fig7 ( a to c ) differs from the embodiment shown in fig6 ( a to c ) and largely corresponds to the embodiment shown in fig5 ( a to c ) but it has a different design , especially in the vicinity of the seal . in any case , the pitch of the bayonet connection can be selected so that the desired pretensioning of the seal is achieved . it is particularly important in connection with the container according to the invention that no additional material is required to manufacture the bayonet flange of the plug connection , since the flange can be formed completely from container lid 1 . all of the embodiments described above have in common the fact that the so - called hole flange , in other words the collar 2 including locking elements 21 on the collar , are molded completely from the material of which container lid 1 is composed . the following embodiments are described in which although collar 2 is made from container lid 1 , additional stiffening and / or additional elements are mounted on the collar and / or the container lid which support the locking elements . fig8 ( a to c ) shows versions of an eighth embodiment in which a support ring 7 is mounted on container lid 1 , said ring supporting collar 2 externally and thus increasing protection against bursting . in the designs shown in fig8 ( a and b ), support ring 7 is &# 34 ; permanently crimped &# 34 ; on collar 2 , while in the example shown in fig8 c on the other hand , permanent attachment by welding is provided by spot welds 71 . otherwise , the versions shown differ in the design of the collar and the position and design of sealing element 6 and the sealing surfaces . reference is made here expressly to the drawings , wherein the support ring 7 has a lower edge attached to the base of the collar and an upper edge attached to the lip of the collar , as shown in fig8 ( b ) and 8 ( c ). fig9 ( a to c ) shows , in a representation similar to fig5 a to 7c , an embodiment with a bayonet connection and additionally a support ring 7 welded on by spot welds or a welded seam 71 , to increase protection against bursting . to avoid repetition , with respect to the other features in this embodiment , the reader is referred to the description for fig5 to 7 . fig1 a and 10b show designs for another embodiment of the invention in which a collar 2 is once again formed from the material of which container lid 1 is made , into which collar a ring 4 is inserted with an internal thread 21 , said ring being held in position by spot welds 41 at the circumference . the position of the seal is chosen so that it is independent of inserted ring 4 . in the design shown in fig1 b , the thread ( e . g . 3 / 4 inch or 2 inch ) and the position of seal 6 are chosen so that commercial plugs 3 may be used and the sealing function is independent of internally threaded ring 4 . fig1 a to 11c show designs for an embodiment with a &# 34 ; shortened &# 34 ; collar height . in the version shown in fig1 a , collar 2 is produced by simply crimping the material of container 1 outward , forming the sealing surface . an inwardly extending threaded ring 4 is fastened to the crimp by spot welds 41 on the circumference . the versions shown in fig1 b and 11c differ from the version shown in fig1 a in the shape of the crimp and hence the arrangement of the sealing surface and / or sealing element 6 . in addition , holes 22 are provided in welded ring 4 which permit complete emptying of the container . in addition , the internal thread on ring 4 is designed so that commercial plugs may be used . fig1 a to 12f show sealing possibilities in which collar 2 is produced simply by crimping outward . an internally threaded ring 4 is mounted on container lid 1 and fastened by spot welds 41 . sealing is accomplished independently of the threaded connection between plug 3 and ring 4 by a seal 6 between plug 3 and collar 2 created by crimping . in the version shown in fig1 a , internally threaded ring 4 is hollowed out at one end to produce the largest possible inside diameter . the version shown in fig1 b is similarly designed , but additionally has a bead on ring 4 which allows the use of resistance welding for fastening . the version shown in fig1 c has no hollowed - out area on ring 4 so that it is simpler to manufacture . the versions shown in fig1 d to 12f are similarly designed to the version shown in fig1 c and differ essentially only in the design of the bead and hence of seal 6 . the following discussion will refer to the embodiments in fig1 to 19 , which in particular have improved protection against bursting . fig1 shows an embodiment in which collar 2 is produced by deep drawing of an annular protuberance from the non - perforated container material 1 with a subsequent perforation and additional deep drawing . a 2 inch or 3 / 4 inch thread for example is pressed into the double wall thus produced . the design of the thread and the position of the sealing surface are selected so that ordinary plugs 3 may be used . reference number 22 again refers to corresponding holes in &# 34 ; double &# 34 ; collar 2 which permit complete emptying of the container . fig1 shows an embodiment similar to the embodiment shown in fig1 , in which improved protection against bursting is achieved by an additional annular projection 2 &# 39 ; in the form of a crimp or the like . fig1 shows an embodiment in which projection 2 which forms the collar is made so that it shields plug 3 if the container falls down . otherwise this embodiment is largely similar to the embodiments shown in fig1 and 15 . fig1 and 17 also show embodiments that resemble the embodiment in fig1 , in which , by an additional forming process , the annular projection is forced outward until the three walls are located side by side with no gaps between them . then the thread can be stamped in . the differences between fig1 and 17 lie in the sequence of the individual wall parts . fig1 and 19 show embodiments in which bayonet connections are additionally protected , in one case by a corresponding bead 2 &# 39 ; projecting beyond plug 3 and in the other case by an additional welded support ring 7 . following is a description of the invention with reference to fig2 ( a to d ), which shows a flange in a side view , a top view , another side view , and in perspective , the manufacture of a container with a plug . threaded segments 21 are used to fasten plug 3 . these threaded segments are produced by thread - shaped punches 10 which press collar wall 2 against a corresponding threaded mandrel 11 . while punch 10 forces parts of the collar wall into the threaded mandrel , the remaining areas of the flange are positively held by appropriately designed radial holddowns 12 . with the aid of an axial holddown 13 , lid 1 and collar 2 are positioned and held during the production of the threads ; then the threaded mandrel is withdrawn . thus , by providing recesses between the threaded segments , a provision is made such that the now - segmented threaded mandrel can be withdrawn axially by rotating it by a corresponding number of degrees . another improvement in manufacturing is achieved by providing axially movable slides in the recesses between the threaded segments . this has the advantage that when the thread is compressed by the thread punches into the segmented threaded mandrel , the walls of collar 2 which are not machined can be supported by the slides , and then the threaded mandrel as described above can be pulled out of the flange . sealing surface 61 is supported during manufacture by suitable supports so that it keeps its shape within admissible tolerances . to increase the protection of the flange against bursting and bending , integrated and / or additional shaping steps can be provided during manufacture by which for example additional stiffening beads can be produced . although the invention has been shown and described with respect to illustrative embodiments thereof , it should be understood by those skilled in the art that various changes , omissions and additions in the form and detail thereof may be made therein without departing from the spirit and scope of the invention .
| 1 |
the embodiments of the present invention provide a gas - path leakage seal structure for use in a turbine engine . fig1 illustrates first and second turbine engine components comprising first and second adjacent stationary vanes 10 and 12 . the first vane 10 comprises a first airfoil 10 a and a first platform 10 b . the second vane 12 comprises a second airfoil 12 a and a second platform 12 b . the vane airfoils 10 a and 12 a function to guide hot combustion gases to rotatable blades ( not shown ) coupled to a rotor to effect rotation of the rotor . as is apparent from fig1 and 2 , the first and second vane platforms 10 b and 12 b are positioned adjacent to one another . in accordance with a first embodiment of the present invention , a seal structure 20 is provided between the adjacent first and second vane platforms 10 b and 12 b to seal a gap g between the first and second platforms 10 b and 12 b , see fig1 - 4 . the first platform 10 a is provided with first and second circumferentially spaced apart slots 10 c and 10 d and the second platform 12 b is provided with third and fourth circumferentially spaced apart slots 12 c and 12 d . the second and third slots 10 d and 12 c are adjacent to one another and are open to the gap g , see fig1 and 2 . the seal structure 20 fits into the second and third slots 10 d and 12 c and spans across the gap g so as to seal the gap g to prevent the hot working gases moving past the vane airfoils 10 b and 12 b from passing through the gap g . the seal structure 20 also prevents cooling gases or air exposed to lower surfaces 100 a and 120 a of the platforms 10 b and 12 b from passing through gap g . it is also contemplated that the seal structure 20 may be used to seal gaps between other turbine engine components such as blades and ring segments ( not shown ). the first and second vanes 10 and 12 may be formed from a metal alloy via a casting operation . the first , second , third and fourth slots 10 c , 10 d , 12 c and 12 d in the vane platforms 10 b and 12 b may be formed via a conventional electro - discharge machining ( also referred to as electric discharge machining ) operation . the second slot 10 d is defined by first and second inner surfaces 100 c and 100 d in the first vane platform 10 a and the third slot 12 c is defined by third and fourth inner surfaces 120 c and 120 d in the second vane platform 12 b , see fig2 . the first , second , third and fourth inner surfaces 100 c , 100 d , 120 c and 120 d of the first and second vane platforms 10 b and 12 b , because they are formed via an electro - discharge machining operation , have irregular surfaces s i or non - smooth topologies , see fig3 , which is an enlarged schematic view of portions of the third and fourth surfaces 120 c and 120 d in the second vane platform 12 a . the inner surfaces 100 c , 100 d , 120 c and 120 d my have a surface roughness ra falling within a range of from about 0 . 8 micrometer to about 12 . 5 micrometers . in a first embodiment illustrated in fig2 - 4 , the seal structure 20 comprises a wear resistant layer 22 , a core layer 24 and a deformable layer 26 , wherein the core layer 24 is positioned between the wear resistant layer 22 and the deformable layer 26 . in the illustrated embodiment , the wear resistant layer 22 is positioned adjacent to the first and third surfaces 100 c and 120 c of the first and second vane platforms 10 b and 12 b . hence , the wear resistant layer 22 is exposed to cooling gases , which cooling gases also contact the lower surfaces 100 a and 120 a of the platforms 10 b and 12 b , as noted above . since the wear resistant layer 22 is preferably harder than the first and third surfaces 100 c and 120 c of the first and second vane platforms 1013 and 12 b , the wear resistant layer 22 will experience minimal wear during turbine engine operation . the wear resistant layer 22 may be formed via a conventional laser cladding operation from one of a metal powder , e . g ., nickel alloys , and a ceramic powder . such a laser cladding operation may involve injecting a metal or ceramic powder towards a laser beam , such that the laser beam melts the powder , which melted powder is then deposited onto a substrate , i . e ., the core layer 24 . preferably , the wear resistant layer 22 is slightly harder than the first and second vane platforms 10 b and 12 b . hardness of the wear resistant layer 22 can be defined by selecting a metal powder or ceramic powder having a desired hardness , which , preferably , exceeds that of the first and second vane platforms 10 b and 12 b . the core layer 24 may be formed from a metal such as a nickel or cobalt based alloy and functions to provide load carrying strength and / or provide a spring function to the seal structure 20 . in the illustrated embodiment , the deformable layer 26 is positioned adjacent to the second and fourth surfaces 100 d and 120 d of the first and second vane platforms 10 b and 12 b . hence , the deformable layer 26 is exposed to the hot working gases , which hot gases also contact the airfoils 10 a and 12 a , as noted above . the deformable layer 26 may also be formed via a conventional laser cladding operation from one of a metal powder , e . g ., nickel alloys , and a ceramic powder . preferably , the deformable layer 26 is softer , i . e ., less hard , than the first and second vane platforms 10 b and 12 b . softness / hardness of the deformable layer 26 can be selected based on the softness / hardness of the metal powder or ceramic powder used in forming the deformable layer 26 . softness / hardness can also be varied based on the density of the deformable layer 26 , which density can be varied with metal or ceramic powder feed rate as well as by selecting an appropriate laser power . for example , as laser power is decreased , the resulting layer may comprise less densely packed powder particles with more voids between the powder particles , thereby resulting in a less hard and / or more deformable layer 26 . softness / hardness can further be varied based on porosity of the deformable layer 26 , which porosity can be varied based on metal or ceramic powder particle size and / or laser power . for example , as laser power is decreased , the resulting layer may comprise less densely packed powder particles with more voids between the powder particles . preferably , the deformable layer 26 includes an outer surface 260 a , near the second and fourth surfaces 100 d and 120 d of the first and second vane platforms 10 b and 12 b , and an inner surface 260 b , adjacent the core layer 24 , see fig3 . the deformable layer 26 preferably comprises a density which increases gradually from the outer surface 260 a to the inner surface 260 b . alternatively , the deformable layer 26 may comprise a porosity which decreases gradually from the outer surface 260 a to the inner surface 260 b . fig3 schematically illustrates the seal structure 20 just after it is first inserted into the second and third slots 10 d and 12 c in the vane platforms 10 b and 12 b . during operation of the engine turbine , the cooling gases have a greater pressure than that of the hot working gases . hence , the cooling gases apply a force on the wear resistant layer 22 so as to force the deformable layer 26 against the second and fourth surfaces 100 d and 120 d of the first and second vane platforms 10 b and 12 b . hence , the deformable layer 26 may permanently deform , i . e ., powder or metal particles of the deformable layer 26 may break off from adjacent particles , such that the layer 26 corresponds in shape to the surface imperfections on the second and fourth surfaces 100 d and 120 d of the first and second vane platforms 10 b and 12 b . because the deformable layer 26 conforms to the irregular surfaces s i of the second and fourth surfaces 100 d and 120 d , an enhanced seal is made between the seal structure 20 and the second and fourth surfaces 100 d and 120 d of the first and second vane platforms 10 b and 12 b so as to limit or minimize leakage of hot working gases and / or cooling gases through the gap g . in a second embodiment illustrated in fig5 , the seal structure 20 ′ comprises a wear resistant layer 22 ′ and a deformable layer 26 ′. no metal core layer is provided in this embodiment . the wear resistant and deformable layers 22 ′ and 26 ′ may be formed in the same manner as the wear resistant and deformable layers 22 and 26 illustrated in fig3 and 4 . during operation of the engine turbine , the cooling gases apply a force on the wear resistant layer 22 ′ so as to force the deformable layer 26 ′ against the second and fourth surfaces 100 d and 120 d of the first and second vane platforms 10 b and 12 b . hence , the deformable layer 26 ′ may permanently deform , i . e ., powder or metal particles of the deformable layer 26 ′ may break off from adjacent particles , such that the layer 26 ′ corresponds in shape to the surface imperfections on the second and fourth surfaces 100 d and 120 d of the first and second vane platforms 10 b and 12 b . because the deformable layer 26 ′ conforms to the irregular surfaces s i of the second and fourth surfaces 100 d and 120 d , an enhanced seal is made between the seal structure 20 ′ and the second and fourth surfaces 100 d and 120 d of the first and second vane platforms 10 b and 12 b so as to limit or minimize leakage of hot working gases and / or cooling gases through the gap g . while particular embodiments of the present invention have been illustrated and described , it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention . it is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention .
| 5 |
although specific embodiments of the present invention will now be described with reference to the drawings , it should be understood that such embodiments are by way of example only and merely illustrative of but a small number of the many possible specific embodiments which can represent applications of the principles of the present invention . various changes and modifications obvious to one skilled in the art to which the present invention pertains are deemed to be within the spirit , scope and contemplation of the present invention as further defined in the appended claims . referring to fig2 - 5 , there is illustrated front elevational and rear elevational views of the wet floor caution sign in the closed condition and perspective views of the wet floor caution sign in the open condition , both looking from the exterior and from the interior . referring to fig2 and 3 , the wet floor caution sign 10 consists of a first panel 20 which has a pair of feet 21 and 22 which rest against the floor 50 a . the panel itself can have any design in addition to the design as illustrated . the panel can also have silkscreened thereon wording such as “ caution ” with a person in a triangle and the words “ wet floor ” beneath it . referring to fig3 , the wet floor caution sign has a second panel 30 larger than first panel 20 which has a pair of feet 31 and 32 which rest on floor 50 a . the second panel 30 also has a hand grip opening 40 by which the sign can be grasped by a hand and carried from one location to another . the two panels 20 and 30 are retained together at the upper location by a spring actuated mechanism 58 which will be discussed in detail below . referring to fig4 , the present invention wet floor caution sign 10 is shown in the open condition from the rear view . the two panels 20 and 30 are at approximately 90 degrees to each other and the feet rest against the floor 50 a so that the two panels are at a 90 degree angle separated by the interlocking mechanism which will be discussed below . referring to fig4 . there is shown the exterior view of the wet floor caution sign wherein the two panels are at 90 degrees to each other . advertising 20 aa and 30 aa can be placed on each of the exterior panels 20 a and 30 a in addition to the customary warning information . referring to fig5 , there is shown the interior view of the wet floor caution sign wherein again the two panels are at 90 degrees to each other . advertising 20 bb and 30 bb can be placed on each of the interior panels numbered 20 b and 30 b . also cautionary wording can be placed . the benefit of this invention is that rather than having two panels that are viewable from the outside , the sign has four panels , both the inside and the outside of each section 20 and 30 , wherein advertising and / or cautionary information can be placed . panel 20 has a distal side edge 23 and proximal side edge 24 . proximal side edge 24 contains a post 26 adjacent its lower end 28 . panel 30 has a distal side edge 33 and a proximal side edge 34 . proximal side edge 34 has collar 36 adjacent its lower end 38 . proximal side edges 26 and 36 are adjacent to each other . collar 36 rotatably fits over post 26 and provides the rotatable opening and closing means at the bottom for the sign 10 . it will be appreciated that other combinations of rotatable opening and closing means are within the spirit and scope of the present invention and the purpose of the rotatable opening and closing means adjacent the bottom of the sign 10 is to provide a balance at the bottom of the sign as the primary opening and closing means is the locking mechanism adjacent the top of the sign . the unique locking mechanism provides the rotatable opening closing means for the sign 10 . the primary opening and closing meas for the sign by which it is opened and closed is by an actuated pushbutton mechanism which is shown in fig6 a and 6b . the preferred embodiment operates in a unique manner , never before seen in the art . referring to fig7 , the present invention has two panels , a first panel 20 and a second panel 30 , however , unlike the prior art , the two panels are not hinged together at their tops , but instead , are rotatable affixed along one of their vertical sides . also unlike the prior art , these two panels are not free to flop open and closed , but instead have a locking mechanism 58 that controls the positions of the two panels relative to each other . the locking mechanism 58 has cylindrical housing 60 . at the top end of the cylindrical housing 60 is located a button 80 , and at the opposite end is a bottom collar 90 . the bottom collar 90 contains two notches 91 and 92 . the present invention also has an engagement bar 62 . the engagement bar 62 is preferably comprised of a single rod having four sections divided by generally right angles 62 a , 62 b , 62 c and 62 d such that there are two portions of the rod 62 a and 62 c that are horizontal and two portions of the rod 62 b and 62 d that are vertical . the first vertical portion 62 d resides within the cylindrical housing 60 and engages the button 80 . there are many methods by which the engagement bar may engage the button , and is shown preferably engaged by a spring mechanism 66 , the spring being attached to the underside of the button 80 on one end and to the first vertical portion 62 d of the engagement rod at its other end . the first vertical portion of the engagement rod 62 d is followed by a first horizontal portion of the engagement rod 62 a . the first horizontal portion of the engagement rod exits the cylindrical housing 60 at the bottom collar 90 and engages with the two notches 91 and 92 in the bottom collar 90 , one notch at a time . the first notch 91 is positioned such that when the first horizontal portion of the engagement bar 62 a is retained in the first notch 91 , the two panels of the present invention 20 and 30 are in a closed position . the second notch 92 is positioned approximately 90 - degrees clockwise from the first notch 91 , so that when the first horizontal portion of the engagement bar 62 a is retained in the second notch 92 , the two panels 20 and 30 of the present invention are in the open position . the locking mechanism 58 is affixed to the second panel 30 , thus , the first vertical portion of the engagement rod 62 d is joined to the second panel 30 by being within the cylindrical housing 60 of the locking mechanism 58 , the first horizontal portion 62 a goes between the second panel 30 and the first panel 20 , and the remaining portions of the engagement bar serve to connect to the first panel to the second panel by being retained in the retention means 27 on the first panel 20 . as the engagement rod moves from the first notch 91 to the second notch 92 , the first panel 20 moves correspondingly and respectively from a closed position to an open position . the first horizontal portion of the engagement bar 62 a moves from notch to notch and is retained therein as follows . starting with the preferred embodiment of the present invention in the closed position , the first horizontal portion of the engagement bar 62 a is retained in the first notch 91 and first panel 20 and second panel 30 are touching each other , in the closed position . the first vertical portion of the engagement bar 62 d is engaged by a tight spring 66 to the underside of the button 80 of the locking mechanism 58 . to open the present invention , the button 80 is depressed . depressing the button 80 , puts pressure on the spring 66 within the cylindrical housing 60 . although the spring 66 wants to deform , and does deform slightly , the spring 66 is tight enough to transfer the downward force from depressing the button 80 to the top of the vertical portion of the engagement bar 62 d . the engagement bar 62 , when experiencing the downward force from the spring 66 , may flex slightly , may flex the retention means 26 and 36 on the first panel 20 slightly , or both . there does not need to be a lot of movement , only enough downward movement on the first vertical portion of the engagement bar 62 d to result in the first horizontal portion of the engagement bar 62 a being pushed below the rim of the bottom collar 91 of the cylindrical housing 60 . once the first horizontal portion of the engagement bar 62 a is below the rim of the bottom collar 91 , the first panel 20 is free to be moved by hand or swung over to the second notch 92 . once the first horizontal portion of the engagement bar 62 a has been moved away from the first notch 91 , the user may release the button 80 at any time , thus when the first horizontal portion of the engagement bar 62 a reaches the second notch 92 , the first horizontal portion of the engagement bar 62 a is pulled up into the second notch 92 and is retained there . this is because the top of the first vertical portion of the engagement bar 62 d is no longer experiencing a downward force , and being attached to the spring 66 , which in turn is attached to the underside of the button 80 , is no longer displaced and therefore is forced by the spring 66 to return to its original vertical position , and the present invention is “ locked ” into an open position . the process to close the present invention is nearly identical , the difference being the moving of or the swinging of the first horizontal portion of the engagement bar 62 a from the second notch 92 back to the first notch 91 , whereupon the engagement bar is again pulled up into the first notch 91 and is releasably “ locked ” in that position . referring to fig8 - 11 , there is illustrated front elevational and rear elevational views of an alternative embodiment of the wet floor caution sign in the closed condition and perspective views of the wet floor caution sign in the open condition , both looking from the exterior and from the interior . referring to fig8 and 9 , the wet floor caution sign 110 consists of a first panel 120 which has a pair of feet 121 and 122 which rest against the floor 50 b . the panel itself can have any design in addition to the design as illustrated . the panel can also have silkscreened thereon wording such as “ caution ” with a person in a triangle and the words “ wet floor ” beneath it . referring to fig9 , the wet floor caution sign has a second panel 130 larger than first panel 120 which has a pair of feet 131 and 132 . the second panel 130 also has a hand grip opening 140 by which the sign can be grasped by a hand and carried from one location to another . panel 120 has a distal side edge 123 and a proximal side edge 124 . proximal side edge 124 contains a post 126 adjacent to its lower end 128 . panel 130 has a distal side edge 133 and a proximal side edge 134 . proximal side edge 134 has a collar 136 adjacent its lower end 138 . proximal side edges 126 and 136 are adjacent to each other . collar 136 rotatably fits over post 126 and provides a rotatable opening and closing means at the bottom for the sign 110 . it will be appreciated that other combinations of rotatable opening and closing means are within the spirit and scope of the present invention and the purpose of the rotatable opening and closing means adjacent the bottom of the sign is to provide a balance at the bottom of the sign . the primary opening and closing means is a locking mechanism adjacent the top of the sign . the two panels 120 and 130 are retained together at the upper location by a spring actuated mechanism 158 which will be discussed in detail below . referring to fig1 , the present invention wet floor caution sign 110 is shown in the open condition from the rear view . the two panels 120 and 130 are at approximately 90 degrees to each other and the feet rest against the floor so that the two panels are at a 90 degree angle separated by the interlocking mechanism which will be discussed below . referring to fig1 , there is shown the exterior view of the wet floor caution sign wherein the two panels are at 90 degrees to each other . advertising can be placed on each of the exterior panels 120 a and 130 a in addition to the customary warning information . referring to fig1 , there is shown the interior view of the wet floor caution sign wherein again the two panels are at 90 degrees to each other . advertising can be placed on each of the interior panels numbered 120 b and 130 b . also cautionary wording can be placed . the benefit of this invention is that rather than having two panels that are viewable from the outside , the sign has four panels , both the inside and the outside of each section 120 and 130 , wherein advertising and / or cautionary information can be placed the sign is opened and closed by an actuated pushbutton mechanism which is shown in fig1 a and 12b . the second embodiment works in a very similar manner . the second embodiment has two panels , a first panel 120 and a second panel 130 that are rotatably attached along one of their vertical sides . the lower rotatable mechanism with the post and collar is the same as the first mechanism . the second embodiment has a locking mechanism 158 that controls the positions of the two panels relative to each other . the locking mechanism 158 has two housings , an upper housing 160 affixed to the second panel 130 and a lower housing 170 affixed to the first panel 120 . at the top end of the upper housing 160 is located a button 180 , and at the opposite end is a bottom collar 190 . the bottom collar 190 contains two notches 191 and 192 . the second housing 170 abuts the side of the first panel 120 and has a small nipple 194 residing on its upper surface , near the perimeter thereof , and is located and sized to fit within the notches 191 and 192 on the bottom collar 190 of the first housing . residing within both the first housing and the second housing is an engagement rod , 160 r having a first end 160 a and a second end 160 b . the first end 160 a of the engagement rod 160 r resides within the first housing 160 and is attached by spring 166 to the underside of the button 180 . the second end 160 b of the engagement rod 160 r resides within the second housing 170 and is preferably non - rotationally fixed therein . in other words , the engagement rod 160 r is affixed to the second housing 160 b in such a manner that it can freely rotate within the first housing 160 and does not freely rotate within the second housing 170 , and as the engagement rod moves , so does the first panel 120 , without affecting movement on the second panel 130 . with regard to the two notches 191 and 192 of the second embodiment , the first notch 191 is positioned such that when the nipple 194 on the second housing 170 is retained in the first notch 192 , the two panels 120 and 130 of the present invention are in a closed position . the second notch 191 is positioned approximately 90 - degrees clockwise from the first notch 192 , so that when the nipple 194 on the second housing 170 is retained in the second notch 191 , the two panels 120 and 130 of the present invention are in the open position . the second embodiment 110 opens and closes in the following manner . starting with the second embodiment 110 of the present invention in the closed position , the nipple 194 on the second housing is retained in the first notch 192 , and first panel 120 and second panel 130 are touching each other , in the closed position . the first end of the engagement bar 160 a is engaged by a tight spring 166 to the underside of the button 180 of the locking mechanism 158 . to open the present invention , the button 180 is depressed . depressing the button 180 puts pressure on the spring 166 within the first housing 160 . although the spring 166 wants to deform , and does deform slightly , the spring 166 is tight enough to transfer the downward force from depressing the button 180 to the top of the first end 160 a of the engagement bar 160 r . the engagement rod 160 b , when experiencing the downward force from the spring 166 , moves correspondingly downwards , and the first panel 120 may flex slightly , the hinges on the side may flex slightly , or both . there does not need to be a lot of movement , only enough downward movement on the first end 160 a of the engagement rod 160 r to result in the first panel 120 being pushed downwardly so that the nipple 194 disengages the first notch 192 and is pushed below the rim of the bottom collar 190 of the first housing 160 . once nipple 194 is below the rim of the bottom collar 190 , the first panel 120 is free to be moved by hand or swung over to the second notch 192 . once the nipple 194 has been moved away from the first notch 192 , the user may release the button 180 at any time , thus when the nipple 194 reaches the second notch 191 , the nipple 194 is pulled up into the second notch 192 and is retained there . this is because the top of the first vertical portion of the engagement rod 160 a is no longer experiencing a downward force , and being attached to the spring 166 , which in turn is attached to the underside of the button 180 , is no longer displaced and therefore is forced by the spring 166 to return to its original vertical position , and the present invention is “ locked ” into an open position . the process to close the present invention is nearly identical , the difference being the moving of or the swinging of the nipple 194 from the second notch 191 back to the first notch 192 , whereupon the engagement rod 160 r is again pulled up into the first notch 192 and the nipple 194 is releasably “ locked ” in that position . the present invention wet floor caution sign is a significant improvement over the prior art in that it provides for a much more stable structure where the two panels are intersecting 90 degrees to each other and the sign has four sides on which advertising or cautionary information can be displayed . in addition , the sign is much easier to carry in that there is a handle member molded into one of the two sections so that when the wet floor caution sign is folded flat as illustrated in fig2 and 3 , the sign can be carried by hand and when it is desired to have the sign in the open and activated condition , the pushbutton 80 is pushed down to overcome the force of the spring force 72 so that the interlocking mechanism 90 can be activated and retain the two panels 20 and 30 at 90 degrees to each other with their respective feet 21 , 22 , 31 and 32 resting against the floor where there is a wet location . of course the present invention is not intended to be restricted to any particular form or arrangement , or any specific embodiment , or any specific use , disclosed herein , since the same may be modified in various particulars or relations without departing from the spirit or scope of the claimed invention hereinabove shown and described of which the apparatus or method shown is intended only for illustration and disclosure of an operative embodiment and not to show all of the various forms or modifications in which this invention might be embodied or operated .
| 6 |
some embodiments of the present invention will now be described in detail with reference to the accompanying drawings . [ 0061 ] fig4 exemplifies the construction of a bit line potential overdrive circuit of a dram according to a first embodiment of the present invention . the bit line potential overdrive circuit according to the first embodiment of the present invention , which is shown in fig4 is featured in that the circuit comprises a vblh power supply line 1 . to be more specific , in the conventional bit line potential overdrive circuit , the power supply of the bit line overdrive potential vint and the power supply of the bit line final potential vblh are connected to the pcs node . in the first embodiment of the present invention , however , a vblh potential generation circuit 2 for allowing the power supply of vint to generate a potential of vblh , a transistor q 10 for supplying the overdrive potential vint to the bit line bln , and the charge adjusting capacitance c are connected to the vblh power supply line 1 , and the vblh power supply line 1 is connected to the pcs node 3 . in the prior art , the bit line overdrive potential serves to overdrive directly the bit line . in the first embodiment of the present invention , however , the bit line overdrive potential vint serves to charge ( pre - charge ) the total capacitance of the vblh line 1 including the charge adjusting capacitance c to a potential in the vicinity of the final potential vblh ( vblh & lt ; vint ). the potential of the bit line bln is finally imparted by the vblh potential generation circuit 2 and is held . to be more specific , as shown in fig4 the charge adjusting capacitance 10 , the p - channel transistor q 10 serving to connect the power supply of the bit line overdrive potential vint to the vblh power supply line 1 upon receipt of the control signal / pset 1 , and a vblh potential generation circuit 2 generating the bit line final potential vblh by using the power supply of the potential vint are connected to the vblh power supply line 1 . also , the p - channel transistor q 8 serving to transfer the potential of the vblh power supply line 1 to the pcs node 3 upon receipt of the control signal / pset 2 is connected to the vblh power supply line 1 . the construction of the other portion is equal to that shown in fig2 and , thus , the same constituents are denoted by the same reference numerals so as to avoid an overlapping description . the operation of the bit line potential overdrive circuit of the dram according to the first embodiment of the present invention will now be described in detail with reference to the timing wave form diagram shown in fig5 . as described previously , the bit line potential overdrive circuit according to the first embodiment of the present invention widely differs from the conventional bit line potential overdrive circuit in the circuit operation in respect of the method of using the vblh power supply . the operation of the bit line overdrive circuit will now be described with reference to fig5 . ( 1 ) while the word line wln is set at “ l ” and the cell capacitor cc is separated from the bit line bln , / pset 1 is set at “ l ” and the transistor q 10 is turned on so as to connect the power supply of the potential vint to the vblh power supply line 1 . also , / pset 2 is set at “ h ” and the transistor q 8 is turned off so as to separate the pcs node 3 from the vblh power supply line 1 . in this fashion , the potential of the vblh power supply line is charged ( pre - charged ) to the potential vint ( vint & gt ; vblh ). it should be noted that , since the / pset 2 is set at “ h ”, the transistor q 8 is turned off , the nset is set at “ l ”, and the transistor q 7 is turned off in this case , the sense amplifier is in the stand - by state and , thus , the potential of each of pcs and ncs is set at vblh / 2 . ( 2 ) the word line wln is set at “ h ” so as to connect the cell capacitor cc to the bit line bln through the cell transistor qc . the charge of the cell capacitor cc is read out to the bit line bln . then , the / pset 1 is set at “ h ” and the transistor q 10 is turned off so as to separate the power supply of the bit line overdrive potential vint from the vblh power supply line 1 . incidentally , since the states that the / pset 2 is set at “ h ” and that the nset is set at “ l ” are left unchanged , the stand - by state of the sense amplifier is maintained . ( 3 ) if the nset is set at “ h ” under the states that the / pset 1 is set at “ h ” and that the / pset 2 is set at “ h ”, the transistor q 7 is turned on so as to activate the n - channel side of the sense amplifier and , thus , to lower the potential of the complementary bit line / bln to vss . then , if the / pset 2 is set at “ l ” so as to turn on the transistor q 8 , the vblh power supply line 1 charged to the bit line overdrive potential vint and the bit line bln are connected to each other so as to activate the p - channel side of the sense amplifier and , thus , the potential of the bit line bln is rapidly elevated as shown in the upper stage of fig5 . also , since the charge stored in the vblh power supply line 1 is released , the potential of the vblh power supply line 1 is lowered from vint to vblh as shown in the lower stage of fig5 . as described above , the charge of the cell capacitor cc is read out to the bit line bln . also , the charge of the vblh power supply line charged to the bit line overdrive potential vint is transmitted through the route of the activated sense amplifier , the bit line bln ( or complementary bit line / bln ), the transfer transistor qc , and the cell capacitor cc via the transistor q 8 , with the result that the cell capacitor cc is restored in the bit line final potential vblh . the value of the bit line final potential vblh , which is determined by the operation that the charge of the vblh power supply line 1 charged to the bit line overdrive potential vint is discharged through the route noted above , is determined by the charge share based on the total of the capacitance of the vblh power supply line 1 , the parasitic capacitance of the vblh potential generation circuit 2 and the charge adjusting capacitance c connected to the vblh power supply line 1 , the capacitance of the bit line bln and the capacitance of the memory cell . it follows that , if the balance of these capacitance values is optimized , it is possible to charge the bit line and the memory cell to vblh without operating the vblh potential generation circuit 2 . however , because of the nonuniformity of the manufacturing process , it is practically difficult to make the bit line final potential exactly equal to vblh . therefore , in the first embodiment of the present invention , prepared is the vblh potential generation circuit 2 so as to make the bit line final potential exactly equal to vblh . according to the overdrive circuit of the semiconductor memory device according to the first embodiment of the present invention , it is possible to use one system of substantially vblh alone as the power supply for imparting the overdrive potential to the bit line , making it possible to decrease the chip size , compared with the conventional semiconductor memory device . also , it is unnecessary to switch the supply path of the bit line charge potential during activation of the sense amplifier , which is required in the prior art , and it suffices to redistribute the charge pre - charged to the vblh power supply line to the bit line capacitor and the cell capacitor . as a result , the generation of the power supply noise can be markedly suppressed . a second embodiment of the present invention will now be described with reference to fig6 . the second embodiment is directed to the circuit for adjusting the value of the charge adjusting capacitance c added to the vblh power supply line described previously in conjunction with the first embodiment . if the final potential of the bit line is made as close to vblh as possible in the bit line potential overdrive circuit described previously in conjunction with the first embodiment , it is possible to suppress the power consumption of the vblh potential generation circuit . also , it is possible to eliminate the vblh potential generation circuit , if the final potential of the bit line is allowed to coincide with vblh with a high accuracy . such being the situation , it is desirable to adjust the value of the charge adjusting capacitance c added to the vblh power supply line as precisely as possible . the construction of the adjusting circuit of the charge adjusting capacitance c according to the second embodiment of the present invention is shown in fig6 . as shown in the drawing , the adjusting circuit of the charge adjusting capacitance c comprises a vblh power supply line 1 , a transfer gate 9 consisting of a pair of a p - channel transistor and an n - channel transistor , inverters inv 0 to invn , and miniature capacitors c 0 to cn for adjusting the charge . the other terminals of the miniature capacitors c 0 to cn are connected to the ground or vss . the charge adjusting capacitance c is the sum of the capacitance values of c 0 to cn . if any of the trim signals tr 0 to trn supplied to the inverters inv 0 to invn is set at “ h ”, the corresponding miniature capacitor is connected to the vblh power supply line 1 via the transfer gate 9 . on the other hand , if any of the trim signals tr 0 to trn supplied to the inverters inv 0 to invn is set at “ l ”, the corresponding miniature capacitor is separated from the vblh power supply line 1 . the trim signals tr 0 to trn are prepared as a part of the signals included in the test program of the function test conducted after the manufacture of the semiconductor memory device . in the function test , the combination of “ h ” and “ l ” of the trim signals tr 0 to trn optimizing the operation of the semiconductor memory device is determined and coded . the trim signals tr 0 to trn thus coded are written in , for example , a fuse rom ( read only memory ) integrated in the semiconductor memory device . when the semiconductor memory device is operated , the coded trim signals are read out so as to optimize the value of the charge adjusting capacitance c . a third embodiment of the present invention will now be described with reference to fig7 . in the third embodiment , it will be described that it is possible for the timing of the operation to separate the vblh power supply line 1 from the power supply of the bit line overdrive potential vint with the control signal / pset 1 set at “ h ” and the transistor q 10 turned off to be different from that in the first embodiment . in the bit line potential overdrive circuit described previously in conjunction with the first embodiment , the operation to set the control signal / pset 1 at “ h ” was performed in the time region ( 2 ), as shown in fig5 . to be more specific , after the charge of the cell capacitor cc is read out to the bit line bln with the word line wln se at “ h ”, the power supply of the bit line overdrive potential vint was separated from the vblh power supply line 1 with the / pset 1 set at “ h ” and the transistor q 10 turned off . in the third embodiment of the present invention , however , the operation to set the control signal / pset 1 at “ h ” is performed within the time region ( 3 ), as shown in fig7 . in the third embodiment of the present invention , after the p - channel side of the sense amplifier is activated within the time region ( 3 ) with the / pset 2 set at “ l ” and the transistor q 8 turned on , the vblh power supply line 1 is separated from the power supply of the bit line overdrive potential vint with the / pset 1 set at “ h ” and the transistor q 10 turned off . in other words , even after the vblh power supply line 1 is connected to the pcs node with the / pset 2 set at “ l ” and the transistor q 8 turned on , the current continues to be supplied from the power supply of the bit line overdrive potential vint via the transistor q 10 , and the vblh power supply line 1 is separated from the bit line overdrive potential vint with the / pset 1 set at “ h ” and the transistor q 10 turned off before the bit line bln reaches the bit line final potential vblh so as to supply the charge stored in the vblh power supply line 1 including the charge adjusting capacitance c to the pcs node . the particular construction of the third embodiment permits flexibly coping with various cases in the design of the bit line overdrive circuit including the case where the time for charging the vblh power supply line 1 to the bit line overdrive potential vint is insufficient in view of the requirement for the improved operation speed , the case where it is impossible to increase sufficiently the value of the charge adjusting capacitance c because of the limitation in the layout , and the case where it is desirable to conduct the operation to set the control signal / pset 1 at “ h ” after activation of the sense amplifier depending on the characteristics of the power supply of vint . a fourth embodiment of the present invention will now be described with reference to fig8 . the fourth embodiment covers the case where the bit line overdrive circuit of the present invention is applied to the dram of a multi - bank structure . a four bank structure is employed in , for example , a dram product of 256 megabits . in this case , a high speed interleave writing / reading is performed by using a bank select signal . [ 0091 ] fig8 shows as an example the arrangement of the bit line overdrive circuit of the present invention in the multi - bank dram of the four bank structure . in this multi - bank dram , a memory cell array 10 of the multi - bank structure consisting of banks 1 to 4 having vblh power supply lines of vblh 1 to vblh 4 is formed on a semiconductor chip 20 . in the dram of the multi - bank structure , the word line is selected for each bank and , thus , the vblh power supply lines described previously in conjunction with the first to third embodiments of the present invention are arranged separately from each other for each bank . on the other hand , in the conventional bit line potential overdrive circuit , it is necessary to arrange power supplies of two systems for vint and vblh for each sense amplifier region arranged by further dividing each bank . it is also necessary to arrange large size transistors of two system for controlling the power supplies of the two systems . in other words , the conventional bit line potential overdrive circuit requires a complex wiring , with the result that the chip size is increased . in the bit line overdrive circuit of the present invention , however , it suffices to arrange the vblh power supply line forming the main constituent of the circuit for each bank . also , concerning the power supply system , it suffices to arrange only the power supply for the bit line overdrive potential vblh . it follows that it is possible to markedly decrease the number of large size transistors and the wiring amount . incidentally , the arrows shown in fig8 denote the draw in of the wirings from the vblh power supply line 1 arranged for each bank to the sense amplifier region divided in the bank . to be more specific , in the bit line overdrive circuit of the present invention , it suffices to form collectively the vblh potential generation circuit , the large size transistor q 8 , q 10 and the charge adjusting capacitance , which generate a problem in terms of the layout , in the arranging region of the vblh power supply line 1 and to simply draw the wiring in the sense amplifier region divided in each bank . the present invention is not limited to the embodiments described above . for example , in each of the embodiments described above , the transistors q 8 and q 10 for transmitting the bit line overdrive potential were formed of p - channel transistors . however , it is also possible for these transistors q 8 and q 10 to be formed of n - channel transistors . further , various other modifications are available within the technical scope of the present invention . as described above , the present invention provides a semiconductor memory device equipped with a bit line overdrive circuit , particularly , the present invention provides a multi - bank semiconductor memory device . according to the semiconductor memory device of the present invention , it suffices to arrange a bit line potential overdrive circuit consisting of a power supply of a single system and a large size transistor of a single system for each bank , making it possible to decrease the chip size of the semiconductor memory device . it should also be noted that it suffices to use a power supply system of a single system for the overdriving of the bit line potential . since it is unnecessary to switch the power supply system as in the prior art for preventing an excessive overdriving of the bit line potential , the power supply noise can be eliminated . what should also be noted is that , since the bit line potential overdrive circuit of the present invention is arranged for each bank , the memory core portion of the semiconductor memory device is not affected in terms of the layout . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents .
| 6 |
[ 0020 ] fig1 shows part of a relay box 1 having a carrier plate 2 . the relay box 1 serves to connect electrical conductors to a relay 4 . the relay box 1 houses a carrier for the relay signal conductors and control conductors which are to be switched . a relay box housing has the carrier plate 2 positioned on an upper side and connected to a side wall 3 . further side walls and housing parts of the relay box are not explicitly illustrated . the carrier plate 2 has plug openings 6 , 7 , 8 for receiving plug contacts of a relay 4 . in each of the plug openings 6 , 7 , 8 there is arranged an electrical receptacle contact 59 which is in turn connected to electrical conductors . on the left side of the carrier plate are illustrated three relays 4 , plugged into three corresponding plug openings 6 , 7 , 8 . the plug openings 6 , 7 , 8 are preferably arranged perpendicular to the edge of the carrier plate 2 which is joined to the side wall 3 . in the embodiment described , each relay 4 has four contact pins 58 ( fig1 ). three of these contact pins 58 are plugged into the plug openings 6 , 7 , 8 and hence into the associated receptacle contacts . three plug openings 6 , 7 , 8 are arranged on the carrier plate 2 to receive three respective contact pins 58 of the relay 4 . while the fourth plug opening 9 is located in a plug - in module 5 for receiving a fourth contact pin 58 of the relay 4 . the plug - in module 5 is detachably mounted to the relay box 1 . the three plug openings 6 , 7 , 8 are arranged near the side wall 3 . the side wall 3 has a mount 12 in the form of a first and a second retaining member 14 , 15 . the first and second retaining members 14 , 15 are each constructed in the form of an elongate angled holding strip . the first and the second retaining members 14 , 15 are angled with respect to each other and project from the side wall 3 at a predetermined spacing , so that two opposing holding edges 48 are formed . the retaining member 15 has a latching cutout 49 for receiving a latching lug on the plug - in module 5 . between the first and the second retaining members 14 , 15 the side wall 3 has a cutout 11 which is arranged parallel to and between the first and second retaining members 14 , 15 . both the cutout 11 and the first and second retaining members 14 , 15 are freely accessible from the upper side , so that a plug - in module 5 can be pushed into either the cutout 11 or the mount 12 . provided next to one another on the carrier plate 2 are mounts 12 which are arranged next to one another for receiving a plurality of relays 4 . because of the advantageous arrangement of the plug contacts in the region of the edge where the carrier plate 2 meets the side wall 3 , a compact arrangement of the relays 4 with the plug - in modules 5 is possible . a relay 4 has all four contact pins 58 ( fig1 ) on an underside and , when a relay 4 is plugged in , these are arranged in the direction of the carrier plate 2 . however , at least one contact pin 58 is arranged next to the carrier plate 2 and is plugged into a fourth plug opening 9 in a plug - in module 5 . the plug - in module 5 has a rear side which is secured in the mount 12 . provided on an upper side of the plug - in module 5 is a fuse mount 50 which serves to hold a fuse 16 . the fuse mount 50 is freely accessible from above the fourth plug opening 9 located between the fuse mount 50 and the rear side of the plug - in module 5 . the fourth plug opening 9 is preferably arranged with the longitudinal side parallel to the rear side of the plug - in module 5 . similarly , the fuse mount 50 is preferably arranged on the upper side , parallel to the side edge of the rear side of the plug - in module 5 . because of the preferred arrangement of the fuse mount 50 and the fourth plug opening 9 , a compact structure of the plug - in module 5 is possible with a small surface area on the upper side . furthermore , the arrangement of the fuse mount 50 on the upper side of the plug - in module 5 offers the advantage that it is easily discernible which fuse 16 belongs with which relay 4 . opposite the upper side , on an underside of the plug - in module 5 , a conductor 10 is connected to the plug - in module 5 . preferably , the longitudinal side of the fourth plug opening 9 is not arranged parallel to the longitudinal sides of the first , second and third plug openings 6 , 7 , 8 , to prevent incorrect insertion of the relay 4 . it goes without saying that the contact pins associated with the plug openings 6 , 7 , 8 , 9 are also arranged in the corresponding orientation . in the embodiment described , the second and third plug openings 7 , 8 are used to connect control conductors to the relay 4 . the first plug opening 6 and the fourth plug opening 9 are used as terminals for a signal conductor to be switched . the relay 4 serves as a switch which closes or opens the conductor to be switched ( completes or opens the circuit ) by way of the first and fourth plug openings 6 , 9 , in dependence on the control signals . [ 0026 ] fig2 shows a view from above of the carrier plate 2 . a first and a second retaining member 21 , 22 of the fuse mount 50 are arranged opposite one another at a predetermined spacing . the retaining members 21 , 22 have on the mutually facing sides latching hooks which hold a fuse 16 firmly after it has been pushed into the fuse mount 50 from above . between the retaining members 21 , 22 are a fifth and a sixth plug opening 19 , 20 which are arranged with their longitudinal sides corresponding to the longitudinal side of the fuse mount 50 . the fifth and sixth plug openings 19 , 20 serve to receive a first and a second fuse contact 17 , 18 of a fuse 16 . a fuse 16 is pushed from above , with the first and second fuse contacts 17 , 18 forward , into the fuse mount 50 and the correspondingly associated fifth and sixth plug openings 19 , 20 . in so doing , the fuse 16 is pushed in far enough for the fuse 16 to be held firmly in a seated position by the first and second retaining members 21 , 22 . furthermore , the shape , angled in cross - section , of the first and second retaining members 14 , 15 and the central adjustment of the cutout 11 between the first and second retaining members 14 , 15 are clearly visible . the relays 4 have two diametrically arranged spacers 51 on two opposing side faces . the arrangement of the spacers 51 is selected to ensure correct insertion of the relay 4 into the plug openings of the carrier plate 2 and into the plug opening of the plug - in module 5 . in fig2 a plug opening arrangement 52 used for plugging in a single relay 4 is encircled by a dashed line . for each relay 4 , a corresponding plug opening arrangement 52 is provided , with the plug opening arrangements 52 being arranged next to one another near an edge of the carrier plate 2 . [ 0030 ] fig3 shows a perspective view of the rear side of the plug - in module 5 . here , the shape of the first and second retaining members 21 , 22 can clearly be seen . each retaining member 21 , 22 has at the upper end a latching hook 56 for receiving a fuse 16 . the two retaining members 21 , 22 are surrounded by a protective frame 23 . the protective frame 23 has raised protective elements 54 in the region of the first and second retaining members 21 , 22 which are extended beyond the retaining members 21 , 22 . between the retaining members 21 , 22 , the protective frame 23 has connection web 53 . the preferred embodiment of the protective frame 23 makes it possible to mount and remove the fuse 16 simply and yet ensures that the retaining members 21 , 22 are screened , so that inadvertently detaching the fuse 16 or damaging the retaining members 21 , 22 is prevented . two mutually parallel rails 25 are constructed on the rear side of the plug - in module 5 near the fourth plug opening 9 . the rails 25 run substantially parallel to a longitudinal axis of the plug - in module 5 . the rails 25 serve to guide and orient the plug - in module 5 in the cutout 11 . the position of the rails 25 when a plug - in module 5 is pushed in can clearly be seen in fig2 . furthermore , the plug - in module 5 has first and a second rails 26 , 27 located on the side edges of the rear side facing opposite one another . when the plug - in module 5 is pushed into the mount 12 , the first and second rails 26 , 27 are pushed into the region delimited by the first and second angled retaining members 14 , 15 . the lateral spacing between the first and second holding rails 26 , 27 are matched to the spacing between the first and second retaining members 14 , 15 . in the upper region , the first and second holding rails 26 , 27 have a stop wall 30 which lies on the upper side of the first and second retaining members 14 . the position of the stop wall 30 establishes the vertical position of a plug - in module 5 when plugged into the carrier plate 2 . furthermore , a latching lug 24 which latches into the latching cutout 49 ( fig1 ) is constructed in the top right - hand region of the rear side of the plug - in module 5 . the plug - in module 5 is detached by urging a flexible tab 55 on which the latching lug 24 is formed away from the latching cutout 49 . the flexible tab 55 is connected to the housing of the plug - in module 5 by connection webs 57 . [ 0033 ] fig4 shows a view of the underside of the plug - in module 5 , with a first and a second holding cutout 28 , 29 formed by the first and second holding rails 26 , 27 being clearly visible . when the plug - in module 5 is fixed to the carrier plate 2 , the angled longitudinal edges of the first and second retaining members 14 , 15 are pushed into the first and second holding cutouts 28 , 29 respectively . furthermore , a cable opening 38 for receiving a plug connector 37 is provided on the underside of the plug - in module 5 . an electrical conductor 10 is connected to the plug connector 37 . furthermore , a first and a second clamp opening 31 , 32 are provided on the underside for receiving a bridge clamp 33 . the bridge clamp 33 has a first and a second clamping arm 34 , 36 , being electrically connected to one another by a rear connection plate 35 . the first and second clamp limbs 34 , 36 and the connection plate 35 are made from an electrically conductive material . the housing of the plug - in module 5 and the relay box 1 are made from an electrically insulating material . the first and second clamp limbs 34 , 36 each have two opposing double clamps . a latching lug 39 projects from a short transverse side of the connection plate 35 . when the bridge clamp 33 is pushed into the first and second clamp openings 31 , 32 , the latching lug 39 engages in a latching cutout 40 on the inside of the housing . in this way , the bridge clamp 33 is securing latched . corresponding fixing means are also constructed on the plug connector 37 and the inner wall of the cable opening 38 in order to connect the plug connector 37 firmly to the plug - in module 5 . [ 0034 ] fig5 shows the plug - in module 5 with the bridge clamp 33 plugged in and the plugged - in plug connector 37 with the electrical conductor 10 . [ 0035 ] fig6 shows the upper side of the plug - in module 5 in an enlarged illustration . the first clamping arm 34 of the bridge clamp 33 is illustrated diagrammatically in the fourth plug opening 9 . a contact pin of the relay 4 , which is plugged into the fourth plug opening 9 , is received by the first clamping arm 34 to form an electrical connection . furthermore , the second clamping arm 36 can be seen diagrammatically in the sixth plug opening 20 . if a fuse with a second fuse contact 18 is pushed into the fuse mount 50 , then the second fuse contact 18 is grasped by the second clamping arm 36 to form an electrical contact between the bridge clamp 33 and the second fuse contact 18 . furthermore , the plug connector 37 can be seen in the fifth plug opening 19 . when a fuse 16 is plugged in , the plug connector 37 receives the first fuse contact 17 and makes an electrical connection between the conductor 10 and the first fuse contact 17 . in fig7 the electrical contact is clearly shown between the electrical conductor 10 , with a conductor 46 , and a first contact 44 . the first contact 44 is arranged in the plug connector 37 . above the first contact 44 in the housing of the plug - in module 5 , the fifth plug opening 19 is illustrated the first contact 44 comprises two contact arms which are pre - tensioned toward each other and form a funnel - like receiving region corresponding with the fifth plug opening 19 . in fig8 the arrangement of the first and second contact arms 34 , 36 of the bridge clamp 33 can clearly be seen . the first contact arm 34 is associated with the fourth plug opening 9 and the second contact arm 36 is associated with the fifth plug opening 20 . in fig1 , once again a cross - section through the fifth and sixth plug openings 19 , 20 is illustrated . here , it can be seen that the first contact 44 is composed of two opposing spring arms . when a plug - in module 5 is plugged onto the carrier plate 2 and a relay is plugged into both the carrier plate 2 and the plug - in module 5 , the conductor 10 to be switched is connected through the fifth plug opening 19 , the fuse 16 , the sixth plug opening 20 , the bridge clamp 33 and the fourth plug opening 9 to a contact pin of the relay 4 . the relay 4 preferably has as the input to the conductor to be switched by a plug contact which is associated with the second plug opening 7 . the first and third plug openings 6 , 8 are used to feed control signals and preferably a control voltage to the relay . [ 0040 ] fig1 shows a relay 4 from the underside , with four contact pins 58 which project downwards out of the relay 4 . an advantage of the invention consists in setting at least one electrical terminal of a relay outside a carrier plate . the missing electrical terminal is constructed on a plug - in module 5 which is detachably connected to the carrier plate 2 .
| 7 |
an exemplary embodiment of the invention is a system for retrieving and reordering control data encoded in the horizontal overscan area of a video signal . because the control data is concatenated with the video signal on a line - by - line basis , the control data is temporarily synchronized with the underlying video signal . this allows the controlled devices , such as wireless mechanical characters , to behave as characters in a scene defined by the programming information of the video signal . the protocol for the encoded control data is addressable , forwardly compatible , error tolerant , and feasible to deploy in connection with a system that is primarily intended to be a children &# 39 ; s entertainment product . an analog video signal is typically divided into two fields , each of which contains a plurality of lines . these lines are analogous to a single row of luminescence displayed on a television . thus , the typical television display may be thought of as a series of lines , broken up into two fields . the two fields are interlaced , such that every other line belongs to the same field . a portion of each field falls within a horizontal overscan region . this region is the portion of a display device &# 39 ; s screen which cannot be visibly perceived . for example , on a television the first several lines of each field are hidden from the user ; they cannot be seen in any manner . control data for controlled devices are concatenated with the lines making up the horizontal overscan region . encoded control data must be retrieved by a controlled device in the same order in which the data is transmitted , or the data is worthless . for example , if two lines of the underlying video signal are swapped in transmission , the control data may become meaningless , insofar as the first portion of a data string may be received after the second portion of the same string . the present invention may be deployed in a wireless communication environment that includes a controller ( also referred to as a master device ) that communicates with and controls one or more controlled devices ( also referred to as slave devices ) on a single radio - frequency ( rf ) communication channel . a specific embodiment of the invention is known as the “ realmation ” system . “ realmation ,” derived from combining the words “ realistic ” and “ animation ,” is descriptive of a technology developed by microsoft corporation of redmond washington . a controller in a typical “ realmation ” system includes a computer system with a display device and a wireless modem that communicates with and controls one or more controlled devices , such as animated mechanical characters . the controller drives a display device to depict programming information , such as scenes of an audio / video presentation , while simultaneously transmitting control data , including voice coefficients and motion vectors , to one or more mechanical characters . the mechanical characters , in response to receiving the control data , move and talk as characters in the scenes depicted on the display device . the “ realmation ” product line includes two main components : a controller ( i . e ., master device ) known as the “ realmation controller ,” and one or more controlled devices ( i . e ., slave devices ) known as “ realmation performers .” a controlled device may be specially designed for a specific industrial , educational , research , entertainment , or other purpose . for example , a controlled device such as the “ barney ” dinosaur character is specially designed for a learning and entertainment system for small children . each controlled device includes an rf receiver system for receiving , demodulating , and decoding signals transmitted by the controller . the signals transmitted by the controller contain control data , such as speech coefficients and motion vectors . this control data is transmitted in a specific order to the controlled device , to elicit specific actions on the part of the controlled device . the control data causes the controlled device to behave as a character in a scene depicted on a display device driven by the controller , presuming the control data is correctly ordered upon receipt by the controlled device . in a duplex environment , each controlled device may also include an rf transmitter system for encoding , modulating , and transmitting response signals back to the controller . these response signals may include test or receptor data defining status information concerning the controlled device . for example , a controlled device may include pressure or light sensitive receptors for receiving user input , such as squeezing or covering a part of the character . this is particularly useful in an interactive learning environment in which a child interacts with the controlled device . for example , the controller may direct a “ barney ” controlled device to say , “ please squeeze my left hand .” the controlled device may then transmit the child &# 39 ; s response back to the controller , which responds accordingly . for example , if the child squeezes the controlled device &# 39 ; s right hand , the controller may direct the controlled device to say , “ no , that &# 39 ; s my right hand , please squeeze my left hand .” the controller includes a data source that receives or generates video data and related control data so that one or more controlled devices may behave as characters in a scene depicted on a display device . to do so , the control system includes a wireless modem ( or wireless modulator for a simplex environment ), known as the “ realmation link master ,” and a display device , such as a television or a computer monitor . the data source may be an active device , such as computer system or an interactive television system , that generates the video data and related control data in real - time . alternatively , the data source may be a passive device , such as a cable system , vcr , or television broadcast signal , that feeds a previously - created data stream including video data and encoded control data to the wireless modem . in this case , the wireless modem extracts the control data from the data stream , feeds the video data to the display device , and broadcasts the control data to one or more controlled devices . the wireless modem or modulator further contains a control data retrieval system for detecting and properly ordering encoded control data . this eliminates both field swapping and vertical shifting , described with respect to fig3 . in addition , the controller may be an intelligent system that is operative to generate , select , and combine video and control data from a number of sources in response to user input or other control signals . regardless of the configuration , some type of data source provides a data stream including video and related control data , and the wireless modem extracts the control data from the video data , detects the presence of an intelligent signal detect word ( isdw ), orders the control data according to the transmission order as exemplified by the isdw , routes the video data to the display device , and broadcasts the control data to one or more controlled devices . to broadcast control data , the wireless modem encodes the control data into a special differential - pulse data modulation ( ddm ) format and transmits the ddm - encoded control data to the controlled devices . in addition , the wireless modem may receive ddm - encoded response signals from the controlled devices and decode the response signals . the “ realmation ” product line may operate in a simplex environment or in a duplex environment , although the exemplary embodiment is described in the context of a simplex environment . the operation of exemplary embodiments of the controller , the wireless modulator ( or modem ), and the controlled devices in these environments will be described in the context of programs running on microprocessor - based computer systems . those skilled in the art will recognize that implementations of the present invention may include various types of program modules , use various programming languages , and be operable with various types of computing equipment . additionally , although the descriptions of exemplary embodiments describe the controller as communicating with a controlled device over an re communication channel , those skilled in the art will appreciate that substitutions to the rf communication channel can include other communication mediums such as fiber optic links , copper wires , infrared signals , etc . referring now to the drawings , in which like numerals represent like elements throughout the several figures , aspects of the present invention and exemplary operating environments will be described . reference is made to fig1 - 3 below to provide a description of suitable environments in which the invention may be implemented . reference is then made to fig4 - 9 to describe the preferred wireless communication protocol for controllers and controlled devices in these environments . fig1 illustrates an exemplary simplex environment for embodiments of the present invention . this simplex environment may be operated as a learning and entertainment system for a child . the simplex environment includes a controller 11 that controls a controlled device 60 . the controller 11 includes an audio / video signal source 56 , a wireless modulator 90 , an antenna 98 , and a display device 35 including a speaker 59 . the controller 11 transmits control data to the controlled device 60 via an antenna 98 and an rf communication channel 15 . to accomplish this task , the wireless modulator 90 interfaces with the audio / video signal source 56 and the display device 35 through a standard video interface . over this standard video interface , the wireless modulator 90 receives a video signal encoded with control data ( encoded video ) from the audio / video signal source 56 . the wireless modulator 90 extracts the control data from the encoded video signal , and then transfers the control data to a controlled device 60 through the rf communication channel 15 . in addition , the wireless modulator 90 passes the video signal to the display device 35 . the audio / video signal source 56 also interfaces with the speaker 59 in the display device 35 over this interface , the audio / video signal source 56 provides audio for an audio / visual presentation . thus , a child can observe the audio / visual presentation on the display device 35 and the speaker 59 while the wireless modulator 90 transmits control data to one or more controlled devices 60 . the reception of the control data causes the controlled device 60 to move and talk as though it is a character in the audio / visual presentation . as mentioned above , the movement and speech of the controlled 30 device 60 is dependent on the controlled device receiving control data in the order in which the control data was transmitted . the control data module 101 monitors each line of the horizontal overscan portion of the video signal for the presence of an isdw . each line containing encoded data also contains an isdw . in the exemplary embodiment , the isdw pattern ( discussed further with respect to fig7 and 8 ) repeats every six lines . further , in the exemplary embodiment the first line of the video signal containing encoded control data is line 23 of field 1 . by knowing the isdw pattern corresponding to line 23 of field 1 , the control data module 101 may scan each line within the horizontal overscan region in turn in order to detect the first line containing encoded data . in the event that the first line containing encoded data is not located at line 23 of field 1 , the control data module may further reorder the fields or lines based on the proper isdw pattern . this process is more fully discussed with respect to fig9 . there is no need to modify the encoded video signal before passing it to the display device 35 . typically , the controller 11 receives the encoded video signal , which is a standard video signal that has been modified to include digital information in the horizontal overscan intervals of the scan lines , which are invisible to the display device 35 . thus , the display device 35 can receive and display the encoded video signal without modification . the controller 11 only needs to extract the control data from the encoded video signal and generate the rf - modulated control signals for transmission to the controlled device 60 . fig2 is a block diagram illustrating a system for creating , transmitting , receiving and properly ordering an encoded video data stream including video data and encoded control data , embodied as an “ encoder ” 22 . the encoder 22 may be comprised of discrete hardware or software elements , or may represent a single physical unit . a variety of sources , including but not limited to , a video cassette recorder or player , a cable reception box , a tv tuner , a laser disc player , or a computer with a video output , may provide the encoded video . in fig2 the computer system 20 interfaces with a video data encoder 76 and an audio / video signal source 56 . the audio / video signal source 56 provides two output signals : video and audio . these output signals may include live camera feeds , prerecorded playbacks , broadcast reception , etc . the computer system 20 controls the operation of the audio / video source 56 via a control signal . the control signal gates the output of the video and audio signals from the audio / video signal source 56 . the computer system 20 also provides the control data , which is encoded onto the video signal . the computer system 20 transfers the control data and gates the video signal to the video data encoder 76 . the video data encoder combines the video signal and the control data by encoding the control data onto the video signal ( i . e ., generating an encoded video data stream ). this encoding technique includes modulating the luminance of the horizontal overscan area of the video signal on a line - by - line basis . for example , the overscan area of each scan line may be modulated to represent a single control data bit . furthermore , the field boundaries of the video signal provide a framing structure for the control data , in which each field contains a fixed number of data words . more specifically , each field of the video signal contains a intelligent signal detect word ( isdw ) consisting of four bits . the value of the intelligent signal detect word in each contiguous field cyclically , sequences through a defined set of values . the presence of the isdw distinguishes an encoded video signal from a normal video signal . in a normal video signal , random noise appears in place of the intelligent signal detect word . a decoder attempting to recover control data from an encoded video signal therefore determines whether the signal is an encoded video signal by detecting the presence of the isdw . thus , the intelligent signal detect word provides an additional layer of integrity to the recovered control data beyond that of simple checksum error detection . still with respect to fig2 the wireless modulator 90 receives the encoded video signal from the audio / video signal source 56 and recovers the control data from the encoded video signal . the wireless modulator 90 then transmits the control data to one or more controlled device , represented by the controlled device 60 shown in fig4 . alternatively , video broadcast equipment 79 may receive the encoded video signal along with the audio signal and then broadcast the signals to one or more remotely located wireless modulators and / or wireless modems . in another alternative , video storage equipment 78 may receive the encoded video signal along with the audio signal and then store the signals in a storage medium for future retrieval . fig3 displays an exemplary environment for transmitting an encoded video signal . the encoder 22 converts an audio / video signal ( hereinafter , the “ video signal ”) into a digital format , and concatenates the video signal with encoded control data . this process was discussed with respect to fig2 . the encoder then passes the encoded signal to a transmitter 31 in a completely digital format . the transmitter 31 relays the signal from the broadcast location to receiver 33 , located at a receiving location . oftentimes , a satellite 32 serves as a relay , receiving data from the transmitter 31 and broadcasting the encoded digital video signal to the receiver 33 . the receiver in turn passes the encoded digital video signal to a decoder 34 , typically located at the receiving location . alternate embodiments may place the decoder at any point between the receiver 33 and display device 35 , such as at the end user &# 39 ; s premises . once the video signal is decoded , the decoder 35 transmits the analog video signal , with encoded control data , to the user &# 39 ; s display device 35 . at any point along the transmission route outlined in fig3 two errors may occur , either of which renders the encoded control data useless . first , lines within a single field may be shifted either up or down from their intended location . this causes the picture displayed by the display device 35 to begin on an incorrect scan line . this phenomenon is referred to as “ vertical shifting .” the second possible problem is known as “ field swapping .” when field swapping occurs , field one and field two of the video signal are reversed , such that all even lines are displayed as odd lines , and vice versa . while neither of these has marked effects on the quality of a transmitted video signal , either or both may destroy the integrity of the concatenated control data . fig4 is a functional block diagram of a control data retrieval system 100 , embodied in a wireless modulator 90 , operative to receive and reorder control data encoded in a video signal . each of the components of the wireless modulator 90 may be implemented as a hardware or software module , or as a combination of both . the modulator 90 receives an encoded video signal 104 provided by a video data encoder 76 . the video data encoder generates the encoded video signal by concatenating control data with a video signal 102 generated by an audio / video signal source 56 . the audio / video signal source 56 may be any of a variety of conventional video sources , such as a video camera , a broadcast or cable television signal , a video tape player , the internet transmitting a video signal , a computer generating a video signal , and so forth . the video signal 102 may be any type of video signal that includes a plurality of fields that each include a plurality of scan lines . for example , the video signal 102 may be a standard 525 - line , two - field interlaced ntsc television signal that includes 30 frames per second , each frame including two fields of 262 . 5 interlaced lines , as is well known to those skilled in the art . in an exemplary embodiment , the control data module 101 is responsible for not only receiving the encoded video signal 104 , but also for determining whether the encoded control data has been received in the same order in which the video data encoder 76 encoded the control data on the video signal . further , the control data module 101 reorders the lines and fields comprising the encoded video signal 104 as necessary to reconstruct the transmission order intended by the video data encoder . the control data module 101 comprises two components , a video data detector 91 and a data error processor 99 . the video data detector 91 receives the encoded video signal 104 , which may be a remote device that receives the encoded video signal 104 by way of a broadcast - level transmission . alternatively , video data detector 91 may be a local device , for example in an intercom application . the encoded data does not interfere with the transmission of the underlying video signal 102 . thus , the encoded video signal 104 may be transmitted using any type of video transmission media , such as a broadcast - level cable television signal , a video tape player , the internet transmitting a video signal , a computer generating a video signal , and so forth . in addition , because the encoded data is located in the pre - visible or post - visible portions of the video signal 102 , the encoded data does not visibly interfere with the operation of typical televisions or monitors . therefore , the encoded video signal 104 may be passed directly from the video data detector 91 to the display device 35 , which displays the underlying video signal 102 undisturbed by the encoded data . the video data detector 91 detects the presence of the encoded data in the encoded video signal 104 by detecting the presence of an intelligent signal detection word ( isdw ), as described with reference to fig7 and 8 . preferably , a single isdw is transmitted in the same location of each field of the encoded video signal 104 , such as lines 23 - 29 in field - 1 and 286 - 292 in field - 2 , of a standard interlaced 525 - line ntsc television signal . a consecutive series of the isdws defines a dynamic validation sequence in which each isdw varies in at least two bits from the immediately preceding signal detection word . for example , the dynamic validation sequence may be the binary representation of 8 , 1 , 10 , 3 , 12 , 5 , 14 , 7 . the video data detector 91 reads the data , if any , in the specified lines , corrects the data for correctable errors that may have occurred in the isdw bits , and detects the presence of the isdw . if the video data detector detects the presence of the isdw , then the detector determines whether the isdw is the first in the dynamic validation sequence . if not , then the video data detector 91 enters a fast acquisition mode , wherein the detector scans all lines of field one as quickly as possible to find the first isdw in the dynamic validation sequence . if the first isdw is found , then the video data detector shifts whichever line upon which the first isdw is present to the first line of the horizontal overscan portion of the video signal . in an exemplary embodiment , the video detector sets the line equal to line 23 of field one . this eliminates any vertical shifting that may have occurred during transmission . if the video data detector 91 does not detect the first isdw of the dynamic validation sequence on any line in field one , then the detector performs the same search on all lines within field two . if the first isdw of the dynamic validation sequence is detected on any line in field two , then the fields are swapped and the line containing the first isdw moved to the position equating to that of the first line of the horizontal overscan region . thus , the video data detector 91 may counteract signal errors caused by field swapping as well as vertical shifting . in each field , the isdw is typically followed by a number of content words . if the video data detector 91 detects the presence of the isdw in the encoded video signal 104 , it extracts the content words from the encoded video signal and assembles the content words into a serial data communication signal 106 . the video data detector 91 then transmits the serial data communication signal 106 to a data error processor 99 . the data error processor 99 strips out the error correction bits , corrects any correctable errors in the content bits , and assembles the corrected content words into a 9 - bit error corrected data stream . this 9 - bit error corrected data stream is transmitted to a protocol handler 93 , which includes a number of data handlers that detect and route device - specific control data to associated controlled devices 60 as described above . the addressing protocol for the content data is described with reference to u . s . application ser . no . 08 / 795 , 710 entitled “ protocol for a wireless control system ” filed on feb . 4 , 1997 , which is assigned to a common assignee and incorporated herein by reference . although the various components and modules have been described separately , one skilled in the art should recognize that the components and modules could be combined in various ways and that new program components and modules could be created to accomplish similar results . fig5 and 6 show the location of the encoded data in the context of a single scan line of the encoded video signal 104 . fig5 is a wave form diagram illustrating a data bit value “ one ” 128 encoded in the horizontal overscan portion of a scan line of the encoded video signal 104 . the scan line represents one line of one field displayed on the display device 35 . the vertical axis represents the magnitude of the signal wave form 120 in units of ire and the horizontal axis represents time in micro - seconds , as is familiar to those skilled in the art . although fig5 and 6 are not drawn precisely to scale , important reference points are marked in the units of their corresponding axis . the wave form 120 for the scan line begins with a horizontal synchronization pulse 122 down to − 40 ire , which is a timing signal that indicates the beginning of the scan line ( i . e ., time = 0 ) when the leading edge of the pulse passes through − 20 ire to establish the horizontal reference point “ h - ref .” the horizontal synchronization pulse 122 is followed by a sinusoidal color burst 124 ( the approximate envelope is shown ), which is used as a calibration signal for the display device 35 . the color burst 124 is followed by a wave form representing the visible raster 126 ( the approximate envelope is shown ), which creates and typically overlaps slightly the visible image on the display device 35 . the wave form 120 includes a pre - visible horizontal overscan area 127 , approximately from 9 . 2 micro - seconds to 10 . 2 micro - seconds after h - ref , that occurs after the color burst 124 and before the visible raster 126 . the video data encoder 76 locates a pre - visible ( i . e ., before the visible raster 126 ) data bit “ one ” 128 by driving the wave form 120 to a predetermined high value , such as 80 ire , in the interval from 9 . 2 micro - seconds to 10 . 2 micro - seconds after h - ref . because the pulse denoting the data bit “ one ” 128 occurs after the calibration interval of the color burst 124 and before the visible raster 126 , it does not interfere with the operation of the display device 35 or appear on the image displayed . fig6 is a wave form diagram illustrating a data bit value “ zero ” 128 ′ encoded in the horizontal overscan portion of a scan line of the encoded video signal 104 . the video data encoder 76 locates the pre - visible data bit “ zero ” 128 ′ by driving the wave form 120 to a predetermined low value , such as 7 . 5 ire , in the interval from 9 . 2 micro - seconds to 10 . 2 micro - seconds after h - ref . as noted above , each 16 - bit content word includes nine data bits , and each field includes 13 content words . thus , encoding one bit per scan line produces a bandwidth for the data encoded in a typical 59 . 94 hertz ntsc video signal of 7 , 013 baud . this bandwidth is sufficient to provide the controlled device 60 with sufficient data to control several wireless controlled devices 60 in the manner described above . see also , the related patent application , u . s . application ser . no . 08 / 795 , 710 entitled “ protocol for a wireless control system ” filed on feb . 4 , 1997 , which is assigned to a common assignee and incorporated herein by reference . the 7 , 013 baud one - bit - per - scan - line bandwidth of the encoded data is also sufficient to control several other wireless controlled devices 60 to provide additional services , such as advertising , subscription , and emergency warning information for transmission to the display device 35 or other possible display elements . for example , these services might include e - mail , foreign language subtitling , intercom capability , telephone pages , weather warnings , configuration data for a set - top box , and so forth . at present , the 7 , 013 baud one - bit - per - scan - line bandwidth is preferred because it provides sufficient bandwidth for the “ realmation ” system and minimizes the cost of the system components , in particular the video data encoder 76 and the video data detector 91 . the bandwidth may be increased , however , by locating a second pulse in the post - visual horizontal overscan area 130 , which occurs after the visible raster 126 and before the horizontal blanking interval 132 ( during which the electron gun in the crt of the display device 35 sweeps back from the end of the just completed scan line to the beginning of the next scan line ). and the bandwidth may be further increased by enabling each pulse 128 , 130 to represent more that just two ( 1 , 0 ) states . for example , for 3 states ( c . f ., the 1 . 0 , 1 . 5 , 2 . 0 ddm pulse widths ), an analog of the “ realmation ” ddm protocol could be used . for 4 states , the pulse could represent 2 bits ( e . g ., 100 - 80 ire = 1 , 1 ; 70 - 50 ire = 1 , 0 ; 40 - 20 ire = 0 , 0 ; 10 to − 40 ire = 0 , 1 ). for 8 states , the pulse could represent 3 bits ; for 16 states , the pulse could represent 4 bits , and so forth . for example , if the system 100 were to employ data pulses in both the pre - visual horizontal overscan area 127 and the post - visual horizontal overscan area 130 , each data pulse having 16 states , each scan line would be able to transmit eight bits . this would increase the bandwidth from 7 , 013 baud to 56 , 104 baud , which might be worth the increased cost for the video data encoder 76 and the video data detector 91 for future applications . fig7 and 8 show the location of encoded data in the context of a standard ntsc video frame . fig7 is a diagram illustrating the location of data bits in a portion of a standard 525 - line two - field interlaced ntsc video signal . each field of the video data includes a vertical blanking interval 140 ( during which the electron gun in the crt of the display device 35 sweeps back and up from the end of the just completed field to the beginning of the next field ) followed by an active video interval 142 , which includes a number of left - to - right scan lines that sequentially paint the display device 35 from the top to the bottom of the screen . at the end of the vertical blanking interval 140 , the last two pulses are typically reserved for closed caption data 146 and vertical blanking data 148 , which may be already dedicated to other purposes . in addition , the bottom of each field is typically corrupted by head switching noise present in the output of helical - scan video tape players of consumer formats such as vhs and 8 mm . therefore , the horizontal overscan portion of individual scan lines provides the preferred location for encoded data bits 128 , 128 ′ of the encoded video signal 104 . fig8 is a diagram illustrating the location of data bits in the two interlaced fields of the standard ntsc video frame . that is , fig7 shows the location of the encoded data in the context of a complete ntsc 525 - line two - field interlaced video frame . the frame of video data includes lines 1 - 262 in field - 1 152 interlaced with lines 263 - 525 in field - 2 154 . field - 1 152 includes a vertical blanking interval 140 a and an active video interval 142 a . the vertical blanking interval 140 a includes lines 1 - 22 and concludes with line 21 , which may include closed caption data 146 a , and line 22 , which may include vertical blanking data 148 a . an isdw 156 a is encoded in lines 23 - 29 and content data 158 a is encoded in lines 30 - 237 . field - 2 154 includes a vertical blanking interval 140 b and a active video interval 142 b . the vertical blanking interval 140 b includes lines 263 - 284 and concludes with line 283 , which may include closed caption data 146 b , and line 284 , which may include vertical blanking data 148 b . an isdw 156 b is encoded in lines 286 - 292 and content data 158 b is encoded in lines 293 - 500 . each isdw preferably includes a plurality of data bits and a plurality of error correction bits defining a correction sequence that allows a single - bit error in the data bits to be detected and corrected . for example , the isdw may include a seven - bit hamming code ( i . e ., four data bits and three error correction bits ) in the format shown below in table 1 . each content word preferably includes a plurality of data bits 164 and a plurality of error correction bits 166 defining a correction sequence that allows a single - bit error in the data bits to be detected and corrected . for example , the content word may include a seven - bit hamming code ( i . e ., four data bits and three error correction bits ) and a nine - bit . hamming code ( i . e ., five data bits and four error correction bits ) in the format shown below in table 3 . fig9 displays a flowchart displaying the steps executed when retrieving scrambled encoded data from a horizontal overscan portion of a video signal . the flowchart begins in start state 900 . from start state 900 , step 905 is accessed . in step 905 , the control data retrieval system 10 begins the decoding procedure on the line n of field one . when step 905 is initially entered , n is the first line of a field which may contain an isdw . in the exemplary embodiment , this is line 23 , although alternate embodiments may set n equal to another line . from step 905 , step 910 is accessed . in step 910 , the control data retrieval system 10 enters a fast acquisition mode . the system operates in one of two distinct acquisition modes , fast and slow . fast mode is initiated when the control data retrieval system 10 has not detected the isdw for a fixed period of time , and seeks to reacquire the isdw quickly . once the isdw is again located , the system enters slow mode , wherein the isdw polling frequency is dramatically decreased . following step 910 , the control data retrieval system 10 enters step 915 . in step 915 , the system checks whether the isdw decode sequence has been executed . the isdw decode sequence is executed if the control data retrieval system 10 detects the intelligent signal detect word . in the event that the system has not detected the isdw , then step 917 is entered . in step 917 , the control data retrieval system 10 sets the decode line to n + 1 , incrementing the line being searched by 1 . thus , if the isdw decode sequence is not detected in step 915 , the system prepares in step 917 to search the next line in sequence . following step 917 , the control data retrieval system 10 returns to step 910 . if the control data retrieval system 10 detects in step 915 that the isdw decode sequence was executed , then step 920 is entered . the control data retrieval system 10 checks whether the isdw is valid in step 920 . that is , the system determines whether the configuration of the detected isdw matches the data string comprising the first isdw in the series . if so , then step 925 is accessed . otherwise , the control data retrieval system 10 enters step 930 . in step 925 , the control data retrieval system 10 sets the search time to slow , thus entering slow acquisition mode as discussed with respect to step 910 . from step 925 , step 927 is accessed . in step 927 , the current line ( that is , the line in which the isdw beginning the isdw sequence is found ) is set as line n of field one . all subsequent lines are shifted accordingly . thus , if the 29 th line of field one contains the proper isdw , that line is shifted up in the exemplary embodiment to line 23 , as are all subsequent lines . similarly , if line 31 of field two contains the initial isdw , then not only is that line shifted to line 23 , but the fields are swapped as well . this ensures that no matter where the initial isdw is found , that line is always set as the first line of field one containing encoded data . in this manner , both vertical shifting and field swapping may be alleviated and the encoded data signal properly reconstructed . in step 930 , the control data retrieval system 10 determines whether the search timer has expired . the search timer measures the length of time elapsed since the control data retrieval system 10 last detected the isdw . the length of time necessary for the search timer to expire is variable . alternate embodiments may permit the time necessary for the search timer to expire to be set according to a user &# 39 ; s desires . the expiration time is preferably longer than several minutes , in order to ensure that momentary service interruptions or commercial breaks in a program do not trigger search timer expiration . if the search time has expired , then the control data retrieval system 10 returns to step 910 , with results as detailed above . in the event that the search timer has not expired , the control data retrieval system 10 enters step 935 . in step 935 , the system determines whether all field lines have been searched . if the control data retrieval system 10 has already searched all lines in the current field , then the system accesses step 945 . otherwise , step 940 is entered and the control data retrieval system 10 sets the decode start line to line n + 1 . this increments the decode line by one , thus ensuring that the next pass through the search algorithm looks for the presence of the isdw on the following line . after step 940 , the control data retrieval system 10 returns to step 910 and the isdw detection process begins again . in step 945 , the control data retrieval system 10 determines whether both field one and field two have been completely searched for the presence of the first isdw in the decode sequence . if so , then step 947 is entered . if not , then step 950 is accessed . in step 947 , the control data retrieval system 10 must begin searching for the initial isdw from line n of field one , insofar as the proper isdw was not detected in any line of either field . thus , the control data retrieval system 10 sets the decode start line to line 1 of field one in step 947 . following this step , the system enters step 910 . in step 950 , the control data retrieval system 10 sets the decode start line to line n of field two . once the system executes step 950 , step 910 is entered . note that the algorithm shown in fig9 contains no end state . rather , the algorithm is a closed repeating loop , constantly scanning for the presence of the first isdw of an isdw series . those skilled in the art will understand that the specific protocol illustrated in tables 1 - 4 are just one example of many specific protocols that could be used to implement an addressing scheme using short addresses and long address in accordance with the present invention . in addition , the location of the data within the encoded video signal 104 may be varied somewhat without unduly affecting the performance of the system 100 . in particular , microsoft corporation has been granted permission by the federal communications commission to encode digital data in lines 23 - 257 in field - 1 and lines 285 - 519 in field - 2 of a standard 525 line ntsc television broadcast signal . as shown in fig7 and tables 1 - 4 above , the preferred protocol only utilizes lines 23 - 237 in field - 1 and lines 286 - 500 in field - 2 . this enhances compatibility of the encoded video signal 104 with mpeg - based video compression algorithms , which typically exclude line 285 and include a compressed representation of only 480 visible scan lines . the invention thus provides a method and system for encoding control data for wireless controlled devices in connection with a video signal so that the actions of the controlled devices operate in synchronism with the programming information defined by the video signal . additional data may be transmitted encoded into the video signal for providing additional services , such as e - mail , foreign language subtitling , intercom capability , telephone pages , weather warnings , configuration data for a set - top box , and so forth . the protocol for the encoded data is addressable , forwardly compatible , error tolerant , and feasible to deploy in connection with a system that is primarily intended to be a children &# 39 ; s entertainment product . it should be understood that the foregoing relates only to specific embodiments of the invention , and that numerous changes may be made therein without departing from the spirit and scope of the invention as defined by the following claims .
