text
stringlengths 1.55k
332k
| label
int64 0
8
|
|---|---|
referring to the accompanying drawings , and , more particularly , to fig1 - 3 , it can be seen that the present invention represents an outgrowth of my prior invention , described in u . s . pat . no . 4 , 013 , 265 , the disclosure of which is to be considered incorporated in this disclosure . in fig1 - 3 is shown a deflation valve 10 for a blood pressure measuring device . this valve consists essentially of a valve housing 11 with an axial main bore 14 ( fig3 ) leading through the housing and through a forwardly extending connecting nipple 13 and a rearwardly extending connecting tube 12 . to the former is normally attached a flexible air hose whose other end is connected to the measuring cuff of the device ( not shown ), to the latter is attached an inflation bulb ( likewise not shown ). inside the valve housing 11 , in line with the valve plunger 15 , of which only the upper portion is shown , is further arranged a cross bore which leads from the main bore 14 to a tapered valve seat surrounding the valve plunger on the upper side of the housing 11 . inside the cross bore is further arranged a plunger return spring which urges the valve plunger 15 outwardly , into a closed position against the valve seat . the cross bore , valve seat , valve plunger , and plunger return spring may be part of a subassembly which is mounted inside a removable valve insert . the valve plunger 15 controls an air outlet through which the pressure in the measuring cuff can be gradually reduced , as required for the determination of the two blood pressure values . the complete depression of the valve plunger 15 opens up additional air passages , for the rapid release or &# 34 ; dumping &# 34 ; of the residual air pressure from the measuring cuff . the opening position of the valve plunger 15 is controlled by means of an actuating lever 16 which is pivotably attached to the valve housing 11 by means of a pivot pin 22 . the latter is an integral part of the actuating lever 16 , being snappable into a suitable pin lodgement of the valve housing 11 , as a result of a clamping slot 23 which renders a portion of the valve housing flexible . the actuating lever 16 has the shape of an inverted &# 34 ; u &# 34 ;, with side wall portion 18 and 19 reaching over the parallel side walls 20 and 21 of the valve housing 11 . a linking bridge portion 17 of lever 16 is designed for finger application , having on its outside appropriate anti - slip ridges and a hump with a release flank 27 , the purpose of which will be described further below . the inner side of the bridge portion 17 engages the upper extremity of the valve plunger 15 . thus , when the actuating lever 16 is gradually depressed , it slowly pushes the valve plunger 15 into the valve housing 11 , away from its valve seat . the fully closed and fully open positions of the actuating lever 16 and of the valve plunger 15 are shown in fig1 and fig2 respectively . as can be seen in fig3 the valve housing 11 has a generally rectangular cross section , its side walls 20 and 21 serving to loosely guide the overhanging side wall portions 18 and 19 of the actuating lever 16 . the four walls are thus perpendicular to the pivot axis of the actuating lever 16 . the deflation valve 10 is normally self - closing , under the influence of its plunger return spring ( not shown ), meaning that finger pressure is necessary to maintain the actuating lever 16 in the desired deflation position . a removal of the finger pressure will immediately close the valve . however , for a complete evacuation of the measuring system , following termination of the measuring procedure , the deflation valve 10 also has a detent mechanism 24 which maintains the valve in its dumping mode , i . e . the fully open valve position , without requiring finger pressure on the actuating lever 16 . for this purpose , the housing side walls 20 and 21 and the lever side wall portions 18 and 19 have cooperating detent members in the form of triangular detent grooves 26 in the housing side walls 20 and 21 and matching triangular detent ridges 25 in the lever side wall portions 18 and 19 . the detent grooves 26 and cooperating detent ridges 25 are preferably arranged in a near - radial orientation with respect to the pivot axis of the actuating lever , although this is not a requirement . in order to obtain a highly sensitive adjustment operation on the actuating lever 16 and valve plunger 15 , it is desirable to minimize the frictional contact between the valve housing 11 and the actuating lever 16 . this can be achieved by arranging the location of the detent members 25 and 26 near the upper edge of the valve housing 11 and close to the bridge portion 17 of the actuating lever 16 , so that the protruding detent ridges 26 will not come in contact with the housing side walls 20 and 21 , until the actuating lever 16 has almost reached its dumping end position . alternatively , if the detent ridges were to be arranged on the valve housing 11 , with cooperating detent grooves in the side wall portions 18 and 19 of the actuating lever 16 , then it would be preferable to locate these grooves near the lower edges of the lever side wall portions 18 and 19 . the flexibility of the side wall portions 18 and 19 and bridge portion 17 of the actuating lever 16 , in conjunction with the particular shape and depth of engagement of the detent cam formation has to be such that the pivoting torque required for the disengagement of the detent ridges 25 from the detent grooves 26 is greater than the torque which is exerted against the actuating lever 16 by the fully depressed plunger return spring . accordingly , while the detent mechanism 24 retains the actuating lever 16 in the dumping position ( fig2 ), it can readily be released from this position by applying finger pressure against the inclined release flank 27 , thereby creating a counterclockwise torque on the actuating lever 16 which adds itself to the valve closing torque produced by the plunger return spring . this deflation valve is thus designed for operation with one finger , preferably the thumb of the hand in which the unit is held . in fig4 - 6 is shown a second embodiment of the invention , as applied to a compact blood pressure measuring device which has a valve housing 28 , a pressure gauge 30 , and an inflation bulb 29 mounted together in a hand - held pressure unit . the valve housing 28 has an oblique mounting face for the pressure gauge 30 , thus giving the housing 28 a generally triangular contour . as is shown in fig4 the actuating lever 31 has a corresponding triangular contour , being recessed into the body of the valve housing 28 . this is shown in detail in fig5 and 6 . the valve housing 28 of this embodiment has a rounded lower contour , being preferably injection - molded of plastic material . fig5 shows how the cup - shaped sheet metal housing 33 of the pressure gauge 30 is directly attached to the oblique mounting face of the valve housing 28 . for this purpose , the gauge housing 33 has two openings 34 surrounded by outwardly tapering wall portions into which are engaged matching weld buttons 35 of the valve housing 28 . these weld buttons , initially cylindrical integral extensions of the housing 28 , are inserted through the bottom openings 34 of the gauge housing at assembly , whereupon they are flattened into the tapered depressions which surround the openings 34 , using a suitable heated tool . the actuating lever 31 of this embodiment , being received in a recess 32 of the valve housing 28 , has a shape which substantially fills out the recess . the pivot pin 40 for the actuating lever is again arranged near the forward extremity of the lever 31 which , in this case , is much narrower than the rear portion of lever 31 . the orientation of the pivot pin 40 is perpendicular to the oblique mounting face for the pressure gauge 30 . although generally triangular in contour , the actuating lever 31 has again a u - shaped cross section , the outer extremity of the valve plunger bearing against the inside of a transverse wall portion of lever 31 . but , because the side walls of the actuating lever 31 are no longer parallel , the detent mechanism 36 of this embodiment is restricted to only the upper lever side wall 39 which extends in a radial plane with respect to the lever pivot axis . one of the cooperating detent members is defined by a detent groove 37 near the edge of the lever side wall 39 ; the other detent member is a cantilever - type spring member 38 of round spring wire . the attached end portion of the detent spring member 38 is shaped in the form of an eye portion 42 , surrounding one of the two weld buttons 35 and being clamped between the valve housing 28 and the rim of the opening 34 of gauge housing 33 . the free extremity of the spring member 38 is rounded to form a detent nose 41 engaging the detent groove 37 of lever 31 . in this case , the detent cam formations are not triangular , but rounded , i . e . matchingly convex and concave . the arrangement of the detent grooves 37 near the edge of the lever side wall 39 has again for its purpose to avoid frictional resistance against the movements of the actuating lever 31 , until shortly before the latter reaches its fully depressed dumping position . at this point , a bevel on the edge of side wall 39 lifts the detent nose 41 onto the side wall 39 . a tongue - shaped lever guide 44 extends outwardly from the bottom of the housing recess 32 with a small clearance to the inner side of the lever side wall 39 , thereby serving as a support for the actuating lever 31 , against the transverse bias of the detent spring member 38 . a recess 43 in the upper portion of the valve housing 28 gives the detent spring member 38 freedom to move against the lever side wall 39 . in the lateral sense , this recess 43 is only slightly larger than the wire diameter of the detent spring member 38 , thereby positioning and guiding the latter . in general , the operation of the deflation valve of the embodiment of fig4 - 6 is the same as that of the previously described embodiment , the actuating lever 31 having again an upwardly inclined release flank on its narrow forward end portion , for the application of finger pressure , when the deflation valve is to be released from the dumping position in which it is held by the detent mechanism 36 . the deflation valve and pressure unit of fig4 - 6 is designed for right - handed operation . it should be understood that an equivalent pressure unit for left - handed operation requires only a left - to - right mirror image rearrangement of the housing recess 32 , actuating lever 31 , and detent mechanism 36 inside the valve housing 28 . in fig7 and 8 is shown a third embodiment of the invention which is generally similar to the embodiment of fig4 - 6 just described . outwardly , the differences between these two embodiments would not be visable in fig4 . the device of fig7 and 8 differs from the device of fig5 and 6 only in the type of spring member which serves as the second detent member , in cooperation with the upper side wall of the actuating lever 53 . the other features of this embodiment are unchanged from the previously described embodiment and will therefore not be separately described here . taking the place of the earlier wire spring detent member 38 is a spring member 45 of flat spring steel . this leaf spring is again of the cantilever type , having one end portion clamped between the oblique mounting face of the valve housing 46 and the bottom of the gauge housing 50 . this clamped end portion of the detent spring member 45 is retained inside a shallow recess portion 48 of the valve housing 46 , having a bore 47 engaged by a small integral positioning knob 49 of the valve housing 46 . a downwardly offset portion of the spring member 45 is positioned inside a deep recess portion 52 of the valve housing 46 , extending outwardly into the housing recess of the actuating lever 53 and engaging a detent groove 55 in the side wall of the latter . while the detent spring member 45 is no longer positioned around one of the weld buttons 51 of the unit , its assembly is similar , though somewhat simpler , than is the case in the previously described embodiment : the detent spring member 45 is placed into its recess , the gauge housing 50 is inserted over the -- initially cylindrical -- weld buttons 51 , and the latter are permanently set into their surrounding tapered depressions . the small positioning knob 49 , engaging the bore 47 of spring member 45 , prevents the latter from being pulled out of its seat in the shallow recess portion 48 . the detent cam formations of this embodiment , rather than being convexly and concavely curved , as previously , are triangular in shape , the downwardly offset length portion of the detent spring member 45 being preferably located just above the side wall of the actuating lever 53 . the use of a leaf spring as a detent member has the advantage of providing a larger contact surface between the spring and the cooperating detent groove of the actuating lever , thereby greatly reducing any potential wear on the detent cam formations over the long run . it should be understood , of course , that the foregoing disclosure describes only preferred embodiments of the invention and that it is intended to cover all changes and modifications of these examples of the invention which fall within the scope of the appended claims .
| 0 |
before describing the invention , a typical computer is described to provide a basis for understanding the invention . fig1 illustrates a typical computer system 10 that includes a host computer 12 , a small computer system interface ( scsi ) peripheral device 14 , and a scsi buss 16 for conveying communications between the host computer 12 and the scsi peripheral device 14 . the host computer 12 includes a memory ( not shown ) for storing instructions that are executed by a processor ( not shown ). a set of instructions for performing a particular task form a program . one of the programs that is typically executed by the host computer 12 is an operating system program that performs certain basic tasks , like processing input from a keyboard , sending output to a monitor or printer , keeping track of files and directories , and controlling the operation of peripherals , such as the scsi device 14 , at a general level . in many situations , the host computer 10 also executes an application program 20 . an example of an application program is a word processing program that is used to produce documents . the execution of an application program typically requires the use of a peripheral , such as the scsi device 14 . for example , if the application program is a word processing program , the documents produced with the word processing program are typically transferred from the memory of the host computer 12 to a storage peripheral so that the memory within the host computer 12 , which is typically limited , can be used for other purposes . consequently , in many situations , the scsi device 14 is a storage peripheral ( e . g ., tape drive , disk drive , tape library , disk library ). in most cases , it is impracticable for an application program to communicate directly with a peripheral device , such as the scsi device 14 . this impracticability stems from the facts that : ( 1 ) there are typically a number of different peripherals in a computer system that each have different command / communication protocols ; and ( 2 ) the peripherals associated with one computer system are likely to be different from the peripherals associated with another computer system . for an application program to work in such an environment , the program would have to be customized for each of the computer systems in which it is installed . to avoid this problem , most application programs are designed to work with a particular operating system ( e . g ., windows , macintosh and unix ), which has a set of generic commands that the application program can use to communicate with a peripheral . to translate the generic commands into device specific commands that a particular peripheral understands , the operating system 18 utilizes a device driver . in the case of scsi device 14 , a scsi device driver 22 is utilized by the operating system 18 to translate the generic commands into the commands used by the scsi device 14 . in addition to the translation of generic commands into device specific commands , the host computer 12 must also convey command related information to and from a peripheral device according to a data transfer protocol . the protocol typically includes some kind of “ handshake ” between the host computer and the peripheral device that is used to assure that both the host computer and the peripheral are synchronized . the protocol also typically defines the manner in which data is transferred and when the data transfer is complete . in the case of the scsi device 14 , the host computer includes a scsi adapter driver 24 and a scsi adapter 26 . the scsi adapter 26 is a card that interfaces with the scsi buss 16 and includes the electrical circuitry that is used to transfer scsi command related information between the host computer 12 and the scsi device 14 . the scsi driver adapter 24 controls the scsi adapter 26 and the transfer of scsi command related information to and from the scsi device driver 22 . fig2 illustrates a basic computer network 28 that includes a first computer system 30 and a second computer system 32 . the first computer system 30 includes a first computer 34 and a first scsi device 36 . the second computer system 32 includes a second computer 38 and a second scsi device 40 . connecting the first computer system 30 and the second computer system 32 is a network cable or buss 42 . the operating system associated with the first computer system 30 utilizes a first network card 44 to conduct communications of the network buss 42 . likewise , a second network card 46 is utilized by the second computer 32 to conduct communications over the network buss 42 . communications between the first and second computer systems 30 , 32 , are conducted over the network buss 42 according to a protocol . a popular protocol that allows communications to occur over many different types of carriers ( e . g ., ethernet , modems , satellite links etc .) is tcp / ip . with continuing reference to fig2 the first computer system 30 includes a scsi device driver that , once installed , identifies the first scsi device 36 to the operating system associated wit the first computer 30 and allows the operating system to interact with the first scsi device 36 . because the first scsi device 36 is known to the operating system of the first computer 34 , the first scsi device 36 is commonly referred to as a “ local ” device . the second scsi device 40 is likewise recognized by the second computer 38 as a “ local ” device . however , the first scsi device 36 is not part of and not recognized by the second computer system 32 . further , for the second computer system 32 to communicate with the first scsi device 36 , the network buss 42 must be utilized . for these reasons , the first scsi device 36 is referred to as a “ remote ” device relative to the second computer system 32 . likewise , the second scsi device 40 is a “ remote ” device relative to the first computer system 30 . with continuing reference to fig2 if it is desirable for an application program executing on the first computer 34 to conduct communications with the second scsi device 40 , which is a remote device relative to the first computer 30 , the application program must be modified relative to the application program 20 shown in fig1 that utilizes the local scsi device 14 . further , the time and resources of the second computer system 32 must be utilized . for example , if an appropriately modified application program executing on the first computer 34 wants to send information to the second scsi device 40 , the operating system of the first computer 34 must bundle the information in the appropriate format to be sent over the network buss 42 and the network card 44 must engage in the appropriate protocol exchanges to transfer the information . upon receiving the information at the second network card 46 , the operating system associated with the second computer system 38 must process the information received by the second network card 46 and then engage in whatever other processing is necessary to place the information in condition for sending to the second scsi device 40 . the present invention allows an application program executing on one computer system to communicate with a remote peripheral device as if the remote device were a local device . as a consequence , the invention prevents an application program that was designed to use local peripherals from having to be modified to work with a remote peripheral , i . e ., a peripheral that is situated such that communications must occur over a network buss . fig3 illustrates an embodiment of a computer network 50 in which an unmodified application program is capable of communicating with a remote scsi device . the computer network 50 includes a computer 52 , a remote scsi peripheral 54 , and a network buss 56 for conveying data between the computer 52 and the remote scsi peripheral 54 . the computer 52 includes , when the invention is in use , an application program 58 that has been written to communicate with local peripherals associated with the computer 52 . for simplicity , no local peripherals have been shown as being associated with the computer 52 . however , such peripherals are not precluded . further included in the computer 52 is an operating system 60 for performing the tasks noted with respect to the operating system 18 shown in fig1 . among those tasks , the operating system 18 receives requests from the application program 58 that require communication with a peripheral and if necessary , provides information to the application program resulting from the communication with a peripheral . the computer 52 also includes a scsi device driver 62 that identifies a remote scsi device 64 associated with the remote scsi peripheral 54 to the operating system 60 . the scsi driver 62 also translates the generic commands that the operating system 60 receives from the application program into a scsi command / commands that is / are recognized by the remote scsi device 64 . further , the scsi device driver 62 receives any communications back from the remote scsi device 64 that result from the execution of a command previously sent to the scsi device 64 and , if necessary , provides or makes available any such communications to the operating system 60 and / or application program 58 . unlike the scsi device driver 22 shown in fig1 the scsi device driver 62 communicates with a scsi virtual adapter 66 that : ( 1 ) takes any scsi command received from the scsi device driver 62 and embeds the scsi command in the format required for sending the command over the network buss 56 and provides the embedded scsi command to the operating system 60 , which can then cause the command to be conveyed over the network buss 56 via a network controller 68 ; and ( 2 ) receives any response to a previously issued scsi command ( which has also been embedded or encoded by the scsi peripheral 54 for transmission over the network buss 56 , received by the network controller 68 , and provided to the operating system 60 ), un - encodes the response , and provides the un - encoded response to the scsi device driver 62 . generally , the encoding of scsi command related information for transport in either direction over the network buss 56 involves the transmitting element placing the scsi command related information in a pre - determined structure that can be decoded or un - embedded by the receiving element to obtain the relevant information . scsi commands and their related data are encoded or embedded by the computer for transmission of the computer network and decoded or un - embedded by the scsi peripheral or device . with respect to the embodiment illustrated in fig3 the virtual adapter 66 encodes or embeds scsi commands ( including any command data ) that are to be executed by the remote scsi peripheral 54 ( more specifically , the scsi device 64 ) for transmission over the network buss 56 pursuant to the tcp / ip protocol . the ethernet - to - scsi controller 70 decodes or un - embeds the encoded scsi commands so that the commands can be applied to the scsi device 64 . fig4 a illustrates one type of pre - determined structure , a scsi request block ( srb )- command request data operation packet ( dop ), that is suitable for embedding or encoding scsi command information for transmission from a computer to a scsi peripheral , e . g ., from the computer 52 to the remote scsi peripheral 54 . the srb includes a dop header that specifies the nature and length of the scsi command related information that follows . this information facilitates the proper decoding or un - embedding of the following scsi command related information by the scsi peripheral or device . following the dop header is a srb command header that provides information relating to the identification of a specific scsi command to be performed by a scsi device , e . g ., the scsi device 64 . following the srb command header is the srb command data block that provides the data associated with the scsi command identified in the srb command header . the responses to scsi commands and their related data are encoded or embedded by the scsi peripheral or device and decoded or un - embedded by the computer . with respect to the embodiment illustrated in fig3 the ethernet - to - scsi controller 70 encodes or embeds the responses ( including any data ) to scsi commands that have been executed by the remote scsi peripheral 54 ( more specifically , the remote scsi device 64 ) for transmission over the network buss 56 pursuant to the tcp / ip protocol . the virtual adapter 66 decodes or un - embeds the encoded scsi command responses so that the responses can be supplied to the operating system 60 and / or application program 58 . fig4 b illustrates one type of pre - determined structure , a scsi request block ( srb )- command response data operation packet ( dop ), that is suitable for embedding or encoding responses to scsi commands for transmission from a scsi peripheral or device to a computer , e . g ., from the remote scsi peripheral 54 to the computer 52 . the srb includes a dop header that specifies the nature and length of the scsi command response related information that follows . this information facilitates the proper decoding or un - embedding of the following scsi command response related information by the computer . following the dop header is a srb command header that provides information relating to the status of the scsi command that has been performed by a scsi device , e . g ., the scsi device 64 . following the srb command header is the srb command data block that provides any data associated with the processing of the scsi command by the scsi peripheral 54 and , in particular , the scsi device 64 ( such as data read from a tape ). in the illustrated embodiment , the network buss 56 is a lan or wan and the tcp / ip protocol is utilized to manage the transmissions over the buss 56 . it should , however , be appreciated that the invention is not limited to any particular network or data transfer protocol . with continuing reference to fig3 the remote peripheral 54 includes the scsi device 64 . additional scsi devices can be incorporated into the remote peripheral 54 if desired . also part of the remote peripheral 54 is an ethernet - to - scsi controller 70 for : ( 1 ) receiving encoded scsi command related information that has been transmitted from the computer 52 over the network 56 and un - encoding the scsi command related information so that the scsi command related information can be transmitted to the scsi device 64 via a scsi buss 72 ; and ( 2 ) receiving scsi command related information from the scsi device 64 via the scsi buss 72 and encoding the received scsi command related information for transmission to the computer 52 over the network buss 56 . it should be appreciated that the invention is not limited to ethernet based networks . consequently , other types of scsi controllers can be utilized . having described the computer network 50 , an example of the operation is now provided . in this particular example , the scsi device 64 is a data storage device with data that the application program 58 needs to accomplish its task . initially , the application program 58 issues a generic file read command to the operating system 60 that identifies the file that the application program 58 requires to have brought into the computer 52 . in response , the operating system 60 associates the file identified with the scsi device 64 and passes the generic read command onto the scsi device driver 62 for translating the generic read command into one or more scsi read commands that are appropriate for retrieving the requested file from the scsi device 64 in the remote peripheral 54 . the scsi commands produced by the scsi device driver 62 are conveyed to the scsi virtual adapter 66 . in response , the scsi virtual adapter 66 encodes or embeds the scsi command ( s ) for transmission over the network 56 and issues a request to operating system 60 to cause the transmission to occur . in response , the operating system 60 causes the encoded scsi command ( s ) to be placed on the network buss 56 by the network controller 68 for transmission to the remote peripheral 54 . initially , the ethernet - to - scsi controller 70 receives the encoded scsi command ( s ) that have been transmitted over the network buss 56 by operation of the computer 52 . in response , the ethernet - to - scsi controller 70 un - encodes the scsi command ( s ) from the overhead associated with transmitting the commands over the network buss 56 and places the scsi command ( s ) on the scsi buss 72 such that the commands are directed to the scsi device 64 . upon receipt of the scsi command ( s ), the scsi device 64 takes the action ( s ) required by the command ( s ), which in this case are operations related to reading data from the identified file . to elaborate , once the scsi device 64 has located the identified file , it reads the data contained in the file and conveys the data to the ethernet - to - scsi controller 70 over the scsi buss 72 according to the scsi protocol . the ethernet - to - scsi controller 70 , in response , encodes or embeds the data ( scsi command related information ) in a form for transmission over the network buss 56 and causes the encoded data to be transmitted over the network buss 56 . the network controller 68 receives the encoded data and informs the operating system 60 that a network communication has been received that is related to the scsi device 64 . since the scsi virtual adapter 66 appears to the operating system 60 to be the scsi device 64 , it causes the encoded data to be communicated to the scsi virtual adapter 66 . upon receiving the encoded data , the scsi virtual adapter 66 un - encodes the data and provides the un - encoded data to the scsi device driver 62 . the scsi device driver 62 and the operating system 60 , then cooperate to make the data available to the application program 58 . other aspects of the operations associated with the communications between a host computer and a remote scsi tape storage device that appears to the operating system of the host computer as a local device are now described . the present invention recognizes that operating systems in many computer systems , upon booting up , endeavor to identify all the local scsi devices associated with the computer system and that this identification process occurs before the operating system enables network communications . consequently , any remote scsi device that is meant to appear to the operating system to be a local cannot be identified at the time that the operating system has allotted for identify local scsi devices because network communications have not yet been enabled . this problem is addressed by providing a program that is executed on the computer system 50 as part of installation of the virtual adapter 66 and permits a user to identify the remote scsi tape storage devices associated with the virtual adapter 66 . once identified , the program stores the information that would be requested by the operating system if the remote scsi tape storage device were a conventional local device in a portion of the memory allocated solely to the operating system and known as the system registry . when the operating system subsequently issues an inquiry to the virtual adapter to provide the information required by the operating system for conducting communications with the remote scsi tape storage device , the virtual adapter 66 responds by providing the information stored in the system registry to the operating system . memory other than the system registry may be used to store the information provided that the memory is accessible to the virtual adapter 66 when the operating system requests the information on boot up of the system 50 . another aspect of the communications between a computer system and a remote scsi tape storage device that appears to the operating system of the computer system to be a local device is a reduced number of exchanges between the computer system and the remote scsi tape storage device . fig5 a illustrates the known sequence of exchanges that occurs between a computer and a scsi device . the sequence commences with the computer sending a command without any of the data associated with the command to the device . in response , the scsi device accepts the command and sends a request for the data associated with the command to the computer . the computer , in reply to the request , sends the command data to the device . once the device receives the command data , the device has all of the information needed to process the command and proceeds to do so . once the command has been processed by the device , a response is sent from the device to the computer . examples of responses include providing an indication that the command has been completed or that the command could not be executed . in other cases , the response may involve the providing of user data to the computer that was stored on the device . in any event , at least four exchanges between the computer and the device are required to process a scsi command . with reference to fig5 b , the computer system 52 and , in particular , the virtual adapter 66 and ethernet - to - scsi controller 70 , have been designed to reduce the number of exchanges between the computer system 52 and the remote device 54 that are needed to process a scsi command to two exchanges . to elaborate , the virtual adapter 66 , instead of sending the command and the command data in separate communications to the remote device 54 , sends both the command and the command data to the remote device 54 in the same communication and pursuant to the tcp / ip protocol . the remote device 54 is , however , only able to process the command and the associated command data when sufficient resources , such as memory and processing time , are available . consequently , the remote device 54 does not allow the tcp / ip protocol to provide an acknowledgment to the computer system 52 until the resources needed to process the command are available . until the resources are available , the command and data are essentially retained in the pipeline provided by the buss 56 . stated differently , the computer system 52 and the remote device 54 make use of the network buss 56 and the tcp / ip protocol to synchronize the exchange of scsi command related information instead of the sequence of scsi exchanges described with respect to fig5 a . in one embodiment , this control is achieved by the ethernet - to - scsi controller 70 reviewing the dop header of a srb command request dop ( fig4 a ) to determine what scsi command the computer 52 wants to have the remote scsi device 64 perform . based on this determination , the controller 70 determines if the resources for processing the command are available . if the resources are not available , a flag is set that is used to instruct the tcp / ip event handler not to acknowledge the receipt of any data associated with the command . once the resources are available , the flag is reset and the receipt of the data is acknowledged . yet a further aspect of the communications between a computer system and a remote scsi tape storage device that appears to the operating system of the computer system to be a local device is an increase in the frequency of scsi write commands to remote scsi tape storage devices relative to the known approach . fig6 a illustrates the sequence of exchanges that presently occur between a computer and a scsi device in processing a write command . initially , the computer system issues a write command to the remote device . in response , the controller associated with the device initiates processing of the command , waits for processing of the command to be completed ( e . g ., data written to a tape storage device ), and sends an indication to the computer that the processing of the command has been completed . only after the computer receives the indication that the command has been completed is the computer free to issue further commands . with reference to fig6 b , the sequence of operations associated with the processing of a write command in the system 50 is discussed . initially , the computer system 52 issues a write command to the remote device 54 via the virtual adapter 66 . the ethernet - to - scsi controller 70 , upon receiving the write command , sends a response back to the computer system 52 that the write command has been completed before the write command has actually been completed by the remote scsi tape storage device 64 . as a consequence , the computer system 52 is free to issue another command . in one embodiment , the ethernet - to - scsi controller 70 only provides the noted write completed response if the immediately preceding write or similar command was successfully completed by the remote device 54 and , in particular , the scsi device 64 . the successful processing and completion of the command immediately preceding the current write command provides assurance that the scsi device 64 is likely to successfully complete the processing of the current write command . in an alternative embodiment , the virtual adapter 66 , rather than the ethernet - to - scsi controller 70 , generates the response to the write command indicating that the write command has been completed before the scsi device 64 completes the command . another aspect of the communications between a computer system and a remote scsi tape storage device that appears to the operating system of the computer system to be a local device is the ability to provide robust or error tolerant communications between the computer system and the remote scsi tape storage device . to elaborate , the virtual adapter 66 operates to terminate endpoint connections ( i . e ., connections established at the tcp / ip level between the computer system 52 and the remote device 54 ) if a predetermined amount of time has elapsed from the point at which it had no outstanding scsi commands . by having the virtual adapter terminate endpoint connections in this fashion , the exposure to situations that can disrupt endpoint connections ( e . g ., endpoint resets and restarts , transport carrier disruption etc .) and require lengthy and / or resource consuming recovery procedures is reduced . however , while purposely terminating endpoints avoids such problems , such terminations adversely impact the ability to support : ( 1 ) scsi “ reserve ” functionality which allows a scsi device to be exclusively used by what is known as an initiator to complete all or a portion of a task and ( 2 ) scsi “ release ” functionality which allows a present initiator to release the scsi device for use by other initiators when the present initiator no longer needs the scsi device . to provide this functionality , the virtual adapter 66 is capable of defining a “ session ” of two or more endpoint connections that allows the computer system 52 and the remote device 54 to relatively quickly resume the execution of sequence of commands when the computer system 52 has reserved the scsi device 64 even though the sequence has been interrupted by the noted endpoint terminations . a session is defined by the virtual adapter to have an identifier during an endpoint connection that is communicated to the scsi device 64 and allows , should the endpoint connection be purposefully terminated due to a time out , the computer system 52 and the scsi device 64 to resume execution of a command string when the virtual adapter 66 is next presented with a command without having to engage in a lengthy “ handshake ” process . more specifically , the identifier is used to store state and / or property information , such as the scsi i / t / l nexus , that can be subsequently recalled and used to quickly resume execution of the command string rather than have to be re - created . in one embodiment , the virtual adapter changes the session identifier each time a new endpoint connection is established to enhance security . in one embodiment , a pseudo - random number generator is used to alter the session identifier . while the purposeful termination of endpoint connections reduces the possibility of disruptions and lengthy and / or resource consuming recovery procedures and the use of a session identifiers that allow status information ( e . g ., scsi i / t / l ) to be preserved over multiple tcp / ip endpoint connections to support scsi reserve / release functionality , there is still the possibility that an endpoint connection will fail rather than be purposefully terminated by the virtual adapter 66 . to address this possibility , the virtual adapter 66 and the scsi device 64 have the ability to re - synchronize following an endpoint failure so that previously executed commands are not duplicated and commands that were unlikely to have been executed are queued up for execution . to elaborate , both the virtual adapter 66 and the scsi device 64 maintain lists of outstanding commands . following an endpoint failure , the virtual adapter 66 initiates a comparison of the two lists . if a command is in the adapter list but not in the scsi device list , it is likely that the scsi device 64 never received the command from the computer system 52 and so the command is added to the scsi device list for execution . conversely , if the command is not in the adapter list but is in the scsi device list , then it is likely that the scsi device 64 completed the command , informed the computer system 52 of the completion , but failed to receive an acknowledgment from the computer system 52 that would have allowed the scsi device 64 to delete the command from its list . the failure to receive the acknowledgment is likely due to the endpoint connection failure . in this case , the command is deleted from the scsi device list . finally , if a command is in both the adapter list and the scsi device list , the command remains on both lists . there is also a possibility that a computer system would need to obtain or discover information relating to a remote scsi tape storage device 64 while the device is engaged in one or more sessions with the computer system or other computer systems . to accommodate this possibility the virtual adapter 66 and controller 70 are capable of establishing an endpoint connection between the computer system 52 and the scsi device 64 that does not interfere with existing sessions . to avoid such interference , the adapter 66 and controller 70 operate to establish an endpoint connection that only permits that use of scsi commands that do not change the state of the scsi device 64 and , as such , do not interfere with any existing sessions in which the device is engaged . the foregoing description of the invention has been presented for purposes of illustration and description . further , the description is not intended to limit the invention to the form disclosed herein . consequently , variations and modifications commensurate with the above teachings , and the skill or knowledge in the relevant art are within the scope of the present invention . the embodiment described hereinabove is further intended to explain the best mode known of practicing the invention and to enable others skilled in the art to utilize the invention in various embodiments and with the various modifications required by their particular applications or uses of the invention . it is intended that the appended claims be construed to include alternate embodiments to the extent permitted by the prior art .
| 7 |
the following discussion is presented to enable a person skilled in the art to make and use the invention . the general principles described herein may be applied to embodiments and applications other than those detailed above without departing from the spirit and scope of the present invention . the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest scope consistent with the principles and features disclosed or suggested herein . fig5 is a schematic diagram of an electronic circuit having a front - end bypass test circuit for testing logic according to an embodiment of the invention . the electronic circuit includes typical elements associated with an atpg such as launch flip - flop 511 and capture flip - flop 521 . the electronic circuit to be tested resides between the launch flip - flop 511 and the capture flip - flop 521 and , in this embodiment , the electronic circuit to be tested includes input logic 510 and output logic 520 associated with a memory block , such as the ram block 500 . the electronic circuit also includes front - end bypass circuitry 508 . these elements and their relationships between each other are detailed in the following paragraphs . as was discussed previously in the background section , it is extremely difficult to predict the logical outcome of values passed through a memory block in an electronic circuit using a scan vector test in an atpg tester . as such , a reliable and predictable way of passing logical values either through or around the memory block is needed such that known values loaded at the launch flip - flop 511 will yield expected logical values at the capture flip - flop 521 . one such way utilizes an off - the - shelf type of memory block that includes a write - through capability and a built - in self - test mode ( bist mode ) inputs . a memory block that has write - through capability , such as ram block 500 , monitors a specific write - through input 535 to determine the operation of its inputs and outputs . in one embodiment , if the write - through input 535 is set to a low logic value , the outputs of the ram block 500 typically operate normally according to the functions of the memory blocks . on the other hand , if the write - through input 535 is set to a high logic value , the outputs of the ram block 500 typically reflect the logic value of respective corresponding inputs . that is , any logic value received on an input will be written directly through to a corresponding output . although discussed in more detail below with respect to the operation of the embodiment of fig5 , memory blocks having write - through capability are well - known in the industry and will not be discussed in further detail herein . the ram block 500 also includes a bist mode such that another input is able to set the ram block 500 to a bist mode ( e . g ., bist input 536 set to a high logical value ) or a functional mode ( e . g ., bist input 536 set to a low logical value ). when in bist mode , a memory block will typically receive inputs through dedicated test inputs ( e . g ., test mode input 551 ) and when in functional mode , a memory block will receive inputs through dedicated functional mode inputs ( e . g ., functional mode input 552 ). as a result , when in bist mode , logical values on the functional input 552 will be ignored , and , when in functional mode , logical values on the test mode input 551 will be ignored . again , this aspect of the ram block 500 is discussed in more detail below with respect to the operation of the embodiment of fig5 ; however , memory blocks having bist capability are also well - known in the industry and will not be discussed in further detail herein . as can be seen in fig5 , the electronic circuit monitors inputs that include write - through input 535 , bist input 536 , and scan mode input 506 . various combinations of logical values on these inputs control some aspects of the operation of the entire electronic circuit . the schematic layout and connections of these inputs are discussed below and then a discussion of the operation of the electronic circuit in the various combinations of input values is presented . the write - though mode input 535 controls the operation of the output multiplexor 565 ( only one is shown for clarity , but several may all be linked to the same write - through mode input 535 ). in one embodiment , when the write - through input 535 is set to a low logic value , the output multiplexor 565 recognizes the logical values received from the ram cells 504 according to normal operation of the ram block 500 and passes these logic values to the output 502 of the ram block 500 ( again , only one shown for clarity ), while at the same time ignoring any logic value on the write - through bypass line 555 . likewise , when the write - through input 535 is set to a high logic value , the output multiplexor 565 recognizes the logical values received on the write - through bypass line 555 and also passes these logic values to each respective ram block output 502 , while at the same time ignoring any logic value from the ram cells 504 . similarly , the bist input 536 controls the operation of the input multiplexor 560 ( only one is shown for clarity , but several may all be linked to the same bist mode input 536 ). this input multiplexor can reside inside or outside of the ram block . in one embodiment , when the bist input 536 is set to a high logic value , the input multiplexor 560 recognizes the logical values received on the test mode input 551 and passes these logic values accordingly , while at the same time ignoring any logic value on the functional mode input 552 . likewise , when the bist input 536 is set to a low logic value , the input multiplexor 560 recognizes the logical values received on the functional mode input 552 and also passes these logic values accordingly while at the same time ignoring any logic value on the test mode input 551 . both the write - through mode and bist mode are discussed in greater detail below with respect to the operation of this embodiment of the electronic circuit of fig5 . as was briefly mentioned above , the embodiment of fig5 includes front - end bypass circuitry 508 for handling scan tests when in an atpg environment . the front - end bypass circuitry 508 includes an observation flip - flop 550 and a front - end multiplexor 517 . the input of the observation flip - flop 550 is coupled to the functional input 552 of the ram block 500 . the electronic circuit of fig5 may include bypass circuitry 508 for each input to the ram block 500 , but only one is shown here for clarity . the output of the observation flip - flop 550 is coupled to one of two selectable inputs on the front - end multiplexor 517 . the other input of the front - end multiplexor 517 is coupled to a signal line from a bist circuit 516 ( not shown in detail ). the input which the front - end multiplexor 517 selects is determined by the logic value of the bist input 536 . in one embodiment , when the bist input 536 is set to a high logic value , the front - end multiplexor 517 recognizes the logical values received from the bist circuit 516 and passes these logic values accordingly while at the same time ignoring any logic value from the observation flip - flop 550 . likewise , when the bist input 536 is set to a low logic value , the front - end multiplexor 517 recognizes the logical values received from the observation flip - flop 550 and passes these logic values accordingly while at the same time ignoring any logic value from the bist circuit 516 . in a similar manner to the bist input 536 , the scan mode input 506 also controls the operation of the input multiplexor 560 ( only one is shown for clarity , but several may all be linked to the same scan mode input 506 ). in one embodiment , when the scan mode input 506 is set to a high logic value , the input multiplexor 560 recognizes the logical values received on the test mode input 551 and passes these logic values accordingly . likewise , when the scan mode input 506 is set to a low logic value , each input multiplexor 560 recognizes the logical values received on the functional mode input 552 and also passes these logic values accordingly . since the input multiplexor 560 is coupled to two different inputs ( scan mode input 506 and bist input 536 ), if either one is set to a high logic value , then the input multiplexor 560 selects the test mode input 551 for passing signals and rejects logic values on the functional mode input 552 . this may be accomplished by using or gate 507 such that the signal line controlling the input multiplexor 560 is a high logic value if either the scan mode input 506 or bist input 536 or both are at a high logic value . with these three inputs ( scan mode input 506 , bist input 536 , and write - through input 535 ) controlling some aspects of the operations of the electronic circuit , eight possible control states exist with respect to these three binary input values . while a technician has the option of setting up to eight control states using the three binary inputs values , the primary control states for the purposes of the present invention include a functional mode state , a scan mode state , and a bist mode state . although other input combinations exist ( and consequently , other possible control states , such as write - though mode ), only the afore - mentioned control states will be discussed herein as the other combinations may be duplicative and / or unused . in a first control state , the electronic circuit may be set for functional mode . in this control state , each of the inputs ( write - through input 535 , scan mode input 506 , and bist input 536 ) is set to a low logic value . as such , logic signals that are initiated at the launch flip - flop 511 propagate through the input logic 510 to the functional mode input 552 . at the input multiplexor 560 , the logic value at the functional mode input 552 is recognized while any logic value at the test mode input 551 is ignored because neither the scan mode input 506 nor the bist input 536 is set to a high logic value . thus , only the logic value on the functional mode input 552 is allowed to pass . furthermore , even though logic values are , in fact , passed through the observation flip - flop 550 and the front - end multiplexor 517 , any resultant logic value on the test mode input 551 is ignored because the input multiplexor 560 is set to only pass logic values on the functional mode input 552 . in essence , when in functional mode operation , the electronic circuit is unconcerned with any signals propagating through the front - end circuitry 508 . once logic values are passed to the ram block 500 at the input multiplexor 560 , the ram block 500 behaves normally . that is , input values are passed to ram cells 504 according to the parameters of operation of the ram block 500 itself . additionally , all logic values at the input multiplexor 560 are passed along the write - through bypass line 555 to the output multiplexor 565 . the output multiplexor 565 is set to only recognize logic values from the ram cells 504 , however , as the write - through mode input 535 is set to a low logic value when in functional mode operation . as a result , even though logic values are passed to the output multiplexor 565 on the write - through bypass line 555 , the output multiplexor 565 ignores these logic values because the write through input 535 is set to a low logic value . the recognized logic values from the ram cells 504 are passed to the output 502 of the ram block 500 , then to the output logic 520 , and eventually to the capture flip - flop 521 . the front - end bypass circuit 508 is not used in functional mode since its main purpose is control and observation of the ram block inputs 551 during scan mode . furthermore , the timing of signals propagating through the electronic circuit will be approximately two clock cycles . during a first clock cycle , a logic value propagates to the input of the ram block 500 through the input logic 510 . likewise , during a second clock cycle , the logic value propagates from the output of the ram block 500 through the output logic 520 . the additional time that it takes a signal to pass through the multiplexors 560 and 565 inside the ram block 500 have a negligible timing impact with respect to the two clock cycles during functional mode operation despite the fact that they are designed into the ram block 500 and are not removable . thus , it is desirable that any testing of the electronic circuit is also accomplished in the same time frame ( i . e ., two clock cycles ). when a technician needs to test the input logic 510 and output logic 520 using an atpg , the technician may set the scan mode control state wherein the scan mode input 506 is set to a high logic value . at the same time , the write - through input 535 is also set to a high logic value to take advantage of the write - through capability of the ram block 500 . the bist input 536 remains at a low logic value during an atpg test . in this control state ( scan mode ), logic signals that are initiated at the launch flip - flop 511 propagate normally through the input logic 510 to the functional mode input 552 . at the input multiplexor 560 , any logic value at the functional mode input 552 , however , is ignored , while , at the same time , any logic value at the test mode input is recognized because the scan mode input 506 is set to a high logic value which controls the input multiplexor 560 . thus , only the logic value on the test mode input 551 is allowed to pass . any resultant logic value on the test mode input 551 is recognized and passed because the input multiplexor 560 is set to only pass logic values on the test mode input 551 . in essence , when in scan mode operation , the electronic circuit is unconcerned with any signals propagating to the functional mode input 552 at the ram block 500 . furthermore , logic values on the functional mode input 552 are also the same as logic values at the input to the observation flip - flop 550 , and are passed through the observation flip - flop 550 and the front - end multiplexor 517 accordingly . the front - end bypass multiplexor 517 , in scan mode , is set to recognize and pass logic values from the output of the observation flip - flop 550 while ignoring any logic values from the bist circuit 516 . this is because the bist input 536 is still set to a low logic value . once logic values are passed to the ram block 500 at the input multiplexor 560 , the ram block 500 again behaves normally . that is , input values are passed to ram cells 504 according to the parameters of the ram block 500 itself . additionally , all logic values at the input multiplexor 560 are passed along the write - through bypass line 555 to the output multiplexor 565 . however , in scan mode , the output multiplexor 565 is set to only recognize logic values from the write - through bypass line 555 and to ignore any logic values from the ram cells 504 . this is because the write - through mode input 535 is set to a high logic value when in scan mode operation . as a result , even though logic values are passed to the output multiplexor 565 from the ram cells 504 , the output multiplexor 565 ignores these logic values because the write through input 535 is set to a high logic value . the recognized logic values from the write - through bypass line 555 are passed to the output 502 of the ram block 500 , then to the output logic 520 , and eventually to the capture flip - flop 521 . in scan mode , the launch flip - flop 511 and the capture flip - flop 521 will , in fact , be part of the overall logical circuitry in the electronic circuit as these flip - flops are a typical feature of an atpg environment that facilitates the testing procedure . furthermore , much like the timing of signals in functional mode , the timing of signals propagating through the electronic circuit in scan mode will also be approximately two clock cycles . during a first clock cycle , a logic value propagates to the input of the observation flip - flop 550 through the input logic 510 . likewise , during a second clock cycle , the logic value propagates from the output observation flip - flop 550 through the ram block 500 and the output logic 520 . again , the additional time that it takes a signal to pass through the multiplexors 560 and 565 inside the ram block 500 as well as the bypass multiplexor 517 is negligible with respect to the two clock cycles during scan mode operation . therefore , any testing of the logic is accomplished in the same time frame ( i . e ., two clock cycles ) as the timing of the functional mode . that is , the scan test may be run at - speed . furthermore , the bypass circuitry 508 is not within the critical path of the electronic circuit . thus , the critical path of the electronic circuit will remain as fast as possible while at the same time still having test circuitry ( bypass circuitry 508 ) for testing the circuit at - speed . a third control state that is available in this embodiment of the invention is a bist mode . in this control state , logic signals that are initiated at the launch flip - flop 511 ( or any other circuit that may be coupled to the input logic 510 ) propagate normally through the input logic 510 to the functional mode input 552 . as was the case with scan mode , at the input multiplexor 560 , the logic value at the functional mode input 552 is ignored . any logic value at the test mode input 551 is recognized because the bist input 536 is set to a high logic value . thus , only logic values on the test mode input 551 are allowed to pass and any resultant logic values on the test mode input 551 are recognized and passed because the input multiplexor 560 is set to only pass logic values on the test mode input 551 . in essence , when in bist mode operation , the electronic circuit is unconcerned with any signals propagating to the functional mode input 552 at the ram block 500 . the front - end bypass multiplexor 517 , in the bist mode , is set to recognize and pass logic values from the bist circuit 516 while ignoring any logic values from the output of the observation flip - flop 550 . this is because the bist mode input 536 is set to a high logic value causing the bypass multiplexor 517 to only recognize and pass signals from the bist circuit 516 . once logic values are passed to the ram block 500 at the input multiplexor 560 , the ram block 500 behaves according to the parameters of the bist testing procedures . the bist parameters are not described in further detail as they are not within the scope of the present invention . thus , signals may be passed to the output 502 of the ram block 500 , then to the output logic 520 and eventually to the capture flip - flop 521 according to known bist test procedures . fig6 is a block diagram of a typical atpg 600 that may be used in conjunction with the electronic circuit of fig5 according to an embodiment of the invention . the atpg 600 includes two test paths that may be used to compare a first electronic circuit against a standard test circuit or a second electronic circuit . as shown , the first path 610 includes a first launch flip - flop 611 , a first input logic 612 a test flip - flop 613 , a first output logic 614 and a first capture flip - flop 615 . likewise , the second path 620 also includes a second launch flip - flop 621 , a second input logic 622 , a second output logic 624 , and a second capture flip - flop 625 . additionally , instead of a test flip - flop , the second path 620 includes a device between the input logic 622 and output logic 624 , such as ram block 623 . the second input logic 622 , the ram block 623 and the output logic 624 may be similar to the electronic circuit of fig5 and may also include the bypass circuitry 508 of fig5 . as such , a technician may perform a scan vector test using the atpg 600 of fig6 on both the first path 610 and the second path 620 . the results may be analyzed and compared according to known test procedures . furthermore , each test may be performed at - speed such that testing is accomplished at the same speed in which the electronic circuit in either path would operate normally .
| 6 |
fig1 is a block diagram of a virtual machine based computer system 100 in which one or more embodiments may be practiced . computer system 100 includes a hardware platform 130 , including , for example , central processing units ( cpus ) 131 , system memory 132 , host bus adapters ( hbas ) 133 that connect computer system 100 to remote data storage systems , and network interface controllers ( nics ) 134 that connect computer system 100 to a computer network , e . g ., the internet . a virtualization software , commonly known as a hypervisor 114 , is implemented on top of hardware platform 130 , to support a virtual machine execution space 101 within which n virtual machines ( vms ) 103 can be instantiated and executed . in one embodiment , hypervisor 114 corresponds to the vsphere product ( and related utilities ) developed and distributed by vmware , inc ., palo alto , calif . although it should be recognized that vsphere is not required in the practice of the teachings herein . hypervisor 114 provides the services and support that enable concurrent execution of vms 103 . each vm 103 supports the execution of a guest operating system 108 , which , in turn , supports the execution of applications 106 . examples of guest operating system 108 include microsoft ® windows ®, the linux ® operating system , and netware ®- based operating systems , although it should be recognized that any other operating system may be used in embodiments . guest operating system 108 includes a native or guest file system , such as , for example , an ntfs or ext3fs type file system . the guest file system may utilize a host bus adapter driver ( not shown ) in guest operating system 108 to interact with a host bus adapter emulator 113 in a virtual machine monitor component ( vmm ) 104 of hypervisor 114 . conceptually , this interaction provides guest operating system 108 ( and the guest file system ) with the perception that it is interacting with actual hardware . fig1 also depicts a virtual hardware platform 110 as a conceptual layer in vm 203 ( 0 ) that includes virtual devices , such as virtual hba 112 and virtual disk 111 , which itself may be accessed by guest operating system 108 through virtual hba 112 . in one embodiment , the perception of a virtual machine that includes such virtual devices is effectuated through the interaction of device driver components in guest operating system 108 with device emulation components ( such as host bus adapter emulator 113 ) in vmm 104 ( 0 ) ( and other components in hypervisor 114 ). file system calls initiated by guest operating system 108 to perform file system - related data transfer and control operations are processed and passed to vmm 104 ( 0 ) and other components of hypervisor 114 that implement the virtual system support necessary to coordinate operation with hardware platform 130 . for example , hba emulator 113 functionally enables data transfer and control operations to be ultimately passed to hbas 133 . file system calls for performing data transfer and control operations generated , for example , by one of applications 106 are translated and passed to a virtual machine file system ( vmfs ) driver 116 that manages access to files ( e . g ., virtual disks , etc .) stored in data storage systems ( such as storage system 150 ) that may be accessed by any of vms 103 . for example , guest operating system 108 receives file system calls and performs corresponding command and data transfer operations against virtual disks , such as virtual scsi devices accessible through hba emulator 113 , that are visible to guest operating system 108 . each such virtual disk may be maintained as a file or set of files stored on vmfs , for example , in a data store exposed by storage system 150 . the file or set of files may be generally referred to herein as a virtual disk and , in one embodiment , complies with virtual machine disk format specifications promulgated by vmware ( e . g ., sometimes referred to as a vmdk files ). file system calls received by guest operating system 108 are translated to instructions applicable to particular file in a virtual disk visible to guest operating system 108 ( e . g ., data block - level instructions for 4 kb data blocks of the virtual disk , etc .) to instructions applicable to a corresponding vmdk file in vmfs ( e . g ., virtual machine file system data block - level instructions for 1 mb data blocks of the virtual disk ) and ultimately to instructions applicable to a data store exposed by storage system 150 that stores the vmfs ( e . g ., scsi data sector - level commands ). such translations are performed through a number of component layers of an “ io stack ,” beginning at guest operating system 108 ( which receives the file system calls from applications 106 ), through host bus emulator 113 , vmfs driver 116 , a logical volume manager 118 which assists vmfs driver 116 with mapping files stored in vmfs with the data stores exposed by storage system 150 , a data access layer 120 , including device drivers , and hbas 133 ( which , e . g ., issues scsi commands to storage system 150 ). according to one or more embodiments , an io manager 117 running inside vmfs driver 116 implements the functionalities described herein . io manager 117 is responsible for setting up request queues for each resource of storage system 150 that are being targeted by ios issued by vms 103 in a “ blocking context .” a “ blocking context ” as used herein refers to ios performed on a storage resource , such as a data block or data blocks , that would block other ios from being issued thereto . one example of a “ blocking context ” is a write . fig2 is a conceptual diagram that illustrates an io management method that employs request queues . for simplicity , only five concurrently executing threads are shown in fig2 . in practice , the number of concurrently executing threads may equal the number of virtual cpus . in the example of fig2 , the threads request ios r1 , r3 , r2 , rm , and rn in the following time order : t0 , t1 , t2 , t3 , and t4 , respectively . each request has an associated priority assigned thereto by the thread according to the relative importance of the io . five levels of priority , p1 through p5 , are assigned in the example shown , with p1 being the lowest priority , then p2 , p3 , and p4 , and p5 being the highest priority . for example , a metadata io may be given a high priority , such as p5 . on the other hand , a data io may be given a tow priority , such as p1 . when multiple ios are placed in the same request queue , io manager 117 examines the priorities assigned to the ios and issues the ios according to the priorities , with the higher priority ios being processed before lower priority ios . in one embodiment , when an io is issued from a request queue , an event identifier associated with the io is stored . in fig2 , the storage area for request queue 201 is indicated as event id 211 and the storage area for request queue 202 is indicated as event id 212 . upon completion of the io , the event identifier of the io is updated . as a result , an io request that is queued in request queue 201 can detect a completion of an in - flight io that caused it to be queued , and an io request that is queued in request queue 202 can detect a completion of an in - flight io that caused it to be queued . in the example shown in fig2 , it is assumed that resource x is targeted in ios requested by threads 1 , 2 , 3 and resource y is targeted in ios requested by threads m , n . also , resource x is assumed to be unblocked at time t0 and resource y is assumed to be blocked from time t3 through time t4 . thus , when thread 1 requests io r1 at time t0 , the io is issued right away because resource x is available . in addition , event bd 211 is updated with an event identifier for io r1 . when the io completes , event id 211 is updated with a different value . for purposes of illustrating this embodiment , however , it is assumed that io r1 does not complete by the time io r3 is requested at time t1 and io r2 is requested at time t2 . continuing with the example , when thread 3 requests io r3 at time t1 , the request is added to request queue 201 because resource x is not available . also , when thread 2 requests io r2 at time t2 , the request is added to request queue 201 because resource x is not available . when the io associated with io r1 eventually completes , thread 1 updates the event identifier stored in event id 211 . when threads 2 and 3 detect this update , thread 2 issues io associated with its request ( io r2 ) out of request queue 201 ( assuming no other ios of higher priority have been added to request queue 201 ) and thread 3 is forced to wait again because io r2 has a higher priority than io r3 ( p4 & gt ; p3 ). when thread 2 issues io r2 , it inserts a new event identifier in event id 211 . upon completion of this io , thread 2 updates the event identifier stored in event id 211 . when thread 3 detects this update , thread 3 issues io r3 out of request queue 201 ( assuming no other ios of higher priority have been added to request queue 201 ). when thread 3 issues io r3 , it inserts a new event identifier in event id 211 . upon completion of this io , thread 3 updates the event identifier stored in event id 211 . when thread m requests io rm at time t3 and thread n requests io rn at time t4 , both requests are added to request queue 202 because resource y is not available . when resource y becomes available , thread m issues io rm out of request queue 202 before thread n issues io rn out of request queue 202 . although io rm and io rn have the same priorities , io rm is issued first because it was added to request queue 202 prior to io rn . when thread m issues io rm , it inserts a new event identifier in event id 212 . upon completion of this io , thread m updates the event identifier stored in event id 212 which causes thread n to issue io rn out of request queue 202 ( assuming no other io requests of higher priority have been added to request queue 202 ). fig3 is a flow diagram of method steps for issuing ios according to an embodiment . in the embodiment described herein , the method steps of fig3 are carried out by io manager 117 , in particular the individual threads that are managing ios requested by vms 103 . in this embodiment , the threads place blocking ios requested by vms in appropriate queues if they cannot be executed because another io is concurrently targeting the same storage resource . according to a predetermined schedule , the threads check the availability of the storage resource and issue the ios as the storage resource becomes available . the predetermined schedule may define equally spaced time intervals between the checks or time intervals that are exponentially increasing between the checks . the method shown in fig3 begins at step 302 , with a thread determining whether or not the requested io has a blocking context . if it does not , the io is issued in the normal manner ( step 330 ). if the requested io has a blocking context , the requested io is added to a request queue for a storage resource targeted by the io ( step 304 ). then , at step 306 , the thread determines whether or not the storage resource is available . if the storage resource is not available , a loop counter is updated at step 308 and a timer is set based on the loop counter at step 310 . in one embodiment , the timer is set as a product of the loop counter and a predetermined time interval . for example , the first time through the loop , the timer may be set at x msec and n - th time through the loop as n * x msec . in another embodiment , the timer is set as a product of a multiplier and a predetermined time interval , where the multiplier may be some number raised to the power of the loop counter minus 1 . for example , the first time through the loop , the timer may be set at 2 ^ 0 * x msec and n - th time through the loop as 2 ^( n − 1 )* x msec . at step 312 , the thread waits for the timer to expire and returns to step 306 when the timer expires . returning to step 306 , if the thread determines that the storage resource is available , the thread issues the io at step 316 . then , at step 318 , the io issued at step 316 is removed from the request queue . fig4 is a flow diagram of method steps for issuing ios according to another embodiment . in the embodiment described herein , the method steps of fig4 are carried out by io manager 117 , in particular the individual threads that are managing ios requested by vms 103 . in this embodiment , the threads place blocking ios requested by vms in queues if they cannot be executed because another io is concurrently targeting the same storage resource . when this other io that is concurrently targeting the same storage resource completes , the thread that issued this other io updates an event identifier associated with the queue of the storage resource . upon detecting that this event identifier has been updated , the io request in the queue having the highest priority is executed next . the process repeats in this manner until all io request in the queue are executed . the method shown in fig4 begins at step 402 , with a thread determining whether or not the requested io has a blocking context . if it does not , the io is issued in the normal manner ( step 430 ). if the requested io has a blocking context , the requested io is added to a request queue for a storage resource targeted by the io ( step 404 ). then , at step 406 , the thread determines whether or not the storage resource is available . if the storage resource is not available , at step 408 , the thread tracks an event identifier that has been assigned to the request queue . at steps 410 and 412 , the thread polls the event identifier for updates . if the event identifier has been updated ( indicating that the pending io has completed ), the decision block at step 414 is executed . in this decision block at step 414 , the thread determines whether its io should be issued . in one embodiment , if the thread &# 39 ; s io has been placed in the request queue at the earliest time among the ios having the highest io priority , the thread issues the io and inserts a new event identifier for this request queue ( step 416 ). at step 418 , the io that was issued at step 416 is removed from the request queue . returning to step 414 , if another thread &# 39 ; s io has a higher priority or has the same priority and was placed in the request queue earlier , this other thread &# 39 ; s io is issued , and the method returns to step 408 where the thread tracks for updates the event identifier for this request queue as inserted by this other thread . the inventive features described herein may be applied in non - virtualized embodiments having applications running on top of an operating system and a filter driver implemented on top of a native file system driver of the operating system . the filter driver in such embodiments may be implemented in software or hardware and is configured to expose and manage thinly - provisioned files in a similar manner as the virtual disk in the virtualized embodiments . the various embodiments described herein may employ various computer - implemented operations involving data stored in computer systems . for example , these operations may require physical manipulation of physical quantities — usually , though not necessarily , these quantities may take the form of electrical or magnetic signals , where they or representations of them are capable of being stored , transferred , combined , compared , or otherwise manipulated . further , such manipulations are often referred to in terms , such as producing , identifying , determining , or comparing . any operations described herein that form part of one or more embodiments of the invention may be useful machine operations . in addition , one or more embodiments of the invention also relate to a device or an apparatus for performing these operations . the apparatus may be specially constructed for specific required purposes , or it may be a general purpose computer selectively activated or configured by a computer program stored in the computer . in particular , various general purpose machines may be used with computer programs written in accordance with the teachings herein , or it may be more convenient to construct a more specialized apparatus to perform the required operations . the various embodiments described herein may be practiced with other computer system configurations including hand - held devices , microprocessor systems , microprocessor - based or programmable consumer electronics , minicomputers , mainframe computers , and the like . one or more embodiments of the present invention may be implemented as one or more computer programs or as one or more computer program modules embodied in one or more computer readable media . the term computer readable medium refers to any data storage device that can store data which can thereafter be input to a computer system — computer readable media may be based on any existing or subsequently developed technology for embodying computer programs in a manner that enables them to be read by a computer . examples of a computer readable medium include a hard drive , network attached storage ( nas ), read - only memory , random - access memory ( e . g ., a flash memory device ), a cd ( compact discs )— cd - rom , a cd - r , or a cd - rw , a dvd ( digital versatile disc ), a magnetic tape , and other optical and non - optical data storage devices . the computer readable medium can also be distributed over a network coupled computer system so that the computer readable code is stored and executed in a distributed fashion . although one or more embodiments of the present invention have been described in some detail for clarity of understanding , it will be apparent that certain changes and modifications may be made within the scope of the claims . accordingly , the described embodiments are to be considered as illustrative and not restrictive , and the scope of the claims is not to be limited to details given herein , but may be modified within the scope and equivalents of the claims . in the claims , elements and / or steps do not imply any particular order of operation , unless explicitly stated in the claims . virtualization systems in accordance with the various embodiments , may be implemented as hosted embodiments , non - hosted embodiments or as embodiments that tend to blur distinctions between the two , are all envisioned . furthermore , various virtualization operations may be wholly or partially implemented in hardware . for example , a hardware implementation may employ a look - up table for modification of storage access requests to secure non - disk data . many variations , modifications , additions , and improvements are possible , regardless the degree of virtualization . the virtualization software can therefore include components of a host , console , or guest operating system that performs virtualization functions . plural instances may be provided for components , operations or structures described herein as a single instance . finally , boundaries between various components , operations and data stores are somewhat arbitrary , and particular operations are illustrated in the context of specific illustrative configurations . other allocations of functionality are envisioned and may fall within the scope of the invention ( s ). in general , structures and functionality presented as separate components in exemplary configurations may be implemented as a combined structure or component . similarly , structures and functionality presented as a single component may be implemented as separate components . these and other variations , modifications , additions , and improvements may fall within the scope of the appended claims ( s ).
| 6 |
fig1 shows a wood processor according to the invention , especially a first illustrative example of the arm system and the unit in a lateral view . the arm system contains an outer beam 10 intended to be attached to a vehicle , for example a wood tractor ( not shown ). the arm system is particularly designed to be utilized as a so - called rotator unit at the power take - off of a usual wood tractor , but can also be used for bigger wood processing machines . movably arranged within this outer beam 10 , as an inner beam 12 which supports , at one of its ends , a delimbing head 13 connected to a felling head 14 in the position shown in fig1 . the felling head is attached to the outer beam 10 . an attachment 15 for a double - armed hinge 16a , 16b is arranged at the outer end of the inner beam 12 , one arm hinge 16a being pivotably connected at one of its ends to the attachment 15 and pivotably connected at its other end to the other arm hinge 16b . the other arm hinge 166 is pivotally attached to an attachment 17 at its other end . the attachment 17 is attached to a slide bar 18 sliding on the outer beam 10 . the double - armed hinge 16a , 16b is operated by a hydraulic cylinder 19 which is also attached to the slide bar 18 . an attachment 20 for a second double - armed hinge 21a , 21b is also attached to the slide bar 18 , one arm hinge 21a being pivotably attached at one of its ends to the attachment 20 and pivotably connected with the other arm hinge 21b at its other end . the arm hinge 21b is pivotably connected at its other end to an attachment 22 attached to the outer beam 10 . this second arm hinge 21a , 21b is operated by a second hydraulic cylinder 23 . although not apparent from the figure , a corresponding second arm hinge and second hydraulic cylinder are attached at the other side of the outer beam 10 and the other side of the slide bar 18 . part of the arm system in fig1 is shown in fig2 viz , the outer portion of the arm system , with the difference from fig1 that the unit consisting of delimbing head 13 and felling head 14 is opened to a substantially vertical position to enable felling of standing wood . as is apparent from this figure , a hydraulic cylinder 24 is attached to the outer beam 10 and to the felling head 14 at its other end to enable turning of the felling head 14 together with the delimbing head 13 about a tilt shaft 25 at the outer end of the inner beam 12 . fig3 is a lateral view of the arm system in a position , in which the inner beam 12 has been moved out of the outer beam 10 and , thus , the delimbing head 13 has been separated from the felling head 14 and is spaced from the felling head 14 . the inner beam 12 has been pushed out , in that the hydraulic cylinder 19 has been activated and pushed out its piston rod , which has caused turning of the arm hinge 16b about its turning point in the attachment 17 and consequently a displacemant of the arm hinge 16a which has enforced extraction of the inner beam out of the outer beam . in fig4 a position is shown , in which the other hydraulic cylinder 23 also has been activated and pushed out its piston rod and compelled , in this way , the arm hinge 21b to pivot about its turning point in the attachment 22 , forcing , in this way , the arm hinge 21a to be moved forwards . however , this arm hinge 21a is attached to an attachment 20 on the slide bar 18 , and , in this way , the slide bar 18 has been forced to be moved forwards along the outer beam 10 and move the inner beam 12 further outwards . an intermediate beam 11 arranged between the inner beam 12 and the outer beam 10 also is pushed out of the outer beam 10 . this intermediate beam 11 has been drawn out of the outer beam 10 , in that it has been carried along by the inner beam 12 when this has reached its furthest pushed - out position relative to the intermediate beam 11 . the intermediate beam 11 can then be arranged to be brought along into the outer beam 10 upon retraction of the inner beam 12 , when the inner beam 12 has reached its most pushed - in position relative to the intermediate beam 11 . fig5 shows the outer end of the inner beam 12 with the attachment 15 of one arm hinge ( 16a ) and with an attachment 26 at its underside to receive the delimbing head and turning thereof about the tilt shaft 25 . as is apparent from fig5 a locking plate 27 is also attached to the underside of the outer beam 12 . the locking plate 27 has a hole 28 for securing the delimbing head to the beam 12 when the beam 12 is pushed out of the outer beam 10 . this is described in greater detail below . fig6 shows a section of the inner beam 12 according to the arrows vi -- vi on fig5 . fig7 is a view corresponding to fig5 but of the end of the outer beam 10 . this end of the outer beam supports a mounting clamp 29 for the felling head ( not shown in this figure ). as is apparent from fig7 the mounting clamp 29 projects in the longitudinal direction of the beam 10 , past the end of the beam , and has a hole 30 for attachment of a pivot pin for the suspension of the felling head . the projection of the mounting clamp 29 past the end of the beam 10 is so adapted that the center of the hole 30 coincides with the center of the attachment 26 of the delimbing head , so that the tilt shaft 25 of the felling head and that of the delimbing head coincide . for illustrative purposes , this mounting clamp 29 has been omitted in fig1 - 4 , because it would otherwise hide other essential parts . in fig8 a section according to the arrows viii -- viii in fig7 is shown , from which it is apparent that the mounting clamp also projects from the side of the outer beam 10 to leave a sufficient space between its two arm ends in order that the delimbing head and the felling head might pass therebetween . fig9 is an end view of the slide bar 18 , from which it is apparent that the slide bar comprises a supporting surface which is inwardly flanged at its ends to engage flanges 31 projecting on both sides of the outer beam 10 , as is apparent from fig1 and 11 . the slide bar supports attachments 17 and 20 for the arm hinges 16b and 21a , respectively . thus , the slide bar is movable in the longitudinal direction of the outer beam , 10 and is guided along the beam in that its ends are folded around the flanges 31 projecting sidewise from the beam . fig1 and 13 are lateral and end views , respectively , of the delimbing head 13 carrying gripping claws 32 which are arranged at the same time to delimit a tree - trunk upon displacement of the delimbing head . the delimbing head 13 has a circular recess 33 located substantially centrally , and , in parallel with this recess 33 , a smaller hole 34 extends receiving a locking pin 35 . at one of its ends , this locking pin projects over the edge of the delimbing head 13 to project into the locking plate 27 when the delimbing head is in the position shown in fig3 and 4 . in the hole 34 , the locking pin 35 is spring biased to enter this position when not actuated by other forces , the locking pin projecting out of the delimbing head . at its other end , the locking pin is bent with substantially two right angles and projects with an end surface 36 into the recess 33 . this end surface 36 and its bending are made to be able to displace the locking pin 35 out of engagement with the locking plate 27 and into the delimbing head upon insertion of an actuating means into the recess . fig1 and 16 are a lateral view and an end view , respectively , of the felling head 14 . the felling head 14 , also , supports gripping claws 37 and a cutter which , however , is not shown in the drawings . the felling head 14 has attaching arms 38 which have through holes 39 at their ends , in which pins can be attached to connect the attaching arms 38 and , consequently , the felling head 14 with the mounting clamp 29 , in that the pin passes through the holes 30 in the mounting clamp . the felling head has a substantially circular projection 40 projecting in parallel with the attaching arms and somewhat beneath these . the projection 40 is arranged to project into the recess 33 in the delimbing head 13 when the beams have been moved to the position shown in fig1 and 2 . when the projection is introduced into the recess 33 in the delimbing head , the projection 40 will press the end surface 36 further into the recess and move , in this way the locking pin 35 out of engagement with the locking plate 27 . by this movement , the delimbing head 13 is then connected to the felling head 14 and can be turned around the tilt shaft 25 when the felling head is actuated by the hydraulic cylinder 24 . although not shown in fig1 and 16 , the felling head 14 is also provided with an attachment for attaching the piston rod of the hydraulic cylinder 24 , as is apparent from fig1 and 2 . the elements described herein as attachments are shown including respective ear - like flanges mounted on the respective parts , and having openings for respective pins for pivotally securing the respective other elements to the elements on which the ear - like flanges are mounted . the elements described herein as arm hinges are , perhaps , more accurately thought of as being hinge arms . by the arrangements according to the invention , a relatively simple and easily - operable unit consisting of a delimbing head and a felling head has been achieved , which can be easily opened to the position shown in fig2 for felling standing wood . felling is then carried out by means of the cutter mentioned above , but not shown in the drawing , which can be of a type usual with wood processors and , for example , a hydraulically - operated chain saw . when a tree is to be felled , the wood processor is driven up to the tree with the arm system in the position shown in fig1 with the end provided with the delimbing head 13 and felling head 14 close to the tree to be felled . the hydraulic cylinder 24 is thereafter activated to lower the felling head 14 and the delimbing head 13 to the position shown in fig2 after which the gripping claws of these two units grab the tree - trunk in a conventional manner and the cutter saws off the tree . after this , the tree is felled , in that the hydraulic cylinder 24 retracts its piston rod and folds - up the felling head 14 back to the position shown in fig1 . when the felling head thereafter has returned to the position shown in fig1 the gripping claws 32 of the delimbing head will loosen their grip somewhat and the tree - trunk is held fast merely by the gripping claws 37 on the felling head 14 . the hydraulic cylinder 19 is thereafter activated and actuates the double - armed hinge 16a , 16b , pushing out the inner beam 12 and , consequently , the delimbing head 13 away from the felling head . the delimbing head 13 , moving along the tree - trunk , and the gripping claws 32 , running loosely against the tree - trunk , will then delimb the tree - trunk , and in dependence on the desired length of the trunk , the other hydraulic cylinder 23 can also be activated when the inner beam 12 has been pushed out , in order to also push out the intermediate beam 11 to the position shown in fig4 by the displacement of the slide bar 18 . when the intended length of the tree - trunk has been reached , corresponding to the distance between the delimbing head 13 and the felling head 14 , the gripping claws 32 of the delimbing head 13 will again grab firmly around the tree - trunk , while the gripping claws 37 of the felling head 14 will loosen their grip somewhat , after which the hydraulic cylinders 19 and 23 , respectively , are again activated to draw - in the beams 11 and 12 to the position shown in fig1 . when this has been attained , the saw in the felling head 14 is activated to cut - off the tree - trunk and a new delimbing process can next be carried out . fig1 shows a illustrative example of an arm system for a wood processor according to the invention . in this design , the arm system is composed of merely two arms , an outer beam 50 which at one of its ends is intended to be attached to a wood tractor and receives displaceably in itself an inner beam 51 which receives a delimbing head 13 at its outer end . the outer beam 50 carries a felling head 14 . the delimbing head 13 and the felling head 14 are of the same design as described in connection with the first illustrative example , however with the single essential difference that the felling head 14 in connection with the second illustrative example is attached to a traveling carriage 52 which is movable along the outer beam 50 . the traveling carriage 52 can preferably run by means of rollers 53 on the upper side of the outer beam . as in the first illustrative example , the felling head 14 can be opened to a substantially vertical position by means of a hydraulic cylinder 24 attached to the traveling carriage 52 . in order that the inner beam 51 might be pushed out of the outer beam 50 for extension of the arm system , an hydraulic cylinder 54 is arranged within the outer beam 50 and attached to each beam 50 , 51 by one attaching point . at both ends of the outer beam 50 , chain wheels 55 , 56 are arranged for control of chains 57 , 58 , which are attached at their one ends to the inner beam 51 and at their other ends to the traveling carriage 52 in such a way that the carriage moves on the outer beam 50 in a opposite direction relative to the inner beam 51 . by this embodiment of the arm system , a very simple and easy construction is obtained which can be carried even by small tractors .
| 0 |
a first embodiment of a pumping chamber for a micropump according to the invention will be described with reference to fig1 a , 1b , and 2 . this pumping chamber is determined by the wafers 2 , 4 sealed to each other , for example by anodic welding or by adhesion . these wafers are generally of the order of a few tenths of a millimeter thick . the cavity 6 defining the pumping chamber as well as an inlet channel 8 and an outlet channel 10 are obtained by etching the wafer 2 using conventional photolithographic techniques , such as wet etching . the diameter of the cavity is of the order of 1 cm and it is between 5 and 200 micrometers high . the wafer 2 is of a material which can be easily etched , such as monocrystalline silicon ; the wafer 4 is for example of glass . a control element such as , for example , a piezoelectric disc 12 is bonded to the outside face of the wafer 4 at the level of the cavity 6 . each face of this piezoelectric disc is covered by an electrode connected to a source of potential ( not shown ). fig1 a and 2 respectively illustrate the position of the wafer 4 in which no electrical potential is applied to the piezoelectric disc 12 ( first position ) or in which an electrical potential is applied to this piezoelectric disc ( second position ). according to the invention the pumping chamber is provided with a stop 14 which , in limiting the amplitude of the movement of the flexible wall 13 of the wafer 4 , precisely defines the second position of this flexible wall . as a result , the volume of the pumping chamber at the end of the delivery operation , i . e . when the flexible wall 13 is in the second position , has a value that is precisely definable and reproducible . when the flexible wall is in the first position the distance between the stop and the opposing wall of the chamber is of the order of 10 μm or less . this distance clearly depends on the dimensions of the pumping chamber and on the fluid output desired in the embodiment shown in fig1 a , 1b and 2 , the piezoelectric disc 12 is fixed to the glass wafer 4 . it is of course possible to fix the piezoelectric disc 12 onto the silicon wafer 2 . a pumping chamber of this type is shown in section along the line iii -- iii and in plan view in fig3 a and 3b respectively . in these figures the elements identical to those shown in fig1 a , 1b and 2 have the same reference numerals . when the silicon wafer 2 supports the piezoelectric disc 12 , a layer 16 of sio 2 is interposed between the disc 2 and the piezoelectric disc 12 for purposes of electrical insulation . finally , it should be noted that , in this embodiment , the diameter of the stop 14 must be substantially lower than that of the piezoelectric disc so as not to excessively restrict the flexibility of the wafer 2 . in the two first described embodiments , the stop 14 is composed of a stop which extends from one wall of the pumping chamber . this projection is provided in the silicon wafer 2 during the etching of the cavity and of the inlet and outlet channels the upper surface 18 of the projection , against which the opposing wall of the pumping chamber impinges when the piezoelectric disc is subjected to an electrical potential is preferably planar . this makes it possible to define the second position of the flexible wall more precisely . it is also possible to use the bottom of the cavity itself as the stop . this is the case when a cavity is provided , the height of which is equal to the desired amplitude of movement of the flexible wall . fig4 and 5 show transverse sections through a pumping chamber of this kind in the first and second positions respectively of the flexible wafer 4 . in these figures , the pumping chamber is defined by a cavity 6 linked to an inlet channel 8 and an outlet channel ( not shown ). this pumping chamber is composed of a silicon wafer 2 and a glass wafer 4 as in the previous figures . the piezoelectric disc is disposed on the glass wafer 4 ; this wafer 12 may of course also be disposed on the silicon disc 2 , as in fig3 a and 3b . the advantage of using the bottom 20 of the cavity 6 as a stop for the flexible wall is that it reduces the number of operations needed to etch the silicon wafer 2 in comparison to the previous embodiments in which the stop is composed of a projection . moreover , as shown in fig5 the volume of the chamber at the end of the delivery phase is very small . this ensures effective pumping , even if the liquid contains many gas bubbles ( provided the parasite volume between the valves and the chamber itself is also very small ). on the other hand , if the volume of the pumping chamber remains relatively large at the end of the delivery phase , and this is generally the case when the stop is a projection , the gas bubbles can be compressed without being expelled from the pumping chamber . in contradistinction it should be noted that the resistance to fluid flow is greater with a pumping chamber as shown in fig4 which is thus particularly suitable for very low output micropumps . one embodiment of a micropump of the invention is shown in section along the line vi -- vi and in plan view in fig6 a and 6b respectively . this micropump mainly comprises a silicon wafer 22 disposed between glass wafers 24 and 26 . the wafer 22 is etched on one face to form a cavity 28 defining the pumping chamber and on the other face to regulate the thickness of the part of the wafer 22 which constitutes the flexible wall 30 of the pumping chamber . this thickness is for example 150 μm . the two faces of the wafer 22 are in addition engraved to form a membrane 32 and an annular rib 34 of an inlet valve , a membrane 36 and an annular rib 38 of an outlet valve , and an inlet channel 40a , 40b and an outlet channel 42a , 42b . to prevent the valves adhering to the glass wafers , the former are covered with a fine layer 35 , 39 of sio 2 . the piezoelectric disc 44 which controls the movement of the flexible wall 30 is bonded using cyano acrylate glue after the flexible wall has been covered with a fine layer 46 of sio 2 to provide electrical insulation . the piezoelectric disc 44 can be of the pxe - 5 type , manufactured by philips , 10 mm in diameter and 0 . 20 mm thick . since the flexible wall 30 and the membranes 32 , 36 are formed in the silicon wafer 22 , the latter is preferably a wafer of monocrystalline silicon of & lt ; 100 & gt ; orientation with good mechanical properties and which is very suitable for etching . this disc can be 5 cm in diameter and be of the order of 300 micrometers thick . the wafers 24 and 26 are of polished glass . they are 5 cm in diameter and 1 mm thick . the wafer 24 is pierced by an inlet hole 48 and an outlet hole 50 . the wafers 24 and 26 are sealed to the wafer 22 using the technique known as anodic welding . in the embodiment shown in fig6 a and 6b , the height of the pumping chamber , that is the distance between the flexible wall 30 and the wafer 26 when no electrical potential is applied to the piezoelectric disc 44 , is selected ( during etching of the wafer 22 ) so that the stop is formed by the surface of the wafer 26 . the pumping chamber is thus similar to that described with reference to fig4 and 5 , the only difference being that the piezoelectric disc is fixed onto the silicon wafer instead of onto the glass wafer . fig7 a and 7b respectively show a section along the line vii -- vii and a plan view of a micropump according to another embodiment of the invention . this micropump is more compact than the micropump shown in fig6 a and 6b . this is achieved by placing the inlet valve of the micropump directly onto one of the walls of the pumping chamber . it would be possible also to place a part of the outlet valve thereon . this micropump is composed of a silicon wafer 52 disposed between two glass wafers 54 and 56 . one face of the wafer 52 is etched to form a cavity 58 , defining the pumping chamber and during this etching operation a projection 60 is formed to constitute a stop according to the invention . the two faces of the silicon wafer 52 are also etched to form a membrane 62 and an annular rib 64 of an inlet valve , and an inlet channel 70 and an outlet channel 72a , 72b . layers 65 , 67 of sio 2 are formed on the annular ribs 64 , 68 to prevent the valves adhering to the glass wafers . the inlet valve is preferably centered on the cavity 58 . in this case , the projection 60 , also centered in relation to the cavity 58 and to the inlet valve , is in the form of a ring . the valves can be provided with an amplitude limiter to reduce the risk of breakage of the membrane . in the case of the outlet valve , this limiter is composed of an annular rib 69 ; in the case of the inlet valve , it is the projection 60 which acts as the limiter . channels 71 , 73 are preferably provided in the amplitude limiters of the valves to permit flow of liquid when these limiters are in contact with the glass wafers 54 , 56 . after the etching operations , the glass wafers 54 and 56 are sealed by anodic welding to the silicon wafer 52 , the glass wafer 54 being provided with an inlet opening 74 and an outlet opening 76 . the flexible wall 78 of the pumping chamber is composed of part of the glass wafer 56 ; its thickness is of the order of 200 μm . a piezoelectric disc 80 is bonded to this wall 78 to control its movement . in accordance with the invention the annular projection 60 limits the amplitude of movement of the flexible wall which makes it possible to precisely define the volume of the pumping chamber at the end of the delivery operation . this stop also makes it possible to keep the output of the micropump constant under normal use . as may be seen from the diagram of fig8 the output 0 of a conventional two - valve micropump is a linear function of the pressure p prevailing at the outlet of the micropump ( curve a ). in contrast , the output 0 of a micropump of the invention is substantially constant in the normal operating pressure range ( curve b ). this is because , for a pressure below the maximum operating pressure , the variation in volume caused by displacement of the flexible wall is limited . the output is thus virtually the same as that corresponding to the maximum operating pressure .
| 5 |
fig1 presents a typical application of the preferred embodiment of this invention . in that application , a missile 10 with folded tail fins 12 is launched from an aircraft weapons bay along guide rails 14 . fixed fins 15 are not involved with this invention although any number of folded fins can be accommodated by the invention , with minor modifications . launch is initiated by means not part of this invention but which might be explosive bolts , solenoid actuated pin retractors or any suitable device used to separate the missile from its carrier tie down or securement position . at initiation of launch , a forcing function device such as hydraulic or pneumatic plunger system 16 , imparts vertical velocity to the missile proper . travel of missile 10 is controlled by guide rails 14 along either side thereof . at the aft end of the weapons bay , fixed to aircraft structure , is the slotted deployment mechanism 20 of this invention . mechanism 20 comprises a rigid plate 18 of metal or plastic , with curved or slanted slots 22 cut therein . slot 22 can be designed with an initial vertical section 24 followed by arcs of curvature or straight slanted sides 26 of a given character . for most launcher configurations , slot 22 will be of the j - type , with a mechanical blocking switch 28 located at , or slightly above , its maximum horizontal width point 30 . missile 10 is stowed in the bay with control fins 12 folded . figures herein show a missile with two of its four fins folded , but variations of this invention can deploy one folded fin or as many thereof as can be accommodated by separate j - slots . each of folded fins 12 has a pin 34 affixed at a position along the trailing edge of hinged section 36 . pin 34 follows slot 22 in base plate 18 by reason of forces exerted by edges 26 thereon as missile 10 drops vertically between rails 14 . at the point of maximum outboard horizontal excursion 30 of pin 34 , folded portion 36 of fin 12 will be horizontal , and this point is selectable by design , based on stress analysis of pin and fin structure and dynamics of the launch environment . as pin 34 passes inflection point 30 , it changes direction of its horizontal excursion and continues to force folded fin portion 36 into alignment with fixed portion 42 thereof . as pin 34 passes inflection point 30 , a mechanical switch 28 is activated , whereby pin 34 depresses its spring restrained lever arm 38 . lever arm 38 of switch 28 has spring 46 urging it upwards to a position across slot 22 . when pin 34 has passed over lever arm 38 , spring 46 urges the arm upwards and brings surface 48 across slot 22 , effectively blocking return travel of pin 34 . switch 28 has lever arm 38 pivoted at axle 54 and urged upwardly by spring 46 fixed to axle 50 of spring housing 52 . axles 50 and 54 are fixed to base plate 18 . spring 46 tension can be nominally small since its primary purpose is to bring surface 48 of lever arm 38 upwards across slot 22 . when folded surfaces 12 have been deployed , a variety of means , not part of this invention , can be used to secure them there . spring loaded pins riding on ridges of the folded portion can be caused to seat themselves in sockets of the folded portion and a variety of other securement devices can be employed to insure stability of the deployed surface . with fins 12 fully extended , missile 10 continues its vertical travel , with pins 34 moving down the slot &# 39 ; s second vertical section 44 .