| 7 |
certain exemplary embodiments will now be described to provide an overall understanding of the principles of the structure , function , and use of the systems and devices disclosed herein . one or more examples of these embodiments are illustrated in the accompanying drawings , which are not necessarily to scale . those skilled in the art will appreciate that the systems and devices specifically described herein and illustrated in the accompanying drawings are non - limiting exemplary embodiments and that the scope of the present invention is defined solely by the claims . the features illustrated or described in connection with one exemplary embodiment may be combined with the features of other embodiments . such modifications and variations are intended to be included within the scope of the present invention . methods , systems , and apparatus for hair treatment are provided herein which include applying treatment radiation to a skin treatment area and / or to one or more hairs so as to modify the structure ( e . g ., the mechanical structure and / or the chemical structure and / or the geometrical structure of at least a portion of the hair ( s )). the applied radiation can modify at least a portion of the hair ( e . g ., the hair tip ) to make the hair less capable of re - entering the skin . in various aspects , the methods , systems , and apparatus disclosed herein can treat and / or prevent ( pfb ) in the treatment area . in some aspects , one or more blades can be combined with a radiation source and / or an optical system to modify the mechanical properties of a portion of the hair such as the tip ( e . g ., to reduce the stiffness of the hair tip and / or make the hair tip blunter ). by way of example , a razor ( e . g ., an electric razor ) can be combined with and / or integrated with a system for light - based hair treatment to modify the hair structure to lessen and / or eliminate the incidence of extra - follicular penetration and / or trans - follicular penetration associated with pfb . with reference now to fig1 a - 1c , an exemplary device 100 in accordance with various aspects of the present teachings is depicted in which a blade 120 of a razor ( e . g ., an electric razor ) is integrated with a source of optical treatment radiation 110 . the treatment radiation is optical radiation ( e . g ., emr ) having wavelength ( s ) in the range of about 200 to about 12 , 000 nm , about 300 to about 1500 nm , and , about 350 to about 450 nm . the source of the optical radiation can be , for example , a laser , an led , or a lamp . the blade 120 can be substantially parallel with the source of optical treatment radiation 110 . referring to fig1 a , the device 100 can contact the surface of skin 40 in a region of hair growth . the device 100 is moved , while in contact with the surface of the skin 40 , in the direction 60 such that the blade 120 of the razor cuts the hair 50 . in some embodiments , the hair 50 is cut at a height that is level with the surface of the skin 40 . in some embodiments , the hair 50 is cut at a height that is lower than the level with the surface of the skin 40 . in other embodiments , the hair 50 is cut at a height that is higher than the level of the surface of the skin 40 . after it is cut , the hair 50 has a newly cut tip 55 . referring now to fig1 b and 1c , after the hair 50 is cut and while the device 100 continues to move in the direction 60 in some embodiments , the source of optical treatment radiation 110 contacts tip 55 of the hair 50 that sticks out of the follicle after being cut by the blade 120 . suitable sources of optical treatment radiation 110 may be , for example , a diode laser , a led , and / or a lamp with or without a waveguide . the source of optical treatment radiation 110 provides optical radiation with sufficient energy density and power density to induce desired physical , chemical , and / or geometrical changes in the areas of the hair where the said radiation is absorbed through a photo thermal mechanism . the source of optical treatment radiation 110 is employed to modify the mechanical properties of the newly cut hair tip 55 ( e . g ., to soften and / or lessen the stiffness of the hair tip 55 ). the source of optical treatment radiation 110 may include an optical element that is being coupled from the source of energy to the hair tip 55 . for example , the source of optical energy may be a diode laser coupled to a waveguide . for example , the optical treatment radiation is coupled to the hair tip 55 through direct contact between the source of optical treatment radiation 110 and the newly cut hair tip 55 . the source of optical treatment radiation 110 may be provided to the hair tip 55 , through , for example , a mechanism of disturbed total internal reflection ( dtir ) resulting in the absorption of the optical radiation in hair in the area of direct contact with a waveguide ( e . g ., a sapphire waveguide ). optionally , reflective coupling may be provided through the blade 120 of the razor . fig2 shows an exemplary device 200 for dtir delivery having a frame that includes a blade 220 of a razor such as a hand - held razor ( e . g ., a manual razor or electric razor ) that is integrated with a source of optical treatment radiation 210 and an optical element such as a waveguide 213 . in one embodiment of the device 200 the blade 220 is substantially parallel with the source of optical treatment radiation 210 and / or the waveguide 213 . the device 200 contacts the surface of skin 40 in a region of hair growth . the device 200 is moved , while in contact with the surface of the skin 40 , in the direction 60 such that the blade 220 of the razor cuts the hair 50 . in some embodiments , the hair 50 is cut at a height that is level with the surface of the skin 40 . in other embodiments , the hair 50 is cut at a height that is lower than the level of the skin 40 . in other embodiments , the hair 50 is cut at a height that is higher than the level of the surface of the skin 40 . after the blade 220 cuts the hair 50 to form the newly cut tip 55 , the optical radiation source 210 together with the waveguide 213 provide optical treatment radiation to modify ( e . g ., soften ) the newly cut tip 55 ( here , the tip is cut at a height that is higher than the level of the skin 40 ). the source of optical treatment radiation 210 provides optical radiation with sufficient energy density and power density to induce desired physical , chemical , and / or geometrical changes in the areas of the hair where the said radiation is absorbed through a photo thermal mechanism . in some embodiments , the source of optical treatment radiation 210 together with the waveguide 213 provide treatment radiation to the cut tip 55 of the hair 50 when the device 200 is turned “ on .” alternatively , safety features may be built into the device 200 to ensure that the device 200 is in contact with the skin 40 surface . for example , in some embodiments , suitable contact sensors including , for example , a mechanical contact sensor , a light - gate sensor , an electrical ( capacitive or impedance ) sensor , or an optical sensor such as an image ( camera ) sensor are coupled to the device 200 to determine if the device 200 is in contact with the skin 40 . other suitable contact sensors are disclosed in u . s . pat . no . 7 , 204 , 832 , which is incorporated herein by reference in its entirety . a controller may be coupled to the device 200 and in response to the contact sensor the controller is configured to permit application of the treatment radiation from the source of optical treatment radiation 210 through the waveguide 213 when the contact sensor detects contact between the device 200 and skin 40 . optionally , referring still to fig2 , the device 200 , light source 210 , and waveguide 213 work in concert to permit application of the treatment radiation from the source 210 only when the waveguide 213 is in physical contact with a hair 50 . for example , the waveguide 213 may have a contact sensor that detects resistance when the waveguide 213 is pushed against the hair 50 ( e . g ., the recently cut hair tip 55 ); when resistance is detected , the optical radiation from the source 210 is signaled by the contact sensor to fire a treatment radiation suitable to treat the hair 50 ( e . g ., suitable to mechanically alter and / or soften the recently cut hair tip 55 ). the location where the waveguide 213 contacts and provides treatment radiation to the hair 50 creates a dtir zone 59 in the hair 50 itself in this way , treatment radiation is absorbed by the hair 50 via contact with the waveguide 213 fig3 shows another exemplary device 300 for direct beam delivery in accordance with various aspects of the present teachings . the device 300 includes a frame that includes a blade 320 of a razor ( e . g ., an electric razor ) that is integrated with a source of optical treatment radiation 310 . the source of optical treatment radiation 310 includes a light source that employs beam shaping optics 312 ( e . g ., a focusing lens ). the device 300 includes a detector 314 for detecting the light output 313 that travels through the beam shaping optics 312 after having originated from the source of optical treatment radiation 310 . in the device 300 the blade 320 is substantially parallel with the source of optical treatment radiation 310 . the device 300 contacts the surface of skin 40 in a region of hair growth . the device 300 is moved , while in contact with the surface of the skin 40 , in the direction 60 such that the blade 320 of the razor cuts the hair 50 . in some embodiments , the hair 50 is cut at a height that is level with the surface of the skin 40 . in other embodiments , the hair 50 is cut at a height that is lower than the level of the skin 40 . in other embodiments , the hair 50 is cut at a height that is higher than the level of the surface of the skin 40 . after the blade 320 cuts the hair 50 to form the newly cut tip 55 the light source 310 provides optical treatment radiation to modify ( e . g ., soften ) the newly cut tip 55 . the source of optical treatment radiation 310 provides optical radiation with sufficient energy density and power density to induce desired physical , chemical , and / or geometrical changes in the areas of the hair where the said radiation is absorbed through a photo thermal mechanism . in some embodiments , the source of optical treatment radiation 310 provides treatment radiation 313 when the device 300 is turned “ on .” alternatively , safety features may be built into the device 300 to ensure that the device is in contact with the skin . for example , in some embodiments , suitable contact sensors including , for example , a mechanical contact sensor , a light - gate sensor , an electrical ( capacitive or impedance ) sensor , or an optical sensor such as an image ( camera ) sensor are coupled to the device 300 to determine if the device 300 is in contact with the skin 40 . a controller is coupled to the device 300 and in response to the contact sensor when the contact sensor detects contact between the device 300 and skin 40 the controller is configured to permit application of the treatment radiation 313 that is focused through the beam shaping optics 312 after having exited the source of optical treatment radiation 310 . optionally , referring still to fig3 , the device 300 includes a detector 314 that works in concert with the light source 310 to permit application of the treatment radiation from the source 310 only when the detector 314 determines that a hair 50 is present in the path of the light output 313 . for example , the light source 310 can provide a detection light emission ( e . g ., when it is determined that the device 300 is in contact with the skin 40 ) such that the detector 314 can determine , based on its analysis of the emission 313 received from the light source 310 , that a hair 50 is in the path of the light output 313 from the beam shaping optics 312 . typically the determination of the presence of a hair 50 in the light output 313 is based on the melanin content of the hair . once the detector 314 determines that hair is present in the path of the light output 313 the treatment radiation is permitted to be illuminated from the source of optical treatment radiation 310 . for example , a controller coupled to the device is configured to permit application of the treatment radiation from the source of optical treatment radiation 310 once the detector 314 determines that hair is present in the path of the light output 313 . in this way , the newly cut tip 55 can be modified by the device 300 . still referring to fig3 , optionally , the light source 310 provides a level of radiation ( e . g ., a diagnostic level of radiation ) and when the detector 314 detects a drop in the level of radiation ( e . g ., in the level of the diagnostic radiation ) then the device 300 determines that hair 50 is present in the path of the light output 313 due to absorption of light by the hair 50 in the light absorption zone 57 . accordingly , the light source 310 increases the level of radiation to achieve the desired treatment of the newly cut hair tip 55 and / or of the hair 50 . optionally , one could use short wavelengths with high absorption to determine the presence of melanin . fig4 shows an exemplary device 400 for scanned beam delivery in accordance with various aspect of the applicants &# 39 ; present teachings . the device 400 includes a blade 420 of a razor ( e . g ., an electric razor ) that is integrated with a source of optical treatment radiation 410 . the source of optical treatment radiation 410 includes a light source that employs a 1d scanning system ( e . g ., a mirror ). all or a portion of the device 400 contacts the surface of skin 40 in a region of hair growth . the device 400 is moved , while in contact with the surface of the skin 40 , in the direction 60 such that the blade 420 of the razor cuts the hair 50 . in some embodiments , the hair 50 is cut at a height that is level with the surface of the skin 40 . in other embodiments , the hair 50 is cut at a height that is lower than the level of the skin 40 . in other embodiments , the hair 50 is cut at a height that is higher than the level of the surface of the skin 40 . after the blade 420 cuts the hair 50 to form the newly cut tip 55 , the optical radiation source 410 provides optical treatment radiation 413 that is scanned via a 1d scanning system 415 that scans optical treatment radiation 413 over the surface of the skin 40 ( in the path of the scan line 417 ) to modify ( e . g ., soften ) the newly cut tip 55 . in some embodiments , the optical radiation source 410 is focused to provide a spot size that is about the size of a hair e . g ., about 100 microns , from about 10 microns to about 200 microns , or from about 50 microns to about 150 microns . in some embodiments , the 1d scanning systems 415 provides focusing ( e . g ., is a focusing mirror ). the source of optical treatment radiation 410 provides optical radiation with sufficient energy density and power density to induce desired physical , chemical , and / or geometrical changes in the areas of the hair where the said radiation is absorbed through a photo thermal mechanism . in some embodiments , the source of optical treatment radiation 410 provides treatment radiation that is scanned via a 1d scanning system 415 when the device 400 is turned “ on .” in some embodiments , a controller is coupled to the device 400 and in response to a contact sensor the controller is configured to permit scanned application of the treatment radiation 413 from the source of optical treatment radiation 410 when the contact sensor detects contact between the device 400 and skin . optionally , the scanned beam 413 that travels through the 1d scanning system 415 is a free beam . in some embodiments , the 1d scanning system 415 features feedback control to provide feedback control detection such that a detection radiation is the scanned beam 413 that is scanned by the 1d scanning system 415 and when the feedback control detects the presence of hair it prompts the optical radiation source 410 to provide optical treatment radiation 410 that is fired at the hair tip 55 . suitable feedback control mechanisms can include an array such as a ccd camera that detects the presence of hair on the surface of the skin . the scanned treatment radiation 413 may be controlled such that the optical treatment radiation hits the target hair 55 ; this intersection may be referred to as the light absorption zone 57 . fig5 shows another exemplary device 500 for disturbed tir delivery that includes a rotary shaver in accordance with various aspects of the present teachings . the device 500 includes one or more blades 520 ( e . g ., blades 520 a , 520 b , 520 c , and 520 d ) of a razor ( e . g ., an electric razor ) that are integrated with a source of optical treatment radiation 510 , an optical delivery system 514 and one or more optical waveguides 513 ( e . g ., waveguides 513 a and 513 b ). the device 500 contacts the surface of skin 40 in a region of hair growth . the device 500 includes a protective grid 530 comprised of one or more protective grid members ( 530 a , 530 b , 530 c , 530 d , 530 e etc .) and the protective grid 530 makes the skin in contact therewith immobile to ensure that the skin 40 avoids contact with the blades 530 ( e . g ., during use of the device 500 on someone &# 39 ; s skin ). at least a portion of the device 500 moves in the direction of rotation 560 such that the blades 520 of the razor ( e . g ., blades 520 a , 520 b , 520 c , and 520 d ) move in rotation direction 560 to cut the hair ( s ) 50 in their path . in some embodiments , the hair 50 is cut at a height that is level with the surface of the skin 40 . in other embodiments , the hair 50 is cut at a height that is lower than the level of the skin 40 . in other embodiments , the hair 50 is cut at a height that is higher than the level of the surface of the skin 40 . after the blades 520 cut the hair ( s ) 50 to form the newly cut tip , the optical radiation source 510 together with the optical delivery system 514 and waveguide ( s ) 513 ( e . g ., 513 a and 513 b ) provide optical treatment radiation to modify ( e . g ., soften ) the newly cut hair tip ( s ). the optical delivery system 514 can be , for example , an open beam , a fiber , and / or a waveguide . the source of optical treatment radiation 510 provides optical radiation with sufficient energy density and power density to induce desired physical , chemical , and / or geometrical changes in the areas of the hair where the said radiation is absorbed through photo thermal mechanism . in some embodiments , the source of optical treatment radiation 510 together with the waveguide ( s ) 513 provide treatment radiation to the cut tip ( s ) of the hair ( s ) 50 when the device 500 is turned “ on .” alternatively , safety features may be built into the device 500 to ensure that the device is in contact with the skin . for example , in some embodiments , suitable contact sensors including , for example , a mechanical contact sensor , a light - gate sensor , an electrical ( capacitive or impedance ) sensor , or an optical sensor such as an image ( camera ) sensor are coupled to the device 500 to determine if the device 500 is in contact with the skin 40 . a controller is coupled to the device 500 and in response to the contact sensor the controller is configured to permit application of the treatment radiation from the source of optical treatment radiation 510 through the optical delivery system 514 and then through the waveguide ( s ) 513 ( e . g ., waveguides 513 a and 513 b ) when the contact sensor detects contact between the device 500 and the skin 40 . optionally , referring still to fig5 , the device 500 , light source 510 , optical delivery system 514 and waveguide ( s ) 513 work in concert to permit application of the treatment radiation from the source 510 only when at least one of the waveguide ( s ) 513 ( e . g ., 513 a or 513 b ) is in contact with the hair 50 ( e . g ., when waveguide 513 b is in contact with the newly cut tip of a hair 50 cut by blade 520 c after the device 500 turns in the direction of rotation 560 to cut the hair 50 ). for example , each of the waveguide ( s ) 513 ( e . g ., waveguides 513 a and 513 b ) may have a contact sensor that detects resistance when the individual waveguide 513 is pushed against a hair 50 or a portion of a hair 50 ( e . g ., a recently cut hair tip ); when resistance is detected the optical radiation from the source 510 is signaled by the contact sensor to fire a treatment radiation suitable to treat the hair 50 ( e . g ., suitable to mechanically alter and / or soften the recently cut hair tip ). the location where the waveguide 513 contacts the hair 50 creates a disturbed tir ( total internal reflection ) zone in the recently cut hair itself . in this way , treatment radiation is absorbed by the hair 50 via contact with the waveguide ( s ) 513 . more specifically , a hair 50 is cut by blade 520 c and thereafter waveguide 513 b contacts the recently cut hair 50 ( e . g ., the recently cut hair tip ) and the treatment radiation is absorbed by the cut hair via contact with the waveguide 513 b . fig6 shows an exemplary device 600 for scanned beam delivery that includes a rotary shaver . the device 600 includes one or more blades 620 ( e . g ., blades 620 a , 620 b , 620 c , and 620 d ) of a razor ( e . g ., an electric razor ) that are integrated with one or more sources of optical treatment radiation 610 . the device 600 contacts the surface of skin 40 in a region of hair growth . the device 600 includes a protective grid 630 comprised of one or more protective grid members ( 630 a , 630 b , 630 c , 630 d , 630 e etc .) and the protective grid 630 makes the skin in contact therewith immobile to ensure that the skin 40 avoids contact with the blades 630 . the device 600 moves in the direction of rotation 660 such that the blades 620 of the razor ( e . g ., blades 620 a , 620 b , 620 c , and 620 d ) move in rotation direction 660 to cut the hair ( s ) 50 in their path . in some embodiments , the hair 50 is cut at a height that is level with the surface of the skin 40 . in other embodiments , the hair 50 is cut at a height that is lower than the level of the skin 40 . in other embodiments , the hair 50 is cut at a height that is higher than the level of the surface of the skin 40 . after the blades 620 cut the hair ( s ) 50 to form the newly cut tip , the optical radiation source 610 provides optical radiation that is delivered via scanning components ( e . g ., 1d scanning components 615 a and 615 b ). fig6 depicts optical radiation from the source 610 being delivered via an optical delivery system 614 ( e . g ., a waveguide or fiber ) that exits the optical delivery system 614 as a split beam 613 to be scanned by the 1d scanning components 615 a and 615 b . the optical treatment radiation 613 is scanned via the 1d scanning system 615 a and 615 b to scan optical treatment radiation 613 over the surface of the skin 40 ( in the path of the scan lines 617 a and 617 b ) to modify ( e . g ., soften ) the newly cut tip ( s ). in some embodiments , the optical radiation source 610 is focused to provide a spot size that is about the size of a hair e . g ., about 100 microns , or from about 10 microns to about 200 microns , or from about 50 microns to about 150 microns . in some embodiments , the 1d scanning systems 615 a and 615 b provides focusing ( e . g ., is a focusing mirror ). the source of optical treatment radiation 610 provides optical radiation with sufficient energy density and power density to induce desired physical , chemical , and / or geometrical changes in the areas of the hair where the said radiation is absorbed through photo thermal mechanism . in some embodiments , the source of optical treatment radiation 610 provides treatment radiation 613 that is scanned via a 1d scanning system ( s ) 615 a and 615 b when the device 600 is turned “ on .” in some embodiments , a controller is coupled to the device 600 and in response to a contact sensor the controller is configured to permit scanned application of the treatment radiation 613 from the source of optical treatment radiation 610 when the contact sensor detects contact between the device 600 and skin 40 . optionally , the scanned beam 613 that travels through the 1d scanning system 615 a and 615 b is a free beam ( not shown ). in some embodiments , the 1d scanning system 615 features feedback control to provide feedback control detection such that a detection radiation is the scanned beam 613 that is scanned by the 1d scanning system 615 a and 615 b and when the feedback control detects the presence of hair it prompts the optical radiation source 610 to provide optical treatment radiation 613 that is fired at the hair 50 ( e . g ., at the hair tip ). suitable feedback control mechanisms can include an array such as a ccd camera that detects the presence of hair 50 on the surface of the skin . the scanned treatment radiation 613 may be controlled such that the optical treatment radiation hits the target hair 50 . in any of the disclosed embodiments , the hair 50 to be cut may be pre - heated ( e . g ., pre - heated via light energy such as emr ) and the blade used to cut the hair 50 may be warm or may be cold before the final cut of the hair . it may be desirable to pre - heat the hair 50 at about the height of the hair that will actually be cut accounting for the blade pulling the hair up slightly . by employing heat to heat the hair , the hair to be cut is softened hair and after it is cut it will be short and soft . warm hair will be relatively easier to cut than cold hair . in any of the disclosed embodiments , a linear lamp may be employed together with a focusing device .
| 0 |
a preferred embodiment of the invention is now described in detail . referring to the drawings , like numbers indicate like parts throughout the views . as used in the description herein and throughout the claims , the following terms take the meanings explicitly associated herein , unless the context clearly dictates otherwise : the meaning of “ a ,” “ an ,” and “ the ” includes plural reference , the meaning of “ in ” includes “ in ” and “ on .” referring now to fig3 , illustrated therein is one preferred embodiment of a machine 300 for removed debris from a battery cell or battery cells . while the exemplary embodiment of fig3 is designed to accommodate a single cell , it will be obvious to those of ordinary skill in the art having the benefit of this disclosure that the machine 300 could be altered to accommodate multiple cells by duplication of parts . the machine 300 includes a base member 300 for supporting the various elements of the machine . the base member 301 may be mounted on rubber feet 302 to prevent motion while in action . disposed atop the base member 301 is a means for holding a battery cell 303 . the means for holding a battery cell 303 includes a fixed block 304 for accommodating at least one battery cell . the fixed block 304 includes a recess 309 for holding a battery cell . the recess 309 of this exemplary embodiment is suited for holding cylindrical cells , and is thusly cut as a “ v ” shaped groove . it will be obvious to those of ordinary skill in the art having the benefit of this disclosure that other shapes could be substituted for the v - shaped recess to accommodate cells of other shapes , including rectangles , semi - circles , and squares . a moveable member , illustrated here as a moveable belt 305 , passes through the fixed block 304 . the moveable belt 305 forms a complimentary v - shape that opposes that of the recess 309 . in so doing , the moveable belt 305 and the recess 309 of the fixed block 304 form a closed loop 306 when viewed from the top . a battery cell may be inserted into this closed loop 306 . as stated , the moveable belt 305 passes through an aperture 301 in the fixed block 304 , and is coupled to a moveable support 307 . the moveable support 307 , and therefore the attached moveable belt 305 , are spring loaded against the fixed block 304 by at least one coil spring 309 . the coil spring 309 pulls the moveable belt 305 toward the recess 309 when the spring is at rest . a lever 308 coupled to the moveable support 307 allows an operator to open the closed loop 306 by pulling on the lever 308 . when the lever 308 is released , the coil spring 309 causes the moveable belt 305 to again pull back into the aperture 310 . a cutting means 312 , having at least one blade 313 coupled thereto , is provided for removing debris from the battery cells . the operation of the cutting means 312 will be described in more detail below with respect to fig7 and 8 . the cutting means 312 is electrically isolated from the means for holding a battery cell 303 to prevent inadvertent short circuits of the battery cell through the machine . the isolation can be achieved in many different ways , including the addition of rubber gaskets between components . one preferred way of electrically isolating the cutting means 312 from the means for holding a battery cell 303 is by anodizing the various components . the anodization electrically insulates each component from another . a magnet 314 is disposed below the cutting means 312 . the magnet 314 serves to “ catch ” metallic debris that is removed from the surface of the battery cell when the moveable cutting means 312 passes across the cell &# 39 ; s surface . while the magnet 314 is optional , it proves extremely effective in keeping the overall workspace clean . the magnet 314 additionally ensures that metallic fragments do not attach themselves to the cell , by static electricity , residual glue , ink or otherwise . such “ sticky fragments ” could end up within a battery pack , thereby compromising the reliability of the pack . the cutting means 312 is mechanically coupled to a sliding member 311 . the sliding member travels on rails 312 , and moves parallel to the base member 301 . a removable blade carrier 315 secures the blade to the sliding member 311 by bolts or other fastening members . the sliding member 311 is actuated by a main lever 316 . the main lever 316 is rotatably coupled to the sliding member 311 by a gear assembly 317 . essentially , when the main lever 316 is rotated , the gear assembly 317 actuates , thereby causing the sliding member 311 , and thus the cutting member 312 , to travel parallel to the base member 301 along the rails 318 . it is this parallel travel that allows the blade of the cutting member 312 to pass across at least one surface of the battery cell , thereby removing debris . in other words , actuation of the lever 316 actuates the cutting means 312 , thereby causing the cutting means 312 to pass along one end of the battery cell . the starting point and amount of travel of the sliding member 311 and cutting means is determined by a travel assembly . the travel assembly includes a threaded member 320 coupled to the sliding member 311 , a threaded stop 321 disposed about the threaded member 320 , a fixed adjustment stop 319 coupled to the base member 301 , and a second threaded stop 322 . the threaded member 320 passes through the fixed stop 319 , and the threaded stop 321 is coupled to the threaded member 320 such that the fixed adjustment stop 319 is disposed between the sliding member 311 and the threaded stop 321 . for removing debris with the push stroke of the lever 316 , the preferred method so debris falls to the magnet 314 rather than remaining on the cutting member 312 , the starting location of both the sliding member 311 and the cutting member 312 is set by the position of the second threaded stop 322 on the threaded member 320 . by twisting the second threaded stop 322 about the threaded member 320 , a user may adjust this starting location . note that the sliding member 311 may optionally be spring loaded to keep the sliding member 311 pushed or pulled towards or away from the means for holding a battery cell 303 in the rest position . the space between the second threaded stop 322 and the first threaded stop 321 , relative to the fixed adjustment stop 319 determines the amount of travel of the sliding member 311 . one may adjust the travel of the sliding member 311 by twisting either the threaded stop 321 or second threaded stop 322 about the threaded member 320 . this twisting causes the first and second threaded stops 321 , 322 to contact the fixed adjustment stop 319 at different points during the motion of the sliding member 311 . referring now to fig4 , illustrated therein is a top , plan view of a machine in accordance with the invention . a second spring 400 can be seen in this view . two springs 309 , 400 are useful in that it keeps the travel of the moveable support 307 uniform relative to the fixed member 304 . one inserts a battery cell into the machine 300 by pulling the lever 308 in the x direction 401 , thereby opening the closed loop 306 . when the battery is inserted into now expanded closed loop 306 of the means for holding a battery 303 , the amount if insertion is limited by the leveling means 403 coupled to the cutting means 312 . once the battery cell contacts the leveling means 403 , the user releases the lever 308 , wherein the springs 309 , 400 cause the moveable support to move in the - x direction 402 . the leveling means 403 is essentially a flat surface coupled to the cutting means 312 that limits the amount of insertion , thereby ensuring that the blade of the cutting means 312 aligns properly with a surface of the battery cell . after the battery cell is inserted , this alignment allows the blade of the cutting means 312 to pass cleanly across the surface of the battery cell when the cutting means 312 is actuated . as such , the cutting means “ shaves ” debris from the surface of the battery cell . fig5 and 6 illustrate side , elevated views of the machine . these views provide clearer looks of parts that are seen only fractionally in the perspective view of fig3 . referring now to fig7 , illustrated therein is the cutting action performed by a machine in accordance with the invention . as stated above , after the means for holding a battery cell is opened , a battery cell 700 having metallic debris 701 , 702 is inserted into the means for holding a battery cell 303 until one end or edge 703 of the cell touches or otherwise contacts the leveling means 403 . once the means for holding a battery cell 303 has been closed , the cutting means 312 may be actuated . actuation of the cutting means 312 causes the blade 313 to pass along the end 703 of the battery cell 700 , thereby removing debris 701 , 702 from the battery cell 700 . once removed , the debris 701 , 702 may then fall upon the magnet 314 , where it remains magnetically attached until an operator performs a cleaning operation . the method described in this paragraph is illustrated in fig8 . while simple in operation , the machine produced superior and surprising results in practice . the principal improvement was an increase in pull strength resistance of tab - cell assemblies . in other words , cells that were shaved with the machine and then welded to tabs survived larger pull forces without the welds breaking than did new cells that were welded to tabs without having passed through the machine . this result is indicated in table 1 below . as can be seen from the table above , when tests were run on sample sets of five cells , the average increase in pull strength was over 85 %, or 1 . 6 lbs . this increase in pull strength not only increases the reliability of the overall battery pack , but also reduces costs due to customer field returns . a second improvement realized with the machine was reduced cost in manufacture . the reduced cost came primarily from two sources : first , overall raw material cost was reduced because cells did not have to be scrapped . when a poor weld joint appeared , the machine facilitated refurbishment of the cell surface . a second reduction of cost came from reduced labor time . in contrast to the time consuming rotary tool reworking , the machine facilitated a fast , clean refurbishment cycle . a third improvement was decreased electrical impedance . when cells were refurbished with the machine , experimental results showed lower electrical impedance from tab to cell . this reduced impedance means that more of the battery cell &# 39 ; s energy will be delivered to the host , as opposed to being dissipated as heat in the battery pack . while the preferred embodiments of the invention have been illustrated and described , it is clear that the invention is not so limited . numerous modifications , changes , variations , substitutions , and equivalents will occur to those skilled in the art without departing from the spirit and scope of the present invention as defined by the following claims .
| 8 |
referring now to fig1 there is shown a schematic diagram of a flash memory cell array structure 10 , according to one preferred embodiment of the present invention . the memory array 10 is an n × n array having n rows by n columns of memory cells t ( φ , φ ) through t ( φ , n -- 1 ), t ( 1 , φ ) through t ( 1 , n -- 1 ), . . ., and t ( n --, φ ) through t ( n -- 1 , n -- 1 ). each memory cell t is a flash transistor device having drain , source and control gate nodes , and a floating gate . each memory cell t is preferably a conventional single - transistor flash cell like that shown in fig3 . transistor t is an n - channel mos having an n + source region 12 and an n + drain region 14 formed in the surface of a p - silicon substrate 20 , and a floating gate 16 and a control gate 18 formed in stacked fashion on the silicon substrate 20 . floating gate 16 stores a negative charge when programmed and can be erased via fowler - nordheim tunneling . the control gates of each memory cell t in the same row are connected together with a common word line wl ( φ )˜ wl ( n -- 1 ). the drains of each memory cell t in the same column are connected together with a common bit line bl ( φ )˜ bl ( n -- 1 ). the sources of all memory cells t are connected together with a source line 30 . in the memory array 10 , each row of memory cells t is connected with a self - limiting - erase floating gate transistor tl ( φ )˜ tl ( n -- 1 ) of the present invention . the control gates of the self - limiting - erase transistors tl are connected to the corresponding word lines wl , and the sources of the transistors tl are connected to the source line 30 . the initial threshold voltage v ti2 of the transistors tl is smaller than the initial threshold voltage v ti1 of the memory cell transistors t for example , v ti1 = 1 . 0 volts and v ti2 = 0 . different v ti values can be set during the manufacturing process of the memory array 10 , for example by using the conventional process of ion implantation into the channel regions of the memory cell transistors t and the self - limiting - erase transistors tl . another method to set the different vti values is to program each memory cell after the flash memory ic is finished and before it is used to store data , so that its initial threshold voltage is larger than that of the self - limiting - erase transistors tl . the operation voltages of the memory array 10 and the self - limiting - erase transistors tl in three modes of operation , i . e . programming , erasing , and read modes , are given in the following table where &# 34 ; f &# 34 ; means &# 34 ; floating .&# 34 ; __________________________________________________________________________mode of drain sourceoperation bl ( φ ) bl ( 1 ) bl ( n - 1 ) vs wl ( φ ) wl ( 1 ) wl ( n - 1 ) of tl ( φ ) of tl ( φ ) __________________________________________________________________________program t ( φ , φ ) 7 v 0 v 0 v 0 v 12 v 0 v 0 v 7 v 0 verase t ( φ , φ ) ˜ f f f 12 v connected 12 v 12 v connected 12 vt ( φ , n - 1 ) to drain of to wl ( φ ) tl ( φ ) read t ( φ , φ ) 1 v 0 v 0 v 0 v 5 v 0 v 0 v f 0 v__________________________________________________________________________ as indicated in the table , if the user wants to selectively program the memory cell transistor t ( φ , φ ), the bit line bl ( φ ) is held at 7 volts , and the other bit lines bl ( 1 ) through bl ( n -- 1 ) are held at 0 volts . the voltage v s of the source line 30 is set to 0 volts . the word line wl ( φ ) is held at 12 volts , and the other word lines wl ( 1 ) through wl ( n -- 1 ) are held at 0 volts . the drain of the self - limiting - erase transistor tl ( φ ) is held at 7 volts , and the source is held at 0 volts . in this manner , channel hot electrons are generated at the channel region of the memory cell transistor t ( φ , φ ), and injected into its floating gate . similarly , channel hot electrons are also generated in the channel region of the self - limiting - erase transistor tl ( φ ), and injected into its floating gate . thus , both threshold voltages of the memory cell transistor t ( φ , φ ) and the self - limiting - erase transistor tl ( φ ) are increased . for instance , after programming , the threshold voltage vtp 1 of the memory cell transistor t ( φ , φ ) is 6 volts , and the threshold voltage v tp2 of the self - limiting - erase transistor tl ( φ ) is 5 volts . the preset voltage difference is maintained . in an erase operation , this preferred embodiment can 5 selectively erase only one row of memory cell devices . for example , if the first row of memory cell transistors t ( φ , φ ) through t ( φ , n -- 1 ) is to be erased , the voltage v s of the source line 30 is set to 12 volts , and all bit lines are floating . the drain of the self - limiting - erase transistor tl ( φ ) is connected to the word line wl ( φ ) via a feedback path 32 with an initial reset value for the word line wl ( φ ) equal to zero volt . in this embodiment , the feedback path 32 includes an impedance element 36 . the other word lines wl ( 1 ) through wl ( n -- 1 ) are held at 12 volts . in this manner , the charge stored in the floating gates of the first row of memory cell transistors t ( φ , φ ) through t ( φ , n -- 1 ) will be pulled out to the sources via capacitance coupling across the oxide between the floating gates and the sources . similarly , the charge stored in the floating gate of the self - limiting - erase transistor tl ( φ ) will be pulled out to the source via capacitance coupling across the oxide between the floating gate and the source . thus , the threshold voltages of the memory cells and the self - limiting - erase transistor will be reduced from their programmed values v tp1 , v tp2 to their initial values v ti1 , v ti2 . when the threshold voltage of the self - limiting - erase transistor tl ( φ ) reaches v ti2 = 0 volt due to erasing , the transistor tl ( φ ) will turn on , and thus the erasing voltage of 12 volts at its source will transfer to the word line wl ( φ ) via the feedback path 32 . this will stop the erase operation since now the voltage across the gate oxide between the floating gates and the sources is very small . at this point , the memory cells t ( φ , φ ) through t ( φ , n -- 1 ) all have a threshold voltage v ti1 = 1 volts . thus , the erase operation is self limited to completely avoid the over - erasing problem . when the erased memory cell , for example the cell t ( φ , φ ), is read , the bit line bl ( φ ) is held at 1 volts , and the other bit lines bl ( 1 )˜ bl ( n -- 1 ) are held at 0 volts . the voltage v s is set to 0 volts . the word line wl ( φ ) is held at 5 volts , and the other word lines wl ( 1 )˜ wl ( n -- 1 ) are held at 0 volts . the drain of the self - limiting - erase transistor tl ( φ ) is floating , and its source is held at 0 volts . as the threshold voltage of the cell t ( φ , φ ) is constant and well known , a constant predetermined read current is delivered between its source and drain . of course , when a programmed cell is read , there is no read current because the read voltage of 5 volts at the word line wl ( φ ) is less than v tp1 = 6 volts of the cell . thus , memory array 10 of the present invention is very suitable for high speed applications which require constant high cell current . for a memory cell array with self - limiting erase , the threshold voltage v . sub . ti1 of the memory cells can be preset to a low value , e . g . 0 . 5 volts or even 0 . 1 volts . a lower v ti1 results in a higher read current . if the self - limiting erase scheme is not used , v ti1 is higher , e . g . 1 . 5 volts , to provide more margin for preventing the cell devices from going into the depletion mode ( v ti1 & lt ; 0 ) after erase . referring now to fig2 there is shown a schematic diagram of a flash memory cell array structure 10 with a self - limiting erase according to another preferred embodiment of the present invention . the above - described embodiment of fig1 is suitable for memory array applications which need to selectively erase only one row of memory cells . if the erase operation of the memory array is to erase all rows of memory cells every time , only one self - limiting - erase floating gate transistor of the present invention is needed . as shown in fig2 a self - limiting - erase transistor tl &# 39 ; is coupled to the memory cell array 10 with its source connected to the source line 30 and its control gate connected to the output terminal of a switching circuit , for example , an or gate 40 . all word lines wl ( φ ) through wl ( n -- 1 ) of the memory array 10 are connected to the input terminals of the or gate 40 . in an erase operation for all memory cells , the voltage v s of the source line 30 is set to 12 volts , and all bit lines are floating . the drain of the self - limiting - erase transistor tl &# 39 ; is connected to all word lines wl ( φ ) through wl ( n -- 1 ) via a feedback path 32 &# 39 ; with an initial reset value for the word lines wl ( φ ) through wl ( n -- 1 ) equal to zero volts . in this embodiment , the feedback path 32 &# 39 ; includes an impedance element 36 &# 39 ;. in this manner , the charge stored in the floating gates of all memory cells will be pulled out to the sources . similarly , the charge stored in the floating gate of the self - limiting - erase transistor tl &# 39 ; will be pulled out to the source . thus , the threshold voltages of the memory cells and the self - limiting - erase transistor will be reduced from their programmed values v tp1 , v tp2 to their initial values v ti1 , v ti2 . when the threshold voltage of the self - limiting - erase transistor tl &# 39 ; reaches v ti2 = 0 volts due to erasing , the transistor tl &# 39 ; will turn on , and thus the erasing voltage of 12 volts at its source will transfer to all word lines wl ( φ ) through wl ( n -- 1 ) via the feedback path 32 &# 39 ;. this will stop the erase operation . at this point , all memory cells have a threshold voltage v ti1 = 1 volt . thus , the erase operation is also self limited to completely avoid the over - erasing problem . furthermore , this embodiment also can obtain a constant read current in the read operation of an erased cell . while the invention has been described in terms of what is presently considered to be the most practical and preferred embodiments , it is to be understood that the invention need not be limited to the disclosed embodiments . on the contrary , it is intended to cover various modifications and similar arrangements included within the spirit and scope of the appended claims , the scope of which should be accorded the broadest interpretation so as to encompass all such modifications and similar structures .
| 6 |
in the present application , the terms “ logger ”, “ indicator ”, or the phrase “ logging indicator ” refers to any devices used to provided an indication of the moved position of the brake activation pushrod . moreover , it will be clear to the skilled artisan that while the present application is primarily directed to the use of pneumatically operated braking systems , the systems of the present invention can also be applied to hydraulic brake systems . further , the skilled artisan will be aware that brake stroke logging indicators of the type described herein can be used in a wide variety of applications . accordingly , while the present application is described with particular reference to the trucking industry , industry , the skilled artisan would be aware that the present application is equally applicable in other non - trucking industries , such as the rail industry , or the like , or in other vehicles operating pneumatic braking systems , such as in bus or recreational vehicle applications . embodiments of this invention will now be described by way of example only in association with the accompanying drawings in which : fig1 shows an isometric view of a preferred embodiment of the visual brake stroke logging indicator of the present invention , and the logger housing ; fig2 shows section view of the reciprocating locking tab on the logger indicator and locking tab holes on the logger housing , where the reciprocating locking tab is hinged up and down to hold the logger indicator in position when the clevis pin is not pushing on it ; fig3 shows side view of the assembly with brakes released where the clevis pin is in alignment with the release indicator , with the logger indicator at the same ; fig4 shows side view of the same assembly positioned about half way into the stroke , and clevis pin indicator pushing the logger indicator forward ; fig5 shows side view of the same assembly in the brakes released position where the clevis pin is again in alignment with the release indicator , but the logger indicator remains in a position showing the longest applied stroke travel ; fig6 shows side view of the assembly with brakes released where the clevis pin is in alignment with the release marker indicator , but the arrow indicator on the logger indicator is past the stroke limit indicator showing an out of adjustment brake stroke ; fig7 shows an isometric view of the assembly installed in an upwards facing position , which orientation might be used to accommodate different chassis designs , obstacles and / or better line of sight ; fig8 shows isometric view of the assembly installed downward position with brakes released and the logger indicator showing an out of adjustment brake stroke ; fig9 shows isometric view of the assembly installed where the logger housing includes attached indicators ; fig1 shows a closer view of the assembly installed on the bracket where the logger housing has attached indicators ; fig1 shows another embodiment mounted to the air brake chamber where the logger indicator slides linearly on the bracket slot and uses cut slots on the side of the mounting bracket where the release markers and the stroke limit indicator are inserted ; fig1 shows an exploded view of another embodiment of the device of the present invention where the mounting bracket comprises two pivoting parts and the clevis housing is inserted through the clevis pin to move it linearly , on a pivoting guide , wherein the brake stroke indicator is fastened to the pivoting guide and the logger pointer housing is moved along the pivoting guide ; fig1 shows the fig1 embodiment mounted onto the air brake chamber ; and fig1 shows the assembled parts of the device shown in figure fig1 . the novel features which are believed to be characteristic of the present invention , as to its structure , organization , use and method of operation , together with further objectives and advantages thereof , will be better understood from the following drawings in which a presently preferred embodiment of the invention will now be illustrated by way of example only . in the drawings , like reference numerals depict like elements . it is expressly understood , however , that the drawings are for the purpose of illustration and description only and are not intended as a definition of the limits of the invention . also , unless otherwise specifically noted , all of the features described herein may be combined with any of the above aspects , in any combination . further , it will be noted that operation of brake stroke indicators are well known within the industry . as such , the present invention will first be described with respect to the system described in u . s . pat . no . 5 , 913 , 385 , although it will be clear to the skilled artisan that the logging system of the present invention can be easily adapted for use with other visual brake stroke indicator devices of the prior art . in reference to fig1 and 2 the logger housing 6 has a circular cutaway where the logger indicator 9 slides concentrically within the center line ( cl ), the clevis pin 8 ( fig3 ) is positioned behind the logger pin arm 11 , thus pushing the logger pin arm 11 forward ( fig4 ), the indicating arrow 7 then displays the farthest position traveled by the clevis pin 8 . the stop pin 14 is positioned to keep the logger indicator 9 from travelling off the logger housing 6 . the cross sectional view in fig2 , shows how the logger indicator 9 is held in position to the logger housing 6 , where the reciprocating stepping tab 16 , is a hinged part of the logger indicator 9 . the reciprocating stepping tab 16 moves up and down to allow forward and backward linear movement of the logger indicator 9 and therefore locking into the locking tab holes 15 when force or movement is not applied . referring to fig3 , the brakes are in their initial , release position , but it can be seen that the air chamber 1 will actuate push rod 2 fastened to a clevis yoke 12 that pivotally mates to the slack adjuster 3 by the clevis pin 8 . the logger pin arm 11 is in front and tangent to the clevis pin 8 that is centered to the brakes released marker 13 . in fig4 the brakes have now been applied and the clevis pin 8 has moved forward pushing the logger pin arm 11 forward . the logger arrow 7 is in line with the clevis pin 8 . in fig5 the brakes have been released , and are now again in their initial , released position where the clevis pin 8 is again in line with the brake released marker 13 . at this point , however , indicating arrow 7 remains in its brake - actuated position , and therefore marks the distance of the last stroke traveled . when the brakes have been applied numerous times , logger arrow 7 shows the furthest movement of the logger indicator 9 within housing 6 . when inspected , the operator preferably observes the system in this position , namely wherein the indicator at its initial position is within the lower tolerance position , and the indicating arrow of the pushrod stroke logging device is also within the pushrod &# 39 ; s upper tolerance position , shown by maximum stroke limit indicator 4 . the lower and upper tolerance positions are marked by indicators 4 and 13 which preferably are two upright digits that are connected one to the other by a joining plate , and are mounted on a mounting bracket 5 . as such , upright digits 4 and 13 have the ability to move in unison with one another . housing 6 is also mounted on bracket 5 , using bolt 10 , which bolt 10 can also be used to hold indicators 4 and 13 in place . fig6 shows brakes in release position with the clevis pin 8 aligned with the brake released marker 13 . this particular position is a continuation of similar to that of fig5 , but in this case , the pushrod has exceeded the upper tolerance since the pushrod stroke traveled past the stroke limit indicator 4 . this shows an out of adjustment value 17 for the maximum brake stroke position . fig7 is an isometric view showing the whole brake assembly , with brakes released , arranged in an inverted orientation to accommodate different chassis designs , obstacles and provide a different visual indication . fig8 is an isometric view again showing the whole brake assembly , with the brakes in a released position , in still further orientation to that shown in fig7 . in this embodiment , the brake released marker 13 is in alignment with the clevis pin 8 . similar to fig6 , indicating arrow 7 is past the stroke limit indicator 4 . fig9 and 10 show yet another embodiment of the present invention wherein the initial brake released marker 13 and the stroke limit indicator 4 ( fig3 to fig8 ) are shown on the logger housing 6 which thereby reduces the number of parts . the brake initial brake released marker 13 and the stroke limit indicator 4 are extruded as part of the logger housing 6 . also logger arrow 7 maybe be duplicated with a second extruded arrow logger 7 a which provides increased visual indication . additionally , fig1 shows a closer view on the extruded brake released marker 13 and the stroke limit indicator 4 with the logger arrows 7 and 7 a showing a brake application . fig1 and 12 show another embodiment using a logger housing bracket 18 fastened to a brake chamber 1 . the logger indicator 9 slides concentrically with the center line within the logger housing bracket 18 . fig1 provides a closer view of the apparatus showing the logger housing bracket 18 with a brake released marker slot 19 and multiple stroke limit indicator slots 20 . the brake released marker 13 is inserted into the brake released marker slot 19 and the stroke limit indicator 4 may be inserted into selected stroke limit indicator slots 20 . this allows the user to insert the limit indicators into appropriate slots to show the maximum travel for the particular braking system being used . typically the distances from the brake released marker slot 19 and the selected indicator slots 20 , will be between 1 and 2 inches , although other values might be provided , where needed . fig1 to 15 show the features of another embodiment of the apparatus showing an exploded view of the assembly in fig1 , where the mounting bracket 27 is fastened to a brake chamber using a bracket mounting hole 31 . the pivoting guide 21 is attached to the mounting bracket 27 by a pivoting pin 29 for vertical movement . the brake stroke indicator 23 slides onto the pivoting guide 21 and is fastened in place with a set screw or like fastener . the clevis housing 26 with the integrated logger pointer 32 slides onto the pivoting guide 21 . the clevis pin 8 ( see fig1 ) is inserted into the clevis mounting hole 28 to linearly move the clevis housing 26 along the pivoting guide 21 . the logger pointer housing 25 with the integrated logger pointer 30 slides linearly along the pivoting guide 21 . fig1 shows the device assembled and mounted onto a brake chamber 1 . the clevis indicator 32 may be aligned with one of the multiple brake released markers 22 and when the brakes are applied , the clevis housing 26 pushes on the logger pointer housing 25 where the logger pointer 30 shows the distance traveled relative to the stroke limit indicator 24 . fig1 shows a closer view of the embodiment of fig1 and fig1 with its parts as an assembly . it will be understood that the components of the various parts of the visual brake stroke logging indicator of the present invention can be manufactured of any suitable materials . particularly preferred are plastic components that can be readily fabricated at low cost . moreover , it is preferred that the indicator arrows , and limit indicators , and the like , be made of , or covered with brightly coloured materials to assist in observing their various positions . this is particularly preferred since the amount of dirt in the area of the brakes , can be significant , and can interfere with observing the various components . also , the visual brake stroke logging indicator device of the present invention should be manufactured with components that will not inadvertently interfere with the normal operation of the braking system . plastic components are particularly preferred in this respect . thus , it is apparent that there has been provided , in accordance with the present invention , a visual brake stroke indicator which fully satisfies the goals , objects , and advantages set forth hereinbefore . therefore , having described specific embodiments of the present invention , it will be understood that alternatives , modifications and variations thereof may be suggested to those skilled in the art , and that it is intended that the present specification embrace all such alternatives , modifications and variations as fall within the scope of the appended claims . additionally , for clarity and unless otherwise stated , the word “ comprise ” and variations of the word such as “ comprising ” and “ comprises ”, when used in the description and claims of the present specification , is not intended to exclude other additives , components , integers or steps . further , the invention illustratively disclosed herein suitably may be practiced in the absence of any element which is not specifically disclosed herein . moreover , words such as “ substantially ” or “ essentially ”, when used with an adjective or adverb is intended to enhance the scope of the particular characteristic ; e . g ., substantially planar is intended to mean planar , nearly planar and / or exhibiting characteristics associated with a planar element . further , use of the terms “ he ”, “ him ”, or “ his ”, is not intended to be specifically directed to persons of the masculine gender , and could easily be read as “ she ”, “ her ”, or “ hers ”, respectively . also , while this discussion has addressed prior art known to the inventor , it is not an admission that all art discussed is citable against the present application .
| 1 |
in the following descriptions , the term “ inner side ” is used to indicate a side close to the center of the device in the horizontal direction , while “ outer side ” is used to indicate a side away from the center of the device in the horizontal direction . fig1 is a top view of the superjunction device according to a preferred embodiment of the present invention . it should be mentioned that fig1 is a top view taken from the top of the n - type epitaxial layer 2 , namely those elements above the epitaxial layer 2 are not shown in fig1 , although included in the superjunction device . as shown in fig1 , the superjunction device of the present invention is divided into three regions , region i , region ii and region iii . also refer to fig3 , region i , namely a central region of the superjunction device , is defined as an active region of the device . the active region includes alternately arranged p - type regions 25 and n - type regions formed in an n - type epitaxial layer 2 . the p - type regions 25 are p - type pillars formed in the active region , and the n - type regions are n - type pillars formed in the active region . in the active region , currents flow through n - type regions , from source electrode via channels to drain electrode . when the device is in a reverse off - state , the p - type regions 25 and the n - type regions form depletion regions to withstand voltage . regions ii and iii constitute a terminal protection region of the superjunction device . when the superjunction device is in an on - state , the terminal protection region does not provide current path ; when the superjunction device is in a reverse off - state , regions ii and iii withstand both a voltage in the lateral direction between the outermost unit of region i ( namely the p - type region 25 a at the border of region i ) and the outside border of the superjunction device , and a voltage in the vertical direction between the surface of the outermost unit of region i and the substrate . region ii contains at least one p - type ring 3 b , which is generally electrically connected with p - wells 3 a in region i . only one p - type ring 3 b is illustrated in fig1 . region ii further contains a polysilicon field plate 8 b and a metal field plate 13 a for preventing rapid changes in surface electric field . region ii also contains p - type annular columns 24 . in some embodiments , region ii may not contain metal field plate 13 a . region iii is a voltage withstanding region formed by alternately arranged p - type annular columns 23 and n - type annular columns formed by the n - type epitaxial layer , wherein the p - type annular columns 23 are p - type regions formed in the terminal protection region , and the n - type annular columns are n - type regions formed in the terminal protection region . region iii may either contain metal field plates 13 a , 13 b or not . a channel stopper 21 is arranged at the outside border of region iii . the channel stopper 21 may be formed by an n + implantation region , or an n + implantation region with a dielectric or with a dielectric and a metal formed on it . additional p - type pillars 22 may be optionally formed at the corners of the p - type annular columns 23 to achieve better charge balance . as shown in fig1 , all the structures in the active region , namely the p - type regions 25 and n - type regions , are pillar - shaped . the terminal protection region surrounds the active region , and the p - type ring 3 b , p - type annular columns 24 , p - type annular columns 23 , and channel stopper 21 all have a cross section of straight - flanked ring shape or straight - flanked ring shape with curved corners . in fig1 , the p - type regions 25 in the active region all have a cross section of stripe shape . the active region may also be formed by two - dimensionally arranged p - type regions of square , hexagonal , octagonal or other shapes . the additional p - type pillars 22 at the corner areas in fig1 can be designed according to the requirement of optimizing local electric charge balance . if the width of a p - type annular column 23 is a , and the distance between two adjacent p - type annular columns 23 is also a , then the additional p - type pillars 22 can be designed as p - type square holes with a length of 0 . 3 a ˜ 0 . 5 a . fig2 is a schematic view of a resistivity curve from the n - type epitaxial layer to the n + substrate of a superjunction device . after the superjunction device of this embodiment is formed , a transition region exists in the n - type epitaxial layer 2 adjacent to the surface of the n + substrate 1 . the doping concentration of the transition region is lower than that of the n + substrate 1 and is higher than that of the n - type epitaxial layer 2 . the resistivity of the transition region is higher than that of the n + substrate 1 and is lower than that of the n - type epitaxial layer 2 . the n + substrate 1 is evenly doped with a doping concentration higher than 1e19 cm − 3 , and the doping concentration of the n - type epitaxial layer 2 is lower than 5e16 cm − 3 . during the high - temperature process of epitaxial deposition and other high - temperature processes after epitaxy , such as drive - in , trench refilling and gate oxidation processes , the impurity in the n + substrate 1 will diffuse into the n - type epitaxial layer 2 , thereby forming a transition region having a continuous concentration gradient in the n - type epitaxial layer 2 . as shown in fig2 , the x - axis indicates the position coordinates from the surface of the n - type epitaxial layer 2 toward the bottom of the n + substrate 1 . the y - axis indicates the changes in resistivity . the thickness of the n - type epitaxial layer 2 is t , and the thickness of the transition region is t 0 . the resistivity in the transition region continuously declines . fig3 is a cross sectional view of the superjunction device according to embodiment 1 along the line a - a in fig1 . in this embodiment , an n - type epitaxial layer 2 is formed on an n + substrate 1 . a transition region ( not shown ) exists in the n - type epitaxial layer 2 adjacent to the surface of the n + substrate 1 . region i , which is in a central area of the superjunction device , is an active region and includes alternately arranged p - type regions 25 and n - type regions formed in the n - type epitaxial layer 2 . the p - type regions 25 are constituted of p - type pillars 51 formed in the first trenches 41 in region i in fig3 . the first trenches 41 may have a cross sectional shape of rectangular , square , hexagonal , octagonal , etc . a p - well 3 a is formed beneath the surface of each p - type region 25 and may extend laterally into the n - type regions on both sides of the p - type region 25 . source regions 11 formed by n + implantation regions are respectively formed in each of the p - wells 3 a . gate structures are formed above the n - type epitaxial layer 2 . each gate structure corresponds to a p - well 3 a and includes a gate oxide 7 a and a polysilicon gate formed on the gate oxide 7 a . the gate oxide 7 a is formed on the surface of the n - type epitaxial layer 2 in the active region . a metal layer 13 is formed above the n - type epitaxial layer 2 and is connected to the polysilicon gates 8 a or the source regions 11 through contact holes 10 to pick up gate electrodes or source electrodes . p + ion implantation regions 12 are formed to build ohmic contacts between the p - wells 3 a and the metal layer 13 . a backside metal layer 14 is formed at the backside of the n + substrate 1 to pick up a drain electrode . regions ii and iii constitute the terminal protection region of the superjunction device according to embodiment 1 of the present invention . the terminal protection region surrounds the active region and includes at least one p - type ring 3 b , a plurality of p - type annular columns 24 in region ii , a plurality of p - type annular columns 23 in region iii , a channel stopper 21 , a terminal dielectric film 6 , at least one polysilicon field plate 8 b , and metal field plates 13 a and 13 b . in other embodiments , the terminal protection region may not include metal field plates 13 a or 13 b . in embodiment 1 , five metal field plates ( one 13 a and four 13 b ) are included in total . the p - type annular columns 24 are constituted of p - type annular columns 52 formed in the second trenches 42 in region ii . the p - type annular columns 23 include p - type annular columns 53 a formed in the second trenches 43 a at the inner side of region iii , and p - type annular columns 53 b formed in the second trenches 43 b at the outer side of region iii . all the second trenches 42 , 43 a , 43 b may have a cross sectional shape of straight - flanked ring or straight - flanked ring with curved corners . the p - type pillars 51 and the p - type annular columns 52 , 53 a , 53 b are formed by filling a p - type silicon into the respective trenches 42 , 43 a , 43 b . p - type annular columns 52 , 53 a and 53 b are arranged in order between the outermost p - type region 25 in the active region , namely the p - type pillar 51 a , and the channel stopper 21 . the p - type pillars 51 , p - type annular columns 52 , 53 a , 53 b and the adjacent n - type epitaxial layer 2 form a plurality of alternately arranged p - type and n - type regions . as shown in fig3 , assuming that the thickness of the n - type epitaxial layer 2 is t , the thickness of the transition region in the n - type epitaxial layer 2 is t 0 ( referring to fig2 ), the distance from the bottom of any one of the p - type pillars 51 to the upper surface of the n - type epitaxial layer 2 is t 1 , the distance from the bottom of any one of the p - type annular columns 52 to the upper surface of the n - type epitaxial layer 2 is t 2 , and the distance from the bottom of any one of the p - type annular columns 53 a , 53 b to the upper surface of the n - type epitaxial layer 2 is t 3 , then the distances from the bottoms of p - type pillars 51 or the p - type annular columns 52 , 53 a , 53 b to the surface of the n + substrate 1 are all greater than the thickness of the transition region , namely t − t 1 & gt ; t 0 , t − t 2 & gt ; t 0 , and t − t 3 & gt ; t 0 . the superjunction device according to embodiment 1 of the present invention is a device having a breakdown voltage ( bvds ) of 600v . the n + substrate 1 has a resistivity of from 0 . 001 ω · cm to 0 . 003 ω · cm and a doping concentration of higher than 1e19 cm − 3 ; the n - type epitaxial layer 2 has a thickness t of 45 μm and a resistivity of 4 ω · cm . after the whole process , the thickness t 0 of the transition region in the n - type epitaxial layer 2 formed due to the impurity diffusion from the n + substrate 1 to the n - type epitaxial layer 2 is about 5 μm . t 1 , t 2 and t 3 are 35 μm , equal to one another . the distances between the n + substrate 1 and the bottoms of the p - type pillars 51 or p - type annular columns 52 , 53 a , 53 b , namely the distances between the n + substrate 1 and the bottoms of all the p - type regions , are all 10 μm , which is greater than the thickness of the transition region ( 5 μm ). the p - type ring 3 b is formed beneath the surface of the n - type epitaxial layer 2 in region ii in the terminal protection region and is adjacent to the outermost p - type pillar 51 a in region i . the p - type ring 3 b covers a plurality of p - type annular columns 52 . the doping concentration of the p - type ring 3 b is greater than that of the p - type annular columns 52 . the p - type ring 3 b covers at least one p - type annular column 52 closest to the active region ( i . e . closest to the p - type pillar 51 a ) and its adjacent n - type annular column the p - type ring 3 b and p - wells 3 a are formed under the same process conditions , in other words , the p - type ring 3 b and the p - wells 3 a are simultaneously implanted . the p - type ring 3 b may also be implanted separately by a single implantation . the channel stopper 21 is formed beneath the surface of the n - type epitaxial layer 2 at the outer side of the outermost p - type annular column 53 b . the terminal dielectric film 6 is formed on the n - type epitaxial layer 2 in the terminal protection region . the terminal dielectric film 6 has a step structure 6 a at the side close to the active region . the terminal dielectric film 6 covers all the p - type annular columns from the p - type annular column under the step structure 6 a to the p - type annular column 23 at the outermost . the polysilicon field plate 8 b is formed on the terminal dielectric film 6 and covers a part of the terminal dielectric film 6 , wherein the part of the terminal dielectric film 6 includes the entire step structure 6 a . the polysilicon field plate 8 b extends toward the inner side of the device to cover the n - type epitaxial layer 2 between the outside border of the active region and the step structure 6 a . the extension part of the polysilicon field plate 8 b covers one or more of the p - type annular columns 24 . the extension part of the polysilicon field plate 8 b is isolated from the n - type epitaxial layer 2 below it by the gate oxide 7 a and a second dielectric layer 7 b . the second dielectric layer 7 b has a thickness greater than that of the gate oxide 7 a and covers all the p - type annular columns 52 in region ii . the polysilicon field plate 8 b is electrically connected with the polysilicon gates 8 a . an inter layer film 9 is formed on the n - type epitaxial layer 2 in the terminal protection region , on the terminal dielectric film 6 , on the polysilicon field plate 8 b , and also on the top face and side faces of each gate structure . in regions ii and iii , a plurality of metal field plates 13 a and 13 b ( five in total in this embodiment ) are formed on the inter layer film 9 . metal field plates 13 a and 13 b are formed by lithographing and etching a metal layer 13 . the metal field plates 13 a and 13 b are respectively formed on the inter layer film 9 above the p - type ring 3 b or above the p - type annular columns 53 a , 53 b or above the channel stopper 21 . the metal field plate 13 a covers the entire step structure 6 a . the metal field plate 13 a is separated from the source electrode and is not connected to the source electrode . a part of the metal field plate 13 a covers the entire p - type ring 3 b . the metal field plate 13 a is formed above the polysilicon field plate 8 b and may either be connected to the polysilicon field plate 8 b through contact holes 10 or not connected to the polysilicon field plate 8 b . all the metal field plates 13 a and 13 b have a floating structure . the thickness of the gate oxide 7 a is from 800 å to 1200 å ; the thicknesses of the polysilicon field plate 8 b and polysilicon gates 8 a are from 3000 å to 10000 å ; the thickness of the terminal dielectric film 6 is from 5000 å to 15000 å and the thickness of the inter layer film 9 is from 5000 å to 15000 å . the stepping of the alternately arranged p - type and n - type regions below the p - type ring 3 b in region ii , namely the intervals between adjacent trenches in region ii is smaller than or equal to the stepping of the alternately arranged p - type and n - type regions in region i . the width ratio of p - type and n - type regions in region ii ( the ratio of p - type region &# 39 ; s width to n - type region &# 39 ; s width ) is greater than or equal to that in region i . in this embodiment , the widths of p - type regions in regions i , ii and iii are all 5 μ and the widths of n - type regions in regions i , ii and iii are all 10 μm . the alternately arranged p - type and n - type regions formed by p - type annular columns 53 a , 53 b and the n - type epitaxial layer in region iii are used as a voltage withstanding region . metal field plates 13 a and 13 b are formed above the p - type and n - type annular columns in region iii . a polysilicon field plate may either be formed above the p - type and n - type annular columns in region iii or not . a p - type ring may either be formed in region iii or not . the channel stopper 21 at the outermost of region iii is formed by an n + implantation region , or an n + implantation region with a metal formed on it . the n + implantation region of the channel stopper 21 is formed by the same process as the source regions 11 . in embodiment 1 , a metal field plate 13 b is formed above the channel stopper 21 and is connected to the channel stopper 21 through a contact hole 10 . in other embodiments , the channel stopper 21 may not be connected to the metal field plate 13 b so that the metal field plate 13 b will be floating . the metal field plate 13 b may also be substituted by a polysilicon field plate . in embodiment 1 , no polysilicon field plate is arranged . fig4 is a cross sectional view of the superjunction device according to embodiment 2 along the line a - a in fig1 . the difference between embodiment 2 and embodiment 1 is that : in embodiment 2 , the bottoms of the trenches 42 in region ii and the bottoms of the trenches 43 a , 43 b in region iii are in contact with the n + substrate 1 , so that after the filling of p - type silicon into the trenches , the p - type annular columns 52 , 53 a , 53 b all pass through the n - type epitaxial layer 2 and are in contact with the n + substrate 1 , while the bottoms of the p - type pillars 51 do not pass through the n - type epitaxial layer 2 and are not in contact with the n + substrate 1 , and the distance between the bottom of any one of the p - type pillars 51 and the surface of the n + substrate 1 is greater than the thickness of the transition region in the n - type epitaxial layer 2 . wherein , the distance from the bottoms of the p - type pillars 51 to the surface of the n - type epitaxial layer 2 , namely t 1 , is 35 μm , and the thickness of the n - type epitaxial layer 2 , namely t , is 45 μm . fig5 is a cross sectional view of the superjunction device according to embodiment 3 along the line a - a in fig1 . the difference between embodiment 3 and embodiment 2 is that : in embodiment 3 , the bottoms of the two trenches 43 b at the outermost , namely closest to the outside border of the terminal protection region , are not in contact with the n + substrate 1 . the depth t 4 of the trenches 43 b , namely the distance from the bottoms of the trenches 43 b to the surface of the n - type epitaxial layer 2 , is smaller than the thickness t of the n - type epitaxial layer 2 , and is also smaller than t 2 and t 3 . after the filling of p - type silicon into the trenches , the p - type annular columns 53 b formed in the trenches 43 b have a depth smaller than that of the adjacent p - type annular column 53 a . this makes sure that the pn junction at the outermost of region iii is a graded junction , and thereby increasing the breakdown voltage at the terminal end . fig6 is a cross - sectional view of the superjunction device according to embodiment 4 along the line a - a in fig1 . the difference between embodiment 4 and embodiment 1 is that : in embodiment 4 , each p - type annular column in the terminal protection region forms a contact with the n + substrate 1 through a p - type implantation ring formed in the n - type epitaxial layer between the n + substrate and the bottom of the corresponding p - type annular column . more specifically , in this embodiment , the n - type epitaxial layer 2 is formed by a first n - type epitaxial layer 2 a and a second n - type epitaxial layer 2 b , wherein the first n - type epitaxial layer 2 a is situated at the bottom of the second n - type epitaxial layer 2 b , and the first n - type epitaxial layer 2 a has a thickness greater than or equal to the thickness of the transition region in the n - type epitaxial layer 2 . each p - type region in the terminal protection region is formed from bottom up by a p - type implantation ring and a p - type annular column ; p - type regions in the active region are formed of p - type pillars . the p - type implantation rings are formed by p - type implantation into the first n - type epitaxial layer 2 a . the p - type implantation rings include p - type implantation rings 62 , 63 a , 63 b formed in different regions , wherein the p - type implantation rings 62 are formed in region ii ; the p - type implantation rings 63 a are formed at the inner side of region iii , namely the side close to region ii ; and the p - type implantation rings 63 b are formed at the outer side of region iii . all the p - type implantation rings 62 , 63 a and 63 b are formed through the first n - type epitaxial layer 2 a and are in contact with the n + substrate 1 . the p - type impurity implanted into the p - type implantation rings 62 , 63 a and 63 b may be b , bf 2 or other p - type impurities . the p - type implantation rings 62 , 63 a and 63 b may be formed by ion implantation with an implantation energy of 5 kev to 500 kev and an implantation dose of 1e14 cm − 2 to 1e16 cm − 2 . the implantation can be performed by one - time or be performed by multiple times under different conditions . p - type pillars 51 are formed by filling a p - type impurity into the trenches 41 in region i ; p - type annular columns 52 are formed by filling a p - type impurity into the trenches 42 in region ii ; p - type annular columns 53 a are formed by filling a p - type impurity into the trenches 43 a at the inner side of region iii ; and p - type annular columns 53 b are formed by filling a p - type impurity into the trenches 43 b at the outer side of region iii ; wherein the bottoms of the p - type annular columns 52 , 53 a and 53 b all pass through the second n - type epitaxial layer 2 b and connect with the respective p - type implantation rings 62 , 63 a and 63 b to form contact with the n + substrate 1 through the p - type implantation rings 62 , 63 a and 63 b . and therefore , the p - type regions in region i are constituted by the p - type pillars 51 ; the p - type regions in region ii are constituted by the p - type annular columns 52 and the corresponding p - type implantation rings 62 ; the p - type regions in region iii are constituted by the p - type annular columns 63 a , 63 b and the corresponding p - type implantation rings 63 a , 63 b . as the bottoms of the p - type pillars 51 are separated from the surface of the n + substrate 1 by the first n - type epitaxial layer 2 a , the distance between the bottom of any one of the p - type pillars 51 and the surface of the n + substrate 1 is greater than the thickness of the transition region in the first n - type epitaxial layer 2 a . fig7 is a cross - sectional view of the superjunction device according to embodiment 5 along the line a - a in fig1 . the difference between embodiment 5 and embodiment 4 is that : in embodiment 5 , the two p - type regions at the outermost of region iii are just formed by p - type annular columns 53 b , namely the two p - type regions at the outermost of region iii do not contain the p - type implantation rings 63 b in fig6 . fig8 is a cross - sectional view of the superjunction device according to embodiment 6 along the line a - a in fig1 . the difference between embodiment 6 and embodiment 1 is that : no trenches are formed in the n - type epitaxial layer 2 ; each p - type pillar is formed by a plurality of vertically stacked p - type stripes formed in the n - type epitaxial layer 2 in the active region ; and each p - type annular column is formed by a plurality of vertically stacked p - type implantation regions formed in the n - type epitaxial layer 2 in the terminal protection region . more specifically , in this embodiment , the n - type epitaxial layer 2 is formed of a plurality of stacked n - type epitaxial layers 201 , 202 , . . . , 20 n ; the p - type pillars 51 ′ in the active region , namely in region i , are formed by a plurality of vertically stacked p - type stripes 511 , 512 , . . . ; the p - type annular columns 52 ′, 53 ′ a , 53 ′ b in the terminal protection region , namely in regions ii and iii , are formed by a plurality of vertically stacked p - type implantation regions 521 , 522 , . . . ; 531 a , 532 a , . . . ; 531 b , 532 b , . . . ; the distance between the bottom of any one of the p - type pillars 51 ′ or the p - type annular columns 52 ′, 53 ′ a , 53 ′ b and the surface of the n + substrate 1 is greater than the thickness of the transition region . the p - type pillars 51 ′ and the p - type annular columns 52 ′, 53 ′ a , 53 ′ b may be formed by ion implantation into the respective n - type epitaxial layers 201 , 202 , . . . , 20 n with an implantation energy of 5 kev to 500 kev and an implantation dose of 1e14 cm − 2 to 1e16 cm − 2 . the p - type impurity implanted into the p - type pillars 51 ′ and the p - type annular columns 52 ′, 53 ′ a , 53 ′ b may be b , bf 2 or other p - type impurities . the implantation can be carried out for one - time or for multiple times with different conditions . fig9 is a cross - sectional view of the superjunction device according to embodiment 7 along the line a - a in fig1 . the difference between embodiment 7 and embodiment 6 is that : in embodiment 7 , each of the p - type annular columns forms a contact with the n + substrate 1 through a p - type implantation ring formed in the n - type epitaxial layer 2 between the n + substrate 1 and the bottom of the corresponding p - type annular column . more specifically , in this embodiment , the p - type pillars 51 ′, namely p - type regions in region i , are formed by a plurality of stacked p - type stripes ; each of the p - type regions in regions ii and iii is formed by a p - type implantation ring 62 ′, 63 ′ a or 63 b and a corresponding p - type annular column 52 ′, 53 ′ a or 53 ′ b formed by a plurality of stacked p - type implantation regions . the p - type implantation rings 62 ′, 63 ′ a and 63 ′ b are formed in the lowest n - type epitaxial layer ( namely the n - type epitaxial layer at the bottom ) and are connected to the n + substrate 1 , so that all the p - type regions in regions ii and iii are in contact with the n + substrate 1 . fig1 is a cross - sectional view of the superjunction device according to embodiment 8 along the line a - a in fig1 . the difference between embodiment 8 and embodiment 7 is that in embodiment 8 , the p - type regions at the outermost of region iii do not include the p - type implantation rings 63 b in the lowest n - type epitaxial layer or the p - type implantation regions in the second lowest n - type epitaxial layer ( see fig9 ), so that the bottoms of the two p - type annular columns 53 b at the outermost of region iii are separated from the n + substrate 1 by a certain distance . referring to fig3 to fig5 , the method for manufacturing the superjunction devices according to embodiments 1 to 3 of the present invention includes : step 1 : form an n - type epitaxial layer 2 on an n + substrate 1 ; form p - wells 3 a in the active region , namely in region i , and a p - type ring 3 b in the terminal protection region beneath the surface of the n - type epitaxial layer 2 ; the n - type epitaxial layer 2 has a thickness t of about 45 μm ; the n + substrate 1 has a resistivity of from 0 . 001 ω · cm to 0 . 003 ω · cm ; the n + substrate 1 has a doping concentration higher than 1e19 cm − 3 . step 2 : form first trenches and second trenches in the n - type epitaxial layer 2 respectively in the active region and in the terminal protection region ; none of the first trenches in the active region is in contact with the n + substrate 1 ; the distance between the surface of the n + substrate 1 and the bottom of any one of the first trenches 41 in the active region is greater than the thickness of the transition region ; wherein the first trenches are constituted by trenches 41 in region i , which are formed in the n - type epitaxial layer 2 in the active region ; the second trenches are constituted by trenches 42 in region ii and trenches 43 a , 43 b in region iii , which are formed in the n - type epitaxial layer 2 in the terminal protection region ; none of the trenches 41 in region i is in contact with the n + substrate 1 , and the distance between the bottom of any one of the trenches 41 in region i and the surface of the n + substrate 1 is greater than the thickness t 0 of the transition region in the n - type epitaxial layer 2 , wherein t 0 is about 5 μm . as shown in fig3 , the depth t 1 of the trenches 41 in region i , the depth t 2 of the trenches 42 in region ii and the depths t 3 of the trenches 43 a , 43 b in region iii are all about 35 μm . the distances from the bottoms of trenches 41 in region i , trenches 42 in region ii and trenches 43 a , 43 b in region iii to the surface of the n + substrate 1 are all about 10 μm . the mask for producing trench patterns in the active region and in the terminal protection region during the lithography process is designed such that the widths of the trenches both in the active region and in the terminal protection region are set to a same value of 5 μm , and the intervals between adjacent trenches , namely the steppings of alternately arranged p - type and n - type regions , are set to be 10 μm . as shown in fig4 , the trenches 41 in region i have a depth t 1 of about 35 μm . the bottoms of the trenches 42 in region ii and trenches 43 a , 43 b in region iii are all in contact with the n + substrate 1 . trenches of two different depths can be achieved through a microloading effect in etching , namely by setting different lateral widths and steppings for trenches 41 in the active region ( i . e . region i ) and trenches in the terminal protection region ( i . e . regions ii and iii ) in the lithography process . for example , the lateral width and stepping of the trenches 41 in region i are respectively set to be 5 μm and 10 μm ; the lateral width and stepping of the trenches 42 in region ii and trenches 43 a , 43 b in region iii are respectively set to be 7 μm and 14 μm ; the interval between the trench at the innermost of region ii and the trench at the outermost of region i is 12 μm ; due to the microloading effect in etching , when the trenches 41 of 5 μm wide is etched to a depth of 35 μm , the depths of the trenches 42 , 43 a , 43 b of 7 μm wide have already exceeded 46 μm and have formed contact with the n + substrate 1 . as shown in fig5 , the superjunction device includes trenches of three different depths , wherein the trenches 41 in region i have a depth t 1 of about 35 μm ; the bottoms of the trenches 42 in region ii and trenches 43 a in region iii are all in contact with the n + substrate 1 , while the bottoms of the two trenches 43 b at the outermost of region iii are not in contact with the n + substrate 1 . the two trenches 43 b in region iii have a depth t 4 smaller than the depth t 2 of any one of the trenches 42 in region ii and the depth t 3 of any one of the trenches 43 a in region iii , wherein t 2 and t 3 are equal to t . trenches of three different depths can be achieved through the microloading effect in etching , namely by setting different lateral widths and steppings for trenches in the active region and trenches in the terminal protection region in the lithography process . for example , the lateral width and stepping of the trenches 41 in region i are set to be 5 μm and 10 μm , respectively ; the lateral width and stepping of the trenches 42 in region ii and trenches 43 a in region iii are set to be 7 μm and 14 μm , respectively ; the interval between the trench at the innermost of region ii and the trench at the outermost of region i is 12 μm ; the lateral width and stepping of the two outermost trenches 43 b in region iii are set to be 3 μm and 3 μm , respectively ; the interval between the outermost trench 43 a and its adjacent trench 43 b is 8 . 5 μm ; due to the microloading effect in etching , when the trenches 41 of 5 μm wide is etched to a depth of 35 μm , the depths of the trenches 42 , 43 a of 7 μm wide have already exceeded 46 μm and have formed contact with the n + substrate 1 , meanwhile , the depth of the trenches 43 b at the outermost is merely 20 μm , so that the pn junction at the outermost will be a graded junction , thereby increasing the breakdown voltage of the device at the terminal end . step 3 : fill the trenches 41 in region i with a p - type silicon to form p - type pillars 51 ; fill the trenches 42 in region ii and trenches 43 a , 43 b in region iii with a p - type silicon to form p - type annular columns 52 , 53 a and 53 b ; and then remove the silicon above the surface of the n - type epitaxial layer 2 to form alternately arranged p - type and n - type regions both in the active region and in the terminal protection region , wherein the p - type regions include the p - type pillars 51 and the p - type annular columns 52 , 53 a and 53 b . step 4 : deposit a dielectric film and remove part of the dielectric film in region i by lithography and etch to form a terminal dielectric film 6 in the terminal protection region , wherein the terminal dielectric film 6 has a step structure 6 a at the side near the active region ; deposit another dielectric film to form a second dielectric layer 7 b in the terminal protection region by lithography and etch , wherein the second dielectric layer 7 b is formed on the n - type epitaxial layer 2 between the outside border of the active region and the step structure 6 a ; the second dielectric layer 7 b has a thickness greater than the gate oxide 7 a to be formed in subsequent process ; the second dielectric layer 7 b at least covers the central region of the p - type regions covered by the polysilicon field plate 8 b to be formed in subsequent process ; in fig3 to fig5 , the second dielectric layer 7 b covers all the p - type annular columns 52 in region ii . step 5 : form a gate oxide 7 a and a polysilicon layer in sequence on the structure after steps 1 to 4 , namely on the second dielectric layer 7 b , the terminal dielectric film 6 and the p - type and n - type regions not covered by the second dielectric layer 7 b or the terminal dielectric film 6 ; form polysilicon gates 8 a in the active region and at least one polysilicon field plate 8 b in the terminal protection region by etching the polysilicon layer . the polysilicon field plate 8 b covers the entire step structure 6 a and a part of the terminal dielectric film 6 and extends above the n - type epitaxial layer 2 between the outside border of the active region and the step structure 6 a . the extension part of the polysilicon field plate 8 b covers one or more p - type regions , namely the p - type annular columns 52 in region ii . the bottom of the polysilicon field plate 8 b is isolated from the n - type epitaxial layer 2 by the gate oxide 7 a and the second dielectric layer 7 b . step 6 : form source regions 11 and a channel stopper 21 by lithography and ion implantation . step 7 : deposit an inter layer film 9 . step 8 : form contact holes 10 by lithography and etch . step 9 : form ohmic contacts 12 between the p - wells 3 a and the metal layer 13 to be formed in subsequent process by p + ion implantation . step 10 : deposit a metal layer 13 on the above structure and form a source electrode , a drain electrode and a plurality of metal field plates 13 a , 13 b by lithography and etch . the metal field plates 13 a and 13 b are formed on the inter layer film 9 respectively above the p - type ring 3 b and above the p - type annular columns 23 , namely the p - type annular columns 52 , 53 a and 53 b , wherein the metal field plate 13 a covers the entire step structure 6 a . when no metal field plates 13 a and 13 b are arranged in regions ii and iii , the step of forming metal field plates 13 a and 13 b can be omitted . step 11 : perform backside grinding to reduce the thickness of the n + substrate 1 . step 12 : deposit a metal layer 14 on the backside of the n + substrate 1 and form a drain electrode . referring to fig6 and fig7 , the method for manufacturing the superjunction devices according to embodiments 4 and 5 of the present invention includes : step 1 : form a first n - type epitaxial layer 2 a on an n + substrate 1 , wherein the first n - type epitaxial layer 2 a has a thickness greater than or equal to the thickness t 0 of the transition region in the first n - type epitaxial layer 2 a , wherein t 0 is 5 μm ; the n + substrate 1 has a resistivity of from 0 . 001 ω · cm to 0 . 003 ω · cm and a doping concentration higher than 1e19 cm − 3 ; implant a p - type impurity into the first n - type epitaxial layer 2 a in the terminal protection region to form a plurality of p - type implantation rings in contact with the n + substrate 1 , wherein the p - type impurity may be b , bf 2 or other p - type impurities ; the p - type implantation rings may be formed by ion implantation with an implantation energy of 5 kev to 500 kev and an implantation dose of 1e14 cm − 2 to 1e16 cm − 2 ; the implantation may be performed by one - time or by multiple times with different conditions . as shown in fig6 , p - type implantation rings 62 , 63 a and 63 b are formed in regions ii and iii ; no p - type implantation ring is formed in region i . wherein , the p - type implantation rings 62 are formed in region ii ; the p - type implantation rings 63 a are formed at the inner side of region iii , namely the side close to region ii ; and the p - type implantation rings 63 b are formed at the outer side of region iii . all the p - type implantation rings 62 , 63 a and 63 b are formed through the first n - type epitaxial layer 2 a and are in contact with the n + substrate 1 . as shown in fig7 , no p - type implantation ring is formed in region i and the outer side of region iii , namely the side far from region ii ; p - type implantation rings are formed in both region ii and at the inner side of region iii , namely the side close to region ii , so that only p - type implantation rings 62 and 63 a in region ii and at the inner side of region iii exist . step 2 : form a second n - type epitaxial layer 2 b on the first n - type epitaxial layer 2 a , wherein the first n - type epitaxial layer 2 a and the second n - type epitaxial layer 2 b constitute the n - type epitaxial layer 2 ; the thickness of the n - type epitaxial layer 2 maintains to be about 45 μm ; form p - wells 3 a in the active region and a p - type ring 3 b in the terminal protection region beneath the surface of the second n - type epitaxial layer 2 b ; form first trenches 41 and second trenches 42 , 43 a , 43 b in the second n - type epitaxial layer 2 b respectively in the active region and in the terminal protection region , wherein none of the first trenches 41 in the active region is in contact with the n + substrate 1 , and the distance between the bottom of any one of the first trenches 41 in the active region and the surface of the n + substrate 1 is greater than the thickness of the transition region in the first n - type epitaxial layer 2 a . the number of the second trenches 42 , 43 a , 43 b in the terminal protection region is greater than or equal to the number of the p - type implantation rings ( in fig6 , the number of the second trenches 42 , 43 a and 43 b is equal to the number of the p - type implantation rings 62 , 63 a and 63 b ; in fig7 , the number of the second trenches 42 , 43 a and 43 b is greater than the number of the p - type implantation rings 62 and 63 a ). each p - type implantation ring has a second trench formed above it with the bottom of the second trench contacting with it , namely in fig6 , each of the p - type implantation rings 62 , 63 a , 63 b has a corresponding trench 42 , 43 a , 43 b formed above it and connecting to it ; in fig7 , each of the p - type implantation rings 62 , 63 a has a corresponding trench 42 , 43 a formed above it and connecting to it . in the case that the number of second trenches is greater than that of the p - type implantation rings , namely in the case as shown in fig7 , all those trenches 43 b not in contact with p - type implantation rings are situated at the outermost of the terminal protection region ; the bottom of these trenches 43 b are not in contact with the n + substrate 1 , and the distance between the bottoms of the trenches 43 b and the surface of the n + substrate 1 is greater than the thickness of the transition region in the first n - type epitaxial layer 2 a . wherein , the first trenches in the active region include the trenches 41 formed in region i ; the second trenches 42 in the terminal protection region include the trenches 42 in region ii and the trenches 43 a , 43 b in region iii . as shown in fig6 , the bottom of each of the trenches 42 in region ii or trenches 43 a , 43 b in region iii is in contact with a p - type implantation ring , namely in contact with the corresponding p - type implantation ring 62 , 63 a or 63 b . since no p - type implantation rings are formed at the bottoms of the trenches 41 in region i , the bottoms of the trenches 41 in region i are not in contact with the n + substrate 1 . as shown in fig7 , the bottom of each of the trenches 42 in region ii or trenches 43 a in region iii is in contact with a p - type implantation ring , namely in contact with the corresponding p - type implantation ring 62 or 63 a . since no p - type implantation rings are formed at the bottoms of the trenches 41 in region i , the bottoms of the trenches 41 in region i are not in contact with the n + substrate 1 . since no p - type implantation rings 63 b are formed , the bottoms of the trenches 43 b in region iii are not in contact with the n + substrate 1 . step 3 : fill the trenches 41 in the active region with a p - type silicon to form p - type pillars 51 , and fill the trenches 42 , 43 a , 43 b in the terminal protection region with a p - type silicon to form p - type annular columns 52 , 53 a , 53 b . p - type regions are formed by p - type annular columns and the corresponding p - type implantation rings connected to the bottom of the p - type annular columns at wherever p - type implantation rings are formed ; p - type regions are formed by p - type annular columns only at wherever no p - type implantation rings are formed . thereby , alternately arranged p - type and n - type regions are formed in the active region and in the terminal protection region . step 4 : deposit a dielectric film and remove part of the dielectric film in region i by lithography and etch to form a terminal dielectric film 6 in the terminal protection region , wherein the terminal dielectric film 6 has a step structure 6 a at the side near the active region ; deposit another dielectric film to form a second dielectric layer 7 b in the terminal protection region by lithography and etch , wherein the second dielectric layer 7 b is formed on the n - type epitaxial layer 2 between the outside border of the active region and the step structure 6 a ; the second dielectric layer 7 b has a thickness greater than the gate oxide 7 a to be formed in subsequent process ; the second dielectric layer 7 b at least covers the central region of the p - type regions covered by the polysilicon field plate 8 b to be formed in subsequent process ; in fig6 and fig7 , the second dielectric layer 7 b covers all the p - type annular columns 52 in region ii . step 5 : form a gate oxide 7 a and a polysilicon layer in sequence on the structure after steps 1 to 4 , namely on the second dielectric layer 7 b , the terminal dielectric film 6 and the p - type and n - type regions not covered by the second dielectric layer 7 b or the terminal dielectric film 6 ; form polysilicon gates 8 a in the active region and at least one polysilicon field plate 8 b in the terminal protection region by etching the polysilicon layer . the polysilicon field plate 8 b covers the entire step structure 6 a and a part of the terminal dielectric film 6 and extends above the n - type epitaxial layer 2 between the outside border of the active region and the step structure 6 a . the extension part of the polysilicon field plate 8 b covers one or more p - type regions , namely the p - type annular columns 52 in region ii . the bottom of the polysilicon field plate 8 b is isolated from the n - type epitaxial layer 2 by the gate oxide 7 a and the second dielectric layer 7 b . step 6 : form source regions 11 and a channel stopper 21 by lithography and ion implantation . step 7 : deposit an inter layer film 9 . step 8 : form contact holes 10 by lithography and etch . step 9 : form ohmic contacts 12 between the p - wells 3 a and the metal layer 13 to be formed in subsequent process by p + ion implantation . step 10 : deposit a metal layer 13 on the above structure and form a source electrode , a drain electrode and a plurality of metal field plates 13 a , 13 b by lithography and etch . the metal field plates 13 a and 13 b are formed on the inter layer film 9 respectively above the p - type ring 3 b and above the p - type annular columns 23 , namely the p - type annular columns 52 , 53 a and 53 b , wherein the metal field plate 13 a covers the entire step structure 6 a . since the metal field plates 13 a and 13 b may be omitted in regions ii and iii , when no metal field plates 13 a and 13 b are arranged , the step of forming metal field plates 13 a and 13 b can be omitted . step 11 : perform backside grinding to reduce the thickness of the n + substrate 1 . step 12 : deposit a metal layer 14 on the backside of the n + substrate 1 and form a drain electrode . referring to fig8 , the method for manufacturing the superjunction device according to embodiment 6 of the present invention includes : step 1 : form a first n - type epitaxial layer 201 on an n + substrate 1 , wherein the first n - type epitaxial layer 201 has a thickness of 18 μm , which is greater than the thickness of the transition region in the first n - type epitaxial layer ( 5 μm ); the n + substrate 1 has a resistivity of from 0 . 001 ω · cm to 0 . 003 ω · cm and a doping concentration higher than 1e19 cm - 3 ; implant a p - type impurity into the first n - type epitaxial layer 201 to form a plurality of first p - type stripes 511 in the active region and a plurality of first p - type implantation regions 521 , 531 a and 531 b surrounding the active region in the terminal protection region , wherein none of the p - type stripes 511 or the first p - type implantation regions 521 , 531 a and 531 b are in contact with the n + substrate ; the distance between the bottom of any one of the p - type stripes 511 or the first p - type implantation regions 521 , 531 a , 531 b and the surface of the n + substrate is greater than the thickness of the transition region in the first n - type epitaxial layer 201 . step 2 : form a second n - type epitaxial layer 202 having a thickness of 7 μm on the first n - type epitaxial layer 201 ; implant a p - type impurity into the second n - type epitaxial layer 202 to form a plurality of second p - type stripes 512 in the active region and a plurality of second p - type implantation regions 522 , 532 a and 532 b surrounding the active region in the terminal protection region . the number of the second p - type stripes 512 is equal to the number of the first p - type stripes 511 ; each second p - type stripe 512 is vertically aligned with a first p - type stripe 511 and is in contact with the corresponding first p - type stripe 511 . the number of the second p - type implantation regions 522 , 532 a and 532 b is equal to the number of the first p - type implantation regions 521 , 531 a and 531 b ; each second p - type implantation region 522 , 532 a , 532 b is vertically aligned with a first p - type implantation regions 521 , 531 a , 531 b and is in contact with the corresponding first p - type implantation region . step 3 : form a third to an n - th n - type epitaxial layer 203 ˜ 20 n ( n is a natural number ) on the second n - type epitaxial layer 202 in sequence and form p - type stripes and p - type implantation regions in the respective n - type epitaxial layers 203 ˜ 20 n until the total thickness of the n - type epitaxial layer 2 formed by the respective n - type epitaxial layers 201 ˜ 20 n meets the requirement of the process . in embodiment 6 , the total thickness t of the n - type epitaxial layer 2 is 45 μm , so that step 2 can be repeated for three times to form n - type epitaxial layers 203 , 204 and 205 ( reference numbers not shown in fig8 ); the thicknesses of the n - type epitaxial layers 203 , 204 and 205 may be 7 μm , 7 μm and 6 μm , respectively . the p - type stripes in the respective n - type epitaxial layers 201 ˜ 20 n ( n = 5 ) are connected from bottom up to form p - type pillars 51 ′, and the p - type implantation regions in the respective n - type epitaxial layers 201 ˜ 20 n ( n = 5 ) are connected from bottom up to form p - type annular columns 52 ′, 53 ′ a and 53 b , thereby forming alternately arranged p - type and n - type regions both in the active region and in the terminal protection region . as shown in fig8 , the p - type pillars 51 ′ in region i are stacked by the respective p - type stripes 511 , 512 , . . . in the n - type epitaxial layer 2 ; the p - type annular columns 52 ′ in region ii and the p - type annular columns 53 ′ a , 53 ′ b in region iii are stacked by the respective p - type implantation regions 521 , 522 , . . . ; 531 a , 532 a , . . . ; and 531 b , 532 b , . . . in the n - type epitaxial layer 2 . the depth of the p - type pillars 51 ′ in region i is t 1 ; the depth of the p - type annular columns 52 ′ in region ii is t 2 ; the depths of the p - type annular columns 53 ′ a and 53 ′ b in region iii are respectively t 3 and t 4 ; all of t 1 ˜ t 4 are more than 5 μm smaller than the total thickness t of the n - type epitaxial layer 2 . step 4 : form p - wells 3 a in the active region and a p - type ring 3 b in the terminal protection region beneath the surface of the n - th ( in embodiment 6 , n = 5 ) n - type epitaxial layer . step 5 : deposit a dielectric film and remove part of the dielectric film in region i by lithography and etch to form a terminal dielectric film 6 in the terminal protection region , wherein the terminal dielectric film 6 has a step structure 6 a at the side near the active region ; deposit another dielectric film to form a second dielectric layer 7 b in the terminal protection region by lithography and etch , wherein the second dielectric layer 7 b is formed on the n - type epitaxial layer 2 between the outside border of the active region and the step structure 6 a ; the second dielectric layer 7 b has a thickness greater than the gate oxide 7 a to be formed in subsequent process ; the second dielectric layer 7 b at least covers the central region of the p - type regions covered by the polysilicon field plate 8 b to be formed in subsequent process ; in fig8 , the second dielectric layer 7 b covers all the p - type annular columns 52 ′ in region ii . step 6 : form a gate oxide 7 a and a polysilicon layer in sequence on the structure after steps 1 to 5 , namely on the second dielectric layer 7 b , the terminal dielectric film 6 and the p - type and n - type regions not covered by the second dielectric layer 7 b or the terminal dielectric film 6 ; form polysilicon gates 8 a in the active region and at least one polysilicon field plate 8 b in the terminal protection region by etching the polysilicon layer . the polysilicon field plate 8 b covers the entire step structure 6 a and a part of the terminal dielectric film 6 and extends above the n - type epitaxial layer 2 between the outside border of the active region and the step structure 6 a . the extension part of the polysilicon field plate 8 b covers one or more p - type regions , namely the p - type annular columns 52 ′ in region ii . the bottom of the polysilicon field plate 8 b is isolated from the n - type epitaxial layer 2 by the gate oxide 7 a and the second dielectric layer 7 b . step 7 : form source regions 11 and a channel stopper 21 by lithography and ion implantation . step 8 : deposit an inter layer film 9 . step 9 : form contact holes 10 by lithography and etch . step 10 : form ohmic contacts 12 between the p - wells 3 a and the metal layer 13 to be formed in subsequent process by p + ion implantation . step 11 : deposit a metal layer 13 on the above structure and form a source electrode , a drain electrode and a plurality of metal field plates 13 a , 13 b by lithography and etch . the metal field plates 13 a and 13 b are formed on the inter layer film 9 respectively above the p - type ring 3 b and above the p - type annular columns 23 , namely the p - type annular columns 52 ′, 53 ′ a and 53 ′ b , wherein the metal field plate 13 a covers the entire step structure 6 a . since the metal field plates 13 a and 13 b may be omitted in regions ii and iii , when no metal field plates 13 a and 13 b are arranged , the step of forming metal field plates 13 a and 13 b can be omitted . step 12 : perform backside grinding to reduce the thickness of the n + substrate 1 . step 13 : deposit a metal layer 14 on the backside of the n + substrate 1 and form a drain electrode . referring to fig9 and fig1 , the method for manufacturing the superjunction devices according to embodiments 7 and 8 of the present invention includes : step 1 : form a first n - type epitaxial layer on an n + substrate 1 , wherein the first n - type epitaxial layer has a thickness of 10 μm , which is greater than or equal to the thickness of the transition region in the first n - type epitaxial layer ( 5 μm ); the n + substrate 1 has a resistivity of from 0 . 001 ω · cm to 0 . 003 ω · cm and a doping concentration higher than 1e19 cm − 3 ; implant a p - type impurity into the first n - type epitaxial layer to form a plurality of p - type implantation rings surrounding the active region and contacting with the n + substrate 1 , wherein the p - type impurity may be b , bf 2 or other p - type impurities ; the p - type implantation rings may be formed by ion implantation with an implantation energy of 5 kev to 500 kev and an implantation dose of 1e14 cm − 2 to 1e16 cm − 2 ; the implantation may be performed by one - time or by multiple times with different conditions . as shown in fig9 , p - type implantation rings are defined and formed in regions ii and iii , while no p - type implantation rings are defined in region i , wherein p - type implantation rings 62 ′ are formed in region ii ; p - type implantation rings 63 ′ a are formed at the inner side of region iii , namely the side close to region ii ; p - type implantation rings 63 b are formed at the outer side of region iii . the p - type implantation rings 62 ′, 63 ′ a and 63 b are all formed through the first n - type epitaxial layer and are in contact with the n + substrate 1 . as shown in fig1 , no p - type implantation rings are defined in region i and at the outer side of region iii , namely the side far from region ii , while p - type implantation rings 62 ′ and 63 ′ a are formed in region ii and at the inner side of region iii . step 2 : form a second n - type epitaxial layer having a thickness of 8 μm on the first n - type epitaxial layer ; implant a p - type impurity into the second n - type epitaxial layer to form a plurality of first p - type stripes in the active region and a plurality of first p - type implantation regions surrounding the active region in the terminal protection region , wherein none of the first p - type stripes in the active region is in contact with the n + substrate 1 ; the distance between the bottom of any one of the first p - type stripes and the surface of the n + substrate 1 is greater than the thickness of the transition region in the first n - type epitaxial layer . the number of the first p - type implantation regions in the terminal protection region is equal to the number of the p - type implantation rings ; each first p - type implantation region is connected to the n + substrate 1 through the corresponding p - type implantation ring . the p - type impurity may be b , bf 2 or other p - type impurities ; the first p - type stripes and the first p - type implantation regions may be formed by ion implantation with an implantation energy of 5 kev to 500 kev and an implantation dose of 1e14 cm − 2 to 1e16 cm − 2 ; the implantation can be performed by one - time or by multiple times with different conditions . as shown in fig9 , the first p - type stripes are formed in the second n - type epitaxial layer in region i , and the first p - type implantation regions are formed in the second n - type epitaxial layer in both regions ii and iii . the bottoms of the first p - type stripes in region i are separated from the n + substrate 1 by a distance greater than the thickness of the transition region in the first n - type epitaxial layer , wherein the thickness of the transition region is 5 μm . the first p - type implantation regions in regions ii and iii are in contact with the n + substrate 1 through the p - type implantation rings 62 ′, 63 ′ a and 63 ′ b formed in the layer under the first p - type implantation regions . as shown in fig1 , the first p - type stripes are formed in the second n - type epitaxial layer in region i . the first p - type implantation regions are formed in the second n - type epitaxial layer in region ii and at the inner side of region iii ; no first p - type implantation regions are formed at the outer side of region iii . the bottoms of the p - type stripes in region i are separated from the n + substrate 1 by a distance greater than the thickness of the transition region in the first n - type epitaxial layer , wherein the thickness of the transition region is 5 μm . the first p - type implantation regions in region ii and at the inner side of region iii are in contact with the n + substrate 1 through the p - type implantation rings 62 ′ and 63 ′ a formed in the layer under the first p - type implantation regions . step 3 : form a third n - type epitaxial layer having a thickness of 7 μm on the second n - type epitaxial layer ; implant a p - type impurity into the third n - type epitaxial layer to form a plurality of second p - type stripes in the active region and a plurality of second p - type implantation regions surrounding the active region in the terminal protection region , wherein the number of the second p - type stripes is equal to the number of the first p - type stripes ; each second p - type stripe is vertically aligned with a first p - type stripe and is in contact with the corresponding first p - type stripe ; the number of the second p - type implantation regions is greater than or equal to the number of the first p - type implantation regions ; each first p - type implantation region has a second p - type implantation region formed above it with the bottom of the second p - type implantation region contacting with it . in the case that the number of the second p - type implantation regions is greater than the number of the first p - type implantation regions , those second p - type implantation regions not in contact with first p - type implantation regions are all situated at the outermost of the terminal protection region and are separated from the n + substrate 1 by a distance greater than the thickness of the transition region in the first n - type epitaxial layer . the p - type impurity may be b , bf 2 or other p - type impurities ; the first p - type stripes and the first p - type implantation regions may be formed by ion implantation with an implantation energy of 5 kev to 500 kev and an implantation dose of 1e14 cm − 2 to 1e16 cm − 2 ; the implantation can be performed by one - time or by multiple times with different conditions . as shown in fig9 , the second p - type stripes are formed in the third n - type epitaxial layer in region i , and the second p - type implantation regions are formed in the third n - type epitaxial layer in both regions ii and iii . each of the second p - type stripes is vertically aligned with a first p - type stripe and is in contact with the corresponding first p - type stripe ; each of the second p - type implantation regions is vertically aligned with a first p - type implantation region and is in contact with the corresponding first p - type implantation region . as shown in fig1 , the second p - type stripes are formed in the third n - type epitaxial layer in region i , and the second p - type implantation regions are formed in the third n - type epitaxial layer in both regions ii and iii . each of the second p - type stripes is vertically aligned with a first p - type stripe and is in contact with the corresponding first p - type stripe . each of the second p - type implantation regions in region ii and at the inner side of region iii is vertically aligned with a first p - type implantation region and is in contact with the corresponding first p - type implantation region , while the bottoms of the second p - type implantation regions at the outer side of region iii are not in contact with any one of the first p - type implantation regions ; the distance between the bottoms of the second p - type implantation regions at the outer side of region iii and the surface of the n + substrate 1 is greater than the thickness of the transition region in the first n - type epitaxial layer . step 4 : form a fourth to an n - th n - type epitaxial layer on the third n - type epitaxial layer in sequence , and form p - type stripes and p - type implantation regions in the respective n - type epitaxial layers until the total thickness of the n - type epitaxial layer 2 formed by the respective n - type epitaxial layers meets the requirement of the process . in embodiments 7 and 8 , the total thickness t of the n - type epitaxial layer 2 is 45 μm , so that step 3 can be repeated for three times to form the fourth to the sixth n - type epitaxial layers ; the thicknesses of the fourth to the sixth n - type epitaxial layers may be 7 μm , 7 μm and 6 μm , respectively . the p - type stripes in the respective n - type epitaxial layers are connected from bottom up to form the p - type pillars 51 ′, and the p - type implantation regions in the respective n - type epitaxial layers are connected from bottom up to form p - type annular columns 52 ′, 53 ′ a and 53 b , wherein the p - type annular columns 52 ′, 53 ′ a and 53 ′ b may form contact with the n + substrate 1 through the corresponding p - type implantation rings 62 ′, 63 ′ a and 63 ′ b formed under them , thereby forming alternately arranged p - type and n - type regions both in the active region and in the terminal protection region . as shown in fig9 , each of the p - type regions in region i is constituted by a p - type pillar 51 ′ stacked by the p - type stripes in the respective layers ; each of the p - type regions in region ii is constituted by a p - type annular column 52 ′ stacked by the p - type implantation regions in the respective layers and the corresponding p - type implantation ring 62 ′ formed below the p - type annular column 52 ′; each of the p - type regions at the inner side of region iii is constituted by a p - type annular column 53 ′ a stacked by the p - type implantation regions in the respective layers and the corresponding p - type implantation ring 63 ′ a formed below the p - type annular column 53 ′ a ; each of the p - type regions at the outer side of region iii is constituted by a p - type annular column 53 ′ b stacked by the p - type implantation regions in the respective layers and the corresponding p - type implantation ring 63 ′ b formed below the p - type annular column 53 b . as shown in fig1 , each of the p - type regions in region i is constituted by a p - type pillar 51 ′ stacked by the p - type stripes in the respective layers ; each of the p - type regions in region ii is constituted by a p - type annular column 52 ′ stacked by the p - type implantation regions in the respective layers and the corresponding p - type implantation ring 62 ′ formed below the p - type annular column 52 ′; each of the p - type regions at the inner side of region iii is constituted by a p - type annular column 53 ′ a stacked by the p - type implantation regions in the respective layers and the corresponding p - type implantation ring 63 ′ a formed below the p - type annular column 53 ′ a ; each of the p - type regions at the outer side of region iii is constituted by a p - type annular column 53 ′ b stacked by the p - type implantation regions in the respective layers . step 5 : form p - wells 3 a in the active region and a p - type ring 3 b in the terminal protection region beneath the surface of the n - th ( in embodiments 7 and 8 , n = 6 ) n - type epitaxial layer . step 6 : deposit a dielectric film and remove part of the dielectric film in region i by lithography and etch to form a terminal dielectric film 6 in the terminal protection region , wherein the terminal dielectric film 6 has a step structure 6 a at the side near the active region ; deposit another dielectric film to form a second dielectric layer 7 b in the terminal protection region by lithography and etch , wherein the second dielectric layer 7 b is formed on the n - type epitaxial layer 2 between the outside border of the active region and the step structure 6 a ; the second dielectric layer 7 b has a thickness greater than the gate oxide 7 a to be formed in subsequent process ; the second dielectric layer 7 b at least covers the central region of the p - type regions covered by the polysilicon field plate 8 b to be formed in subsequent process ; in fig9 and fig1 , the second dielectric layer 7 b covers all the p - type annular columns 52 ′ in region ii . step 7 : form a gate oxide 7 a and a polysilicon layer in sequence on the structure after steps 1 to 6 , namely on the second dielectric layer 7 b , the terminal dielectric film 6 and the p - type and n - type regions not covered by the second dielectric layer 7 b or the terminal dielectric film 6 ; form polysilicon gates 8 a in the active region and at least one polysilicon field plate 8 b in the terminal protection region by etching the polysilicon layer . the polysilicon field plate 8 b covers the entire step structure 6 a and a part of the terminal dielectric film 6 and extends above the n - type epitaxial layer 2 between the outside border of the active region and the step structure 6 a . the extension part of the polysilicon field plate 8 b covers one or more p - type regions , namely the p - type annular columns 52 ′ in region ii . the bottom of the polysilicon field plate 8 b is isolated from the n - type epitaxial layer 2 by the gate oxide 7 a and the second dielectric layer 7 b . step 8 : form source regions 11 and a channel stopper 21 by lithography and ion implantation . step 10 : form contact holes 10 by lithography and etch . step 11 : form ohmic contacts 12 between the p - wells 3 a and the metal layer 13 to be formed in subsequent process by p + ion implantation . step 12 : deposit a metal layer 13 on the above structure and form a source electrode , a drain electrode and a plurality of metal field plates 13 a , 13 b by lithography and etch . the metal field plates 13 a and 13 b are formed on the inter layer film 9 respectively above the p - type ring 3 b and above the p - type annular columns 23 , namely the p - type annular columns 52 ′, 53 ′ a and 53 b , wherein the metal field plate 13 a covers the entire step structure 6 a . since the metal field plates 13 a and 13 b may be omitted in regions ii and iii , when no metal field plates 13 a and 13 b are arranged , the step of forming metal field plates 13 a and 13 b can be omitted . step 13 : perform backside grinding to reduce the thickness of the n + substrate 1 . step 14 : deposit a metal layer 14 on the backside of the n + substrate 1 and form a drain electrode . although the present invention has been described in considerable detail with reference to certain preferred embodiments thereof , the disclosure is not for limiting the scope of the present invention . persons having ordinary skill in the art may make various modifications and changes without departing from the scope and spirit of the present invention . therefore , the scope of the appended claims should not be limited to the description of the preferred embodiments described above .