| 5 |
aspects of the present invention relate to predictive text used by electronic messagers , such as mobile phones . in accordance with the present invention , a user &# 39 ; s messager maintains a user message profile . the user message profile includes information about incoming and outgoing message histories for each of the user &# 39 ; s contacts . the user profile also includes the user &# 39 ; s personal data , including inter alia the user &# 39 ; s contact names , items in the user &# 39 ; s scheduler , and files and file names in the messager &# 39 ; s file system . reference is now made to fig1 , which is a simplified block diagram of an electronic messager 100 with a predictive text editor , in accordance with an embodiment of the present invention . messager 100 is used for receiving incoming messages , for sending outgoing messages , and for composing messages . as such , messager 100 includes a receiver 110 , a transmitter 120 , a key pad 130 for inputting characters when composing a message , and a display 140 for displaying received messages , sent messages , and messages being composed . messager 100 includes a text editor 150 for composing messages . many compact messagers have limited space for only a small key pad 130 for inputting characters . as a trade - off for the compactness of key pad 130 , several button presses are often required to input a single character , which is cumbersome . a user may spend several minutes composing , a short message of 10 - 20 words . to speed up the process of composing messages , messager 100 includes a text predictor 160 , which predicts words and phrases based on characters that were input . for example , if a user has input the characters r - e - a , then text predictor 160 may provide a list of predicted words and phrases the user can select from to complete the characters , including inter alia “ reach ”, “ react ”, “ read ”, “ ready ”, “ rear ” and “ really ”. the user can select one of the words in the list and thereby accelerate composing his message . in general , text predictor 160 receives a character string as input and produces on - the - fly a list of predicted words and phrases as output . conventional text predictors 160 use dictionaries to generate the list of predicted words and phrases . in accordance with the present invention , text predictor 160 predicts its words and phrases from a user message profile 170 generated and maintained in a storage unit of messager 100 . user message profile 170 includes a data structure , such as the tree data structure described hereinbelow with reference to fig4 , used by text predictor 160 to generate its output list . user message profile 170 is generated and maintained by a data manager 180 . data manager 180 regularly updates the data structure of user message profile 170 dynamically , based on incoming and outgoing messages that the user has received and sent , respectively . data manager 180 may also update message profile 170 based on personal user information , such as a list of the user &# 39 ; s contacts , the contents of a user &# 39 ; s scheduler , and user files stored within messager 100 . implementation details for text predictor 160 are described hereinbelow with reference to fig4 . when the user is composing a message to a designated recipient contact , text predictor 160 bases its predictions on messages in user message profile 170 that were received from the designated contact and on messages that were sent to the designated contact , if such messages exist . if the user is composing a message to a new contact then user message profile 170 does not contain a history of messages for the new contact , and text predictor 160 bases its predictions on general messages in user message profile 170 . it will be appreciated by those skilled in the art that the data structure stored in user message profile 170 may also be populated by words detected in speech during a conversation between the user and a user &# 39 ; s contact . speech - to - text conversion is used to convert voice to text . words extracted from the converted text are then added to user message profile 170 . such speech - to - text conversion may be performed by a speech - to - text convertor component within messager 100 ( not shown in fig1 ), or via a service provided by an application server . an example of such a service is the mobile speech - to - text interface available at http :// www . jott . com . when the user is replying to a message received from a contact , text predictor 160 derives its predictions based on the contents of the received message . a text parser 190 identifies special words , phrases and questions in the received message , and text predictor 160 uses these results to present the user with reply text he can choose from . for example , if text parser 190 identifies a question beginning with “ where ” in the received message , then text predictor 160 retrieves data from the user &# 39 ; s scheduler . thus , if the user responds to a message beginning with “ where ” while the user is in a meeting that is posted in the user &# 39 ; s scheduler as , subject : meeting with john location : my office start - time : wed oct . 17 , 2007 8 : 00 am end - time : wed oct . 17 , 2007 9 : 00 am then the predicted response takes the form “ i am in a meeting with john in my office between 8 : 00 am and 9 : 00 am .” alternative , if text parser 190 identifies a question beginning with “ where ” in the received message , then text predictor 160 presents a list of locations that user can choose from , including his home , his office and his physical location as determined by a gps unit , in case massager 100 contains a gps unit ( not shown ). if text parser 190 identifies a question beginning with “ who ” in the received message , then text predictor 160 presents a list of people the user can choose from , including his contacts . if text parser 190 identifies a question beginning with “ when ” in the received message , then text predictor 160 presents text beginning with “ at . . . ”, and if the user chooses this text then text editor 150 automatically switches into a numeric input mode . if text parser 190 identifies a question beginning with “ why ” in the received message , then text predictor 160 presents a text reply beginning with “ since . . . ” or “ because . . . ” if text parser 190 identifies a phone number in the received message , then text editor 150 enables the user to edit , save or dial the identified phone number . if text parser 190 identifies a special phrase , such as “ how are you ?” in the received message , text predict 160 presents text replies beginning with “ i &# 39 ; m fine ”, “ i &# 39 ; m doing well ” and “ i &# 39 ; m tired ” that the user can choose from . reference is now made to fig2 , which is a simplified flow chart of a method for text prediction when composing a new message , in accordance with an embodiment of the present invention . at step 210 a user initiates a new message to a recipient contact , using a message editor . at step 220 a determination is made whether the user &# 39 ; s new message is the first message the user is writing to the recipient contact . if not , then at step 231 the message editor predicts text patterns based on words in the user &# 39 ; s message history for the recipient contact . the predicted text may be based on the most recent message sent or received from this contact , or may be based on frequencies of word occurrences in the user &# 39 ; s overall message history for the recipient contact , or both . for example , if a first word was used 10 times , but not recently , and a second word was used 5 times and recently , then based on most recent , the second word is predicted , and based on most frequent , the first word is predicted . based on both most recent and most frequent , a score based on these two factors is derived and the first word or the second word is predicted in accordance with their respective scores . if the user &# 39 ; s new message is the first message the user is writing to the recipient contact , as determined an at step 220 , then at step 232 the message editor predicts text patterns based on word frequencies in the user &# 39 ; s general message history . implementation details for steps 231 and 232 are described hereinbelow with reference to fig4 . at step 240 the user sends his new message , and at step 250 information about the sent message is added to the user &# 39 ; s message profile for reference when subsequently predicting text . reference is now made to fig3 , which is a simplified flow chart of a method for text prediction when composing a reply message , in accordance with an embodiment of the present invention . at step 310 a user receives a message on his mobile phone , from one of his contacts . at step 320 the user initiates a new message as a reply to the message he received at step 310 , using a message editor . at step 330 the message received at step 310 is parsed for the presence of questions that begin with “ wh ”. in fact , because of their short lengths , many short messages such as sms messages include questions that begin with “ where ”, “ who ”, “ when ” and “ why ”. depending on the outcome of step 330 , processing proceeds to one of the pairs of steps 341 and 351 , 342 and 352 , etc . if the message received at step 310 contains a question that begins with “ where ”, as determined at step 341 , then at step 351 the message editor offers a list of locations the user can choose from , including inter alia the user &# 39 ; s home , the user &# 39 ; s workplace , and the user &# 39 ; s location as determined by gps information . alternatively , as described hereinabove , the message editor may generate a response based on the user &# 39 ; s scheduler . if the message received at step 310 contains a question that begins with “ who ”, as determined at step 342 , then at step 352 the message editor offers a list of people the user can choose from , including inter alia the user &# 39 ; s contacts . if the message received at step 310 contains a question that begins with “ when ”, as determined at step 343 , then at step 353 the message editor offers to begin the reply message with “ at . . . ”, and the characters are automatically switched to numerical mode . if the message received at step 310 contains a question that begins with “ why ”, as determined at step 344 , then at step 354 the message editor offers to begin the reply message with “ because . . . ”. if the message received at step 310 contains a phone number , as determined at step 345 , then at step 355 the message editor offers to save , edit or dial the identified phone number . if the message received at step 310 contains a special phrase , as determined at step 346 , then at step 356 the message editor offers to formulate the reply according to pre - defined options . for example , if the incoming message contains the phrase “ how are you ?”, then possible replies may include “ i &# 39 ; m fine , thanks ” and “ i &# 39 ; m tired ”. if the incoming message contains a yes / no question , then possible replies may include “ yes ”, “ no ” and “ perhaps ”. at step 360 the user sends the reply message that he composed , and at step 370 information about the sent message is added to the user &# 39 ; s message profile . reference is now made to fig4 , which is a simplified illustration of a data structure for predicting text , in accordance with an embodiment of the present invention . the data structure shown in fig4 is stored in user message profile 170 of fig1 , and such a data structure is generated and maintained by data manager 180 for each one of a user &# 39 ; s contacts . the data structure includes a tree 410 whose nodes 420 contain alphabetically left - to - right sorted character strings , where a parent node is a prefix of its child nodes . the root 430 of tree 410 is the character string “ c ”, although it will be appreciated by those skilled in the art that “ c ” may itself be a child node , together with siblings “ a ”, “ b ”, “ d ”, etc ., of a parent node corresponding to an empty character string . conversely , node 430 may not be present , and tree 410 may include three trees with respective root nodes “ ca ”, “ ch ”, “ cl ”. in addition to its character string , within each node 420 of tree 410 is also stored a linked list 440 corresponding to those words that have that character string as their prefix . each linked list 440 includes words and their frequencies of use with the specific user &# 39 ; s contact for whom the data structure is associated with . the linked lists 440 are ordered based on frequency of use . data manager 180 is responsible for generating and maintaining tree 410 and linked lists 440 , and for dynamically updating them when new messages are sent and received to and from the specific user &# 39 ; s contact , respectively , and new words and frequencies are derived therefrom . when a word &# 39 ; s frequency of use changes , or when a new word is added , data manager updates tree 410 and its linked lists 440 accordingly . as mentioned hereinabove with reference to fig1 , text predictor 160 operates by accepting as input a character string entered by a user , and providing on - the - fly as output a list of predicted words that have the input character string as prefix , the list being sorted according to frequency . using the tree data structure of fig4 , text predictor 160 directly generates the words in the output list from the linked list 440 associated with the input character string . the output list may be empty if the input character string is not a node of tree 410 . conversely , the output list may need to be truncated if the linked list 440 is too large . for example , if text predictor 160 receives the character string “ ca ” as input , then using tree 410 it references the linked list 440 at the node for “ ca ”, and generates as output the ordered list of words ( 1 ) cat , ( 2 ) cable , ( 3 ) car , ( 4 ) camel . in case the output list is limited to three words , the above list is truncated to ( 1 ) cat , ( 2 ) cable , ( 3 ) car . it will be appreciated by those skilled in the art that linked lists 440 may contain pointers to words stored in memory , instead of the words themselves . the data structure of fig4 is appropriate for frequency - based sorting for the output list . if a sorting based on most recent use is desired , than linked lists 440 store a most recent date & amp ; time of use for each word , instead of a frequency of use . if a sorting based on most frequent and most recent is desired , then linked lists 440 store a score for each word entry , the score being a function of how frequently and how recently a word has been used . it is noted that the data structure of fig4 has redundancy , since each linked list 440 may be derived from the linked list of its parent node . as such , the linked list of root node 430 of tree 410 contains all of the information necessary to generate each of the linked lists of the other nodes of tree 410 . an alternate data structure , instead of the tree structure illustrated in fig4 , is a tabulated dictionary of words sorted in alphabetical order , where each word entry includes a frequency and at least one date & amp ; time of use . as above , text predictor 160 operates by accepting as input a character string entered by a user , and providing as output a list of words that have the input character string as prefix , the list being sorted according to frequency . using this dictionary data structure , text predictor 160 performs a dictionary word look - up and word sort in order to generate its output list . for example , if text predictor 160 receives the character string “ ca ” as input , then using the dictionary it looks - up the words cable , camel , car and cat , and sorts these words according to their frequencies of use ; namely , ( 1 ) cat ( freq = 9 ), ( 2 ) cable ( freq = 7 , ( 3 ) car ( freq = 4 ), ( 4 ) camel ( freq = 1 ). as above , if the output list is limited to three words , the above list is truncated to ( 1 ) cat , ( 2 ) cable , ( 3 ) car . in accordance with the present invention , such a dictionary data structure is generated and maintained for each of the user &# 39 ; s contacts . it will be appreciated by those skilled in the art that storing tree data structures or dictionary data structures for a large number of contacts may require more memory than is available in messager 100 . in such case , a first in first out ( fifo ) policy is implemented to purge the oldest words and profiles in order to accommodate new words and profiles . for example , if a user has 200 contacts and if the average size of a dictionary for the contacts is 10 , 000 entries and if each entry requires 16 bytes of storage , then the required memory is 200 * 10 , 000 * 16 bytes = 32 mb of storage . for messagers that include one or more gbs of memory , the required memory for the dictionaries is approximately 3 % or less of the total capacity . comparing the tree data structure with the dictionary data structure , it will be appreciated that the data structure illustrated in fig4 requires less on - the - fly processing by text predictor 160 , at the expense of storing a lot of redundant data in tree 410 and at the expense of more background processing by data manager 180 to maintain tree 410 and its linked lists 440 . in distinction , the alternative data structure using a dictionary uses less memory and requires less background processing by data manager 180 to maintain the dictionary , at the expense of requiring more on - the - fly processing by text predictor 160 . it will further be appreciated by those skilled in the art that various optimizations may be performed to enhance the performance of text predictor 160 and data manager 180 , for both the tree data structure and the dictionary data structure embodiments . thus , the output list of text predictor 160 may be sorted only relative to the first three characters , say , of the predicted words . such partial sort reduces processing requirements for data manager 180 vis a vis the tree data structure , and for text predictor 160 vis a vis the dictionary data structure . additionally , the entries in the dictionary data structure may be pre - sorted for specific prefixes , thereby reducing on - the - fly processing requirements for text predictor 160 vis a vis the dictionary data structure . the present invention may be embodied as an enhancement to existing text prediction , such as t9 text prediction , by fine - tuning the prediction to each specific user contact . t9 bases its prediction on key strokes . for example , when a user presses on “ 228 ”, predictions such as “ cat ”, “ bat ”, “ act ” are derived , since the “ 2 ” key represents “ a ”, “ b ” and “ c ”, and the “ 8 ” key represents “ t ”, “ u ” and “ v ”. the t9 predictions may also include words that have prefixes that correspond to “ 228 ”, such as “ cats ”, “ bats ”, “ actor ”, “ acting ”. the predictions are sorted by frequency of use . the present invention enhances t9 prediction inter alia by generating and sorting predictions according to frequencies of use for a specific user contact . the present invention may also be embodied as a stand - alone text predictor . in distinction to t9 , when the present invention is embodied as a stand - alone predictor , predictions are based on characters that are input , instead of key strokes per se . for example , when a user presses on “ 222 - 2 ”, for example , corresponding to “ c - a ”, predictions include words that have “ ca ” as prefix , such as “ cat ”, “ cable ”, “ car ”, “ camel ”, as in fig4 . in reading the above description , persons skilled in the art will realize that there are many apparent variations that can be applied to the methods and systems described . although the present invention has been described with reference to text messages , such as short message service ( sms ) messages , it also applies to other modes of communication , including inter alia e - mail messages and multi - media messaging service ( mms ) messages . the data structure in fig4 may integrate combined usage histories , sms / e - mail / mms , for each user contact . alternatively , separate data structures may be generated and maintained for each mode of communication , namely , an sms usage history , an e - mail usage history and an mms usage history ; for each user contact . in the foregoing specification , the invention has been described with reference to specific exemplary embodiments thereof . it will ; however , be evident that various modifications and changes may be made to the specific exemplary embodiments without departing from the broader spirit and scope of the invention as set forth in the appended claims . accordingly , the specification and drawings are to be regarded in an illustrative rather than a restrictive sense .
| 8 |
certain terminology will be used in the following description for convenience in reference only and will not be limiting . the words “ up ”, “ down ”, “ right ” and “ left ” will designate directions in the drawings to which reference is made . the words “ in ” and “ out ” will refer to directions toward and away from , respectively , the geometric center of the device and designated parts thereof . such terminology will include derivatives and words of similar import . in the drawings , only a fragment of a birthing bed 10 has been illustrated , namely , that part of the bed 10 having a mattress section 11 upon which the birthing mother sits with her legs extending beyond the right edge 12 thereof . if desired , another mattress surface can be provided to the right of the mattress section 11 and therebelow so that the feet of the birthing mother can rest thereon . the mattress section 11 is supported on a mattress frame 13 which in turn is elevatably supported on a main frame 14 . the mechanism for elevating the mattress frame 13 up and down in relation to the main frame 14 is well known in the art and , accordingly , a further detailed discussion thereof is believed unnecessary . a labor grip mechanism 15 is mounted on both lateral sides of the main frame 14 as shown in fig6 and both labor grip mechanisms are the mirror image of each other and include a post 16 having a free end section 17 and a hand grip 18 mounted at the aforesaid free end 17 . for purposes of simplifying this disclosure , only one labor grip mechanism is shown in the drawings and will be described in detail . in this particular embodiment , the post 16 is an elongate rod - like member having a first section 19 and a second section 21 forming an angle θ ( fig3 ) formed therebetween . the handle 18 is a continuation of the rod - like member and is bent at a 90 ° angle with respect to the section 21 . a protective member 22 is secured to the free end of the pipe section , namely , the handle 18 . the labor grip mechanism 15 further includes an elongate straight rod section 23 connected at a right angle to the rod section 19 . the straight section 23 is supported in a guide opening 24 provided on the main frame 14 , which guide opening guides the straight section 23 between a first position thereof illustrated in fig1 and a second position thereof illustrated in fig3 . an additional support mechanism 45 described in more detail below in reference to fig6 is provided for assisting the guiding of the straight section 23 between the aforesaid first and second sections , particularly in order to stabilize the straight section 23 when it is in the second position illustrated in fig3 . a spring 26 is either anchored to the main frame 14 on a side of the birthing bed remote from the side illustrated in fig3 of the drawings and is connected at the other end to the end of the straight section 23 remote from the rod section 19 or is embodied in the additional support mechanism 45 discussed in more detail below . as the straight section is transitioned between the first and second positions , the spring 26 will generate a return force urging the straight section 23 and , consequently , the labor grip mechanism to the first position of the labor grip mechanism illustrated in fig1 . while the spring 26 is illustrated in fig3 as a tension spring , it will be recognized by those of ordinary skill in the art that the straight section 23 can be configured to operate utilizing a compression spring as will be described below with reference to fig6 . as is illustrated in the drawings , the mattress frame 13 includes a cut out section 27 of a sufficient dimension to permit the region of the labor grip mechanism 15 adjacent the juncture between the rod section 19 and the straight section 23 to move therethrough when the labor grip mechanism 15 is transitioning between the first position illustrated in fig1 and the second position illustrated in fig3 . a hand grip positioning bracket 30 is secured by means of a base member 31 to the underside of the mattress frame 13 by means of a plurality of screws ( not illustrated ) received in appropriate holes 32 . an elongate rod 33 is secured to the base member 31 and extends in a direction generally parallel to the straight section 23 . the distal end of the rod 33 terminates adjacent an outer edge 34 of the mattress frame 13 . a reinforcement or bracing member 36 is secured to the base member 31 and the distal end of the rod 33 . the brace 36 also provides a smooth surface between the end thereof adjacent the main frame 14 through to the end thereof adjacent the distal end of the rod 33 . an elongate arm , also known as a cam , 37 is secured to the straight section 23 and is movable therewith in all directions of movement of the straight section 23 . the cam 37 extends radially outwardly from the straight section 23 and a surface 38 thereof is configured to engage the surface of the brace 36 so as to prevent counterclockwise rotation of the labor grip mechanism 15 about an axis defined by the longitudinal axis of the straight section 23 . rotational movements of the labor grip mechanism 15 in the opposite direction , namely , the clockwise direction is prevented by a surface 39 on the cam 37 engaging the undersurface 41 of the mattress frame 13 . the labor grip mechanism 15 is movable between the aforesaid first position thereof illustrated in fig1 and the second position thereof illustrated in fig3 by a simple manual force being applied to the post 16 and pulling outwardly in a direction parallel to the longitudinal axis of the straight section 23 . in the second position , the cam 37 will be oriented between the distal end of the rod 33 and the edge 34 of the mattress frame 13 so that the cam 37 can be moved therebetween by rotating the labor grip mechanism about the longitudinal axis of the straight section 23 . once the cam 37 is moved to a location generally above the rod 33 , the return spring 26 will cause the straight section 23 to retract back into the guide opening 24 to orient the cam 37 on the upper surface of the rod 33 as illustrated in fig4 . the base member 31 forms a stop against which the cam 37 will abut when the cam 37 is oriented above the rod 33 as illustrated in fig4 . the base 31 effectively orients the cam 37 in a position spaced outwardly from the main frame 14 so that the post sections 19 and 21 of the labor grip mechanism 15 are oriented laterally of the mattress frame 13 and mattress 11 mounted thereon . as is illustrated in fig3 the cam 37 has a width x . the spacing between the exterior surface of the rod 33 and the undersurface 41 of the mattress frame 13 is equal to the aforesaid distance x or a slightly greater distance so as to facilitate the receipt of the cam 37 snugly therebetween . this snug orientation of the cam 37 between the exterior surface of the rod 33 and the surface 41 of the mattress frame 13 ( see fig4 ) provides a substantial rigidity to the orientation of the hand grip 18 and will provide a perceived sense of security to the birthing mother to cause her to think that as much force as she wishes to place onto the hand grip 18 will be sufficiently supported . the additional support mechanism or translational device 45 is shown in more detail in fig6 . the additional support mechanism or translational device 45 additionally facilitates simultaneous deployment or stowing of both labor grip mechanisms in response to manual forces applied to only one labor grip mechanism 45 to effect deployment or stowing as described above . more specifically , the additional support mechanism 45 includes a pair of axially spaced hollow bearing members 46 and 47 configured to be fastened to the underside of the mattress frame 13 as schematically represented in fig1 . an elongate housing 48 is provided which has a pair of axially aligned openings 49 and 51 in opposite ends which are configured to be coaxially arranged with the holes in the bearing members 46 and 47 so that the straight sections 23 of each labor grip mechanism is axially slidably and rotatively received in and supported by the bearing members 46 and 47 and extend into the interior 52 of the housing . a pair of toothed racks , only one rack 53 is shown in fig6 are slidably supported in corresponding guides 56 and 57 . each rack 53 is secured to an end of the respective straight section 23 that terminates in the interior of the housing . a compression spring 58 encircles each straight section 23 and is oriented between spring abutments formed by each end wall of the housing 48 and the end of the straight section 23 whereat the toothed rack 53 is secured . the racks 53 are spaced from each other and a pinion gear 59 rotatably supported on the housing 48 is configured so that its teeth schematically illustrated at 61 matingly engage the teeth 62 of each rack . as a result , a pulling force applied to one labor grip mechanism 15 to effect a movement thereof from the first position illustrated in fig1 to the second position illustrated in fig3 will cause the driven rack to rotatively drive the pinion gear 59 and cause a corresponding driven movement of the other rack to effect a corresponding and simultaneously occurring deploying movement of the other labor grip mechanism 15 . the bearing elements 46 and 47 will enable simultaneous rotation of the straight sections 23 between the second position shown in fig3 to the deployed position where the hand grips 18 are oriented above the upper surface of the mattress 11 as well as vice versa . although a particular preferred embodiment of the invention has been disclosed in detail for illustrative purposes , it will be recognized that variations or modifications of the disclosed apparatus , including the rearrangement of parts , lie within the scope of the present invention .
| 0 |
as illustrated in fig1 and 2 , the diving stick of the first preferred embodiment of the invention includes a generally cylindrical or elongated body 1 made of a material having sufficient softness and / or malleability to bend when it encounters a person so as 1 include soft polyvinyl chloride and rubber , although the invention is intended to encompass any material with similar properties of softness and malleability . body 1 of the diving stick is divided into two sections or chambers 2 and 3 , which may be separated from each other by an inwardly extending flange 4 . chamber 2 is arranged to hold a weight 5 and includes an end cap 6 that enables removal of the weight , although those skilled in the art will appreciate that the weight 5 may instead be permanently enclosed within the chamber and the end cap replaced by an end wall of the body 1 . the weight 5 , may for example be of the approximate size and weight of a { fraction ( 3 / 16 )}″× ½ ″ bolt and nut , although the configuration of the weight may be varied depending on the size and desired sink rate of the stick . in order for the diving stick of this embodiment to work , however , the weight must be confined to the end portion of the stick represented by chamber 2 . chamber 3 includes at least two openings , one at each end , to permit flow of air and water . in particular , opening 7 , which is the opening closest to divider 4 of the illustrated embodiment , is arranged to permit ingress of water while openings 8 , of which there are three in the illustrated embodiment are arranged to vent air as water flows into openings 8 . as a result , when the diving stick of this embodiment is initially tossed into a swimming pool or other body of water , it will initially float in a horizontal orientation . because one end is weighted , the end of the diving stick containing the weight will dip sufficiently into the water to cause water to begin to enter opening 7 , as illustrated in fig3 a . as water enters opening 7 , air will be expelled through openings 8 , as illustrated in fig3 b , causing the stick to be filled with water up to the level of the closest of openings 8 to the end of the stick opposite to the weighted end . however , a pocket of air will remain trapped in the end portion of chamber 3 , which will cause the stick to maintain an upright orientation as it sinks and comes to rest on the bottom of the pool , as illustrated in fig3 c . once the diving stick is retrieved from the bottom of the pool , the water will flow out through openings 7 and 8 and the stick will be ready for re - use . in the embodiment illustrated in fig4 the diving stick includes an elongated soft body 10 made of a natural or synthetic , water permeable , cloth or fabric material such as polyester or nylon , filled with a soft stuffing material such as foam or polyfill 11 . again , the invention is intended to encompass any materials having properties of softness and pliability corresponding to the described materials , with softness and pliability being defined by the lack of potential for impalement or serious injury to a diver . in this embodiment , the weight is provided by a mesh or cloth sack 12 filled with sand 13 or a similar material will cause the stick to have a preferred orientation as it sinks . the enlarged end 14 opposite the weighted end helps the stick of this embodiment maintain an upright posture by serving as a reservoir for air trapped in the polyfill stuffing material as water is absorbed through the cloth outer layer 10 . in a modification of this embodiment of the invention , the fabric and polyfill construction of the stick illustrated in fig4 may be replaced by a tube of woven material 15 , as shown in fig5 that is stiff enough to maintain a generally cylindrical shape without stuffing , and that has a weighted end 16 so that the specific gravity of the tube at the weighted end is greater than 1 . this type of tube will sink in the same manner as the conventional diving tube as water enters the tube through the woven material or through openings in the tube , and may optionally include provision for an air pocket at the top to help maintain the upright posture . the material in question is often used in lawn furniture , and also in a novelty device known as the lawyer &# 39 ; s handcuff . although various preferred embodiments of the invention have been described with sufficient particularity to enable a person skilled in the art to make and use the invention without undue experimentation , it will be appreciated that numerous other variations and modifications of the illustrated embodiments , in addition to those already noted above , may be made by those skilled in the art . for example , the diving stick may have a shape other than the generally cylindrical shapes illustrated in the drawings , so long as the sticks are generally elongated so as to have a preferred orientation and so long as the sticks can easily be grasped by a diver . in addition , it is possible that other ways of achieving negative buoyancy could be used without departing from the broadest principle of the invention , which is to make the diving sticks of a soft , malleable material in order to eliminate the risk of impalement . for example , although the illustrated embodiments use discrete weights , the illustrated diving sticks may utilize any construction in which one end has a specific gravity greater than 1 ( the specific gravity of water ) so that the stick will begin to sink and therefore take on enough water to bring the overall specific gravity of the stick to greater than one . each of these variations and modifications , including those not specifically mentioned herein , is intended to be included within the scope of the invention , and thus the description of the invention and the illustrations thereof are not to be taken as limiting , but rather it is intended that the invention should be defined solely by the appended claims .
| 0 |
the terpolymers utilized in the self - emulsifiable resin powders of the present invention are synthesized utilizing a free radical polymerization technique in an aqueous medium . these terpolymers are comprised of repeat units which are derived from three or more different monomers . two of the monomers that are utilized in the preparation of these terpolymers are acrylic acid and methacrylic acid . in addition to the acrylic acid and methacrylic acid monomers , one or more additional copolymerizable monomers are also utilized in the preparation of the terpolymer . in other words , the terpolymers utilized in the powder compositions of the present invention are comprised of repeat units derived from ( 1 ) acrylic acid , ( 2 ) methacrylic acid , and ( 3 ) at least one copolymerizable monomer . the term &# 34 ; copolymerizable monomer &# 34 ; as used herein means any monomer that can be copolymerized with acrylic acid and methacrylic acid . in cases where more than one copolymerizable monomer are utilized it is , of course , necessary for the copolymerizable monomers to be capable of being copolymerized together . these terpolymers will normally contain ( 1 ) from about 0 . 1 to 6 weight percent acrylic acid , ( 2 ) from about 0 . 1 to 4 weight percent methacrylic acid , and ( 3 ) from about 93 to 99 weight percent copolymerizable monomers . technically , these terpolymers contain repeat units ( chain linkages ) which are derived from acrylic acid monomers , methacrylic acid monomers , and one or more copolymerizable monomers . these repeat units differ from the monomers that they were derived from in that they contain one less carbon - carbon double bond than is present in the monomer . in other words , an carbon - carbon double bond is consumed during the polymerization of the monomer into a repeat unit in the polymer . thus , in saying that a polymer contains various monomers in actuality means that it contains repeat units derived from those monomers . preferably the terpolymers utilized in the present invention will have from 0 . 5 to 4 weight percent of their repeat units being derived from acrylic acid and from 0 . 5 to 3 weight percent of their repeat units being derived from methacrylic acid . in any case no more than 7 weight percent of the repeat units in the terpolymer can be derived from acrylic acid , methacrylic acid , and other carboxyl group containing monomers . preferably no more than 5 weight percent of the repeat units in said terpolymers will be derived from acrylic acid , methacrylic acid , and other carboxyl group containing monomers . most preferably from 2 to 4 weight percent of the repeat units in such terpolymers will be derived from acrylic acid and methacrylic acid monomers . generally the only repeat units in such terpolymers that contain carboxyl groups are the repeat units which are derived from the acrylic acid and the methacrylic acid monomers . in other words , normally acrylic acid and methacrylic acid are the only carboxyl group containing monomers that are utilized in the preparation of the terpolymers utilized in the present invention . the terpolymers of the present invention are synthesized in an aqueous reaction mixture by utilizing a free radical polymerization technique . the reaction mixture utilized in this polymerization technique is comprised of water , the appropriate monomers , a suitable initiator , and a metal salt of an alkyl sulfate or a metal salt of an alkyl sulfonate . the reaction mixture utilized in this polymerization technique will normally contain from about 10 to about 80 weight percent monomers , based upon the total weight of the reaction mixture . the reaction mixture will preferably contain from 20 to 70 weight percent monomers and will most preferably contain from 40 to 50 weight percent monomers . the reaction mixtures utilized in carrying out such polymerizations also contain from about 0 . 005 to 1 phm ( parts per hundred parts of monomer by weight ) of at least one member selected from the group consisting of metal salts of alkyl sulfates and metal salts of alkyl sulfonates . preferably from 0 . 008 to 0 . 3 phm and most preferably from 0 . 01 to 0 . 1 phm of a metal salt of an alkyl sulfonate and / or a metal salt of an alkyl sulfate will be utilized in the reaction mixture . the free radical polymerization technique utilized in this synthesis is normally initiated by including a free radical initiator in the reaction mixture . the utilization of a metal persulfate or ammonium persulfate as the initiator works well with potassium persulfate , sodium persulfate , and ammonium persulfate being highly suitable as the initiator . the subject polymerization can be carried out in a batch process , on a semi - continuous basis , or in a continuous process . the polymerization temperature that can be used varies greatly with the type of initiator being employed and with the copolymerizable monomers that are being polymerized . as a general rule the polymerization temperature utilized is from 20 ° c . to 95 ° c . in most cases the polymerization temperature utilized will vary between 60 ° c . and 80 ° c . normally , the polymerization will be continued until a high monomer conversion is attained . the terpolymer emulsion that is produced by this process is therefore comprised of the terpolymer , water , and at least one member selected from the group consisting of metal salts of alkyl sulfonates and metal salts of alkyl sulfates . the amount of initiator employed will vary with the monomers being polymerized and with the desired molecular weight of the terpolymer . however , as a general rule from 0 . 005 to 1 phm of an initiator will be included in the reaction mixture . in the case of metal persulfate initiators most commonly from 0 . 1 to 0 . 5 phm will be utilized . the metal salts of alkyl sulfates and metal salts of alkyl sulfonates that are utilized in the practice of the present invention will generally contain from 1 to 30 carbon atoms in their alkyl group . preferably these salts will have alkyl groups that contain from 8 to 18 carbon atoms and most preferably they will have alkyl groups that contain from 10 to 14 carbon atoms . sodium lauryl sulfate ( dodecyl sodium sulfate ) is a highly preferred metal salt of an alkyl sulfate . the copolymerizable monomers that are utilized in the terpolymers of this invention are selected with the ultimate use of the particular latex being synthesized in mind . most commonly the copolymerizable monomers utilized will be vinylaromatic monomers , acrylate monomers , alkyl acrylate monomers , and / or diene monomers . the vinyl monomers that can be employed will contain at least one vinyl group ( ch 2 ═ ch --). these vinyl monomers generally contain from 2 to 16 carbon atoms . such vinyl monomers can also contain nitrogen , oxygen and / or halogen . some representative examples of vinylaromatic monomers that can be used include styrene , orthomethylstyrene , metamethylstyrene , paramethylstyrene , ethylstyrene , dimethylstyrene , α - methylstyrene , parachlorostyrene , paramethoxystyrene , parachlorostyrene , 2 , 4 - dichlorostyrene , 2 , 5 - dichlorostyrene , parabromostyrene , α - methyl - paramethylstyrene , metaethylstyrene , paraisopropylstyrene , vinylnaphthalene , and the like . the alkyl acrylate monomers that can be utilized have the structural formula : ## str1 ## wherein r represents an alkyl group which contains from 1 to 20 carbon atoms and wherein r &# 39 ; represents a methyl group or a hydrogen atom . preferably the alkyl group in such alkyl acrylate monomers will contain from 1 to 12 carbon atoms . some representative examples of alkyl acrylate monomers that can be utilized include ethylacrylate , propylacrylate , butylacrylate , 2 - ethylhexylacrylate , n - octylacrylate , ethylmethacrylate , propylmethacrylate , butylmethacrylate , 2 - ethylhexylmethacrylate , n - octylmethacrylate , and the like . the diene monomers that can be utilized normally contain from 4 to about 12 carbon atoms . either conjugated diene monomers or nonconjugated diene monomers can be utilized . some representative examples of conjugated diene monomers that can be utilized include isoprene , 1 , 3 - butadiene , piperylene , 1 , 4 - hexadiene , 1 , 3 - heptadiene , 1 , 3 - octadiene , 2 , 4 - hexadiene , 2 , 4 - heptadiene , 2 , 4 - octadiene , 2 , 3 - dimethylbutadiene , 2 , 3 - dimethyl - 1 , 3 - hexadiene , 2 , 3 - dimethyl - 1 , 3 - heptadiene , 2 , 3 - dimethyl - 1 , 3 - octadiene , 2 , 3 - dimethyl - 1 , 3 - nonadiene , and the like . the terpolymers that are used in latices which are used in making surface coatings or paints will preferably be hard resins and have a glass transition temperature of at least 40 ° c . the copolymerizable monomers used in making such terpolymers will be selected with these properties being kept in mind . for example , alkyl methacrylate monomers can be copolymerized into terpolymers in order to increase the glass transition temperature of the terpolymer . on the other hand , use can be made of the ability of alkyl acrylate monomers to plasticize or lower the glass transition temperature of such terpolymers . in other words , by a judicious choice of alkyl acrylate monomers , alkyl methacrylate monomers or mixtures thereof the desired glass transition temperature can be obtained . a terpolymer resin that has good properties for utilization in coatings can be synthesized utilizing as the monomers 43 to 89 weight percent vinylaromatic monomers , 10 to 50 weight percent alkyl acrylate monomers , 0 . 5 to 4 weight percent acrylic acid , and 0 . 5 to 3 weight percent methacrylic acid . it is preferable to utilize from 55 to 78 weight percent vinylaromatic monomers , from 20 to 40 weight percent alkyl acrylate monomers , from 1 to 3 weight percent acrylic acid , and from 0 . 5 to 2 weight percent methacrylic acid in such resins . a preferred vinylaromatic monomer for use in such resins is styrene and the preferred alkyl acrylates are those which have alkyl groups containing from 2 to 6 carbon atoms . butylacrylate is a highly preferred alkyl acrylate for use in such applications . all acrylic resins can be made by sutstituting methyl methacrylate for the vinylaromatic monomer ( styrene ) without substantially changing the glass transition temperature of the resulting resin . the self - emulsifiable resin powder compositions of the present invention can be prepared by simply spray drying a terpolymer emulsion which was made in accordance with the present invention . this spray drying process can be carried out by utilizing conventional equipment which is readily commercially available and techniques which are well known to persons skilled in the art . the self - emulsifiable resin powder compositions which are made in this manner can then be redispersed in water by simply adjusting the ph of the water to above 7 and mixing the resin powder into it with only mild agitation being required . the ph of the water can be adjusted to above 7 by adding to it an organic or inorganic base , such as ammonium hydroxide , sodium hydroxide , potassium hydroxide , monoethanolamine , or the like . a fugitive base is preferred . the ph of the water will most commonly be adjusted to a ph of between 8 and 10 . the reconstituted latices made in accordance with this invention can then be utilized in many applications . for instance , they could be used in making surface coatings , paints , and concrete ( cement ) additives . it is , of course , also possible to use the latices of the present invention in such applications without first drying them into a powder form followed by reconstituting them to latex form by adding water . surface coating compositions or paints made by utilizing the reconstituted latices of the present invention will quite commonly be comprised of ( a ) the terpolymer resin ; ( b ) water ; ( c ) a coalescing agent ; ( d ) a plasticizer ; and ( e ) optionally a wetting or dispersing agent . in general , the use of wetting or dispersing agents is not required since the reconstituted latex acts as a dispersing agent by itself . such surface coatings or paints will also commonly contain a pigment in order to provide the desired color . the amount of coalescing agent and plasticizer needed in such surface coating compositions varies greatly with the type of terpolymer resin being utilized . more specifically , in surface coating compositions that utilize a terpolymer resin with a high glass transition temperature greater amounts of coalescing agents are required than if the terpolymer resin has a low glass transition temperature . in fact , if a terpolymer resin having a glass transition temperature of about 20 ° c . to about 25 ° c . is utilized , then it will probably not be necessary to include a coalescing agent in the surface coating composition . in any case , persons having skill in the art will be able to determine the amount of coalescing agent that is required in order for the surface coating composition to ensure that it provides a continuous film upon drying after application to a surface . compounds that are designed to increase the open time or drying time of the surface coating composition are also commonly utilized in such compositions . the amount of pigment required to produce a desired color will vary greatly with the pigment or combination of pigments being utilized which in turn will influence the gloss and other properties of the final paint film . a typical paint composition can be comprised of 20 to 40 weight percent water , 20 to 40 weight percent of the terpolymer resin of the present invention , 5 to 10 weight percent of a coalescing agent , 1 to 4 weight percent of a plasticizer , and 15 to 35 weight percent of a pigment . butyldiglycol is a coalescing agent that is commonly used in such applications which also acts as a transient plasticizer . white spirits are also commonly used in such compositions as a coalescing agent . propylene glycol is sometimes utilized in such surface coating compositions in an amount ranging from about 1 percent to about 4 percent in order to increase the open time of the surface coating composition . this invention is illustrated by the following examples which are merely for the purpose of illustration and are not to be regarded as limiting the scope of this invention or the manner in which it can be practiced . unless specifically indicated otherwise , all parts and percentages are given by weight . an aqueous reaction mixture was prepared by mixing 67 phm of styrene , 30 phm of butylacrylate , 2 phm of acrylic acid , 1 phm of methacrylic acid , 0 . 6 phm of tertiary - dodecyl mercaptan , 0 . 05 phm of sodium lauryl sulfate , 0 . 8 phm of ammonium persulfate and 200 phm of water in a reaction vessel . the polymerization mixture was allowed to polymerize for 1 hour at 59 ° c . the reaction temperature was then increased to 79 ° c . and the polymerization was allowed to continue for an additional 2 . 5 hours with a terpolymer emulsion being formed . the terpolymer emulsion produced was then spray dried utilizing a buchi 190 mini spray dryer . the spray dryer was operated utilizing an inlet temperature of 90 ° c ., an outlet temperature of 57 ° c . and with the pump , aspirator , and heater settings being 3 , 5 , and 4 . 5 , respectively . a self - emulsifiable resin powder composition was obtained by this procedure . reconstituted latices were prepared by simply shaking equal amounts of the powder composition prepared and water together in bottles . the water utilized in this procedure had a ph of 9 - 10 which was attained by the addition of ammonia . the 50 percent solids latex formed was very stable and after 12 months of standing did not show any signs of destabilization . the procedure utilized in example 1 was repeated in this experiment except that no sodium lauryl sulfate was included in the reaction mixture . in this experiment the powder composition produced could not be reconstituted to form a stable latex . in fact , after the resin powder composition was dispersed in the water phase separation occurred very quickly upon standing . the reconstituted latex prepared in example 1 was utilized in making a white paint . this paint was prepared by mixing 100 parts of the resin powder composition made in example 1 with 100 parts of water , 1 part of surfinol ™ 104 ( a wetting agent and antifoam agent ), 10 parts of propylene glycol , 5 parts of an amine , 10 parts of butyldiglycol , 8 parts of plastilit ™ ( a plasticizer ), 12 . 5 parts of white spirits , and 80 parts of titanium dioxide ( a white pigment ). this paint was prepared with only a moderate amount of agitation being required . in fact , much less mechanical agitation was required in preparing this paint than is normally required using conventional latices in making paints . the white paint made in this experiment exhibited excellent adhesion to steel and aluminum . this paint was also determined to provide a copper plate with excellent protection against oxidation . more specifically , copper surfaces which have been painted utilizing this paint do not quickly turn blue due to oxidation as do copper surfaces which have been painted using conventional water borne paint formulations . while certain representative embodiments have been shown for the purpose of illustrating the invention , it will be apparent to those skilled in this art that various changes and modifications can be made therein without departing from the scope of the invention .
| 2 |
this is a division of ser . no . 09 / 752 , 086 , filed dec . 29 , 2000 . reference should now be made to the drawing figures herein , numbered from 1 to 9 , on which similar or identical elements are given consistent identifying numerals throughout the various figures thereof , and on which parenthetical references to figure numbers direct the reader to the view ( s ) on which the element ( s ) being described is ( are ) best seen , although the element ( s ) may be seen also on other views . [ 0025 ] fig1 illustrates inner elements of a shock - absorbing bicycle seat mount , generally indicated by the reference numeral 200 , constructed to accomodate longitudinal movement of a slotted seat post 210 , onto which bicycle saddle 212 is clamped by collar 214 but which is prevented from rotational motion by protrusion 262 that extends inwardly from snug fitting , dimensionally conforming insert 250 into slot 264 of seat post 210 . rotational motion of insert 250 is prevented by tab 220 extending outwardly from the outer wall of 250 , depending from flange 252 and protruding into notch 240 of seat tube 202 . seat post 210 , optional spacer blocks 222 , biasing means 224 and vibration eliminator wafer 230 are supported on platform 232 which is enabled to move longitudinally in seat tube 202 with it &# 39 ; s opposite ends extended through diametrically opposite openings 246 through the wall of seat tube 202 . the ends of platform 232 are connected to one embodiment of an extension spring arrangement for use in a bicycle seat mount system that re - directs the downward force loading on 232 to an upper portion of a bicycle seat tube as shown in fig2 a . [ 0028 ] fig2 a , generally indicated by the reference numeral 200 , is a side elevational view , partially in cross section , that illustrates a preferred embodiment of a bicycle shock - absorbing seat mount constructed according to the present invention . extension spring arrangement 700 includes a first vertical tube 710 having disposed therein an extension spring 712 . the upper end of extension spring 712 is attached to the lower end of a first rod 720 and the lower end of extension spring 712 is attached to the upper end of a second rod 722 . the lower end of second rod 722 and the upper end of a third rod 730 are threadedly attached to a turnbuckle 732 . the upper end of first rod 720 is attached to a collar 740 operatively fixedly disposed around an upper perimeter of bicycle seat tube 702 , while the lower end of third rod 730 is attached to a yoke 742 which , in turn , is attached to the ends of support platform 744 that protrude through the wall of bicycle seat tube 702 through diametrically opposite vertical slots 746 ( only one shown on fig2 a ) which may be provided with a flexible cover . a second vertical tube 750 telescoping inserted into the lower end of first vertical tube 710 permits access to turnbuckle 732 for the adjustment thereof and provides for an adjustable total length of extension spring arrangement 700 that is suitable for emplacement along bicycle seat tube 702 of any originally manufactured bicycle . upper and lower clamps 760 and 762 , respectively , may be provided for the attachment of extension spring arrangement 700 to bicycle seat tube 702 and / or the arrangement may be attached by weld 764 . platform 744 movably supports a bicycle seat post and any ancillary components including biasing means which may be similar to those described above in fig1 . in any case , extension spring arrangement 700 re - directs a downward force loading on longitudinally movable support platform 744 to an upper portion of the bicycle and provides mechanical shock absorption . upper and lower sliding means 770 and 772 , respectively , may be provided between bicycle seat tube 702 and first and third rods 720 and 730 and may consist of rollers , wheels , low friction blocks or the like . [ 0030 ] fig2 b is a frontal elevational view of the same components of extension spring 700 except weld 764 is not visible . [ 0031 ] fig3 illustrates a more simplified extension spring arrangement , generally indicated by the reference numeral 800 , as compared with extension spring arrangement 700 of fig2 a and 2b . extension spring arrangement 800 includes an extension spring 810 disposed in a vertical tube 812 . the upper end of extension spring 810 is attached to the lower end of an upper rod 820 , while the lower end of the extension spring is attached to the upper end of a lower rod 822 . the upper end of upper rod 820 is attached to a collar 826 disposed around an upper perimeter of bicycle seat tube 802 , while the lower end of lower rod 822 is attached to a yoke 830 which , in turn , is attached to the ends of support platform 832 that protrude through diametrically opposite openings in bicycle seat tube 802 . upper and lower sliding means 840 and 842 may be provided , respectively , between bicycle seat tube 802 and upper rod 820 and lower rod 822 . vertical tube 812 may be attached to bicycle seat tube 802 by means of a weld 850 . extension spring arrangement 800 is applicable in oem bike manufacture where the length of bicycle seat tube 802 is known and no adjustment of the total length of extension spring arrangement is required , as would be required for retrofitting in a variety of bicycle seat tube lengths . [ 0033 ] fig4 illustrates in more detail , the components of upper clamp 760 attaching first tube 710 to bicycle seat tube 702 while fig5 illustrates in more detail , the components of lower clamp 762 attaching second tube 750 to the bicycle seat tube . [ 0034 ] fig6 illustrates means to manually prevent downward motion of a bicycle seat post ( and an attched saddle ) 650 at a selected elevation when inserted in a bicycle seat tube 652 . a plurality of indents , as at 660 , is defined in the inner surface of vertical slot 662 . an annular collar 670 is disposed around bicycle seat post 650 , the collar having a threaded fastener 672 inserted therethrough and into a selected one of indents 660 , and the collar having dimensions such that it can rest on the top of bicycle seat tube 652 or any insert therein . thus arranged , the minimum height of bicycle seat post 650 can be selectively fixed and further cushiong action dis - engaged . [ 0035 ] fig7 illustrates another arrangement for restriction of downward motion of a bicycle seat post 750 in a bicycle seat tube 752 . a plurality of holes , as at 760 , is defined in the inner surface of vertical slot 762 . a peg 772 with length exceeding the outer diameter of a flanged perimeter of bicycle seat tube 752 , is selectively inserted through one of the holes diametrically across and on the surface of said tube perimeter . thus arranged , the minimum height of bicycle seat post 750 can be selectively fixed at which point of elevation , the means for shock - absorption described above are dis - engaged . [ 0036 ] fig8 is a side elevational view of a bicycle seat tube 900 with notch cut - out 910 in it &# 39 ; s upper perimeter for protrusion of a tab extending from the outer wall of a cylindrical , shape conforming insert ( depicted as 220 and 240 respectively on fig1 ) that prevents rotational motion of a seat post enclosed therein . diametrically opposite , longitudinal , oblong slots 920 in a lower portion of seat tube 900 allow extension therethrough of a longitudinally movable seat post support platform . [ 0037 ] fig9 depicts a common bicycle frame with seat tube 900 identified . in the embodiments of the present invention described above , it will be recognized that individual elements and / or features thereof are not necessarily limited to a particular embodiment but , where applicable , are interchangeable and can be used in any selected embodiment even though such may not be specifically shown . terms such as “ upper ”, “ lower ”, “ inner ”, “ outer ”, “ inwardly ”, “ outwardly ”, “ vertical ”, “ horizontal ”, and the like , when used herein , refer to the positions of the respective elements shown on the accompanying drawing figures and the present invention is not necessarily limited to such positions . it will thus be seen that the objective set forth above , among those elucidated in , or made apparent from , the preceding description , are efficiently attained and , since certain changes may be made in the above construction without departing from the scope of the invention , it is intended that all matter contained in the above description or shown on the accompanying drawing figures shall be interpreted as illustrative only and not in a limited sense . it is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described and all statements of the scope of the invention which , as a matter of language , might be said to fall therebetween .
| 1 |
[ 0017 ] fig1 illustrates a frequency shift keying ( fsk ) signal that can be generated using a particular technique for cycle - by - cycle synchronous waveform shaping . this technique generates a fsk signal by sending a mixed square waveform through a low pass filter . within each predefined frame , the mixed square waveform is either a lower frequency square wave or a higher frequency square wave . thus , the filtered output represents a fsk signal . however , since the mixed square waveform contains both lower and higher frequency square waveforms , the single lowpass filter is not sufficient . this is because the harmonics of the lower frequency square waveforms are not removed . therefore , the harmonics of the lower frequency square waveforms interfere with the higher frequency components of the output signal . as can be seen in fig1 this approach generates a distorted fsk signal . more effective approaches to cycle - by - cycle synchronous waveform shaping are discussed below . [ 0018 ] fig2 is a high level functional block diagram of an illustrative embodiment 200 of a fsk cycle - by - cycle synchronous waveform shaping circuit in accordance with the present invention . the circuit 200 produces a fsk cycle - by - cycle synchronous waveform 290 having distinct data periods including data periods 292 , 294 , 296 , and 298 . four synchronous digital signals 201 , 202 , 203 , and 204 are provided as inputs to the circuit . the digital signals 201 and 202 each has a cycle of length t during which time the signal level transitions from a high level to a low level , or vice versa . similarly , the digital signals 203 and 204 each has a cycle of length t / 2 in which time the signal level transitions from a high level to a low level , or vice versa . typically , the digital signals 201 , 202 , 203 , and 204 can be generated by any of a number of conventional techniques such as digital logic , a processor , or the others implementations . the digital signal 201 is passed through a digital block unit 211 and a low pass filter 221 , to produce a filtered signal 231 . the digital signal 202 is passed through a digital block unit 212 and a low pass filter 222 , to produce a filtered signal 232 . the digital signal 203 is passed through a digital block unit 213 and a low pass filter 223 , to produce a filtered signal 233 . finally , the digital signal 204 is passed through a digital block unit 214 and a low pass filter 224 , to produce a filtered signal 234 . the digital block units 211 , 212 , 213 , and 214 each removes the dc component from each of the digital signals 201 , 202 , 203 , and 204 , respectively . the filtered signals 231 and 232 combine at a combiner 242 to form a first combined signal 252 . the filtered signals 233 and 234 combine at a combiner 244 to form a second combined signal 254 . the first combined signal 252 might include regions in the signal a “ null ”. consider for example , the region “ a ” of the input signals 201 , 202 . the figure shows that at the region “ a ”, there is a 180 ° phase difference between the digital signals 201 and 202 . consequently , the filtered signals 231 and 232 , which correspond to the digital signals 201 and 202 , significantly cancel each other in the region “ a ” when they are combined at the combiner 242 . thus , the first combined signal 252 has an a null signal at a region that corresponds to the region “ a ”. on the other hand , in the same region of the combined signal 254 that corresponds to region “ a ”, the signal is amplified . that is , in region “ a ”, there is a 0 ° phase difference between the digital signals 203 and 204 . thus , the filtered signals 233 and 234 , which correspond to the digital signals 203 and 204 , significantly add to each other in the region “ a ” when they are combined at the combiner 244 . similarly , the second combined signal 254 is effectively a null signal in certain other regions . for example , in an illustrative region 37 b ,” there is ideally a 180 degree phase difference between the digital signals 203 and 204 . consequently , the filtered signals 233 and 234 , which correspond to the digital signals 203 and 204 , significantly cancel each other in the region “ b ” when they are combined at the combiner 244 . thus , the second combined signal 254 is effectively a null signal within the region “ b .” on the other hand , in the same region , the combined signal 252 is an amplified signal . that is , in region “ b ,” there is ideally a 0 degree phase difference between the digital signals 201 and 202 . thus , the filtered signals 231 and 232 , which correspond to the digital signals 201 and 202 , significantly add to each other in the region “ b ” when they are combined at the combiner 242 . the first and second combined signal 252 and 254 are combined to each other at a combiner 260 to form the fsk cycle - by - cycle synchronous waveform 290 suitable for transmission . the waveform 290 has distinct data periods including data periods 292 , 294 , 296 , and 298 . note that data periods 292 , 294 , and 298 correspond to regions in which the first combined signal 252 contributes a signal having a cycle of length t , and the second combined signal 254 contributes an effectively null signal . also note that data period 296 corresponds to a region in which the second combined signal 254 contributes a signal having two cycles of length t / 2 each , and the first combined signal 252 contributes an effectively null signal . it can be appreciated from fig2 that the principle of superposition provides an alternate configuration whereby the digital signals 201 - 204 are combined to produce an intermediate digital signal , prior to performing the filtering . the intermediate digital signal can then be dc blocked to remove a dc component if necessary , and then low pass filtered using a single appropriately designed low pass filter . [ 0024 ] fig3 is a block diagram 300 of an implementation of the fsk cycle - by - cycle synchronous waveform shaping circuit 200 . this implementation produces one cycle of a signal with frequency f 0 ( one cycle having a 1 / f 0 period ) to represent a bit “ 1 ” and two cycles of a signal with frequency f 1 ( two cycles each having 1 / f 1 , period ) to represent a bit “ 0 .” here , f 1 , is a frequency that is twice f 0 . a delayed lock loop ( dll ) circuit 302 receives a raw data signal 304 and an asynchronous clock signal 306 and performs the function of locking to the timing of the incoming raw data signal 304 . the dll circuit 302 outputs a sync clk signal 308 , a sync data signal 310 , and a 2 × sync clk signal 312 . the sync clk signal 308 has a frequency equivalent to the data rate of the sync data signal 310 . the 2 × sync clk signal 312 has a frequency twice the data rate of the sync data signal 310 . both clock signals 308 and 312 are synchronous with the sync data signal 310 . the sync clk signal 308 , sync data signal 310 , and 2 × sync clk signal 312 are input to a combinational logic circuit 314 , which produces a low dout signal 321 , a low clk signal 322 , a high dout signal 323 , and a high clk signal 324 . the low dout signal 321 passes through a coupling capacitor 331 and a low pass filter 341 to form a filtered signal 351 . the low clk signal 322 passes through a coupling capacitor 332 and a low pass filter 342 to form a filtered signal 352 . the high dout signal 323 passes through a delay block 326 , a coupling capacitor 333 , and a low pass filter 343 to form a filtered signal 353 . the high clk signal 324 passes through a delay block 328 , a coupling capacitor 334 , and a low pass filter 344 to form a filtered signal 354 . note that the low dout signal 321 and the low clk signal 322 together represent cycles of the lower frequency f 0 signal used to indicate the bit “ 1 ” s . however , in this implementation , the low dout signal 321 alone carries the information relating to the location of the bit “ 1 ” s . the low clk signal 322 is merely a clock signal synchronous with the low dout signal 321 . nevertheless , the low clk signal 322 is used in combination with the low dout signal 321 to ensure that the time span of a non - zero value on either digital signal 321 or 322 will be at most 2t l , where t l is the time span between two possible transitions on either signal 321 or 322 . similarly , the high dout signal 323 and the high clk signal 324 together represent cycles of the higher frequency f 1 signal used to indicate the bit “ 0 ” s . the high dout signal 323 alone carries the information relating to the location of the bit “ 0 ” s . the high clk signal 324 is merely a clock signal synchronous with the high dout signal 323 . the two signals used in combination ensure that the time span of a non - zero value on either digital signal 323 or 324 will be at most 2t h , where t h is the time span between two possible transitions on either signal 323 or 324 . also note that the low pass filters 341 and 342 together form a low pass filter group 1 in which each filter has a cut - off frequency corresponding to the pulse frequency ½t l of the digital signals ( low dout signal 321 and low clk signal 322 ) they serve . the low pass filters 343 and 344 together form a low pass filter group 2 in which each filter has a cut - off frequency corresponding to the pulse frequency ½t h of the digital signals ( high dout signal 323 and high clk signal 324 ) they serve . the low pass filters 321 , 322 , 323 , and 324 thus appropriately reduce the harmonics in the various signals being filtered . the low pass filters 321 , 322 , 323 , and 324 can be implemented as analog infinite response impulse response filters . any kind of appropriate conventionally known filter can be used , including butterworth filters , bessel filters , and so on . in a particular embodiment of the invention , for example , the low pass filters are implemented as gaussian filters , which are known to contribute less distortion in neighboring pulses of the signals being filtered . delay blocks 326 and 328 are used to add delay to the high dout signal 323 and high clk signal 324 in order to compensate for the difference between the delay associated with low pass filter group 1 and the delay associated with low pass filter group 2 . the delay blocks 326 and 328 can be implemented as adjustable digital delays , a long transmission path or wire , or others . referring again to fig3 the filtered signals 351 and 352 are differentially combined at a differential combiner 360 to produce a first differentially combined signal 364 . within each region representing a data period associated with a bit “ 0 ,” the filtered signals 351 and 352 significantly cancel each other at the differential combiner 360 , and the first differentially combined signal 364 is effectively a null signal within the region . similarly , the filtered signals 353 and 354 are differentially combined at a differential combiner 362 to produce a second differentially combined signal 368 . within each region representing a data period associated with a bit “ 1 ,” the filtered signals 353 and 354 significantly cancel each other at the differential combiner 362 , and the second differentially combined signal 368 is effectively a null signal within that region . the first and second differentially combined signals 364 and 368 are differentially combined to each other at a differential combiner 370 to produce the desired fsk cycle - by - cycle synchronous waveform 290 that is suitable for transmission . note that differential combiners 360 , 362 , and 370 are used because the various signals are transmitted in a differential mode , which allows improvements in noise rejection and formation of sinusoidal waveforms . differential signaling in this embodiment is achieved by using the combinatorial logic circuits 314 to appropriately control the polarity of the low dout signal 321 , the low clk signal 322 , the high dout signal 323 , and the high clk signal 324 . it should be noted that while fig3 illustrates the production of an fsk cycle - by - cycle synchronous waveform , a similar implementation can be used to generate a binary phase shift keying ( bpsk ) or another type of phase shift keying ( psk ) cycle - by - cycle synchronous waveform by generating digital signals of different phases and filtering and / or combining such digital signals . [ 0034 ] fig4 a , 4b , 5 a , and 5 b are time domain plots representing the various filtered signals to be differentially combined in order to produce the desired fsk cycle - by - cycle synchronous waveform 290 . fig4 a and 4b represent the filtered signals 351 and 352 , respectively . note that these two signals are characterized by the time span t l . fig5 a and 5b represent the filtered signals 353 and 354 , respectively . note that these two signals are characterized by the time span t h . fig6 is a time domain plot representing the desired fsk cycle - by - cycle synchronous waveform 290 produced by the circuit shown in fig3 . [ 0035 ] fig7 a is a functional diagram of the convolution process used in a second embodiment 800 ( fig8 ) of the cycle - by - cycle synchronous waveform shaping circuit in accordance with the present invention . a data pulse 702 and a delayed data pulse 704 are differentially combined at a differential combiner 706 to produce an impulse pair 710 having a positive impulse 712 and a negative impulse 714 . the delayed data pulse 704 is delayed in time by a precise amount relative to the data pulse 702 but otherwise resembles the data pulse 702 . the data pulse 702 and delayed data pulse 704 can be generated by digital logic , a processor , or the others implementations . the data pulse 702 and the delayed data pulse 704 overlap in a period of length t / 2 − ts . when differentially combined , the data pulse 702 and the delayed data pulse 704 cancel each other in this overlapping period , and non - overlapping portions of the pulses 702 and 704 form a positive impulse 712 and a negative impulses 714 of an impulse pair 710 . the impulse pair 710 is convolved with a gaussian filter 720 in the time domain to produce a sinusoidal pulse 730 having a positive half cycle 732 and a negative half cycle 734 . the positive impulse 712 of the impulse pair 710 produces the positive half cycle 732 , which resembles the impulse response of the gaussian filter 720 . the negative impulse 714 of the impulse pair 710 produces the negative half cycle 734 , which resembles the negative of the impulse response of the gaussian filter 720 . the gaussian filter 720 has a compact impulse response and a less oscillatory nature compared to other filter designs . the gaussian filter 720 can also be realized in the form of a lc circuit . however , other types of filters such as butterworth filters and bessel filters may also be used . [ 0038 ] fig7 b and 7c illustrate examples of how the convolution process shown in fig7 a can be used to generate a frequency shift keying ( fsk ) or a binary phase shift keying ( bpsk ) signal , respectively . the convolution process shown in fig7 a is highly controllable and precise in generating a sinusoidal pulse at a specified time . by generating and superpositioning appropriate sinusoidal pulses at particular positions in time , appropriate data modulated signals such as fsk and bpsk signals can be produced . fig7 b illustrates that a portion of an fsk signal can be produced by concatenating a sinusoidal impulse having a length of 2 t with two sinusoidal impulses each having a length of t . fig7 c illustrates that a portion of a bpsk signal can be produced by concatenating a sinusoidal impulse having a length of t with another sinusoidal impulse having a length of t but being inverse in amplitude . [ 0039 ] fig8 is a block diagram of the second embodiment 800 of the cycle - by - cycle synchronous waveform shaping circuit producing a bpsk signal in accordance with the present invention . here , two distinct sinusoidal pulses 802 and 804 are generated at particular positions in time and differentially combined to form one portion of a desired bpsk cycle - by - cycle synchronous waveform 806 . although only the sinusoidal pulses 802 and 804 are shown in fig8 it should be understood that other sinusoidal pulses preceding , following , or even overlapping with sinusoidal pulses 802 and 804 are also differentially combined to form other portions of the bpsk cycle - by - cycle synchronous waveform 806 . referring to fig8 a digital signal 810 containing data pulses of length t is generated and provided to the circuit 800 . an and function block 811 receives the digital signal 810 and a clock signal 812 , which has pulses of length t / 2 and is synchronous with the digital signal 810 . the and function block 811 outputs a half - cycle signal 813 . in this manner , each data pulse in digital signal 810 representing a bit ‘ 1 ’ ( or bit ‘ high ’) is extracted and reduced to half duty cycle , producing the half - cycle signal 813 . a delay block 814 receives the half - cycle signal 813 , introduces a delay of t s , and produces a delayed half - cycle signal 815 . the half - cycle signal 813 and the delayed half - cycle signal 815 are differentially combined at a differential combiner 816 to produce an impulse pair signal 818 . the digital signal 810 is inverted at an inverter 819 , producing an inverted digital signal 820 . an and function block 821 receives the inverted digital signal 820 and the clock signal 812 , which has pulses of length t / 2 and is synchronous with the inverted digital signal 820 . the and function block 811 outputs a half - cycle signal 823 . in this manner , each data pulse in digital signal 810 representing a bit ‘ 0 ’ ( or bit ‘ low ’) is extracted and reduced to half duty cycle , producing the half - cycle signal 823 . a delay block 824 receives the half - cycle signal 823 , introduces a delay of t s , and produces a delayed half - cycle signal 825 . the half - cycle signal 823 and the delayed half - cycle signal 825 are differentially combined at a differential combiner 826 to produce an impulse pair signal 828 . an impulse regenerating circuit 830 receives the impulse pair signal 818 and produces a regenerated impulse pair signal 832 . similarly , an impulse regenerating circuit 840 receives the impulse pair signal 828 and produces a regenerated impulse pair signal 842 . under certain conditions , the impulse pair signals 818 and 828 may not have proper signal level and / or form to be adequate impulse signals . for example , a low slew rate associated with the digital signals 813 , 815 , 823 , and 825 caused by digital data buffers supplying these signals may result in a “ smearing ” of the positive pulses and negative pulses of the impulse pair signals 818 and 828 . these positive and negative pulses could thus lack proper signal level and / or form . the impulse regenerating circuits 830 and 840 corrects such problems by adjusting the signal levels and / or other characteristics of the regenerated impulse pair signals 832 and 842 such that they provide adequate impulse signals . a differential combiner 854 receives the regenerated impulse pair signals 832 and 842 and produces a combined regenerated impulse pair signal 852 . a gaussian filter 854 of length t / 2 − t s receives the combined regenerated impulse pair signal 852 and produces the bpsk cycle - by - cycle synchronous waveform 806 . alternatively , the regenerated impulse pair signal 832 and the regenerated impulse pair signal 842 can be separately filtered and then differentially combined . in such case , two gaussian filter are needed . fig9 is a time domain plot representing the desired bpsk cycle - by - cycle synchronous waveform produced by the implementation shown in fig8 . it should be noted that while fig8 illustrates the production of a bpsk cycle - by - cycle synchronous waveform , a similar implementation can be used to generate an fsk cycle - by - cycle synchronous waveform by generating impulse pairs corresponding to different frequencies and filtering and / or combining such impulse pairs . although the present invention has been described in terms of specific embodiments , it should be apparent to those skilled in the art that the scope of the present invention is not limited to the described specific embodiments . the specification and drawings are , accordingly , to be regarded in an illustrative rather than a restrictive sense . it will , however , be evident that additions , subtractions , substitutions , and other modifications may be made without departing from the broader spirit and scope of the invention as set forth in the claims .
| 7 |
in fig1 is shown an embodiment of a device for the torque limitation in a machine for processing means of payment on transmitting a torque . in the shown embodiment a torque of a drive or a motor 16 is transmitted with the help of a shaft 10 , 20 consisting of two parts to a toothed wheel 21 which e . g . with the help of a toothed belt drives parts of the machine for processing means of payment . for example , as shown in fig4 , the device for torque limitation may used in a machine 100 for processing means of payment in combination with a singler 101 or a mechanism 201 disposed in a cassette 200 for receiving means of payment , e . g . for receiving bank notes bn in a singler 101 , and transporting the bank notes on path 202 and stacking the bank notes bn in the cassette 200 . between the two shaft parts 10 , 20 there are disposed two elements 12 , 22 for limiting the transmitted torque , which form a safety coupling . the two elements 12 , 22 can be formed in a disk - shaped fashion . each of the two elements 12 , 22 is firmly connected with one end of the two shaft parts 10 , 20 . for monitoring a rotational speed that has to be observed when operating the shaft 10 , 20 , a clocking disk 11 can be provided , which is firmly connected with the shaft . with the help of a not shown forked light barrier , which is disposed in the rotating area of the clocking disk 11 the rotational speed of the shaft can be determined by evaluating the output signal of the forked light barrier . fig2 and 3 show the shaft 10 , 20 consisting of two parts in a separated state . here the surfaces of the element 12 , 22 forming the safety coupling , that adjoin each other when transmitting a torque , become visible . the first element 12 mounted at the first shaft part 10 has magnets 13 . additionally , the first element 12 can have depressions 14 , which can be formed e . g . cylindrical . moreover , the first shaft part 10 can have a tapered extension 15 , which protrudes beyond the surface of the first element 12 . the second element 22 mounted at the second shaft part 20 has magnets 23 . additionally , the second element 22 can have elevations 24 , which can be formed e . g . as spheres . moreover , the second shaft part 20 can have a bush - shaped bore 25 . when first and second shaft part 10 , 20 , as shown in fig1 , are brought together , the extension 15 of the first shaft part 10 moves into engagement with the bush 25 of the second shaft part 20 . the magnets 13 of the first element 12 and the magnets 23 of the second element 22 attract each other and connect the first element 12 and the second element 22 with each other in a non - positive fashion , so that their surfaces adjoin each other . it is obvious , that the pole direction of the magnets 13 and 23 must be chosen such that the magnets 13 of the first element 12 and the magnets 23 of the second element 22 attract each other . for example , the magnets 13 of the first element 12 are inserted such that they have a north pole at the surface of the first element 12 , whereas the magnets 23 of the second element 22 are inserted such that they have a south pole at the surface of the second element 22 . in the shown example with four magnets per element , then first and second element are connected with each other after a quarter turn at the latest . but it is also possible , that in both elements for example a north pole follows a south pole . in the shown example with four magnets per element , then first and second element are connected with each other after a half turn at the latest . by choosing number , type and size of the magnets 13 , 23 and the size , i . e . the diameter , of the elements 12 , 22 of the device for the torque limitation , or the distance between the magnets 13 , 23 and the axial center of the shaft 10 , 20 , there can be determined the maximum transmittable torque . if , for example , a diameter of 20 millimeters is chosen for the elements 12 , 22 and if four permanent magnets of the refeb type with a degree of magnetization n52 and 5 millimeters diameter at a length of 6 millimeters are chosen and disposed concentric to the axis of the shaft 10 , 20 , a maximum torque of 0 . 18 nm can be transmitted . when bringing together the first and second element 12 , 22 , moreover , the possibly additionally provided elevations 24 of the second element 22 , which e . g . are formed as spheres , move into engagement with the possibly additionally provided , for example , cylindrical depressions 14 of the first element 12 . in this way first and second element 12 , 22 can be positively connected , when viewed in the direction of rotation . with that the torque transmittable by the device for the torque limitation can be increased . the effect of the elevations 24 and depressions 14 , which increases the maximum transmittable torque , substantially depends on their dimensions , in particular on the height and depth of the elevations 24 and depressions 14 , respectively , and their form . instead of providing the elevations and depressions each on one of the elements , elevations and depressions can be alternately provided on the two elements . when the torque transmitted by the shaft 10 , 20 exceeds the maximum permissible value , e . g . because the singler for bank notes is blocked by foreign objects , the retention forces of the magnets 13 , 23 are exceeded and the device for the torque limitation effects a disruption of the shaft 10 , 20 between first and second element 12 , 22 . when , optionally , the above - described depressions 14 and elevations 24 are provided , the transmittable torque is increased respectively , so that for achieving the desired torque lower magnetic forces are sufficient . when the cause , that effects the exceeding of the maximum torque , is eliminated , first and second shaft part 10 , 20 are re - connected with each other with the help of first and second element 12 , 22 as described above , so that a torque can be transmitted until the maximum permissible torque . here the elements 12 , 22 and thus the shaft parts 10 , 20 are put together again and held together by the magnetic forces of the magnets 13 , 23 used . in particular when the described depressions 14 and elevations 24 in the surfaces of the elements 12 , 22 are used , it can be provided , that one of the elements 12 , 22 is mounted movable in axial direction on the respective shaft part 10 , 20 . this permits that in the case the maximum transmittable torque is exceeded the movably mounted element 12 , 22 can evade . the permissible axial movability here can approximately correspond to the height of the elevations 24 . in the described embodiment first and second element 12 , 22 of the device for the torque limitation each have four magnets 13 , 23 . it is obvious , that more or less than four magnets per element 12 , 22 can be used . here it is required , that the magnets 13 of the first element 12 and the magnets 23 of the second element 22 have an angular distribution of the same kind . the same applies for the optionally provided four elevations 24 or depressions 14 per element 22 or 12 . as shown , elements 12 , 22 are formed in a disk - shaped fashion , but it is obvious , that the elements 12 , 22 can also have a different form , in order to in particular accommodate the magnets 13 , 23 . from the figures and the description of the action principle of the device for the torque limitation it obviously appears , that the device for the torque limitation is suitable to effect a torque limitation in both directions of rotation . likewise , from the figures and their description results that the two shaft parts 10 , 20 are separable . for example , the second shaft part 20 can be component part of a cassette , the first shaft part 10 can be disposed in the machine for processing means of payment . thus the cassette and with that the second shaft part 20 can be easily flanged to the machine for processing means of payment and thus to the first shaft part 10 , to permit the driving of the elements located in the cassette .
| 8 |
with reference to the accompanying drawings , hereinafter will be described an embodiment of the present invention , in which an apparatus for estimating the gradient of a road surface ( roadbed or roadway ) is applied to a vehicle control system for controlling acceleration of vehicles . fig1 illustrates a general configuration of the vehicle - control system including the road surface gradient estimating apparatus , which are according to the embodiment . an engine 10 , a gasoline powered internal combustion engine , includes a crank shaft 12 to which an automatic transmission system 14 is connected . the automatic transmission system 14 is provided with a torque converter and a planetary gear automatic transmission . in the planetary gear automatic transmission , any of a plurality of power transmission paths formed by planetary gears pg is selected , depending on the engagement conditions of a clutch c and a brake ( not shown ) as friction elements . the planetary gear automatic transmission is adapted to realize a gear ratio according to the selected power transmission path . the torque of the crank shaft 12 of the engine 10 is changed by the automatic transmission system 14 and then transmitted to drive wheels 16 . the drive wheels 16 and idler wheels 18 can be imparted with braking force by a hydraulic brake actuator 20 . in addition to an electrical pump po , the brake actuator 20 is provided with a retention valve vk and a decompression valve vr , for each of the wheels ( the drive wheels 16 and the idler wheels 18 ). the retention valve vk retains the pressure of the hydraulic oil supplied to a wheel cylinder 24 , and the decompression valve vr reduces the pressure of the hydraulic oil in the wheel cylinder 24 . the brake actuator 20 is also provided with a linear relief valve vf for causing pressure difference between the side of a master cylinder , not shown , and the side of the wheel cylinder 24 . the discharge side of the pump po is connected to the suction side of the pump po via the retention valve vk and the decompression valve vr . the hydraulic oil is flowed in / out between the connected portion of the retention valve vk and the decompression valve vr , and the wheel cylinder 24 . the operation of the linear relief valve vf , the retention valve vk and the decompression valve vr can realize automatic brake control which is performed independent of the user &# 39 ; s brake operation which realizes anti - brake lock braking control ( abs ), traction control and skid prevention control , for example . specifically , in retaining braking force , the pressure of the hydraulic oil in the wheel cylinder 24 is retained by closing both of the retention valve vk and the decompression valve vr . in decreasing braking force , the pressure in the wheel cylinder 24 is lowered by closing the retention valve vk and opening the decompression valve vr . in increasing braking force , the pressure of the hydraulic oil supplied to the wheel cylinder 24 is raised by opening the linear relief valve vf and the retention valve vk and closing the decompression valve vr . in this case , the pressure in the wheel cylinder 24 is controlled by controlling the current supply for the linear relief valve vf . specifically , the linear relief valve vf is adapted to cause pressure difference between the side of the master cylinder and the side of the wheel cylinder 24 , as mentioned above , in proportion to the amount of current supply . accordingly , the pressure difference can be adjusted according to the amount of current supply , which is eventually led to the pressure control in the wheel cylinder 24 . in particular , in the case where the user &# 39 ; s brake operation for realizing skid prevention control , for example , is not performed , the pump po is actuated to produce a pressure to be applied into the wheel cylinder 24 , while at the same time , the pressure is adjusted according to the amount of current supply to the linear relief valve vf . in this regard , hysteresis may be caused to the pressure difference between the side of the master cylinder and the side of the wheel cylinder 24 , accompanying the increase and decrease in the amount of current supply mentioned above . in order to reduce the hysteresis , the operation of current supply to the linear relief valve vf is so carried out based on time - ratio control for adjusting time ratio between logic “ h ” and logic “ l ” of applied voltage ( the ratio of logic “ h ” to the time periods of logic “ h ” and logic “ l ”: duty ). the frequency ( dither frequency ) of the time - ratio control ranges from about “ 1 khz ” to “ several khz &# 39 ; s ”, for example . each of the drive wheels 16 and the idler wheels 18 is provided with a wheel - speed sensor 26 for detecting the rotational speed of the wheel . a control apparatus 30 controls the travel conditions of the vehicle . specifically , the control apparatus 30 retrieves detection values of various sensors for detecting the operating conditions of the engine 10 and the automatic transmission system 14 , as well as the output signals of the wheel - speed sensors 26 , a user interface 32 and an acceleration sensor 34 to control traveling of the vehicle based on these values and signals . the user interface 32 includes an automatic travel switch through which the user can request automatic travel of the vehicle , and an accelerator operating member through which the user can request torque increase to the engine 10 . the accelerator sensor 34 is adapted to detect acceleration based on the force applied to the sensor per se . the acceleration to be detected is acceleration caused in the longitudinal direction ( i . e ., the front - rear direction or the anteroposterior direction ) of the vehicle . a pendulum type or strain - gauge type sensor , for example , can serve as the accelerator sensor 34 . when a request for automatic travel is inputted by the user through the user interface 32 , the control apparatus 30 controls the actual speed ( actual acceleration ) of the vehicle to a target value ( target acceleration ). the details are provided below . fig2 shows the processes associated , in particular , with the automatic travel control , among the processes performed by the control apparatus 30 . fig2 exemplifies such automatic travel applications as a cruise controller m 2 , a vehicle distance ( intervehicle ) controller m 4 and a so precrash controller m 6 . the cruise controller m 2 controls the travel speed of the vehicle to be kept at a certain level . the vehicle distance controller m 4 controls the distance between the vehicle and a preceding vehicle to a predetermined distance . the precrash controller m 6 controls the shock of possible collision with the preceding vehicle to be mitigated . the cruise controller m 2 , the vehicle distance controller m 4 and the precrash controller m 6 all output a requested value of acceleration ( requested acceleration ) and a requested limit value of jerk that will be described later . an arbitrator m 8 outputs a finally requested jerk limit value “ jreq ” and a requested acceleration ( application - based acceleration “ ara ”) based on the outputs from the cruise controller m 2 , the vehicle distance controller m 4 and the precrash controller m 6 , which are provided as various applications for the control apparatus . a vehicle longitudinal controller ( vlc ) m 10 outputs : a requested power - train torque “ twpt ” which is a torque requested for the power train comprising the engine 10 and the automatic transmission system 14 ; and a requested brake torque “ twbk ” which is a torque requested for the brake actuator 20 . a control cycle “ td ” of the vehicle longitudinal controller m 10 is different from a control cycle “ ta ” of the cruise controller m 2 , a control cycle “ tb ” of the vehicle distance controller m 4 and a control cycle “ tc ” of the precrash controller m 6 . specifically , the cycle “ td ” of the vehicle longitudinal controller m 10 is set shorter than the cycle “ ta ” of the cruise controller m 2 , the cycle “ tb ” of the vehicle distance controller m 4 and the cycle “ tc ” of the precrash controller m 6 . this is because the applications are adapted to calculate requested acceleration based on various detection values obtained from detecting means , such as one which detects a preceding vehicle by radar , and thus because the detection cycles of these detecting means tend to be longer than the detection cycles of actual vehicle speed and actual acceleration . a power train controller m 12 outputs a requested value of torque so for the engine 10 ( requested engine torque “ te ”), and a requested value of gear ratio for the automatic transmission system 14 ( requested gear ratio “ gr ”), in response to the requested power train torque “ twpt ”. a brake controller m 14 outputs a requested value of hydraulic oil pressure for the brake actuator 20 ( requested brake pressure “ pmc ”), in response to the requested brake torque “ twbk ”. it should be appreciated that the requested brake pressure “ pmc ” is a manipulated variable of the brake actuator 20 which adjusts , through the hydraulic oil pressure , the braking force in each of the drive wheels 16 and the idler wheels 18 . fig3 shows in detail the processes performed by the vehicle longitudinal controller m 10 . the front - rear direction controller m 10 is configured to output the application acceleration “ ara ” outputted from the arbitrator m 8 to the jerk limiter 812 , as a requested acceleration “ ar ”. the jerk limiter b 12 is configured to perform a process for limiting the amount of change in the requested acceleration value within one control cycle of the front - rear direction controller m 10 , to the requested jerk limit value “ jreq ” or less . fig4 shows a series of processes performed by the jerk limiter b 12 . first , at step s 10 , the jerk limiter b 12 obtains the requested acceleration “ ar ”, the requested jerk limit value “ jreq ” and a jerk acceleration “ aj ” that is the present output of the jerk limiter b 12 . at the subsequent step s 12 , the jerk acceleration “ aj ” is set as a previous value “ aj0 ”. at steps s 14 and s 16 , the change in the requested acceleration “ ar ” is limited so that the difference from the previous value “ aj0 ” will be equal to or less than the jerk limit value “ jreq ”. that is , at step s 16 , a value “ aj1 ” is calculated , which value corresponds to a value obtained by multiplying the jerk limit value “ jreq ” with the control cycle “ td ” and adding the resultant value to the previous value “ aj0 ”, or corresponds to the requested acceleration “ ar ”, whichever is smaller . at the subsequent step s 16 , a value “ aj2 ” is calculated , which value corresponds to a value obtained by multiplying the jerk limit value “ jreq ” with the control cycle “ td ” and subtracting resultant value from the previous value “ aj0 ,” or corresponds to the smaller value “ aj1 ” mentioned above , whichever is larger . at step s 18 , the larger value “ aj2 ” is set as the jerk acceleration “ aj ”. thus , in one control cycle of the applications , the jerk acceleration “ aj ” is shifted stepwise to the requested acceleration “ ar ” at every control cycle “ td ” of the vehicle longitudinal controller m 10 , with the jerk limit value “ jreq ” as being the maximum amount of change . in the vehicle longitudinal controller m 10 , the vehicle acceleration is controlled to the jerk acceleration “ aj ” by two - degree freedom control . in particular , the actual acceleration is feedback - controlled to the jerk acceleration “ aj ”, and at the same time , the actual acceleration is feedforward controlled to the jerk acceleration “ aj ”. an explanation will be given first on the feedback control . a reference model setter 8514 shown in fig3 outputs a reference acceleration “ am1 ” by converting the jerk acceleration “ aj ” in terms of a reference model . the reference model is to determine a behavior of the target acceleration in a transient travel time period of the vehicle , during which the jerk acceleration “ aj ” changes . the process performed by the reference model setter b 14 is shown in fig5 a as step s 20 . specifically , the reference model is a primary delay model , and thus the jerk acceleration “ aj ” is converted in terms of the primary delay model . as shown in fig5 b , the primary delay model is set based on the response characteristics at the time when the response delay of the actual acceleration ( solid lines ) is maximized , in a step change of the target acceleration ( dash - dot line ). more specifically , the response characteristics are supposed to change according to the operating conditions of the vehicle , such as the rotational speed of the engine 10 . thus , in the changing operating conditions , the characteristics at the time when the response delay is maximized are used as the base for the primary delay model . a differential operator b 16 shown in fig3 performs an operation by differentiating an actual vehicle speed “ v ” with respect to time . the actual vehicle speed “ v ” is based on the detection value derived from the wheel - speed sensor 26 provided at each of the drive wheels 16 and the idler wheels 18 . in particular , the actual vehicle speed “ v ” may , for example , be an average of the detection values of the four wheel - speed sensors 26 , or a maximum value of the detection values . a difference calculator b 22 is configured to calculate the difference ( difference “ err ”) between an actual acceleration “ a ” outputted from the differential operator b 16 and the reference acceleration “ am ” outputted from the reference model setter b 14 . a feedback controller b 24 is an element that feedback - controls the actual acceleration “ a ” to the reference acceleration “ am ”. specifically , the feedback controller b 24 of the present embodiment is configured to perform proportional - integral - differential ( pid ) control . fig6 illustrates a series of procedure performed by the feedback controller 24 . first , at step s 30 , an integral value “ ierr ” and a differential value “ derr ” are calculated based on the difference “ err ”. particularly , the current integral value “ ierr ” is calculated by multiplying the current difference “ err ” with the control cycle “ td ” and adding the resultant to a previous integral value “ ierr0 ”. also , the differential value “ derr ” is calculated by subtracting a previous difference “ err0 ” from the current difference “ err ” and dividing the resultant by the control cycle “ td ”. at the subsequent step s 32 , a feedback manipulated variable “ tfb ” is calculated . particularly , the feedback manipulated variable “ tfb ” is calculated by summing up : a value obtained by multiplying the difference “ err ” with a proportional gain “ kp ”; a value obtained by multiplying the integral value “ ierr ” with an integral gain “ ki ”; and a value obtained by multiplying the differential value “ derr ” with a differential gain “ kd ”. the proportional gain “ kp ”, the integral gain “ ki ” and the differential gain “ kd ” are for converting the integral value “ ierr ” so and the differential value “ derr ” into the requested torque . in other words , the feedback manipulated variable “ tfb ” represents a torque requested for rendering the actual acceleration “ a ” to be the reference acceleration “ am ”. when the process pf step s 32 is completed , the difference “ err ” is stored , at step s 34 , as the previous difference “ err0 ” and the integral value “ ierr ” is stored as the previous integral value “ ierr0 ”. hereinafter is explained the feedforward control in the two - degree freedom control mentioned above . a feedforward controller b 26 shown in fig3 performs the feedforward control to achieve the jerk acceleration “ aj ”. fig7 shows a series of processes performed by the feedforward controller b 26 . first , at step s 40 , a force “ fx ” is calculated , which should be added to the travel direction of the vehicle to achieve the jerk acceleration “ aj ”. at this step , the force “ fx ” is calculated as a sum of air resistance , road surface resistance , gravity and reference force . the reference force can be obtained by multiplying the jerk acceleration “ aj ” with a vehicle weight “ m ”. the reference force is necessary for having the vehicle traveled at the jerk acceleration “ aj ” in the state where no resistance is added in traveling the vehicle . the air resistance is a force of air , which is added in the direction reverse of the travel direction of the vehicle . in the present embodiment , the air resistance is calculated by multiplying the square of the actual vehicle speed “ vr ” with an air density “ ρ ”, a coefficient “ cd ” and a projection area “ s ” of the vehicle front , followed by multiplication with “ ½ ”. the road surface resistance is a resistance caused by the friction between the road surface and the drive wheels 16 and the idler wheels 18 , and is calculated by the multiplication of a friction coefficient “ μ ”, the vehicle weight “ m ” and a gravity acceleration “ g ”. the term “ gravity ” refers to a gravity which is , applied to the travel direction of the vehicle when the road surface is inclined . this “ gravity ” can be expressed by “ mg sin θ ” using a road so surface gradient “ θ ”. it should be appreciated that the road surface gradient “ θ ” is calculated based on the actual vehicle speed “ v ” and the detection value of the acceleration sensor 34 mentioned above . at the subsequent step s 42 , a feedforward manipulated variable “ tff ” is calculated by multiplying the force “ fx ” with a radius “ r ” of the drive wheel 16 . the feedforward manipulated variable “ tff ” is the torque requested for having the vehicle traveled at the jerk acceleration “ aj ”. an axle torque calculator b 28 shown in fig3 calculates a requested axle torque “ tw ” by adding the feedback manipulated variable “ tfb ” to the feedforward manipulated variable “ tff ”. a distributor b 30 divides ( distributes ) the requested axle torque “ tw ” into the requested power train torque “ twpt ” and the requested brake torque “ twbk ”. fig8 shows a series of processes performed by the distributor 530 . first , at step s 50 , it is determined whether or not the requested axle torque “ tw ” is equal to or more than a minimal torque “ tptmin ”. this process determines whether or not the requested axle torque “ tw ” can be produced only by the power train . in this regard , the minimal torque “ tptmin ” here is the minimal torque that is available by the engine 10 and the automatic transmission system 14 . if the requested axle torque “ tw ” is equal to or more than the minimal torque “ tptmin ”, the requested axle torque “ tw ” is determined as can be realized only by the power train , and control proceeds to step s 52 . at step s 52 , the requested power train torque “ twpt ” is set as the requested axle torque “ tw ”, while the requested brake torque “ twbk ” is set to zero . on the other hand , if a negative determination is made at step s 50 , the requested axle torque “ tw ” is determined as cannot be produced only by the power train , and control proceeds to step s 54 . at step s 54 , the requested power train torque “ twpt ” is set as the minimal torque “ tptmin ”, and the requested brake torque “ twbk ” is set as a value obtained by subtracting the minimal torque “ tptmin ” from the requested so axle torque “ tw ”. according to the series of processes described above , the actual acceleration of the vehicle can be controlled to the jerk acceleration “ aj ”. in the case where the jerk acceleration “ aj ” changes , the actual acceleration can be properly controlled to the reference acceleration “ am ”. in other words , in the case where the jerk acceleration “ aj ” changes and where the acceleration of the vehicle is feedforward controlled to the jerk acceleration “ aj ”, response delay is caused in the actual acceleration with respect to the change in the jerk acceleration “ aj ”, due to the response delay of the vehicle . however , the actual acceleration estimated from the response delay can be approximated to the reference acceleration “ am ”. in addition , owing to the feedback control , the actual acceleration can be controlled to the reference acceleration “ am ” with high accuracy . the accuracy of the feedforward control described above resultantly relies , for example , on the accuracy of estimating the road surface gradient “ θ ”. in particular , when the accuracy of estimating the road surface gradient “ θ ” is low , the accuracy may be deteriorated in estimating the torque required for controlling the actual acceleration to the jerk acceleration “ aj ”, which may eventually be led to the deterioration in the feedforward controllability . in estimating a road surface gradient , the influence of noises superposed on the detection value of the acceleration sensor 34 and on the differential value of the actual vehicle speed “ v ” are unignorable . to cope with this , the road surface gradient is estimated through the following procedure in the present embodiment . fig9 is a block diagram illustrating the procedure for estimating road surface gradient according to the present embodiment . a first road surface gradient estimator 840 is configured to calculate and output a first estimation value “ accrg ” as a difference between a detection value “ accg ” of the acceleration sensor 34 and a differential value “ accw ” of the actual vehicle speed “ v ”. the difference between the detection value “ accg ” and the differential value “ accw ” is inherently expressed using the road surface gradient “ θ ” as “ g · sin θ ”. however , when the road surface gradient “ θ ” is small , the difference can be expressed by “ g · θ ”. accordingly , the difference between the detection value “ accg ” and the differential value “ accw ” almost equals to a constant multiplication of the road surface gradient ( g - fold of the gravitational acceleration ). a pitch angle estimator b 42 is configured to estimate the amount of rotation in the direction of the rotation angle ( pitch angle “ φ ”) of the lateral axis of the vehicle , based on the requested axle torque “ tw ”. this estimation is carried out considering that the vehicle tilts rearward ( squats ) when the vehicle is accelerated , and the vehicle tilts forward ( dives ) when the vehicle is decelerated . specifically , the pitch angle “ φ ” is considered to be no longer zero during the acceleration or deceleration of a vehicle , and hence the pitch angle “ φ ” can be estimated based on the torque generated by the actuators ( the power train and the brake actuator 20 ). for this reason , the pitch angle “ φ ” is estimated based on the requested axle torque “ tw ”. more specifically , considering that there is a delay for the actual vehicle pitch angle to responsively change according to the axle torque “ tw ”, the pitch angle “ φ ” is estimated , in the present embodiment , using the following primary delay model . where “ kpit ” is a pitch angle gain , and “ tpit ” is a time constant . a pitch angle corrector b 44 is configured to calculate a correction amount for correcting the first estimation value “ accrg ”, based on the pitch angle “ φ ”. since the acceleration sensor 34 tilts in response to the pitch angle “ φ ” of the vehicle , the correction is made considering that , of the acceleration factors sensed by the acceleration sensor 34 , those which are induced by the gravity will be expressed by “ g sin ( θ + φ )”. considering that the first estimation value “ accrg ” here corresponds to “ g · θ ”, the correction amount is set to be “ g · φ ”. a gradient corrector b 46 is configured to calculate and output a second estimation value “ accrgp ” by correcting the output of the first road surface gradient estimator b 40 using the output of the pitch angle corrector 644 . in particular , the gradient corrector b 46 subtracts the correction amount “ g · φ ” from the first estimation value “ accrg ”, that is , corrects the first estimation amount “ accrg ” using the correction amount “ g · φ ”, to calculate and output the second estimation value “ accrgp ”. as a result , the second estimation value “ accrgp ” will be appropriately compensated for the influence of the “ squatting ” and “ diving ” of the vehicle on the detection value “ accg ” of the acceleration sensor 34 . a lowpass filter b 48 is configured to selectively permeate low - frequency components of the second estimation value “ accrgp ” to output a final gradient estimation value “ accrgf ”. particularly , the lowpass filter b 48 is made up of a primary delay filter . more particularly , the lowpass filter b 48 is made up of a filter that uses cut - off frequency “ fc ” and can be expressed by “ 1 /{ 1 /( 2πfc ) s + 1 }”. the cut - off frequency “ fc ” can be variably set through the processes explained below . a lowpass filter b 50 is configured to perform a filtering process of permeating low - frequency components of the first estimation value “ accrg ” to thereby output a delay estimation value “ accrgl ”. the delay estimation value “ accrgl ” expresses the road surface gradient , but when the road surface gradient changes , will be a signal delayed from the first estimation value “ accrg ”, the delay being caused by the filtering process . a gradient change estimator 52 b is configured to calculate and output an estimation value of an amount of change in the road surface gradient ( gradient change estimation value “ δ ”) in terms of a difference between the delay estimation value “ accrgl ” and the first estimation value “ accrg ”. in particular , it is considered that the larger the change in the road surface gradient is , the more the delay estimation value “ accrgl ” is delayed from the first estimation value “ accrg ”. focusing on this point , the gradient change estimator 52 b is adapted to quantify the difference between these values as a gradient change estimation value “ δ ”. a first frequency setter b 54 is configured to set a cut - off frequency “ fc1 ” for determining the cut - off frequency “ fc ” for the filtering process performed by the lowpass filter b 48 . in particular , the cut - off frequency “ fc1 ” is set to a higher value as the gradient change estimation value “ δ ” becomes larger . this is because , if there is a change in the road surface gradient , the delay in the final gradient estimation value “ accrgf ” is likely to be the cause of trouble , which delay is ascribed to the delay effects of the filtering process performed by the lowpass filter b 48 . specifically , considering that the amount of delay is increased as the cut - off frequency “ fc ” is decreased , the first frequency setter b 54 is configured to set the cut - off frequency “ fc1 ” to a higher value , as the delay in the final gradient estimation value “ accrgf ” from the actual gradient is more likely to be the cause of trouble . in other words , a higher value is set for the cut - off frequency “ fc1 ” as the change in the gradient becomes larger . on the other hand , when the change in the road surface gradient is small , the amount of delay in the final estimation value “ accrgf ” from the actual gradient is unlikely to be the cause of trouble . in this case , it is the noises , not the delay in the final gradient estimation value , that are considered to give a larger influence to the estimation accuracy of the road surface gradient , which noises are superposed on the detection value “ accg ” of the acceleration sensor 34 and the differential value “ accw ” of the actual vehicle speed “ v ”. for this reason , the cut - off frequency is decreased as the change in the road surface gradient becomes smaller . in this way , the present embodiment provides a filtering process which establishes a trade - off relationship between the noise removal effects and the responsiveness . specifically , the present embodiment is so configured to variably set the cut - off frequency according to the change in the road surface gradient , and , from hence , to apply an optimal filtering process depending on the degree of contribution of either the noise removal effects or the responsiveness , whichever is larger , to the estimation accuracy of the road surface gradient . a second frequency setter b 56 is configured to switch the cut - off frequency for the filtering process performed by the lowpass filter b 48 , depending on whether or not the automatic transmission system 14 is in the process of effecting switch control for gear ratio . this configuration is based on an idea that , with the switch control for gear ratio , transmission shock is caused , which in turn will trigger the entry of the noises into the detection value “ accg ” of the acceleration sensor 34 , for example . the transmission shock is caused , for example , when transmission of the torque is stopped from the crank shaft 12 of the engine 10 to the drive wheels 16 through the automatic transmission system 14 , or when the conditions of engagement are changed between friction elements , such as the clutch c in the automatic transmission system 14 and the brake . in particular , a cut - off frequency “ fc2 ” under switch control for gear ratio is set lower than a cut - off frequency “ fc3 ” in a steady state where no control is effected for gear ratio . this setting is purposed to enhance the filtering effects and thus to suppress the influence of the noises which are caused in effecting the switch control for gear ratio . a frequency determining section b 58 is configured to determine the cut - off frequency “ fc ” for the lowpass filter 548 , based on the output from the first frequency setter b 54 and the output from the second frequency setter b 56 . in particular , the output value of either the first or second frequency setter b 54 or 556 , whichever is smaller , is set as the final cut - off frequency “ fc ” and outputted to the lowpass filter b 48 . the cut - off frequency “ fc3 ” in the steady state where no switch control is effected for gear ratio , is set to a value equal to or more than the maximum value of the cut - off frequency “ fc ” of the first frequency setter b 54 . this setting is purposed to employ the cut - off frequency “ fc1 ” outputted from the first frequency setter b 54 , as the final cut - off frequency “ fc ”, unless the switch control is being effected for gear ratio . it should be appreciated that the minimum value of the cut - off frequency “ fc1 ” should have been set to an appropriate value by the first frequency setter b 54 , in the case where there is no change in the road surface gradient and no switch control is effected for gear ratio . in other words , the minimum value of the cut - off frequency “ fc1 ” should have been set to a value larger than the cut - off frequency “ fc2 ” used during the switch control of the gear ratio . with the process explained above , the influence of the squatting or diving of the vehicle on the detection value “ accg ” of the acceleration sensor 34 can be compensated by the pitch angle correction amount “ g · φ ”. also , in order to suppress the influence of the vibration transmitted to the vehicle , the process of the lowpass filter b 48 is carried out , with the cut - off frequency for the filter being variably set depending on whether or not the road surface gradient has changed or whether or not the switch control for gear ratio has been conducted . thus , the gradient estimation value “ accrgf ” can be calculated as accurately as possible according to the operating conditions of the vehicle . in this way , high accuracy can be expected in the calculation of the feedforward manipulated variable “ tff ”, which may further be led to the high - accuracy control of the acceleration of the vehicle . it should be appreciated that the gradient estimation value “ accrgf ” corresponds to “ g sin θ ” in the term “ mg sin θ ” at step s 40 shown in fig7 . the present embodiment described above in detail may provide the advantages as provided below . ( 1 ) the second estimation value “ accrgp ” based on the detection value “ accg ” of the acceleration sensor 34 and the differential value “ accw ” of the actual vehicle speed “ v ” has been subjected to filtering process of the lowpass filter b 48 to calculate the gradient estimation value “ accrgf ”. in the calculation , the cut - off frequency “ fc ” for the so filtering process has been variably set according to the operating conditions of the vehicle . thus , the gradient estimation value “ accrgf ” can be calculated with high accuracy in any operating conditions . ( 2 ) the cut - off frequency “ fc ” of the lowpass filter 548 has been variably set based on the information on the change in the road surface gradient , which is outputted from the gradient change estimator b 52 . thus , when the responsiveness in the estimation of the road surface gradient is desired to be enhanced in spite of the changing road surface gradient , the responsiveness can be enhanced by increasing the cut - off frequency “ fc ”. ( 3 ) the gradient change has been estimated based on the difference between the first estimation value “ accrg ” and the delay estimation value “ accrgl ” resulting from the filtration of the first estimation value “ accrg ”. thus , the change in the road surface gradient can be appropriately estimated . ( 4 ) under the switch control for gear ratio , the cut - off frequency “ fc ” has been decreased . thus , the influence quantity of the transmission shock in the estimation of the road surface gradient can be appropriately suppressed . ( 5 ) the pitch angle “ φ ”, i . e . the rotation angler of the lateral axis of the vehicle has been estimated . then , the estimated road surface gradient ( first estimation value “ accrg ”) has been corrected based on the estimated pitch angle “ φ ”. thus , the influence of the pitch angle “ φ ” can be appropriately removed from the estimation of the road surface gradient . ( 6 ) the actual acceleration of the vehicle has been subjected to feedforward control according to the requested acceleration ( jerk acceleration “ aj ”), based on the gradient estimation value “ accrgf ”. thus , the feedforward control can be appropriately performed . as a result , the travel conditions of the vehicle , as well as the ride quality can be improved . under the switch control for gear ratio , the above embodiment has given priority to the removal of noises accompanying the transmission shock , over the enhancement of the responsiveness for the change in the road surface gradient . alternatively , in the case where the change in the road surface gradient is more than a predetermined level , the cut - off frequency “ fc1 ” may be employed as the final cut - off frequency “ fc ”, irrespective of whether or not the switch control for gear ratio is performed . the above embodiment has estimated the pitch angle “ φ ” using the primary delay model by inputting the requested axle torque “ tw ”. alternatively , for example , a secondary delay model may be used . the above embodiment has employed the first estimation value “ accrg ” as the difference between the detection value “ accg ” and the differential value “ accw ” of the actual vehicle speed . alternatively , considering that the above difference corresponds , to be exact , to “ g · sin θ ”, the first estimation value “ accrg ” may be the value expressed by “ arcsin {( difference )/ g }”. also , the first estimation value “ accrg ” may be the value obtained by dividing the above difference with a gravitational acceleration “ g ”. in any case , the pitch angle correction amount in such a case may desirably be the pitch angle “( p ”. the lowpass filters b 48 and b 50 are not limited to primary delay filters , but butterworth filters may alternatively be used . the lowpass filter b 48 to which the cut - off frequency is variably set may be applied to at least one of the detection value “ accg ” of the acceleration sensor and the differential value “ accw ” of the actual vehicle speed “ v ”, instead of applying to the second estimation value “ accrgp ”. the above embodiment has estimated the road surface gradient based on the detection value “ accg ” of the acceleration sensor and the differential value “ accw ” of the actual vehicle speed “ v ”. alternatively , for example , the road surface gradient may be estimated based on the differential value “ accw ” of the actual vehicle speed “ v ” and the acceleration estimated from the torque ( requested axle torque “ tw ”) generated by the actuators of the vehicle . alternatively , the road surface gradient may be estimated based on the detection value “ accg ” of the acceleration sensor and the torque ( requested axle torque “ tw ”) generated by the actuators of the vehicle . the above embodiment has estimated the pitch angle rain from the requested axle torque “ tw ”. alternatively , for example , the pitch angle “ φ ” may be estimated from the differential value “ accw ” of the actual vehicle speed . in the embodiment described above , the reference model has been set based on the response characteristics at the time when the response delay of the actual acceleration is maximized with respect to the step change of the target acceleration . alternatively , for example , the reference model may be variably set according to the response characteristics for every operating condition of the vehicle . also , the reference model is not limited to the primary delay mode , but may , for example , be a secondary delay model . the feedback controller b 24 is not limited to the one that performs pid ( proportional - integral - differential ) control , but may be the one that performs either one of or any two of p control , i control and d control . alternatively , modern control may be used instead of classical control . the feedforward controller b 26 is not limited to the one that performs the processes described above . the feedforward controller b 26 may calculate the feedforward manipulated variable “ tff ” only from the reference force “ maj ”, for example . also , the feedforward manipulated variable “ tff ” may be calculated using either one of or any two of the air resistance , the road surface resistance and the gravity . in the embodiment described above , the two - degree freedom control has been performed . alternatively , for example , only feedforward control may be performed . in the embodiment described above , the model follow - up control so has been performed . alternative to this , the reference model setter b 14 may not be furnished . in the acceleration control in the embodiment described above , the means for imparting positive torque to the vehicle ( more particularly the drive wheels 16 of the vehicle ) has been exemplified by the power train , i . e . motive power generator , including the engine 10 and the automatic transmission system 14 . alternatively , however , a motor may be used , for example , as the motive power generator . also , the automatic transmission system 14 may not necessarily be the one having a planetary gear automatic transmission , but may , for example , be the one having a continuously variable transmission ( cvt ) which is able to adjust the gear ratio in a continuous manner . in the acceleration control in the embodiment described above , the means for imparting negative torque to the vehicle ( more particularly the drive wheels 16 of the vehicle ) has been exemplified by the hydraulic brake actuator . alternatively , however , a generator may be used , for example , which converts the torque of wheels ( drive wheels 16 and the idler wheels 18 ) into electric energy . the apparatus for estimating road surface gradient may not necessarily be applied to the front - rear direction controller m 10 . also , the apparatus for estimating road surface gradient may not necessarily be applied to a vehicle control system equipped with the front - rear direction controller m 10 . the present invention may be embodied in several other forms without departing from the spirit thereof . the embodiments and modifications described so far are therefore intended to be only illustrative and not restrictive , since the scope of the invention is defined by the appended claims rather than by the description preceding them . all changes that fall within the metes and bounds of the claims , or equivalents of such metes and bounds , are therefore intended to be embraced by the claims .
| 1 |
a pallet assembly 10 according to one embodiment of the present invention is shown in fig1 . the pallet 10 generally includes an upper structure 12 and a lower structure 14 . the upper structure 12 includes an upper deck 16 having a generally planar upper support surface 18 and a plurality of column connectors 20 protruding downwardly therefrom . the lower structure 14 includes an integrally molded lower portion 22 including a plurality of columns 24 with runners 26 extending therebetween . fig2 and 3 are front and side views of the pallet assembly 10 . fig4 is a top view of the pallet assembly 10 . fig5 is a bottom view of the pallet assembly 10 . as shown , the lower structure 14 includes a lower reinforcement sheet 30 , shaped to align with the runners 26 and the columns 24 . the upper structure 12 includes an upper reinforcement sheet 32 secured to the bottom thereof . an exploded view of the pallet assembly 10 is shown in fig6 . the upper structure 12 includes the upper deck 16 , reinforcement frame 36 and the upper reinforcement sheet 32 . the reinforcement frame 36 includes a plurality of elongated , hollow rods , preferably having a rectangular cross - section . the rods include peripheral rods 38 forming a periphery of the reinforcement frame 36 and optionally welded to one another . a longitudinal reinforcement rod 40 extends longitudinally along a center of the reinforcement frame 36 between opposite front and rear peripheral rods 38 . a lateral reinforcement rod 42 extends along a center - line between opposite side peripheral rods 38 . optional angled reinforcement rods ( not shown ) may extend diagonally across each of the quadrants formed by the rods 38 , 40 , 42 . the upper reinforcement sheet 32 is generally a planar single piece of plastic extruded as a sheet and having peripheral column openings 46 around its periphery , including the corners , and a central column opening 48 . the lower structure 14 includes the lower portion 22 integrally injection molded as a single piece of plastic including the columns 24 and runners 26 . a lower reinforcement frame 50 includes a plurality of peripheral reinforcement rods 52 around a periphery , which may optionally be welded to one another . a longitudinal reinforcement rod 54 may extend along a center line longitudinally between two opposite peripheral reinforcement rods 52 . a lower reinforcement sheet 30 is generally shaped to align with the bottom of the lower portion 22 . referring again to fig6 , although the pallet assembly 10 is illustrated with all of the reinforcements , the pallet assembly 10 can be configured with various combinations of the reinforcements depending on the application . for example , one configuration might not include any of the reinforcements at all . another configuration would include only the peripheral reinforcement rods 52 and the longitudinal reinforcement rod 54 in the lower structure 14 and only the longitudinal reinforcement rod 40 in the upper structure 12 . another configuration would include the peripheral reinforcement rods 52 and the longitudinal reinforcement rod 54 in the lower structure 14 and peripheral rods 38 , the longitudinal reinforcement rod 40 and the lateral reinforcement rod 42 in the upper structure 12 . another configuration would include the peripheral reinforcement rods 52 and the longitudinal reinforcement rod 54 in the lower structure 14 and peripheral rods 38 , the longitudinal reinforcement rod 40 , the lateral reinforcement rod 42 and the angled reinforcement rods in the upper structure 12 . the various reinforcement rods can be different sizes ( gauge ), depending on the application , as are the channels in the bottoms of the deck and runners for receiving the rods . for example , the peripheral reinforcement rods 38 ( and the corresponding channels in the upper deck 16 ) could have a smaller cross - section ( e . g . ½ ″, which is less than half the total height of the upper deck 16 ) than the other rods and channels ( e . g . ¾ ″). therefore , when the channels are welded shut by the upper reinforcement sheet 32 , the upper deck 16 will be strong with or without the peripheral reinforcement rods 38 . fig7 is an exploded bottom perspective view of the pallet assembly 10 . the upper deck 16 includes a plurality of ribs 56 extending downwardly from the upper sheet 18 . the lower portion 22 also includes a plurality of ribs 58 extending downwardly . a bottom perspective view of the upper deck 16 is shown in fig8 . the plurality of ribs 56 and the column connectors 20 protrude downwardly from the upper sheet 18 . snap - fit connectors may be formed with the column connectors 20 for connecting to the columns 24 in a known manner . peripheral ribs are provided along the periphery of the upper deck 16 . openings are formed between some of the ribs 56 and column connectors 20 to accommodate the upper reinforcement frame 36 ( fig7 ). fig9 is a bottom perspective view of the lower portion 22 in which the columns 24 and runners 26 are integrally molded as a single piece of plastic , such as by injection molding . a plurality of ribs 58 extend downward . openings may be formed through the ribs 58 to accommodate the lower reinforcement frame 50 ( fig7 ). a cross - section of a portion of the upper reinforcement sheet 32 is shown in fig1 . a cross - section of a portion of the lower reinforcement sheet 30 is shown in fig1 . each sheet 30 , 32 includes a pair of coextruded sheets or layers 70 , 72 that may optionally be then die - cut to the shapes shown . the upper layer 70 is formed of a material that matches the material of the upper deck 16 and the lower portion 22 . for example , the upper deck 16 and lower portion 22 may be injection molded of high density polyethylene , and the upper layer 70 may be high density polyethylene . however , “ match ” does not necessarily mean “ identical ”; rather , in this context “ match ” means that matched materials are selected to improve the bond between the two components . the matched materials improve the weld between the upper layer 70 and the upper deck 16 and lower portion 22 via vibration welding or hot plate welding ( or adhesive , etc ). the lower layer 72 is formed of a material with improved fire retardant properties ( such as halogens , metal hydrates , intumescents or other additives ). in a fire , the bottom surfaces of the pallet assembly 10 , including the bottom of the upper deck 16 and the bottom of the lower portion 22 , including the runners 26 is the most important area for fire retardant material . by coextruding the fire retardant material in the lower layer 72 with the upper layer 70 of a material that matches the structure to which the sheet is bonded , a good bond can be obtained while also obtaining good fire retardant characteristics . fig1 is a section view of an optional upper reinforcement sheet 32 and fig1 is a section view of an optional lower reinforcement sheet 30 . each sheet 30 , 32 includes three ( or more ) coextruded sheets or layers 70 , 72 , 74 that may be die - cut or trimmed as needed . again , the upper layer 70 is formed of a material that matches the material of the upper deck 16 and the lower portion 22 . for example , if the upper deck 16 and lower portion 22 are injection molded of high density polyethylene , then the upper layer 70 may be high density polyethylene . the matched materials improve the weld between the upper layer 70 and the upper deck 16 and lower portion 22 via vibration welding or hot plate welding ( or adhesive , etc ). the middle layer 72 is formed of a material with improved fire retardant properties ( such as halogens , metal hydrates , intumescents or other additives ). the lower layer 74 could match the upper layer 70 ( and match the upper deck 16 and lower portion 22 ). alternatively , the lower layer 74 may be another layer of fire retardant material ( which may be the same or different material as that of the middle layer 72 ). as another option , one or more of the layers 72 , 74 could have increased stiffness ( e . g . through additives — in fact , the fire retardant additives increase stiffness too ) which may increase the overall stiffness of the pallet 10 . this may also increase the brittleness of the layers 72 , 74 ; however , because the sheets 30 , 32 are spaced away from the perimeter of the pallet , they will be less subject to impact from fork tines , etc . fig1 is a bottom exploded perspective view of a pallet 110 according to an alternative embodiment . the upper deck 16 and lower portion 22 may be the same as before . the upper reinforcement frame 136 is similar , but only includes ones cross - bar . a lower reinforcement frame is not shown , but could be the same as before . in this embodiment , there are two upper reinforcement sheets 132 secured to the ribs 56 of the upper deck 16 ( again , via vibration or hot plate welding , adhesive , etc ). the upper reinforcement sheets 132 do not cover the upper reinforcement frame 136 , but only cover the two large surfaces of the upper deck 16 between the upper reinforcement frame 136 . on the bottom ribs of the lower portion 22 , a plurality of lower reinforcement sheets 130 ( show optionally overlapping ) are welded or otherwise secured . using the plurality of narrow lower reinforcement sheets 130 in this embodiment reduces the amount of material cut sheet to form the large openings in the single , large extruded of the first embodiment . alternatively , the upper reinforcement sheets 132 and lower reinforcement sheets 130 could be injection molded ( including the numerous apertures formed therein ). in that case , there are several options for achieving improved fire resistance . first , the injection - molded plastic could include some fire retardant additive , such as magnesium hydroxide ( mdh ). second , the injection - molded sheet 130 , 132 could be a twin shot or multi - shot injection , such that the sheet 130 , 132 has a matching upper layer and a fire retardant lower layer formed by different shots in the mold , such that the injection - molded sheets 130 , 132 have an upper layer 70 ( matching ) and lower layer 72 ( fire retardant ) as in fig1 - 11 . the injection - molded sheets 130 , 132 could also have a third layer 74 ( matching or some other property ) as a bottom layer as in fig1 - 13 , with all three layers formed in a multi - shot mold . as a third option , a fire retardant coating could be applied to one side of a mold prior to injection . the plastic is shot into the mold over the fire retardant coating . again , the sheets 130 , 132 include an upper layer 70 ( matching ) and lower layer 72 ( fire retardant ) as in fig1 - 11 . alternatively , the fire retardant layer may be added post injection molding by applying a coating to the bottom side of the injection molded layers ( in which case the lower layers 72 of fig1 - 11 would be the fire retardant coating and the upper layer 70 would be the injection molded layers ). as yet another option , the fire retardant coating layer could also be added to an extruded sheet instead of coextruding the sheets . the fire retardant materials and additives described herein include intumescent type materials , aluminum hydroxide ( ath ) and magnesium hydroxide ( mdh ). in accordance with the provisions of the patent statutes and jurisprudence , exemplary configurations described above are considered to represent a preferred embodiment of the invention . however , it should be noted that the invention can be practiced otherwise than as specifically illustrated and described without departing from its spirit or scope . alphanumeric identifiers in claimed method steps are for ease of reference in dependent claims and do not signify a required sequence of such method steps unless otherwise explicitly indicated .
| 1 |
shown in fig1 is a gas turbine 10 . the gas turbine 10 includes a compressor 12 which provides compressed fluid to a combustor 14 . fuel is injected into the combustor 14 , mixes with the compressed air and is ignited . the hot gas products of the combustion flow to a turbine 16 which extracts work from the hot gas to drive a rotor shaft 18 which in turn drives the compressor 12 . a transition piece 20 is coupled at an upstream end 22 to the combustor 14 at a combustor liner 24 and at a downstream end 26 to an aft frame 28 of the turbine 16 . the transition piece 20 carries hot gas flow from the combustor liner 24 to the turbine 16 . the combustor 14 includes a combustor sleeve 30 spaced radially outward from the combustor liner 24 defining a combustor flow channel 32 therebetween . a combustor cap 34 is coupled to an upstream end 36 of the combustor liner 24 and includes at least one nozzle 38 disposed therein an extending into a combustion chamber 40 defined by the combustor cap 34 and the combustor liner 24 . an impingement sleeve 42 is coupled to the combustor sleeve 30 and is radially spaced from the transition piece 20 defining a transition flow channel 44 therebetween . during operation , discharge flow 46 flows from the compressor 12 through a diffuser 48 to the impingement sleeve 42 . the discharge flow 46 proceeds through a plurality of impingement holes 50 in the impingement sleeve 42 and toward the combustor 14 in the transition flow channel 44 . the discharge flow 46 proceeds from the transition flow channel 44 and through the combustor flow channel 32 until it is finally introduced to the combustor liner 24 through the at least one nozzle 38 . in addition to providing air to the combustor 14 for the combustion process , the relatively cool discharge flow 46 further provides much needed cooling to the components exposed to hot combustion gas , for example , the combustor liner 24 and the transition piece 20 . at the interface between the transition piece and the combustor liner , there is a telescoping fit , where the aft end of the combustor liner is received within the forward end of the transition piece . with reference to fig2 , an annular spring - finger seal 52 , also known as a hula seal , is located radially between the aft end 54 of the liner 24 and the forward end 22 of the transition piece 20 . typically , the spring fingers 56 have uniform widths and extend from a solid end or edge 58 of the seal in an axial direction , uniformly spaced about the circumference of the seal edge , separated by slots 60 as best seen in fig3 . it will be appreciated that the solid edge 58 may be on the upstream or downstream ends of the spring fingers . as in well understood in the art , the seal comprises two or more arcuate segments which , when assembled , form a complete 360 ° annular seal . in exemplary but nonlimiting embodiments of the invention , the hula seal is reconfigured to direct cooling air to specific high - temperature regions of the liner and / or transition piece identified as having “ hot streaks ” related to fuel / air ratio ( far ) and combustion swirling angles . in fig4 , for example , an annular hula seal 62 is formed with discrete groups 64 of two axially - oriented spring fingers 66 , 68 each , at spaced locations about the circumference of the seal . while the spacing between the groups is shown to be substantially uniform , it will be appreciated that the spacing may vary in asymmetric fashion , based on the location of identified hot streaks . in other words , the groups 64 of spring fingers , and just as importantly , the groups of slots 70 between the spring fingers , may be located and arranged so as to preferentially cool any desired region of the aft end of the liner and / or the forward end of the transition piece . seal portions 72 between the groups 64 in fact comprise spring fingers of substantially greater width than fingers 66 , 68 . as such , the larger - width spring fingers may also be used / arranged to divert cooling air away from identified cooler regions of the liner or transition piece toward the hot regions so as to promote cooling uniformity without the need for additional cooling air . fig5 illustrates a further example embodiment of an annular hula seal 74 where the spring fingers 76 and slots 78 are uniformly spaced about the circumference of the seal , but angled relative to a centerline axis cl through the seal to swirl the cooling air passing through the seal . it will be appreciated that the embodiments shown in fig4 and 5 can be combined so that discrete groups of spring fingers and associated slots are angled in the same or different directions to not only swirl the cooling air but to also preferentially cool certain liner and or transition piece regions . here again , spring fingers and slots between the spring fingers can have the same or differential width dimensions . by preferentially targeting specific regions of the adjacent components , ( whether hot or cold ) through unique seal design , more efficient cooling is provided with minimum air flow . minimizing cooling flow , in turn , reduces emissions and increases the service life of the components . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not to be limited to the disclosed embodiment , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims .
| 5 |
hereinafter , an embodiment of the present invention will be described with reference to the accompanying drawings . fig4 is a view showing a concept of relay in a wireless communication system . in fig4 , a communication device ‘ a ’ 410 cannot directly communicate with a communication device ‘ c ’ 430 , but communicates with the communication device ‘ c ’ 430 through the relay of a communication device ‘ b ’ 420 . first , the communication device ‘ a ’ 410 exchanges ad hoc network information with the communication device ‘ b ’ 420 . at the same time , the communication device ‘ c ’ 430 exchanges the ad hoc network information with the communication device ‘ b ’ 420 . since a message needs to be broadcasted to all , the ip layer processing unit 206 instructs the mac layer processing unit 205 at a code that does not require ack communication , e . g ., an address code ‘ 0 ’ and performs a wireless transmission . in the above , if information has been successfully exchanged , it becomes possible that the communication device ‘ a ’ 410 communicates with the communication device ‘ c ’ 430 through the relay of the communication device ‘ b ’ 420 . at this time , since the communication device ‘ a ’ 410 , communication device ‘ c ’ 430 , and communication device ‘ b ’ 420 come to join to the same network , as shown in fig6 , they have unique ip addresses within the same network . fig6 is a view for explaining an ip address when establishing an ad hoc network in the wireless communication system . as to the ip address , the ip layer processing unit 206 determines an address code by , e . g ., the combination of final numbers . the address codes generated by combining unique ip addresses become also unique on the ad hoc network . here , a participation number of the generated address codes are set to 2 and a response order is determined by ascending order of ip addresses . this information is defined as adaptive address code information . the adaptive address code is also set in the mac processing unit 205 . next , the operation of the wireless communication system in accordance with the embodiment of the present invention will be described with reference to fig7 and 8 . fig7 a to 7d are views for explaining adaptive address code information when establishing the ad hoc network in the wireless communication system in accordance with the embodiment of the present invention . fig8 is a view for explaining an arp information update when establishing the ad hoc network in the wireless communication system in accordance with the embodiment of the present invention . in fig8 , an arp information storage unit 826 stores adaptive address code information tables of fig7 b to 7d . when ip layer processing units 513 and 823 exchange the ad hoc network information , the exchange is performed by assigning a mac address and an ip address of the communication device . by using them , when receiving the ad hoc network information , the ip layer processing units 513 and 823 updates arp ( address resolution protocol ) information having combination of the mac address and the ip address . up to this point , it is a pre - process to be executed until a terminal such as a pc transmits an ip packet . next , a process when an ip packet is inputted from a terminal such as a pc to a communication device will be described . when an ip packet is inputted from a terminal such as a pc to a communication device , the ip layer processing units 513 and 823 in the communication device determines whether or not there is relay transmission from the information exchanged on the ad hoc network . the determination of relay transmission is shown in fig9 . fig9 a to 9d are views for explaining relay determination when establishing the ad hoc network in the wireless communication system in accordance with the embodiment of the present invention . for the relay determination , connection information of a wireless section ( hereinafter , referred to as “ link information ”) is used as the content of the ad hoc network information . in this embodiment , since it is known that the communication device ‘ b ’ 420 is connected to the communication device ‘ c ’ 430 as the destination , the communication device ‘ a ’ 410 designates the communication device ‘ b ’ 420 as a relay device . when outputting an ip packet to the mac layer processing unit , a mac address of the destination is set in a case that there is no relay device , and in a case that there is a relay device , a mac address of the relay device is set . at this time , an ip address corresponding to the mac address is extracted from the arp information . the extracted ip address and an ip address of its own communication device are used as search keys to extract a matched address code from the adaptive address code information . the address code is given when the ip packet is inputted to the mac layer processing unit . the mac layer processing unit generates a mac frame based on the given address code and the ip packet , outputs the mac frame to the physical layer processing unit , and performs wireless communication . since the communication device as the destination also holds the adaptive address code information , when the communication device as the destination receives the mac frame , the device determines that the received information is addressed to itself , and transmits ack to the transmission destination , and then sends the received information to the ip layer processing unit . this case is shown in fig1 a and 10b . fig1 a and 10b are a view for explaining relay communication using the adaptive address code in the wireless communication system in accordance with the embodiment of the present invention . in fig1 a and 10b , the arp information storage units 826 and 1016 store the adaptive address code information tables of fig7 b to 7d . relay information storage units 1017 and 1027 store relay information tables of fig9 b to 9d . the communication device ‘ a ’ 410 uses the adaptive address code information shown in fig7 b to 7d and the relay information shown in fig9 b to 9d . from the relay information , it is seen that the communication device ‘ b ’ 420 is used as the relay device to send an ip packet to a terminal # 2 . therefore , the communication device ‘ a ’ 410 selects adaptive address code information ( address code “ 0x0102 ”) constructed between itself and the communication device ‘ b ’ 420 , outputs the selected information to a mac layer processing unit 512 , and wirelessly transmits a mac frame . upon receiving the wireless information , the communication device ‘ b ’ 420 also refers to the adaptive address code information and the relay information , and transmits an ip packet to the communication device ‘ c ’ 430 to send data to the terminal # 2 . at this time , the communication device ‘ b ’ 420 selects adaptive address code information ( address code “ 0x0203 ”) constructed between itself and the communication device ‘ c ’ 430 , outputs the selected information to a mac layer processing unit 522 , and wirelessly transmits a mac frame . then , the communication device ‘ c ’ 430 receives the wireless information . as described above , optimum address code information is constructed and an address code is selected at the time of communication . the wireless communication system in accordance with the embodiment of the present invention can generate address code information with a minimum delay when establishing the ad hoc network . as described above about the present invention in detail , the present invention is useful and available in a wireless communication system . further , it goes without saying that the present invention is not limited to the wireless communication system described herein but can be widely applied to other wireless communication systems . the present application claims priority based on japanese patent application no . 2014 - 244896 filed on dec . 3 , 2014 , the entire contents of which are incorporated herein by reference . 206 , 513 , 523 , 1013 , 1023 , 1033 : ip layer processing unit 514 , 523 , 1034 : ad hoc network processing unit 515 , 525 , 1035 : address code information management unit
| 7 |
fig1 is a schematic illustration of a photoconductor based printing system 100 using an intermediate transfer member according to an exemplary embodiment of the invention . in fig1 a photoconductor drum 10 is illustrated as operative for preparing a latent image for transfer to output . details of the production of the image are substantially irrelevant to the present invention and the process is indicated generally by a block 12 . a wide range of methods known in the art for the production of liquid toner images can be used . optionally , an electrified squeegee roller 14 , as known in the art , is provided to remove excess liquid from the image and to compress the image . optionally , alternatively or additionally , other means for removing excess moisture are used , such as an air knife or other means known in the art . in some embodiments of the invention , the latent image is not transferred directly to an output medium 60 ( e . g . paper or plastic ), but instead it is transferred to an intermediate transfer member ( itm ) 20 , for example in order to protect photoconductor drum 10 and / or to provide a more efficient , controllable process and to improve transfer . in some systems , individual color separations are transferred to the itm and then to the final substrate . in other embodiments , multiple toner images are accumulated on the itm , and transferred as a group to the final substrate . itm 20 is a drum ( or a blanket on a drum ) coated with materials suitable for receiving the toner from photoconductor drum 10 and transferring it to output medium 60 , for example as described in u . s . pat . nos . 4 , 974 , 027 ; 5 , 335 , 054 ; 5 , 276 , 429 ; 5 , 815 , 782 ; 5 , 410 , 392 ; 5 , 592 , 269 ; 5 , 745 , 829 ; 6 , 551 , 716 ; 6 , 584 , 297 ; and pct publication wo 97 / 07433 , the disclosures of which is incorporated herein by reference . in an exemplary embodiment of the invention , a heating roller 80 is coupled to itm 20 , such that it will rotate with itm 20 while forming direct contact , in order to directly heat the toner image on the surface of itm 20 . optionally , heating roller 80 is made from a metal and coated with a substance that is durable to heat , smooth and non - adhesive , for example silicone , condensation cured silicone , teflon , htv and rtv fluorosilicone or other fluoromaterials ; blends of silicone and fluorosilicone , blends of silicone and polyurethane , for example in a range of 10 / 90 to 20 / 80 , of silicone to polyurethane . heater roller 80 preferably heats the toner without degrading the toner image . in an embodiment of the invention , the heater roller is coated with a material that is more replacing than the release coating of the itm . alternatively or additionally , the itm is operated for a number of cycles . operation of an itm generally deteriorates the release properties of the itm , so that the roller is more replacing than the itm . in an exemplary embodiment of the invention , heating roller 80 is heated to a temperature between 60 - 200 ° c . in some embodiments of the invention , the selected temperature of heating roller 80 is a function of the process speed and duration of contact . at a faster process speed contact between heating roller 80 and the toner particles on itm 20 is shorter and a higher temperature is needed . optionally , heating roller 80 comprises an internal heating unit 82 , as known in the art . in preferred embodiments of the invention , contact with roller 80 performs one or more and preferably all of forming the toner articles into a film , removing additional liquid from the image and increasing the transferability of the toner to the substrate . in an exemplary embodiment of the invention , as itm 20 rotates , the heated toner image comes into contact with output medium 60 , which is guided and pressed against itm 20 by a transfer roller 30 . the toner image on itm 20 forms a sharp printout on output medium 60 as a result of its tacky state and from the pressure exerted by transfer roller 30 . in some embodiments of the invention , transfer roller 30 is additionally electro - statically charged in order to cause the toner to be pulled toward the paper during contact . alternatively or additionally , transfer roller 30 is heated in order to assure that the toner is exposed to sufficient heat . the substrate can be pre - heated , for example as described in u . s . pat . no . 6 , 562 , 539 , the disclosure of which is incorporated herein by reference . in this reference , the substrate is heated to a temperature that is below that of the itm at the transfer point , but above room temperature . when used in conjunction with the present invention , the substrate is preferably heated to a temperature that is lower than the temperature of the image . however , it may be heated to a temperature that is above that of the relatively cool itm . in some embodiment of the invention output medium 60 is mounted on transfer roller 30 , in order to form better alignment between the output medium 60 and the toner image on itm 20 . optionally , itm 20 comprises an internal heating unit 40 used to maintain a given temperature level on the surface of itm 20 . this given temperature is lower , optionally 10 , 20 , 30 or more degrees lower than required for complete transfer of the image , without the presence of roller 80 . in some embodiments the itm temperature is only 40 ° c . which is 70 - 80 ° c . lower than necessary in the absence of heating roller 80 . when the itm temperature is low , the toner image does not harden as quickly , if , for example , a malfunction causes the printer to stop . in some embodiments of the invention , internal heating unit 40 supply less than 50 %, 40 % or 30 % of the heat energy for heating the toner image on the surface of itm 20 . the rest of the heat is supplied by directly heating the toner image with heating roller 80 . the roller may be as hot as 130 ° c . to 200 ° c ., although lower temperatures can be used with good effect . in some embodiments of the invention , the total amount of energy needed to heat the toner image to a desired temperature using heating roller 80 is less than 50 %, 60 % or 75 % of the energy needed to heat the image using the methods from the prior art . it should be noted that although heating roller 80 is applied to heat the image toner , some of the heat energy heats the surface of itm 20 by contact between non printed areas and heating roller 80 . however , since the image toner is heated by direct contact the heating efficiency is much greater than in the methods of the prior art . also , the great bulk of the itm , including the bulk of the itm drum , is heated to only a minor degree by roller 80 . the surface of the itm , after transfer of the image to the substrate ( and partly because of cooling by the substrate ) is much lower than it would be in the absence of roller 80 , so that the energy required to maintain this temperature is relatively low , as indicated above . in an embodiment of the invention , in addition to heat and pressure , the roller is electrified with respect to the intermediate transfer member . this electrification has a polarity that presses the toner particles to the intermediate transfer member . thus electrifying the roller has the dual effect of compacting the image and urging the toner from the roller . in general , the toner has a tendency to stick to the hot roller . fig2 is a schematic illustration of an alternative printing system 200 using an intermediate transfer member 20 according to an exemplary embodiment of the invention . in printing system 200 , heating unit 80 is replaced by a belt 90 . belt 90 is optionally mounted on two or more wheels 95 ( an embodiment with three wheels is shown ), to allow coupled motion of belt 90 with itm 20 . in some embodiments of the invention , heating belt 90 provides a larger area of contact between heating belt 90 and the image toner , since it is not limited to a single tangent point of contact such as with heating roller 80 . optionally , heating belt 90 is heated to a lower temperature than heating roller 80 since it is in longer contact with the toner image for transferring heat . alternatively to utilizing a belt , a relatively soft roller 80 is provided , so that a larger nip at its contact with photoconductor 20 is provided . in some embodiments of the invention , heating belt 90 is heated by one or more heating units positioned in wheels 95 . alternatively or additionally , heating belt 90 is heated by one or more heating units 92 positioned in the void covered by heating belt 90 as shown in fig2 . alternatively , the belt may be formed with an internal heater which heats all of its surface or selectively heats only the region of contact ( optionally together with a portion prior to contact ). the present invention has been described using non - limiting detailed descriptions of embodiments thereof that are provided by way of example and are not intended to limit the scope of the invention . it should be understood that features and / or steps described with respect to one embodiment may be used with other embodiments and that not all embodiments of the invention have all of the features and / or steps shown in a particular figure or described with respect to one of the embodiments . variations of embodiments described will occur to persons of the art . it is noted that some of the above described embodiments may describe the best mode contemplated by the inventors and therefore include structure , acts or details of structures and acts that may not be essential to the invention and which are described as examples . for example , the invention is described with reference to particular types of toner . the invention is usable with other types of known toners . furthermore , the invention is described in the context of using a “ photoconductor ” to form the image . however , the invention is not limited to electrophotography or to any particular method of forming the image . structure and acts described herein are replaceable by equivalents which perform the same function , even if the structure or acts are different , as known in the art . therefore , the scope of the invention is limited only by the elements and limitations as used in the claims . when used in the following claims , the terms “ comprise ”, “ include ”, “ have ” and their conjugates mean “ including but not limited to ”.
| 6 |
a first embodiment of the instant invention may consist of two parts , the socket 30 and the handle assembly 31 . the socket 30 , seen in fig1 and 5 , may be a hollow cylinder that may have axially fluted interior walls . the fluting 32 may provide a good grip on nuts and bolts having different shapes , i . e ., square or hexagonal . an example of a hexagonal nut 36 within the socket 30 may be seen in fig5 and 6 . the handle assembly 31 may have a solid cylindrical head 33 with fluting 34 on its outer surface which may cooperate with and complement the fluting 32 of the interior of the socket 30 . the head 33 may be attached to one end of a shaft 35 . the shaft 35 may be affixed to the head 33 by welding or other means known in the art . the head 33 and shaft 35 may also be of singular construction . see fig2 , 3 and 4 . the head 33 may be inserted into the top of the socket 30 to form a socket wrench . to use the wrench the socket 30 may be placed over the nut 36 or bolt ( not shown ) and the head 33 of the handle assembly 31 inserted into the top of the socket 30 . the shaft 35 may be rotated in one direction as far as possible , then the head 33 lifted until it may be separated from the socket 30 so the shaft 35 may be rotated to the starting position , reseated in the socket 30 and rotated again . these steps may be repeated until the nut or bolt is tightened sufficiently or removed , as needed . the smaller the available turning arc , the more often these steps must be repeated to complete the task . the fluted interior of the socket and exterior of the head may enable use of this wrench when only a very small turning arc is available . a second embodiment of the instant invention may also consist of a hollow cylindrical socket 40 and handle assembly 41 . referring to fig7 , the socket 40 may be divided into two interior compartments , an upper compartment and a lower compartment , by means of a transverse partition 46 . the interior walls of both compartments may be fluted . the fluting 42 of the upper compartment may have the same tooth size and arrangement as in the lower compartment , or it may be different , according to usage and method of manufacture . there may be a depression or opening 47 with threaded walls centrally located on the upper surface of the partition 46 . alternatively , a threaded nut or small cylinder ( not illustrated ) may be welded to the center of the partition . the handle assembly 41 may also consist of a solid cylindrical head 43 with a fluted 44 outer surface and a shaft 45 . there may be a smooth bore 48 through the end of the shaft 45 and extending through the center of the head 43 . fig8 and 9 . a pin 37 having one threaded end 38 and one flattened end forming a stop 39 ( fig1 ) may be a part of the wrench . the pin 37 may be inserted downwardly through the bore 48 and fastened into the opening 47 in the partition 46 by mating the threading 38 of the pin 37 with the threaded wall of the opening 47 in the partition 46 . the length of the pin 37 may be slightly greater than the sum of the thickness of the shaft 45 , the depth of the head 43 , and the depth of the upper compartment of the socket 40 . the diameter of the pin 37 may be slightly smaller than the diameter of the bore 48 so that the pin 37 may be easily inserted through the bore 48 and so that the head 43 may be smoothly moved upward and downward while the pin 37 remains fixed in the opening 47 in the partition 46 . the stop 39 of the pin 37 may be larger than the bore 48 so that the head 43 may not slip off the end of the pin 37 . the pin 37 may be used to prevent the head 43 from becoming completely disengaged from the socket 40 and so the head 43 may be quickly and accurately reinserted into the socket 40 for greater efficiency during use . in operation , the head 43 may be set into the upper compartment of the socket 40 where the fluting 44 of the head 43 and the fluting 42 of the socket 40 may be in intimate cooperation . the pin 37 may be inserted through the bore 48 and held in place by means of the treaded opening 47 . the socket 40 may be placed over the nut or bolt to be manipulated and the shaft 45 rotated as far as space may permit . the handle assembly 41 may then be lifted upward until the fluting 44 of the head 43 is no longer in cooperation with the fluting 42 of the socket 40 while the pin 37 may prevent complete separation of two components . the shaft 45 may then be rotated in the reverse direction and the head 43 lowered back into the socket 40 . these steps may be repeated as many times as necessary until the nut or bolt is as tight as desired or as loose as desired . a third embodiment of the instant invention may be the most efficient when operating in a limited space . a socket 50 may be constructed in a similar manner to socket 40 , having a partition 56 separating the interior into two compartments . there may be a threaded depression or opening 57 in the center of the upper surface of the partition 56 . the lower compartment may have fluting 59 as previously noted . however , the fluting 52 in the upper compartment may converge inwardly toward the partition 56 . see fig1 and 12 . to accommodate the converging fluting 52 in the upper compartment , the handle assembly 51 may be altered accordingly . the head 53 of the handle assembly 51 may be frusto - conical in shape and may have fluting 54 on its exterior surface to cooperate with the converging fluting 52 of the upper compartment of the socket 50 . there may be a bore 58 through the end of the shaft 55 of the handle assembly 51 and through the head 53 as seen in fig1 . a pin 60 with a threaded end 61 may be disposed within the bore 58 and screwed into the threaded opening 57 in the partition 56 of the socket 50 . the socket 50 and handle assembly 51 form a wrench that is operable as described above . however , the inward sloping fluting 52 and frusto - conical head 53 , enable the user to reset the wrench by merely lifting the handle assembly 51 a very small distance above the socket 50 . this dissociates the two components sufficiently to rotate the handle assembly 51 in either direction and reinsert it into the socket 50 . these steps may be repeated as necessary and the turning arc may be as great or as small as the working space permits . the pin 60 of the third embodiment 50 need only be slightly longer than the thickness of the shaft 55 and the depth of the head 53 taken together . a small turning arc a may be seen in fig1 , while a larger turning arc b is illustrated in fig1 . when the straight sided socket 40 is used , the head 43 must be lifted upward a distance equal to the full depth of the head 43 , the distance c as seen in fig1 , before the head 43 may be reinserted . the advantage of the alternately shaped system of the third embodiment may be evident in reviewing fig1 which may illustrate the small distance d the head 53 must be lifted to disengage the two components before rotating and reseating the head 53 . to further increase the efficiency of the wrench , a compression spring 62 may surround the lower portion of the pin 60 extending beyond the bottom of the head 53 . a washer 63 may be placed against the spring 62 before the pin 60 is screwed into the threaded opening 57 in the partition 56 of the socket 50 . the pin 60 may have a flattened or enlarged stop 64 at the top so the head 53 may be restrained by the pin 60 from becoming completely separated from the socket 50 even under the tension of the spring 62 . see fig1 and 15 . to operate the wrench composed of socket 50 , handle assembly 51 , and pin 60 with the spring 62 , the components may be put together as illustrated in fig1 . the socket 50 may be placed over the nut or bolt to be rotated and the shaft 55 pressed downward to engage the flutings 52 and 54 . the shaft 55 may then be rotated to the left or right as needed and through the turning distance or arc as permitted by the accessible space . when rotated as far as possible the pressure on the shaft 55 may be released so that the spring 62 forces the head 53 upward . the length of the pin 60 may be dimensioned to permit the head to be raised just far enough to disengage the fluting 54 of the head 53 from the fluting 52 of the socket 50 . the frusto - conical shape of the head 53 and the corresponding shape of the upper compartment of the socket 50 may enable a very short distance d through which the head 53 must be raised to disengage the head 53 from the socket 50 . see fig1 . once the flutings are disengaged the user may rotate the shaft in either direction as far as permitted by the available space and thereafter press the shaft 55 downward to re - engage the components . the above described steps may be repeated until the nut or bolt is tightened sufficiently or removed . it should be noted that if the socket 40 and handle assembly 41 of the second embodiment are used with the pin 37 , a spring and washer may be used also . for these components , the pin 37 , as noted above must be long enough to raise the head 44 above the socket 40 in order to disengage the flutings , with or without the assist of the spring . see fig1 . the fluted socket may enable one socket to accommodate a variety of nuts and bolts of different shapes and , within limitations , different sizes . one single handle assembly may be used with more than one socket as long as the upper compartments of the sockets are of the same dimensions and have the same fluting arrangement to cooperate with the fluting of the head . the socket may then have a lower compartment with a smaller diameter to accommodate smaller nuts and bolts as seen in fig2 , or a lower compartment with a larger diameter as seen in fig2 to accommodate larger nuts and bolts . the wrench may be sold in combinations with one handle assembly and several sockets . there may be more than one such wrench combination to accommodate most common nut and bolt sizes . at times the nut or bolt to be rotated may be recessed in such a way that the handle assembly cannot reach into the area . an extender 65 may be used with the wrench . a typical extender 65 seen in fig2 may have a female cylindrical upper member 66 of comparable dimensions as the upper compartment of the socket and having the same fluting 67 . one end of a rod 68 may be affixed to the underside of the upper member 66 and the other end of the rod 68 may be affixed to a solid cylindrical male member 69 . the male member 69 may have fluting 70 about its outer surface to cooperate with the fluting of the upper compartment of the socket . in operation , the male member 69 of the extender 65 may be inserted into the upper compartment of the socket so that the user may extend the socket into the recessed area and place it over the nut or bolt to be rotated . to insure that the socket does not separate from the extender 65 a spring loaded ball 71 or other retention means known in the art may be placed within a recess in the male member 69 to hold it in place within the socket . the handle assemblies 35 and 45 described above may be used with the extender 65 in the described manner . handle assembly 51 may require the interior fluting of the upper member of the extender to converge downwardly so as to accommodate the head 53 , and the male member to be frustoconical in shape . when the nut or bolt to be rotated may be situated within a recess with insufficient room to permit any rotation of the handle assembly an alternate handle assembly may be used . one type of alternate handle assembly 72 may be seen in fig2 . a configured rod 73 may have a u - shaped section 74 near the top . there may be hand grip 75 rotatably affixed to the top of the rod 73 . a solid cylindrical male member 76 with fluting 77 about its outer surface may be affixed to the bottom of the rod 73 . in operation , the male member 76 may be inserted into the upper compartment of the socket in the same manner as noted above for the extender 65 . to insure that the socket does not separate from the male member 76 , a spring loaded ball 78 or other retention means known in the art may be placed within a recess in the male member 76 . the combination unit may then be lowered to the site of the nut or bolt to be rotated and placed over the nut or bolt . the hand grip 75 may be held in one hand and the vertical portion 79 of the u - shaped section of the rod 73 may be held in the other hand . the rod 73 may then be rotated using both hands and the nut or bolt may be rotated with it . this alternate handle assembly 72 may also be used when a nut or bolt is resistant to rotation when only a small rotation arc is available , since the added leverage obtained by the use of two hands may provide an advantage . also , continued rotation may be possible when using the alternate handle 72 since it may not have to be reset after each rotation . a similar alternate handle assembly with a frustoconical male member may be used with the socket 50 of the third embodiment . the various embodiments of the sockets of the instant invention may be manufactured from one single cylinder , more especially socket 30 . the other embodiments , sockets 40 and 50 may be made from one piece or they may be made from two sections welded together with the partition welded between the two sections . it may also be noted that the wrench may be made with an alternate socket 80 which may have a male member 81 as its upper section and a female member 82 as the head of the handle assembly 83 . a set of two or more sockets with different sized lower compartments may be accommodated by the same handle assembly 83 . while several embodiments of the instant invention have been illustrated and described in detail , it is to be understood that this invention is not limited thereto and may be otherwise practiced within the scope of the following claims .
| 1 |
the drawing shows part of an annealing lehr 1 having refractory roof and sole walls 2 and 3 , along which a freshly formed glass ribbon 4 , supported on rollers 5 , is conveyed in the direction indicated by arrow 6 , from a ribbon forming section ( not shown ) of the flat glass manufacturing plant . the ribbon may for example be formed by a libbey - owens type glass drawing machine , or it may be formed by the float process . the glass ribbon passes beneath a refractory screen 9 to a coating station within the lehr . above the coating station there are fixed rails 15 which extend transversely across the top of the lehr and form a track for a carriage 16 . the carriage has rollers 17 which run along flanges of the said rails . the carriage supports a vertical tube 18 within which there are conduits such as 19 for conducting compressed air and a liquid coating material , e . g . a solution of a coating precursor compound , to a spray gun 20 which is carried by the tube 18 . driving mechanism ( not shown ) displaces the carriage 16 to and fro along the rails 15 so that the spray gun 20 travels to and fro transversely across the path of the glass ribbon 4 . the coating solution discharges from the spray gun as a steady conical spray cone 21 . the coating precursor is transformed on contact with the hot glass ribbon into the required metal oxide or other coating substance , with which the ribbon becomes progressively coated over its entire width during its travel through the lehr . ducting 22 extends through the roof 2 of the lehr , rearwardly of the track rails 15 , for conducting pre - heated gas into the lehr for heating the spray 21 in accordance with the present invention . the ducting 22 may comprise a single duct of flat elongate cross - section which extends over substantially the full width of the lehr , or it may comprise a plurality of ducts disposed side by side across the lehr . the lower end portion 23 of the ducting is disposed substantially horizontally and at a level such that the current or currents of pre - heated gas which issue from the discharge end orifice or orifices 24 of the ducting and is or are represented by the dotted lines 25 , intersect ( s ) the spray 21 at a medial region of the droplet trajectories during the reciprocation of the spray across the ribbon path . the gas current or currents can be pre - heated to a temperature above or below the normal environmental temperature at the coating station so that such current ( s ) heat or cool the droplets during their travel towards the glass ribbon . it is preferable for the ducting 22 to comprise a plurality of side by side ducts as above referred to and for heating means , e . g . electrical resistance heaters , to be provided by which the volumes of gas supplied through the different ducts can be independently heated to different temperatures . it is then possible to modify the temperature of the droplets of spray cone 21 to an extent which varies during any given traversal across the ribbon of glass . compensation can thereby be made for any residual inequalities in the temperature of the glass across the width of the ribbon , and for any accelerations and decelerations of the spray gun during each traversal of the spray cone across the ribbon , with a view to forming a coating which is of substantially uniform thickness over that width . gas discharging from the ducting 22 out of line with the spray 21 flows forwardly across the transverse path of such spray and assists in keeping that path free from vapours which may become entrapped in the spray and adversely affect the quality of the coating , as is described in the co - pending patent application ser . no . 228 , 232 claiming priority from united kingdom patent application no . 80 , 03 , 382 previously referred to . the rate of discharge of pre - heated gas from the orifice or orifices 24 is such that the spray cone 21 is not disrupted by the gas jets . the droplet trajectories are not significantly affected . at positions spaced forwardly from the path of transverse motion of the spray cone 21 across the ribbon there are exhaust ducts 26 which extend across the lehr and are connected to means ( not shown ) for maintaining suction forces in those ducts . the object of this exhaust system is to cause gases in the environment of the spray to be aspirated forwardly away from the path of reciprocation of the spray and into the entry nozzles 27 of the exhaust ducts , as suggested by the broken lines 28 , and thereby reduce the risk of spurious surface deposits on the formed coating . the suction forces are adjusted so that the trajectories of the droplets from the spray gun are substantially unaffected and the process is therefore in accordance with the invention described and claimed in united kingdom pat . no . 1 , 523 , 991 hereinbefore referred to . in addition to influencing the temperature of the spray droplets , the pre - heated gas currents issuing from the ducting 22 intercept or dilute some reaction products which may contaminate the environment behind the spray and be entrained downwardly into contact with the glass immediately before it is coated by the spray 21 . this action , which is described and claimed in the aforesaid co - pending patent application ser . no . 228 , 233 claiming priority from united kingdom patent application no . 80 , 03 , 359 , can however better be achieved by propelling currents of gas against the glass ribbon immediately to the rear of the impingement zones of the spray so that such currents flow against the bottom region of the spray cone . the illustrated apparatus can be modified by providing the ducting 22 with branch nozzles 29 as shown in broken lines so that rear gas currents acting in that manner are formed by some of the pre - heated gas supplied to the ducting 22 . the following are examples of processes according to the invention performed with the aid of apparatus as above described . coating apparatus as described with reference to fig1 was employed for coating a ribbon of glass 3 meters in width in course of its travel along an annealing lehr from a libbey - owens type glass drawing machine . the speed of the glass ribbon along the lehr was of the order of 1 meter per minute . the mean temperature of the glass ribbon at the coating station was about 600 ° c . the temperature of the marginal zones of the glass was appreciably lower than that of the central part of the ribbon width . the spray gun 20 was of a conventional type , and was operated at a pressure of the order of 4 kg / cm 2 . the gun was displaced to and fro across the ribbon path at a height of 30 cm above the glass ribbon , so as to complete nine reciprocations per minute along a path extending just beyond each side edge of the ribbon . the spray gun was directed so that the axis of the spray was at 30 ° to the plane of the glass ribbon . the spray cone angle was 20 °. the spray gun was fed with an aqueous solution of tin chloride at 25 ° c ., such solution having been formed by dissolving hydrated tin chloride ( sncl 2 2h 2 o ) in water in an amount of 375 g of the tin chloride per liter and adding per liter 55 g of nh 4 hf 2 . the rate of delivery of the coating solution was adjusted to form on the glass ribbon a coating of tin oxide doped by fluorine ions and having a thickness as near as possible to 7500 a . the suction forces in the exhaust ducts 26 were adjusted to maintain a continuous flow of environmental gases away from the path of the spray cone as suggested by arrows 28 in the drawing without disrupting the spray cone . the ducting 22 comprises ten side by side ducts covering equal portions of the ribbon width . the axes of the discharge end portions 23 of the ducts were 15 cm above the top face of the glass ribbon and the discharge orifices 24 were at a horizontal distance of 25 cm from the path swept by the rear of the travelling spray cone . pre - heated air was supplied to the ducting at a temperature such that an air current discharged from each orifice 24 at a temperature of the order of 600 ° c . the hot air was supplied to the ducting at a volume rate of about 1800 m 3 / hr to maintain from each of the ten ducts a jet 25 having a velocity of 2 m / sec . the pre - heating temperatures of the volumes of gas supplied through the ten ducts were independently adjustable in steps of 20 ° c . and the temperatures of the different volumes were independently adjusted to values such that the coating formed on the ribbon had a substantially uniform thickness across the full width of the ribbon notwithstanding the temperature gradients across the ribbon on reaching the coating station . the coating thickness at various places across the ribbon was continuously detected at a position within the lehr downstream from the exhaust ducts 26 using a laser beam and a sensor responsive to laser beam reflection , and signals from such sensor were used automatically to control the temperatures of the gas jets . in the result the coating thickness was at all positions across the ribbon 7500 a ± 200 a . in a comparative test in which the process was performed without employing the pre - heated gas jets but under otherwise unchanged conditions , the coating formed on the substrate was found to be thinner on side marginal portions of the ribbon than on its central portion . the variation in the thickness of the coating from the required value of 7500 a could not be reduced below ± 500 a . by pre - heating the gas supplied to ducting 22 to lower temperatures , e . g . to temperatures of the order of 120 ° c ., the rate of evaporation of the solvent can be reduced , thereby leading to thinner coatings . in another modification of the process according to example 1 , ducting 22 was used which had branch nozzles 29 via which a quantity of the pre - heated gas was discharged as downwardly inclined jets which impinged on the glass ribbon just to the rear of the path of the spray cone and flowed against the bottom of the spray cone during its movements across the ribbon . a comparison of the glass coated under those conditions with the glass coated without the influence of such downwardly inclined rear gas jets showed that those jets were beneficial for avoiding or reducing the occurrence of light - diffusing defects at the glass / coating interface . a coating process according to the invention can be carried out by using the apparatus shown in fig1 as in the foregoing example with the sole modification that the glass ribbon travels in the opposite direction to arrow 6 . in those circumstances the droplet stream is directed downwardly and rearwardly within the meaning of this specification . the apparatus shown in fig1 was used for coating a ribbon of float glass 2 . 5 meters in width with cobalt oxide during travel of the ribbon along the annealing lehr at a speed of 4 . 5 m / min . the spray gun was fed with a solution obtained by dissolving cobalt acetylacetonate co ( c 5 h 7 o 2 ) 2 2h 2 o in dimethylformamide in an amount of 140 g of the acetylacetonate per liter of the solvent . the gun was directed at an angle of 30 ° to the plane of the glass ribbon and was located 25 cm above the ribbon and at a position in the lehr such that the droplets of the sprayed solution impinged on the glass ribbon where the glass had a mean temperature of the order of 580 ° c . the spray gun was reciprocated at ten complete reciprocations per minute . the rate of discharge of the coating solution was adjusted to form on the glass a coating of cobalt oxide ( co 3 o 4 ) having a thickness as near as possible to 920 a . the ducting 22 comprised ten side by side ducts having their discharge orifices 24 located below the path of the spray gun and 10 cm above the glass ribbon . hot air pre - heated to 350 ° c . was supplied through this ducting 22 at a volume rate of 1500 m 3 / hr to form the side by side currents of air 25 with a velocity of 2 m / sec . the temperatures of the air currents were independently regulatable in steps of 20 ° c . and regulation was effected in dependence on signals from a coating thickness detector as in example 1 in order to keep the coating thickness an uniform as possible over the width of the ribbon . it was found that a coating could be formed which had a thickness of 920 a ± 50 a over the full width of the glass ribbon . in a comparative test in which the spray was not heated by gas currents but which otherwise employed the same conditions , it was found to be impossible to obtain a coating having such a high standard of uniformity . by heating the air supplied to ducting 22 to lower temperatures , e . g . to temperatures of the order of 150 ° c . regulatable in steps of 10 ° c ., the rate of evaporation of the dimethylformamide from the droplets and the rate of decomposition of the acetylacetonate can be decreased , thereby leading to thinner coatings . the foregoing coating procedures can be followed for forming coloured layers composed of a mixture of oxides by feeding the spray gun with a solution containing a mixture of compounds of different metals , e . g . compounds of metals selected from the group iron , cobalt , chromium and nickel , or by making use of a plurality of spray guns and feeding different solutions simultaneously through different guns .
| 2 |
in fig1 and 2 there are illustrated the bag opening horns 54 and 55 . particularly , in fig1 the operator &# 39 ; s hand ( shown in fragment ) is shown inserting a chicken carcass into a top open - ended bag , supported upon a bag elevator . as the bag is filled , the operator advances bag and carcass against hocking plate 161 , pivoted between upright sides 160 , so as to activate air terminal valve 156 . table top 64 and horns 54 , 55 are then retracted axially away from the package , which is then removed by the operator for shrinking , freezing or other final packaging operation . in fig2 which is a top plan , table top 64 is shown fragmentarily , while the bag elevator is illustrated as having rear guide vertical members 100 , rear slide top cross member 102 , as well as cam track side plates 80 and 81 . the bag supply support plate 106 is urged upwardly by the lift cylinder 87 ( illustrated in fig3 ). the elevator assembly may also include a back mounting plate 79 . the bag opening horns 54 , 55 are mounted by means of identical horn retainer pins 56 which extend into horn opening adjusting holders 47 , each in turn being mounted upon t - slot plates 45 and 46 , the plates being mounted , as illustrated in fig5 and 6 upon transversely extending rods 33 or the like . horns 54 , 55 are extended transversely by means of longitudinal reciprocation of the triangular cams 154 , 155 contacting the complementary plates 152 , 153 , as cam 157 cylinder is actuated . horn 55 and / or 54 may include a moving air jet spacer arm 52 , having a movable air jet mounting block 53 . the frame assembly which supports the reciprocable table top 64 , may include side plates 108 . in fig3 there is illustrated the bag elevator lift cylinder 87 , axially aligned with the bag opening horns 54 , 55 . the longitudinally reciprocable table top 64 is shown superposed with respect to initial opening jet cover 105 and table top support gusset 115 . the apparatus frame may include corner posts 9 and , vertical members 11 and 12 superposed with respect to corner attaching plates 8 and 6 and leg assembly 3 . crossslide rod 33 is shown as supporting bushing 35 , bushing mounting block 34 and the individual t - slot plates 45 and 46 with respect to cam plate base 38 and transverse bars 39 and 40 . the table top bushing mounting block 24 is shown supporting longitudinal carriage 21 in bushing snaprings 25 for the table reciprocating or advancing cylinder 165 . in the elevator assembly cylinder 87 is mounted upon lower pivot pin 85 secured by cotter pins 84 and 86 . the elevator assembly back mounting plate 71 is shown with respect to front slide vertical member 98 . the elevator lift arm pivot mounting bracket 91 is illustrated with respect to lift arm pivot pin 92 and front slide vertical members 97 , 98 . lift arm slide rollers 95 are secured to the vertical members by means of slide roller shaft 96 . the lift cylinder 87 shaft includes a lift cylinder upper clevis 88 which engages upper pivot pin 89 . this mechanism is illustrated in phantom at the lefthand side of fig7 . in fig4 there are illustrated side plates 108 , 109 and top plate 110 supported with the frame . an air pressure manifold 114 is shown in phantom , as secured in support gusset 115 , and connectable with a plurality of pressure regulators 116 . an air pressure on - off selector switch 131 may be provided for activating the entire system . air support elbow 119 supports air control system crossnipple 128 and air supply tube 121 . an access door 130 may be provided between side plates 108 and 109 . the primary air filter 122 is supported between air supply tee 121 , and adjacent air supply tee 123 . a 0 . 01 micron coalescing air filter 124 is shown adjacent bag opening jet air supply tee 125 . a filter system support plug 126 may also be employed . a logic assembly module base , generally illustrated at 129 may be provided for activating the various reciprocating cylinders and pressurized air valves . at the right hand side of fig7 the air control assembly is further illustrated as including a control panel backplate 107 , supply line mounting plate 120 and air supply conduit 118 . the logic elements 140 and 142 are shown supported above logic valve 141 and logic assembly standoff 142 , secured by logic base strap 145 . functional control pressure regulator manifold 114 , secured by means of bottom gusset 113 . a logic manifold 146 is shown , in phantom . also illustrated in fig7 is rear end table top run out protective cover 134 which is stationary . in the mid - section of fig7 table top 64 is shown supported above table top support cross member 61 , top gusset 115 and support upright 62 . a lower support gussett 63 may also by employed to secure the entire mechanism adjacent carriage assembly base plate 28 . a limit valve mounting bracket 76 may also be employed together with valve mounting bracket 67 and mounting bar 69 , as well as power valve mounting bracket 68 and mounting bar 70 . cam slide driving cylinder front mounting plate 58 is shown adjacent the cylinder 157 . initial opening jet orifice block 104 is shown positioned adjacent initial open jet cover 105 . air jet spacer arm 52 is shown adjacent moving air jet mounting block 53 , the pressurized air for bag opening was diverted through air jet quick disconnect valve 150 and coupler 151 . initial opening jet orifice block 104 and initial opening jet cover 105 are illustrated in phantom . for the purposes of poultry packaging , it is assumed that a source of pressurized air is provided for maintaining a constant 80 p . s . i . air supply to the air supply tube 121 . 1 . the operator takes a wicket load of bags , removes the two ( 2 ) rubber grommets retaining the bags on a conventional wicket ( not illustrated ) and inserts the two legs of the wicket into the proper holes in the elevator lift slide and straightens the bags on bag support plate 106 . 2 . the operator places the &# 34 ; run / stop &# 34 ; toggle selector valve in the &# 34 ; stop &# 34 ; position and then slides the &# 34 ; main air supply sleeve valve &# 34 ; into the &# 34 ; open &# 34 ; or &# 34 ; full forward &# 34 ; position . this supplies air to the entire machine causing the following things to occur : a . the bag elevator rises to its uppermost position , locking the cross - bar of the wicket against the bag opening air blast plate . when the bag elevator is fully up , the operator moves the &# 34 ; run / stop &# 34 ; toggle selector valve to the &# 34 ; run &# 34 ; position . the following actions occur : a . the bag opening air blast is turned on , blowing open the top bag on the elevator . c . after an adjustable delay , the table top carriage moves forward . this was accomplished because when the run / off selector valve was moved to the &# 34 ; run &# 34 ; position , the automatic air circuit was then pressurized to the supply port on each of the limit valves in the circuit . the rear most limit valve ( lv - 1 , not illustrated ), which is &# 34 ; normally closed &# 34 ; is held open by the limit valve activator for air to flow through it to pressurize the pilot port on the horns open and close power valve , which causes the horns 54 , 55 to close , if not already closed , as is the case on initial start - up . it also supplies air to the time delay valve ( td - 1 , not illustrated ) which controls the signal to make the carriage movement power valve to shift to move the the horns into the opened top bag . this occurs after the time set on the timer allows the control valve portion of the timer to allow air to pass to the pilot port on the carriage movement power valve , which controls forward motion on the carriage . the carriage moves full forward causing the limit valve activator bar to depress the full forward limit valve ( lv - 2 ) and releasing limit valve ( lv - 1 ). a . lv - 2 is now allowing air to flow to the opposite side of the bag opening power valve pilot port , thus shifting the spool to the &# 34 ; off &# 34 ; position stopping all air flow to the bag opening jets and blast nozzle . b . it also pressurizes the pilot port on the horns &# 34 ; open / close &# 34 ; power valve to shift that valve to the horns open ( or stretch ) position . c . it further sends a signal to the elevator &# 34 ; up &# 34 ; air supply line control valve shutting off the air supply to the elevator lift cylinder , and to a time delay valve ( td - 2 ) which controls the amount of air to be bled out of the elevator lift cylinder to control the amount of &# 34 ; drop &# 34 ; which will occur before the timed valve closes , stopping the air from further bleeding out of the elevator lift cylinder . this elevator drop is a feature used to release the bag wicket cross - bar from the bag opening jet plate , a controlled amount , to prevent locking the portion of each individual bag from being torn off between the wicket holes in each bag and leaving a slug of plastic film which prevents proper opening of the next bag as well as the possibility of introducing those slugs into bags further down in the stack . 3 . the machine is now ready with the bag to be filled stretched open , the air blast turned off and the elevator dropped to its proper position . the operator procures the product to be loaded into the bag , usually a &# 34 ; whole fryer &# 34 ;, by its two legs , places it on its back with the wings between the &# 34 ; lead - in &# 34 ; portion of the two horn blades which have entered and are holding the bag in its stretched open position proceeds to push the chicken into the bag until the chicken and bag press against the swinging &# 34 ; hocking plate &# 34 ;. when the chicken first presses against the swinging &# 34 ; hocking plate &# 34 ;, the pivoting action of the plate depresses limit valve ( lv - 4 ) which sends a signal to the pilot port on the carriage movement power valve which shifts its spool to cause the carriage to move back , pulling the horns out of the loaded bag as the operator finishes &# 34 ; hocking &# 34 ; the chicken . backward movement of the carriage causes the limit valve activator bar to release limit valve ( lv - 2 ) which releases the air pressure holding the &# 34 ; elevator up &# 34 ; blocking valve , allowing it to open and let air return to the elevator lift cylinder to the &# 34 ; full up &# 34 ; position and to reset the elevator lift cylinder bleed valve time delay valve . the operator now lifts the loaded bird out of the &# 34 ; hocking station &# 34 ; and either ties and trims the bag at an attachment mounted on the machine or places it on a conveyor or other device of the processors choosing and the bag is &# 34 ; tied and trimmed &# 34 ; down stream from the loader . 4 . the return of the carriage automatically causes the limit valve activator bar to first trip or open lv - 2 which starts the bag opening air flowing again and when fully back trips or opens lv - 1 to start a new cycle . in the event of a &# 34 ; hocking station &# 34 ; is not used or the horns fail to enter and open the bag or a defective bag tears and allows the horns to move fully open , an activator on the horn opening slide , trips or opens a limit valve ( lv - 4 ) which sends a signal to the carriage movement power valve causing it to shift its spool to make the carriage to move back . both lv - 4 and or lv - 5 cause the same action . cylinder speed for both the carriage movement and the horns open and closing movement are controlled by individual adjustable needle valves in the exhaust ports of their respective power valves . to insure clean , oil free air to open the bags , a primary air filter 122 is used first in the line of the incoming air and then proceeds down stream through a &# 34 ; oil removing filter &# 34 ; 124 which removes all of the oil vapors which might be present in the air . moving the main air sleeve valve to its rearmost position releases all air pressure in the machine and also allows the bag elevator to drop to its lowest position . the dropping of the elevator slide causes the top portion of the elevator slide to move outward from the vertical position to facilitate loading of a wicket of bags . the horn holder blocks 47 are held in place by a tee - nut so that each horn assembly is individually and infinitely adjustable for proper position to enter and open various sized bags . air pressure to the control circuit , carriage movement power valve , horn stretch power valve , elevator lift cylinder and the bag opening air power valve are all individually adjustable by individual regulators or needle valves . the horns and table top and the flexible air line to the air blast nozzle are easily removable for easy access to clean the machine inside and out to meet u . s . d . a . requirements . the &# 34 ; hocking station &# 34 ; is adjustable to allow for different size products if required . also , there is a provision to adjust the height of the table top surface in relation to the floor .
| 1 |
referring now to the drawings , fig1 shows merely those units which are necessary for an understanding of the present invention . filters , limiters and amplifiers have been deleted in fig1 . the signal interpreting circuitry begins with the incoming lines t1 to t4 and h1 to h4 . lines t1 to t4 carry frequencies pertaining to a first group or band of low frequencies , and lines h1 to h4 carry frequencies pertaining to a second group or band of high frequencies . the differences of potential appearing on the aforementioned lines t1 to t4 , and h1 and h4 , are those of the audible frequency receivers ( not shown ) of the group or band of low frequencies and that of high frequencies . reference characters a1 to a5 have been applied to indicate five outgoing lines of the system . the called numbers are received in what is often termed the touch - tone code , also referred - to as pushbutton code , or key code , since touch - tone is a trademark of the bell system . the outgoing lines a1 to a4 of the signal interpreting circuitry carry the called numbers in bcd format in which they are transmitted by appropriate coupling or transmission means to the register of the telephone system . the outgoing line a5 informs the register of the presence of a new number and delays the end of key pressure . assuming that a calling subscriber at the remote end of the line depresses the key number 3 for the period of time indicated in line 1 of fig3 . as a result , the transmitters in the key or pushbutton selector produce the trains of oscillations shown in line 2 of fig3 . according to ccitt code 2 × 1 - out - of - 4 signal code the line carries simultaneously the frequencies of 697 hz and 1477 hz . the audio receivers ( not shown ) tuned to these frequencies oscillate and interrupt their oscillations as indicated in line 3 of fig3 and supply the incoming lines t1 and h3 with signals to be interpreted shown in line 4 of fig3 as d - c pulses . the code tester cp shown in fig1 determines that one , and only one , frequency of each frequency group is received . in the affirmative , unit cp transmits these voltages -- je of line 4 of fig3 -- instantly to the delay line vz1 also shown in fig1 . delay line vz1 has a delay time of , for instance , 15 ms as a result of which a voltage pulse received by delay line vz1 is subsequently , or 15 ms later , received by the serially arranged delay device vz2 , unless -- as shown at the beginning of lines 4 and 5 of fig3 -- prior to the termination of the delay period of , e . g . 15 ms , the voltage level at the signal receiver undergoes a short time reduction . in that instance delay line vz1 returns instantly to its initial state , and produces only 15 ms after the return of the voltage je to normal the output voltage jf , as shown on line 5 of fig3 . simultaneously with the appearance of the voltage pulse jf , a voltage pulse te appears at the output of delay device vz2 . this has been indicated in fig1 and the voltage pulse te has been shown in line 6 of fig3 . the arrow in line 6 of fig3 indicates the steeply rising leading edge of voltage pulse te . in fig1 reference characters sp1 , sp2 , sp3 , sp4 have been applied to indicate four bistable storage logic elements having dynamic inputs e2 . the aforementioned steep leading edge of pulse te causes a change of state of elements or flip - flops sp1 , sp2 , sp3 , sp4 . as a result , the four outputs a1 , a2 , a3 , a4 of flip - flop sp1 , sp2 , sp3 , sp4 assume the voltages which correspond to their previously set inputs e1 and e3 . in the specific example under consideration , i . e . transmittal of the fig3 only the bcd outputs of 2 0 = 1 and 2 1 = 2 of the code converter uc carry a voltage . this voltage is supplied to the inputs e3 of flip - flops sp1 to sp4 and , upon being inverted , also supplied to the inputs e1 of flip - flops sp1 to sp4 . these voltages appear at the outputs a1 and a2 of flip - flops sp1 and sp2 as shown in lines 7 and 8 of fig3 . no output voltage appears at the outputs a3 and a4 of bistable devices or flip - flops sp3 and sp4 . the pulse te for controlling flip - flops sp1 to sp4 with its steep leading edge appears also at the output a5 , and forms a control signal which , when transmitted by a transmission line connected to output a5 to the register of the system , informs the register that new numbers may be received from output terminals a1 to a4 . the voltage signal te restores delay line vz2 to its original state only after a predetermined disconnecting delay period tps which , for instance , may be 25 ms following zero of the voltage pulse jf . this has been shown in lines 5 and 6 of fig3 . since the total time of the second disturbance lasting less than 10 ms ( see lines 3 and 4 of fig3 ) plus the delay time ts ( see line 5 of fig3 ) is less than the time tps , the second disturbance has no consequence , and the signal voltage te drops to zero only about 25 ms upon release of pressure upon the dialing key . this is apparent from line 6 of fig3 . the trailing edge of this signal voltage has no effect upon storage means sp1 to sp4 , i . e . the voltages of outputs a1 and a2 remain unchanged at least to the time of the next rise of the voltage te ( see lines 7 and 8 of fig3 ). it will thus be apparent that disturbances as , for instance , the second short decline of the voltage level , do not result in a change or a repetition of the interpretation of the signal . the right side of the diagrammatic representation of fig3 shows the effects of another depression of one of the dialing keys , namely that of actuating key number 5 . the time of key depression is about 40 ms and so short that after a build - up time of the line of about 20 ms and a protective period ts of 15 ms there remains an impulse time jf ( see line 5 of fig3 ) of but a few msec . in order to secure proper signal interpretation delay element vz2 prolongs that impulse for a period of time tps , or 25 ms , as shown in line 6 of fig3 . according to the recommendations of the ccitt the number 5 is formed by the second frequency ( 770 hz ) of the group or band of lower frequencies and by the second frequency ( 1336 hz ) of the group or band of upper frequencies . hence signal interpreting inputs t2 and h2 carry voltages which are converted by the code converter uc into outputs 2 0 = 1 and 2 2 = 4 . since output 2 0 carried a voltage when number 3 was transmitted , the voltages of set terminals e1 and e3 of storage device of flip - flop sp1 remain unchanged -- as shown on line 7 of fig3 -- and , therefore , also the voltage at the output a1 when the storage devices sp1 to sp4 are reset by the leading edge of the signal voltage te ( see line 6 of fig . 3 ). as this leading edge appears , the voltage heretofore prevailing at the output a2 disappears , as shown in line 8 of fig3 and reset storage device sp3 exhibits a voltage at its output a3 shown in line 9 of fig3 . the voltage that appears simultaneously at the signal output terminal a5 which lasts at least 25 ms ( see line 6 of fig5 ) informs the register of the central station that the code transmitting lines carrying the outputs a1 to a4 now transmit another dial number . the register may accept the number immediately and transmit an acknowledgement signal back to the dial receiver to the effect that -- irrespective of the subsequent duration of the pressure exerted upon a dialing key , the dial receiver is not needed any longer , and its bistable storage means may be reset , or cancelled . as an alternative , the register may scan the transmitted dial number in the period of time available up to the next change of signal . depending upon selection of either of these alternatives , the holding time and the number of required tone receivers and signal interpreting and interrogating means may change . referring now more specifically to fig2 this figure shows in more detail the time delay means vz1 and vz2 of fig1 and the operational amplifiers forming a part thereof . if the code tester cp ( fig1 ) supplies a high input voltage je to the terminals shown to the left of fig2 a base current flows through transistor t1 . this current removes the short across capacitor c1 by the collector - emitter circuit of transistor t2 . hence capacitor c1 starts to be charged through resistor r1 . capacitor c1 reaches the positive voltage determined by the position of a potentiometer connected to the positive input terminal of operational amplifier v1 within a time t1 = r1 . sup .. c1 ( ts = 15 ms ). then the output voltage jf which had previously been positive drops suddenly to 0 . as a result , capacitor c2 is suddenly charged 10 volt by way of diode d1 , the voltage at the negative input of amplifier v2 changes from plus 10 volt to 0 , and the output voltage of amplifier v2 rises simultaneously from 0 to plus 10 volt . the current which had flowed heretofore from the plus 5 volt terminal by way of diode d2 and the output terminal of the amplifier v2 to 0 is interrupted by diode d2 , and the voltage at the terminal te rises from 0 to to plus 5 volt . this voltage remains unchanged upon reversal of the output voltage of amplifier v1 from 0 to plus 10 volts as long as the charge of capacitor c2 being discharged by way of resistor r2 exceeds the voltage which is applied to the positive input of amplifier v2 by a fixedly adjusted potentiometer . the time of discharge tps = r2 . sup .. c2 terminates at about 25 ms , and then the voltage at the negative input of amplifier v2 exceeds that at the positive input , and the output voltage of amplifier v2 changes again from plus 10 volt to 0 , a change which is accelerated by the positive feed - back of the amplifier . therefore the terminal voltage te drops likewise from plus 5 volt to 0 . the times relating to the delay means vz1 and vz2 are given only by way of example , and depend upon the prevailing conditions of signal evaluation . it the period of protection ts is relatively long , this enhances protection against disturbances by voice transmission , but it reduces the times required for recognition of frequency , and consequently the number of frequencies that can be recognized per unit of time . this is so since the time tsp must exceed the longest interruptions of signals that may occur by the time of the periods of protection ts . if this condition were not met , too long key - depressing times might result in plural signal recognition .
| 7 |
hereinafter , preferred embodiments are described in detail with reference to the accompanying drawings so that those skilled in the art to which the present invention pertains may easily practice the present invention . in this case , in describing the preferred embodiments of the present invention in detail , a detailed description of the known functions or elements will be omitted if it is deemed to make the gist of the present invention unnecessarily vague . furthermore , the same reference numerals designate elements having similar functions and operations throughout the drawings . in addition , throughout the specification , when it is described that one element is ‘ connected ’ to the other element , the one element may be ‘ directly connected ’ to the other element or ‘ indirectly connected ’ to the other element through another element . furthermore , when it is described that one element ‘ includes ’ another element , it means that the one element does not exclude another element , but may include other elements , unless otherwise described . fig1 is a diagram illustrating the configuration of an interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention , and fig2 is a diagram illustrating a process of measuring current through the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention . as illustrated in fig1 , the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention may be configured to include magnetic sensor modules 100 , a signal collection module 200 , and a signal interference correction module 300 . more specifically , in the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention , as illustrated in fig2 , the n magnetic sensor modules 100 installed adjacent to respective n busbars 10 may measure the amounts of current i 0 , i 1 , . . . , i n , . . . , i n in their respective locations . the signal collection module 200 may collect the measured amounts ( measured signals ) and transfer the collected amounts to the signal interference correction module 300 . the signal interference correction module 300 may derive corrected current values i ′ 0 , i ′ 1 , . . . , i ′ n , . . . , i ′ n from which interference has been removed by calculating the amount of interference between the busbars . each of the elements of the single - point detection current sensor proposed by the present invention is described below . the magnetic sensor modules 100 are brought in insulation contact with or installed adjacent to the plurality of respective busbars 10 , and they may measure currents flowing into the busbars 10 using magnetic sensors and output the measured currents . since the magnetic sensor modules 100 are installed in the respective busbars , the magnetic sensor modules 100 and the busbars 10 may be configured to have the same number . the magnetic sensor modules 100 may function to convert magnetic field lines , generated by currents flowing into the multiple busbars 10 , into electrical signals . fig3 is a diagram illustrating the current measurement method of the magnetic sensor module in the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention . as illustrated in fig3 , when current flows into the busbar 10 , a magnetic field line is formed according to the right - handed screw rule . the magnetic sensor module 100 may convert the magnetic field line into an electrical signal and measure current flowing into the busbar 10 . in accordance with an embodiment of the present invention , the magnetic sensor module 100 may be configured to include a magnetic sensor which is brought in insulation contact with or installed adjacent to the busbar 10 and which collects a magnetic field line generated by current flowing into the busbar 10 and a signal analysis circuit which interprets a signal collected by the magnetic sensor and calculates back to information about current that flows into the busbar 10 . the magnetic sensor may use a hall sensor , but is not limited thereto . various sensors may be used as the magnetic sensor . fig4 is a diagram illustrating a case where interference is generated due to current that flows into a busbar adjacent to a single busbar in the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention . as illustrated in fig4 , if several busbars 10 are disposed as in a common switch board or panel board environment , a magnetic sensor module 101 mounted on a busbar 11 whose amount of current is to be measured is also influenced by a magnetic field that is subject to interference attributable to current flowing into an adjacent busbar 12 in addition to current flowing into the corresponding busbar 11 . this may be a further serious problem if the distance between the busbars 10 is close , if current flowing into an adjacent busbar is strong , or if perfect shielding is difficult due to a problem , such as the discharging of high voltage . furthermore , although physical shielding is performed , a certain amount of an interference phenomenon is generated because a leaking magnetic field is not perfectly shielded . in order to solve such a problem , the inventor of the present invention proposes that an accurately corrected current value from which interference has been removed can be derived using an interference coefficient , formulated or modeled from a previously measured value , in a measured signal measured by each busbar 10 by including the signal collection module 200 and the signal interference correction module 300 . the signal collection module 200 may function to collect measured signals output by the plurality of magnetic sensor modules 100 and transfer the collected signals to the signal interference correction module 300 . the signal interference correction module 300 may derive corrected current values from which interference has been removed by calculating the amounts of interference between the plurality of busbars 10 in the signal collected by the signal collection module 300 . fig5 is a diagram illustrating a detailed configuration of a signal interference correction module in the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention . as illustrated in fig5 , the signal interference correction module 300 of the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention may be configured to further include an interference coefficient matrix generation unit 310 , an interference coefficient derivation unit 320 , and a correction current value calculation unit 330 . in some embodiments the signal interference correction module 300 may be configured to include interference correction memory 340 . the interference coefficient matrix generation unit 310 may generate an interference coefficient matrix . the interference coefficient may be represented by h n , m , which means the amount of current that flows into an n th busbar 10 and that interferes with an m th busbar 10 . fig6 is a diagram illustrating a structure for modeling an interference equation in the interference correction type single - point detection current sensor for multiple busbars in accordance with an embodiment of the present invention . as illustrated in fig6 , the amount of interference current measured by an ( n + 1 ) th magnetic sensor modules 100 due to current i ′ n actually flowing into the n th busbar 10 may be represented by h n , n + 1 * i ′ n . accordingly , current in measured by the n th busbar 10 may be represented by the amounts of interference current h 0 , n * i ′ 0 + h 1 , n * i ′ 1 + h 2 , n * i ′ 2 . . . based on the amount of current i ′ n actually flowing into the n th busbar 10 and the amounts of current i ′ 0 , i ′ 1 , i ′ n − 1 , and i ′ n + 1 flowing into adjacent busbars 10 . assuming that a matrix indicative of current actually flowing into each busbar 10 is i ′ and a matrix indicative of current measured by the magnetic sensor modules 100 is i , a measured current i may be equal to h * i ′ ( a value obtained by multiplying actual current by an interference coefficient ) according to an interference coefficient matrix h ( refer to equation 1 and a matrix below ). that is , the measured current i may be considered to be a value influenced by interference attributable to the actual current i ′ that flows into the adjacent busbars 10 . the interference coefficient matrix h may be defined in a table form by measuring a temperature and the distance through experiments . if h is the function of i ′, that is , if h is influenced by i ′, i ′ may be calculated as a converging value by repeatedly calculating i = h − 1 * i and obtaining h after obtaining h in the state in which the initial value of i ′ is set to i . h 00 , h 11 , h 22 , and h nn denote ratios of the busbars 10 to be measured which are influenced by the respective busbars 10 and each may be 1 , but may not be 1 depending on variables , such as a temperature , the amount of current , and the distance . the aforementioned interference coefficient matrix may be derived in an equation form according to the physical shape of the busbars 10 and the magnetic sensor modules 100 or may be derived by measurement in an actual environment . furthermore , the aforementioned interference coefficient matrix may be featured according to environment variables , such as a temperature , the distance from a busbar , and the intensity of a magnetic flux , and a value in an environment in which measurement is not performed may be estimated through an interpolation method . experimentally , if current is made sequentially flow into the busbars and measured , when current of 1 a flows into only a no . 1 busbar 10 , a measured current i 0 in a no . 0 busbar is i 0 = h 0 , 0 * i ′ 0 + h 1 , 0 * i ′ 1 + h 2 , 0 * i ′ 2 + . . . + h n , 0 * i ′ n + . . . + h n , 0 * i ′ n . ( in this case , i = current measured by the magnetic sensor module , h n , m = an interference coefficient of current that flows into the n th busbar and that interferes with the m th busbar , i ′= actual current , n = order of a busbar to be measured ) if the actual current is substituted in the measured current , i 0 = h 1 , 0 * i ′ 1 . that is , if current of 0 . 1 a is measured in the no . 0 busbar 10 when an actual current of 1 a flows into the no . 1 busbar 10 , the no . 0 busbar 10 is subject to interference of 10 % due to the no . 1 busbar 10 . in this case , an interference coefficient h 1 . 0 becomes 0 . 1 . meanwhile , although the busbars 10 are assumed to be very regularly installed , such an interference coefficient has a basic physical difference attributable to the distance between the busbars 10 and the distance between the magnetic sensor module 100 and the busbar 10 . accordingly , an interference coefficient needs to be calculated in each of the regularly configured busbars 10 . meanwhile , the interference coefficient may differ depending on a temperature , the intensity of a magnetic flux ( the amount of current ), and the distance between a measured location and the busbar 10 . preferably , a plurality of the interference coefficient matrices may be generated in each predetermined unit within a predetermined range of one or more variables selected from the group consisting of a temperature , the amount of current , and the distance between a measured location and the busbar 10 . the plurality of generated interference coefficient matrices may be stored in the interference correction memory 340 or another separate memory . that is , the interference coefficient may be measured based on a temperature and the intensity of a magnetic flux . the amount of physical interference is proportional to the amount of current , but may be different depending on the arrangement of busbars and a degree that interference is shielded . the matrix h according to a temperature and the amount of current may be derived by measuring the interference coefficient using a different amount of current for each temperature in the aforementioned experiments , and a coefficient may be extracted using an interpolation method with respect to a required part and may be used . accordingly , a plurality of the matrices h may be present with respect to a temperature value and a current value . input for selecting the actual coefficient includes a temperature and the intensity of current . reference may be made to a coefficient corresponding to a temperature value suitable to a matrix h using the temperature value measured by a temperature sensor . as a similar method , a matrix value for the intensity of current has only to be selected based on the current i measured after a temperature value is determined . for example , the aforementioned experiments correspond to a case where the matrices were measured using the amounts of current 1 a , 10 a , 25 a , and 50 a at temperatures of − 40 degrees , − 20 degrees , 0 degrees , 20 degrees , 40 degrees , 60 degrees , and 80 degrees with respect to the busbar 10 of 50 a standard , which is represented by h ( t , c ) for convenience sake . in this case , t is assumed to be a temperature , and c is assumed to be the amount of current . with respect to such a combination , the matrix h has a total number of 4 ( the number of types of the amounts of current )* 7 ( the number of types of temperature ) types = 28 types . if a temperature when the busbar 10 operates is about 40 degrees , the amount of current i ′ 0 is 10 a , and the amount of current i ′ 1 is 20 a , h ( t , c ) results in h ( t = 40 degrees , c = 10 a ) because the first row of the matrix h is an interference coefficient attributable to i ′ 0 , and h ( t , c ) results in h ( t = 40 degrees , c = 20 a ) because the second row is an interference coefficient attributable to i ′ 1 . if a temperature or a current value is not included in the table , h ( t , c ) may be calculated using an interpolation method . mathematical modeling is possible because an influence attributable to the distance and the amount of current that belong to the interference coefficients corresponds to a physical phenomenon . the interference coefficient matrix may be modeled based on the distance from the busbar and the amount of current measured in the busbar because a magnetic flux density b is in inverse proportion to the distance and is proportional to the amount of current . that is , the interference coefficient matrix may be modeled and generated according to the following equation . ( in this case , b = a magnetic flux density , u 0 = permeability in vacuum , i = current , r = the distance from a conductor ( the distance from the busbar or an adjacent busbar ), dl = the curvilinear integral of a current direction , and r ̂= a unit vector in a direction r ) in summary , each element h n , m of the matrix h may be considered to be a function , such as each distance , current , shielding , or temperature . the element may be determined by performing measurement for each temperature , for each current , and for each distance , performing measurement in the state in which the busbar 10 has been installed , or performing modeling . the interference coefficient derivation unit 320 may derive the interference coefficient of a corresponding busbar 10 using an interference coefficient matrix or an interpolation method . the correction current value calculation unit 330 may derive a corrected current value using a corresponding interference coefficient . furthermore , the interference correction memory 340 may store the interference coefficient matrix generated by the interference coefficient matrix generation unit and an interference correction equation for deriving the corrected current value using an interference coefficient . the interference coefficient derivation unit 320 and the correction current value calculation unit 330 may read a value necessary to correct the interference of a measured signal from the interference correction memory 340 and calculate the corrected current value . meanwhile , an actual interference coefficient having sufficient accuracy may be obtained by taking into consideration only interference with a secondarily adjacent busbar because interference in the busbar 10 is rapidly attenuated according to the distance . accordingly , the actual interference coefficient may be represented very simply as in the following equation and the matrix . ( in this case , i = current measured by the magnetic sensor module , h n , m = the interference coefficient of current that flows into the n th busbar and that interferes with the m th busbar , i ′= an actual current , and n = order of a busbar to be measured ) the above example illustrates an example in which the interference of a signal sampled on a time axis has been removed . if the interference of current remains constant for a short time , the amount of currents i ′ and i may be converted into complex numbers by taking a phase into consideration and calculated at once without calculating them for each current sampling value , thereby being capable of reducing a total computation load . fig7 is a diagram illustrating the configuration of an interference correction type single - point detection current sensor for multiple busbars in accordance with another embodiment of the present invention . as illustrated in fig7 , the interference correction type single - point detection current sensor for multiple busbars in accordance with another embodiment of the present invention may be configured to further include a temperature measurement module 400 . a plurality of interference coefficient matrices may be generated in each predetermined unit within a predetermined temperature range and stored . the signal interference correction module 300 may derive a corrected current value using an interference coefficient matrix that complies with a temperature measured by the temperature measurement module 400 . furthermore , the single - point detection current sensor may be configured to further include a measurement error correction module 500 for deriving a measurement error correction value for each sensor by calculating environment variables , including a temperature , the distance from the busbar , and the intensity of a magnetic flux , with respect to a measured signal output by the magnetic sensor module . the signal interference correction module 300 may derive a corrected current value based on a measurement error correction value derived by the measurement error correction module . each of the magnetic sensor modules 100 may have an error attributable to environment variables , such as a temperature , the distance , and the intensity of a magnetic flux , and thus may derive a measurement error correction variable according to environment variables , such as a temperature and the distance , by comparing the measured amount of current , measured by each busbar not having interference , with the actual amount of current . such a measurement error correction variable may be stored in separate memory and used . the present invention described above may be modified or applied in various ways by those skilled in the art to which the present invention pertains , and the scope of a technical spirit according to the present invention should be determined by the following claims .