| 7 |
fig1 shows a block diagram of a communication network , which includes a transmission chain 100 . transmission chain 100 may be comprised of a boarder router 110 , a qos enforcer 120 , one or more data processors 130 a to 130 n , an encapsulation function or an encapsulation device 140 , and a modulator 150 . furthermore , as transmission chain 100 may be a part of a communication network , fig1 also shows a network controller 160 and a front end unit 190 . boarder router 110 may be configured to allow only selected traffic to enter the transmission chain , such as traffic destined to one or more receiving parties at the other end of the transmission channel . qos enforcer 120 may be configured to at least provide flow control functionality by limiting the total data rate sent towards data processors 130 a to 130 n and thereafter towards encapsulation function 140 . in some embodiments , qos enforcer 120 may be replaced by a traffic engineering device or a traffic shaping device , which perform similar flow control functions . one or more data processors 130 a to 130 n may be configured to receive user data and process it using one or more methods and / or algorithms , including but not limited to encryption algorithms , compression algorithms , acceleration methods and any other method which may be applicable for optimizing user traffic over the transmission link . furthermore , data processors 130 a to 130 n may be configured to send the processed data towards encapsulating device 140 , e . g . over an ip protocol . in some embodiments , one or more tcp and / or udp tunnels may be used by each data processor in order to transfer different types of data ( e . g . real - time information , multicast streams , non - real - time data , etc ). encapsulation device 140 may be configured to at least receive user data information ( e . g . over an ip protocol using one or more tcp and / or udp tunnels ), encapsulate it over an applicable transport stream ( e . g . baseband frames for a dvb - s2 carrier in a satellite communication system ) and provide the transport stream to modulator 150 . modulator 150 may be configured to at least modulate the transport stream using the applicable modulation technique and to output a modulated signal . though fig1 shows encapsulation device 140 and modulator 150 as two different entities or devices , in some embodiments the encapsulation function may be integrated with the modulator in a single device . both types of embodiments are consistent with the aspects of this invention . furthermore , in some embodiments , where no processing of the user data prior to transmission is required , data processors 130 a to 130 n may be either bypassed or absent from the transmission chain . in such embodiments , user data may be sent from qos enforcer 120 directly to encapsulation device 140 . this type of embodiments is also consistent with the aspects of this invention . in yet further embodiments , the output of modulator 150 may be fed into a front - end 190 , which may be configured to do any one or more of amplifying the modulated signal , changing the signal &# 39 ; s carrier frequency , converting the signal to a different form ( e . g . form electric form to electro - magnetic form or to optic form ) and any other function which may be required in order to actually have the signal transmitted over the designated media . in some communication systems , modulator 150 and encapsulation device 140 may be configured to use one or more adaptive transmission techniques ( e . g . dvb - s2 in satellite communication systems ), whereby the spectral efficiency of the modulated signal may be modified on a frame - by - frame basis . if a receiving station has good reception conditions ( i . e . the transmitted signal is received at high c / n ratio ), modulator 150 may be indicated to modulate the data destined to that station using a modulation technique , which maps more bits into each transmitted symbol . furthermore , encapsulation device 140 may be indicated in such a case to encode said data using weaker forward error correction ( fec ) codes for at least the purpose of decreasing the number of transmitted bits used for fec . on the other hand , if a receiving station has medium or poor reception conditions ( i . e . the transmitted signal is received at low or minimal c / n ratio respectively ), modulator 150 may be indicated to modulate the data destined to that station using a modulation technique , which maps less bits into each transmitted symbol . furthermore , encapsulation device 140 may be indicated in such a case to use stronger fec codes , which may impose higher overhead but also increase the probability of recovering the transmitted data at the receiving side . in some embodiments , a network controller ( e . g . network controller 160 ) may be configured to send and data processors 130 a to 130 n may be configured to receive information regarding a most efficient modcod combination that may be supported by a receiving party . data processors 130 a to 130 n may be further configured to attach modcod information received from the network controller to every data packet sent towards encapsulation device 140 , wherein said modulation and coding ( modcod ) information relates to the receiving party which the data included in the transmitted packet is destined for . in yet further embodiments , where data processors are not used , modcod information may be sent from the network controller to encapsulation device 140 , which may be further configured to use the appropriate modcod information based on destination analysis . each modcod combination , as described above , may be characterized by a different spectral efficiency figure , i . e . different number of user bits per transmitted symbol . since modcod adaptability may be implemented on a frame - by - frame basis and since modulator 150 , in most cases , may be configured to transmit at a constant preconfigured symbol rate , the channel &# 39 ; s throughput depends on the number of frames transmitted using each modcod combination . throughput may be higher as more frames are transmitted using more efficient modcod combinations , or lower as more frames are transmitted using more robust and less efficient modcod combinations . in one aspect of this invention , encapsulation device 140 may be configured to calculate an average spectral efficiency figure for the transmission channel and thereafter use this average spectral efficiency figure for calculating the available user data throughput or bit rate . encapsulation device 140 may be configured to measure the actual user data throughput , e . g . by counting and / or calculating the number of user traffic bits or bytes being transmitted over a period of time . encapsulation device 140 may be further configured to gather information on the current blend of modcod combinations , which may be used for transmitting the same user data traffic over the same period of time . as previously described , modcod information may be attached to each data packet arriving from the data processors or internally generated by encapsulation device 140 based on information received from a network controller . using this modcod information , encapsulation device 140 may calculate the number of user traffic bits or bytes that were transmitted using each modcod combination . having measured the actual user throughput and determining how many user traffic bits or bytes have been transmitted using each modcod combination , encapsulation device 140 may calculate the average spectral efficiency for the transmitted data . furthermore , knowing the preconfigured channel ( symbol ) rate , encapsulation device 140 may be configured to calculate the number of unused symbols ( which may be filled either by modulator 150 with dummy frames or by encapsulation device 140 with null packets ). knowing the number of unused symbols per the measurement interval , encapsulation device 140 may further be configured to calculate the user traffic bit rate or throughput that may be accommodated by these unused symbols assuming the average spectral efficiency previously calculated is applicable to these symbols as well . the above mechanism may be further described using the following example . considering the following traffic being transmitted : port # 1 of encapsulation device 140 may receive user traffic at a rate of 250 kbytes per second ( 2 mbps ), out of which 100 kbytes per second are transmitted using a qpsk 5 / 6 modcod combination and the remaining 150 kbytes per second are transmitted using an 8psk 2 / 3 modcod option . port # 2 of encapsulation device 140 may receive user traffic at a rate of 250 kbytes per second ( 2 mbps ), all of which is transmitted using an 8psk 2 / 3 modcod option . encapsulation device 140 generates 1 mbps worth of null packets , which are transmitted using a qpsk1 / 4 modcod combination . considering only the user traffic on ports # 1 and # 2 , and given that the spectral efficiency figures for qpsk 5 / 6 is 1 . 654663 and that of 8psk 2 / 3 is 1 . 980636 , the average spectral efficiency may be calculated as follows : in addition , given a spectral efficiency figure of 0 . 490243 for the qpsk1 / 4 modcod combination and the average spectral efficiency for user traffic as calculated above , the available bandwidth represented by the null packets may be calculated as follows : in another aspect of this invention , a feedback path may exist between encapsulation device 140 and qos enforcer 120 . encapsulation device 140 may be configured to use this feedback path for at least the purpose of sending the calculated available bit rate to qos enforcer 120 . though there might be many appropriate methods for sending the available bit rate information to qos enforcer 120 , in some preferred embodiments this information may be encapsulated into an snmp trap packet , which may be transmitted over a local lan to which both devices may be connected . furthermore , qos enforcer 120 may be configured to receive available bit rate information over a feedback channel and to reconfigure any of its internal software and / or hardware modules for at least the purpose of regulating its output bit rate according to the received available bit rate information . in some embodiments , qos enforcer 120 may first serve preconfigured service level agreements ( sla ) and high priority applications and only then allocate the remaining throughput to other applications , streams and / or traffic types . thus , changes in the transmission channel &# 39 ; s throughput may affect low priority traffic while sla and high priority applications may continue to receive high quality of service ( i . e . their required throughput ). as will be appreciated by one of skill in the art upon reading the following disclosure , various aspects described herein may be embodied as methods , systems , apparatus ( e . g ., components of a satellite communication network ), and / or computer program product . accordingly , those aspects may take the form of an entirely hardware embodiment , an entirely software embodiment or an embodiment combining software and hardware aspects . furthermore , such aspects may take the form of a computer program product stored by one or more computer - readable storage media having computer - readable program code , or instructions , embodied in or on the storage media . any suitable computer readable storage media may be utilized , including hard disks , cd - roms , optical storage devices , magnetic storage devices , and / or any combination thereof . in addition , various signals representing data or events as described herein may be transferred between a source and a destination in the form of electromagnetic waves traveling through signal - conducting media such as metal wires , optical fibers , and / or wireless transmission media ( e . g ., air and / or space ). while illustrative systems and methods as described herein embodying various aspects of the present invention are shown , it will be understood by those skilled in the art , that the invention is not limited to these embodiments . modifications may be made by those skilled in the art , particularly in light of the foregoing teachings . for example , each of the elements of the aforementioned embodiments may be utilized alone or in combination or sub - combination with elements of the other embodiments . it will also be appreciated and understood that modifications may be made without departing from the true spirit and scope of the present invention . the description is thus to be regarded as illustrative instead of restrictive on the present invention .
| 7 |
reference will now be made in detail to the present invention , examples of which are illustrated in the accompanying drawings . wherever possible , the same reference numbers will be used throughout the drawings to refer to the same or like parts . methods and systems consistent with the principles of some embodiments of the present invention enhance a consumer &# 39 ; s personal shopping experience by providing a personal shopping device to a consumer in a retail shopping environment and enabling the consumer , utilizing a consumer interface , to access information . further systems and methods consistent with principles of some embodiments of the present invention enable a user , through an application server , to manage information delivered to the personal shopping device . further systems and methods consistent with principles of some embodiments of the present invention enable a retailer to manage inventory , location of products within a shopping establishment and / or study and maximize product layouts in order to maximize sales . further systems and methods consistent with principles of some embodiments of the present invention provide a user with a loyalty card , personal key fob , etc . that interacts with the personal shopping device to customize the shopping experience . further systems and methods consistent with principles of some embodiments of the present invention provide for the efficient exchange of content between a personal shopping device and an application server . further methods and systems consistent with principles of some embodiments of the present invention enable manufacturers to schedule and send information to the personal shopping device . further methods and systems consistent with principles of some embodiments of the present invention enable customers to place orders for counter services . further methods and systems consistent with principles of some embodiments of the present invention enable efficient management of company information , shopping establishment information and customer information within the system . further methods and systems consistent with principles of some embodiments of the present invention enable a customer to generate and maintain a list of products for purchase . it may be appreciated by one of ordinary skill in the art , that the systems and methods discussed herein may be implemented in a variety of shopping environments . for exemplary purposes , systems and methods consistent with principles of the present invention will be discussed herein in a retail grocery shopping environment . the terms personal shopping device and personal computing device are used interchangeably herein . fig1 is an exemplary diagram of a system environment 100 for implementing the principles of the present invention . the components of system 100 may be implemented through any suitable combinations of hardware , software , and / or firmware . as shown in fig1 , system 100 includes a plurality of stores 1 02 , 104 . store 102 includes store server 110 that is maintained by the grocery store . store 102 further includes a plurality of servers 106 , 108 that may interact with a plurality of application servers 120 , 122 through network 116 . alternatively , servers 106 , 108 may be implemented as one server . store 102 may further include a buffer server 107 that is communicably linked to both store server 110 and one or both of application servers 106 , 108 . buffer server 107 may store information that may be shared between application server 106 , 108 and store server 110 . the buffer server 107 may serve to protect information stored at the respective servers , so that all information stores at the respective servers may be secure . alternatively , one of both of application servers 106 , 108 may be communicably linked to store server 1 10 . a plurality of personal shopping devices 112 , 114 physically located within or near store 102 may interact with servers 106 , 108 , using known technology , including wireless communication . a consumer may access the personal shopping device 112 to access and manage information to enhance their shopping experience . each personal shopping device 112 , 114 may be associated with a unique identifier . the consumer may access the personal shopping device 112 with a personalized key fob 140 . system 100 may further include operator server 124 wherein a user at server 124 may manage information that is provided to application servers 120 , 122 , servers 106 , 108 and / or personal shopping device 112 , 114 through network 116 . manufacturer 126 , 128 may further reside on within system 100 wherein manufacturer 126 , 128 may access application servers 120 , 122 to request and / or schedule information related to their products to be downloaded to personal shopping device 112 , 114 . system 100 may further include client computers 130 , 132 , which may be communicably linked to application servers 120 , 122 , wherein a consumer may enter information for access by the personal shopping device 112 , 114 . for example , the consumer may access application servers 120 , 122 and enter information , i . e ., a shopping list , for access at the grocery store by the personal shopping device 112 , 114 . finally , system 100 may include merchant servers 136 , 134 . merchant servers 134 , 136 may be accessed by application servers 120 , 122 and / or personal shopping devices 112 , 114 to obtain content for viewing by the consumer at the personal shopping device 112 , 114 . it may be appreciated by one of ordinary skill in the art that while only one or two devices , client computers , and / or servers may be depicted , that many devices , client computers , and / or servers may reside within system 100 . while network 116 may be implemented as the internet , network 116 may be any local or wide area network , either public or private . fig2 depicts an exemplary block diagram of components included in personal shopping device 112 , 114 . personal shopping device 112 , 114 may be implemented as a computing device that may be made a part of a shopping cart . personal shopping device 112 , 114 may include central processing unit 202 , a touch display screen 204 , application software 206 , memory 208 , secondary storage 210 , and input / output devices 212 . personal shopping device 112 , 114 may be communicably linked to servers 106 , 108 . further , personal shopping device 112 , 114 may be communicably linked to merchant server 134 , 136 through servers 106 , 108 . a customer may access network 116 through sever 106 , 108 using application software 206 wherein the application software may include a conventional browser including conventional browser applications available from microsoft or netscape . application software 206 may further include a user interface that enhances a consumer &# 39 ; s shopping experience by providing a plurality of features as discussed herein . input / output devices 212 may include , for example , a bar code reader , a usb port for receiving key fob 140 , an interface to receive a variety of external devices , including , but not limited to , a smart card , a floppy disk , an external memory device , i . e ., compact flash card , memory stick , etc ., and a touch screen display for displaying information to the consumer and receiving information from the customer through input at the touch screen , etc . fig3 depicts an exemplary block diagram of the components that may reside on key fob 140 consistent with principles of some embodiments of the present invention . as depicted in fig3 , identification information may be stored . upon issuance of the key fob 140 to the consumer , the system associates unique identification information 304 with the consumer . this unique identification information 304 identifying the consumer may be stored on key fob 140 . upon insertion of the key fob 140 into personal shopping device 112 , 114 , a verification algorithm 302 , stored on key fob 140 may be performed to verify the authenticity of key fob 140 . upon proper verification , the consumer may access the information available at the personal shopping device 112 , 114 . further , a session may be created and managed utilizing session management information 308 , stored at key fob 140 . as such , in the event of a personal shopping device failure , as the device stores all interaction between the customer and the personal shopping device , the consumer &# 39 ; s session may be fully restored using the information stored at session management information 308 . fig4 depicts an exemplary diagram of application servers 106 , 108 , 120 , 122 that may be implemented in system environment 100 , consistent with the principles of some embodiments of the present invention . as shown in fig4 , application servers 106 , 108 , 120 , 122 include a cpu 402 , application software 404 , memory 406 , secondary storage 408 , network interface application 410 , and input / output devices 412 . input / output devices 212 may include , for example , a keyboard , a mouse , a video cam , a display , a storage device , a printer , etc . application software 404 may include software applications that facilitate the scheduling and sending of smart content as discussed herein to personal shopping devices 112 , 114 . application software 404 may further include software applications that facilitate the tracking of personal shopping devices within and around the retail shopping environment , and , based upon the tracking information , facilitate determining certain information as discussed herein . application software 404 may further facilitate the functionality in accordance with the personal shopping devices 112 , 114 discussed herein . it may be appreciated that the configuration of operator server 124 , manufacture server 126 , 128 , client computer 130 , 132 and merchant server 134 , 136 may be similarly configured to the application servers as depicted in fig4 wherein the application software may differ in accordance with the functionality of the individual computers as discussed herein . using conventional applications , the system may track the present location of each of the plurality of personal shopping devices located in or near the shopping environment . in addition to tracking each of the plurality of personal shopping devices , for each personal shopping device , the system may store the position of the personal shopping device at predetermined intervals , i . e ., every five seconds . this information may then be used to determine the actual location of the personal shopping device with respect to certain products , either part of or the total path of the personal shopping device as it travels through the shopping environment , etc . this information may be used for several purposes . first , using this information , the system may determine where , within the shopping environment , the personal shopping device is located . certain flags or conditions may be set within the system such that upon the determination of a personal shopping device being within a certain distance of a particular location , directed advertising may be employed . this directed advertising may or may not take into consideration the consumer &# 39 ; s shopping history . the user , at operating server 124 or at application servers 120 , 122 , may create and modify these flags or conditions thus establishing an event - driving process . for example , if it is determined , based upon the location of the personal shopping device , the consumer is located in the juice section , a computer - generated discount may be offered to the consumer . these computer - generated discounts may be offered to some or all of the consumers when they are within a predetermined location of the juice section . alternatively , if it is determined that the consumer has spent $ 20 in juice in the past 2 weeks , based upon a consumer &# 39 ; s stored shopping history , a computer - generated discount may be offered to the consumer based upon the consumer &# 39 ; s shopping history . these computer - generated discounts may be offered by displaying the discount to the consumer on the display of the personal shopping device 112 , 114 . similarly , advertising , surveys , etc ., may selectively be displayed to the consumer based upon personal shopping device location and / or the consumer &# 39 ; s shopping history . second , using the set of determined positions obtained using the personal shopping device location application , a part of or the total path of the personal shopping device through the shopping establishment may be determined . this may be useful to identify how frequently each aisle , area , zone , etc ., of the store is visited . by identifying which areas of the shopping establishment are most frequently visited , the shopping establishment owner may optimize this space by placing certain products within the area that the shopping establishment owner would like to sell quickly , heavily advertise , place special deals , etc . further , by identifying those areas of the store that are least frequently visited , the shopping establishment owner may re - arrange the products within the store to generate more traffic in those less - traveled areas . further , it may provide information indicating that the layout of the shopping establishment is confusing to the consumer ; not laid out properly , etc . third , the system may store information relating to the date , duration , etc . of a customer &# 39 ; s shopping experience . using the information obtained , the shopping establishment owner may be able to compare the speed of shopping at one store with the speed of shopping at another store . fourth , the personal shopping device position information may be used to support the self - healing planogram discussed below . a user may schedule content to be downloaded and displayed to a consumer at the personal shopping device using an application at operator server 124 , and / or application servers 120 , 122 . alternatively , a user at application servers 106 , 108 or buffer server 107 may schedule content to be downloaded and displayed at the personal shopping device . using the content scheduling application , a user may enter the content to be displayed , the start and end date / time , which shopping establishments and / or personal shopping devices the content should be downloaded to ( either by designating the individual personal shopping devices , or the individual consumers ), the commands to be performed by the personal shopping device before and / or after the content is to be displayed , etc . this content may be directed , active , and / or passive advertising and may be in the form of text , images , etc ., commands to be performed by the cpu of the personal shopping device , updates for software applications , etc . alternatively , the manufacturer , using a similar content scheduling application , may access application server 120 , 122 to request scheduling of content by inputting similar information . this request may be reviewed prior to the scheduling of the content , or may be automatically scheduled . alternatively , the content may simply be stored either at application server 106 , 108 , buffer server 107 , or personal shopping device 112 , 114 where the content is pushed to the personal shopping device and played in a list order , randomly , etc . information may be updated at the personal shopping device when the personal shopping device is recharging . a determination may be made to ensure sufficient power remains at the personal shopping device for the duration of the download and installation , if the personal shopping device is not plugged in . for example , upon a determination that the personal shopping device is not recharging , and that a predetermined power level is maintained , the personal shopping device may generate a message to application server 106 , 108 , advising the application server 106 , 108 that the personal shopping device is ready to download content . upon receipt of the message , application server 106 . 108 , prepares a response to the personal shopping device providing the personal shopping device with a public key and advises the personal shopping device that updates are ready for downloading . using the updating content application , the personal shopping device retrieves a private key from its storage and submits a request with the private key for updated content data . this ensures that only the proper personal shopping devices may download content from application server 106 , 108 . upon receipt of the request , application server 106 , 108 transmits the updated content to the personal shopping device . this exchange of transmissions between the personal shopping device and application server 106 , 108 , may be facilitated with microsoft &# 39 ; s message queuing center ( msmq ) wherein the header of the messages are modified to include security information , i . e ., an rsa key , to ensure secure transactions . it may be appreciated by one skilled in the art that the power level determination may not be performed if the personal shopping device is recharging . information relating to the plurality of shopping establishments , the companies that own the shopping establishments and the customers shopping within the shopping establishments may be stored in a manner that enables real - time access to accurate current and historical data . fig4 a depicts exemplary data tables consistent with the principles of some embodiments of the present invention . it may be appreciated that the data tables depicted in the figures may include additional information that is not discussed herein . further , it may be appreciated that additional tables may be stored including additional information relating to the companies , the shopping establishments , and / or the customers . for example , additional information may be stored relating to the customer &# 39 ; s shopping experience , including shopping lists , items , price , and quantity of items purchased , click - throughs of the user interface , customer demographic data as discussed above , path of the customer through the store , advertisements that were presented to the customer , coupons used by the customer , etc . as depicted in fig4 a , a plurality of data tables are provided . data tables may be implemented using an excel spreadsheet application by microsoft corporation , macromedia flash application by adobe systems incorporated , a dynamic html application etc . the data tables may include company information 421 , hierarchy information 423 , level information 425 , location information 427 , and grouping details 429 . fig4 a depicts the association between the data tables . exemplary details of the data tables depicted in fig4 a are set forth in fig4 b - 4c . company information 421 stores information related to the company , including the company id , as a primary key , and further includes the date the company record was created in the data table , and the name , street , state , zip code , country , telephone and fax number of the company . hierarchy information 423 stores information relating to the hierarchy definitions and includes company id and hierarchy as the primary keys , and further includes the date the record was created and the name of the hierarchy . location information 427 stores information relating to the individual locations of each of the shopping establishments of the companies stored in company information 421 and includes company id , hierarchy id , member id and time zone id as primary keys and further includes the date the record was created , the member name , level id , street , city , state , country , zip code , phone and fax number of the shopping establishment . location information 427 establishes which individual shopping establishments belong to which levels . level information 425 stores information relating to the level definitions and includes company id , hierarchy id , and level id as primary keys and further includes the date the record was created in the data table and the level name . grouping details 429 stores information relating to the groupings , or roll - ups of the shopping establishments and includes company id , hierarchy id , and group id as primary keys and further includes the date the record was created and the member id . grouping details 429 associates individual shopping establishments to certain groups . each of the data tables further stores information relating to whether the records included therein are active or inactive . for example , if a store moves locations , then a new record may be created within location information 427 maintaining the member id but updating all of the other stored data in the new record . the old record of the closed store will be saved in the data table , however the record may be indicated as being inactive . by storing the information in this manner , as companies and individual shopping establishments change locations , a simple update to the tables discussed herein , while maintaining the historic data provides for real - time data access to the current and historic data . for example , if member id 1001 moves location to zone - california south , a new record is created in location information 427 listing member id 1001 , the new time zone id , the date the new record was created , the member name , and the new level id associated with the new location . in addition , the old record is marked as inactive and the date the record was marked inactive is stored . none of the other tables need to be updated . the new information is maintained as current information , and the historic information is maintained for data mining purposes . as such , any time any of the values represented in the tables need to be updated , only those tables that store the value to be changed need to be updated . by establishing and maintaining the tables in this manner , real - time current and historic data may be data mined . for example , as the active / inactive status of records and the date records are created and the date records go inactive are stored , while still maintaining the data after records go inactive , by clarifying at least one of company id , hierarchy id , member id , level id , group id , time period , or any other information stored in the tables , accurate real - time current and historic data may be obtained . it may be appreciated that records may be established in order to enable a company to select certain shopping establishments for targeted advertising , without being limited to the previously established levels in the table . for example , a new record may be established in level information 425 with a level id 99999 . company 1 may wish to provide an advertisement for tide detergent only to store member id nos . 1001 , 10001 , and 10002 . by adding new records in the grouping details 429 , where store member id no . 1001 , 10001 , and 10002 have group id no . 99999 ( in addition to group id nos . already assigned , i . e ., 10001 , 1000000 , and 1000000 , respectively ) the company can designate the tide detergent ad be displayed to customers associated with group id no . 99999 . this provides added functionality because company id 1 is not limited to sending the advertising to all of the stores within the levels that may already be defined within level information 425 . company id 1 may , in a simple manner , target advertising to specific stores , regardless of predefined levels . it may be appreciated that this may save the companies money in advertising costs , administrative costs , etc . it may further be appreciated that , in addition to selecting stores to target advertising , a company may similarly select among the demographic customer information , customer &# 39 ; s shopping history , etc ., to target advertising . it may further be appreciated that by establishing such a 99999 record , information regarding the predefined levels are not affected . as such , data mining for the predefined levels remains the same , while providing the added functionality of defining levels for targeted advertising . it may be appreciated that similar functionality may result by adding new hierarchy ids in the hierarchy information table . it may be appreciated that additional tables may be provided for maintaining customer information . for example , a customer information table may be provided including primary key customer id , and storing demographic information of the customer including age , age range , gender , date of creation of customer record , number of members in the household , number of children , age and gender of the children in the household , household income , etc . further a shopping transaction table may be provided including primary keys for customer id , transaction id and location id , and further including date , type , quantity , price , etc ., of products purchased , click - though data , advertisements viewed , date , time and cart path of shopping trip , entry time and exit time of each zone during each shopping trip , etc . it may be appreciated that additional information may be stored in these tables to expand data mining results . it may be appreciated that all of the tables discussed herein may by stored at application server 106 , 108 , 122 , 124 , and / or database 142 , 144 . for each store , application servers 120 , 122 , 106 , 108 may store in memory the store &# 39 ; s planogram , i . e ., a design that shows where specific products are laid out on retail shelves or displays . fig5 depicts an exemplary planogram consistent with principles of some embodiments of the present invention . as depicted in fig5 , the store includes aisles 502 , 504 , 504 , end caps 508 , 510 , and 512 , produce displays 514 , 516 , 518 , 520 , dairy display 522 , meat and seafood display 524 , wine display 526 , 528 , hot food / salad bar display 532 , 534 , and bread display 530 . for example , the store may be broken down into a plurality of zones and each product in the store may be designated as being located within a particular zone . as shown in fig5 , dairy display 522 may be identified as zone 1 536 , and produce displays 514 , 516 , 518 may be designated as zone 2 540 . it may be appreciated that the data relating to each store &# 39 ; s planogram may be stored in data tables with similar structure discussed above with regard to the information management hierarchy . information may be stored relating to the location of products within the shopping establishment . for example , for each of the plurality of zones depicted in fig5 , information may be stored identifying the metes and bounds of each of the plurality of zones and information relating to the location and descriptive information associated with the products located within each zone . fig6 depicts exemplary tables that may be utilized in storing information within the shopping establishment . as shown in fig6 , table a 600 stores the boundaries of each of the plurality of zones , i . e ., the metes and bounds of each of the plurality of zones , in the shopping establishment . col . 602 identifies each zone , col . 604 identifies the minimum coordinates of each of the zones and col . 606 identifies the maximum coordinates of each of the zones . it may be appreciated that alternatively methods may be utilized in identifying the metes and bounds of each of the plurality of zones . col . 611 identifies the location identification of the shopping establishment . further table b 608 may store information about each of the products included in the shopping establishment , including a specific location of the product within the zone , descriptive information relating to the product , etc . for example , table b 608 includes a sku #, a unique identification number that uniquely identifies a particular product , a zone id , representing the zone that the product is located in , and a product number . it may be appreciated by one skilled in the art that additional information may be stored in these tables . one of ordinary skill in the art may appreciate that alternatives to zones may be implemented in storing information relating to the positioning of products within the shopping establishment , i . e ., the store may be broken down into smaller or larger areas ; etc . the planogram discussed herein may be self - healing , in that there does not need to be any user interaction to update the product location information stored in the tables , for example , in the event that the product display has been relocated within the shopping establishment . as noted above , the tables store information identifying the location of each of the products located in the shopping establishment . when a consumer scans an item and places the item in his shopping cart , the personal shopping device receives the bar code information . this information may be uploaded to application servers 106 , 108 . this information may further be associated with the position information of the personal shopping device . the system may assume that the consumer placed the item in the cart at approximately the same location where the consumer took the item from the shelf / display . the location information may be compared with the location information stored in the tables . if the information is different , the system may flag the item and , if a predetermined number of consumers are placing the same item in the their carts at the new location , the system may automatically set the entry of the item in the tables as “ inactive ”, and create a new entry in table b identifying new position or zone of the item . thus , the planogram does not necessarily need to be manually updated . it may be self - healing in that , as consumers shop within the shopping establishment , the tables may be automatically updated . when a consumer performs a search for a product , as discussed below , these tables may be searched to identify the location of the product within the shopping establishment . further , the consumer may use the information in these tables to access the location , direction and distance to the product based upon the current personal shopping device location . further , data mining may be performed to determine where a product sells the best . by viewing data relating to where the item was located and how many customers purchased the item , the shopping establishment may determine where to place an item achieving optimum sales . consistent with some embodiments of the present invention , the user interface of the personal shopping device may be generated based on stored customer information . this customer information may be collected at the time the consumer signs up for a loyalty card / key fob , etc . the information may be stored at store server 110 , application servers 106 , 108 , application servers 120 , 122 , and / or databases 142 , 144 . the user interface may alternatively be generated based on stored customer information that is collected based on a customer &# 39 ; s past shopping experience and / or may be generated based on a combination of the customer information collected at the time the consumer signs up for the loyalty card / key fob , etc ., and the shopping history information . when registering for a loyalty card , key fob , etc ., the customer may be asked for personal information . for example the customer may be asked for age , sex , address , zip code , number of family members in the household , number of children , age of children , household income , etc . all of the information provided by the customer may be stored as indicated above . additionally , information may be stored regarding the date of the last shopping trip of the customer , the duration of the last shopping trip , etc . different display attributes may be stored in memory and associated with the different categories of customer information . certain display attributes may be associated with gender , age and / or age group , race , address , marital status , number of children , sex of children , etc . for example , if the customer is female , then the display may have a certain color background that may be more appealing to females ; if the customer is spanish and the customer &# 39 ; s first language is spanish , then the text displayed on the display may be in the spanish language ; if the customer &# 39 ; s eyesight is poor , this information may be associated with a large font size , etc . information may further be stored relating to a customer &# 39 ; s past shopping experience . for example , each time the customer touches the personal shopping device , the buttons selected by the customer may be stored . this data may be accessed in order to determine how frequently the customer selected each of the menu options on the personal device . if the system determines that the customer uses the shopping list feature the more frequently , then the actuatable button representing the shopping list function may be more prominently displayed on the user interface , i . e ., at the beginning of the list of actuatable buttons , displayed as a larger button than the other actuatable buttons , etc . the next most frequently used feature may be displayed second in the list , as the second largest button , etc . the content to be displayed on the personal shopping device may be stored and associated with the different categories of customer information . the content displayed on the personal shopping device may be displayed based on the stored customer information . for example , if the customer is spanish , the recipes offered to the customer may be from the spanish culture , i . e ., paella , beans and rice , etc . in addition , the weekly flyer may be generated dynamically based on customer information . the advertisements eligible for the weekly flyer may be associated with different categories of customer information ; the advertisements eligible for the weekly flyer may be associated with particular types of products , etc . for example , if the customer has a newborn baby , the weekly flyer may include an advertisement for diapers . alternatively , based upon access of the customer &# 39 ; s shopping history and past purchases , the system may determine that canned corn is frequently purchased . based upon this determination , the weekly flyer may include an advertisement for canned beans , based upon the association of the canned beans with canned vegetables . for another example , an advertisement eligible for the weekly flyer for chips may be associated with soft drinks . these associations may be determined by a store employee , the advertiser , the manufacturer , etc . in addition to the advertising included in the weekly flyer , additional advertising may be displayed on the personal shopping device based on the customer information during the customer &# 39 ; s shopping experience . this additional advertising may be associated with particular products . the system may store information regarding the particular items , quantity , etc . a customer purchased in the past . the additional advertising may be selected and displayed on the personal shopping device based on , for example , the most frequently purchased items . for example , the application server 106 may access the customer &# 39 ; s shopping history and determine the top , for example , eight , products the customer purchases most frequently . advertisements associated with the eight most purchased products may be displayed to the customer throughout the shopping trip randomly ; may be displayed based on the position of the personal shopping device within a predetermined distance of the product , etc . consistent with some embodiments of the present invention , the use of the personal shopping device provides certain functionality to the consumer to enhance his shopping experience . some examples of this functionality include personalized offers , as discussed above , storage of shopping history , item search / locator , price check and / or suggestions of alternative products , access to recipe information , an interactive shopping list , self - scanning , etc . upon access to the personal shopping device , as noted above , the consumer may view an exemplary screen shot as depicted in each of fig7 a - 7d . as shown in fig7 a , a featured recipe is advertised . if the consumer wishes to view the recipe and the ingredients of the recipe , the consumer may select the “ view this recipe ” button 704 . upon selecting button 704 , the recipe may be displayed together with a shopping list of the ingredients that are needed to make the dish . in addition to the featured recipe , the shopping establishment &# 39 ; s top specials 706 may be displayed . further , menu items 708 are provided wherein the consumer may select any of the menu items . for example , the user may select home 708 wherein the consumer may be directed to the home page of the application . the consumer may further select 710 in order to access additional daily specials . these daily specials may be specials offered to all consumers within the shopping establishment or may be special offers made to the consumer based upon the consumer &# 39 ; s shopping history . the consumer may further select 712 in order to access the product directory to , i . e ., search for a product in the store . the consumer may select 714 to access the consumer &# 39 ; s personal shopping list . the consumer may select 716 to access recipes . the consumer may select 718 to access an electronic calculator , a calculation application that allows the consumer to perform basic math computations . the consumer may select 720 to access a help application that explains how to use the personal shopping device . additionally , section 722 presents passive advertising to the consumer , similar to banner advertising . fig7 b depicts an alternative exemplary screen shot that may be displayed to a consumer upon access to the application on the personal shopping device . alternatively , as depicted in fig7 b , the user may select fun stuff 724 to access entertainment information . for example , if the consumer was shopping with a child , the consumer may access appropriate entertaining videos to occupy the child while the consumer was shopping . alternatively , the consumer may access music information for the consumer to listen to while shopping . alternatively , the consumer may purchase this information and store it on the consumer &# 39 ; s personal key fob 140 . this information may subsequently be transferred to a device at the consumer &# 39 ; s home . fig7 c - 7d depicts alternative exemplary screen shots that may be displayed to a consumer upon access to the application on the personal shopping device . it may be appreciated by one skilled in the art that the display of the personal shopping device may be flipped , rotated , etc ., so that a person sitting in the cart may properly view the information appearing on the display of the personal shopping device . it may further be appreciated that the personal shopping device may include speakers , an earphone assembly , microphone ( to enable the consumer to interact with the personal shopping device through voice ), etc . as the customer uses the personal shopping device , information regarding the customer &# 39 ; s interaction with the personal shopping device is stored , including products scanned ( type of product , price , quantity , time of scan , etc . ), advertisements displayed , time advertisements were displayed , click - throughs , products searched , cart path , counter services ordered ( including the details of the order ), shopping list information , date of shopping trip , start and end time of shopping trip , etc . the information may be stored at the personal shopping device during the customer &# 39 ; s shopping experience . the information begins being compiled at the personal shopping device when the customer logs on . during the customer &# 39 ; s shopping experience , the information regarding the customer &# 39 ; s interaction may be stored , for example in a flat file , at the personal shopping device . the flat file may include a customer id , a shopping establishment location id , start date , start time , stop date , stop time , advertisement id representing advertisements displayed , time of advertisement display , time spent is different zones within the shopping establishment , start and stop time entering and leaving zones within the shopping establishment , products scanned , click - throughs , etc . after the customer logs off the device , the personal shopping device may filter the flat file and transmit the filtered flat file to store server 110 , and / or application server 106 , 108 . store server i 10 and / or application server 106 , 108 may update the appropriate data tables with the information stored in the filtered flat file and / or may transmit the filtered flat file to application server 120 , 122 for processing and storage of the data in database 142 , 144 . it may be appreciated that alternatively , the personal shopping device may trigger interaction with other devices within the shopping establishment . for example , kiosks , displays , and other computing devices , may be situated throughout the shopping establishment that may provide additional and / or enhanced services to the customer . based on the customer &# 39 ; s position in the shopping establishment , the system may determine that a customer is physically close to another computing device . the system may instruct the other computing device to active and play content engaging the customer to use the other device and offer the enhanced and / or additional services . some examples of services that may be provides at the displays / kiosks may include printing of coupons , printing , access , and / or searching of recipes , printing of pictures ordered using the photograph counter services application , recording of media on a removable storage device , customized searching on the internet based on the stored customer information , purchasing of lottery tickets , obtaining funds from an automatic teller machine where the kiosk is communicably linked to the customer &# 39 ; s banking company , validating parking and alternatively , validating parking were the parking fee is added to the customer &# 39 ; s shopping check - out total , media rentals including video tapes , dvds , etc ., postal service kiosks wherein the customer may mail a package , and alternatively , the customer &# 39 ; s cost for mailing the package may be added to the customer &# 39 ; s shopping check - out total , providing fast food or snack food services wherein the cost of the food may be added to the customer &# 39 ; s shopping check - out total , providing personalized audio / video directed to the customer , provide games to the customer , provide advanced input features to enable the customer to provide comments or responses to surveys regarding the customer &# 39 ; s shopping experience , providing instructions videos to the customer or members of the customer &# 39 ; s family , printing customized books , i . e ., coloring books , story books , etc ., wherein the book is customized to the customer or members of the customer &# 39 ; s family , enable searching for and provide event tickets , purchase mobile / cellular telephone cards and / or replenish mobile cellular telephone minutes , enable searching for and provide airline tickets , suggest products for purchase based on stored customer information , i . e ., where the product is physically located near the kiosk / display , the product may be suggested based on age , gender , etc ., offering voice - over - ip services where the kiosk is communicably linked to the internet , etc . advertisements may be dynamically generated based on customer information stored within the system . a manufacturer may identify an ad template that may incorporate static components of the ad . additionally , the manufacturer may further identify dynamic components of the ad that may be associated with certain categories of customer information . the dynamic components may have a priority associated with them for example , the manufacturer may provide a template that indicates that tide detergent is on sale . the price of the detergent and the graphic of the price may be incorporated as the static component of the ad . further , a dynamic component including a graphic of a mother with a child may be associated with the family category having a young child . still further , a dynamic component of a graphic of an older woman may be associated with an age range of 55 - 65 . when the system determines that a certain customer is to receive the tide advertisement , the system accesses the customer information . based on the associated priority information and / or the customer information , a customer of 60 years of age will view the tide advertisement having the static components and the dynamic component of the graphic of the older woman . as such , the advertisement may be dynamically generated and presented to all customers where the advertisement will appeal to the particular customer that is viewing the advertisement , as the dynamic components may be tailored to specific customer that is viewing the advertisement . given the real - time capabilities of the system , the return on investment based on the advertising may be realized . as the personal shopping device and / or the system is storing information regarding the advertising that is being viewed by the customer , the items that are being scanned for purchase , and when the items are being scanned , the system may determine the effectiveness of the advertising in real time . the system may process and store information relating to how may customers scanned the advertised product . if the number is low , then the advertisement may be deemed to be ineffective . this information may be reported back to the manufacturer and the manufacturer may decide to update the static and / or dynamic components of the advertising . alternatively , a manufacturer may be able to set thresholds and modify the advertising based on the effectiveness of the advertising . for example , the manufacturer , user , etc ., may be able establish that an advertisement needs to be 30 % effective ; that out of 100 customers viewing the advertisement , 30 customers must purchase the advertised item . if this effectiveness is not achieved , system may automatically i . e ., modify the advertising graphics , expand the target audience of the advertising , generate a message to the manufacturer advising of the ineffectiveness of the advertisement , etc . alternatively , the system may automatically generate reports to the manufacturer at predetermined time ( s ) advising of the effectiveness of the advertisement ( s ). alternatively , payment for the advertising by the manufacturer may be dynamic based upon the effectiveness of the advertisement . for example , the manufacturer may be billed a lesser amount if only a few customers purchased the product after viewing the advertisement , and may be billed a higher amount if many customers purchased the product after viewing the advertisement . alternatively , after viewing the effectiveness of the advertising , the manufacturer may determine that certain dynamic components are more effective than other dynamic components and may decide to modify the priority or the categories of customer information that may be used in generating the advertisement . further , the utilizing the data stored in the data tables , a company may be able to determine if a customer is traveling to purchase products . for example , if a customer with one zip code is shopping at a shopping establishment in a different zip code and purchasing products that the customer is not purchasing at a shopping establishment located in the customer &# 39 ; s zip code , the company may be able to determine that there is a need for a particular product in the customer &# 39 ; s zip code . the company may then provide the needed product at the customer &# 39 ; s shopping establishment , making the customer &# 39 ; s shopping experience more productive and increasing sales . it may be appreciated that other types of dynamic advertising may be displayed to the customer based on the customer &# 39 ; s stored information . for example , if the customer previously paid for their purchases with a bank of new york bank card , the system may store information that the customer holds an account at the bank of new york . during the customer &# 39 ; s shopping experience , a bank of new york advertisement may be displayed promoting the bank &# 39 ; s services . the consumer may further access his personal shopping list using his personal shopping device . for example , the consumer may generate his shopping list at his home computer and download the shopping list to his key fob 140 . after the consumer puts the key fob 140 into the personal shopping device and after the consumer is verified , the shopping list may be retrieved from the key fob 140 . alternatively , the consumer may access an application at application sever 120 , 122 and enter his shopping list using his home computer . this shopping list may be downloaded to the personal shopping device after the consumer is verified . once the shopping list is retrieved , the consumer has the opportunity to add , remove or edit items on the shopping list . alternatively , the system may retrieve the shopping history of the consumer to identify those items that the consumer purchases on a regular basis . for example , the system may determine that the consumer purchases ½ gallon of milk each time the consumer shops . once the consumer is verified , the system may access the shopping history of the consumer and compare the regularly purchased items with the items on the consumer &# 39 ; s shopping list . if there is an item that the consumer normally purchases that is not located on the shopping list , the system may prompt the consumer asking if the item should be placed on the shopping list . this may help to ensure the consumer &# 39 ; s shopping list is complete . further it helps to generate sales for the shopping establishment . in addition , the consumer has the ability to enter budgeting information . upon receipt of the budgeting information , the personal shopping device may analyze the interactive shopping list and the budgeting information and search the information stored in table b to suggest a list of proposed products that will ensure the consumer stays within budget . as the system stores both shopping list information and information relating to the items purchased by the customer , the system may generate reports that show the purchasing trends of the customer . for example , the system may determine what products the customer intended to purchase from the shopping list information , and what products the customer did and did not purchase . further , the system may determine the effectiveness of advertising based on the items intended to purchase on the shopping list , the advertisements that were displayed to the customer , and the actual products purchased . alternatively , the system may generate the shopping list for the next visit to the supermarket based on the actual purchases of the customer during the current visit to the supermarket . this list may be modified by the customer at the customer &# 39 ; s home using the network application at application server 120 , 122 , and / or at the supermarket during the customer &# 39 ; s next visit . the shopping list may be updated as the customer is shopping . each item for purchase by the customer is scanned , for example , using a bar code reader at the personal shopping device . the personal shopping device may send the scanned information to store server 110 or application server 106 , 108 to obtain the associated product information . additionally , the product attribute information may further be accessed . the product information and the product attribute information may be transmitted to the personal shopping device . the customer &# 39 ; s shopping list may then be processed to determine if the scanned product or an associated product is on the list . if the product is on the list , the product is checked off as selected for purchase . if the product is not on the list , the product may be added to the list . at the end of the customer &# 39 ; s shopping trip , all of the items in the shopping cart may be included on the customer &# 39 ; s shopping list . this list may be stored locally on the personal shopping cart and / or stored at application server 106 , 108 120 , 122 . as noted above , personal shopping device may include a bar code reader . the consumer may scan a product to perform a price check . if the consumer wishes to discern the cost of a product , the consumer may scan , i . e ., the bar code , of the product . the bar code information is received at the personal shopping device . the price information may be stored at the personal shopping device , may be stored at the application servers 106 , 108 , or may be stored at buffer server 107 . if the price information is stored at the application servers 106 , 108 , or buffer server 107 , the personal shopping device may transmit the price check request to the server storing the price information , i . e ., application servers 106 , 108 or buffer server 107 . the request is received at the appropriate server , the memory queried , and a response may be transmitted back to the personal shopping device . the response may then be displayed to the consumer . each of the products for sale in the store may be stored at store server 110 , application server 106 , 108 , application server 120 , 122 , and / or database 142 , 144 . associated with each of the products may be keywords that help identify the product . for example , tide detergent may be stored and key words associated with tide detergent may be laundry , soap , detergent , etc . the consumer may query the system attempting to locate a particular item . the item may be located based on the product , or the key words associated with the product . for example , if the customer is searching for tide detergent , the customer may enter in “ laundry soap .” based on the key words associated with tide detergent , including “ laundry ” and “ soap ”, tide detergent may appear as a response to the customer &# 39 ; s query . for another example , the consumer may submit a request seeking to find the location of light bulbs . upon submission of the request , the personal shopping device either searches its own memory , if the information is stored locally , or prepares and submits a query to the application servers 106 , 108 or buffer server 107 , if the information is stored at one of these servers . upon receipt of the query , the appropriate server searches its memory and identifies the location of the product within the shopping establishment . the server then prepares a response to the query and transmits the response to the personal shopping device . the personal shopping device then displays the location of the product on the display of the personal shopping device . alternatively , the personal shopping device or the server may calculate a set of directions based upon the current position of the personal shopping device wherein the directions may be provided to the consumer . this information may be provided to the consumer in a number of ways , including merely identifying the aisle the product is located in , directions , in the form of text , to direct the consumer to the searched product , a map being displayed on the display providing the consumer with a marked path to the product , etc . alternatively , in addition to ads , a manufacturer may purchase certain key words that may only be associated with the products stored in the system . for example , the tide detergent manufacturer may purchase “ laundry ” as a key word associated with tide detergent . no other manufacturer may have the word “ laundry ” associated with their product . each time a customer searches for a product using the key word “ laundry ”, only tide detergent will appear on the list . this may provide an added benefit to the manufacturer as only their product is identified on the search result list , thus reducing competition . alternatively , manufactures may identify certain stores where their key words are associated with certain products . these selected stores may be based on location . alternatively , when a customer searches for a product , and an advertisement is associated with one of the products on the search result list , the customer may be presented with an advertisement that corresponds to a product on the search list . alternatively , after the system determines what product the customer is searching for , the inventory database , discussed below , may be queried to determine if there is stock on the sought after item . if there is no stock left , the system may suggest a substitute product . alternatively , the substitute product may be offered with an advertisement and / or coupon as an incentive for the customer to purchase the alternative item . still alternatively , the customer may be provided a “ rain check ” that may be stored within the system , on the customer &# 39 ; s loyalty card , key fob , etc . further if the item is a sale item , the sale price may further be stored and applied during a later shopping trip . the consumer may scan a product when the product is placed in the cart for purchase . upon the scanning of the item , the personal shopping device may store the information indicating that the consumer wishes to purchase the scanned product . at any time , the consumer may review the list of items placed within the cart . this may be beneficial if the cart is particularly full and the consumer is not sure if a particular item on the shopping list was picked up . upon scanning the item , the interactive shopping list may be searched to determine if the scanned item is on the shopping list . if the scanned item is on the interactive shopping list , the interactive shopping list may be automatically updated and an indication may be made in the interactive shopping list that the item has been picked up for purchase . upon check out , the information identifying the products that have been scanned into the personal shopping device and placed in the cart may be transferred to a checkout device . this may reduce the amount of time the consumer spends checking out . after a consumer checks out , the information identifying the products purchased may be transmitted , through application server 106 , 108 to application servers 120 , 122 , for storage in databases 142 , 144 . alternatively , application servers 106 , 108 may include databases that store the information locally . this stored shopping history may be used for many purposes as discussed herein . alternatively , certain products within the shopping establishment may include a rf id tag . the rf id tag may be active or passive . a product on a shelf with the tag may be active . when the customer registers the product with the personal shopping device and being intended for purchase , the personal shopping device may change the rf id tag to passive . at the time of checkout , the customer &# 39 ; s cart may be scanned to determine if there are any active tags in the shopping cart . an active tag in the customer &# 39 ; s shopping cart indicates that the customer did not properly scan the product for purchase . the consumer may scan a product and search for a similar or cheaper product . for example , the consumer may scan an item that is 64 ozs . and costs $ 8 . 00 . however , maybe the consumer may only need 6 ozs . of the product or maybe the consumer does not wish to pay $ 8 . 00 . the consumer may select a certain application within the consumer interface at the personal shopping device wherein the product directory may be searched to locate a similar product that is smaller and / or does not cost as much . alternatively , the consumer may scan a particular product , i . e ., mr . clean , a cleaning product . the system may identify a similar product that is on sale , or has a computer - generated discount available , and display the alternative to the consumer . the consumer may then take advantage of the information offered to the consumer . for example , the consumer may receive information from the system identifying a computer - generated discount for lysol cleaner . the consumer may decide to use the computer - generated discount and purchase lysol instead of mr . clean . upon scanning the lysol , the system may take note of the use of the computer - generated discount so that , upon checkout , the consumer may receive the discount without having to “ clip coupons ”, produce any paper notification of the discount , etc . in addition to the recipes discussed above , the consumer may search memory located in the personal shopping device and / or application servers 106 , 108 , 120 , 122 , for recipes . the recipes may alternatively be provided by a manufacturer through manufacture server 126 . upon selection of a recipe , the ingredients of the recipe may be placed on the consumer &# 39 ; s interactive shopping list . the consumer may make an indication through the consumer interface to remove the item from the interactive shopping list . further , the consumer may store the recipe on the key fob 140 for downloading at the consumer &# 39 ; s home personal computer . alternatively , the consumer , through personal shopping device 102 , 104 , may e - mail the recipe to himself for viewing at , for example , home , or the consumer may direct the recipe be printed out at a printer located , for example , at the shopping establishment . it may be appreciated by one skilled in the art that the personal shopping device may provide the consumer the capability to browse and access servers 134 , 136 on the internet to access information including recipes . store server 110 , application servers 106 , 108 and / or application servers 120 , 122 may store information relating to recipes . these servers may further store , or have access to data associating the ingredients of the recipes with certain products in order to assist the customer during the shopping experience . these products that are associated with the ingredients may be store brand products , name brand products , etc . the customer may be provided with an option of selecting whether the products associated with the ingredients for the recipe are store brand products or name brand products . for example , if the customer was shopping at safeway supermarket , safeway may want to promote their store brand products . when a customer selects a recipe to view , additional information may be displayed identifying safeway brand products that should be purchased in order for the customer to make the recipe . alternatively , the customer may have the option to select certain recipes based on characteristics of the dishes produced by the recipe . for example , the customer may select a recipe and may further select a low sodium version of the recipe , a diabetic friendly version of the recipe , a low fat version of the recipe , etc . additionally , the system may allow the customer to select how many people are being served and modify the recipe accordingly . for example , if the recipe serves 4 people , and the customer is serving 8 people , the system may automatically double the recipe . further , the products associated with the recipe , taking into account that the recipe has been doubled , may be provided to the customer and / or added to the customer &# 39 ; s shopping list . further , the customer may request a recipe based on other characteristics , including cost of products , number of calories per serving , amount of fat per serving , kosher ingredients , etc . further , the system may enable the customer to select a weekend meal plan , week meal plan , etc ., wherein the customer may select several recipes to serve over the weekend , week , etc . upon selection of the recipes , the associated products may be added to the customer &# 39 ; s shopping list , and the meal plan and / or recipes may be stored on the customer &# 39 ; s key fob or loyalty card , e - mailed to the customer , etc . the customer may be able to remove those items from the shopping list that the customer has at home . alternatively , the system may monitor the selected meal plan to ensure the selected meal plan conforms to a customer &# 39 ; s diet . for example , if the customer is on a weight watcher &# 39 ; s diet , the system may count the points per serving of the recipes selected by the customer and notify the customer of the point count , as a running total , as a final total count , etc . still further , the system may store information relating to wines that may be associated with recipes . if a customer has selected a certain recipe , the system may further recommend a wine that may go well with the selected recipe . by storing information relating to the products that the consumer has placed in the cart , additional features may be realized . for example , the ingredients of the recipes stored in memory may be search and associated with scanned items in the consumer &# 39 ; s shopping cart . for example , if the system determines that the consumer has purchased avocado , onion , and tomato , the personal shopping device , at the direction of application server 106 , 108 , 120 , or 122 , may prompt the consumer to purchase lemon and may further provide a recipe for guacamole . further , directed offers , i . e ., computer - generated discounts , may be made to the consumer . for example , if the consumer has selected $ 75 total merchandise for purchase , the personal shopping device may display an offer to the consumer to access a particular website to receive some incentive ; if the consumer has purchased 3 bags of chips , the consumer may be offered a computer - generated discount to receive a free can of salsa etc . alternatively , the system may offer information to the consumer that is associated with particular products being purchased . for example , if the consumer scans mr . clean into the personal shopping device , the system may search its memory and offer cleaning tips to the consumer . in addition to the information discussed herein , inventory information may be maintained at store server 110 , application server 106 , 108 , application server 120 , 122 and / or database 142 , 144 . this inventory information may be updated in real time as the consumers purchase the products within the shopping establishment . for example , when a consumer scans bounty paper towels at the personal shopping device , an inventory database that may be stored at store server 110 , buffer server 107 , application servers 106 , 108 , application server 120 , 122 , and / or database 142 , 144 may be updated . predetermined thresholds may be established so that when a particular product &# 39 ; s inventory level drops to the predetermined threshold , the system may prompt a user at application server 106 , 108 , store server 110 , and / or application server 120 , 122 to order more of that product . alternatively , the system may automatically generate an order that may be sent through application server 120 , 122 to manufacture sever 126 for more of that product . similarly , the system may provide for predetermined thresholds to identify when there is an overstock of a particular item . if the system determines there is an overstock , the system may automatically generate a computer - generated discount or advertisement that provides incentive for the consumer to purchase the item in order to reduce the overstock situation . these computer - generated discounts may be offered consumers using the plurality of methods discussed herein . alternatively , the manufacturer may predefine a price where products may be offered to customers at the predefined price when an overstock situation occurs . this reduced price may be offered to the customers for a period of time , until the inventory reaches a normal or predefined level , etc . it may be appreciated by one skilled in the art that applying the principles discussed herein , the shopping establishment owner may determine purchasing trends , anticipate further purchases and product arrays and quantities to be ordered upstream , etc . the system may further have the ability to monitor the power level of each of the plurality of personal shopping devices within or near the shopping establishment . each personal shopping device may have a battery charge of a particular time period . each personal shopping device may monitor its own power levels and may communicate the power levels periodically , or upon request , to application servers 106 , 108 . alternatively , the system may be configured so that when the personal shopping device power drops to a predetermined level , an alert may be generated and send to application servers 106 , 108 . the power levels may further be provided to a consumer so that , should a consumer access a personal shopping device , and should the power level be low , the consumer may select a different personal shopping device to access . further , upon receipt of notification that a personal shopping device is low on power , shopping establishment personnel may remove the personal shopping device from use and plug the device in to recharge . using the input device provided in the personal shopping device , the consumer may insert an external memory card , i . e ., compact flash , memory stick , thumb drive , etc . to download image data . using the consumer interface provided at the personal shopping device , the consumer may select the photo processing services the consumer wishes for the downloaded image data . the consumer may then submit the image data to the photo processing service of the shopping establishment . as key fob 140 may be associated with the identification of the consumer , the time taken to order prints of the image data may be reduced . as such , the consumer may shop within the shopping establishment while the image data is being processed . this reduces the need for the consumer to stand in line to request the image processing service and further , reduces the amount of information the consumer may need to input to request the image processing service . it may be appreciated that similar services may be requested using the personal shopping device . for example , the consumer may request from the flower arrangement services that a particular arrangement be prepared . thus , the consumer may shop while the arrangement is being prepared , thus speeding up the consumer &# 39 ; s shopping experience . alternatively , the consumer may request a certain cut of meat from the butcher using the personal shopping device and thus , the consumer can pick up his request without having to wait on line . similarly , the consumer may request movie rental services , coffee orders , seafood or deli orders , hot food orders , etc . in addition to the film processing application , the personal shopping device may enable the customer to select and transmit an order to a bakery section and / or a delicatessen section of the shopping establishment . the customer may be able to access the bakery counter services application , select item ( s ) for purchase , i . e ., a birthday cake , identify the size of cake , the type of cake , the decoration of the cake , the writing on the cake , etc . once the customer enters all of the bakery order information , the bakery order is transmitted from the personal shopping device through the store server 110 or application server 106 , 108 , to a computing device physically located at the bakery section of the shopping establishment . the customer &# 39 ; s order may appear on a display to a worker in the bakery section . the worker may then fulfill the customer &# 39 ; s order . once the worker has completed the order , the worker may transmit a message to the customer &# 39 ; s personal computing device indicating that the order is ready for pick up . if the customer has already left the shopping establishment , the customer may be notified by e - mail , telephone , etc ., that the bakery order is complete . the personal shopping device may enable the customer to select and transmit an order to a delicatessen section of the shopping establishment . the customer may be able to access the delicatessen counter services application , select item ( s ) for purchase , i . e ., a party platter , identify the size of platter , the contents of the platter , the theme of the platter , etc . once the customer enters all of the delicatessen order information , the order is transmitted from the personal shopping device through the store server 110 or application server 106 , 108 , to a computing device physically located at the delicatessen section of the shopping establishment . the customer &# 39 ; s order may appear on a display to a worker in the delicatessen section . the worker may then fulfill the customer &# 39 ; s order . once the worker has completed the order , the worker may transmit a message to the customer &# 39 ; s personal computing device indicating that the order is ready for pick up . if the customer has already left the shopping establishment , the customer may be notified by e - mail , telephone , etc ., that the delicatessen order is complete . alternatively , the personal shopping device may enable a customer to select and purchase media . for example , the personal shopping device may provide the customer with a list of songs for purchase . the songs may be selected by the customer and downloaded on the customer &# 39 ; s key fob , transmitted to the customer by e - mail , burned on a portable storage medium within the shopping establishment , etc . alternatively , the personal shopping device may enable a customer to refill a prescription at the pharmacy section of the shopping establishment . upon selecting this option , the customer may be required to enter the prescription number and details regarding the order . the order is transmitted from the personal shopping device through the store server 110 or application server 106 , 108 , to a computing device physically located at the pharmacy section of the shopping establishment . the customer &# 39 ; s order may appear on a display to a worker in the pharmacy section . the worker may then fulfill the customer &# 39 ; s order . once the worker has completed the order , the worker may transmit a message to the customer &# 39 ; s personal computing device indicating that the order is ready for pick up . if the customer has already left the shopping establishment , the customer may be notified by e - mail , telephone , etc ., that the pharmacy order is complete . the personal shopping device may further provide narrow - casting information to a consumer . for example , if the shopping establishment was a hardware store , and the consumer was purchasing a particular tool , the system may offer information to the consumer , i . e ., a how - to video providing instruction on how to use the tool . this information may be viewed using the personal shopping device , may be downloaded on the consumer &# 39 ; s key fob 140 , or may be e - mailed to the consumer &# 39 ; s e - mail account for home viewing . it may be appreciated that security features may be implemented within the personal shopping device and / or the shopping cart to ensure that all items placed in the shopping cart for purchase are properly scanned . for example , the personal shopping device , and / or the shopping cart may incorporate a camera whereby when the camera , analyzing images taken by the camera determines that the field of view of the top of the shopping cart has been broken , the personal shopping device determines if an item was scanned within a preset period of time . if there was no item scanned , but the field of view was broken , then an alert may be generated at the personal shopping device requesting the customer properly scan the item for purchase . if the item is again not scanned within a predetermined amount of time , an alert may be generated and forwarded to store server 110 or application server 106 , 108 so that a user of the server may examine the customer &# 39 ; s shopping cart at check out to ensure all items are properly scanned . alternatively , the personal shopping device and / or shopping cart may incorporate a three - dimensional scanner that scans the cart , and the items included therein . the scan may then be processed to determine whether all items in the cart were properly scanned . if then items were not all properly scanned , alerts may be generated to the customer and the user as noted above . in addition to the reporting capabilities discussed above , it may be appreciated that based upon the type of data stored within the system and the structures of the data tables discussed herein , real - time current and historic data mining may be realized . further , a company &# 39 ; s return on investment may be accurately determined . for example , assume customers may be categorized in four categories , i . e ., shops little / buys little , shops little / buys a lot , shops a lot / buys little , and shops a lot / buys a lot . these categories may be based upon predetermined thresholds based on the number of times a customer shops , and how much money is spent during each shopping trip . as the customer shopping information discussed above is obtained at the personal shopping device and stored within the system , reports may be generated to determine if customers are moving from one category to another as time progresses , the company may realize a return on investment . as historic data is maintained in addition to current data , accurate return on investment values may be calculated . return on investment may be determined based on an individual store , a predefined group of stores , a demographic group , etc . the return on investment value may be customized for each company , as each company may establish their own predetermined thresholds for each category . modifications and adaptations of the present invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . the foregoing description of an implementation of the invention has been presented for purposes of illustration and description . it is not exhaustive and does not limit the invention to the precise form disclosed . modifications and variations are possible in light of the above teachings or may be acquired from the practicing of the invention . for example , the described implementation includes software , but systems and methods consistent with the present invention may be implemented as a combination of hardware and software or hardware alone . additionally , although aspects of the present invention are described for being stored in memory , one skilled in the art will appreciate that these aspects can also be stored on other types of computer - readable media , such as secondary storage devices , for example , hard disks , floppy disks , or cd - rom ; the internet or other propagation medium ; or other forms of ram or rom . attached to this disclosure as appendix a are ( 1 ) twenty - six ( 26 ) sheets of exemplary displays that may be presented to the consumer consistent with principles of the present invention ; ( 2 ) systems and methods for enabling information management incorporating a personal computing deice : user interface / application design ; ( 3 ) systems and methods for enabling information management incorporating a personal computing device : hardware application design ; ( 4 ) systems and methods for enabling information management incorporating a personal computing device : hardware design ; ( 5 ) two ( 2 ) information sheets including features consistent with some embodiments of the present invention ; all of these 5 documents are incorporated herein by reference in their entirety .
| 6 |
fig1 illustrates an exemplary environment for implementation of a system 10 for monitoring rso 2 of a patient . the system 10 has a spectrophotometric apparatus 18 connected to a sensor 16 through an electrical cable 24 . the electrical cable 24 may include a signal amplifier 26 . the spectrophotometric apparatus 18 is a computer or other processor - based computing device 20 and a monitor or other visual display device 22 . the computing device 20 includes customary memory devices that store data and algorithm instructions and a processor that executes algorithm instructions . the sensor 16 takes spectrophotometric readings of the monitored region and generates corresponding representative electrical signals , which are conveyed to the computing device 20 . the computing device 20 processes the signals and causes data to be displayed on the monitor 22 . periodically , the computing device 20 calculates an rso 2 value from the electrical signals . the calculated real time rso 2 value is numerically displayed on the monitor 22 . additionally , a certain number of historical real time rso 2 values are graphically plotted to generate a line graph of the historical real time rso 2 values over time . from these two displays , a caregiver can observe the current rso 2 level of the patient , as well as the historical rso 2 levels . further , computing device 20 calculates a trend statistic of the real time rso 2 values . one such trend statistic is a trailing average of the real time rso 2 values . a person of ordinary skill in the art understands how to calculate a trailing average value from a group of rso 2 values . in general , an average of all of the non - zero rso 2 values calculated for a particular period of time , e . g ., the last 60 minutes , is calculated each time a new real time rso 2 value is calculated . each calculated average value is plotted to generate a line graph of average rso 2 values over time , which is displayed on the monitor 22 concurrently with the numerical representation of the current real time rso 2 value and the line graph of the historical real time rso 2 values . other known trend statistics may be used instead of a trailing average value , such as a trailing median value , and they may be displayed in various ways other than a line graph . the object is to calculate and display a trend statistic that provides a caregiver with information from which the trend of the real time rso 2 values can be assessed . fig2 illustrates an exemplary display on a monitor 22 showing the real time rso 2 values and the statistical trend data for two different channels . references 100 a and 100 b are directed to the numerical representation of the current real time rso 2 value for the first and second channels , respectively ; lines 104 a and 104 b are the graphical representations of the historical real time rso 2 values , plotted over time , for the first and second channels , respectively ; line 102 a and 102 b are the graphical representations of statistical trend data , e . g ., the trailing average values , plotted over time for the first and second channels , respectively . other configurations and arrangements of the illustrated regions on the monitor 22 are contemplated and within the scope of invention . the exemplary embodiment described herein has several advantages over known blood oxygen saturation monitoring systems . for example , a trend statistic , such as a trailing average or median , can alert a caregiver to slowly progressive changes that presage impending events , including catastrophic biologic changes . this is counterintuitive since it would seem more appropriate to watch the real time measurements than to look at a trend statistic . however , where the perfusion distribution of the patient , such as a neonate , is highly variable , progressive average change of the data can be obscured by the erratic nature of the real time values . displaying a trend statistic assists the caregiver in identifying such progressive average changes . on the other hand , it remains useful to display the real time values as well . the real time values allow the caregiver to determine if the trend statistic represents mostly signal dropout coupled with consistently low readings or if it is just the normal wide variation giving the same low average blood oxygen saturation values . the combined use of real time rso 2 values and trend statistics is beneficial as illustrated by the following examples . an rso 2 profile of mostly rso 2 of 15 - 20 mmhg with intermittent periods of 35 - 45 mmhg can evidence a different clinical condition from prolonged periods of mostly 20 - 25 mmhg with no periods higher . but both could present the same trend statistic ( e . g ., a trailing average ) while the real time data would highlight the difference . conversely , presenting the data as a rolling average in combination with the real time data is critical so that if there is a sudden catastrophic change it will not be obliterated by the average graph . this is exemplified in a situation where paco 2 suddenly drops due to over ventilation causing a dramatic drop in the cerebral blood flow 1 . 1 paco 2 is the partial pressure of carbon dioxide in arterial blood , measured by analyzing an arterial blood sample on a blood gas machine . normal range is 35 - 45 mmhg and increases in paco 2 selectively raise cerebral blood flow by about 2 - 3 % per mmhg and vice versa . an exemplary application of the above - described embodiment is directed to detecting necrotizing entercolitis (“ nec ”) in neonates . nec in neonates may be predicted by caregivers based on the degree of variability of rso 2 in the gut of a neonate . in addition to display of averaged values , an exemplary approach is described where a measure of variance is ascribed to the averaged data epoch . this measure of variance could be the actual statistical variance , the standard deviation , the confidence interval , standard error or some other measure of variability of the data , hereinafter “ index of variability .” variability over short ( 0 - 60 seconds ) and medium ( 1 - 30 minutes ) time frames is inherent to physiological systems and can indicate the robustness of those systems . the index of variability can be used to track both short - and medium - term variability depending on the length of the averaging epochs and the method used to calculate the index . because different areas of the body exhibit differing blood flow rates , the time frames , epoch lengths , and methods used to calculate the variability index can be adjusted based on expected flow in various organs or body areas . this adjustment can be user selectable or can be automatically invoked based on the label assigned to a specific channel indicating its sensor location or typical flow rates . variability in certain physiological systems can change based on factors other than the patient &# 39 ; s well - being . for example , variations of the hemodynamics of the splanchnic circulation can change significantly during pre - and post - prandial conditions . likewise , variations in cerebral blood flow can increase significantly if cerebral perfusion pressure falls to a level close to or below the lower limit of autoregulation . premature infants exhibit very high levels of variability in some organ beds such as the splanchnic bed during the first weeks of life . therefore , the patient monitor disclosed herein can change the method of calculation , the length of data epochs , or the thresholds used for alerting caregivers based on demographics , gestational age , location of the measurement , feeding status or other measures or parameters to allow the system to adjust to varying conditions and demographics . the index of variability can be displayed in several unique ways . for example , in one exemplary implementation , dotted lines above and below the trend line of the average value can indicate variance above and below the mean value . the areas above and below the mean may be filled in with a transparent color such that objects below are still visible . further , a series of whiskers or error bars may be added to the averaged trend to indicate the magnitude of variability above and below the mean . changes in the index of variability can be tracked over time to indicate basic changes in the well - being of the patient . as variability decreases , in most cases the overall well - being of the patient is declining . likewise , as variability increases , well - being is usually improving . therefore , changes in variability beyond a fixed or user - adjustable threshold can be used to alert caregivers to changes that may reflect changes in patient condition . additionally , real time values that remain significantly outside the limits of variability for a preset or adjustable time period may also trigger an alert or message to indicate a major change in the patient &# 39 ; s condition . indication of significant changes in the index of variability can be indicated on the trend through color changes , drawing the user &# 39 ; s attention to the change as it occurs . alternately , changes in variability can trigger a message on the screen or can be used to activate an audible alert to warn the user that a change is occurring . while the index of variability can extract information on significant changes to the magnitude of variations , another implementation can process data in a way that extracts information on the frequency of variations . by observing data in the frequency domain , significant changes in the power and frequency of variability can be observed in real time . the patient monitor described herein is configured to convert epochs of data to the frequency domain using a method such as fourier transformation where the power of variability is plotted against the frequency of that variation . using this technique , significant changes in either power or dominant frequency of variations can be tracked and changes greater than a threshold can be used to trigger an alert as described previously . with regard to the processes , systems , methods , heuristics , etc . described herein , it should be understood that , although the steps of such processes , etc . have been described as occurring according to a certain ordered sequence , such processes could be practiced with the described steps performed in an order other than the order described herein . it further should be understood that certain steps could be performed simultaneously , that other steps could be added , or that certain steps described herein could be omitted . in other words , the descriptions of processes herein are provided for the purpose of illustrating certain embodiments , and should in no way be construed so as to limit the claimed invention . accordingly , it is to be understood that the above description is intended to be illustrative and not restrictive . many embodiments and applications other than the examples provided would be apparent upon reading the above description . the scope of the invention should be determined , not with reference to the above description , but should instead be determined with reference to the appended claims , along with the full scope of equivalents to which such claims are entitled . it is anticipated and intended that future developments will occur in the technologies discussed herein , and that the disclosed systems and methods will be incorporated into such future embodiments . in sum , it should be understood that the invention is capable of modification and variation . all terms used in the claims are intended to be given their broadest reasonable constructions and their ordinary meanings as understood by those knowledgeable in the technologies described herein unless an explicit indication to the contrary in made herein . in particular , use of the singular articles such as “ a ,” “ the ,” “ said ,” etc . should be read to recite one or more of the indicated elements unless a claim recites an explicit limitation to the contrary .
| 0 |
fig1 shows a system 2 which system comprises a flow duct 4 in which a first transducer 6 and a second transducer 8 are transmitting acoustic waves 10 across the duct 4 . both transducers 6 , 8 are connected to a switch 12 by which switching for receiving and transmission is effected . the transmitter receiver switch 12 is connected to a transmitter circuit 14 and to a receiver circuit 16 . the receiver circuit 16 comprises a band pass filter 18 which is connected to a microcontroller 20 , and the microcontroller 20 is connected to a digital converter 22 . the microcontroller 20 further comprises a digital filter 38 , an amplitude function 42 and a phase detection function 44 . the microcontroller 20 further comprises a digital constant fraction discriminator 46 . additionally , a voltage follower 50 is shown in the microcontroller 20 . the microcontroller 20 is also connected to the transmitter circuit 14 which comprises a band pass amplifier 48 . in operation , flow will be measured between the transducers 6 , 8 , and in one situation , the transducer 6 acts as transmitter and the transducer 8 acts as receiver , and in the next situation , the transmission occurs in the opposite direction with the transducer 6 acting as the receiver and the transducer 8 as the transmitter . on the basis of these signals , and by the means provided inside the microcontroller 20 , the system can calculate the flow in a highly efficient manner . fig2 & amp ; 3 show that the received and band pass amplified signal is analog to digital converted by a built - in analog to digital converter and is stored in memory . the measurements of transit times and time difference are solely performed by the microcontroller 120 based on these stored values . after transmission in either direction , a number of samples are stored in the memory . the sampling starts after a time determined by an internal timer in the microcontroller 120 such that the received pulse is sampled from the beginning . the time for the first sample is stored in the memory as one value for transmission against the flow and another value for transmission with the flow . a vector of samples is stored for each direction of transmission . each vector contains an appropriate number n of samples , in the actual embodiment the vector 130 contains 512 samples , but less may work well . the first step in the signal processing is to multiply each value in the frames with a complex number with the magnitude one and a phase corresponding to the transmitted signal : y n = x n · e jω · t s · n = x n ·( cos ( ω · t s · n )+ j sin ( ω · t s · n )) 164 where x n is the stored value at the n th location , jω the angular frequency of the transmitted signal , t s the sampling time interval and n is the sample number . 0 ≦ n & lt ; n the complex result y n is filtered by two low pass filters , one for the real part a n and one for the imaginary part b n . after low pass filtering , 116 im , 116 re is the result is a complex sequence ( a n + jb n ) with n ={ 0 , 1 , . . . n - 1 , n }. the amplitude 142 of the received signal can , sample for sample , be found as the square root of the sum of squares . a n =√{ square root over ( a n 2 + b n 2 )} 142 fig4 shows a possible embodiment for an amplitude signal that is used to determine the arrival times t up and t dwn by means of a digital constant fraction discriminator cfd 146 . the output from the cfd 146 is used to place the sampling frame so that it starts where the pulse would have been if there has been no dead delay . the dead delay is the delay due to cables , solid parts of transducers and delay in the band pass filter . the start of the sampling frame ideally equals the transmission time in the fluid t up and t dwn . the frequency of the timer clock limits the resolution , but the precision is sufficient for the t up and t dwn values in the denominator , but not sufficient for the difference δt since it requires more resolution than the sampling frames are adjusted with . the purpose of the phase detection 144 is to increase the resolution of the time difference t up − t dwn = δt . the output from the low pass filters 116 im , 116 re represents the phase difference between the frame with its reference sequence and the received signal . the filtered output can be further filtered to decrease the standard deviation on the phase measurements . the phase is the argument to the last complex number ( a n - 1 + jb n - 1 ) in the vector 130 where the amplitude and phase are stable . if the signal from the upstream measurement is ( a n - 1 + jb n - 1 ) and from the downstream measurement is ( c n - 1 + jd n - 1 ), then the phase difference is : since the angle is small if the frame is adjusted with steps much smaller than the sample time the arctan is easily calculated by the series : the actual length of the series depends on the required accuracy and the range of values of x , but the shown length will normally suffice . if noise is present , the cfd signal 146 may fluctuate with a few samples and the nominal value of the division may be larger than the range of the arc tan function , but a few numbers out of range can be discarded without offsetting the mean value of measurements since the deviations are expected to be symmetrical . practical measurements have shown a three to five times decrease in standard deviation with the above method compared to the deviations obtained from a zero crossing detection on the same signal . the band pass amplifier is necessary to limit the bandwidth of the transmission burst from the microcontroller . a square wave like the burst from the microcontroller has too a high slew rate which will bring the operational amplifier in the t / r switch 112 into slew rate limit and ruin the essential reciprocity of the t / r switch 112 . the transducer amplifiers can be coupled as voltage followers 150 or as current generators . a main difference from common practice is that the transducer is connected to a node in the circuit without switches , the input of the transmission signal to another and the received signal appears on a third . the transducer is connected to the same node in the circuit both during transmission and reception , and thus , is always loaded with the same impedance . as a result , it obeys the “ reciprocity theorem ” making the time delay difference ( difference in transmission time with or against the flow ) unchanged by transducer changes due to temperature , contamination or aging . fig5 shows a possible embodiment for an amplifier circuit for connoting the transducers 206 , 208 . the voltage on the positive input terminal of one of the operational amplifiers 214 , 216 is followed by the negative input terminal , and if a signal appears on the negative terminal , it is amplified and inverted on the output of the amplifier 214 , 216 . when the amplifier 214 , 216 is used for transmitting a signal , the amplifier 214 , 216 is a “ power amplifier ” of a large signal , and when receiving , the amplifier acts as a preamplifier of a small signal . the anti - parallel diodes 260 , 262 serve as low impedance during transmission and as high impedance during receive mode preventing the amplifier 214 , 216 from going into saturation under transmission of a large signal . under reception of small signals they act virtually as disconnections compared to the resistor they are parallel to . the reciprocity theorem requires the transmitting transducer to be driven with the same impedance as the transducer used as receiver . in fig5 , the impedances are virtually zero , but any impedance can be used . the circuit in fig6 has virtually infinite impedances as a current generator , both as power amplifier and as preamplifier . in principle , the t / r switch 312 of fig7 can look like in fig5 . but in most cases , it is too simple . in practice , a more elaborate scheme must be followed to avoid over coupling of the transmission signal via the off capacitance of the switch 312 . an example of minimizing the influence of the off capacitance in the switch is shown in fig7 . an extra switch 314 , 316 is provided enable a capacitive coupling to ground 318 , 320 instead of to the transmission signal from the other channel . this is especially important in air transducers where the received signal is normally 60 db lower than the transmitted signal and the transmitting transducer continues “ ringing ” long time after the excitation . fig8 shows a band pass amplifier 402 with agc . the signal 404 from the front end is for air transducers in the range of few millivolts and hence too small to be analog to digital converted by the built - in analog to digital converters in standard microcontrollers . at the same time , the sampling rate with present technology of low cost microcontrollers is in the range of 1 to 2 million samples per second . in order to avoid aliasing , all frequencies above half the sampling frequency must be removed before digitizing . the frequencies used in air flow meters are up to 250 khz , and if 500 khz shall be damped to say 60 db , it requires a low pass filter with a very sharp cutoff or a more than 10 th order filter . alternatively and much better , is a band - pass filter . the required bandwidth is 5 to 10 khz depending of the transducer used . sallen - key or multiple feedback active filters are appropriate , but other filter types , such as passive lc filters , switched capacitor filters or even mechanical filters can be used . due to fabrication tolerances and temperature variation , the signal amplitude will change from transducer to transducer and during operation . in order to minimize the digitizing noise , the analog to digital converter will utilize the full dynamic range , so that the controller will be able to adjust the amplification . in order to keep the dynamic range of the analog to digital converter utilized , the amplification must be changed in appropriate small steps , preferably in a converter , within certain limits , the agc will work in a way that gives the same percentage gain increase per step . depending on the gain variation , the necessary number of steps and the size of each step will be chosen . a simple 1 of 8 multiplexer 4051 type number can do the task by selecting feedback resistance 406 in an amplifier as shown fig8 if larger gain variation is necessary due to the same electronic unit be used for many different tube diameters , or if there exists a possibility for contamination that may dampen the signal , a digital resistor 406 with 1024 steps may be preferred . since the steps are linear in most commercial versions , a scheme like the one shown in fig9 may be used . this circuit gives a total gain variation of nearly 30 db distributed over the 1024 steps as shown hereunder : fig1 shows a graph that indicates the correlation between the gain and the binary digits . as can be seen from the curvature , increasing binary numbers will achieve a much better gain . by using an analog signal from either a digital to analog output or a filtered pulse width or rate modulated signal from the processor analog variable gain amplifiers or circuits with diodes or voltage dependent resistors can be used . also , use of ptc resistor circuits or the like that thermally changes attenuation on high signal amplitude may be used . fig1 discloses the preferred transducers which are common piezoelectric transducers with a piezoelectric element 604 exited at the lowest radial resonance frequency and approximately a quarter wavelength silicon rubber disk 606 as impedance alignment is glued to the front surface of the piezoelectric element 604 . alternatively , transducers used for parking sensors in cars can be used . these normally work at 40 khz and have a wide angle transmission pattern . if these are used only direct transmission between transducer are used , due to the risk of direct transmission of a spurious signal during the transmission of the reflected signal . fig1 shows a possible embodiment for a transducer and transducer housing with the following characteristics , for example . while the embodiment is shown in fig1 is preferred , other forms either preformed or molded in pace may be used . since the sound more readily goes through solids than through air , the transducer must be isolated acoustically from the duct 4 , 104 , otherwise some sound would be transmitted through the tube wall and arrive at the receiving transducer 6 , 8 , 106 , 108 , and interfere with the flow signal and create nonlinearity . the isolation can be performed with a silicon rubber foam parts 610 , 604 and 612 in the fig1 . the material of the the impedance alignment disk can be various other materials with low acoustic impedances and loss , e . g ., resin filled with hollow glass spheres or hard foams . fig1 shows a flow duct 704 with a reflection 710 whereby the two transducers 706 , 708 become placed on same side next to each other . the distance between the transducers is the same for all tube diameters ; as a result , the time difference δt for the same flow and temperature becomes the same for all sizes . let c be the sound velocity , d the tube diameter , and lx the distance between the transducers . transducers alternately transmit ultrasonic pulses and alternately receive said transmitted pulses . thus , the transmission goes with the flow and against it alternately . ( c · t up ) 2 =( 2 + d ) 2 +( lx + v · t up ) 2 and ( c · t dwn ) 2 =( 2 + d ) 2 +( lx − v · t dwn ) 2 first , solve both equations for c and set the results equal to each other and solve for v : where δt is equal to t up - t dwn and is found with high precision due to the coherent detection principle . the flow meter will be inserted in tubes with nominal bore according to standards . thus , from t up and t dwn it can be determined which standard diameter the flow meter is inserted in and the appropriate calibration constant can be selected from a table stored in memory . since sound traverses the diameter twice in opposite directions , secondary flow orthogonal to tube axis is partially canceled , so that some common flow disturbances have limited influence . the flow profile due to laminar and turbulent flow does have influence , but since the fluid always is air , the reynold number influence can be compensated for by a calculation based on t up and t dwn . the shift from laminar to turbulent flow creates a known shift in flow profile and the shift appears when the reynolds number is : where p is the pressure in pascal , r = 287 . 05 j /( kg · k ) the specific gas constant and t the temperature in kelvin . ( the density for this purpose can be assumed to be 1 . 2 kg / m 3 ), d h is the hydraulic diameter of the pipe and v is the kinematic viscosity of air . the necessary correction will be determined for each dimension by flow tests , but there exists theoretical / empirical formulas for corrections . by these measures it is possible to minimize deviations to a few percent even with flow disturbances as close as a few diameters from the inlet . for two reflections , two parabolic mirrors will be used and for three reflections two parabolic and one flat mirror preferably will be used . normal direct transmission with one or more tracks is possible and will be used as an alternative . the calibration constants of this are found by standard well proven principles .