| 6 |
referring now in detail to the illustrative embodiment depicted in the accompanying drawings , there is shown in fig1 a pressure regulator 10 having an inlet end portion 12 and an outlet end portion 14 . the inlet end portion 12 is adapted for connection to a source of fluid pressure such as a tank of pressurized breathing air as conventionally used by scuba divers . an output portion 16 of such a breathing tank is shown in fragmentary form in operative connection with the inlet portion 12 . the inlet end portion 12 includes an inlet passage 13 which leads to a pressure chamber 18 . adjacent to pressure chamber 18 and in communication therewith is an outlet passage 15 disposed in outlet end portion 14 . a valve actuator housing 20 is disposed adjacent to pressure chamber 18 . a floating piston 22 is slidably mounted within housing 20 for movement therein in a sealed manner by means of the sealing ring 24 which is disposed in the circumferential surface of piston 22 so as to interact with the interior wall of housing 20 . piston 22 has associated therewith a valve stem 26 and a valve member 28 . the valve member 28 and valve stem 26 , being integrally formed with piston 22 , undergo movement therewith . valve member 28 is adapted to engage a valve seat 30 formed as part of the inlet end portion 12 . in this regard , the valve member 28 carries a sealing element 32 . the valve stem 26 carries a sealing member 34 which sealingly engages that portion of the regulator body in which the valve stem is mounted . the valve member 28 and valve stem 26 respectively include connecting passages 36 and 38 whereby pressure in chamber 18 is openly communicated to the chamber defined in the lefthand interior of housing 20 and end surface 22a of piston 22 . a pressure bleed means in the form of a passage opening 40 is provided in piston 22 to extend between piston end surface 22a and piston end surface 22b . as will be more fully described hereinbelow , the passageway 40 is further formed with an orifice configuration 42 adjacent to the piston end surface 22b . a biasing means in the form of coil spring 44 is provided within the valve actuator housing 20 to engage the end surface 22b if piston 22 so as to urge the latter , as well as the valve stem 26 and valve member 28 , away from valve seat 30 . the valve actuator housing 20 is affixed to the main body portion of the regulator by means of a threaded engagement at 48 and is sealed with respect to the main portion of the regulator by use of a sealing gasket 50 . however , a pressure relief opening 52 is provided through the wall of the valve actuator housing 20 so as to insure that ambient pressure will be reflected in the chamber defined by end surface 22b of the piston , the right - hand portion of housing 20 and the main body of the regulator . a check valve 53 is provided over vent hole 52 to prevent water from entering , while allowing for exhaust of air from orifice 42 . as described in part hereinabove , it has been common practice in the prior art to provide a pressure relief opening such as 52 to provide communication of ambient pressure changes to surface 22b of piston . accordingly , the force exerted by spring 44 and ambient pressure conditions can be predicted . in the general use of the regulator 10 , a supply pressure on the order of 200 to 4 , 000 psi may be supplied through inlet passage 13 -- in other words , the supply pressure undergoes considerable variation as the breathing air is consumed . the principal purpose of regulator 10 , therefore , is to provide or rather maintain a constant output pressure , for example on the order of 150 psi above ambient , which in turn can be effectively consumed by a user of associated scuba diving apparatus . accordingly , the regulated pressure , say 150 psi , is to be maintained in the pressure chamber 18 which in turn communicates such regulated pressure to the output passage 15 disposed in the outlet end portion 14 . furthermore , the regulated pressure in chamber 18 is communicated to the end surface 22a of piston 22 by the passage 36 and 38 . as to be understood by those skilled in the art , the regulated pressure acting on surface 22a of piston 22 imparts a specified force on the piston tending to urge the same to the right so as to close valve member 28 against the valve seat 30 . to counteract this tendency , biasing means , such as spring 44 , can be formed to engage surface 22b of the piston so as to be operable to afford substantially a constant force on piston 22 throughout its range of travel with respect to a regulated pressure in chamber 18 . the force of spring 44 is transmitted to end surface 22a of the piston . should the valve member 28 tend to close against valve seat 30 too much so that the pressure in chamber 18 falls below the desired regulated level , the force applied to end surface 22a of the piston proportionately decreases and the biasing means 44 would tend to open the valve member 28 so as to increase the pressure in chamber 18 and corresponding pressure applied to surface 22a of the piston . conversely , if the valve member 28 tends to open too much with respect to valve seat 30 , the pressure in chamber 18 would exceed the desired regulated level and the corresponding greater amount of force applied to end surface 22a of the piston would tend to move the latter to the right , as viewed in fig1 against the biasing means 44 so as to close down the valve member 28 until the regulated pressure level is reached . in this manner of employing counterbalancing forces , a substantially regulated pressure level is maintained in the output passage 15 . when the regulator is in use , water necessarily could pass inwardly of housing 20 through the pressure relief opening , 52 , absent the present invention , so as to completely fill the volume of space in which the biasing spring 44 is disposed . this water would be necessary to transmit ambient water pressure to surface 22b of piston . normally , this would not present a problem ; but when the regulator is used in extremely cold water , potential icing can take place about the biasing spring 44 which would preclude proper functioning thereof . under such circumstances , a highly dangerous situation could be presented if , for example , the biasing means 44 became inoperative and the force exerted on end surface 22a of the piston urged the valve member 28 to close against the valve seat 30 . with a view towards the potential safety hazard related to water , and particularly very cold water , being present in the area of housing 20 including the biasing spring 44 , the present invention teaches the provision of the pressure bleed means 40 to maintain the housing 20 free of ambient water . a continuous flow of air , restricted in amount by orifice 42 , flows into the housing 20 around spring 44 outwardly through the pressure relief opening 52 . a check valve 53 is provided over vent hole 52 to prevent water from entering , but allow exit of air from orifice 42 . this condition exists only when external pressure is greater than internal pressure . in this manner , ambient water cannot flow inwardly through the opening 52 . due to the relative configuration and size of the orifice 42 , the loss of breathing air will be relatively insignificant . also , the effective operation of the bleed orifice 42 and relief opening 52 can be readily checked by a scuba diver by simply placing the regulator under water and watching for air bubbles passing outwardly of opening 52 . although passage 40 and orifice 42 are shown in fig1 as part of piston 22 , necessarily equivalent types of passages could be potentially formed in the valve stem 26 or the outlet end portion of the regulator so as to bleed air into the housing 20 about the biasing spring 44 . from the foregoing , it is apparent that the objects of the present invention have been fully accomplished . as a result of this invention , an improved pressure regulator for use particularly with scuba diving equipment is provided for increasing the safety thereof . having thus described and illustrated a preferred embodiment of my invention , it will be understood that such description and illustration is by way of example only and that such modifications and changes as may suggest themselves to those skilled in the art are intended to fall within the scope of the present invention as limited only by the appended claims .
| 8 |
in the following detailed description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the disclosed embodiments . it will be apparent , however , that one or more embodiments may be practiced without these specific details . in other instances , well - known structures and devices are schematically shown in order to simplify the drawing . referring to fig1 to fig4 , fig1 is a flow chart of a method for forming a case for an electronic device according to the first embodiment of the disclosure ; fig2 is a schematic view of forming the first plastic layer in the method according to the first embodiment of the disclosure ; fig3 is a schematic view of forming the pcm ( phase change material ) microcapsule layer in the method according to the first embodiment of the disclosure ; fig4 is the front view of the structure of the pcm microcapsule according to the first embodiment of the disclosure . the first embodiment of the disclosure provides a method for forming a case for an electronic device . the method comprises : s 1 : forming a first plastic layer by injection molding . specifically , as shown in fig2 , the injection molding machine 10 makes the first plastic material 14 become the first plastic layer 161 and forms the first plastic layer 161 in the mold 15 by injection molding . in this embodiment , the material of the first plastic layer 161 ( the first plastic material 14 ) is a mixture of polycarbonate and abs resin , but the disclosure is not limited thereto . s 2 : forming a pcm microcapsule layer on one side of the first plastic layer by injection molding . specifically , as shown in fig3 and fig4 , the injection molding machine 10 makes a plurality of pcm microcapsules 20 become the pcm microcapsule layer 163 and forms the pcm microcapsule layer 163 on one side of the first plastic layer 161 . in this embodiment , the pcm microcapsule layer 163 comprises a plurality of pcm microcapsules 20 . the pcm microcapsules 20 each comprises a capsule shell 22 and a capsule core 24 . the capsule core 24 is located inside the capsule shell 22 . preferably , the capsule core 24 is enclosed by the capsule shell 22 . the material of the capsule shell 22 is a high polymer , and the material of the capsule core 24 is a pcm . the melting point of the pcm is between 20 ° c . and 75 ° c ., preferably between 35 ° c . and 55 ° c . in this embodiment , the high polymer forming the case shell 22 is a mixture of polycarbonate and glass fiber . the pcm forming the case core 24 is a heat absorbing substance , such as alkanes ( e . g . icosane to triacontane ), alcohols ( e . g . decan - 1 - ol to icosane - 1 - ol ), acids ( e . g . decanoic acid to icosanoic acid ) or paraffin . however , the material and the composition of the capsule shell 22 and the capsule core 24 are not limited to the disclosure . in this embodiment , the diameter of the pcm microcapsules is between 0 . 1 and 1000 micrometers ( μm ), preferably between 10 and 30 micrometers , and more preferably between 20 and 30 micrometers . since the first plastic material 14 is a mixture of polycarbonate and abs resin , and the melting of the mixture of polycarbonate and abs resin is about 230 ° c . by comparison , the melting point the mixture of polycarbonate and glass fiber which forms the capsule shell 22 is about 285 ° c . in other words , the melting point of the capsule shell 22 is higher than the melting point of the first plastic material 14 . consequently , when the pcm microcapsules 20 is undergone the injection molding process after the first plastic layer 161 , the temperature , set for the first plastic layer 161 for the injection molding , of the injection molding machine 10 is lower than the melting point of the capsule shell 22 . thereby , structural integrity of the pcm microcapsules 20 can be maintained . moreover , the disclosure provides a case structure for the electronic device . referring to fig4 and fig5 , fig5 is the front view of the case structure for the electronic device according to the first embodiment of the disclosure . after the injection molding machine 10 forms the pcm microcapsule layer 163 on one side of the first plastic layer 161 , the users may remove the case structure 16 for the electronic device from the mold 15 . the case structure 16 for the electronic device comprises a first plastic layer 161 and a pcm microcapsule layer 163 . the pcm microcapsule layer 163 is disposed on one side of the first plastic layer 161 . in the case structure for the electronic device and the manufacturing method thereof according to the first embodiment of the disclosure , the pcm microcapsule layer 163 is disposed on one side of the first plastic layer 161 , and the pcm has a great latent heat . that is , the pcm is capable of absorbing a large amount of heat when phase is changing . therefore , the heat dissipation performance of the case structure 16 for the electronic device is improved , and this approach does not require attaching the aluminum foil and the graphite sheet on the surface of the case . thereby , the additional working cost caused by attaching the aluminum foil and the graphite sheet to the case surface , as mentioned in the related art , is eliminated . the second embodiment of the disclosure provides a manufacturing method for a case structure for an electronic device . referring to fig2 , fig3 , fig6 and fig7 , fig6 is a flow chart of a method for forming a case for an electronic device according to the second embodiment of the disclosure ; fig7 is a schematic view of forming the second plastic layer in the method according to the second embodiment of the disclosure . the manufacturing method for the case structure for the electronic device according to the second embodiment is similar to that in the first embodiment , wherein the difference is that a step s 3 is added after fig3 . the step s 3 comprises : forming a second plastic layer on one side of the pcm microcapsule layer by injection molding , wherein the first plastic layer and the second plastic layer surround the pcm microcapsule layer . in this embodiment , the material of the second plastic layer is a mixture of polycarbonate and abs resin , but the disclosure is not limited thereto . specifically , as shown in fig7 , the injection molding machine 10 make the second plastic material 26 become the second plastic player 365 and forms the second plastic player 365 on one side of the pcm microcapsule layer 363 . the first plastic player 361 and the second plastic player 365 surround the pcm microcapsule layer 363 . moreover , the second embodiment of the disclosure provides a case structure for the electronic device . referring to fig8 , fig8 is the front view of the case structure for the electronic device according to the second embodiment of the disclosure . after the injection molding machine 10 forms the second plastic layer 26 on one side of the pcm microcapsule layer 363 , the users may remove the case structure 30 for the electronic device from the mold 15 . the case structure 30 for the electronic device comprises a first plastic layer 361 , a second plastic layer 365 and a pcm microcapsule layer 363 . the first plastic layer 361 and the second plastic layer 365 surround the pcm microcapsule layer 363 . in the case structure for the electronic device and the manufacturing method thereof according to the second embodiment of the disclosure , since the case structure 30 for the electronic device comprises the pcm microcapsule layer 363 , and the pcm has a great latent heat . that is , the pcm is capable of absorbing a large amount of heat when phase is changing . therefore , the heat dissipation performance of the case structure 30 for the electronic device is improved , and this approach does not require attaching the aluminum foil and the graphite sheet on the surface of the case . thereby , the additional working cost caused by attaching the aluminum foil and the graphite sheet to the case surface , as mentioned in the related art , is eliminated . in the case structure for the electronic device and the manufacturing method thereof according to the above - mentioned embodiments , since the case structure for the electronic device comprises the pcm microcapsule layer , the heat dissipation performance can be improved . furthermore , this approach does not require attaching the aluminum foil and the graphite sheet to the case surface . thereby , the additional working cost of attaching the aluminum foil and the graphite sheet can be eliminated . it will be apparent to those skilled in the art that various modifications and variations can be made to the disclosed embodiments . it is intended that the specification and examples be considered as exemplary only , with a true scope of the disclosure being indicated by the following claims and their equivalents .
| 1 |
like reference numerals refer to like parts throughout the following description and the accompanying drawings . fig1 shows an exploded perspective view of an exemplary shoulder prosthesis 100 including an exemplary glenoid component 120 according to the present invention . prosthesis 100 also includes an exemplary humeral component 140 . humeral component 140 is configured in a known manner for implantation in a humerus 160 and replacement of a natural humeral head ( not shown ) and , accordingly , includes a prosthetic humeral head 180 . glenoid component 120 is configured for implantation in a scapula 200 and replacement of a natural glenoid fossa ( not shown in fig1 ). glenoid component 120 includes a bearing 220 . bearing 220 is made from a durable biocompatible plastic or any other suitable durable biocompatible material . for example , bearing 220 may be made from a polyethylene . one particular polyethylene that is well suited for bearing 220 is a high molecular weight polyethylene , for example ultra - high molecular weight polyethylene (“ uhmwpe ”). one such uhmwpe is sold as by johnson & amp ; johnson of new brunswick , n . j . as marathon ™ uhmwpe and is more fully described in u . s . pat . nos . 6 , 228 , 900 and 6 , 281 , 264 to mckellop , which are incorporated herein by reference . bearing 220 includes a generally concave surface 240 that is configured as known for bearing against prosthetic humeral head 180 or , in cases where the natural humeral head is spared , for bearing against the natural humeral head . bearing 220 further includes a post 260 , or some other feature or mechanism capable of mating the bearing to a stem element of the glenoid component , such as stem 280 discussed below . glenoid component 120 also includes a stem 280 . as discussed further below , stem 280 is configured to model a normal or pathologic glenoid vault morphology such that stem 280 fits within a cavity 300 that may be defined , at least partially , by endosteal walls 320 of scapula 200 . to this end , it is noted that the present invention may provide a series of rigidly scaled or sized versions of stem 280 for accommodating various glenoid vault sizes that may be presented among different patients . it should also be appreciated that the glenoid vault of scapula 200 may include some cancellous bone 340 . stem 280 is made from a suitable biocompatible metal such as , for example , a cobalt chromium alloy , a stainless steel alloy , a titanium alloy , or any other suitable durable material . in alternative embodiments , stem 280 may include a porous coating to facilitate bone in - growth into glenoid component 120 . the porous coating may be any suitable porous coating and may for example be porocoat ®, a product of johnson & amp ; johnson of new brunswick , n . j . and more fully described in u . s . pat . no . 3 , 855 , 638 to pilliar , which is incorporated herein by reference . stem 280 can be solid or a thin shell of suitable durable material . stem 280 includes a generally superior surface 360 , a generally inferior surface 380 , a generally anterior - medial surface 400 , a generally posterior - medial surface 420 , and a generally lateral surface 440 . stem 280 defines a socket 460 that extends inwardly from surface 440 . socket 460 receives post 260 ( of bearing 220 ). stem 280 may also define a through - channel 480 that extends , coaxially with socket 460 , through stem 280 . glenoid component 120 further includes a fastener 500 in the form of , for example , a screw . the screw , or screws , may be any screw capable of additionally securing glenoid component 120 within scapula 200 . for example , the screw may be a cortical screw such as depuy ace catalog number 8150 - 36 - 030 available from depuy orthopaedics , inc . of warsaw , ind . the screw has a diameter sufficient to properly secure glenoid component 120 within scapula 200 and may , for example , have a diameter of about two to five millimeters . the screw may have any suitable length capable of properly securing glenoid component 120 within scapula 200 . for example , the screw may have a length of from 10 to 60 millimeters . the screw may be secured to stem 280 in any suitable manner . in the exemplary embodiment , fastener 500 extends through through - channel 480 ( of stem 280 ). however , it is noted that fastener 500 is not indispensable and may be omitted from alternative embodiments . bearing 220 is secured to stem 280 in any suitable manner . for example , bearing 220 may be bonded to stem 280 , or bearing 220 could be made from polyethylene and compression molded to stem 280 . alternately , the bearing 220 may be glued to stem 280 by , for example , an adhesive . alternatively , bearing 220 may be mechanically interlocked to stem 280 by taper locking or otherwise press - fitting post 260 in socket 460 , or post 260 and socket 460 may include any other suitable interlocking features , for example , rib ( s ), lip ( s ), detent ( s ), and / or other protrusion ( s ) and mating groove ( s ), channel ( s ), or indent ( s ) ( not shown ). additionally , it is noted that in alternative embodiments , bearing 220 and stem 280 may be integrated into a single part made from uhmwpe or any other suitable material — with or without an omission of fastener 500 . the present invention contemplates a method for preparing a glenoid component that will satisfy a majority of patient anatomies . thus , in accordance with one method , the steps described in flow diagrams of fig2 a - 2 c correspond to one exemplary method used to model the normal or pathologic glenoid vault morphology , and ultimately to prepare an optimally sized and configured implant . in a first step 1020 ( fig2 a ), a suitable sample of human scapulae (“ scapulae sample ”) is selected to represent a reasonable demographic cross section of an anticipated patient population . in the exemplary embodiment , the scapulae sample included sixty - one human scapulae selected from different sources , thirty - two left - sided and twenty - eight right - sided . various criteria were applied to the selection process so that the sample was as representative of the patient population as possible , including height , sex , gender and ethnicity . at step 1040 ( fig2 a ), volumetric scan of each scapula in the sample was performed using a siemens volume zoom scanner ( a ct scanner available from siemens medical systems of malvern , pa .). it is noted that the initial orientation of the scapulae in the ct images is dependent on the physical placement and orientation of the scapulae within the ct scanner , which is inherently difficult to reproduce . nevertheless , the scapulae were placed in a supine anatomic position and axial images were obtained in one mm increments ( with 0 . 27 to 0 . 35 mm in - plane resolution ). the images were acquired at 120 kv , 100 ma , using a 180 mm field - of - view , large focal spot , and rotation speed of 0 . 5 sec / rev . a medium - smooth reconstruction algorithm was used for reconstruction of the images . fig3 shows a rectangular (“ cartesian ”) coordinates reference system 1060 relative to the plane body of a typical scapula 1080 as defined by three surface points 1100 , 1120 , and 1140 of the scapula 1080 . as at least partially discernable from fig3 , point 1100 represents an inferior tip of the scapula 1080 , point 1120 represents a medial pole of the scapula 1080 where the spine intersects the scapula 1080 , and point 1140 represents the center of the typical glenoid fossa 1160 . further , it should be appreciated that coordinates reference system 1060 defines , among other things , an xz - plane 1180 , an xy - plane 1190 , a vector 1200 extending from the medial pole of the scapula to the center of the glenoid fossa 1160 , and an x - axis 1220 . at step 1230 ( fig2 a ), the three - dimensional (“ 3 - d ”) images of the scapulae were re - sampled to align them on coordinates reference system 1060 ( see fig3 ) for subsequent analysis . in the exemplary embodiment , points 1100 , 1120 , and 1140 were interactively chosen on the 3 - d image of each scapula and the scapulae were again re - sampled such that the plane of the body of each scapula was aligned parallel to the xz - plane 1180 of the coordinates reference system 1060 ( see fig3 ), and such that the vector 1200 extending from the medial pole of the scapula to the center of the glenoid fossa 1160 was parallel to the x - axis 1220 ( see fig3 ). fig4 shows the superior - inferior (“ si ”) dimension 1240 and the anterior - posterior (“ ap ”) dimension 1260 of the glenoid fossa 1160 . at step 1280 ( fig2 a ), the si dimension 1240 and the ap dimension 1260 ( see fig4 ) of each scapula was determined by interactively placing points on the 3 - d images using a suitable software program . at step 1300 ( fig2 a ), the scapulae sample were arbitrarily divided into six sub - groups based on their si dimensions 1240 ( see fig4 ) to reduce the initial number of morphological comparisons and to facilitate determination of the relationship between the global or overall typical glenoid vault size and the typical glenoid vault morphology . fig5 shows a table listing exemplary range and exemplary average si dimension for the six sub - groups of scapulae based on their si dimensions . at step 1420 ( fig2 a ), the endosteal walls 320 of the glenoid vaults of the scapulae were manually traced and digitized . fig6 shows a substantially complete tracing 1320 ( toward the inferior end of the typical glenoid fossa 1160 ) of the endosteal walls 320 of the typical glenoid fossa 1160 . fig7 shows a partial tracing 1360 ( toward the inferior end of the typical glenoid fossa 1160 ) of the endosteal walls 320 of the typical glenoid fossa 1160 as a result of fossa occlusion in the region of the typical scapular spine 1380 . reference line 1400 ( fig7 ) is discussed further below . each endosteal boundary was traced on each of the two - dimensional (“ 2 - d ”) xy - slices of the respective re - sampled image ( see fig6 ), starting at the respective glenoid fossa and extending medially to the scapular spine 1380 ( see fig7 ), but not into the interior of the spine . both the anterior and posterior wall tracings in the region of the spine are terminated at reference line 1400 ( see fig7 ), which was defined to be simultaneously perpendicular to the plane of the respective glenoid fossa and tangential to the surface of the respective endosteal notch . at step 1440 ( fig2 a ), each endosteal tracing defining the respective glenoid vault was normalized by its extent in the si dimension . this measurement was made from the inferior limit of the endosteal walls of the glenoid fossa to the superior limit in the z - dimension ( see fig3 ) of the image . the vaults were rigidly scaled in all three dimensions ( i . e ., x , y , and z ) to normalize the si dimension of the vault tracing to the average within its corresponding sub - grouping . this approach substantially eliminated size differences between the different vaults , facilitating an appropriate shape determination . an assumption was made that right - sided and left - sided scapulae are approximately anatomically symmetrical . under this assumption , right - sided vaults were mirrored about the xz - plane ( see fig3 ) to allow morphological determinations to be made within the entire sample . in the exemplary embodiment , the normalized vaults within each of the six scapular sub - groupings were spatially aligned ( i . e ., “ registered ”) using an iterative closet point (“ icp ”) algorithm such as discussed in besl p . j . and mckay n . d ., “ a method for registration of 3 - d shapes ,” ieee trans . pattern analysis and machine intelligence 1992 , volume 14 , pages 239 - 256 , which is incorporated herein by reference . at step 1460 ( fig2 b ), a 3 - d model of the normalized glenoid vault morphology was then constructed for each sub - group of the scapulae of the scapulae sample based on the morphological constraints imposed by each of the vaults in the sub - group . for each sub - group , the set of registered glenoid vaults were overlaid and the approximate average endosteal walls 320 ( see fig6 and fig7 ) of the sub - group were manually digitized . each endosteal boundary was traced on each of the two - dimensional (“ 2 - d ”) xy - slices of the respective re - sampled image ( see fig6 ), starting at the respective glenoid fossa and extending medially to the scapular spine 1380 ( see fig7 ), but not into the interior of the spine . both the anterior and posterior wall tracings in the region of the spine were terminated at reference line 1400 ( see fig7 ), which was defined to be simultaneously perpendicular to the plane of the respective glenoid fossa and tangential to the surface of the respective endosteal notch . the resulting 3 - d model satisfied the endosteal wall boundaries for each vault within the group . at step 1480 ( fig2 b ), a relatively complex 3 - d model 1500 ( see fig8 ) approximating the average normalized glenoid vault morphology of the entire scapulae sample was constructed based on the morphological constraints imposed by the models for each sub - group . the registered glenoid vaults for the sub - groups were overlaid and the approximate average endosteal walls 320 ( see fig6 and fig7 ) of the sub - group models were manually digitized . each endosteal boundary was again traced on each of the two - dimensional (“ 2 - d ”) xy - slices of the respective re - sampled image ( see fig6 ), starting at the respective glenoid fossa and extending medially to the scapular spine 1380 ( see fig7 ), but not into the interior of the spine . both the anterior and posterior wall tracings in the region of the spine were terminated at reference line 1400 ( see fig7 ), which was defined to be simultaneously perpendicular to the plane of the respective glenoid fossa and tangential to the surface of the respective endosteal notch . the resulting 3 - d model 1500 satisfies the endosteal wall boundaries for each vault within the scapulae sample . fig8 shows views of a volumetric rendering of the relatively complex 3 - d model 1500 generated in the previous steps . as at least partially discernable in fig8 , model 1500 includes a generally superior surface 1520 , a generally inferior surface 1540 , a generally anterior - medial surface 1560 , a generally posterior - medial surface 1580 , and a generally lateral surface 1600 . it should be appreciated that generally superior surface 360 ( of stem 280 ) corresponds roughly to generally superior surface 1520 , generally inferior surface 380 ( of stem 280 ) corresponds roughly to generally inferior surface 1540 , generally anterior - medial surface 400 ( of stem 280 ) corresponds roughly to generally anterior - medial surface 1560 , generally posterior - medial surface 420 ( of stem 280 ) corresponds roughly to generally posterior - medial surface 1580 , and generally lateral surface 440 ( of stem 280 ) corresponds roughly to generally lateral surface 1600 . at step 1720 ( fig2 b ), intermediate 3 - d model 1700 was constructed by inscribing a plurality of mutually parallel triangular cross sections within the boundaries defined by the model walls on a plurality of xy - plane ( see fig3 ) cross - sections of relatively complex 3 - d model 1500 ( see fig8 ). fig9 shows views of a volumetric rendering of this intermediate 3 - d model 1700 of the normalized glenoid vault morphology of the scapulae sample based on relatively complex 3 - d model 1500 ( see fig8 ). at step 1800 ( fig2 b ), a simplified 3 - d model 1820 ( see fig1 ) of the average normalized glenoid vault morphology of the scapulae sample was constructed by selecting five equidistantly inferior - superior spaced - apart mutually parallel triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) ( see fig1 and 11 ) from intermediate 3 - d model 1700 ( see fig9 ). these triangular cross - sections were selected to account for more than 90 % of the volume of intermediate 3 - d model 1700 with almost negligible spatial deviation of the anterior and posterior walls . it should be appreciated that simplified 3 - d model 1820 thus provides a concise geometrical model of the normalized glenoid vault morphology while substantially preserving the morphological nuances inherent to the endosteal walls 320 ( see fig1 ). a perspective view of this simplified 3 - d model 1820 of the average normalized glenoid vault morphology of the scapulae sample is shown in fig1 . fig1 shows a superior view of each of the triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) obtained from the simplified 3 - d model 1820 . as at least partially discernable from fig1 and 11 , cross section 1840 includes a generally medially positioned vertex 2000 , a generally anteriorly and generally laterally positioned vertex 2020 , and a generally posteriorly and generally laterally positioned vertex 2040 . similarly , cross section 1860 includes a generally medially positioned vertex 2060 , a generally anteriorly and generally laterally positioned vertex 2080 , and a generally posteriorly and generally laterally positioned vertex 2100 . cross section 1880 includes a generally medially positioned vertex 2120 , a generally anteriorly and generally laterally positioned vertex 2140 , and a generally posteriorly and generally laterally positioned vertex 2160 . the next cross section 1900 includes a generally medially positioned vertex 2180 , a generally anteriorly and generally laterally positioned vertex 2200 , and a generally posteriorly and generally laterally positioned vertex 2220 . finally , cross section 1920 includes a generally medially positioned vertex 2240 , a generally anteriorly and generally laterally positioned vertex 2260 , and a generally posteriorly and generally laterally positioned vertex 2280 . further , cross section 1840 includes a “ base ” edge 2400 extending between vertex 2020 and vertex 2040 , cross section 1860 includes a “ base ” edge 2420 extending between vertex 2080 and vertex 2100 , cross section 1880 includes a “ base ” edge 2440 extending between vertex 2140 and vertex 2160 , cross section 1900 includes a “ base ” edge 2460 extending between vertex 2200 and vertex 2220 , and cross section 1920 includes a “ base ” edge 2680 extending between vertex 2240 and vertex 2280 . in addition , cross section 1840 includes a “ left ” edge 2500 extending between vertex 2000 and vertex 2020 , cross section 1860 includes a “ left ” edge 2520 extending between vertex 2060 and vertex 2080 , cross section 1880 includes a “ left ” edge 2540 extending between vertex 2120 and vertex 2140 , cross section 1900 includes a “ left ” edge 2560 extending between vertex 2180 and vertex 2200 , and cross section 1920 includes a “ left ” edge 2580 extending between vertex 2240 and vertex 2260 . finally , cross section 1840 includes a “ right ” edge 2600 extending between vertex 2000 and vertex 2040 , cross section 1860 includes a “ right ” edge 2620 extending between vertex 2060 and vertex 2100 , cross section 1880 includes a “ right ” edge 2640 extending between vertex 2120 and vertex 2160 , cross section 1900 includes a “ right ” edge 2660 extending between vertex 2180 and vertex 2220 , and cross section 1920 includes a “ right ” edge 2480 extending between vertex 2260 and vertex 2280 . the respective base edges ( 2400 , 2420 , 2440 , 2460 , 2680 ) of the triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) define lateral boundaries of simplified 3 - d model 1820 , corresponding to the region of the typical glenoid fossa 1160 ( see fig3 ). further , the respective left edges ( 2500 , 2520 , 2540 , 2560 , 2580 ) of triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) define anterior boundaries of simplified 3 - d model 1820 , while the respective “ right ” edges ( 2600 , 2620 , 2640 , 2660 , 2480 ) of triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) define posterior boundaries of simplified 3 - d model 1820 . the respective generally medially positioned vertexes ( 2000 , 2060 , 2120 , 2180 , 2260 ) of triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) sweep from a more posterior orientation at the inferior end of simplified 3 - d model 1820 to a more anterior orientation at the superior end of simplified 3 - d model 1820 . each of the triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) has a respective width dimension (“ w ”) and a depth dimension (“ d ”). the table in fig1 summarizes the respective width dimension (“ w ”) ( see fig1 ), depth dimension (“ d ”) ( see fig1 ), and resulting area of triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ). the table in fig1 lists the coordinates for the respective vertexes of triangular cross sections ( 1840 , 1860 , 1880 , 1900 , 1920 ) relative to rectangular (“ cartesian ”) coordinates reference system 1060 ( see fig3 ). it is contemplated that simplified 3 - d model 1820 may be rigidly scaled according to si size ( see fig4 ) to accommodate larger or smaller glenoid vaults while maintaining the integrity of the basic morphological model . at step 3000 ( fig2 c ), stem 280 is initially fashioned in the shape of the simplified 3 - d model 1820 . in one embodiment , this step 3000 contemplates loading the coordinates of each of the vertexes defining the simplified 3 - d geometrical model 1820 into a suitable stereo lithography system . the stereo lithography system may be operated to produce a corresponding 3 - d form made of a plastic , wax , or any other suitable material as is known in the art . a mold is then prepared from the 3 - d form and a stem 280 is fashioned , such as by injection molding using this mold . in alternative embodiments stem 280 may be otherwise suitably produced in accordance with simplified 3 - d model 1820 via stereo lithography , by hand , or by any other suitable method ( with or without an intervening form or mold ) as known . in subsequent steps , the stem 280 is machined to provide the features necessary to prepare the stem for implantation . thus , at step 3020 ( fig2 c ), socket 460 is bored into stem 280 . at step 3040 ( fig2 c ), through - channel 480 is bored ( coaxially with socket 460 ) through stem 280 . it should be understood that the rough stem produced from the 3 - d model may be machined according to other protocols depending upon the interface between the stem 280 and the bearing 220 . it is further contemplated that the stem 280 may be formed as a solid or a hollow body and may further be provided with certain surface features to facilitate fixation of the stem within the glenoid vault . the improved stem may then be implanted in accordance with known surgical procedures . for instance , cancellous bone 340 may first be removed from the glenoid vault of scapula 200 to construct cavity 300 , which extends to endosteal walls 320 ( see fig1 ). stem 280 is then inserted into cavity 300 into intimate contact with endosteal walls 320 to facilitate alignment and reliable fixation of glenoid component 120 within scapula 200 . bone cement may be used to enhance fixation of the stem within the bone . fastener 480 is inserted through through - channel 480 into engagement with scapula 200 . after fastener 480 is fully inserted into scapula 200 , post 260 is inserted into socket 460 and bearing 220 is secured to stem 280 . the foregoing description of the invention is illustrative only , and is not intended to limit the scope of the invention to the precise terms set forth . further , although the invention has been described in detail with reference to certain illustrative embodiments , variations and modifications exist within the scope and spirit of the invention as described and defined in the following claims . for example , the glenoid components may be solid or hollow bodies . in particular , the stem 280 may be formed as a solid implant , but may be preferably at least partially hollow to reduce the weight and material requirements for the component . if the implant component is hollow , it must have sufficient wall thickness to maintain its strength and integrity under maximum expected physiological loads . the present invention contemplates a glenoid stem component that is formed to closely approximate a normalized glenoid vault morphology . in the embodiments discussed above , this normalized morphology is generated from a relatively large sample size of human scapulae from which relevant measurements were obtained . it was found that the normalized component dimensions obtained in accordance with the invention well approximated the actual dimensions of the sample population . in particular , it was found that at least 85 % of the surface points of the sampled glenoid vaults varied by less than 2 . 0 mm , which represents a minimal variation given the overall dimensions of the endosteal walls of the vault . in generating the vault models for the different groups noted above , it was discovered that for the entire set of vault geometries , 98 . 5 % of the surface points comprising the interior surface models varied by less than 2 . 0 mm . this finding refuted the a prior assumption that vault morphology was dependent upon the global vault size . as a result , a single vault model was derived from the group models using the same steps described above . this final model is depicted in fig9 . from that model of the actual glenoid vault morphology for the entire sample population , the simplified geometric model was developed as described above . this simplified model was found to account for over 80 % of the volume of the model of the actual sample population , while also preserving the morphological nuances inherent to the endosteal surfaces of the glenoid vault . in one aspect of the invention , a morphological model is developed for several discrete groups of glenoid sizes . the groups may be preferably grouped by si ( superior - inferior ) dimension , as summarized in the table of fig5 . the simplified model used to create the component mold in the illustrated embodiment corresponded to group 4 , but it is understood that the simplified model for the other groups may be obtained by directly scaling the dimensions as a function of the ratio of si values .
| 1 |
embodiments according to the present invention are described hereunder referring to tables 3 and 4 accompanied hereto on separate sheets . porous black a - 1 , b - 1 and 2 , c - 1 , 2 , 3 , 4 , 5 , 6 and 7 , d - 1 , e - 1 , 2 and 3 , f - 1 , 2 and 3 and g - 1 , 2 and 3 are shown in table 4 , said porous black being produced by etching carbon blacks a , b , c , d , e , f and g shown in table 3 under high temperatures of 900 ° c .˜ 950 ° c . by means of carbon dioxide gas or steam , thus increasing respective specific surface areas thereof by various magnitudes depending on the varying temperatures . ( according to the 32nd and 47th embodiments , carbon blacks were made porous by means of steam treatment .) the numerals after said alphabetic symbols indicate that the respective magnitudes of specific surface areas are different . the specific surface areas indicated have been measured according to astm d3037 - 88 . high density polyethylene ( 1300j with a melting point of 131 c : manufactured by mitsui petrochemical industries ) was used as the aforementioned crystalline polymer . next , each of said porous black and said high density polyethylene ( 1300 j ) were combined together according to the porous black content ratio shown in table 4 and then blended together in a mixing test roller ( manufactured by kodaira seisakusho co ., ltd . : 150 mmφ × 200 mml ) adjusted at 135 ° c . ; the blended ingredients were processed into material for shaping , chips of approximately 1 mm in size , by means of a crusher ( sprec mini f 180 : manufactured by matsui seisakusho co ., ltd .) and a fine grinder ( wiley - w - 100 : manufactured by ikeda rika co ., ltd .). said material for shaping was shaped together with metallic foils ( produced by fukuda metal foils & amp ; powder co ., ltd . ), which was to serve as electrodes , under pressure of 65 kg / cm 2 and a temperature of 200 ° c . for 3 mins , and finally into the shaped articles through thermal treatment at 120 ° c . for 1 hour . then , said shaped articles were exposed to 10 m rad of gamma radiation and then shaped into articles measuring l 1 = 10 mm , l 2 = 4 . 5 mm , t = 1 . 5 mm , the shape of which is shown in fig6 . thus , ptc device 3 , which comprises ptc element 1 having both sides thereof metallic foil 2 , was obtained . next , ptc device 3 thus obtained was placed in a constant temperature oven and heated with temperature elevation speed of 1 ° c ./ min . therein , with resistivity value r at each temperature measured , and height of ptc was computated from thus measured values r , utilizing the formula ( 1 ) below . the result of the computation is shown in table 4 . the volume resistivity ρ 20 and ρ peak were calculated from the resistivity r of ptc device 3 shown in fig6 utilizing the formula ( 2 ) ## equ1 ## separate table 5 shows examples for comparison , according to which , the same carbon black as that of the present embodiments was combined with high density polyethylene without being made porous by means of vapor etching , but by otherwise identical procedures to produce shaped ptc devices . the resulting volume resistivities and ptc characteristics are shown in table 5 . comparison between the volume resistivities ρ 20 of the examples of table 5 and the embodiments of table 4 shows that the volume resistivites of ptc devices made porous by means of the vapor etching method according to the embodiments of the present invention are smaller in spite of the identical amounts of carbon black in the examples for comparison and the embodiments . this result indicates that the amount of carbon black filler made porous by the vapor etching method required to produce an equivalent degree of conductivity is relatively small compared with that for devices of the examples with unetched carbon black . fig7 through 14 are charts concerning ptc devices of the present embodiments and those of the examples for comparison , showing the relationship between the amount of carbon black in high density polyethylene and the volume resistivity at 20 ° c . ( ρ 20 ): fig7 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black a and porous black a - 1 were combined respectively with high density polyethylene ; fig8 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black b and porous blacks b - 1 and b - 2 were combined respectively with high density polyethylene ; fig9 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black c and porous blacks c - 1 c - 2 , c - 3 and c - 4 were combined respectively with high density polyethylene ; fig1 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black c and porous blacks c - 5 , c - 6 and c - 7 were combined respectively with high density polyethylene ; fig1 is a comparison chart of volume resistivities ρ 20 when various amounts of carbon black d and porous black d - 1 were combined respectively with high density polyethylene ; fig1 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black e and porous blacks e - 1 e - 2 and e - 3 were combined respectively with high density polyethylene ; fig1 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black f and porous blacks f - 1 , f - 2 and f - 3 were combined respectively with high density polyethylene ; fig1 is a comparison chart of volume resistivites ρ 20 when various amounts of carbon black g and porous blacks g - 1 , g - 2 and g - 3 were combined respectively with high density polyethylene . all of these charts clearly show that , at the same content , the volume resistivites ρ 20 of ptc devices of the present embodiments are lower than those of the examples for comparison , where unetched carbon black itself was used . separate table 6 shows the result of measuring volume resistivities ρ 20 and ptc characteristics of ptc devices produced by combining conventional carbon blacks ( shown in table 1 ) with high density polyethylene in the same manner as that for the present embodiments and through further identical procedures . comparison between table 6 showing examples of conventional carbon blacks and table 4 showing the embodiments proves that ptc characteristics of the conventional carbon blacks are below 1 . 0 , except for examples 4 and 9 , while ptc characteristics of the embodiments are all above 1 . 0 . according to fig1 , which is a resistivity - temperature characteristics chart , and fig1 , which is a current - voltage characteristics chart . ptc characteristics are shown as log ( rpeak / ro ). the resistance at ( a ) in fig1 and 16 is ro = vp / ip = vrxir , ptc characteristics value = n = log ( rpeak / ro )= 2 log ( vr / vp ). given that vp is the voltage drop across a ptc device of a self - resetting overcurrent protection device and that vr is the circuit voltage , in general cases , vp must not be more than 20 % of vr . therefore , as n = 2 log ( vr / vp )= 2 log ( 1 / 0 . 2 )= 1 . 39 , a value not less than 1 is required for a device with ptc characteristics to be used as a self - resetting overcurrent protection device . this indicates that ptc characteristics values of the examples of examples of conventional unetched carbon blacks are not sufficient for self - resetting overcurrent protection devices . all of the embodiments of the invention using etched carbon black have favorable ptc characteristics values , greater than 1 . 0 , enabling their use as self - resetting overcurrent protection devices . further , carbon black and porous black were separately blended with high density polyethylene and made into shaped articles in the same manner as said embodiments and examples for comaprison , with the variation of resistance at 70 ° c . of elements made from said shaped articles shown in separte tables 7 and 8 as an example . said variation of resistance was calculated utilizing formula ( 3 ). ## equ2 ## 70 ° c . mentioned above is in general the highest surrounding temperature of an electrical device in use . in case the temperature around a self - resetting overcurrent protection device in use changes , it sometimes presents a problem in that the change in resistance of the element may cause fluctuations in the voltage in the electrical circuit of the apparatus . for this reason , it is important that variation of resistance of a device be small . it is evident from the tables that the variation of resistance of the present embodiments shown in table 7 are lower than those of the examples for comparison shown in table 8 . although high density polyethylene was used for crystalline polymer in the embodiments , it is possible to use alone or in combination , other kinds of polymers , such as low density polyethylene , middle density polyethylene , polypropylene , fluorocarbon polymers , poly ( ethylene terephthalete ), etc . according to the present invention , since the porous carbon black produced by increasing the specific surface area of carbon black by means of the vapor etching method is porous without significant change in particle size and / or structure thereof , the content of porous carbon black dispersed in crystalline polymer to obtain equivalent volume resistivity can be relatively small . further , since porous carbon black is obtained by making carbon black raw material porous by means of vapor etching , oil furnace black , lamp black and other kinds of carbon black with favorable ptc characteristics can be chosen freely for carbon black . therefore , higher ptc characteristics values can be obtained compared with conventional conductive carbon black ( as described in table 1 ), which is obtained by making carbon black porous at the time of its formation . furthermore , as the variation of resistance at 70 ° c . of a self - resetting overcurrent protection device according to the present invention is low , it is possible to stabilize the voltage decrease of the self - resetting overcurrent protection device in relation to changes in the surrounding temperature when the current is below the rated current value . moreover , according to the present invention , as the volume resistivity at 20 ° c . of a self - resetting overcurrent protection device is set in the range of 0 . 4 ohm cm ˜ 150 ohm cm , the device can be designed to fit the range of 0 . 06a ˜ 20a , which is substantially the same as that of the rated current value of ordinary fuses . table 3______________________________________ specific particle surfacecarbon name of diameter areablack grade manufacturer ( mμ ) ( m . sup . 2 / g ) ______________________________________a asahi # 80 asahi carbon co . 20 119 . 6 oil furnace blackb asahi # 70 &# 34 ; 26 77 oil furnace blackc asahi # 60h &# 34 ; 41 45 oil furnace blackd asahi # 60 &# 34 ; 45 40 oil furnace blacke asahi # 55 &# 34 ; 66 29 . 2 oil furnace blackf asahi # 50hg &# 34 ; 80 22 oil furnace blackg lamp black 101 degussa 95 20 ( west germany ) ______________________________________ table 4__________________________________________________________________________ ptc characteristics embodiment porous black area ( m . sup . 2 / g ) specific surface area magnitudespecific surface content ( wt %) porous ρ . sub . 20 ( ωcm ) volume resistivity ## str1 ## __________________________________________________________________________1 a - 1 860 7 . 1 28 . 6 1 . 55 1 . 462 a - 1 860 7 . 1 23 . 1 3 . 88 1 . 743 a - 1 860 7 . 1 20 7 . 86 2 . 164 b - 1 187 2 . 4 33 . 3 0 . 61 2 . 615 b - 1 187 2 . 4 28 . 6 0 . 97 2 . 826 b - 1 187 2 . 4 23 . 1 2 . 11 3 . 397 b - 1 187 2 . 4 20 5 . 87 4 . 268 b - 1 187 2 . 4 16 . 7 12 . 6 4 . 879 b - 1 187 2 . 4 13 . 0 40 . 7 7 . 3310 b - 2 1140 14 . 8 23 . 1 1 . 13 1 . 5911 b - 2 1140 14 . 8 20 2 . 08 2 . 0212 b - 2 1140 14 . 8 16 . 7 4 . 63 2 . 3313 b - 2 1140 14 . 8 13 15 . 2 3 . 1914 c - 1 65 . 4 1 . 5 37 . 5 0 . 52 2 . 6215 c - 1 65 . 4 1 . 5 33 . 3 0 . 87 3 . 3116 c - 1 65 . 4 1 . 5 28 . 6 1 . 92 4 . 6417 c - 1 65 . 4 1 . 5 23 . 1 6 . 02 5 . 5118 c - 1 65 . 4 1 . 5 20 17 . 9 & gt ; 7 . 7919 c - 1 65 . 4 1 . 5 16 . 7 111 & gt ; 6 . 8920 c - 2 415 9 . 2 33 . 3 0 . 56 2 . 2821 c - 2 415 9 . 2 28 . 6 1 . 1 3 . 022 c - 2 415 9 . 2 23 . 1 3 . 0 4 . 0223 c - 2 415 9 . 2 20 7 . 3 5 . 3124 c - 2 415 9 . 2 16 . 7 40 & gt ; 7 . 625 c - 3 813 18 . 1 28 . 6 0 . 61 2 . 0726 c - 3 813 18 . 1 23 . 1 1 . 49 2 . 7827 c - 3 813 18 . 1 20 2 . 89 3 . 3328 c - 3 813 18 . 1 16 . 7 7 . 14 4 . 8129 c - 3 813 18 . 1 13 30 . 5 7 . 5230 c - 4 983 21 . 8 23 . 1 1 . 09 2 . 0431 c - 4 983 21 . 8 20 1 . 83 2 . 2432 c - 5 408 9 . 1 33 . 3 0 . 79 2 . 6333 c - 5 408 9 . 1 28 . 6 1 . 58 3 . 034 c - 5 408 9 . 1 23 . 1 4 . 64 5 . 4835 c - 5 408 9 . 1 20 12 . 1 7 . 2936 c - 5 408 9 . 1 16 . 7 32 7 . 5137 c - 6 528 11 . 7 37 . 5 0 . 43 1 . 3938 c - 6 528 11 . 7 33 . 3 0 . 68 1 . 7439 c - 6 528 11 . 7 28 . 6 1 . 30 2 . 3940 c - 6 528 11 . 7 23 . 1 3 . 63 3 . 1641 c - 6 528 11 . 7 20 7 . 43 3 . 7242 c - 6 528 11 . 7 16 . 7 21 . 3 5 . 1643 c - 7 630 14 37 . 5 0 . 41 1 . 6944 c - 7 630 14 33 . 3 0 . 64 2 . 2845 c - 7 630 14 28 . 6 1 . 25 2 . 5346 c - 7 630 14 23 . 1 3 . 46 4 . 0447 c - 7 630 14 20 7 . 36 4 . 7848 d - 1 451 11 33 . 3 0 . 66 2 . 1549 d - 1 451 11 28 . 6 1 . 24 3 . 050 d - 1 451 11 23 . 1 3 . 56 5 . 1451 d - 1 451 11 20 7 . 37 7 . 6652 d - 1 451 11 16 . 7 25 . 9 & gt ; 7 . 653 e - 1 173 . 7 6 . 0 35 . 5 0 . 88 3 . 854 e - 1 173 . 7 6 . 0 33 . 3 1 . 16 3 . 955 e - 1 173 . 7 6 . 0 28 . 6 2 . 77 5 . 756 e - 1 173 . 7 6 . 0 23 . 1 9 . 85 & gt ; 857 e - 1 173 . 7 6 . 0 20 26 . 6 & gt ; 7 . 658 e - 2 489 16 . 7 33 . 3 0 . 68 2 . 9259 e - 2 489 16 . 7 28 . 6 1 . 5 3 . 3760 e - 2 489 16 . 7 23 . 1 4 . 5 6 . 3561 e - 2 489 16 . 7 20 13 & gt ; 7 . 962 e - 2 489 16 . 7 16 . 7 44 & gt ; 7 . 463 e - 3 659 22 . 6 33 . 3 0 . 53 2 . 1164 e - 3 659 22 . 6 28 . 6 1 . 1 2 . 7265 e - 3 659 22 . 6 23 . 1 3 . 1 4 . 4466 e - 3 659 22 . 6 20 6 . 3 5 . 967 e - 3 659 22 . 6 16 . 7 21 & gt ; 7 . 868 f - 1 220 . 7 10 33 . 3 1 . 11 4 . 1669 f - 1 220 . 7 10 28 . 6 2 . 69 8 . 4870 f - 1 220 . 7 10 23 . 1 12 . 1 & gt ; 7 . 871 f - 1 220 . 7 10 20 81 . 7 & gt ; 6 . 972 f - 2 449 20 . 4 33 . 3 0 . 85 3 . 6573 f - 2 449 20 . 4 28 . 6 1 . 9 6 . 2974 f - 2 449 20 . 4 23 . 1 7 . 47 & gt ; 8 . 175 f - 2 449 20 . 4 20 22 . 3 & gt ; 7 . 676 f - 3 945 43 33 . 3 0 . 46 2 . 0177 f - 3 945 43 28 . 6 0 . 86 2 . 778 f - 3 945 43 23 . 1 2 . 67 4 . 5879 f - 3 945 43 20 7 . 08 6 . 4980 f - 3 945 43 16 . 7 42 . 1 & gt ; 7 . 681 g - 1 66 . 1 3 . 3 37 . 5 0 . 56 3 . 4882 g - 1 66 . 1 3 . 3 33 . 3 0 . 99 3 . 983 g - 1 66 . 1 3 . 3 28 . 6 2 . 34 5 . 8284 g - 1 66 . 1 3 . 3 23 . 1 12 . 7 & gt ; 7 . 985 g - 1 66 . 1 3 . 3 20 153 & gt ; 5 . 886 g - 2 420 21 37 . 5 0 . 38 2 . 6587 g - 2 420 21 33 . 3 0 . 68 2 . 7588 g - 2 420 21 28 . 6 1 . 48 3 . 9289 g - 2 420 21 23 . 1 5 . 55 & gt ; 8 . 190 g - 2 420 21 20 22 . 3 & gt ; 7 . 591 g - 3 930 46 . 5 23 . 1 2 . 1 3 . 2392 g - 3 930 46 . 5 20 4 . 72 4 . 25__________________________________________________________________________ table 5__________________________________________________________________________ ptc characteristics comparisonexample for blackcarbon area ( m . sup . 2 / g ) specific surface content ( wt %) carbon black ρ . sub . 20 ( ωcm ) volume ## str2 ## __________________________________________________________________________1 a 119 . 6 33 . 3 0 . 96 2 . 342 a 119 . 6 28 . 6 1 . 63 2 . 633 a 119 . 6 20 10 . 8 3 . 584 a 119 . 6 16 . 7 29 . 3 5 . 445 b 77 37 . 5 0 . 88 2 . 776 b 77 33 . 3 1 . 66 3 . 267 b 77 28 . 6 3 . 73 4 . 368 b 77 23 . 1 12 . 9 6 . 169 b 77 20 41 . 5 & gt ; 7 . 310 c 45 37 . 5 0 . 69 2 . 8211 c 45 33 . 3 1 . 1 3 . 7112 c 45 28 . 6 2 . 4 4 . 0813 c 45 23 . 1 9 . 6 7 . 2614 d 40 37 . 5 0 . 83 3 . 3615 d 40 28 . 6 3 . 33 6 . 3416 d 40 23 . 1 16 . 0 & gt ; 7 . 917 d 40 20 40 . 8 & gt ; 7 . 518 e 29 . 2 41 . 2 0 . 8 4 . 6219 e 29 . 2 37 . 5 1 . 42 5 . 5920 e 29 . 2 33 . 3 3 . 04 6 . 7621 e 29 . 2 28 . 6 9 . 5 8 . 122 e 29 . 2 23 . 1 53 7 . 623 f 22 37 . 5 1 . 59 5 . 6924 f 22 33 . 3 3 . 77 & gt ; 8 . 525 f 22 28 . 6 11 . 5 & gt ; 826 g 20 50 0 . 21 2 . 6827 g 20 47 . 4 0 . 3 2 . 8928 g 20 44 . 4 0 . 4 3 . 2929 g 20 41 . 2 0 . 61 3 . 8530 g 20 37 . 5 0 . 93 4 . 9331 g 20 33 . 3 1 . 93 & gt ; 7 . 932 g 20 28 . 6 5 . 67 & gt ; 8 . 4__________________________________________________________________________ table 6__________________________________________________________________________ ptc characteristics carbon blackexample of conventional carbon black area ( m . sup . 2 / g ) specific surface content ( wt %) carbon black ρ . sub . 20 ( ωcm ) volume resistivity ## str3 ## __________________________________________________________________________1 black pearls 2000 1475 28 . 6 0 . 61 0 . 522 black pearls 2000 1475 23 . 1 1 . 31 0 . 663 black pearls 2000 1475 16 . 7 4 . 76 0 . 744 black pearls 2000 1475 9 . 1 84 . 4 1 . 145 conductex 40 - 220 1066 33 . 3 0 . 46 0 . 346 conductex 40 - 220 1066 28 . 6 1 . 09 0 . 77 conductex 40 - 220 1066 23 . 1 2 . 5 0 . 738 conductex 40 - 220 1066 16 . 7 9 . 2 0 . 859 conductex 40 - 220 1066 9 . 1 242 1 . 8210 ketjen black ec 950 33 . 3 0 . 25 0 . 2311 ketjen black ec 950 28 . 6 0 . 43 0 . 5412 ketjen black ec 950 23 . 1 0 . 85 0 . 713 ketjen black ec 950 16 . 7 2 . 81 0 . 91__________________________________________________________________________ table 7______________________________________ volume vari - specific porous resistivity ation of surface black ( at 20 ° c .) resis - embodi - porous area content ρ . sub . 20 tancement black magnitude ( wt %) ( ωcm ) (%) ______________________________________53 e - 1 6 . 0 35 . 5 0 . 88 22 . 054 e - 1 6 . 0 33 . 3 1 . 16 19 . 755 e - 1 6 . 0 28 . 6 2 . 77 23 . 956 e - 1 6 . 0 23 . 1 9 . 85 30 . 257 e - 1 6 . 0 20 26 . 6 36 . 558 e - 2 16 . 7 33 . 3 0 . 68 17 . 659 e - 2 16 . 7 28 . 6 1 . 5 15 . 560 e - 2 16 . 7 23 . 1 4 . 5 17 . 861 e - 2 16 . 7 20 13 20 . 562 e - 2 16 . 7 16 . 7 44 26 . 963 e - 3 22 . 6 33 . 3 0 . 53 13 . 264 e - 3 22 . 6 28 . 6 1 . 1 13 . 165 e - 3 22 . 6 23 . 1 3 . 1 11 . 766 e - 3 22 . 6 20 6 . 3 12 . 367 e - 3 22 . 6 16 . 7 21 14 . 868 f - 1 10 33 . 3 1 . 11 17 . 069 f - 1 10 28 . 6 2 . 69 19 . 670 f - 1 10 23 . 1 12 . 1 27 . 571 f - 1 10 20 81 . 7 58 . 772 f - 2 20 . 4 33 . 3 0 . 85 13 . 473 f - 2 20 . 4 28 . 6 1 . 9 13 . 574 f - 2 20 . 4 23 . 1 7 . 47 18 . 275 f - 2 20 . 4 20 22 . 3 24 . 976 f - 3 43 33 . 3 0 . 46 10 . 277 f - 3 43 28 . 6 0 . 86 7 . 8778 f - 3 43 23 . 1 2 . 67 7 . 0479 f - 3 43 20 7 . 08 8 . 1880 f - 3 43 16 . 7 42 . 1 12 . 9______________________________________ table 8______________________________________example specific carbon volume variationfor surface black resistivity ofcom - carbon area content ρ . sub . 20 resistanceparison black ( m . sup . 2 / g ) ( wt %) ( ωcm ) (%) ______________________________________18 e 29 . 2 41 . 2 0 . 8 20 . 019 e 29 . 2 37 . 5 1 . 42 22 . 820 e 29 . 2 33 . 3 3 . 04 27 . 521 e 29 . 2 28 . 6 9 . 5 30 . 422 e 29 . 2 23 . 1 53 39 . 723 f 22 37 . 5 1 . 59 21 . 924 f 22 33 . 3 3 . 77 24 . 525 f 22 28 . 6 11 . 5 29 . 3______________________________________
| 2 |
turning now to the drawings , and particularly to fig2 , and 4 , the liquid crystal display ( lcd ) element 10 or components thereof made in accordance with the method of the invention is illustrated . according to fig3 and 4 , liquid crystal display element 10 is generally defined as having a first transparent substrate , or alternatively deck plate , 12 fixedly bonded to a second transparent substrate , or alternatively signal plate , 18 . according to fig2 among other things , deck plate 12 provides barrier protection for an indium tin oxide ( ito ) coating layer 32 deposited on active surface 20 of signal plate 18 . referring to fig2 the ito coating layer 32 provides electrical continuity between active surfaces 20 , 22 through vias 30 . it should be appreciated that existing lcd panels teach an ito coating layer 32 deposited only on one active surface of the signal plate in contradistinction to the present lcd element having an ito coating layer 32 deposited on opposing active surfaces 20 , 22 of signal plate 18 . referring to fig2 and 4 , important to the present invention , a plurality of through holes , commonly referred to as vias 30 , is formed in the signal plate 18 . as indicated , vias 30 provide electrical continuity paths between the opposing active surfaces 20 , 22 of the signal plate 18 , as described in greater details below . skilled artisans in the field of lcd manufacturing will appreciate that the present invention necessitates solving a range of new and challenging problems never before presented in traditional lcd manufacturing . to maintain transparency of the signal plate 18 , it was discovered that vias 30 then had to be filled with an optical grade adhesive material 34 ( described below ) free of air bubbles or voids so as to prevent light scattering from the functioning lcd ( compare fig1 and 2 ). moreover , it was discovered that the adhesive material 34 provides the unexpected benefit of further protecting the ito coating layer 32 bonding the deck plate 12 to the signal plate 18 . referring to fig2 and 3 , by carefully controlling gap 11 separating the deck plate 12 and active surface 20 of signal plate 18 , we were able to facilitate capillary action that efficiently wicked the optical grade adhesive material 34 into the vias 30 formed in signal plate 18 . spacers 28 , such as standoffs or shims , affixed to deck plate 12 is preferably used to control the spacing between deck plate 12 and signal plate 18 . as shown in fig5 surface tension and the presence of a cavity 70 in the assembly fixture 60 prohibit the optical grade adhesive material 34 from wicking out onto second active surface ( alternatively referred to as the pixel side of the lcd element ) 22 of signal plate 18 . second active surface 22 of signal plate 18 is then coated with a first polyimide alignment layer 38 which aligns the lcd medium 42 ( typically a liquid crystal material formulation ) with a second polyimide alignment layer 39 applied over a third transparent substrate ( typically an electrode panel ) 46 . lcd medium 42 contains spacers , such as a plurality of glass spheres , 40 that separate first polyimide alignment layer 38 from second polyimide layer 39 on electrode panel 46 thereby forming the active region 43 of lcd . an epoxy seal 44 is applied to the perimeter of the electrode panel 46 before it is bonded to the second active surface 22 of signal plate 18 . as shown in fig2 electrode panel 46 comprises an active electrode surface 48 containing an ito coating layer 52 and an outer passive electrode surface 50 opposite active electrode surface 48 . active electrode surface 48 generally faces lcd medium 42 . referring to fig2 , 4 and 5 , in constructing lcd element 10 of the invention , deck plate or first transparent substrate 12 is provided with a first surface 14 and an opposed second surface 16 . spacers 28 are bonded along peripheral edges 29 , 31 of first surface 14 of deck plate 12 with a suitable adhesive , such as an epoxy . we prefer using an optical grade adhesive material 34 such as the same epoxy used to bond deck plate 12 and signal plate 18 . alternatively , the spacers 28 could be integrally formed into the deck plate 12 by etching and machining the deck plate 12 . as can be appreciated in fig2 signal plate 18 containing vias 30 filled with an optical grade adhesive material 34 provides a boundary wall for the liquid crystal when it is injected into the active region 43 of the lcd element 10 . moreover , second surface 16 of deck plate 12 is coated with a protective ultra - violet transparent protective layer 24 of a predetermined thickness to prevent light penetration through deck plate 12 and into gap 11 . those skilled in the art will appreciate that deck plate 12 , of the present invention , is not contemplated in existing lcd elements . with reference to fig3 we have experimentally determined that the preferred thickness of spacers 28 structurally associated with deck plate 12 is about 0 . 150 mm . this preferred thickness of spacers 28 corresponds to deck plate 12 having a thickness of about 0 . 500 - mm and a signal plate 18 having vias 30 with an average diameter of about 0 . 300 - mm . therefore , our experience indicates that the spacer thickness is modified based on the average diameter of the vias 30 . the thickness of spacer 28 must be controlled to allow the adhesive material to flow into the vias 30 . referring again to fig3 formation of undesirable voids in adhesive material 34 filling vias 30 as well as insufficient filling of the vias 30 with optical grade adhesive material 34 , preferably epotek 310 ™, are strongly influenced by the diameter of the vias 30 and dimensions of spacers 28 . as examples , vias 30 having an average diameter of about 0 . 300 mm and the absence of spacers 28 affixed to deck plate 12 have both shown to produce voids in vias 30 and filling problems . the same result was observed if the spacers 28 had a thickness of less than about 0 . 075 mm . referring to fig2 gap 11 defined by the height of spacers 28 enables the vias in the signal plate 18 to be filled efficiently without introducing voids or air bubbles into the vias 30 . as indicated previously , experience indicates that the presence of air bubbles in the vias 30 causes the light to scatter in the operating lcd . according to fig4 signal plate 18 , in greater details , has opposed first and second active surfaces 20 , 22 . in stark contrast , prior art signal plates only have one active surface . in constructing the lcd element 10 , first active surface 20 of signal plate 18 is bonded with a suitable optical grade adhesive material 34 , such as an epoxy , acrylic or ester , to second surface 16 of deck plate 12 . it is important to the invention that signal plate 18 has formed therein a plurality of vias 30 . vias 30 pass between the first active surface 20 and the second active surface 22 to facilitate electrical continuity between the first active surface 20 and the second active surface 22 . also , vias 30 in the signal plate 18 allow a higher patterning density for the lcd , thereby decreasing the lcd size . vias 30 are filled with the optical grade adhesive material 34 , as described more fully below , that prevents the formation of voids or air bubbles in the optical grade adhesive material 34 . as indicated above in the prior art , voids or air bubbles in the adhesive filling become a source of undesirable light scatter ( see for instance prior art fig1 ). referring to fig2 and 4 , skilled artisans will appreciate that vias 30 in signal plate or second substrate 18 may be formed in one of several ways . we prefer vias that have been drilled in the signal plate or second substrate 18 because the drill process is easier to use and results in smoother wall surfaces within the vias hole . referring to fig2 and 5 , vias 30 in signal plate 18 are filled when the lcd element 10 of the invention is assembled . as indicated above , deck plate 12 is assembled with spacers 28 that spatially separate the deck plate 12 from the signal plate 18 . the optical grade adhesive material 34 is dispensed along the perimeter of the deck plate 12 in an optimized pattern to minimize voiding between the two substrates ( first transparent substrate or deck plate 12 and second transparent substrate or signal plate 18 ). moreover , spacers 28 allow the optical grade adhesive material 34 to fill the vias 30 without voids . the process disclosed herein allows the manufactured lcd panels to meet the specification of a void free epoxy plug in the vias 30 and a void free deck plate 12 attachment to the signal plate 18 . voids in the adhesive either between the signal plate 18 and deck plate 12 or in the vias 30 of the signal plate 18 cause light to scatter in the lcd application . referring again to fig2 and 5 , wicking of the optical grade adhesive material 34 beyond vias 30 and onto ito pattern features is controllable by , among other ways , a novel and unobvious dispensing process . also , predetermining surface tension effects of optical grade adhesive material 34 , selectively designing cavity 70 in assembly fixture 60 , and predetermining the height of spacers 28 also play important roles in preventing the optical grade adhesive materials 34 from wicking beyond vias 30 and onto the ito coating layer 32 . by using the dispensing process of the invention , vias 30 are filled to a plug height ( h ) that ranges from no more than about 5 microns above active surface 22 of signal plate 18 to not less than 40 microns below active surface 22 of signal plate 18 . referring to fig6 if optical grade material in vias 30 exceed a plug height ( h ) greater than about 5 microns beyond second active surface 22 , the excess material level 34 a which extends into the polyimide layer 38 and into the liquid crystal medium 42 will interfere with the application , preferably coating , of polyimide alignment layer 38 onto the second surface 22 of signal plate 18 . moreover , the excess material level 34 a may interfere with the formation of patterns ( not shown ) on polyimide layer 38 . furthermore , excess material level 34 a may cause an increased separation between second active surface 22 and an active surface 48 of electrode panel 46 . therefore , the result of excessive material level 34 a in vias 30 would be improper alignment of the liquid crystal medium 42 . referring now to fig7 if optical grade material in vias 30 exceed a plug height ( h ) less than about 40 microns below the second active surface 22 , the deficient material level 34 b which falls below the polyimide layer 38 in vias 30 will also interfere with the application , preferably coating , of polyimide alignment layer 38 onto the second surface 22 of signal plate 18 . therefore , the result of deficient material level 34 b in vias 30 would also be improper alignment of the liquid crystal medium 42 . those skilled in the art will appreciate that several known processes exist for filling vias 30 in a workpiece , for instance , an lcd element . among the method currently used include screen printing and pressure rolling . however , these alternative methods are known to exert a force on the lcd element 10 forcing the optical grade adhesive material 34 through vias 30 and thereby contaminating second active surface 22 of signal plate 18 . of course , an additional process step would then be required which would include an adhesive removal and cleaning process . experience has taught that optical grade adhesive material 34 removal affects the optical quality of the optical grade adhesive material 34 as well as the adherence of the remaining optical grade adhesive material 34 to interior walls 33 of vias 30 . moreover , dispense processes , like screen - printing , introduce air into the vias 30 as the optical grade adhesive material 34 is dispensed into the vias 30 . referring again to fig5 an important novel and unobvious process for filling vias 30 free of air pockets or voids is now described . our preferred adhesive material dispense process requires several important steps in order to construct the lcd element 10 of the invention . assemblage for adhesive material dispense process 68 containing assembly fixture 60 is used . assembly fixture 60 has a cavity 70 alignable under the vias 30 drilled in the signal plate 18 . cavity 70 keeps the dispensed optical grade adhesive material 34 , such as epoxy , from exiting the vias 30 after the optical grade adhesive material 34 has flowed into the vias 30 . if the cavity 70 was not present in the assembly fixture 60 , then capillary action would continue to pull the epoxy out of the vias 30 and contaminate the second active surface 22 of signal plate 18 with epoxy and create voids in the vias 30 . according to fig5 at the outset , signal plate 18 is placed in the assembly fixture 60 and a positioning bracket 61 is slid into place . the positioning bracket 61 was designed to hold the deck plate 12 in place during the epoxy dispensing process . the positioning bracket 61 allows the deck plate 12 to be aligned properly prior to adhesive dispense . moreover , the positioning bracket 61 was designed with a gap 72 so it would not slide on top of first active surface 20 of signal plate 18 . furthermore , it is important that the design of positioning bracket 61 not interfere with the optical grade adhesive material 34 as it flows between the deck plate 12 and signal plate 18 . referring again to fig5 after the deck plate 12 is positioned on top of the signal plate 18 , a stabilizing member , preferably a glass block 62 , is placed on top of the deck plate 12 . the weight of glass block 62 keeps the deck plate 12 from moving either rotationally or translationally , during adhesive dispensing . a quartz block is preferably used , however the glass block 62 could also be fabricated from other materials such as aluminum . since the deck plate 12 is mounted to signal plate 18 at the same time the optical grade adhesive material 34 in the vias 30 is cured , some sort of supporting weight on the deck plate 12 is required . without the glass block 62 , there would be thickness variations in lcd elements produced in this process . if the deck plate 12 is allowed to float , i . e ., is not supported by glass block 62 or its equivalent , the deck plate 12 would displace the excess optical grade adhesive material 34 from the vias 30 to the second active surface 22 of the signal plate 18 . the same would result if deck plate 12 is allowed to stabilize to the plug height ( h ) of spacers 28 during adhesive material curing . displacement of the optical grade adhesive material 34 invariably contaminates the patterned ito and causes defective pixels in the lcd . again referring to fig5 once the signal plate 18 and deck plate 12 are arranged in the assembly fixture 60 , the optical grade adhesive material 34 is dispensed with an automated dispensing unit 63 . the dispensing unit 63 contains a base plate 65 with a heating element 66 , preferably a hot plate , that preheats the assembly fixture 60 , the signal plate 18 , and the deck plate 12 . preheating assists the flow of the optical grade adhesive material 34 . the optical grade adhesive material 34 is dispensed in a predetermined pattern , preferably a substantially “ l ” shaped pattern along two perimeter edges of deck plate 12 . this technique prevents the occurrence of voids or air bubbles in the adhesive layer 34 between the signal plate 18 and deck plate 12 , as previously described . a void in adhesive material 34 causes incoming light to scatter during the lcd application . more particularly , adhesive material 34 is dispensed along perimeter 64 of the deck plate 12 . capillary action allows the adhesive material 34 to flow between the deck plate 12 and the signal plate 18 . by dispensing adhesive material 34 along the perimeter 64 of the deck plate 12 , capillary action fills the gap 11 between the deck plate 12 and signal plate 18 . the 0 . 15 - mm spacer 28 between the deck plate 12 and the signal plate 18 enables the adhesive material 34 to flow into the vias 30 without trapping air in the vias 30 and creating voids . since surface tension controls the flow depth of the adhesive material 34 in vias 30 , when the adhesive material exits the vias 30 , surface tension keeps it from flowing out of the vias 30 onto the patterned ito . the invention has been described with reference to a preferred embodiment . however , it will be appreciated that variations and modifications can be effected by a person of ordinary skill in the art without departing from the scope of the invention . [ 0044 ] 4 prior art active surface second side signal plate [ 0045 ] 5 prior art active surface first side signal plate [ 0082 ] 64 adhesive dispensed along perimeter of deck plate 12
| 6 |
in fig1 , a six - cylinder internal combustion engine , for example a diesel engine , is denoted by 1 , the crankshaft 2 of which is coupled to a single - disk dry plate clutch denoted generally by 3 , which is enclosed in a clutch case 4 . the crankshaft 2 is connected , non - rotatably , to an input shaft 7 , which is rotatably mounted in the housing 8 of a gearbox denoted generally by 9 . also rotatably mounted in the housing 8 are a main shaft 10 and an intermediate shaft 11 . a gear wheel is rotatably mounted on the input shaft 7 and can be locked on the shaft with the aid of a synchronizing device provided with a coupling sleeve , which is mounted in a non - rotatable but axially displaceable manner on a hub connected , non - rotatably , to the output shaft . with the aid of the coupling sleeve , a gear wheel rotatably mounted on the main shaft 10 can be locked relative to the input shaft 7 . with the coupling sleeve in a middle position , both the gearwheels are disengaged from their respective shafts 7 and 10 . the above mentioned gear wheels , together with the synchronizing device and the coupling sleeve , form a splitter gear . disposed in a rotationally secure manner on the intermediate shaft are further gear wheels , which each engage with a respective gear wheel rotatably mounted on the main shaft 10 , which latter gear wheels can be locked on the main shaft with the aid of further coupling sleeves , which , in the illustrative embodiment shown , have no synchronizing devices . in the illustrative embodiment shown , a range gear step of the planetary gear type is also provided on the output end of the main shaft . all coupling sleeves are displaceable with the aid of servo elements ( not shown ), which can be pneumatically operated piston cylinder devices of the type utilized in a transmission of the kind described above , which is marketed under the name the servo elements are electronically controlled by a control unit 45 , comprising a microcomputer , in dependence on signals fed into the control unit and representing various engine and vehicle data , which minimally comprise engine speed , vehicle speed , the position of the gas pedal 48 of the vehicle , and , where appropriate , engine brake on - off , when an electronic gear selector 46 , coupled to the control unit 45 , is in its automatic gear position . the gas pedal position is obtained from an angle transmitter 49 , which is coordinated with the pedal arm 51 , pivotably mounted on a shaft 50 , of the gas pedal 48 . when the selector 46 is in the manual gearshift position , the gearshift is realized on the command of the driver via the gear selector 46 . the control unit 45 also controls the fuel injection , i . e . the engine speed , in dependence on the gas pedal position and the air supply to a pneumatic piston - cylinder device 47 , by which the clutch 3 is disengaged . the control unit 45 is programmed so that the freewheel function is activated when the driver , with the vehicle in motion and with possible engine brake , for example an exhaust - gas regulator or compression brake , deactivated , lets up the gas pedal 48 to a position within the predefined swivel angle range , represented in fig1 and denoted by α , of the pedal arm 51 , in which γ denotes the total swivel angle of the pedal arm 51 and β denotes a predefined angular range within which the engine does not inject fuel but within which disengagement does not take place , so that engine braking is obtainable . in the illustrative embodiment shown , the swivel angles α and β are about 5 ° each within the total swivel angle of the pedal arm 51 of about 30 ° but the angle β can be chosen , where appropriate , at 0 °. this means that when the gas pedal is let up to a position below about 5 ° from its non - actuated rest position , the freewheel function is activated by the control unit 45 first controlling the engine speed , so that no torque is transmitted between the input shaft 7 of the transmission and the main shaft 10 . the control unit 45 then transmits a signal to a servo element so that the input shaft 7 is disengaged from the intermediate shaft 11 by displacement of the coupling sleeve of the splitter gear into its neutral position , after which the engine is set to idling speed . the drive line is now separated and the vehicle is able to freewheel . in this case , therefore , a synchronized splitter gear is disengaged in order to achieve the freewheel function . other means for disengaging the engine from the drive wheels of the vehicle can also be used to achieve the freewheel function . according to the present invention , the control unit 45 is programmed so that the freewheel function is automatically deactivated when the speed of the vehicle exceeds a predetermined speed limit v max . in the embodiment according to fig1 , a device is shown for setting the predetermined speed v max , which device is denoted by 47 . this device can be a separate control with selectable speed levels on the instrument panel of the vehicle , alternatively the device 47 can be a selectable setting function in a menu system belonging to , for example , the trip computer of the vehicle . in one embodiment of the invention , the device 47 can be a unit which automatically predetermines the speed in dependence on the road gradient on which the vehicle is found or will be found (“ will be found ” is more fully explained below ). various arrangements for measuring the road gradient are known per se . the control diagram 20 according to fig2 shows in greater detail the various control steps performed by the control unit 45 according to one embodiment of the invention . in the step 21 , the control unit 45 detects whether the pedal arm 51 is within the swivel angle range a or not . if it is established that the pedal arm 51 is outside the swivel angle range α , then the freewheel function is not activated . the control unit 45 continuously detects the position of the pedal arm 51 . if it is established that the pedal arm 51 is inside the swivel angle range α , then the freewheel function is activated according to the disengagement of , for example , the splitter gear . this is done according to step 22 . if the freewheel function is activated , the instantaneous speed v of the vehicle is compared in step 23 with the predetermined speed according to this embodiment , the control unit 45 performs this comparison continuously as long as the freewheel function is engaged . according to the illustrative embodiment shown in fig2 , the control unit 45 activates the freewheel function in step 24 if the instantaneous speed v of the vehicle exceeds the predetermined speed v max whereupon the control unit 45 , according to the next step 25 , brakes the vehicle by , for example , activating the brake system ( not shown ) of the vehicle . the brake system can be constituted by the service brake and / or auxiliary brake of the vehicle , in which the auxiliary brake can be a compression brake disposed in the engine or an exhaust brake disposed on the exhaust pipe . as an alternative or in addition thereto , the vehicle can be engine - braked , i . e . with the aid of the internal friction of the engine 1 . in the following patent claims , the means comprises one or more of : engine brake ( through the internal friction of the engine ), service brake auxiliary brake . engine braking , with the aid of the internal friction of the engine , can be realized in those situations where the braking force from the engine friction is calculated to be sufficient . in this case , the control unit chooses in the transmission 9 a gear which is tailored to the braking force . in the deactivation of the freewheel function , the control unit 45 firstly adjusts the engine speed to a rev speed which allows synchronization , and the gear which has previously been disengaged is then reengaged . the drive line is now reconnected and engine braking or driving is again possible . the control unit 45 compares , according to step 26 , the instantaneous speed v of the vehicle with the predetermined speed v max , the control unit 45 terminating the braking , in step 27 , once the control unit 45 has established that the speed - lowering means have reduced the speed v of the vehicle to below following completed braking of the vehicle , the control diagram 20 proceeds to the return step 28 . according to a further embodiment of the invention , an identification is made of the fact that the downhill slope on which the vehicle is traveling will end within a near future . this can preferably be done by the control unit 45 with the aid , for example , of a gps - based navigation system positioning system ) disposed in the vehicle . with the aid of gps and electronic maps in the navigation system of the vehicle , the control unit 45 acquires information on the instantaneous position of the vehicle and the surrounding topography . the control unit 45 registers the future topography continuously throughout the period the freewheel function is deactivated . once the control unit 45 has identified that the downhill slope will soon end , the freewheel function is reactivated some time before the vehicle has fallen below the speed limit v max , i . e . when the instantaneous speed v is close to and somewhat above the predetermined speed limit v max . the time before the vehicle has fallen below the speed v max depends on when the downhill slope is calculated to end . this can be calculated through knowledge of the current speed v of the vehicle , expected deceleration and future topography . in a preferred embodiment of the invention , the control unit 45 takes account of how the topography looks after the downhill slope has come to an end , i . e . whether the downhill slope is followed by an uphill slope of a certain gradient or whether it is followed by an approximately flat road . simulations in the control unit 45 allow the most fuel - efficient controlling of the freewheel function , for example , to be chosen . in a further preferred embodiment , the system comprises an upper absolute maximum speed which lies a bit above v max and which the vehicle , with the aid of the automatic control system , must absolutely not be allowed to exceed , despite , for example , a simulation finding promising good fuel economy through maximum exploitation of the fact that the downhill slope will soon end and that this is followed by a steep uphill slope , steep enough to brake the vehicle to below v max . for safety reasons , the absolute maximum speed should be factory - set . according to a further embodiment of the invention , the control unit 45 continuously monitors the future topography both during the time the freewheel function is deactivated and when it is activated . the control unit 45 can hence allow the speed v of the vehicle to increase to somewhere between v max and the absolute maximum speed without the freewheel function being deactivated or without the system braking the vehicle with the brake system ( or just engine braking ), and subject to the control unit 45 having identified that the downhill slope will soon end and that the speed of the vehicle is hence calculated to stay below the absolute maximum speed . taken as a whole , this can further improve the fuel economy . should the device 47 automatically determine the speed v max in dependence on the road gradient for the downhill slope on which the vehicle is found , then the determination of v max can here form part of the continuous simulations , i . e . determination of when the freewheel function is to be deactivated , and then possibly reactivated , is realized continuously and in dependence on the instantaneous state of the vehicle and on future topography . in the embodiments , account has hitherto only been taken of the road gradient on which the vehicle is traveling . the acceleration and deceleration of the vehicle are also influenced , however , by rolling resistance and air resistance . the road gradient , the rolling resistance and the air resistance , taken together , are commonly referred to as road resistance . in a further embodiment of the invention , the automatic determination of v max and / or the simulations are realized in dependence on the instantaneous and , in some actual embodiments , also future road resistance of the vehicle . fig3 shows an apparatus 500 according to one embodiment of the invention , comprising a nonvolatile memory 520 , a processor 510 and a read and write memory 560 . the memory 520 has a first memory part 530 , in which a computer program for controlling the apparatus 500 is stored . the computer program in the memory part 530 for controlling the apparatus 500 can be an operating system . the apparatus 500 can be enclosed in , for example , a control unit , such as the control unit 45 . the data - processing unit 510 can comprise , for example , a microcomputer . the memory 520 also has a second memory part 540 , in which a program for controlling the freewheel function according to the invention is stored . in an alternative embodiment , the program for controlling the freewheel function is stored in a separate nonvolatile data storage medium 550 , such as , for example , a cd or an exchangeable semiconductor memory . the program can be stored in an executable form or in a compressed state . when it is stated below that the data - processing unit 510 runs a specific function , it should be clear that the data - processing unit 510 is running a specific part of the program stored in the memory 540 or a specific part of the program stored in the nonvolatile recording medium 550 . the data - processing unit 510 is tailored for communication with the memory 550 through a data bus 514 . the data - processing unit 510 is also tailored for communication with the memory 520 through a data bus 512 . in addition , the data - processing unit 510 is tailored for communication with the memory 560 through a data bus 511 . the data - processing unit 510 is also tailored for communication with a data port 590 by the use of a data bus 515 . the method according to the present invention can be executed by the data - processing unit 510 , by the data - processing unit 510 running the program stored in the memory 540 or the program stored in the nonvolatile recording medium 550 . in the present application , the use of terms such as “ including ” is open - ended and is intended to have the same meaning as terms such as “ comprising ” and not preclude the presence of other structure , material , or acts . similarly , though the use of terms such as “ can ” or “ may ” is intended to be open - ended and to reflect that structure , material , or acts are not necessary , the failure to use such terms is not intended to reflect that structure , material , or acts are essential . to the extent that structure , material , or acts are presently considered to be essential , they are identified as such . the invention should not be deemed to be limited to the illustrative embodiments described above , but rather a number of further variants and modifications are conceivable within the scope of the following patent claims .