| 6 |
referring to fig1 , well 10 is shown drilled with a horizontal segment in reservoir 12 . casing 16 has been placed in the wellbore and cement 14 pumped into the well to seal the annulus between casing and the wall of the wellbore . perforations 18 have then been formed sequentially during the completion process of the well , usually using a well - known process ( often called “ perf and plug ”) that involves sequential formation of clusters of perforations 18 beginning from the distal end ( toe ) of the well . one set of perforations is formed , a fracturing treatment is performed through that set of perforations , then a bridge plug is set in the wellbore above the perforations and another set of perforations is formed . a fracturing treatment is then performed in the well through the second set of perforations . this process may be repeated for dozens of times in long horizontal wells . the plugs are removed from the well after all fracturing treatments are performed and the well is placed on production . after the “ perf - and - plug ” method of hydraulic fracturing is used , the plugs are removed and the well is produced , the wellbore condition is as depicted in fig1 . the casing in the well contains a large number of perforations , spaced apart over a distance of hundreds or thousands of feet . the production rate of wells completed and fractured as described typically declines at a rapid rate . it is not unusual for the production rate to decline to less than half its initial value within one year . there is then a need to increase production rate from these previously fractured wells . the process to accomplish that is commonly called “ re - stimulation ” or “ re - fracing .” re - stimulating an existing well by fracturing , however , is more difficult than fracturing during initial completion . to fracture a formation effectively , fluids must be pumped downhole under high pressure , through perforations and into the surrounding formation . on a new well , a single stage is perforated and fractured at a time beginning at the toe , as described above . in a re - stimulation process , the casing already contains many perforations spread over a large interval . unless perforations can be isolated or plugged during the treatment , pressure applied during the fracturing process is distributed across the entire perforated segment of the well , which results in practically no new fracturing activity during injection of fracturing fluids . the key to re - fracturing a producing well is to close off most of the perforations at a time when a treatment is to be performed , which reduces the surface area of the exposed formation and increases the pressure on the open areas . the method disclosed herewith employs buoyant or floating ball sealers or ball sealers having a specific gravity very near that of the injection fluid used to treat a well . batches of these ball sealers that may have different rates of degradation under conditions in the wellbore are injected . some ball sealers may have a very slow rate of degradation , degrading in the well over many hours or even days . other ball sealer may degrade at wellbore conditions within a few hours . degradable ball sealers are commercially available with a broad range of degradation times over a range of wellbore temperatures . in preparation for the process described herein , system 13 ( fig1 ) is preferably installed to monitor the fracturing process in the well being re - stimulated . system 13 may be a microseismic system , which is commercially available from pinnacle ( a halliburton company ), microseismic inc . or others , or an imaging system called eem that is commercially available from deep imaging technologies of tomball , tex ., or any other system to monitor the real - time formation of a hydraulic fracture around well 10 . detectors may be installed in well 10 , in an offset well or at the surface around well 10 . in preparation for the fracture treatment , degradable ball sealers may be injected into a well using commonly available ball injection apparatus . the ball sealers are pumped downhole with the conveying fluids at pressures that fracture at least one interval in the well . they follow the path of the conveying fluid and may get lodged in the first perforations they come to where fluid is flowing through the perforations — blocking the flow through those perforations , or they may seat in perforations farther down the well . it is usually not possible to predict a priori where the ball sealers will seat . fig2 illustrates ball sealers 11 a , having the longest degradation time under wellbore conditions of all ball sealers to be injected , arriving at the first cluster of perforations and beginning to seal perforations in that interval . the ball sealers may not seat on the first perforations , but are much more likely to seat on the first perforations where fluid is flowing through perforations and fracturing the adjoining rock . although fig2 illustrates ball sealers seating in the first cluster of perforations , it should be understood that the location of the perforations where ball first seat may be anywhere along the wellbore . during the pumping of fluid and first fracturing , monitoring system 13 is preferably used to determine which interval of the well is being fractured . alternatively , calculations of pressure drops through perforations may be used to analyze the fracturing process , using methods well known in industry . there are multiple scenarios relating to the use of the combination of both “ time and temperature buoyant degrading ball sealers ” and “ non - degrading balls which lose their buoyancy ” in the re - stimulation process . the term “ buoyant ball sealers ” or “ floating balls ” is used to designate ball sealers having a specific gravity within a selected range of the specific gravity of the fluid carrying the ball sealers down the wellbore . balls may be selected with different ranges of specific gravity differences by allowing balls to segregate in a fluid having a selected specific gravity . a range of differences of 0 . 2 , 0 . 1 0 . 05 and 0 . 02 may be selected for batches of buoyant or floating balls , for example . a range of degradation - time of balls can be pumped at fracturing rate to achieve a near ballout . this will allow for treatment of a specific interval with a large stage fracture treatment . at the end of the treatment a sufficient number of the non - degradable floating balls can be used to plug off the section treated until the entire lateral is stimulated . when the shortest degradation set of balls has degraded , another fracturing stage will be initiated and pumped to completion followed by non - degradable floating balls to seal off the second stage . this process may be repeated until the entire section is treated . for various reasons it is possible that the degradable balls will break down earlier than anticipated and more time - degradable balls will be required to temporarily shut - off the section of the lateral prior to stimulation . any breakdown can be observed using microseismic and or eem . where microseismic and eem are not available , the process can be conducted utilizing well - known calculations of perforation friction . this process without surface observation or monitoring , although not optimum , is expected to be superior to diversion techniques using fiber or particulate material . the process disclosed herein will be very dynamic , since it is unknown what intervals were actually treated in the initial fracturing of a well . therefore , multiple iterations of ball drops with various degradation levels may be required in the present process . after fracturing subsides or ceases in the first interval after ball sealers have stopped flow into that interval , pumping is continued to begin fracturing in another interval , which is monitored by monitoring system 13 . each round of ball sealers injected may be selected to degrade in progressively shorter time duration after they block perforations . alternatively , each round of ball sealers injected may be selected to degrade in progressively longer time duration after they block perforations . if the nearest open perforations are blocked with each subsequent round of ball sealers , the sealers closest to the toe may break down the fastest or break down first . ball sealer injection may continue until the well is “ balled out ,” meaning that the maximum rate of fluid injection is very low , for example , less than 5 barrels per minute or even 1 barrel per minute . with microseismic , an electromagnetic imaging system or good information on friction pressure losses in pipe and perforations , it may be desirable to initiate the first fracturing treatment through perforations that have not received ball sealers . after this first treatment , non - degradable balls are dropped , degradable balls are dropped and time for degradation of degradable balls is allowed before the next treatment is started . fig3 illustrates that ball sealers 11 a , 11 b and 11 c , having progressively shorter or progressively longer degradation times , have sealed three sets of perforations at increasing distance from the heel of the well . the last cluster of perforations , nearest the toe of the well , may have been sealed by ball sealers 11 d , having the shortest degradation time of all ball sealers injected , but sealers 11 d are not shown because if they were injected they have degraded . the perforations in that segment may have been opened by the degradation of ball sealers that were originally in that interval . alternatively , injection of balls may have been stopped before blocking that interval . fig4 illustrates a fracturing treatment being pumped through the farthest set of the perforations , or those nearest the toe of the well . fracture - affected volume 15 a in reservoir 12 has been formed as a result of the first stage of the re - fracturing treatment . microseismic data may be collected at the surface or in offset wells or in the well being re - fractured to provide better understanding of where each re - fracturing treatment is occurring . data may also be obtained by electrical or magnetic or any other technique used to detect fracturing in the earth . fig5 illustrates the placement of non - degradable or slowly degradable ball sealers 11 e into the newly fractured perforations . “ slowly degradable ” means that the balls are expected to degrade in a time greater than the total treatment time of all the intervals in a well . after this step the well is prepared for the next fracturing treatment after ball sealers 11 c have degraded . fig6 illustrates that the ball sealers 11 c have degraded in another cluster of perforations , displaced from the distal set of perforations and a second fracturing treatment may be performed in this interval , forming fracture - affected volume 15 b . fig7 illustrates that another batch of non - degradable or slowly degradable ball sealers is injected to close off the second re - fractured interval . the process may be repeated until all intervals have been fractured . of course , it should be realized that , although the invention has been described herein as having fracturing treatments proceed from the toe ( distal end ) or deepest interval of a well successively toward the heel or shallowest segment of a well , the degradation times of ball sealers may be selected such that the most rapidly degrading ball sealers are pumped first and the first fracturing treatment is pumped into the zone where these ball sealers have seated , the nearest interval . then this interval may be isolated by long - life or slowly degradable ball sealers and the next interval be fractured . in most wells this procedure would require longer degradation times of the different stages and , therefore , it would not be the preferred procedure . the non - degradable or slowly degradable ball sealers will eventually degrade in the perforations or wellbore , leaving open fractures with greatly increased productivity , or they may be produced back to surface and collected using conventional ball - catching equipment . the degradation time of a ball sealer in perforations may be determined by placing the ball sealer in a real or simulated perforation in pipe with water or brine immersing the ball sealer and with pressure in the water to seat the ball , bringing the water and pipe to a temperature expected in a well and observing the pressure behavior of water in the pipe . other well - known similar techniques may be used to simulate conditions in a well after ball sealers are injected . the ball sealer is considered to have degraded when the flow resistance through the perforation is less than double the resistance in the absence of a ball sealer . although the present invention has been described with respect to specific details , it is not intended that such details should be regarded as limitations on the scope of the invention , except to the extent that they are included in the accompanying claims .
| 4 |
reference will now be made in detail to specific embodiments or features , examples of which are illustrated in the accompanying drawings . generally , corresponding or similar reference numbers will be used , when possible , throughout the drawings to refer to the same or corresponding parts . fig1 - 8 illustrate an exemplary embodiment of an energy harvester 10 in accordance with various aspects of the disclosure . according to some aspects , as shown in fig1 , an exemplary energy harvester 10 may include a housing 14 and a coupling arrangement 56 for coupling the housing 14 to a host structure 15 . referring to fig2 , the energy harvester 10 may further include a single degree of freedom resonator 12 , a pin 16 ( described in more detail below ), electro - mechanical transducers 18 , and electronic circuitry 20 . in an exemplary embodiment , the electromechanical transducers 18 are piezoelectric elements . referring now to fig3 , in an exemplary embodiment the resonator 12 may be a monolithic single degree of freedom resonator . the resonator 12 may include a beam - spring 21 , a proof - mass 24 , and a backplane 26 . the backplane 26 is relatively rigid in comparison with the beam - spring 21 to support the monolithic construction of the resonator , preferable methods of fabrication include removal of material from regions of a single piece of material or an extrusion that provides the proper geometry . both methods provide a two dimensional structure that can be further shaped to the proper geometry with additional fabrication methods . for example , the material removal can be achieved using electric discharge machining ( edm ), water jet cutting , laser cutting , or manual machining . in order to maximize power density of the resonator , a thin cutout in a rectangular c - shaped pattern , as shown by the dashed - dotted region a ( fig3 ), forms the resonator &# 39 ; s profile . during fabrication , channels 28 , 28 ′, 28 ″ are removed from a monolithic block of material 15 . for example , as shown in fig3 , three separate channels 28 , 28 ′, 28 ″ may be removed from the monolithic block 15 . these channels 28 , 28 ′, 28 ″ run completely through the block of material and separate the elements of the resonator 12 . the channels 28 , 28 ′, 28 ″ define a body 124 of the proof mass 24 , the rigid backplane 26 , the beam - springs 21 , and a plurality of flexures 30 , 32 . holes 34 can be created into the proof mass body 124 as mass receptacles . the holes 34 may be cylindrical , rectangular , or any other desired shape . the holes 34 can run completely or partially through the proof mass body 124 . in some aspects , the proof mass body 124 may account for a majority of the proof mass 24 . other holes ( not shown ) can be added to the mounting base 14 to reduce its weight since it is a parasitic mass in the power density calculation . in some aspects , the holes 34 may be filled with additional mass ( either greater than or less than the removed mass ). in some aspects , additional mass may be fixedly coupled to the proof mass body 124 instead of or in addition to the holes 34 . thus , the number and size of holes 34 and / or the additional mass in the holes or secured to the proof mass body 124 may allow tunability of the resonator 12 . according to various aspects of the disclosure , an exemplary preferred sized of the harvester 10 may be 1 to 100 cubic centimeters in volume . the length to height aspect ratio and / or the width to height aspect ratio can range from 1 to 10 . the material of the mounting base 14 may comprise , for example , a metal , a plastic , or a composite material . according to various aspects , it may be preferable that the base 14 comprise a material with low damping such as , for example , brass , steel , titanium , or aluminum or other metals . referring now to fig4 , in an exemplary embodiment of the single - degree of freedom resonator 12 , the beam - springs 21 comprise a pair of cantilevered beams 22 having a first end 23 and a second opposite end 25 . the beams 22 are supported at the first end 23 by the rigid backplane 26 and are connected to the proof mass 24 at the second end 25 by a flexure 30 . when the proof mass 24 causes the beam 22 to deflect in a direction parallel to the backplane 26 as shown by the arrows c , a spring return force is generated , which causes the beam 22 to return to the rest position . referring now to fig5 , in the current exemplary embodiment , flexures 30 , 32 are used to connect various elements of the resonator 12 . the flexures 30 , 32 may perform similarly to hinge or pin joints with no slop and work to define the resonator &# 39 ; s degree of freedom . the flexures 32 have a first end 27 and a second end 29 . the first end 27 is connected to the proof mass 24 and the second end 29 is connected to the rigid backplane 26 . these flexures 32 are anchored to the rigid backplane 26 and thus serve to restrict the proof mass 24 from moving in a direction parallel to the surface of the beam 22 , as shown by arrows d . such restricted motion would otherwise place the flexures 32 in compression or tension . referring now to fig6 , which shows only half of the resonator 12 and one flexure 32 for clarity , since a cross - sectional dimension of the flexure 32 , as shown by the lines e , is small relative to the average cross - section of the beam 22 , shown by the lines f , the flexure 32 bends easily and offers little resistance to motion of the proof mass in a direction that is normal to the surface of the beam 22 , as shown by the arrows c . hence , the stiffness of the flexures 32 is relatively low , adding only small amounts of stiffness to the beam - spring system 21 . similarly , flexures 30 ( fig3 ) connect the proof mass 24 to the beam 22 at second end 25 where force and moment are only transmitted from the proof mass 24 to the open second end 25 of the cantilevered beam 22 in a direction normal to the surface of the beam 22 , as shown by arrows c . with this setup , the stiffness of the resonator 12 in the direction normal to the surface of the beam 22 , as shown by arrows c , is maximized while the stiffness of the resonator 12 in a direction parallel to the length of the beam 22 , as shown by arrows d , is tailored to define the linearity of the spring stiffness . referring to fig7 , which shows just the beam - spring system 21 for clarity , the cross - section f ( fig6 ) of the beam 22 in an exemplary embodiment of the resonator 12 is varied from a minimum value at the second end 25 to a maximum value at the opposite first end 23 . the first end 23 is attached to the rigid backplane 26 so that as the proof mass 24 bends the beam 22 , the surface strain distribution along the length g of the beam 22 is constant . the thickness of the beam 22 can be tapered according to the particular strain distribution and basic harvester geometry . the beam - spring system 21 is designed such that strain discontinuities from the piezoelectric element 18 are located where the beam 22 is immobilized . the piezoelectric transducer 18 is positioned at the cantilevered first end 23 of the beam 22 such that the end 40 of the transducer 18 is on the rigid back plane side of channel 28 , as shown by lines h . thus , the end 40 of the peizoelectic element 18 nearest the back plane 26 is over a section of material having a cross - sectional dimension i , which is much larger than the cross - sectional dimension k of the beam 22 at the cantilevered first end 23 and is effectively immobilized . at the open second end 25 of the cantilevered beam 22 , the flexure 30 and the beam 22 are connected via a tapered section 42 of material . thus , the end 44 of the piezoelectric element 18 nearest the open second end 25 of the beam 22 is over a section of material with a cross - sectional dimension j , which is larger than the beams cross - sectional dimension l and is effectively immobilized . this geometry minimizes stress concentrations that can lead to fatigue cracks and , for the case in which a piezoelectric transducer 18 is used , it provides a substantially uniform strain distribution on the transducer 18 , which can be relatively fragile . for typical linear resonate systems , linear stiffness may be used to maximize the mechanical quality factor of the resonator 12 . this linearity requires that the proof mass amplitude grows proportionally with increasing input vibration amplitude . in the case of high input vibration amplitudes , damage can occur due to excessive beam - spring deflection or impact of the proof mass with device mechanical packaging . aspects of the disclosure overcome this because the boundary conditions of the beams 22 are designed such that the mode of deflection of the beams 22 changes from a pure bending mode for small displacements m to a combination of a bending and stretching mode for large displacements n . ( the displacements m and n are illustrative only and not necessarily to scale .) the aforementioned transition occurs when the deflection of the beam is sufficiently high that tensile stress in the beam provides the primary restoring force rather than bending stress . for smaller displacements m , the beam - spring system operates similarly to a typical linear resonant system . for higher displacements n , the linear stiffness of the beam - spring system increases . this increased stiffness variation reduces the resonator &# 39 ; s quality factor ( q ) and alters the frequency of the transmissibility maxima . this behavior may be advantageous for many industrial applications where a high level of sensitivity is required for low vibration levels ( i . e ., a high q system for low vibration ) and mechanical robustness is desired for shock and high vibration levels ( i . e ., a low q system for high vibration ). in an exemplary embodiment , as shown in fig8 , the proof mass 24 includes holes 34 as a mechanism for tuning the resonance frequency of the resonator 12 after manufacturing . resonance frequency tuning may be particularly important in manufacturing where it may be undesirable to adhere to tight tolerances and specific fabrication methods which are required for achieving a precise resonance frequency . for an energy harvester 10 with a typical quality factor of 50 and a resonance frequency of 360 hz , the power output will be half of the peak power , if there is a frequency mismatch of 3 . 6 hz . a reasonable 1 . 0 hz frequency tolerance translates to an approximate 3 . 6 micrometer tolerance for the thickness dimension on the 0 . 5 mm thick beam , assuming that all other dimensions are held perfectly to the specification . this level of precision increases the cost of the harvester and decreases its applicability in many markets . the holes 34 in the proof mass 24 are receptacles for discrete masses of different sizes and densities which change the resonance frequency of the resonator 12 . resonance modes of the mounting base 14 and proof mass 24 can adversely influence the performance of the resonator 12 if they lie in the frequency range for which the resonator 12 is designed to operate . the mounting base 14 is therefore designed such that resonance modes dictated primarily by its structure will be much higher than that of the resonator &# 39 ; s spring - proof mass resonance frequency . to achieve this , the mounting base 14 may be designed to be stiff relative to its mass . the mounting base 14 may be constructed with a thick cross - section , shown by the lines marked o , to maximize its first moment of area which in turn defines its flexural stiffness . the base 14 can be constructed from the same material as the single - degree - of - freedom resonator 12 or can be a different material . the preferred materials are ones that have low intrinsic damping and high fatigue resistance . for example , steel generally exhibits a good combination of these two characteristics . as described above , the material of the mounting base 14 may comprise , for example , a metal , a plastic , or a composite material . according to various aspects , it may be preferable that the base 14 comprise a material with low damping such as , for example , brass , steel , titanium , or aluminum or other metals . according to some aspects , the mounting base 14 and the resonator 12 are separately constructed components . one end surface of the resonator 12 includes an arch 48 . an end surface of the mounting base 14 includes an arch 50 opposing the arch 48 , thereby forming a substantially circular hole 46 . a pin 16 ( fig2 ) may be inserted into a hole 46 formed by the arches 48 , 50 to create a compression fitting to hold the resonator 12 together with the base 14 . another arch 52 may be formed at the opposite end of the resonator 12 relative to the arch 48 , and the base 14 may include a notched - out arch 52 . the arch 52 formed on the resonator may fit into the complementary notched - out arch in the base 54 for a compression fitting at the end of the resonator opposite the insertion point ( i . e ., hole 46 ) of the pin 16 . in an exemplary embodiment , a threaded fastener 56 ( fig1 and 2 ) may be used to attach the base 14 to host structure 15 . the fastener 56 may preferably be located below the center of mass of the energy harvester 10 and be oriented parallel to the idealized straight line motion of the proof mass 24 . in some aspects , the fastener size may preferably be a 10 - 32 or ¼ - 28 fastener . the proof mass 24 is designed such that its structural resonance modes are well above the resonance frequency of the resonator &# 39 ; s spring - proof mass resonance frequency . thus , the proof mass 24 is relatively rigid . the proof mass 24 accounts for a majority of the energy harvester &# 39 ; s volume . thus parasitic mass may be reduced and the power output of the resonator 12 increased . the channels 28 , 28 ′, 28 ″ provide clearance around the perimeter of the proof mass 24 so that the proof mass 24 does not impact the surrounding structure . the clearance between the proof mass 24 and the surrounding structure may typically be on the order of 0 . 1 - 5 mm . the beam 22 has a substantially flat surface facing the piezoelectric element 18 so that a thin piezoelectric element 18 can be bonded to the beam 22 . it should be appreciate that the piezoelectric element 18 may preferably be attached to the beam 22 using an adhesive or solder bond , but any suitable means may be used . the flexing of the beam 22 creates a strain in the piezoelectric transducers . based on the properties of the piezoelectric material , the strain induces an electric charge at the transducers electrodes ( not shown ). the electrodes can be connected to electronic circuitry 20 ( fig2 ) allowing the charge to be extracted and placed across an electronic load ( not shown ). in an exemplary embodiment , the energy harvester 10 uses a piezoelectric material with electrodes that are perpendicular to the primary direction of strain experience by the beam 22 . since the electric field generated in the piezoelectric material is proportional to the strain , the voltage at the electrodes is minimized by using thin layers of material . in this configuration , the d31 piezoelectric constant defines the relationship between strain and electric field . since thin layers are also required in this configuration , the piezoelectric material is attached directly to the surface of the beam . piezoelectric elements are generally diced into thin elements that have a uniform cross - section and flat mounting surfaces . in another embodiment for the piezoelectric transducer 18 , piezo fiber composites are used instead of bulk piezoelectric elements . in these composites , piezoelectric fibers are embedded in a plastic laminated package . the laminated package has arrays of electrodes on its surfaces . the piezo fiber composites can be bonded to the beam in a similar way to the bulk piezoelectric elements . this configuration uses the d33 coupling because the piezoelectric material can be poled in parallel with the fibers . in yet another embodiment of the piezoelectric transducers 18 , one or more piezoelectric element ( s ) can be attached to either or both sides of the beams 22 . the piezoelectric elements can be wired in series or parallel to adjust the voltage and current that delivered to the circuit . the piezoelectric element ( s ) preferably have either a pmn - pt composition or a pzt composition . soft piezoelectric materials such as pzt - 5h are used for low frequency applications where maximizing charge density per strain is important . hard piezoelectric such as pzt - 5a is used for higher frequency applications where intrinsic losses in the material &# 39 ; s electromechanical transduction are minimized . the use of piezoelectric transducers to convert mechanical energy to electrical energy is well known in the art and will not be discussed further . in an exemplary embodiment of the energy harvester circuitry 20 , shown in fig9 , energy is harvested from the electromechanical transducer using an electrical circuit 900 that includes an input voltage protection 902 such as a diode bridge , a power conditioner 904 such as a dc - dc converter , an energy storage element 906 , a voltage regulator 908 , and an output switch 910 . input voltage protection and overvoltage protection for the storage element are also included in the circuit 900 . the input voltage protection 902 ( e . g ., a diode bridge ) provides rectification of the voltage waveform from the energy harvester transducer . the uni - polar rectified waveform is fed to one or more input capacitors that act as a voltage filter so that a steady dc voltage is available for the power conditioner 904 ( e . g ., dc - dc converter ). the power conditioner 904 optimally transfers energy from the input capacitor ( s ) which are at variable voltages to a much large size energy storage element that is typically used within a narrow voltage range . the energy storage element 906 provides an energy reservoir so that the load can draw power that is much higher than that supplied by the harvester for short durations . this is needed because the electrical load is generally determined by its specific application and it is often much higher than that which is available directly from the energy transducer . however , these loads are typically required for a brief period of time , which allows for a duty cycle operation that balances the harvester - load energy budget . the load can either be connected directly with the energy reservoir or an additional voltage regulator can be used between the reservoir and the load . this is necessary for many applications because the energy reservoir voltage often fluctuates with the amount of energy stored while the load requires an input voltage that is fixed . in addition to the regulator , a hysteretic power supply switch is required that provides conductivity from the energy storage element or voltage regulator to the load . the hysteresis is provided by a comparator circuit and is based on the energy stored at the storage element . energy stored is typically related to the voltage , particularly in the typical case of a battery or capacitor . one exemplary implementation of the bridge may be an array of low voltage schottky diodes in a full or half bridge arrangement . the input capacitor ( s ) are ceramic . the exemplary dc - dc converter uses a non - synchronous buck boost or non - synchronous boost style topology . the exemplary energy storage element 906 is a capacitor or rechargeable battery . various types of capacitors including tantalum , electrolytic , ultra - capacitors , and ceramic capacitors can be used in this application . the output voltage regulator 908 is preferably a regulated switching power supply . the circuit is preferably located in a region that is remote to the load path between the host structure 15 and the proof mass 24 . the electrical connection is preferably in the form of a sealed detachable connector or a wire with a strain relief . referring to fig1 , another exemplary embodiment of the monolithic single degree of freedom resonator 58 is shown . in this embodiment , the electromechanical transducers 60 are placed between the proof mass 62 and the rigid backplane 64 and are mounted to both . as the proof mass 62 is excited and moves in a direction parallel to the rigid backplane 26 , as indicated by p , the piezoelectric transducers experience a shear force which induces an electrical charge between the terminals ( not shown ) of the transducers 60 . several flexures 66 are once again used to connect the proof mass 62 , beam - springs 68 and rigid backplane 64 to each other . the flexures are again used to define the stiffness and linearity of the resonator . holes 70 in the proof mass for resonance frequency tuning are also included . fig1 represents another exemplary embodiment of the energy harvester . here multiple resonators 72 are constructed from the monolithic building block . two resonators are shown but more may be included . this allows the energy harvester to produce peak power over a larger vibration bandwidth . fig1 shows a typical single resonator embodiments power output where the maximum power output is associated with the resonators single resonance frequency . by changing the resonance frequency , the peak power output can be move in the frequency band as shown by arrows q . however , fig1 shows the inventions power band when two resonators are included in the same housing each tuned to a separate resonance frequency thus allowing the energy harvester to be designed to have more than one vibration frequency in which peak power is generated . in this case a wider power band can be generated , as shown by arrows r . the power band can be configured by choosing and / or adjusting the difference between the two resonance frequencies f 1 , f 2 . referring now to fig1 , another exemplary embodiment of the resonator 76 is shown in which the proof mass 78 is attached to the center of a beam spring 80 which is supported by the rigid structure 82 at both ends 84 , 86 . flexures 90 are again used to connect the elements and define the resonators degree of freedom . two levers 92 are incorporated for frequency tuning and holes 94 in the rigid base structure 82 are used to reduce the parasitic mass of the resonator . referring now to fig1 , two levers can be included as an additional frequency tuning mechanism to induce curvature in the beam . the curvature can be induced in parallel or normal to the axis of curvature of the beam &# 39 ; s resonance mode . in the parallel case 96 , the curvature induced in the beam 80 causes the beam to experience higher membrane stresses for a given vibration level which in turn increases its effective stiffness . for the normal case 98 , bending increases the beam &# 39 ; s 100 cross - sectional first moment of area , which increases the beam stiffness . practical implementation of this tuning method is straightforward because movement of the two levers 92 relative to one another as shown by lines can be achieved with a simple fastener that stretches between the levers . the fastener pulls the ends of the two levers together or pushes them apart . referring now to fig1 , another exemplary embodiment of the invention , an electromagnetic device 102 is used to extract energy from the moving mass or beam . the electromagnetic transducer consists of a permanent magnet 104 or magnetic device and a wire coil 108 . movement of the magnet relative to the 108 coil causes variation in the magnetic field in the proximity of the coil 108 . this in turn induces current flow through the coil 108 according to maxwell &# 39 ; s equations . the wire coil 108 can include a magnetically permeable core 106 to enhance the electromagnetic coupling in the coil 108 . the coil 108 may be mounted on the proof mass 110 and the magnet 104 on the mounting base 112 . alternatively , the coil 108 may be mounted on the mounting base 112 and the magnet 104 mounted on the proof mass 110 . from the foregoing , it will be appreciated that , although specific embodiments have been described herein for purposes of illustration , various modifications or variations may be made without deviating from the spirit or scope of inventive features claimed herein . other embodiments will be apparent to those skilled in the art from consideration of the specification and figures and practice of the arrangements disclosed herein . it is intended that the specification and disclosed examples be considered as exemplary only , with a true inventive scope and spirit being indicated by the following claims and their equivalents .
| 7 |
the disclosure is illustrated by way of example and not by way of limitation in the figures of the accompanying drawings in which like references indicate similar elements . it should be noted that references to “ an ” or “ one ” embodiment in this disclosure are not necessarily to the same embodiment , and such references mean “ at least one .” fig1 shows an enclosure supporter 10 according to one embodiment . the enclosure supporter 10 is used for supporting an enclosure 30 . the enclosure 30 includes a bottom panel 31 . the bottom panel 31 defines two engaging holes 311 . fig2 and 3 show that the enclosure supporter 10 includes a mounting member 11 and two sliding members 13 . the mounting member 11 includes a panel body 111 and two engaging portions 113 , extending from an upper side 1110 of the panel body 111 . the mounting member 11 includes two engaging tabs 115 extending from a lower side 1112 of the panel body 111 . the upper side 1110 is substantially parallel to the lower side 1112 . the panel body 111 defines a recess portion 1111 . the mounting member 11 further includes a rotating shaft 1113 extending from the bottom portion of the recess portion 1111 . the panel body 111 defines two sliding slots 1115 recessed from the lower side 1112 . each sliding slot 1115 communicates with the recess portion 1111 via a connecting opening 1117 . each sliding slot 1115 communicates with a positioning opening 1119 . the panel body 111 further defines two mounting slots 117 in the lower side 1112 . each mounting slot 117 defines a wide part 1171 , a first narrow part 1173 communicating with the wide part 1171 , and , a second narrow part 1175 communicating with the wide part 1171 . the first narrow part 1173 and the second narrow part 1175 are located on opposite sides of the wide part 1171 . the first narrow part 1173 and the second narrow part 1175 pass through the upper side 1110 and the lower side 1112 . a separating portion 1114 is located on the upper side 1110 corresponding to the wide part 1171 . the mounting member 11 further includes a gear 119 pivotally mounted to the rotating shaft 1113 . each sliding member 13 includes a main body 131 and a first sliding portion 133 , a second sliding portion 135 , and a rack 137 for engaging with the gear 119 . the first sliding portion 133 , the second sliding portion 135 , and the rack 137 extend from the main body 131 . the extending direction of the rack 137 is substantially parallel to the extending direction of the first narrow part 1173 . the main body 131 includes a wide portion 1311 and a narrow portion 1313 extending from the wide portion 1311 . the main body 131 is l - shaped . the rack 137 is mounted to the main body 131 . the first sliding portion 133 includes a first neck portion 1331 , extending from the wide portion 1311 of the main body 131 , and a first head portion 1333 , extending from the first neck portion 1331 . the second sliding portion 135 includes a second neck portion 1351 , extending from the narrow portion 1313 of the main body 131 , and a second head portion 1353 , extending from the second neck portion 1351 . the main body 131 defines two engaging openings 1315 corresponding to the engaging tabs 115 . fig4 and 5 show that in assembly of the enclosure supporter 10 , the rack 137 of one of the sliding members 13 is mounted in the sliding slot 1115 of the mounting member 11 , to pass through the positioning opening 1119 . the first sliding portion 133 and the second sliding portion 135 are placed in the two wide parts 1171 of the two mounting slots 117 . the first sliding portion 133 moves a distance to be positioned in the first narrow part 1173 , to enable the main body 131 to contact the mounting member 11 . the first sliding portion 133 is positioned in the first narrow part 1173 to contact an edge of the separating portion 1114 . at this time , the second sliding portion 135 is positioned in the second narrow part 1175 of another mounting slot 117 . a part of the rack 137 is received in recess portion 1111 via the connecting opening 1117 . another sliding member 13 is mounted to the mounting member 11 according to the above steps . at this time , the two racks 137 are substantially parallel to each other . the two engaging tabs 115 engage in the engaging openings 1315 . the gear 119 is pivotally mounted to the rotating shaft 1113 to engage the two racks 137 . fig7 shows that the two engaging portions 113 , of the enclosure supporter 10 , correspond to the engaging holes 311 of the enclosure 30 . the enclosure supporter 10 moves to the bottom panel 31 of the enclosure 30 to enable the two engaging portions 113 to engage in the two engaging holes 311 , thereby securing the enclosure supporter 10 to the enclosure 30 . fig6 and 8 show that in use , one of the sliding members 13 is pulled outwards along a first direction . the first sliding portion 133 of the sliding member 13 1 slides in the first narrow part 1173 of the mounting slot 117 . the second sliding portion 135 slides in the second narrow part 1175 of another mounting slot 117 . the rack 137 of the sliding member 13 drives the gear 119 to rotate , thereby driving another sliding member 13 to move outward along a second direction substantially opposite to the first direction . the enclosure supporter 10 is thus unfolded to support the enclosure 30 . at this time , the two engaging tabs 115 engage in the engaging openings 1315 . it is to be understood , however , that even though numerous characteristics and advantages of the embodiments have been set forth in the foregoing description , together with details of the structure and function of the embodiments , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the present disclosure to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .
| 5 |
reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . a digital cable broadcast under an open cable and a cable ready standards observes an atsc standard . therefore , the caption_service_descriptor the eit or the pmt within the psip , included in the digital cable broadcast signal is prescribed by the atsc standard ( a65 , program and system information protocol for terrestrial broadcast and cable ). fig2 is a view showing a syntax of the caption_service_descriptor under the open cable and the cable ready standards according to the present invention . “ descriptor_tag ”, which is a parameter for checking a type of a descriptor , is described by 8 bits . “ descriptor_length ”, which is a parameter representing a length of the whole structure , is described by 8 bits . “ number_of_services ” represents a number of provided caption services and is described by 5 bits . “ language ” represents language information of a relevant caption , such as english for a service 1 and spanish for a service 2 , and is a 3 - byte language code under iso 639 . 2 / b , each letter of which is coded with 8 bits and inserted into a 24 - bit field . “ cc_type ” represents a kind of caption . if cc_type == 1 , it is a digital caption ( advanced caption ) and if cc_type == 0 , it is an analog caption ( analog caption under the eia 708 or the scte 20 ( dvs 157 )). the “ cc_type ” is described by 1 bit . “ analog_cc_type ” represents a kind of an analog caption . if analog_cc_type == 1 , it means caption data transmitted through a line 21 of the vbi under the eia 708 , and if analog_cc_type == 0 , it means caption data transmitted through other line except the line 21 of the vbi according to the scte 20 or the dvs 157 . “ line_offset ” represents a number of the vbi line including the caption data in case caption data under the scte 20 or the dvs 157 is transmitted , namely , in case the analog_cc_type == 0 , and is described by 5 bits . “ line_field ” represents whether the caption data is included in an even field or an odd field . that is , if line_field == 0 , it means the caption data is included in an odd field and if line_field == 1 , it means the caption data is included in an even field . “ caption_service_number ” represents 1 - 63 caption service numbers in case it is a digital caption , namely , in case cc_type == 1 . and is described by 6 bits . “ easy_reader ” is a flag representing whether it is a caption easily read by a user or not . “ wide_aspect_ratio ” is related to a screen ratio , and more particularly , is a flag representing whether a received caption data is intended for a 16 : 9 screen or not . if cc_type == 0 , a received caption is an analog caption . as described above , for the analog caption there exist an analog caption under the eia 708 standard , and an analog caption under the scte 20 or the dvs 157 standard . however , since the analog caption under the eia 608 standard is a pure analog caption , not a closed caption for a digital tv mentioned in the present invention , the analog caption under the eia 608 standard is excluded . therefore , an analog caption for the case cc_type == 0 , is either an analog caption under the eia 708 standard or an analog caption under the scte 20 or the dvs 157 standard . “ analog_cc_type ” represents whether a received caption is an analog caption under the eia 708 standard or an analog caption under the scte 20 or the dvs 157 standard . if analog_cc_type == 0 , it means that the relevant caption is included in a video data region in form of user data under the scte 20 or the dvs 157 , which are standards on the digital cable broadcast . in that case , since to which line of the vbi the received caption is assigned , is not known in view of characteristics of the cable broadcast , the line_offset describes to which line of the vbi the received caption is included . if analog_cc_type == 1 , it means that an analog caption under the eia 708 standard is included in a video data region in form of user data . in that case , since the caption is assigned to a 21 st line of the vbi , a line_offset value is not required . therefore , 5 bits assigned to the line_offset becomes a reserved bit and 1 bit is assigned to the line_field representing whether a caption is a caption included in an even field or a caption included in an odd field . if line_field == 0 , it means a caption is included in an odd field and if line_field == 1 , it means a caption is included in an even field . as described above , whether a caption included in the digital cable broadcast is an analog caption or a digital caption is judged on the basis of information included in the caption_service_descriptor . further , if the received caption is an analog caption , whether the caption is an analog caption under the eia 708 standard or a caption for a cable broadcast under the scte 20 or the dvs 157 standard , is judged . if the received caption is a caption under the scte 20 or the dvs 157 standard , in which line of the vbi the caption data is included , is judged . if the received caption is a digital caption , information as to which service the caption includes among sixty - three services , is checked . a broadcast station generates caption information including the above described various information and adds the caption information to a broadcast signal . a broadcast receiver detects caption information included in a broadcast signal provided from the broadcast station , and judges various characteristics of the received caption data on the basis of parameter values included in the detected caption information . fig3 is a block diagram illustrating a construction of a digital broadcast receiver according to the present invention . referring to fig3 , a mpeg demultiplexer 501 receives a mpeg - 2 transport stream from a cable and decodes the transport stream so as to extract video data , audio data , and supplementary information . further , the mpeg demultiplexer 501 detects an eit and a pmt included in the supplementary information . the detected pmt is stored in a pmt buffer 502 and the detected eit is stored in an eit buffer 503 . here , the detected pmt or eit includes caption information , namely , a caption_service_descriptor . a controller 504 receives caption information from the pmt buffer 502 or the eit buffer 503 and detects caption data included in the transport stream on the basis of the caption information . a video parser 505 receives video data decoded by the demultiplexer 501 and separates the video data into user_data and mpeg - 2 video data . an analog caption decoder 506 receives user_data from the video parser 505 and detects analog caption data from the user_data on the basis of a signal outputted from the controller 504 . a digital caption decoder 507 receives the user_data from the video parser 505 and detects digital caption data from the user_data on the basis of a signal outputted from the controller 504 . a mpeg - 2 video decoder 508 decodes mpeg - 2 video data generated by the video parser 505 . a graphic block 510 outputs a signal for generating a gui ( graphic user interface ) such as an osd ( on screen display ) menu including information provided from the controller 504 . the graphic block 510 displays , on a screen , various characteristics of the received caption data , for example , a number of caption services , a national language of a caption , a type and a standard of the received caption data , vbi line information and field information that correspond to the caption data , a difficulty level of the caption , a picture ratio of the caption . a video combiner 509 receives analog caption data from the analog caption decoder 506 or receives digital caption data from the digital caption decoder 507 . further , the video combiner 509 receives video data from the mpeg - 2 video decoder 508 and receives a signal outputted from the graphic block 510 . the video combiner 509 combines the received signals so as to generate data that will be possibly displayed . a video reconstructor 511 encodes an analog caption data decoded by the analog caption decoder 506 , at a 21 st line of the vbi . operation of the digital broadcast receiver as described above according to the present invention will now be described . fig4 illustrates a method for processing a caption according to the present invention . if a mpeg - 2 transport stream transmitted through a cable is received , the mpeg demultiplexer 501 divides the received transport stream into video data , and audio data , supplementary information . the supplementary information includes a psip defining electronic program guide ( epg ) and system information ( si ). the psip includes a plurality of tables including information for transmitting / receiving a / v ( audio / video ) data made in a mpeg - 2 video and ac - 3 ( audio coding - 3 ) audio formats , and information regarding channels of each broadcast station and information regarding each program of channel . among them , information regarding the pmt and information regarding the eit are stored in the pmt buffer 502 and the eit buffer 503 , respectively . under the atsc standard , the digital cable broadcast signal must include a caption_service_descriptor in its pmt or eit . the controller 504 reads a caption - related option stored in a memory ( not shown ) and determines a caption - related option selected by a user ( s 11 ). for example , the caption - related option includes various options such as “ caption off ”, “ caption service selection ( cc1 , cc2 , cc3 , . . . )”, “ english caption display ”, “ korean caption display ”, “ size of caption ”, “ color of caption ”. if a user selects “ caption off ”, the controller 504 does not display the received caption . if a user selects “ english caption display ”, the controller 504 controls the caption decoders 506 and 507 so that only the caption written in english may be displayed on a screen . further , the controller 504 controls the caption decoders 506 and 507 so that the received caption data may be processed according to a set size and a set color of a caption . the controller 504 receives the caption information and judges characteristics of the received caption data on the basis of parameter values included in the caption information ( s 12 ). the controller 504 judges a number of caption services on the basis of the caption information . for example , the controller 504 judges whether a synchronous caption , an asynchronous caption service , a letter information service are provided . the controller 504 judges a language of the received caption on the basis of the caption information . for example , the controller 504 judges whether the received caption is english , japanese , or korean . the controller 504 judges a type of the received caption data on the basis of the caption information . for example , the controller 504 judges whether the received caption data is digital caption data or analog caption data ( s 13 ). the controller 504 determines a standard of the received caption data on the basis of the caption information . for example , if the received caption data is analog caption data , the controller 504 judges whether the received caption data is caption data under the eia 708 standard or the scte 20 or the dvs 157 standard . further , the controller 504 judges a vbi line number and a field including the received caption , a difficulty level of the received caption , and a picture ratio of the received caption on the basis of the caption information . to judge whether the received caption data is digital caption data in the step of s 13 , the controller 504 judges whether the digital caption data is included in the video data on the basis of the caption information . if digital caption data under the eia 708 is included in the video data ( if cc_type == 1 ), the controller 504 detects a service id that corresponds to the caption data from the caption information ( s 14 ) and transmits the detected service id to the digital caption decoder 507 . the service id can be known from a capto_service_number included in the caption information . the digital caption decoder 507 extracts and decodes caption data that corresponds to the service id from user_data of a picture header transmitted from the video parser 505 ( s 15 ). subsequently , the extracted caption data is transmitted to the video combiner 509 . the video combiner 509 combines the extracted caption data , video data outputted from the mpeg - 2 video decoder 508 , and signals outputted from the graphic block 510 . if analog caption data is included in the video data ( if cc_type == 0 ), the controller 504 judges whether the received caption data is analog caption data ( analog_cc_type == 1 ) under the eia 708 standard or analog caption data ( analog_cc_type == 0 ) under the scte 20 or dvs 157 standard ( s 16 ). at this point , the controller 504 determines a standard of the received analog caption data on the basis of the caption information . if the received caption data is analog caption data under the scte 20 or the dvs 157 , the controller 504 checks vbi line information described in 5 bits by a line_offset included in the caption information . the vbi line information represents a position of the caption data . further , the controller 504 judges a field where the caption data exists on the basis of line_field information included in the caption information . if line_field == 0 , the caption data exists in an odd field and if line_field == 1 , the caption data exists in an even field . after that , the controller 504 transmits the above checked vbi line information and the line field information to the analog caption decoder 506 . if the received caption data is analog caption data , user_data outputted from the video parser 505 is not processed by the digital caption decoder 507 . the analog caption decoder 506 finds out ( s 18 ) analog caption data made in the scte 20 or the dvs 157 standard from user_data inputted from the video parser 505 on the basis of the vbi line information and the line field information , and decodes the analog caption data ( s 19 ). the analog caption data found by the analog caption decoder 506 is transmitted to the video combiner 509 . the video combiner 509 combines the analog caption data , video data outputted from the mpeg - 2 video decoder 508 , and signals outputted from the graphic block 510 . signals outputted from the video combiner 509 are transmitted to the video reconstructor 511 . the video reconstructor 511 reconstructs a caption by encoding analog caption data outputted from the analog caption decoder 506 , at a vbi 21 st line . the reconstruction of a caption is to prevent analog caption data from being an open caption in case of storing , data , as it is , outputted from the video combiner 509 in a storage medium such as a vcr ( video cassette recorder ). if the received caption data is analog caption data under the eia 708 standard ( if analog_cc_type == 1 ), the controller 504 transmits line_field information included in the caption information to the analog caption decoder 506 . since analog caption data under the eia 708 standard is positioned at a vbi 21 st line , a line_offset value is not required . at this point , the digital caption decoder 507 extracts a 2 - byte analog data in user_data including digital caption data from the video parser 505 and transmits the analog data to the analog caption decoder 506 . subsequently , the analog caption decoder 506 finds out ( s 17 ) analog caption data present in a vbi 21 st line from the 2 - byte analog data on the basis of the line_field information and decodes the analog caption data ( s 19 ). the found analog caption data is combined with video data from the mpeg - 2 video decoder 508 and signals from the graphic block 510 by the video combiner 509 . the video reconstructor 511 reconstructs a caption by encoding analog caption data from the analog caption decoder 506 at a vbi 21 st line . if analog caption data under the eia 708 and analog caption data under the scte 20 and the dvs 157 are all present in the user_data , the analog caption data under the eia 708 is processed . further , if digital caption data under the eia 708 and analog caption data under the eia 708 are all present in the user_data , the digital caption data is processed . as described above , the present invention judges a type of caption data on the basis of caption information included in the received broadcast signal and automatically processes the caption data according to the type , thereby providing convenience to a user . further , the present invention judges various characteristics of the received caption data such as a standard of caption data , a number of caption services being received and provides the characteristics to a user . furthermore , the present invention can store caption - related options selected by a user and display the caption being received according to the caption - related options . it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention . thus , it is intended that the present invention covers the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents .
| 7 |
fig1 is a plan view of a perforated label assembly 10 in accordance with one embodiment of the present invention . the label assembly 10 includes a backing 1000 and two label members 100 . each label member 100 is configured and dimensioned to be applied to a portion of an electrical apparatus ( as depicted in fig2 - 4 ). each label member 100 includes a primary label portion 110 and severable label portion 120 . each label member 100 also includes an alignment strip 200 including alignment strip portions 201 which are delineated from the label 100 via perforation 220 , and from each other via secondary perforation 230 . the alignment strip 200 depicted in fig1 is configured in an “ l ” shaped configuration which corresponds with structuring structural features of the surface to which the label 100 will be applied , as described below . it will be understood that the alignment strip 200 may comprise a variety of dimensions and configurations . each alignment strip portion 201 includes a tabbed end 210 which protrudes beyond the boundary of the label member 100 . as such , the tabbed end 210 facilitates removal of the alignment strip portion 201 by providing a surface which is easily graspable by a user , once the label member 100 is applied to the desired surface . as such , the label member 100 is configured to be removed from the backing 1000 as a single member . fig2 depicts a detail of the area of fig1 indicated as 2 . therein , further details of the perforation 220 may be seen . accordingly , the perforation 220 comprises a plurality of apertures 223 and webs 222 disposed along the perforation 220 . as such , when it is desired to remove the alignment strip portion 201 , the perforation 220 facilitates an orderly removal by concentrating stresses at each web 222 , thereby allowing the alignment strip channel 201 to be torn substantially along the perforation 220 . fig3 is a section view taken along line 3 - 3 of fig2 . therein , it can be seen that the apertures 223 extend through the thickness of the alignment strip portion 201 . it will be appreciated that in alternative embodiments the apertures 223 may only extend partially through the alignment strip portion 201 and in yet further embodiments the apertures 223 may extend into the backing 1000 , depending at least in part upon manufacturing processes used . it may also be seen that an adhesive coating 130 is applied to the label 100 , which is then disposed onto the backing 1000 at an interface 1010 . in at least one embodiment , the aperture size , aperture depth , web size , adhesive composition , and backing composition are cooperatively selected such that a force placed on the web 222 during removal of the label 100 from the backing 1000 is less than a force required to tear the webs 222 . stated another way , at least some of the above referenced characteristics are selected such that a failure stress of the webs 223 is larger than the actual stress experienced by the webs 223 during removal of the label 100 from the backing 1000 . one way to accomplish such a relation may be to optimize the perforations 220 , such as optimizing the dimensional relationships between apertures 223 and webs 222 . alternatively , one method might focus on reducing an adhesion strength between the adhesive layer 120 and backing 1000 at the interface 1010 . however , it will be appreciated that other dimensional and compositional relationships may also accomplish the goals of the present invention . in an additional embodiment , the adhesion strength between the adhesive coating 130 and the electrical apparatus is larger than the adhesion strength at the interface 1010 . indeed , the adhesion strength between the adhesive coating 130 and the electrical apparatus may be larger than the perforation strength such that , after application of the label member 100 to the electrical apparatus , the alignment strip 200 may be removed by simply peeling it away from the electrical apparatus , tearing the perforation 220 , and leaving the desired primary label portion 110 and severable label portion 120 of the label member 100 adhered to the electrical apparatus . fig4 is a plan view of one embodiment of a label member 100 of the present invention affixed to an electrical apparatus 2010 . as can be seen , the label member 100 has been removed from the backing 1000 ( depicted in fig1 ) and affixed to the electrical apparatus 2010 as a single member , with alignment strip 200 connected to the primary label portion 110 and severable label portion 120 . fig5 is a plan view of one embodiment of a label member 100 of the present invention affixed to an electrical apparatus 2010 and having an alignment strip portion 201 removed . in at least one embodiment , the alignment strip portion 201 may be removed by grasping the tabbed portion 210 and pulling , thereby separating the alignment strip portion 201 from the label member 100 at the perforations 220 . additionally , as the depicted alignment strip is “ l ” shaped , a secondary perforation 230 may be disposed at an angled or radiused portion 231 therof so as to avoid unintentional tearing of the alignment strip portion 201 as it is removed . one feature of the present invention is the provision of an alignment spacing 300 due to removal of the alignment strip 200 . as can be seen , the electrical apparatus 2000 includes a primary portion 2010 and a secondary portion 2020 , which interconnect via an interface 2030 . the alignment strip 200 is correspondingly disposed and dimensioned to overlie the interface 2030 and provide a desired positioning of the primary label portion 110 and severable label portion 120 relative to the interface . as such , once the alignment strip 200 is removed , an alignment spacing 300 is provided such that the label member 100 does not interfere with operation or separation of the electrical apparatus 2000 . fig6 is a plan view of one embodiment of a label member 100 affixed to an electrical apparatus 2000 and having alignment strip portions removed . as such , no portion of the label member 100 occupies the alignment spacing 300 , and the severable portion 2020 of the electrical apparatus 2000 may be severed and / or replaced without interference from the label member 100 of the present invention . additionally , the primary label portion 110 and severable label portion 120 maintain a predetermined distance relative to both the interface 2030 and the outer boundary of the electrical apparatus 2000 . such an orientation is facilitated by the single - member application of the label member 100 , as opposed to individually applying the primary label portion 110 and severable label portion 120 . as such , a precise and aesthetically pleasing arrangement of the label member 100 may be achieved via a substantially centered disposition of the single - member label member 100 on the electrical apparatus 2000 , as well as a provision of a predetermined alignment spacing 300 of a predetermined distance , created from removal of the alignment strip 200 . fig7 and 8 depict alternative embodiments of the present invention comprising different dimensional relationships relative to each other , as well as the embodiment depicted in fig1 . as such , the present invention may be easily adapted to fit a variety of electrical apparatus . for example , where the label 100 of fig1 comprises a substantially rounded square shape of approximately 2 . 5 inches on a side , the label 100 ′ of fig7 may comprise a dimension of 2 . 125 inches on a side , and the label 100 ″ of fig8 may comprise a dimension of 1 . 75 inches on a side . it will be appreciated that the dimensions of the alignment strip 200 , 200 ′, 200 ″, such as width and length , may be accordingly adjusted to maintain a proportional relationship to the label 100 , 100 ′, 100 ″ size and / or corresponding placement relative to an interface of the electrical apparatus . since many modifications , variations and changes in detail can be made to the described preferred embodiment of the invention , it is intended that all matters in the foregoing description and shown in the accompanying drawings be interpreted as illustrative and not in a limiting sense . thus , the scope of the invention should be determined by the appended claims and their legal equivalents .
| 6 |
the process sequence within an installation 1 shown in the exemplary embodiment according to fig1 is part of an overall process in a power plant ( not shown in detail ). the installation 1 comprises a pump a 1 connected in a steam line 2 , with an upstream steam valve a 2 and a blow - off regulating valve a 3 connected in a branch line 4 . a throughflow sensor 6 is provided between the pump a 1 and the steam valve a 2 , being used to detect the quantity of steam flowing through the steam line 2 per unit of time . a pressure sensor 8 is also provided on the pressure side of the pump a 1 . the pump a 1 is provided with a speed sensor 10 . the steam valve a 2 and the blow - off regulating valve a 3 each have a control and message element 12 and 14 . the pump a 1 and the steam valve a 2 as well as the blow - off regulating valve a 3 are referred to below as installation components a 1 to a 3 . measurement values mw detected by the sensors 6 , 8 and 10 and message signals ms emitted by the message elements 12 and 14 are supplied to an automation system 20 . the measurement values mw and message signals ms are preprocessed into process signals ps in the automation units of the automation system 20 . in some instances control signals si are emitted to the installation components a 1 to a 3 of the installation 1 . the power plant with its installation components a 1 to a 3 is controlled and monitored automatically by the processes operating within the automation system 20 . the process signals ps generated in the automation units of the automation system 20 from measurement values mw and / or message signals ms detected online are then supplied to a central monitoring system 30 , for example a control system or a process control system . the monitoring system 30 can in particular be a suitable data processing unit . the monitoring system 30 here is used in particular in the manner of a central process system for process management and monitoring . in the event of a failure or some other abnormal status of the monitored process or one of the installation components a 1 to a 3 , the process signals ps generated for this failure from measurement values mw or message signals ms detected online are supplied to a control unit 34 of the monitoring system 30 . if a fault in an installation part ( not shown ) connected in the steam line 2 causes the pressure to rise in the steam line 2 , the speed of the pump a 1 drops and the blow - off regulating valve a 3 opens . the automation system 20 then closes the steam valve a 2 by means of a control signal si , so that the speed of the pump a 1 normalizes and the blow - off regulating valve a 3 closes again . when the steam valve a 2 is then reopened by the automation system 20 , the pressure within the steam line 2 rises again and the process is repeated until the fault is eliminated . measurement values mw describing this process , e . g . the quantity of steam detected by the throughflow sensor 6 and the steam pressure detected by the pressure sensor 8 and the pump speed detected by the speed sensor 10 , are supplied to the automation system 20 . the control signals si for the opening or closing of the valves a 2 and a 3 are output by the automation system 20 of the installation 1 in response to the measurement values mw received in the automation system 20 . process signals ps are produced from the measurement values mw and the control signals si for analysis purposes . to inform the operator and in some instances to allow manual intervention in the process sequences , in the event of such abnormal situations or failures the control unit 34 generates or supplies status messages , which can be displayed on an assigned display unit 36 in the form of message windows . in order to allow the information to be displayed in a manner that is particularly appropriate for the respective situation and requirements and therefore to allow the operator to intervene in a particularly focused manner , provision is made for appropriate prefiltering of the available information when generating the status message . to this end the information content or individual messages to be used to form the status message is / are selected as a function of the situation and as a function of the context . the status messages here are output in the form of so - called message windows 40 , 42 , 44 on the display unit 36 , as shown for example in the screen shots according to fig2 and 3 . context - related selection of the individual messages or information items to be taken into account here means the following in particular : messages from the functions shown in a process image : process images represent the process engineering view of the process and are used for process observation and process operation . pictograms for example are integrated in the process images . messages from an automation level ( overview , area or individual level ): the automation level represents the control - related view . messages from an individual automation function are shown in process images or in an automation level . the automation function comprises a pump , a valve or a regulator for example . during the preparation and preprocessing of the information it is possible for example to click on the pump a 1 in a pictogram of a process image , whereupon all the messages relating to the pump a 1 appear in an assigned message window on actuation of the right mouse button . a corresponding information assignment can likewise be provided for other constellations or contexts . clicking on a software module or a ( graphic ) object , which represents a defined function in the power plant , in the corresponding view on the display unit 36 causes relevant messages relating to this object or module to be displayed in response to such an operator request . the messages to be displayed in a message window are determined automatically using the information from a data model , which contains relationships between message sources and contexts . the search criterion here results from the context , from which the message window is opened . specifically for example the screenshot in fig3 contains a diagrammatic representation of interlinked installation components in a major technical installation with assigned process and status parameters within a basic window . this is a specific segment from a larger process image ( process engineering view ). the individual installation components are shown in the manner of pictograms in the form of graphic objects . in the event of failures or particular operating situations , which are detected and identified automatically by suitable measurement sensors and monitoring routines within the installation , the components or units affected or the associated status parameters are automatically highlighted in color , for example in the signal color red , in the screen display by the installation controller . an operator alerted in this manner can click on a free area of the basic window with a mouse input device or the like and use the right mouse button to call up the message window 42 , in which a number of status reports of relevance to the selected segment of the process image , i . e . the context thus defined , are displayed . in particular the message window 42 can contain a tabular list , in the manner of a brief summary , of status reports from all the installation components displayed on the image segment of the basic window . the individual messages bundled in this manner can each contain for example a serial number , identification code , type designation or group assignment , error description , date and time stamp , associated parameters and optionally further status information . the operator can also click on the individual graphic objects , which represent the installation components — in particular the graphic objects highlighted in color , which represent the faulty or “ conspicuous ” installation components having particular operating statuses — and call up or bring to the foreground , for example by actuating the right mouse button , a message window 44 specifically for the respective component containing ( preferably exclusively ) component - specific individual messages . since such context - specific message windows are preferably only shown further to a corresponding operator request , the operator is spared a multitude of automatically overlaid “ popup ” windows . the same function mechanism is shown in fig2 for a screenshot which represents a corresponding control - related , i . e . higher order or comprehensive and abstract , view of the technical installation to be monitored and its control sequences . corresponding message windows 40 can be called up as required here too , providing context - related content .
| 6 |
the repeated processing of a chromatography column generally will typically cause the further compaction of the previously packed media . this compaction can be significant . for example , in one trial , using media , repeated separation of a milieu of e . coli proteins was performed . during the first separation process , the bed height was measured to be 56 cm . after the fortieth separation , the bed height had been compacted to a height of only 48 cm . this compaction led to a breach between the top surface of the media bed and the top bed support and decreased efficiency . there is also a second issue associated with the bed height . the support matrices of the resins used in the media can change in volume . each matrix possesses its own swelling behavior , with dextran - based and cellulosic resins being most suspectible to swelling when subjected to ph changes . ionic strength also has a significant impact on the swelling of cellulosic , agarosic and dextran - based chromatography media such as ion exchangers . generally , this swelling is most pronounced during the elution , regeneration , and most particularly the cleaning phases of a chromatographic separation cycle . therefore , the column must be capable of adapting to swelling - induced changes in the media bed to prevent over - pressurization of the column , or overstressing of the media . fig3 illustrates the preferred embodiment of the present invention . before use , chromatography column 110 is filled with media slurry in a manner known to those skilled in the art . the adjustable bed support 112 , which forms a tight seal along the walls of column 110 , is then moved down inside the column tube 110 . typically , the adjustable bed support has a cross - sectional configuration that matches that of the column . preferably , the bed support also has a gasket , or other sealing means along its perimeter to ensure the tightness of the seal . this allows the buffer within the column 110 to flow out the bottom flow port 113 . generally one bed support is fixed in place while the other is free to move . alternatively , both supports can move if desired . in the embodiment as shown the bottom bed support 114 is fixed in place to the column . during this packing process , a media bed 120 forms and is contacted by the adjustable bed support as it continues to apply force to the bed 120 . thus , when the bed 120 is fully compacted , it exerts a force on adjustable bed support 112 . adjustable bed support 112 is coupled to a shaft 130 , which is preferably threaded . shaft 130 passes through an opening 141 in yoke 140 , which opening is also preferably threaded . yoke 140 is held in position by stanchions 150 , which are mounted to a base 160 , on which the column 110 preferably rests . in the preferred embodiment , the stanchions 150 are held in contact with the base through the use of fasteners 161 , such as bolts , which extend through openings 164 in the base and engage with the stanchion via slots 151 bored into the stanchion , which are also threaded . the fastener has a shaft 162 , which is preferably threaded , of a given diameter , and a head 163 having a diameter larger than that of the shaft . the openings 164 in the base 160 are preferably larger than the diameter of the fastener &# 39 ; s shaft 162 , but smaller than the diameter of the fastener &# 39 ; s head 163 , to allow the fastener &# 39 ; s shaft to move freely through the opening 164 . the fastener 161 is inserted from the underside of the base 160 , through the opening 164 such that the fastener &# 39 ; s shaft 162 engages with the slot 151 in the stanchion 150 . yoke 140 is affixed to a plurality of stanchions 150 . two stanchions typically provide the needed structural stability for smaller diameter columns , while additional stanchions may be used for large diameter columns . these stanchions 150 are preferably placed equidistant from one another around the circumference of a circle that is concentric to , but larger than column 110 . the stanchions 150 have a height equal to , or preferably greater than , that of the column 110 . in one embodiment , yoke 140 is connected to the two or more stanchions and it spans the width and centerline of the column 110 . the yoke 140 is retained to the stanchions 150 by means such as slot 152 , a ring or other device that can affirmatively hold the yoke 140 in place . the yoke 40 may be permanently attached to the stanchions 150 or more preferably , it may be removably connected to the stanchions 150 by bolts , clevis pins , cotter pins , clamps and the like . in one preferred embodiment , the yoke 40 is attached to one stanchion 50 by a bolt , and the other stanchion by a clevis pin so that when adjustable bed support 112 is withdrawn from the column , the yoke 140 can be pivoted vertically about stanchion 150 containing the bolt and moved up and out of the way of the column to allow easy access to the column interior . fig4 shows that embodiment in the pivoted position . in another embodiment , the yoke 140 can also rotate in a horizontal circular motion away from the mouth of the column 110 . atop the yoke 140 is an actuator 170 adapted to move the shaft in the vertical direction , independent of the yoke 140 . this actuator can be pneumatically , electrically or hydraulically controlled . in the preferred embodiment , a motor , preferably electrically powered , is equipped with a gear that contacts the threaded shaft 130 . the movement of the motor causes the rotation of the gear , which in turn causes rotation of the threaded shaft 130 . the resulting rotation of the threaded shaft 130 , through the threaded opening 141 in yoke 140 causes the shaft 130 to move relative to the yoke 140 in the vertical direction . the adjustable bed support 112 , shaft 130 , and actuator 170 comprise the adjuster assembly . these components operate in unison to adjust the position of the adjustable bed support 112 inside the column 110 , thereby also controlling the pressure exerted on the media bed . the yoke 140 and the stanchions 150 comprise a support structure 155 . this structure is rigidly coupled and is affixed to the shaft 130 and the base 160 , such that any force exerted on adjustable bed support 112 is transferred through shaft 130 , through support structure 155 , to the connection point between the support structure 155 and the base 160 . while this embodiment comprises a preferred embodiment in which a single shaft with 2 stanchions is used , the invention is not so limited . those skilled in the art will appreciate that it is within the scope of the present invention to use multiple shafts and a greater number of stanchions . for example , a very large diameter column may require a greater number of shafts and stanchions in order to insure that the adjustable bed support descends uniformly and evenly onto the media bed . alternatively , other structures can be utilized . chromatography columns are formed of three basic components ; a column tube , a bottom fixed end and a top , movable end . see u . s . pat . no . 4 , 350 , 595 and u . s . pat . no . 6 , 139 , 732 . the top end moves relative to the tube so as to be capable of removal for introduction and removal of chromatography media in the tube and to be capable of longitudinal travel into the tube to compress the media for use . this top end however needs to be fixed at some point to the column in order to move relative to the column . a first means for accomplishing this is to form a tube of high strength materials , including metals such as stainless steel or rigid structural plastics , such as acrylics or polymethylpentenes such as tpx ® plastic available from mitsui petrochemical industries ltd corporation of japan . the tube has a flange at the upper end to which a top plate is attached to the column and a flange at the lower end to which a fixed bottom end is attached . the top , movable end is then attached to this top plate and travels relative to it in and out of the tube . in one embodiment , shown in fig1 , the tube 2 has a bottom plate 4 fixed in place by bolts 6 attached to a flange 8 of the tube 2 . a top plate 10 is fixed to a top flange 12 of the tube 2 by setscrews 13 . a movable end 14 is centrally located in the top plate 10 and is capable , by movement of rod 16 , of moving into or out of the tube 2 . as the end 14 moves into the tube 2 to compress the media bed 18 for use , longitudinal forces are carried from the end 14 to the rod 16 to the top plate 10 and then to the tube 2 itself . another alternative is shown in fig2 . it uses a series of rods 20 or screws closely aligned around the outside of the tube 24 to carry the longitudinal forces rather than the wall of the tube itself . this allows one to use less structurally rigid materials , such as glass or plastics , preferably acrylic or styrene , and to also use thinner walled tubes . all of this reduces the weight and cost of the device . most of the elements of that tube 24 of fig2 are similar to those of fig1 . one has a movable top end plate 22 , a bottom plate 26 , attached to a fixed bottom end 27 , flanges 28 , either as part of the tube 24 or in this example as separate pieces to secure the fixed top plate 30 and bottom plate 26 to the tube 22 . a rod 32 extends through the plate 30 and is connected to the movable end 22 by a handle 34 . a bed of chromatography media 36 is compressed by the movement of the end 22 . also shown in fig2 are a series of guide rods 38 , which are used , in larger columns to keep the end 22 horizontal during movement . plate 30 is normally affixed on flange 33 and attached by numerous mechanical fasteners 31 . in the preferred embodiment , a load cell 180 is located between the head 163 of the fastening device and the underside of base 160 . however , the load cell 180 can be positioned in any location where it can measure the force exerted on the media bed . for example , the load cell can be positioned between bolt 6 and bottom plate 4 in fig1 . similarly , the load cell can be located between mechanical fastener 31 and plate 30 or between mechanical fastener 31 and bottom plate 26 in fig2 . a load cell is a device that translates the load exerted on it into an analog electrical output , such as voltage or current . the relationship between the exerted load and the electrical output is well established and tightly controlled , such that the exact load experienced by the load cell can be determined by monitoring its electrical output . the term load cell is used herein to include any device that carries out this function . returning to fig3 , the load cell 180 is preferably circular , with a concentric opening in the middle , such that the diameter of the opening is large enough to allow shaft 162 to be slid through the opening . however , the diameter of the opening is preferably smaller than the diameter of the head 163 of the fastener , such that the head cannot pass through the opening , thereby causing the load cell to interconnect with the fastener in a similar manner as a traditional washer . thus , the fastener is inserted through the concentric opening in the load cell 180 , through the opening in the base 160 , and into the slot of stanchion 150 . preferably , one load cell is used , regardless of the number of stanchions , however multiple load cells , or one load cell for each stanchion , are also envisioned as an embodiment of the present invention . one skilled in the art will appreciate that although the preferred embodiment comprises an adjustable top bed support , and a fixed lower bed support , the invention is not so limited . the apparatus can also be constructed such that the top support is fixed , and the lower bed support is adjustable . in the preferred embodiment , the fluid to be processed by the column 110 travels in a conduit through a hollow cavity within shaft 130 to adjustable bed support 112 . alternatively , the fluid may also travel in a conduit parallel to the shaft and then enter the adjustable bed support under a hollow arch formed at the base of the shaft . adjustable bed support 112 also comprises a flow cell , which equally distributes the fluid such that it enters the media bed uniformly . the processed fluid then exits the column through bottom flow port 113 . those skilled in the art will appreciate that the direction of the fluid &# 39 ; s travel is not limited to top to bottom ; the fluid can also be forced into the bottom of the column and drawn out of the top surface . similarly , it is not required that the fluid entry and the movable support be located in the same end of the column . the pressure of the fluid entering the column is monitored . there are a number of methods known in the art for performing this monitoring . for example , a bubble trap can be inserted between the source of the fluid and the entrance to the shaft 130 . a pressure sensor associated with the bubble trap can be used to supply the measured fluid pressure . in the preferred embodiment , a pressure sensor 190 , preferably a transducer , is in communication with the fluid flow through the use of a t connection in close proximity to the shaft 130 . a pressure transducer is used to convert a pressure measurement into either an analog or digital electrical signal , such as voltage or current . in this scenario , the transducer 190 measures the pressure of the fluid being forced through the conduit and into the column 110 . having defined the components of the present invention , the operation now will be described . first , the media in the column is compressed to form a media bed . this process can be accomplished in a variety of ways well known to those skilled in the art , and the present invention is not limited to a specific packing methodology . once the column has been packed , the adjustable bed support 112 will be in direct contact with the top of the bed 120 , holding it under some amount of sufficient force to insure that it remains compacted . the media bed 120 exerts a counterforce onto the adjustable bed support 112 . since the adjustable bed support 112 is rigidly affixed to the shaft 130 , which is rigidly affixed to the yoke 140 , which is in turn rigidly affixed to the stanchions 150 , this exerted force is transferred directly to the fastener 161 which is securing the stanchion 150 to the base 160 . thus , the force exerted by the media bed 120 is measurable by load cell 180 , located between fastener 161 and the underside of the base 160 . in the preferred embodiment , a single load cell is utilized , thus this load cell will experience only a fraction of the total force exerted by the media bed . that fraction is defined as 1 /(# of stanchions ) . thus , if two stanchions are utilized , the load cell will experience ½ of the total force exerted by the media bed 120 . alternatively , load cells can be placed in association with each stanchion . in this case , the total force would be defined as the sum of the forces experienced by each load cell . similarly , if load cells are arranged on only a portion of the stanchions , the total load can be expressed as : the outputs from the pressure sensor 190 and the load cell 180 are in communication with controller 100 . controller 100 also generates outputs to the actuator 170 directing it to alter the position of the adjustable bed support . by using the output from the load cell 180 in conjunction with controller 100 , it is then possible to create a control system , whereby the load experienced by the load cell is used by the controller 100 to adjust the position of the shaft 130 , using actuator 170 . one skilled in the art will appreciate that the controller can be of various types , including , but not limited to proportional , proportional - derivative ( pd ), proportional integral ( pi ) or proportional - integral - derivative ( pid ), and that the invention is not limited by the choice of the controller . similarly , the output from the controller 100 to the actuator 170 can be in various forms , including but not limited to analog voltage , current , digital signals , or pulses . the optimal force to be applied to the media bed 120 can be determined using a number of different methods , such as but not limited to empirical measurements as the column is packed , or fixed values based on the amount and type of media being used . once the optimal force required to create the proper compression on the media bed 120 is determined , the control system comprising the load cell 180 , actuator 170 and controller 100 operate to maintain this force . the method of determining this optimal force is independent of the present invention , and therefore any method of determining this value is suitable . having established the proper compression for the media bed 120 , the column is then ready to accept fluid . the fluid that enters the column will also be under pressure , and this pressure will also be exerted on the adjustable bed support . therefore , the total force exerted on the adjustable bed support can be given by : f total = p fluid * area adjustable bed support + f media compression . since the total force can be measured via the load cell , and the fluid pressure can be measured via the pressure sensor 190 , it is possible to determine the amount of force being applied to the media bed . f media compression = f total − p fluid * area adjustable bed support . this computed f media compression is then compared to the optimal compression force . by adjusting the position of shaft 130 based on the measurement from the load cell 180 and the pressure sensor 170 , it is possible to maintain a constant optimal pressure on the media bed 120 . for example , as the media bed compresses , it will exert less force on the adjustable bed support 112 . this reduction will be measured by the load cell as a decrease in total force ( assuming a constant fluid pressure ). the controller will detect this reduced force , and will determine that the force being exerted on the media bed has decreased . to compensate for this , the controller will actuate the actuator 170 to adjust the shaft 130 to further compress the column , until the media compression force returns to the optimal value . conversely , if the media bed expands , the controller detects an increase in total force and will actuate the actuator 170 to retract the shaft 130 in a direction out of the column , until the media compression force returns to the optimal value . the control system of the present invention can be utilized in a number of different ways . in a first embodiment , the control system is used only between separation cycles to correct for any changes in the height of the media bed 120 that occurred during the previous cycle . in this embodiment , the position of the adjustable bed support within the cylinder is held constant throughout the separation cycle , and then its height is adjusted after the completion of the cycle . in a second embodiment , the control system is continuously operational , thereby constantly adjusting the pressure exerted on the media bed by changing the position of the adjustable bed support within the cylinder . due to the precision required , this embodiment preferably utilizes a pid controller . one skilled in the art will recognize that a continuous control system can be approximated through the use of a sampled system , whereby the load cell and pressure transducers are sampled at periodic intervals and adjustments to the vertical position of the adjustable bed support are made in response to these sampled measurements .
| 6 |
in the following description , various embodiments of the present invention will be described . for purposes of explanation , specific configurations and details are set forth in order to provide a thorough understanding of the embodiments . however , it will also be apparent to one skilled in the art that the present invention may be practiced without the specific details . furthermore , well - known features may be omitted or simplified in order not to obscure the embodiment being described . as shown in fig1 a , the braking system of in accordance with embodiments is shown operating in an improved portable multi - stage lift 28 to be now described having a mobile base assembly 30 . the lift 28 has a front carriage section 31 which can carry a load support 32 . at the rear ( fig1 b ) the lift 28 has a winch 34 which may be manually operated or can be a motor driven unit . the winch 34 is mounted on the rear of a back stationary mast stage 35 . for purposes of example , two extensible mast stages 36 , 37 have been illustrated between the back stage 35 and the carriage 31 , but one or more than two could be provided . the mast stages 35 , 36 , 37 and carriage 31 are preferably identical in cross - section and comprise a length of extruded aluminum bar stock whose cross - section is shown in fig2 . it will be seen that each mast stage has a central hollow column 38 of generally rectangular cross - section having front and back walls 40 , 41 and a pair of right and left side walls 42 , 43 extending there between . at the rear of the column 38 the side walls 42 , 43 continue rearwardly at 42 a , 43 a and join back laterally extending flanges 44 , 45 . at the front of the column the side walls 42 , 43 continue forwardly at 42 b , 43 b and join right and left inturned front channels 46 , 47 comprising outwardly extending central flanges 46 a , 47 a , outside sections 46 b , 47 b , and inturned front flanges 46 c , 47 c . it will be noted that the central flanges 46 a , 47 a together with the walls 42 , 43 and back flanges 44 , 45 define right and left outwardly facing back channels 52 , 53 . directing attention to fig6 , the described mast stage configuration enables the front inturned channels 46 , 47 of one mast stage to interfit with the back out - turned channels 52 , 53 of a second mast stage with the back flanges 44 , 45 of the front stage facing the front of the central flanges 46 a , 47 a of the back stage , and the front flanges 46 c , 47 c of the back stage facing the rear of the central flanges 46 a , 47 a of the front stage . when mast stages 35 , 37 are interfitted as described , a plurality of side - to - side glide blocks 350 located at the top and bottom of each column track on the right and left side of each adjacent mast stage preventing excess slop and maintaining vertical alignment of each mast stage . front to back alignment of the mast stages is provided by bottom front - to - back pairs of rollers 202 ( e . g ., fig5 ) on mast stages 35 , 36 and 37 , and top front - to - back pairs of rollers 203 on stages 35 - 36 . cutouts are provided at the bottom of the back flanges 44 , 45 of the mast stages , and a central bottom cutout 65 ( fig4 ) is provided in the back wall 41 of the mast stages . these cutouts 65 provide operating space for the rear portion of the bottom rollers 202 and access to washers and nuts 66 on the bolt shafts for these rollers passing through the right and left walls 42 , 43 . space for the front portion of the top rollers 203 is provided by top cutouts 300 ( fig1 ) in the front flanges 46 c , 47 c . the shaft bolts 69 for the top rollers 203 pass outwardly through the outside sections 46 b , 47 b to receive washers and nuts 70 . with the described arrangement of front - to - back rollers , the bottom rollers 202 track on the rear face of the front inturned flanges 46 c , 47 c or the front face of the intermediate flanges 46 a , 47 a of the rear mast stage of interfitting mast stages . similarly , the top front - to - back rollers 203 track on the front face of the rear out - turned flanges 44 , 45 or the back face of the intermediate flanges 46 a , 47 a of the front stage of interfitting mast stages . the carriage 31 has front - to - back rollers 202 adjacent its four corners . many features of the mast system in the current embodiment are known in the prior art . for example , the reeving systems described in the background section of this disclosure are known , and a similar system is used in the current lift . however , to aid the reader , fig3 shows a prior art mast system , many similar parts of which are used in the present lift . referring to fig3 , each of the extensible mast stages 36 - 37 has a top pulley 71 and a bottom pulley 72 adjacent its ends for receiving a cable 73 , from the winch 34 . each top pulley 71 extends through a cutout 74 in the front wall 40 of the respective mast stage , and each bottom pulley 72 extends through a cutout 75 in the back wall 41 of the respective mast stage . the rear stationary mast stage 35 has a single upper pulley 76 journal - mounted on an angle bracket 77 mounted on its front wall and extending through registering cutouts 78 in the front and back walls thereof . the carriage 31 has a pulley 80 extending through a cutout in its back wall . the two upper pulleys 71 are tilted such as to extend rearward into the right portion of a center passage of the respective mast stage . the two lower pulleys 72 and the carriage pulley 80 , on the other hand , angle rearward from the right portion of the central passage 85 to the left passage 55 which is next to the rear . this positions the pulleys such that the cable 73 extends from the upper end of the front mast stage 37 , and is reeved on the pulleys by traveling under the carriage pulley 80 , then over the top pulley 71 and under the bottom pulley 72 of the extensible mast stages 37 , 36 progressing from front to back , then travelling over the top pulley 76 on the back stationary mast stage 35 and down to the winch 34 . in embodiments , the pulleys 71 , 72 , 76 and 80 are provided with guards 90 ( fig1 and 14 ). one of these guards 90 is discussed more below . from the foregoing description it is seen that the carriage 31 and the extensible mast sections 36 - 37 are roller guided front - to - back and glide block guided for side - to - side motion for smooth up and down travel . when cable is taken up on the winch 34 , first the carriage 31 travels up the mast stage 37 . then the front extensible stage 37 is raised following which the next stage 36 is raised . it will be apparent that additional extensible mast sections can be added which duplicate stage 36 . the braking system in accordance with embodiments is adapted to stop downward travel of the carriage 31 and extensible mast stages 36 , 37 in case of a lift failure such , for example , as a failure of the cable 73 . as further described below , the braking system includes a spring loaded lower cable pulley mount 84 ( fig1 and 14 ) that moves mechanical linkages 450 and 200 and knurled toothed cams 201 from engaged ( fig9 ) to disengaged ( fig8 ) braking positions depending on cable tension at the lower pulleys . in embodiments , the cams may be formed of any material that is capable of high friction ( to stop movement of the adjacent mast sections ) and that is hard enough to “ bite ” into the mast column ( e . g ., not just wear away or bend as a result of engagement ). as an example , if the mast sections are formed of aluminum , then the cams may be formed of an aluminum alloy that is harder than the aluminum mast sections , but a brass , plated steel or stainless steel cam could also work . the fasteners 400 ( only one shown in fig1 ) that mount the spring loaded lower pulley - mount 84 are connected through bushings 350 ( fig1 ) that are seated in slotted holes 402 ( top one best shown in fig1 , and bottom one covered by flat washer 460 in fig1 ) on the lift stage . the fasteners 400 are directly connected to the pulley mount 84 , and the fasteners and the lower pulley mount 84 are fixed together to the linkage 450 . the bushings 350 are formed of a material , such as bronze , that may easily slide in the slotted holes 402 without excessive wear . these bushings are taller than the adjacent metal on the mast stage section so that the fasteners 400 may be tightened with the washers 460 seating against the bushings , but not against the mast stage surface . thus , even after tightened in place , the bushings 350 , the flat washer 460 , pulley mount 84 are still free to move up and down in the slotted holes 402 , which permits vertical movement of the lower pulley - mount 84 and the pulley . another fastener 72 a ( fig1 ) connects the pulley 72 to the pulley mount 84 , while sandwiching the pulley guard 90 in place . the pulley - mounts 84 are spring biased so they biased downward ( fig1 and 12 ). when no cable tension is present at the lower cable pulley the pulley mounts 84 move downward , until positioned in a lowermost position . otherwise , the pulley mounts 84 are pulled by the cable , against the tension of the spring bias , to an upper position . thus , the lower pulleys 72 and pulley mounts 84 are positioned downward when the cable is not in tension , and upward when cable tension is present . each pulley mount 84 is connected to an upper mechanical linkage 450 ( fig1 and 13 ). this linkage 450 is connected by small connecting rods to a lower linkage 200 . the knurled cams 201 are fixed at ends of the lower linkage 200 . the lower linkage 200 is fixed in position , and is loosely mounted for free rotation in the respective mast section . the small connecting rods are connected eccentrically to the lower linkage . thus , when the upper linkage 450 moves upward and downward with the pulley mount 84 , the small connecting rods push and pull on the eccentric mounting of the lower linkage 200 , rotating the lower linkage and the knurled cams 201 . when the upper linkage advances downward , due to tension not being present , the upper linkage and lower linkage rotate the knurled cams 201 to the braking position ( fig9 ). in this position , the cams 201 , which are mounted adjacent the rollers 202 in the right and left outwardly facing back channels 52 , 53 , are positioned to engage the front inturned flanges 46 c , 47 c of the adjacent channels , preventing sliding of adjacent mast sections . thus , once cable tension is removed , i . e . the cable 73 breaks , the spring loaded pulley - mounts 84 move the upper mechanical linkage 450 and lower linkage 200 , rotating the knurled cams 201 into a wedging position between adjacent mast stages , stopping or severely braking downward movement of all mast stages . when cable tension is present , the pulleys move to the upward deactivated position , rotating the knurled cam 201 to the non - braking position . in this position , the cam is no longer in contact with the adjacent mast section , and the two sections are free to slide relative to each other . other variations are within the spirit of the present invention . thus , while the invention is susceptible to various modifications and alternative constructions , certain illustrated embodiments thereof are shown in the drawings and have been described above in detail . it should be understood , however , that there is no intention to limit the invention to the specific form or forms disclosed , but on the contrary , the intention is to cover all modifications , alternative constructions , and equivalents falling within the spirit and scope of the invention , as defined in the appended claims . the use of the terms “ a ” and “ an ” and “ the ” and similar referents in the context of describing the invention ( especially in the context of the following claims ) are to be construed to cover both the singular and the plural , unless otherwise indicated herein or clearly contradicted by context . the terms “ comprising ,” “ having ,” “ including ,” and “ containing ” are to be construed as open - ended terms ( i . e ., meaning “ including , but not limited to ,”) unless otherwise noted . the term “ connected ” is to be construed as partly or wholly contained within , attached to , or joined together , even if there is something intervening . recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range , unless otherwise indicated herein , and each separate value is incorporated into the specification as if it were individually recited herein . all methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context . the use of any and all examples , or exemplary language ( e . g ., “ such as ”) provided herein , is intended merely to better illuminate embodiments of the invention and does not pose a limitation on the scope of the invention unless otherwise claimed . no language in the specification should be construed as indicating any non - claimed element as essential to the practice of the invention . preferred embodiments of this invention are described herein , including the best mode known to the inventors for carrying out the invention . variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description . the inventors expect skilled artisans to employ such variations as appropriate , and the inventors intend for the invention to be practiced otherwise than as specifically described herein . accordingly , this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law . moreover , any combination of the above - described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context . all references , including publications , patent applications , and patents , cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein .
| 1 |
the present invention is part of a document processing system , such as an inserting machine , comprising a plurality of stations situated successively along a paper path for processing documents conveyed along the path . with reference to fig1 - 7 , a document registration apparatus , generally shown as 10 , is used in conjunction with a document transport system , generally designated 11 . as shown in fig3 registration apparatus 10 cooperates with transport system 11 in transporting a document 12 along a path 13 in an upstream to downstream direction , designated as arrow d . there is a document registration position 16 where document 12 is stopped in its path by registration unit 10 and is held or &# 34 ; queued &# 34 ; until the next successive station in the processing system is ready to process document 12 . the apparatus 10 simultaneously stops and aligns the document 12 conveyed by transport system 11 . document registration apparatus 10 aligns document 12 relative to path 13 , or , if desired , some other document raceway in the system . although fig3 shows a single document 12 , it is to be understood that the present invention is applicable to situations where document 12 is a stack of documents . document registration apparatus 10 is suitable for use in a queuing station or in an inserting station of an inserting machine wherein document 12 must be stopped and aligned before further processing . apparatus 10 is suitably mounted to the frame ( not shown ) of the inserting machine . for example , apparatus 10 can be pivotally mounted at the upstream end to provide easy access for document jams . a more detailed description of such an arrangement is provided in u . s . application ser . no . 808 , 863 , noted previously herein . referring now to fig2 and 4 , apparatus 10 comprises a document registration unit 20 pivotally mounted to a top plate 18 . document registration unit 20 preferably comprises a one piece document registration unit holder 45 to which a one piece frame member 20b is attached . frame member 20b includes four registration stops 21 , 22 , 23 and 24 on the downstream end thereof and two urge rollers 25 and 26 on urge roller arms 25a - b and 26a - b , respectively , on the upstream end of unit 20 . urge rollers 25 and 26 are spaced at lateral positions between the lateral positions o registration stops 21 and 22 on the one hand , and the lateral positions of registration stops 23 and 24 on the other hand , respectively . frame member 20b pivots vertically around pivot axis 31 . a rotary solenoid 27 is linked to a pivoting arm 14 by a pin 28 which rides in a slot 15 of pivoting arm 14 . pin 28 moves along a circular path on each actuation of solenoid 27 and reciprocates in slot 15 , thereby rocking pivot arm 14 . as pivot arm 14 rocks , frame member 20b of document registration unit 20 pivots vertically around pivot axis 31 . the combination of registration stops 21 - 24 and urge rollers 25 and 26 are used to stop and align document 12 at document registration position 16 , and then to release it for further processing . the stopped document 12 is aligned at this position so that it can subsequently be processed with minimal skew relative to path 13 or , if desired , some other document raceway as discussed above . for example , if document 12 is an envelope to which enclosures will be inserted , then registration stops 21 - 24 ensure that the envelope will be aligned relative to the enclosures . this insertion process can take place at document registration position 16 ( where the envelope will be held open by an envelope opening claw ) or , if desired , at a subsequent location along path 13 . similarly , if document 12 is an enclosure which will be subsequently inserted into an envelope , then registration stops 21 - 24 ensure that the enclosure will be aligned relative to the envelope . finally , if document 12 is a sheet or stack of sheets which will subsequently be folded , then registration stops 21 - 24 ensure that the document is aligned so that the folder can make a square fold of the document . the registration units shown in fig1 and 2 are comprised of different lengths with each being suitable for a particular use . for example , the longer apparatus in fig2 may be more suitable for use with a sheet feeder that can feed sheets of different lengths . the shorter apparatus in fig1 may be more suitable at an insertion station or at an enclosure feeder where the length of the document being fed is less than full size sheets . in order to stop document 12 at document registration position 16 , registration stops 21 - 24 are urged clockwise to position a ( fig3 ) by actuating solenoid 27 . in position a , registration stops 21 - 24 extend into document path 13 and preferably project below the plane of transport system 11 , so as to block document 12 from being transported further downstream by transport system 11 . in the preferred embodiment , transport system 11 includes two transport belts 11a and 11b ( fig1 and 7 ) which move in synchronization . preferably , transport belts 11a and 11b are each approximately 0 . 5 inch wide . laterally spaced on each side of each transport belt 11a and 11b are registration stops 21 , 22 and 23 , 24 , respectively . the projection of stops 21 - 24 below the plane of transport system 11 assures that document 12 cannot slip through . registration stops 21 - 24 are laterally - spaced along document registration unit 20 so that when document 12 is stopped at document registration position 16 , the downstream edge 49 ( see fig3 and 7 ) of document 12 is aligned with respect to document path 13 or , if desired , another path with which it is desired to align document 12 , for example , one orthogonal to path 13 . the continued travel of transport system 11 while document 12 is stopped assures that document 12 registers completely against stops 21 - 24 . when it is time to release document 12 , solenoid 27 is actuated to pivot registration stops 21 - 24 to position b ( fig3 ) wherein urge rollers 25 and 26 urge document 12 against transport belts 11a and 11b , thus increasing the frictional force between document 12 and transport system il . the increased frictional force is enough to stop the slippage between document 12 and transport system 11 and moves document 12 downstream for further processing . as document 12 moves in the downstream direction , it encounters exit pinch rollers 32 and 33 which are mounted on independent sets of support arms 34a , 34b and 35a , 35b , corresponding to exit pinch rollers 32 and 33 , respectively , and which also pivot about pivoting axis 31 . arms 34a , 34b and 35a , 35b and thus rollers 32 and 33 , are respectively spring biased by separate torsion springs ( not shown ) to urge rollers 32 and 33 against transport belts 11a and 11b . rollers 32 and 33 move away from belts 11a and 11b when document 12 is released , but move back into engagement with transport system 11 as soon as document 12 is conveyed beyond rollers 32 and 33 . the released document is thus urged against transport system 11 and driven while the next document is held . the mounting of pinch rollers 32 and 33 on separate support arms 34a , 34b and 35a , 35b results in minimal &# 34 ; shingling &# 34 ; of documents when a stack of documents exit the document registration apparatus . this is because rollers 32 and 33 and sets of arms 34a , 34b and 35a , 35b can move away from transport system 11 as required by the thickness of document 12 to allow document 12 to pass , without lifting the remainder of unit 20 . as shown in fig3 and 4 , document registration unit 20 is preferably formed from one - piece document registration unit holder 45 , to which a one piece frame 20b is pivotally attached . frame 20b comprises stops 21 - 24 and arms 25a - b and 26a - b . because document registration frame 20b is formed from a one - piece member , it is less subject to mechanical failure than registration devices formed from multiple interconnected parts . furthermore , because registration stops 21 - 24 are rigidly and pivotally linked to urge rollers 25 and 26 , it is not necessary to align registration stops 21 - 24 relative to urge rollers 25 and 26 in order for the overall document registration apparatus to be properly aligned . registration stops 21 - 24 are inherently aligned with urge rollers 25 and 26 because urge rollers arms 25a , 25b , 26a and 26b are part of the same one - piece member as registration stops 21 - 24 . top plate 18 , which is suitably mounted to the frame of the inserting machine ( not shown ), supports document registration unit 20 which is mounted to the underside of plate 18 ( fig1 and 4 ). top plate 18 includes a longitudinal slot 56 which guides a slide member 60 as it moves back and forth on top of plate 18 . slide member 60 comprises a rectangular tang 62 molded to its upstream end and a pin clamping section at its downstream end ( fig6 ). tang 62 fits through a close fitting rectangular aperture 64 at slot 56 in top plate 18 . by inserting tang 62 into aperture 64 and then sliding slide member 60 to the rear of plate 18 , tang 62 is trapped under top plate 18 , whereby slide member can be positioned on plate 18 along slot 56 . a u - shaped bracket 70 is suitably mounted to the top side of document registration unit 20 . in the preferred embodiment of the present invention each leg 72 and 74 of bracket 70 includes a flange member 76 and 78 which is secured to registration unit 20 by screws . solenoid 27 is fixedly mounted to one leg 76 of bracket 70 . the top portion of bracket 70 includes a pin 80 in the middle of the downstream side of bracket 70 , and a tab 82 in the middle of the upstream side . shaft 90 has a groove 100 at one end and a knurled surface at the other end . there is a threaded section 102 adjacent groove 100 . slide 60 includes a mating thread molded into it to accept threaded section 102 of shaft 90 . bracket 70 is assembled to top plate 18 in the following manner . bracket 70 is lifted up against the underside of plate 18 with pin 80 and tab 82 protruding through slot 56 . slide 60 includes a slotted clamp member 84 with a cutout portion 86 for retaining pin 80 and an aperture 94 through which tab 82 extends when bracket 70 is assembled to top plate 18 . slide 60 is positioned over slot 56 with clamp member 84 adjacent pin 80 . slide 60 is then slid forward causing pin 80 to be locked in place at cutout 86 of slotted clamp member 84 and tab 82 to be locked in place on groove 100 . thus registration unit 20 is slidably mounted to top plate 18 . the pivotal adjustment about pin 80 is implemented by shaft 90 . as best shown in fig7 when shaft 90 is rotated clockwise , it is threaded into slide 60 causing groove 100 to move towards the rear of the machine . tab 82 moves with groove 100 causing the pivotal rotation of the registration unit 20 around pin 80 in a clockwise direction . this causes the stops 21 , 22 , 23 and 24 and rollers 32 and 33 to rotate accordingly . it will be understood that rotating shaft 90 counter - clockwise has the opposite effect . slide 60 includes a pointer member 96 which indicates how much skew is introduced and the direction of the skew at registration apparatus 10 . slide 60 further includes a molded pointer 98 which indicate .. s the length of insert the registration apparatus 10 has be adjusted to handle . further details regarding the basic document registration apparatus 10 may be obtained from the above noted u . s . patent application ser . no . 808 , 863 . thus it is seen that the present invention provides skew adjustment means to a document registration apparatus that has a design that does not result in frequent mechanical failure , that has minimum number of mechanical parts , that is not difficult to align , that can simultaneously align a stack of documents without shingling , and which allows easy access to jammed documents . one skilled in the art will appreciate that the present invention can be practiced by other than the described embodiments , which are presented for purposes of illustration and not of limitation , and the present invention is limited only by the claims which follow .
| 1 |
exemplary embodiments of the present invention will be described below with reference to the drawings . fig1 is a functional block diagram showing the configuration of a keyword extractor 10 according to an embodiment of an information processing apparatus according to the invention . the keyword extractor 10 is implemented by an information instrument such as a tablet - type pda or pc which will be described later , a projector system which can detect a position designated on a screen by a user , etc . the keyword extractor 10 according to the embodiment is constituted by a tablet - type pda . the keyword extractor 10 is provided with an overall controller 11 , a touch region controller 20 , a pen region controller 21 , an enlarged region controller 22 , and a character recognition controller 23 , which consist of a computer ( cpu ). these respective controllers 11 , 20 , 21 , 22 and 23 control operations of respective units in accordance with an apparatus control program pr stored in a not - shown memory such as a hard disk or an rom . the apparatus control program pr is started up in accordance with an input signal from an input device 13 of a transparent touch panel , which is , for example , provided on top of a screen of a backlighted color liquid crystal display device 12 . the input device 13 is a double - layered touch panel in which an electromagnetic induction type touch panel as a first touch panel and an electrostatic capacitance type touch panel as a second touch panel are provided on a display screen of the display device 12 . the electromagnetic induction type touch panel detects an operation performed by a special pen generating a magnetic field on the display screen of the display device 12 based on an electromagnetic induction system . the electrostatic capacitance type touch panel detects an operation performed by a finger on the display screen of the display device 12 based on an electrostatic capacitance system . a keyword extraction process program pr 1 for extracting a keyword from a region designated in accordance with a touch operation performed by a finger , a touch operation performed by a pen or an enlargement touch operation on a presentation screen ( image ) displayed on the display device 12 , a keyword recording program pr 2 for editing and recording the extracted keyword on a predetermined keyword recording form fk , a presentation material creation process program pr 3 for creating new presentation materials based on the recorded keyword , etc . are stored as the apparatus control program pr in addition to the system program for controlling the whole of the apparatus . the keyword extractor 10 is provided with a presentation material storage unit 14 , an operation information storage unit 15 , a touch operation region data storage unit 16 , a pen operation region data storage unit 17 , an enlarged operation region data storage unit 18 and a keyword data storage unit 19 , whose storage regions are allocated in a not - shown memory such as a hard disk or an ram . a presentation material screen ( presentation screen ) 14 g which is created in advance or which is created in accordance with the presentation material creation process program pr 3 is stored in the presentation material storage unit 14 . fig2 is a view showing an example of the presentation screen 14 g stored in the presentation material storage unit 14 of the keyword extractor 10 . information about a position or a region on the presentation screen 14 g in accordance with a touch operation performed by a user in the input device ( touch panel ) 13 is stored in the operation information storage unit 15 in accordance with the control of the overall controller 11 . fig3 is a view showing user operation information stored in the operation information storage unit 15 of the keyword extractor 10 . a touch operation information address 15 t , an enlargement operation information address 15 z and a pen operation information address 15 p are allocated in the operation information storage unit 15 . coordinates ( x , y ) 15 t 1 , 15 t 2 or the like of touch positions 1 , 2 or the like designated by touch operation on the presentation screen 14 g with a finger by the user are stored in the touch operation information address 15 t . in addition , coordinates ( x , y , sx , sy ) 15 z 1 , 15 z 2 or the like of enlarged regions 1 , 2 or the like enlarged by multitouch - operation on the same presentation screen 14 g with fingers by the user are stored in the enlargement operation information address 15 z . in addition , coordinates ( x , y ) 15 p 1 , 15 p 2 or the like of pen touch positions 1 , 2 or the like designated by touch operation on the same presentation screen 14 g with a pen by the user are stored in the pen operation information address 15 p . in the input device ( touch panel ) 13 , a touch operation performed by a finger is detected by the electrostatic capacitance type touch panel and a touch operation performed by a pen is detected by the electromagnetic induction type touch panel . incidentally , when the input device ( touch panel ) 13 consists of one layer of the electrostatic capacitance type touch panel , detection of a touch operation performed by a finger or detection of a touch operation performed by a pen may be determined based on whether the center ( x , y ) of the touch position is detected with a spread not smaller than a threshold or not ( or detected as a pin point or not ). fig4 is a view showing touch operation region data stored in the touch operation region data storage unit 16 of the keyword extractor 10 . coordinates ( x , y , sx , sy ) 16 t 1 , 16 t 2 or the like indicating regions 1 , 2 or the like of rectangular sizes set in advance correspondingly to the coordinates ( x , y ) 15 t 1 , 15 t 2 or the like of the positions 1 , 2 or the like designated by the touch operation with the finger by the user in accordance with the control of the overall controller 11 and the touch region controller 20 are stored in the touch operation region data storage unit 16 . coordinates ( x , y , sx , sy ) indicating regions 1 , 2 or the like of rectangular sizes set in advance correspondingly to the coordinates ( x , y ) 15 p 1 , 15 p 2 , . . . of the positions 1 , 2 or the like designated by the touch operation with the pen by the user in accordance with the control of the overall controller 11 and the pen region controller 21 are stored in the pen operation region data storage unit 17 in the same manner as the touch operation region data ( 16 ). the coordinates ( x , y , sx , sy ) 15 z 1 , 15 z 2 or the like of the enlarged regions 1 , 2 or the like enlarged by the multi - touch operation of the user in accordance with the control of the overall controller 11 and the enlarged region controller 22 are transferred to and stored in the enlargement operation region data storage unit 18 as they are with the same contents as those stored in the enlargement operation information address 15 z ( see fig3 ). characters in an image extracted from the presentation screen 14 g in accordance with the coordinates ( x , y , sx , sy ) 16 t 1 , 16 t 2 or the like of the touch operation regions 1 , 2 or the like stored in the touch operation region data storage unit 16 , or the coordinates ( x , y , sx , sy ) of the pen touch operation regions 1 , 2 or the like stored in the pen operation region data storage unit 17 , or the coordinates ( x , y , sx , sy ) 15 z 1 , 15 z 2 or the like of the enlarged regions 1 , 2 or the like stored in the enlargement operation region data storage unit 18 are recognized in accordance with the control of the character recognition controller 23 . a character string consisting of the recognized characters is stored as a keyword in the keyword data storage unit 19 . on this occasion , assume that a user using his / her finger or fingers to perform a touch operation or an enlargement operation on the presentation screen 14 g displayed on the display device 12 is regarded as a presenting side user ( for example , a “ salesclerk ”) and a user using the pen to perform a touch operation on the same presentation screen 14 g is regarded as a presented side user ( for example , a “ client ”) in the embodiment . therefore , for example , as shown in fig5 , character recognition results of images extracted from the presentation screen 14 g in accordance with the coordinates ( x , y , sx , sy ) 16 t 1 , 16 t 2 or the like of the touch operation regions 1 , 2 or the like performed by the finger and character recognition results of images extracted from the presentation screen 14 g in accordance with the coordinates ( x , y , sx , sy ) 15 z 1 , 15 z 2 or the like of the enlarged regions 1 , 2 or the like , are stored as presenting side ( salesclerk ) keywords 19 s 1 , 19 s 2 or the like in the keyword data storage unit 19 . in addition , character recognition results of images extracted from the presentation screen 14 g in accordance with the coordinates ( x , y , sx , sy ) of the touch operation regions 1 , 2 or the like performed by the pen is stored as presented side ( client ) keywords 19 c 1 , 19 c 2 or the like in the keyword data storage unit 19 . fig5 is a view showing keyword data stored in the keyword data storage unit 19 of the keyword extractor 10 . the respective controllers ( cpu ) 11 , 20 , 21 , 22 and 23 control operations of respective units in accordance with commands described in the respective programs pr 1 , pr 2 and pr 3 so that software and hardware can operate in cooperation with each other . in this manner , the keyword extractor 10 configured thus implements functions which will be described in the following operation description . next , operation of the keyword extractor 10 having the aforementioned configuration will be described . fig6 is a flow chart showing a keyword extraction process ( first part ) executed in accordance with the keyword extraction process program pr 1 of the keyword extractor 10 . fig7 is a flow chart showing the keyword extraction process ( second part ) executed in accordance with the keyword extraction process program pr 1 of the keyword extractor 10 . fig8 is a flow chart showing the keyword extraction process ( third part ) executed in accordance with the keyword extraction process program pr 1 of the keyword extractor 10 . for example , in a presentation operation mode set in response to a touch operation performed on the input device ( touch panel ) 13 by the presenting side user , an operation information recording ( keyword extraction process ) is started ( step s 1 ). when a desired presentation screen 14 g stored in the presentation material storage unit 14 is selected in accordance with an operation of the user , the selected presentation screen 14 g is displayed on the display device 12 ( step s 2 ). when the user performs a touch operation on the input device 13 in the presentation screen 14 g displayed on the display device 12 , it may be determined that the operation is a touch operation performed with a finger ( step s 4 ( touch )). in this case , coordinates ( x , y ) 15 t 1 , 15 t 2 or the like of the position the finger touches are recorded in the touch operation information address 15 t of the operation information storage unit 15 every time the touch operation is determined ( step s 5 t ). further , it may be determined that the operation is a touch operation performed with a pen ( step 4 ( pen )). in this case , coordinates ( x , y ) 15 p 1 , 15 p 2 or the like of the position the pen touches are recorded in the pen operation information address 15 p of the operation information storage unit 15 every time the touch operation is determined ( step s 5 p ). on the other hand , it may be determined that the operation is an enlargement operation performed by multi - touch ( step s 4 ( enlarge )). in this case , coordinates ( x , y , sx , sy ) 15 z 1 , 15 z 2 or the like of a region subjected to the enlargement operation are recorded in the enlargement operation information address 15 z of the operation information storage unit 15 every time the enlargement operation is determined ( step s 5 z ). in this manner , in accordance with the touch operations using the input device ( touch panel ) 13 on the presentation screen 14 g displayed on the display device 12 , the coordinates ( x , y ) 15 t 1 , 15 t 2 or the like designated by the touch operation with the finger on the presenting side and the coordinates ( x , y , sx , zy ) 15 z 1 , 15 z 2 or the like of the region subjected to the enlargement operation are recorded in the touch operation information address 15 t and the enlargement operation information address 15 z of the operation information storage unit 15 respectively , and the coordinates ( x , y ) 15 p 1 , 15 p 2 or the like designated by the touch operation with a pen on the presented side are recorded in the pen operation information address 15 p of the same operation information storage unit 15 . when it is then determined that an operation to terminate the presentation has been performed (“ yes ” in step s 3 ), it is determined whether the touch operation information of the finger has been recorded in the touch operation information address 15 t of the operation information storage unit 15 or not ( step s 6 ). here , when it is determined that the touch operation information of the finger has been recorded in the touch operation information address 15 t of the operation information storage unit 15 (“ yes ” in step s 6 ), the coordinates ( x , y ) 15 t 1 , 15 t 2 or the like which are the touch operation information of the finger are acquired ( step s 7 ). a region surrounded by a rectangular size of ± 50 dots in both an x direction and a y direction with respect to the coordinates ( x , y ) 15 t 1 , 15 t 2 or the like acquired from the touch operation information address 15 t in accordance with the coordinates ( x , y ) is created as coordinates ( x , y , sx , sy ) 16 t 1 , 16 t 2 or the like indicating a touch operation region 1 , 2 or the like and stored in the touch operation region data storage unit 16 ( steps s 8 to s 11 ). on this occasion , it is determined whether a touch operation region ( 16 tm ) located on the same presentation screen 14 g and already stored in the touch operation region data storage unit 16 has an overlapping region or not with a touch operation region ( 16 tn ) created this time ( step s 9 ). when it is determined that the touch operation region ( 16 tm ) has no overlapping region (“ no ” in step s 9 ), the coordinates ( x , y , sx , sy ) 16 tn of the touch operation region 1 , 2 or the like created this time are additionally stored in the touch operation region data storage unit 16 ( step s 10 ). on the other hand , when it is determined that the touch operation region ( 16 tm ) has an overlapping region (“ yes ” in step s 9 ), coordinates ( 16 tm + tn ) of an expanded region obtained by adding the touch operation region ( 16 tn ) created this time to the touch operation region ( 16 tm ) which has been already stored and which is determined to have the overlapping region are stored for update in the touch operation region data storage unit 16 ( step s 11 ). when it is determined that next touch operation information ( 15 tn ) has been recorded in the touch operation information address 15 t of the operation information storage unit 15 , the same process of creating and storing touch operation region information ( 16 tn ) is repeated ( steps s 6 to s 11 ). then , it is determined whether touch operation information of the pen has been recorded in the pen operation information address 15 p of the operation information storage unit 15 or not ( step s 12 ). here , when it is determined that the touch operation information of the pen has been recorded in the pen operation information address 15 p of the operation information storage unit 15 (“ yes ” in step s 12 ), coordinates ( x , y ) 15 p 1 , 15 p 2 or the like which are the touch operation information of the pen are acquired ( step s 13 ). a region surrounded by a rectangular size of ± 50 dots in both the x direction and the y direction with respect to the coordinates ( x , y ) 15 p 1 , 15 p 2 or the like acquired from the pen operation information address 15 p in accordance with the coordinates ( x , y ) are created as coordinates ( x , y , sx , sy ) indicating the pen operation region 1 , 2 or the like and stored in the pen operation region data storage unit 17 ( step s 14 ). on this occasion , it is determined whether a pen operation region located on the same presentation screen 14 g and already stored in the pen operation region data storage unit 17 has an overlapping region or not with the pen operation region created this time ( step s 15 ). when it is determined that the pen operation region has no overlapping region (“ no ” in step s 15 ), the coordinates ( x , y , sx , sy ) of the pen operation region 1 , 2 or the like created this time are additionally stored in the pen operation region data storage unit 17 ( step s 16 ). on the other hand , when it is determined that the pen operation region has an overlapping region (“ yes ” in step s 15 ), coordinates of an expanded region obtained by adding the pen operation region created this time to the pen operation region which is determined to have the overlapping region and which has already been stored are stored for update in the pen operation region data storage unit 17 ( step s 17 ). when it is determined that next pen operation information has been recorded in the pen operation information address 15 p of the operation information storage unit 15 , the same process of creating and storing pen operation region information is repeated ( step s 12 to s 17 ). next , it is determined whether touch operation region information have been stored in the touch operation region data storage unit 16 or not ( step s 18 ). here , when it is determined that touch operation region information have been recorded in the touch operation region data storage unit 16 (“ yes ” in step s 18 ), the coordinates ( x , y , sx , sy ) 16 t 1 , 16 t 2 or the like which are the touch operation region information are acquired ( step s 19 ). then , in accordance with the coordinates ( x , y , sx , sy ) 16 t 1 , 16 t 2 or the like of each of the touch operation regions acquired thus , characters are recognized in an image extracted from the presentation screen 14 g correspondingly to the coordinates ( x , y , sx , sy ) of the region by the character recognition controller 23 ( step s 20 ). strings of characters recognized thus are registered as presenting side keywords 19 s 1 , 19 s 2 or the like in the keyword data storage unit 19 ( see fig5 ) ( step s 21 ). next , it is determined whether pen operation region information have been stored in the pen operation region data storage unit 17 or not ( step s 22 ). here , when it is determined that the pen operation region information have been recorded in the pen operation region data storage unit 17 ( yes in step s 22 ), coordinates ( x , y , sx , sy ) or the like which are the pen operation region information are acquired ( step s 23 ). then , in accordance with the coordinates ( x , y , sx , sy ) or the like of each of the pen operation regions acquired thus , characters are recognized in an image extracted from the presentation screen 14 g correspondingly to the coordinates ( x , y , sx , sy ) of the region by the character recognition controller 23 ( step s 24 ). strings of characters recognized thus are registered as presented side ( client ) keywords 19 c 1 , 19 c 2 or the like in the keyword data storage unit 19 ( see fig5 ) ( step s 25 ). then , it is determined whether enlargement operation region information have been stored in the enlargement operation region data storage unit 18 or not ( step s 26 ). here , when it is determined that the enlargement operation region information have been recorded in the enlargement operation region data storage unit 18 ( yes in step s 26 ), coordinates ( x , y , sx , sy ) or the like which are the enlargement operation region information are acquired ( step s 27 ). then , in accordance with the coordinates ( x , y , sx , sy ) or the like of each of the enlargement operation regions acquired thus , characters are recognized in an image extracted from the presentation screen 14 g correspondingly to the coordinates ( x , y , sx , sy ) of the region by the character recognition controller 23 ( step s 28 ). strings of characters recognized thus are registered as presenting side keywords 19 s 1 , 19 s 2 or the like in the keyword data storage unit 19 ( see fig5 ) ( step 29 ). fig9 a and 9b are views showing a specific display operation on the presentation screen 14 g in accordance with a keyword extraction process of the keyword extractor 10 . fig9 a is a view showing touch operation positions t 1 to t 3 touched by a finger , a touch operation position p 1 touched by a pen and an enlargement operation region z 1 on the presentation screen 14 g displayed on the display device 12 . fig9 b is a view showing an enlarged display screen 14 g z of the enlargement operation region z 1 . fig1 is a view showing a specific example in which touch operation information are obtained on the presentation screen 14 g in fig9 a and 9b in accordance with the keyword extraction process of the keyword extractor 10 . fig1 is a view showing a specific example in which touch operation region information are created correspondingly to the touch operation information in fig1 respectively in accordance with the keyword extraction process of the keyword extractor 10 while expanded region information is created when the regions of the touch operation region information overlap with each other . when , for example , the presenting side touches three desired points t 1 to t 3 with a finger on the presentation screen 14 g displayed on the display device 12 as shown in fig9 a ( steps s 1 and s 2 ), xy coordinates ( x = 50 , y = 200 ) 15 t 1 corresponding to the touch operation position t 1 , xy coordinates ( x = 100 , y = 220 ) 15 t 2 corresponding to the touch operation position t 2 and xy coordinates ( x = 80 , y = 170 ) 15 t 3 corresponding to the touch operation position t 3 are recorded in the touch operation information address 15 t of the operation information storage unit 15 as shown in fig1 ( steps s 4 and s 5 t ). in addition , when , for example , the presenting side touches a region z 1 to be enlarged , coordinates ( x = 200 , y = 250 , sx = 150 , sy = 100 ) 15 z 1 corresponding to the upper left of the enlargement operation region z 1 and a range extending therefrom in the x direction and the y direction are recorded in the enlargement operation information address 15 z of the operation information storage unit 15 as shown in fig1 ( steps s 4 and s 5 z ). further , when , for example , the presented side ( client ) touches one desired point p 1 with the pen , xy coordinates ( x = 200 , y = 220 ) 15 p 1 corresponding to the pen operation position p 1 are recorded in the pen operation information address 15 p of the operation information storage unit 15 as shown in fig1 ( steps s 4 and s 5 p ). when an operation to terminate the presentation is performed ( yes in step s 3 ), the coordinates ( x = 50 , y = 200 ) 15 t 1 corresponding to the first touch operation position t 1 are first acquired from the touch operation information address 15 t of the operation information storage unit 15 so that coordinates ( x = 0 , y = 150 , sx = 100 , sy = 100 ) 16 t 1 of a touch operation region surrounded by a rectangular size of ± 50 dots in both the x direction and the y direction are created as shown in ( a ) of fig1 ( steps s 6 to t 8 ). in this case , there is no other touch operation region overlapping with the first touch operation region ( x = 0 , y = 150 , sx = 100 , sy = 100 ) 16 t 1 . accordingly , the touch operation region 16 t 1 is stored in the touch operation region data storage unit 16 as it is ( steps s 9 and s 10 ). then , the coordinates ( x = 100 , y = 220 ) 15 t 2 corresponding to the second touch operation position t 2 are acquired from the touch operation information address 15 t of the operation information storage unit 15 so that coordinates ( x = 50 , y = 170 , sx = 100 , sy = 100 ) 16 t 2 of a touch operation region surrounded by a rectangular size of ± 50 dots in both the x direction and the y direction are created as shown in ( b ) of fig1 ( steps s 6 to s 8 ). in this case , a region overlapping with the second touch operation region ( x = 50 , y = 170 , sx = 100 , sy = 100 ) 16 t 2 created this time corresponds to the first touch operation region ( x = 0 , y = 150 , sx = 100 , sy = 100 ) 16 t 1 which has been already stored in the touch operation region data storage unit 16 . accordingly , coordinates ( 0 , 150 , 150 , 120 ) 16 t 1 + t 2 of an expanded touch operation region obtained by adding the second touch operation region 16 t 2 to the existing and overlapping touch operation region 16 t 1 are stored for update in the touch operation region data storage unit 16 ( step s 11 ). then , the coordinates ( x = 80 , y = 170 ) 15 t 3 corresponding to the third touch operation position t 3 are acquired from the touch operation information address 15 t of the operation information storage unit 15 so that coordinates ( x = 30 , y = 120 , sx = 100 , sy = 100 ) 16 t 3 of a touch operation region surrounded by a rectangular size of ± 50 dots in both the x direction and the y direction are created as shown in ( c ) of fig1 ( steps s 6 to s 8 ). in this case , a region overlapping with the third touch operation region ( x = 30 , y = 120 , sx = 100 , sy = 100 ) 16 t 3 created this time corresponds to the expanded touch operation region ( 0 , 150 , 150 , 120 ) 16 t 1 + t 2 which has been already stored in the touch operation region data storage unit 16 . accordingly , coordinates ( 0 , 120 , 150 , 150 ) 16 t 1 + t 2 + t 3 of an expanded touch operation region obtained by adding the third touch operation region 16 t 3 to the existing and overlapping touch operation region 16 t 1 + t 2 are stored for update in the touch operation region data storage unit 16 ( step s 11 ). also as for the coordinates ( 200 , 220 ) 15 p 1 ( see fig1 ) corresponding to the pen operation position p 1 which has been stored in the pen operation information address 15 p of the operation information storage unit 15 , a pen operation region corresponding to the pen operation position p 1 is created in the same manner as in the process of creating and storing the touch operation region 16 tn corresponding to the touch operation position 15 tn , and stored in the pen operation region data storage unit 17 ( steps s 12 to s 17 ). fig1 is a view showing a specific example of a touch region image gt extracted from a touch operation region 16 tn on the presentation screen 14 g in accordance with the keyword extraction process of the keyword extractor 10 . fig1 is a view showing a specific example of an enlarged region image gz extracted from an enlarged operation region 16 zn on the presentation screen 14 g in accordance with the keyword extraction process of the keyword extractor 10 . fig1 is a view showing specific examples of respective keywords extracted from respective operation regions on the presentation screen 14 g in accordance with the keyword extraction process of the keyword extractor 10 and registered in the keyword data storage unit 19 . when the coordinates ( 0 , 120 , 150 , 150 ) 16 t 1 + t 2 + t 3 of the touch operation region stored in the touch operation region data storage unit 16 are acquired as shown in fig1 ( steps s 18 and s 19 ), a touch region image gt corresponding to the touch operation region 16 t 1 + t 2 + t 3 is extracted from the presentation image 14 g ( see fig9 a ) as shown in fig1 so that characters can be recognized in the touch region image gt by the character recognition controller 23 ( step s 20 ). then , a character string “ acquisition of more clients at abc • def ” consisting of the characters recognized thus from the touch region image gt is registered as a presenting side ( t ) keyword 19 s 1 in the keyword data storage unit 19 as shown in fig1 ( step s 21 ). when a pen operation region which has been stored in the pen operation region data storage unit 17 is acquired ( steps s 22 and s 23 ), a pen region image corresponding to the pen operation region is extracted from the presentation image 14 g so that characters can be recognized in the pen region image by the character recognition controller 23 ( step s 24 ). then , a character string consisting of the characters recognized thus from the pen region image is registered as a presented side ( client ) ( p ) keyword 19 c 1 in the keyword data storage unit 19 ( step s 25 ). when coordinates ( 200 , 250 , 150 , 100 ) 15 z 1 of an enlargement operation region which has been stored in the enlargement operation region data storage unit 18 are acquired ( steps s 26 and s 27 ), an enlarged region image gz corresponding to the enlargement operation region 15 z 1 is extracted from the presentation image 14 g ( see fig9 a and 9b ) as shown in fig1 so that characters can be recognized in the enlarged region image gz by the character recognition controller 23 ( step s 28 ). then , a character string “ support for various electronic moneys ” consisting of the characters recognized thus from the enlarged region image gz is registered as a presenting side ( z ) keyword 19 s 2 in the keyword data storage unit 19 as shown in fig1 ( step s 29 ). fig1 is a flow chart showing a keyword recording for editing and recording keywords which have been registered in the keyword data storage unit 19 by the keyword extraction process of the keyword extractor 10 . fig1 is a view showing a keyword recording form fk used in the keyword recording of the keyword extractor 10 . when a keyword corresponding to each operation region of the user ( the presenting side ( salesclerk )/ the presented side ( client )) on the presentation screen 14 g is extracted and registered in the keyword data storage unit 19 in accordance with the keyword extraction process ( see fig6 to 14 ), the keyword recording in fig1 is executed . when the keyword recording is started up , the keyword recording form fk ( see fig1 ) corresponding to the presentation this time and stored in the keyword data storage unit 19 is read ( step a 1 ) so that it can be determined whether presented side ( client ) keywords ( p ) have been registered in the same keyword data storage unit 19 ( see fig1 ) or not ( step a 2 ). here , when it is determined that presented side ( client ) keywords ( p ) 19 c 1 to 19 cn have been registered ( yes in step a 2 ), the keywords ( p ) 19 c 1 to 19 cn are acquired sequentially ( step a 3 ) and added and recorded sequentially in a client keyword region kc in the keyword recording form fk ( step a 4 ). when it is determined that there is no presented side ( client ) keyword ( p ) which should be acquired from the keyword data storage unit 19 (“ no ” in step a 2 ), it is then determined whether presenting side ( salesclerk ) keywords ( t ) and ( z ) have been registered in the same keyword data storage unit 19 ( see fig1 ) or not ( step a 5 ). here , when it is determined that presenting side ( salesclerk ) keywords ( t ) 19 s 1 and ( z ) 19 s 2 have been registered (“ yes ” in step a 5 ), the keywords ( t ) 19 s 1 and ( z ) 19 s 2 are acquired sequentially ( step s 6 ) and added and recorded sequentially in a salesclerk keyword region ks in the keyword recording form fk ( step a 7 ). when it is determined that there is no presenting side ( salesclerk ) keyword ( t ) or ( z ) which should be acquired from the keyword data storage unit 19 (“ no ” in step a 5 ), the keyword recording form fk in which the presented side ( client ) keyword ( p ) 19 c 1 is classified and recorded into the client keyword region kc and the presenting side ( salesclerk ) keywords ( t ) 19 s 1 and ( z ) 19 s 2 are classified and recorded into the salesclerk keyword region ks is registered in the keyword data storage unit 19 . fig1 is a flow chart showing a presentation material creation process for creating a new presentation material based on a keyword recording form fk which has been recorded by the keyword recording of the keyword extractor 10 . fig1 is a view showing a presentation material form fp used in a presentation material creation process of the keyword extractor 10 . when a presentation material creation process in fig1 is started up in response to an operation of a user ( step b 1 ) after a keyword recording form fk in which presented side ( client ) keywords ( p ) are classified into a client keyword region kc and presenting side ( salesclerk ) keywords ( t ) and ( z ) are classified into a salesclerk keyword region ks has been created in accordance with the keyword recording ( fig1 and 16 ), a message encouraging the user to display a list of keywords which have been recorded in the keyword recording form fk or to terminate the process is displayed ( step b 2 ). here , when the message to display the list of keywords is selected (“ yes ” in step b 3 ), it is determined whether there are or not any keywords which have been recorded in the client keyword region kc or the salesclerk keyword region ks of the keyword recording form fk ( step b 4 ). when it is first determined that presented side ( client ) keywords ( p ) 19 c 1 to 19 cn have been recorded in the client keyword region kc of the keyword recording form fk ( yes in both steps b 4 and b 5 ), all the presented side ( client ) keywords ( p ) 19 c 1 to 19 cn which have been recorded are read out and added onto a pen keyword list screen lk displayed in a window on the display device 12 as shown in fig1 ( step b 6 ). when it is then determined that presenting side ( salesclerk ) keywords ( t ) and ( z ) 19 s 1 to 19 sn have been recorded in the salesclerk keyword region ks of the keyword recording form fk (“ yes ” in step b 7 ), all the presenting side ( salesclerk ) keywords ( t ) and ( z ) 19 s 1 to 195 n which have been recorded are read out and added onto a touch keyword list screen mk displayed in a window on the display device 12 ( step b 8 ) as shown in fig1 . then , the pen keyword list screen lk and the touch keyword list screen mk are compared with each other so that keywords which are coincident between a list on the pen keyword list screen lk and a list on the touch keyword list screen mk are highlighted and displayed in the lists . in this manner , all the presented side ( client ) keywords ( p ) 19 c 1 to 19 cn and the presenting side ( salesclerk ) keywords ( t ) and ( z ) 19 s 1 to 195 n which have been classified and recorded in the keyword recording form fk are classified and displayed in the respective lists on the pen keyword list screen lk and the touch keyword list screen mk which are displayed in the respective windows on the display device 12 . accordingly , the contents which drew client &# 39 ; s attention and the contents which were emphasized by the salesclerk when the presentation was made by means of the presentation screen 14 g can be compared with each other . in addition , the coincident keywords are highlighted so that consistent points and different points between the client &# 39 ; s thought and the salesclerk &# 39 ; s thought can be made clear . thus , keywords regarded as highly important for future presentation can be known . then , when a keyword desired to be used as a new presentation material is selected from the respective keywords displayed in the lists on the pen keyword list screen lk and the touch keyword list screen mk (“ yes ” in both steps b 9 and b 10 ), the selected keyword is inputted into and displayed on a presentation material form fp which is displayed adjacently to the pen keyword list screen lk and the touch keyword list screen mk ( step b 11 ). in this manner , keywords selected desirably from the keyword list screen lk in which keywords regarded as important are listed and displayed sequentially in order of importance are inputted into and displayed on the presentation material form fp as they are . thus , new and suitable presentation materials can be created easily without any omission of the important keywords . accordingly , according to the keyword extraction function of the keyword extractor 10 having the aforementioned configuration , the presentation screen 14 g is displayed on the display device 12 provided with the touch panel type input device 13 . the presenting side ( salesclerk ) performs a touch operation or an enlargement operation with a finger or fingers on the presentation screen 14 g , or the presented side ( client ) performs a touch operation with the pen likewise . in the touch operation with the finger or the touch operation with the pen , characters are recognized from an image of a region in a fixed range corresponding to coordinates of the touch position in the touch operation , and a keyword of a character string consisting of the recognized characters is extracted . in the enlargement operation , characters are recognized from an image of an enlarged region designated by the enlargement operation , and a keyword of a character string consisting of the recognized characters is extracted . the keyword extracted in accordance with the presenting side ( salesclerk ) operation region and the keyword extracted in accordance with the presented side ( client ) operation region are classified and stored in a keyword recording form fk having a client keyword region kc and a salesclerk keyword region ks respectively . therefore , information which drew attention in a presentation can be recorded in a form which can serve for making materials for a future presentation . regions corresponding to touch operation positions designated with a finger on the presentation screen 14 g may overlap with one another , or regions corresponding to touch operation positions designated with a pen likewise may overlap with one another . in this case , according to the keyword extraction function of the keyword extractor 10 having the aforementioned configuration , the region corresponding to the touch operation performed this time is added to the region corresponding to the touch operation performed last time so that a keyword consisting of characters recognized from an image of the operation region expanded thus can be extracted . therefore , it is possible to eliminate such a disadvantage that characters of one and the same keyword are recognized and extracted severally from an image of a portion where regions corresponding to a plurality of touch operations overlap with each other . in addition , in each of the embodiments , the extracted keywords are used for a new presentation material form . the invention is not limited thereto . when one is selected from the extracted keywords , a keyword in the presentation screen 14 g coincident with the selected keyword may be highlighted . in this case , a keyword extracted in response to a touch operation may be highlighted and displayed in another way than a keyword extracted in response to a pen operation . in this manner , keywords in which lots of clients are interested , keywords which have to be explained , etc . for a next presentation can be known so that the quality of the presentation can be improved . even when another salesclerk performs operation , the quality of presentation can be maintained . incidentally , in each of the embodiments , keywords are extracted from one presentation . the invention is not limited thereto . keywords which have been extracted a large number of times may be displayed in a list whenever presentation is made several times . in this case , keywords are extracted whenever a presentation is terminated . when there is a keyword coincident with one of the extracted keywords , a counter of the keyword is counted up . thus , keywords which has been extracted a larger number of times can be displayed . incidentally , each of the techniques of the respective processes performed by the keyword extractor 10 described in the aforementioned embodiments , that is , each of the techniques of the keyword extraction process shown in the flow charts of fig6 to 8 , the keyword recording shown in the flow chart of fig1 , the presentation material creation process shown in the flow chart of fig1 , etc . may be distributed as a program which is stored in a medium of an external storage device such as a memory card ( an rom card , an ram card , etc . ), a magnetic disk ( a floppy disk , a hard disk , etc . ), an optical disk ( a cd - rom , a dvd , etc . ), or a semiconductor memory so that the program can be executed by a computer . in a computer ( control device ) of an electronic instrument provided with a display device 12 , the program stored in the medium of the external storage device is read into a storage device so that operation of the electronic instrument can be controlled by the read program . in this manner , the keyword extraction function , the keyword recording function and the presentation material creation function in response to presentation operations described in the embodiments can be implemented so that the same processes based on the aforementioned techniques can be executed . incidentally , in the embodiments , keywords are extracted based on touched places . however , information to be extracted is not limited thereto . images may be extracted or data associated with the touched places may be extracted . in addition , data of the program for implementing each of the techniques may be transmitted as a form of program codes on a communication network . the data of the program can be imported into the computer ( control device ) of the electronic instrument provided with the display device 12 from a computer apparatus ( program server ) connected to the communication network and stored into the storage device so that the keyword extraction function , the keyword recording function and the presentation material creation function in response to presentation operations can be implemented . while the present invention has been shown and described with reference to certain exemplary embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims . it is aimed , therefore , to cover in the appended claim all such changes and modifications as fall within the true spirit and scope of the present invention .
| 6 |
referring to fig1 a , 2 represents an electrically - actuated hammer , which may be a conventional electric demolition hammer such as sold by milwaukee electric tools and others , and fitted with an impact rod 3 . different impact plates 4 and 4 a ( fig1 b and 1c ) may be applied for hard and soft surfaces respectively . the stroke rate of such a hammer may be varied substantially linearly by varying the supply voltage , over a range , for example , of 20 - 80 hz . the energy content of each impact does not depend on the input voltage , being typically about 20 j ( depending on the power of the hammer ). the voltage input to the hammer in line c is controlled by a controller 2 according to signals on line b from a computer 7 , the controller 1 receiving electrical power on a line from a generator 8 or other power source . the controller receives an enable signal on line d from a switch on the hammer 2 , after positioning of the hammer using a handle , to initiate an impact sequence and then controls the repetition frequency of the impacts by causing the control circuit to sweep the potential applied to the hammer on line c over a period equal to the length of the desired impact sequence , which should be at least 100 impacts and will typically contain 500 impacts or more . the hammer is coupled to the rock or other material to be investigated by pressing an impact plate against it through the rod 3 , and is readily moved to successive application points in that it is a hand - held tool . signals from the site being mapped are picked up by a receiver transducer 6 and passed on line f to the controller 1 whence they may be passed by a radio link g or a landline h to a receiver 6 ( see fig1 e ) which forwards the signals to a seismograph 10 including a computer which processes the signals and either displays and saves the processed signals or passes them to an optional processing computer 11 for display and storage . the computer 7 is optional and its functions in determining the impact sequence generated by the controller 1 may be built into the latter , with external controls provided for setting up a desired sequence . referring to fig2 the hammer unit of this embodiment is again based on a conventional electrical demolition hammer 20 , modified by substituting a spherically terminated impact rod 30 in place of the conventional chisel , the spherical termination being fitted with an impact plate 40 . this may have a plane sole as shown for engagement with hard surfaces , or protuberances as shown in fig1 c to improve engagement with soft surfaces . the presently preferred hammer is type us 427 / 1800 w manufactured by bosch , although other similar hammers may be used . the spherical termination allows the plate 40 to articulate so as to improve engagement with the surface of the test site , typically through about 35 degrees relative to the axis of the impact rod . depending on soil characteristics such as hardness and slope , the impact plate 40 may have different characteristics designed to obtain proper acoustic coupling to the surface , which coupling should be as tight as possible to prevent secondary shocks due to recoil of the hammer . for the same reason , a seating plate 43 may be used to secure the impact plate 40 to the rod 30 . modified articulated positioning systems , including weight compensation and / or recoil attenuation devices , can be used for applications requiring the shocks to be applied at an angle to the impact rod axis . further details of the impact plate and associated parts are shown in fig3 . the actuator of the hammer 20 is pressed into impact rod 30 , the spherical end of which is held in a socket of the impact plate 40 by the plate 43 secured by bolts 46 through a rubber washer 45 having a minimum hardness of 70 shore . a trigger device 50 is mounted into the impact plate 40 , through an elastic mounting designed to attenuate shocks transmitted from the plate during operation . the shock rate of the hammer 20 may be varied linearly , over a range of about 15 - 30 hz , by varying the supply voltage ; the available range may vary for different hammer types . the energy content of each impact does not depend on input voltage ; a typical hand held electric demolition hammer delivers about 20 j per impact . the generated frequency range extends well beyond 2 khz . referring to fig2 a controller 110 provides a controlled supply voltage to the hammer 20 on line d . the controller is powered via line a from a power generator 80 or alternative electric power source . an impact coding function is generated by a programmable computer 70 on line b and it is either used as such or it is stored in the memory of the controller 100 to be used later . using the computer 70 provides greater versatility because virtually any sweep function may be programmed whereas only linear saw - tooth functions are readily set up by the control panel , which allows for the selection of sweep time , voltage gain determining the ratio of minimum to maximum impact rate , and offset voltage determining the minimum impact rate . in either case the controller 110 must receive an enable signal from the operator of the hammer 20 to start the sweep . the operator positions the plate 40 against the surface of the test site and presses a switch 124 on a handle of the hammer which sends a signal on line e to the controller to initiate a sequence of impacts . according to the setting of the switch sw 1 , the controller generates the sequence either according to its own programming or programming received from computer 70 on line b in response to a signal transmitted on line c . the response of the site is sensed by a prepositioned chain of seismic signal receivers ( accelerometers , geophones or hydrophones ) r 1 , r 2 , . . . r n and transmitted to a seismograph 100 via a long geophysical cable l . recording of response signals is triggered by rectangular pulses generated by the controller 110 and fed to the seismograph 100 on line h . the trigger sensor 60 is a small piezoelectric sensor or geophone incorporated in the trigger device 50 , which sensor picks up mechanical shocks corresponding to the impacts for transmission to controller 110 on line f formed by an armored geophysical or coaxial cable . the controller 110 includes a trigger module ( see fig4 ), a firing module ( see fig5 ), and a power supply . referring to fig4 a differential input stage 111 receives the signal on line f from transducer 60 . this signal is fed after optional filtering and shaping by a low pass filter 112 and / or a schmitt trigger 113 to an optical isolation stage 114 . the differential input stage rejects common mode noise and permits input sensitivity to be adjusted to avoid clipping of the signal , yet provide adequate amplitude to be detected by the seismograph which receives the output of stage 114 on line h . the optical isolation protects the seismograph 100 from spikes and transients , while the filtering and shaping reject noise and convert the transducer output into a single rectangular pulse with a fast rising edge which provides a steady timing reference for recording signals from cable l . the rectangular trigger signals may alternatively be modulated and transmitted by a radio transmitter 115 to provide a radio link g ( see fig2 ) to the radio receiver 90 and thence the seismograph 100 . the transmitter may be incorporated in the controller 110 as shown or be a separate unit . in either case the seismograph is electrically isolated from the controller so as to reject spikes and noise present on the controller power supply and permitting the seismograph to be independently powered . the seismograph 100 processes the receiver signals on line l , and either displays or saves them , or passes them to an optional processing computer 130 for further processing and storage . referring to fig5 the switch sw 1 selects either a local signal from the controller or a remote signal from the programming computer 70 . in the first case a saw tooth generator 116 programmed on the controller panel is enabled on receipt of the signal from switch 124 , and the gain and offset of this signal are adjusted by amplifiers 118 and 119 . the generator 116 also generates an enable signal applied to the seismograph 100 throughout the sweep via an opto - isolator 117 . a remote signal from the computer 70 is amplified by a differential input amplifier 125 , filtered by a band - pass filter 126 to remove spikes and high frequency noise , and passed to switch sw 1 through an opto - isolator 123 . the signal selected by switch sw 1 is amplified by amplifier 121 and applied to a phase angle controller 122 , which modulates the supply potential of the power delivered to the hammer . the power supply provides power to the various circuits , and includes an isolated dc / dc converter to power those circuits in direct connection with the seismograph 100 or the computer 70 . in fig6 the electric demolition hammer is replaced by a piezo - electric hammer 208 , and the control unit 1 incorporates a generator 210 of high voltage ( e . g ., 8000 volt ) pulses connected to electrodes between piezo - electric elements 212 secured in a stack between loading blocks 214 and 216 . one of the loading blocks 214 is coupled to a casing 218 of the unit , and the other 210 is coupled to the walls of a borehole to be investigated either through perforations 222 in the wall of the casing , or by a known motor driven wedge system ( not shown ). this embodiment is suitable for use in boreholes , and the hammer may be moved through the borehole between successive locations , after releasing the wedge system , if necessary , by means of a cable attached to an eye 21 on the casing . in fig7 the electric demolition hammer of fig2 is replaced by a hammer formed by stack of piezoelectric transducer plates 140 secured between two loading blocks 150 and 160 . the loading block 150 is coupled to the casing 170 of the unit , while the loading block 160 is coupled to the wall of a borehole in which the unit is inserted by an axial to radial converter 180 . a trigger sensor and local preamplifier are associated with the hammer , conveniently in a housing 500 ( see fig8 ) connected above the hammer by a cable 400 and couplings 190 . the housing 500 also accommodates a pulse generating system described in more detail with reference to fig1 . a sequence of high voltage pulses ( up to 7 kv ) from this generator is applied in parallel to the plates of the stack so that the elongations of the plates produced by the pulses are summed to produce an axial elongation of the stack which is transmitted to the converter 180 and thence to the wall 310 of the borehole 320 . two forms of converter 180 are exemplified . in the embodiment of fig9 and 10 , the impacts are transmitted through a series of perforations in the converter casing , using water filling the borehole as a transmission medium , while in the embodiment of fig1 transmission is through a motor driven wedge system . in both cases the loading block 160 provides an inertial mass . the stack typically comprises at least 45 piezoelectric plates 140 clamped by a rod 141 between end blocks 142 , 143 and 144 within a tube 146 within the casing 170 . the rod 141 acts as a spring compressing the stack , which on receiving a pulse expands with a force equal to that developed by each plate in the stack , through a stroke equal to the sum of the expansions of the plates . the loading and damping provided by the loading block 150 and a damping element 147 are selected so that maximum displacement occurs downwardly ( as seen in the drawings ) and reflections in the opposing direction are largely absorbed by the element 147 . in the water coupled converter shown in fig8 and 10 , water is compressed between plates of a stack of alternating metal plates 181 and 182 ( see fig1 ), the plates 181 of which receive the impacts of the hammer through a rod 184 connected to the block 144 , while the plates 182 are stacked , through circular peripheral flanges forming a converter casing and defining openings 185 , on the loading block 160 . the impacts result in water trapped between facing surfaces 186 and 187 being ejected radially through the openings 185 and impacting on the wall 310 . the plates 181 are secured on the rod 184 between nuts 188 and collars 189 , while an extension of the rod through the loading block 160 supports the latter through an energy absorbing block 161 and washers 162 , the block in this example being of polyurethane with a shore hardness of at least 92 . a further block 163 of similar material is located between the topmost plate 182 and the block 144 . initial clearance between the surfaces 186 and 187 is typically in the range 1 . 35 - 2 . 2 mm for borehole diameters of 33 to 100 mm diameter , while the outer diameter of the converter 180 should be about 2 - 4 mm less than that of the borehole 320 . the length of the converter 180 should be about half the wavelength in the converter of the resonant frequency of the piezoelectric hammer , which may for example be about 2100 hz . this wavelength may be adjusted by suitably selecting the length of the collars 189 and the number of pairs of plates 181 and 182 , typically 10 - 15 . in the embodiment of fig1 , the converter is mechanical , energy developed by the hammer being transferred radially to the wall of the borehole through wedges 171 located in slots in an extension 172 of the casing 170 and engaging guide slots 173 in a coned surface of the block 144 . typically there are three wedges with 120 degree spacing . the piezoelectric hammer 150 is longitudinally movable within the casing 170 so as either to force the wedges against the wall 310 at a test site or to release them so that the apparatus may be moved longitudinally within the bore 320 . a geared motor 190 drives a nut 192 through a coupling 191 , the nut in turn driving a screw 193 supporting the hammer 150 within the casing . the motor is reversible and the current it draws is sensed so that when torque rises as the wedges engage the bore wall 310 or the screw is fully retracted , it shuts off . the controller 110 is functionally somewhat similar to that of fig2 but differs in its manner of controlling the repetition frequency of the hammer and delivering power to the latter , as shown in fig1 . in this embodiment the power supply voltage is constant . as well as driving the motor 190 through a motor driver 194 ( only for the embodiment of fig1 , in which it also provides a clamp - unclamp signal controlling the direction of the motor ), it charges a capacitor 195 through a rectifier 199 , preferably of the voltage doubler type , which capacitor is discharged at a repetition frequency which is programmed as previously described by closing an electronic switch 196 , typically a thyristor , and opening electronic switch 197 to isolate the supply . the capacitor discharges through the primary of a transformer 198 to generate a high voltage pulse across the transducers 140 . advantageously the discharge circuit is tuned to the resonant frequency ( e . g . about 2100 hz ) of the transducer stack to increase efficiency the switches 196 and 197 are controlled by a timer and logic circuit 189 which also generates trigger signals at each discharge for application to line h to control the seismograph 100 . utilization of such tools to provide sist data is discussed further below : r c ( t )= ψ ( t )* s ( t )+ n ( t ) ( 1 ) where ψ ( t ) is the controlled impact sequence , s ( t ) is the source signature , e ( t ) is the earth impulse response and n ( t ) is the noise . following park ( park et al , 1996 ), a “ normal ” seismic record can be obtained by cross - correlating the controlled impact sequence ψ ( t ) and the coded record r c ( t ): r d ( t )= ψ ( t ){ circle over (×)} r c ( t )= acf { ψ ( t )}* s ( t )+ ψ ( t )* n ( t ) ( 2 ) a key assumption in equation ( 2 ) is that the auto - correlation function acf { ψ ( t )}≅ 0 everywhere except at zero - lag . in practice , the degree of compliance with this condition will provide a way to evaluate the performance of various coding schemes . several time functions were studied and compared with the linear frequency scheme . in particular , an inversely linear frequency ( linear period ) was found to be effective . a 15 - 30 hz ., 30 s , 675 - pulses linear frequency sweep was tested . it was noticed during the study that with the linear - period scheme the band could be narrowed to 18 - 30 hz without an apparent loss of quality . this was done primarily for practical purposes , as a narrow bandwidth simplifies the mechanical construction of the source . in spite of the narrower band , the linear - period sweep led to a more effective cancellation of the correlation noise . a source signature with a frequency band of 800 - 1800 hz has been used with modeling , corresponding to the experimentally - determined spectrum of several small - scale sist sources . in theory , the high limit of the impact frequency band should be as low as possible , to reduce correlation noise . in practice , it turns out that there are considerable benefits in increasing the impact frequency as much as possible , up to 180 or even 200 hz . in borehole investigations , provided that the quality of the decoded signal does not decrease noticeably . two sweep ranges were tested , one of 18 - 30 hz and the other of 90 - 150 hz . the sweep duration of the former was 30 s , the latter only 6 s which , if signal quality can be maintained , represents a significant improvement of performance . since production of a tomographic section of a site being investigated requires thousands of measurements which have to be recorded , inspected for quality assurance , and decoded , the time needed for all these operations depends on the sweep length . in fact , the time - domain - signal decoded from the 6 s sweep looked as clean , or arguably cleaner , than the 30 s signal . the characteristics of the noise were the same in both cases . the sweeps were contaminated with 60 - 2000 hz uniform random noise and noise bursts with bands of 50 - 200 hz and 600 - 1350 hz . the random noise was twice the amplitude of the source signals . the burst amplitudes were 10 times higher and the mean rate is 6 / second and 10 / second , respectively . these noise levels , however extreme they may seem , represent realistic conditions , e . g ., in a production area of a mine . as in equation ( 2 ) ψ ( t )= 1 at the moments of impact and ψ ( t )= 0 at any other time , the cross - correlation can be replaced by summing to provide simple “ shift - and - stack ” averaging . for purely random noise , the s / n of the sum signal will decrease by the square root of the number of impacts . however , in real life , the straight sum may not be the most efficient way to increase the s / n ratio . as shown below , sist techniques based on more elaborate procedures than the shift - and - stack average , possess an even higher capability to suppress noise . three techniques were tested for processing the signals obtained : average , median and alpha - trimmed median . the noise was the same combination of uniform random and bursts as described above . the signal was initially invisible in the unprocessed signals . the time - domain signals obtained by all techniques for the power spectrum of the signal somewhat resembled that of the applied impact , with median techniques providing better results than simple averaging . investigations were carried out at the grimsel test site in switzerland to compare known techniques with those of the invention . the rocks at the grimsel test site ( gts ) are paleozoic granite and granodiorite that have been heavily deformed and altered during the alpine orogeny . consequently , the seismic transparency of the rock at gts is very low , corresponding to a q factor of 10 to 20 . earlier studies regarding the performance of various seismic sources suggested that a suitable combination of high frequency and high energy for mapping the site could be reached only by explosive sources . the fact that explosives are able to produce both high energy and frequency in a burst is because the high energy results from the high speed of the particles during the detonation rather than from the movement of a large mass . the low seismic transparency of the gts rocks was overcome by using the sist concept in accordance with the invention . measurements were performed in a rock block positioned between two gently down - going boreholes , 120 m apart , 150 m and 190 deep ( bous 85 . 003 and adus 96 . 001 ) and a tunnel wt , perpendicular to the boreholes . the measurements performed included tunnel - to - hole and crosshole measurements . the maximum source - receiver distance was around 200 m . a first measuring campaign was carried out with single - pulse sources . 30 - component accelerometers were clamped in one of the holes and the sources were fired in the other hole and in the tunnel . a piezo - electric and an electromechanical source , both single - pulse , were used . the conclusion from this campaign was that single - pulse sources are not suitable for high resolution surveys because , on one hand , increasing the source power to increase s / n ratio narrows the frequency band of the seismic pulse , and on the other hand , increasing the total energy by on - line stacking takes too long , for routine operations . a first attempt at using standard construction site equipment to build a sist source used a modified 1 kw electric hammer drill . a 20 - 80 hz impact frequency band was generated by varying the input voltage . it is important to note that the amplitude of the pulse does not depend on the input voltage and it was found that the impact frequency varied linearly with the voltage . these characteristics make electromechanical sources computer - controllable , by adjusting the voltage as a function of time . various impact frequency schemes can thus be generated . several models of surface and tunnel - wall electromechanical sist sources have been tested . a typical held - held 1 . 5 kw electric demolition hammer delivers 20 j per impact , at a mean impact rate of 25 / second . the energy delivered in a 20 s sweep is 10 kj , which compares with a midsize drop - weight . the signal frequency , though , goes well beyond 1 khz , while a drop weight of comparable energy , used in similar conditions , remains in the low hundreds of hz . gts tunnel - to - hole surveys carried out with a sist source as shown in fig1 applied to the tunnel wall and an array of down - the - hole accelerometers in the boreholes , produced spectra in which frequencies above 1 khz tend to be lost in steps , corresponding to zones of fractured and altered rock crossed by the seismic signal . however , frequencies of up to 2 khz can be observed all the way to a depth of 110 m , which corresponds to a source - receiver distance of approximately 140 m . the frequency content at the receiver end was higher than obtained , with single - pulse sources . it was also higher than reported by earlier seismic investigation programmes carried out at the same site ( bühnemann , 1998 ). piezo - electric sist sources ( see fig2 ) for investigation depths up to 1 km and for borehole diameters from 46 to 100 mm were built based on an existing single - pulse piezo - electric impact generator ( hammer ) model ph52 from vibrometric . the seismic signals are produced by applying controlled sequences of high voltage pulses to the stack of piezo - electric ceramic elements . the frequency band produced is 500 - 2500 hz and could be adjusted . the source is clamped to the borehole wall by a motor - driven wedge mechanism , or by coupling of the source through the borehole water , as shown in fig2 . this latter arrangement is preferred since the delays in operating the clamping mechanism otherwise severely limit the rate at which impact sequences can be performed , and discount the advantages of the invention . the technique of the invention proved capable of characterizing a rock mass at the test site , providing a level of detail necessary for the construction of tomographic images , despite the fact that fracturing and extensive lamprofyre dikes brought the average q - factor of the rock as low as 10 . the proof of the ability of high - resolution seismic techniques to detect and characterize rock discontinuities was made by characterizing a rock block delimited by two parallel , gently dipping boreholes and a tunnel perpendicular to them . the rockmass characterization included the determination of the 3 - d positions and orientations of rock features by multi - offset vsp and crosshole imaging and the tomographic mapping of seismic velocities . the structural model was constructed by joint analysis of reflection and transmission data . the main groups of reflectors were located and their existence and position confirmed in borehole and tunnel profiles . one of the main sets strikes roughly perpendicularly to the tunnel dipping approximately 60 °. this set is abundantly represented in the tunnel as lamprofyre dikes . another set dipping 60 ° strikes nearly parallel to the tunnel and consists of zones of dense fracturing . the presence of this set was confirmed by observations in the tunnel and boreholes . the third main orientation is semi - horizontal and was confirmed mainly by borehole observations . besides the reflectors following these main orientations , some isolated features were associated with a high - velocity feature found by tomographic analysis . in spite of the low q factor of the rock , the acquisition system including sist sources provided the level of detail needed for tomography and migration , while data of acceptable quality could not be obtained with single - pulse sources .
| 6 |
the present invention is directed to method and system for utilizing polarization reuse in wireless communications . although the invention is described with respect to specific embodiments , the principles of the invention , as defined by the claims appended herein , can obviously be applied beyond the embodiments of the description described specifically herein . moreover , certain details have been left out in order to not obscure the inventive aspects of the invention . the specific details not described in the present application are within the knowledge of a person of ordinary skill in the art . the drawings in the present application and their accompanying detailed description are directed to merely example embodiments of the invention . to maintain brevity , other embodiments of the invention that use the principles of the present invention are not specifically described in the present application and are not specifically illustrated by the present drawings . the word “ exemplary ” is used exclusively herein to mean “ serving as an example , instance , or illustration .” any embodiment described herein as “ exemplary ” is not necessarily to be construed as preferred or advantageous over other embodiments . [ 0014 ] fig1 illustrates an exemplary wireless communication system in accordance with one embodiment . exemplary wireless communication system 100 shown in fig1 can comprise , for example , part of a code division multiple access (“ cdma ”) communication system . alternatively , system 100 can be a frequency division multiple access (“ fdma ”) system , a time division multiple access (“ tdma ”) system , a wideband code division multiple access (“ wcdma ”), a high data rate (“ hdr ”) system , or in general any wireless communication system employing a combination of cdma , tdma , and / or fdma techniques . by way of a specific example , the present invention is discussed in relation to a cdma communication system . however , it is understood that the invention can be used in other communications systems as stated above . the general principles of cdma communication systems , and in particular the general principles for generation of spread spectrum signals for transmission over a communication channel is described in u . s . pat . no . 4 , 901 , 307 entitled “ spread spectrum multiple access communication system using satellite or terrestrial repeaters ” and assigned to the assignee of the present invention . the disclosure in that parent , i . e . u . s . pat . no . 4 , 901 , 307 , is hereby fully incorporated by reference into the present application . moreover , u . s . pat . no . 5 , 103 , 459 entitled “ system and method for generating signal waveforms in a cdma cellular telephone system ” and assigned to the assignee of the present invention , discloses principles related to pn spreading , walsh covering , and techniques to generate cdma spread spectrum communication signals . the disclosure in that patent , i . e . u . s . pat . no . 5 , 103 , 459 , is also hereby fully incorporated by reference into the present application . further , the present invention utilizes time multiplexing of data and various principles related to “ high data rate ” communication systems , and the present invention can be used in “ high data rate ” communication systems , such as that disclosed in u . s . patent application entitled “ method and apparatus for high rate packet data transmission ” ser . no . 08 / 963 , 386 filed on nov . 3 , 1997 , and assigned to the assignee of the present invention . the disclosure in that patent application is also hereby fully incorporated by reference into the present application . continuing with fig1 exemplary wireless communication system 100 , which can be a cdma communication system , comprises components typically found in wireless communication systems , including a wireless access terminal such as wireless modem 110 , base transceiver station (“ bts ”) 134 , base station controller (“ bsc ”) 136 , mobile switching center (“ msc ”) 138 , public switched telephone network (“ pstn ”) 140 , and internet service provider (“ isp ”) 142 . in wireless communication system 100 , bts 134 , which is also referred to as a “ base station ” in the present application , serves as a radio link between the wireless access terminal , e . g . wireless modem 110 , and the rest of the system . as illustrated in fig1 bts 134 comprises vertically polarized bts antenna 130 , which is configured to transmit and receive vertically polarized radio signals , and horizontally polarized bts antenna 132 , which is configured to transmit and receive horizontally polarized radio signals . by way of background , a vertically polarized antenna , such as vertically polarized bts antenna 130 , has an electric field perpendicular to the earth &# 39 ; s surface while a horizontally polarized antenna , such as horizontally polarized bts antenna 132 , has an electric field parallel to the earth &# 39 ; s surface . in a different embodiment , bts 134 can comprise a right hand circular polarized antenna and a left hand circular polarized antenna configured to transmit and receive circular polarized radio signals . by way of background , in a circular polarized antenna , the plane of polarization rotates in a circle , making one complete revolution during one period of the radio wave . if the rotation is clockwise looking in the direction of propagation , the sense is called right hand circular . if the rotation is counterclockwise , the sense is called left hand circular . referring back to fig1 connections between bts 134 , bsc 136 , msc 138 , pstn 140 , and isp 142 can be wired , wireless , or both . wireless modem 110 in fig1 includes , among other components which are not shown in fig1 central processing unit (“ cpu ”) 112 , read only memory module (“ rom ”) 114 , flash memory module 116 , random access memory module (“ ram ”) 118 , and transmitter and receiver 120 . as shown in fig1 bus 122 couples cpu 112 , rom 114 , flash memory module 116 , ram 118 , and transmitter and receiver 120 . in accordance with one embodiment , wireless modem 110 comprises vertically polarized modem antenna 124 and horizontally polarized modem antenna 126 . vertically polarized modem antenna 124 is configured to receive and transmit vertically polarized radio signals , and horizontally polarized modem antenna 126 is configured to receive and transmit horizontally polarized radio signals . in a different embodiment , wireless modem 110 can comprise a right hand circular polarized antenna and a left hand circular polarized antenna configured to receive and transmit circular polarized radio signals . it is noted that wireless modem 110 is also referred to as a “ polarized reception system ” in the present application . in accordance with the present embodiment , communication between wireless modem 110 and bts 134 is achieved by the transmission and reception of polarized radio signals . for example , bts 134 can communicate with wireless modem 110 by using vertically polarized bts antenna 130 to transmit vertically polarized radio signals that are received by vertically polarized modem antenna 124 . similarly , communication between wireless modem 110 and bts 134 could involve horizontally polarized bts antenna 132 transmitting a horizontally polarized radio signal that is received by horizontally polarized modem antenna 126 . continuing with fig1 pstn 140 refers to a conventional wireline telephone network , and isp 142 refers to services providing access to the internet . data and voice information provided by isp 142 and pstn 140 can be communicated to wireless modem 110 by being routed through msc 138 , bsc 136 , and bts 134 . msc 138 functions generally as a switch between the wireless network and pstn 140 and isp 142 , while the role of bsc 136 , among others , is to manage the signal transmission power of bts 134 . for example , internet data can be communicated to wireless modem 110 by being routed from isp 142 through msc 138 , bsc 136 , and to bts 134 in order for bts 134 to transmit the data to wireless modem 110 as radio frequency signals on both vertically polarized bts antenna 130 and horizontally polarized bts antenna 132 in a manner known in the art . bts 134 can , for example , transmit radio frequency signals as vertically polarized radio signals transmitted by vertically polarized bts antenna 130 that are generally received by vertically polarized modem antenna 124 . the radio frequency signals are demodulated by transmitter and receiver 120 and the information extracted at wireless modem 110 . communication between isp 142 and wireless modem 110 is thereby completed . thus , fig1 shows a block diagram of an exemplary wireless communication system in which communication between a base transceiver station and a wireless modem is accomplished by means of polarized radio signals . [ 0022 ] fig2 illustrates a two cell array in a wireless communication system in accordance with one embodiment . cell array 200 shown in fig2 comprises a geographical region in a wireless communication system , which can be , for example , a cdma communication system . cell array 200 comprises cell 210 and cell 240 which are defined by solid lines and shown as hexagons in fig2 . in the present embodiment , cell 210 is divided into six sectors , which are sector 214 , sector 216 , sector 218 , sector 220 , sector 222 , and sector 224 . sectors 214 , 216 , 218 , 220 , 222 , and 224 are defined by dashed lines in fig2 . similarly , cell 240 comprises six sectors , which are sectors 244 , 246 , 248 , 250 , 252 , and 254 which are also defined by dashed lines . it is noted that an article entitled “ smart antennas for broadband wireless access networks ,” authored by khurram sheikh , david gesbert , dhananjay gore , and arogyaswami paulraj , published in the november 1999 issue of ieee communications magazine , pages 100 through 105 , discusses vertically polarized and horizontally polarized signals in adjacent sectors of a cell . however , the article does not disclose or suggest how an access terminal may take advantage of such differently polarized signals in adjacent sectors . referring again to fig2 cell 210 of cell array 200 comprises base transceiver station (“ bts ”) 230 positioned at the center of cell 210 . in accordance with the present embodiment , bts 230 is equipped with vertically polarized bts antenna 232 and horizontally polarized bts antenna 234 . vertically polarized bts antenna 232 is configured to transmit and receive vertically polarized radio signals , and horizontally polarized bts antenna 234 is configured to transmit and receive horizontally polarized radio signals . utilizing vertically polarized bts antenna 232 and horizontally polarized bts antenna 234 , bts 230 can communicate with wireless access terminals in cell array 200 using polarized radio signals . wireless access terminals are not shown in fig2 but can be , for example , a wireless modem such as wireless modem 110 shown in fig1 . in accordance with one embodiment , bts 230 is a sectorized base transceiver station . bts 230 continuously broadcasts a pilot signal in each sector of cell 210 on the polarization designated for that particular sector . bts 230 utilizes vertically polarized bts antenna 232 to transmit vertically polarized pilot signals to sectors 216 , 220 and 224 and utilizes horizontally polarized bts antenna 234 to transmit horizontally polarized pilot signals to sectors 214 , 218 and 222 . by way of background , data from bts 230 is transmitted in frames where each data frame contains an initial pilot sequence as well as a subsequent message data sequence . as an example , the initial pilot sequence may take up approximately 5 % of the entire data frame . the pilot sequence is generally a known data sequence recognizable to a receiving wireless access terminal . a receiving wireless access terminal can use the data sequence contained in a pilot signal to identify the particular sector and base transceiver station transmitting the particular pilot signal . a wireless access terminal such as wireless modem 110 in fig1 equipped with both vertically and horizontally polarized antennas would have the capability to receive both vertically and horizontally polarized pilot signals transmitted by bts 230 . continuing with fig2 cell 240 is organized similarly to cell 210 . base transceiver station 260 (“ bts 260 ”) is situated at the center of cell 210 and comprises vertically polarized bts antenna 262 and horizontally polarized bts antenna 264 which are configured to transmit and receive , respectively , vertically and horizontally polarized radio signals . bts 260 is a sectorized base transceiver station which continuously broadcasts a pilot signal to each sector of cell 240 on the polarization assigned to that sector . bts 260 utilizes vertically polarized bts antenna 262 to transmit vertically polarized pilot signals to sectors 244 , 248 and 252 and utilizes horizontally polarized bts antenna 264 to transmit horizontally polarized pilot signals to sectors 246 , 250 and 254 . the pilot signals transmitted by bts 260 can be received by wireless access terminals in cell array 200 equipped with vertically and horizontally polarized antennas . a wireless access terminal can use , for example , the unique data sequence contained in the pilot signals it receives to identify a particular sector and base transceiver station transmitting a particular pilot signal . it is noted that even though cells 210 and 240 and their sectors have been shown in fig2 as discretely defined areas , a person skilled in the art would appreciate that the radio frequency coverage area for a cell or sector commonly overlaps into adjacent cells and / or sectors . therefore , a wireless access terminal , particularly one situated near the boundaries between adjacent cells and / or sectors , may receive signals from different cells and sectors . fig2 thus illustrates a two cell array in an exemplary communication system wherein base transceiver stations situated at the center of the cells are equipped with polarized antennas to transmit polarized pilot signals in each sector . in one embodiment , the pilot signals are received by wireless access terminals which utilize a unique data sequence contained in the pilot signals in order to identify the particular sector and base transceiver station transmitting the pilot signal . referring to fig3 flow chart 300 illustrates an example method for selecting a pilot signal having a highest signal to interference ratio in accordance with one embodiment . the signal to interference ratio is a quantification of the power of the desired signal to interference signals . the signal to interference ratio therefore indicates the signal quality of the received data signal . the process illustrated in flow chart 300 in fig3 describes the process as performed by a wireless access terminal in a wireless communication system , which can be , for example , a cdma communication system . for illustrative purposes , the process shown in flow chart 300 is described in the context of wireless modem 110 in fig1 and exemplary cell array 200 in fig2 . as such , it is manifest that the process illustrated in flow chart 300 can be practiced by an access terminal other than wireless modem 110 and in a wireless environment other than cell array 200 . flow chart 300 illustrates the process of selecting a pilot signal having a highest signal to interference ratio beginning at step 302 . the process continues at step 304 where a wireless access terminal using a vertically polarized antenna receives vertically polarized pilot signals transmitted by base transceiver stations situated throughout the wireless communication system . for example , wireless modem 110 can use vertically polarized modem antenna 124 to receive vertically polarized pilot signals transmitted by vertically polarized bts antenna 232 and vertically polarized bts antenna 262 . as discussed above , because signals in one sector or cell commonly overlap into nearby cells and sectors , vertically polarized modem antenna 124 may receive vertically polarized pilot signals transmitted throughout cell array 200 , i . e . vertically polarized pilot signals transmitted by both vertically polarized bts antenna 232 and vertically polarized bts antenna 262 . at the same time , vertically polarized modem antenna 124 may not receive all of the vertically polarized pilot signals transmitted by vertically polarized bts antenna 232 and vertically polarized bts antenna 262 , depending on , for example , the power of the transmission , as well as the distance and terrain between vertically polarized modem antenna 124 and vertically polarized bts antennas 232 and 262 . as is known in the art , radio signals lose their power over distance and can also be reflected by obstacles such as hills , buildings , and trees in their paths . thus , when the radio signals containing the pilot signals reach vertically polarized modem antenna 124 , some of the pilot signals may be too weak to be received . furthermore , because the various pilot signals travel different paths to reach wireless modem 110 , vertically polarized modem antenna 124 receives the various pilot signals at different reception power or signal to interference ratios . once the pilot signals are received by wireless modem 110 , they can be demodulated by a receiver module in transmitter and receiver 120 in order to extract the information in the pilot signals . the information signal can comprise , for example , a data sequence which identifies the base transceiver station and the sector transmitting the pilot signals . the steps involved in the demodulation of radio signals is generally known in the art . at step 306 , the vertically polarized pilot signals received by vertically polarized modem antenna 124 at wireless modem 110 are ranked by their signal to interference ratios . ranking of vertically polarized pilot signals by their signal to interference ratios involves measuring the signal quality of each pilot signal received , comparing the signal quality of the pilot signals to one another , and ordering the pilot signals by their signal to interference ratios . ranking of vertically polarized pilot signals by their signal to interference ratio can be performed , for example , by software running on cpu 112 . the ranking can be stored , for example , in flash memory 116 . continuing with flow chart 300 , at step 308 , wireless modem 110 switches from vertically polarized modem antenna 124 to horizontally polarized modem antenna 126 in order to receive horizontally polarized pilot signals . the horizontally polarized pilot signals are transmitted continuously by horizontally polarized bts antennas 234 and 264 in cell array 200 . and because radio signals can overlap into nearby cells and sectors , as discussed above , horizontally polarized modem antenna 126 may receive horizontally polarized pilot signals form throughout cell array 200 . the horizontally polarized pilot signals are received by horizontally polarized modem antenna 126 at different signal to interference ratios , depending on , for example , the distance and type of terrain between horizontally polarized modem antenna 126 and the horizontally polarized bts antennas transmitting the pilot signals . at step 310 , the horizontally polarized pilot signals received by horizontally polarized modem antenna 126 are ranked by their signal to interference ratios . as with ranking of vertically polarized pilot signals at step 306 , the ranking of horizontally polarized pilot signals can involve , for example , measuring the signal quality of each pilot signal , comparing the signal quality of the pilot signals , and ordering the pilot signals in sequence of their signal to interference ratios . ranking horizontally polarized pilot signals by their signal to interference ratio can be performed , for example , by software running on cpu 112 . the ranking can be stored , for example , in flash memory 116 . at step 312 , the ranking of vertically polarized pilot signals is compared to the ranking of horizontally polarized pilot signals . by comparing the two groups of rankings , the pilot signal having the highest signal to interference ratio overall can be selected . the signal to interference ratio for a pilot signal indicates the signal quality of the initial pilot sequence in a data frame as well as the signal quality of the message data sequence in the data frame received from the base transceiver station on the particular sector transmitting the pilot signal . the operation for selecting a pilot signal having the highest signal to interference ratio then ends at step 314 . after the pilot signal having the highest signal to interference ratio has been selected , wireless modem 110 uses the information contained in the pilot signal to identify and select the sector and base transceiver station transmitting the pilot signal . wireless modem 110 sends an identification signal (“ id signal ”) to the base transceiver station transmitting the pilot signal . the id signal can be , for example , an electronic serial number unique to wireless modem 110 which identifies wireless modem 110 to the base transceiver station . the id signal informs the particular base transceiver station that wireless modem 110 has selected to communicate with that station on the particular sector which wireless modem 110 has determined to have the highest signal quality . it is noted that the id signal is also referred to as a “ sector identification ” in the present application . communications between wireless modem 110 and the selected base transceiver station on the selected sector are then performed using the same polarization as the polarization of the pilot signal having the highest signal to interference ratio . thus , flow chart 300 in fig3 illustrates a process for selecting a pilot signal having the highest signal to interference ratio and communicating with the sector and base transceiver station transmitting the pilot signal having the highest signal to interference ratio so as to improve signal reception quality in accordance with one embodiment . the steps shown in flow chart 300 to receive and rank pilot signals , and thereafter communicate with a selected base station on a sector having the highest quality signal are repeated periodically , such as every few days . the reason is that due to terrain changes , for example changes in the configuration of obstacles such as buildings and trees in the signal path , it is necessary to periodically determine whether a different base transceiver station and / or a different sector should be used for communication with wireless modem 110 . it is noted that although the present example uses the signal to interference ratio as the signal quality measurement for ranking and selecting pilot signals , it is manifest that other signal quality measurements can be used . for example , a signal to noise ratio measurement can also be used . it is also noted that although the present application was discussed in relation to vertically polarized and horizontally polarized signals , the invention can also be used with right hand circular polarized and left hand circular polarized signals . in another embodiment which is not illustrated in any of the figures in the present application , a wireless access terminal , such as wireless modem 110 , utilizes the process set forth in fig3 to receive and select a polarized pilot signal having a highest signal to interference ratio . subsequently , the wireless access terminal communicates with a number of sectors corresponding to one or more base transceiver stations on the same polarization as the polarization of the pilot signal providing the highest signal to interference ratio . each of the sectors of the one or more base transceiver stations would be configured to transmit on the same polarization as the polarization of the pilot signal . for example , if the pilot signal having the highest signal to interference ratio is received on a vertically polarized antenna , the wireless access terminal would communicate with a number of “ vertically polarized sectors ” in one or more base transceiver stations by means of vertically polarized radio signals . in this embodiment , the vertically polarized signals from the base transceiver stations are received and then combined to generate diversity . in its various embodiments , the present invention is a system and method for “ polarization reuse .” as discussed in the present application , polarization reuse involves allocating orthogonal polarizations to adjacent sectors , rather than allocating different frequencies to adjacent sectors . using the polarization reuse system and method described above , interference between various sectors is reduced because their signals are polarized perpendicularly to one another . one advantage of polarization reuse described above is that it increases the overall system capacity without requiring the allocation of more frequencies . those of skill in the art would understand that information and signals may be represented using any of a variety of different technologies and techniques . for example , data , instructions , commands , information , signals , bits , symbols , and chips that may be referenced throughout the above description may be represented by voltages , currents , electromagnetic waves , magnetic fields or particles , optical fields or particles , or any combination thereof . those of skill would further appreciate that the various illustrative logical blocks , modules , circuits , and algorithm steps described in connection with the embodiments disclosed herein may be implemented as electronic hardware , computer software , or combinations of both . to clearly illustrate this interchangeability of hardware and software , various illustrative components , blocks , modules , circuits , and steps have been described above generally in terms of their functionality . whether such functionality is implemented as hardware or software depends upon the particular application and design constraints imposed on the overall system . skilled artisans may implement the described functionality in varying ways for each particular application , but such implementation decisions should not be interpreted as causing a departure from the scope of the present invention . the various illustrative logical blocks , modules , and circuits described in connection with the embodiments disclosed herein may be implemented or performed with a general purpose processor , a digital signal processor ( dsp ), an application specific integrated circuit ( asic ), a field programmable gate array ( fpga ) or other programmable logic device , discrete gate or transistor logic , discrete hardware components , or any combination thereof designed to perform the functions described herein . a general purpose processor may be a microprocessor , but in the alternative , the processor may be any conventional processor , controller , microcontroller , or state machine . a processor may also be implemented as a combination of computing devices , e . g ., a combination of a dsp and a microprocessor , a plurality of microprocessors , one or more microprocessors in conjunction with a dsp core , or any other such configuration . the steps of a method or algorithm described in connection with the embodiments disclosed herein may be embodied directly in hardware , in a software module executed by a processor , or in a combination of the two . a software module may reside in ram memory , flash memory , rom memory , eprom memory , eeprom memory , registers , hard disk , a removable disk , a cd - rom , or any other form of storage medium known in the art . an exemplary storage medium is coupled to the processor such that the processor can read information from , and write information to , the storage medium . in the alternative , the storage medium may be integral to the processor . the processor and the storage medium may reside in an application specific integrated circuit (“ asic ”). the asic may reside in a wireless modem . in the alternative , the processor and the storage medium may reside as discrete components in the wireless modem . the previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention . various modifications to these embodiments will be readily apparent to those skilled in the art , and the principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention . for example , in the embodiment of the invention described above , the access terminal , i . e . wireless modem 110 , has a single receiver . in this embodiment , a single receiver within transmitter and receiver module 120 must be switched between the different wireless modem antennas , such as vertically polarized antenna 124 and horizontally polarized antenna 126 , so that wireless modem 110 can receive and rank the highest signal to interference ratio as described above . in an alternative embodiment , the access terminal would have a dedicated receiver for each antenna . in that embodiment , the dedicated receivers are not switched between the various antennas of the access terminal . it is noted that in one embodiment , the polarization reuse technique of the present invention can be employed in addition to the conventional frequency reuse . it is also noted that the invention can be used in a mimo (“ multiple input multiple output ”) system where multiple transmit antennas and multiple receive antennas are used by the communication channel to carry multiple streams of user data . therefore , the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein . thus , method and system for utilizing polarization reuse in wireless communications have been described .
| 7 |
as used herein in the specification and claims , the terms &# 34 ; hydrogel &# 34 ; and &# 34 ; polymer hydrogel &# 34 ; are each intended to refer to a shaped hydrophilic polymer , e . g . a hydrophilic polymer lens , which contains imbibed water in an amount ranging generally from less than one percent to 90 percent by weight of the shaped polyer . however , it is well recognized that to be completely comfortable to the eye , soft contact lenses for practical application normally contain at least about 25 percent , preferably about 30 percent water , and still more preferably about 35 percent water , by weight . accordingly , polymer hydrogels employed herein in preferred embodiments of the process of this invention are those containing at least about 25 percent water , by weight . in general , any polymer hydrogel which contains a polar functional group capable of reacting with an appropriate functional group of the modifying compound as defined hereinafter may be successfully treated in accordance with this invention . however , the acrylic hydrogels which contain polar functional ester groups currently enjoy the most widespread commercial acceptance . accordingly , in the description of the invention which follows , specific reference will be made paticularly to acrylic ester hydrogels . the preparation of methanol - insoluble acrylic ester hydrophilic polymers by copolymerizing , for example , hydroxyethyl methacrylate and ethylene glycol dimethacrylate has long been known , being described in the aforementioned u . s . pat nos . 2 , 976 , 576 and 3 , 220 , 960 . the later patents directed to various modifications of the foregoing basic copolymers include among others , copolymers of the hydroxyalkyl methacrylates with vinyl pyrrolidone as described , for example , in a series of u . s . patents beginning with u . s . pat . no . 3 , 503 , 942 to seiderman . it is to be understood , however , that while many hydrophilic polymers adapted for the preparation of soft contact lenses contain suitable polar functional groups and thus may be successfully treated in accordance with this invention , neither said hydrophilic polymers per se nor their preparation and / or fabrication into lenses constitute a part of this invention . to effect the desired structural modification of the polymer hydrogel , a compound having at least one , and preferably two appropriate functional groups is employed . suitable such compounds include , for example , mono - and poly - ureas and their corresponding thiourea analogs , diepoxides , aldehydes and dialdehydes , aminoalcohols , aliphatic diols and dithiols , arylene mono - and dihalides , and aliphatic amines , as well as other functional compounds which will be easily recognized as suitable for use herein by those skilled in the art . in treating acrylic ester hydrogels , aminoalcohols as well as the amines are presently preferred because of the comparatively stable modifying linkages formed between polymer and amine functional groups . amines which are suitable may be either monoamines or polyamines wherein the organic moiety contains 2 - 12 carbon atoms . preferably , these compounds have no other functional group . particular polyamines suitable herein are those of the ethyleneamine series , e . g ., ethylenediamine , diethylenetriamine , tri - ethylenetetramine , tetraethylenepentamine or pentaethylenehexamine ; and commercially available higher homolors of the aforesaid ethyleneamines such as propylenediamine ( or 1 , 2 - tropanediamine ), 1 , 3 - diaminopropane , tetramethylenediamine , hexamethylenediamine and the like . because of its bifunctionality and comparatively high reactivity , ethylenediamine is presently preferred for use herein . for this reason and also for purposes of convenience , specific reference will be made hereinafter to ethylenediamine . such specific reference , however , is not to be construed in any way as limiting the invention to the use of only this particular amine . aminoalcohols which are suitable are monoamine derivatives of c 2 - c 6 aliphatic alcohols with boiling points above 100 ° c . specific aminoalcohol compounds are 2 - aminoethanol ; 3 - amino - 1 - propanol ; 4 - amino - 1 - butanol ; and 6 - amino - 1 - hexanol , with 2 - aminoethanol ( also designated as ethanolamine ) presently preferred . in general , from 0 . 001 to 0 . 5 weight percent of aminoalcohol will be incorporated in the process , by weight of the polymer . as described previously , the process of this invention comprises contacting a polymer hydrogel with any one of the aforesaid modifying compounds , e . g . an amine , for a sufficient period of time to effect the desired modification of the polymer . as indicated earlier , it is preferable to employ a hydrogel which contains at least about 25 percent water , by weight . it is nevertheless possible to effect the modifying treatment satisfactorily employing a hydrogel with a water content substantially less than 25 percent , by weight , i . e . about 10 percent , by weight . however , since the hydrogel inherently becomes significantly embrittled during treatment due to water loss , use of such a slightly hydrated polymer may not consistently provide a strong , coherent , uncrazed modified lens material . to carry out the process , the soft contact lens material is simply immersed and maintained in the selected compound at a temperature ranging generally from room temperature to about 100 ° c . for a time period ranging from about 5 minutes to about 3 hours . it is to be understood , of course , that for any particular modifying treatment , the most satisfactory reaction time generally will be inversely proportional to the temperature , i . e ., the time required to effect the desired degree of modification typically will be shorter as the reaction temperature is increased . particularly satisfactory results are obtained employing reaction temperatures of 40 ° - 70 ° c . for 1 - 3 hours . when using ethylenediamine , optimum results presently are obtained employing a temperature of 60 ° c . for a time period of about 2 hours . in preferred embodiments of this invention employing amines as modifiers , the proportion of amine used to polymer material is not especially critical . use of excessive amine is advantageous , however , to ensure the desired reaction in the shortest possible time . likewise , it is preferred to employ undiluted amine , although aqueous solutions which contain at least about 15 parts , by volume , of aine per part of water may optionally be used . while we do not wish to be bound by any particular theory , polymer modification presently is believed to be effected in the process of this invention by the attachment of functional groups supplied by the modifying compound onto the polymeric chains . in particular , when an acrylic ester hydrogel is treated with an amine under the prescribed reaction conditions , it is believed that preferentially an ester - amine interchange reaction occurs , forming covalent c - n linkages in the polymer structure . this belief is derived from studies of the treated polymers which indicate that the polymer has been modified permanently in the reaction , as through such stable linkages . modification alternatively through hydrogen bonding , on the other hand , would provide primarily unstable linkages and no permanent modification of the polymer . upon completion of the modification reaction herein , the treated polymer lens material is removed from the modifying compound , e . g . an amine , and rinsed well with water , one percent ( physiological ) saline solution or the like . it is then normally equilibrated for at least 12 hours in the saline solution ( ph - 7 . 4 ), whereupon the polymer material typically regains any flexibility lost during the modifying treatment . when employing amines as modifying chemicals , the equilibrated polymer finally is soaked in a suitable medium , e . g ., water or simulated human tear solution ( at physiological ph ), until no more detectable amine is leached therefrom . it can readily be understood that the aforesaid lens leaching process is necessary to remove therefrom any unreacted or residual amine which may be irritating or damaging to the eye . that the process of this invention does indeed modify the surface of the lens material is substantiated by leaching studies of polymer materials treated with radioactive amines , as shown hereinafter by specific examples . the improved ability of the modified polymer to inhibit the diffusion of e . g . proteins and bacteria compared to untreated lens materials likewise may be indicated by protein diffusion studies carried out by prolonged soaking of treated lenses in simulated human tear solution or other suitable media containing labeled enzymes and / or proteins . by significantly inhibiting the transmission of opacifying and / or discoloring substances into soft contact lens materials , the process of this invention provides lens products which are greatly improved over those presently available . the treated products of this invention remain clear , transparent , and optically beneficial to the wearer for a longer period of time than is possible with presently used lenses and , accordingly , need be replaced much less often . likewise , the modified lens products of this invention appear to retain water during use more efficiently than presently used lenses , thereby being extremely resistant to shrinkage or other dimensional change and providing optimum optical acuity to the wearer . for a fuller understanding of the nature and objects of this invention , the following specific examples are given . these examples are intended merely to illustrate the invention and are not to be construed in a limiting sense . all percentages , proportions and quantities given in these examples are by weight , unless otherwise indicated . an acrylic ester polymer hydrogel is prepared by first mixing together in 15 ml ethylene glycol as solvent , 15 ml of a monomer mixture containing , by weight , 95 % hydroxyethyl methacrylate ( hema ) and 5 % ethylene glycol dimethacrylate , with 0 . 05 ml of a 6 % aqueous solution of ammonium persulfate and 0 . 05 ml of a 12 % aqueous sodium meta - bisulfite . the resulting mixture is placed in a glass plate to a height of 0 . 009 cm . the plate is sealed with another plate and placed in a vacuum oven wherein copolymerization is conducted at approximately 70 ° c . for 12 hours . upon cooling , the resulting hema polymer film is removed , weighed and then soaked in physiological saline solution for 15 hours . reweighing of the surface - dried film determines that it has absorbed 36 . 0 % water , comparable to the percentage of water absorbed by a commercially available hema polymer soft contact lens similarly tested . radioactive ethylenediamine is prepared by dissolving 300μ ci 14 c - ethylenediamine in 50 ml of non - labeled ethylenediamine . the hema hydrogel lens material prepared in example 1 is cut into samples , 1 . 27 cm square , which are then immersed in 50 ml of the radioactive ethylenediamine solution for 2 hours at room temperature . the clear , transparent treated lens samples are removed and washed in distilled water for 30 minutes , after which they are equilibrated in 1 % saline solution for approximately 15 hours . comparatively brittle after the ethylenediamine treatment , the lens samples become flexible again upon equilibration . the equilibrated samples are placed in scintillation fluid for counting of labeled ethylenediamine . an average of 831 disintegrations per minute ( dpm ) corrected for background and quenching efficiency is obtained , indicating that some reaction has taken place and the diamine has been incorporated within the polymer . this example illustrates that diamine has been chemically bound in the polymer lens material by the process of the invention . a simulated human tear solution ( physiological ph ) is prepared with contains the following ingredients for each 100 ml of aqueous solution : the equilibrated lens samples are individually placed in separate vials each containing 2 . 5 ml of the tear solution . the vials are then positioned and maintained on a shaker apparatus in a water bath for 24 hours at 37 ° c . at the end of this time period , the lens samples are removed from the sample vials , and successively cleaned in commercial lens cleaning solution and sterilized with boiling in saline solution for 20 minutes in the manner normally performed daily by a contact lens wearer . some of these sterilized samples are placed in scintillation fluid and counted for labeled carbon content . the remaining sterilized lens samples are placed in fresh 2 . 5 ml portions of the tear solution and the aforedescribed storage procedure at 37 ° c . for 24 hours is repeated , followed by cleaning and sterilization of the lens samples and labeled carbon counts of some of these . this same procedure is carried out for at least 40 days , employing fresh tear solution in each leaching cycle , while cleaning and sterilizing the lens samples after each cycle . using this procedure , remaining 14 c - ethylenediamine in the lens samples is counted with the following results : table 1______________________________________no . of days in average . sup . 14 carbon counttear solution in lens sample ( dpm )* ______________________________________1 2252 1503 784 625 5410 5115 3720 3540 36______________________________________ * dpm = disintegrations per minute the above results indicate that a major portion of unreacted free diamine is removed from the lens samples with soaking in saline solution for up to 48 hours . thereafter , any remaining extractable amine is removed slowly by leaching the lens material over a period of 12 - 13 days . after a total of 15 days leaching , the average 14 c - ethylenediamine content of the lens samples is 35 dpm / lens , which count then remains constant with continued leaching for 24 additional days . this count represents the amount of diamine permanently bound in the lens material . a lightly cross - linked hydrophilic hema polymer is prepared in a series of experiments conducted as outlined generally in example 1 above . in these reactions , however , the monomer mixture used contains 15 ml of 99 % hydroxyethyl methacrylate and 1 . 5 ml of ethylene glycol dimethacrylate . the redox initiator requirement in each instance is supplied by 0 . 2 ml each of the ammonium persulfate and sodium metabisulfite solutions described in example 1 . each copolymerization reaction is conducted for 7 hours at 65 °- 75 ° c . after being successively dried for 2 hours at 45 ° c ., tared and then equilibrated in saline solution for 15 hours , the prepared hydrophilic polymer converts to a polymer hydrogel , absorbing 35 . 9 % water . a commercial soft contact lens ( soflens , a hema - type polymer lens manufactured by bausch and lomb , inc .) is similarly dried , tared and equilibrated in saline solution to determine the amount of water incorporated in the commercial soft contact lens . this lens material is found to absorb 37 . 3 % water , similar to the amount absorbed by the polymer hydrogel of this example . following the general procedures as outlined in example 2 above , samples of the hema polymer hydrogels of example 4 are immersed in the radioactive ethylenediamine solution for varying times at different temperatures . after treatment , 14 c - ethylenediamine counts are determined for samples of the treated lens materials after being equilibrated and boiled in saline solution for 2 hours . results obtained are as follows : table 2______________________________________ . sup . 14 c - amine treatment average . sup . 14 carbon counttemperature time ( min .) in lens sample ( dpm )* ______________________________________40 30 20 , 338 60 31 , 019 120 56 , 08260 30 40 , 810 60 52 , 316 120 70 , 76070 30 42 , 432 120 29 , 394______________________________________ * as described previously the treated lens samples are then subjected to extended leaching in simulated tear solution as described in example 3 . throughout the leaching period , aliquots of the tear solution are counted daily along with periodic counting of the lens material . after 15 days leaching , 14 c - ethylenediamine counts on the lens materials are as follows : table 3______________________________________ . sup . 14 c - amine treatment average . sup . 14 carbon counttemperature time ( min .) in leached lens sample ( dpm ) ______________________________________40 30 50 60 68 120 6860 30 88 60 71 120 15070 30 140 120 34______________________________________ the foregoing results indicate that the polymer truly becomes modified by the amine treatment , and further , that the greatest degree of modification appears effected with amine treatment at 60 ° c . for approximately 2 hours . an acrylic ester hydrogel lens material is cut into samples , 1 . 27 cm square . these are immersed for 3 hours in labeled 2 - aminoethanol ( ethanolamine ) maintained at 60 ° c . at the end of this time period , the films , which are somewhat brittle , are rinsed with distilled water and equilibrated in physiological saline solution for 4 hours . replicate equilibrated samples are placed in scintillation fluid for counting of the 14 c - ethanolamine . the average count obtained is 267 , 780 dpm corrected for background and quenching efficiency , employing counts of replicate untreated lens samples as controls . the remaining equilibrated lens specimens are individually placed in separate vials , each containing 2 . 5 ml . of the simulated tear solution described in example 3 . the vials are then positioned and maintained at 37 ° c . on a shaker apparatus in a water bath for 20 days . at the end of each 24 hour storage period , the samples are removed , boiled in saline solution , and placed in fresh tear solution . after 20 days leaching , the average 14 carbon count in the lens sample is 101 dpm , equivalent to 0 . 00095 weight percent of incorporated 2 - aminoethanol , by weight of the polymer . samples of acrylic ester hydrogel a ( containing 35 . 0 % water , by weight ) are immersed in separate containers which contain 50 ml . of 4 - amino - 1 - butanol or 6 - amino - 1 - hexanol . other hydrogel samples which have been heated at 60 ° c . for 40 minutes and contain less than 25 % water , by weight , ( hydrogel b ) are likewise immersed in separate containers of the specified aminoalcohols . all of the sample containers are then maintained at 60 ° c . for 120 minutes . after treatment , the lens samples are removed , washed in distilled water for 30 minutes , and then equilibrated by immersion in physiological saline solution for approximately 15 hours . they are then sterilized in boiling saline solution for 20 minutes . untreated lens samples are likewise sterilized as a control . the sterilized treated samples and the untreated controls are stored in fresh tear solution , being removed daily and successively cleaned in commercial lens cleaning solution and sterilized in boiling saline solution for 20 minutes in the manner normally performed by a contact lens wearer . after being thus leached for 25 days , the treated lens samples are immersed in labeled fluorescein dye for 2 minutes , then washed with distilled water , and finally placed in scintillation fluid and counted for labeled dye content , as a measure of dye absorption by the lenses . results are as follows : table 4______________________________________ labeled dye dpm . sup . 1modifying compound hydrogel a hydrogel b______________________________________untreated lens . sup . 2 2324 22854 - amino - 1 - butanol 1105 11156 - amino - 1 - hexanol 1099 1285______________________________________ . sup . 1 disintegrations per minute ( average of at least 3 replicate . sup . 2 untreated lens immersed in dye and counted after storage in saline solution for 24 hours the above results indicate that the aminoalcohols tested significantly modify the polymer structure of the lens materials and increase their resistance to the absorption of clouding and / or coloring substances , by comparison to the untreated lenses . also , the lens materials with a higher degree of hydration appear to be somewhat more efficiently modified in the treatment than those with the lower degree of hydration .