| 8 |
referring now to fig1 there is shown emission apparatus 10 in accordance with the present invention which comprises a housing 18 , and emission cell 10a comprising a u - shaped conduit 12 having separated cylindrical electrodes 14 and 16 , a first radiation detector 30 ( typically a photodiode ), an essentially light tight chamber 32 , a collimator 34 , a filter assembly 36 and a second radiation detector 38 ( typically a photodiode ) which is optional . a sample of gas being analyzed is flowed through conduit 12 at a controlled pressure and flow rate . the present invention uses the apparatus shown in fig .&# 39 ; s 1 , 2 and 3 and a method which utilizes emission spectrosocopy for measuring the composition or relative concentration of at least one component gas of a multi - component gas mixture . the spectrum used is typically the visible spectrum which is defined herein as 200 to 900 nanometers ( nm ). conduit 12 comprises a base portion 22 and leg portions 20 and 24 which extend through housing 18 . cylindrical electrodes 14 and 16 , formed preferably of non - corrosive conducting materials , surround sections of leg portions 22 and 20 , respectively , of conduit 12 in a spaced - apart mutually longitudinal relationship . typically electrode 14 is solid and electrode 16 is meshed . conduit 12 is transparent , preferably of glass or quartz , to permit transmission of the visible spectra to an optical detection device 30 ( also shown in fig2 ). electrodes 14 and 16 are mounted externally of conduit 12 to avoid exposure to the gases being measured and are connected by respective conductors 26 and 28 to a conventional rf ( radio - frequency ) power source 52 which is not shown in fig1 but is shown in fig2 . electrode 16 is typically grounded . it has been found that the ratio of the areas of the hot and ground electrodes is one factor which determines the voltage distribution within the sheath of the plasma created by the application of rf energy to the emission cell . gas flowing through conduit 12 experiences an r . f . glow discharge reaction in the region of conduit 12 between electrodes 14 and 16 when power source 52 is on . light emitted as a product of the glow discharge reaction is collimated through collimator 34 and illuminates photodiode 30 . optional detector ( photodiode ) 38 is positioned within housing 18 to sense the radiation therein and thereby to provide an operational on - means of the generation of electromagnetic radiation within housing 18 during analysis of a gaseous mixture . the voltages present at cell electrodes 14 and 16 give rise to an electric field which tends to accelerate ions and electrons in the enclosed gas and to form a plasma which is manifested by a stable glow discharge . in the plasma electrons , ions and neutral atoms and molecules are in continuing collision with each other . visible photons are thus emitted . there are many discrete energy levels at which photons can be emitted and the wavelengths of these photons is known to be inversely proportional to the energy of the transitions between levels . if only one gas species is present a continuous spectrum of visible radiation is observed and the gas can be identified from its characteristic pattern of wavelengths and lines of intensity . spectra of individual gases have been catalogued . for background information on the general subject of the interpretation of spectral signals in gas compositions , reference is made to the book by bochkov et al . published in 1965 by academie press and entitled &# 34 ; spectroscopic analysis of gas mixtures &# 34 ;. the emission spectrum emanating from a discharge within a mixture of gases is the sum of all the photons being emitted with the result that the combined spectrum is not a linear sum of the individual spectra . the relative intensities of the spectral lines associated with the individual gases are not preserved due to what is known as the matrix effect . deconvolution or separation of the individual spectra from a combined spectrum is thus more of an art than a science . complexity increases rapidly in multigas mixtures . in general matrix effects are obtained whenever two or more gases are mixed . furthermore , the effects are invariably nonlinear , which is to say that the change in shape of the emission spectrum of a particular gas is dependent not only on the quantity of another gas with which it is mixed , but also on the characteristics of the other gas or gases added . with a relatively simple binary mixture of , say , oxygen and argon , it is possible in many cases to determine empirically the variation in peak height of a particular feature versus composition . provided that this variation is monotonic , it is feasible to use this relationship to act as an indication of the relative amounts of the two gases present . however , when more than two gases are present in a mixture , the relationships between any set of the various relative heights of emission peaks and overall gas composition become too complex for reliable interpretation by prior methods . despite the inordinate complexity of multigas analysis i have found that for at least several multigas mixtures there exists an algebraic relationship , or more properly a family of such relationships , which does accurately and uniquely describe the composition of a multigas mixture over a specific range of compositions in terms of specific components of the spectral emission from that gas mixture . such an analytical algorithm can then be embedded in the program memory of a dedicated microcomputer capable of running that algorithm and continually recalculating the gas composition based on spectral data supplied by the optical detector . there then exists a dedicated , real - time gas analyzer . given a stable source configuration , the first step is to retrieve the visible emission spectrum for each of the pure gases of interest for different source regions and operating conditions . the mixture of interest for analysis in the preferred embodiment consists of percentage - level argon and oxygen with parts per million ( ppm ) levels of nitrogen to be monitored and controlled . it is to be noted that the intensity of the nitrogen signal depends not only the nitrogen concentration but also on the argon / oxygen ratio . the very low level of nitrogen means that it is desirable that the rf excitation source favor the generation of nitrogen emission energy compared with the more abundant argon and oxygen in the gas . this is accomplished by positioning the optical detector longitudinally with respect to the leg about which is wrapped the ground electrode . the spectrum varies along the length of the cell . it is preferred to select a region of the cell near electrode 16 . there is a tendency for the nitrogen peaks to be stronger in this area . i have found this positioning attitude makes it possible to develop an emission source that provides sufficient light output at an intensity and stability commensurate with a good signal - to - noise ratio and a rapid retrieval rate . the second step is to find a broad set of candidate wavelength regions by which interferences among spectral lines are not overpowering and where intensities are of comparable magnitude . fig4 depicts the emission spectrum corresponding to a gas mixture consisting of 500 ppm nitrogen , 18 % argon and the balance oxygen . the abscissa represent wavelengths in nanometers and the ordinates represent light intensity in arbitrary units . the gap in the vicinity of 800 nm represents off - scale argon and oxygen lines . a number of different peaks are identified as resulting from each of the component gases . a series of spectra were retrieved over a rang of cell operating pressures . it was found that intensity declined with cell pressures in the range of 2 . 75 to 5 . 75 torr ( one torricelli = 1 / 760 atmosphere ). however , it was noted that the rate of intensity decline of the different regions was most similar at pressures greater than about 4 torr . at higher pressures the response time of the cell declines ( at a constant gas sampling rate ) along with signal intensity . accordingly , a compromise pressure of 4 . 0 torr is assumed . the third step is to learn if and how the various light intensities are related to gas composition . to accomplish this task a large number ( 50 to 100 different compositions were used to provide a workable data set ) of emission spectra were generated from known gas proportions using a monochromator and the resultant spectra were digitized . the spectra were next split up into wavelength regions and for each region intensities of light emission were integrated and their relationships to nitrogen and argon concentrations were identified . from this analysis it became possible to determine the minimum number o ± regions needed to correlate reliably with these concentrations . application of well known principles of linear regression reveals that a high correlation exists with continuous , well behaved functions of the integrated light intensities within three of the selected regions . as shown in fig4 these three regions are centered on these emission peaks : the final step is to derive an analytical function or algorithm . the integrated light intensities from each of the three regions can be denominated as v1 , v2and v3 . two of these values can be normalized with respect to the third in order to facilitate two - dimensional plotting . thus , two independent variables are made available as : the relationship between each gas component and the independent variables r1 and r2 can in fact be described by a set of full quadratic equations with appropriate boundaries . the analytic response functions thus derived are of the following forms : where the a &# 39 ; s and b &# 39 ; s are numerical coefficients and z1 = r1 - m1 , z2 = r2 - m2 , and m1 and m2 are midvalues of the respective data groups . if these equation do not yield solutions of the desired accuracy because of possible discontinuities , the responses can be segregated into adjoining segments . in the preferred embodiment the equations were derived for three segments : a = r 2 & lt ;= 1 . 62 ; b = 1 . 62 & lt ; r2 & lt ;= 1 . 88 ; and c = r2 & gt ; 1 . 88 . the resultant midpoint values and coefficients adopted are shown in the following table i : ______________________________________coefficient a b c______________________________________a0 313 . 60 196 . 57 87 . 41a1 - 211 . 64 - 259 . 27 - 227 . 14a2 - 626 . 94 - 424 . 81 - 211 . 21a3 - 116 . 41 - 79 . 41 - 67 . 03a4 - 126 . 24 8 . 306 104 . 31a5 892 . 24 387 . 65 107 . 89b0 13 . 88 12 . 53 8 . 47b1 25 . 90 21 . 34 14 . 40b2 - 19 . 00 - 14 . 89 - 6 . 172b3 9 . 792 7 . 604 4 . 316b4 - 32 . 89 - 22 . 03 - 14 . 49b5 17 . 20 16 . 87 1 . 860m1 0 . 8185 0 . 884 0 . 850m2 1 . 537 1 . 738 2 . 1415______________________________________ referring again to fig2 filter assembly 36 is comprised of rotating filter wheel 54 connected by shaft 56 to motor 58 and is provided with three filter elements 60 , 62 and 64 . the filter elements 60 , 62 and 64 have spectral transmission characteristics which are matched to certain features of the visible emission spectra emanating from the excited mixture of nitrogen , argon and oxygen . the bandwidths of the filter elements are matched to the molecular species in the gaseous mixture in breadth sufficient to allow transmission of sufficient light at the wavelengths of interest without undue contribution from neighboring features of the spectrum which are not needed . the bandwidth of each filter element is defined as the width of the bandpass at some arbitrarily defined proportion of the peak transmission . generally , as previously discussed , the particular site from which the visible emission is sensed is preferably located at a point where the intensity of the band for each species is about the same thereby to minimize gain effects on the photodiode which may result when the photodiode is subjected to extreme ranges between high and low intensities of light emission . a timing wheel 66 is mounted on shaft 56 and is provided with a plurality of equally spaced - apart apertures 68 with one - half of such apertures aligned with respect to the filters 60 , 62 and 64 , it being understood that an electronic circuit may be employed to adjust and compensate for mechanical misalignment . radiation detector 30 is coupled to a conductor 70 for transmitting information to a data processing section 40 . timing wheel 66 is provided with two light emitting diodes 72 and phototransistors 74 to receive information via apertures 68 and transmit timing information via conductors 76 and 78 to data processing section 40 . in data processing section 40 , the information from radiation detector 30 comprised of a repeating series of the three spectral intensity signals is passed via conductor 70 and is correlated with the signals received from the phototransistors 74 transmitted via conductors 76 and 78 and wherein the data processing section 40 is provided with hardware to continually translate the spectral signals into signals proportional to the peak intensity of each waveform . data - processing section 40 comprises sample - and - hold circuits ( s / h ), differential amplifiers , and other circuits , all denoted by number 79 , an analog - to - digital converter 81 , digital microcomputer 82 and digital - to - analog converter 83 . circuits 79 receive the train of exponential waves from photodiode 30 over lead 70 resulting from the integration of energy in the exemplary three filters on filter wheel 36 . circuits 79 are also supplied with two timing signals derived from timing wheel 68 . both timing signals are cyclic with the rotation of shaft 56 . the first timing signal provides two sampling instants through a conventional ring counter for each selected bandpass . the second timing signal establishes the sequence in which each of the spectral signals generated is read . fig3 shows details of circuits 79 of fig2 . the top input line 70 shows a voltage waveform 105 which varies with time that represents spectral signals from collimator 34 and filter wheel 54 that are converted into electrical waves in photodiode and amplifier 30 in a conventional manner and appear on output line 70 as separate and sequential wave samples from each of the individual filters in wheel 54 . the sampling and cycle timing signals generated by the apertures in timing wheel 66 are converted into electrical signals in phototransistor block 74 in a conventional manner and appear on lines 76 and 78 . these signals are referred to a fixed base level in pulseformers 77 and 107 , which can constitute conventional operational amplifiers . the sample timing pulses from pulseformer 77 are subjected to a delay adjustment in block 90 and are applied to sample and hold block 100 in the form of timing pulses shown in waveform 97 . the sample timing pulses are also applied as clock pulses to ring counter 91 . similarly , reset pulses of the form shown in waveform 96 and occurring at the cyclic rate of timing wheel 66 are formed in pulseformer 107 from signals appearing on lead 78 from phototransistor 74 . ring counter 91 , which is typically composed of conventional jk - type flip flops , is driven by clock pulses from pulseformer 77 and reset pulses from pulseformer 107 . ring counter 91 delivers a group of six gating pulses ( waveforms 98 ) to sample and hold block and differential amplifier block 100 so that the delay - adjusted sampling pulses from delay adjust block 77 can respond to the respective peak ( designated 1 , 3 and 5 on waveform 105 ) and baseline ( designated 2 , 4 and 6 on waveform 105 ) pulses of the spectral signals shown in waveform 105 . the respective peak and rest levels held in sample and hold portion of block 100 are then made available to differential amplifiers portion of block 100 which then generate analog voltage signals proportional to the energy levels in the selected bandwidths of the complete spectral signals . these signals are delivered on leads 80 - 1 80 - 2 and 80 - 3 to converter 81 and microcomputer 82 for analysis according to the algorithms set forth above . referring again to fig2 converter 81 digitizes these analog magnitudes into suitable input signals for microcomputer 82 . microcomputer 82 processes these applied signals in accordance with the algorithm set forth above using the coefficients in table 1 to generate signals proportional to the amount of the contaminant nitrogen in the mixed gas being analyzed and the percentage of the desired argon noble gas . digital output signals from computer 82 are coupled to inputs of d / a converter 83 which converts them into analog form . the resultant analog signals appear on leads 84 and 86 to drive suitable display devices 85a and 85b , respectively . device 85a displays by direct readout the parts - per - million nitrogen content and device 85b , the percentage of argon in the mixture . in operation , the gaseous mixture to be analyzed is introduced into conduit 12 of emission cell 10 via leg 20 at a pressure of from about 1 to 10 torr . electrodes 14 and 16 are in spaced longitudinal relationship about the conduit 12 of from 1 / 8 to 10 inches and a source of rf energy connected thereto to generate the light emission spectra as generally determined by the electrical properties of the cell wall material . conduit 12 is formed of a dielectric material , such as quartz or like transparent material , for example , glass , i . e ., which also acts as an electrical insulator . the generated spectral emission must be capable of visual observation or sensing by a radiation detector with minimal attenuation . the conduit 12 may be formed into any desired geometry depending on the gaseous mixture to be analyzed , the visible emission spectra to be generated and its spectroscopy given the desire to evaluate wavelength peaks of like amplitude representative of the components of the gaseous mixture . electrodes 14 and 16 may be formed of a suitable electrically conductive material in either solid or meshed form thereby permitting viewing or sensing at any predetermined location along the conduit 12 as best determined by a general assay of the gaseous mixture being analyzed and specifics as to inherent variables when considering process requirements of the adjunct processing equipment , e . g ., trace amounts of nitrogen in an argon - oxygen gaseous mixture ( 4 - 20 % argon - balance o 2 ). in the instant application as previously disclosed , it was found particularly desirable to use the visible emission spectra along the axis of the leg portion 20 of the conduit 12 with the electronic circuitry hardwired for the composition of such aforementioned gases with appropriate filter elements 60 , 62 and 64 for argon - ni - trogen - oxygen positioned in the filter orifices of the filter assembly 36 . in one illustrative example , a gaseous stream ( approximately 20 sccm ) is continuously withdrawn from a gaseous conduit of an argon purification process to determine in real time the nitrogen content thereof . the nitrogen content is to range with trace concentrations of from 100 to 1500 ppm in an argon - oxygen gas mixture ( 4 - 20 % argon - balance o 2 ). outside this range the overall process will tend to break down . the gaseous stream at a pressure of 4 . 0 torr is introduced via leg portion 20 into conduit 12 ( 0 . 152 &# 34 ; id ) including cylindrically - shaped solid stainless steel electrode 14 and a cylindrically - shaped mesh electrode 16 formed of stainless steel and spaced apart about 5 mm . an rf energy source of 13 . 56 mhz is applied to generate a visible emission spectra . the light emission from conduit 12 is viewed by radiation detector 30 via collimator 34 and filter assembly 36 along the axis of leg portion 20 of conduit 12 , it being understood that the exact positioning thereof is determined by trial and error with reference to generated signals including amplitudes of each signal . filter wheel 52 is provided with commercially available circular optional bandpass interference filters having the following details : ______________________________________ bandwidthfiltercenter wavelength ( nm ) ( nm ) comment______________________________________1 360 11 corion p10 - 360 - f2 620 10 corion s10 - 620 - f inclined 12 ° to incident angle3 700 25 corion s25 - 700 - f + neutral density filter______________________________________ the signals received on radiation detector 30 are converted into three analog voltages corresponding to each optical channel from which gas composition is computed in real time from the magnitude . in the aforementioned example , use was made of a filter wheel to disperse the emission spectra ; however , it is to be understood by one skilled in the art that a spectrograph or rapid scanning monochromator could be used in conjunction with one or more optoelectronic detectors or a plurality of photodetectors with individual fixed filters . simplified for ease of understanding , the basic principles of this invention can be summarized as follows : the invention is a technique for measuring the composition , or relative concentration , of at least one component of a multicomponent ( two or more ) gas mixture within a more or less specific range of compositions . in some applications the interest is in determining when a particular component falls outside , either above or below a specified range , as in the important application of assuring that the nitrogen component in the example nitrogen , argon and oxygen mixture remains within a desired range . for the three - gas mixture example , the technique involves the application of radio - frequency energy to a gas mixture in order to excite visible emission which is dispersed into certain discrete spectral regions such that the gaseous composition is a function of the light intensity emanating within those spectral regions . the light intensities in the target regions are separately converted into electrical currents . by observing a sufficient number of controlled mixtures whose compositions vary over the working range of concentrations , one can devise an algorithm providing a continuum of compositional values of the component gases in terms of the light intensities observed in the chosen regions . the algorithm itself can be stored , typically in the electronic memory of a computer along with appropriate coefficients . subsequently , an unknown gas mixture with components within the assumed working range can be analyzed quantitatively through the application of the previously derived stored algorithm . while the invention has been described in connection with a specific exemplary embodiment , it will be understood that many modifications will be apparent to those skilled in the art , and that this disclosure and the appended claims are intended to cover any adaptations or variations thereof . moreover , while the invention has been disclosed in the context of a specific three - gas mixture which can be charted in two dimensions , its principles are clearly extensible into more complex mixtures where the matrix effect may be more intractable and the charting multidimensional
| 6 |
preferred embodiments of the present invention will be described herein below with reference to the accompanying drawings . in the following description , well - known functions or constructions are not described in detail since they would obscure the invention in unnecessary detail . a slide type terminal is illustrated in describing the present invention , but the present invention is not limited thereto . for example , the present invention may be applied to various wireless devices such as personal digital assistants ( pdas ), general terminals , and wireless notebook computers including plate type built - in antenna modules . as illustrated in fig1 and 2 , the slide type portable wireless terminal 100 includes a main body 110 , and a slide body 120 that can slide a predetermined length on the main body 100 in a length direction of the terminal 100 . the slide body 120 is installed on the main body 110 . as illustrated in fig2 , the slide body 120 is slid over the main body 110 to the predetermined length , and is used for overall functions of the terminal such as a call operation . a display unit 121 is installed on a front surface of the slide body 120 . the display unit 121 may be a color wide liquid crystal display ( lcd ) module , and may be a touch screen panel . a speaker unit 122 is installed above the display unit 121 , and at least one keypad assembly 123 is installed under the display unit 121 . the keypad assembly 123 may include a functional key button or a navigating key button so that a user can use a portion of functions of the terminal without opening the slide body 120 on the main body 110 . another keypad assembly 111 including a plurality of key buttons may be installed on a surface of the main body 110 viewed when the slide body 120 is opened on the main body 110 . the keypad assembly may be number key buttons ( 3 × 4 key buttons ). a microphone unit 112 is installed under the keypad assembly 111 . the main body 110 includes upper and lower case frames 13 and 14 , respectively , and a built - in antenna module ( 10 of fig3 ) is provided within a predetermined space defined by the upper and lower case frames 13 and 14 . as the built - in antennal module , a planar inverted f - antenna ( pifa ) may be used . the built - in antenna module 10 may be installed in an inner side ( indicated by a dotted line in fig2 ) of a rear upper portion of the main body 110 above a battery pack 113 . fig3 is an exploded perspective view of a built - in antenna module 10 according to the present invention . the built - in antenna module 10 includes the upper case frame 13 of the terminal , a main board 20 installed in the case frame 13 , an antenna radiator 40 installed on the main board 20 , and an electro - magnetic interference ( emi ) pigment 132 applied on an inner surface 131 of the case frame 13 to face a bottom surface 24 ′ ( see fig4 ) opposite a top surface 24 of the main board 20 on which the antenna radiator 40 is installed . the main board 20 includes a ground pad 21 and a feed pad 22 on the top surface 24 . the ground pad 21 and the feed pad 22 are electrically connected respectively to a ground pin 41 and a feed pin 42 extending from the antenna radiator 40 . the feed pad 22 is electrically connected to a radio frequency ( rf ) connector 25 by a pattern 23 formed on the main board 20 . the antenna radiator 40 may be fixed on an antenna carrier 30 having a predetermined height . the antenna carrier 30 may be formed of a synthetic resin . this is because if the antennal radiator 40 , a thin metallic plate , is fixed directly onto the main board 20 without the antenna carrier 30 , the shape of the antenna radiator 40 might be twisted afterward , deteriorating a radiation characteristic of the antenna module . thus , the antenna radiator 40 may include a plurality of opening 43 and thus be fixed to the antenna carrier 30 by , for example , ultrasonic welding . the antenna carrier 30 may include through holes 31 and 32 at predetermined locations , so that the ground pin 41 and the feed pin 42 of the antenna radiator 40 pass through the through holes 31 and 32 and are connected to the ground pad 21 and the feed pad 22 of the main board 20 , respectively . also , fixing protrusions 36 protrude downwardly from both sides of the antenna carrier 30 . the fixing protrusions 36 are inserted in fixing grooves 26 formed in the main board 20 so that the antenna carrier 30 can be firmly fixed to the main board 20 . the emi pigment 132 is formed on the inner surface 131 of the case frame 13 of the terminal . the emi pigment 132 may be deposited or applied on the inner surface 131 of the case frame 13 . the emi pigment 132 may have a greater area than that of the antenna radiator 40 , and may be applied or deposited at a location overlapping a portion of the main board 20 where the antenna radiator 40 is installed . thus , one end of the emi pigment 132 is electrically connected to the ground pad 21 , and the other end thereof is electrically connected to a ground layer ( 29 of fig4 ) of the main board 20 , so that the emi pigment 132 may serve as a ground surface for the antenna radiator 40 . however , the present invention is not limited to the above description . besides the emi pigment 132 , similar conductors may be used . examples of the conductor may include a metal plate or a flexible printed circuit ( fpc ) that has a predetermined area and thickness , and the conductor is attached to the inner surface 131 of the case frame 13 . for example , the metal plate excluding a portion for the electrical connection may be inserted into the case frame 13 by insertion molding when the case frame 13 is fabricated . of course , an electrical connection unit is used for an electrical connection of the ground pad 21 and the ground layer ( item 29 in fig4 ) with the emi pigment 132 as the conductor . as the electrical connection unit , conductive tapes 11 and 12 , each formed by being wound a plurality of times and having a predetermined height , are used . however , the electrical connection unit is not limited to the conductive tapes , but other materials such as a conductive foam or a plate type metal spring may also be used . fig4 is a rear perspective view of the main board 20 according to the present invention . the ground layer 29 is formed on the bottom surface 24 ′ of the main board 20 opposite the top surface 24 where the antenna radiator 40 is installed . the ground layer 29 serves to ground various electronic function groups used in the portable wireless terminal 100 , and also serves as a ground surface of the antenna radiator 40 . thus , the ground layer 29 may be formed on a bottom surface of the main board 20 , which is located at the farthest vertical distance from the antenna radiator 40 . the ground layer 29 may not be formed in a clearance area on the bottom surface 24 ′; the clearance area is an area in which the antenna radiator 40 is orthogonally projected on the bottom surface 24 ′. of course , a first contact point 27 electrically connected to the ground pad 21 is formed on the bottom surface 24 ′ opposite the top surface 24 where the ground pad 21 is formed , therefore the first contact point 27 may be electrically connected to the ground pad 21 through a via . also , a second contact point 28 electrically connected to the ground layer 29 is exposed on the bottom surface 24 ′, and the ground layer 29 is not exposed from the main board 20 in general . particularly , the first and second contact points 27 and 28 may be used as contact points with the conductive tapes 11 and 12 , the electrical connection unit ( fig5 ). fig5 is a cross - sectional view of a main part , illustrating that the built - in antenna module is installed at the main board according to the present invention , which will now be described with reference to fig3 through 5 . first , the antenna radiator 40 is fixed on the top surface 24 of the main board 20 via the antenna carrier 30 . here , the feed pin 42 of the antenna radiator 40 is connected to the feed pad 22 of the main board 20 , and the ground pin 41 is connected to the ground pad 21 of the main board 20 . in this case , the ground pad 21 of the main board 20 and the ground pin 41 of the antenna radiator 40 are electrically connected together , but are not yet connected to the ground layer 29 of the main board 20 . thereafter , when the main board 20 having the antenna radiator 40 is mounted to the case frame 13 , the main board 20 and the emi pigment 132 are electrically connected together by the conductive tapes 11 and 12 . here , the first contact point 27 of the main board 20 contacts one end of the emi pigment 132 by the conductive tape 11 , and the second contact point 28 contacts the other end of the emi pigment 132 by another conductive tape 12 . consequently , the antenna radiator 40 is grounded in the order of ground pin 41 of antenna radiator 40 → ground pad 21 of main board 20 → first contact portion 27 of main board 20 → conductive tape 11 → emi pigment ( conductor ) 132 → conductive tape 12 → ground layer 29 of main board 20 . thus , the emi pigment 132 is used as a ground surface together with the ground layer 29 for the antenna radiator 40 of the main board 20 . also , since the emi pigment 132 is formed on the inner surface 131 of the case frame 13 , an effect of maximizing a distance from the antenna radiator 40 can be obtained . that is , as illustrated in fig5 , the distance between the antenna radiator 40 and the ground surface is t 1 + t 2 . the maximum distance between the antenna radiator 40 and the ground surface may contribute to improving radiation performance of the antenna radiator 40 . fig6 a and 6b are graphs showing voltage standing wave ratio ( vswr ) according to opening and closing of a slide type terminal including a built - in antenna module according to the present invention . the antenna was designed to optimize its characteristic in a slide - up mode , an actual call mode of the terminal . since a slide - down mode is a reception stand - by mode in most cases , somewhat high vswr ( marker 1 and marker 3 in the drawing ) in transmission does not have significant influence on the terminal performance . in actuality , it is almost impossible to implement a design that satisfies performance in both the slide - up and slide - down modes . based on a mutual trade - off relation , the transmission characteristic in the slide - down mode which less affects the terminal performance is sacrificed . the sar in the case of the global system for mobile communications ( gsm ) and the sar in the case of the digital cellular system ( dcs ) are shown in tables 1 and 2 below . as shown in table 1 and table 2 , the sar was maximum 0 . 472 w / kg in the case of the gsm , and was maximum 0 . 137 w / kg in the case of the dcs . it can be seen that excellent performance can be achieved compared to the average 2 . 0 w / kg per log of the european standard . because the sar characteristic has recently been emphasized to a great extent and strictly managed internationally , such results are very much satisfactory , and may be used as a reference in developing a like terminal . in the built - in antenna module according to the present invention , a ground surface interacting with the antenna radiator is applied to the case frame of the terminal . thus , a distance between the antenna radiator and the ground surface is maximized without increasing the volume of the terminal , so that radiation performance can be improved , and thus the slimness and high quality of the terminal can be achieved . while the invention has been shown and described with reference to certain preferred embodiments thereof , it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims .
| 7 |
the features and description of one embodiment the present invention are best understood while viewing the cross sectional structure views ( fig1 - 12 ) in light of the process block diagram fig1 , illustrating the use of capped seed layers during the formation of a perpendicular write head with a trailing shield . an alternate embodiment of the present invention is disclosed in fig1 - 15 , which illustrates the use of capped seed layers during the formation of a perpendicular write head having a wrap around shield . although these two example shield geometries have been chosen to illustrate the application of capped seed layers , application to these examples should not be taken as limiting , as the disclosed embodiments of the present invention may equally applicable to other shield or head geometries , as would be evident to those of skill in the art . fig1 is a schematic block diagram of the process for fabricating a trailing shield , in accordance with an embodiment of the present invention . the process begins at step 1302 , wherein the layer stack of fig1 is deposited . fig1 is a partial cross sectional view 100 looking into the air bearing surface ( abs ) of a blanket deposited film stack prior to fabrication of a perpendicular write head with a trailing shield , in accordance with an embodiment of the present invention . the film stack comprises blanket layers 102 - 112 deposited on substrate 114 , which is typically alumina ( at the air bearing surface ), but may be other materials such as magnetic pole shaping layers deeper ( further from the abs ) into the structure . for the purposes of this disclosure , substrate 114 can be a bulk material on which all subsequent layers are deposited , or it can be a layer deposited over previously deposited under - layers . for example , when fabricating a combined read and write head structure , the latter is usually the case , as the read head structure is generally deposited first ( not shown ). layer 112 makes up the magnetic pole material , and is typically a laminated , multilayer structure comprising layers of magnetic and non - magnetic materials . above pole layer 112 is gap layer 110 , comprised of alumina or other non - magnetic materials . preferably , alumina is used . above gap layer is cmp stop layer 109 . typically , dlc ( diamond like carbon ) is used for this layer . a spacer layer 108 is deposited above dlc layer 109 , and is comprised of durimide . above spacer layer 108 , layers 102 , 104 , and 106 are deposited . layer 102 comprises the imaging photo resist layer that defines the width and location of the write pole . layers 104 and 106 aid in transferring the developed features of photo resist layer 102 to the spacer layer 108 . layer 106 is typically comprised of silica , and layer 104 is typically comprised of durimide . in step 1304 of fig1 , photo resist layer 102 is imaged and developed , creating feature 102 ′ in fig2 . fig2 is a partial cross sectional view 200 looking into the air bearing surface ( abs ) of the film structure following the imaging and development of photo - resist layer 102 , in accordance with an embodiment of the present invention . in step 1306 of fig1 , photo resist feature 102 ′ is transferred to layers 106 and 108 , creating features 106 ′ and 108 ′. fig3 is a partial cross sectional view 300 looking into the air bearing surface ( abs ) of the film structure subsequent to the transfer of patterned feature 102 ′ into layers 106 and 108 , in accordance with an embodiment of the present invention . the transfer is carried out with three consecutive rie process steps comprising a first oxidation step to etch layer 104 , a second fluorine etch step to etch silica layer 106 , followed by a third oxidation step to etch spacer layer 108 . details of the rie processes are well known to those skilled in the art . during the oxidation steps , photo resist layer 102 is removed , resulting in structure 300 . in step 1308 of fig1 , the structure of fig3 is etched and ion milled to form the pole structure comprising features 108 ′, 109 ′, 110 ′ and 112 ′. fig4 is a partial cross sectional view 400 looking into the air bearing surface ( abs ) of the film structure subsequent to etching and ion milling to form the pole structure , in accordance with an embodiment of the present invention . the width of the pole structure ( 108 ′, 109 ′, 110 ′, 112 ′) is w p 402 . details of the formation of the tapered pole section 112 ′ have been previously disclosed in the prior art and are well known . in step 1310 of fig1 , dielectric layer 502 is deposited around pole structure 108 ′, 109 ′, 110 ′, 112 ′. fig5 is a partial cross sectional view 500 looking into the air bearing surface ( abs ) of the film structure subsequent to deposition of dielectric layer 502 , in accordance with an embodiment of the present invention . layer 502 typically comprises alumina , and is deposited by a process known to those skilled in the art . in step 1312 of fig1 , the structure of fig5 is planarized by cmp . fig6 is a partial cross sectional view 600 looking into the air bearing surface ( abs ) of the film structure subsequent to planarization by cmp , in accordance with an embodiment of the present invention . planarization is slowed or terminated by dlc stop layer 109 ′. in step 1314 of fig1 , layer 109 ′ is removed . fig7 is a partial cross sectional view 700 looking into the air bearing surface ( abs ) of the film structure subsequent to the removal of layer 109 ′, in accordance with an embodiment of the present invention . layer 109 ′ is removed by an oxidation based rie process suitable for the removal of dlc layers , well known to those skilled in the art . in step 1316 of fig1 , the combined seed / capping layer 802 is deposited over the structure of fig7 . fig8 a is a partial cross sectional view looking into the air bearing surface ( abs ) of the film structure subsequent to the deposition of seed / capping layer 802 , in accordance with an embodiment of the present invention . fig8 b is a partial cross sectional view of detail 804 of fig8 a , in accordance with an embodiment of the present invention . seed / capping layer 802 serves as conductive cathode layer for the subsequent deposition of the wrap around shield , which is usually deposited by electroplating . prior to electroplating the shield , portions of the surface covered by seed / capping layer 802 need to be masked to define the locations to which the shield will be confined . the masking is performed by a photo resist layer , which must be exposed and developed to create the mask . the adhesion of the photo resist to the upper surface of seed / capping layer is essential to prevent under - plating of the shield , which is deposition of the shield metal under the photo resist layer . under - plating compromises the accuracy of the mask , allowing deposition of shield metal in unwanted locations , and is therefore undesirable . in the prior art , seed layers having upper surfaces of exposed precious metals such as rh , can exhibit photo resist adhesion problems . to improve photo resist adhesion to the rh seed layer , an inorganic sio x n y , anti - reflective coating is often deposited over the rh . since this coating is non - conductive , it must be removed via an rie process prior electroplating of the shield structure . while the arc can be applied over precious metal seed layers to resolve the photo resist adhesion problems , the removal process can compromise the accuracy of the photo resist mask since the rie removal process must be performed after the photo resist mask is fully formed . exposure of the mask to rie can damage portions of the mask , compromising critical dimension control . another common seed layer material used in the prior art , containing alloys of ni and cr , does not have the photo resist adhesion problem , but can exhibit corrosion or oxidation problems after exposure to air and moisture . the oxides can be poor conductors , making plating of the shield layer difficult , non - uniform , or non - adherent . these oxides are also not easily removed by the plating bath chemistry , so they may remain on the seed layer surface during electroplating . it is a main advantage of embodiments of the present invention to resolve the photo resist adhesion and corrosion problems of prior art seed layers without the need for a separate arc layer that must be removed prior to electroplating . this is accomplished by providing a dual layer seed layer , or a base seed layer 802 b with a conductive capping layer 802 a that need not be removed prior to plating . a number of advantages of the present invention are evident . the base seed layer 802 b can be chosen without concern for its corrosion performance , or photo resist adhesion performance . for example , if a high seed layer conductivity is desired , noble metals such as gold , silver , rhodium , platinum , palladium , or other precious metals may be used even though they may not have good photo resist adhesion . conductive capping layer 802 a provides an adhesive interface with the subsequently applied photo resist . in another example , cost may be an issue , suggesting the use of conventional nicr ( or another low cost material such as ir ) base seed layer . the oxide formation or corrosion of these cheaper base seed layers is suppressed through use of an appropriate capping layer 802 a . for these base seed layers , capping layer 802 b provides a adhesive interface to the plated shield . capping layer 802 a can made from alloys of co , fe , and ni , preferably alloys of cofe , conife , or nife . oxides of these alloys are easily removed in the plating bath chemistry during the deposition of the shield , allowing void free plating and good adhesion to the shield . photo resist adhesion is also acceptable . the thickness of the capping layer 802 a can range from 1 to 20 nm , preferably 2 - 5 nm . base seed layer 802 b can be comprised of : a noble metal such as au , ag , pd , pt , rh , ru , ir , and os ; alloys of ni and p ; alloys of ni and cr ; w , and ta . thickness for the base seed layer 802 b can range from 1 to 100 nm , preferably 5 to 50 nm , and more preferably 20 to 30 nm . deposition of seed layer / capping layer 802 can be performed by pvd , cvd , ion beam deposition , or any other method known to those skilled in the art . returning to fig1 , in step 1318 a blanket photo resist is deposited over seed / capping layer 802 . fig9 is a partial cross sectional view 900 looking into the air bearing surface ( abs ) of the film structure subsequent to the deposition of photo resist layer 902 , in accordance with an embodiment of the present invention . in step 1320 of fig1 , photo resist layer 902 is imaged and developed in accordance with methods well known to those skilled in the art . fig1 is a partial cross sectional view 1000 looking into the air bearing surface ( abs ) of the film structure subsequent to the imaging and development of photo resist layer 902 , in accordance with an embodiment of the present invention . in step 1322 of fig1 , the trailing shield 1102 is deposited over seed / capping layer 802 via electroplating , a process well known to those skilled in the art . fig1 is a partial cross sectional view 1100 looking into the air bearing surface ( abs ) of the film structure subsequent to the deposition of shield layer 1102 , in accordance with an embodiment of the present invention . in step 1324 of fig1 , the photo resist layer 902 is removed by methods well known to skilled in the art . fig1 is a partial cross sectional view 1200 looking into the air bearing surface ( abs ) of the film structure subsequent to the removal of photo resist layer 902 , in accordance with an embodiment of the present invention . the forgoing discussion has been focused upon the process for making a perpendicular write head having a trailing shield . however , the suitability and application of seed / capping layers is not limited only to the production of trailing shields , but may be applied to perpendicular write heads having wrap around shields as well . for simplification , structures corresponding to process steps prior to seed / capping layer deposition are not shown for the wrap around shield . fig1 a is a partial cross sectional view 1400 looking into the air bearing surface ( abs ) of the film structure subsequent to the deposition of seed / capping layer 1402 , during fabrication of a perpendicular write head with a wrap around shield , in accordance with an alternate embodiment of the present invention . in view 1400 , tapered magnetic pole structure 112 ′, gap layer 110 ′, and side gap layer 503 have been previously deposited on substrate 114 by methods well known to those skilled in the art . fig1 b is a partial cross sectional view of detail 1404 of fig1 a , in accordance with an alternate embodiment of the present invention . the materials , thickness ranges , and other limitations disclosed above for base seed layer 802 b and capping layer 802 a apply equally to layers 1502 a and 1502 b for this alternative embodiment of the present invention . fig1 is a partial cross sectional view 1500 looking into the air bearing surface ( abs ) of the film structure subsequent to the deposition of wrap around shield 1502 , in accordance with an alternate embodiment of the present invention . the preceding steps of photo resist deposition , exposure , development and removal are not shown , as these processes are self evident to those of skill in the art , and in the light of the forgoing embodiments and discussion . the present invention is not limited by the previous embodiments heretofore described . rather , the scope of the present invention is to be defined by these descriptions taken together with the attached claims and their equivalents .
| 8 |
the figure shows , without being drawn to scale , a multifunction pressure probe 1 with its moving vane 10 and its fastening base 11 . the moving vane 10 , in the form of a fin , is fastened via its root 12 in a bearing 13 of the fastening base 11 , thereby allowing it to rotate about a longitudinal axis 14 and giving it the possibility of being oriented in the direction of the wind in the manner of a weather cock . the fastening base 11 is designed to be mounted on the skin of an aircraft so that the moving vane 10 of the probe 1 projects to the outside of the aircraft and is oriented according to the local flow of the air relative to the skin of the aircraft . thus , the angle of orientation adopted by the moving vane 10 is the local angle - of - attack or the angle - of - sideslip according to the configuration on the aircraft . stops ( not shown ) limit the deflection of the moving vane on either side of the neutral position , for example to ± 60 °. in addition to the local angle - of - attack measurement , the probe 1 allows measurements of the dynamic and static pressures thanks to air taps 15 , 16 made on the moving vane 10 and air lines that connect these air taps 15 , 16 to pressure sensors ( not shown ) placed on the inside of the aircraft . the air lines connecting the air taps 15 , 16 located on the moving vane to the pressure sensors placed inside the aircraft pass through the root 12 of the moving vane 10 . they must faithfully transmit the pressures at the air taps 15 , 16 to the pressure sensors , while still accommodating the relative rotational movements of the moving vane 10 with respect to the fastening base 11 and opposing these movements with only a minimal restoring force . in the first part of their path going , within the moving vane 10 , from the air taps 15 , 16 to the root 12 of the vane , the air lines are produced by means of suitably curved rigid metal tubes 17 , 18 , which terminate in openings 19 , 20 projecting beneath the root of the moving vane 12 . in the second part of their path on the outside of the moving vane 12 , the air lines are produced using lengths of flexible tubing 21 , 22 that are fitted over the openings 19 , 20 of the metal tubes 17 , 18 projecting from the root 12 of the moving vane 10 are also held in place by a plate 23 through which they pass before continuing their paths toward the pressure sensors placed on the inside of the aircraft &# 39 ; s skin . the fact of using lengths of flexible tubing 21 , 22 instead of lengths of rigid tubing butted together by means of friction rotary joints makes it possible for the dry friction during rotation of the moving vane 10 to be substantially reduced since it is therefore no longer a question of dry friction but of elastic stiffness . this elastic stiffness may be reduced as much as desired by varying the nature of the flexible tubings , their diameter , their arrangement relative to the rotation axis of the bearing 13 and the distance of the plate 23 from the root 12 of the moving vane . the figure also shows multistrand electrical wires 32 , 33 placed parallel to the lengths of flexible tubing 21 , 22 in the gap between the root 12 of the moving vane 10 and the plate 23 . these electrical wires 32 , 33 are intended for a heating system mounted in the moving vane 10 of the probe in order to prevent it from icing up . other multistrand electrical wires , again placed parallel to the lengths of flexible tubing 21 , 22 may be used , especially for measuring the value of a thermistance of a system for measuring the total temperature of the air , said system being mounted in the moving vane . these electrical wires have , unlike the flexible tubings , a high longitudinal stiffness that is transformed into elastic stiffness by the flexibility of the plate 23 or of its fastening . the error in angular measurement resulting from the difference between the true position α v and the measured position α of the vane induced by the elastic stiffness due to the lengths of flexible tubing 21 , 22 and to the electrical wires 32 , 33 may be subjected to a subsequent compensation , as it may be calculated by means of the equation : α v - α = ( α - α 0 ) r k v 2 ( 1 ) v being the air speed , kv 2 the aerodynamic restoring force of the vane in the direction of the wind , α 0 the neutral position of the vane and r the stiffness coefficient . to a first approximation : p t - p s = 1 2 ρ v 2 p t being the total pressure and p s being the static pressure , so that equation ( 1 ) becomes : α v - α = ( α - α 0 ) ρ r 2 k ( p t - p s ) = k ( α - α 0 ) ( p t - p s ) where α 0 may be set to the angle - of - attack zero and k may be measured in a wind tunnel . the parameters p t , p s and α are measured by the probe . the correction ( α v - α ) may therefore be calculated and the true angle α v deduced from the angle α measured by the probe . in this case , the system for measuring the angular position of the moving vane 10 includes a sensor for measuring the angular position of the vane 10 together with error estimation means operating on the basis of the above equation and means for correcting the measurement by the angular position sensor , taking into account the estimated error provided by the error estimation means . the lengths of flexible tubing 21 , 22 and the electrical wires 32 , 33 are fastened at the plate 23 in penetrations 24 , 25 , 26 , 27 which may have thicker walls than the plate 23 in order to improve their retention . the plate 23 is placed beneath the fastening base 11 of the probe , along the axis of and at a certain distance from the bearing 13 . it is attached to the fastening base 11 of the probe so as to greatly limit and possibly prevent any rotational movement about the axis of the bearing 13 so that the relative rotational movement of the moving vane 10 with respect to the fastening base 11 of the probe is , for the large part , between the root 12 of the moving vane 10 and the plate 23 . thus , any deformation on the lengths of flexible tubing 21 , 22 by the relative movement of the moving vane 10 with respect to the fastening base 11 of the probe is localized along the distance separating the root 12 of the moving vane 10 from the plate 23 . in the gap separating the root 12 of the moving vane 10 , the electrical wires 32 , 33 are placed symmetrically with respect to the axis 14 of the bearing 13 , close to the axis 14 so as to minimize the restoring torque due to their stiffness . likewise , the lengths of flexible tubing 21 , 22 are placed symmetrically with respect to the axis 14 of the bearing 13 so that both undergo the same deformation amplitudes . to avoid any frictional wear of one against the other during the rotational movements of the moving vane or any vibrations transmitted by the structure of the aircraft , the flexible tubings 21 , 22 and electrical wires 32 , 33 are slightly tensioned in the gap separating the root 12 of the vane 10 from the plate 23 , these being fastened to this plate 23 and to the root 12 of the moving vane so as to be parallel to the axis of the bearing 13 when the moving vane 10 is in the neutral position and are sufficiently far apart not to be touched when the moving vane 10 comes into its stop positions . because they are slightly tensioned , the lengths of flexible tubing 21 , 22 are subjected to tensile or elongational forces owing to the moving vane 10 when the latter moves away from its neutral position . they then exert , in reaction , a torque restoring the vane to its neutral position , which is deleterious as it introduces an error in the positioning of the vane in the direction of the wind , which error increases as the air speed of the aircraft decreases and as the vane moves away from its neutral position . to bring this restoring torque to a very low value , it is possible to vary various factors : the diameter , thickness and nature of the lengths of flexible tubing 21 , 22 ; the length of the flexible tubings 21 , 22 , that is to say the spacing between the root 12 of the moving vane , but this is rapidly limited by the available space in the aircraft to the rear of the probe root ; the capability of absorption , by the plate 23 or its fastening to the base 11 of the probe , of the tensile forces exerted by the moving vane 10 on the lengths of flexible tubing 21 , 22 during its rotational movements ; the distance of the lengths of flexible tubing 21 , 22 from the axis 14 of the bearing ; and the maximum deflection . when the moving vane 10 moves away from its neutral position , the plate 23 absorbs the tensile forces exerted on the electrical wires 32 , 33 and also a relatively large part of the forces exerted on the lengths of flexible tubing 21 , 22 either , as shown , thanks to an elastic system 28 , 29 for attachment to the fastening base 11 allowing a certain deflection depthwise with respect to the base , or by elastic deformation thanks to natural flexibility , or else by a combination of natural flexibility and an elastic attachment system . the lengths of flexible tubing 21 , 22 must withstand the rigorous environmental conditions encountered on the skin of the aircraft and must not undergo premature aging liable to weaken them in the long term and to impair the reliability of the probe . advantageously , they are made of a thermoplastic elastomer such as a styrene / ethylene - butylene / styrene copolymer modified with silicone oil . flexible tubings of this composition have already been proposed commercially for exclusively medical use , for example by the company consolidated polymer technologies , which sells them under the name “ c - flex ® 50a ”. the plate 23 may consist of a flexible sheet made of rubber or an elastomer , for example a thermoplastic elastomer such as a modified styrene / ethylene - butylene / styrene copolymer like the flexible tubings , and may be fastened to the base 11 of the probe by a rigid attachment system , such as a rigid clip fastened to the base by screws .
| 5 |
although the disclosure hereof is detailed and exact to enable those skilled in the art to practice the invention , the physical embodiments herein disclosed merely exemplify the invention which may be embodied in other specific structures . while the preferred embodiment has been described , the details may be changed without departing from the invention , which is defined by the claims . fig1 - 3 illustrate a first exemplary embodiment 100 of a truck box cover according to the present invention in a first position both independently and as installed in the box 12 of a truck 10 . the box 12 of a truck 10 typically comprises a box floor 14 , a first body panel 16 with a first box rail 18 , a second body panel 20 with a second box rail 22 , a box end panel 24 with a third box rail 26 , and a tailgate 28 ( see also fig1 and 11 ). the truck box cover system 100 according to an exemplary first embodiment of the present invention preferably comprises a first frame 102 ; a second frame 124 ; a top 160 preferably comprising a first compliant material ; a second compliant material 170 ( see also fig6 ), a rear panel 70 , and a plurality of columns 190 . the first frame 102 preferably comprises a first rail member 104 , a second rail member 114 , and a third rail member 120 . the first , second , and third rail members 104 , 114 , 120 are configured to follow the shape of the truck box 12 , specifically the first , second , and third box rails 18 , 22 , 26 , respectively . the first , second , and third rail members 104 , 114 , 120 are preferably configured to be set upon the first , second , and third box rails 18 , 22 , 26 of the box 12 , respectively . securing at least the first and second rail members 104 , 114 , to the first and second box rails 18 , 22 may be accomplished by clamping , bolting , and / or any other method now known or later developed . looking at fig5 a the first rail member 104 is shown in more detail . preferably , the first rail member 104 comprises a first rail member retainer 106 and a first rail member enclosure 112 . similarly , but not shown in this figure , the second rail member 114 preferably comprises a second rail member retainer 116 and a second rail member enclosure 118 . as discussed further below , the first and second rail member retainers 106 , 116 are configured to retain a first end portion 172 of the second compliant member 170 , and the first and second rail member enclosures 112 , 118 are configured to house at least a portion of the second compliant material 170 when the truck box cover system 100 is in the first position ( see fig5 ). looking back to fig1 , the third rail member 120 is shown preferably comprising a third rail member retainer 122 , similar to the first and second rail member retainers 106 , 116 . the third rail member 120 extends between the first and second rail members 104 , 114 and is configured to retain the first end portion 172 of the second compliant member 170 . the second frame 124 is more easily seen in fig6 and 7a . the second frame 124 preferably comprises a first cover member 126 , a second cover member 136 , a third cover member 146 , and a fourth cover member 150 ( see fig4 b ). looking to fig5 a for a more detailed view , the first cover member 126 is shown preferably comprising a first cover member retainer 128 , a first cover member flange 130 , and a first cover member plate 132 extending inward from the first cover member retainer 128 . hook - and - loop fastener material 30 is preferably provided along the first cover member flange 130 . the first cover member plate 132 preferably has a shelf 134 extending the length thereof and a first cam member 80 with a surface 82 is preferably provided thereupon . the first cover member retainer 128 is preferably configured to retain a second end portion 176 of the second compliant member 170 . as shown in fig1 , the second cover member 136 is similar to the first cover member 126 and comprises a second cover member retainer 138 , a second cover member flange 140 , and a second cover member plate 142 extending inward from the second cover member retainer 138 . hook - and - loop fastener material 30 is preferably provided along the second cover member flange 140 ( see fig1 ). the second cover member plate 142 preferably has a shelf 144 and a second cam member 82 with a surface 84 is preferably provided thereupon . the second cover member retainer 138 is preferably configured to retain the second end portion 176 of the second compliant member 170 . the third cover member 146 preferably comprises a third cover member retainer 148 and extends between the first and second cover members 126 , 136 . the third cover member 146 is configured to retain the second end portion 176 of the second compliant member 170 and a third side 166 of the first compliant member 160 ( discussed further below ). looking to fig4 b , the fourth cover member 150 is shown . the fourth cover member 150 preferably comprises a fourth cover member retainer 152 ( see fig2 ) and a pair of latches 154 . the pair of latches 154 are configured to removably engage with the first and second cover members 126 , 136 . as shown in fig1 and 13 , each of the latches 154 preferably has a spring - loaded rod 156 with a pin 157 configured to interface with the first and second cover member plates 132 , 142 of the respective first and second cover members 126 , 136 when in an engaged position . the interface with the first and second cover member plates 132 , 142 may be made through the respective first and second cam members 80 , 84 . to disengage the fourth cover member 150 from the first and second cover members 126 , 136 , the spring - loaded rods 156 are moved inward toward each other until clear of the first and second cover member plates 132 , 146 and potentially the first and second cam members 80 , 84 , then the fourth cover member 150 is free to move relative to the first and second cover members 126 , 136 . the spring - loaded rods 156 may be maintained in the disengaged position by placing the pin 157 against a catch 158 . to engage the fourth cover member 150 with the first and second cover members 126 , 136 , the reverse of the disengaging procedure is performed ; however , the spring - loaded rods 156 may be in the engaged position prior to engaging with the first and second cover members 126 , 136 . in that case , during the process of lowering the fourth cover member 150 into position between the first and second cover members 126 , 136 , each of the spring - loaded rods 156 will follow the surfaces 82 , 86 of the respective first and second cam members 80 , 84 . through the biased nature of the spring - loaded rods 156 , the spring - loaded rods 156 will engage with the first and second cover member plates 132 , 142 when they are below the most inwardly extending portion of the first and second cam members 80 , 84 . looking back to fig5 a , one method of securing the second compliant material 170 is shown with respect to the first rail member retainer 106 of the first rail member 104 . the first end portion 172 of the second compliant material 170 is preferably fed into the first cover member retainer 106 through a slot 108 creating a loop 178 in the first end portion 172 . preferably , a dowel 50 is then inserted into the loop 178 along the length of the first rail member retainer 106 . the diameter 52 of the dowel 50 is preferably greater than the width 110 of the slot 108 , thereby retaining the first end portion 172 of the second compliant material 170 within the first rail member retainer 106 . clips ( not shown ) may further secure the free end 174 of the first end portion 172 of the second compliant member 170 to the first cover member retainer 106 ; however , as shown with respect to a second embodiment 200 of the cover system shown in fig5 b , the loop 178 may be formed by sewing ( or otherwise attaching ) the free end 174 back to the second compliant material . the same retention method is preferably provided for the second compliant material 170 within at least the second rail member 114 , the third rail member 120 , the first cover member 126 , the second cover member 136 , and the third cover member 146 , and the first compliant material 160 within at least the fourth cover member 150 . the second frame 124 is preferably sized and configured to be positioned adjacent to and substantially over the first frame 102 , whereby the first cover member 126 , the second cover member 136 , and the third cover member 146 of the second frame 124 are positioned substantially directly above the first rail member 104 , the second rail member 114 , and the third rail member 120 of the first frame 102 , respectively , when the truck box cover system 100 is in the first position ( see fig1 , and 5 ). additionally , as depicted in fig1 - 5 , when in the first position , the second compliant material 170 along and between the first rail member 104 and the first cover member 126 is preferably substantially positioned within the first rail member enclosure 112 and the second compliant material 170 along and between the second rail member 114 and the second cover member 136 is preferably substantially positioned within the second rail member enclosure 118 . the second embodiment 200 of the cover system shown in fig5 b preferably comprises a first frame 202 with a first rail member 204 and a second frame 224 with first cover member 226 . in the second embodiment 200 , it should be understood that the second rail member ( not shown ) of the first frame 202 and the second cover member ( not shown ) of the second frame 224 are mirror images of the respective first rail member 204 and the first cover member 226 . the first rail member 204 comprises a first rail member retainer 206 with a slot 208 and a first rail member enclosure 212 . the first cover member 226 comprises a first cover retainer 228 , a first cover member flange 230 , and a first cover member plate 232 with a shelf 234 . preferably , a hook - and - loop fastener material 30 is provided on the inside surface of the first cover member flange 230 . the first compliant material 160 preferably comprises a first side 162 , a second side 164 , a third side 166 , and a fourth side 168 . the first and second sides 162 , 164 preferably comprise hook - and - loop fastener material ( see fig1 ) therealong and are configured to be removably attachable to the first and second cover member flanges 130 , 140 of the second frame 124 , respectively . the third side 166 of the first compliant material 160 is preferably retained within the third cover member retainer 146 of the third cover member 146 and the fourth side 168 is preferably retained within the fourth cover member retainer 150 of the fourth cover member 150 . the first compliant material 160 is shown as being removably attached by the hook - and - loop fastener material 30 , however , additional or alternative fastening configurations , such as snaps , are contemplated . looking at fig1 and 14 , a plurality of removable cover supports 60 are shown . the plurality of cover supports 60 are preferably provided positioned on the shelves 134 , 144 of the first and second cover members 126 , 136 and extend therebetween . each of the plurality of columns 190 preferably comprises a telescopic assembly 192 with a base 194 , a telescopic portion 196 ( see fig1 ), and an actuator 198 ( see fig4 a ) preferably located within , or at least substantially within , the base 194 and configured to actively engage with the telescopic portion 196 . the base 194 is preferably attached to at least one of the floor 14 of the truck box 12 and the first frame 102 . the telescopic portions 196 are preferably attached to the second frame 124 . even more preferably , the telescopic portions 196 are attached to the first and second cover member plates 132 , 142 of as shown in fig5 a . looking to fig6 - 7b , the cover system 100 is shown in an intermediate state as it is being raised from the first , lowered , position to a second , raised , position . extension of the telescoping portions 196 is performed by activation of the actuators 198 through a switch ( not shown ) in electrical communication therewith . the switch ( not shown ) is preferably operated through a remote ( not shown ). upon activation , the second frame 124 is raised relative to the first frame 102 . as shown in fig7 a and 7b , the second compliant material 170 is unfurled from the first and second rail member enclosures 112 , 118 . the second compliant material 170 is preferably a continuous un - interrupted piece of material and made from a pliable and weather - resistant material such as a stretch tent textile . the second frame 124 continues the upward assent until reaching the second position shown in fig8 - 11 . in the second position , the second compliant member 170 is preferably made taught between the first frame 102 and the second frame 124 and provides a first wall 180 , a second wall 182 , and a third wall 184 . to return the second frame 124 to the first position , the actuators 198 are activated by the switch ( not shown ) in the reverse direction . the actuators 198 are preferably hydraulically driven but a pneumatic system is also within the purview of the present invention . activation of the actuators 198 to extend the telescoping portions 196 is preferably a one - touch activation , whereas the retraction of the telescoping portions 196 to lower the second frame 124 from the second position to the first position preferably requires constant activation of the switch ( not shown ) by a user ( not shown ). this is done to reduce the chance of user injury , damage to the cover 100 , and / or the load ( not shown ) being carried in the truck box 12 by accidental activation ; however , this functionality should not be viewed as limiting the invention . additionally , or alternatively , a manually operated switch ( not shown ) may be included which must be manually closed prior to activation of the actuators 198 . turning now to fig1 in which the rear panel 70 is shown as installed . the rear panel 70 preferably comprises a first rod ( hidden ) provided along a first side 72 and a second rod ( hidden ) provided along a second side 74 , a third side 76 , and a fourth side 78 . with reference to fig1 , the first rod ( hidden ) is receivable within the recesses 92 of a pair of upper brackets 90 attached to the first and second cover members 126 , 136 and the second rod ( hidden ) is receivable within the recesses 96 of a pair of lower brackets 94 attached to the first and second rail members 104 , 114 . the third and fourth sides 76 , 78 are preferably configured to be secured in a weatherproof manner to the second compliant member 170 . the weatherproof connection may be made through hook - and - loop material or any other method now known or later developed . the rear panel 70 is preferably formed from a compliant material , such as a stretch tent textile , and is configured to be rolled up and stored when not in use . turning now to fig1 - 21 a rack system 300 according to the present invention is shown . the rack system 300 is preferably configured to interface with the cover system 100 , 200 . the rack system 300 comprises a plurality of upstanding members 302 and a plurality of cross - members 320 . fig2 provides a view of an exemplary embodiment of an upstanding member 302 according to the present invention . the upstanding member 302 preferably comprises a pillar 304 , with a through - hole 306 , extending from a base 308 , and an arm 310 extending alongside at least a portion of the pillar 304 and below the base 308 . the arm 310 has an upturned end 312 . each upstanding member 302 is configured to interface with the first and second cover members 126 , 136 . as shown in fig1 and 19 with respect to placement of an upstanding member 302 on the second cover member 136 , the upstanding member 302 is positioned with the upturned end 312 received within the second cover member 136 between the second cover member retainer 138 and the second cover member flange 140 with the remainder of the arm 310 that is below the base 308 abutting the outside of the second cover member flange 140 . the base 308 is positioned atop the second cover member 136 . this arrangement allows for increased versatility as the plurality of upstanding members 302 may be placed at any location along the first and second cover members 126 , 136 . fig2 illustrates the plurality of cross - members 320 attached to and extending between opposing upstanding members 302 . here , the plurality of cross - members 320 have through - holes ( hidden ) at opposing end portions 322 , 324 which are configured to be alignable with the through - holes 306 of the pillars 304 . the plurality of cross - members 320 are preferably removably attached to the upstanding members 302 with pins 330 extending through the aligned upstanding member through - hole 306 and the cross - member through - hole ( hidden ), however , other methods of removable attachment are contemplated , such as by a threaded fastener ( not shown ). it should also be noted that the placement of the plurality of cross - members 320 on the plurality of upstanding members 302 may be adjustable . the rack system 300 is configured to be incorporated and usable with both cover system 100 , 200 in both the first position and the second position . fig1 - 20 illustrate thus with the cover system 100 . a method for raising and lowering a truck box cover is also contemplated according to the present invention and is describes with respect to the first embodiment of the truck box cover assembly 100 . the method preferably comprises the steps of : providing a first frame 102 and a second frame 124 ; providing a plurality of telescopic assemblies 192 operably connected to the first frame 102 and the second frame 124 , whereby the second frame 124 is configured to be movable relative to the first frame 102 through activation of the plurality of telescopic assemblies 192 between two positions : a first position and a second position ; whereby in the first position the first frame 102 and the second frame 124 are juxtaposed and in the second position the first frame 102 and the second frame 124 are spaced apart ; providing a first compliant member 160 supported by and extending across the second frame 124 ; providing a second compliant material 170 supported by and extending between the first frame 102 and the second frame 124 ; whereby , when in the first position , activating the plurality of telescoping assemblies 192 to move the second frame 124 to the second position wherein the second compliant material 170 is taut ; and whereby when in the second position , activating the plurality of telescoping assemblies 192 to move the second frame 124 to the first position . the method further comprises the step of actively monitoring the truck box cover system 100 when moving from the second position to the first position . active monitoring may include , but should not be limited to , constantly maintained activation of the plurality of telescopic assemblies 192 by a user ( not shown ) and / or pressure sensors ( not shown ) monitoring force applied in a direction different than the downward movement of the second frame 124 . the method may further comprise the step of tucking the second compliant member 170 into a first rail member retainer 112 and a second rail member enclosure 118 of the first frame 102 when moving the second frame 124 from the second position to the first position . the foregoing is considered as illustrative only of the principles of the invention . furthermore , because numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described . while the preferred embodiment has been described , the details may be changed without departing from the invention , which is defined by the claims .
| 1 |
embodiments of the present disclosure are described herein . it is to be understood , however , that the disclosed embodiments are merely examples and other embodiments may take various and alternative forms . the figures are not necessarily to scale ; some features could be exaggerated or minimized to show details of particular components . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the present invention . as those of ordinary skill in the art will understand , various features illustrated and described with reference to any one of the figures may be combined with features illustrated in one or more other figures to produce embodiments that are not explicitly illustrated or described . the combinations of features illustrated provide representative embodiments for typical applications . various combinations and modifications of the features consistent with the teachings of this disclosure , however , could be desired for particular applications or implementations . there are several basic constructions associated with flexible circuits including single - sided flex circuits , double access or back bared flex circuits , sculptured flex circuits , double - sided flex circuits , multilayer flex circuits , rigid - flex circuits , and polymer thick film flex circuits . single - sided flexible circuits have a single conductor layer made of either , for example , a metal or conductive polymer on a flexible dielectric film . component termination features are accessible from one side . holes may be formed in the base film to allow component leads to pass through for interconnection . double access or back bared flexible circuits have a single conductor layer . selected features of the conductor pattern , however , are accessible from both sides . sculptured flexible circuits ( a subset of flexible circuit structures ) are manufactured via a multi - step etching method which yields copper conductors of differing thickness along the circuit . for example , conductors can be thin in flexible areas and thick at interconnection points . double - sided flexible circuits have two conductor layers , and can be fabricated with or without plated through holes . the plated through holes permit terminations for electronic components to be provided on both sides of the circuit . as such , components can be placed on either side . protective cover layers can be placed on one , both or neither side of the completed circuit . multilayer flexible circuits have three or more layers of conductors . the layers are typically interconnected by means of plated through holes . the layers may or may not be continuously laminated together throughout the construction except in areas occupied by plated through holes . rigid - flexible circuits are a hybrid construction of rigid and flexible substrates laminated together into a single structure . polymer thick film ( ptf ) flexible circuits have conductors that are printed onto , for example , a polymer base film . they are typically single conductor layer structures . two or more metal layers , however , can be printed sequentially with insulating layers printed between printed conductor layers . basic flex circuit materials often include a base , bonding adhesive , and metal foil . the base material is the flexible polymer film which provides the foundation for the laminate . typically , the flex circuit base material defines most of the physical and electrical properties of the circuit . the base material in adhesiveless circuit constructions , however , defines all of the characteristic properties . a number of different materials can be used as a base including polyester , polyimide , polyethylene napthalate , polyetherimide , and various fluropolymers . while a wide range of thicknesses are possible , many flexible films are manufactured in the range of 12 μm to 125 μm . thinner and thicker materials are also possible . thinner materials are more flexible , and film stiffness usually increases in proportion to the cube of thickness . adhesives can be used as the bonding medium for creating a laminate . these adhesives , however , are typically the performance limiting element with respect to temperature , particularly when polyimide is the base material . adhesive systems of different polymer families , however , can be used to address such issues . similar to the base films , adhesives are manufactured in different thicknesses . and thickness selection is typically a function of the application . different adhesive thicknesses , for example , are commonly used in the creation of cover layers to meet the fill demands of different copper foil thickness . metal foil is a common conductive element of a flexible laminate , and is the material from which circuit paths are normally etched . although a variety of metal ( and metal alloy ) foils of varying thickness are used , copper foils are often preferred because of their cost and physical and electrical characteristics . copper foils are typically electrodeposited or wrought ( rolled )— yielding different properties . as a result , a number of different types of copper foil are available for flexible circuit applications . with most copper foil , a thin surface treatment is commonly applied to one side of the foil to improve its adhesion to the base film . flexible circuits , such as those described above , are used within magnetic tape storage devices . a head assembly , for example , can include a flex circuit connected to transducer elements of a head . elements in recording heads of tape drives have become smaller over time . as a result , issues associated with flex circuit electrostatic discharge ( esd ) have become more frequent . if , for example , a single track of a multi - track recording head does not work because of an esd event , the entire head will not work . techniques to manage esd are therefore of interest . the inventors have found through experimental observation that electrostatic charge may build up on the outside of flex circuits of a recording head , which may induce a charge in the conductors of the recording head . and when the recording head is grounded ( e . g ., plugged in ), the induced charge in the conductors may result in problematic current flow through the head . certain arrangements disclosed herein may facilitate reductions in electrostatic charge associated with , for example , recording heads . prior attempts at addressing electrostatic build up in flex circuits may have relied on the inclusion of static dissipative layers on the conductors or the insulating layers of the circuits . such layers , however , can be expensive and ineffective at keeping the charge at 0 v for certain sensitive devices . other attempts may have relied on a user wiping the flex circuit with isopropyl alcohol before activation . ( the alcohol acts as a resistor — preventing rapid discharge .) application inconsistencies , however , may reduce the effectiveness of this technique . here , an ink or other material having a known resistivity , in certain examples , can be layered on the flex circuit to create an electrical path between the conductors and portions of the flex circuit used for handling purposes . thus , charge in these arrangements can travel from the conductors , through the ink , and dissipated when the flex circuit is handled during installation . that is , the conductors may be continuously grounded while the connector is being plugged in . referring to fig1 and 2 , a head assembly 10 for a magnetic tape storage device 12 includes a head 14 with a plurality of transducer elements and a flexible circuit 16 . the flexible circuit 16 includes an end 17 , a gripping portion 18 , and a substrate 19 having electrical contacts or pads 20 ( e . g ., gold ) for the head 14 , conductors 22 ( e . g ., copper ) electrically connecting the transducer elements to the electrical contacts 20 , and traces 24 thereon . a zero insertion force type connector is shown . any suitable connector , however , may be used . moreover , the underlying basic components of the flexible circuit 16 are constructed in a manner similar to one of the examples described above . any suitable construction , however , may be used . the traces 24 begin at the electrical contacts 20 ( every other of the electrical contacts 20 in this example ), extend along the end 17 between the electrical contacts 20 and gripping portion 18 , and terminate at the gripping portion 18 . space permitting , the traces 24 may begin at each of the electrical contacts 20 , etc . other configurations are also possible . the traces 24 of fig1 and 2 are formed in a tree - like pattern . that is , thin “ leaves ” of the traces 24 are in contact with the electrical contacts 20 , thick “ trunks ” of the traces 24 are formed on the perimeter of the gripping portion 18 ( in areas typically used to handle the end 17 , and “ branches ” of the traces 24 extend between the “ leaves ” and the “ trunks .” this tree - like pattern in combination with the material composition of the traces 24 , as explained in more detail below , was selected to achieve a desired resistance in the static dissipative range between the electrical contacts 20 and the gripping portion 18 to facilitate electrostatic charge dissipation when handled . if silk screening techniques are used to apply the traces 24 , silk screening alignment tolerances should be considered when selecting a width for the electrical contacts 20 . the width of each of the electrical contacts in the example of fig1 and 2 is 0 . 64 mm . moreover if printing on edge is required , a small area , for example 1 mm , should be cut out at the perimeter so the edge is exposed . the traces 24 , in the example of fig1 and 2 , are an ink ( e . g ., silk screen ink ) that is applied ( e . g ., silk screened ) onto the underlying gripping portion 18 , electrical contacts 20 , and conductors 22 of the flexible circuit 16 . other suitable materials ( e . g ., thin metal films , etc . ), however , may be used . the ink forming the traces 24 has a resistivity of at least 500 kω /□. other inks and suitable trace materials can have a resistivity in the range of , for example , 5 kω /□ to 1 mω /□ provided that such resistivity in combination with the trace pattern / dimensions yields a desirable resistance in the static dissipative range ( e . g ., 100 kω to 100 gω ). put a different way , certain trace materials may have conductivities less than a conductivity of the electrical contacts 20 but greater than a conductivity of insulating layers of the flexible circuit 16 . given the electrical characteristics of the ink described above and the tree - like pattern formed by the traces 24 , a resistance of an electrical trace path between one of the electrical contacts 20 and that section of the gripping portion 18 covered by the ink is approximately 1 mω . resistances in other such electrical paths in other examples may range from at least 100 kω to more than 1 mω depending on application and design requirements . referring to fig3 a through 3c , other example trace patterns are schematically shown . if , for example , the same trace material was used to create these patterns , it is likely that the resistances associated with the electrical paths defined by these trace patterns would be different . it is possible , however , that with proper selection of trace material for each design similar path resistances could be achieved . that is , a change in trace material resistivity from pattern to pattern may offset the impact the differing patterns have on electrical path resistance defined by the traces . flexible circuits adopting the trace concepts discussed herein may improve yield for assemblies incorporating such flexible circuits as the number of assemblies lost due to esd events during plug - in may be reduced . likewise , reliability may be improved as handling of the flexible circuits may cause electrostatic charge to dissipate prior to it becoming problematic . the words used in the specification are words of description rather than limitation , and it is understood that various changes may be made without departing from the spirit and scope of the disclosure . as previously described , the features of various embodiments may be combined to form further embodiments of the invention that may not be explicitly described or illustrated . while various embodiments could have been described as providing advantages or being preferred over other embodiments or prior art implementations with respect to one or more desired characteristics , those of ordinary skill in the art recognize that one or more features or characteristics may be compromised to achieve desired overall system attributes , which depend on the specific application and implementation . these attributes may include , but are not limited to cost , strength , durability , life cycle cost , marketability , appearance , packaging , size , serviceability , weight , manufacturability , ease of assembly , etc . as such , embodiments described as less desirable than other embodiments or prior art implementations with respect to one or more characteristics are not outside the scope of the disclosure and may be desirable for particular applications .
| 7 |
like numbered elements in these figures are either identical elements or perform the same function . elements which have been discussed previously will not necessarily be discussed in later figures if the function is equivalent . fig1 shows an example of a method according to an embodiment of the invention . in step 1000 , the substrate is provided . in step 1002 , a process step is performed for forming the display component and the circuit component . in step 1004 , the document is formed using the substrate . this method reduces manufacturing costs by performing steps for manufacturing the integrated display and manufacturing the circuit component at the same time . manufacturing the integrated display directly in the substrate is also advantageous , because the substrate may have a special appearance or configuration which can be used as a security feature . manufacturing the integrated display directly on the substrate incorporates the integrated display into the substrate . if the integrated display were separate , it would be easier for someone to forge the document , because they too could incorporate a separate display into the document . in order to forge the document , the forger would need to have access to the same level of manufacturing as the manufacturer of the document . fig2 shows a substrate 158 where an integrated display 160 and an electronic circuit 164 are being manufactured . the electronic circuit 164 is shown as being coupled to the integrated display 160 . also shown is a display driver 162 . the display driver 162 may be an integrated part of the integrated display 160 , or it may be a separate component . fig2 demonstrates how a display component and a circuit component can be manufactured at the same time . for example , word line 186 is a part of the display 160 and a conductor 188 is a portion of the electronic circuit 164 , both of which can be deposited or manufactured at the same time . fig3 shows an example of a substrate 158 which can be used to form a document according to an embodiment of the invention . the substrate 158 has an integrated display 160 , an interface 172 , an antenna 142 , and an electronic device 102 . the antenna 142 may also be considered a contactless interface . the antenna can be used for powering the electronic device 102 in some embodiments and / or it may be used for exchanging data with a terminal system or a radio transceiver . the interface 172 may be a touch sensitive interface which allows an operator to manipulate the data displayed on the display . the interface 172 may also be a series of contacts which is adapted for connecting a computer or other electronic device to the document . the interface 172 may also be a biometric sensor . for example the biometric sensor may be a fingerprint sensor . the interface 172 may also contain an interface which functions as a touch sensitive interface as describe above and as a biometric or fingerprint sensor . this is because the interface may be used both to read the fingerprint of a finger in contact with the biometric sensor and to detect finger motion on the surface of the interface . the interface 172 may also comprise a switch for manual operation by a user . the integrated display comprises a display driver 162 in this embodiment . however , the display driver may also be a separate component . the integrated display 160 also comprises a display component 166 . the electronic device 102 comprises an electronic circuit 164 , a central processing unit 156 , a transmitter 130 , a receiver 128 , a security module 170 , computer memory 126 , it may also contain one or more integrated circuits 154 , and , contacts for attaching the integrated circuit to the substrate 158 . the electronic circuit 164 comprises a circuit component 168 . the electronic circuit 164 is connected to the integrated display 160 . the central processing unit ( cpu ) 156 is also shown as being connected to the display driver 162 . the central processing unit 156 is adapted for performing machine executable instructions and may contain memory for holding machine executable instructions to execute . the cpu is shown as containing a software application 110 . the software application may be considered a computer program product . the integrated circuit 154 is connected to the contacts 152 which are connected to the central processing unit 156 . a security module 170 is shown as also being connected to the cpu 156 . the security module 170 may store cryptographic keys or ciphers . and it may also provide encryption or decryption of data using hardware . the memory 126 is also shown as being connected to the central processing unit 156 . this is computer memory 126 and can be used for storing such things as data objects 104 . the computer memory contains such things as data objects 104 , image data 150 , and a computer program product 148 . the image data 150 is data which represents an image , or which can be used to generate an image which can be displayed on the integrated display 160 . the computer program product contains machine executable instructions and may comprise instructions for the electrical operation of the document . the central processing unit is shown as being coupled to the receiver 128 and the transmitter 130 . both the receiver 128 and the transmitter 130 are coupled to a power block 132 . the power block 132 performs power management for the power supply of electronic components on the substrate . the power block is connected to the antenna 142 . the power block may be adapted to receive electrical power that is coupled into the antenna 142 via electromagnetic radiation . the power block 132 may also function as a protection circuit for the electronic components on the substrate . if too high of a voltage is induced in the antenna by electromagnetic radiation the electronic components on the substrate may be damaged . the power block 132 may incorporate a single diode , a single diode circuitry or a voltage regulator integrated circuit to protect the electronic components on the substrate from voltages which may damage them . the receiver 128 and transmitter 130 and power block 132 may be attached to a common antenna , or there may be multiple antennas . for instance there may be an antenna which is only for coupling power to the power block 132 and there may be and additional antenna for transmitting and receiving data using the transmitter 130 and the receiver 128 . the receiver 128 and the transmitter 130 may also be combined into a single transceiver component . the components of the electronic device 102 may be separate discrete components or they may be combined together , e . g ., within an electronic module . for example the security module 170 may be an integrated circuit 154 . the same is true for the memory 126 and the central processing unit . the electronic circuit 164 is intended to be representative of a generic electronic circuit . the central processing unit 156 , the security module 170 , the memory 126 , the transmitter 128 , and the receiver 130 could all be considered as part of an electronic circuit . during manufacturing , a process step is performed where a display component 166 and circuit component 168 are formed or are partially formed . this may be during a single process step . during this process step , essentially a portion of the display 160 and a portion of the electronic device 102 are formed or constructed at the same time . in operation , the display 160 , electronic device 102 , and interface 172 shown in fig3 may be powered by electromagnetic energy received by the antenna 142 . although a battery or power source could be included , they are typically not not included . the antenna is also adapted to send and receive data by use of the transmitter 130 and receiver 128 . the document may receive a signal from an external data terminal or reader which requests data or information stored in the memory 126 . in some embodiments , the document may need to receive a special security code of cryptographic key before the document will respond to a request for data or information . the security module may be used to authenticate a request . the security module may also be used to encrypt or decrypt data stored within the memory 126 . once a request for data is authenticated , the document may transmit the requested data using the transmitter 130 and the antenna 142 . the interface 172 may be used to control the data or image displayed on the display . for instance , the interface could be a touch sensitive interface . as an operator drags a finger across the interface , the perspective view of a photograph could change . instead of a single two dimensional photograph being used for an identity card , multiple images could be stored in the memory 126 and recalled depending upon control signals received from the interface 172 . the cpu 156 may receive control signals from the interface 172 . the control signals are then used to select image data contained within the memory 126 using a selection criteria that programmed into the computer program product 110 . as was described previously , the interface 172 may incorporate a biometric sensor and / or touch sensitive interface . fig4 shows a document 174 according to an embodiment of the invention . the document 174 was formed using the substrate 158 which is shown in fig3 . the document has an integrated display 160 . adjacent to the integrated display 160 is an interface 172 . also on the document 174 is a printed region 176 . the document 174 may contain more than one printed region 176 . in the printed region 176 information , symbols , or markings are printed on the document 174 . the printed region 176 may contain , but is not limited to , a name 178 , a marking indicating validity of the document 180 , a signature 182 , and / or machine readable markings 184 . the display may cover the entire surface or most of the surface of the document . in this case , the display its self may function as the document . all of the information in the printed region could be represented on the display . if the display were a bistable display or electronic paper display then the document could display information even when not powered . a validity marking 180 , as used herein , is a marking which indicates the validity of the document and may include such information as a date or it may be a symbol which is used to indicate official validity of the document . the machine readable markings 184 may also be readable by a human or they may be exclusively machine readable . with such a document as is shown in fig4 , a variety of different information can be displayed on the integrated display 160 . the information that is displayed on the integrated display 160 may be controlled by a computer program product . the interface 172 may also be used to control what is displayed on the integrated display 160 . for instance the interface 172 may be a touch sensitive pad . by touching and moving a user &# 39 ; s finger or stylus , e . g ., a stylus of a pda , around on the interface 172 the view of what is shown on the integrated display 160 may change . for instance , different views of the same person may be displayed . the interface 172 could also control a menu system which is used to control what sort of information is displayed on the integrated display 160 . furthermore the interface 172 could be used to verify biometic features . for example the interface 172 could include a fingerprint sensor and / or touch sensitive pad as was described previously with respect to fig3 . fig5 shows a block diagram of one embodiment of data terminal 100 and of electronic device 102 , which is integrated into an identity document 114 . the identity document is illustrated as a passport in a schematic , perspective view and features a zone with machine - readable printed data 116 . integration of the electronic device into the identity document can be done , for example , by embedding it into the cover page or the main page of a passport . both electronic device 102 and data terminal 100 can have a contactless interface 142 or 142 ′, which is connected to both a transmitter 130 or 130 ′ and a receiver 128 or 128 ′ and facilitates the contactless communication between data terminal and electronic device . electronic device 102 can feature a memory 126 for a number of data objects 104 . personal biometric data such as a photograph , fingerprints , or iris data of the owner of identity document 114 can be stored in one or more of data objects 104 . in addition information such as address data , date of birth , location of birth , country of birth , and visa information may be stored in the data objects . storage of data objects 104 in memory 126 may follow the standard series 9303 “ machine - readable travel documents ” of the international civil aviation organization , icao . under the designation “ logical data structure ” ( lds ), the icao defines a file system that conforms to the chip card standard iso 7816 - 4 as well as an interoperable structure of the data objects stored in this file system . data terminal 100 can be programmed with computer - executable instructions 124 ′, which allow it to read data objects 104 stored in memory 126 of electronic device 102 via contactless interfaces 142 ′ and 142 . to protect the personal biometric data , in particular , from unauthorized readout , electronic device 102 can have program instructions 124 , which permit read access on data objects 104 only after a successful execution of a cryptographic protocol with data terminal 100 . one such measure is recommended by the icao , which specifies the support of a number of data protection options as a mandatory requirement for the standardized lds . various types of personal biometric data which are categorized or attributed to different levels of protection can be stored in different data objects 104 . for example , a low level of protection can be attributed to a photograph , whereas fingerprints or iris data are attributed to a higher level of protection . the various assessments of levels of protection of different data objects 104 are coded by allocation table 106 of electronic device 102 . each data object 104 in the allocation table is assigned a cryptographic protocol 108 of a different security level . the allocation table can assign free access without the mandatory implementation of a cryptographic protocol to one or a number of data objects 104 . in operation , electronic device 102 receives a request for one of the data objects 104 from data terminal 100 via receiver 128 and contactless interface 142 . thereupon , using allocation table 106 , the electronic device specifies a cryptographic protocol 108 , the successful execution of which is set as a condition for read access of the data terminal to one of the data objects . the electronic device and the data terminal carry out the cryptographic protocol and , if successful , the electronic device transmits the data object to the data terminal . alternatively , data may be displayed on the integrated display 160 . electronic device 102 may feature a software application 110 , which includes allocation table 106 . cryptographic protocol 108 is thus specified by the software application , the cryptographic protocol is executed by the data terminal and the software application , and the one data object is transmitted by the software application . the electronic device can provide an operating system 112 , which , working together with the hardware of the electronic device , prevents any unauthorized alteration or removal of the software application and only allows access to data objects 104 via the software application . in this way , it is possible to manufacture electronic device 102 on the basis of mass - produced , standardized hardware , while at the same time the specifications of the cryptographic protocols which are being used and the coded allocation of data objects 104 in allocation table 126 can be adapted to cryptographic protocols of varying requirements . the electronic device can be a java card with a virtual java machine , on which software application 110 is installed in the form of a java applet . operating system 112 can protect software application 110 including allocation table 126 from unauthorized alteration or removal , while at the same time provide an administrator function 140 , which allows alteration or removal of the software application following authentication as administrator of electronic device 102 . the administrator function is especially advantageous because the electronic device can be adapted to revised requirements instead of being replaced by a new electronic device . revised requirements can pertain , for example , to improved cryptographic protocols 108 or a revised classification of levels of protection of different data objects 104 . various encryption protocols 109 can also be assigned to different data objects in allocation table 106 , according to which electronic device 102 and data terminal 100 can encrypt their communication . encryption is particularly advantageous , since it allows third parties to be prevented from monitoring the contactless communication between the electronic device and the data terminal . electronic device 102 and data terminal 100 may have suitable cryptographic keys 118 , 120 and 146 , which are used in executing various cryptographic protocols . data terminal 100 can derive another device - specific key for electronic device 102 from machine - readable printed data 116 , e . g ., directly from or by hashing the machine - readable printed data 116 , partly or as a whole . alternatively , if the integrated display 160 is a bistable display , the machine - readable data may be displayed on the integrated display . to this end , the data terminal may be provided with an optical sensor to read printed data 116 . a symmetrical key for communicating with electronic device 102 can thus be obtained from the data recorded in this manner . in one embodiment , data 116 is used as a symmetrical key . this symmetrical key can be stored in unprotected or protected form in electronic device 102 . alternatively , electronic device 102 is designed in such a way that , if needed , it can generate this symmetrical key from data 116 also electronically stored in electronic device 102 . a general key 146 or 146 ′ can also be used , which is known to both the electronic device and data terminal 100 . the data terminal may also be provided with an asymmetrical pair of keys from public 118 and private 120 keys , whereby it transmits its public key to the electronic device as part of a cryptographic protocol . the public key can be provided with a digital signature 122 , which allows it to verify the authenticity of the key 118 by means of a certificate chain . general key 146 ′ can be used from data terminal 100 , for example , in order to generate the additional symmetrical key from optically recorded data 116 . to this end , general key 146 ′ and data 116 are associated to each other . there is an integrated display 160 coupled to the electronic device 102 . the memory 126 may contain data for being displayed on the integrated display 160 .
| 6 |
the coalescing solvent is generally selected from the group consisting of ethylene glycol monomethyl ether , ethylene glycol monoethyl ether , ethylene glycol monobutyl ether , diethylene glycol monobutyl ether , diethylene glycol monoethyl ether acetate , diethylene glycol diethyl ether , ethylene glycol monomethyl ether acetate , methyl ethyl ketone , acetone , methyl propyl ketone and diacetone alcohol . of the various solvents which can be used , generally the ethylene glycol monobutyl ether , ethylene glycol monoethyl ether , diethylene glycol monomethyl ether , diethylene glycol monoethyl ether and diethylene glycol monobutyl ether are preferred . representative of the various amines which may be used to form the water reducible compositions are : primary amines such as ethyl amine , propyl amine , butyl amine , isoamyl amine , amyl amine , hexyl amine , heptyl amine and ethanol amine ; secondary amines such as diethyl amine , ethyl ethanol amine , and morpholine ; and tertiary amines such as dimethylethanol amine , trimethyl amine , triethylamine and n - methyl morpholine . the amount of water used depends on whether a high or a low viscosity dispersion is desired or whether high or low solids content is desired . it also depends on the type and amount of coalescing solvent used . the water , amine and coalescing solvent are evaporated from applied coatings usually at a temperature in the range of about 20 ° c . to about 100 ° c ., preferably about 25 ° c . to about 50 ° c . the resins which are preferred for use in water reducible compositions are those requiring the least number of monomers for their synthesis . this , of course , simplifies the manufacture of the resins . the invention will be further clarified by a consideration of the following examples , which are intended to be purely exemplary of the use of the invention . unless otherwise stated , parts are parts by weight , and percentages are by weight . polymerizations were carried out in one quart ( 0 . 95 liter ) glass bottles which were clamped in a rotating wheel - polymerizer . the wheel of this polymerizer was located in a water bath held at 52 ° c . each bottle was charged with the ingredients , purged with nitrogen , and capped with a perforated cap having a rubber disc seal through which a hypodermic needle could be inserted for the taking of samples . two bottles were run for each recipe . the percent conversion for a given polymerization time was determined by measuring total percent solids of the sample at that time and estimating conversion from a total solids - conversion straight line relationship . the total solids was determined by drying a weighed sample of the latex in a weighed aluminum dish by means of an infrared lamp until the sample appeared to be dry . the bottle polymerizations ran approximately to completion . reaction ingredients , conditions , and final product characteristics are given in table 1 . table 1______________________________________emulsion polymerization of acrylic resinssample no . ingredients ( in parts ) 406c 447a 447b______________________________________water 151 . 0 151 . 0 151 . 0 * emulsifier 3 . 0 3 . 0 3 . 0metal complexing agent 0 . 1 0 . 1 0 . 1sodium acid pyrophosphate 0 . 2 0 . 2 0 . 2k . sub . 2 s . sub . 2 o . sub . 8 ( free radical catalyst ) 0 . 1 0 . 1 0 . 1tert .- mercaptan 0 . 8 0 . 8 0 . 8isobutyl methacrylate 71 . 0 42 . 0 40 . 02 - ethylhexyl methacrylate 24 . 0 28 . 0 27 . 0styrene -- 25 . 0 25 . 0n - vinyl - 2 - pyrrolidone 2 . 0 2 . 0 5 . 0methacrylic acid 3 . 0 3 . 0 3 . 0final % solids 40 . 3 39 . 8 39 . 8final ph 2 . 7 6 . 1 6 . 0final viscosity ( cps ) 22 30 25reaction time ( hrs ) 12 12 12______________________________________ * complex surfactant phosphate ester acid neutralized with naoh to ph = 6 . 5 . surfactant used herein was gafac re - 410 , a trademark of gaf corporation . the resins produced in example i above were separated from the reaction product mixtures by coagulation and drying . the duplicate bottles were blended together before coagulation . the coagulant in each case was a mixture of 6 grams alum ( aluminum sulfate ), 3 grams sulfuric acid ( 95 - 98 %), and 4000 milliliters of water . the temperature of the coagulation is given in table 2 . the slurry resulting from each coagulation was filtered using a cloth - lined buchner funnel . after filtration the resin cake was washed twice with cold soft water . the resin was then dried at 60 ° c . in an oven . table 2______________________________________coagulation and drying of resinssample 406c 447a 447b______________________________________coagulationtemperature (° c ) 49 - 60 60 60______________________________________ film forming water reducible coating compositions can be prepared from resins such as those of example ii by mixing such a resin with a coalescing solvent generally at a temperature of from about 25 ° c . to about 80 ° c ., and generally for a period of from about 20 to about 60 minutes . sufficient volatile amine is added to achieve a ph in the final water dispersion in the range of about 8 to about 14 . the water reduced compositions are formed by mixing about 330 parts of water with the amine neutralized compositions at a temperature of from about 25 ° c . to about 80 ° c . and for a period of from about 20 to about 60 minutes . films formed by applying said coating compositions to substrates are generally dried for a period of from about 8 to about 24 hours . other embodiments of this invention will be apparent to those skilled in the art from a consideration of this specification or practice of the invention disclosed herein . it is intended that the specification and examples be considered as exemplary only , with the true scope and spirit of the invention being indicated by the following claims .