| 1 |
double bond - containing rubbers should , however , also be understood to mean rubbers which are m - rubbers in accordance with din / iso 1629 and , in addition to the saturated main chain , exhibit double bonds in side chains . these include , for example , epdm . crosslinked rubber particles ( b ), also called rubber gels or microgels , are described , for example , in u . s . ser . no . 5 , 124 , 408 , u . s . ser . no . 5 , 395 , 891 , de - a 19 726 729 and in the german patent application 19 701 487 . 9 . rubbers gels with functional groups with acidic hydrogen which react with alkoxysilanes or with isocyanates are preferred . preferred functional groups are hydroxyl groups , carboxyl groups , amino groups or amido groups . br —, nr —, nbr —, cr — and / or sbr - gels , which are optionally equipped with groups located on the surface of the gels and which are capable of reacting with the isocyanatosilanes , in particular , may be used . such groups are , for example , the above - mentioned functional groups . a rubber gel which is hydroxyl - modified may be used particularly advantageously , the acrylates and methacrylates of hydroxyethanol , hydroxypropanol and hydroxybutanol being used for the hydroxyl modification . the quantity of hydroxylation agent is 0 . 1 to 50 phr based on the unmodified rubber gel . 0 . 5 to 20 phr are particularly preferred . hydroxybutylacrylate in quantities of 0 . 5 to 20 phr is preferably used for the hydroxyl modification . the microgels have particle diameters of 5 to 1 , 000 nm , preferably 20 to 600 nm ( dvn value to din 53206 ). the diameters d 10 , d 50 and d 80 denote characteristic diameters in which 10 , 50 and 80 percent by weight of the respective sample have a diameter which is smaller than the corresponding characteristic diameter . owing to their crosslinking , the rubber gels are insoluble and can be swollen in suitable swelling agents such as toluene . the gel content of the rubber gels is ≧ 80 wt . % the swelling indices of the microgels ( si ) in toluene are 1 to 50 , preferably 1 to 20 . gel content and swelling index ( si ) of the rubber gels are determined by extracting the sample with toluene at ambient temperature . the gel content indicates the percentage by weight of the content which is deposited and can be separated in toluene with centrifugation at 20 , 000 rpm . the swelling index is calculated from the weight of the solvent - containing gel ( after centrifugation at 20 , 000 rpm ) and the weight of the dry gel : s i = weight of the sample swollen with toluene ( wet weight ) weight of the toluene - free sample ( dry weight ) 250 mg of gel are allowed to swell in 25 ml of toluene for 24 hours with shaking in order to determine the gel content and swelling index . the gel is centrifuged off and weighed and subsequently dried at 70 ° c . to constant weight and weighed again . the glass transition temperature ( tg ) of the rubber gels is between − 70 ° c . and + 10 ° c . it is determined by dsc ( differential scanning calorimetry ) ( for example pyris dsc - 7 calorimeter produced by perkin - elmer ). 11 . 6 + 0 . 3 mg of substance in normal capsules are used to determine tg . two heating operations of − 100 ° c . to + 150 ° c . in each case are carried out at a heating rate of 20 k / min and a cooling rate of 320 k / min while purging with nitrogen . the glass transition temperatures are determined during the second dsc heating operation . r 1 , r 2 and r 3 which may be the same or different represent alkoxy groups with 1 to 12 carbon atoms , preferably 1 to 8 carbon atoms and q represents a spacer group with structural elements based on aliphatic , heteroaliphatic , aromatic and heteroaromatic carbon chains . r 1 , r 2 and r 3 preferably represent methoxy , ethoxy , propoxy and butoxy groups and q preferably represents methyl , ethyl , propyl , butyl , pentyl and hexyl groups . this product is commercially available from witco , for example , under the name silquest ® a - 1310 silanes . the rubber mixtures according to the invention can also contain further components such as fillers . particularly suitable fillers for producing the rubber mixtures and vulcanisates according to the invention are : carbon blacks . the carbon blacks to be used in this case are produced by the lampblack , furnace or gas black processes and have bet surface areas of 20to 200 m 2 g , such as saf - isaf -, iisaf -, haf -, fef - or gpf - carbon blacks . highly dispersed silica , produced , for example , by precipitation of silicate solutions or flame hydrolysis of silicon halides with specific surface areas of 5 to 1 , 000 , preferably 20 to 400 m 2 / g ( bet surface area ) and primary particle sizes of 5 to 400 nm . the silicas can optionally also be mixed oxides with other metal oxides , such as al , mg , ca , ba , zn and ti oxides . synthetic silicates , such as aluminium silicate , alkaline earth silicate , such as magnesium silicate or calcium silicate with bet surface areas of 20 to 400 m 2 / g and primary particle diameters of 5 to 400 nm . thermoplastics with high melting point , such as trans - 1 , 4 - polybutadiene , syndiotactic 1 , 2 - polybutadiene , polybutylene and polyethylene terephthalate or syndiotactic polystyrene . thermoplastics with high glass transition temperature , such as polyamides , polyphenylene sulphide or polycarbonates . rubber gels based on cr , br , sbr or any other above - described gel particles which have a high degree of crosslinking and particle sizes of 5 to 1 , 000 nm . the above - mentioned fillers can be used alone or in a mixture . the quantity of fillers is normally 5 to 200 parts by weight , based on 100 parts by weight of rubber . in a particularly preferred embodiment of the process , 10 to 100 parts by weight of rubber gel ( b ) together with 0 . 1 to 100 parts by weight of carbon black and / or 0 . 1 to 100 parts by weight of light fillers , in each case based on 100 parts by weight of uncrosslinked rubber , are used . if a mixture of carbon black and light fillers is used the overall quantity is 100 parts by weight maximum . the rubber mixtures according to the invention can contain additional rubber auxiliary agents , such as crosslinking agents , reaction accelerators , antioxidants , heat stabilisers , light stabilisers , anti - ozonants , processing aids , plasticizers , tackifiers , blowing agents , dyes , pigments , wax , extenders , organic acids , retarders , metal oxides and filler activators , such as triethanolamine , polyethylene glycol , hexanetriol , bis -( triethoxysilylpropyl )- tetrasulphide or other auxiliary agents which are known in the rubber industry . the above - mentioned rubber auxiliary agents are used in conventional quantities which depend inter alia on the application . conventional quantities are , for example , quantities of 0 . 1 to 50 wt . %, based on quantities of rubber ( a ) used . crosslinking agents such as sulphur , sulphur donors , peroxides or crosslinking agents such as diisopropenylbenzene , divinylbenzene , divinylether , divinylsulphone , diallylphthalate , triallylcyanurate , triallylisocyanurate , 1 , 2 - polybutadiene , n , n ′- m - phenylene - maleimide and / or triallyltrimellitate can be used as additional auxiliary agents . the acrylates and methacrylates of polyhydric , preferably dihydric to tetrahydric c 2 to c 10 alcohols , such as ethylene glycol , propanediol - 1 , 2 - butanediol , hexanediol , polyethylene glycol with 2 to 20 , preferably 2 to 8 oxyethylene units , neopentylglycol , bisphenol a , glycerol , trimethylpropane , pentaerythritol , sorbitol with unsaturated polyesters of aliphatic di - and polyols and maleic acid , fumaric acid and / or itaconic acid are also considered . the quantity of crosslinking agent is generally 1 to 30 parts by weight , based on 100 parts by weight of the monomers . the rubber mixtures according to the invention can also contain vulcanisation accelerators . examples of suitable vulcanisation accelerators are , for example , mercaptobenzothiazoles , mercaptosulphenamides , guanidines , thiurams , dithiocarbamates , thioureas and thiocarbonates . the vulcanisation accelerators , crosslinking agents or additional crosslinking agents , such as dimeric 2 , 4 - toluylidene - di - isocyanate (= demodur tt ) or 1 , 4 - bis -( 2 - hydroxyethoxy ) benzene (= crosslinking agent 30 / 10 from rheinchemie ) are used in quantities of approximately 0 . 1 to 40 percent by weight , preferably 0 . 1 to 10 percent by weight , based on the total quantity of rubber . the rubber mixtures according to the invention can be vulcanised at temperatures of 100 to 250 ° c ., preferably 130 to 180 ° c ., optionally under pressure of 10 to 200 bar . the mixtures according to the invention can be produced in various ways . on the one hand it is of course possible to mix the solid individual components . mixing units suitable for this purpose are , for example , rollers , closed mixers or mixing extruders . mixing by combining the latices of the uncrosslinked or of the crosslinked rubbers is , however , also possible . the mixture according to the invention produced in this way can be isolated in a conventional manner by evaporation , precipitation or freezing coagulation ( cf . u . s . ser . no . 2 , 187 , 146 ). by mixing fillers into the latex mixture and subsequent working up , the mixtures according to the invention can be obtained directly as rubber / filler formulation . further mixing components are added to the rubber mixture consisting of double bond - containing rubber ( a ), rubber gel ( b ) and isocyanatosilane ( c ), such as additional fillers and optionally rubber auxiliary agents in conventional mixing units , rollers , closed mixers or mixing extruders . the mixing temperatures are approximately 50 to 180 ° c . the rubber mixtures according to the invention are suitable for producing vulcanised moulded articles , for example for producing cable sheaths , hoses , driving belts , conveyor belts , roller coverings , shoe soles , ring seals , cushioning elements or diaphragms and for various tire components , such as tire treads , sub - tread mixtures , carcasses or side wall inserts for tires with emergency running properties . gel 2 : production is as described in german patent application no . 19919459 . 9 , gel name i , wherein 1 . 5 phr dicumylperoxide is used for crosslinking ( see 1a ) “ crosslinking of the rubbers present in latex form ”). grafting with hydroxyethylmethacrylate is as described in 1b ) “ grafting of the rubbers present in latex form ”. stabilisation and working up of the hydroxyl - modified microgel is as described under item 1c ) “ stabilisation and working up of the hydroxyl - modified microgels ”. gel 3 : polymerisation of the br starting latex is as described in u . s . pat . no . 5 , 395 , 891 . crosslinking with dcp , grafting with hema and working up are described in the above - mentioned german application . gel 4 : gel 4 is produced in a similar way to gel 3 , hydroxybutylacrylate ( hba ) being used for the hydroxyl modification instead of hydroxyethylmethacrylate ( hema ). the effect according to the invention in an unmodified br gel ( gel 1 ) and in a hema - modified sbr rubber gel ( gel 2 ) is demonstrated in the first mixing run : for this purpose , the mixing components are mixed on the roller in the specified sequence and in accordance with the following formulations : the vulcanisation behaviour of the mixtures is investigated in the rheometer at 160 ° c . to din 53 529 . in this way characteristic data such as f a , f max , f max . − f a ., t 10 , t 80 and t 90 is determined : result : it is shown in the first mixing run that an improvement in the mechanical properties ( s 300 × d ) is achieved owing to the use of γ - isocyanatopropyltriethoxysilane both in a non - hydroxyl - modified br gel ( gel 1 ) and in a hydroxyl - modified sbr gel ( gel 2 ). the effect according to the invention in two hydroxyl group - containing br rubber gels is demonstrated in the second mixing run , gel 3 being modified with hema and gel 4 with hba . for this purpose , the mixing components are mixed on the roller in the specified sequence and in accordance with the following formulations : the vulcanisation behaviour of the mixtures is investigated in the rheometer at 160 ° c . characteristic data such as f min , f max . − f min ., t 10 , t 80 and t 90 is determined in this way : the improvement in the mechanical properties ( s 300 × d ) owing to the use of γ - isocyanatopropyltriethoxysilane with two hydroxyl group - containing br rubber gels is demonstrated in the second mixing run , greater effects being achieved with the hydroxybutylacrylate -( hba )- modified br gel 4 than with the hydroxyethylmethacrylate -( hema )- modified br gel 3 .
| 2 |
certain preferred embodiments of the present invention will be described below in greater detail with reference to the accompanying drawings . in this embodiment , foundation fabrics may be formed by weaving , however , they may be formed by knitting instead of weaving . fig1 illustrates a portion of a double cloth composed of a first foundation fabric 10 and a second foundation fabric 20 , partly omitted , each of which forms one part of the present invention . the illustrated double cloth is a narrow tape - like woven fabric woven on a needle loom having a small width . the first and second foundation fabrics 10 and 20 each have a weft thread 14 , 24 laid in double picks in such a manner as to form a two - ply thread . the first foundation fabric 10 is a part which corresponds to a conventional surface - type fastener having female interlocking elements . in the illustrated embodiment , the first foundation fabric 10 has a plurality of pile threads 11 composed of multifilaments and forming a number of female or looped interlocking elements 13 on a front surface of the first foundation fabric 10 . each of the pile threads 11 extends over two adjacent foundation warp threads 12 to form a raised loop , then is interwoven with the weft threads 14 , subsequently extends again over the same two foundation warp threads 12 to form a next raised loop , and thereafter repeats the foregoing weaving pattern with the result that a large number of raised female or looped interlocking elements 13 arranged in rows and tiers at predetermined intervals or pitches are formed . although the first foundation fabric 10 has a base woven structure composed of a plain weave , two adjacent warp threads 12a laid next to eight consecutive foundation warp threads 12 are so woven as to form a leno fabric . in general , the warp threads 12 and the weft threads 14 are composed of multifilaments , however , either or both of these threads 12 , 14 may be composed of monofilaments . the monofilaments and the multifilaments are composed of a filament formed by spinning from a synthetic resin material such as polyester , polyamide , polyacryl or polypropylene . fibrous materials eligible for the foundation fabrics may include a variety of semisynthetic or natural fibers other than the synthetic resin materials specified above . the second foundation fabric 20 is woven integrally with the first foundation fabric 10 by means of a plurality of connecting threads 21 . although the base woven structure of the second foundation fabric 20 is a plain weave , a warp thread laid next to twelve consecutive foundation warp threads 22 is used as one of the connecting threads 21 . as shown in fig1 and 2 , the connecting threads 21 are also interwoven in the first foundation fabric 10 simultaneously with weaving of the first foundation fabric 10 , so that the first and second foundation fabrics 10 , 20 are integrally connected by the connecting threads 21 . the connecting threads 21 and the foundation warp threads 22 of the second foundation fabric 20 are both composed of multifilaments , however , a variety of spun yarns and monofilaments may be used according to the usage of the surface - type fastener . in the illustrated embodiment , the weft threads 24 of the second foundation fabric 20 are composed of monofilaments made from any one of the materials specified above , for the purpose of not only stabilizing the form and configuration of a final product , but also facilitating roll - up operation of an elongated continuous surface - type fastener , thus insuring the stability in shape and configuration of the final product during storage . in general , the second foundation fabric 20 of the foregoing construction is so designed as to have a weaving density lower or coarser than that of the first foundation fabric 10 , and the connecting threads 21 and the warp threads 22 used therein are each composed of a thread having a larger count of yarn than the warp threads 12 of the first foundation fabric 10 . the weaving density and the yarn count value may obviously be varied according to the usage of the surface - type fastener . however , in consideration of the permeability of synthetic resin described later , an extremely high weaving density is not preferable . the connecting threads 21 and the warp threads 22 may be composed of monofilaments or yarns made from any one of the synthetic resin fibers , semisynthetic fibers and natural fibers described above . fig3 illustrates another structural example of the foundation fabric 10 having on its front surface a number of male interlocking elements 15 each provided on its upper end with a hook 15a . the interlocking elements 15 are composed of monofilaments made from a synthetic resin material , such as polyester , polyamide , polyacryl or polypropylene , which is the same as the monofilament used in the first foundation fabric 10 described above . according to the woven structure of the first foundation fabric 10 shown in fig3 the male interlocking elements 15 are formed in such a manner that the monofilaments are interwoven in the first foundation fabric 10 so as to form a pile having a mass of raised uncut loops on the first foundation fabric 10 in the same manner as the female interlocking elements 13 of fig2 and subsequently the loops on the pile are cut at one side to form hooks 15a in the usual manner using a known comb - like cutting tool . the shape of a top end of the male interlocking elements 15 should by no means be limited to the hooks 15a described above . alternatively , it is possible to cut away or remove a round head portion of each loop on the first foundation pile fabric 10 , and subsequently a cut end of the loop is shaped into a radially outwardly swelled mushroom - like head 15b such as shown in fig4 either by forcing the cut end of the loop against a hot plate having a number of hemispherical recesses or by bringing a heat source close to the cut end of the loop . the double cloth which is composed of the aforesaid first and second woven foundation fabrics 10 and 20 integrally connected together by the connecting threads 21 is then impregnated with a synthetic resin . the impregnating synthetic resin should preferably be a material having a good adhesive property relative to the first and second foundation fabrics 10 , 20 . eligible materials for the impregnating synthetic resin may include polyester resin , polyamide resin , polyacryl resin , polyurethane resin , and various synthetic rubbers . to achieve the impregnation , the second foundation fabric 20 is coated on its back surface with a solvent solution of any one of the synthetic resin specified above or a melt of the synthetic resin of the same synthetic resin , which has been added with an extender , a surface - active agent , a curing agent and the like . then , a pressure is applied from a suitable means to the coated back surface of the second foundation fabric 20 whereupon the synthetic resin solution or melt is forced to flow successively into the second foundation fabric 20 and the first foundation fabric 10 until the first and second foundation fabrics 10 , 20 are fully impregnated with the synthetic resin . the thus impregnated first and second foundation fabrics 10 , 20 are then heated to cure the impregnating synthetic resin . in this instance , since the second foundation fabric 20 has a lower weaving density than the first foundation fabric 10 and hence has a sufficient degree of permeability of synthetic resin , the impregnating synthetic resin is readily able to reach the inside of the first foundation fabric 10 in a short time . fig2 - 4 show in cross section typical different examples of the surface - type fastener having a thick foundation fabric produced according to the present invention . as shown in these figures , there is a synthetic resin layer 30 which is interposed between the first and second foundation fabrics 10 and 20 and which fills up the inside of the first and second foundation fabrics 10 , 20 . thus , and first and second foundation fabrics 10 , 20 and the synthetic resin layer 30 are firmly united together . the thickness of a portion of the synthetic layer 30 lying between the first and second foundation fabrics 10 and 20 can be determined by adjusting the distance between respective joined portions of the first and second foundation fabrics 10 , 20 which are interconnected by the connecting threads 21 when the double cloth is woven . as will be understood from fig3 and 4 , the stiffness of the first foundation fabric 10 can be varied by changing the thickness or diameter of the connecting threads 21 . in the illustrated embodiments , the front surface of the surface - type fastener is provided with a number of raised interlocking elements 13 , 15 having the same shape and configuration . however , it is also possible according to the present invention to arrange the female interlocking elements 13 and the male interlocking elements 15 in combination on the front surface of a single surface - type fastener . to this end , during weaving of a double cloth , a plurality of pile threads 11 ( fig2 ) composed of multifilaments for forming female or looped interlocking elements 13 and a plurality of monofilaments 16 ( fig3 ) for forming male interlocking elements 15 are arranged alternately in the widthwise direction of the double cloth being woven . after the weaving , loops of the monofilaments 16 projecting from the first foundation fabric 10 are cut at one side to form hooks 15a ( fig3 ). as an alternative , the pile threads 11 composed of the multifilaments described above and the monofilaments 16 for forming the male interlocking elements may be arranged alternately and interwoven in the first foundation fabric 10 to form a double cloth ( surface - type fastener ) in such a manner that a portion of the surface - type fastener extending over a predetermined length of the surface - type fastener is provided solely with loops of the pile threads 11 , and an adjacent portion of the surface - type fastener extending over the predetermined length of the surface - type fastener is provided solely with loops of the monofilaments 16 which are subsequently cut to form hooks . the thus formed surface - type fastener has areas of female interlocking elements and areas of male interlocking elements arranged alternately in the lengthwise direction of the surface - type fastener and each having the predetermined length . fig5 exemplifies a binding device 40 which includes a female surface - type fastener 41 having female interlocking elements 13 of the present invention used in combination with a male surface - type fastener 42 having male interlocking elements 15 of the present invention . one end of the female surface - type fastener 41 having a predetermined length is threaded through a ring member 43 of metal or synthetic resin , then folded back , and finally attached to the female surface - type fastener body by means of a fastening device 44 . the opposite end of the female surface - type fastener 41 is held in abutment with one end of the male surface - type fastener 42 and firmly attached to the latter by means of a similar fastening device 44 , so that the binding device 40 is formed . when the binding device 40 is used for binding a plurality of articles , the binding device 40 is first wound around the articles with the female and male interlocking elements 13 and 15 faced outwardly , and then the free end of the male surface - type fastener 42 is threaded through the ring member 43 to tightly bind the articles . the free end of the male surface - type fastener 42 is subsequently turned or folded back about a portion of the ring member 43 , and finally pressed against the female surface - type fastener 41 so that the male interlocking elements 15 on the free end of the male surface - type fastener 42 are engaged with the female interlocking elements 13 on a portion of the female surface - type fastener 41 . in the embodiment shown in fig5 the female surface - type fastener 41 and the male surface - type fastener 42 are connected end to end by the fastening device 44 . however , the fastening device 44 used for connecting the female and male surface - type fasteners 41 and 42 can be omitted when the female and male interlocking elements 13 , 15 are formed in combination on one surface of a single woven surface - type fastener , or when a female surface - type fastener 41 and a male surface - type fastener 42 are continuously woven one after another . thus , the binding device 40 can be produced using a single surface - type fastener . it is apparent from the foregoing description that the surface - type fastener of this invention includes a first foundation fabric 10 having on its front surface a number of raised interlocking elements 13 , 15 , and a second foundation fabric 20 integrally woven or knitted with the first foundation fabric by means of connecting threads 21 . the first and second foundation fabrics 10 , 20 are impregnated with a synthetic resin so that confronting inside surfaces of the first and second foundation fabrics 10 , 20 are firmly connected together . with this construction , the surface - type fastener excels in productivity and is able to prevent the first and second foundation fabrics 10 , 20 from separating under severe conditions of use . furthermore , by using a first foundation fabric 10 having a woven or knitted structure similar to that of the conventional surface - type fastener , and by properly selecting the count of yarn for the threads forming the second foundation fabric 20 , a surface - type fastener having a desired thickness can be produced without affecting the bonding strength between , and the stability in shape and configuration of , the first and second foundation fabrics 10 , 20 . in the case where weft threads 24 of the second foundation fabric are composed of monofilaments , a final product ( surface - type fastener ) can be readily rolled up on a reel and hence is convenient for storage . since the second foundation fabric 20 is coarser in weaving or knitting density than the first foundation fabric 10 , the impregnating synthetic resin can readily penetrate the second foundation fabric 20 and subsequently flows into the first foundation fabric 20 . the first foundation fabric 20 can , therefore , be fully impregnated with the synthetic resin . furthermore , the first and second foundation fabrics 10 . 20 woven or knitted integrally can be readily matched with each other in terms of the dimensions and color , making it possible to obviate the need for a complicated inventory management . obviously , various minor changes and modifications of the present invention are possible in the light of the above teaching . it is therefore to be understood that within the scope of the appended claims the invention may be practiced otherwise than as specifically described .
| 8 |
preferred embodiments will be described in detail with reference to the accompanying drawings . to simplify the description , the same elements have been given the same reference numerals throughout the figures . fig1 is a cross - sectional side view of a first embodiment of a projection television according to the present invention . referring to fig1 an upper casing 2 is mounted on a fixed lower casing 11 . the casing 2 is securely connected to the shaft 3 so that when the shaft is rotated , the tiltable casing 2 is tilted . the casing 2 can be rotated about a shaft 3 that extends horizontally and parallel with a screen 4 fixed to the upper casing 2 . the upper casing 2 may be driven to tilt relative to the lower casing 11 by an appropriate drive mechanism 14 that incorporates a power source , for example , a motor . the drive power is transmitted through a gear train , not shown , from the motor 14 to the shaft 3 . for precise , smooth tilting of the casing 2 , the gear train is required to have as large a reduction ratio as possible . in particular , the final gear should have a large reduction ratio . a chain - drive type transmission mechanism having a chain and a sprocket wheel may be used in place of the gear train . still alternatively , the casing 2 may be driven manually through an appropriate mechanism . a reflecting mirror 5 is disposed behind the screen 4 in the upper casing 2 , and a projector 6 disposed at a lower part in the casing 2 . a circuit 7 is disposed in the lower casing 11 and supplies image signals to the projector 6 . the circuit 7 is located at a place where the circuit 7 does not interfere with the upper casing 2 when the upper casing 2 is rotated about the shaft 3 . for example , the projection television has a screen 4 having an axis of image 9 such that when a viewer 8 stands in front of the screen 4 , the line of sight of the viewer 8 is in line with the axis of image 9 . in this specification , the axis of image 9 is used to cover an axis that is normal to the screen 4 and passes through the center of the screen 4 . when the upper casing 2 is at the dotted line position , the screen 4 is vertical and substantially in the same plane as the front of the lower casing 11 , and the axis of image 9 extends horizontally . when the viewer 8 views the image sitting on a chair , the upper casing 2 can be rotated about the shaft 3 by a predetermined angle θ to incline downward to the solid line position . consequently , the axis of image 9 is tilted downward by the angle θ , so that the line of sight of the viewer sitting on the chair coincides with the axis of image 9 . this ensures that the viewer 8 views the projected image having a maximum luminance . the aforementioned tiltable casing 2 allows the viewer to view images having a maximum luminance even if the eyes of the viewer are not exactly on the axis of image 9 . the first embodiment has been described with respect to a projection television in which the projector 6 and the electrical circuit 7 are separate components . however , the invention is also applicable to an apparatus such as a crt video projector , a liquid crystal video projector , a dlp projector , and a slide projector in which the projector 6 and the electrical circuit 7 are integrated in a single assembly . fig2 is a cross - sectional side view of a second embodiment , illustrating the positional relationship among the projector and the surroundings . referring to fig2 the screen 4 and reflecting mirror 5 are housed in a casing 2 a and the projector 6 is housed in a casing 2 b . the casings 2 a and 2 b are separate casings but are pivotal about the shafts 3 laterally projecting from the reflecting mirror 5 . the casings 2 a and 2 b are pivoted drivingly in opposite directions to each other . the casings 2 a and 2 b may be driven to tilt by an appropriate drive mechanism 14 incorporating a power source , for example , a motor . the drive power is transmitted in a similar manner to the first embodiment . alternatively , the casings 2 a and 2 b may be manually driven to tilt . when the screen 4 and the projector 6 are at their dotted line positions and the viewer &# 39 ; s eyes are below the axis 9 a , then the casings 2 a and 2 b are tilted toward each together by an angle θ so that the casings 2 a and 2 b are at the solid line positions and the viewer &# 39 ; s eyes are on the axis of image 9 b . when the screen 4 and the projector 6 are at their solid line positions and the viewer &# 39 ; s eyes are above the axis 9 b , then the casings 2 a and 2 b are tilted away from each together by an angle θ so that the casings 2 a and 2 b are at the solid line positions and the viewer &# 39 ; s eyes are on the axis of image 9 a . fig3 a is a sectional side view of a third embodiment , showing the positional relationship among the projector and the surroundings . the screen 4 and the reflecting mirror 5 are tiltable while the projector 6 is fixed . the screen 4 and reflecting mirror are drivingly tilted by the drive mechanism 14 shown in fig3 b . alternatively , the casing 2 a and 2 b may be manually driven to tilt . the screen 4 is rotated by an angle θ about the shaft 3 and the reflecting mirror 5 is rotated by an angle θ / 2 about the shaft 3 in the same direction as the screen 4 . consequently , the direction of the axis of image 9 is tilted in a vertical plane by the angle θ . in order to prevent the images on the screen 4 from being disturbed , the reflecting mirror 5 and the screen 4 have to be tilted simultaneously , i . e ., the reflecting mirror 5 is tilted at an angular speed half that of the screen 4 . a fourth embodiment is a modification of the first embodiment . the fourth embodiment is characterized in that the casing can be rotated so that the axis of image 9 is tiltable not only in the vertical plane but also in the horizontal plane . fig4 a is a top view of a projection television according to the fourth embodiment . fig4 b is a perspective view of a projection television according to the fourth embodiment . referring to fig4 a and 4b , the casing 12 is mounted on a casing 12 a . the casing 12 a is mounted in the stationary lower casing and can be swiveled about a shaft 13 in horizontal directions shown by arrows c and d . other structural elements such as the projector 6 are fixedly disposed in the casing 12 . the casing 12 can be driven to swivel in the horizontal plane by a drive mechanism . the screen 4 , the reflecting mirror 5 , and projector 6 are fixedly disposed in the casing 12 as in the first embodiment . by controllably driving the casing 12 a to swivel , the casing 12 a can be swiveled by a predetermined angle θ about the rotation axis 13 . rotating the casing 12 in a horizontal plane enables the viewer to view the image with a maximum possible luminance even when the viewer is not exactly in front of the projection television but on the right or left side of the television , toward the front . the fourth embodiment allows the axis of image 9 to be varied both in the vertical direction and in the horizontal direction . therefore , the screen can be oriented so that the viewer who is not directly in front of the projection television can view the image with a maximum luminance . the fourth embodiment may also be applicable to the second and third embodiments if the screen 4 , the reflecting mirror 5 , and projector 6 are mounted on a single casing that can be horizontally swiveled . fig5 illustrates an apparatus according to a fifth embodiment . referring to fig5 the projection television incorporates a receiver 16 that receives controlling signals from a wireless remote controller 15 . the receiver 16 converts the controlling signals into drive signals that drive the motor 14 , thereby controlling the orientation of the projection television . the use of the remote controller 15 enables the viewer to adjust the orientation of the projection television in the vertical direction from a place remote from the projection television , so that the viewer can view the image having a maximum luminance . a sixth embodiment is directed to the construction in which heat radiated by or voice uttered by the viewer is detected to find where the viewer is relative to the projection television , and the screen is oriented toward the viewer . fig6 shows an example of a projection television with a sensor 17 disposed 9 on the front panel of the stationary casing 11 . the sensor 17 detects the heat radiated by or voice uttered by the viewer 8 and the detection output of the sensor 17 is converted into a drive signal that drives the motor 14 . the motor 14 is controlled to orient the screen 4 toward the viewer 8 so that the viewer 8 can view the image having a maximum luminance . one way of detecting the viewer &# 39 ; s position is to use a heat detector that detects a temperature higher than a predetermined threshold temperature such as the viewer &# 39 ; s body temperature , or detects temperatures within a predetermined range . as an alternative , a sound sensor may be used for sensing sounds having sound pressures higher than a predetermined sound pressure or within a predetermined sound pressure range , or for detecting sounds having frequencies higher than a predetermined frequency or within a predetermined frequency range . the use of such a sensor enables to automatically adjust the orientation of the screen 4 so that the viewer is able to view the image having a maximum luminance . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art intended to be included within the scope of the following claims .
| 7 |
as indicated above , the aryl groups in the present invention may be substituted or unsubstituted . although in principle all available hydrogen atoms in the aryl groups may be replaced with other groups , it is preferable to use an unsubstituted phenyl group or a mono - or disubstituted aryl group , especially an ortho - and / or para - substituted group . compounds substituted in the para - position are less sensitive to radical reactions in said position as a result of a steric hindrance and are relatively easy to prepare . examples of especially suitable substituents in the aryl groups are alkyl groups having 1 to 4 carbon atoms , aryl groups , fluorine , chlorine , bromine and iodine atoms , acyl groups , aroyl groups , esterified or unesterified carboxyl groups ,, alkoxy groups , aryloxy groups , amino groups , in which the hydrogen atoms are substituted or not with other groups , nitro groups , alkyl or aryl sulfonyl groups or alkyl or aryl sulfinyl groups . suitable substituents in the x , y , c and d groups in the formula of fig2 on the formula sheet are all those groups that have no unfavorable influence on the formation of radicals or on the properties of the chemical products in the radical reactions . suitable substituents are , for example , fluorine , chlorine , bromine or iodine , alkyl , aryl , alkoxy , alkylthio , carboxyl ester and cyano groups . functional groups , such as hydroxyl , -- nh 2 and / or -- cooh , may also be present , so that the respective groups or radical initiator or decomposition products thereof can also be incorporated into the chemical product formed . even an -- so 3 h group may be present , so that the radical initiator can be emulsified in the reaction mixture to be initiated . one skilled in the art can easily choose for each special application for the most favorable groups and the appropriate substituents . it will , in general , be aimed at obtaining a maximally homogeneous distribution both of the radical initiators in the reaction mixture and of the decomposition products of the initiator in the final reaction product . if the reaction mixture contains substances with free hydroxyl groups or amino groups , the groups x and / or y may be chlorine . under properly chosen reaction conditions that radical initiator will be chemically bound to one or more of the components of the reaction mixture to be initiated . it is also possible to make use of ethylenically unsaturated groups in x or y which can also be chemically bound to the reaction product under the influence or the radicals formed in the reaction . this is especially of importance if the present radical initiators are used for the polymerization of ethylenically unsaturated monomers , such as styrene , α - methyl styrene , methyl methacrylate , acrylamide , acrylonitrile , methacrylonitrile , ethylene vinyl chloride , vinylidene chloride , vinyl acetate , divinyl benzene , n - vinyl pyrrolidone , butadiene , isoprene , chloroprene , dialkyl phthalate , diallyl carbonate , diallyl fumarate , et cetera , or mixtures of the aforementioned compounds . as is the case with the previously known 1 , 2 - diaryl - 1 , 2 - dicyano - ethane compounds , the compounds according to the present invention are insensitive to oxygen . although the present compounds are generally active at a lower temperature than the known 1 , 2 - diaryl - 1 , 2 - dicyano - ethane compounds , the present compounds can also be kept in a reaction mixture at room temperature without premature reaction taking place . the reaction can be made to start at any moment by heating the mixture . this feature may be taken advantage of in polymerization processes and in the paint and lacquers industry . particularly attractive fields of application are the preparation of high - polymers and unsaturated polyester resins . compositions of the present radical initiators and polymerizable compounds , such as monomers , prepolymers , or polymers which still contain unsaturated compounds or functionl groups which react with functional groups in the radical initiators , can be given a particular desired form and be cured by heating . curing is used as meaning polymerizatiion in a broad sense , i . e ., not necessarily attended with the formation of cross - links . giving the compositions of radical initiators a particular form may consist in , for example , applying them as coatings , pouring them into molds , applying the compositions to glass fiber structures , impregnating all kinds of materials , injection molding , extrusion , film casting , vacuum forming , or some other forming technique . for instance , a monomer may be mixed with the radical initiators according to the invention and polymerization may be started by heating . the polymerization process may be interrupted by decreasing the temperature . at such a stage one has a mixture of monomer and polymer ( also referred to herein as a prepolymer ), which can be further polymerized after it has been given a particular form . if desired , cross - linking agents may , of course , be added prior to further polymerization . the polymerization reactions with the novel radical initiators according to the invention can be carried out by using any known technique . for instance , the monomer , or the monomer mixture , can be made to polymerize as such . the polymerization also may be made to take place in a solution , a suspension , or an emulsion . those skilled in the art are well versed in such techniques . if desired , various additives may also be used . the radical initiators are employed in units of , for instance , 0 . 01 to 5 % by weight , calculated on the amount of compounds to be reacted . the reaction temperature is generally in the range of 40 ° to 200 ° c . with respect to the process for making the present initiators , in one embodiment of the present invention the radical initiators are prepared in the monomer known to be used for making corresponding compounds . the oxidative coupling reaction utilized in the present process is well - known . such a reaction may be carried out using an oxidizing agent such as manganese dioxide , lead dioxide , potassium permangante , potassium ferricyanide , hydrogen peroxide , nitric acid , iodine , organic peroxides such as di - tert - butyl peroxide , or by electrochemical oxidation . in practice it is often preferred that use should be made of silver oxide or oxygen in combination with a copper amine catalyst . a large number of copper amine catalysts are described in the british pat . no . 982 , 471 . the temperature used is generally in the range of - 40 ° to + 130 ° c . and is dependent on the type of compound . although in the preparation of the novel radical initiator according to the present invention the reaction with the reaction product of sodium hydride may be carried out with one of a great many organic solvents which are inert under the reaction conditions , it has been found that very favorable results are obtained if dioxane or dimethoxyethane is employed as the solvent . when a metal alcoholate is used , the organic solvent is preferably benzene or toluene . it has been found that the best results are obtained if as metal alcoholate there is used a sodium alcoholate having a lower alcoholate group , such as sodium methylate . in the case where a and b respectively represent sulfur or oxygen and x and y respectively represent a substituted or an unsubstituted phenyl group , it is preferred to use a somewhat modified method of preparation . such a method , can , of course , also be used if x and / or y does not have the meaning of a phenyl group , but has one of the other meanings indicated above . in the modified process , the reaction product of sodium hydride or a metal alcoholate and a compound of the formula ar -- ch 2 -- cn , which is utilized in the basic process , is replaced with the reaction product of an alkali solution in dimethylsulfoxide ( dmso ) and a compound of the formula ar -- ch 2 -- cn . the remainder of the basic process is unchanged . it has been found that very favorable results are obtained if as organic solvent dioxan or dimethoxyethane is used . in an alternative process for preparing the present initiators , a solution of a compound of the formula ## str5 ## wherein the terms are as above - defined , a compound of the formula ar -- ch 2 -- cn , wherein ar has the above - defined meaning , and an organic quaternary ammonium compound in a water - immiscible or practically water - immiscible organic solution are intimately contacted with a solution of alkali in water . after completion of the reaction , the reaction mixture is acidified and the isolated organic phase washed until neutral . the resultant monomeric product is then isolated , if desired , subjected to any known oxidative coupling reaction , and the desired product is isolated . the amount of solution of alkali in water which is utilized may vary between wide limits . use is often made of a concentrated alkali solution of , for example , 50 % by weight naoh in water . the alkyl groups in the tetraalkyl ammonium salt used may be straight - or branch - chained ; they generally contain 1 to 20 carbon atoms . an example of a suitable tetraalkyl ammonium salt is the tetra - n - butyl ammonium salt . very good results were obtained with the triethyl benzyl ammonium salt . use may be made of various organic solvents , which are not , or hardly , miscible with water and are inert to the reaction components used . it has been found that use may be made of halogenated organic solvents , and more particularly of methylene chloride . especially with the use of the triethyl benzyl ammonium salt , these solvents may lead to very high yields . other solvents which also give favorable results include carbon tetrachloride , 1 , 1 , 1 - trichloroethane and tri - and perchloroethylene . for the acidification in either of the two abovementioned methods of preparation , favorable results are obtained with the use of acetic acid or an inorganic acid such as hydrochloric acid . the invention will be further described in the following examples which are of course given by way of illustration only and should not be interpreted as limitative of the present invention . 148 g . ( 0 . 8 moles ) of cyanuric chloride at 30 ° c . were added to a suspension of 134 g . ( 1 . 6 moles ) of sodium bicarbonate in a mixture of 400 ml . of methanol and 40 ml . of water . after reaction for seven hours the reaction mixture was extracted with methylene chloride , followed by washing with water until neutral , drying with mgso 4 and evaporating the solvent . after recrystallization from petroleum ether ( boiling point 40 ° to 60 ° c .) 126 g . of 2 , 4 - dimethoxy - 6 - chloro - 1 , 3 , 5 - triazine were obtained with a melting point between 74 . 2 ° and 76 . 2 ° c . subsequently , a suspension was prepared of 1 . 2 g . ( 0 . 05 mol ) of sodium hydroxide in 20 ml . of dimethoxyethane . to this suspension were added , with stirring , 3 . 28 g . ( 0 . 025 mole ) of p - xylylcyanide in 20 ml . of dimethoxyethane . after 15 minutes 4 . 4 g . ( 0 . 25 mole ) of 2 , 4 - dimethoxy - 6 - chloro - 1 , 3 , 5 - triazine in 10 ml . of dioxane were added dropwise to the reaction mixture . after 16 hours of stirring , the reaction mixture was poured into ice water , acidified with acetic acid , and extracted with chloroform . the extract was successively washed with water , saturated sodium carbonate solution and water , until neutral , dried with magnesium sulfate and the solvent evaporated . next , the residue was dissolved in methanol and shaken with oxygen in the presence of cu 2 cl 2 / n , n , n , n - tetramethyl ethylene diamine as catalyst . when no more oxygen was taken up , the reaction mixture was poured into a 1 % by weight solution of hcl in water and extracted with methylene chloride . the extract was washed with water until neutral , dried with magnesium sulfate , and the solvent evaporated . recrystallization from methanol gave 2 . 8 g . of α , α ,&# 39 ;- bis -( p - methylphenyl ) α , α &# 39 ;- bis ( 2 , 4 - dimethoxy - 1 , 3 , 5 - triazine ) succinonitrile in 21 % yield . the melting point of the compound was in the range of 220 ° to 221 . 7 ° c . the 2 , 4 - dimethoxy - 6 - chloro - 1 , 3 , 5 - triazine was prepared in the same manner as described in example i . subsequently , a solution was prepared of 3 . 6 g . ( 0 . 028 mole ) of p - xylyl cyanide , 3 ml . of 50 % by weight naoh in water and 20 ml . of dmso . a solution of 4 . 7 g ( 0 . 027 mole ) of 2 , 4 - dimethoxy - 6 - chloro - 1 , 3 , 5 - triazine in 15 ml . of dioxane was added dropwise over a period of 15 minutes . after one hour stirring the reaction mixture was poured into water , acidified with hydrochloric acid and extracted with methylene chloride . the extract was washed with water until neutral and dried with magnesium sulfate . the residue was subsequently treated in the same manner as described in example i . recrystallization from methanol gave 3 . 72 g . of α , α &# 39 ;- bis ( p - methylphenyl ) α , α &# 39 ;- bis ( 2 , 4 - dimethoxy - 1 , 3 , 5 - triazine ) succinonitrile in 25 . 8 % yield . the melting point was the same as mentioned in example i . 20 ml . of water at - 5 ° c . were added to a suspension of 14 . 7 g . ( 0 . 175 mole ) of sodium bicarbonate in a solution of 15 . 8 g . ( 0 . 086 mole ) of cyanuric chloride in 70 ml . of acetone . at a temperature of 0 ° c . 8 . 4 g . ( 0 . 175 mole ) of methyl mercaptan were added to the suspension . the reaction time was nine hours and the temperature rose to 20 ° c . after being poured into water , the reaction mixture was extracted with ether . following washing with water , drying with na 2 so 4 and evaporating the solvent , the crude product was purified by recrystallization from petroleum ether ( boiling point 40 °- 60 ° c .). in this way 12 . 2 g . of 2 , 4 - dimethylthio - 6 - chloro - 1 , 3 , 5 - triazine were obtained in 69 % yield . the melting point was in the range of 83 . 6 ° to 84 . 4 ° c . of the product thus prepared , 2 g . ( 0 . 0096 mole ) were , as indicated in example i for 2 , 4 - dimethoxy - 6 - chloro - 1 , 3 , 5 - triazine , reacted with 1 . 27 g . ( 0 . 0096 mole ) of p - xylyl cyanide and 2 . 5 g . ( 0 . 01 mole ) of sodium hydride . purification and recrystallization from methanol gave 1 . 76 g . of ( 2 , 4 - dimethylthio - s - triazinyl - 6 -)( tolyl - 4 ) methyl cyanide in 60 . 5 % yield . the melting point was in the range of 101 . 2 ° to 102 . 6 ° c . of the compound thus prepared 1 . 51 g . were dissolved in a suspension of 1 . 75 g . of silver oxide in 50 ml . of benzene . the resulting mixture was boiled under reflux for 60 hours , followed by adding 300 ml . of chloroform and 2 spatulas of active carbon . after another two hours boiling under reflux , the mixture was filtrated and the filtrate concentrated by evaporation . there were obtained 1 . 04 g . ( in 68 . 8 % yield ) of white crystalline α , α &# 39 ;- bis ( p - tolyl ) α , α &# 39 ;- bis ( 2 , 4 - dimethylthio - 1 , 3 , 5 - triazine ) succinonitrile having a melting point of 220 . 8 ° to 221 . 0 ° c . to a suspension of 2 . 5 g . ( 0 . 1 mole ) of sodium hydride in 20 ml . of dimethoxyethane there was added a solution of 3 . 68 g . ( 0 . 025 mole ) of p - methoxybenzyl cyanide in 30 ml . of dimethoxyethane . after 15 minutes a solution of 4 . 4 g . ( 0 . 025 mole ) of 2 , 4 - dimethoxy - 6 - chloro - 1 , 3 , 5 - triazine in 15 ml . of dimethoxyethane and 20 ml . of dioxane was added to the reaction mixture . subsequently , the mixture was boiled under reflux for 60 hours , after which it was poured into a dilute ( 4 n ) hydrochloric acid solution at 0 ° c . the acid solution was extracted with methylene chloride . next , the extract was washed with a saturated sodium bicarbonate solution and with water until neutral , followed by drying with magnesium sulfate and concentrating by evaporation . the residue was isolated chromatographically on a silica gel column ( silica gel 60 ( 70 - 230 mesh ) astm ; eluent : dimethoxyethane / hexane = 7 / 3 ). there were obtained 4 . 86 g . ( in 74 % yield ) of 2 , 4 - dimethoxy - s - triazinyl - 6 -) ( anisyl - 4 ) methyl cyanide . in the same manner as described in example iii , 2 . 36 g . of the compound thus prepared were dissolved in a suspension of 2 . 5 g . of silver oxide in 50 ml . of benzene . after 45 hours &# 39 ; boiling under reflux , 300 ml . of methylene chloride and two spatulas of active carbon were added . after another two hours boiling under reflux , the mixture was filtrated and concentrated by evaporation . there were obtained 1 . 07 g . ( in 45 . 3 % yield ) of white crystalline α , α &# 39 ;- bis ( p - methoxyphenyl ) α , α &# 39 ;- bis ( 2 , 4 - dimethoxy - 1 , 3 , 5 - triazine ) succinonitrile having a melting point in the range of 234 . 0 ° to 234 . 2 ° c . 9 . 0 g . ( 0 . 225 mole ) of powdered sodium hydroxide at a reaction temperature of 32 ° to 37 ° c . were added to a solution of 18 . 4 g . ( 0 . 1 mole ) of cyanuric chloride and 51 . 2 g . ( 0 . 2 mole ) of stearyl alcohol in 200 ml . of dioxane over a period of 20 minutes . after seven hours the reaction mixture was poured into 500 ml . of petroleum ether ( boiling point 60 ° c .). the solution thus obtained was washed with water , dried with mgso 4 , and concentrated by evaporation . 10 g . ( 0 . 016 mole ) of the resulting product and 3 . 64 g . ( 0 . 016 mole ) of triethyl benzyl ammonium chloride and 2 . 09 g . ( 0 . 016 mole ) of p - xylyl cyanide were dissolved in 400 ml . of methylene chloride . with a supertorax stirrer , the solution obtained was vigorously stirred for three hours in the presence of 50 ml . of 50 % by weight -- sodium hydroxide . after completion of the reaction , the reaction mixture was poured into 400 ml . of 4 n hcl , followed by washing the isolated organic phase with water until neutral , drying with mgso 4 , and concentrating by evaporation . the ( 2 , 4 - distearoxy - s - triazinyl - 6 -) ( tolyl - 4 ) methyl cyanide was purified by recrystallization from methanol . there were obtained 11 . 1 g . of product in 87 % yield . starting from 3 . 8 g . the coupling reaction was carried out by using the same procedure as described in example i using oxygen in the presence of cu 2 cl 2 / n , n , n , n - tetramethyl ethylene diamine as catalyst , with the exception that it was performed in a mixture of equal parts by volume of methanol and methylene chloride . recrystallization from acetone gave 3 . 14 g . ( in 83 % yield ) of white crystalline α , α &# 39 ;- bis ( p - tolyl ) α , α &# 39 ;- bis ( 2 , 4 - distearoxy - 1 , 3 , 5 - triazine ) succinonitrile having a melting point in the range of 75 . 0 ° to 82 . 3 ° c . at a reaction temperature of 15 ° to 20 ° c . a solution of 19 . 0 g . ( 0 . 2 mole ) of phenol and 8 . 0 g . ( 0 . 2 mole ) of sodium hydroxide in 75 ml . of water was added dropwise to a solution of 18 . 4 g . ( 0 . 1 mole ) of cyanuric chloride in 90 ml . of acetone . after 41 / 2 hours the precipitate formed was removed by suction , washed with water and dried ( with mgso 4 ). purification by recrystallization from n - heptane gave 24 . 7 g . of 2 , 4 - diphenoxy - 6 - chloro - 1 , 3 , 5 - triazine in 82 % yield . the melting point was 119 °- 121 ° c . in the same manner as described in example v , 3 . 23 g . of this product were coupled to 1 . 41 g . of p - xylyl cyanide by way of a phase - transfer catalyzed two - phase reaction . purification of the reaction product : ( 2 , 4 - diphenoxy - s - triazine - 6 -) ( tolyl - 4 ) methyl cyanide by recrystallization from ethyl acetate gave 3 . 6 g . of the title product in 85 % yield . the compound ( 2 , 4 - dipiperidino - s - triazinyl - 6 ) ( tolyl - 4 ) methyl cyanide was obtained by boiling the above - mentioned reaction product with two molar equivalents of piperidine for 16 hours in chloroform under reflux . after the solvent had been evaporated , the residue was sublimated , with phenol escaping from the reaction mixture . after the residue had been boiled in an ether / chloroform mixture , the solid matter was filtered off , dissolved in methylene chloride , and the solution washed with water . following drying with mgso 4 the solvent was evaporated and the resulting solid matter boiled in ether . subsequently , the solid matter was filtered off and dried . the coupling reaction was carried out in the same manner as described in example iii , using silver oxide in boiling toluene . the product was obtained in 49 % yield . the melting point was in the range of 257 . 0 ° to 258 . 0 ° c . in the preparation of this compound , the same procedure was used as described in example iv , with the exception that it was started from 3 . 79 g . ( 0 . 025 mole ) of p - chlorobenzyl cyanide . further , the period over which the reaction mixture was boiled under reflux was only one hour instead of 60 hours . further treatment resulted in a residue which after recrystallization from a mixture of ethanol and ethyl acetate gave 5 . 05 g . of the title product in 74 . 3 % yield . the melting point was in the range of 238 . 4 ° and 241 . 4 ° c . in these examples the reactivities are determined of the radical initiators and polymerization initiators according to the invention and some known radical initiators . the reactivity is indicated with the polymerization constant kp . the latter is very much dependent on the temperature and occurs in the formula rp = kp ( m ) ( i ) 1 / 2 where rp is the polymerization speed , ( m ) the concentration of the monomer and ( i ) the concentration of the radical initiator ( see &# 34 ; die makromolekulare chemie &# 34 ; 157 ( 1972 ), p . 279 ff ). in all determinations 50 ml . of the monomer were mixed with the radial initiators listed in the following table and transferred to a dilatometer . the dilatometer was cooled to - 80 ° c ., filled with nitrogen , followed by applying vacuum to it ; the last two treatments were repeated three times . then the dilatometer was placed in a thermostated bath which had been set to the polymerization temperature mentioned in the table below . the concentration values were determined in accordance with the standard dilatometric technique ( see &# 34 ; angewandte chemie &# 34 ; 59 ( 1947 ), p90 ). from the values obtained the conversion and the kp - values were successively determined . the table below gives the values obtained for the compounds are prepared in the examples i through vii . for comparison also the kp - values of some known radical initiators , namely , α , α &# 39 ;- bis ( methoxycarbo ) α , α &# 39 ;- bis ( p - methylphenyl ) succinonitrile ( dl ) ( ix ), dilauroyl peroxide ( x ), di - t - butyl perpivalate ( xi ) and tert . butyl peroxypivalate ( xii ) are listed in the table . because of the poor solubility of some of the radical initiators prepared in the preceding examples , the determination of the kp - value was started from 0 . 05 % by weight , whereas normally 0 . 2 % by weight is included in the monomer to be polymerized . the kp - values of other radical initiators in styrene are listed in the tables 2 and 3 on page 283 of the aforementioned article in &# 34 ; die makromolekulare chemie &# 34 ;. table i______________________________________ kp - value × 10 . sup . 4 methylmethacrylate styreneradical initiator temperature ° c . temperature ° c . of example 50 60 70 80 90______________________________________i + ii 3 . 85 7 . 5 x xiii 2 . 85 5 . 92 x xiv 1 . 1 2 . 7 x xv 2 . 32 4 . 48 3 . 05 7 . 86vi no polymerization 1 . 60 3 . 56vii 2 . 10 5 . 52 6 . 10 5 . 70ix 1 . 3 3 . 4x 2 . 4 5 . 8xi 4 . 2 10 . 1xii 3 . 0______________________________________ x : although at these temperatures polymerization took place , the conversiontime curves were nonlinear . the difference in behaviour between the compound of example v and that of i through iv , is probably due to a far better compatibility of the compound of example v in styrene and in polystyrene .
| 2 |
the present invention provides a method for preparing a whole soybean milk , comprising the steps of : 1 ) roasting and dehulling soybeans to obtain dehulled soybeans ; 2 ) cooking the dehulled soybeans to obtain cooked soybeans ; 3 ) coarsely grinding the cooked soybeans to obtain a coarsely ground soybean liquid ; 4 ) finely grinding particles of the coarsely ground soybean liquid in a cutting manner by using a grinding device to obtain a whole soybean liquid ; and 5 ) micro homogenizing the whole soybean liquid . the term “ whole soybean milk ” in the present invention refers to a soybean milk prepared to contain entire nutrients of soybeans without removing the useful components which were discarded as soybean milk residue in pre - existing methods for preparing a soybean milk from whole soybeans or dehulled soybeans . the present invention allows preparation of a whole soybean milk which has small particle diameters and shows almost no change in viscosity even when stored for a long time , by the following process : cooking dehulled soybeans which went through a roasting step for an appropriate time and at a proper temperature , then finely grinding them using a mechanical grinding device which finely grinds particles in a cutting manner , such as comitrol , and micro homogenizing them by applying homogeneous pressure . specifically , a process of the present invention may be carried out through the following steps described below . foreign materials ( e . g ., iron pieces , stones , wood , or grains , etc .) are removed from whole soybeans using a stone picker or careful selector . in the present invention , soybeans are roasted to add savory taste to a whole soybean milk , inactivate an agent which causes beany flavour characteristic of beans beforehand , and improve the particle diameters of the whole soybean liquid to be finally prepared . the roasting step may be carried out in any one of the fashions commonly known in the art , such as hot air fashion , semi - hot air fashion , flame fashion , or far - infrared fashion , etc . a roaster used in the roasting step may be appropriately selected in accordance with the above fashions . for example , a drum roaster can be used in case of a flame fashion . in a roasting step according to the flame fashion of the present invention , the inside temperature of the drum roaster , rotational speed of the drum and roasting time can influence the extent of roasting of soybeans and the particle diameters , viscosity , and sensory property of finally prepared soybean liquid . in order to obtain a whole soybean milk with a favorable taste , it is recommended that the inside temperature of the drum roaster range from 150 to 240 ° c ., the rotational speed of the drum range from 20 to 40 rpm , the roasting time range from 4 to 12 minutes , and input and output amounts of the soybeans range from 40 to 50 kg per minute . as an example of the present invention , in case of a drum roaster , tastes can be diversified by adjusting the roasting time while the inside temperature and rotational speed of the drum are fixed . for example , if the inside temperature of the drum just before the soybean input , and the rotational speed of the drum are fixed at about 220 ° c . and at about 27 rpm , respectively , fresh taste can be obtained by roasting the soybeans for a short time of 4 to 8 minutes , while nutty taste be obtained by roasting them for a long time of 9 to 12 minutes . according to one embodiment of the present invention , the roasting step can be carried out by roasting the carefully selected whole soybeans for 4 to 12 minutes in a drum roaster in which its temperature and rotational speed are fixed at 220 ° c . and at 27 rpm , respectively . in addition , a roasting step according to the hot air fashion of the present invention is preferably carried out with the roasting temperature of 150 to 200 ° c ., the soybean input speed of 30 to 70 %, the soybean output rate of 60 to 95 %, and the roasting time of 40 to 120 seconds , while a roasting step according to the infra - red fashion is preferably carried out with the roasting temperature of 180 to 230 ° c ., and the roasting time of 4 to 14 minutes . it is recommended that skin of soybeans should be removed as it can increase the viscosity of the whole soybean milk product to be finally prepared afterwards and may cause residual taste ( bitter and astringent taste ) characteristic of soybean skin . accordingly , soybeans which went through the roasting step are rapidly cooled to 40 ° c . or lower , preferably 20 to 30 ° c ., sorted according to size using a particle diameter sorter , followed by removing their skin using a dehuller , and diving the dehulled soybeans in half . half - divided dehulled soybeans which went through the dehulling step are cooked in hot water with a temperature of 91 to 99 ° c ., preferably 95 to 99 ° c . ( e . g ., 98 ° c .) for 3 to 10 minutes ( e . g ., 4 minutes ). such cooking steps can not only effectively improve the sensory property of a whole soybean liquid by inactivating an agent causing beany flavour characteristic of beans , but also help improve the particle diameters of the whole soybean liquid by softening the soybean structure and thus easing the grinding in a coarse grinding step to be carried out afterward , but also can take a role in adding deep taste to the whole soybean liquid to be finally prepared . in addition , the productivity can be increased since , owing to the cooking step , a long soaking process of about 8 to 15 hours and an enzyme - inactivation process ( carried out for 5 minutes at 98 ° c .) can be omitted , which have been carried out in pre - existing methods for the preparation of whole soybean milk . the cooked soybeans may be coarsely ground using a grinder such as crusher . in this step , cooked soybeans can be treated with 2 . 4 to 10 - fold by weight of water and coarsely ground . the higher the solid content of the whole soybean liquid obtained from the coarse grinding process is , the more difficult it becomes to attain desired particle diameters in the fine grinding process afterwards , and thus it is recommended that the solid content of the soybean liquid obtained from the coarse grinding step be 5 to 15 %. one example of devices that can be used in the coarse grinding step of the present invention is crusher in which the size of its passage net is 1 to 4 φ , for example , 1 . 5 φ . soybean particles can be micronized by finely grinding the coarsely ground soybean liquid obtained from the coarse grinding step , using comitrol , a mechanical grinding device which finely grinds particles in a cutting manner . the comitrol used in the present invention is the main device which finely cuts particles and is composed of a circular head and an impeller located at the center of the head and equipped with blade rotating at a high speed . types of circular head in comitrol are cutting head assembly , microcut head assembly , slicing head assembly , etc . ; and microcut head assembly can be preferably used . main components of microcut head assembly are multiple blades , circular upper and under blade holding rings to which multiple blades are attached . the principle of comitrol &# 39 ; s cutting and micronization of particles is as follows . an impeller equipped with blade cuts particles while rotating at a high speed , and centrifugal force and strong compressive force between the gap between microcut head assembly and the impeller rotating at a high speed , etc . are generated , which make particles collide with the cutting surfaces of the blades attached to microcut head assembly , resulting in cutting and micronization of particles . among such micronized particles , only those which are smaller than the openings between the blades can pass , while those too large to pass get micronized repeatedly . the microcut head assembly can adjust particle diameters according to the number of blades attached ( i . e ., the more blades are attached , the narrower the openings between the blades get , which allows only the more micronized particles to pass ). in addition , as the shape of the microcut head assembly is circular , blades attached to the upper and lower blade holding rings do not align with the adjacent blades in a straight line , and differences in depth of cut are generated , which can maximize the efficiency of particle cutting . specifically , a fine grinding step of the present invention comprises first and second micronization steps of the coarsely ground soybean liquid using comitrol . the comitrol may have 50 to 222 blades in which the distance between blades ranges from 0 . 001 to 0 . 2214 inch and the difference in depth between cutting surfaces of a blade and another blade immediately next thereto ranges from 0 . 0012 to 0 . 0237 inch . according to a specific embodiment of the present invention , comitrol having 212 blades in which the distance between blades is 0 . 005 inch and the difference in depth between cutting surfaces of a blade and another blade immediately next thereto is 0 . 0013 inch ( e . g ., comitrol processor model 1700 , urschel lab ., inc .) can be used in the first micronization step ; and comitrol having 222 blades in which the distance between blades is 0 . 001 inch and the difference in depth between cutting surfaces of a blade and another blade immediately next thereto is 0 . 0012 inch ( e . g ., comitrol processor model 1500 , urschel lab ., inc .) can be used in the second micronization step . the mean particle diameter of soybean particles obtained from the first and second micronization steps ranges from about 80 to 100 μm , and from about 60 to 70 μm , respectively . meanwhile , to process a large amount of coarsely ground whole soybean liquid in the fine grinding step of the present invention or to prepare a whole soybean liquid having a smaller particle diameter , the first and second micronization steps can be carried out using other models of comitrol ( e . g ., comitrol processor model 9300 with feeder , urschel lab ., inc .). in such comitrols , 172 to 241 blades are included , the distance between blades ranges from 0 . 00043 to 0 . 606 inch , and the difference in depth between cutting surfaces of a blade and another blade immediately next thereto ranges from 0 . 0001 to 0 . 042 . a grinding step in the conventional methods for preparing a whole soybean milk micronizes particles using ultramizer and a reactor in a way of crushing particles by a milling stone method , and a resulting mean particle diameter of soybean particles ranges from about 130 to 150 μm . on the other hand , in the present invention , a whole soybean milk with a mean particle diameter ( about 60 to 70 μm ) smaller than the conventional methods can be obtained by micronizing particles in a way of cutting them with blades using comitrol . according to a method of the present invention , soybean milk residue components with a large particle size decrease dramatically , enabling the hydration of soybean milk residue components to take place sufficiently during the process , and thus additional hydration of them does not take place over time . accordingly , the viscosity of a whole soybean milk to be finally prepared gets stabilized , which can contribute to its storage stability . moreover , the process can be simplified by not using additional processing devices such as ultramizer and a reactor . the micro homogenization step of the present invention comprises first micro homogenizing the whole soybean liquid prepared in the grinding step at a homogeneous pressure of 200 to 300 bar ( e . g ., 300 bar ); pasteurizing , cooling and sterilizing the whole soybean liquid obtained ; and second micro homogenizing the sterilized whole soybean liquid at a homogeneous pressure of 150 to 300 bar ( e . g ., 300 bar ). the homogeneous pressure at the first micro homogenization step should be preferably 300 bar or less , since homogenous pressure exceeding 300 bar in the first micro homogenization step can cause unfavorable texture on tasting due to increased viscosity , and impose loads to a mechanical facility resulting in reduced life span of the facility or noise in the working area . the mean particle diameter of the whole soybean liquid obtained from the first micro homogenization step ranges from 45 to 55 μm . next , the whole soybean liquid obtained from the first micro homogenization step is pasteurized in a heat exchanger ( e . g ., plate - type heat exchanger ) at 95 to 99 ° c . ( e . g ., about 98 ° c .) for 30 seconds to 60 seconds ( e . g ., about 30 seconds ), followed by cooling to 10 ° c . or lower ( e . g ., about 5 ° c .) in a cooler . then , it may be transported to a sterilizer and sterilized by a heat exchanger ( e . g ., a heat exchanger with a steam infusion method ) at 135 to 151 ° c . ( e . g ., 150 ° c .) for 3 seconds to 200 seconds ( e . g ., 5 seconds ). the second micro homogenization of the sterilized whole soybean liquid obtained from the above process is carried out at a homogeneous pressure of 150 to 300 bar ( e . g ., 300 bar ). the mean particle diameter of the whole soybean liquid obtained from the second micro homogenization process ranges from 25 to 35 μm . in addition , the present invention provides a whole soybean milk prepared by the preparation method above . physical properties of the whole soybean milk according to the present invention include a particle diameter of about 25 to 35 and viscosity of 34 to 55 cp . the whole soybean milk has excellent storage stability due to almost no viscosity change over time , and is characterized by its small viscosity increase of less than 12 cp even after 22 months when stored in the form of a commercialized product at room temperature ( about 1 to 35 ° c .). for the distribution of the prepared whole soybean milk in a liquid phase at room temperature , a whole soybean milk product can be prepared by blending and mixing the whole soybean milk with a sitologically acceptable food and a small amount of additives , followed by a conventional process of packaging soybean milk products . accordingly , the present invention provides a method for preparing a whole soybean milk product comprising the steps of blending and mixing a whole soybean milk with a sitologically acceptable food and a small amount of additives , and then stabilizing , filling , sterilizing , and cooling the resulting mixture in a conventional way . when preparing the soybean milk product , scent or taste of the final soybean milk product can be improved by adding flavoring agents to a whole soybean milk , and available flavoring agents can be , for example , fruit , fruit puree , juice , concentrate , powder , and a mixture thereof . in addition , to promote health , a whole soybean milk product can be prepared with the addition of an appropriate amount of extracts or powders , etc . of milk calcium or various natural foods , for example , sesame seeds , black sesame seeds , carrots , spinach , green tea , black tea , mulberry , arrowroot , herbs , ginseng , red ginseng , chinese bellflower , etc . a feeling of repulsion starts to arise upon sensory evaluation if the viscosity of whole soybean milk exceeds 80 cp . a whole soybean milk product prepared according to a conventional process with a water - soaking method ( korean patent no . 822 , 165 ) shows gradual increase in its viscosity over time , exceeding 80 cp after about 80 days , and exceeding 100 cp after about 180 days . however , the whole soybean milk prepared according to the method of the present invention showed almost no viscosity increase even 9 months after the preparation , and even showed about 5 to 18 cp decrease from the viscosity at the time of preparation . in addition , even until 22 months after the preparation , the viscosity increase was at maximum about 11 . 5 cp , which implies that there is almost no change in viscosity . therefore , a longer shelf life can be achieved for the whole soybean milk product prepared according to the method of the present invention than that prepared according to the conventional process with water - soaking method . hereinafter , the present invention will be described in more detail with the following examples . the following examples are provided to illustrate the present invention , but the scope of the present invention is not limited thereto . after carefully selecting soybeans and removing foreign materials from them , the soybeans were roasted in a flame fashion for 10 minutes using a roaster ( drum roaster available from korea energy technology ) with the inside temperature of the drum just before the soybean input and the rotational speed of the drum fixed at about 220 ° c . and at about 27 rpm , respectively . the roasted soybeans were cooled quickly to about 30 ° c ., were sorted according to the size using a particle diameter sorter , and were half - divided after their hull was removed using a dehuller . the dehulled half - divided soybeans were cooked by bean cooker by passing them in hot water of 98 ° c ., for about 4 minutes . 7 . 45 - fold by weight of water was added to the cooked soybeans obtained and the resulting was coarsely ground by passing it through crusher ( seikensha co ., ltd ., japan ) which has a passage net of 1 . 5 φ . in order to finely grind the coarsely ground soybean liquid obtained , a first micronization was carried out by cutting it with comitrol ( comitrol processor model 1700 , urschel lab ., inc .) having 212 blades in which the distance between blades is 0 . 005 inch and the difference in depth between cutting surfaces of a blade and another blade immediately next thereto is 0 . 0013 inch . the mean particle diameter of the soybean liquid obtained from the first micronization process was measured using a particle diameter analyzer ( microtrac s - 3000 , microtrac inc ., usa ), which was shown to be 80 . 99 μm ( fig2 and table 1 ). then , a second micronization of the soybean liquid obtained from the first micronization process was carried out by cutting it with comitrol ( comitrol processor model 1500 , urschel lab ., inc .) having 222 blades in which the distance between blades is 0 . 001 inch and the difference in depth between cutting surfaces of a blade and another blade immediately next thereto is 0 . 0012 inch . the mean particle diameter of the soybean liquid obtained from the second micronization process was measured by the same method as above , which was confirmed to be 63 . 23 μm ( fig3 and table 2 ). a first micro homogenization of the whole soybean liquid obtained from the above micronization processes was carried out using a homogenizer ( homogenizer , donga homogenizer , china ) at a pressure of 300 bar . the mean particle diameter of the whole soybean liquid obtained was measured by the same method as above , which was confirmed to be 47 . 54 μm ( fig4 and table 3 ). then , the whole soybean liquid obtained from the first micro homogenization was pasteurized using a plate - type heat exchanger at about 98 ° c . for 30 seconds , followed by cooling down to about 5 ° c . using a plate - type heat exchanger . then , it was transported to a sterilizer and sterilized by a heat exchanger with a steam infusion method at 150 ° c . for 5 seconds . a second micro homogenization of the sterilized whole soybean liquid obtained from the above process was carried out at a pressure of 300 bar . the mean particle diameter of the whole soybean liquid obtained from the second micro homogenization was confirmed to be 29 . 52 μm ( fig5 and table 4 ). specifically , after carefully selecting soybeans and removing foreign materials , 330 kg of the soybeans were soaked in water of 18 ° c . for about 10 hours . first grinding of the soaked soybeans was carried out using a grinder ( crusher , seikensha co ., ltd ., japan ) while adding purified water thereto . after the grinding , outer skins of soybeans or foreign materials contained in the ground liquid were removed three times using a refiner ( bertuzzi , italy ). then , second grinding was carried out using a fine grinder ( ultramizer ). the mean particle diameter of the whole soybean liquid obtained from the second grinding process was confirmed to be 450 μm . then , the ground liquid was maintained at 90 ° c . for 2 minutes to inactivate enzymes , and was micronized using a circulating grinding device ( hansung pulverizing machinery co ., ltd .) equipped with a mechanical grinding device such as colloid mill , etc ., and a recirculating device , to prepare a whole soybean liquid . the mean particle diameter of the whole soybean liquid was confirmed to be about 130 μm . two consecutive homogenizations of the prepared whole soybean liquid were carried out using a ultra - high pressure homogenizer ( homogenizer , donga homogenizer , china ) at a pressure of 400 bar each , and the whole soybean liquid was cooled to 4 ° c . the obtained liquid was subjected to a third homogenization at a pressure of 400 bar and then sterilization at 150 ° c . for 3 seconds , to prepare a whole soybean liquid . the final mean particle diameter of the prepared whole soybean liquid was 77 . 42 μm ( fig6 and table 5 ). particle diameters and viscosity of the example 1 and comparative example 1 , and commercially available soybean milk products a and b were measured using a particle diameter analyzer ( microtrac s - 3000 , microtrac inc ., usa ) and a viscosity analyzer ( brookfield viscometer lvdve230e5871 , spindle no . 1 ( s61 ), and spindle rotational speed : 20 rpm ). the results are shown in table 6 below . in addition , the results of particle diameter analysis of comparative example 1 , and commercially available soybean milk products a and b are shown , respectively , in fig6 to 8 ( tables 5 , 7 , and 8 ). whole soybean milks prepared in example 1 and comparative example 1 were sterilized at 150 ° c . for 3 to 5 seconds , and were commercialized by packaging them using a sterile automatic packaging machine ( combibloc - filling machine cfa112 - 32 , sig combibloc ). in order to measure the viscosity changes according to storage time , products of example 1 and comparative example 1 were stored at room temperature and the viscosity increase over storage time was measured by the same method as experimental example 1 . results are shown in tables 9 and 10 below , and fig9 and 10 . as shown in tables 9 and 10 , and fig9 and 10 , the whole soybean milk of example 1 showed no viscosity increase at 9 months after the preparation , but rather showed about 5 to 18 cp decrease from the viscosity at the time of preparation . in addition , even until 22 months after the preparation , the viscosity increase was at maximum about 11 . 5 cp , which implies that there was almost no change in viscosity . on the other hand , the whole soybean milk of comparative example 1 showed gradual increase in its viscosity over time , exceeding 80 cp after about 80 days , and exceeding 100 cp after about 180 days . a feeling of repulsion starts to arise upon sensory evaluation if the viscosity of a whole soybean milk exceeds 80 cp . these results indicate that products using a whole soybean milk of example 1 can be stored for a longer period without change in taste than those using a whole soybean milk of comparative example 1 .
| 0 |
the present invention will now be further described by way of example and with reference to the figures which show : fig1 : antibody response of common carp against different isolates of a . hydrophila determined by elisa expressed as an absorbance at 450 nm . all sera were diluted 1 : 512 . fig2 : western blot analysis of different whole cell preparations of a . hydrophila against pooled serum from common carp infected with 6 different a . hydrophila isolates . lanes : ( 1 ) standard marker ; ( 2 ) t4 ; ( 3 ) 98141 ; ( 4 ) hh ; ( 5 ) vds ; ( 6 ) catla ; ( 7 ) c241i ; ( 8 ) 2d 2 o ; ( 9 ) 3d14 ; ( 10 ) 2n14 ; ( 11 ) 98140 ; ( 12 ) 98139 ; ( 13 ) b2 / 12 ; ( 14 ) f1d75 ; ( 15 ) calf . fig3 : western blot analysis of different preparations of 6 a . hydrophila isolates screened with serum raised against corresponding a . hydrophila isolates in common carp . ( a ) t4 , ( b ) 98141 , ( c ) hh , ( d ) vds , ( e ) catla , ( f ) c241i . lanes : ( 1 ) standard marker ; ( 2 ) wc in vitro ; ( 3 ) wc in vivo 25 kda ; ( 4 ) wc in vivo 100 kda ; ( 5 ) omp in vitro ; ( 6 ) omp in vivo 25 kda ; ( 7 ) omp in vivo 100 kda ; ( 8 ) ecp in vitro ; ( 9 ) ecp in vivo 25 kda ; ( 10 ) ecp in vivo 100 kda . fig4 : 2d western blot analysis of whole cell preparation of a . hydrophila t4 isolate screened with antibody from common carp infected with a . hydrophila t4 isolate . fig5 : cumulative percentage of goldfish mortality in preliminary vaccination trial fig6 : maldi - tof ms spectrum showing the peptide profiles of 50 kda band fig7 : nucleic and amino acid sequences of a . hydrophila s - layer protein signal peptide sequences are highlighted ( nucleic acid in green and amino acid in yellow ). fig8 : genomic sequences of a . hydrophila isolate t4 bases different to that genome reported for the s - layer protein of a . hydrophila isolate tf7 by thomas and trust ( 1995a ) have been highlighted . fig9 : amplification of the s - layer gene of a . hydrophila isolate t4 shown on a 1 % agarose gel . lanes : ( 1 ) standard marker ; ( 2 ) s - layer protein gene ; ( 3 ) purified s - layer protein gene ; ( 4 ) pqe60 vector carrying s - layer protein gene . fig1 : expression of s - layer protein of a . hydrophila with e . coli wc protein . ( a ) 12 % sds - page stained with coomassie blue , ( b ) western blot of protein using an anti - histidine tag antibodies . lanes : ( 1 ) standard protein marker ; ( 2 ) wc preparation of recombinant e . coli without iptg induction ; ( 3 ) wc preparation of recombinant e . coli with iptg induction showing s - layer protein . fig1 : cumulative percentage mortality of carp vaccinated with recombinant s - layer protein and challenged with a . hydrophila isolates . ( a ) t4 , ( b ) hh , ( c ) 98140 , ( d ) 98141 , ( e ) vds , ( f ) b2 / 12 . four virulent strains ; t4 , 98141 , hh , vds and two avirulent strains ; catla and c241i of a . hydrophila were used ( table 1 ). common carp ( average weight 30 g ) were maintained in 6 separate glass tanks . the fish were anesthetized and injected intraperitoneally ( ip ) with 0 . 1 ml pbs containing 1 × 10 6 viable a . hydrophila . each strain was injected into 24 fish and an additional 24 fish were injected with phosphate buffered saline ( pbs ) as controls . after injection , the fish were supplied with re - circulating water that had been passed through a sedimentation tank , drum filter , biofilter and ultraviolet ( uv ) radiation . the temperature of the tank water was maintained at 20 ± 1 ° c . blood samples were taken 3 , 9 , 12 and 21 days post - injection and pre - injection bleeds were taken from six fish . blood was stored overnight at 4 ° c . and the serum collected by centrifuging at 2000 × g for 5 min . the serum was stored at − 20 ° c . until further analysis . western blot analysis was performed using fish anti - sera as per the method outlined by wiens et al . ( 1990 : with modifications ). western blot analysis was carried out for the 14 a . hydrophila isolates shown in table 1 using pooled common carp serum raised against six isolates of a . hydrophila strains ( t4 , 98141 , hh , vds , catla and c241i ). different preparations of the bacterium ( i . e . whole cell ( wc ), outer membrane protein ( omp ) and extracellular products ( ecp )) prepared from these 6 isolates of a . hydrophila grown either in vitro or in vivo were screened by western blot with each of the 6 anti - sera raised against different isolates of a . hydrophila . the bacterial preparations described above were subjected to 12 % sds - page and the resolved antigens transferred to nitrocellulose membranes (@ 60 v for 1 h ). the nitrocellulose membranes were blocked using 2 % ( w / v ) casein for 1 h at 20 - 22 ° c . the membranes were washed three times ( tris buffered saline containing 0 . 1 % ( v / v ) tween - 20 : ttbs / 5 min per wash ) and then incubated overnight in the common carp anti - serum diluted 1 / 10 in tris buffered saline ( tbs ). membranes were again washed and incubated with an anti - carp igm monoclonal antibody ( aquatic diagnostics ltd , stirling , uk ) for 2 h . the membranes were washed and incubated with anti - mouse igg - hrp ( sigma , missouri , usa ) for 1 h . the blots were developed by adding chromogen and substrate solution ( 2 ml of 4 - chloro - naphthol solution with 10 mls of pbs and 10 μl of h 2 o 2 ) until bands were observed . the antigenic profile of wc preparation of isolate t4 grown in vitro was screened using 2d sds - page and western blotting with anti - serum ( raised for t4 isolate ) from common carp . assessing the levels of protection of a 50 kda protein in goldfish against a . hydrophila challenge : preparation of the antigen . volumes ( 100 μl ) of sample were subjected to 12 % sds page . the gels were run for between 5 - 6 h at 250 v / 130 ma . on completion the 50 kda band was cut from the gel and finely chopped . these were placed in tubes containing 300 μl sds - page reservoir buffer a blotting paper disk and a porous polyethylene plug . the tip of the tube was cut and placed into a 1 . 5 ml centrifuge tube containing 300 μl of 4 × sds - page reservoir buffer . the tubes were then placed into an electroluter and subjected to 50 v at 0 . 5 ma and a reverse run at 50 v for 5 sec at the end . the eluted protein was collected and the reservoir buffer removed using a 10 , 000 mw cut - off spin concentrator . the concentration of protein was determined . the presence of the 50 kda protein was confirmed by sds - page and western blot . for preliminary vaccination , four goldfish weighing around 30 - 40 g were injected ip with 200 μl of suspension having 12 . 3 μg of 50 kda protein in 60 μl of pbs and 140 μl of montanide adjuvant . another four fish were also injected with pbs to serve as controls . all the fish were challenged with a . hydrophila 31 days post - vaccination and sacrificed 21 days after challenge as described above . samples were taken from their kidneys . the relative percentage survival ( rps ) was calculated using the following formula ( ellis , 1988 ). in addition , two goldfish weighing 30 - 40 g were injected ip with 200 μl , of antigen ( i . e . 12 . 3 μg 50 kda protein ) emulsified with freund &# 39 ; s complete adjuvant ( fca ). thirty four days later , both fish were re - vaccinated with the same suspension as described above except freund &# 39 ; s incomplete adjuvant was used in place of fca . seventeen days after the booster injection , blood was collected from one fish and the anti - serum collected . three goldfish weighing between 30 - 40 g were immunised by ip injection with 0 . 1 ml of goldfish sera raised against the 50 kda protein electro - eluted from a . hydrophila , and 3 fish were injected with control serum collected from non - vaccinated goldfish . after 24 h all the fish were challenged with 0 . 1 ml of 2 . 5 × 10 7 ml − 1 a . hydrophila t4 isolate in pbs by ip injection , but on the opposite side to the site where they had been injected with the antiserum ( lafrentz , 2003 ). kidney samples from fish which died during the experiment and surviving fish at day 21 post - challenge were streaked on tsa to confirm specific mortality . sequencing and identification of the 50 kda protein of a . hydrophila a whole cell preparation of a . hydrophila t4 isolate in sds - page sample buffer was prepared for sequencing and analysis of the 50 kda protein by maldi - tof ms . samples were in - gel reductively alkylated prior to staining with colloidal coomassie blue , then digested in 0 . 1 % of n - octyl glucoside / 20 mm ammonium bicarbonate plus 12 . 5 μg ml − 1 trypsin , and the sample ( 1 . 5 μl ) was spotted from the extract ( 30 μl ) after adding an equal volume of acetonitrile for performing maldi - tof ms analysis . recombinant protein was produced in order to have a sufficient quantity of protein for a large scale vaccination trial . all the recombinant protein work was conducted at the genomic laboratory , tokyo university of marine sciences and technology , japan . polymerase chain reaction ( pcr ) of a . hydrophila 50 kda protein gene specific primers were designed to amplify the full length of the 50 kda protein gene based on the sequence data for the s - layer gene of a . hydrophila published by thomas and trust ( 1995a : see fig8 ). restriction sites nco i and bgl ii were added to the forward and reverse primers respectively to assist its cloning into the expression vector pqe60 . the pcr was run for 32 cycles ( 95 ′ c / 5 min ; denaturation for 95 ° c ./ 30 sec ; annealing at 55 ° c ./ 30 sec ; elongation at 72 ° c ./ 1 min and a final elongation step at 72 ° c ./ 5 min ). the primers used were as follows : forward : acatgggagttaatctggacactggtgc ; reverse : gacttgtggtacttgcgtaagtctaga the pcr products were resolved by 1 % agarose gel electrophoresis and the dna was extracted using a dna purification kit . digestion of the pcr products and the pqe 60 vector ( qiagen ) were carried out overnight at 37 ° c . both pqe 60 vectors and pcr products were purified after the digestion process and ligated by mixing 2 μl of vector with 8 μl of pcr products and adding 10 μl ligation high ( cosmo bio co ltd , tokyo ) before incubating it overnight at 16 ° c . transformation of vectors carrying 50 kda protein gene into e . coli escherichia coli , m15 ( quiagen , tokyo , japan ) was transformed with pqe 60 vectors carrying the amplified 50 kda protein gene of a . hydrophila . expression of the recombinant 50 kda protein in e . coli the clones containing the 50 kda protein gene insert identified by pcr , were inoculated into lb broth containing ampicillin ( 100 μg ml − 1 ) and kanamycin ( 25 μg ml − 1 ), and incubated overnight at 37 ° c . recombinant protein expression was induced by addition of 1 mm isopropyl - β - thiogalactoside ( iptg ) for 4 h . for large scale production , positive clones were cultured in 50 ml of antibiotic supplemented lb broth overnight at 37 ° c . with vigorous shaking . this culture was transferred to 1 l fresh lb broth and cultured at 37 ° c . with vigorous shaking . recombinant protein expression was induced by adding 1 mm iptg . sequencing of the a . hydrophila t4 isolate 50 kda protein gene the whole 50 kda protein gene of a . hydrophila isolate t4 was sequenced at the genomic laboratory , tokyo university of marine sciences and technology . recombinant 50 kda protein of a . hydrophila diluted in pbs was mixed with montanide adjuvant at a ratio of 30 : 70 ( v / v ) to a final antigen concentration of 300 μg ml − 1 . buffer ( pbs ) mixed with the adjuvant was also prepared at the same ratio as the antigen to serve as a negative control . one hundred and fifty common carp ( 30 - 40 g ) were vaccinated by ip injection with 0 . 1 ml of the vaccine preparation , and another 150 fish were injected with the pbs adjuvant mixture . all the fish were maintained for 35 days in 1 × 1m ( diameter × depth ) tanks with recirculating water before challenging with six different isolates of a . hydrophila . each of the six virulent isolates described above were used to challenge vaccinated fish . twenty vaccinated and 20 control fish were injected ip with each strain . the concentrations of the bacteria used in the challenge were 1 × 10 8 , 2 × 10 7 , 2 × 10 7 , 5 × 10 7 , 7 . 5 × 10 6 and 2 × 10 7 bacteria ml − 1 for t4 , 98140 , 98141 , hh , b2 / 12 and vds respectively . all 40 fish within each group were placed in separate glass tank ( 90 cm length × 47 cm height × 40 cm depth ) with aeration and recirculating water . the fish were maintained for 16 days post - challenge and dead fish were removed 3 times a day . samples from the kidney of dead fish and also from surviving fish at the end of the experiment on day 16 post - challenge were streaked onto tsa . the results obtained were statically analysed using chi - square test for survival , comparing the mortality of vaccinated fish with the control group fish after challenging with bacteria . antibody response of common carp infected with different isolates of a . hydrophila the antibody levels increased after day 9 and a positive response was observed on day 12 post - infection with all the isolates , except for isolate 98141 . by day 21 post - infection , this response had increased for all the isolates , with the highest antibody response recorded against isolate t4 ( fig1 ). the wc preparations of a . hydrophila isolates grown in vitro , screened by western blot with the anti - sera from infected common carp , exhibited a distribution of bands between 20 and 160 kda ( fig2 ). carp antibodies bound to antigens ranging from 30 - 50 kda for 3 of the virulent isolates , t4 , hh and b2 / 12 . except for isolate 2d20 , one band was observed at approximately 50 kda . the antibody response against wc , omp and ecp preparations of a . hydrophila grown in vitro and in vivo , showed similar profiles among isolates t4 , 98141 and hh ( fig3 ). with all the virulent isolates ( t4 , hh , 98141 and vds ), a band was evident at around 50 kda in wc and omp preparations . this band was also present in ecp preparations from in vitro cultured bacteria . the omp preparations from isolate vds grown in vitro showed 6 bands between 25 and 50 kda . a band at 50 kda was observed in wc and omp preparations of isolate catla grown in vitro . a band at around 50 kda was seen in both wc and omp preparations from isolate c241i grown in vitro and in vivo . six bands were seen between 35 and 100 kda with ecp preparations from bacteria grown in mw cut - off tubes but the bands were weakly stained in the case of bacteria grown in the 100 mw cut off tube . the 2d western blot for a . hydrophila t4 isolate using the antibody raised against the isolate in common carp expressed three spots at approximately 50 kda with pi values between 5 and 5 . 7 ( fig4 ). vaccination and passive immunisation of goldfish with an electro - eluted 50 kda protein from a . hydrophila in the vaccination experiment , two control and one vaccinated fish died due to unknown causes before challenging them with a . hydrophila isolate t4 . the two fish remaining in the control group died on day one and day 4 post - challenge ( fig6 ). one fish from the vaccinated group was also sacrificed one week post - challenge as it was suffering from a severe lesion and a . hydrophila was isolated from swabs taken from the lesion and kidney of the sacrificed fish . the remaining two fish in the vaccinated group were healthy and sacrificed at the end of the experiment , at 21 days post - challenge . all kidney swabs taken from dead fish were positive for a . hydrophila while the samples taken from two vaccinated fish at the end of experiment were negative . though the numbers of fish used in the experiment were low , the rps value was 66 . 7 %. the fish serum raised against the 50 kda protein of a . hydrophila used to passively immunise fish , had a titre of 1 / 16 . in the trial , one fish from the control group died two days post - infection and the presence of a . hydrophila in its kidney was confirmed using an api 20e strip . no other fish died and no kidneys were positive for the bacteria when remaining fish were sampled at the end of the trial on day 21 . maldi - tof sequence of the 50 kda protein from a . hydrophila after maldi - tof analysis and sequencing , the 50 kda protein of a . hydrophila isolate t4 was identified as a 47 . 6 kda s - layer protein ( fig7 and fig9 ). six bases were found to be different in the whole s - layer genome of a . hydrophila t4 isolate ( fig9 ) compared with the s - layer genome sequence of isolate tf7 reported by thomas and trust ( 1995a : fig8 ). the amino acid sequence shown in fig8 was obtained from the ncbi database . production of a recombinant protein for the s - layer of a . hydrophila isolate t4 bands at 1353 by on the 1 % ( w / v ) agrose gel verified that the amplification of s - layer genomic dna was successful ( fig1 ). after transformation of vectors into e . coli cells , the presence of the s - layer genome in e . coli was confirmed by pcr ( fig1 a ) and western blot ( fig1 b ). all six strains t4 , 98140 , 98141 , hh , b2 / 12 and vds were passaged twice through common carp and the bacteria were successfully recovered from both passages . during the first passage , no mortalities occurred in any of the groups of fish , while most fish died upon passaging the bacterium a second time with all strains except t4 . the values obtained in the preliminary challenge experiment in which the ld 50 dose for each strain was determined are given in table 2 . in fish challenged with isolate t4 , 75 % of control and 10 % of vaccinated fish died . a high percentage of mortalities were recorded in control fish challenged with isolate t4 compared with fish challenged with the other isolates of a . hydrophila . fifteen percent of the control group died by the first day post - challenge and 25 % had died by day 2 post - challenge . the levels of mortality decreased to 10 % by day 3 post - challenge and thereafter it varied between 5 and 10 % until the mortalities stopped by day 8 post - challenge . the mortality in the vaccinated group was 5 % on day 1 post - challenge and another 5 % had died by day 5 ( fig1 a ). a relatively high percentage survival ( rps ) value ( 87 %) was found with isolate t4 compared with other isolates ( table 3 ). mortality of 5 % was noted in the control group challenged with isolate hh on day 1 post - challenge . however , the mortality increased to 20 % by day 2 , 15 % occurred on day 5 and 10 % on day 6 . the remainder of mortalities ( i . e . 15 %) were distributed over the period after day 7 . in the vaccinated group , 5 % of mortalities were recorded on the first and third day post - challenge ( fig1 b ). the second highest rps value ( 85 %) in the trial was observed with this isolate . fifty - percentage mortality was seen with the control group challenged with isolate 98140 . thirty percent died in the control group during the first two days post - challenge and remainder died over the course of the experiment ( 16 days post - challenge ). five percent mortality was recorded in the vaccinated group during the first two days post - challenge , and no further mortalities occurred in this group leading to an 80 % rps value for this isolate ( fig1 c ). in the control group challenged with isolate 98141 , 25 % of mortality occurred over the first two days of the experiment and thereafter 15 % mortalities occurred . the mortality with the vaccinated group was similar to that of the mortality recorded with vaccinated group challenged with isolate 98140 ( fig1 d ). an rps value of 75 % was recorded with this isolate . the control group challenged with isolate vds experienced a 10 % mortality on day 1 , day 2 and day 5 post - challenge , while 5 % mortalities occurred on the third and sixth day post - challenge ( fig1 e ). a total of 15 % mortality occurred in the vaccinated group distributed over day 2 , 3 and 5 post - challenge . the rps value with this isolate was 62 . 5 %. percentage mortality in the control group rose to 30 % during the first two days after challenging the fish with isolate b2 / 12 . another 15 % mortality occurred in this group over the remainder of the experiment . the highest percentage mortality amongst vaccinated fish was recorded in the group challenged with b2 / 12 . ten percent mortality was observed in this group on the next day post - challenge and 5 % of mortality occurred on the second day and the third day post - challenge ( fig1 f ). the rps value was low ( 56 %) with this isolate compared to other isolates . all the fish that died during the experiment showed the presence of a . hydrophila in their kidneys . in contrast , a . hydrophila was not cultured from kidney swabs taken from the surviving fish except very few colonies from one fish in the vaccinated group challenged with isolate 98140 and one fish in the control group challenged with isolate 98141 . statistical analysis revealed that survival against isolates t4 , 98140 , 98141 and hh were significant in vaccinated fish compared to control fish , while levels of survival were not statistically significant for isolates b2 / 12 and vds ( table 3 ). in this study , common carp were infected with a . hydrophila and the anti - sera produced were used to identify immunogenic components of the bacterium . the different a . hydrophila isolates examined elicited a variety of responses in common carp , as determined by elisa . an increase in antibody response against a . hydrophila was seen after day 9 post - infection for all the isolates except one ( 98141 ). antibody response peaked on day 12 post - infection for two isolates ( hh and catla ) and on day 21 post - infection for three isolates ( t4 , vds and c241i ). the antibody response of common carp did not show any differentiation between virulent and avirulent isolates of a . hydrophila . this may be due to differences in the ability of the immune system of the host to respond to foreign agents . western blot analysis using the anti - sera produced on day 21 post - infection , against different strains of a . hydrophila , showed differences in the profiles between the isolates . however , when pooled sera ( from common carp infected with 6 different isolates ) were used to examine the response against the 14 isolates of a . hydrophila ( described in table 1 ), a band at around 50 kda was observed in all the isolates grown in vitro , except for isolate 2d 2 o . moreover , bands from 30 - 50 kda were stained in the profiles of 3 of the virulent isolates , t4 , hh and b2 / 12 grown in vitro . a band at around 50 kda was seen with all the preparations ( wc , omp , ecp ) from the virulent isolates grown both in vitro and in vivo compared with avirulent isolates , with the exception of the ecp from bacteria grown in vivo . the 2d western blot analysis of a . hydrophila ( t4 isolate ) wc revealed 3 spots at approximately 50 kda between 5 and 5 . 7 μl range when serum raised against t4 isolates was used . the results of the 1d and 2d western blot analysis suggest that a molecule at approximately 50 kda ( ranging between 47 and 51 kda ) might be one of the major immunogenic components of a . hydrophila . the 50 kda protein of a . hydrophila was considered to be the most immunogenic and most homogenous protein , recognised on each of the a . hydrophila isolates examined . the 50 kda protein conferred protection in goldfish against a . hydrophila in the direct immunisation trial . after maldi - tof ms sequencing , six bases were found to be different in the whole s - layer genome of a . hydrophila t4 isolate ( fig9 ) compared with the s - layer genome sequence of isolate tf7 reported by thomas and trust ( 1995a : fig8 ). this in turn could result with changes in 4 amino acids in the s - layer protein of a . hydrophila isolate t4 compared with s - layer amino acid sequence reported for isolate tf7 . a recombinant s - layer protein of a . hydrophila was produced to confirm the protection efficacy of this protein in common carp against different isolates of a . hydrophila . the recombinant s - layer protein proved reactive in western blot analysis against anti - a . hydrophila t4 common carp serum and it was used to vaccinate a number of fish . these fish were then challenged with a range of different a . hydrophila isolates . high mortality rate was observed both in the vaccinated and control group within two days post - challenge compared with the mortality from day 3 post - challenge as described in fig4 . 8 . the protection elicited by the s - layer protein in vaccinated fish indicates a potential role for this protein in the virulence of a . hydrophila . the s - layer protein antigen of a . hydrophila appears to have conferred protection against the different isolates of a . hydrophila tested , although the rps values of carp did vary between the different challenge isolates . no mortalities occurred in any of the groups of fish after day 11 post - challenge in the vaccination trial described in this chapter . moreover , no colonies of a . hydrophila grew from the kidney swabs taken from surviving fish at the end of experiment except for two fish . this suggests that most of the surviving fish in the control group had cleared the bacterium through their own immune response , as fish can produce an antibody response against different components of bacterium and clear the bacteria in blood circulatory system within seven days post - infection ( leung and stevenson , 1988b ; chandran et al ., 2002b ). asha a ., nayak d . k ., shankar k . m . and mohan c . v . ( 2004 ) antigen expression in biofilm cells of aeromonas hydrophila employed in oral vaccination of fish . fish & amp ; shellfish immunology 16 , 429 - 436 . azad i . s ., shankar k . m ., mohan c . v . and kalita b . ( 1999 ) biofilm vaccine of aeromonas hydrophila - standardization of dose and duration for oral vaccination of carps . fish & amp ; shellfish immunology 9 , 519 - 528 . azad i . s ., shankar k . m ., mohan c . v . and kalita b . ( 2000a ) uptake and processing of biofilm and free - cell vaccines of aeromonas hydrophila in indian major carps and common carp following oral vaccination - antigen localization by a monoclonal antibody . diseases of aquatic organisms 43 , 103 - 108 . baba t ., imamura j ., izawa k . and ikeda k . ( 1988a ) cell - mediated protection in carp , cyprinus carpio l ., against aeromonas hydrophila . journal of fish diseases 11 , 171 - 178 . baba t ., imamura j ., izawa k . and ikeda k . ( 1988b ) immune protection in carp , cyprinus carpio l ., after immunization with aeromonas hydrophila crude lipopolysaccharide . journal of fish diseases 11 , 237 - 244 . chandran m . r ., aruna b . v ., logambal s . m . and dinakaran m . r . ( 2002b ) immunisation of indian major carps against aeromonas hydrophila by intraperitoneal injection . fish & amp ; shellfish immunology 13 , 1 - 9 . chandran m . r ., aruna b . v ., logambal s . m . and michael r . d . ( 2002a ) field immunization of indian major carps against aeromonas hydrophila by dooley j . s . g ., lallier r . and trust t . j . ( 1986 ) surface antigens of virulent strains of aeromonas hydrophila . veterinary immunology and immunopathology 12 , 339 - 344 . ellis a . e . ( 1988 ) general principles of fish vaccination . in : fish vaccination ( ed . by ellis a . e . ), academic press , london , pp . 2031 . esteve c ., amaro c ., garay e ., santos y . and toranzo a . e . ( 1995 ) pathogenicity of live bacteria and extracellular products of motile aeromonas isolated from eels . journal of applied bacteriology 78 , 555 - 562 . fang h . m ., ge r . and sin y . m . ( 2004 ) cloning , characterisation and expression of aeromonas hydrophila major adhesin . fish & amp ; shellfish immunology 16 , 645 - 658 . janda j . m ., guthertz l . s ., kokka r . p . and shimada t . ( 1994b ) aeromonas species in septicemia : laboratory characteristics and clinical observations . clinical infectious diseases 19 , 77 - 83 . khashe s ., hill w . and janda j . m . ( 1996 ) characterization of aeromonas hydrophila strains of clinical , animal , and environmental origin expressing the o : 34 antigen . current microbiology 33 , 104 - 108 . kusuda r ., chen c . and kawai k . ( 1987 ) changes in the agglutinating antibody titre and serum protein composition of colored carp after immunization with aeromonas hydrophila . fish pathology 22 , 141 - 146 . lafrentz b . r ., lapatra s . e ., jones g . r . and cain k . d . ( 2003 ) passive immunisation of rainbow trout , oncorhynchus mykiss ( walbaum ), aganist flavobacterium psychrophilum , the causative agent of bacterial coldwater disease and rainbow trout fry syndrome . journal of fish diseases 26 , 377 - 384 . lamers c . h . j ., de haas m . j . h . and van muiswinkel w . b . ( 1985 ) the reaction of the immune system of fish to vaccination : development of immunological memory in carp , cyprinus carpio l ., following direct immersion in aeromonas hydrophila bacterin . journal of fish diseases 8 , 253 - 262 . leung k . y . and stevenson r . m . w . ( 1988b ) tn5 - induced protease - deficient strains of aeromonas hydrophila with reduced virulence for fish . infection and immunity 56 , 2639 - 2644 . leung k . y ., wong l . s ., low k . w . and sin y . m . ( 1997 ) mini - tn5 induced growth - and protease - deficient mutants of aeromonas hydrophila as live vaccines for blue gourami , trichogaster trichopterus ( pallas ). aquaculture 158 , 11 - 22 . leung k . y ., yeap l v ., lam t . j . and sin y . m . ( 1995 ) serum resistance as a good indicator for virulence in aeromonas hydrophila strains isolated from diseased fish in south - east asia . journal of fish diseases 18 , 511 - 518 . loghothetis p . n . and austin b . ( 1994 ) immune response of rainbow trout ( oncorhynchus mykiss , walbaum ) to aeromonas hydrophila . fish & amp ; shellfish immunology 4 , 239 - 254 . loghothetis p . n . and austin b . ( 1996b ) antibody responses of rainbow trout ( oncorhynchus mykiss , walbaum ) to live aeromonas hydrophila as assessed by various antigen preparations . fish & amp ; shellfish immunology 6 , 455 - 464 . majumdar t ., ghosh d ., datta s ., sahoo c ., pal j . and mazumder s . ( 2006 ) an attenuated plasmid - cured strain of aeromonas hydrophila elicits protective immunity in clarias batrachus l . fish & amp ; shellfish immunology in press . moral c . h ., del castillo e . f ., fierro p . l ., cortes a . v ., castillo j . a ., soriano a . c ., salazar m . s ., peralta b . r . and carrasco g . n . ( 1998 ) molecular characterization of the aeromonas hydrophila aroa gene and potential use of an auxotrophic aroa mutant as a live attenuated vaccine . infection and immunity 66 , 1813 - 1821 . munn c . b . ( 1994 ) the use of recombinant dna technology in the development of fish vaccines . fish & amp ; shellfish immunology 4 , 459 - 473 . nayak d . k ., asha a ., shankar k . m . and mohan c . v . ( 2004b ) evaluation of biofilm of aeromonas hydrophila for oral vaccination of clarias batrachus - a carnivore model . fish & amp ; shellfish immunology 16 , 613 - 619 . newman s . g . ( 1993 ) bacterial vaccines for fish . annual review of fish diseases 3 , 145 - 185 . olivier , g ., lallier , r . and lariviere , s . ( 1981 ) a toxigenic profile of aeromonas hydrophila and aeromonas sobria isolated from fish . canadian journal of microbiology 27 , 330 - 333 . rahman m . h . and kawai k . ( 2000 ) outer membrane proteins of aeromonas hydrophila induce protective immunity in goldfish . fish & amp ; shellfish immunology 10 , 379 - 382 . sakazaki r . and shimada t . ( 1984 ) o - serogrouping scheme for mesophilic aeromonas strains . japanese journal of medical science and biology 37 , 247 - 255 . shotts e . b ., gaines j . l ., martin l . and prestwood a . k . ( 1972 ) aeromonas - induced deaths among fish and reptiles in an eutrophic inlands lake . journal of the american veterinary medical association 161 , 603 - 607 . stevenson r . m . w . ( 1988 ) vaccination against aeromonas hydrophila . in : fish vaccination ( ed . by ellis a . e . ), academic press , new york , pp . 112 - 123 . thomas s . r . and trust t . j . ( 1995a ) tyrosine phosphorylation of the tetragonal paracrystalline array of aeromonas hydrophila : molecular cloning and high - level expression of the s - layer protein gene . journal of molecular biology 245 , 568 - 581 . vivas j ., riano j ., carracedo b ., razquin b . e ., lopez - fierro p ., naharro g . and villena a . j . ( 2004b ) the auxotrophic aroa mutant of aeromonas hydrophila as a live attenuated vaccine against a . salmonicida infections in rainbow trout ( oncorhynchus mykiss ). fish & amp ; shellfish immunology 16 , 193 - 206 . vivas j ., carracedo b ., riano j ., razquin b . e ., lopez - fierro p ., acosta f ., naharro g . and villena a . j . ( 2004c ) behavior of an aeromonas hydrophila aroa live vaccine in water microcosms . applied and environmental microbiology 70 , 2702 - 2708 . vivas j ., razquin b ., lopez - fierro p . and villena a . j . ( 2005 ) modulation of the immune response to an aeromonas hydrophila aroa live vaccine in rainbow trout : effect of culture media on the humoral immune response and complement consumption . fish & amp ; shellfish immunology 18 , 223 - 233 .