| 2 |
the subject invention includes devices and methods for arousing a person from sleep . as noted above , all too often the familiar repeated alarm sounds and radio or cd music offered by conventional alarm clocks tend to become ineffective in arousing a person from sleep . to address this and other issues , the alarm clocks of the subject invention include , in addition to clock circuitry , a stored sound library , thereby substantially increasing the quantity and variety of sounds that may be used for wake - up signals . the sound library of the subject alarm clocks may include any number of different wake - up sounds . the alarm clocks of the subject invention are adapted to store a far greater number of wake - up sounds than available in conventional alarm clocks . in certain embodiments , the number of sounds of a sound library stored in a subject alarm clock may be of sufficient number to enable a different wake - up sound to be used every time the alarm is activated , ( e . g ., once per day for a period of about one month or more , for a period of about 6 months or more , for a period of about 1 year or more , for a period of about 2 or more years ). the number of sounds that may be stored in a subject alarm clock for use as a wake - up signal may range from several , to tens , hundreds , thousands or more . the sound selection played from within a given intensity mode may be the next sequential selection or track . in this way , the unit may cycle through a playlist . alternatively , the sounds may be selected at random . the random feature may play any sound , or it may be configured to avoid repetition of ones played recently or until all other sounds are played . it may be desirable that the default setting for the clock is random with regard to sound selection from a given intensity category . the sounds that make - up a sound library may differ by intensity or type . in other words , the subject alarm clocks may include a plurality of sound intensity modes — including a random setting for selection between the varioius sound intensity modes or for any sound in the library or catalogue of sounds . the particular sound mode desired ( including a fully random mode selecting any sound stored within the clock ), for a given wake - up protocol may be designatable by the user , ( e . g ., by way of a knob , switch , button , dial , user - interactive display , or the like ) of the alarm clock , as described in greater detail below . each sound mode within the sound library may include one or more sounds of the selected / given sound intensity , type or genre . user designation of particular intensity mode causes a sound within that group or intensity mode to be emitted from the alarm clock when the alarm is triggered . once a particular intensity mode is designated , the alarm clock is adapted to emit a sound from the designated type . to reiterate the above , the particular sound may be randomly selected from the set of sounds of the designated intensity ; alternatively , the sound may be one that comes next in cycling through a list or cue . embodiments include at least a first sound intensity mode and a second sound intensity mode , and may also include a random mode for random selection from the at least first and second sound modes . for example , the sound library may include a first set of sounds of a first sound intensity and a second set of sounds of a second sound intensity . certain embodiments include at least a first sound mode , a second sound mode and a third sound mode ( or four or more ), and may also include a random mode ( in which its designation provides or plays a sound from any of the stored library of sounds ). the sound intensities used may be any suitable sound intensities , with the requirement being that the intensities differ amongst the different designated intensities . for example , if two sound intensity modes are included , the sound intensity of the sounds of the first mode will differ substantially ( albeit maybe only in a subjective or relative fashion ) from the sound intensity of the sounds of the second mode . if three sound intensity modes are included , the intensities of the sounds of each mode will differ substantially from the sound intensities of the sounds of the other modes . in certain embodiments , the sound intensities may be chosen from commonly accepted sound intensities , ranging from soothing sounds to severe sounds . in a system incorporating at least first , second and third sound intensity modes , the first may be a soothing sound intensity mode , the second a “ standard ” alarm sound intensity mode , and the third mode may be a severe sound intensity mode . other groupings of sounds may include funny ( e . g ., comedic excerpt or cartoon soundtrack effect ), painful ( e . g ., nails on a chalkboard ), scary or spooky ( e . g ., sounds commonly associated with halloween like ghosts moaning , wolf howling , bat wings flapping ), disgusting ( e . g ., flatulence , vomiting , nose blowing ) or other genre . regarding a “ soothing ” sound intensity , it is one including such associated sounds as a distant fog horn , gentle ocean waves , seagulls , light wind , running water , rustling trees , bacon sizzling , and the like . a “ severe ” sound intensity is one including such sounds as charging elephants , garbage truck unloading trash , new york city traffic , train crossing gates , train passage or horn , and the like . a “ standard ” or intermediate sound intensity falls between the extremes and may even include variations on the same sounds ( though possibly altered in volume or magnitude ( e . g ., smaller vs . crashing waves , gusting or howling wind vs . a light breeze , etc .). for the purpose of further definition , table 1 of fig1 provides additional exemplary sounds that may be included as standard / intermediate , soothing and severe sound intensities . note , however , that another device according to the invention could use many of the same sounds and group them somewhat differently based on user preference , feedback studies , etc . and still fall within the intended scope . in another aspect of the invention , multiple or serial alarms may be provided as in the “ primed ” mode of alarm use described above . in one variation , the alarm clock may be programmed to trigger successive alarms at the next higher intensity mode setting ( e . g ., from soothing to standard , standard to severe , or the like ). in another variation , upon occurrence of a predetermined event such as use of a “ snooze ” button ( i . e ., alarm repeat / delay activation feature ) more than a predetermined number of times ( e . g ., about 2 , 3 , 4 , 5 or more times in certain embodiments ), or if the alarm sounds continuously for a predetermined amount of time ( e . g ., about 2 , 5 , 10 or 20 minutes in certain embodiments ), then the intensity may be ratcheted upward . referring now to the block diagram of fig2 , an exemplary hardware implementation of the subject system is shown . here , the wake - up sounds of the sound library are stored in wake - up sound memory 4 . memory device 4 may be any device capable of storing audio content , and may be removable or non - removable media , and include volatile or non volatile memory devices . in many embodiments , memory 4 is non - removable memory . memory devices that may be used include , but are not limited to , read - only memory ( rom ), random access memory ( ram ), static random access memory ( sram ), dynamic random access memory ( dram ), pcmcia standard compatible plug - in memory card , flash card for accepting recordings over a modem which may be included as part of the alarm clock circuit or may be external to the circuit of the present invention , floppy disk , hard disk , dvd , tape , flash memory , a memory stick , and the like . for example , an alarm clock may include a rom device containing instructions and programs and a ram device for storing sound in digital form . wake - up sound memory device 4 may include a plurality of memory locations and each location may store audio content of a particular sound intensity . for example , a memory device may include a first memory region for storing first intensity mode sounds ( e . g ., standard wake - up mode sounds ), a second memory region for storing second intensity mode sounds ( e . g ., soothing wake - up mode sounds ), and a third location for storing third intensity mode sounds ( e . g ., severe wake - up mode sounds ). no such organization is , however , required . any approach to addressing the stored data for access and replay will suffice . still , a more organized data structure may be desirable for the sake of programming and / or upgrading or adding sounds to the repertoire or library of the device . in any case , the subject alarm clock also includes a controller or processor 6 that can access memory 4 and control the functions of the alarm clock ( e . g ., drive a display 11 for displaying time , etc .). a “ processor ” references any combination of hardware or software which can control components as required to execute recited steps and includes , for example , a general purpose digital microprocessor suitably programmed ( e . g ., from a computer readable medium carrying necessary program code or by communication from a remote location ) to perform all of the steps required of it , or any hardware or software combination which will perform those or equivalent steps . the programming may be provided remotely to processor 6 , or previously saved in a computer program product such as memory 4 or some other portable or fixed computer readable storage medium . such media include , but are not limited to : magnetic storage media , such as floppy discs , hard disc storage medium , and magnetic tape ; optical storage media such as cd - roms and dvds ; electrical storage media such as ram , rom and eprom ; and hybrids of these categories such as magnetic / optical storage media . program - containing computer - readable medium may be read locally or from a remote location through a communication channel ( not shown ). indeed , the present invention can be run on a general - purpose computer . in which case , the product to be purchased by the user may be software package — boxed or downloaded . still , a preferred embodiment is one in which the “ clock ” is a stand - alone unit , that a user can purchase on - line or at any retail outlet . variations of the inveniton include alarm clocks that are programmable for two or more independent wake - up protocols . in other words , an alarm clock maybe adapted to store a plurality of preset wake - up protocols , e . g ., thereby obviating the need to reset the alarm for varying wake - up schedules . such may be based on time of day , day of week , etc . the presets may be user - programmed or pre - programmed and associated with a series of buttons for ease of user access . in certain embodiments , the sound library of a subject alarm clock may be modifiable ( e . g ., periodically updated or changed ). embodiments that are adapted to enable editing of the sound library increase the customization and personalization of an alarm clock . the sound library may be personalized in a number of ways . the sound library may be personalized by adding to the library recorded speech or familiar sounds . for example , familiar speech such as a spouse &# 39 ; s voice may be recorded as a wake - up sound ( e . g ., a husband or wife screaming “ wake up !”, and the like ), a baby &# 39 ; s cry may be may be recorded as a wake - up sound , etc . accordingly , an aspect of the invention may include audio acquisition 8 ( i . e ., audio input ) so that the user may add wake - up sounds to the sound library from an external sound source . sounds may be added to the sound library by / from ( but not limited to ), e . g ., computer download , internet download , voice input , keypad input , radio frequency download , wireless application protocol download , mp3 player , radio , television , home theater system , telephone , and the like . in certain embodiments , audio content may be downloaded from an external source such as via wifi . the external source may be a specific website , e . g ., a subscription music service website . for example , a user may subscribe to a web - based service that permits the download of audio content for a fee . the alarm clock may include a download button or the like and audio content may be downloaded to the alarm clock by activation button of the alarm clock to download audio content from the website , e . g ., via wifi . wake - up sounds acquired from an external source and stored in wake - up sound memory device 4 will typically be identified or designated as a particular sound intensity ( i . e ., are stored in memory 4 as one of the sound intensity modes of the alarm clock ). designation of a particular sound as a member of a set of a particular sound intensity may cause the sound to be stored in a certain location of a memory device or otherwise designated as the particular intensity . a user may designate a sound as a particular sound intensity by any suitable means ( e . g ., optional keyboard connected to the alarm clock or optional alphanumeric pad integrated with the alarm clock , or , as shown in alarm clock 2 of fig3 optional selector 12 such as a dial , toggle , button , display , etc .,) of the alarm clock . in certain embodiments , the audio input 8 is built into or otherwise integrated with the alarm clock . an alarm clock may include a built - in microphone used to record a new audio wake - up segment from a sound source and store the recorded sound in memory 4 , and / or may include an audio input jack for a monaural or stereo signal . still further , a user may download or create the sound in a computer and transmit the audio to the alarm clock , e . g ., through a connection cable . as such , input 8 may comprise a usb port or other typical digital interface means . audio input 8 may include a microphone and associated analog - to - digital ( a / d ) and digital signal processing ( dsp ) circuitry 7 ( alternatively processor 6 may provide the dsp function ) to capture an analog audio signal . the processor may then store the digitized speech in wake - up sound memory 4 , as described herein . thus , in accordance with an embodiment of the present invention , sound signals representative of the desired sound segments may be received by the microphone , converted into digital signals by an a / d converter , and processed and stored in memory under the direction of a digital signal processor . in this manner , the stored sound segments may be used to wake - up a user in a distinctive , personalized way . as part of the audio acquisition system , an alarm clock may include a visual indicator 8 a such as an led , lcd or the like to indicate audio acquisition . the indicator may also be adapted to notify the user of recording time remaining ( such as by blinking ) when a predetermined amount of record time remains . the subject alarm clocks also include audio output 10 . audio output 10 may include an amplifier , speaker , digital - to - analog ( d / a ) converter and dsp circuitry 9 ( alternatively dsp circuitry may be provided by processor 6 ) to receive digitized audio content from processor 6 and memory 4 , convert the digitized audio content to an analog audio wake - up signal , amplify , and broadcast the analog audio wake - up signal through the speaker at the pre - set wake - up time . audio output 10 may include one or more speakers for playing the intensity - specific alarm sound and may be associated with the alarm clock in any suitable manner . for example , one or more speakers may be connected to the alarm clock by one of a direct , wired connection to a speaker , a wireless radio connection to a speaker , a wireless infrared connection to a speaker , and a means of transmitting data to a speaker that includes transmitting data in a wireless manner . in certain embodiments , the one or more speakers are integrated into the alarm clock , as shown in fig3 . audio output 10 may include a volume control switch 14 for manually setting volume . use of this control may further compound the effect of recording level for the various sounds output from the device . furthermore , audio output 10 may include an automatic volume control to automatically increase the volume of the analog audio signal during wake - up , from an initial volume to a maximum volume level , over a predetermined time period to provide crescendo to certain wake - up tones . such automated volume control could also be employed in repeating one type of sound as successively higher levels to vary its intensity . an example of a sound that could be soothing at low levels is a “ distant ” fog horn . at a higher level , it offers and intermediate level of wake - up alarm . blaring at maximum speaker intensity , the fog horn could be regarded as an intense wake - up signal . in certain embodiments , the functions of the a / d , dsp and d / a circuitry may be provided on a single chip or device , such as ( but not limited to ), for example , an isd2532 single chip voice record / playback device ( manufactured by winbond electronics corp . of san jose , calif .) or analogous device . in such embodiments , audio input 8 may include a microphone and the single - chip voice record / playback device , which may include on - chip audio memory to store the digitized audio content , while audio output may include the speaker and associated amplification circuitry , which may include volume control , as noted above . the audio acquisition process may be activated by a control switch , and the analog sound signal may be input to the single - chip voice record / playback device via the microphone , converted to digitized speech and then stored in on - chip memory ( e . g ., a particular sound intensity ). in certain embodiments , speakers of the alarm clock may be used with external audio sources so that audio from the external source may be played through the alarm clock speakers ( e . g ., even when not used for wake - up ). for example , a communication link , e . g ., an input jack , may be adapted for cable connection to a conventional radio , home theater , dvd , mp3 player , computer , etc ., allowing the audio from such external sources to be amplified by the speakers of the alarm clock . alarm clocks of the subject invention may include various optional features such as multiple alarm protocols , snooze , etc ., whereas such features are well - known in the art to which the invention pertains . alarm clocks according to the present invention may be adapted to store a plurality of independent wake - up protocols or events ( see for example alarm programs 1 . . . n of display 12 b of fig6 ) and may be adapted to store weekly wake - up protocols , monthly protocols , yearly protocols , etc . in other words , an alarm clock may be programmed for a wake - up schedule for an entire week , month , year , etc ., such that the wake - up schedule includes a plurality of wake - up protocols that differ in at least one parameter ( date , time , wake - up intensity , etc .). the different wake - up protocols may be selectively activated by the user , for example on a weekday the user may simply activate the weekday schedule or schedule for a particular day of the week , or the alarm may be programmed to automatically run the stored alarm protocols at the appropriate time ( as the appropriate date / time occurs ). the protocols may be selectively deactivateable so that , ( e . g ., a first programmed alarm protocol may be deactivated for a particular week if a schedule requires temporary deactivation ) without deactivating any other programmed alarm protocols . the user may be on vacation and not require the effective wake - up offering of the present invention . setting an alarm clock for various wake - up schedules may be accomplished in any suitable manner , e . g ., by way of one or more selectors of the alarm clock . the subject alarm clocks are adapted to enable different wake - up intensities for different , independent wake - up protocols programmed into the alarm clock . for example , a subject alarm clock may be programmed for a first alarm protocol of first intensity and a second alarm protocol of second intensity . in certain embodiments , a single alarm clock may be programmed to accommodate wake - up protocols for two or more persons ( i . e ., an alarm clock may be programmed for a first wake - up protocol ( time / wake - up intensity , and the like ) for a first person and a different , second wake - up protocol for a second person ). an alarm may be programmed for two or more wake - up protocols based on the days of the week . an alarm may be programmed for a first wake - up protocol for certain days of the week ( e . g ., weekdays ) and a second wake - up protocol for certain other days of the week ( e . g ., weekend days ). the alarm intensities of the first and second wake - up protocols may differ ( i . e ., the first alarm protocol ( weekday wake - up protocol ) may be of a first alarm intensity , such as for example severe intensity mode , and the second alarm protocol ( weekend protocol ) may be of a second alarm intensity , such as for example soothing alarm intensity ). other configurations are possible as well . for example , an alarm clock may be preset for a daily , weekly , monthly , etc ., wake - up protocol that accounts for the day / time of street cleaning , parking regulations , etc . seven ( one for each day of the week ) individual alarm protocols may be preset so that a weekly schedule need only be programmed one time . it is known that a user may set the time of the clock ahead by a known amount in an attempt to deceive themselves when the alarm is triggered into thinking that the time is actually later than it really is . however , this technique is often ineffective because the person knows exactly how much time has been added to the clock . by a simple math computation when the alarm is triggered , the actual time may be quickly determined . using the microprocessor of the present invention , however , the alarm clock may include a “ time warp ” feature that belies user avoidance . in certain embodiments , a time warp may occur from about 30 to about 20 minutes before the alarm is triggered and continue until a predetermined time after the alarm is triggered or until the alarm is turned - off by the user — at which time the time is returned to actual time . for example , time warp may occur from about 1 minute to about 15 minutes before the alarm is triggered ( e . g ., from about 5 minutes before the alarm is triggered to about 10 minutes before the alarm is triggered ). the time warp may continue through the alarm signal and for a period of time after the alarm is triggered ( in certain embodiments regardless of whether the alarm is turned - off by the user or not ). for example , time warp may continue from about 30 seconds to about 20 minutes after the alarm is triggered ( e . g ., from about 1 minute to about 15 minutes after the alarm is triggered ). by such continuation , the user is not able to avoid the imperative of the alarm by waiting for the actual time to display and then return to sleep . the time warp may change on a periodic or random basis so that the time may be modulated by different amounts for different wake - up events . the warp may be set such that it may go to +/− about 5 min . 10 min , 15 , min ., etc . in other words , the clock processor may include a plus and / or minus time warp in that the time ( real or current time ) may be randomly modulated by addition or subtraction of time . yet , it will remain basically centered about the actual time . accordingly , it offers a time - piece that one can employ ( if set conservatively ) to meet the tasks of the day . for such a purpose , it may also be desirable that when employing time warp features that the actual real time may be shown . it may appear automatically after a prescribed time , or it could be accessed by a user depressing an override or “ real time ” button ( not shown ). as referenced above , the subject alarm clocks may include a snooze feature , to temporarily silence the wake - up signal for a predetermined time period . this feature may too be variable ( i . e ., set by a user to a desired time interval ) and / or randomizable in a manner similar to the time warp so that it may offer any amount of time between ( e . g ., 5 and 15 min .) or some user - set interval . the snooze mode may be activated in any suitable manner , e . g ., snooze activator 16 . in certain embodiments , the snooze function may be activated by voice command . certain alarm clocks may limit the total time that the wake - up signal will be played to a specific period , such as one hour or the like , to prevent the signal from sounding continuously if the user is unable to terminate the wake - up signal . or , as described above , after a prescribed — or even randomized — amount of time , the intensity of the alarm setting or alarm type may be edged or jump upwards . the alarm clocks of the subject invention may be powered by any suitable power source ( not shown ). the power supply may provide ac power or dc power , at the appropriate voltages and currents , to the various components of an alarm clock . in certain embodiments , the power supply may include a rechargeable , or non - rechargeable , battery , voltage regulator , power control circuitry , power switch , etc ., to provide one or more supply voltages , such as , for example , 9v , 5v , etc . for example , the power supply may operate on 120v ac power only , dc power only , a combination of ac and rechargeable , or non - rechargeable , dc power , etc . the dc power may provide a back - up against power outages . alternatively , by running on dc by being switchable between ac and dc power , the clock may be suitable for use as a travel alarm clock ( in addition to home use , if so - desired ). still further , a subject alarm clock may be adapted to utilize ac power via connection to a standard household electrical outlet , and also utilize a re - chargeable battery which re - charges when connected to the electrical outlet . the alarm clock of fig3 shows various other features that may be included in the subject alarm clocks . shown are time display 11 ( e . g ., lcd or led display ) for displaying the current time , wake - up intensity mode selector 12 , alarm on / off 22 , alarm time set 24 , actual time set 26 , hour set selector 27 , minute set selector 28 . am / pm indicator ( s ) 31 and 32 are also provided . in certain embodiments , the am / pm indicators are “ am ” and “ pm ” lighted letters , e . g ., led or lcd am / pm displays . in sum , the clock may employ a custom or any typical enclosure , power management options and / or display means . of greater interest , the alarm clocks include a wake - up intensity mode selector 12 . wake - up intensity mode selector 12 may be in any suitable form including , but not limited , such a rotatable dial , a sliding scale , an alphanumeric input control ( e . g ., allowing the user to type in a number , letter , or word ), buttons , a manual switch is shown , a touch - panel type lcd , etc . fig4 shows an exemplary embodiment of a dial 12 a that may be used to select a desired intensity mode . dial 12 a is rotatable so that pointer 13 points to the desired intensity mode . it may point to any of the aforementioned modes , including a random mode as shown . intensity mode selector may also be a digital display adapted to display characters or graphics at least corresponding to the available sound intensity modes of the invention and optional random mode . the display may include one or more screens of alarm clock content . fig5 shows an exemplary embodiment of digital display 12 b . in this embodiment , display 12 b also displays the individual sounds that fall within each intensity mode . display 12 b also includes navigation graphics 42 and 43 in the form of arrows that may be utilized for navigating or scrolling of information displayed on display 12 b . display 12 b may be adapted to allow a user to designate an intensity mode displayed on the screen . for example , display 12 b may be provided with a touch screen interface that allows a user to select displayed content . an input device , including , but not limited to , a stylus ( not shown ) may be used to interact with display 12 b . a digital display may additionally be adapted to display a variety of alarm clock information and functions such as , but not limited to , battery indicator , volume indicator , available memory size , etc . in certain embodiments , a display may be adapted for user selection of a variety of alarm parameters . for example , some or all of the wake - up time parameters of a wake - up protocol may be selected from the display , ( e . g ., by way of a touch screen as described above ). fig6 shows display 12 c that includes user selectable features for setting various parameters of a wake - up protocol . in such embodiments , the display may include icons , characters or the like that correspond to the different alarm protocol parameters such as the selection of a first alarm protocol , second alarm protocol . . . n alarm protocol , and the various parameters of that particular alarm protocol such as the day ( s ) of the week , wake - up time , intensity mode , etc . content may be shown on one screen as shown in fig6 or multiple screens navigatable by the user . using a subject alarm clock generally includes , in any order , setting a wake - up time in the alarm clock to activate the wake - up signal when the set time matches a current time , and designating a particular intensity mode . as described above , the intensity mode may be designated from a plurality of intensity modes , including random mode , e . g ., standard mode , soothing mode , severe mode and random mode . an aspect of the invention includes setting at least two different wake - up protocols wherein the designated wake - up intensities of the protocols may differ . for example , such embodiments may include , in any order , setting a first wake - up time in the alarm clock to activate the wake - up signal when the set time matches a current time , and designating a particular intensity mode for the first wake - up protocol ; and setting a second wake - up time in the alarm clock to activate the wake - up signal when the set time matches a current time , and designating a particular intensity mode for the second wake - up protocol . another aspect of the invention includes editing a sound library of an alarm clock , ( e . g ., by adding and / or deleting sounds from the sound library , and assigning the newly added sounds a sound intensity identifier ). the sound library may be edited by any suitable method , e . g ., connection cable , wireless connection ( e . g ., wifi , and the like ), etc . methods may also include connecting an external device such as an mp3 player , computer , stereo , cd player , etc ., to a subject alarm clock ( e . g ., via an input jack or the like ) and listening to audio from the external source using the audio output of the alarm clock . exemplary aspects of the invention , together with details regarding material selection and manufacture have been set forth above . as for other details of the present invention , these may be appreciated in connection with the above - referenced patents and publications as well as generally know or appreciated by those with skill in the art . the same may hold true with respect to method - based aspects of the invention in terms of additional acts as commonly or logically employed . in addition , though the invention has been described in reference to several examples , optionally incorporating various features , the invention is not to be limited to that which is described or indicated as contemplated with respect to each variation of the invention . various changes may be made to the invention described and equivalents ( whether recited herein or not included for the sake of some brevity ) may be substituted without departing from the true spirit and scope of the invention . in addition , where a range of values is provided , it is understood that every intervening value , between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention . also , it is contemplated that any optional feature of the inventive variations described may be set forth and claimed independently , or in combination with any one or more of the features described herein . reference to a singular item , includes the possibility that there are plural of the same items present . more specifically , as used herein and in the appended claims , the singular forms “ a ,” “ an ,” “ said ,” and “ the ” include plural referents unless the specifically stated otherwise . in other words , use of the articles allow for “ at least one ” of the subject item in the description above as well as the claims below . it is further noted that the claims may be drafted to exclude any optional element . as such , this statement is intended to serve as antecedent basis for use of such exclusive terminology as “ solely ,” “ only ” and the like in connection with the recitation of claim elements , or use of a “ negative ” limitation . without the use of such exclusive terminology , the term “ comprising ” in the claims shall allow for the inclusion of any additional element — irrespective of whether a given number of elements are enumerated in the claim , or the addition of a feature could be regarded as transforming the nature of an element set forth n the claims . stated otherwise , except as specifically defined herein , all technical and scientific terms used herein are to be given as broad a commonly understood meaning as possible while maintaining claim validity . the breadth of the present invention is not to be limited to the examples provided and / or the subject specification , but rather only by the scope of the claim language . that being said , we claim :
| 6 |
a hydrodynamic bearing is schematically shown in fig2 as a test bearing in a stage before final assembly and is designated there in its entirety by reference numeral 10 . test bearing 10 includes a shaft seat 12 in which a shaft 14 is rotatably arranged . the shaft 14 extends in a longitudinal direction 16 . at one end of the shaft 14 , a thrust plate 15 is arranged whose outer diameter is larger than the diameter of the shaft 14 . the shaft seat 12 has a first cylindrical seat area 17 in which a section of the shaft 14 is positioned and , together with the corresponding section of the shaft seat 12 , forms a radial bearing . a second cylindrical seat area 19 is located adjacently to the first seat area 17 . thrust plate 15 is positioned within the second cylindrical seat area 19 . on final assembly , the hydrodynamic bearing is provided with a counter plate ( not shown in the drawing ) which encloses the shaft seat 12 at one end . in the embodiment shown in fig2 a cylindrical recess 21 is provided located adjacently to the second seat area 19 of the shaft seat 12 . counter plate can be inserted into the cylindrical recess 21 . a bearing gap 18 , substantially annular in cross - section , is formed between the shaft seat 12 and the shaft 14 , when the shaft 14 is in place . a typical gap width for hydrodynamic bearings , used , for example , for the rotary bearing of small - scale motors for hard disk drives , is about 3 μm , wherein tolerances in the order of ± 0 . 5 μm are permitted . in a completed bearing , a lubricant is located in the bearing gap 18 . due to these tight tolerances , a hydrodynamic bearing can only be classified before final assembly when the shaft 14 is positioned in the shaft seat 12 in its functional position , since the frictional losses within the lubricant in the bearing gap 18 are largely determined by the gap design and in particular the gap width . in accordance with the present invention , in order to verify ( inspect ) and classify hydrodynamic bearings , the test bearing 10 , with the shaft 14 placed in its functional position within the shaft seat 12 , is exposed to a gaseous measuring fluid , such as air , and the through - flow - related parameters of the fluid flowing through the bearing gap 18 of the test bearing 10 are determined . such testing is performed before final assembly of the bearing and , in particular , before the counter plate is mounted and the lubricant is injected into the bearing gap 18 . for this purpose , as shown in fig1 an admission device , designated in its entirety by reference numeral 20 , is provided for admission of a gaseous measuring fluid to the test bearing 10 . in the embodiment illustrated , the admission device includes a pressure reducer 22 , via which a defined start pressure of the gaseous measuring fluid which flows through the bearing gap 18 , can be set . an outlet 24 of the pressure reducer 22 is operatively connected to the bearing gap 18 so that a stream of measuring gas with a defined start pressure , adjusted by means of the pressure reducer 22 , can be fed to the bearing gap . when air is used as the measuring fluid , a typical pressure range for the start pressure is 2 bar to 3 bar . a filter / water separator 26 is positioned before the pressure reducer 22 . the filter / water separator 26 filters out contaminants from the measuring fluid . when air is used as the measuring fluid , water droplets can also be removed by the filter / water separator . therefore , essentially pure , dry air is preferably used as a measuring fluid in measuring the test bearing 10 . using a controllable valve 28 , the admission device 20 can be operatively ( as to fluid flow ) coupled or uncoupled to a source 30 of the measuring fluid . in the embodiment illustrated in fig1 the valve 28 is a lever - operated 2 / 2 valve . in using air as the measuring fluid , the source 30 could , for example , be the surrounding air , whereby an air compressor sucks in the air and makes it available to or feeds it to the admission device 20 . as shown in fig2 the measuring fluid is fed via a feeding device 32 to the bearing gap 18 of the test bearing 10 . for this purpose , the test bearing 10 is open at both ends 34 , 36 of the shaft seat 12 , so that the measuring fluid can flow from one end 34 through the bearing gap 18 to the other end 36 . the feeding device 32 is coupled to the end 34 . the thrust plate 15 is arranged in the region of the other end 36 , without the counter plate being assembled allowing fluid to flow freely through the bearing gap 18 . the feeding device 32 is provided with a hood 38 which can be attached to the end 34 of the test bearing 10 . a seal 42 , for example , in the form of an o - ring seal is positioned between the end face 40 of the hood 38 and the shaft seat 12 . this seal 42 encloses the bearing gap 18 and ensures that the measuring fluid from the feeding device 32 can only discharge through the bearing gap 18 . in particular , the seal 42 is positioned at the end face 40 of the hood 38 so that when the hood 38 is placed against the shaft seat 12 , suitable sealing is ensured . an inlet 44 of the feeding device 32 is operatively ( as to fluid flow ) connected to the outlet 24 of the pressure reducer 22 so that measuring fluid , which has a defined start pressure , can be provided to the feeding device 32 . by measuring one or more parameters which characterize the through - flow of measuring fluid through the bearing gap 18 , the bearing gap 18 itself can be characterized since the narrowest part of the system with through - flow determines the flow parameters . for instance , the hydraulic volume of the bearing gap 18 can be determined . since the overall dimension of the shaft seat 12 in the longitudinal direction 16 of the shaft 14 is known with great precision , a mean hydraulic diameter of the bearing gap 18 can be derived from the hydraulic volume , and the gap width can in turn be determined . it is then easy to establish whether the test bearing 10 conforms to the specified manufacturing tolerances or not . an end - mounted hydrodynamic bearing can thus be classified according to its manufacturing quality . in accordance with the invention , it is possible to determine the quantity of the measuring fluid passing through the bearing gap 18 . in the embodiment illustrated in the figures , provision is made to measure the pressure loss of the measuring fluid due to its through - flow through the gap 18 . for this purpose , the pressure reducer 22 provides a defined start pressure . a pressure sensor 46 of a measuring device 45 , positioned after the pressure reducer 22 and before the test bearing 10 , measures the pressure applied at the feeding device 32 . due to the flow resistance incurred in the through - flow of measuring fluid through the bearing gap 10 , this pressure is reduced in relation to the start pressure of the pressure reducer 22 , whereby , for an embodiment in which the defined start pressure is in the order of magnitude of 2 to 3 bar , the typical pressure difference ( pressure reduction ) is in the order of magnitude between 0 . 7 bar and 1 . 4 bar . the result of the measurement , in other words the pressure difference which characterizes the test bearing 10 , is shown on a display unit 48 . the pressure sensor 46 can be in connection with a control unit which controls the production process of hydrodynamic bearings and , for example , monitors and records the production steps for each individual bearing . thus , for example , the measurement result can be directly used to assign an identification to the measured test bearing 10 and to store this identification which characterizes the measured mean hydraulic diameter of the bearing gap 18 of the test bearing 10 . the pressure sensor 46 includes , for example , a pneumatic / electric piezo transducer by means of which the effective pressure is converted into an electric signal which can then be preferably read on the display unit 48 . a holding device , designated in its entirety by reference numeral 50 , is provided to hold the shaft 14 in the shaft seat 12 in its functional position ( fig3 and 4 ). due to the admission of measuring fluid , a force is exerted on the shaft 14 which has a tendency to move the shaft out of the shaft seat 12 . the holding device 50 is used to hold the shaft 14 in its functional position in the shaft seat 12 . in a first embodiment which is schematically illustrated in fig3 the holding device 50 includes a contact element 52 , which rests against the shaft at its end 36 and thus blocks the shaft 14 from being displaced towards the contact element 52 as soon as the shaft 14 contacts it . here , the contact element 52 is positioned in such a way that between the thrust plate 15 and an annular transverse surface 54 , which bounds the second seat area 19 , an annular gap 56 is formed as part of the bearing gap 18 . the measuring fluid is then diverted transversely in its direction of flow which , in the part of the bearing gap 18 disposed within the first seat area 17 , is essentially parallel to the longitudinal direction 16 , in order to flow into the gap 56 between one end area of the thrust plate 15 facing the end 34 and the second seat area 19 . at the outer end of the gap 56 , the measuring fluid is again diverted in order to flow between an outer side of the thrust plate 15 and the shaft seat 12 towards the end 36 , once again essentially parallel to the longitudinal direction 16 . a second embodiment of a holding device , which is schematically illustrated in fig4 and 5 , is of particular use if the thrust plate 15 is provided with re - circulation holes 58 for lubricant . such re - circulation hole 58 connects the bearing gap 18 with the recess 21 for the counter plate . in accordance with this embodiment , the holding device 50 includes a force exerting device 60 by means of which the shaft 14 can be pressed onto the transverse surface 54 of the second seat area 19 . the force exerting device 60 allows a force to be exerted in the direction opposite to the direction of through - flow of the measuring fluid through the bearing gap 18 . for this purpose , for example , the force exerting device 60 includes an elastic element 62 , such as a compression spring , so that the necessary force action can be provided . after through - flowing through the bearing gap 18 , the measuring fluid flows through the re - circulation holes 58 in the thrust plate 15 . following is the description of the method of measuring and inspecting the bearing gap in accordance with the invention . gaseous measuring fluid such as air is admitted to the bearing gap 18 under a defined start pressure p 0 specified by the pressure reducer 22 . due to the flow resistance during the flow of fluid through the bearing gap 18 , a pressure loss in relation to the start pressure is incurred so that a lower pressure p 1 appears in the feeding device 32 , whereby the magnitude of the pressure difference δp = p 0 − p 1 is characteristic for the mean hydraulic diameter of the bearing gap 18 . thus , by determining the pressure difference δp , the bearing gap 18 of the test bearing 10 can be measured , or the end - mounted hydrodynamic bearing itself can be characterized and classified . the measurement to characterize the test bearing 10 is preferably only taken when quasi - stationary conditions prevail , this means that with a start pressure explicitly specified by the pressure reducer 22 , the measurement is only taken when the pressure sensor 46 shows a stable value within the degree of measurement accuracy . the conditions of fluid admission , that is the start parameters , are preferably selected in such a way that the through - flow of fluid through the bearing gap 18 from one end 34 in the direction towards the other end 36 , does not result in a turbulent flow but rather result in a quasi - stationary , laminar flow . therefore pressure losses are not caused by turbulence . the device in accordance with the invention and the method in accordance with the invention allow a hydrodynamic bearing , even one with very narrow bearing gap widths in the order of magnitude of a few μm , to be characterized easily and quickly . in particular , test bearings in which the shaft 14 is placed in the shaft seat 12 in its functional position can be tested in this way . for the convenience of the reader , the above description has focused on a representative sample of all possible embodiments , a sample that teaches the principles of the invention and conveys the best mode contemplated for carrying it out . the description has not attempted to exhaustively enumerate all possible variations . other undescribed variations or modifications may be possible . for example , where multiple alternative embodiments are described , in many cases it will be possible to combine elements of different embodiments , or to combine elements of the embodiments described here with other modifications or variations that are not expressly described . many of those undescribed variations , modifications and variations are within the literal scope of the following claims , and others are equivalent .
| 5 |
the preferred embodiment of the improved high performance aluminum connecting rod of the present invention will be described in detail , but first the high performance aluminum alloy from which it is manufactured will be described in detail . as mentioned above , this high performance aluminum alloy is a variant of the aluminum alloy taught in alcoa &# 39 ; s u . s . pat . no . 5 , 221 , 377 , which has previously been incorporated herein by reference . prior to the development leading up to the improved high performance aluminum connecting rod of the present invention , this aluminum alloy has not been known to be suitable for the fabrication of connecting rods . the preferred high performance aluminum alloy used to make the improved high performance aluminum connecting rod of the present invention is an alloy available from alcoa as 7055 - t77511 , also referred to as hp007 . this aluminum alloy has been available from alcoa for some time , but never made into extruded bar stock for forging . by working with alcoa , the inventors of the invention described herein obtained 7055 - t77511 aluminum alloy from alcoa in extruded bar stock suitable for forging . the 7055 - t77511 aluminum alloy used to fabricate the improved high performance aluminum connecting rod of the present invention is formulated ( by weight ) as follows : ______________________________________material percentage by weight______________________________________si 0 . 10fe 0 . 15cu 2 . 0 - 2 . 6mn 0 . 05mg 1 . 8 - 2 . 3cr 0 . 04zn 7 . 6 - 8 . 4zr 0 . 08 - 0 . 25ti 0 . 06al balance______________________________________ in accord with the present invention , the 7055 - t77511 aluminum alloy is provided as extruded bar stock which is suitable for forging , and may be either rectangular bar stock or round bar stock . typically , a rectangular bar stock can be used to make a billet rod that is not forged . if rectangular bar stock is used as a blank for the forging operation , it is preferably between 1 . 0 and 2 . 5 inches in thickness , between 2 . 0 and 5 . 0 inches wide , and between 6 . 0 and 15 . 0 inches long . the preferred dimensions for a rectangular bar stock blank are approximately 1 . 5 inches in thickness , approximately 4 . 0 inches wide , and approximately 12 . 5 inches long . such a rectangular bar stock blank 20 is illustrated in fig1 . generally , the length should fill the die , but not be so long as to present the possibility of breaking the die . if round bar stock is used as a blank for the forging operation , it is preferably between 1 . 5 and 2 . 5 inches in diameter , and between 11 . 5 and 14 . 5 inches long . the preferred dimensions for a round bar stock blank are approximately 2 . 0 inches in diameter , and approximately 12 . 5 inches long . such a round bar stock blank 22 is illustrated in fig2 . the single most critical portion of the manufacture of the improved high performance aluminum connecting rod of the present invention is the forging operation , which in large part determines the characteristics of the complete connecting rod . the temperature that the rectangular bar stock blank 20 or the round bar stock blank 22 is heated to for the forging operation is critical . in the development of the improved high performance aluminum connecting rod of the present invention , a substantial amount of testing was required in order to establish the temperature range which would produce a product with acceptable material characteristics , since the 7055 - t77511 high performance aluminum alloy had never been supplied as extruded forging stock , far less been used to manufacture connecting rods . in the experimental work on prototype forgings , machining revealed cracks in the vicinity of the bearing housing bore . in fact , approximately 20 - 25 percent of the prototype connecting rods were found to be cracked near the bearing housing bore . the experimental work which was performed included chemistry comparisons , mechanical property comparisons , and extrusion parameter comparisons of the 7055 - t77511 high performance aluminum alloy ; met allographic examinations and ultrasonic examinations of the bar stock ; failure analyses of the connecting rods , which included ultrasonic examination of the connecting rods , macro etching of the connecting rods to examine material flow during forging , and met allographic examination of the connecting rods ; and forging trials to duplicate failures and identify the causes therefor , including jogging samples , and forging temperature trials . the results of this experimental work reduced the possible causes one by one . the chemical composition of three different lots was nearly identical . the mechanical properties of the three different lots were substantially similar . the actual extrusion parameters for the three different lots were also substantially similar . the met allographic examinations of the bar stock revealed no material discontinuities . similarly , the ultrasonic examination of the bar stock revealed no material discontinuities . macro etching of the connecting rods found no differences in material flow when comparing good connecting rods to failed connecting rods . met allographic examination of failed connecting rods revealed internal voids . jogging samples during forging trials did not duplicate the failure mode . finally , the cause of the failure was determined to be caused by a totally unexpected cause , namely forge slug temperatures above 800 ° fahrenheit . whenever the forge slug was heated to temperatures of approximately 800 ° fahrenheit or above , internal voids resulted . the voids were quite small at approximately 800 ° fahrenheit , and became progressively larger at higher temperatures . thus , 800 ° fahrenheit was identified as the slug temperature at the top of the range of temperatures which could produce acceptable forgings . the lowest slug temperature which could be used was identified as 500 ° fahrenheit . the optimum slug temperature was identified to be approximately 775 ° fahrenheit . extruded bar stock is preferred but rectangular bar stock can be used . a blocker die used to rough out the rectangular bar stock blank 20 is illustrated in fig3 . blocker die halves 30 and 32 are shown with the rectangular bar stock blank 20 located therebetween . the forging operation is illustrated in fig3 with the rectangular bar stock blank 20 heated to the forging temperature , which in the preferred embodiment is approximately 775 ° fahrenheit . the heated rectangular bar stock blank 20 is the forging slug . the blocker die half 30 is hit , forcing it toward the blocker die half 32 , forming the heated rectangular bar stock blank 20 into a rough forging 34 ( which is illustrated in fig4 ). in the preferred embodiment , the forging slug is struck only once in the blocker die . a finisher die used to finish the rough forging 34 is illustrated in fig4 . finisher die halves 36 and 38 are shown with the rough forging 34 located therebetween . the finishing forging operation illustrated in fig4 is performed immediately after the rough forging operation illustrated in fig3 . the finisher die half 36 is hit , forcing it toward the finisher die half 38 , forming the rough forging 34 into a finished forging 40 ( which is illustrated in fig5 ). in the preferred embodiment , the rough forging 34 is truck in the finisher die , die cleaned , and hit again . a trim die used to trim the flashing ( indicated generally by the reference numeral 42 ) from the finished forging 40 is illustrated in fig5 . trim die halves 44 and 46 are shown with the finished forging 40 located therebetween . the trimming operation illustrated in fig5 is performed after cooling to room temperature after the finishing forging operation illustrated in fig4 . the trim die half 44 is hit , forcing it toward the trim die half 46 , trimming the flashing 42 from the finished forging 40 and completing the forging operation . in the preferred embodiment , the finished forging 40 need be struck only once in the trim die . the connecting rod forging is then heat treated , following which it is etched . at this point , the connecting rod forging is then penetrant inspected and ultrasonically tested in order to detect any latent defects . the connecting rod forging is then ball burnished , which completes the portion of the manufacturing process prior to machining . the various machining steps required to complete the manufacture of the improved high performance aluminum connecting rod 50 will be described with reference to the remaining figures , which show the improved high performance aluminum connecting rod 50 in its completed form . referring first to fig6 and 7 , the improved high performance aluminum connecting rod 50 is illustrated with its pin end on the right and its crank end at the left . a wrist pin bore 52 is illustrated in the pin end of the improved high performance aluminum connecting rod 50 , and a bearing housing bore 54 is illustrated in the crank end of the improved high performance aluminum connecting rod 50 . the improved high performance aluminum connecting rod 50 is split to form a cap 56 and a fork 58 of the improved high performance aluminum connecting rod 50 . ( as mentioned above , the cap 56 and the balance of the improved high performance aluminum connecting rod 50 may alternatively be forged as two separate segments .) as best illustrated in fig6 the split between the cap 56 and the fork 58 is defined by a plane which can be orthogonal or at any angle to the longitudinal axis of the improved high performance aluminum connecting rod 50 ( the axis extending between the pin end and the crank end of the improved high performance aluminum connecting rod 50 ), which plane divides the bearing housing bore 54 at the crank end of the improved high performance aluminum connecting rod 50 in half . the portion of the improved high performance aluminum connecting rod 50 located between the fork 58 and the rod end of the improved high performance aluminum connecting rod 50 forms the rod beam 60 of the improved high performance aluminum connecting rod 50 . as mentioned above , there are three methods which may be used to remove the cap 56 from the fork 58 of the improved high performance aluminum connecting rod 50 , all of which are conventional in the art . these methods include sawing the cap 56 from the fork 58 of the improved high performance aluminum connecting rod 50 , using a laser to divide the cap 56 from the fork 58 of the improved high performance aluminum connecting rod 50 , and fracturing the cap 56 from the fork 58 of the improved high performance aluminum connecting rod 50 . while the first two methods are self - explanatory , examples of fracturing the cap 56 from the fork 58 of the improved high performance aluminum connecting rod 50 are provided in u . s . pat . no . 5 , 105 , 538 , to hoag et al ., u . s . pat . no . 5 , 507 , 093 , to wittenstein et al ., and u . s . pat . no . 5 , 655 , 296 , to ravenhorst et al . u . s . pat . no . 5 , 105 , 538 , u . s . pat . no . 5 , 507 , 093 , and u . s . pat . no . 5 , 655 , 296 are each hereby incorporated herein by reference . following the separation of the cap 56 from the fork 58 of the improved high performance aluminum connecting rod 50 , a radius approximately 0 . 005 larger than the finished radius of the bearing housing bore 54 is machined into both the cap 56 and the fork 58 . referring particularly to fig8 in addition to fig6 , and 9 , in the preferred embodiment of the present invention , the adjoining faces of the cap 56 and the fork 58 of the improved high performance aluminum connecting rod 50 are machined into mutually engaging serrated surfaces 62 and 64 , respectively . referring now to fig6 , 9 , and particularly 10 and 11 , two holes 66 and 68 are drilled into the cap 56 . the holes 66 and 68 are located in the cap 56 on opposite sides of the bearing housing bore 54 , and are parallel to the axis of the improved high performance aluminum connecting rod 50 ( which extends between the rod end and the crank end of the improved high performance aluminum connecting rod 50 ). referring particularly to fig1 , two smaller holes 70 and 72 are drilled into the fork 58 of the improved high performance aluminum connecting rod 50 . the holes 70 and 72 are located in the fork 58 on opposite sides of the bearing housing bore 54 , and are coaxial with the holes 66 and 68 in the cap 56 . the holes 70 and 72 in the fork 58 of the improved high performance aluminum connecting rod 50 are threaded . next , the cap 56 is assembled onto the fork 58 of the improved high performance aluminum connecting rod 50 using two rod bolts 74 and 76 , which are , by way of example , 7 / 16 - 20 unfj class 3a bolts with a rockwell of 51c to 52c , rated at 272 ksi . the rod bolts 74 and 76 are preferably lubricated with s . a . e . 30 weight motor oil , and are torqued to the proper degree , preferably approximately 85 ft . lbs . four keyways , ( bearing tang grooves ) two of which are referred to by the reference numerals 78 and 80 , are machined into the cap 56 and the fork 58 in the bearing housing bore 54 at the location of the split between the cap 56 and the fork 58 , as best illustrated in fig9 . the other two keyways which are not illustrated herein are located on the opposite side of the bearing housing bore 54 from the keyways 78 and 80 . also machined into the bearing housing bore 54 in the cap 56 is a bearing pin lock aperture 82 , which is illustrated in fig9 . an oil passage 84 , which is also illustrated in fig9 is machined into the wrist pin bore 52 . following the assembly of the cap 56 to the fork 58 of the improved high performance aluminum connecting rod 50 using the rod bolts 74 and 76 , the bearing housing bore 54 is then rough bored , finish bored , and honed to the proper size . on the pin end of the improved high performance aluminum connecting rod 50 , the wrist pin bore 52 is bored and honed to the proper size . this completes the manufacture of the improved high performance aluminum connecting rod 50 of the present invention . it may therefore be appreciated from the above detailed description of the preferred embodiment of the present invention that it teaches an improved high performance aluminum connecting rod made of an improved material capable of withstanding the high compressive loads of current drag racing engine technology . the material used by the improved high performance aluminum connecting rod of the present invention has lightweight construction which is comparable to presently known high performance aluminum materials such as 7075 - t6 , while possessing substantially enhanced compression yield strength characteristics as compared to such presently known materials . in addition , this improved material also retains or enhances all of the other favorable material characteristics of such presently known materials . the improved high performance aluminum connecting rod of the present invention is readily susceptible of manufacture by conventional forging techniques , with the forged part being readily machinable to the required finished dimensions . the high performance characteristics of the aluminum material used to make the improved high performance aluminum connecting rod of the present invention are not adversely affected in either the forging or machining operations . most importantly , the improved high performance aluminum connecting rod of the present invention has sufficiently improved compression yield strength so as to hold both its dimensional length and the dimensional roundness of the wrist pin bore and the bearing housing bore . the improved high performance aluminum connecting rod of the present invention is of a construction which is both durable and long lasting , and which will remain within dimensional specifications throughout an extended operating lifetime . the improved high performance aluminum connecting rod of the present invention is also of relatively inexpensive construction to enhance its market appeal and to thereby afford it the broadest possible market . finally , all of the aforesaid advantages and objectives of the improved high performance aluminum connecting rod of the present invention are achieved without incurring any substantial relative disadvantage . although an exemplary embodiment of the improved high performance aluminum connecting rod of the present invention has been shown and described with reference to particular embodiments and applications thereof , it will be apparent to those having ordinary skill in the art that a number of changes , modifications , or alterations to the invention as described herein may be made , none of which depart from the spirit or scope of the present invention . all such changes , modifications , and alterations should therefore be seen as being within the scope of the present invention .
| 8 |
an embodiment of information output unit according to the invention is shown in fig2 a and 2b in perspective view and in top view respectively . designated by 11 is a light source comprising a plurality of semiconductor laser groups 11a , 11b , 11c , . . . which are driven independently of each other and united together to form a single chip element . information from the output means of a driving system 14 is put into these semiconductor lasers in the order of 11a , 11b , 11c , . . . so that they are lighted up successively . light emitted from each of the semiconductor lasers 11a , 11b , 11c , . . . is collimated through a collimator lens 12 . when they emerge from the collimator lens 12 , the lights from the different semiconductor lasers have different exit angles with respect to each other . beam diameter and angle magnification of light emitted from the collimator lens are converted by an afocal converter 13 into those which are most suitable for the system then used . fig3 a and 3b illustrate the beam entering and emerging from the afocal converter 13 . generally , incident beam diameter hi , exit beam diameter h o , incident angle θi and exit angle θ o have the following relation : ## equ1 ## this value of r is called &# 34 ; angle magnification &# 34 ;. for very small values of θ o and θi or for a system particularly designed for this purpose , the following approximation holds : ## equ2 ## by suitably selecting the value of r in view of the system used , there can be obtained a scanning system as hereinafter described . returning again to fig2 b , the light which emerges from the afocal converter 13 is deflected by a deflector 15 ( shifting means ) which may be , for example , a galvano mirror or a polygon mirror , and is then imaged on a recording surface 17 through an imaging lens 16 . here , the light source 11a , 11b , 11c and the associated beam of light travelling up to the recording surface 17 constitute an information recording means . the imaging lens 16 is of the type known as an f - θ lens wherein the incident angle and the imaging position are in a linear relation . the unidimensional deflection of the beam by means of the deflector 15 and the unidirectional ( in the direction of arrow 17a in fig2 a ) feeding of the recording surface 17 by means of feeding means 17b enable the recording of a picture image two - dimensionally . to carry out the two - dimensional recording , the recording surface 17 may be advanced stepwise in the direction of arrow 17a after every linear area of a picture corresponding to one scanning line has been recorded on the surface 17 in the direction perpendicular to the arrow 17a , that is , in the direction across the surface 17 as a result of deflection by the deflector 15 . alternatively , the recording surface 17 may be formed as a cylindrical surface as that of a recording drum 26 shown in fig1 . to carry out two - dimensional a recording with such recording drum which is rotated by feeding means 17b , deflection by the deflector 15 is effected in such a manner that for every one revolution of feeding means 17b there may take place a deflection by l elements corresponding to the amount of shift which occurs for every clock pulse as will be described in detail later . let f 1 denote the focal length of the collimator lens 12 and d the center distance between every two light surfaces of m semi - conductor lasers . then , since usually d & lt ; f 1 , one beam of light emerging from the collimator lens 12 and the next beam of light are different in exit angle from each other by the amount of ## equ3 ## for the beam of light after passing through the afocal converter 13 the angle manification of which is r , the following equation is given : ## equ4 ## assuming that the deflector 15 such as a galvano mirror be still in its position , every spot formed by images of the neighbouring semiconductor laser light sources through the imaging lens 16 will be spaced from one another owing to the f - θ characteristics of the imaging lens , by the amount of : ## equ5 ## wherein f 2 is the focal length of the imaging lens . let ω denote the angular velocity of deflection of the beam of light by the deflection system . then each spot will be moved by the following distance during time . increment . t : here , assuming that there is a clock pulse one cycle of which is δt , it is defined that δs stands for the size of one picture element when the distance moved by every spot for time δt is δs . in addition , it is assumed that the distance δd between spots on the recording surface be a whole number (≡ n , n is a whole number ) times larger than . increment . s , namely it is assumed this assumption may be realized by suitably setting the clock pulse interval δt or the angle magnification r of the afocal converter 13 . in this manner , when information of one line of a picture is introduced in the unit in time series there is obtained a regularity with respect to the distribution of signals to m semiconductor laser light sources , the sequence of lighting of light sources , the time intervals of illumination etc . therefore , as a whole , the speed of recording may be increased m times by distributing the picture information among m number of light sources and / or making full use of vacant time provided that each light source should be operated with the same duty as that for the conventional case . now , the general rule of regularity of lighting according to the invention and the usability of the invention will be described in detail showing simple concrete examples thereof . for the purpose of explanation , the following definitions are given : the number of semiconductor laser light sources is m , the spacing between two neighbouring spots is δd , the size of pel ( picture element ) c is δs , the ratio of the spot spacing to the size of pel is n element ( s ) ## equ6 ## the amount of shift for every one clock pulse ( of which explanation will be made later ) is l element ( s ) and the number of light sources to be lighted at the same time is θ . under the above given definitions , there may be considered the following cases : this is the case wherein the pitch of spot spacing on a recording or displaying surface using five semiconductor lasers is equal to the size of one pel δs . these five light sources ( more correctly images thereof ) are shifted rightward stepwise by one pel for every clock pulse and at the same time they light up one by one in a sequence as shown in fig4 a - 4c in which coordinate of space ( r ) is taken on the abscissa and coordinate of time ( t ) on the ordinate and in which a black dot stands for semiconductor laser which is energized at that time . for the purpose of explanation , these five semiconductor lasers are numbered as 1 , 2 , 3 , 4 and 5 from left to right on the drawing . it will be understood that all the picture elements can be recorded or displayed without any dropping and without any over - lapping of elements only when the five semiconductor lasers , 1 , 2 , 3 , 4 and 5 are energized to light up in the following sequence ( lighting sequence ): cases wherein all the picture elements can be recorded without any dropping and without any overlapping are limited only to the above three cases . on fig4 a , 4b and 4c ( also on fig7 , 11 and 13 ), s is an enlarged scanning line . black dots standing for light sources in the state of on are also shown on the scanning line s in the corresponding portions for assisting in understanding of the lighting sequence . an example of an electric circuit adapted for realizing the above described sequence of lighting of light sources is shown in fig5 . one line of information to be recorded or displayed is put into the circuit in time series and the circuit distributes the information to the semiconductor laser elements and determines the sequence of lighting thereof . the electric circuit shown in fig5 is designed for realizing the lighting sequence illustrated in fig4 a , that is , the case wherein five semiconductor laser elements are energized to light up in the order of 1 - 2 - 3 - 4 - 5 . the circuit receives information of serial picture elements in an amount of one line of the picture at its input ( b ). the information received by the circuit corresponds to that designated by 0 or 1 in fig6 b . this information is delivered to 5 - bit shift register 18 in time series and in synchronism with a clock pulse ( fig6 a ) introduced into the circuit from the input ( a ). each information corresponding to each picture element is shifted successively with every clock pulse and is processed as a serial data in the order of 1a , 2a , 3a , 4a , 5a , 1b , 2b , 3b , 4b , 5b , 1c - - - in time series . outputs a , b , c , d and e of the 5 - bit shift register 13 put out data of picture elements as shown in fig6 c , 6d , 6e , 6f and 6g respectively . in a similar manner , from output k , l and m of modulo - 5 counter 19 there are put out the outputs of wave forms of fig6 h , 6i and 6j respectively . furthermore , signals of outputs n , o , p , q and r of bcd decimal decoder 20 are introduced into inverters 21a - 21e which then put out the wave forms of fig6 k , 6l , 6m , 6n and 6o respectively . outputs a , b , c , d , e from the 5 - bit shift register 18 and outputs from inverters 21a - 21e are combined together respectively and their logical products are obtained at and - gates 22a - 22e . thus , in accordance of the lighting sequence of 1 - 2 - 3 - 4 - 5 , information of each picture element can be put out continuously into the output line group 22 - 1 through 22 - 5 in the sequence of 1a - 3a - 5a - 2b - 4b - - - ( which are driving signals of the output part formed by rearranging the original time series sequence .). in the same manner and by changing the wiring sequence of the 5 - bit shift register 18 , the lighting sequence of fig4 b and that of fig4 c can be easily realized ( for 4b there is formed 1a - 5a - 4a - 3b - 2b - - - and for 4c formed 1a - 4a - 2b - 5a - 3b - - - in the same manner as described for 4a ). the following is the case wherein the pitch of spot spacing on a recording or displaying surface is two times larger than the size of pel δs . in this case , as seen from fig7 a - 7c , possible lighting sequences in which all of the picture elements can be covered without any overlapping are limited to only three cases given below : by way of example , the lighting sequence of fig7 a is considered . in order to energize the five semiconductor lasers in the sequence of 1 - 2 - 3 - 4 - 5 , it is necessary to put information out as time series pel signals in the sequence of 1a - 4a - 2b - 5b - 3c - - - ( similarly , for 7b 1a - 3b - 5a - 2c - 4b - - - and for 7c 1a - 5b - 4b - 3b - 2b - - -). fig8 shows an electric circuit used for realizing this lighting sequence . the circuit shown in fig8 is essentially the same as that shown in fig5 except that 5 - bit shift register 18 is replaced by a 10 - bit shift register 18a . the lighting sequences of fig7 b and 7c can be realized in a similar manner . in the above described cases ( i ) and ( ii ), only one light source is energized to light on at one time ( θ = 1 ). but , there may be considered other cases wherein two or more light sources are lighted up at the same time as mentioned hereinafter . this is the case wherein two light sources are energized at the same time as shown in fig9 and image of each light source is shifted by two picture elements with every clock pulse . since a shift of two picture elements is done for every clock pulse and two light sources are energized at the same time , the speed of recording is doubled without any change of load on the light sources . in order to advance the image of each light source by two picture elements with every clock pulse , a circuit as shown in fig1 which includes a 4 - bit shift register 18b , binary counter 19 etc . may be used . the frequency of clock pulses used in the circuit is doubled so that the light image is advanced by one picture element with every one clock and the light source is energized to light up with every two clocks . lighting sequence necessary for this case is illustrated in fig1 . the lighting sequence may be realized by a circuit including four gates and a decimal counter ( not shown ). ( v ) generalization with n = n and by a general formula ( m , n , l , θ ); as a general case , it is considered that on a recording surface there are arranged regularly m light sources with a pitch of spacing n times larger than the size of a picture element and that the light sources are driven in such a manner that with every one clock pulse they are shifted by l picture element ( s ) and θ of the light sources is ( or are ) energized to light up at the same time for every one clock pulse . conditions necessary for recording all of the picture elements without any dropping and without any overlapping are : ( b ) m / θ is a natural number , ( m / θ , i ) are prime to each other wherein i is a natural number satisfying the condition i ≦ m / θ and for this natural number i ( mn / θ , ni + l ) are prime to each other . when such natural numbers ( m , n , l , θ , i ) satisfying the above conditions are found out , m light sources should be energized to light up in the following sequence : 1 , m / θ + 1 , 2m / θ + 1 - - - ( but , km / θ + 1 & lt ; m wherein k is a natural number ) light up at first and then light up the above conditions will be understood more clearly from the following description . assuming that the image of each light source is shifted by l picture elements with every one clock pulse and θ pieces of pel information are issued for every one clock pulse , the number of pel information issued after c pulses will become θc . during the time , the image of light source has moved a distance of lc . if l & gt ; θ , then lc & gt ; θc , which means that there occurred some vacancy . therefore , the condition l = θ is absolutely necessary . secondly , the condition necessary for recording all of the picture elements without any overlapping is considered . among m light sources there must be energized θ light source ( s ) to light up at the same time . therefore , these light sources can be devided into θ groups . the number of light sources per group is m / θ which must be a natural number . lighting of the light sources must be made successively and without overlapping in the sequence of the first one , i + 1 th one , 2i + 1 th one , - - - ni + 1 - - -, until all of m / θ light sources have lighted up . in order to satisfy the condition , i and m / θ must be prime to each other . namely , it is only when i and m / θ are prime to each other that using m / θ as a divisor the sum of 1 and i can be distributed to m / θ without any overlapping . fig1 shows the lighting sequence for the case wherein m light sources are regularly arranged with a pitch of n . the total length of light source corresponds to m n picture elements . therefore , the number of picture elements covered by one single group is m n / θ . it is required to avoid overlapping among all of the picture elements contained in this area . the distance moved by each light source within one group with every one clock is ni + l in picture element unit . lighting of light source is advanced in the sequence of 1 , i + 1 , 2i + 1 , - - - ni + 1 . if the sequence number of lighting exceeded the number of light sources contained in one group , that is , the number m / θ , then it must be considered that lighting of light source went along into the next group because of the above described condition that ( m / θ , i ) are prime to each other . thus , in order to cover all the picture elements without overlapping , it is required that no overlapping exists among multiples of ni + l using mn / θ as a divisor . therefore , the condition that in the combination ( mn / θ , ni + l ), the two numbers mn / θ and ni + l should be prime to each other , is absolutely necessary . like the condition of ( m / θ , i ), the above condition of ( mn / θ , ni + l ) can be demonstrated as follows : numerical values produced by multiples of ni + l with mn / θ as a divisor are generally represented by : in the above equation , values which γ may to be are : here , it should be noted that ( mn / θ - 1 ) is the possible maximum value which γ may take . assume that ni + l and mn / θ were not prime to each other , and let p denote a common factor . then , ## equ7 ## here , values which the residue γ is allowed to be are : ## equ8 ## note should be taken to the fact that the possible maximum value which the residue γ can take is only ## equ9 ## which is smaller than mn / θ . therefore , under this assumption it is impossible to cover all of mn / θ . now , it is concluded that mn / θ and ni + l should be prime to each other . since l = θ = 1 and m / θ = 5 , i = 1 , 2 , 3 , 4 . ## equ10 ## the condition that mn / θ and ni + l should be prime to each other can be satisfied only when i = 1 , 2 , 3 . this corresponds to the above mentioned case ( i ) wherein m = 5 , n = 1 , l = 1 and θ = 1 . in this case , ## equ11 ## therefore , the necessary condition is satisfied only when i = 1 , 3 , 4 . this corresponds to the above mentioned case ( ii ) wherein m = 5 , n = 2 , l = 1 and θ = 1 . in this case , m / θ = 1 , ∴ i = 1 only , ( mn / θ , ni + l )=( 3 , 5 ), which are prime to each other and therefore satisfy the necessary condition . the sequence of lighting is the simultaneous lighting of 1 and 2 . this corresponds to the above mentioned case ( iii ) wherein m = 2 , n = 3 , l = 2 , θ = 2 . ## equ12 ## which are prime to each other . the lighting sequence becomes ( 1 , 3 )-( 2 , 4 ). this corresponds to the above mentioned case ( iv ) wherein m = 4 , n = 3 , l = 2 and θ = 2 . ## equ13 ## the necessary condition is satisified only when i = 2 , 3 , 4 . fig1 a through d illustrate this example in which ( m , n , l , θ )=( 10 , 3 , 2 , 2 ), fig1 a being for i = 1 , fig1 b for i = 2 , fig1 c for i = 3 and fig1 d for i = 4 . from these figures it is seen that when i = 1 there occur evidently some overlaps ( see mark . in fig1 a ) and that there is no overlap when i = 2 , 3 , 4 . in fig1 b - 13d , the portions extending rightward from α can be used for scanning , respectively . the information output unit according to the invention are applicable not only to scanning in a principal scanning direction ( constant direction ) but also to scanning in a secondary direction ( in the direction across the principal direction ). therefore , a further speed - up is attainable by doing so . for example , as shown in fig1 , light sources 11d - 11i may be arranged two - dimensionally . arrow 23a indicates the principal scanning direction and arrow 24a indicates the secondary scanning direction . when the light sources are lightened up one by one or two or more at the same time in the principal direction and all of the light sources are together driven in the secondary scanning direction in timing with the lighting of light sources in the principal direction , then scanning speed may be increase to an extent corresponding to the number of light sources . as to the example of fig1 , when ( m , n , l , θ )=( 3 , 2 , 1 , 1 ) and i = 2 , only ( mn / θ , ni + l )=( 3 , 5 ) becomes effective in the principal scanning direction and the light sources become light in the sequence of 1 , 3 , 2 - - -. in the secondary scanning direction , when ( m , n , l , θ )=( 2 , 3 , 2 , 2 ) and i = 1 , ( mn / θ , ni + l )=( 3 , 4 ) - - - become prime to each other . therefore , recording may be carried out in such manner that information shifted by three lines in the secondary direction is recorded by principal scanning at first , the light sources are advanced by two lines in the secondary direction after recording one line and then again scanning is carried out in the principal direction . by employing this mode of recording , it is allowed to use and arrange such light sources the size of which is larger than the pitch of picture element . moreover , the information output unit according to the invention is applicable to all types of apparatus in which recording is effected with scanning . thus , for a recording method using light , information recording means may be formed by combining plurality of light sources driven independently of each other . for a thermal recording method , a combination of thermal head and heating wire may be used as information recording means according to the invention . for a recording method using electric current , a combination of stylus electrode and electric current path may be used as information recording means . also , for a recording method using a spray of liquid droplets , the inject head and droplets may be combined to form information recording means according to the invention . while scanning these information means with suitable shifting means which may be deflection of light , mechanical feeding etc ., picture elements can be recorded on a recording medium according to the invention previously described in detail . fig1 illustrates one example of application form of the invention . designated by 25 is a stylus electrode which is driven in the principal scanning direction indicated by arrow 23b at a uniform speed using a suitable driving means such as linear motor . during the stylus electrodes 25 being driven in the principal scanning direction , a rotary recording drum 26 is rotated by a motor 26 in the secondary scanning direction of arrow 24a nearly perpendicular to the principal scanning direction so as to effect recording . regular arrangement of semiconductor laser , l e d or other light sources in rows may be done very easily employing conventional techniques . assuming that when one single light source is used , it takes t seconds for recording , the time necessary for recording will be reduced to t / m seconds by arranging m light sources driven independently of each other with a constant spacing in the scanning direction according to the invention . this remarkable speed - up is attainable without adding load on the light sources , that is , without changing the above mentioned duty of operation . one particular advantage of the information output unit according to the invention is found in that it is also applicable to such case where the distance between the neighbouring light source images on the recording surface is relatively large as compared with the pitch of picture elements . owing to this advantage , the arrangement of plurality of light sources ( or electrodes ) becomes easy and accuracy can be improved . furthermore , it has an advantageous effect on dissipation of heat generated from the used light sources , crosstalk of electric charge or the like . while the invention has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and details can be made therein without departing from the spirit and scope of the invention .