| 2 |
fig1 shows a network 1 with communication nodes 2 , 3 , 4 and 5 . communication node 5 is a clock generator node which provides the reference time base for synchronization of the time bases in the other nodes of network 1 . the reference clock pulse generator time base of communication node 5 is generated by a timer 6 which , by timing with a local clock of communication node 5 , constantly counts from 0 to n − 1 . the communication node 5 is used to create a data telegram 7 for node 2 . the data telegram 7 contains the desired value of the time base of node 2 at the point at which the data telegram is received . the time base of node 2 is realized by a timer 8 , which basically has the same structure as the timer 6 of the communication node 5 . the timer 8 has its own local clock for timing of the counter of the timer which is independent of the clock of the communication node 5 . when node 2 is switched on timer 8 is thus asynchronous with timer 6 . after an initial synchronization an ongoing adjustment is necessary since the clock frequencies of the different clocks of the time bases are never exactly identical . for synchronization of the time base of node 2 , i . e . of its timer 8 , communication node 5 generates data telegram 7 . the data telegram 7 is sent from port h of communication node 5 to port a of communication node 2 via the corresponding network connection in network 1 . in this way communication node 2 obtains the necessary desired value for adjusting its time base . accordingly communication nodes 3 and 4 also receive data telegrams 7 from communication node 5 for adjusting the corresponding timers 9 and 10 . after the synchronization of the time base in the individual nodes 2 , 3 and 4 of the network 1 the communication cycles of point - to - point connections of the network 1 are asynchronous to each other . for example the communication node 2 can send one or more data telegrams to the communication node 3 during a communication cycle by using a point - to - point connection between port b of the communication node 2 and port c of the communication node 3 . accordingly , data telegrams can also be received during the synchronized communication cycle from port c of communication node 3 to port b of communication node 2 . the same applies correspondingly to communication between two different communication nodes which are linked to each other by a network connection of network 1 . when such a direct network connection does not exist a telecommunication connection it will be established via a switching matrix in the communication node . if for example the communication node 4 would like to send a data telegram to the communication node 2 , this will be done so that communication node 4 initially sends the data telegram from its port e to the port d of communication node 3 , from where it is forwarded via the switching matrix of communication node 3 to the port c , to be transmitted from there via the direct network connection point - to - point to the port b of communication node 2 . this process requires , especially for real - time capable packet data transmission in a deterministic communication system , as needed particularly for the purposes of automation technology , a synchronization of the communication cycles of the individual point - to - point connections in the network 1 . fig2 shows a block diagram of communication node 2 of fig1 . timer 8 of communication node 2 has a counter 11 which constantly counts from 0 to the threshold value n − 1 in the threshold value register 12 . the counter 11 is clocked by a local oscillator 13 , that is by a clock . the contents of the threshold value register 12 , i . e . the parameter n , can be selected by a user . selecting the parameter n defines the length of a communication cycle . the counter 11 has a register 14 with the actual value of the counter . furthermore the counter 11 has a register 15 and a register 16 , each for storing a parameter s 1 and s 2 of the manipulated variables for adjusting counter 11 to synchronize the time base of the communication cycle . when the threshold value specified by the contents of threshold value register 12 is reached , counter 11 issues a cycle signal which starts a transmission cycle . this cycle signal is issued for example to port b of communication node 2 . port b contains a send list 17 and a receive list 18 . during a communication cycle both the send list 17 and also the receive list 18 are processed . the communication node 2 also has a program 19 . the program 19 has a program module 24 for entering the actual counter value of counter 11 and the desired counter value . furthermore program 19 has a program module 21 for determining a system deviation by comparing the actual timer value and the desired timer value . furthermore program 19 has program modules 22 and 23 each with an adjustment rule for creating a manipulated variable for controlling or adjusting the time base in accordance with the system deviation . the program module 22 is used here for controlling an initialization phase and program module 23 for adjustment during operation . both program modules 22 and 23 generate the parameters s 1 and s 2 of the manipulated variable for the adjustment of the time base , i . e . of the timer 11 of timer 8 . at this input the program 19 receives the contents of register 14 , i . e . the actual count of value and in addition it receives via a communication connection between communication node 2 and communication node 5 ( cf . fig1 ) the data telegram 7 ( cf . likewise fig1 ) via the port a of communication node 2 . during the initialization phase of node 2 , i . e . during of the initial synchronization of the timer 11 which is running asynchronously the communication node 2 receives the data telegram 7 with the current desired timer value . this data telegram 7 will be received by the communication node 5 , i . e . its port h at port a of communication node 2 and forwarded from there to program 19 . likewise in program 19 the actual counter value from register 14 is entered . from program module 20 the corresponding actual timer and threshold values are then forwarded to program module 21 to determine the system deviation . to do this program module 21 accesses program module 22 during the initialization phase . this then generates the manipulated variable , i . e . the parameters s 1 and s 2 of the manipulated variable . these parameters will be written by program 19 into registers 15 or 16 . this adjustment is preferably not effective until the cycle signal has been issued , i . e . for the subsequent communication cycle . parameter s 1 specifies for such a subsequent communication cycle which of the clocks is to be influenced by the adjustment in the communication cycle . in this case for example this can involve a second , third or mth clock . parameter s 2 in register 16 by contrast specifies how to proceed with the clocks to be influenced . preferably the contents of register 16 are either 0 or 2 , i . e . an extension of the cycle is achieved by the timer 11 not being incremented for the clock concerned or a shortening of the cycle is achieved by the timer 11 being incremented by 2 at the clock concerned . it is not however mandatory for the adjustment by means of the parameters s 1 and s 2 to be undertaken in the very next communication cycle , it can also be undertaken in subsequent communication cycles . after the initialization phase , i . e . after the initial synchronization of the timer 11 which is initially running fully asynchronously , the program module 21 selects program module 23 for the adjustment which then creates the parameters s 1 and s 2 in accordance with the adjustment rules applicable for the operating phase . by this method of adjustment the extension or shortening of the communications cycle are distributed uniformly over the clocks during a communication cycle . in accordance with an alternative preferred embodiment the synchronization is undertaken during the initialization phase of the node not by adjustment , in which ( as in operation ) the number of clocks to be adjusted are uniformly distributed within the cycle . with the aid of a first synchronization telegram in the initialization phase the synchronization slave is by contrast first set “ rigidly ” to the value of the synchronization master . this is advantageous , in order , with a max . adjustment difference of a half isochronous cycle , not to obtain any unnecessarily long synchronization times . this is especially necessary for networks with a number of nodes , since otherwise oscillation effects can occur in the network under some circumstances , which may possibly not allow any adjustment at all and thereby no synchronization . fig3 shows a flowchart of an embodiment of the method in accordance with the invention . in step 30 a desired value of the time base of the relevant communication node is received from a clock pulse generator of the communication system . in step 32 a system deviation is determined from the difference between desired value and the actual timer value of the time base of the relevant communication node . in step 34 a manipulated variable for adjusting the time base , that is the duration of a communication cycle , is determined by means of an adjustment rule from the system deviation . the manipulated variable is determined in such a way here that the adjustment of the duration of the subsequent communication cycle is distributed as uniformly as possible over the clocks of the communication cycle . the actual adjustment of the communication cycle is undertaken in step 36 by activating the corresponding manipulated variables in the timer of the communications node concerned after issuing the cycle signal , i . e . at the beginning of the subsequent communication cycle . fig4 shows an example for the use of the adjustment method in accordance with the invention . a signal 24 of the synchronization master , i . e . the clock of the clock pulse generator node , is subdivided into cycles 25 . in each cycle 25 the timer of the clock pulse generator node counts from 0 to 9 , i . e . 10 clocks 26 are generated per cycle 25 . this provides the clock pulse generator time base for the synchronization of the communication cycles in the communication system . the signal 27 belongs to a synchronization slave , i . e . one of the communication nodes of the communication system , for which the time base is to be adjusted for synchronization of its communication cycles . the synchronization slave initially has a system deviation from the cycle of the synchronization master of two clocks . a corresponding manipulated variable is determined from this system deviation . the manipulated variable specifies whether within the next communication cycle this communication cycle must be extended or shortened and by how much the next communication cycle must be changed if necessary . in the example case considered here the subsequent communication cycle is to be extended by four clocks . this is to be done by repeating every second clock . the corresponding parameters s 1 and s 2 ( cf . fig2 ) are then s 1 = 2 and s 2 = 0 . it is particularly advantageous here that the additional four clocks are not simply appended to this cycle to extend it but are uniformly distributed within the cycle so that the subordinate cycle clock 28 varies at most by +/− one clock . this avoids cycle clock 28 of the communication cycle being extended disproportionately at the end of the communication cycle compared to other communication cycles . the outcome of this is that the subordinate higher frequency cycle clock 28 merely features a jitter of one timer clock within the communication cycle . the present invention is particularly advantageous in that it allows a distributed software / hardware control of the communication cycle , i . e . of what is referred to as the isochronous cycle , in real time capable network components , particularly ethernet switches . this makes it possible to dynamically adapt the control algorithms depending on the network characteristics or area of application in the field . in this case the adjustment in the initialization or startup phase of the communication system can be distinguished from the adjustment during operation . furthermore , because of the uniform distribution of the manipulated variable and the associated adjustment of the time base during a communication cycle subordinate cycles can also be adjusted .
| 7 |
examples of the phenolic compounds of the previously described formula ( i ) employed as the color developers in the present invention are as follows : ______________________________________compoundno . structural formula______________________________________ ( 1 ) ## str4 ## ( 2 ) ## str5 ## ( 3 ) ## str6 ## ( 4 ) ## str7 ## ( 5 ) ## str8 ## ( 6 ) ## str9 ##( 7 ) ## str10 ## ( 8 ) ## str11 ## ( 9 ) ## str12 ## ( 10 ) ## str13 ## ( 11 ) ## str14 ## ______________________________________ the above phenolic compounds can be used in combination with conventional phenolic materials when necessary . the colorless or light - colored leuco dyes to be used in combination with the above phenolic compounds are , for example , as follows : examples of the fluoran compounds of the general formula ( ii ) are as follows : the above leuco dyes can be used alone or in combination . it is preferable that the phenolic materials of the formula ( i ) for use in the present invention be employed in an amount of 1 to 6 times the amount of the leuco dye . in the thermosensitive coloring layer of a thermosensitive recording material according to the present invention , the following binder agents can be employed : water - soluble organic polymers such as polyvinyl alcohol , methoxy cellulose , hydroxyethyl cellulose , carboxymethyl cellulose , polyvinyl pyrrolidone , polyacrylamide , polyacrylic acid , starch and gelatin ; and water emulsions of polystyrene , copolymer of vinyl chloride and vinyl acetate , and polybutyl methacrylate . furthermore , in the thermosensitive coloring layer , the following additives can be contained in the form of fine powder to obtain clear images : calcium carbonate , silica , barium sulfate and aluminum stearate . in order to increase the thermal sensitivity of the recording material , a variety of conventional thermo - fusible materials can also be employed . as the thermo - fusible materials , organic low - molecular - weight compounds , oligomers and polymers having appropriate melting or softening points can be employed . specific examples of such organic materials are animal waxes , vegetable waxes , mineral waxes , petroleum waxes and other synthesized waxes such as higher fatty acids , higher fatty amine , higher fatty acid amides , phenyl benzoate derivatives , crystalline alkylnaphthalenes , crystalline alkyldiphenyl derivatives and alkylphenyl derivatives . the thermosensitive recording material according to the present invention can be prepared with a variety of structures , including all the conventional structures in which the coloring reaction between a leuco dye and a color developer is employed . for instance , in the thermosensitive recording material according to the present invention , a leuco dye and the color developer can be supported on the same support material or they can be supported separately on two different support materials . in the case where a leuco dye and a color developer are supported on the same support material , a thermosensitive coloring layer comprising the leuco dye and the color developer is formed on the support material , with addition of a binder agent thereto , or a thermosensitive coloring layer comprising two layers , with the leuco dye contained in one layer , and the color developer contained in the other layer . in the case where a leuco dye and the color developer are separately supported on the support materials , those support materials are superimposed on each other in such a manner that the surface of one support material which bears the leuco dye and the surface of the other support material which bears the color developer come into contact with each other when thermal printing is performed . thereafter , the two support materials are separated , whereby color images are obtained in one support material . in other words , the present invention can be applied to any conventional thermosensitive recording materials which utilize the coloring reaction between a leuco dye and a color developer . the thermosensitive recording according to the present invention can also be used as a thermal - image - transfer - type thermosensitive recording material which comprises an image transfer sheet consisting of a support material and an image transfer layer formed on the support material , containing a leuco dye , and an image acceptor sheet consisting of a support material and an image acceptor layer formed on the support material , containing the color developer . in the case of the thermal - image - transfer - type recording material , the image transfer sheet is superimposed on the image acceptor sheet in such a manner that the image acceptor layer comes into contact with the image transfer layer of the image transfer sheet , so that thermal printing is performed on the front side or back side of the superimposed sheets , whereby the desired developed images are formed on the image acceptor layer of the acceptor sheet . the thermosensitive recording material according to the present invention can be prepared , for example , by application of a thermosensitive coloring layer formation liquid containing the above described components to a support material , for example , paper , synthetic paper or a plastic film , and by drying the same . when the leuco dye and the color developer are supported on two separate support materials , a leuco dye dispersion or solution and a color developer dispersion or solution are applied to each support material . the thermosensitive recording material according to the present invention can be employed in a wide variety of fields , particularly advantageously in the fields of thermosensitive recording label sheets and thermosensitive recording type magnetic tickets , utilizing the excellent stability of the developed images . when the thermosensitive recording material is employed as the thermosensitive recording label sheet , there is formed a thermosensitive coloring layer comprising one of the previously mentioned leuco dyes and one of the phenolic materials on one side of a support material , and on the other side of the support material , there is formed an adhesive layer , and a disposable backing sheet is attached to the adhesive layer . when the thermosensitive recording material is employed as the thermosensitive recording type magnetic ticket , the disposable backing sheet in the label sheet is replaced with a magnetic recording layer comprising as the main components a ferromagnetic material and a binder agent . the phenolic compounds of the previously described general formula ( i ) can be prepared without difficulty . for example , the compound no . 3 of the following formula was prepared as follows : ## str15 ## 6 . 4 g of sodium hydroxide was dissolved in 22 g of methanol . to this solution , 20 . 2 g of p - hydroxybenzenethiol was added . further , 9 . 42 g of 2 - hydroxy - 1 , 3 - dichloropropane was added dropwise to this mixture at room temperature . after the addition of the 2 - hydroxy - 1 , 3 - dichloropropane , the reaction mixture was heated for 2 hours under the condition that the methanol contained in the reaction mixture was refluxed . after this , the reaction mixture was cooled and freed of the methanol under reduced pressure . to the residue was added 500 ml of water . crystals were separated , which were filtered off , sufficiently washed with water and dried . the thus obtained crystals were recrystallized from a mixed solvent of toluene and ethyl acetate , so that 15 . 5 g of 1 , 3 - di ( 4 &# 39 ;- hydroxyphenylthio )- 2 - hydroxypropane ( compound no . 3 ) was obtained in the form of white crystals ( m . p . 108 °- 109 ° c .). the results of the elemental analysis of the product , 1 , 3 - di ( 4 - hydroxyphenylthio )- 2 - hydroxypropane , were as follows : ______________________________________ % c % h % s______________________________________found 58 . 51 5 . 18 20 . 68calculated 58 . 42 5 . 23 20 . 79______________________________________ embodiments of the thermosensitive recording material according to the present invention will now be explained by referring to the following examples . a dispersion a - 1 , a dispersion b - 1 and a dispersion c - 1 were separately prepared by grinding and dispersing the following respective components in a ceramic bowl for 2 days : ______________________________________ parts by weight______________________________________dispersion a - 13 -( n -- cyclohexyl - n -- methylamino )- 206 - methyl - 7 - anilinofluoran10 % aqueous solution of hydroxyethyl 20cellulosewater 60dispersion b - 11 , 3 - di ( 4 &# 39 ;- hydroxyphenylthio )- 2 - hydroxy - 20propane ( compound no . 3 ) 10 % aqueous solution of hydroxyethyl 20cellulosewater 60dispersion c - 1calcium carbonate 205 % aqueous solution of methyl cellulose 20water 60______________________________________ 10 parts by weight of the dispersion a - 1 , 30 parts by weight of the dispersion b - 1 , 30 parts by weight of the dispersion c - 1 and 10 parts by weight of a 20 % aqueous alkali solution of isobutylene -- maleic anhydride were mixed to prepare a thermosensitive coloring layer formation liquid . this thermosensitive coloring layer formation liquid was applied to the surface of a sheet of commercially available high quality paper ( 50 g / m 2 ) by a wire bar and was then dried , whereby a thermosensitive coloring layer was formed thereon . the deposition of the thermosensitive coloring layer on the sheet was in the range of 4 to 5 g / m 2 when dried . the thus prepared thermosensitive recording material was subjected to calendering , so that surface of the thermosensitive coloring layer was made smooth to the degree ranging from 500 to 600 sec in terms of bekk &# 39 ; s smoothness , whereby a thermosensitive recording material no . 1 according to the present invention was prepared . example 1 was repeated except that the dispersion b - 1 employed in example 1 was replaced by a dispersion b - 2 with the following formulation , whereby a thermosensitive recording material no . 2 according to the present invention was prepared . ______________________________________ parts by weight______________________________________dispersion b - 21 , 6 - di ( 4 &# 39 ;- hydroxyphenylthio )- 2 , 4 - 20dihydroxyhexane ( compound no . 10 ) 10 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 1 was repeated except that the dispersion b - 1 employed in example 1 was replaced by a dispersion b - 3 with the following formulation , whereby a thermosensitive recording material no . 3 according to the present invention was prepared . ______________________________________ parts by weight______________________________________dispersion b - 31 , 4 - di ( 4 &# 39 ;- hydroxyphenylthio )- 2 , 3 - 20dihydroxybutane ( compound no . 8 ) 10 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 1 was repeated except that the dispersion b - 1 employed in example 1 was replaced by a comparative dispersion cb - 1 with the following formulation , whereby a comparative thermosensitive recording material no . 1 was prepared . ______________________________________ parts by weight______________________________________comparative dispersion cb - 1bisphenol a 2010 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 1 was repeated except that the dispersion b - 1 employed in example 1 was replaced by a comparative dispersion cb - 2 with the following formulation , whereby comparative thermosensitive recording material no . 2 was prepared . ______________________________________ parts by weight______________________________________comparative dispersion cb - 2p - hydroxybenzoic acid benzyl ester 2010 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ the thus prepared thermosensitive recording materials no . 1 through 3 according to the present invention and the comparative thermosensitive recording materials no . 1 and no . 2 were subjected to thermal printing by use of a thermal printing test apparatus including thermal head ( made by matsushita electronic components co ., ltd .) under the conditions that the power applied to the head was 0 . 45 w / dot , the recording time per line was 20 msec , the scanning line density was 8 × 3 . 85 dots / mm , with the pulse width applied thereto changed to 3 steps of 1 . 6 msec , 2 . 0 msec , and 2 . 4 msec . the density of the developed images was measured by macbeth densitometer rd - 514 with a filter w - 106 . the results are shown in the following table 1 . table 1______________________________________ developed thermosensitive image density back - recording pulse width ( msec ) ground material 1 . 6 2 . 0 2 . 4 density______________________________________example 1 no . 1 0 . 94 1 . 25 1 . 28 0 . 10example 2 no . 2 0 . 92 1 . 22 1 . 27 0 . 09example 3 no . 3 0 . 92 1 . 23 1 . 27 0 . 10comparative no . 1 0 . 40 0 . 74 1 . 05 0 . 09example 1comparative no . 2 0 . 90 1 . 21 1 . 27 0 . 08example 2______________________________________ the thermosensitive recording materials with images printed thereon under the condition of the pulse width being 2 . 4 msec were allowed to stand at room temperature for one week and the image densities were measured again by the macbeth densitometer rd - 514 and were visually checked whether or not crystals ( or powder ) of the phenolic material were separated on the surface of the recording materials . the results are shown in table 2 . table 2______________________________________ thermosensitive separation of recording image density phenolic material after 1 week material______________________________________example 1 no . 1 1 . 29 noneexample 2 no . 2 1 . 28 noneexample 3 no . 3 1 . 29 nonecomparative no . 1 1 . 03 noneexample 1comparative no . 2 0 . 95 observedexample 2______________________________________ the thermal recording materials no . 1 through no . 3 according to the present invention and the comparative thermal recording materials no . 1 and no . 2 were subjected to thermal printing tests by use of a heat gradient test apparatus ( made by toyo seiki co ., ltd .) at 150 ° c . with a pressure of 2 kg / cm 2 and with a heat application time of 1 second , so that printed images were formed on each of the thermosensitive recording materials . to the printed images on the thermosensitive recording materials , there was applied cotton seed oil , and the recording materials were then allowed to stand for 24 hours to see whether or not the images were discolored or caused to disappear by the oil . the results are shown in the following table 3 . table 3______________________________________ thermosensitive discoloration recording or disappearance of material images______________________________________example 1 no . 1 substantially no discolorationexample 2 no . 2 substantially no discolorationexample 3 no . 3 substantially no discolorationcomparative no . 1 disappearedexample 1comparative no . 2 disappearedexample 2______________________________________ as can be seen from the above results , the thermosensitive recording materials according to the present invention are excellent in development performance in high - speed recording and provided images free from the white crystallization of the phenolic materials and discoloration by the oil and stabler in quality as compared with the comparative thermosensitive recording material examples . a dispersion a - 2 , a dispersion b - 1 and a dispersion c - 1 were separately prepared by grinding and dispersing the following respective components in a ceramic bowl for 2 days : ______________________________________ parts by weight______________________________________dispersion a - 23 - diethylamino - 6 - methyl - 207 - anilinofluoran10 % aqueous solution of hydroxyethyl 20cellulosewater 60dispersion b - 11 , 3 - di ( 4 &# 39 ;- hydroxyphenylthio )- 2 - hydroxy - 20propane ( compound no . 3 ) 10 % aqueous solution of hydroxyethyl 20cellulosewater 60dispersion c - 1calcium carbonate 205 % aqueous solution of methyl cellulose 20water 60______________________________________ 10 parts by weight of the dispersion a - 2 , 30 parts by weight of the dispersion b - 1 , 30 parts by weight of the dispersion c - 1 and 10 parts by weight of a 20 % aqueous alkali solution of isobutylene -- maleic anhydride were mixed to prepare a thermosensitive coloring layer formation liquid . this thermosensitive coloring layer formation liquid was applied to the surface of a sheet of commercially available high quality paper ( 50 g / m 2 ) by a wire bar and was then dried , whereby a thermosensitive coloring layer was formed thereon . the deposition of the thermosensitive coloring layer on the sheet was in the range of 4 to 5 g / m 2 when dried . the thus prepared thermosensitive recording material was subjected to calendering , so that surface of the thermosensitive coloring layer was made smooth to the degree ranging from 500 to 600 sec . in terms of bekk &# 39 ; s smoothness , whereby a thermosensitive recording material no . 4 according to the present invention was prepared . example 4 was repeated except that the dispersion a - 2 employed in example 4 was replaced by a dispersion a - 3 with the following formulation , whereby a thermosensitive recording material no . 5 according to the present invention was prepared . ______________________________________ parts by weight______________________________________dispersion a - 33 -( n -- ethyl - n -- isoamylamino )- 6 - methyl - 207 - anilinofluoran10 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 4 was repeated except that the dispersion a - 2 employed in example 4 was replaced by a dispersion a - 4 with the following formulation , whereby a thermosensitive recording material no . 6 according to the present invention was prepared . ______________________________________ parts by weight______________________________________dispersion a - 43 ( n -- methyl - n -- n - hexylamino )- 6 - methyl - 207 - anilinofluoran10 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 4 was repeated except that the dispersion a - 2 employed in example 4 was replaced by a dispersion a - 5 with the following formulation , whereby a thermosensitive recording material no . 7 according to the present invention was prepared . ______________________________________ parts by weight______________________________________dispersion a - 53 - di - n - butylamino - 7 -( o - chloroanilino )- 20fluoran10 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 4 was repeated except that the dispersion a - 2 employed in example 4 was replaced by a dispersion a - 6 with the following formulation , whereby a thermosensitive recording material no . 8 according to the present invention was prepared . ______________________________________ parts by weight______________________________________dispersion a - 63 -( n -- ethyl - n -- p - toluidino )- 6 - methyl - 7 - 20anilinofluoran10 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ example 4 was repeated except that the dispersion b - 1 employed in example 4 was replaced by a comparative dispersion cb - 1 with the following formulation , whereby a comparative thermosensitive recording material no . 3 was prepared . ______________________________________ parts by weight______________________________________comparative dispersion cb - 1bisphenol a 2010 % aqueous solution of hydroxyethyl 20cellulosewater 60______________________________________ the thus prepared thermosensitive recording materials no . 4 through 8 according to the present invention and the comparative thermosensitive recording material no . 3 were subjected to thermal printing tests by use of the heat gradient test apparatus ( made by toyo seiki co ., ltd .) at 150 ° c . with a pressure of 2 kg / cm 2 and with a heat application time of 1 second , so that printed images were formed on each of the thermosensitive recording materials . to the printed - images - bearing thermosensitive recording materials , there was applied cotton seed oil , and the recording materials were then allowed to stand for 24 hours to see whether or not the images and the background thereof were discolored or caused to disappear by the oil . the results were that in the thermosensitive recording materials no . 4 through no . 8 , the image areas were not discolored , and the background areas were not colored . in contrast to this , in the comparative thermosensitive recording material no . 3 , the background areas were not colored , but the image areas faded . the thermosensitive recording materials no . 4 through no . 8 according to the present invention and the comparative recording material no . 3 were subjected to thermal printing by use of a thermal printing test apparatus including a thermal head ( made by matsushita electronic components co ., ltd .) under the conditions that the power applied to the head was 0 . 45 w / dot , the recording time per line was 20 msec , the scanning line density was 8 × 3 . 85 dots / mm , with the pulse width applied thereto being 2 . 4 msec . the density of the developed images was measured by a macbeth densitometer rd - 514 . samples of the above thermosensitive recording materials with a size of 4 cm 2 were made so as to include image areas in the central portion thereof and were laid on a polyvinyl chloride film ( poly wrapper v - 300 made by the shin - etsu chemical industry co ., ltd .) with a load of 500 g / m 2 applied at room temperature for 24 hours . thereafter , the densities of the image areas of those samples was measured by a macbeth densitometer rd - 514 , so that the image densities of the samples before the above polyvinyl chloride film test and after the test were compared . the results were as shown in the following table 4 . table 4______________________________________ thermo - sensitive polyvinyl chloride film test recording image density image density material before test after test______________________________________example 4 no . 4 1 . 35 1 . 21example 5 no . 5 1 . 35 1 . 12example 6 no . 6 1 . 36 1 . 14example 7 no . 7 1 . 29 0 . 41example 8 no . 8 1 . 35 0 . 49comparative no . 3 1 . 29 0 . 30example 3______________________________________ in the thermosensitive recording materials no . 4 through no . 6 in examples 4 to 6 , as the leuco dyes , the fluoran compounds of the previously described formula ( ii ) were employed , while in the thermosensitive recording materials no . 7 and no . 8 , other fluoran compounds which were not covered by the formula ( ii ) were employed . from the above results , it can be seen that the thermosensitive recording materials employing the fluoran compounds of the formula ( ii ) yielded images which were more resistant to the polyvinyl chloride film than the images provided by the thermosensitive recording materials containing other fluoran compounds . according to the present invention , by use of the above described phenolic materials , thermosensitive recording materials with the following advantages over the conventional thermosensitive recording materials can be obtained : ( 1 ) high thermal sensitivity ( i . e . high thermal response ) is obtained , since no sensitizers or melting - point reducing agents are employed . due to the high thermal response , images can be recorded with high density and clearness in high speed recording . ( 2 ) since no sensitizers or melting - point reducing agents are employed , printed images do not substantially discolor with time , and high image contrast can be maintained . in other words , the quality of printed images is very stable . ( 3 ) since no sensitizers or melting point reducing agents are employed , no components come out from the thermosensitive recording material and accumulate on or adhere to a thermal head during thermal printing by use of a thermal printer with a thermal head , and no troubles such as trailing of images and ghost images take place , thereby attaining high recording performance . ( 4 ) by use of the phenolic compounds of the previously described formula ( i ), no fogging of the developed images takes place at room temperature , and there is no problem of an unpleasant phenolic odor as in other conventional phenolic compounds . thus , the recording materials according to the present invention are useful in practice . ( 5 ) the phenolic materials employed in the present invention as the color developer are readily available since they can be synthesized with higher yield and higher purity and at a comparatively lower cost , as compared with the conventional color developers . ( 6 ) by use of the phenolic compounds of the previously described formula ( i ), it does not occur that printed images discolor with time and components contained in the thermosensitive recording material separated out in the form of white crystals on the surface thereof during storage . thus , the printed images are very stable in quality . ( 7 ) by use of the phenolic compounds of the previously described formula ( i ), the printed images are resistant to finger prints , oils and plasticizers contained , for instance , in polyvinyl chloride film , thereby yielding thermosensitive recording materials with excellent and stable image quality . ( 8 ) by applying a thermosensitive coloring layer formation liquid prepared in accordance with the present invention to a sheet of thin base paper or to a film , an excellent thermosensitive copy sheet for use with an infrared lamp or a storobo flash can be prepared . ( 9 ) since the coating amount of the thermosensitive coloring layer formation liquid can be reduced , in comparison with the conventional thermosensitive recording materials , the manufacturing efficiency of the thermosensitive recording materials according to the present invention can be significantly increased as compared with the manufacturing efficiency of the conventional thermosensitive recording materials .
| 1 |
the final extruded snack products of the invention are of expanded cellular construction and are characterized by a plurality of cell - defining walls . as indicated , the walls are made up of material including at least about 5 % by weight meat , and more preferably from about 7 . 5 - 15 % by weight meat . particularly preferred snack products have about 10 % by weight meat . the meat products can be selected from a variety of sources , but for reasons of costs and processability , the meat is selected from the group consisting of beef , pork and poultry . particularly preferred are the mechanically deboned poultry products . such extruded products are further characterized as having a moisture content of from about 1 - 10 % by weight , more preferably from about 2 - 6 % by weight , a specific gravity of from about 0 . 08 to 0 . 15 , and a bulk density of from about 5 - 9 pounds per cubic foot . moreover , they exhibit an instron compressibility rating of from about 1 . 0 - 5 . 0 kilograms force , as measured in a warner - bratzler shear cell , and have a water activity of less than 0 . 65 and preferably from about 0 . 2 - 0 . 4 . finally , the products of the invention have a protein content of from about 5 - 25 % by weight , more preferably from about 10 - 15 % by weight , and an as - extruded fat content ( i . e ., as the product exists after extrusion but before application of any topical flavorings or the like ) of from about 0 - 20 % by weight , more preferably up to about 4 % by weight , and most preferably below 3 % by weight by weight . the topical flavorings on the snack products of the invention are normally applied by spraying , and the quantity used typically ranges from about 0 . 1 to 0 . 5 % by weight of the total product . after such flavor coating , the products may be toasted using an impingement oven or similar device , in order to brown the surface of the snack pieces and enhance the crispness thereof . the snacks may assume virtually any desired shape which can be obtained via extrusion processing . for example , the products may be in the form of rods or cubes , and typically have a length of at least about 1 / 8 inch . alternately , the products may be in the form of rings or tubes . the extrusion process for fabricating the snack products of the invention involves first forming a mixture including at least about 15 % by weight meat ( such fraction including the normal moisture content of the meat being employed ), and more preferably from about 20 - 40 % by weight meat , and most preferably about 25 % by weight meat . the starting mixture also includes at least about 50 % by weight wheat flour , and more preferably from about 60 - 80 % by weight thereof . no additional moisture is required to be added to the starting mixture , if use is made of mdpm as a meat source . advantageously , the starting ingredients may be mixed in a preconditioner , without steam or water addition ; and the residence time in the preconditioner is preferably from about 60 - 180 seconds . in any event , the total moisture content of the mixture fed to the extruder should be from about 15 - 40 % by weight , and more preferably from about 20 - 30 % by weight . optional ingredients which may be added to the starting mixture include salt , surfactant , dextrose , fiber , antioxidants and sodium tripolyphosphate . these are normally present in very minor amounts of less than 5 % by weight . this mixture is then fed to the inlet of an extruder , most advantageously a twin screw extruder of the type commercialized by wenger manufacturing , inc . of sabetha , kans . as described previously , the starting ingredients for the mixture may be fed to a preconditioner apparatus to insure homogeneity of the final mixture , with the latter then being directed to the extruder inlet . during passage through the extruder , the mixture is subjected to elevated temperatures and pressures in order to cook and denature the meat protein of the mixture , and to form a final product . the maximum temperature of the mixture in the extruder barrel should be up to about 280 ° f ., more preferably from about 180 °- 250 ° f ., and most preferably from about 210 °- 240 ° f . the maximum pressure achieved in the extruder barrel should be up to about 2500 psig , and more preferably from about 500 - 1500 psig . the residence time of the mixture in the extruder barrel should be from about 10 - 60 seconds , and more preferably from about 15 - 45 seconds . as the material emerges from the endmost extruder die , it is normally cut via a rotating knife , with the knife speed determining product length . thereafter , the cut extrudate is directed to a dryer for drying the product down to essentially the final product moisture . a conventional multiple - stage dryer may be used to good effect for this purpose , with drying conditions being variable . after drying , the product may be flavored by the topical application of liquid or solid flavoring such as described previously . thereafter , if desired , the product may be subjected to a toasting process . the products of the invention exhibit a number of important properties making them eminently suited as desirable snacks . for example , they are relatively high in protein and low in fat , and are therefore nutritionally advantageous . moreover , because of the low moisture and water activity inherent in the products , there is virtually no possibility of microbial growth . as a consequence , the products of the invention , when properly packaged , should remain completely edible for many months . finally , when use is made of low cost ( at present prices about 17 cents per pound ) mdpm as a meat source , a high quality meat snack is provided which can be flavored to meet the dictates of consumer preference while still giving enhance nutritional benefits . these advantages are present in the invention largely because of the relatively high wheat flour content of the product , coupled with the relatively low fat content thereof . the following examples set forth a series of extrusion runs for the fabrication of snack products in accordance with the invention . it is to be understood that these examples are provided by way of illustration only , and nothing therein should be taken as a limitation upon the overall scope of the invention . in this series of tests , two starting mixtures were employed , namely a wheat flour based mixture having 97 % by weight wisdom wheat flour , 1 % by weight salt , 0 . 5 % by weight dimodan p . v . surfactant and 1 . 5 % by weight dextrose ; and a meat mixture including 93 . 98 % by weight mechanically deboned chicken product ( surimi ), 5 % by weight carboxymethyl cellulose ( fiber ), 0 . 5 % by weight sodium tripolyphosphate , 0 . 5 % by weight chicken flavoring , and 0 . 02 % by weight bht antioxidant . in extrusion mixture no . 1 , 75 % by weight of the wheat mixture was added to 25 % by weight of the meat mixture ; in extrusion mixture no . 2 , 73 . 16 % by weight of the wheat mixture was added to 26 . 34 % by weight of the meat mixture , and an additional 0 . 50 % by weight of chicken flavoring was added . in runs 1 and 2 , the respective extrusion mixtures were fed first to a conventional preconditioner ( mixing cylinder ) and then into the inlet of a wenger model tx - 52 twin screw extruder commercialized by wenger manufacturing , inc . of sabetha , kans . in run 3 , no preconditioner was used , and the material as fed directly to the tx - 52 . this type of extruder is described in u . s . pat . no . 4 , 875 , 847 , which is incorporated by reference herein . the tx - 52 extruder was equipped with a total of six heads , with heads 2 - 6 being jacketed for the introduction of heat exchange media in order to indirectly heat or cool the material passing through the extruder . the media included water ( w ), warm water ( w / temp ), or hot oil ( ho / temp ). the outlet end of the extruder was provided with a die spacer and a final apertured die . the internal screw of the extruder was equipped with two sets of spaced shearlock elements and a final , triple flighted conical screw adjacent the die . the specific die employed consisted of a wenger model no . 74010 - 271 backup die plate , together with a wenger model no . 55372 - 101 final die insert holder equipped with a pair of wenger model no . 74010 - 466 stainless steel die inserts . the backup die plate has two sets of circularly arranged apertures ( 8 per set , 5 / 32 &# 34 ; diameter ) respectively oriented in alignment with each of the extruder screws . the insert holder includes a pair of insert - receiving openings , while each insert includes a conical passage leading to a final die opening having a 5 / 32 &# 34 ; diameter . this die arrangement is typically used for breading products . the extrusion conditions recorded for this series of runs are set forth below : ______________________________________extruder : tx - 52 run # 1 run # 2 run # 3______________________________________extruder screw speed - rpm 406 403 403temp / control 2nd head w w wtemp / control 3rd head w w w / 63 ° f . temp / control 4th head ho ho ho / 87 ° f . temp / control 5th head ho ho ho / 128 ° f . temp / control 6th head w / w / w / 154 ° f . 149 ° f . 152 ° f . water to extruder 25 25 25 ( brooks ) extruder % load 25 % 25 % 30 % feeder rpm 11 11 13mixing cyl rpm 305 305pressure head # 5 psig 100 100 100extruder stability good good goodproduct stability good good goodformula no . 1 1 2______________________________________ in another series of runs , the extrusion mixture no . 1 described above was used , except that after drying , the extruded products were spray - coated with external flavorings , namely pork ( runs 1 and 2 ), chicken ( run 3 ) and beef ( run 4 ). the starting extrusion mixtures were fed to a preconditioner and then into the inlet of a model tx - 52 twin screw extruder , and in this instance having a total of nine heads , of which nos . 2 - 9 were jacketed for introduction of heat exchange media . the internal screw included a conical terminal screw section and was configured for a bread stick - type product . the final die was identical to that described in connection with example i . the data derived from this series of runs is set forth below . __________________________________________________________________________ run # 1 run # 2 run # 3 run # 4__________________________________________________________________________raw material rate pph 120 . 00 120 . 00 120 . 00 120 . 00feed screw speed rpm 11 11 11 11mixing cylinder rpm 300 300 300 298speedmoisture entering mcwb 20 . 70 23 . 44 23 . 21extruderextruder shaft speed rpm 400 397 396 398motor load % 40 30 25 31water flow to extruder ppm 0 . 090 0 . 500 0 . 400 0 . 350control / temperature ° f . w / 84 w / 86 w / 84 w / 862nd headcontrol / temperature ° f . w / 84 w / 86 w / 84 w / 863rd headcontrol / temperature ° f . ho / 106 ho / 118 ho / 127 ho / 1364th headcontrol / temperature ° f . ho / 111 ho / 126 ho / 133 ho / 1425th headcontrol / temperature ° f . ho / 108 ho / 86 ho / 176 ho / 866th headcontrol / temperature ° f . w / 70 w / 75 w / 70 w / 727th headcontrol / temperature ° f . w / 70 w / 75 w / 70 w / 728th headcontrol / temperature ° f . w / 158 w / 147 w / 140 w / 1449th headhead / pressure psig 8 / 550 8 / 300 8 / 250 8 / 300head / pressure psig 9 / 900 9 / 600 9 / 500 9 / 600knife drive speed rpm 6 7 7 7extrudate moisture mcwb 16 . 48 26 . 74 32 . 01 23 . 50final product pork pork chicken beefdescription stick stick stick stick__________________________________________________________________________ the extrudate from these runs was flavor - coated and then dried in a multiple pass dryer using an air temperature of 280 ° f ., with a retention time , first pass , of 7 . 5 minutes ; a retention time , second pass , of 7 . 5 minutes ; and a cooler retention time of 3 . 8 minutes . the moisture analyses of run 1 indicated that the product exiting the preconditioner had a moisture content of 20 . 7 % by weight mcwb ( moisture content , wet basis ); the extrudate prior to coating had a moisture content of 16 . 8 % by weight mcwb ; and the product after coating had a moisture content of 3 . 85 % by weight mcwb . in the case of run 2 , the extrudate had a moisture content of 26 . 74 % by weight mcwb and a moisture content after coating of 12 . 21 % by weight mcwb . in run 3 , the material from the preconditioner had a moisture content of 23 . 44 % by weight mcwb , the extrudate had a moisture content of 32 . 01 % by weight mcwb , and the product after coating had a moisture content of 11 . 33 % by weight mcwb . finally , in the case of run 4 , the moisture contents recorded after preconditioning , extrusion and coating were respectively 23 . 23 %, 23 . 50 % and 8 . 71 % by weight mcwb . the run 1 product exhibited a very large cell structure and was cut into 2 . 5 inch pieces as it emerged from the die . the run 2 product exhibited an excessively hard bite , indicating the need for changing the moisture content of the material in the barrel . runs 3 and 4 exhibited only minimal expansion . in a final series of tests , a formula identical with extrusion mixture no . 1 described above and using chicken flavoring was used , with various types of wheat being employed . the purpose of these tests was to determine which wheat variety gave the most optimum snack product . it was determined that soft white winter wheat gave the best product , although all wheats tested gave an acceptable snack . the most preferred run from this series of tests was conducted using a nine head wenger tx - 52 twin screw extruder and a wenger model mdl 1 dc preconditioner configured for relatively long retention time . the drawing figure is a schematic representation of the preferred dual screw configuration used in the tx - 52 . as shown , each screw 10 includes a series of axially interconnected screw sections with a number of spaced shearlock element sets 12 . a cut flight screw section 14 is also included , together with a high shear cone nose screw section 16 . the die assembly was a wenger back - up assembly , including a model 55361 - 001 back - up die plate and 55372 - 113 final die insert holder . a loop die ( 3 / 4 &# 34 ; diameter insert presenting an annular opening having an outer diameter of 5 . 75 mm , a pin diameter of 3 . 15 mm and an open area of 18 . 17 sq . mm ) formed a part of the die assembly giving an annular product . the extrusion and drying conditions recorded for this preferred run are set forth below : ______________________________________moisture 25 . 0raw material rate pph 128 . 00feed screw speed rpm 15 . 0mixing cylinder speed rpm 221steam flow to mixing cylinder ppm 0 . 0water flow to mixing cylinder ppm 0 . 0discharge temp . ° f . ambientdischarge moisture % 25 . 0shaft speed rpm 407motor load % 33zone temperature 2nd head ° f . w / 104zone temperature 3rd head ° f . w / 104zone temperature 4th head ° f . ho / 221zone temperature 5th head ° f . ho / 230zone temperature 6th head ° f . ho / 230zone temperature 7th head ° f . w / 122zone temperature 8th head ° f . w / 122zone temperature 9th head ° f . w / 189pressure - 9th head psig 700pressure - die psig 900knife drive speed rpm 6extrudate moisture % 17 . 9product rate lbs / hr 115 . 0dryer temperature ° c . 154retention time - top flight minutes 3 . 7retention time - bottom flight minutes 6retention time - cooling flight minutes 5 . 1______________________________________ the dried extrudate was then coated with various flavorings , including taco and cheese flavorings . this was accomplished by simply spraying a conventional coating mixture on the outer surface of the dried extrudate at levels of from about 0 . 1 to 0 . 5 % by weight . portions of these sprayed products were then subjected to toasting in an ordinary kitchen toaster oven ( temperature of about 250 ° f .) in order to crisp the surface of the products . the dried , flavored , and toasted extrudate products were then tested and determined to have a moisture content of 4 . 4 % by weight , and ash content of about 2 . 4 % by weight , a protein content of about 17 . 7 % by weight , and a fat content of about 0 . 5 % by weight . in addition , chicken flavored products made as outlined in this example were tested by a sensory panel for crispness , mouth feel and acceptability ; and were subjected to a tba ( thiobarburic acid ) rancidity test . the dried product had a crispness rating of 7 . 0 , a mouth feel rating of 7 . 5 , an acceptability rating of 7 . 5 , and tba results of 0 . 236 . the toasted product had a crispness rating of 8 . 0 , a mouth feel of 7 . 8 , an acceptability of 7 . 9 and tba results of 0 . 298 . the standard error of the means in all cases was 0 . 1 . in this example , 15 extruded samples of the type described in the foregoing operative example iii were analyzed for physical properties , namely , sectional , longitudinal and volumetric expansion , bulk density , specific gravity and instron compressibility . an additional 7 representative samples were tested for compressibility . section , longitudinal and volumetric expansion indices developed by alvarez - martinez , et al . ( j . food sci . 53 : 609 ) were used to characterize expansion of the products obtained in this study . sectional expansion index ( sei ) is a measure of radial expansion of the extrudate and is the ratio of the cross - sectional area of the extrudate to the cross - sectional area of the die . longitudinal expansion index ( lei ) is a measure of expansion in the axial direction and is described by the following equation : ## equ1 ## where a d is the open area of the die in square meters , l se is the specific length of the extrudate in m / kg , ρ d is the density of the dough behind the die ( assumed to be constant and equal to 1 , 200 kg / m 3 , and mc d and mc e are the moisture contents of the dough and extrudate , respectively . volumetric expansion index ( vei ) takes into account sei and lei to describe the expansion on a volumetric basis ( vei = sei × lei ). fifteen pieces from each treatment were measured for the expansion indices and the results are shown in the table below . bulk density was determined by filling a one liter volume container to level full capacity with product and weighing it in grams and converting it to lbs / ft 3 ( factor : 0 . 0624 ). bulk specific gravity is defined as the weight of a given volume of product relative to the weight of an equal volume of water at 4 ° c . thus , the gram / liter bulk density of the product was divided by 1 , 000 grams / liter bulk density of water to yield specific gravity . the results are shown in the table below . instron compressibility was determined with a warner - bratzler shear cell according to the method of faubion and hoseney ( cereal chemistry 59 : 529 , 1982 ). the warner - bratzler shear cell is attached to the instron universal testing machine and used to shear across the extruded tube perpendicular to its long axis ( or perpendicular to the axial direction of extrusion ). the cross - head speed was set at 5 cm / min . and the results expressed as the maximum force in kg required to shear through the piece . ______________________________________ bulk instron com - sample density specific pressibility # sei lei vei lb / cu . ft gravity kg force______________________________________ 1 11 . 30 0 . 49 5 . 54 7 . 67 0 . 12 3 . 85 2 4 . 22 0 . 45 1 . 92 7 . 33 0 . 12 3 . 60 3 7 . 96 0 . 54 4 . 27 7 . 21 0 . 12 1 . 25 4 9 . 22 0 . 56 5 . 19 7 . 32 0 . 12 4 . 00 5 10 . 31 0 . 56 5 . 77 7 . 30 0 . 12 2 . 80 6 10 . 50 0 . 47 4 . 98 7 . 02 0 . 11 4 . 05 7 10 . 05 0 . 43 4 . 35 6 . 99 0 . 11 3 . 95 8 8 . 64 0 . 53 4 . 60 6 . 72 0 . 11 4 . 15 9 13 . 25 0 . 56 7 . 38 6 . 77 0 . 11 2 . 2010 10 . 74 0 . 55 5 . 90 6 . 53 0 . 10 4 . 3511 8 . 48 0 . 53 4 . 54 6 . 76 0 . 11 1 . 8512 10 . 93 0 . 55 5 . 99 6 . 74 0 . 11 1 . 5013 8 . 45 0 . 48 4 . 07 6 . 66 0 . 11 2 . 0514 9 . 91 0 . 55 5 . 43 6 . 62 0 . 11 3 . 2515 10 . 75 0 . 46 4 . 98 6 . 55 0 . 10 1 . 9016 1 . 3017 2 . 0518 1 . 7519 1 . 7520 1 . 6021 0 . 9522 4 . 45______________________________________ accordingly , it was determined that products in accordance with the invention should have a sectional expansion index of from about 3 - 15 , and more preferably from about 7 - 13 ; a longitudinal expansion index of from about 0 . 3 - 0 . 7 , and more preferably from about 0 . 4 - 0 . 6 ; and a volumetric expansion index of from about 1 . 5 - 9 , and more preferably from about 4 - 7 . 5 .
| 0 |
as depicted in fig1 , publisher 1 has a database 11 , and a dgg 12 . database 11 holds the content 5 . dgg 12 is a hardware that allows the publisher 1 to encrypt / decrypt data . the encryption mechanism of 12 has two layers , the inner layer lock 121 and the outer layer lock 122 . publisher 1 always uses the pocket lock 6 and pocket key 7 for encryption / decryption when sending or receiving messages through the internet . the network manager is a network service center that supports a database 21 containing an isbn table 211 and a device serial number table 212 . the network service center 2 assigns an isbn lock when presented with a novel isbn by the publisher and keep the record in table 211 . the pubnetmanager 2 also obtains the device lock 31 and key 311 from the device manufacturer and keeps the record in table 212 . the pubnetmanager 2 also uses pocket lock 6 and pocket key 7 for encryption / decryption when sending or receiving messages from the internet . digibookstore , dgb 3 is a specialty server designed for bookstores . it can store encrypted digital contents 5 from the publisher 1 for sale to consumers . when a consumer buys a digital content 5 , dgb can relay the isbn and device serial numbers , provided by the buyer , to the pubnetmanager 2 and request the isbn key 1221 and the device lock 31 . dgb always uses pocket lock 6 and key 7 for encryption / decryption to protect transmitted files when using the internet to communicate . upon receipt of the isbn key 1221 and device lock 31 , dgb will release the isbn lock and replace the encryption with device lock 31 for the content 5 . content 5 , thus encrypted , are ready for download by the consumer . digireader , dgr 4 is a device built for the consumer to decrypt the encrypted content 5 and display the information . dgr 4 has a flash memory 41 and a decryption chip 42 . the flash memory is for the storage of content 5 downloaded from the dgb 3 and the decryption chip 42 contains a specific device key 311 and the publisher key 1211 for device lock 31 and publisher lock 121 . fig1 a illustrates the interactive flow between the publisher and the pubnetmanager . publisher 1 , when publishing a content 5 , produces digital content 100 and assigns an isbn number 101 , and stores the information in a content database 102 . the publisher encrypts in a pocket lock 103 and dispatch the file through the internet to the pubnetmanager 104 . pubnetmanager 2 will decrypt the pocket lock with her pocket key 200 to obtain the isbn number and assign an isbn lock 201 to the number , and store the information in the isbn table 202 . the pubnetmanager 2 will also encrypt a copy of the isbn lock in a pocket lock 203 and dispatch the file to the publisher via the internet 204 . upon receipt of the package from the pubnetmanager the publisherwill open the pocket lock 105 , and install the isbn lock into dgg 106 . dgg 12 has a two layer structure ; the inner layer , the publisher lock 121 , comes preinstalled by the manufacturer and the outer layer is the isbn lock 122 . fig1 b illustrates the interactive flow between the publisher 1 and the digibookstore . before sending the digital content 5 to the bookstore 3 , publisher 1 will secure the content with the dgg 12 encryption facility and , after the input of the isbn number and payment information 110 , protect the file with a pocket lock encryption 111 and then will dispatch the file to the dgbvia internet 112 . upon receipt of the file , bookstore 3 will release the pocket lock 300 and store the content file in dgb for purchase by consumer 301 . fig1 c illustrates the interactive flow between bookstore and consumer . buying content 5 , consumer will provide the isbn number of the content and the serial number of his dgr to the dgb 320 . dgb will secure the information with a pocket lock encryption 321 and request , via internet 322 , the pubnetmanager 2 for the isbn key and the device lock 323 . pubnetmanager 2 , upon receipt of the file , will release the pocket lock with pocket key 220 and search the isbn table for the corresponding isbn key and the device lock 221 . retrieving both , pubnetmanager 2 will secure the information with a pocket lock encryption 222 and send the file , via internet , to the dgb 223 . dgb 3 , upon receipt of the file , will release the pocket lock with a pocket key 324 , and obtain the isbn key and device lock 325 . with the isbn key , dgb will release the isbn lock 326 and replace the outer layer with the device lock 327 . the resulting encrypted content is ready for downloading into the flash memory of the consumer 328 . ( flash memory 41 can be either replaceable or embedded .) fig1 d illustrates the flow when buyer uses dgr to access the content . consumer places his flash memory 41 into the device , dgr 4 , for access to the content 400 using the embedded chip for decryption 401 . the content 5 , encrypted with the inner publisher lock 121 and the outer device lock 122 , is released of its device lock 402 and , then , of its publisher lock 403 and becomes available to the consumer 404 . other devices 4 or computers cannot access nor copy the content . fig2 illustrates a digireader , a device 4 with a core processor and a decryption chip . the device shall contain , in the minimum ; a cradle for flash memory 411 , using a proprietary interface , digipub , for access to the content in the flash memory ; a decryption chip 42 with a two layer structure , the inner key being publisher key and the outer layer being the device key . the decryption uses matryoshka architecture , a layered structure ; a core processor 43 , capable of processing the digital content codes into image , sound , video , and , after decryption , for display ; control buttons 44 ; allow users to choose the functions of device 4 ; a flat panel display 45 , for the display of decrypted content ; and fig3 illustrates the digibookstore 3 , a specialty server built for bookstores capable of storing encrypted digital content . the server contains , in the minimum ; database memory 311 , with a database containing the encrypted digital content from publishers ; a core processor 312 , processing the receiving and storing of the digital content and other information from publishers ; a pocket lock / key mechanism , for the automatic encryption / decryption of files when using the internet ; a flash memory cradle 314 , using a proprietary dg pub interface , for the downloading of digital contents into flash memories equipped with the same interface ; a second flash memory cradle 315 , using the proprietary dg pub interface , for the downloading / deletion of digital content files in the flash memory in the secondary market ; a cache memory region 316 , for the temporary storage of digital contents in the secondary market ; a flat panel display 318 , for the display of input and / or received information . fig4 illustrates the network service center operating pubnetmanager 2 . the service center can manage the information concerning the devices and the content isbn numbers . the center contains , in the minimum ; a network manager database 21 , storing the isbn number table 211 and the device serial number table 212 ; a core processor 22 , for the processing of the data concerning the device and the content isbn ; a pocket lock / key mechanism 23 , for the encryption / decryption of files transmitted through the internet ; an input keyboard 24 , for the operators to input information ; and a monitor 25 , for the display of received / input information . fig5 illustrates digiguard , a hardware device for the publishers to encrypt / decrypt . the device contains , in minimum ; an encryption mechanism 120 , which uses matryoshka ( one inside another ) type encryption method , with the publisher key 121 being the inner key ; a core processor 123 , for the processing of information including the requesting of isbn lock 122 to be the outer layer lock and the encryption of digital content : a pocket lock / key mechanism 124 , for encryption / decryption of files to be transmitted through the internet ; and an input keyboard 126 , that allow the operators to input commands . if there are seller and buyer , the transaction in the secondary market can be carried out with digibookstore 3 . during the transaction , the seller &# 39 ; s device lock on the digital content needs to be replaced with the buyer &# 39 ; s device lock to allow access to the digital content 5 by the buyer . the following describes the process : seller 91 of digital content 5 places the flash memory 912 of his device 911 onto the specific cradle of dgb 3 and input the serial number of his device and the isbn number of the content 5 into the cache memory region of dgb 3 . dgb 3 will relay the information to the network service center and request for the device key 9131 of the seller and the buyer &# 39 ; s device lock 923 , as well as the price and other information . the file will be secured with a pocket lock 6 before transmission over the internet . upon receipt of the file , pubnetmanager 2 will release the pocket lock 6 with her pocket key 7 and obtain the isbn number and device number , with which to search for the price and other information corresponding to the isbn number from the isbn table 211 , and for the seller &# 39 ; s device key 8131 and buyer &# 39 ; s device lock 923 from the device serial number table 212 . pubnetmanager 2 will secure the price and other information and seller &# 39 ; s device key 9131 and buyer &# 39 ; s device lock 923 with a pocket lock and dispatch the file to the dgb 3 via internet . upon receipt of the file , dgb 3 will release the pocket lock 6 with pocket key 7 and obtain the seller &# 39 ; s device key 9131 and buyer &# 39 ; s device lock 923 . dgb will , then use seller &# 39 ; s device key 9131 to release seller &# 39 ; s device lock 913 and replace it with buyer &# 39 ; s device lock 923 . the digital content can , then , be downloaded into the flash memory 922 of the device 921 of the buyer 92 . buyer 92 can now display the content with his device 921 . the decryption chip of his device will release the buyer &# 39 ; s device lock 923 and the publisher lock 924 to make available digital content 5 , which he bought from the secondary market . ( seller and buyer &# 39 ; s publisher keys are identical and needs no replacement .) if bookstore 3 is interested in a transaction even if seller 91 cannot find a buyer 92 temporarily , the bookstore can transplant the content into one of its own device with the aforementioned mechanism . when a buyer 92 is found , the same mechanism can be used to transplant the content into buyer &# 39 ; s device 921 . many changes and modifications in the above described embodiment of the invention can , of course , be carried out without departing from the scope thereof . accordingly , to promote the progress in science and the useful arts , the invention is disclosed and is intended to be limited only by the scope of the appended claims .
| 6 |
we describe an attachment method for a heat sink , according to an embodiment of the present invention . as will be shown , the present embodiment changes the mechanical boundary conditions of the heat sink to allow slowly varying relative motion while still providing mechanical support for shock inputs . this is accomplished by changing the method of heat sink attachment , such that mechanical motion is limited under shock but provides compliance for thermal expansion . as such this will reduce the heat sink / package mechanical interaction due to the mismatch of the coefficients of thermal expansion ( cte ) for those materials . a cte mismatch occurs when the heat sink material experiences thermal expansion at a different rate than that of the frame . this is one of the main causes of package deformation . referring now in specific detail to the drawings , and particularly fig3 a there is shown a side view of a chip package assembly 300 with attached heat sink 302 . according to an embodiment of the present invention , pads 312 and 314 are fabricated from a highly damped elastomeric material such as those commercially available as c - 1105 from ear specialty composites . these materials are also viscoelastic in that they exhibit both the properties of a viscous liquid which “ flows ” at slow deformation speeds and an elastic solid at higher speeds . these materials have a frequency dependent elastic modulus which increases at higher frequencies , thus becoming stiffer if the load changes quickly . fig3 b shows a top view of the chip package assembly 300 . the elastomeric material is used in the x and y pads 314 and 318 at the corner mounts of the heat sink 302 to control motion of the heat sink 302 in the x and y directions as well as the z pads 312 at the bottom side of the heat sink 302 corners to control motion in the z direction . as shown in fig3 b the x and y pads 314 and 318 are disposed at the corner mounts , positioned between the heat sink 302 and the horizontal limit stops 316 . pads 312 are also positioned between the heat sink 302 and the vertical stops 308 . the viscoelastic material is sufficiently rigid that it limits mechanical motion in the presence of shocks ; yet it provides compliance sufficient to handle the thermal expansion mismatch of the heat sink / package 300 . the positioning of the pads will reduce the effects of shock from x , y , and z forces exerted on the heat sink 302 . positioning the pads 314 at the bottom only will limit the effects from a z force shock only . the key advantages of employing the pads 312 , 314 , 318 at the corner mounts and the bottom of the heat sink 302 are : 1 ) they allow mechanical motion from thermal expansion ; and 2 ) they restrict mechanical motion due to shock . the key aspects of the pads are the viscoelastic properties of the material used and the positioning of the pads with respect to the heat sink 302 . fig3 c presents a detailed view of one corner of the the chip assembly package 300 of fig3 a and 3 b . this view shows the corner of the heat sink 302 which is abutted by pads 314 and 318 which may be , for example , attached to the limit stop 316 and the heat sink 302 with an adhesive glue . when a force f 2 is applied to the heat sink 302 , pad 318 is compressed . however , as the elastic modulus of the pad 318 is frequency dependent , the restoring force would depend upon the frequency of the applied force . for slowly varying forces such as would occur with thermal expansion , pad 318 would be soft , but for higher frequency forces the pad 318 would be very stiff . this allows the heat sink 302 to expand due to temperature changes , but provides constraint of the heat sink 302 for high frequency forces . note that pad 314 experiences a shear force during the applied force f 2 and allows movement of the heat sink 302 both for thermal and high frequency forces . for a force f ( 320 ) in the x , y plane the pad 314 would experience a force f 1 = f cos ( θ ) and pad 318 would experience a force f 2 = f sin ( θ ). each pad would respond as described above . as the package may experience a force in any arbitrary direction , the heat sink 302 can experience a force which has components in the x , y and z planes . as shown in the three - dimensional ( 3d ) view of fig4 , the pads in the z direction will compress when a force has a downward z component . the clamp 304 holds the center of the heat sink 302 in the z direction and applies a downward bias force on the pads 312 which prevents the heat sink from lifting off the chip 320 when there is an upward z component . to minimize the deflection of the pad 312 to the bias force a higher modulus elastomer may be deployed or the pad thickness may be reduced . in one example the dimension of the pads may measure 5 mm by 5 mm and have a thickness of 1 mm . another embodiment is shown in fig5 a in which ball bearings 504 allow the heat sink 502 to move in a horizontal direction while limiting motion in the vertical direction . fig5 b illustrates how the horizontal motion is impeded by pads 514 secured to horizontal stops 516 . the pads 514 are viscoelastic as shown in fig4 . the ball bearings 504 are secured by braces 506 attached to the horizontal stops 516 . note that these bearings 504 are only at the bottom , not the sides . fig6 shows a close - up view of one of the ball bearings 504 . the arrows encircling the ball bearing 504 indicate how the ball bearing 504 can rotate , or spin , while remaining in a fixed position . the heat sink 502 is in contact with the top portion of the ball bearing 504 . a slight horizontal motion of the heat sink 502 will produce a swiveling of the ball bearing 504 . the horizontal stops 516 with the pads 514 attached will constrain the heat sink 502 from excessive movement . it should be understood that what has been discussed and illustrated serves to provide examples of the possible embodiments within the spirit and scope of the invention ; they should not be construed to limit the invention . one with knowledge in the art , after following the discussion and diagrams herein , can employ any viscoelastic material having the same properties as c - 1105 bearings from ear , or flexures properly positioned at the corner mounts as discussed above to provide the advantages of a reduction in package deformation while allowing for limited mechanical motion due to thermal expansion . another approach to limit mechanical motion in the presence of shocks and / or vibrations while allowing for slow thermal expansion is to deploy active servo control of the heat sink . h . newton , newton &# 39 ; s telecom dictionary , 22 nd edition , copyright © 2006 harry newton , defines a servo as : “ servo : short for servomechanism . devices which constantly detect a variable , and adjust a mechanism to response to changes .” another embodiment of the present invention is shown in fig7 wherein active servo control is employed to constrain the movement and / or expansion of a heat sink 702 . voice coil motors are used to actuate the heat sink 702 . fig7 shows one example of a voice coil motor 728 which controls the x motion of one corner of the heat sink 702 . each voice coil motor includes : a voice coil 726 mounted onto the heat sink 702 and a magnetic circuit consisting of permanently affixed magnets 720 and 722 , with flux return paths and mechanical assembly to hold the magnets in place 724 . the servo method of heat sink constraint differs from the previously described embodiments in that there may be no actual contact made between the heat sink 702 and the board 744 . this is indicated in fig7 by the gaps 799 . fig8 shows a top view of the assembly of fig7 with z direction voice coil motors 710 and 712 . fig8 also shows the voice coils for the x and y directions , 724 , 726 and 734 and 736 , in opposite corners , which are part of the voice coil motor assembly . for example 726 is the voice coil for voice coil motor 728 as shown in fig7 . gap sensors 735 , 737 , 725 , 727 measure the location of the heat sink 702 edge to a fixed frame in the x and y directions . similarly , gap sensors 704 and 706 measure the location of the heat sink 702 to the frame 744 in the z direction . one example of gap sensors may include proximity sensors using well known capacitance or eddy current measurement methods . the capacitance between two plates is proportional to 1 / d , where d is the gap between the plates , thereby the gap can be measured by measuring c and computing 1 / c . the voice coil motor and gap sensors are used in a servo loop to control the location of the heat sink 702 relative to the frame 744 . as shown in fig8 two vertical axis voice coil motors 710 and 712 are disposed in opposite corners of the top frame 744 to maintain the z height of the heat sink 702 relative to the frame 744 . for example , a z position signal z gap 704 is compared to a z gap target and the difference between the z gap target and z gap 704 will create an error signal as shown in fig1 which is input to the servo controller gc which produces a signal to control the current to the physical plant gp which includes z voice coil motors 710 and heat sink 702 . the current applied to z voice coil motor 710 will produce a force on the heat sink 702 to actuate it in the + z or − z direction until the z gap value is equal to the target value . similarly a second servo loop using z gap 706 would be running in parallel , which for example may have a z gap target 706 equal to the z gap 704 target 704 , to maintain the heat sink 702 parallel to the frame 744 . to maintain the x and y position of the heat sink 702 , horizontal axis voice coils 724 , 726 are deployed in one corner of the heat sink 702 and voice coils 734 and 736 are deployed in the opposite corner of the heat sink 702 . these voice coils are part of a voice coil motor assembly , an example of which is shown in fig7 as 728 . a position signal from the difference of gap x = xgap 735 − xgap 725 can be generated by measuring the gap in the x direction using xgap sensors 735 and 725 and taking the difference between the two signals . similarly , by monitoring the gap in the y direction using y gap sensors 737 and 727 a position signal can be generated from the difference of gap y = ygap 737 − ygap 727 . these signals are input to the servo control system as shown in fig1 . for example , gapx would be compared to a gapx target , which for example may have a value of zero such as would occur when xgap 735 is equal to x gap 725 and the heat sink 702 is centered with respect to the center of the frame 744 . the difference between the gapx and gap x target will create an error signal as shown in fig1 which is input to the servo controller , gc , which produces a signal to control the current to gp , the physical plant , which includes the voice coil motor and heat sink 702 . the current applied to the voice coils 726 , 736 to produces a force on the heat sink 702 to actuate it in the + x or − x direction until the gapx value is equal to the gap x target value . referring to fig9 there is shown an exploded top view of voice coil motor ( vcm ) 728 located in the right quadrant of fig8 . this vcm produces a motion of the heat sink 702 in the x direction when a current is applied to the voice coil 726 . the vcm is comprised of permanent magnets 720 and 722 , each of which is made of two magnets with reverse polarity . the magnets 720 and 722 and flux return plates 721 , 723 are held in place by a non - magnetic mechanical fixture 724 . when a current passes through the coil 726 , the coil experiences a force in the + x or − x direction dependent on the direction of the current and transfers that force to the heat sink . similarly a current passing through voice coil 736 applies a force in the x direction on the opposite corner of the heat sink 702 . the coils 726 and 736 are attached to the heat sink 702 and using the servo control system the heat sink 702 will remain centered with respect to the frame 744 in the x direction as previously described while allowing thermal expansion of the heat sink 702 . similarly , when using the servo control system with voice coils 724 and 734 , the same control of the heat sink 702 in the y direction can be achieved . in the z direction , the gap 799 between the heat sink 702 and the frame 744 will be held to a predetermined target value , such that the heat sink 702 remains parallel to the frame 744 . therefore , while there have been described what are presently considered to be the preferred embodiments , it will be understood by those skilled in the art that other modifications can be made within the spirit of the invention . solutions which combine elements of the described solutions including using mechanical and servo control systems are also possible .
| 8 |
with continued reference to the drawing figures , the coating solution supply assembly 10 of the present invention is shown mounted to a standard or other support 11 adjacent to a conventional sugar pan unit 12 . the sugar pan unit includes a base 13 to which is rotatable mounted a somewhat cylindrical pan 14 which is inclined such that the inner chamber 15 defined thereby is angled upwardly relative to the vertical such that product “ p ” is contained beneath an opening 16 and within the chamber of the pan . the pan 14 is a conventional coating pan of the type which may enable processing of anywhere up to several hundred pounds of product . the pan is mounted on a rotating shaft 18 , fig2 driven by a motor ( not shown ) mounted within the base 13 . to harden the solution which is introduced into the pan 14 , a drying air duct 20 is provided having a nozzle portion which extends into the chamber 15 , as shown generally in fig5 and 6 . the configuration of the drying duct and nozzle may be varied depending upon the coating process . each duct is connected to a central source of either hot or cold drying air . in the drawing figures , the coating solution supply assembly is shown as being mounted to a fixed standard 11 . it should be noted that the assembly may also be mounted to moveable supports so that each assembly may be moved from one pan to another , as may be required , or so that the relationship between assemblies may be altered depending upon the environment in which the coating process is taking place . each coating solution supply assembly includes a coating solution supply container 24 in which a coating solution “ s ” is retained . the container may include appropriate markings to indicate the volume content of solution . the solution is withdrawn from the container 24 and pumped through a distribution header 25 which extends inwardly of the chamber 15 of the coating pan 14 . the distribution header may include a plurality of spray or drip nozzles 26 which , in some embodiments , may include adjustable control valves 28 . the metering and supply of the solution is controlled by a pan pump 30 which is mounted to the standard 11 . the pan pump 30 is a double piston metering pump including a metering chamber or cylinder 32 and a pumping or coating solution supply chamber or cylinder 34 . a first metering piston 35 is mounted within the metering chamber 32 in such a manner that it may be adjustable relative to an elongated piston rod 36 . in the drawing figures , the piston 35 is shown as being threadingly engaged with a threaded portion 37 of the piston rod 36 such that rotation of the piston rod relative to the piston will vary the effective stroke length of the piston 35 within the chamber 32 . in this manner , the effective stroke length of a second piston 38 mounted within a pumping or coating solution supply chamber 34 is adjusted . the piston 38 is mounted to the upper end of the piston rod 36 such that the piston 38 and the piston 35 move simultaneously with one another . the piston rod extends through an elongated seal 39 which extends between the cylinders 32 and 34 so as to prevent contamination of the cylinder chamber 34 . the movement of the metering piston 35 is controlled by a pair of pneumatic lines 40 and 42 which extend through openings 43 and 44 , respectively , into the chamber 32 . each of the pneumatic lines are connected to a solenoid valve 45 which controls an air supply to the lines . the valve is electrically connected to a controller 50 which is connected to an appropriate on - off switch 48 . the controller 50 may be used to control the effective stroke and thus the quantity of solution which is to be pumped into the chamber 15 of the pan 14 during each pumping cycle of the pan pump 30 as well as to control the supply of drying air . as shown in drawing fig4 and 5 , a fluid inlet line 52 extends within the solution supply container 24 and is connected to an inlet 54 into the chamber 34 through a first one - way check valve 55 . when the piston 38 is moved away from the inlet 54 , a partial vacuum is created within the chamber 34 thus drawing the coating solution “ s ” from the container 24 and into the chamber 34 . the stroke is effectively controlled by the metering piston 35 and its movement within the chamber 32 . in fig5 the piston 34 is being driven downwardly by a pneumatic source such as air supplied through pneumatic line 42 . air below the piston is bled from the lower portion of the chamber through pneumatic line 40 which functions as an exhaust line until the effective downward stroke of the piston 35 is achieved . at this point in time , the valve 45 is reversed thus driving air through the pneumatic line 40 and moving the piston 35 upwardly and thus moving the piston 38 upwardly so as to discharge solution “ s ” from within the coating solution supply chamber 34 . the solution is prevented from entering the container 24 because of the one way check valve 55 . the discharging fluid passes through a second one - way check valve 56 and into the distribution header 25 wherein the solution is introduced within the chamber 15 by way of the nozzles 26 . as previously discussed , the effective amount of coating solution can be controlled not only by predetermining the position of the piston 35 within the chamber 32 but also by varying the effective stroke length of the piston 35 by way of air supplied to the metering chamber 32 . pumping of the solution from the chamber 34 is illustrated in drawing fig6 . also shown in fig5 and 6 is a source of lubricant and cleansing agent which is introduced in a cyclic manner into the lower portion of the solution pumping chamber 34 . the solution is contained within an enclosed container 60 which is connected by supply line 62 through an inlet opening 64 in the side wall of the chamber 34 . the fluid may be a vegetable oil type fluid which is utilized to provide both a lubricant source within the pumping chamber as well as a cleansing source . it should be noted that as opposed to applying a single outlet 54 from the pumping chamber 34 , a separate inlet may be provided for drawing solution “ s ” from the container 24 through check valve 55 into the chamber 34 and a separate outlet may be provided to which the check valve 56 is connected so that fluid is discharged through the separate outlet to the distribution header 25 . utilizing the apparatus of the present invention , the controller 50 is utilized as a timer . an initial determination is made to set the position of the metering piston 35 relative to the piston rod 36 . the controller 50 also includes a connection to a drying air controller 70 . whenever solution is being introduced into the chamber 15 of the pan 14 , the dryer is normally deactivated so as to allow a predetermined residence or distribution time of the solution within the product “ p ” prior to drying air being introduced to affect drying . utilizing the pan pump 30 of the present invention , no contamination of the coating solution is possible as the metering is effectively accomplished in the lower portion of the pan pump with the metering piston 35 operating within the metering chamber 32 . therefore , the sterility of the coating solution is maintained throughout the coating process . utilizing the present invention , uniform quantities of solution are introduced into the pans 14 and the distribution time of the solution within the product and the drying time is accurately assured thereby insuring uniformity of the coated product from one pan to another . the foregoing description of the preferred embodiment of the invention has been presented to illustrate the principles of the invention and not to limit the invention to the particular embodiment illustrated . it is intended that the scope of the invention be defined by all of the embodiments encompassed within the following claims and their equivalents .