| 6 |
fig1 shows an overview of how an illustrative modular personal network ( mpn ) may be used . the mpn is associated with a user 1 . the mpn may include multiple individual network components ( incs ), each of which may have one or more primary functions . each inc may include a wireless transceiver for communicating with other incs in the mpn . the wireless network may be associated with user 1 , for example , within a few meters of the user . each inc may be worn or carried by user 1 , or otherwise in the user &# 39 ; s immediate vicinity . for example , inc 2 , which may be worn on the user &# 39 ; s waist , may be a control unit that includes a processor and memory , to store and run software to control other incs in the mpn . inc 3 , which may be worn on the user &# 39 ; s hand or wrist , may be a display device . if desired , a variety of mountings may be provided to allow the display to be seen optimally in variety of circumstances , such as mounting on the side of the hand or wrist . if desired , a reusable mount may allow a display or other inc to be easily repositioned , reoriented , and replaced . inc 4 , which may be a headset or may be worn in a headband or hat , may be an audio output device . one or more speakers may be worn in the ear , or may be worn against the skin near the ear . the audio output device may support output of tones , music , or voice . audio cues of various types may be generated . if desired , the audio output device may provide multiple types of audio output . one output may be paused or muted while the other is provided . incs 5 , 7 , and 7 may be user input devices . any suitable type of user input may be provided , such as voice input , buttons , a portable keyboard , or a stylus . as shown , pressure sensors are worn in the fingertips of a glove , and are operated by tapping with the fingers . different commands may be indicated by tapping with different fingers or in different sequences . if desired , such pressure sensors may be worn on the hand , at the waist , on the foot , or in any other suitable manner . inc 8 may provide another function for the user , such as an input function , an output function , a storage function , or a control function . as many or as few incs may be included in the mpn as desired . if desired , one or more incs may be removed from the mpn to remove functions , and one or more incs , such as inc 9 , may be added to add other functions . the changed configuration may be determined dynamically or the changes may be indicated by the user . second user 10 may have a second mpn . for example , second user 10 may be riding a bicycle . inc 11 may be mounted on the handlebars of the bicycle and may include display functions , user input functions , and control unit functions . inc 12 may be an audio output device , mounted on second user 10 &# 39 ; s helmet . inc 13 may be a sensor mounted on the bicycle to measure its speed . when second user 10 comes into range of first user 1 &# 39 ; s mpn , there is no interference . each inc in either mpn is programmed with a network identifier that is common to all incs in the mpn but unique among different mpns . each message sent from one inc in an mpn to another inc in the same mpn may be tagged with the common network identifier or with a unique component identifier of the target inc , so that no unintended incs process the message . in addition , the network identifier may be stored in secure memory in each inc , so that the inc cannot be used in a different mpn without explicit authorization from the user who programmed the network identifier . the mpn may interface with a more stationary device , such as base station 15 or personal computer 16 . base station 15 may act as part of the mpn when the mpn is within range . base station 15 may include a wireless communication device to communicate with one or more of the incs in the mpn . alternatively , base station 15 may communicate with one of the incs using another means , such as a serial cable , usb , a docking station , infrared , or other connection . personal computer 16 may communicate with base station 15 . alternatively , personal computer 16 may communicate directly with one or more incs , acting as a base station . personal computer 16 or base station 15 may download software , data , settings , and other information to one or more incs . for example , software may be downloaded to control one or more incs , or to implement one or more features . as unanticipated incs are added to the mpn , new software modules may be downloaded to control and interface with them , and an application on personal computer 16 may be used to configure settings related to the new incs . personal computer 16 and base station 15 may be used to program the common network identifier into each inc in the mpn . data may be uploaded from one or more incs to personal computer 16 to be stored , displayed , or analyzed . if desired , personal computer 16 may communicate with another computer 18 over a wide area network 17 , such as the internet . software , data , settings , and other information may be sent from computer 18 to personal computer 16 for use with the mpn , and data from the mpn may be sent from personal computer 16 to computer 18 . an mpn may be used for one or more purposes . for example , the mpn may support a global turn on or turn off feature , in which all active devices may be disabled or re - enabled with a single command to a single inc . the mpn may provide clock functions 20 , such as providing the current time and date , supporting multiple time zones , providing stopwatch features , and synchronizing other features of the mpn . the mpn may provide communication functions 25 , such as communicating with another mpn to support games , competitions , and other types of data transfers , telephone features , paging features , instant messaging , and electronic mail . the mpn may provide entertainment functions 30 , such as playing music , recording audio and video media , and games . the mpn may provide personal organization functions 35 , such as scheduling appointments , managing contacts , tracking tasks , and maintaining a mobile electronic journal . the mpn may support guidance functions 40 , such as showing current position , speed , and elevation , providing route guidance , collecting and annotating position and speed data , and recommending an athletic training route . the mpn may support athletic functions 45 , such as supporting a workout plan , supporting workout definition , controlling a workout , communicating with exercise equipment , collecting athletic data , detecting and correcting errors in collected data , estimating secondary data based on collected data , providing competition between users of multiple mpns , logging lap swim workouts , providing form feedback , and providing an athletic training journal . the mpn may support physical therapy and medical functions 50 , such as measuring range of motion , gait analysis , measuring muscle strength , measuring changes in physical therapy , monitoring a metabolic value , detecting a medical problem , controlling a treatment device , providing emergency communication , storing medical databases , providing an electronic medical journal , and supporting incs that may be injected , ingested , or implanted . the mpn may provide disabled access 55 , such as alternate input devices , alternate output devices , and alternate inc mounting means . the mpn may support travel functions 60 , such as language translation , currency conversion , time zone conversion , route guidance , local information , guidebook features , wildlife recognition , a mobile electronic travel journal , weather information , local transit and entertainment schedules , and expense tracking the mpn may support outdoor functions 65 , such as compass direction , geographical location , route guidance , elevation reporting , and weather features . the mpn may support identity functions 70 , such as identifying a user to another user or another system , providing exchange of money , providing product discounts , and providing product purchasing . the mpn may support personal security functions 75 , such as an audible alert , an alert message to a public safety facility , and storage of emergency information . the mpn may support military functions 80 , such as communications , geographical position , route guidance , and weather features . the mpn may support combinations of functions , and its functions may vary over time as incs are added or removed , as different software or data is downloaded , or as the user &# 39 ; s needs change . fig1 a shows a block diagram of illustrative mpn 100 a . this mpn includes incs 110 a , 110 b , 110 c , and 110 / d . each inc includes communication device 120 , for communicating with other incs over wireless communication path 140 . communication device 120 may be , for example , a standard radio frequency wireless transceiver with a range appropriate for a personal network ( e . g ., between six feet and sixty feet ). communication device 120 may also include hardware and software implementing a standard wireless protocol , such as bluetooth or ieee 802 . 15 . an antenna may be included . if desired , transmitter and receiver may be separate devices . not shown in each inc is a power source . each inc also includes one or more other functions 130 - 137 . these other functions may be provided by hardware and / or software incorporated into the inc . the software may be firmware provided with the inc , or it may be downloaded into the inc over communication path 140 or using other means . fig1 b shows how mpn 100 a may be modified to become mpn 100 b . in the modified mpn , inc 110 c has been removed , and inc 110 e has been added . correspondingly , other function 135 associated with inc 110 c is no longer available , and other functions 138 and 139 associated with inc 110 e are now available . different manufacturers may manufacture incs . each manufacturer may be assigned a unique manufacturer identifier , as shown in table 210 of fig2 a . each manufacturer may provide various types of incs , each of which may be assigned a model identifier by the manufacturer , as shown in table 220 of fig2 b . the model identifier may be unique for a specific manufacturer . there may also be defined a set of device types , as shown in table 230 of fig2 c . the device type identifiers may be standard across all manufacturers and models . for example , model 3 by manufacturer 2 may have the same device type as model 7 by manufacturer 12 . device types may be divided into a range for input devices 234 and a range for output devices 232 . it may also have ranges 236 and 238 for manufacturers to use when a standard device type has not yet been assigned . an inc may have multiple device types , if it has multiple functions 130 - 139 ( fig1 ). for each device type , there may be a standard set of defined capabilities , which may or may not be supported by any specific inc with that device type . for example , as shown in table 240 of fig2 d , device type 257 , which may be an audio output inc , may have three standard capabilities , any of which may or may not be supported by any particular audio output inc . capability 242 may be the ability to output stereo audio . capability 244 may be the ability to control the output volume of the audio . capability 246 may specify the number of volume increments supported by a particular inc . these capabilities are merely illustrative . the manufacturer identifier , model identifier , one or more device types , and any supported device capabilities and values may be stored in read - only memory in the inc , and provided over communication path 140 ( fig1 ), to allow the inc to be identified by another inc . fig3 a through 3j illustrate an exemplary communications protocol that may be used between incs in an mpn . the protocol may include a defined set of messages that may be sent from one inc to another . this message protocol may be encapsulated in one or more lower - level protocols , such as bluetooth or ieee 801 . 15 . if desired , this protocol may function on different lower - level protocols in different environments . as shown in fig3 a , each message may include message type 301 and error detection / correction fields 302 . message type 301 may indicate to the receiving inc how to process the message . error detection / correction may include parity , checksums , cyclic redundance checks ( crcs ), or other mechanisms for detecting that a received message has one or more errors , and possibly correcting the error ( s ). identity request message 300 of fig3 a may be sent by an inc ( such as a control unit or base station ) wishing to determine the identity and characteristics of one or more other incs in the mpn . for example , this message may be broadcast and all other incs in the mpn may respond . identity request message 300 may include a unique network identifier 303 common to all incs in the mpn . it may include a network address 304 of the inc sending the request . each inc in the mpn may have a network address that is unique among all incs in the mpn . identity request message 300 may also include controller identifier 305 . this may be an identifier that is unique across all incs , and it may correspond to the control unit , base station , or other inc that is sending the message . component identity message 310 of fig3 b may be sent by an inc in response to identity request message 300 . it may include network identifier 311 of the inc sending the message . network identifier 311 may be the same as the network identifier 303 in the requesting message , if both incs are part of the same mpn . it may be blank if this inc has not yet been assigned to an mpn . it may be different if this inc belongs to a different mpn . if this inc has been assigned to an mpn , component identity message 310 may also include network address 312 . component identity message 310 may also include information about the type of inc and its capabilities that may be stored in read - only memory in the inc . for example , the message may include component identifier 313 , which may be the identifier for this inc that is unique across all incs . the message may also include manufacturer identifier 314 , model identifier 315 , one or more device types 316 , and capability list 317 . net address assignment message 320 of fig3 c may be sent by a control unit , base station , or other inc to configure a newly detected inc to function within the mpn . it may include controller identifier 305 . it may include the new network identifier 321 and network address 322 to be programmed into the inc . it may include component identifier 313 to ensure that the correct inc processes the message . it may also include security code 323 to ensure that unauthorized personnel do not change the network identifier and network address . on processing net address assignment message 320 , the inc may respond with network acknowledgement message 330 of fig3 d . this message may repeat component identifier 313 , network identifier 321 , and network address 322 , to inform the controller that the operation was successful . alternatively , the message may include a field indicating success or failure of the operation , and the reason for failure if it was not successful . output data request message 340 of fig3 e may be sent to an inc that is capable of outputting . it may include the network identifier 321 and network address 322 of the inc that is to perform the output function . the message may include request serial number 341 . this number may be used by the requesting inc and the outputting inc to keep track of multiple pending requests . output data request message 340 may include device type 316 and capability type 317 to inform an inc that supports multiple output functions how to process the data . output data request message 340 may also include the data to output 342 . the format of this data may depend on the type of inc receiving the data and how it is to be processed . after processing output data request message 340 , the output inc may respond with output acknowledgement message 350 of fig3 f . this message may include network identifier 321 , network address 322 , and request serial number 341 to allow the controller to determine which request this acknowledgement corresponds to . it may also include acknowledgement code 351 , which may indicate whether the request was processed correctly , and if not successful may include a reason for the failure . input data request message 360 of fig3 g may be sent to an inc that is capable of inputting . it may include the network identifier 321 and network address 322 of the inc that is to perform the input function . the message may include request serial number 361 . this number may be used by the requesting inc and the inputting inc to keep track of multiple pending requests . input data request message 360 may include device type 316 and capability type 317 to inform an inc that supports multiple input functions how to process the data . after processing input data request message 360 , the input inc may respond with input acknowledgement message 370 of fig3 h . this message may include network identifier 321 , network address 322 , and request serial number 361 to allow the controller to determine which request this acknowledgement corresponds to . it may include acknowledgement code 371 , which may indicate whether the request was processed correctly , and if not successful may include a reason for the failure . it may also include the requested data 372 , formatted as appropriate for the device and data type . an inc may also send unsolicited data message 380 of fig3 . this message may be sent when the inc has acquired some data for which there may be an ongoing request , or when the inc has entered a state , such as an error condition , that needs to be reported to a control unit , base station , or other inc . this message may include the network identifier 321 and network address 322 of the inc . it may include device type 316 and capability type 317 to allow the receiving inc to know how to process the data . it may also include data 381 , formatted as appropriate for the device type and capability type . a control unit , base station , or other inc may periodically send out network poll message 390 of fig3 j . this message is sent to determine whether an inc is still present on the mpn . it may include network identifier 321 and network address 322 of the inc being polled . the polled inc may respond with component identity message 310 or other suitable message . the message types shown in fig3 a through 3j are merely illustrative . other types of messages may be defined and sent between incs in the mpn . for example , a command may be sent to turn on an inc or to turn off an inc . if desired , a command may be broadcast to all incs in an mpn , rather than addressed to a specific inc . table 400 of fig4 shows an illustrative data structure that may be maintained by a control unit , base station , or other inc to track incs on the mpn . if desired , multiple incs in the mpn may maintain such information . column 410 may hold the network address of each inc . column 420 may hold the component identifier of each inc . column 430 may hold the manufacturer identifier of the inc . column 440 may hold the model identifier of the inc . column 450 may hold the device type of each inc . multiple device types may be stored for a single inc if desired . column 460 may hold a list of capability types for each device type listed for each inc . column 460 may also hold specific values related to each capability type . column 470 may hold a flag indicating whether the inc is currently active . for example , if an inc has not recently responded to a network poll message 390 ( fig3 j ), flag 470 may be changed to indicate that the inc is no longer active . if an inc responds to an identity request message 300 ( fig3 a ), the inc may be added to table 400 if it is not already present , and flag 470 may be set indicating that the inc is active . table 400 is merely illustrative . other columns may be included . other data structures may be used . if desired , this information may be stored in multiple data structures . fig5 shows flow chart 500 of an illustrative process for providing an mpn . all steps are optional and may be performed in any suitable order . in step 510 , multiple incs may be provided . this may include substep 514 of providing wireless communications with each inc . it may also include substep 512 of providing at least one primary function for each inc . the primary function may correspond to other function 130 - 139 ( fig1 a and 1b ). if desired , an inc may include multiple primary functions . alternatively , an inc may include a primary function , a secondary function , etc . in step 520 , incs may be changed dynamically . this may include substep 522 in which an inc may be removed . it may also include substep 524 in which a new inc may be added . in step 530 , the change may be detected automatically , for example using messages 300 through 390 of the communications protocol of fig3 a through 3j . the system may alternatively allow a user to enter information about the change in step 535 . for example , a user may add or remove an entry for an inc from a configuration screen on a personal computer . in step 540 , the functions of the mpn may be adjusted to compensate for the change . in substep 542 , this may include removing a function from the mpn that may have been provided ( or partly provided ) by the removed inc . in substep 544 , this may also include adding a function to the mpn that may be at least partly supported by the new inc . fig6 a shows illustrative mpn 600 showing how software may be downloaded to control incs . mpn 600 may interface with personal computer 610 to control downloading and configuration functions . personal computer 610 may include control application 620 , which may be configured to control downloading to an mpn and configuring various aspects of mpn functions . control application 620 may support plug - ins for different types of incs . for example , plug - in a 622 may support downloading code to support inc a 650 . plug - in a 622 may support loading driver a 626 , for example from local storage such as a compact disk or over the internet , as well as downloading driver a 626 . it may also support configuring inc a 650 , as well as downloading data to and uploading data from inc a 650 . personal computer 610 may include communications device 612 for communicating with one of the incs , such as a control unit 630 , using communication path 670 . control unit 630 may include communications device 632 for communicating with personal computer 610 . communications device 612 , communications device 632 , and communication path 670 may be , for example : a docking station and connector ; a universal serial bus ( usb ) port ; infrared transmitters and receivers ; serial ports ; ethernet connectors ; radio frequency ( rf ) transceivers ; or any other suitable communications means . if desired , communications may be performed wirelessly , and communications device 632 may be the same as wireless communications device 636 used to communicate between control unit 630 and other incs . one of the incs may be a control unit 630 . control unit 630 may include processor 634 and memory 638 , as well as communications device 632 for communicating with personal computer 610 , and wireless communications device 636 for communicating with other incs over wireless communication path 675 . memory 638 may hold control software 640 which may include firmware , operating system , boot software , communication software , and the like . memory 638 may also hold downloaded driver a 626 for controlling inc a 650 . mpn 600 may also include inc a 650 . this component may include wireless communications device 652 for communicating with control unit 630 and other incs over wireless communication path 675 . inc a 650 may also include device hardware and firmware 654 for performing one or more primary functions of the inc . in operation , a user may run control application 620 on personal computer 610 . the user may load and run plug - in a 622 to configure mpn 600 to function with inc 650 . the user may load driver a 626 and download it to control unit 630 . control unit 630 may subsequently use downloaded driver a 626 to control the functions of inc a 650 . the user may also use plug - in a 622 to configure aspects of inc a 650 , to download data to the inc , to upload data that may have been collected by the inc , or to perform other functions related to inc a 650 . in fig6 b , inc b 660 has been added to mpn , creating new mpn configuration 605 . inc b 660 may include wireless communications device 662 for communicating with control unit 630 and other incs over wireless communication path 675 . it may also include device hardware and firmware 664 for performing one or more primary functions associated with inc b 660 . plug - in b 624 may be loaded into control application 620 on personal computer 610 , for controlling aspects of inc b 660 . driver b 628 may be loaded into personal computer 610 and downloaded into control unit 630 for subsequently controlling inc b 660 . although fig6 a and 6b show drivers being downloaded into a control unit , software may alternatively be downloaded into any of the incs , for example , if control unit 630 is not present . fig7 shows illustrative screen 700 of mpn 600 ( fig6 a ) that may be displayed by control application 620 and plug - in a 622 on personal computer 610 . menu bar 710 may allow the user to access various application functions , such as file functions , security functions , device functions , system functions , help functions , and the like . item 720 may display information about the inc , such as the name of the manufacturer , the model number , capabilities , and other suitable information . item 730 may display the version number of the device plug - in currently loaded on personal computer 610 . button 735 may allow the user to download the selected driver to control unit 630 or other inc . button 737 may allow the user to load a more recent driver from the internet . region 740 may allow the user to set various configuration parameters associated with the inc . for example , region 742 may allow the user to enter text for a first parameter . selection 745 may allow the user to select from a set of options for a second parameter . this screen is purely illustrative and may be configured and designed in any suitable manner . fig8 shows flow chart 800 of an illustrative process to allow an unanticipated inc to be added to the mpn . for example , after a user has several incs of an mpn , a new inc with a new capability may be manufactured . the user does not need to discard any existing incs ; they can continue to be used just as they have been . the unanticipated inc can be added to the mpn and the capabilities of the mpn will be expanded to encompass the capabilities of the new inc . all steps are optional and may be performed in any suitable order . in step 810 , the unanticipated inc may be added to the mpn . the system may detect the inc using an identity request message 300 ( fig3 a ). in step 820 , a software application may be run , for example on a personal computer , which controls downloading software objects to incs . in step 830 , that application may be used to download the specific software object to control the unanticipated inc . in step 840 , software may be downloaded to control the unanticipated inc . the software may be downloaded , for example , to a control unit . alternatively , the software may be downloaded to the unanticipated inc itself . in substep 842 , multiple software objects may be downloaded , one of which may control the unanticipated inc . other software objects may be used to control other incs , or to perform other mpn functions . in step 850 , a software extension , such as a plug - in , may be provided to the software application . in step 860 , the user may be allowed to configure the new inc and the downloaded software object , using the software application and the software extension . flow chart 900 of fig9 shows an illustrative process for downloading data to control an inc . all steps are optional and may be performed in any suitable order . in step 910 , software may be downloaded . in step 912 , data may be downloaded . in step 914 , setup options may be downloaded . in step 916 , the current time may be downloaded . if desired , other suitable types of data may be downloaded as well . in step 920 , data may be downloaded over a network , such as the internet . for example , software or other data may be downloaded from an internet site into a personal computer . in step 922 , data may be downloaded from a computer , such as a personal computer . in step 924 , data may be downloaded from a base station . a base station may be a stationary device that communicates with one or more incs . the base station may be independent , or it may be connected to a personal computer . in step 930 , the data may be downloaded into the inc to be controlled . in step 932 , the data may be downloaded into a control unit . the control unit may be an inc configured with a processor and memory to control aspects of other incs in the mpn . the control unit may send information or commands to the inc in step 934 . in step 940 , the downloaded data may be used to modify one or more functions of the inc . software and other data may also be downloaded , for example into a control unit , to coordinate the functions of multiple incs . fig1 shows how two mpns 1000 and 1050 may interact . first mpn 1000 may include audio output inc 1010 , display inc 1012 , control unit 1014 , and accelerometer 1016 . second mpn 1050 may include display 1060 , heart rate sensor 1062 , and control unit 1064 . any of the incs of either mpn may send a message intended for one or more incs of the same mpn . the incs of the other mpn may need to ignore the message . for example , control unit 1014 may send data to display 1012 to be displayed . display 1060 will ignore the message , because it did not originate within second mpn 1050 . similarly , heart rate monitor 1062 may send heart rate data to control unit 1064 for processing . control unit 1014 will ignore the data , as it did not originate within first mpn 1000 . the configuration of these two mpns is merely illustrative , and all incs are optional . fig1 shows illustrative partial mpn 1100 , illustrating how an inc 1130 may be programmed with a common network identifier using a base station 1110 . base station 1110 may be a personal computer , a card installed in a personal computer , a docking station connected to a personal computer over a connection such as usb , a standalone device , or any other suitable configuration . base station 1110 may include memory 1120 , which may be random access memory , a hard disk , or other suitable memory . base station 1110 may also include communications device 1112 , which may be a wireless communications device similar to the communications device in each of the other incs , or may be any other wired or wireless connection . memory 1120 may be used to hold a common network identifier to be used within all incs of a single mpn . it may also be used to hold information about the various incs that have been configured using base station 1110 . inc 1130 may be a new inc , which has not yet been assigned a network identifier . alternatively , it may already have been assigned a network identifier , which may be stored in secure memory 1140 . secure memory 1140 may be memory that can only be read or written by inc 1130 , and cannot be accessed without a security code . a user of base station 1110 may indicate that inc 1130 is to be programmed with the base station &# 39 ; s network identifier . the user may make this indication by , for example , bringing inc 1130 into proximity of base station 1110 , making a physical connection between base station 1110 and inc 1130 , pressing a button on base station 1110 , making a menu selection on base station 1110 ( for example , if base station 1110 is a personal computer or is connected to a personal computer ), or by taking other suitable actions . the user may also be required to enter a personal code , or to invoke other security measures to ensure his or her proper identity . base station 1110 may then send a message to inc 1130 with the new common network identifier and the proper security code . if inc 1130 is a new inc , it may store the security code and the network identifier in secure memory 1140 . if it has previously been programmed with a network identifier , it may compare its stored security code with the security code it just received , and if they match may store the new network identifier . if desired , inc 1130 may also incorporate an algorithm to prevent a large number of consecutive attempts at changing the network identifier . for example , if inc 1130 receives more than three unsuccessful attempts to change the network identifier within a ten - minute period , it may lock out any further attempts for the next thirty minutes . using this configuration a user may assign any new inc into his or her mpn . a user may also move an inc from one mpn to another , but only with the authorization of the original owner of the inc . fig1 shows illustrative screen 1200 that may be shown by base station 1110 ( fig1 ) or personal computer to allow an inc 1130 to be personalized with the user &# 39 ; s network identifier . the user may be allowed to enter a security code in screen region 1210 . when the security code has been verified , and the security code and network identifier have been successfully sent to the inc 1130 , the system may display overlay 1220 . fig1 shows illustrative screen 1300 that may be shown by base station 1110 ( fig1 ) or personal computer to allow inc 1130 to be programmed with a different network identifier when it already has a network identifier stored in secure memory 1140 . the user may be prompted for a security code in screen region 1310 , as well as the old security code used to program inc 1130 with the previous network identifier in region 1320 . when the security codes have been verified , and the security code and network identifier have been successfully sent to the inc 1130 , the system may display overlay 1330 . these screens are purely illustrative and may be configured and designed in any suitable manner . fig1 shows flow chart 1400 of an illustrative process to use a common network identifier among incs in an mpn . all steps are optional and may be performed in any suitable order . in step 1410 , each inc may be programmed with a common network identifier . this may be done with a base station , personal computer , or other device . the programming may use appropriate security to ensure that an unauthorized user cannot reprogram the network identifier in any inc . in step 1420 , any messages sent from a first inc in the mpn to a second inc in the same mpn may contain the network identifier stored within the first inc . the second inc , on receiving the message , may compare the network identifier within the message to the network identifier stored in the secure memory in the second inc . if the two identifiers are different , the message may be ignored . if the two identifiers are the same , the second inc may assume that the message originated from an inc within the same mpn , and may process the message if appropriate . in step 1430 , an inc may be moved from one mpn to another . this may involve changing the network identifier stored in the inc to a new value . to do this may require explicit authorization from a user , in substep 1432 . it may also require the entry of a password or code or another security measure to ensure that the user is authorized to make the change , in substep 1434 . fig1 shows extended mpn 1500 . this block diagram shows how an mpn may interface with other systems . mpn 1500 may include control unit 1510 . the use of control unit 1510 is merely illustrative . any other suitable inc may be used . control unit 1510 may include wireless communications device 1512 for communicating over wireless communications paths 1546 and 1547 with other incs within the mpn . control unit 1510 may also include one or more other functions 1514 , which may include a processor and memory for controlling other incs in the mpn . mpn 1500 may also include incs 1520 and 1530 . these incs may include wireless communications devices 1522 and 1532 , respectively . each may include one or more other functions 1524 and 1534 , respectively . control unit 1510 , and other incs , may communicate over communication path 1545 with base station 1540 . as shown , communications path 1545 may be a wireless communications path . alternatively , base station 1540 may communication with one or more incs using any suitable wired path . base station 1540 may include communications device 1542 for communicating with control unit 1510 and other incs , and a second communications device 1544 for communicating over communication path 1555 with personal computer 1550 . if desired , communications device 1542 and communications device 1544 may be the same device . communications device 1544 may communicate with communications device 1556 on personal computer 1550 using any suitable physical and logical protocol . this may include a serial port , usb , infrared , radio frequency , a docking station , or other means . in addition to communications device 1556 , personal computer 1550 may have display 1552 , keyboard 1553 , mouse , printer 1554 , and modem 1551 . modem 1551 may be any suitable type of connection to a wide area network , and may include a telephone modem , a digital subscriber line modem , a cable modem , an ethernet hub , and ethernet router , or other suitable equipment . personal computer 1550 may connect using path 1565 to wide area communications network 1560 , which may be the internet . personal computer 1550 may be configured to send or receive information from another computer using wide area network 1560 . fig1 shows flow chart 1600 of an illustrative process for uploading information from an inc . all steps are optional and may be performed in any suitable order . in step 1610 , information may be reported by an inc . that information may have been collected by the inc , for example using a sensor within the inc . alternatively , the information may have been generated by the inc . in step 1615 , the information may be received by a control unit , which may be another inc within the same mpn . the information may be sent from the control unit , or any other suitable inc , to a base station in step 1620 , and to a personal computer in step 1622 . if desired , any of the control unit , base station , and personal computer may be omitted , or their functions may be combined in any suitable manner . if desired , the collected information may be sent over a communications network , such as the internet , in step 1624 , and received by another computer . in step 1630 , the information may be stored , for example by the base station , the personal computer , or by another computer accessed over the communications network . the information may be displayed for a user . the information may be analyzed , in step 1632 . in step 1640 , the uploaded information may be used , at least in part , to create information to download . this derived information may be downloaded to the same inc that originated the uploaded data , to the control unit , or to another inc in the mpn . refer to the description of fig9 above for steps related to downloading of data . fig1 shows a more detailed block diagram 1700 of a portion of mpn 1500 of fig1 . base station 1540 , control unit 1510 , and inc 1520 are shown . it can be seen that control unit 1510 includes processor 1742 and memory 1744 . inc 1720 , which is an audio output inc , is also shown . audio output inc 1720 includes wireless communications device 1722 for communicating over wireless communication path 1730 with control unit 1510 and other incs . audio output inc 1720 also includes digital - to - analog converter 1724 , for converting digital audio data to an analog audio signal , and speaker 1726 for playing the analog audio signal audibly . the incs shown are merely illustrative . fig1 shows flow chart 1800 of illustrative process for using an inc that is a control unit in an mpn . all steps are optional and may be performed in any suitable order . in step 1810 , the control unit may be configured to be worn . it may be attached , for example , to a waistband , a wristband , an armband , or other worn in another suitable location . if desired , the control unit may alternatively be carried , mounted on personal equipment , or otherwise associated with the user . information may be downloaded to the control unit , for example from a base station or personal computer . in step 1820 , software may be downloaded to the control unit . in step 1822 , data may be downloaded to the control unit . in step 1824 , configuration parameters may be downloaded to the control unit . in step 1826 , the date and / or time may be downloaded to the control unit . in step 1830 , data may be sent from the control unit to another inc within the mpn . for example , any of the data sent to the control unit in steps 1820 , 1822 , 1824 , or 1826 may be sent to another inc . the control unit may also send information to another inc that is derived from downloaded data , from data collected from other incs , or other suitable data . in step 1832 , the control unit may control a function of another inc . the control unit may accomplish this by sending one or more messages to the other inc , and possibly by receiving messages in response . the control may be based on downloaded software , downloaded data , downloaded parameters , time , or any derived data . in step 1834 , the control unit may collect data from another inc . the control unit may request the data by sending a message to the other inc . alternatively , the other inc may send the data unsolicited . the data may be a single item , or it may consist of several samples collected over a period of time . the control unit may process the data , combine data samples , combine data from multiple incs , or otherwise modify the collected data . in step 1850 , data may be uploaded from the control unit , for example to a base station or personal computer . this may included collected data , derived data , or data generated by the control unit . in step 1860 , functions of the control unit may be integrated with other functions . for example , the control unit may also have a display or a user input device . the control unit may also include clock functions , in step 1840 , and it may track time to coordinate functions of the mpn , to schedule actions , and to tag collected data . the control unit may treat the other integrated functions as though they were in another inc , without the need to send and receive wireless messages to communicate with them . in step 1870 , the control unit may support multiple other incs with multiple functions . some may be input incs , some may be output incs , and some may be a combination . some incs may be wholly contained without external input or output , such as a storage inc or a data processing inc . the control unit may maintain a table of active incs , and communicate with the other incs as required . the control unit may automatically detect when an inc is added to the mpn or removed from the mpn . when an inc is added to the mpn , the control unit may ignore it until it receives downloaded software or data related to the new inc . alternatively , it may automatically make use of the capabilities of the new inc . when a inc is removed from the mpn , the control unit may wait for a period of time to make sure that communications with the inc were not temporarily lost . the control unit may continue functioning with reduced functions . in addition or alternatively it may generate an alert to the user . if desired , an mpn need not include a control unit . some or all of the functions of a control unit may be incorporated into one or more of the other incs . if desired , each inc may provide its own control . if desired , software , data , configuration settings , and other information may be downloaded directly into some or all of the incs by a base station or personal computer prior to mobile use . fig1 shows flow chart 1900 of an illustrative process for providing personal incs in an mpn . all steps are optional and may be performed in any suitable order . in step 1910 , the user may wear an inc . for example , in substep 1912 , the user may wear an inc on a hand , wrist , arm , leg , foot , waist , head , or other suitable part of the body . the inc may be worn on an article of clothing in substep 1914 , such as a glove , a partial glove , a wristband , an armband , a hat , a headband , a shirt , a waistband , a shoe , or other suitable item of clothing . in step 1920 , the inc may be mounted on personal equipment that may be used by the user . for example , in substep 1922 , the inc may be mounted on a bicycle , a car , a piece of exercise equipment , or other suitable personal equipment . the inc may provide an input or output function associated with the personal equipment . in step 1930 , the mpn may also include a relatively stationary inc , such as a base station or personal computer . the base station or personal computer may function as part of the mpn while the user is in proximity to the device . the communications connection with the stationary device may be the same wireless network used to communicate between the incs , or it may be another type of connection . the other type of communication may be a docking station or other fixed method , usb or other wired method , or infrared or other wireless method . the stationary device may only support communications with one of the mobile incs , such as a control unit , or it may support communications with several or substantially all of the incs . fig2 a through 20c show several illustrative methods for mounting incs . for example , fig2 a shows some options for allowing a user 2005 to wear incs . inc 2012 , which may be an audio output inc , may be mounted on headband 2010 . inc 2022 , which may be a display , may be mounted on wristband 2020 . inc 2032 , which may be a user control , may be mounted on glove 2030 . inc 2042 , which may be a control unit , may be mounted on waistband 2040 . inc 2052 , which may be an accelerometer , may be mounted on shoe 2050 . these incs and options for wearing are merely illustrative . other options may be used if desired . the user 2005 may decide what functions will be provided simply by choosing to wear a specific set of incs at any given time . fig2 b shows some options for mounting incs on a piece of exercise equipment 2070 . for example , inc 2074 may be an input sensor to read data associated with the exercise equipment , or may be an output inc to control aspects of the exercise equipment . inc 2072 may be a display inc , or may be configured to communicate with a processor embedded within the exercise equipment . these incs may function as part of the mpn when the user is on or near the device . fig2 c shows options for mounting incs on a bicycle 2060 . for example , inc 2062 may be a display inc . inc 2064 may be a sensor for measuring pedaling cadence . inc 2066 may be a sensor for measuring wheel speed . these incs may function as part of the mpn when the user is on or near the bicycle . the options shown in fig2 a through 20c are merely illustrative . other types of incs , other types of mounting , and other types of personal equipment may be supported if desired . fig2 shows flow chart 2100 of an illustrative process for using an inc mounted on a piece of exercise equipment . all steps are optional and may be performed in any suitable order . in step 2110 , the inc may be mounted on a piece of exercise equipment . in substep 2112 , the inc may be mounted on a bicycle . the inc may function as part of the user &# 39 ; s mpn when the user is near or on the exercise equipment . in step 2120 , control commands may be sent to the inc mounted on the exercise equipment . the inc may control the function of the exercise equipment directly , or it may send a command to the exercise equipment , for example using a serial port or radio frequency transmitter . as shown in substep 2122 , the command may be to control the difficulty of the exercise , such as by changing a resistance setting , a speed setting , a slope setting , or the like . the control command may also be to a display inc or other user output inc mounted on the exercise equipment . in step 2130 , data may be collected from the inc . the inc may measure the collected data directly , or it may retrieve the data from the exercise equipment , for example using a serial port or radio frequency receiver . the data may be , for example , pedal speed of a bicycle in substep 2132 or wheel speed of a bicycle in substep 2134 . in substep 2136 , other performance information may be collected from the exercise equipment , such as speed , power , or heart rate . the data may be collected , for example , using a sensor attached to the exercise equipment or bicycle , or by communicating with a processor embedded in the exercise equipment . the collected data may be stored , it may be displayed , and it may be used to modify a workout . if desired , the collected data may be uploaded to a base station or personal computer , where it may be stored , displayed , or analyzed . an inc may function as a display inc . a display inc may be worn or carried by the user or mounted on a piece of personal equipment . a display inc may be combined with other functions , such as user controls , audio output , or a control unit , or the inc may function solely as a display inc . a single display inc may be used to display different types of information at different times , depending on the other incs in the mpn . the display inc may not need to be changed to provide new types of information display . rather this may be accomplished by adding a new inc with a new function , downloading new software into the display inc or a control unit , or otherwise modifying other parts of the mpn . in addition , the user may switch to a different style of display inc without changing any other part of the mpn , and maintain all preexisting mpn settings and functions . the display inc may include a wireless communications device for communicating with other incs in the mpn . for example , the display inc may receive display commands and data from one of the other incs , such as a control unit . the display inc may incorporate any appropriate display technology , such as liquid crystal displays ( lcds ), light emitting diodes ( leds ), etc . it may also include means for mounting the inc to the user &# 39 ; s body . if desired , a display inc may accept different types of input for display , such as text , bit - map or other graphics , video data , instructions to turn on or off specific visual indicators , instructions to turn on or off various display modes , or other suitable display items and instructions . in a mounting similar to a wristwatch , a display inc 2215 may be mounted on the back of a wrist 2210 , using wristband 2220 , as shown in fig2 a . fig2 b shows a variation , in which display inc 2235 is mounted on the side of wrist 2230 , using wristband 2240 . in another variation shown in fig2 c , display inc 2255 may be mounted on the back of hand 2250 using partial glove 2260 . in these examples , the display incs are shown to display time . however , any suitable information appropriate to the functions provided by the incs of the mpn may be shown on the display inc . fig2 a through 23f show how a display inc may be worn on the side of a hand , and may be configured with various orientations . for example , in fig2 a through 23c , the display inc may be configured to be oriented toward the back of the hand , toward the fingertips , or at an angle between them , respectively . in these figs ., the display is shown on the left hand . alternatively , the display may be configured to be worn on the right hand , as shown in fig2 d through 23f . different users with different needs may desire displays worn on opposite hands , in different positions on the hand or wrist , and at different orientations . some , for example , may wish to wear the display in the traditional wristwatch position and orientation on the back of the wrist . others , for example athletes , may desire a display that can be quickly viewed on the side of the hand without having to twist the arm . the preferred orientation may depend on the user &# 39 ; s activity . a display may be provided in which the user may configure the position and / or orientation . for example , a user may wish to switch the display between the left wrist / hand and the right wrist / hand . a user may also be allowed to change the orientation of the display . for example , if the display is implemented using a dot - matrix liquid crystal display ( lcd ), the software within the mpn may support multiple orientations . a display may also be provided with multiple mounts — e . g ., wristbands , partial gloves , and the like . fig2 a shows flow chart 2400 of an illustrative process for providing a display as an inc in an mpn . all steps are optional and may be performed in any suitable order . in step 2410 , a display may be provided as an inc . the inc may include a wireless communications device for communicating with other incs in the mpn . if desired , the display may be combined with one or more other functions into a single inc , sharing a single wireless communications device . in step 2415 , the display inc may be configured to be worn , for example on a wristband , partial glove , or the like . in step 2420 , the display inc may be configured to be mounted on an item of personal equipment . that may include , for example , a car in substep 2424 , a bicycle in substep 2422 , or a piece of exercise equipment in substep 2426 . in step 2430 , the user may be allowed to change the mounting of the display inc . for example , multiple mounts may be provided so that the display inc may be moved from one part of the body to another , or from the wrist to a piece of exercise equipment . fig2 b shows a flow chart with illustrative expanded detailed of step 2415 , in which the display inc may be worn by the user . all steps are optional and may be performed in any suitable order . in step 2460 , the display may be configured to be worn on a hand or wrist . for example , a wristband or partial glove may be provided . if desired , the display may be worn on other parts of the body instead of the hand or wrist . in step 2465 , the display may be configured to be worn on the side of the hand or wrist , allowing the display to be viewed more easily , for example by an athlete . in step 2470 , the display and mount may be configured to allow the display to be worn on either the left or right hand or wrist . in step 2480 , the display may be oriented in a direction desirable to the user . for example , in substep 2482 , the display may be oriented toward the fingertips . in substep 2484 , the display may be oriented toward the back of the hand or wrist . in substep 2486 , the display may be oriented at an angle between those two options . in step 2490 , the orientation of the display may be configurable by a user , allowing the user to select from one or more orientation options . fig2 shows illustrative flow chart 2500 of an illustrative process for providing a reusable wearable mount that may be used with various incs , such as a display inc . this method may allow the user to use different mounts or displays to match clothing , to use displays with different functions , and to quickly and easily change the position and orientation of the display . all steps are optional and may be performed in any suitable order . in step 2510 , a reusable mount may be provided that may be worn on the user &# 39 ; s body . in step 2515 , the mount may be provided as part of an article of clothing , such as a glove , partial glove , wristband , waistband , shirt , or any other suitable article of clothing . in step 2520 , the mount may use a hook and loop type of fastener . if desired , any other suitable type of fastener may be used on the article of clothing . in step 2525 , the mount may be made directly to the user &# 39 ; s skin . for example , a non - toxic adhesive may be used on the back of the inc to be mounted . in step 2530 , a plurality of mounts may be provided . for example , in substep 2532 , mounts may be manufactured in different styles or colors . in substep 2534 , mounts may be manufactured to be worn on different parts of the body . a user may choose one of the mounts based on style , whim , convenience , function , or for any other reason . in step 2540 , the mount may be used with an inc . the user may temporarily attach the inc to the mount . if desired , the mount may also be configured to allow devices that are not incs to be attached . in step 2545 , the inc attached to the mount may be a display inc . the display inc may be used to display current time and other information that may be provided by the mpn . in step 2550 , the user may be allowed to reposition the inc on the mount . for example , the user may be allowed to change the placement and orientation of a display inc to make it more convenient to read the displayed information . in step 2560 , the user may be allowed to mount various incs onto a single mount . the incs may be manufactured with different shapes , materials , colors , styles , functions , or otherwise may be of different value to a user at different times . fig2 a through 26c show various examples of reconfigurable wearable mounts that may be provided . fig2 a shows a wristband with a buckle . fig2 b shows a partial glove . fig2 c shows a stretchable band that may be looped around the hand and over the thumb . each of these mounts may be manufactured with an area of hook and loop fasteners , where the mount includes , for example , the hook portion , and the loop portion is on the back of the inc to be mounted . fig2 a through 27d show various display incs that may be used with the mounts of fig2 a through 26c . these displays may have different shapes , different materials , different functions ( for example showing either time or heart rate ), or may otherwise differ . each of the incs may provide the means to fasten to the mount , for example the loop portion of a hook and loop fastener . an inc may function as an audio output inc . an audio output inc may be worn or carried by the user or mounted on a piece of personal equipment . the audio output inc may be combined with other functions , such as user controls , display , or a control unit , or the inc may function solely as an audio output inc . a single audio output inc may be used to output different types of information at different times , depending on the other incs in the mpn . the audio output inc may not need to be changed to provide new types of information output . rather this may be accomplished by adding a new inc with a new function , downloading new software into the audio output inc or a control unit , or otherwise modifying other parts of the mpn . in addition , the user may switch to a different style of audio output inc without changing any other part of the mpn , and maintain all preexisting mpn functions . the audio output inc may include a wireless communications device for communicating with other incs in the mpn . for example , the audio output inc may receive digital audio data from one of the other incs , such as a control unit . the audio output inc may include a digital - to - analog converter ( dac ) for converting the digital audio data to an analog audio signal . alternatively , the audio output inc may receive an analog audio signal from another inc . it may include one or more amplifiers and one or more speakers . it may also include means for mounting the inc to the user &# 39 ; s body . if desired , the audio output inc may also include more advanced audio processing capabilities , including speech synthesis , recognition of various audio file formats , decryption of secure data formats , the ability to generate any of a predefined set of tones or audio segments , or other suitable circuits and algorithms . fig2 a through 28d show various types of audio output inc that may be used with an mpn . fig2 a shows an audio output inc configured as a pair of headphones 2810 . it may include two speakers 2812 and 2814 . a wireless communications device , dac , and amplifiers may also be included . the headphones may also be configured as two separate incs , which may each communicate wirelessly with control unit and other incs . each inc may have its own dac , amplifier , and speaker . headphones may be provided with connecting bar , or they may be configured as small modules to be inserted inside the ear and worn independently . fig2 b shows audio output inc 2822 that may be configured to be worn with a headband 2820 . the audio output inc may be worn near the ear so that minimal power is needed to drive its speaker . sound from the speaker may be provided via conduction through the skull . fig2 c shows two independent audio output incs 2832 and 2834 , which may be worn with a headband 2830 , to provide stereo sound . in fig2 d , audio output inc 2844 may be configured to be worn with hat 2840 . if desired , hat 2840 may be configured to function with two audio output incs ( not shown ). the audio output inc of fig2 b through 28d may be configured to fit into the ear , or to lie flat across the skin near the ear . the headband or hat may be designed to hold the audio output inc or incs in place in the ear , or to hold the audio output inc in place against the skin where sound may be conducted through the skull . if desired , the headband or hat and the audio output inc may be jointly designed so that the audio output inc may be repositioned to best meet the user &# 39 ; s needs , and so that alternate designs of audio output incs may be used with the same mount . fig2 shows flow chart 2900 of an illustrative process for providing an audio output inc in an mpn . all steps are optional and may be performed in any suitable order . in step 2910 an audio output inc may be provided . audio output inc may include a wireless communications device for receiving audio data and other audio commands from one or more other incs in the mpn . it may include dac , one or more amplifiers , and one or more speakers . it may also include speech synthesis circuitry , tone generation circuitry , digital audio file processing capability , decryption circuitry , a library of audio segments , or other suitable subsystems . in step 2920 , the audio output inc may be configured to be worn . for example , in substep 2922 , it may be configured as a headset . in substep 2924 , it may be configured as one or more independent earphones , for example to be inserted inside an ear . in substep 2926 , it may be configured to be worn with a hat . in substep 2928 , it may be configured to be worn with a headband . in step 2930 , the audio output inc may include one or more speakers . for example , it may be configured to provide stereo sound . alternatively , multiple audio output incs may be included as separate incs in a single mpn , and may be controlled independently . in step 2932 , audio output inc may provide music . music may be provided in stereo . in step 2934 , synthesized voice may be provided . the synthesized voice may be provided to the audio output inc as digital or analog audio . alternatively , the voice may be provided to the inc in another form , such as text or phonemes , and the audio output inc may create the synthesized voice . in step 2936 , tones may be output . the tones may be provided to the audio output inc as digital or analog audio . alternatively , the tones may be provided to the inc in another form , such as waveform descriptions or indexes into a table of predefined audio segments , and the audio output inc may create the tones . in step 2940 , the audio output inc may be used by the mpn to provide audio cues to the user . the audio cues may be for any purpose appropriate to the functions provided by the mpn and its other incs . for example , cues may be provided to an athlete with performance information 2941 , workout zone information 2942 , workout prompt 2943 , or change intensity prompt 2944 . route prompt 2945 or direction alert 2947 may be provided by an mpn that provides route guidance . medical alert 2946 may be provided by an mpn that monitors medical conditions . communication alert ( e . g ., notification of an incoming telephone call or message ) 2948 and voice communication 2949 may be provided by an mpn that provides communication services . in step 2950 , sound may be used to indicate different conditions or different audio cues . for example , in substep 2952 , different sounds ( e . g ., different tones ) may be used to indicate different conditions . in substep 2954 , different sound sequences may be used to indicate different conditions . in substep 2956 , sound may be sent to different speakers or audio output incs to indicate different conditions . in step 2960 , the audio output inc may be used for multiple purposes simultaneously . for example , in a system that provides both music and audible athletic workout feedback , both may be sent to the same audio output inc or incs . when an audio cue , such as workout feedback , is output , the music may be muted in substep 2962 or the volume of the music may be lowered in substep 2964 . alternatively , the music may be paused in substep 2966 while the audio cue is presented . the volume changing or pausing of the music may be controlled , for example , by a control unit . for example , the control unit may send both music and audio cues to the audio output inc , and may send commands to the audio output inc to control the volume of both . to pause the music , which may be stored in digital form in memory in the control unit , the control unit may temporarily stop reading music data from its memory while the audio cue is presented , and then resume reading the music data from where it was left off . if desired , the pausing , muting , or volume reduction of the music itself may constitute the audio cue , with no additional sound generated . for example , the system may pause the music once for two seconds as one type of cue , and pause the music three times for one half second each time as a second type of cue . in step 2970 , an audio output inc may be provided separately from a display inc . this may be an advantage over many existing systems in which these two functions are combined into a single unit worn on the wrist . in these prior art devices , either the sound volume is so loud that it disturbs other nearby people , or it is too soft to be heard by the user at all times . in this invention , the audio output inc can be provided close to the ear , and the volume can be kept low while still allowing the user to hear the audio even in poor environmental conditions . if desired , the mpn may include the ability for a user to control the volume of audio output . the system may also allow a user to independently control the volume of different types of audio output . for example , the volume of the music may be controlled separately from the volume of the audio cues , and both of those may be controlled separately from the volume of voice communications . in substep 2975 , cues may be sent to either the audio output inc as audio cues , or to the display inc as visual cues , or both . the user may be allowed to configure where different types of cues are sent . an inc may function as a user input inc . a user input inc may be worn or carried by the user or mounted on a piece of personal equipment . the user input inc may be combined with other functions , such as a display or control unit , or the inc may function solely as a user input inc . a single user input inc may be used to input different types of information at different times , depending on the other incs in the mpn . the user input inc may not need to be changed to provide new types of information input . rather this may be accomplished by adding a new inc with a new function , downloading new software into the user input inc or a control unit , or otherwise modifying other parts of the mpn . in addition , the user may switch to a different style of user input inc without changing any other part of the mpn , and maintain all preexisting mpn functions . an mpn may include multiple user input incs , which may be of similar types or of different types . the user input inc may include a wireless communications device for communicating with other incs in the mpn . for example , the user input inc may send digital commands or data to one of the other incs , such as a control unit . the user input inc may include an analog - to - digital converter ( adc ) for converting analog inputs to digital data . it may also include means for mounting the inc to the user &# 39 ; s body . if desired , the user input inc may also include more advanced input processing capabilities , including voice recognition , tensile , audible , or visual feedback of input commands , anticipation of likely commands , grouping and combining of similar inputs , or other suitable circuits and algorithms . fig3 shows flow chart 3000 of an illustrative process for providing a user input inc in an mpn . all steps are optional and may be performed in any suitable order . in step 3010 , a user input inc may be provided . in step 3020 , the user input inc may be separate from other incs , such as a display inc or a control unit . this may be an advantage to some users . for example , in many prior art systems the user controls are mounted on a display device worn on the wrist . controls may be small and close together , and may require the user to look at the display device to operate it . this requires to user to twist the arm , to look and find the controls , and to reach one hand over to the other . these actions may not be convenient for all users at all times . for example , an athlete may need to operate a system using the minimum possible motions , and without having to change the direction he or she is looking . if desired , user controls may be combined with any other inc . in step 3020 , any suitable type of user input inc may be used . preferably , the inc is one that may be used in a mobile environment . for example , a computer keyboard and mouse may not be appropriate except as attached to a personal computer or base station that may be used at times with the mpn . appropriate types of input inc may include a pressure sensor or button 3021 , multiple pressure sensors or buttons 3022 , a touch pad 3023 , a stylus 3024 used for example with a touch pad , a portable keyboard 3025 , and a microphone 3026 . microphone 3026 may be used to capture audio data , or it may include speech recognition circuitry . if desired , an mpn may include multiple user input incs . for example , one system may include several buttons , a microphone with speech recognition , and a touch pad with a stylus . in step 3030 , the user input inc may be configured to be worn or carried . for example , a pressure sensor may be attached to a fingertip 3032 , hand 3031 , foot 3035 , or waist 3034 . a touch pad or microphone may be worn at the waist 3034 . a microphone may be worn on the wrist 3033 or other part of the arm , or may be configured as part of a headset . if desired , the user input inc may be designed to be mounted on an item of clothing in step 3040 , such as glove 3041 , partial glove 3042 , wristband 3043 , waistband 3044 , or footband 3045 , shoe , or sock . the user input inc may also be mounted on an item of personal equipment in step 3050 , such as on a car 3051 , bicycle 3052 , or exercise equipment 3053 . in step 3060 , if user input inc includes one or more pressure sensors or buttons , it may be operated by tapping . for example , the user may mount a pressure sensor on one or more fingertips , and they may be operated by tapping the fingertip against the palm of the hand , the thumb , other part of the body , or another surface . the user may mount a pressure sensor on the palm of the hand and operate it by tapping it with a fingertip , with the other hand , hitting another part of the body , or striking another surface . the user may mount a pressure sensor on a waistband and operate it by tapping it . the user may mount a pressure sensor on the foot and operate it by tapping an object with the toe or by pushing off the wall while swimming laps in a swimming pool . in substep 3062 , the user may tap different sensors for different commands . for example , an athlete may tap with the sensor on one finger to start and stop a stopwatch function , and tap with the sensor on a different finger to capture a single lap split time . in substep 3064 , the user may tap different sequences to indicate different commands . for example , the user may tap once , twice in quick succession , or other suitable sequences . in substep 3066 , the user may tap a specific combination of sensors simultaneously to input a specific command . fig3 a through 31c show several illustrative methods for mounting a user input inc . in fig3 a , pressure sensors 3110 , 3111 , 3112 , 3113 , 3114 , and 3120 are mounted on a user &# 39 ; s hand 3100 . if desired , they may also be mounted on a glove or partial glove worn by the user . in this configuration , any single sensor may be operated independently . in addition , combinations of sensors may be operated simultaneously . for example , a user may tap the thumb with the forefinger and simultaneously operate both sensor 3110 and sensor 3111 . the user may also simultaneously strike a surface with one , two , or more sensors to provide various input commands . fig3 b shows pressure sensor 3134 mounted to a user &# 39 ; s foot 3130 using footband 3132 . this configuration may be useful to a swimmer , who may tap the wall of a swimming pool to count laps , and may tap the bottom of the pool to indicate other commands . fig3 c shows user 3140 who has mounted two input incs 3144 and 3146 on waistband 3142 . these input incs may be pressure sensors and may be operated by tapping . alternatively , these incs may include a microphone , portable keyboard , touchpad and stylus , or other input inc carried on the waist and retrieved for use . any suitable combination of input incs and mounts may be used . an mpn may be used for many purposes . a single mpn may be used for a single purpose , or it may be used for multiple purposes . the uses of the mpn may change over time , as the user adds and removes incs , downloads or removes software , changes configuration parameters , or just changes how he or she interacts with the system . a single inc may have a single purpose , or it may be used for multiple purposes . some types of incs , such as control units incs , display incs , audio output incs , and user input incs , may be general purpose . fig3 shows a flow chart of an illustrative process for using an mpn for multiple purposes . all steps are optional and may be performed in any suitable order . in step 3205 , the mpn may be used to provide a time - related function . in step 3208 , the mpn may be used to provide a guidance function . in step 3210 , the mpn may be used to provide an athletic function . in step 3215 , the mpn may be used to provide a medical function . in step 3220 , the mpn may be used to provide an entertainment function . in step 3225 , the mpn may be used to provide an outdoor - related function . in step 3230 , the mpn may be used to provide a communications function . in step 3235 , the mpn may be used to provide a personal organization function . in step 3240 , the mpn may be used to provide an identification function . in step 3245 , the mpn may be used to provide a personal security function . in step 3250 , the mpn may be used to provide a military function . in step 3255 , the mpn may be used to provide a physical therapy function . in step 3260 , the mpn may be used to provide a disability - related function . in step 3265 , the mpn may be used to provide a travel - related function . in step 3270 , the mpn may be used to provide multiple functions . this may include substep 3272 of providing multiple functions with a single mpn configuration . it may also include substep 3274 of providing multiple functions with multiple mpn configurations . the functions shown in fig3 are merely illustrative . other functions may be provided if desired . step 3205 , providing time - related functions , is shown in more detail in fig3 . all steps are optional and may be performed in any suitable order . in step 3310 , a clock may be provided as part of an mpn . this may include substep 3312 in which the clock is provided as part of another inc , such as a control unit or display inc . in step 3320 , the current date and time may be downloaded into the inc . this may include substep 3322 in which the current time is downloaded over the wireless network , for example from a personal computer . alternatively , it may include substep 3324 in which the inc include a radio receiver to acquire the current time from station wwv time of day radio broadcast . in step 3330 , the inc may provide a clock function . this may include displaying the current day and time on a display inc . the inc may include a time zone function in step 3331 . this may include displaying the current time in multiple time zones , or converting a time from one time zone to another . in step 3332 , the inc may provide a stopwatch function . this may include allowing the user to time individual events . it may include step 3334 of providing a split timer function , in which the user is allowed to time individual portions of an event . it may also include step 3335 in which the user is allowed to time multiple events . in step 3333 , the system may provide an interval timer function , allowing the user to mark one or more recurring intervals of specific durations . in step 3340 , the system may store collected time information . this may include collected stopwatch , split , and event times . this collected data may be tagged with the date and time on which it was stored . the user may also be allowed to input descriptive data related to the collected time data . the stored data may also include time zone settings , intervals settings , or other settings . in step 3342 , the collected time information may be uploaded , for example to a base station or personal computer . in step 3350 , the clock functions may be used to synchronize other mpn functions . for example , a control unit may collect data from a particular inc on a regular interval , or update a display once per second . the control unit may be allowed to read the current time from the clock . the clock may also be configured to provide an unsolicited interrupt to the control unit or other inc at a regular interval . in step 3352 , data collected from other incs may be tagged with the current time retrieved from the clock . fig3 shows a block diagram of an illustrative mpn 3400 with a clock function . in this system , the clock 3420 is embedded in the control unit 3410 . clock information is sent to a separate display inc 3430 , which may output the information on display 3440 . user commands , such as changing clock mode and starting and stopping the stopwatch , are provided by buttons 3460 on a separate input inc 3450 . the input inc 3450 may be worn on the hand , the control unit / clock 3410 may be worn on the waist , and the display inc 3440 may be worn on the wrist . fig3 shows an illustrative screen 3500 that may be shown on display 3440 ( fig3 ). mode list 3520 may list the available clock modes . in this case , the system may support a time mode , a zone mode ( e . g ., time zone ), a stopwatch mode , an interval timer mode , and an event timer mode . indicator 3530 may show the currently active mode , in this case the time mode . the user may change to a different mode by pressing one of buttons 3460 ( fig3 ). the current time 3510 may be displayed while in time mode . more details of step 3230 ( fig3 ), providing a communication function in an mpn , are shown in fig3 . all steps are optional and may be performed in any suitable order . in step 3610 , communication may be provided with another mpn . this may be accomplished if one of the incs in the mpn includes a communications device capable of communicating with an inc of another mpn . the wireless communications device used for communicating among the incs within an mpn may also be used for communicating with another mpn , if the user of that mpn is in close proximity . the system may be configured to accept messages with the specific network identifier associated with the other mpn , while the communications are in progress . in step 3620 , wireless telephone communications may be provided , if one of the incs includes a wireless telephone . the audio output inc for the mpn may output the incoming audio from a telephone call , and a microphone used as a user input inc for the mpn may be used to provide the outgoing audio for the telephone call . this allows the telephone inc itself to be smaller and less costly , since it does not require a built - in speaker or microphone . in step 3625 , paging services may be provided . for example , one of the incs may include a paging receiver . text pages may be shown on the display inc . audio alerts and voice pages may be sent to the audio output inc . two - way paging may be provided if desired . an instant messaging function may be provided in step 3630 , with one inc receiving text messages for display on the display inc , and another inc allowing text messages to be composed and sent to another person elsewhere . electronic mail messages may also be composed and received in a similar manner in step 3635 . different types of communication may be provided as appropriate . for example , voice communications may be provided in step 3640 . text communication may be provided in step 3642 . video communication may be provided in step 3644 . other formats of communication may also be supported if desired . in step 3650 , data may be transmitted by a communications device in one of the incs in the mpn . this may include substep 3652 transmitting image data , substep 3654 transmitting audio data , substep 3656 transmitting video data , and substep 3658 transmitting text data . the data to be transmitted may be provided by the user with a user input inc , may be stored in memory within the mpn , and may be transmitted among incs in the mpn prior to sending . in step 3660 , data may be received by a communications device in one of the incs in the mpn . this may include substep 3662 receiving image data , substep 3664 receiving audio data , substep 3666 receiving video data , and substep 3668 receiving text data . the data received may be transmitted among incs in the mpn and stored in memory within the mpn , prior to its being provided to the user on one or more of the incs , such as a display inc or audio output inc . if desired , a communications alert may be provided to the user on the display or audio output inc to let the user know that a message has been received . if desired , input and output incs in the mpn may be shared between a communications function and another function of the mpn . for example , music may be paused or muted while voice communications or communications alerts are being provided to the audio output inc . fig3 shows more detail of step 3610 ( fig3 ), communicating between mpns . all steps are optional and may be performed in any suitable order . as described above , one of the incs of the mpn may include a communications device for exchanging data with an inc of another mpn . alternatively , the communications device used for exchanging data among incs of a single mpn may also be used to exchange data with another mpn that may be in proximity . for example , the user may have downloaded software into the control unit or other inc that allows such communication . the user may use the user input inc to notify the mpn that these communications are to begin . the mpn may then begin to send messages to an inc of the other mpn , and may listen for incoming messages from the other mpn . in this manner , each mpn may determine the network identifier of the other user &# 39 ; s mpn . in step 3710 of fig3 , data may be sent from one mpn to another . for example , the control unit or other inc may tag an outgoing message with the network identifier of the other mpn . the data may include personal data in step 3720 . for example , if the two mpns are configured to provide personal organization features , the data sent from one to the other may include contact information , such as a name , phone number , electronic mail address , or other suitable information . in step 3730 , the data sent between mpns may include game data . this may allow the users to play a game that requires two or more players , if both users have the same game software installed . in step 3740 , the data may allow two users to compete athletically . for example , the two users may each be on a stationary bicycle , and performance data may be exchanged between them . the two mpns may determine who wins the competition based on data gathered from the two stationary bicycles or other sensors . in step 3750 , one user may send software to another user . this may include , for example , software that enables an mpn to perform a specific feature or provide a specific function . in step 3760 , one user may be allowed to send a digital music file , or other recorded media , to another . any other suitable type of data may be exchanged between mpns . if desired , data may be exchanged between more than two mpns simultaneously , for example allowing a game with more than two players . fig3 shows two users with mpns that are communicating . first user 3820 is wearing first mpn 3810 . first mpn 3810 includes control unit 3830 and display inc 3840 . user controls may be incorporated into either inc . second user 3870 is wearing second mpn 3860 , consisting of control unit 3880 and display inc 3890 . either of these two incs may have user controls as well . data may be exchanged between control unit 3830 and control unit 3880 . exchanged data may be displayed on display inc 3840 and display inc 3890 . user 3820 and user 3870 may , for example , exchange personal contact information or may play a game . the incs shown are merely illustrative . another example of two users with communicating mpns is shown in fig3 . first user 3920 is on first bicycle 3915 , mounted on a stationary training stand . second user 3970 is on second bicycle 3965 , also mounted on a stationary training stand . first mpn 3910 may include inc 3925 which may combine display functions and user controls with a control unit and which may be mounted on bicycle 3915 . first mpn 3910 may include audio output inc 3930 worn by first user 3920 inside a helmet or headband . it may include inc 3935 that controls the difficulty setting of the training stand . it may also include inc 3940 that measures the speed of the rear wheel of bicycle 3915 . second mpn 3960 may similarly include user input / display / control unit 3975 , audio output inc 3980 , difficulty setting inc 3985 , and speed sensor 3990 . the two control units may control the difficulty for the two riders to simulate a specific race course , and may compare the speeds of the two riders . the display incs may be used to provide feedback on the comparative progress on the simulated course of the two riders , for example notifying each rider of the comparative position of the other . the incs shown are merely illustrative . fig4 shows more detail of step 3220 ( fig3 ), providing entertainment functions . all steps are optional and may be performed in any suitable order . in step 4010 , recorded music may be played . for example , songs may be stored in digital format ( e . g ., mp3 format ) in memory in the control unit or other inc with storage capabilities . the storage inc may read the digital audio data and send it to the audio output inc , which may play the audio for the user . if desired , the system may provide audio control functions , such as volume control , playing and stopping , skipping songs , repeating a song , random play , etc . in step 4015 , broadcast music ( e . g ., radio ) may be played by the mpn . a radio receiver may be included in one of the incs . the radio signal may be received and sent to the audio output inc to allow the user to listen . if desired , the audio signal may be digitized for processing within the system . if desired , the system may include volume changing and station selection functions , and other desired radio - related features . in step 4020 , the system may allow audio to be recorded . for example , one of the incs may include a microphone . the audio may be digitized and stored into memory in one of the incs , such as a control unit . the recorded audio may be replayed by the user , using the audio output inc . similarly , video segments may be captured in step 4022 and still video images may be captured in step 4024 by an inc with a video input . the video segments may be digitized and stored in memory in one of the incs . if desired , the captured video segments and images may be viewed by the user on the display inc . if desired , any stored music or any recorded media may be shared with a user of another mpn , as described above in conjunction with fig3 . any recorded audio , video , or image data may be uploaded to a personal computer , if desired . in step 4030 , the user may be allowed to play a game . the game may involve only the user of the mpn . alternatively it may involve a user of another mpn , if one of the incs in each mpn includes a communication device capable of communicating with the other mpn . for example , the wireless communications device within each of the incs may be used to transfer game - related information between mpns if the two users are in close proximity . an inc of the mpn may also be configured to communicate with an external game device . music and audio cues may both be provided by a single mpn , as described previously in conjunction with fig2 . fig4 shows more details of step 3235 ( fig3 ), providing personal organization features with an mpn . all steps are optional and may be performed in any suitable order . in step 4110 , the mpn may support scheduling of appointments . the user input inc and display inc may be used for entering new appointments , modifying appointments , and viewing upcoming schedules . the display inc and audio output inc may be used to inform the user of imminent appointments . in step 4120 , the mpn may manage contact information . this may include names , phone numbers , addresses , electronic mail addresses , and other information about contacts . in step 4130 , the mpn may be used to manage a task list . for example , the user may be allowed to enter and prioritize tasks , and to track their completion . in step 4140 , the mpn may allow the user to keep a journal . the user may be able to create text , audio , video , and other types of entries . in step 4150 , the personal organizer data stored by the mpn may be synchronized with another system , such as a software application running on a personal computer . appointments , contacts , tasks , and journal entries created on either system may be copied to the other system . this may allow the user to keep a permanent or backup copy of data created in the mobile system , and may also allow the user to take advantage of the keyboard , mouse , and full - sized monitor on the personal computer to enter significant amounts of information . in step 4160 , information may be shared with another mpn , as described above in conjunction with fig3 . fig4 shows more detail of step 4140 ( fig4 ), allowing the user to maintain a mobile electronic journal . all steps are optional and may be performed in any suitable order . in step 4210 , a user may be allowed to enter journal entries . entries may include voice in substep 4212 , text in substep 4214 , input from an electronic sketchpad in substep 4216 , or any other suitable type of entry or combination of entries . in step 4220 , the user may be allowed to capture a video image , for example using an inc that has digital camera hardware . if desired , the user may capture a video clip . in substep 4225 , the captured video image may be stored with a journal entry . for example , it may be stored in the same memory , and there may be a link from one to the other . in step 4230 , the journal entry may be automatically tagged with the current date and time if one of the incs in the mpn includes a clock . in step 4235 , the journal entry may be automatically tagged with the current location , if one of the incs in the mpn includes a position monitor such as a global positioning system ( gps ) monitor . in step 4240 , the user may be allowed to control functions of the journal using the audio input , if the mpn includes a speech recognition function . in step 4250 , a database may be downloaded into memory in the mpn . the database may include data of interest to the user , and may relate to topics to which the user may refer in the journal . for example , the database may include travel - related information , music - related information , school - related information , work - related information , or any other suitable data . in step 4255 , the user may be allowed to link a journal entry to a database element . in step 4260 , any journal entries stored in the mpn may be uploaded to a personal computer . this may include the voice , text , and drawing parts of the entries , as well as any linked images and time and location tags . it may also include links to any database elements that may be linked to the journal entries , or it may include the data from the database elements themselves . in step 4265 , the uploaded journal may be converted into a standard file format , so that it may be easily viewed or printed with the personal computer . the file format may include html , pdf , or any other suitable format . images and audio segments may also be stored in a common file format . the data may be loaded into a database on the personal computer if desired . fig4 a shows more detail of step 3208 ( fig3 ), providing a guidance function using an mpn . in step 4310 , the mpn may include a position monitor inc . this may be a gps monitor in substep 4312 . the system may also include an elevation monitor in substep 4314 , which may , for example , use barometric pressure readings . in step 4320 , the position monitor may be used to provide current user information . this may include current position in substep 4322 , current speed in substep 4324 , current elevation in substep 4326 , and current elevation gain in substep 4328 . if desired , the system may also collect direction information , for example from a compass , and provide direction information . in step 4330 , route guidance may be provided to a user . turning to fig4 b for greater detail of step 4330 , route guidance may include step 4331 , in which map information may be downloaded into memory in the mpn . the map information may be downloaded using the wireless communications device in one of the incs . alternatively , it may be loaded from a memory device , such as a cd - rom . in step 4332 , the user may be allowed to enter a desired location . for example , the user may enter an address or the name of a destination , the user may choose a destination from a list , the user may point to a destination on a map displayed on a touch screen , or the user may speak the desired location . in step 4333 , an inc in the mpn may calculate a route from the current location to the desired location . this may be done using any suitable algorithm or combination of algorithms that may compare various routes based on distance , estimated time , traffic , road conditions , or any other suitable criteria . if desired , the user may be allowed to enter criteria for choosing a route , or may be allowed to choose from multiple routes . in step 4334 , map information may be displayed . the map information may include the current location , the desired location , and / or all or part of the route between them . in step 4335 , the user &# 39 ; s current location may be displayed on the map . this may also include other information , such as the user &# 39 ; s direction and speed . in step 4336 , route guidance may be displayed . in addition to displaying the chosen route on the map , the system may provide , either visually or audibly , prompts informing the user of turns and other actions . the system may also make corrections to the route if the user misses a turn or otherwise does not follow the guidance . returning to fig4 a , in step 4340 , the system may collect and store position information as the user moves . this may include , for example , location , speed , and elevation , along with the time at which each measurement was taken . this step may also include substep 4341 , uploading the collected data to a base station or personal computer . the collected data may be saved in a database , displayed , or analyzed , by an inc of the mpn , by a base station , by a personal computer , by a computer accessed over a wide area network such as the internet , or in any other suitable location . in step 4342 , the user may be allowed to annotate the collected position data , or otherwise modify it . for example , the user may enter text , create a voice annotation , or capture a video image or segment . annotations may include information about a location , about the route , personal notes , images or video clips of sights seen , or any other information . if desired , the system may have a number of predefined annotations that may be quickly and easily entered by the user at any point . the system may store the annotation with the position information , and may create a link between the data items . the user may also be allowed to modify the collected data itself . the annotation or modification may be created as the position information is collected in substep 4343 , for example using an input device that may be an inc in the mpn . the annotation or modification may also be created after the position information has been collected in substep 4344 , for example using an input device connected to a personal computer . in step 4345 , the collected information may be correlated with map data . this may be done in the mpn , using map data stored in memory in an inc of the mpn , or on a personal computer after the position information has been uploaded . the position information , along with any annotations , may be displayed on a map , for example showing the route taken by the user . in step 4350 , position information may be correlated with simultaneously collected performance information . this may be useful in an mpn that is also used to support athletic workouts . for example , the route may be an athletic training route or an athletic competition route . the performance information may , for example , be speed in substep 4351 , heart rate in substep 4352 , cadence , or any other suitable performance data . the personal data may be stored with the position data , and the system may also store links between the two data items . this collected performance data may be displayed during the session . it may also be displayed or printed on a personal computer at a later time . it may be displayed in a table , in a graph , on a map , on an elevation profile , or any other suitable format . in step 4353 , performance data may be collected during multiple sessions . in step 4354 , the performance data may be compared between sessions . the comparison may be for the entire sessions , or for portions of the sessions following the same route . for example , a table or graph may be used to show the performance differences between two sessions . summary information , such as averages , may also be provided . information may be displayed on an inc of the mpn , on a personal computer after being uploaded , to a computer accessed via a wide area network such as the internet , or at any other suitable location . the collected position information may be used to recommend a route for a later session in step 4360 . for example , the mpn may store position information from one or more sessions , and may construct map data of routes that are available to the user . prior to or during a later session , the constructed map data may be used to plan a route for the user . the system may also use the collected performance data to plan the route . if desired , the route may be that of an upcoming athletic competition , and the system may be used to collect information about the route , such as elevation profile , distance of individual segments , landmarks , or other information of interest . in substep 4361 , a route may be recommended based on a desired workout intensity . for example , the system may use collected heart rate data or an elevation profile to choose a route with the desired difficulty . in substep 4362 , a user may specify a desired elevation profile , and the system may choose a route that most closely matches the user &# 39 ; s preference . in substep 4363 , the system may recommend a route based on a desired distance chosen by the user . if desired , the system may allow the user to specify any other suitable criteria , or combination of criteria , for route selection . in step 4365 , the mpn may provide directions or other guidance to the user during a session , based on the selected route . if desired , the guidance may be based on a route chosen ahead of time and downloaded . alternatively , the directions may be made dynamically , as specific decision points are reached . for example , a prompt to take a specific turn may be shown on the display inc or played through the audio output inc . the system may also make modifications to the recommended route if the user does not follow the prompts . if desired , the chosen route may be based on map and elevation information loaded from a cd - rom or other memory device or loaded from the internet or other network , rather than using position information collected by the user . position data collected in one session may also be used to simulate the same route in a later session . for example , a user may travel the route of an upcoming competition in one or more sessions and collect position and elevation information . this collected position and elevation information may be used to control exercise equipment in later sessions to simulate the racecourse . fig4 shows an illustrative mpn 4400 that may be used to provide guidance to an athlete . inc 4410 may be worn on a waistband , and may include a control unit , a gps monitor , an elevation sensor , user input controls , and a clock . inc 4420 may be worn on a wristband and may include a display device and an accelerometer . inc 4430 may be worn on a headband , and may include an audio output device . inc 4440 may be worn on a chest strap and may include a heart rate sensor . inc 4450 may be worn on an ankle band and may include an accelerometer . use of accelerometers mounted on the arm and leg to perform functions such as measuring cadence and providing form feedback is described in more detail below . incs shown are merely illustrative , and all incs are optional . fig4 a through 45l show examples of screens that may be provided by display inc 4420 in an mpn 4400 ( fig4 ) that may be used for guidance and athletic functions . fig4 a provides a display of the user &# 39 ; s current altitude . fig4 b provides a display of the user &# 39 ; s current geographical location . fig4 c provides a display of the user &# 39 ; s current speed . fig4 d provides a display of the user &# 39 ; s current rate of elevation change . fig4 e provides a display of the user &# 39 ; s heart rate . fig4 f provides a display of a route prompt . fig4 g provides a display of the user &# 39 ; s current cadence . fig4 h provides a display of the user &# 39 ; s current stride length . fig4 i provides a display of the current date and time . fig4 j provides a display of a session total time and partial time from a stopwatch function . fig4 k provides a display of an interval timer . fig4 l provides a display of a speed prompt . these screens are merely illustrative . any suitable information may be displayed , in any suitable format . if desired , any of this information may be sent to an audio output inc in addition to or instead of the display inc . fig4 through 49 show illustrative screens that may be displayed on a personal computer configured to interface with an mpn that provides guidance features and athletic features . fig4 shows session overview screen 4600 that may display collected position , performance , and annotation data for a session . graphs 4610 , 4620 , 4630 , 4640 , and 4650 , along with note line 4660 , may all be displayed relative to a common time line . graph 4610 may display elevation vs . time for the session or portion of session . graph 4620 may display speed vs . time for the session or portion of session . graph 4630 may display heart rate vs . time for the session or portion of session . graph 4640 may display stride length vs . time for the session or portion of session . graph 4650 may display cadence vs . time for the session or portion of session . the user may be allowed to click on any graph to view more details of the graphed data ( such as a chart of the data ). these graphs are merely illustrative . any suitable data may be graphed or charted . note line 4660 may display indicator to show the link between time and each annotation . for example , indicator 4662 may indicate that an audio annotation has been linked to that first specific time during the session . indicator 4664 may indicate that a video annotation may be linked to that second specific time during the session . indicator 4666 may indicate that a text annotation has been linked to that third specific time during the session . the user may be allowed to point the mouse at an indicator or click on it to view the actual annotation . menu bar 4670 may provide user access to various functions . for example , file menu 4672 may allow the user to save the session data , open a file with other session data , or perform other file related functions . notes menu 4674 may allow the user to perform functions related to annotations , such as adding a new annotation , modifying an annotation , deleting an annotation , or viewing an existing annotation . time menu 4676 may allow the user to perform time - related functions , such as modifying which time span from the session is graphed . view menu 4678 may allow the user to change the display to another view of the same data ( such as a chart ), or to any other display supported by the system . this may include , for example , allowing the user to select session comparison display 4700 of fig4 or map view 4800 of fig4 . the menu options described here are merely illustrative . any suitable menu options may be offered . for example , an option may be offered to allow the user to select which types of data to graph . fig4 shows session comparison screen 4700 that may display collected position , performance , and annotation data for multiple sessions or partial session in which the user followed the same route . graphs 4720 , 4730 , and 4740 may all be displayed relative to a common distance line . graph 4720 may display elevation vs . distance for the common route or portion of route . graph 4730 may display speed vs . distance for the first session or portion of session on date 4735 . graph 4740 may display speed vs . distance for the second session or portion of session on date 4745 . the user may be allowed to click on any graph to view more details of the graphed data ( such as a chart of the data ). these graphs are merely illustrative . any suitable data may be graphed or charted . summary region 4750 may display and compare summary data from the multiple sessions . for example , if speed data is graphed on the screen , the summary region 4750 may display average and maximum speed for the graphed segment of each session . menu bar 4710 may provide user access to various functions . for example , file menu 4712 may allow the user to save the session data , open a file with other session data , or perform other file related functions . time menu 4714 may allow the user to perform time - related functions , such as modifying which time span from the session is graphed . data menu 4716 may allow the user to perform data - related functions , such as modifying which data from the session is graphed . view menu 4718 may allow the user to change the display to another view of the same data ( such as a chart ), or to any other display supported by the system . this may include , for example , allowing the user to select session overview display 4600 of fig4 or map view 4800 of fig4 . the menu options described here are merely illustrative . any suitable menu options may be offered . for example , an option may be offered to view or modify annotations . fig4 shows map view screen 4800 that may display collected position , performance , and annotation data for a session or partial session in relation to a map . date field 4820 may display the date and / or time of the session being viewed . road indicator 4830 may show the roads , trails , and other fixed items from the region in which the session occurred . route indicator 4840 may be used to indicate the actual route followed by the user during the session . route indicator 4840 may have different characteristics to indicate different performance data . for example , there may be three different line styles used to indicate heart rate above a desired zone , within a desired zone , and below a desired zone . the number of line styles and the performance parameter shown are merely illustrative . any suitable data divided into any suitable number of zones may be drawn on the map . if desired , multiple performance parameters may be shown on the same map . the user may be allowed to click on the map to view more details of the data ( such as a chart or graph of the data ). note indicators may be displayed on the map to show the link between the route and each annotation . for example , indicator 4852 may indicate that an audio annotation has been linked to that first specific time during the session . indicator 4854 may indicate that a video annotation may be linked to that second specific time during the session . indicator 4856 may indicate that a text annotation has been linked to that third specific time during the session . the user may be allowed to point the mouse at an indicator or click on it to view the actual annotation . legend 4860 may display a legend of the line styles used for the road indicator and route indicator , along with any other information that may be displayed on the map . for example , a legend may be provided for the different styles of annotation indicator . menu bar 4810 may provide user access to various functions . for example , file menu 4812 may allow the user to save the session data , open a file with other session data , or perform other file related functions . notes menu 4814 may allow the user to perform functions related to annotations , such as adding a new annotation , modifying an annotation , deleting an annotation , or viewing an existing annotation . data menu 4816 may allow the user to perform data - related functions , such as modifying which data from the session is shown on the map . view menu 4818 may allow the user to change the display to another view of the same data ( such as a chart ), or to any other display supported by the system . this may include , for example , allowing the user to select session overview display 4600 of fig4 or session comparison display 4700 of fig4 . the menu options described here are merely illustrative . any suitable menu options may be offered . for example , an option may be offered to zoom into a portion of the route . fig4 shows session planning screen 4900 that may allow the user to enter desired attributes of an upcoming session , to allow the system to plan an appropriate route . for example , the user may be allowed to enter a desired total distance in screen region 4910 . screen region 4920 may allow the user to enter a desired total time for the session . screen region 4930 may allow the user to enter a desired elevation gain for the route . screen region 4940 may allow the user to enter a desired pace or speed for the session . screen region 4950 may allow the user to enter a desired heart rate or heart rate range for the session . these parameters are merely illustrative . any suitable parameters may be offered . the user may be allowed to enter a subset of desired parameters , and the system may create a route that best matches the entered parameters . menu bar 4960 may provide user access to various functions . for example , file menu 4962 may allow the user to save the session data , open a file with other session data , or perform other file related functions . maps menu 4964 may allow the user to perform functions related to maps , such as viewing maps of available routes , and selecting one or more preferred routes . the menu options described here are merely illustrative . any suitable menu options may be offered . for example , an option may be offered to view data from previous sessions . fig5 shows more detail of step 3210 of fig3 , providing an athletic function with an mpn . all steps are optional and may be performed in any suitable order . in step 5005 , the mpn may be used to control a workout . in step 5010 , the mpn may be used to control one or more sections of a workout . in step 5015 , the mpn may be used to collect data from a workout . in step 5020 , the mpn may be used to provide both music and audio workout cues , as described previously with respect to fig2 . in step 5025 , the mpn may be used to provide route guidance during a workout , as described previously with respect to fig4 a . in step 5030 , the mpn may measure an athlete &# 39 ; s cadence . in step 5035 , the mpn may measure an athlete &# 39 ; s stride length . in step 5040 , the mpn may be used to control a piece of exercise equipment , as described previously with respect to fig2 . in step 5045 , the mpn may be used to collect data from a piece of exercise equipment , as described previously with respect to fig2 . in step 5050 , the mpn may correct errors in collected athletic data . in step 5055 , the mpn may remind an athlete to consume a consumable . in step 5060 , the mpn may use previously stored data to estimate a performance parameter . in step 5065 , the mpn may provide for an athletic competition between two or more athletes , as described previously with respect to fig3 . in step 5070 , the mpn may provide for a coaching interface . in step 5075 , the mpn may count swimming laps . in step 5080 , the mpn may provide form feedback to an athlete . in step 5085 , the mpn may provide a training journal . more details of these embodiments are described below . these athletic uses of the mpn are merely illustrative . other athletic uses are possible if desired . fig5 shows flow chart 5100 of an illustrative process for providing workout control and feedback . all steps are optional and may be performed in any suitable order . in step 5110 , workout parameters may be defined . the parameters may be defined , for example , on a coach &# 39 ; s computer or on an athlete &# 39 ; s computer . the parameters may be entered by a user such as the coach or athlete , or they may be generated automatically by a coaching software application . the parameters may define aspects of a planned workout , such as its type , duration , intensity , etc . in step 5120 , if the workout parameters were defined on a coach &# 39 ; s computer , they may be downloaded to the athlete &# 39 ; s computer . in step 5125 , the parameters may be downloaded from the athlete &# 39 ; s computer to an inc in the mpn , such as a control unit . in step 5130 , the inc may control aspects of the workout session , using an output inc in the mpn . in step 5140 , the inc may collect workout results from an input inc in the mpn . in step 5150 , the workout results may be uploaded to the athlete &# 39 ; s computer . in step 5155 , the workout results may be uploaded to the coach &# 39 ; s computer . in step 5160 , the workout results may be stored , for example on the athlete &# 39 ; s computer or the coach &# 39 ; s computer . in step 5170 , the workout results may be analyzed , for example on the athlete &# 39 ; s computer or the coach &# 39 ; s computer . for example , the workout results may be displayed , or may be compared with workout results from other workout sessions . in step 5180 , the workout results may be used to determine parameters for one or more upcoming workout sessions , for example on the athlete &# 39 ; s computer or the coach &# 39 ; s computer . fig5 shows a block diagram of an illustrative system 5200 for communicating between a personal computer 5210 and a control unit 5240 that is an inc in an mpn . personal computer 5210 may have communications device 5220 , control unit 5240 may have communications device 5250 , and they may communicate using communication path 5230 . communication path 5230 may be a wireless radio frequency link , an infrared link , a docking station link , a usb link , a serial port link , or any other suitable type of communications path . control unit 5240 may include processor 5260 for executing software related to controlling a workout , collecting workout results , communicating with personal computer 5210 , and communicating with other incs in the mpn . control unit 5240 may also include memory 5270 for holding software , downloaded workout parameters , and collected workout results . fig5 shows a block diagram of an illustrative mpn 5300 for controlling aspects of an athletic workout and collecting results from a workout . control unit 5240 may be the same control unit shown in fig5 , and may be configured to communicate with a personal computer as shown in that fig . it may also have wireless communications device 5310 for communicating with other incs in mpn 5300 over wireless communication path 5350 , such as data collection inc 5320 and output inc 5330 . if desired , wireless communications device 5310 may be the same as communications device 5250 . if desired , control unit 5240 may be omitted , and its functions may be assumed by other incs in the mpn . data collection inc 5320 may have wireless communication device 5322 for sending collected data to control unit 5240 or other inc having storage capabilities . it may also have data collection circuit 5324 . data collection circuit 5324 may collect any athletic data , such as speed , heart rate , power , resistance , location , cadence , or any other suitable type of athletic data . data collection inc 5320 may be worn by the athlete . if desired , data collection inc 5320 may be mounted on a piece of athletic equipment or a bicycle and may collect data from that equipment . output inc 5330 may have wireless communication device 5332 for receiving control commands from control unit 5240 or other suitable inc . it may also have output circuit 5334 . output circuit 5334 may output athletic control data using any appropriate method , such as displaying a prompt to the user , outputting a prompt to the user , controlling resistance , controlling speed , or any other suitable type of athletic control . output inc 5330 may be worn by the athlete . if desired , output inc 5330 may be mounted on a piece of athletic equipment or a bicycle and may send control commands to that equipment . fig5 shows how mpn 5300 ( fig5 ) may communicate with an athlete &# 39 ; s personal computer 5210 and a coach &# 39 ; s personal computer 5410 . athlete &# 39 ; s personal computer 5210 may communicate with coach &# 39 ; s personal computer 5410 using any suitable network 5415 , such as the internet . either computer may connect with network 5415 using connection 5412 and 5418 , such as a telephone modem , a cable modem , a digital subscriber line modem , or any other suitable type of connection . as shown previously , athlete &# 39 ; s personal computer 5210 may connect to control unit 5240 , and control unit 5240 may send commands to athletic output inc 5330 and collect data from athletic data collection inc 5320 . if desired , connections may not all be in place simultaneously . for example , at a first time , coach &# 39 ; s computer 5410 may be connected to network 5415 , and workout parameters may be uploaded to a web server . at a second time , athlete &# 39 ; s computer 5210 may be connected to network 5415 , and workout parameters may be downloaded from the web server . at a third time , athlete &# 39 ; s personal computer 5210 may be connected to control unit 5240 , and workout parameters may be downloaded into control unit 5240 . at a fourth time , which may be during a workout session , the control unit 5240 may send control commands to athletic output inc 5330 and may receive data from athletic data collection inc 5320 . at a fifth time , workout results may be uploaded from control unit 5240 to athlete &# 39 ; s personal computer 5210 . at a sixth time , workout results may be uploaded from athlete &# 39 ; s personal computer 5210 to a web server in network 5415 . at a seventh time , workout results may be downloaded from the web server in network 5415 into coach &# 39 ; s computer 5410 . if desired , data may be sent directly between coach &# 39 ; s computer 5410 and athlete &# 39 ; s computer 5210 , rather than using a web server to store data sent from one to the other . if desired , control unit 5240 may be omitted , and athlete &# 39 ; s personal computer 5210 may connect directly to athletic output inc 5330 and athletic data collection inc 5320 or storage inc ( not shown ). fig5 shows illustrative mpn 5500 that may be used to provide control of an athletic workout and collect workout results . inc 5510 may be a control unit , and may be worn by the athlete . inc 5515 may be an athletic data collection inc worn by the athlete , and may include a heart rate sensor . inc 5520 may be an athletic output inc worn by the athlete , and may include an audio output inc . inc 5525 may be an athletic output inc mounted on a bicycle , and may include a display inc . inc 5530 may be an athletic data collection inc mounted on a bicycle , and may include a pedal cadence sensor . inc 5535 may be an athletic data collection inc mounted on a bicycle , and may include a wheel speed sensor . inc 5540 may be an athletic output inc mounted on a bicycle training stand , and may include resistance control device . during a workout , the control unit may control aspects of the workout by changing the cycling difficulty using inc 5540 , and by providing prompts to the athlete using inc 5520 and inc 5525 . prompts may include , for example , prompts to pedal faster , slower , harder , or easier , to stand or sit , to pedal with one leg or both legs , or any other suitable prompts . incs shown are merely illustrative , and each inc is optional . fig5 shows a flow chart of an illustrative process 5600 for managing a workout plan . all steps are optional and may be performed in any suitable order . the workout plan may be managed using software on athlete &# 39 ; s computer 5210 or coach &# 39 ; s computer 5410 ( fig5 ). in step 5610 , a workout goal may be defined . this may include a specific date in substep 5612 , a specific upcoming competition in substep 5614 , a specific performance goal in substep 5616 , a specific health goal in substep 5618 , or any other suitable type of goal . if desired , multiple goals may be defined . in step 5620 , a workout plan may be defined based on the workout goal . this may include different types of workouts , different periods of time with specific sub - goals , or other suitable plan . in step 5625 , a workout session may be defined . that may include a type of workout , duration , intensity , repetitions , or any other suitable parameters . as many parameters as desired may be created for each workout . the workout plan may include tracking of multiple planned workout sessions . in step 5630 , the workout parameters may be downloaded from the coach &# 39 ; s computer or athlete &# 39 ; s computer into an inc of the mpn , such as a control unit or storage inc . in step 5635 and step 5640 , during a workout session , aspects of the workout may be controlled and data may be collected . in step 5645 , workout results may be uploaded . this may include storing results on the athlete &# 39 ; s computer or the coach &# 39 ; s computer . results may be stored for multiple workout sessions . this may include storing the parameters that were used to define the workout sessions , as well as data collected during the sessions . in step 5650 , workout results may be displayed for the athlete or coach . in step 5655 , workout results may be analyzed . this may include comparing results between multiple workout sessions . in step 5660 , the workout results may be used to modify one or more parameters for an upcoming workout session . workout results may include data collected during a workout , as well as the workout parameters used during the workout session . workout results may include information on missed workout sessions . workout results may also include related information such as athlete health information , athlete eating and drinking records , athlete &# 39 ; s resting heart rate , and other auxiliary information . for example , a future workout may be made easier or harder depending on the results of the workout . in another example , if the time of a workout session was changed , an upcoming session may also be moved or canceled . if desired , in substep 5665 , rules may be applied to restrict how future workout modifications may be made . for example , a rule may restrict the system from scheduling two workouts of the same type on the same or consecutive days . as another example , the intensity , difficulty , or duration may not be allowed to increase more than a fixed percentage , such as ten percent . and in step 5670 , the results of all workouts in a plan may be tracked as they occur . the coach or athlete may be allowed to view historical data , to view trends and improvements , or compare the results of two or more workout sessions . this may also include comparing the collected workout results to the workout plan goal or goals . if desired , other data , such as data entered by the coach or athlete , may be compared with the workout plan goal . in fig5 , more details are shown of step 5625 ( fig5 ), defining the workout parameters . all steps are optional and may be performed in any suitable order . in step 5710 , the day and time of a workout may be defined . the workout time may be defined with any suitable degree of specificity , such as any time within a week , any time within a three day period , any time on a specific day , before or after a different workout , or at a specific hour . in step 5720 , the type of workout may be defined . this may include a general workout type , such as running , cycling , swimming , weightlifting , rowing , or the like . it may also include a style of workout , such as endurance , speed work , interval training , fartlek (“ speed play ”— bursts of speed during a training run ) training , hill work , strength training , or any other suitable style . in step 5730 , the duration of the workout may be defined . the duration may be measured in time , distance , or any other suitable units . the duration may be expressed as a range , if desired . in step 5740 , the workout may be divided into sections . each section may have its own goal , such as warm up , increasing anaerobic threshold , recovery , increasing endurance , cool down , or any other suitable goal . each section may be provided its own set of workout parameters . for example , in step 5750 , target intensity may be defined for a section . in step 5760 , target heart rate , speed , power , cadence , or any other parameter to be controlled may be defined for the section . if desired , multiple parameters to be controlled may be defined . if desired , the desired profile of the parameter or parameters during the section may be specified . if desired , a section may be defined with no parameter to be controlled . for example , the desired heart rate for a section may be 100 beats per minute at the start of the section , and may increase linearly to a value of 130 beats per minute at the end of the section . in step 5770 , the duration of each section may be defined . the duration may be measured in units of time , units of distance , or any other suitable units . in step 5780 , the controlling parameter for the section may be defined . for example , to control the heart rate , the athlete &# 39 ; s speed may be controlled by sending audible prompts , the speed may be controlled by sending commands to a piece of exercise equipment , or the resistance may be controlled by sending commands to a piece of exercise equipment . if desired , multiple controlling parameters may be specified . if desired , limits on the values or rate of change of the controlling parameter may be specified . in step 5790 , repetitions of sections may be defined . for example , two sections may be alternated , and the combination may be repeated four times . any other suitable attributes of a section may also be defined . if desired , the definition of one section may be copied from the definition of another section . fig5 shows illustrative screen 5800 that may be shown on athlete &# 39 ; s computer or coach &# 39 ; s computer for defining a workout . region 5810 may be used to enter the total number of sections . region 5820 may be used to enter the duration of a section , in this example in minutes . selection 5830 may be used to choose the parameter to be controlled . in this example , heart rate has been chosen , and other choices are cadence , power , and speed . the user may also choose to control no parameter during the section . selection 5840 may allow the user to specify the type of control , such as constant , between two values , linear , or on a defined curve . in this example , the user has chosen linear control . in region 5850 , the user may enter the value or values at which to control the parameter . in this example , the user has entered a desired starting and ending heart rate for the section . selection 5860 may allow the user to specify the controlling parameter , such as controlling heart rate by controlling speed or difficulty . in this example , the user has chosen difficulty as the controlling parameter . scroll bar 5880 may allow the user to view and modify more fields , such as parameters for other sections in the workout . menu bar 5870 may allow the user to access other features , such as file features ( e . g ., save and loading workout session definition files ), edit features , download features ( e . g ., downloading workout definitions from a coach &# 39 ; s computer or to an inc of the mpn ), and help features . fig5 shows illustrative data structure 5900 that may be used to store information about a workout session . this data structure or a similar structure may be stored in a personal computer , in memory in an inc of the mpn , or in any other suitable location . if desired , similar information may be stored in multiple data structures . a workout session may consist of multiple “ super sections ,” wherein each super section consists of one or more sections , and wherein each super section may be repeated multiple times . data structure 5900 may include a definition of the number of super sections 5910 . it may also include the definition of each super section , such as super section definition 5920 , super section definition 5940 , and super section definition 5960 . each super section definition may include a definition of number of sections in the super section , such as definition 5921 , definition 5941 , and definition 5961 . each super section definition may include a definition of number of times the super section is to be repeated during the workout session , such as definition 5922 , definition 5942 , and definition 5962 . section a definition 5925 may specify that the section is to have a duration of 15 minutes in duration definition 5926 . it may specify that the heart rate is to be controlled in primary parameter definition 5927 , and that the heart rate is to follow a linear curve from 100 beats per minute to 125 beats per minute in curve definition 5928 . it may specify a secondary parameter of cadence , which is to be kept at a rate of 90 revolutions per minute in secondary parameter specification 5929 . it may specify in controlling parameter definition 5930 that the heart rate is to be controlled by user audio prompt . in this definition , section a is to occur once during the workout session . section b definition 5945 may specify that the section is to have a duration of 5 minutes in duration definition 5946 . it may specify that the heart rate is to be controlled in primary parameter definition 5947 , and that the heart rate is to be maintained in a range between 150 beats per minute and 160 beats per minute in curve definition 5948 . it may specify a secondary parameter of cadence , which is to be kept at a rate of 90 revolutions per minute in secondary parameter specification 5949 . it may specify in controlling parameter definition 5950 that the heart rate is to be controlled using a resistance setting output . section c definition 5955 may specify that the section is to have a duration of 1 minute and 30 seconds in duration definition 5956 . it may specify that speed is to be controlled in primary parameter definition 5957 , and that the speed is to be maintained below 15 miles per hour in curve definition 5958 . it may specify a secondary parameter of resistance , which is to be kept at the easy setting in secondary parameter specification 5959 . it may specify in controlling parameter definition 5960 that the speed is to be controlled by user audio prompt . in this definition , section b and section c are combined into a single super section , which is to occur twice during the workout session . section d definition 5975 may specify that the section is to have a duration of 15 minutes in duration definition 5976 . it may specify that the heart rate is to be controlled in primary parameter definition 5977 , and that the heart rate is to be maintained at a constant rate of 110 beats per minute in curve definition 5978 . it may specify a secondary parameter of cadence , which is to be kept at a rate of 90 revolutions per minute in secondary parameter specification 5979 . it may specify in controlling parameter definition 5980 that the heart rate is to be controlled by user audio prompt . in this definition , section d is to occur once during the workout session . fig6 shows flow chart 6000 of an illustrative process for controlling multiple sections of a workout . all steps are optional and may be performed in any suitable order . in step 6010 , an athletic workout session may be defined as multiple sections . this workout definition may occur , for example , on an athlete &# 39 ; s computer or on a coach &# 39 ; s computer . in substep 6012 , the definition may specify that a section is to be repeated multiple times during a workout session . the repetitions do not have to be consecutive . in substep 6014 , groups of sections , such as super sections , may be repeated multiple times . in substep 6016 , one section may be a copy of another section , in the same workout or in another workout . in substep 6018 , one section may be a variation of another section , in the same workout or another workout . in substep 6020 , the starting value of a parameter in one sections may be specified as the ending value of the same parameter in the previous section . in step 6030 , the workout parameters for each section may be defined . this may include substep 6032 in which a performance parameter to be controlled may be specified . this may include , for example , heart rate , cadence , power , or speed . in substep 6034 , the desired value , values , or profile of the performance parameter to be controlled may be specified . this may include specifying a constant level , a defined curve , the end points of a linear variation , or two values to maintain the parameter between . if desired , a range above and below the desired curve may be defined . in substep 6036 , an output parameter to be used to control the performance parameter may be specified . in substep 6038 , one or more secondary performance parameters with corresponding desired values may be specified . in substep 6040 , the duration of the section may be specified , for example , in time or distance . after all workout parameters have been defined , they may be downloaded from the coach &# 39 ; s computer or athlete &# 39 ; s computer into memory in an inc of the mpn , such as a control unit , for use during the workout . if desired , the workout parameters may be transmitted directly from the coach &# 39 ; s computer into an inc of the mpn , or they may be transmitted over a wide area network such as the internet to the athlete &# 39 ; s computer , and downloaded from the athlete &# 39 ; s computer into an inc of the mpn . in step 6050 , data may be collected during the section of the workout session . that may include heart rate data in substep 6052 , speed data in substep 6054 , position data in substep 6056 , cadence data in substep 6058 , power data in substep 6060 , data from a sensor mounted on a piece of exercise equipment in substep 6062 , data from a sensor mounted on a bicycle in substep 6064 , or any other suitable type of input data . data collected during a workout may be presented to the athlete during the workout , for example on a display inc . if desired , collected data may be uploaded to a base station , the athlete &# 39 ; s personal computer or the coach &# 39 ; s personal computer , where they may be stored , displayed as a chart or graph , compared with results from previous workouts , or otherwise analyzed . if desired , collected workout results may be used to modify workout parameters of future workout sessions . in step 6070 , a performance parameter may be controlled during the section of the workout session . this may be done by prompting the user in substep 6072 . the prompt may be a visual prompt in substep 6074 or an audible prompt in substep 6076 . in substep 6078 , the prompt may be to change speed , change intensity or level of effort , change route , or any other suitable prompt . in substep 6080 , the control may be performed by changing a setting , such as a difficulty , speed , or resistance setting , on an output inc . in substep 6082 , the control may be performed by changing a setting on a piece of exercise equipment . in substep 6084 , the control may be performed using a position - integral - derivative ( pid ) servo algorithm , in which the value of an input parameter , the rate of change of the input parameter , and previous values of the input parameter are used to calculate a new value for the controlling parameter . the system may also include a set of limits on the output value to prevent it from exceeding a minimum value , a maximum value , and / or a maximum rate of change . in substep 6086 , the input data used in the algorithm may be data that was collected in step 6050 , and the definition of the input parameter and the controlling parameter may be part of the workout parameters that were defined in step 6030 . the constants in the servo equation may be standard values , may be entered or downloaded by a user , or may be derived and modified with use . in substep 6088 , one or more additional parameters may be controlled during the workout section , as specified in the workout parameters . for example , a secondary parameter may be maintained between two values in substep 6090 , maintained at a constant level , controlled linearly , or controlled in any other suitable fashion . in addition to directly collecting data to measure a performance parameter , an mpn may use stored information along with collected information to estimate a derived performance parameter . a process for doing so is illustrated in flow chart 6100 of fig6 . all steps are optional and may be performed in any suitable order . in step 6110 , previously collected personal data may be stored in an inc of the mpn . the personal data may be age in substep 6112 , gender in substep 6114 , weight in substep 6116 , resting heart rate in substep 6118 , maximum heart rate in substep 6120 , vo 2 max in substep 6122 , results ( e . g ., time and distance or speed and distance ) from a previous athletic effort in substep 6124 , or any other suitable personal data . the personal data may have been collected using an inc of the mpn , in step 6130 . alternatively , the personal data may have been downloaded in step 6135 , for example from an athlete &# 39 ; s computer or from a coach &# 39 ; s computer , where it may have been entered . in step 6140 , primary performance data may be collected , for example by an inc of the mpn during an athletic effort . the data may be a single sample , or it may be many samples collected over a period of time . in step 6150 , a secondary performance parameter may be estimated using the stored personal data and the collected primary performance data . in substep 6162 , maximum heart rate ( mhr ) may be calculated . mhr is the maximum rate at which the athlete &# 39 ; s heart can beat during a maximal effort , and is commonly measured in beats per minute . the mhr value may be entered by the user as personal data . the mhr may be estimated by the system based on the age and gender entered by the user . for example , mhr is commonly estimated as 220 - age in years . alternatively it may be estimated as 214 -( age * 0 . 