| 5 |
the multiplier in the present invention is hardware implemented on an asic ( application - specific integrated circuit ) or fpga ( field - programmable gate array ) and operates on a b - bit data bus . a number of bits b is qualified hereafter by the term “ machine word ”. the bus size is often a power of 2 . the numbering base r is defined as being equal to 2 b . the modulus is an odd number saved as t n machine words . and finally , r is defined as a power of the numbering base , where r is greater than the modulus n . a number x can be broken down in the base r as t + 1 digits x i as follows : x = x 0 + x 1 . r + x 2 . r 2 + . . . + x t . r t , where each digit x i is the size of a machine word . the multiplier in the present invention uses two numbers x and y to calculate x . y . r − 1 mod n + e . n , where e is a value dependent on x and y , and between 0 and r / 2 . the operation x . y . r − 1 mod n is the montgomery modular multiplication . the multiplier thus performs a montgomery modular multiplication and an additive masking of the result of this multiplication . as the value e depends on x and y , when the input values x and y are already masked by a random value before being used by the multiplier , the result is itself also masked by a random value . the multiplier thus propagates the masking of the input data . according to an implementation variant , the value e depends on a random variable independent of x and y . before performing multiplications , a value , designated n ′, is precalculated : n ′=− n − 1 mod r . the multiplication result is designated s . the digits of a number n in the base r are designated n i . the montgomery modular multiplication with additive masking of the result is calculated through the following process : i . s ← x 0 . y ii . for i ranging from 0 to t n − 1 , do : a . m i ← s 0 . n ′ mod r b . s ← x i . y +( m i . n + s )/ r iii . m tn ← s 0 . n ′ mod r iv . z ← x 0 xor x 1 xor . . . xor x tn xor y 0 xor y 1 xor . . . xor y tn v . s ← z . n +( m tn . n + s )/ r where the values m i are the intermediate coefficients of the calculation . the role of the fourth stage ( iv ) is to provide a pseudo - random value z dependent on x and y . the process for calculating this pseudo - random value z given in the above example may be changed to combine the numbers x and y differently . the fifth stage ( v ) includes the uncertainty generated during the previous stage , in the multiplication result . as the number added ( z . n ) is a multiple of n , the modified result is congruous with the result as it would have been generated by a conventional process . the stage ( ii . b .) ( s ← x i . y +( m i . n + s )/ r ) is the most costly in terms of calculation time . it can be performed by a sequence of two multiplication - addition operations , the first multiplication - addition being s ←( m i . n + s )/ r , and the second multiplication - addition being s ← x i . y + s . each multiplication - addition is performed by a loop , and the first multiplication - addition differs from the second by a division by r . according to an implementation method , the loop performed by the second multiplication - addition is as follows : c = 0 for j ranging from 0 to t n , do : p ← p i q j + v j + c s j ← lsb ( p ) c ← msb ( p ) where s designates the multiplication - addition result p i . q + v , and c is a carry variable . during the modular multiplication stage ( ii . b . ), the value p i is replaced by x i , the value q is replaced by y and the value v is replaced by s . the basic operation p ← p i q j + v j + c is performed with p i , q j , v j , where c ranges from 0 to r − 1 . the intermediate result p is thus between 0 and r 2 − 1 , and is expressed as two digits . the expression lsb ( p ) designates the low order digit , and msb ( p ) the high order digit of the number p . unlike a multiplication - addition operating on unmasked numbers , where q n is equal to 1 or less , the multiplication - addition implemented by the device in the present invention performs an operation on a digitn of between 0 and r / 2 in the last iteration of the loop ( when j = t n ),. the value s n + 1 can thus be greater than 2 . the first multiplication - addition s ←( m i . n + s )/ r is performed similarly to the second multiplication - addition but also shifts the result by b bits towards the lower order bit . this shift is equivalent to a division by r . the multiplication - addition with a shift is performed as follows : c = 0 for j ranging from 0 to t n , do : p ← p i q j + v j + c s j − 1 ← lsb ( p ) c ← msb ( p ) during the modular multiplication stage ( ii . b . ), the value p i is replaced by m i , the value q is replaced by n and the value v is replaced by s . thus , for the iteration j = t n , n j = 0 by definition of t n , and thus p ≦ 2 ( r − 1 ), implying msb ( p )≦ 1 . the loop is thus , give or take an index shift , close to the loop corresponding to the second multiplication - addition , allowing the implementing of a component able to perform two loops to be considered . a multiplier can notably break the operation p i q j + v j + c down into ( p i q j + v j )+ c , by pipelining the multiplication - addition operation ( p i q j + v j ) and adding the variable c as the results are obtained . fig1 is an example of the multiplication - addition cell used in the masked modular multiplication in the present invention . the cell calculates the two multiplication - addition operations described above . it is pipelined to improve its performance . the pipeline involves adding register barriers between the logic phases to reduce the critical path , and thus increase the maximum operating frequency ( theoretically that of a base r adder ). the pipeline depth of an elementary component is defined by its number of internal registers . the output register is not counted . the example given in fig1 assumes the availability of a pipelined multiplier - adder 1 , of depth p . it notably includes a set of logic - register pairs ( ii , ri ). the number p of these pairs is notably chosen to ensure that the maximum frequency f 1 max of the pipelined multiplier - adder is not less than the adder &# 39 ; s maximum frequency f 2 max , the values of these two frequencies being as similar as possible . the maximum operating frequency of the multiplier - adder is given by the inverse of the run time of the multiplication - addition operation , whereas the maximum operating frequency of the pipelined multiplier - adder is given by the inverse of the execution time of only one of the p stages . for optimum operation , the adder &# 39 ; s maximum frequency is determined , which gives the adder &# 39 ; s run time and the multiplier - adder is broken down into p stages with a throughput time not exceeding , but as close as possible to , the adder &# 39 ; s run time . the inputs of the multiplier - adder 1 correspond to three digits : p i , q j and v j and the output is a pair of digits corresponding to lsb ( p i q j + v j ) and msb ( p i q j + v j ). the output is two digits long . the multiplier - adder results are sent to a three - input adder , referenced 2 : digit + digit + carry ← digit + carry , operating over 1 cycle ( pipeline 0 ) at a frequency of f 2 max . the register temp corresponds to the storing of c required for the following calculation : add c to the next lsb and the previous carry . the data ( digits of p × q + v ) are thus output in series at each cycle , with the low order digit first , in the same direction as the carry propagation . the operation s n = c + v n + 1 can be performed by an adder , not shown in the figure , using b − 1 bits + 1 bit = b bits and not 2 bits + 1 bits = 3 bits , as in a conventional device , since v n + 1 may be greater than 2 . the other stages in the montgomery modular multiplication process with additive masking of the result can be implemented using conventional registers and multiplexers . a multiplier performing a modular multiplication as per the montgomery method is described in the patent request published under the number wo2006103288 . the stages in the masking process in the present invention can be readily implemented in a device including a multiplication - addition cell as described above . the pseudo - random number can be generated by a logic component with two inputs and one output , with the first input receiving the first operand x to be multiplied , the second input receiving the second operand y to be multiplied , and the output producing a combination of x and y , such as a number equal to x xor y , for example , where xor designates the binary exclusive or operation . the pseudo - random number z obtained from this logic component can then be combined with n in a multiplier to provide a multiple pseudo - random of n , equal to z . n . fig2 is a schematic diagram of the use of a multiplier implementing the masking process in the present invention by an algorithm making use of the modular multiplication operation . during the algorithm execution , all the multiplications performed operate on numbers , all obtained from a few fixed initial values . by way of example , four initial values designated h , x , d and s are used to generate all the other values used in the algorithms . in an initial first stage 21 , an additive masking is implemented on these initial values h , x , d and s . the masked values h m , x m , d m , and s m are obtained as follows : hm = h + e h . n ; x m = e x . n ; d m = e d . n ; s m = e s . n ; where e h , e x , e d , e s , are random values between 0 and 2 p . in practice , the value p should preferably at least be equal to 63 for the additive masking to be effective . in a second stage 22 , the algorithm is executed by making use of the multiplier in the present invention , as many times as necessary . no change to the algorithm is required , and all the results produced by the multiplier in the present invention are masked , allowing the algorithm to process the masked data only . after the algorithm is executed , a “ unmasking ” operation is applied , in a third stage 23 , to the masked values 231 to find the results which would have been obtained without masking . this operation can , for example , be implemented by the multiplier in the present invention by choosing specific input values . the use of the device illustrated in fig2 shows that the values used in the calculations are uncorrelated from the initial values . as a consequence , an attacker analyzing physical magnitudes during the algorithm execution can thus no longer , through a judicious choice of input variables , locate the secret data used during the calculation . in a conventional device , for example , an attacker can choose an input variable including a large number of ‘ 0 ’ or a large number of ‘ 1 ’, and then analyze the electrical consumption to determine a relationship between the input variables and the consumption and / or deduce the type of operations performed by the algorithm . through the use of additive masking , these long initial sequences of ‘ 0 ’ or ‘ 1 ’ are eliminated in the operands used by the algorithm , thus reducing any assumptions that the attacker may have been able to make as regards any input variables selected by the attacker himself . the extra overhead in terms of calculation time and , in the case of a hardware integration , circuit surface area , is very low . the multiplier block advantageously allows algorithms to be executed on numbers of any size without changing the hardware implementation . a multiplier synthesized in fpga or asic and implemented in the present invention performs multiplications on any modules 128 , 256 , 512 , 1024 , and 2048 bits in size , for example . one of the advantages of the process in the present invention is that it can be implemented in a cryptographic calculation component existing transparently as far as the component architecture is concerned . indeed , the conventional modular multiplication calculation operator only has to be replaced by an operator implementing the process in the present invention . the replacement of this elementary operation then globally improves the component protection , since the functions used by security mechanisms such as encryption or authentication make use of the operator in the present invention . it will be readily seen by one of ordinary skill in the art that the present invention fulfils all of the objects set forth above . after reading the foregoing specification , one of ordinary skill in the art will be able to affect various changes , substitutions of equivalents and various aspects of the invention as broadly disclosed herein . it is therefore intended that the protection granted hereon be limited only by definition contained in the appended claims and equivalents thereof .
| 6 |
fig1 shows an exemplary substantially rectangular shaped web having substantially parallel top and bottom edges , 100 a and 100 b that can be used in the present invention . other starting web configurations can be used . the web can be made from paper or polymeric films . suitable polymeric films include , but not limited to , polyethylene terephthalate , polypropylene , and polyethylene , and copolymers thereof . in one embodiment , the thickness of the web is less than about 0 . 2 mm . the web can be light transmissive , meaning that it will allow at least a portion of incident light through , or it can be opaque . furthermore , the web can be colored . the web material should be able to adhere to the adhesive used on the substrate . fig2 shows a top plan view of the web of fig1 after a portion of the web has been excised and perforated . a perforated web 110 has an overall length l and an overall width w . the web includes a plurality of open sections or cutouts 112 interposed between a plurality of retained sections 114 connected to carrier sections 116 . the carrier sections of the perforated web include substantially parallel top and bottom edges 110 a and 110 b that correspond to the top and bottom edges of the predecessor web 100 of fig1 , namely edges 100 a and 100 b . in this particular embodiment , the perforated web 110 has an upper carrier section that includes the top edge 110 a to the perforation 118 lying closest to the top edge and the lower carrier section that includes the bottom edge 110 b to the perforation 118 lying closest to the bottom edge . the retained sections have substantially the same geometry , each in the form of substantially an “ x ”. while fig2 shows perforations 118 disposed on the retained sections , they can also be disposed between the carrier section and the retained section , or on the carrier section . the perforations span from one open section to the next adjacent open section . the perforations typically include slits on the web lying between ties . the perforation design should be selected so that the separation of the carrier section does not dislodge the retained sections from the adhesive . in one embodiment , the perforated web based on the design of fig2 has a first width , w 1 , of about 4 inch ( 10 . 2 cm ), a second width , w 2 , of about 2 . 5 inch ( 6 . 4 cm ), and a third width , w 3 , of about 0 . 2 inch ( 5 mm ). the third width denotes the distance from an inner surface of the carrier , 116 a , to the perforation . the web 110 also has a length l 1 of about 2 . 5 inch and a length l 2 , which denotes one dimension of the retained section , of about 0 . 27 inch ( 6 . 9 mm ). in this particular embodiment , the perforation includes two ties , each of 0 . 010 inch ( 0 . 25 mm ) in length disposed between three slits . the three slits consist of a long slit , a short slit , and a long slit , with the long slit being 0 . 078 inch ( 2 . 0 mm ) in length and the short slit being 0 . 0321 inch ( 0 . 82 mm ) in length . thus , from one open section to the next , the perforation on the retained section can be described as a long slit , a tie , a short slit , a tie , and a long slit . while the foregoing description of the perforation of fig2 is useful , other designs can be used . for example , another perforation design includes a short slit , a tie , a long slit , a tie , and a short slit . furthermore , three or more ties can be used along with long and or short slits therebetween . fig3 shows a bottom plan view of an exemplary substantially rectangular shaped substrate having opposing first ( not shown ) and second 202 surfaces and top and bottom edges , 200 a and 200 b . adhesive 204 is disposed on the second surface proximate to the top edge . in this particular embodiment , the adhesive is in generally in the form of a stripe having substantially parallel upper and lower edges , 204 a and 204 b respectively . in one exemplary embodiment , the substrate is a sheet of easel paper . in some embodiments , the width of the adhesive stripe varies from 7 . 6 to 0 . 32 cm . in other embodiments , the width of the adhesive stripe varies from 7 . 6 to 2 . 5 cm . in one embodiment , the thickness of the substrate is less than about 0 . 5 mm . any type of adhesive can be used for the substrate and the adhesive can cover any portion of the substrate . in one embodiment , the adhesive is a microsphere - based repositionable pressure sensitive adhesive . the repositionable adhesive can be solvent based , water based , or can be a solventless , hot melt adhesive . suitable repositionable adhesives includes those disclosed in the following u . s . pat . no . 3 , 691 , 140 ( silver ); u . s . pat . no . 3 , 857 , 731 ( merrill et al . ); u . s . pat . no . 4 , 166 , 152 ( baker et al . ); u . s . pat . no . 4 , 495 , 318 ( howard ); u . s . pat . no . 5 , 045 , 569 ( delgado ); u . s . pat . no . 5 , 073 , 457 ( blackwell ); u . s . pat . no . 5 , 571 , 617 ( cooprider et al . ); u . s . pat . no . 5 , 663 , 241 ( takamatsu et al . ); u . s . pat . no . 5 , 714 , 327 ( cooprider et al . ); u . s . pat . re no . 37 , 563 ( cooprider et al . ); u . s . pat . no . 5 , 756 , 625 ( crandall et al . ); u . s . pat . no . 5 , 824 , 748 ( kesti et al . ); and u . s . pat . no . 5 , 877 , 252 ( tsujimoto et al .). in another embodiment , the repositionable pressure sensitive adhesive is polyacrylate - based microsphere adhesive . fig4 shows a bottom plan view of the substrate of fig3 with the perforated web 110 of fig2 disposed on the adhesive region of the substrate . in one exemplary method , the web 110 is aligned with the adhesive 204 of the substrate such that the perforations 118 on the perforated web substantially coincides with at least one of the upper and lower edges of the adhesive . fig4 a shows a bottom plan view of a substrate 400 , similar that of substrate 200 of fig3 , laminated to a perforated web 310 . the substrate has a stripe of adhesive 404 on its second side 402 . the web includes a plurality of open sections or cutouts 312 interposed between a plurality of retained sections 314 connected to upper and lower carrier sections 316 . the retained sections have substantially the same geometry , each in the form of substantially a rectangle . perforations 318 are disposed between the carrier section , the retained sections . the perforations span from one open section to the next adjacent open section and align with the top and bottom edges of the adhesive stripe of the substrate . specifically , the patterned and perforated web of this figure includes substantially rectangular open sections , each having dimensions of 2 . 5 by 2 . 0 inch ( 6 . 4 by 5 . 1 cm ). the distance between one open section to the next adjacent open section is 0 . 25 inch ( 6 . 4 mm ). the corners of the open section are rounded to a 0 . 25 inch radius . and , the distance between a top and a bottom perforation is about 2 . 1 inch ( 5 . 3 cm ). the design of the perforations is very similar to that described in fig2 . thus , a wide variety of designs can be used for the perforated web . fig5 shows a cross - sectional view of the embodiment of fig4 taken along line 5 - 5 showing substrate 200 having opposing first and second surfaces , 201 and 202 . disposed on the second surface of the substrate is adhesive 204 having top and bottom edges 204 a and 204 b . the patterned and perforated web includes retained section 114 attached to carrier section 116 . interposed between the retained sections are open sections 112 . this cross - sectional view better shows that the retained portion 114 has a certain thickness , denoted as s 1 , which function to space or separate an exposed surface 204 c of adhesive 204 from contacting an adjacent surface . thus sheet 200 can be handled and moved across the adjacent surface without adhering thereto by adhesive 204 . examplary adjacent surfaces include , but are not limited to , another sheet , a desktop , or a wall . in this way , the retained sections , which are non - adhesive forms a part of a securing mechanism , allowing the sheet to exhibit adhesion on demand . fig6 shows the embodiment of fig4 where the upper and lower carrier sections are being removed at the perforation . typically the carriers are discarded after they have been removed . in one method , after the perforated web 110 has been attached to the adhesive 204 of the substrate , such a composite is laminated together using pressure and or heat to adhere more securely the web 110 to the adhesive . upon removal of the carrier , the retained sections , which now have been effectively laminated to the adhesive , will not lift off when the carrier section is being removed . fig7 shows the embodiment of fig6 with both carrier sections removed leaving retained sections 115 ( also referred to herein as “ non - adhesive sections ”) with portions spanning substantially from the upper edge 204 a to the lower edge 204 b of the adhesive as well as substantially the entire length of the adhesive stripe . this figure shows that the retained sections are in the form of a plurality of discrete “ x ”. here , both legs of the “ x ” shaped retained section span from the top edge 204 a of the adhesive to the bottom edge 204 b of the adhesive . furthermore , the retained sections span nearly the entire length of the adhesive portion . other configurations can be used . for example , the retained sections can be in the form of geometric shapes that are substantially circles , squares , rectangles , other polygons , and combinations thereof . furthermore , the line can be a continuous line a broken line , meaning that adhesive is exposed in between breaks in the line . fig8 shows another exemplary perforated web 510 having a plurality of open sections 512 interposed between a plurality of retained sections 514 connected to carrier sections 516 . the perforated web includes an upper carrier section that includes a top edge 510 a and a lower carrier section that includes a bottom edge 510 b . this particular design of the perforated web 510 facilitates the carrier section removal step . in one embodiment , a plurality of substrates such as that of fig7 is assembled together to form a pad of substrates as shown in fig9 . such a construction is typical of an easel pad 700 , typically having 25 to 50 sheets of the substrate 720 stacked and bound together at one end 701 , usually near the end of the adhesive region . the presence of the discrete sections disposed on the adhesive allows the sheets to be stacked without one sheet becoming substantially adhesively attached to the next subsequent sheet and thus the removal of a sheet can be done under substantially lower peel force . furthermore , as a plurality of these sheets is used , e . g ., for transcribing notes of a meeting , they are typically removed and displayed on a wall . at the end of the meeting , one participant usually collects the used sheets , stack them together , and optionally roll the sheets into a cylindrical tube for easy transport . the stacked sheets will typically not adhere to one another , unless a threshold force has been applied to the adhesive region . this adhesive on demand property provides the consumer with an added ease of use feature . a rotary die cutting apparatus available from webtron corp ., ft . lauderdale , fla ., equipped with a vacuum trim removal system was used to make a 4 . 0 inch ( 10 . 2 cm ) wide and a 0 . 002 inch ( 0 . 05 mm ) thick general purpose polyethylene terephthalate available from grafix plastics , cleveland , ohio perforated web having the pattern shown in fig2 having open sections and retained sections attached to a carrier . in this example , the excising of the web and the perforation of the web occurred using the same rotary die and done in one step . the perforated web was contacted to an adhesive stripe of a sheet of post - it ® self - stick easel pad , product no . 559 , commercially available from 3m company , st . paul , minn . the perforated web was attached to the sheet of easel paper such that the perforations substantially nearly coincided with a top and a bottom edge of the adhesive stripe . thereafter , the carrier of the patterned and perforated web was manually separated , collected , and discarded leaving the discrete retained sections behind with the sheet of easel paper . a patterned and perforated web was made as in example 1 , except that the resulting web had a design substantially similar to web 310 shown in fig4 a . the patterned and perforated web was laminated to a sheet of post - it ® self - stick easel pad , product no . 559 as in example 1 and the carrier of the web was separated leaving discrete retained sections behind with the sheet of easel paper . although specific embodiments of the present invention have been shown and described , it is understood that these embodiments are merely illustrative of the many possible specific arrangements that can be devised in application of the principles of the invention . numerous and varied other arrangements can be devised in accordance with these principles by those of ordinary skill in the art without departing from the spirit and scope of the invention . thus , the scope of the present invention should not be limited to the structures described in this application , but only by the structures described by the language of the claims and the equivalents of those structures .
| 2 |
in the following , exemplary embodiments of the present invention will be described in detail . it is to be understood that the following description is given only for the purpose of illustrating the principles of the invention and is not be taken in a limiting sense . rather , the scope of the invention is defined only by the appended claims and not intended to be limited by the exemplary embodiments hereinafter . it is to be understood that the features of the various exemplary embodiments described herein may be combined with each other unless specifically noted otherwise . fig1 shows schematically a device 10 which may be connected to a server 50 via a network 30 . a connection 20 between the device 10 and the network 30 may be a wireless connection , for example a gsm , umts , gprs or bluetooth connection . however , connection 20 may be any other kind of wireless or wired connection . connection 40 between the network 30 and the server 50 may be also any kind of wireless or wired connection . the device 10 may be any kind of mobile or stationary or non - portable device , for example a mobile phone , a mobile audio reproduction device , an mp3 player , a mobile navigation system , a notebook , a laptop , or a stationary personal computer . in the following , it will be assumed that the device 10 is a mobile device , e . g . a mobile phone . the device 10 comprises a radio frequency transceiver 11 , a user interface 12 , a processing unit 13 , a memory 14 , and a head phone connector 15 . instead or additionally to the head phone connector 15 , the device 10 may provide one or more loudspeakers . additionally , the device 10 may comprise additional components , for example a display , a keypad , a loudspeaker , a microphone , and so on , but these components are not shown in fig1 to simplify matters . the processing unit 13 is connected to the radio frequency transceiver 11 , the user interface , the memory 14 , and the head phone connector 15 . the radio frequency transceiver 11 may utilize a data communication between the processing unit 13 and the server 50 via a wireless connection 20 and the data communication network 30 . the memory may be used to store a plurality of audio files which may be played back by the processing unit as audio data which may be output via the head phone connector 15 . additionally , the processing unit 13 may be adapted to download or stream audio data from the server 50 and to play back the downloaded or streamed audio data via the head phone connector 15 . for downloading or streaming music from the server 50 , a user of the device 10 may be prompted in advance via the user interface 12 for allowing access to the server 50 . operation of the processing unit 13 will now be described in more detail in connection with fig1 and 2 . assuming a user of the device 10 wants to set up a list of audio files , a so - called playlist , the user selects via the user interface 12 a menu 200 as indicated in fig2 . the menu 200 shows a list of artists of the audio files which are stored in memory 14 or which may be accessible by the processing unit 13 via the network 30 at the server 50 . as shown in fig2 , the list of artists comprises five artists 201 - 205 . in case more artists are present , an additional ( not shown ) scroll bar may be used to extend the list of artists . for each artist a selection box 211 - 215 is provided . with appropriate input means , for example a mouse or a stylus and a touch screen , the user can select for each artist the number or quantity of titles or tracks to be added to the playlist from this artist by adjusting the number of titles in the corresponding selection box 211 - 215 . in the example shown in fig2 , the user selects six titles to be played from “ the beatles ”, two titles to be played from “ bon jovi ”, and four titles to be played from “ linkin park ”. according to this user selection , the processing unit 13 selects automatically the respective quantity of titles from the audio files stored in memory 14 . as shown in the exemplary embodiment of fig2 , six titles from “ the beatles ”, two titles from “ bon jovi ” and four titles from “ linkin park ” are selected from the audio files stored in memory 14 . if for example more than six titles from “ the beatles ” are present in the memory 14 , the processing unit may for example select six audio files randomly from the more than six beatles audio files . however , the selection may also be based on user - preferred audio files , for example , the processing unit 13 may select those files from the beatles audio files to which the user was listening in the past most frequently . after the user has selected for each of the artists 201 - 205 a desired number of tracks or titles , a new playlist is set up . the titles within the playlist may be mixed randomly or may be re - arranged by the user before the audio files of the playlist are played back by the device 10 . another embodiment of the present invention will be described below in connection with fig1 and 3 . fig3 shows a menu 300 displaying a user a list of artists 301 - 305 . selection boxes 311 to 315 assigned to the artists 301 - 305 enable the user to select how many minutes of music from the respective artist shall be added to a playlist . in the exemplary embodiment shown in fig3 , the user has selected ten minutes for “ the beatles ”, five minutes for “ bon jovi ”, and ten minutes for “ linkin park ”. upon the user selection the processing unit 13 selects from the audio files stored in memory 14 or accessible via the network 30 at the server 50 , one or more tracks from the respective artist such that the required playing time is approximately met . for enabling this , each track or each audio file of memory 14 or server 50 provides a playing time information indicating a time duration which is required for playing back the audio file . in the example shown in fig3 , the processing unit 13 selects the following three tracks of “ the beatles ”: a first track “ hey jude ” with a playing time of 3 minutes and 24 seconds , a second track “ get back ” with a playing time of 4 minutes and 29 seconds , and a third track “ in my life ” with a playing time of 2 minutes and 57 seconds . thus , a total playing time for “ the beatles ” of 10 minutes and 50 seconds is reached . in the same way two tracks of “ bon jovi ” are selected having together a total playing time of approximately 5 minutes and another three tracks of “ linkin park ” are selected having together a total playing time of approximately 10 minutes . the selected tracks are added by the processing unit 13 to the playing list which may be displayed to the user for rearranging the selected tracks into a desired order . furthermore , the tracks may be added to the playlist in a randomized order . in case a lot of tracks of one artist , for example “ the beatles ”, are stored in memory 14 or at the server 50 , the processing unit 13 may find several combinations of tracks of this artist , wherein each of these combinations has a total playing time of approximately the desired duration , for example 10 minutes . in this case , the processing unit 13 may select a combination of tracks which fits best to the desired total playing time or the processing unit 13 may select a combination comprising tracks the user prefers . in the examples shown above in connection with fig2 and 3 , the selection criteria in the menus 200 and 300 is the artist of the audio files . however , instead of the artist a name of an album or a music genre may be used . in case of an album , the user may select the number of tracks of an album which shall be added to the playlist or a total playing time of tracks of an album which shall be added to the playlist . likewise , the user may set up a playlist based on the genre of the audio files , for example by selecting a number of audio files of a first genre , for example pop music , to be added to the playlist , and by selecting a number of audio files of a second genre , for example jazz music , which shall be selected and added to the playlist . while exemplary embodiments have been described above , various modifications may be implemented in other embodiments . for example , the characteristic upon which a number or quantity of audio files or a total playing time is selected by the user , may be an album name , a name of an artist or interpreter , or a genre of the audio files , and may further comprise a year when the songs was published , or a quality of the audio file , for example a sampling rate . finally , it is to be understood that all the embodiments described above are considered to be comprised by the present invention as it is defined by the appended claims .
| 6 |
fig3 and fig4 show waveform diagrams of a ( load ) current or voltage before compensation . referring to fig3 and fig4 , an input capacitor cin impacts the dc voltage vdc such that the dc voltage vdc has ripples . furthermore , the dc voltage vdc having ripple components varies an average current or average voltage on a load . as shown in fig3 , an operation period of the load current or voltage of a pulse is d 1 , the average load current of voltage is avg 1 , a maximum peak value of the pulse is p 1 , and a waveform of the varied pulse is illustrated in fig4 . the operation period of the ( load ) current or voltage of the pulse as shown in fig4 is changed to d 2 or d 3 . the possible conditions may be one of the following : d 2 = d 1 − d 3 or d 2 = d 1 + d 3 . however , the maximum peak value at this time is not changed , and the values of average ( load ) current / voltage is changed to avg 2 , therefore , it is possible to get a situation of avg 2 & lt ; avg 1 or a situation of avg 2 & gt ; avg 1 . as a result , the value of average current or voltage will be varied . fig5 shows a flowchart of an automatic brightness compensation in an led illuminant driving circuit according to an embodiment of the present invention . referring to fig5 , the automatic brightness compensation method may be applied to the led illuminant driving circuit of an illuminant device in order to solve an unstableness of the illuminant device caused by voltage ripples and variations of illuminant brightness . the automatic brightness compensation method includes the following steps . first , in step s 510 , a target value is provided , and the target value may be utilized as a setting value of the average current or the average voltage to drive the led illuminant . next , in step s 520 , an operation period of a pulse output from the led illuminant driving circuit is detected . then , in step s 530 , a peak value according to the target value and the operation period is decided . furthermore , in step s 540 , a peak level of the pulse is set according to the peak value . fig6 shows a flowchart of an automatic brightness compensation in an led illuminant driving circuit according to another embodiment of fig5 . referring to fig6 , when the above - described automatic brightness compensation method of fig5 is proceeded in step s 520 , the step may further includes the following steps : in step s 522 , a turn - on period and a cut - off period of the pulse output from the led illuminant driving circuit are counted ; next , in step s 524 , the operation period is calculated according to the turn - on period and the cut - off period . then , when the above - described automatic brightness compensation method of fig5 proceeds in step s 530 , step s 532 may be processed to generate a control signal for setting the peak level of the pulse output from the led illuminant driving circuit . fig7 shows a block diagram of an led illuminant device according to one embodiment of the present invention . referring to fig7 , the led illuminant device 700 may include an electronic transformer 100 , a rectifier circuit 100 , an input capacitor cin , an led illuminant driving circuit 710 , and an led illuminant 730 . in this embodiment , the led illuminant driving circuit 710 includes a driver unit 720 and an automatic brightness compensation unit 740 . a power input terminal vin of the driver unit 720 receives the dc voltage vdc having ripples components , in order to output a pulse to drive the led illuminant 730 . the automatic brightness compensation circuit 740 is coupled to the driver unit 720 to detect an operation period of the pulse , and then decides a peak value according to a target value and the operation period , and controls the driver unit 720 according to the peak value such that the driver unit 720 then sets a peak level of the pulse according to the peak value . in order to stabilize the average current or the average voltage of the led illuminant 730 , the automatic brightness compensation circuit 740 is used to generate a feedback control signal ref to the driver unit 720 . the driver unit 720 is able to stably maintain the average current or the average voltage of the led illuminant 730 according to the feedback control signal ref . fig8 shows a waveform diagram of a ( load ) current or voltage after compensation according to one embodiment of the present invention . please refer to fig8 in accordance with fig4 and fig3 . the working principle of the automatic brightness compensation circuit 740 is as the following : before compensation , the output pulse of the driver unit 720 as shown in fig4 has the operation period of the pulse as d 2 ; after compensation , the operation period of the output pulse of the driver unit 720 is not changed but the peak value of the output pulse of the driver unit 720 is set as p 2 for a result of compensation . therefore , a situation of p 2 & gt ; p 1 or a situation of p 2 & lt ; p 1 is obtained . and setting of p 2 may be embodied as follows : for example , if the target value of the average current is avg 1 , then p 2 is set as the value of avg 1 divided by d 2 . it means at last the average current or the average voltage values avg 3 of the output pulse of the driver unit 720 is equal to the target value avg 1 . this means that the average load current or the average load voltage values of the led illuminant 730 is not changed , and hence , a functionality of the automatic brightness compensation of the led illuminant may be obtained to make a stable and uniform emitting light brightness of the led illuminant . fig9 shows a block diagram of an led illuminant device of another embodiment of the present invention . referring to fig9 , the power input terminal vin of the driver unit 720 receives a dc voltage vdc as shown in fig7 , and the automatic brightness compensation circuit 900 is coupled to the driver unit 720 and the led illuminant 730 . the automatic brightness compensation circuit 900 may include a turn - on counter 910 , a cut - off counter 920 , an operation period calculation circuit 930 , an average load setting circuit 940 , and a feedback compensation circuit 960 . fig1 shows a waveform of the pulse output from the driver unit 720 . referring to fig1 , the pulse output from the driver unit 720 is similar to a square wave , and the turn - on period and the cut - off of each operation period is t 1 and t 2 respectively . referring to fig9 , the main purpose of the turn - on counter 910 is to count the turn - on period t 1 of the pulse output from the driver unit 720 , and the cut - off counter 920 is used for counting the cut - off period t 2 of the pulse output from the driver unit 720 . surely , the turn - on counter 910 can be used to count the turn - on period t 1 of current or voltage on the led illuminant 730 instead of the pulse , and the cut - off counter 920 to count the cut - off period t 2 of current or voltage on the led illuminant 730 instead of the pulse . these changes belong to the scope of the present invention . next , the operation period calculation circuit 930 is utilized to generate current operation period d 2 according to counting results from the turn - on counter 910 and the cut - off counter 920 to generate . in this embodiment , d 2 = t 1 /( t 1 + t 2 ). the average load setting circuit 940 is connected to an output terminal of the operation period calculation circuit 930 , and together with a variable resistor 950 to form a setting unit for setting the target value avg 1 of the average current or the average voltage output from the driver unit 720 or for setting the target value avg 1 of the average current or the average voltage conducting through the led illuminant 730 . the feedback compensation circuit 960 is connected to the output end of the average load setting circuit 940 for obtaining the target value avg 1 and the operation period d 2 of the average current or the average voltage of the led illuminant 730 . the first compensation is mentioned previously as illustrated in the fig3 and fig4 . then , after processed by the feedback compensation circuit 960 , where the way of process does not change the operation period d 2 of the average current or the average voltage and sets the peak value of the output pulse to p 2 , or alternatively , the way of processing may also set the maximum peak value of the load current or the load voltage to p 2 as a result of compensation so as to achieve a situation of p 2 & gt ; p 1 or a situation of p 2 & lt ; p 1 . the above - described feedback compensation circuit 960 may operate as the followings . for example , the target value of the average current is avg 1 , and then p 2 is equal to the value of avg 1 divided by d 2 . the feedback compensation circuit 960 generates a feedback control signal ref after processing . the control signal ref is transferred to the driver unit 720 . the driver unit 720 compensates the average current or the average voltage of the led illuminant 730 according to the feedback control signal ref . the embodiment detects the variations of the operation period to compensate the average current or the average voltage so as to maintain them such that the automatic brightness compensation of the led illuminant is achieved . fig1 shows another embodiment of the automatic brightness compensation circuit 900 . in this embodiment , the average load setting circuit 940 may be implemented with an analog - to - digital converter ( adc ), and the feedback compensation circuit 960 may be implemented with an arithmetic logic unit ( alu ), where the alu receives the target value avg 1 and the operation period d 2 and generates the feedback control signal ref after computation of p 2 ( equal to the value of avg 1 divided by d 2 ). it is noted that in the above - described embodiments , the illuminant device 700 may be an mr16 lamp , but surely may be an e26 lamp or an e27 lamp . it is understood by people skilled in the field that embodiments of the present invention are not limited to the embodiments disclosed above , embodiments may be varied according to design requirements , so long as realizations , which detect the operation period of the pulse output from the led illuminant driving circuit and use the operation period and the target value to set the peak level of the pulse , fall within domains of the present invention . in summary , the embodiments of the present invention have at least the following advantages : ( 1 ) having an automatic brightness compensation mechanism to provide stable average current / voltage to the led illuminant ( load ) so as to avoid variations of illuminant brightness ; ( 2 ) may applies to the led illuminant ( load ) requiring stable average current or average voltage to make brightness of emitting light uniform and in turn enhances convenience of applications , for example , the led illuminant may be applied to an mr16 lamp , an e26 lamp or an e27 lamp . though the present invention has been disclosed above by the preferred embodiments , they are not intended to limit the present invention . anybody skilled in the art can make some modifications and variations without departing from the spirit and scope of the present invention . therefore , the protecting range of the present invention falls in the appended claims .
| 7 |
fig1 is a schematic diagram of an embodiment of the invention . first , the digitized image is subsampled using a reduction factor of two to increase the speed of the computational process . this function is included in preprocessing unit 100 of the invention . thus , an input image ( 95 ) of 525 × 637 will be reduced to an output image ( 150 ) of 267 × 319 after preprocessing . fig2 is a digital chest portrait image of size 525 × 637 . fig3 is a digital chest landscape image of size 525 × 637 . a flow chart of a preferred method for image subsampling is shown in fig4 . there , oi ( original image ) refers to the digital chest image . the i denotes the width of the original image in pixels , and j denotes the height of the original image in pixels . next is unit 200 , the fuzzy clustering unit . according to a preferred embodiment of the invention , in this unit , a gaussian clustering method ( gcm ) is employed . fuzzy clustering is an unsupervised learning technique by which a group of objects is split up into some subgroups based on a measure function . gcm is one of the most commonly used clustering methods . it has a complete gaussian membership function derived by using a maximum - fuzzy - entropy interpretation . fig5 shows an exemplary flow chart of this method . in fig5 , u ik = exp [ - x k - v i 2 / 2 σ 2 ] / ∑ j = 1 c exp [ - x k - v j 2 / 2 σ 2 ] , and v i = ∑ k = 1 n u ik x k / ∑ k = 1 n u ik . here , x k represents the k - th input , i . e ., k - th pixel , v i represents the center vector of cluster i . u ik represents membership assignment , that is the degree to which the input k belongs to cluster i . σ is a real constant greater than zero , which represents the “ fuzziness ” of classification . t represents the maximum number of iterations , ε is a small positive number that determines the termination criterion of the algorithm . n and c represent the number of inputs and number of clusters , respectively . note that in fig5 , the superscripts denote iteration number . after about ten iterations , both of the center vectors and membership function will converge . this method is further described in li , r . p . and mukaidono , m ., “ gaussian clustering method based on maximum - fuzzy entropy interpretation ”, journal of fuzzy sets and systems , 102 ( 1999 ), pp . 253 - 258 , which is incorporated herein by reference . in the present invention , c is 2 , which means that the image after clustering is a binary image . note that a defuzzification process is necessary and is performed by using the following formula : u ik = max i = l i = c { u ik ] ∀ k , u ik = { 1 if i = i 0 otherwise fig6 is the rough image of fig2 obtained through preprocessing unit 100 and fuzzy clustering unit 200 . the rough image is a binary image . pixels in the rough image have two possible gray values , i . e ., white or black . such a binary image roughly presents lung regions ( most of the area of black cluster ) of the original chest image by contrasting with white cluster area . the third unit ( 300 ) serves to identify the orientation of a pa chest image . according to the method of the invention , this task is designed to find the orientation of the “ spinal ” area of a pa chest image . preferably , the inventive orientation identification method is based on the rough image instead of the original image . obviously , the difference between portrait and landscape images is that for a portrait image there is a rectangle located in the middle section of the horizontal direction and oriented in the vertical direction , whereas , for a landscape image such a rectangle is located in middle section of the vertical direction and oriented in the horizontal direction . in this rectangle almost all the pixels are of the white gray value . the length of the long side of the rectangle is close to the image &# 39 ; s height for the portrait case or close to the image &# 39 ; s width for the landscape case . fig7 shows a portrait case , while fig8 shows a landscape case . the method of identifying orientation of a chest image based on the rough image is simple but effective . the default assumption for the method is that the image is landscape . to judge whether an image is in portrait orientation or not , two conjunctive conditions are used . first , in a portrait image , there is a rectangle as defined above that is located in the middle section of the horizontal direction and oriented in the vertical direction . further , in a portrait image , gray level value must be black at point ( width / 4 , height / 2 ) and point ( 3width / 4 , height / 2 ). here , “ width ” represents image width in pixels , and “ height ” represents image height in pixels . if an image is portrait , it can be passed to post - processing unit ( 400 ) directly . otherwise , a landscape image would be rotated to become a portrait image first , and then passed to the next processing unit . as will be noted below , according to an embodiment of the method of the invention , this rectangle can be used in determining the central zone of a pa chest image . fig9 is a schematic diagram of an embodiment of post - processing unit 400 of fig1 . in this unit , there are five ( 5 ) functions , as follows : 1 ) isolated - point assimilation ( 1350 ), 2 ) landmark point search ( 2350 ), 3 ) top - down edge trimming ( 3350 ), 4 ) bottom - up edge trimming ( 4350 ), and 5 ) region extension and / or region shrink ( 5350 ). according to an embodiment of the inventive method , the purpose of the isolated - point assimilation part 1350 is to assimilate isolated white points in a black cluster and isolated black points in a white cluster . fig7 is the input ( 350 ) of isolated - point assimilation part 1350 , and fig1 is the corresponding output ( 1450 ) of isolated - point assimilation part 1350 . comparing fig1 to fig7 , after this block , isolated points are almost all assimilated . to segment lung regions based on a rough image , the first step is to locate landmark points . landmark points here include top lung edge points and bottom lung edge points . to determine top lung edge points , rough images are classified into two types . type 1 images are those in which the boundary of the top lung is clearly separated , as shown in fig7 and fig8 . type 2 images are otherwise rough images , as shown in fig1 . for type 1 , as shown in fig1 , the method is straightforward . considering the right lung , the search region , in the x - direction is from the right side of the rectangular central zone to x = width / 4 , and in the y direction is from y = 15 to y = height / 3 ; note that the point ( x , y )=( 0 , 0 ) is located at the upper left corner of the image . the first pixel encountered that has “ black ” gray - value is called inner point of top lung ( itl ). the final left pixel that has “ black ” gray - value is called outer point of top lung ( otl ). in an exemplary embodiment , the maximum length of top lung edge is set to be 20 pixels . if the top lung edge cannot be found through this process , the rough image is considered to be type 2 . a corresponding process may be carried out for the left lung , as well . the search process for the top lung edge for type 2 images is divided into four ( 4 ) steps , which will be described in terms of the right lung ( i . e ., the left side of fig1 ); corresponding steps may be used to search for the top lung edge of a left lung in a type 2 image . step 1 is to find the intermediate y coordinate ( y ), which is the location of the first pixel whose gray - value is “ black ” when y decreases to zero from y = height / 4 while x = 10 ( i . e ., the value of x is chosen to be close to , but not quite , zero , where zero represents the outer edge of the right lung image ). step 2 is to locate the starting coordinate ( x 1 , y 1 ), which must have a gray - value of black and be the nearest such pixel to the left side of the rectangular central zone in the x - direction in the search region y = 0 to y ′ and x ranging from the left side of the rectangular central zone ( i . e ., the innermost border of the right lung image ) to 0 . step 3 is to locate the ending coordinate ( x 2 , y 2 ), which must have a gray - value of “ black ” and be the nearest such pixel to the left side of the rectangular central zone in the x - direction in the search region y = y 1 to height / 2 and x ranging from the left side of the rectangular central zone to x = width / 4 . step 4 is to find the itl , which must have a gray - value of white and be the furthest such pixel from the left side of the rectangular central zone in the x - direction within the search region y = y 1 to y 2 and x ranging from the left side of the rectangular central zone to x = width / 4 . fig1 shows the top lung edge point of a type 2 image . for this type , the position of otl is the same as that of itl . similarly , for determination of bottom lung edge points , rough images are classified into two ( 2 ) cases . case 1 refers to those in which the boundary of bottom lung is clearly separated as shown in fig7 and fig8 . case 2 are those images that are otherwise rough as shown in fig1 . the search region , for the right lung , is from y = height / 3 to y = height in the y direction and from x = width / 3 to x = 0 in the x direction ( a corresponding region and process may be applied to the left lung ). a common necessary condition of being a bottom lung edge point is that such a point must be an edge point between a “ black ” region and a “ white ” region . let an edge point &# 39 ; s coordinates be ( x , y ). for case 1 , a sufficient condition for being a bottom edge point is : 1 ) gray - value ( gv ) of pixel ( x - 1 , y ) must be “ white ”, 2 ) gv of pixel ( x - 2 , y - 1 ) must be “ white ”, and 3 ) gv of pixel ( x − 1 , y + 1 ) must be “ white ”. in fig1 and fig1 , the outer point of bottom lung ( obl ) belongs to case 1 . for case 2 , sufficient condition of being bottom edge point is : 1 ) gray - value ( gv ) of pixel ( x - 1 , y ) must be “ white ”, 2 ) gv of pixel ( x - 1 , y - 1 ) must be “ white ”, and 3 ) gv of pixel ( x − 1 , y + 1 ) must be “ black ”. in fig1 , obl belongs to case 2 . therefore , if the input of landmark point search part ( 2350 ) of postprocessing unit ( 400 ) in fig9 is an image similar to fig1 , then the output will be similar to fig1 . top - down trimming part ( 3350 ) of the post - processing unit ( 400 ) in fig9 , according to an embodiment of the invention , takes an input image like that shown in fig1 , and uses a heuristic rule to trim the boundary of the lung and remove noise . a heuristic rule employed here states that the width of the lung region should continually increase as it moves from top to bottom . let ( x t , y t ) represent the detected outer edge point of the right lung when y = y t at evolution time t , and let the successive edge points be ( x t + 1 , y t + 1 ), ( x t + 2 , y t + 2 ), and so on . according to an embodiment of the invention , if x t + 1 & gt ; x t , then x t + 1 is not changed . otherwise , x t + 1 reduces 3 pixels every 3 evolution times . the trimming region is from top lung edge point to bottom lung edge point . fig1 shows the result after trimming the right lung shown in fig1 . comparing fig1 with fig1 , after top - down trimming , despite the recovery of misclassified bottom lung area and the removal of noise , the boundary of the top lung area is not complete . according to an embodiment of the invention , the bottom - up trimming part ( 4350 ) of post - processing unit ( 400 ) in fig9 is designed to trim the boundary of the top lung area using the following heuristic rule . like above discussion , let ( x t , y t ) represent the detected outer edge point of the right lung when y = y t at evolution time t , and let the successive edge points be ( x t + 1 , y t + 1 ), ( x t + 2 , y t + 2 ), and so on . if x t + 1 & lt ; x t , then x t + 1 is not changed . otherwise , x t + 1 increases 1 pixel every evolution time . the trimming region is from bottom lung edge point to top lung edge point . fig1 shows the result after bottom - up trimming of the right lung shown in fig1 . similarly , top - down trimming and bottom - up trimming techniques may also be applied to the left lung . thus , after bottom - up trimming , an initial mask image is obtained as , shown in fig1 . extension / shrink fitting part ( 5350 ) of the post - processing unit ( 400 ) in fig9 , according to an embodiment of the invention , is designed to adjust the segmented lung region to get the best fit to a real lung . after extension / shrink processing 5350 is completed , a mask that shows five ( 5 ) different zones is obtained , as shown in fig1 . fig1 shows the chest image ( portrait image ) of fig2 overlaying boundaries of the zone mask image of fig1 . fig1 shows a chest image ( landscape image ) of fig3 overlaying boundaries of a corresponding zone mask image . the five zones cover the following anatomic regions : lung zone : left lung and right lung ; central zone : superior mediastinum , heart , and part of subdiaphragm ; special zone : part of lung , part of heart , and part of subdiaphragm ; bottom zone :. most of subdiaphragm ; uninteresting zone : background , base of neck , and axilla . table 1 illustrates the chest image orientation identification performance of the method for 3459 images . of them , 519 images were landscape . images , and the rest were portrait images . it should be noted that , as in any ill - defined problem , the evaluation criterion used here is very subjective . the “ quit ” case indicates that the method as embodied for these trials was unable to deal with a given image . the same concept has been expanded to lung segmentation in a ct image . fig2 - 21 demonstrate the performance of applying the invention to a ct image . obviously , numerous modifications to and variations of the present invention are possible in light of the above technique . it is , therefore , to be understood that within the scope of the appended claims , the invention may be implemented in situations other than as specifically described herein . although the present application is focused on chest image and ct image , the concept can be expanded to other medical images and other object segmentation problems , such as mri , brain and vessel segmentation , and the like . the invention is thus of broad application and not limited to the specifically disclosed embodiment .
| 6 |
a display rack 10 in accordance with the present invention is shown in fig1 to include two component supports 12 and it will be appreciated with the description following that any number of component supports could be incorporated into the display rack . when assembled as shown in fig1 , the two component supports define a completed rack with two display shelves 14 for inanimate objects 16 such as golf balls . the display rack shown in fig1 has an uppermost support component 12 u and a bottommost support component 12 b even though as seen in fig2 , for example , an intermediate support component 12 i could be positioned between the uppermost and bottommost components to add a third display shelf 14 . referencing fig3 , the three component supports 12 shown in fig2 are separated . the intermediate support component 12 i can be seen to include a plate - like back 18 that has a horizontal groove 20 routed or otherwise formed in a front face thereof near the bottom edge of the back plate . a relatively thin display shelf 14 has its rear most edge inserted into the groove and is retained therein either frictionally , with adhesive or with other suitable means . the shelf itself is provided with a plurality of indentations 22 formed in a top surface thereof at equally spaced locations with the indentations being provided to releasably retain inanimate objects 16 to be displayed in the rack at the predetermined locations . for example , in the embodiment shown in fig1 - 6 , the indentations 22 form a segment of a sphere so that a golf ball or other spherical object could be placed or seated in an indentation to keep the ball from rolling off the shelf . immediately below the shelf 14 on the front face of the support component 12 , a tongue - and - groove connector 24 is formed so that a forwardly projecting tongue 26 is defined by a rearwardly projecting groove 28 immediately thereabove and a lower edge 30 of the back plate 18 . the tongue and the groove are defined by substantially horizontal surfaces 32 and substantially vertical surfaces 34 but as is probably best appreciated by reference to fig4 , the substantially horizontal surfaces are in reality sloped slightly downwardly and rearwardly from the front face of the back plate toward the rear of the back plate . the substantially vertical surfaces are similarly slightly inclined upwardly and rearwardly from the front face of the back plate toward the rear face . it will therefore be appreciated a front lip 36 is defined at the upper front edge of the tongue 26 and an inner corner 38 in the bottom rear edge of the groove 28 . the lip is positioned higher than the inner corner for a reason to be explained hereafter . a similar tongue - and groove connection 24 is formed near the top edge of the back plate in its rear surface so that the tongue 26 overlies the groove 28 but again the substantially horizontal surfaces 32 are inclined slightly rearwardly and downwardly while the substantially vertical surfaces 34 are inclined slightly rearwardly and upwardly identically to those in the front face of the back plate . the tongue - and - groove connection in the top of the back plate is therefore complimentary to the tongue - and - groove connection in the bottom of the back plate so that , while not illustrated , the tongue - and - groove at the top of one intermediate support component 12 i can be received in the tongue - and - groove connection of a next adjacent upper identical intermediate support component 12 i such that the back plates of both intermediate support components are co - planer . as will be appreciated , any number of intermediate support components can therefore be interconnected and suspended from each other with the rearwardly and downwardly inclined surfaces in the tongue and the groove of each connector encouraging a positive interconnection by gravity . further , if one were to try to horizontally remove an intermediate component from an interconnected intermediate component , it could not be easily separated unless the lowermost component was pulled upwardly and forwardly which is restricted by the display shelves 14 . this is due to the fact that the above - defined lip of the tongue 26 is higher than the inner corner of the groove 28 . if the support components are made of a soft wood or plastic they can be snapped together or apart but typically the support components are interconnected or supported by sliding one component longitudinally of the other . looking again at fig3 , an uppermost component 12 h of the display rack 10 is shown to be very similar to an intermediate component 12 i in that it has a lower tongue - and - groove connector 24 along the lower edge of the back plate 18 and in the front face thereof and the connector is immediately beneath a shelf 14 mounted on the back plate as described above with the shelf having a plurality of indentations 22 . the top edge of the back plate in the uppermost support component , however , does not include a tongue - and - groove connector as in the intermediate components . a horizontal overhang plate or flange 40 , however is secured to the top edge of the back plate of the uppermost component along its rear edge for decorative purposes so that the overhang plate or flange 40 overlies the shelf 14 on the uppermost support component of the display rack . similarly , the bottommost component 12 b of the display rack 10 has a tongue - and - groove connector 24 formed along its top edge in the rear face thereof but no tongue - and - groove connector along the bottom edge . a bottom wall or flange 42 of the bottommost support component , however , is connected to the bottom edge of the back plate 18 of the bottommost component so that the bottom wall or flange projects forwardly and horizontally from the lower edge of the back plate . rather than having a shelf in the bottommost component , the bottom wall or flange 42 serves as a shelf in the display rack and has a plurality of aligned indentations 22 formed therein . it will be appreciated from the above that the display rack 10 will preferably include an uppermost support component 12 u , a bottommost support component 12 b and one or more intermediate support components 12 i that are interconnected with each other and / or to an uppermost support component or a bottommost component depending upon the number of components desired for the display rack . as mentioned above , the tongue - and - groove connectors 24 on the support components cooperate with each other in supporting and interconnecting the support components so they can best be separated by sliding one component longitudinally of the other . it will also be appreciated that any number of intermediate support components 12 i can be provided as by adding or subtracting from an existing display rack . further , as shown in fig1 , there does not need to be an intermediate support component , but rather the bottommost component 12 b can be connected directly to the uppermost component 12 u if a two - shelf display rack were desired . as will be appreciated , a display rack 10 with multiple components is vertically suspendable from a vertical surface such as a wall . when suspending the display rack from a vertical support surface , one or more notches 44 ( fig6 ) could be formed in the rear of the uppermost component 12 u to receive a nail or other fastener projecting from the vertical support surface . if the recess was of the type illustrated in fig6 where it included a relatively large circular opening 46 near its bottom to receive the head of , for example , a screw and a relatively thin neck 48 projecting upwardly therefrom smaller than the head of the screw , a very positive interconnection of the display rack with the vertical support surface can be obtained . while the embodiment shown in fig1 - 6 illustrates one form and use of the display rack in accordance with the present invention , the systems incorporated into the display rack for releasably but positively positioning objects being displayed could be varied . for example , in fig7 , the uppermost component 12 u of the display rack 10 , which is shown as being taller than the intermediate 12 i and bottommost 12 b components , also includes a plurality of horizontally disposed cylindrical pins 50 projecting forwardly from the back plate 18 on which objects such as spools of thread , or the like could be displayed . also , on the top surface of the shelf 14 of the uppermost component , a pair of rectangular embossments or raised areas 52 are provided which might cooperate , for example , with a recess in the bottom of a figurine that might be displayed on the shelf . on the shelf of the intermediate component 12 i , a plurality of holes 54 are formed through the shelf through which other inanimate objects such as might have a larger upper body than a lower body might be positioned so that the lower body could be dropped through the hole but the larger upper body would be supported above the shelf . on the bottom wall 42 of the bottommost support component 12 b , a plurality of upstanding pins 56 are provided which again , for example , might be used to support spools of thread , yarn or the like or other similar objects for display . it will be appreciated from the above , that while several embodiments of the invention have been illustrated , it will be evident to those skilled in the art that other variations could be made to the shelves , the bottom wall , or the back plates for displaying objects of different configurations and the invention is not intended to be limited to those few possibilities illustrated . further , while one particular tongue - and - groove system for interconnecting adjacent support components has been illustrated and has been felt to work very well , other systems might also work for interconnecting the support components in co - planer relationship in any manner so that they are not easily separated . although the present invention has been described with a certain degree of particularity , it is understood the disclosure has been made by way of example , and changes in detail or structure may be made without departing from the spirit of the invention as defined in the appended claims .
| 0 |
referring to fig1 the preferred embodiment generally includes a creel 10 for yarn supply packages 12 , a plurality of yarn tensioning bars generally designated 14 , a finish applicator 16 comprised of a rotatable finish roll 18 emersed in a pan 20 filled with a liquid finish 22 a pair of grooved roller guides 24 , 26 are located between the finish applicator 16 and a turbo stapler 28 ( manufactured by the turbo machine co ., lansdale , pa .). the turbo - stapler includes a pair of driven nip rolls 30 , 32 which firmly grip the tow band 34 that has been consolidated from the indvidual yarns in guide 29 . the nip rolls 30 , 32 feed tow band 34 at a constant rate to a pair of front rolls 36 , 38 which also grip the tow band 34 and withdraw it from breaker bars 39 and feed it as a sliver to a condensing guide 40 from which the sliver is fed to a windup ( not shown ) for packaging . in operation , glass or carbon yarn 13 from individual packages 12 is fed from creel 10 over finish roll 18 where it is coated with finish 22 . the yarns are consolidated in guide 29 , tensioned between rolls 30 , 32 and front rolls 36 , 38 , then randomly broken by sharply deflecting them laterally by the breaker bars 39 . the coating of finish on the yarn in the sliver is sufficient to enable the sliver to be pulled through guide 40 to the windup without disassociation of the fibers in the sliver . while the continuous process illustrated in fig1 is preferred , the application of finish to continuous filament carbon or glass fibers and the stretch - breaking of the coated filaments can be carried out in two steps ; i . e ., separate finish application and stretch - breaking processes , according to fig2 and 3 and as described subsequently in example 1 . more particularly , in fig2 glass or carbon yarn 13 from package 12 is fed over yarn tensioning bars 14 &# 39 ; over finish roll 18 where it is coated with finish 22 and wound onto a bobbin 12 &# 39 ; and allowed to dry . the yarn from bobbins 12 &# 39 ; is then stretch - broken by breaker bars 39 ( fig3 ) in the turbo - stapler as described above in connection with fig1 . the finish used in this invention is a material that causes an interfilament viscous drag sufficiently high to permit the handling required to make a composite , such as winding and unwinding from a package . more particularly , the finish used for the carbon fiber application is a mixture of a one part of a suitable antistat and two parts of a non - tacky viscous lubricant of a consistency to impart to the chopped sliver adequate cohesiveness ( minimum of 0 . 01 grams per denier ) without tackiness or without compromising the fiber - matrix adhesion in the final composite . the antistat portion of the mixture could be reduced or even eliminated if the reinforcing fiber is electrically conductive ( e . g ., carbon fibers ). a suitable viscous lubricant is polyethylene glycol ( 400 mol . wt ) monolaurate and a lauric amide while a suitable antistat is mixed mono and di - phosphate esters of c8 - c12 fatty alcohols neutralized with diethanol amine . preferably , the percent finish on fiber is in the range of from about 0 . 3 % to about 0 . 5 %. formable planar and shaped non - planar composites are contemplated by the present invention . for the formable composites , that is , those composites that can be formed into shaped non - planar three - dimensional structures at elevated temperatures ( where necessary ), matrix resins of the thermoplastic variety or of the not fully cured thermoset type may be employed . in the latter case the thermosettable resin is cured after the composite has been shaped . suitable thermoplastic resins include polyesters ( including copolyesters ), e . g ., polyethylene terephthalate , kodar ® petg copolyester 6763 ( eastman kodak ); polyamides , e . g ., nylon 6 , 6 ; polyolefins , e . g ., polypropylene ; also included are the high temperature resins such as an amorphous polyamide copolymer based upon bis ( para - aminocyclohexyl ) methane , a semi - crystalline polyamide homopolymer also based on bis ( para - aminocyclohexyl ) methane , and polyetheretherketone . thermosetting resins that are useful include phenolic resins , epoxy resins and vinyl ester resins . the ratio of reinforcement to matrix can vary , but preferably is between 40 % to 75 % by volume . the average fiber lengths also may vary but preferably range from about 1 / 2 to about 6 inches in length with a random overlap distribution . about 85 percent of the fibers are aligned within ± 10 degrees , preferably ± 5 degrees of the axial direction . the composite may be made by a variety of procedures . thus , a stretch broken sliver may be wound on a frame covered with a film of thermoplastic resin to form a warp . the warp of stretch - broken sliver , however , can be made by any technique known to those skilled in the art , e . g ., by creeling or beaming . a preform is obtained when another film of thermoplastic resin is placed over the warp to form a sandwich which is heated in a vacuum bag and then removed from the frame . several of such preforms may be stacked while offset to provide multi - directionality and then the stack may be heated under pressure to form a composite structure . other techniques for applying matrix polymer include sprinkling of powdered resin on the sliver warp followed by heating to melt the resin , flowing liquid resin over the sliver warp , intermingling thermoplastic fiber with the sliver warp and then heating to melt the thermoplastic fiber thereby forming the matrix resin , calendering the warp between layers of matrix film , etc . the composite tensile tests followed the general procedure described in astm test d 3039 - 76 entitled &# 34 ; standard test method for tensile properties of fiber -- resin composites .&# 34 ; the short beam shear tests followed the general procedure described in astm method d 2344 - 76 entitled , &# 34 ; standard test method for apparent interlaminar shear strength of parallel fiber composites by short beam method &# 34 ; with the following exception , the loading nose was 1 / 16 inch radius instead of 1 / 8 inch . the yarn to be tested for sliver cohesion was placed in the clamps of an instron tensile testing machine set to a gauge length of 17 inches , a crosshead speed of 10 inches per minute and a chart speed of 12 inches per minute . the crosshead was started to apply tension to the sample and the maximum force in grams indicated on the chart was recorded and divided by the sliver denier to give the sliver cohesion . finish on yarn is determined in a method wherein weighed specimens are extracted gravimetrically with prescribed solvent ( s ) at room temperature , the solvent containing dissolved finish and any other materials which may wash off the specimens , is transferred to a preweighed container and evaporated . the extractable residue is weighed . percentage extractables based on extractable - free specimen weight is calculated . aerothane ® ( 1 , 1 , 1 - trichloroethane ) is used as the solvent for all finish materials except glycerine and methanol is used as the solvent for that material . the sample to be tested was placed in the clamps of an instron tensile testing machine set to a particular gauge length and a crosshead speed depending on the sample . a thermocouple was attached the surface of the sample midway between the clamps and an 8 inch long electrically heated cylindrical oven was placed around the sample leaving a one inch space between the bottom of the oven and the lower clamp . the open ends of the oven were plugged with insulation material to prevent convective heat loss and heating of the clamps . the oven was turned on and the sample heated to reduce its viscosity to permit drawing ( temperature determined by the viscosity , time , temperature data of the matrix material . samples made with thermosetting matrix resins must be tested in their uncured state .). the sample was held at this temperature for 15 minutes to insure thermal equilibrium . the crosshead was then started and allowed to run until the heated section of the sample was drawn 50 %. the oven was removed and the sample inspected to determine whether it had broken . a photomicrograph of the surface of the composite ( enlarged 240x ) was prepared . the angle between each fiber axis and the axial direction of the composite was measured with a protractor on the photomicrograph and tabulated . the percentage of fibers with an angle within ± 5 degrees of the axial direction was reported . four bobbins of 2000 denier continuous filament carbon fiber ( 3k as - 4 from hercules inc .) were prepared for stretch - breaking by applying a finish composed of two parts of a lubricant ( polyethylene glycol monolaurate and a lauric amide ) and one part of an antistat ( mixed mono and diphosphate esters of c8 - c12 fatty alcohols neutralized with diethanol amine ). the finish was applied by running the continuous filament carbon fiber , one bobbin at a time , at 75 yards / minute over a finish roll which was wet with a 4 % aqueous emulsion of the lubricant - antistat mixture ( fig2 ). the four bobbins were allowed to stand overnight to evaporate the water . finish level after drying was 0 . 33 %. the four bobbins of carbon fiber were stretch - broken on a turbo - stapler ( turbo machine co ., lansdale , pa ) as shown in fig3 . the surface speed of the rolls ( 30 , 32 ) was 35 . 4 yards / minute and the surface speed of the front rolls ( 36 , 38 ) was 110 yards / minute . the tip speed of the breaker bars ( 39 ) was 71 yards / minute . the resulting sliver was 2422 denier and had a cohesion value of 0 . 18 grams / denier which was sufficient to allow winding without twist on a cylindrical paper tube using a leesona type 959 winder . the average fiber length of fifty measurements of this sliver was 3 . 2 inches ( shortest 0 . 7 inch , longest 5 . 6 inches ). a warp was prepared from this sliver by winding it from the paper tube , 25 ends to the inch on a 16 inch square metal plate . a 2 . 0 mil thick film of thermoplastic resin ( an amorphous polyamide copolymer based on bis ( para - aminocyclohexyl ) methane ) was placed on the frame before winding the sliver and another was added after winding was complete . the entire sandwich was vacuum bagged at 280 ° c . for 15 minutes after which time it was cut from the plate . this product , called a preform was now a well - impregnated , relatively stiff matrix / stretch - broken sliver sandwich , in which all the slivers were aligned in one direction . twelve of these preforms were stacked on top of one another with all the fibers in the same direction . this stack was heated in a mold at 305 ° c . at 500 pounds per square inch for 35 minutes to make a well - consolidated plate 93 mils thick and fiber volume fraction of 55 %. short beam shear tests conducted on 0 . 5 inch wide strips cut from this plate gave a value of 13 , 700 pounds per square inch . it was concluded that the presence of the finish did not adversely affect the adhesion of the fiber to the matrix polymer . a second plate was made from ten of these preforms by stacking them so that the direction of the stretch - broken fibers were offset by 45 degrees in a clockwise direction in successive layers . the bottom plane of the fifth layer was considered a reflecting plane and the next five layers were stacked so that the warp directions of the stretch - broken sliver were mirror images of the top five layers with respect to that plane . this sandwich was molded as above to make a well consolidated plate with a fiber volume fraction of 55 %. this plate was heated to 322 ° c . and molded into a hemisphere with a radius of 3 inches . the plate conformed very well to the shape of the mold and it was concluded that the product was deep drawable without wrinkles . a sliver of stretch - broken glass fiber was prepared by the method in example 1 except that 6700 denier continuous filament glass fiber was used ( t - 30 p353b from owens - corning fiberglass ) and the finish was applied by spraying a 10 % aqueous emulsion on the fiber . the emulsion was pumped to the spray nozzle at 5 cc . per minute and the air pressure used was 3 psi . the yarn was pulled past the spray head at 55 yards per minute by a pair of nip rolls and wound on a cylindrical paper tube . after drying , the finish level was 0 . 35 %. stretch - broken sliver was prepared from two finish treated continuous filament bobbins and had a cohesion of 0 . 09 grams per denier which was adequate for winding as in example 1 . further , the finish controlled static generation in the stretch - breaking process to an acceptable level . the average fiber length of fifty measurements of this sliver was 3 . 4 inches ( shortest 1 . 0 inch , longest 10 . 2 inches ). a unidirectional plate was made from this sliver and petg film ( kodar ® petg copolyester 6763 , eastman kodak ) by the method of example 1 except that the sliver spacing was 26 ends per inch , the film thickness was 3 . 0 mils and 8 layers of preform were used to 55 % fiber volume fraction . short beam shear tests on 0 . 5 inch wide strips cut from this plate gave a result of 5 , 400 pounds per square inch . it was concluded that the presence of the finish did not affect the adhesion of the fiber to the matrix polymer . a sample of carbon fiber sliver was prepared using the stretch - breaking process of example 1 except that finish was not pre - applied to the continuous fiber and two bobbins were used instead of four . the two ends of carbon fiber were contacted by a felt pad saturated with glycerine which was placed between the tension guide and the infeed roll . glycerine level on the sliver was 0 . 5 %. the average fiber length of fifty measurements of this sliver was 3 . 2 inches ( shortest 0 . 6 inch , longest 7 . 9 inch ). cohesion was measured as a function of time vs . the sliver from example 1 with the following results . ______________________________________ cohesion , grams per denierdays glycerine example 1______________________________________ 1 . 58 . 15 9 . 79 . 2416 . 02 . 2522 . 02 . 2530 . 02 . 21______________________________________ glycerine treated sliver from example 3 was made into a warp , preforms and a unidirectional plate by the method of example 1 . the end count was 12 per inch , the film was 3 . 0 mil thick petg ( kodar ® petg copolyester 6763 from eastman kodak ) and 6 preforms were stacked to make the plate which was 40 % fiber volume fraction . the plate was cut into 0 . 5 inch strips , provided with aluminum tabs and subjected to tensile tests at 8 inch guage length with the following results : it was concluded that the product had very high strength and modulus . the uniformity of orientation of the fibers on the surface of this plate were measured from a photomicrograph and it was found that 85 % of the fibers were within ± 5 degrees of the axial direction . continuous filament 2000 denier carbon fiber was made into a warp , preforms and a unidirectional plate . the end count was 12 per inch , the film was 3 . 0 mil thick petg ( kodar ® petg copolyester 6763 from eastman kodak ) and 16 preforms were stacked to make the plate which was 40 % fiber volume fraction . the plate was cut into 0 . 5 inch strips , provided with aluminum tabs and subjected to tensile tests at 8 inch guage length with the following results : it was concluded that the product of example 4 exhibited the strength and stiffness expected of continuous filament carbon fiber . the product of example 4 , although made of stretch - broken discontinuous staple fiber , came within 90 % of the strength and stiffness of the continuous filament product . this excellent performance is believed due to the high degree of order of the stretch - broken fibers . stretch broken glass sliver was prepared by the method of example 2 except that finish was not pre - applied to the continuous fiber . instead , the fiber being supplied to the turbo - stapler was sprayed periodically with jif - job antistatic spray ( schafco , lancaster , pa ). the roll and breaker bar speeds were one - half the values in example 2 . the average fiber length of fifty measurements of this sliver was 3 . 1 inches ( shortest 1 . 0 inch , longest 5 . 8 inch ). this sliver was made into a warp , preforms and a unidirectional plate by the method of example 1 . the end count was 21 per inch , the film was 3 . 0 mil thick petg ( kodar ® petg copolyester 6763 from eastman kodak ) and 5 preforms were stacked to make the plate which was 40 % fiber volume fraction . the plate was cut into 0 . 5 inch strips , provided with aluminum tabs and subjected to tensile tests at 8 inch guage length with the following results : it was concluded that the product had very high strength and modulus . continuous filament 6700 denier glass fiber was made into a warp , preforms and a unidirectional plate . the end count was 13 per inch , the film was 3 . 0 mils thick petg ( kodar ® petg copolyester 6763 from eastman kodak ) and 5 preforms were stacked to make the plate which was 40 % fiber volume fraction . the plate was cut into 0 . 5 inch strips , provided with aluminum tabs and subjected to tensile tests at 8 inch guage length with the following results : it was concluded that the product of example 6 exhibited the strength and stiffness expected of continuous filament glass fiber . the product of example 6 , although made of discontinuous staple fiber , came within 90 % of the strength and stiffness of the continuous filament product . a preform of stretch broken carbon fiber sliver in an epoxy resin ( hercules 3501 - 6 ) was made by the following procedure : ( 1 ) the frozen resin was thawed at room temperature , then heated to 180 ° f . for 15 minutes . ( 2 ) a film of resin was cast onto release paper then chilled to 40 ° f . to stop the polymerization reaction and the exposed surface was covered with polyester film for protection . ( 3 ) the paper - resin - film sandwich was wound on a 7 - foot diameter drum and the polyester film removed . ( 4 ) 2300 denier graphite sliver made by the process of example 1 was wound on the exposed resin at 9 ends per inch for a total width of 10 . 5 inches . the average fiber length of fifty measurements of this sliver was 3 . 2 inches ( shortest 0 . 7 inch , longest 5 . 6 inches ). ( 5 ) the polyester film was removed from a second paper - resin - film sandwich and wound over the graphite layer on the drum to make a paper - resin - graphite - resin - paper sandwich . ( 6 ) the sandwich was unwound from the drum and vacuum bagged flat at 140 ° f . for 10 minutes to force the resin into the graphite layer , then frozen for later use . the thickness of the resin - graphite part of this sandwich was 7 mils . a unidirectional composite strip made by stacking together ten layers of 3 / 4 - inch wide and 14 - inch long strips ( fiber direction parallel to the 14 - inch dimension ) of the graphite - resin preform was vacuum bagged for two minutes . one inch on either end of the strip was partially cured by heating it to 120 ° c . for two hours while keeping the middle 12 inches of the strip cold with dry ice . at a guage length of 11 inches and a crosshead speed of 5 inches per minute , a high temperature tensile drawing test was conducted at 124 ° c . on the 14 inch long by 0 . 75 inch wide strip which showed the composite could be drawn 50 % without breaking , predicting a high degree of formability . a composite plate was made from 10 layers of the sandwich from step 6 above by removing the release paper , cutting the graphite - resin preform into sheets and stacking them so that the direction of the stretch - broken fibers were offset by 45 degrees in a clockwise direction in successive layers . the bottom plane of the fifth layer was considered a reflecting plane and the next five layers were stacked so that the warp directions of the stretch - broken sliver were mirror images of the top five layers with respect to that plane . this sandwich was vacuum - bagged at ambient temperature for 2 minutes to stick the layers together . this plate was molded into a hemisphere with a radius of 3 inches and cured in the mold at 175 ° c . for 2 hours . the plate conformed very well to the shape of the mold and it was concluded that the product was formable . four bobbins of 2000 denier continuous filament carbon fiber ( 3k as - 4 from hercules inc .) were stretch - broken on a turbo - stapler ( turbo machine co ., lansdale , pa ) set up as shown in fig1 . a 10 % aqueous solution of the finish described in example 1 was applied with a wetted roll . the surface speed of the intermediate rolls was 17 . 7 yards / minute and the surface speed of the front rolls was 55 yards / minute . the tip speed of the breaker bars was 35 . 5 yards / minute . the resulting sliver was 2250 denier . the average fiber length of fifty measurements of this sliver was 3 . 3 inches ( shortest 0 . 8 inch , longest 5 . 5 inches ). a warp was prepared from this sliver by winding it , 27 ends to the inch on a 18 inch square metal plate . a 3 . 0 mil thick film of thermoplastic resin ( petg copolyester ) was placed on the frame before winding the sliver and another was added after winding was complete . the entire sanwich was vacuum bagged at 220 ° c . for 15 minutes after which time it was cut from the frame . this product , called a preform was now a well - impregnated , relatively stiff matrix / stretch - broken sliver sandwich , in which all the slivers were aligned in one direction . seven of these preforms were stacked on top of one another with all the fibers in the same direction . this stack was heated in a mold at 200 ° c . at 400 pounds per square inch for 30 minutes to make a well - consolidated plate 82 mils thick and fiber volume fraction of 50 %. high temperature tensile drawing tests at a guage length of 10 inches and crosshead speed of 10 inches per minute conducted at 262 ° c . on 12 inch long by 0 . 75 inch wide strips cut from this plate with the fiber direction parallel to the 12 inch dimension showed the composite could be drawn 50 % without breaking , predicting a high degree of formability . two bobbins of 6700 denier continuous filament glass fiber ( t - 30 p353b from owens - corning fiberglass ) were stretch - broken on a turbo - stapler ( turbo machine co ., lansdale , pa ) set up as shown in fig1 . a 10 % aqueous solution of the finish described in example 1 was applied with a wetted roll . the surface speed of the intermediate rolls was 17 . 7 yards / minute and the surface speed of the front rolls was 55 yards / minute . the tip speed of the breaker bars was 35 . 5 yards / minute . the resulting sliver was 4100 denier . the average fiber length of fifty measurements of this sliver was 3 . 4 inches ( shortest 0 . 9 inch , longest 8 . 7 inches ). a warp was prepared from this sliver by winding it , 22 ends to the inch on a 18 inch square metal plate . a 3 . 0 mil thick film of thermoplastic resin ( petg copolyester ) was placed on the frame before winding the sliver and another was added after winding was complete . the entire sandwich was vacuum bagged at 220 ° c . for 15 minutes after which time it was cut from the frame . this product , called a preform was now a well - impregnated , relatively stiff matrix / stretch - broken sliver sandwich , in which all the slivers were aligned in one direction . seven of these preforms were stacked on top of one another with all the fibers in the same direction . this stack was heated in a mold at 200 ° c . at 400 pounds per square inch for 30 minutes to make a well - consolidated plate 82 mils thick and fiber volume fraction of 50 %. high temperature tensile drawing tests at a guage length of 10 inches and crosshead speed of 10 inches per minute conducted at 262 ° c . on 12 inch long by 0 . 75 inch wide strips cut from this plate with the fiber direction parallel to the 12 inch dimension showed the composite could be drawn 50 % without breaking , predicting a high degree of formability . sliver from example 10 was re - broken to reduce the fiber length by passing it through two sets of elastomer coated nip rolls with a separation of 2 . 50 inches between the nips . the surface speed of the second set of rolls was 10 yards per minute and the surface speed of the first set of rolls was 7 . 1 yards per minute giving a draft of 1 . 4 . denier of this re - broken sliver was 5371 and the average fiber length of fifty measurements of this sliver was 1 . 57 inches ( shortest 0 . 5 inch , longest 3 . 6 inches ). a ` warp ` was prepared from this sliver by winding it , 17 ends to the inch on a 18 inch square metal plate . a 3 . 0 mil thick film of thermoplastic resin ( petg copolyester ) was placed on the frame before winding the sliver and another was added after winding was complete . the entire sanwich was vacuum bagged at 220 ° c . for 15 minutes after which time it was cut from the frame . this product , called a preform was now a well - impregnated , relatively stiff matrix / stretch - broken sliver sandwich , in which all the slivers were aligned in one direction . seven of these preforms were stacked on top of one another with all the fibers in the same direction . this stack was heated in a mold at 200 ° c . at 400 pounds per square inch for 30 minutes to make a well - consolidated plate 80 mils thick and fiber volume fraction of 50 %. high temperature tensile drawing tests at a guage length of 10 inches and crosshead speed of 10 inches per minute conducted at 262 ° c . on 12 inch long by 0 . 75 inch wide strips cut from this plate with the fiber direction parallel to the 12 inch dimension showed the composite could be drawn 50 % without breaking , predicting a high degree of formability . sliver from example 9 was re - broken to reduce the fiber length by passing it through two sets of elastomer coated nip rolls with a separation of 2 . 50 inches between the nips . the surface speed of the second set of rolls was 10 yards per minute and the surface speed of the first set of rolls was 7 . 1 yards per minute giving a draft of 1 . 4 . denier of this re - broken sliver was 4623 and the average fiber length of fifty measurements of this sliver was 1 . 33 inches ( shortest 0 . 6 inch , longest 3 . 1 inches ). a warp was prepared from this sliver by winding it , 13 ends to the inch on an 18 inch square metal plate . a 3 . 0 mil thick film of thermoplastic resin ( petg copolyester ) was placed on the frame before winding the sliver and another was added after winding was complete . the entire sandwich was vacuum bagged at 220 ° c . for 15 minutes after which time it was cut from the frame . this product , called a preform was now a well - impregnated , relatively stiff matrix / stretch - broken sliver sandwich , in which all the slivers were aligned in one direction . seven of these preforms were stacked on top of one another with all the fibers in the same direction . this stack was heated in a mold at 200 ° c . at 400 pounds per square inch for 30 minutes to make a well - consolidated plate 80 mils thick and fiber volume fraction of 50 %. high temperature tensile drawing tests , at a guage length of 10 inches and a crosshead speed of 10 inches per minute , conducted , at 262 ° c ., on 12 inch long by 0 . 75 inch wide strips cut from this plate with the fiber direction parallel to the 12 inch dimension showed the composite could be drawn 50 % without breaking , predicting a high degree of formability . a pre - laminate was prepared from glass fiber from example 2 by a continuous process as follows : 46 ends of sliver were fed from a creel into a 6 inch wide warp which was sandwiched between two 1 . 0 mil pet poly ( ethylene terephthalate ) films to give a pre - laminate of 55 % fiber volume fraction . a release film of ` kapton ` polyimide was placed on each side of this sandwich to prevent sticking of molten pet to hot surfaces . this sandwich was then passed at 10 feet per minute through the nip of two steel rolls heated to 278 ° c . to tack the assembly together . a composite plate was made from this pre - laminate by removing the release film , trimming the excess pet from the edges and placing strips of pre - laminate in layers in a 16 inch square mold . each layer was made up of side - by side strips of pre - laminate to reach the required 16 inch width . a plate was made from 10 layers of pre - laminate by arranging them so that the direction of the stretch - broken fibers were offset by 45 degrees in a clockwise direction in successive layers . the bottom plane of the fifth layer was considered a reflecting plane and the next five layers were stacked so that the warp directions of the stretch - broken sliver were mirror images of the top five layers with respect to that plane . this sandwich was molded as in example 2 to make a well - consolidated composite plate with a fiber volume fraction of 55 %. this plate was heated to 280 ° c . and molded into a hemisphere with a radius of 3 inches . the plate conformed very well to the shape of the mold and it was concluded that the product was formable . a plate was made from 10 layers of pre - forms made by the method of example 11 by arranging them in a 16 inch square mold so that the direction of the stretch - broken fibers were offset by 45 degrees in a clockwise direction in successive layers . the bottom plane of the fifth layer was considered a reflecting plane and the next five layers were stacked so that the warp directions of the stretch - broken sliver were mirror images of the top five layers with respect to that plane . this sandwich was molded as in example 2 to make a well - consolidated composite plate with a fiber volume fraction of 55 %. this plate was heated to 280 ° c . and molded into a hemisphere with a radius of 3 inches . the plate conformed very well to the shape of the mold and it was concluded that the product was formable . continuous filament 2000 denier carbon fiber was made into a warp , preforms and a unidirectional plate by the method of example 1 . the end count was 25 per inch , the film was 2 . 0 mil thick film of thermoplastic resin ( an amorphous polyamide copolymer based on bis ( para - aminocyclohexl ) methane ). seven preforms were stacked to make the plate which was 55 mils thick and 55 % fiber volume fraction . the plate was cut into 0 . 5 inch strips , provided with aluminum tabs and subjected to tensile tests at 8 inch gauge length with the following results : it was concluded that the product had very high strength and modulus . a warp was prepared from sliver from example 9 by winding it , 21 ends to the inch on a 18 inch square metal plate . a 2 . 0 mil thick film of thermoplastic resin ( an amorphous polyamide copolymer based on bis ( para - aminocyclohexl ) methane ) was placed on the frame before winding the sliver and another was added after winding was complete . the entire sandwich was vacuum bagged at 280 ° c . for 20 minutes after which time it was cut from the frame . this product , called a preform was now a well - impregnated , relatively stiff matrix / stretch - broken sliver sandwich , in which all the slivers were aligned in one direction . seven of these preforms were stacked on top of one another with all the fibers in the same direction . this stack was heated in a mold at 305 ° c . at 600 pounds per square inch for 40 minutes to make a well - consolidated plate 58 mils thick and fiber volume fraction of 55 %. one half inch strips cut from this plate were subjected to tensile tests at 8 inch gauge length with the following results : the uniformity of orientation of the fibers on the surface of this plate were measured from a photomicrograph and it was found that 92 % of the fibers were within ± 5 degrees of the axial direction . the product of this example , although made of discontinuous staple fiber , was equivalent to the strength and modulus of continuous filament fiber ( example 15 ). continuous filament 6700 denier glass fiber was made into a warp , preforms and a unidirectional plate by the method of example 1 . the end count was 15 . 5 per inch , the film was 3 . 0 mil thick pet ( poly ( ethylene terephthalate )) and 5 preforms were stacked to make the plate which was 55 % fiber volume fraction . the plate was cut into 0 . 5 inch strips , provided with aluminum tabs and subjected to tensile tests at 8 inch gauge length with the following results : it was concluded that the product of example 17 exhibited the strength and stiffness expected of continuous filament glass fiber . a unidirectional plate was made from pre - laminate from example 13 by stacking 5 layers in a mold with all slivers in the same direction and heating in a press as in the reference example to give a final thickness of 103 mils . one - half inch strips cut from this plate were subjected to tensile tests at 8 inch gauge length with the following results : it was concluded that strength and modulus of the product of this example , although not as high as those from continuous filament glass ( example 17 ) were far superior to those of randomly oriented glass composites of equivalent fiber volume fraction reported in the literature ( ref . b . d . agarwal , l . j . broutman , &# 34 ; analysis and performance of fiber composites &# 34 ; p . 92 ) which are :
| 8 |
turning now to the drawings , and beginning with fig1 and 2 , indicated generally at 10 in fig1 , in block / schematic form , is an illustration of both the preferred methodology , and the preferred general structural organization , of the system and practice of the present invention . from the description which now follows , when read in conjunction with these and the other two drawing figures , those generally skilled in the relevant art will know clearly how to implement and practice the invention . included in system and methodology 10 ( reference hereinafter will be made more specifically to methodology ), as shown in fig1 , are two diamond - shaped blocks 12 , 14 , and four rectangular blocks 16 , 18 , 20 , 22 . appropriately shown interconnecting these several blocks are arrow - headed lines which generally picture the operational flow that is implemented by methodology 10 . block 12 , marked “ toner - save ?”, asks , as on a user - interface display screen , a question of a user preparing to call for printing of a pdl color image ( object ). this question asks whether that user wishes ( yes / no ) to call for toner - save color rendering of an image selected for printing . the ( yes / no ) paths out of block 20 are clearly illustrated in fig1 , with the “ yes ” path leading to block 16 , marked “ image category ”, and the “ no ” path leading to block 20 , marked “ regular rendering ”. block 12 thus represents an opportunity for a user of the methodology of this invention to make a specific “ yes / no ” selection regarding implementation or non - implementation of toner - save color - image rendering . if a “ no ” selection is made , whatever the image is is simply treated in block 20 to regular , conventional rendering , and is then passed along from block 20 to block 22 which is labeled “ to printing ”. if the answer posed to the question presented in accordance with block 12 is “ yes ”, then control effectively passes to block 16 which obtains information ( see arrow 24 in fig1 ) from the relevant imaging system ( not part of this invention ) which describes the nature , or category , of pdl image , or object , that has been selected for toner - save rendering . in this context , there are three high - level general categories of imagery ( objects ) which are specifically addressed by the present invention . these three categories include ( a ) text imagery , ( b ) graphics imagery , ( c ) and raster imagery . thus , in block 16 , after a “ yes ” toner - save decision has occurred , the first image - related determination which takes place by operation of the invention is the category of the image respecting which toner - save rendering is to take place . previously mentioned arrow 24 , which points toward the right side of block 16 in fig1 , represents the presentation of image - category information from the relevant pdl imaging - system interpreter regarding the specific category of imagery just mentioned . from block 16 , control is handed to block 14 , labeled “ ts rendering ?”. this block essentially asks the next question , which is whether or not the categorically specific image that has been identified by block 16 , possesses certain predetermined imagery characteristics ( a threshold ) which make it suitable for tone - save rendering . in other words , because of this thresholding consideration , not necessarily are all images actually subjected to toner - save rendering . rather , and in order that the system and methodology of this invention will operate most efficiently and effectively , a further image - specific determination is made in order to confirm whether or not toner - save rendering is actually to take place . this thresholding practices separates images with regard to which toner - save rendering is unnecessary and / or inappropriate . with regard to text imagery , font size is employed as a threshold determiner regarding whether or not a particular text image is to be presented for toner - save rendering . clearly , and as will be recognized by those generally skilled in the relevant art , what this toner size specifically is is a matter of user / system - designer choice . in the preferred implementation of methodology 10 now being described herein , the font - size threshold level which has been selected is font - size - 12 . with regard to graphics imagery , the threshold determiner involves an assessment of both image pixel height and image pixel width . while these two pixel dimensions may be different in number if desired , in most instances it has been found to be preferable to employ like size numbers for both of these dimensions . in the preferred embodiment of the invention now being described , the pixel height and pixel width numbers are the same , and are set at the level of 8 - pixels . with respect to a raster image , that categorical determination alone is employed , without any additional threshold questioning , to determine that such an image is indeed appropriate for toner - save rendering . a point which should be made here regarding what occurs when the question presented by block 12 is answered in the affirmative is that the related imaging system is placed in a condition for performing any actually implemented toner - save rendering in a bi - tonal mode of operation . those skilled in the art will immediately recognize the significance of this selection , and also how it may be implemented . with respect to the operation of block 14 , if a particular image which has been reviewed has characteristics that lead to a “ yes ” answer emerging from block 14 , control passes to block 18 , labeled “ toner - save rendering ”. block 18 performs toner - save rendering , as will shortly be described , and passes rendered imagery data to block 22 for ultimate printing . if an image being reviewed for toner - save rendering results in a “ no ” answer emerging from block 14 , that image is passed directly to block 20 for regular rendering , after which , such rendered image data is passed to block 22 for printing . turning attention now more specifically to fig2 , this fragmentary block / schematic diagram presents a somewhat more detailed picture of previously described toner - save rendering block 18 shown in fig1 . in accordance with practice of the present invention , toner - save rendering fundamentally involves two steps which are represented in fig2 by two blocks , 26 , 28 . the step represented by block 26 , labeled “ preserve edge density ”, involves a decision not to make any change in current pixel edge density ( a preserving pixel edge density modality ). thus , for all of the categories of imagery which are to be subjected to toner - save printing , all will be treated in exactly this fashion with respect to the preservation of edge density in the region of an object &# 39 ; s edge . the other step is represented by block 28 , labeled “ maximize dot gain ”. this step of the invention relates to pixel content in the region within an image &# 39 ; s bounding edge . fundamentally what is implemented here is the rendering of an image so as to create , within the image &# 39 ; s edge , or boundary , a pixel distribution which is checkerboard - like in nature , and which , when implemented appropriately , results in the inside region of an image displaying what is known in the art as maximum pixel dot gain . this concept of maximum pixel dot gain is well known to those skilled in the art , and needs no elaboration here . this rendering practice is referred to herein as a checkerboarding dot - gain maximizing modality . completion of the activities represented by blocks 26 , 28 in fig2 effects the desired and requested color - image toner - save rendering in accordance with practice of the invention . before turning specific attention to fig4 in the drawings which presents a representative image that has been toner - save rendered , let us turn attention for a moment to fig3 which , effectively , illustrates in greater detail that which is shown in fig1 and 2 . included in the illustration presented in fig3 are three diamond - shaped blocks 30 , 32 , 34 , and twelve rectangular blocks 36 - 58 ( even numbers only ), inclusive . a comparative viewing of fig1 and 3 will make readily apparent to those skilled in the art how the components shown in fig3 relate to those which are pictured in fig1 and 2 . as illustrated in fig3 , block 36 represents the start of an implementation of the methodology of the invention , and block 30 represents , essentially , the same as that which is represented by block 12 in fig1 . if a user elects to use toner - save rendering , control passes to block 38 , and if not , control passes to block 40 . block 38 effectively places the relevant imaging system in a condition ready for bi - tonal modal operation with respect to any implemented toner - save rendering . next , blocks 42 , 44 , 46 ( which combinedly are represented by single block 16 in fig1 ), assess the category , among the three mentioned earlier , of color imagery which is to be rendered . if control , instead of being handed to block 38 , goes to block 40 , then conventional , regular rendering of a particular image takes place , and the rendered result is sent to block 58 which is the same , effectively , as block 22 in fig1 . diamond blocks 32 , 34 are referred to herein as thresholding blocks , and represent the determinations which are performed , as earlier mentioned , with respect to assessing threshold characteristics of text and graphics images , respectively . the functionalities of these blocks are represented collectively in fig1 within block 14 . no such diamond - shape thresholding block is employed on the downstream side of block 46 , inasmuch as the categorical determination that a raster image is to be rendered is all that needs to occur in order for toner - save rendering to be implemented for such an image . with regard to a text image , if the threshold font size characteristic is appropriate , toner - save rendering is implemented in block 48 , and the rendered result is passed to block 58 . if the text font size threshold is not met , the image is passed for rendering in a regular fashion within block 50 , and from this block , rendered data is passed to print block 58 . with respect to a graphics image , a “ yes ” answer with respect to image characteristics related to pixel height and pixel width dimensions causes control to pass through block 52 for toner - save rendering , and thence to print block 58 . if either the height or the width threshold level is not met by a particular reviewed graphics image , rendering is performed in a normal , non - toner - save manner within block 54 , with the “ normally ” rendered image data then being passed to print block 58 . a raster image is simply automatically toner - save rendered as illustrated by block 56 in fig3 . this toner - save rendered raster image is then passed along to print block 58 . it should be apparent that blocks 40 , 50 and 54 in fig3 are represented by singular block 20 in fig1 . similarly , it should be apparent that blocks 48 , 52 , 56 in fig3 are represented by singular block 18 in fig1 . with respect to the activities which are effected by toner - save rendering blocks 48 , 52 , 56 in fig3 , these activities are implemented in blocks 26 , 28 in fig2 . turning attention now to fig4 in the drawings , illustrated in this figure , in a row - and - column fashion at 60 , is a representative image which is has been toner - save rendered in accordance with practice of the present invention . image 60 is employed herein to illustrate practice of the invention with respect to each of the three categories of pdl images mentioned earlier , namely , text images , graphics images , and raster images . it will be assumed for the purpose of this description that image 60 , with respect to its representation of a text image , is characterized with a font size of at least 12 . with respect to thinking of image 60 as relating to a graphic image , one can see that the image shown here in fig4 has a pixel height of 8 - pixels as well as a pixel width of 8 - pixels . thus , what is shown in fig4 meets the minimum threshold requirements for the implementation of toner - save rendering for both text and graphics images . thinking about image 60 as representing a raster image , that determination alone is sufficient to determine that toner - save rendering is appropriate . image 60 , as mentioned above , is shown in a toner - save rendered condition . what will be noticed , therefore , about this thus - rendered image , is that edge density , shown generally at 62 , has been preserved to form a continuous , bounding pixel edge 62 . within this preserved - density , bounding edge is a central pattern 64 which is checkerboarded in nature , and which very specifically , is checkerboarded in a manner which produces maximum pixel dot gain . the invention thus proposes a unique , quite simply implemented , and very effective toner - save method which may be employed with regard to pdl text , graphics and raster color images , or objects . where toner - save rendering is selected to be employed , once an image to be considered for toner - save rendering has been determined to pass all of the thresholding tests necessary , that image is toner - save rendered in a manner whereby pixel edge - region density is preserved , and central regions of the image are prepared with a maximized dot gain checkerboard pattern . accordingly , while a preferred embodiment and manner of practicing the invention have been described herein , it is appreciated that variations and modifications may be made therein without departing from the spirit of the invention , and it is intended that all claims to invention herein will cover such variations and modifications .
| 6 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.