8 ) for males and 209 -( age * 0 . 7 ) for females . another method of estimating mhr is 210 -( 0 . 5 * age )−( 0 . 05 * weight in pounds )+( 4 if male or 0 if female ). the estimate may be modified based on the specific type of activity or other factors . alternatively , mhr may be estimated based on actual heart rate measurements in a defined athletic effort . resting heart rate ( rhr ) may be entered by the athlete as personal data or it may be measured . rhr is a measure of the rate at which the athlete &# 39 ; s heart beats when at complete rest , and is also measured in beats per minute . rhr may be estimated based on actual heart rate measurements taken over a period of time , for example while the athlete is asleep . regardless of how mhr was entered , measured or estimated , the percent of maximum heart rate may be estimated by dividing actual heart rate ( hr ) by mhr , in substep 6154 . percent of heart rate reserve may be estimated as ( hr - rhr )/( mhr - rhr ), in substep 6156 . another performance parameter of interest to athletes is oxygen uptake ( vo 2 ) and maximum oxygen uptake ( vo 2 max ). vo 2 is a measure of the amount of oxygen removed from the blood and used by the muscles during an athletic effort . vo 2 max is a measure of the maximum amount of oxygen that can be used by the athlete during an effort . both are commonly measured in units of ml / kg / min . although the actual measurement of vo 2 requires sophisticated equipment , there are several known methods to estimate it . for example , in “ jack daniels , conditioning for distance running — the scientific aspects ,” wiley & amp ; sons , 1978 , the following formulas are used : in the above formulas , t is the time to complete a race - level effort in minutes , and v is the speed during the race in meters per minute . oxygen uptake may be estimated during an athletic effort in substep 6152 , using the above formula or any other suitable method . vo 2 max may similarly be estimated in substep 6166 . the system may also estimate the speed , heart rate , or other parameter corresponding to the level of effort at which vo 2 max is reached . if desired , time and speed data may have been entered by the athlete as personal data , or may be measured by the mpn . in substep 6158 , the system may estimate energy consumed during an athletic effort . energy consumption may be expressed in calories , and may be estimated based on age , gender , height , and weight , which may be entered as personal data . it may also be estimated based on type of activity , hr , speed , elevation gain , and other factors that may be measured during an athletic effort . similarly , the power exerted while exercising may be estimated in substep 6160 . lactate threshold ( lt ) may be estimated in substep 6164 . lt represents the highest level at which exercise may be maintained for an extended period without a build - up of lactate in the blood . it may be measured , for example as a percent of vo 2 max or a percent of mhr above which lactic acid begins to accumulate in the blood . it may be estimated , for example , by using the average heart rate for a maximal athletic effort over a half hour . alternatively , it may be estimated by measuring heart rate during a series of progressively more difficult efforts , and based on the rate of increase of heart rate between the efforts . in step 6170 , the estimated secondary parameter may be used to modify an athletic workout . for example , the intensity of a workout may be expressed as percent of lt , and during the workout the system may measure heart rate , estimate lt , and increase or decrease the speed setting of a piece of exercise equipment to maintain the proper level of effort . in step 6175 , the user may be prompted to modify the level of effort based on an estimate of a secondary performance parameter . for example , the intensity of a workout may be expressed as percent of vo 2 max , and during the workout the system may measure heart rate , estimate vo 2 , and prompt the user to speed up or slow down to maintain the proper level of effort . the estimated secondary parameter may also be displayed for the user by the mpn , or it may be uploaded to a base station or personal computer to be stored , displayed , or analyzed . fig6 shows illustrative mpn 6200 that may be used to measure a primary performance parameter and estimate a secondary performance parameter . inc 6210 may be a control unit or other inc with memory and processing capabilities , and may include software to control the other incs , as well as to perform the estimation . it may also include memory to hold software , as well as downloaded personal data such as age , gender , and weight . it may also include a communications device to download the personal data . inc 6220 may be a display inc , on which the primary and secondary performance parameters may be displayed . inc 6230 may be a heart rate sensor , used for monitoring the athlete &# 39 ; s heart rate , which may be a primary performance parameter . inc 6240 may be an accelerometer for measuring cadence , which may also be a primary performance parameter . inc 6250 may be an audio output inc , which may be used to prompt the user to modify the level of effort based on the estimated secondary performance parameter . these incs are merely illustrative , and all incs are optional . fig6 shows illustrative display screen 6300 that may be displayed by the athlete &# 39 ; s personal computer to allow the entry of personal data . it may include entry region 6310 for entering the athlete &# 39 ; s name . it may include entry region 6320 for entering the athlete &# 39 ; s age . it may include entry region 6330 for entering the athlete &# 39 ; s weight . it may include selection 6340 for entering the athlete &# 39 ; s gender . it may include entry region 6350 for entering the athlete &# 39 ; s height . it may include entry region 6360 for entering the athlete &# 39 ; s rhr . it may include entry region 6370 for entering the athlete &# 39 ; s mhr . these fields are merely illustrative . any suitable personal data may be entered on a screen such as display screen 6300 . display screen 6300 may also include menu bar 6380 , which may allow the user to perform other functions . other functions supported may include file - related functions ( e . g ., loading and storing personal data ), device - related functions ( e . g ., downloading personal data to a device ), system - related functions , user - related functions , security - related functions , and help - related functions . these functions are merely illustrative . fig6 a through 64f show illustrative display screens that may be displayed by a display inc in an mpn during an athletic effort . fig6 a shows screen 6410 , which may be a prompt for the athlete to go faster , and may be based on an estimated secondary performance parameter . fig6 b shows screen 6420 , which may display the athlete &# 39 ; s currently measured heart rate 6422 , percent of mhr 6424 , and percent of hrr 6426 . fig6 c shows screen 6430 , which may display the estimated vo 2 max 6432 , lt 6434 , and mhr 6436 at the end of a testing effort . fig6 d shows screen 6440 , which may display the athlete &# 39 ; s estimated vo 2 during or after an effort . fig6 e shows screen 6450 , which may display the athlete &# 39 ; s cumulative energy consumption for a workout 6452 and current power exertion 6454 . fig6 f shows screen 6460 , which may show the athlete &# 39 ; s current actual percent of hrr 6462 , the target hrr range for the workout 6464 , and a prompt to the athlete 6466 to modify the level of effort based on those values . as described herein , the mpn may be used to collect data , such as heart rate and other athletic data . however , at times the data collection may be unreliable , for example because of interference with the wireless communications between incs in the mpn . temporary interference may be common because of nearby electro - mechanical devices , other radio frequency transmitters , poor contact between a metabolic sensor and the skin , and even static electricity between the athlete &# 39 ; s body and clothing . one way of handling this is by including memory in the data collection inc , and retransmitting any lost data once the interference is gone . however , this may not be practical , as it may significantly increase the cost of the data collection inc . also , at times data samples may not be collected successfully by the data collection inc , due to such factors as intermittent connections between the inc and the athlete &# 39 ; s body . therefore , the mpn may include algorithms to recognize invalid data samples and to estimate new values for the invalid samples . fig6 shows illustrative mpn 6500 that may be used to collect data and that may include detection of invalid data and estimation of replacement data for the invalid data . control unit 6520 may collect data samples from heart rate monitor 6530 using wireless communication path 6550 and store the collected heart rate data in memory in control unit 6520 . control unit may display heart rate data on display 6540 . control unit 6520 may detect invalid data received from heart rate monitor 6530 , perhaps due to a failure in communication path 6550 , and may estimate replacement data to store and to send to display 6540 . collected heart rate data may also be uploaded to personal computer 6510 and stored there . personal computer 6510 may recognize invalid samples , and may estimate replacement data for the invalid data samples . the collected heart rate data , including any estimated replacement data may be displayed on a monitor attached to personal computer 6510 . incs shown are merely illustrative . all incs are optional . fig6 shows flow chart 6600 of an illustrative process for estimating replacement data for invalid collected data . all steps are optional and may be performed in any suitable order . in step 6610 , data samples , such as athletic performance data samples , may be collected by an mpn . this may be , for example , heart beat data in substep 6612 , or heart rate data in substep 6614 . any suitable type of data may be collected . in step 6620 , one or more invalid samples may be recognized . the invalid samples may be recognized , for example , by a control unit while data is being collected or by a personal computer after collected data has been uploaded . in substep 6621 , invalid samples may be recognized on the basis of missing values . in substep 6622 , invalid samples may be recognized on the basis of zero values , i . e ., samples with the value of zero . in substep 6623 , invalid samples may be recognized on the basis of values outside a defined range , for example , heart rate data lower than the resting heart rate or greater than the maximum heart rate . in substep 6624 , invalid samples may be recognized on the basis of a rapid change in values , for examples values that indicate a very significant change in heart rate in a very short period of time . in substep 6625 , invalid samples may be recognized on the basis of values inconsistent with other data , for example significantly different from samples collected before and after , or for example heart rate data inconsistent with collected speed and elevation data . in step 6630 , replacement values may be estimated for the invalid samples . replacement values may be interpolated based on valid samples collected before , after , or both before and after the invalid samples in substep 6631 . replacement values may be interpolated linearly in substep 6632 . replacement values may be interpolated based on the first derivative of valid samples in substep 6633 . replacement values may be interpolated linearly based on the first derivative in substep 6634 . replacement data may be interpolated using a quadratic equation in substep 6636 . replacement data may be interpolated using a polynomial equation in substep 6638 , and may match the values and / or derivatives of valid samples at the end points of the interpolation range . the data may also be estimated based on data collected in previous sessions under similar conditions , for example , the rate of change of the data may be made to match the rate of change of data collected in the similar session . in step 6640 , the data samples may be listed , for example on personal computer 6510 ( fig6 ). in substep 6642 , estimated samples may be indicated in the listing . in step 6645 , the data samples may be graphed , for example on personal computer 6510 . in substep 6647 , estimated samples ranges may be indicated in the graph . in step 6650 , secondary data may be derived from the collected data . in step 6652 , the secondary data may be listed , for example on personal computer 6510 . in substep 6654 , secondary data values derived from estimated samples may be indicated in the listing . in step 6656 , the secondary data may be graphed , for example on personal computer 6510 . in substep 6658 , secondary data values derived from estimated samples ranges may be indicated in the graph . fig6 shows an example 6700 of heart beat data that may have been collected by an mpn . the data may include samples 6705 through 6740 . it may be seen that each sample is approximately 0 . 5 seconds after the previous , with the exception of sample 6725 . this sample was collected almost three seconds after the previous sample , indicating that samples were likely lost . by interpolation , it may be estimated that five samples were missed , and the user &# 39 ; s heart rate may be estimated at about 122 beats per minute during this time by dividing the number of samples by the time . fig6 a and 68b illustrate how samples may be estimated to replace invalid samples . fig6 a shows illustrative heart rate sample data 6800 that may have been collected at a regular interval , such as every 15 seconds . in this example , heart rate data is increasing at a rate of eight beats per minute per minute in first sample range 6805 . heart rate data samples are all zero and are assumed to be invalid in second sample range 6810 . heart rate data is increasing at a reduced rate of four beats per minute per minute in third sample range 6815 . heart rate data samples are all out of range and are assumed to be invalid in fourth sample range 6820 . and heart rate data is decreasing at a rate of one beat per minute per minute in fifth sample range 6825 . fig6 b shows how replacement values may be created for the invalid samples , creating revised heart rate sample data 6830 . range 6835 , which corresponds to range 6810 in the original data , has been filled using a linear interpolation between samples collected just prior to and just after the invalid data in range 6810 . similarly , range 6840 , which corresponds to range 6820 in the original data , has been filled using a linear interpolation between samples collected just prior to and just after the invalid data in range 6820 . fig6 a shows illustrative display screen 6900 , which lists and graphs collected sample heart rate data . sample data list 6905 may include estimated samples 6910 . estimated samples may be marked as estimated , for example with an asterisk . the sample data may also be shown in graph 6915 . range 6920 of the graph , corresponding to the estimated data , may be drawn with a different line style to indicate that the samples were estimated . fig6 b shows illustrative display screen 6950 , which lists and displays average heart rate data derived from the collected heart rate data samples . data list 6955 may include data point 6960 and 6970 derived from estimated samples . estimated data may be marked as estimated , for example with an asterisk . the derived data may also be shown in graph 6965 . values 6960 and 6970 on the graph , corresponding to the data derived from estimated samples , may be marked , for example with an asterisk , to indicate that data is estimated . an mpn may also be used to provide an athlete , such as a runner or walker , with cadence information and stride length information . fig7 shows flow chart 7000 of an illustrative process for providing this information . all steps are optional and may be performed in any suitable order . in step 7010 , an accelerometer may be provided as an inc in the mpn . the accelerometer may send acceleration data to a control unit or other inc with storage capabilities at regular intervals . if desired , multiple accelerometers may be used to measure motion by different parts of the body , or components of motion in different directions . in step 7020 , the accelerometer may be worn by the user . for example , it may be worn on the leg in substep 7022 , the foot in substep 7024 , the arm in substep 7026 , or the hand in substep 7028 . in step 7030 , the accelerometer may be used to measure cadence . for example , a control unit may collect the data from the accelerometer , and measure the frequency at which the data reaches its relative maximums and minimums . this may correspond to the rate at which the user is swinging his or her arms or moving his or her legs , which translates directly to cadence . in step 7040 , a position monitor may be provided as an inc in the mpn . the position monitor may be a gps monitor in substep 7042 . the position monitor may send position data to a control unit or other component with storage capabilities at regular intervals . the position monitor may also be worn by the user . in step 7050 , the position monitor may be used to measure the user &# 39 ; s speed , which can be calculated as distance traveled divided by time . in step 7060 , stride length may be calculated based on the speed and cadence of the user . in substep 7062 , the stride length may be calculated as speed divided by cadence . if desired , the units of stride length displayed to the user may be converted to feet , meters , or other appropriate units . if desired , any of speed , cadence , and stride length may be displayed for the user . fig4 g shows an example of how cadence may be displayed on a display inc in the mpn . fig4 h shows an example of how stride length may be displayed on a display inc in the mpn . if desired , any of speed , cadence and stride length may be recorded for the duration of a session , and uploaded to a personal computer or base station for storage , display , or analysis . fig4 shows illustrative mpn 4400 that may be used to calculate and display cadence and stride length . a significant impact on athletic performance is the loss of certain valuable consumables by the athlete during a training or competition event . for example , as the user continues at a high level of exertion , levels of water , sodium , carbohydrates , and other nutrients will decrease , and performance will correspondingly decrease . as levels decrease further , performance levels will decrease at an even higher rate , until the athlete is no longer able to continue . however , if the athlete consumes too much of any of these consumables , performance will also suffer , with conditions such as stomach distress and cramping , hyponatremia , and hypernatremia . the mpn can be used to measure the usage or loss of such consumables , and provide the athlete with reminders to take in specific amounts of one or more of them . fig7 shows flow chart 7100 of an illustrative process for providing consumption reminders to an athlete . all steps are optional and may be performed in any suitable order . in step 7110 , metabolic data may be collected from a user such as an athlete . for example , an inc in an mpn may include a sensor to measure a specific metabolic value . in substep 7112 , heart rate data may be collected . in substep 7114 , skin resistance data may be collected . in substep 7116 , body temperature data may be collected . in substep 7118 , blood pressure data may be collected . in step 7120 , the loss of a consumable may be estimated based on the metabolic data . for example , water may be estimated in substep 7122 , carbohydrates in substep 7124 , and sodium in substep 7126 . a rate of loss of each consumable based on level of effort indicated by heart rate may be used skin resistance may be used to measure the amount of sweat , which translates to water and sodium loss . an increasing body temperature or blood pressure may indicate a significant loss of water . need may also be estimated based on information stored about the athlete , such as weight or gender . in step 7130 , time may be measured since the most recent reminder , and the time may be used to refine the estimate of lost consumables . in step 7140 , the mpn may include an inc to measure the amount of consumable , such as energy drink or water , carried by the user . the measured amount may be reported to the user . additionally , the measured amount may be used to calculate the amount previously consumed by the user , and may be used to refine the estimate of needed consumables . in step 7150 , the user may be reminded to consume a consumable based on the estimated loss . in substep 7152 , the reminder may be presented when the loss or usage reaches a defined amount . in substep 7154 , the user may be told a specific amount of the consumable to consume . in substep 7156 , the user may be given an audible reminder . in substep 7158 , the user may be given a visual reminder . fig7 shows illustrative mpn 7200 that may be used to provide consumable reminders to an athlete . inc 7210 may be a control unit , which may include memory for storing input data samples , a processor for estimating consumable loss , and a wireless communications device for receiving metabolic data and sending reminders to the user . inc 7220 may be a metabolic data monitor , such as a skin resistance monitor , body temperature monitor , or blood pressure monitor . inc 7230 may be an audio output inc for providing audible reminders . inc 7240 may be a display inc for providing visual reminders . inc 7250 may be a device capable of measure the volume of consumable in , for example , a bladder worn by the user . inc 7260 may be a heart rate monitor . incs shown are merely illustrative and are optional in practice . fig7 shows illustrative display screen 7300 that may be provided on display inc 7240 ( fig7 ). prompt 7310 may tell the user to consume a specific amount of consumable , in this case four ounces of sports drink . information display 7320 may tell the user how much sports drink is remaining . display 7330 may inform the user that a salt pill should be taken in 15 minutes . an mpn may be used by a swimmer to provide swimming - related information , such as lap counts . this is illustrated in flow chart 7400 of fig7 . all steps are optional and may be performed in any suitable order . in step 7410 , the mpn may include a monitor , such as a flow meter , which may be worn by the swimmer in a swimming pool . other examples of monitors that may be used include a turbulence meter , or an accelerometer to measure arm or leg movements . preferably , the monitor should provide data with one characteristic while swimming and another characteristic while turning . if desired , multiple monitors may be worn , of the same or different types . in step 7415 , the monitor may be used to measure a parameter , such as rate of flow of water past the user &# 39 ; s body , amount of water turbulence near the user &# 39 ; s body , arm movements , or leg movements . in step 7420 , a characteristic of the parameter may be evaluated . for example , one characteristic of the flow may be the irregular readings during the turbulence of the turn at the end of the pool , as opposed to the more cyclical readings seen while swimming . water flow may maintain a fairly constant positive value while swimming , and may vary in rate and direction while turning . arm or leg movements may have different characteristics while swimming various strokes , while kicking , while turning , or while resting . arm or leg movements may be regular and cyclical while swimming , and irregular while turning or resting . if desired , multiple characteristics of the measurement may be evaluated to determine which of several strokes is being used . in step 7425 , transitions between the two values or characteristics may be counted . in step 7430 , the count of transitions may be used , to provide a lap count . if desired , more than two characteristics of the parameter may be measured . for example , a third characteristic may be seen while the swimmer rests at the end of the pool . also , different characteristics may be seen when the swimmer performs different strokes . for example , a system in which an athlete wears a water flow meter and a single accelerometer on one wrist can be used to detect the difference between swimming the crawl , breaststroke , backstroke , butterfly , and kicking . in step 7440 , the duration of the two or more characteristics may be measured , and this measurement may be used to provide a lap time in step 7445 . if desired , the measured lap time may be compared with a typical lap time in step 7450 , and validated that it falls within a normal range . for example , if two consecutive measured lap times are much less than the typical lap time , the user may have paused in the middle of a lap . similarly , the turn time may be measured in step 7460 , and may be validated in step 7465 . typical lap times and typical turn times may be standard values , they may be entered by the swimmer , they may be measured during a calibration swim , or they may be entered in any other suitable way . in a calibration swim , for example , the swimmer may swim a small number of laps of each stroke , while the system measures the characteristics of the data collected by the monitor and measures the typical lap times . based on the data collected during a swim workout , the system may construct a model of the entire workout , including each swim , with type of stroke , speed , and distance for each swim , duration of rest periods , and other data . the data from the model may be stored , displayed , graphed , analyzed , or processed in any other suitable manner . fig7 shows illustrative mpn 7500 that may be used to provide lap swimming information . inc 7510 may combine the functions of a control unit and a flow meter , and may be configured to be worn attached to the swimsuit . inc 7520 may combine the functions of a display and an accelerometer and may be configured to be worn on the wrist . inc 7530 may be an audio output inc , and may be configured to be worn attached to a goggle strap or swim cap . inc 7540 may be an input inc worn on the foot , and it may be operated by tapping the end or bottom of the pool . incs shown are merely illustrative and are optional in practice . fig7 a shows an example of a screen 7600 that may be displayed on display inc 7520 ( fig7 ) to provide distance information to the swimmer . for example , the swimmer may have configured the system with the length of the pool , and the mpn may convert a lap count into a total distance 7605 for display . screen 7610 of fig7 b may be provided on display inc 7520 at the conclusion of a swim . it shows the distance of the swim 7612 which may have been derived from the measured lap count . it shows the swim stroke 7615 , which may be determined automatically based on the characteristic of data measured by input inc 7510 and 7520 ( fig7 ). screen 7610 also includes total swim time 7620 , which may be measured by the system . fig7 shows illustrative display screen 7700 which may be shown on a monitor attached to a personal computer , after data has been uploaded from inc 7510 ( fig7 ) of the mpn . date and time of workout 7710 may be displayed , and may have been determined automatically by a clock embedded in inc 7510 . distance 7720 may be listed for each swim , along with stroke 7722 and time 7724 . rest times 7726 may also be listed . the user may be allowed to scroll through more data , using scroll bar 7730 . other functions may be available using menu bar 7740 . other functions may include file - related functions ( e . g ., loading and saving data sets ), data - related functions ( e . g ., viewing different subsets of data , or viewing the data in different formats or units ), profile - related data ( e . g ., defining the length of the pool , typical swim times , etc . ), history - related functions ( e . g ., comparing performance between swim sessions ), and help - related functions . an mpn may be used to provide form or gait feedback to an athlete or other user . through the use of one or more accelerometers mounted on a part of the body that is moved during a particular activity , the system may compare the measured movements with ideal movements , and provide feedback to the user . an example of such a process is shown in flow chart 7800 of fig7 . all steps are optional and may be performed in any suitable order . in step 7810 , a user may be allowed to wear an accelerometer , which may be included in an inc of an mpn . it may be worn on a part of the body that is moved , intentionally or unintentionally , during an activity for which the user desired form feedback . for example , it may be worn on a foot , leg , hand , arm , or wrist . any other suitable part of the body may also be monitored . in step 7815 , multiple accelerometers may be worn by the user . multiple accelerometers may be worn on a single part of the body , for example to provide validation of readings , or to provide readings of different components of motion in different directions . accelerometers may be worn on corresponding parts of the body , on opposite sides , such as opposite arms or legs , for example to monitor symmetry of motion . accelerometers may be worn on different parts of the body , such as an arm and a leg , for example to monitor different motion aspects of an activity . in step 7820 , the user may be allowed to wear the accelerometer or accelerometers during a training activity . for example , one or more accelerometers may be worn while running in substep 7821 , walking in substep 7822 , swimming in substep 7823 , bicycling in substep 7824 , rowing , during a physical therapy activity in substep 7825 , or during any other suitable activity . in step 7830 , characteristics of desired movements of the monitored part or parts of the body may be stored . for example , the characteristics may have been captured by an expert in the activity wearing one or more accelerometers in the same location or locations . alternatively , the characteristics may have been generated by monitoring multiple users and averaging the results , or by calculating optimum characteristics theoretically . if desired , the characteristics of desired motions may be stored in a personal computer , or they may be downloaded into memory in an inc of the mpn . if desired , a coach or physical therapist may wear the accelerometer or accelerometers and demonstrate the motion , while the mpn captures the characteristics of the coach &# 39 ; s motions or therapist &# 39 ; s motions . in step 7835 , data from the accelerometer or accelerometers may be collected during the training activity . if desired , the collected accelerometer data may be uploaded from the mpn into a personal computer . in step 7840 , the system may compare the collected accelerometer data with the stored characteristics of desired motion . this comparison may be performed in the mpn , for example using a control unit , or it may be performed using a personal computer to which the data was uploaded . in step 7845 , the comparison may be used to evaluate the user &# 39 ; s form during the training activity , for example to determine incorrect aspects of the user &# 39 ; s form . for example , while running , incorrect form may include over - striding , under - striding , lifting the feet too high , crossing the arms excessively in front of the body , or any other suitable type of incorrect form . feedback on incorrect form may be provided to the user during the activity in step 7850 . this may be audible feedback , for example using an audio output inc , and may be synthesized voice . the feedback may be visual feedback , for example using a display inc . in step 7855 , feedback may be provided to the user after the training activity has been completed , for example using a personal computer . the raw data may be collected and uploaded to the personal computer , which may provide the comparison to create the feedback . alternatively , the comparison may be performed in an inc of the mpn , and the results of the comparison may be collected and uploaded to the personal computer . the feedback may be in the form of a chart , table , or graph , it may be displayed or printed , or it may be presented in any other suitable form . form feedback data may be combined with other suitable data when displayed , such as time , speed , or percent grade uphill or downhill . in step 7860 , the collected data or the form feedback may be transmitted to a coach or physical therapist , for example over a network such as the internet , and the coach or physical therapist may view the data or feedback . fig7 shows an example of an mpn 7900 that may be used to provide form feedback based on accelerometer data collected during a training activity . inc 7930 may be a control unit . the control unit may include a processor to control the data collection and to perform the form comparison . it may also include memory to store desired form characteristics and collected data . it may also include a wireless communications device for collecting accelerometer data and for providing form feedback . inc 7920 may be an accelerometer mounted on the left wrist , for measuring movements of the left arm . inc 7910 may be a display inc for providing visual feedback to the user . if desired , a display inc and an accelerometer may be combined into a single inc . inc 7940 may be an audio output inc , for providing audible form feedback . incs 7950 may be accelerometers worn on the feet for measuring movements of the legs and feet . if desired , accelerometers may be worn on any part of the body , and may be combined with any other inc . if desired , an accelerometer may be worn on a part of the body that is not expected to move , and the system may use it to detect incorrect motions by that part of the body . incs shown are merely illustrative and are optional in practice . fig8 a through 80c show examples of screens that may be shown on display inc 7910 ( fig7 ) during a training activity such as running or walking , to provide form feedback to a user . screen 8010 of fig8 a may suggest that the user shorten his or her stride , if the collected data indicates a stride length longer than the desired stride length . screen 8020 of fig8 b may suggest that the user relax his or her shoulders . tightly held shoulders may be inferred , for example , based on the range of motion measured from the arms . screen 8030 of fig8 c may suggest that the user run with less bounce , for example if the collected data indicates too much vertical motion . any suitable type of feedback may be provided for any suitable characteristic of the training activity . any suitable training activity may be monitored . feedback may be provided audibly during the training activity if desired , for example using audio output inc 7940 ( fig7 ). screen 8100 of fig8 is an illustrative example of a display screen that may be displayed after a training activity on a personal computer , to provide form feedback on the training activity . the screen may be displayed for the user ( e . g ., athlete or physical therapy patient ) or may be displayed for a coach , physical therapist or other interested party . graph 8110 may include curve 8120 of ideal motions , and curve 8130 of actual motions . this type of graph may illustrate the parts of the user &# 39 ; s motions that vary from the ideal motions . if desired , multiple types of curves may be shown on the same graph . for example , the forward component of the motion may be represented using one curve , and the side - to - side component of the motion may be represented using a second curve . as another example , motions of both legs or of both arms may be shown on a single graph , or motions of an arm and a leg may be shown on the same graph . legend 8140 may illustrate the line styles of the various curves . menu bar 8150 may provide access to various functions , such as file - related functions ( e . g ., saving or loading collected data files or loading a file with a different set of ideal characteristics ), session - related functions ( e . g ., looking at data from different training sessions ), data - related functions ( e . g ., looking at data collected using different accelerometers during a single session ), or help - related functions . an mpn may be used to provide an athletic training journal . fig8 shows flow chart 8200 of an illustrative process for providing an athletic training journal . all steps are optional and may be performed in any suitable order . in step 8210 , a mobile electronic journal may be provided , for example as described earlier in connection with fig4 . in step 8220 , the journal may include an exercise database . for example , the exercise database may include a list of different types of exercises , and may include characteristics of each , such as calories burned per hour at different intensities or muscle groups trained . the exercise database may also include data on recommended levels , types , and amounts of exercise . in step 8230 , the journal may include a nutrition database . for example , the nutrition database may include a list of different types of foods , and characteristics of each , such as calories , amount of fat , carbohydrates , protein , and other nutrients . the nutrition database may also include data on recommended amounts of various types of nutrients . in step 8240 , the journal may include a competition database . the competition database may include lists of competitions of various types of activities , results , times , and other information . in step 8250 , the journal may include a personal database . the personal database may include data on the user &# 39 ; s own exercise needs or plans , the user &# 39 ; s own nutrition needs , the user &# 39 ; s own competition history or goals , or other suitable user data . it may include data on the user &# 39 ; s weight , body fat percentage , waist measurement , and other suitable health measurements . in step 8260 , the journal may include an athletic data collection inc . for example , it may include a heart rate monitor , a blood pressure monitor , a stopwatch , or other inc that may be used to measure athletic performance . in practice , the user may enter journal entries related to exercise , nutrition , competition , health , and other related items . for example , the user may log foods eaten , exercises performed , competitions entered , and other items of interest . if desired , journal entries may be linked to suitable database entries . the journal may make automatic calculations related to the journal entry and the database , such as calories consumed or burned , nutrition taken in or needed , etc . journal entries may also be linked to audio or video media files , clock data , position data , or other suitable information . as described in step 3255 of flow chart 3200 of fig3 , an mpn may be used to provide physical therapy functions . this is illustrated in more detail in fig8 . all steps are optional and may be performed in any suitable order . in step 8310 , the mpn may be used to measure range of motion . for example , a range of motion monitor may be one of the incs in the mpn . in step 8320 , the mpn may be used to measure gait or do gait analysis . for example , the form feedback functions described previously in conjunction with fig7 may be used . in step 8330 , the mpn may be used to test muscle strength . for example , a muscle - strength tester may be incorporated into an inc of the mpn . in step 8340 , the mpn may be used to measure changes in a user &# 39 ; s physical capabilities . this may be done , for example , using the functions of the mobile electronic journal described in conjunction with fig4 . if desired , the mobile electronic journal used for physical therapy purposes may include a patient database , a treatment database , an insurance database , a diagnostic database , a range of motion sensor , accelerometers to be used for form feedback , a muscle strength tester , or other appropriate incs . as described in step 3215 of flow chart 3200 of fig3 , an mpn may be used to provide medical functions . this is illustrated in more detail in fig8 . all steps are optional and may be performed in any suitable order . in step 8410 , an inc may be worn or carried by a doctor , patient or nurse , mounted on equipment such as a wheelchair , or implanted , ingested , or injected into a patient . any suitable method of providing a portable medical inc may be used . in step 8420 , an inc of the mpn may be used to measure a metabolic value of a patient . this may include heart rate in substep 8421 , blood oxygen level in substep 8422 , body temperature in substep 8423 , skin resistance in substep 8424 , breath rate in substep 8425 , blood pressure in substep 8426 , blood sugar level in substep 8427 , or any other suitable metabolic parameter . in step 8430 , the mpn may be used to automatically detect a medical problem . in step 8440 , the mpn may control a medical device , such as a treatment device . the medical device may be an inc in the mpn , or an inc in the mpn may send commands to the device . in substep 8445 , the mpn may control a syringe pump . in step 8450 , the mpn may provide emergency communications , such as an alert to emergency medical personnel . in step 8460 , the mpn may provide storage of medical records . in step 8465 , the mpn may provide storage of insurance information . in step 8470 , the mpn may store a medical database , such as a treatment database , diagnostic database , pharmaceutical database , medical instrument database , or health alert database . in step 8480 , the mpn may provide a medical journal . fig8 shows flow chart 8500 of an illustrative process for using a measured metabolic parameter to detect a medical problem . all steps are optional and may be performed in any suitable order . in step 8510 , a metabolic parameter of the user may be measured , for example by an inc of the mpn . this may include measuring heart rate in substep 8511 , blood oxygen level in substep 8512 , body temperature in substep 8513 , skin resistance in substep 8514 , breath rate in substep 8515 , blood pressure in substep 8516 , blood sugar level in substep 8517 , or any other suitable metabolic parameter that may be measured using a portable system . in step 8520 , the system may use the measured metabolic parameter to estimate a medical problem . other factors may also be used to estimate the medical problem , such as information stored about the user , level and time of exertion , water and other substances consumed , or other suitable data . estimating a medical problem may include detecting a medical problem , predicting a medical problem , or estimating the likelihood that the medical problem exists or will occur . for example , the system may estimate the likelihood that the user is affected with dehydration in substep 8521 , hyponatremia in substep 8522 , a heat injury in substep 8523 , heat cramps in substep 8524 , heat exhaustion in substep 8525 , heatstroke in substep 8526 , heart attack in substep 8527 , hypoglycemia in substep 8528 , hyperglycemia in substep 8529 , insulin shock , diabetic coma , or any other medical problem . the system may take an action to address the estimated medical problem in step 8530 . for example , a prompt may be provided to the user , visually or audibly , in step 8540 . that may include a prompt to drink in substep 8541 , a prompt to consume sodium in substep 8542 , a prompt to slow down in substep 8543 , a prompt to cease activity in substep 8544 , a prompt to eat in substep 8545 , a prompt to take insulin in substep 8546 , a prompt to take medication in substep 8547 , a prompt to seek emergency medical attention in substep 8548 , or any other suitable prompt . if desired , the system may send an alert message in step 8550 . for example , a radio frequency message may be sent to emergency medical personnel . in step 8560 , an audible alert may be sounded . if desired , the action may include control of a medical treatment device , such as a portable syringe pump , an implanted defibrillator , or other suitable device . fig8 shows more detail of step 8480 ( fig8 ), providing a mobile electronic medical journal . all steps are optional and may be performed in any suitable order . in step 8610 , a mobile electronic journal may be provided as described earlier with reference to fig4 . in step 8620 , a treatment database may be provided , which may provide information about different types of medical treatments . a diagnostic database may be provided in step 8625 , and may contain information about different medical diagnoses . a patient database may be provided in step 8630 , and may include information about patients of a medical provider , such as medical history , previous diagnoses , previous treatments , family medical history , risk factors , insurance and payment information or other suitable types of information . in step 8635 , a pharmaceutical database may be provided , and may include information about various drugs , including indications for use , recommended dosage , side effects , availability , and other suitable drug information . in step 8640 , an insurance database may be provided , and may include information about different insurance providers , such as types of policies , payment histories , covered expenses , and other suitable information . a medical instrument database may be provided in step 8645 , and may include information about various medical instruments , their uses , risks , and other related data . a health alert database may be provided in step 8650 , and may include information about current and recent health alerts , such as may be issued by public agencies like the centers for disease control . any journal entry may be linked to one or more elements from one or more of the included databases . each journal entry may have one or more linked images or video clips . medical images such as x - rays , cat scans , mris , bone scans and the like , may also be input and linked to journal entries . each journal entry may also have one or more audio clips , such as a doctor &# 39 ; s dictation . the dictation may be translated into text using voice recognition software if desired . the journal may include a medical diagnostic instrument in step 8660 , and a journal entry may be linked to one or more readings from the instrument . the journal may include a medical treatment device in step 8670 . any journal entry may be linked to a usage report of the treatment device . fig8 shows an illustrative block diagram of a mobile electronic medical journal 8700 . journal 8700 may include processor 8710 , which may , for example , be in a control unit . image memory 8712 for holding images and other user data and library memory 8714 for holding one or more databases may also be included in the control unit if desired , and if desired may be the same memory . digital camera 8720 may be provided . it may be capable of capturing video still images to link to journal entries . if desired it may also be capable of capturing video clips for the journal entries . communications device 8730 may be used for downloading database information and uploading journal entries . text input inc 8740 , drawing pad / touch screen input 8742 , and voice input inc 8744 may be provided to allow text , drawing , and voice portions of a journal entry respectively . if desired , voice input inc 8744 may also include a voice recognition capability . a device such as a scanner may also be included to input medical images . clock 8750 may be provided to tag journal entries with the current time . medical device 8752 may be included to perform a medical function , and may be either a medical diagnostic / input device or a medical treatment device . if desired , multiple medical devices may be included . display 8760 may also be provided to view journal entries , database information , and other data . if desired , an audio output inc , not shown , may be provided . incs may be separate devices , or may be combined in any suitable fashion . all incs shown are merely illustrative and are optional . fig8 shows more detail of step 3260 of fig3 , providing features for a disabled user . all steps are optional and may be performed in any suitable order . in step 8810 , braille may be output for a visually impaired user . for example , an inc may include an output device capable of generating braille characters . in step 8820 , audio may be output for a visually impaired user , in addition to or instead of a visual output . this may include speech generation . in step 8830 , information may be output visually for a hearing impaired user , in addition to or instead of an audible output . in step 8835 , voice input may be translated into a visual input for a hearing impaired user . for example , the mpn may include an audio input inc to accept a voice input that the user wishes to have translated . the system may use voice recognition to provide a visual display , which may be , for example , text or sign language . in step 8840 , voice input may be accepted from a physically impaired user . in step 8850 , breath input may be accepted from a physically impaired user . this may include allowing a user to input commands to the mpn by blowing into a tube . in step 8860 , one or more incs may be configured to be mounted on a wheelchair or other device used by a disabled user . as described in step 3265 of fig3 , an mpn may be used by a traveler to provide travel - related functions . this is illustrated in more detail in fig8 . all steps are optional and may be performed in any suitable order . in step 8902 , the system may provide language translation . it may translate from the user &# 39 ; s language to a second language , or from a second language to the user &# 39 ; s language . input may be text or it may be spoken with voice recognition . output may be text , spoken with speech generation , or both . translation may be based on a local dialect or local slang . in step 8904 , the system may provide currency conversion . it may convert home currency to travel currency , or travel currency to home currency . in step 8906 , the system may provide time zone conversion . it may allow the display of time in the local time zone , in the home time zone , or any other time zone . in step 8910 , the mpn may monitor the user &# 39 ; s position , for example using a gps monitor . information on the user &# 39 ; s position may be provided to the user in step 8912 . in step 8914 , the system may provide guidance to the user based on the user &# 39 ; s location . in step 8916 , the system may provide the user with information about a geographical region . this may include geographical information , local customs , laws , tipping guidelines , and other suitable local information . in step 8920 , the system may provide directions to a local business or attraction , which may be based on the user &# 39 ; s location . in step 8922 , a discount with a local business may be provided . in step 8924 , an advertisement for a local business may be provided to the user . in step 8930 , information may be provided about local flora and / or fauna . in step 8932 , the system may assist the user in identifying local wildlife . in step 8940 , the system may allow the user to maintain a travel journal . in step 8950 , the system may provide weather information , such as a local weather forecast . in step 8952 , the system may provide a transit schedule , such as an airline schedule to or from a travel location , local train and bus schedules , and the like . in step 8954 , the system may provide a local entertainment schedule . in step 8956 , the system may allow the user to track expenses , for example in either local or home currency . the system may accept text input in step 8960 , voice input in step 8962 , video input in step 8964 , still image input in step 8966 , sketch pad input in step 8968 , or any other suitable form of user input . in step 8970 , the system may be customized to a specific geographical region . for example , prior to a trip , a user may enter the destination or destinations into a software application running on a personal computer . suitable information for the specific region or regions may be downloaded over a network such as the internet , and may be downloaded into an inc of the electronic travel journal , such as a control unit . suitable information may include local language and dialect translation dictionaries , currency exchange rates , time zone information , information about a location , businesses , customs , laws , geography , wildlife , flora , climate information and weather forecasts , local transit schedules , local entertainment schedules , and any other suitable local information . if desired , local information may be updated while traveling , for example by connecting one of the incs to a connection such as an internet connection . fig9 shows a block diagram of illustrative mpn 9000 that may be used while traveling . mpn may include processor 9010 , which may , for example , be part of a control unit . image memory 9012 may be used for storing video images and other user inputs . database memory 9014 may be used to store downloaded data . image memory 9012 and database memory 9014 may be the same memory , and may be part of a control unit . digital camera 9020 may be provided . it may be capable of capturing video still images . if desired it may also be capable of capturing video clips . communications device 9030 may be used for downloading data into database memory 9014 , and for uploading user data form image memory 9012 . text input inc 9040 , drawing pad / touch screen input 9042 , and voice input inc 9044 may be provided to allow text , drawing , and voice input for travel features , respectively . if desired , voice input inc 9044 may also include a voice recognition capability . clock 9050 may be provided to tag user entries with the current time , and to provide a user time display . gps monitor 9052 may be included to provide location information in support of travel features . display 9060 may also be provided to view information . if desired , an audio output inc , not shown , may be provided . incs may be separate devices , or may be combined in any suitable fashion . step 8940 ( fig8 ), providing a travel journal , is described in more detail in fig9 . all steps are optional and may be performed in any suitable order . in step 9110 , a mobile electronic journal may be provided , for example as described in conjunction with fig4 . the travel journal may be configured , for example , as the mpn shown in fig9 . any suitable travel database or databases may be included and stored in database memory 9014 . for example , a database of local businesses may be provided in step 9120 . a database of local attractions may be provided in step 9121 . a database of local parks may be provided in step 9122 . a database of local plants may be provided in step 9123 . a database of local animals may be provided in step 9124 . a database of local geology may be provided in step 9125 . a database of local customs may be provided in step 9126 . any other suitable travel data may also be included . the database or databases may be downloaded into the database memory prior to a trip , based on the planned destination or destinations . if desired , any database may be updated during a trip , for example using communications device 9030 to connect to a network such as the internet . any journal entry may be allowed to link to one or more database elements from any of the supported databases . the travel journal may also provide any other suitable travel function or functions , such as language translation in step 9130 , currency conversion in step 9132 , time zone conversion in step 9134 , route guidance in step 9136 , electronic guidebook features ( e . g ., information about local customs , businesses , attractions , etc .) in step 9138 , advertisements in step 9140 , a discount at a local business in step 9142 , a local weather forecast in step 9144 , transit schedules in step 9146 , entertainment schedules in step 9148 , or expense management in step 9150 . if desired , any journal entry may be linked to an element from another travel feature . step 8932 ( fig8 ), assisting a user in identifying local wildlife , is described in more detail in fig9 . all steps are optional and may be performed in any suitable order . the mpn may be configured , for example , as shown in fig9 . in step 9210 , the user may be allowed to capture an image of wildlife , for example using digital camera 9020 , and it may be stored in image memory 9012 . in step 9220 , a library of images of wildlife may be stored , for example in database memory 9014 . the library of images may be downloaded into database memory 9014 in step 9222 for example using communications device 9030 . the images downloaded may be specific to a geographical region in step 9224 . in step 9230 , the captured image may be compared with the images from the library , using , for example , processor 9010 . in step 9232 , the system may allow the user to assist the search , for example by using a user input inc to narrow a list of potential matches . in step 9234 , one or more potential matches may be presented to the user , for example using display 9060 . in step 9240 , additional information may be provided for the wildlife in the library . for example , there may be text descriptions , descriptions of habitat and habits , sound samples characteristic of the wildlife , etc . in step 9250 , the user may be allowed to annotate the captured image . for example , the user may be allowed to add text in substep 9252 , voice or other captured audio in substep 9254 , a drawing in substep 9256 , or any other suitable type of user annotation . in step 9260 , the captured image may be automatically annotated . that may include an annotation with a link to any match or matches from the wildlife library in substep 9262 , the time the image was captured determined for example using clock 9050 in substep 9264 , the location at which the image was captured in substep 9266 determined for example using gps monitor 9052 , or any other suitable automatic annotation . fig9 shows more detail of step 3225 of fig3 , supporting outdoor enthusiast features with an mpn . all steps are optional and may be performed in any suitable order . in step 9310 , the mpn may provide directional information . for example , one of the incs may include a compass . in step 9320 , the mpn may provide position information , if for example one of the incs contains a position monitor . in step 9330 , the mpn may provide elevation information , using an inc that may include an elevation monitor . in step 9340 , the mpn may provide route guidance . guidance may be based on , for example , topographical information , trail maps , visual landmarks , and other items useful to a hiker , skier , snowshoer , or other outdoor enthusiast . the mpn may also provide weather related information , such as environmental temperature readings in step 9350 , humidity readings in step 9360 , or barometric readings in step 9370 . other suitable outdoor features may also be included if desired . fig9 shows more detail of step 3240 of fig3 , providing an identification function with an mpn . all steps are optional and may be performed in any suitable order . in step 9410 , the mpn may confirm an identity using a smart card , with an inc that may include a smart card reader . in step 9415 , the mpn may confirm an identity using a personal code or password , for example if one of the incs allows numeric or text entry . in step 9420 , an identity may be confirmed using biometrics . the biometric may be any suitable technique adapted to a portable inc in the mpn , and may include fingerprint analysis in substep 9421 , voice identification in substep 9422 , hand or finger scanning in substep 9423 , analysis of typing characteristics in substep 9424 , signature analysis in substep 9425 , iris scanning in substep 9426 , retina scanning in substep 9427 , or facial scanning in substep 9428 . if desired , other physical characteristics may be used for identification , such as athletic performance data or metabolic data . in step 9430 , exchange of money may be provided based on the confirmed identity . in step 9440 , the identity may be proven to another person . in step 9445 , the identity may be proven to another system , such as another mpn . in step 9450 , a product discount may be provided based on the confirmed identity . in step 9455 , product purchasing may be provided based on the confirmed identity . if desired , the system may store purchasing information , such as a credit card number , a bank account number , a bank balance , or any other suitable information . if desired , the personal identification may also be used to prevent unauthorized use of the mpn or any of its incs . the personal identification may also be used to provide secure access to restricted areas , features , and the like . fig9 shows more detail of step 3245 of fig3 , providing a personal security function with an mpn . all steps are optional and may be performed in any suitable order . in step 9505 , the mpn may be capable of providing an audible alert , such as a whistle or other alarm . in step 9510 , the mpn may be configured to provide an alert to public safety personnel . for example , an inc may be provided that includes a communication inc configured to transmit a message to an emergency dispatch facility , a police department , a fire department , or an emergency medical facility . the audible alert or emergency message may be triggered by a specific user input , or by any other suitable input or lack of input that may arise in the event of a personal or public emergency . in step 9520 , the mpn may store emergency contact information for the user , and may be configured to display or otherwise provide that information with suitable authorization . in step 9530 , the mpn may be configured to store emergency medical information , such as preexisting conditions , allergies , current prescriptions , etc ., and may be configured to display or otherwise provide that information with suitable authorization . fig9 shows more detail of step 3250 of fig3 , providing a military function in an mpn . all steps are optional and may be performed in any suitable order . for example , individual military members involved in ground support may each be equipped with an mpn having suitable incs and functions . the mpn may provide a communications function in step 9610 , such as instant message , and voice , data , text , or video communications . the mpn may provide location functions in step 9620 , such as providing the current location using a gps monitor . the mpn may include guidance functions in step 9630 . that may include guidance to specific position in substep 9632 , and directional information in substep 9634 . the mpn may provide weather functions in step 9640 . this may include barometric readings in substep 9642 , environmental temperature readings in substep 9644 , humidity readings in substep 9646 , or any other suitable weather function . as described in step 3270 of fig3 , an mpn may support multiple functions . some combinations have been described above . for example , providing both athletic and guidance functions was described in conjunction with fig4 a . providing both music and other audio cues was described in conjunction with step 2960 of fig2 . another example of an mpn 9700 that may be used for multiple purposes is shown in fig9 . mpn 9700 may include inc 9710 , configured to be worn on the wrist . inc 9710 may include a display inc , user controls , and a microphone . mpn 9700 may include inc 9720 , configured to be worn on a waistband . inc 9720 may include control unit functions , clock functions , storage of audio and video media , and a gps monitor . mpn 9700 may include inc 9730 , which may be a video / still camera configured to be worn on a waistband . mpn 9700 may include inc 9740 , which may be an audio output inc . mpn 9700 may include inc 9750 , which may be a heart rate sensor configured to be worn on the chest . these incs are merely illustrative . any suitable incs and method of carrying may be used . fig9 shows flow chart 9800 of an illustrative process for allowing multiple uses of mpn 9700 ( fig9 ). all steps are optional and may be performed in any suitable order . in step 9805 , the user may be allowed to listen to music . music may be stored digitally in inc 9720 and sent to inc 9740 to be heard . in step 9810 , the user may be allowed to collect media data . for example , using the microphone in inc 9710 and using inc 9730 , the user may collect audio data in substep 9812 , video data in substep 9814 , and still images in substep 9816 . in step 9820 , the mpn may collect personal data . that may include , for example , heart rate data 9822 collected from inc 9750 or other suitable athletic data 9826 , and speed , location 9824 , and elevation data collected from the gps monitor in inc 9720 . in step 9830 , the media data may be stored , for example in memory in inc 9720 . in step 9832 , the personal data may be stored , for example in memory in inc 9720 . in step 9834 , a relationship may be stored between the media data and the personal data . for example , the personal data may be stored at a regular interval with a time stamp , and the collected media data may use the same time stamp . in step 9840 , the mpn may interpret collected media . that may include speech recognition in substep 9842 . the interpreted media may be used to control the functions of the mpn in step 9845 , for example controlling the collection of personal data . alternatively , the interpreted media may be stored as text or in another suitable format . in step 9850 , data may be uploaded , for example to a base station or personal computer . that may include uploading the personal data in substep 9852 , the media data in substep 9854 , and the relationship between them in step 9856 . in step 9860 , the uploaded data may be stored . this may include storing the personal data in substep 9862 , the media data in substep 9864 , and the relationship data in substep 9866 . in step 9870 , the personal data may be displayed . in step 9872 , the media data may be displayed or output based on its relationship to the personal data . see the description of fig4 and 48 for examples of the display of personal data and the related media data . fig9 shows illustrative data structure 9900 that may be used to store personal data and their relationships to media data . in this example , personal data samples are stored every second . first sample 9920 has time stamp 9910 and has no linked media . second sample 9940 has time stamp 9930 , and has related media link 9950 . in this case , the media link is the name of a file containing a still image captured by the user . the mpn has automatically named the file based on the type of content and date and time of capture . third sample 9970 with stamp 9960 in this example has no linked media . the ability to easily turn off all incs in an mpn may be useful to conserve power . it may also be useful to terminate radio frequency transmission in an environment in which they may cause unwanted interference , such as on a commercial airliner . one of the commands received by the user input inc may be a turn on command , or a turn off command . these may be global commands applying to all incs in the mpn . a process for handling a global turn on command and a global turn off command is shown in fig1 a and fig1 b . all steps are optional and may be performed in any suitable order . flow chart 10100 of fig1 a shows an illustrative process that may be performed by a user input inc , or by an inc such as a control unit that receives commands from a user input inc . in step 10102 , the inc may be in its normal “ on ” state , in which it processes commands and data normally . the inc may check for user input in step 10104 . if no user input is received , the inc may remain in its normal “ on ” state and continue with normal functions . if user input is received , the inc may check to see if it is a turn off command in step 10106 . any appropriate type of user input may be used , such as a voice input , a key press , etc . if the user input is not a turn off command , the inc may process the user input normally in step 10108 and continue with normal functions . if the user input is a turn off command , the inc may check to see if the command is validated in step 10110 . validation may consist of a second input , holding the key down for an extended period , the entry of a personal code , or any other suitable user validation . if desired , the inc may not require validation . if the turn off command is not validated within a defined period of time , the inc may return to its normal “ on ” state . if the turn off command is validated , the inc may proceed with the turn off sequence . in step 10112 , the inc may send a turn off command to all of the incs in the mpn . this may be a single message that is broadcast to all incs with the same network identifier in substep 10114 . alternatively , individual messages may be sent addressed to each inc in substep 10116 . in step 10118 , the inc may wait for confirmation from each other inc . if confirmation is not received , the inc may resend the turn off command , display an error message , or perform another suitable action . if desired , the wait for confirmation step may be optional . once all confirmations have been received , the inc may enter a low power mode , in step 10120 . for example , if a processor with a sleep mode is used in the inc , it may enter the sleep mode , and it may configure an interrupt to be generated when a user input is received . while in the low power turned off state , the inc may check for user input , in step 10122 . for example , an interrupt may be generated when a user input is received . if no user input is received , the inc may remain in the turned off state . if user input is received , the inc may check to see if it is a turn on command , in step 10124 . if not , the user input may be ignored and the inc may remain in the turned off state . if the turn on command is confirmed , the inc may resume its high power mode , in step 10126 . turn on messages may be sent to all components in step 10128 , either as a single broadcast message or as individually addressed messages . the inc may resynchronize with the other components in step 10130 . this may include waiting for acknowledgement from the turn on message , resending the turn on message if required , or synchronizing functions that may have been in progress prior to the turn off command . in step 10132 , normal functioning may resume . flow chart 10150 of fig1 b shows an illustrative process that may be performed by an inc that does not receive user input . the inc may start in its normal “ on ” state , in step 10152 . it may be performing its normal functions , such as data collection , output , control , storage , or other functions or combination of functions . in step 10154 , the inc may check for a message , such as a wireless message from another inc in the mpn . this may include checking to see if the message has the correct network identifier , component identifier , or other address . if no message is received , the inc may continue its normal functions . when a message is received , the inc may check to see if it is a turn off message , in step 10156 . if not , the message may be handled normally , in step 10158 , and the inc may remain in its normal “ on ” state . when a turn off message is received , the inc may acknowledge the message in step 10160 . the acknowledgement may be optional . in step 10162 , the inc may stop its normal functions . this may include stopping any data collection , output , or control functions . the inc may stop sending any information using its wireless transmitter . preferably , the inc will retain any stored information in memory , including information about any processes that may have been underway , and any other information required to later resume normal functions . in step 10164 , the inc may enter a low power mode . for example , if a processor with a sleep mode is used in the inc , it may enter the sleep mode , and it may configure an interrupt to be generated when a wireless message is received . while in low power mode , the inc may check for incoming messages , in step 10166 . if no message is received , it may remain in low power mode . when a message is received , the inc may check to see if it is a turn on message , in step 10168 . if the message is not a turn on message , the inc may ignore it and remain in the low power off state . when the turn on message is received , the inc may resume its high power mode in step 10170 . an optional acknowledgement message may be sent in step 10172 . optionally , the inc may resynchronize with other incs in the mpn , in step 10174 . this may include synchronizing any functions that were in progress when the power off message was received . in step 10176 , the inc may resume normal functions , and return to its normal “ on ” state . although various embodiments have been described herein in terms of an mpn , many of them are possible without all of the features and aspects of an mpn . for example , components may be designed specifically for a single purpose , and may not support dynamic configuration of a wireless network . although our present invention has been described in considerable detail with reference to certain preferred embodiments thereof , other embodiments are possible . this includes uses , functions , components , and combinations thereof that may not be fully described . therefore , the spirit and scope of the appended claims should not be limited to the description of the preferred embodiments contained herein .
| 6 |
although , for sake of clarity and brevity , this invention is described in detail herein with respect to pumping hdpe , it can be used in the pumping of any molten polymer . fig1 shows polymer pump 1 having a closed top 2 and closed bottom 3 . upstanding , spaced apart sides 15 and 16 support internally of pump 1 a pair of parallel , opposed shafts 11 and 13 that extend fully across the pump &# 39 ; s interior ( fig4 ). upstanding side 4 and an opposing upstanding side 20 ( fig3 ) complete the enclosure of the interior of pump 1 . side 4 is the inlet side of pump 1 . side 4 has an opening 5 through which polymer is introduced into the interior of pump 1 to be forced to the outlet 21 ( fig2 ) of the pump . through opening 5 pumping teeth ( teeth ) carried by shafts 11 and 13 can be seen . shaft 11 carries chevron style teeth 7 and 9 , while shaft 13 carries chevron style teeth 6 and 8 . these teeth are shown in a more spaced apart configuration than actual for sake of clarity . the teeth shown are chevron style , but can be any style , including spur gear or single helical . line 10 denotes the demarcation line between shafts 11 and 13 and is the line ( point ) of closest approach for teeth carried by opposing shafts 11 and 13 when those teeth are at their closest approach and in a meshed configuration ( fig6 ). shafts 11 and 13 carry key ways 12 and 14 respectively so that shafts 11 and 13 can be fixed to one another by conventional apparatus ( not shown ) that maintains , while the pump is in operation , the non - touching registry between adjacent opposing teeth when at their point of closest approach . fig2 shows the outlet side 20 of pump 1 to carry an opening 21 to allow pressurized polymer to issue from the interior of the pump . fig2 shows a pair of opposing chevron teeth 22 and 23 carried respectively by shafts 13 and 11 after they have pushed polymer toward opening 21 and as they near their line of closest approach 10 for meshing engagement thereof . again , although a plurality of teeth are present around the entire periphery of both shafts 11 and 13 ( fig6 ), only two pairs of teeth are shown only for sake of clarity . fig3 shows the side 16 of pump 1 wherein shaft ends 11 and 13 are exposed outside the interior of pump 1 . shaft ends 11 and 13 have center points 32 and 31 , respectively . the shafts rotate about their respective center points in the directions shown by arrows 33 and 34 . entering polymer shown by arrow 35 passes into inlet 5 ( fig1 ) wherein it is picked up by moving pumping teeth and forced to outlet 21 as shown by arrow 36 , and as shown in greater detail in fig6 . fig4 shows the view of fig1 with side 4 removed to reveal that shafts 11 and 13 extend across the full interior of the pump . shaft 11 has an exposed end face 41 outside of the pump , while its opposing end 44 is carried in side 15 journaled in circular bearing 45 . similarly , shaft 13 has end face 40 that is exposed outside the interior of the pump , and an opposed end 42 journaled in side 15 in circular bearing 43 . fig4 shows that shafts 11 and 13 are of substantially larger diameter inside pump 1 , these larger diameter portions 47 and 48 being the part of the shafts that carries the pumping teeth . in this figure , the pumping teeth spaces 49 and 50 for shaft parts 47 and 48 , respectively , are shown to be relatively larger than normal for sake of clarity only , the teeth being relatively small compared to the diameter of parts 47 and 48 . this is better shown in fig6 . fig5 shows a plurality of teeth in general and a close - up of teeth 6 through 9 on the inlet side 5 ( fig1 ) in particular . fig5 shows these teeth as they are rotated away from meshing along line of closest approach 10 . in this mode , the teeth pickup additional polymer ( not shown ) and move it in a pumping mode . on the inlet side of the pump , upper teeth 6 and 8 on shaft part 47 are moving upwardly ( and carrying polymer upwardly ) as shown by arrow 51 while lower teeth 7 and 9 on shaft part 48 are moving downwardly ( and carrying polymer downwardly ) as shown by arrow 52 . all of the moving teeth are carrying incoming polymer with them in the direction of their movement , whether up ( arrow 51 ) or down ( arrow 52 ). in this figure , for example , when in the meshing configuration at line 10 , tooth 7 was in between teeth 6 and 8 , and , when so disposed , with proper pump timing registry , tooth 7 is maintained at its 0 . 02 inch tolerance with teeth 6 and 8 . thus , tooth 7 did not physically contact either of teeth 6 and 8 , the tolerance being filled with polymer . fig6 shows vertical cross - section a - a of fig5 . fig5 shows inlet opening 60 to be of substantially larger area and volume than outlet opening 61 . polymer entering at 35 is forced by its conveying teeth into progressively smaller volumes 67 and 68 , and thereby put under substantially greater compressive forces when delivered to outlet 61 . thus , exiting polymer 36 is under a substantially higher pressure , e . g ., 3000 psig , than entering polymer 35 , e . g ., 30 psig . this pressure differential can cause flow back in the direction of arrow 73 if the teeth carried by shaft parts 47 and 48 become worn by repeated physical contact between the opposing teeth when in their point of closest approach 10 ( fig4 ). cross - sectional fig6 shows that after teeth 6 , 7 , and 8 have delivered their conveyed polymer through restricted passage ways 69 and 71 to outlet 61 , these teeth then move into the meshing configuration of closest approach shown in fig6 . in this inter - meshing configuration , tooth 7 is physically disposed between and adjacent to teeth 6 and 8 , but not physically touching either of those teeth . this is the point of closest approach 10 for these three teeth . the gaps 65 , between teeth 6 and 7 , and 66 , between teeth 7 and 8 , are both desirably maintained at the 0 . 02 inch registry tolerance mentioned hereinabove for hdpe . this prevents premature wear of these teeth when repeatedly put into and out of this meshed configuration during the pumping life of pump 1 . initially , for example , when new , pump 1 is timed in a conventional manner well known in the art . after some operation of pump 1 so that it contains polymer in its interior , template 80 is prepared so that it is unique to the particular shafts of pump 1 . once made , the template can be used to restore pump 1 to its timed state at any time over the service life of that pump . if the teeth carrying shafts of pump 1 are re - used in another pump , template 80 could be used to establish proper timing for those shafts . fig7 shows the first step in carrying out this invention . in this step , when pump 1 is not in operation and shafts 11 and 13 are in proper timing registry to maintain the desired 0 . 02 inch tolerance , shaft faces 40 and 41 are exposed , i . e ., separated from the apparatus ( not shown ) that causes shafts 11 and 13 to stay in the desired registry during the operation of pump 1 . each exposed shaft face 40 and 41 has at least two spaced apart apertures drilled there into . in the case of face 40 , apertures 76 and 77 are drilled a finite distance into the body of shaft 13 . in this example , apertures 76 and 77 are placed asymmetrically on face 40 in that aperture 76 is further from center point 31 and closer to outer periphery 75 of shaft 13 than is aperture 77 . apertures 78 and 79 are shown in this example to be drilled symmetrically into the body of shaft 11 . that is , apertures 78 and 79 are each located an equal distance above and below center point 32 ( an equal distance from outer periphery 74 ). fig8 shows a separate , unitary template member 80 that is employed in this example of the process of this invention . template 80 is co - extensive with shafts 13 and 11 in that it essentially covers at least a substantial area of shaft end faces 40 and 41 . a pattern of holes 81 through 84 is provided which holes extend fully through template 80 . this pattern of holes is made to match the pattern of apertures 76 through 79 in end faces 40 and 41 ( fig7 ) with a symmetrical aperture pattern 78 / 79 such as that shown for shaft 11 there is more than one way ( front or back side ) template 80 can be held up to shaft ends 40 and 41 and the hole pattern 83 / 84 matched ( aligned ). however , with asymmetrical aperture pattern 76 / 77 there is only one orientation in which template 80 can be held up to shaft ends 40 and 41 and hole pattern 81 / 82 matched to pattern aperture 76 / 77 . thus , pursuant to this invention , at least one of shafts 11 and 13 will have an asymmetrical aperture pattern . if desired , both shafts can have an asymmetrical shaft pattern with their asymmetries the same or different . fig9 shows an exploded view in respect of template 80 being held adjacent ( abutting ) faces 40 and 41 in order to match the aperture patterns of faces 40 and 41 to the hole patterns of template 80 . if pump 1 is out of timing , the patterns cannot be made to match . in such a case , one or both of shafts 11 and 13 are rotated until the patterns can be made to match exactly . dowels are then inserted through the template holes into the shaft apertures . to ensure that the desired gap , e . g ., 0 . 02 of an inch for hdpe , is obtained between the teeth then meshing inside the pump , the tolerance between the dowel inserted and the hole / aperture pair in which it is inserted should not be greater than about 0 . 001 of an inch . fig9 shows template 80 essentially up against , but not touching shaft faces 40 and 41 for sake of clarity only . in practice , template 80 will be firmly touching faces 40 and 41 . this can be achieved in any desired manner known in the art such as drilling and tapping either or both of center points 31 and 32 to form a threaded opening 95 , 96 , 97 and 98 to receive a holding bolt ( not shown ) that temporarily affixes template 80 to shafts 11 and 13 . with template 80 in place abutting faces 40 and 41 , dowels 91 , 92 , 93 , and 94 are inserted , respectively , through holes 81 , 82 , 83 , and 84 , and fully into apertures 76 , 77 , 78 , and 79 . when template 80 is firmly abutting faces 40 and 41 with the template hole / shaft aperture patterns matching , and dowels firmly inserted through the holes into the apertures , the desired timing registry between the meshing teeth inside the pump is achieved even though those teeth are covered with polymer . dowels 91 through 94 are then removed from their apertures , and template 80 removed from contact with faces 40 and 41 . shafts 11 and 13 are then re - attached to the apparatus ( not shown ) that is normally used during pump operation to maintain these shafts in their desired registry , and operation of the pump begun . a matching template hole / shaft end aperture pair can be straight sided or tapered . in a specific embodiment , hole / aperture pairs can be straight sided , tapered , or a combination of such pairs . if a hole / aperture pair is tapered , the taper should be uniform from the start of the hole to the end of the aperture so that the mating dowel , with its close tolerance , can tightly and uniformly follow the taper angle from the start of the hole to the end of the aperture . the cross - section of the dowels used can be curvilinear , polygonal , or any desired combination thereof . all apertures need not be drilled to the same depth in the shafts . if desired , apertures can be drilled to differing depths with dowels being sized in length to match those depths in order to give an added dimension of asymmetry . more than two apertures can be employed on a given shaft face . the cross - sectional distance across a shaft aperture and / or template hole , e . g ., the diameter for a straight sided matching aperture / hole pair that is round , can be at least ⅛th of an inch , and preferably not more than about 1 inch . the apertures in the shaft ends can vary in depth from about ½ to about 1 inch . the template itself can be any rigid member such as carbon steel plate at least ½ inch in thickness . the dowels can be solid metal members and should not be semi - rigid or otherwise flexible such as are hollow roll pins and the like .
| 8 |
hereinbelow , embodiments of the present invention are described with reference to the accompanying drawings . fig1 gives an appearance perspective view of the present invention . this figure consists of a transmission - side unit s and a reception - side unit r , the equipment comprising a light emitter ssd and a light receiver srd on the transmission side , and a light emitter rsd and a light receiver rrd on the reception side , as main components . transmitting light s 1 from the light emitter ssd on the transmission side is received by the light receiver rrd as received light r 2 on the reception side . also , as feedback from the reception side to the transmission side , transmitting light s 2 emitted from the light emitter rsd on the reception side is received by the light receiver srd as received light r 1 on the transmission side . fig2 is a configuration example of electronic equipment having an optical communication function according to a first embodiment of the invention . the electronic equipment having an optical communication function of this figure comprises , as main components , a light - receiving circuit 1 , a light - emitting circuit 2 , a cpu 3 , a power - supply control circuit 4 and a signal discriminating circuit 5 . the light - receiving circuit 1 comprises a photodiode , an amplifier , a transistor or the like , and its output is connected to the signal discriminating circuit 5 . the signal discriminating circuit 5 comprises a counter implemented by , for example , a flip - flop , and discriminates whether or not the frequency of an input optical signal is a preset frequency , by referencing a sub - clock from the cpu . a resultant signal after the discrimination is outputted to a terminal rx of the cpu 3 , by which the received signal is inputted to the cpu 3 . the light - emitting circuit 2 comprises a light - emitting diode and a transistor , and its input is connected to a terminal tx of the cpu 3 . the light - emitting circuit 2 , fed with a transmitting signal from the cpu 3 , performs light emission according to the transmitting signal from the cpu 3 . to the power - supply control circuit 4 , a power - supply control signal is inputted from the cpu 3 , by which the power supply for the light - receiving circuit 1 can be interrupted . the power - supply control circuit 4 comprises , for example , a transistor , and power control is implemented by the transistor turning on / off . in addition , a timing chart of signals used on the circuit structure of fig2 is presented as fig4 . in fig4 reference characters designate received light by a , transmitting light by b , a received signal by c , a transmitting signal by e and a received signal after the signal discrimination by f . also , the power - supply control signal for the light receiver is designated by d . in order to show how the standby state of the cpu is changed by these signals , a main clock clk 1 , which is a high - speed clock for the cpu , and a sub - clock clk 2 , which is a low - speed clock , are charted . in this case , while the cpu is in the standby mode , the main clock clk 1 keeps halted , where only the sub - clock clk 2 is operating . also , when the cpu , after cancellation of the standby mode , actually starts optical communication , both clk 1 and clk 2 are operating . at the beginning of the timing chart of fig4 the cpu 3 of fig2 is in the standby mode . at that time , the cpu 3 is outputting a power - supply control signal d that is a signal resulting from frequency - dividing by two the sub - clock clk 2 by an unshown frequency divider . in this state , when the received light a is inputted to the light - receiving circuit 1 , subsequent operation differs depending on the state of the power - supply control signal d . with d “ inactive ” ( low state in fig4 ), even if this received light a is inputted , the signal is not transferred to the succeeding - stage signal discriminating circuit 5 , nor is the standby mode canceled . with d “ active ” ( high state in fig4 ), when the received light a is inputted , the signal is transferred to the succeeding - stage signal discriminating circuit 5 . in fig4 when the received light a is inputted , the signal d is “ inactive ”, with no operations going . when the signal d goes “ active ”, the received signal c goes operative so that the received signal is inputted to the signal discriminating circuit 5 . it is noted that a signal ( c 1 ) of c is the same as a signal ( a 1 ) of the received light a . the signal discriminating circuit 5 makes an internal counter operate at an inputted frequency c 1 , determines the count value by referencing the sub - clock g , and measures the frequency of the c 1 input . in this case , if the count value is not a desired value , the signal ( received signal f in fig4 ) is not transferred to the succeeding - stage cpu , so that the cpu 3 holds the standby mode . in fig4 assuming that the frequency is the desired value , the received signal f is operated . as a result of this , the standby mode of the cpu 3 is canceled ( the main clock is operated ). after the cancellation of the standby mode , a cnt signal of the cpu 3 itself ( i . e ., the power - supply control signal d ) is always set to the “ active ” state , where light reception is normally enabled . in the case of fig4 the a 2 signal of the received light a is communication data . this data passes , in fig2 through the light - receiving circuit 1 and the signal discriminating circuit 5 , becoming the received signal c and the received signal f , thus being connected to the cpu 3 as an rx signal , where the communication is started . fig3 shows a configuration example of an electronic circuit system according to a second embodiment of the invention . the electronic circuit system comprises , as main components , a light - receiving circuit 6 , a light - emitting circuit 7 , a cpu 8 , a power - supply control circuit 9 , a signal discriminating circuit 10 and a signal feedback circuit 11 . the light - receiving circuit 6 is of the same structure as the light - receiving circuit 1 . its output is connected to a terminal rxs of the signal discriminating circuit 10 , and a received signal is inputted to the signal discriminating circuit 10 . the signal discriminating circuit 10 , although similar in structure to the signal discriminating circuit 5 , additionally has a function of once connecting a discriminated signal to the signal feedback circuit 11 , and an output for uniquely implementing power supply control for the light - receiving circuit . in order to discriminate over several cycles on the sub - clock basis whether the signal from the light - receiving circuit 6 is extraneous light ( noise ) or a signal from the transmission side , a received signal k will not be connected to the cpu until it is finally discriminated that the signal is a transmitting signal . then , if it is finally discriminated that the optical input is a received signal , the received signal k is transferred to the cpu 8 . in the state of halfway the discrimination , a power - supply control signal 2 ( o ) is outputted to maintain the light receiver always “ active ”, and the received signal is connected to the signal feedback circuit 11 , by which the signal that is being received is fed back to the transmission side . the signal feedback circuit 11 is a switch that functions , in the standby mode , to connect a signal from the signal discriminating circuit 10 to the light - emitting circuit 7 and , in the operation mode , to connect a terminal txs signal of the cpu 8 to the light - emitting circuit 7 . the light - emitting circuit 7 is of the same structure as the light - emitting circuit 2 . the power - supply control circuit 9 is also of the same structure as the power - supply control circuit 4 , controlling the power supply for the light - receiving circuit 6 . however , the power - supply control signal is connected in two from the cpu 8 and the signal discriminating circuit 10 . the signal discriminating circuit 10 , although equivalent in structure to the signal discriminating circuit 5 , has a feedback signal p connected to the signal feedback circuit to feed back a signal to the transmission side , and also outputs a unique power - supply control signal . the signal discrimination is executed as the cpu 8 is kept in the standby mode . further , the signal discriminating circuit 10 has a plurality of desired count values , and has a structure that the counter can be freely set so that whether or not a desired value is set can be discriminated for a plurality of frequencies . after the discrimination that the signal is a desired frequency , the signal discriminating circuit 10 transfers the received signal to the cpu 8 , canceling the standby mode , where normal optical communication is executed . in addition , a timing chart of signals used on this circuit structure is presented as fig5 . in fig5 reference characters designate received light by h , transmitting light by i , a received signal by j , and a transmitting signal by q . also , power - supply control signals for the light receiver are designated by l , o , and a signal fed back from the reception side to the transmission side is designated by p . also , a received signal from the signal discriminating circuit to the cpu ( a received signal after the final discrimination of being an optical signal ) is designated by k , and a transmitting signal from the cpu is designated by m . further , in order to show how the standby state of the cpu is changed by these signals , a main clock clk 3 and a sub - clock clk 4 of the cpu are shown . in this case , while the cpu is in the standby mode , the main clock clk 3 keeps halted while only the sub - clock clk 4 is operating . also , when the cpu , after cancellation of the standby mode , actually starts optical communication , both clk 3 and clk 4 are operating . in fig5 the operation to be executed until the received light h is inputted to the light - receiving circuit so that the power - supply control signal l goes “ active ” is equivalent to the operation described in fig4 . after that , with the received signal j inputted to the signal discriminating circuit 10 , if it is discriminated by half the sub - clock n that the signal is a desired frequency , then the power - supply control signal 2 ( o ) is made “ active ” so that signal reception is always enabled , where the transmission feedback signal p is connected to the signal feedback circuit 11 . this signal p is a signal for feeding back the received frequency signal , as it is , to the transmission side , where h 11 and p 12 are signals of the same frequency at the time of start of the feedback . the signal feedback circuit 11 outputs the feedback signal p as a transmitting signal q . the transmission side , receiving transmitting light i outputted as an optical signal into which the signal q comes , changes the frequency of its transmitting signal . received light h is inputted as an h 12 signal of this changed frequency . at this time point , the frequency p 12 of the feedback signal p becomes the same as the h 12 . after that , the signal discriminating circuit 10 counts the h 12 signal at the half - clock time of the sub - clock n , thereby verifying that the signal is of a desired frequency . then , the feedback signal p 12 is changed to a signal p 13 having a frequency resulting from frequency - dividing by two the received signal j as an example . as a result , a q 13 signal of the transmitting signal q becomes the same frequency signal as the p 13 . when this fed - back optical signal i 13 is returned to the transmission side , the transmission side outputs the signal with its frequency further changed . the received light h is inputted as h 13 of the changed frequency . such a sequence is iterated a plurality of times , by which it is correctly discriminated whether the received light is an optical signal or noise such as extraneous light . if it is an optical signal , received signal k in fig3 is outputted to the cpu 8 so that the standby mode of the cpu is canceled . after that , the power - supply control signal 1 ( l ) is changed “ active ”, by which a normally communicatable state is set . then , an h 2 signal , which is actual communication data , is received . at any time point , if it is discriminated that the inputted optical signal is not a desired frequency , the received signal k is not outputted to the cpu 8 , and the reception side equipment holds the standby mode . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims .
| 7 |
the present invention will be understood from the following detailed description of preferred embodiments , which are meant to be descriptive and not limiting . for the sake of brevity , some well - known features , methods , systems , procedures , components , circuits , and so on , are not described in detail . fig1 depicts the wheel to be braked by the prior art vehicular brake and by the vehicular brake of the present invention . a wheel 30 of a vehicle is screwed by screws to studs 40 of a wheel carrier 52 ( hidden ) thereof . fig2 is a side sectional view of a braking system according to one embodiment of the present invention . wheel 30 , held by studs 40 to wheel carrier 52 , spins together with axle 36 . a vehicular brake 10 of the present invention brakes wheel carrier 52 by reducing or even totally blocking the flow of hydraulic liquid 72 therewithin . this hydraulic braking is intended to replace the prior art brake caliper twisting a disk . wheel carrier 52 spins together with a disk 12 , through wheel bearings 48 , about the stationary package 54 of vehicular brake 10 . seals 46 confine lubricant 72 of wheel bearings 48 . braking the rotation of wheel carrier 52 is performed by rotating a sheave 44 to close a faucet 24 , for blocking the flow of hydraulic liquid 72 within vehicular brake 10 . fig3 is a front view of the hydraulic pump of the braking system of fig2 . a significant part of the external envelope 56 of disk 12 is annular . stationary package 54 includes an annular round internal envelope 58 . the center of disk 12 is shifted from the center of annular internal envelope 58 of package 54 , providing eccentric rotation of disk 12 about annular internal envelope 58 of stationary package 54 . this eccentric disposition forms an initial tunnel 14 containing hydraulic liquid 72 between external envelope 56 of rotating disk 12 and internal envelope 58 of stationary package 54 . the terms “ top ” and “ bottom ” refer herein to the locations as drawn in the sheets of fig2 and 3 only . however , initial tunnel 14 is present at the “ top ” and “ sides ” of fig2 and 3 and is absent at the “ bottom ” of fig2 and 3 , due to this eccentric disposition . disk 12 includes and is connected to vanes 22 , thus disk 12 and vanes 22 move together . motion of vanes 22 within initial tunnel 14 moves hydraulic liquid 72 therethrough . vanes 22 are formed as slideable pistons 22 within cylinders 60 . the external sides 64 of pistons 22 are adapted to always touch internal envelope 58 of package 54 , blocking pistons 22 when hydraulic liquid 72 does not flow , i . e ., when braking is activated . pistons 12 rotating together with vehicle wheel 30 and disk 12 together press hydraulic liquid 72 to flow within initial tunnel 14 . however , the hydraulic liquid 72 cannot flow at the portion where initial tunnel 14 is absent , which is at the bottom of fig3 between external envelope 56 of disk 12 and internal envelope 58 of package 54 . instead , the hydraulic liquid 72 flows from initial tunnel 14 and returns thereto through a bypass 62 . the term “ closed - circuit tunnel ” refers herein to initial tunnel 14 together with bypass 62 . thus , rotation of vehicle wheel 30 circulates hydraulic liquid 72 within a closed - circuit tunnel including initial tunnel 14 and bypass 62 , within wheel brake 10 . appropriate hydraulic liquid 72 is to be selected for reducing friction of the hydraulic liquid flow . in order to bring external sides 64 of pistons 22 towards internal envelope 58 of package 54 , and in order that external sides 64 of pistons 22 will not enter inlet 68 of bypass 62 , a stationary track 18 delimits and leads pistons 22 between internal wall 66 and an external wall 70 thereof . stationary track 18 and initial tunnel 14 are inherent elements of stationary package 54 . external wall 70 of track 18 delimits external bearings 20 a of piston 22 , and internal wall 66 of track 18 delimits internal bearings 20 b of piston 22 . faucet 24 may reduce the cross - section area of bypass 62 from area a 1 to area a 2 or other . the level of the braking may be adjusted by the level of closing faucet 24 . hydraulic liquid 72 may be added through an inlet 28 . in the figures and / or description herein , the following reference numerals have been mentioned : numeral 10 denotes a vehicle brake , according to one embodiment of the present invention ; numeral 12 denotes a disk within the brake , which spins together with the vehicle wheel ; numeral 14 denotes a tunnel in which hydraulic liquid is moved by the pistons ; numeral 18 denotes a stationary track for leading the pistons ; numerals 20 a and 20 b denote bearings in the pistons for being led by the stationary track ; numeral 22 denotes a vane for moving hydraulic liquid ; according to a preferred embodiment this vane is a piston ; numeral 24 denotes a faucet for blocking the flow of the hydraulic liquid ; numeral 26 denotes a cable for closing and opening the faucet ; numeral 28 denotes a inlet for adding hydraulic liquid to the vehicular brake ; numeral 30 denotes the wheel of the vehicle to be braked ; numeral 36 denotes an axle of the wheel ; according to the depicted example , the axle spins together with the wheel ; numeral 40 denotes a stud for connecting the wheel to the vehicle ; numeral 44 denotes a sheave for opening or closing the faucet of the hydraulic liquid ; numeral 46 denotes a seal for confining lubricant of the wheel bearings ; numeral 48 denotes a wheel bearing , which allows the wheel to spin about the stationary elements of the vehicle ; numeral 52 denotes a wheel carrier ; numeral 54 denotes the package of the vehicular brake , and it is stationary ; numeral 56 denotes the perimeter , which is the external envelope of the rotating disk ; numeral 58 denotes the internal envelope of the stationary package ; this envelope is round , and includes an inlet and an outlet of the bypass ; numeral 60 denotes a cylinder in which a piston may slide outward or inward the rotating disk ; numeral 62 denotes a bypass for the hydraulic liquid continuing the initial tunnel ; numeral 64 denotes the external side of the piston , i . e ., the side close to the perimeter of the disk which spins together with the vehicular wheel ; numeral 66 denotes an internal wall of the leading track ; numeral 68 denotes the inlet of the bypass ; the leading track avoids entrance of the pistons thereinto ; numeral 70 denotes the external wall of the leading track ; and numeral 72 denotes hydraulic liquid . the foregoing description and illustrations of the embodiments of the invention has been presented for the purposes of illustration . it is not intended to be exhaustive or to limit the invention to the above description in any form . any term that has been defined above and used in the claims , should to be interpreted according to this definition .
| 5 |
in this example the oligomerization is carried out in a continuous stirred tank reactor , which is continuously charged with fresh and recycled monomer and with recycled catalyst complex and which is pressurized with bf 3 in order to establish an excess of bf 3 . cooling is provided by circulating the reactor content via an external heat - exchanger . for example 1 - decene is used as monomer and n - butanol as cocatalyst . the temperature is set on - 10 ° c . to + 70 ° c ., preferably on 0 ° to 50 ° c ., for example on 30 ° c . bf 3 gas is supplied at constant rate to obtain the quantity required in producing bf 3 - buoh complex . the pressure is maintained to 0 . 05 to 10 bars , preferably to 1 . 5 to 4 bars . subsequent to oligomerization the reactor product , consisting of unreacted monomer , dimers , trimers and higher oligomers , free and dissolved bf 3 and catalyst complex , is fed in 1 to a distillation column 2 operated under vacuum . pressure at the top 3 of the column is lower than 30 mbar , preferably lower than 15 mbar , for example 10 mbar . the temperature is maintained as low as possible in the upper part of the column , which is located above the feed position 1 , for example 50 °- 60 ° c . in any case at the top 3 of the column the temperature is less than 70 ° c ., preferably 45 °- 50 ° c . above 70 °- 80 ° c ., the catalyst complex of the present example starts to decompose into undesired products . preferably , the temperature at the top 3 of the column 2 is also lower than the boiling temperature of the dimer fraction resulting from the oligomerization , in order to avoid a distillation of any dimer . vaporization of the catalyst complex and unreacted monomer at low temperature is achieved while operating at the above disclosed low pressures . in order to obtain an essentially complete removal of both unreacted monomer and bf 3 - residues from the bottom product , the pressure at the lower packing 4 of the column is maintained lower than 50 mbar , preferably lower than 25 mbar . here , the temperature is lower than the boiling temperature of the dimer fraction , and lower than the decomposition temperature of the cocatalyst complex , at the applied pressures , and higher than the boiling temperature of the unreacted monomer and of the cocatalyst complex . in the present example , at the lower packing 4 of the column , a temperature of 70 °- 80 ° c . is maintained at pressure of 15 mbar . in the illustrated example , a reboiler 5 is mounted to receive the bottom product of the column 2 and to heat the latter . this product is completely free of cocatalyst complex and of monomer . in a following flash drum 6 a portion of vaporized dimer is separated from the heated oligomerized product at a temperature of for example 200 °- 220 ° c . and the vaporized dimer portion is recycled in 7 into the bottom 11 of the distillation column . by means of a pump 8 , the product issuing from the bottom of the flash drum 6 and consisting of the desired products ( dimers , trimers , tetramers and heavier oligomers ) essentially free from monomer and bf 3 - residues is transferred towards the next treatment . at the outlet of the pump 8 , bottom product still at its boiling point is recycled via a minimum - flow line 10 into the bottom 11 of the distillation column . in the illustrated example the bottom 11 of the distillation column is consequently a contact zone for a liquid coming down from the lower packing 4 , a dimer vapor rising from the flash drum 6 and a bottom product at its boiling point issuing from the outlet of the pump 8 . if residual monomer and catalyst complex are still included in the liquid from the lower packing 4 , they are evaporated in the bottom 11 of the column by the heat inputs via lines 7 and 10 . in this way , by a direct heating , it is possible to prevent especially the catalyst complex from entering the reboiler 5 , where catalyst residues can cause severe corrosion . the evaporation of said components is advantageously achieved without exposing the catalyst complex to hot heat - transfer surfaces . obviously the step of heating the bottom product in the bottom 11 of the column could be obtained also by other means , for example by heat exchangers . obviously the introduction in 7 of the vaporized dimer and in 10 of a fraction of vaporized bottom product may be controlled by any known means . this introduction must regulate the required heat for monomer and catalyst complex evaporation and enable a good temperature control of the bottom 11 of the column . in the bottom 11 of the column , at a pressure of approximately 15 mbar , the temperature is in the present example regulated advantageously to a temperature of 130 °- 150 ° c . the distillate fraction leaving in 9 the distillation column 2 consists of free bf 3 , catalyst complex and monomer . distillate vapor is condensed and catalyst complex is separated from the monomer phase by gravitation and the two are independently recycled back to the oligomerization process . uncondensable bf 3 - gas is optionally trapped in a vacuum system such as the system disclosed in ep - a - 0493024 . the catalyst complex formed in the vacuum system as a result of the reaction between bf 3 and n - butanol is also recycled to the oligomerization process . it is also possible to conceive a direct recycling of the condensed distillate without previous separation of the monomer from the cocatalyst complex . a separation of the condensed vapour may also be carried out for example by means of a centrifuge or cyclonesystem .
| 1 |
embodiments of the present invention are described below in detail with reference to the accompanying drawings . in this disclosure , a gray tone mask may be a mask with a transparence region , a translucence region and a blocked region , and the translucence region can be obtained with slits that can diffract light , a translucent material of low transmissivity and the like , thus a gray tone mask also comprises a half tone mask . fig1 is a top view showing a pattern after a first photolithography is carried out with a first gray tone mask , fig1 a is a cross - sectional view along line a - a ′ in fig1 , and fig1 a ′ is a cross - sectional view along line b - b ′ in fig1 . as shown in fig1 , 1 a , and 1 a ′, a gate conductive layer 11 , a first insulating layer 12 , a semiconductor layer 13 , and a doped semiconductor layer 14 are deposited in sequence on a substrate 100 , a photoresist film is applied on the resultant layer structure , and an exposure process with the first gray tone mask and development process are carried out to form a photoresist pattern corresponding to a gate line and gate island pattern , as shown in fig1 . as can be seen from fig1 , 1 a , and 1 a ′, there is no photoresist in the region other than a gate line 101 and a gate electrode 102 that are to be formed , an isolating groove 103 is to be formed on the gate line and corresponds to the partially retained photoresist region 15 in the first photolithography process , and the portions other than the isolating groove 103 on the gate line corresponds to the fully retained photoresist region 15 ′ in the first photolithography . then , etching is carried out by using the photoresist pattern as an etching mask so that the region which is not protected by the photoresist pattern is removed , i . e ., the doped semiconductor layer 14 , the semiconductor layer 13 , the first insulating layer 12 , and the gate conductive layer 11 in the non - photoresist region that is not covered by the photoresist is etched away . fig1 b shows a cross - sectional view along line a - a ′ in fig1 after etching on the non - photoresist region . then , an ashing process on photoresist is carried out . the cross - sectional view along line a - a ′ in fig1 after ashing is shown in fig1 c , and the cross - sectional view along line b - b ′ in fig1 after ashing is shown in fig1 b ′. as shown in fig1 b ′, a portion of the doped semiconductor layer 14 corresponding to the isolating groove 103 on the gate line is exposed , and the fully retained photoresist region 15 ′ is thinned in thickness . the exposed portion of the doped semiconductor layer 14 and the semiconductor layer 13 under the doped semiconductor layer 14 are etched to form the isolating groove 103 ′ on the gate line , as shown in fig1 c ′. then , a second insulating layer 16 is deposited to protect the gate line and gate electrode . the cross - sectional view along line a - a ′ in fig1 after deposition of the second insulating layer is shown in fig1 d . a lift - off process is carried out to remove the fully retained photoresist region 15 ′ together with the second insulating layer 16 deposited thereon . the cross - sectional view along line a - a ′ in fig1 after the lift - off process is shown in fig1 e . the cross - sectional view along line b - b ′ in fig1 after deposition of the second insulating layer 16 is shown in fig1 d ′. the semiconductor layer 13 corresponding to the isolating groove 103 ′ is covered by the second insulating layer 16 . the substrate 100 may be a glass substrate or a plastic substrate . the gate conductive layer 11 may be a single layer film of al / nd , al , cu , mo , mo / w or cr , or a composite film of any combination of al / nd , al , cu , mo , mo / w and cr . the first insulating layer 12 and second insulating layer 16 may be a single layer film of sinx , siox or sioxny , or a composite film of any combination of sinx , siox and sioxny . both of the first insulating layer 12 and the second insulating layer 16 may be transparent so as to allow transmission of light . the semiconductor layer 13 may comprise amorphous silicon ( a - si ), poly - silicon ( p - si ) and the like . the doped semiconductor layer 14 may be doped with a dopant such as boron ( b ) or phosphor ( p ). here , all the processes with the first gray tone mask have been described , and the plan view of the pixel structure after the processes are completed is shown in fig1 ′. as can be seen from the above processes , in the present embodiment , a second insulating layer is deposited during the first photolithography process so that the pixel structure is planarized , which provides process tolerance for subsequent processes . in addition , the conventional gray tone mask and lift - off process for manufacturing a tft - lcd can be used in the first photolithography process , which makes the first photolithography process easy to implement . then , a transparent pixel electrode layer 21 and a source / drain electrode layer 22 are deposited in sequence over the pixel structure after the above processes . a photoresist film is applied on the resultant structure , and an exposure process with a second gray tone mask and a development process are carried out to form a second photoresist pattern having a photoresist pattern 201 corresponding to the data line to be formed and a photoresist pattern 202 corresponding to the pixel electrode to be formed , as shown in fig2 . the photoresist pattern 201 is relatively thin in thickness , i . e ., it is a partially retained photoresist region 23 in the second photolithography process . the photoresist pattern 202 is relatively thick thickness , i . e ., it is a fully retained photoresist region 23 ′ in the second photolithography process . other region corresponds to the non - photoresist region , as shown in fig2 a . then , etching is carried out with the photoresist patterns as an etching mask on the non - photoresist region so that the source / drain electrode layer 22 , the transparent pixel electrode layer 21 , the doped semiconductor layer 14 and the semiconductor layer 13 which are not covered by the photoresist are removed . as a result , the source electrode 203 together with the data line , the drain electrode 204 together with the pixel electrode , and the channel of the semiconductor layer defined between the source electrode 203 and the drain electrode 204 are formed . then , an ashing process on photoresist is carried out so that the source electrode 203 and the data line are exposed and the thick photoresist pattern 202 ( i . e ., the fully retained photoresist region 23 ′) is thinned in thickness , as shown in fig2 c . then , a passivation layer 24 is deposited on the resultant structure , as shown in fig2 d . a lift - off process is carried out to remove the photoresist 23 ′ together with the passivation layer deposited thereon . the cross - sectional view along line a - a ′ in fig2 after the lift - off process is shown in fig2 e . since the region corresponding to the source electrode 203 and the data line is protected by the passivation layer , an etching process is carried out on the pixel electrode region to etch away the source / drain electrode layer 22 in the region corresponding to the pixel electrode to be formed and expose the transparent pixel electrode layer 21 as the pixel electrode , as shown in fig2 f . in this way , the manufacturing process of the tft - lcd pixel structure is completed here . the transparent pixel electrode layer 21 may be formed of indium tin oxides ( ito ) which is superior in conductivity and transparency and can block ultraviolet and far - infrared radiation as well as electronic radiation which is harmful to a human being . therefore , ito can be applied in the pixel structure to enhance the conductivity and transparency and block the ultraviolet and far - infrared radiation as well as electronic radiation which is harmful to a human being . in addition , indium zinc oxide , tin oxide and other transparent conductive material can be used for the transparent pixel electrode layer 21 . the source / drain electrode layer 22 may be a single layer film of mo , mo / w or cr , or a composite film of any combination of mo , mo / w and cr . in addition , different materials in the drawings are differently indicated in the drawings . since the substrate 100 , the source / drain electrode layer 22 , the second insulating layer 16 , and the transparent pixel electrode layer 21 are all transparent , these layers are illustrated with pure colors . one can refer to the indications in each drawing . furthermore , during the second gray tone photolithography process in the above embodiment , a portion of the transparent pixel electrode is also formed as the drain electrode of the tft , which can avoid the problem about contact resistance . two masks can be used in the embodiment of the present invention to manufacture a tft - lcd , thus the number of mask can be decreased , the cost for the array process and the occupation time can be reduced , and the production volume and yield can be improved compared with the conventional method . in addition , the conventional gray tone photolithography process and the lift - off process can be employed , which makes simple and convenient to implement the complete process . the tft manufactured by the method described above comprises a substrate 100 , a gate line 101 , a first insulating layer 12 , a semiconductor layer 13 , a doped semiconductor layer 14 , a second insulating layer 16 , a source electrode 203 which is a portion of a data line , a drain electrode 204 which is a portion of a pixel electrode , and a passivation layer 24 . in the pixel structure of the embodiment of the present invention , the first insulating layer 12 , the semiconductor layer 13 , and the doped semiconductor layer 14 are disposed sequentially over the gate 102 and the gate line 101 , the isolating groove 103 is formed on the gate line 101 and disconnects the semiconductor layer on the gate line , the second insulating layer 16 covers the isolating groove 103 as well as the portion of the substrate where the gate line 101 and the gate 102 are not formed , the transparent pixel electrode layer 21 is retained under the source electrode 203 which is integral with the data line , the drain electrode 204 which is integral with the pixel electrode is formed over the second insulating layer 16 , that is , the pixel electrode is connected with the doped semiconductor layer 14 on the gate 102 at the place where the drain electrode 204 is formed , and the passivation layer 24 covers the portion of the substrate where the pixel electrode 204 is not formed , i . e ., exposes the pixel electrode 204 . the surface of the second insulating layer 16 flushes with that of the doped semiconductor layer 14 . the transparent pixel electrode layer 21 for forming the drain electrode 204 which is a portion of the pixel electrode is also retained under the source electrode 203 which is a portion of the data line . in the embodiment described above , description is made by reference to the structure with one tft and the manufacturing process thereof . there can be formed a plurality of tfts on the substrate , and the tfts can be manufactured simultaneously by the photolithography processes , in which case the isolating groove on the gate line can prevent the short circuit among the data lines . the embodiment of the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to those skilled in the art are intended to be comprised within the scope of the following claims .
| 7 |
the composition for treating diabetes of the present invention includes fenugreek and bile from the gallbladder of ruminants , such as cattle , sheep , bison , and goats . bile from the gallbladder of cattle is preferred . the fenugreek is preferably pulverized into a powder . the bile and fenugreek is mixed together to form an acceptable medium for administering a dose . this acceptable medium can be a solution , a syrup , an emulsion , a dispersion , a paste , or a pill . it is preferred that a small amount of water be added to the mixture of fenugreek and bile to aid in the formation of pills . pills are the preferred medium for administering the dose . alternatively , the active components of fenugreek can be made synthetically and be formulated into the composition of the present invention . fenugreek , also spelled foenugreek , is a slender annual herb of the pea family . its dried seeds have been used for generations as a food , a flavoring , and a medicine . steroidal saponins account for many of the beneficial effects of fenugreek , particularly the inhibition of cholesterol absorption and synthesis . the seeds are rich in dietary fiber , which may be the reason it can lower blood sugar levels in diabetics . it is contemplated , as part of the present invention , that fennel seed can be used to replace all or part of the fenugreek in the composition for treating diabetes of the present invention . fennel seed , like fenugreek , is an herb native to southern europe and the mediterranean area . the second primary component of the present invention is bile from the gallbladder of ruminant mammals . synthetic compositions of the active components in bile can also be used in the composition of the present invention . bile , also called gall , is a for concentration , storage , or transport into the first region of the small intestine , the duodenum . bile is composed of bile acids and salts , cholesterol , pigments , water , and electrolyte chemicals that keep the total solution slightly acidic . the ph of bile is typically about 5 to 6 . bile acid typically includes cholic , deoxycholic , chenodeoxycholic , and lithocholic acids . the bile salts include the salts of these acids with amino acids , such as glycine and taurine . other components of bile include hemoglobin , mucus , serum proteins , lecithin , neutral fats , fatty acids , and urea . the method of treating diabetes of the present invention begins with the preparation of doses of a composition for treating diabetes which includes an effective amount of fenugreek and / or fennel seed mixed together with an effective amount of bile from the gallbladder of ruminant mammals . the doses are often mixed together in a paste to form pills . the doses are administered at regular intervals throughout the day . by administered , what is meant is providing the composition to a patient and the patient consuming the composition by accepted medical practice . accepted medical practice is meant to include any method approved by the american medical association for introduction of the composition into the human body . the amount of the composition administered as part of the doses is an amount sufficient to counteract the effects of diabetes . these effects or symptoms which are affected will include blood glucose levels , stomach neuropathy , appetite , sleep habits , general energy level , strength , body weight , reflux , headaches , minear &# 39 ; s disease , and eye sight . a sufficient amount is an amount , when administered , that provides relief from one or more of the effects or symptoms . when the composition is administered in the form of a pill , it is preferred that the pills be used with approximate dimensions of 0 . 5 inches diameter and 0 . 125 inches thickness . the preferred dose administration is three pills administered three times during the day . a composition for treating diabetes was made by mixing approximately 3 ounces by weight of pulverized fenugreek and approximately 1 ounce by weight of bile from the gallbladder of a calf . a small amount of water was added to the mixture to form a paste from which pills were formed . each pill weighed approximately that of an average 5 gram aspirin pill . the pills were administered to a male subject aged 58 who suffers from type iii diabetes and demonstrated particular side effects , such as irregularity , stomach neuropathy , poor appetite , insomnia , lethargy , reflux , migraine headaches , minear &# 39 ; s disease , and deteriorating eyesight . the subject took three pills , three times during the day and just prior to going to sleep for the night . the subject reported a marked improvement in all of the above - mentioned symptoms after one week to two weeks of treatment . the invention has been described with reference to the preferred embodiment . obvious modifications and alterations will occur to others upon reading and understanding the preceding detailed description . it is intended that the invention be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof .
| 0 |
as best shown in fig1 - 3 , the present invention is directed to a molded plywood door skin d having an exterior surface 2 and an interior surface 4 , and at least one panel portion 10 . a molded depression 12 surrounds and is integral with panel portion 10 . an outer portion 14 surrounds and is integral with molded depression 12 . as best shown in fig3 molded depression 12 is preferably formed to have a depression base 16 that is recessed from the plane of outer portion 14 from between about 6 mm to about 9 mm . panel portion 10 is preferably coplanar with outer portion 14 . however , it should be understood that panel portion 10 may also lie on a plane that is spaced from the plane of outer portion 14 . molded depression 12 may include an inclined wall 18 extending from base 16 to panel portion 10 , and a contoured portion 20 extending from base 16 to outer portion 14 . preferably , molded plywood door skin d is formed from a luan plywood board . the luan plywood board used to form multi - layer door skin d includes a high - grade solid , natural wood ply , which provides a wood grain pattern on exterior surface 2 . preferably , luan plywood having a thickness of between about 2 . 5 millimeters ( mm ) to about 4 . 0 mm is used . other types of plywood may also be used to form molded plywood door skin d . as used herein , the term plywood includes any multi - layer substrate having an exteriorly disposed solid , natural wood ply , such as a veneer . the plywood may include more than solid wood plies . alternatively , the plywood may include only one solid wood ply , or veneer , preferably forming exterior surface 2 of door skin d . the plywood may also include one or more composite core layers . the core layer ( s ) may be formed from a wood composite , such as mdf , chipboard , osb , hardboard , soft board , or particleboard . the solid , natural wood layer is bonded to the core layer ( s ) to form a plywood board b . for example , an exterior layer of veneer may be bonded to a wood composite substrate , such as mdf , to form plywood board b . as best shown in fig4 plywood board b is first subjected to a conditioning step in a chamber 22 , wherein board b is heated and treated with steam generated by a boiler 24 to increase moisture content of board b , thereby softening the plies and resin of board b . preferably , plywood board b has an initial water content of about 7 % prior to conditioning . however , it should be understood that different types of plywood may have different initial water contents . various methods of conditioning board b may be used . the plywood may be exposed to steam in an atmospheric ( i . e . non - pressurized ) chamber . alternatively , the plywood may be exposed to steam in a pressurized , sealed steam injection cavity . preferably , the plywood is exposed for about 30 minutes in a pressurized cavity having a steam pressure of about 100 psi . alternatively , the plywood may be soaked in a water bath , or exposed to surface water sprays . the preferred soaking time is between about 4 hours and about 24 hours . surfactants may also be used to achieve the desired moisture pick - up . for example , the plywood may be soaked in a water - surfactant bath for between about 4 hours and about 24 hours , wherein the bath comprises water and about 0 . 2 % rhodasurf surfactant . in any case , the plywood board b is conditioned through the use of water and heat in chamber 22 until moisture content of the board b has increased to a moisture content of between about 10 % to about 40 %, depending on the depth of molded depression 12 to be achieved during the molding process , as well as the type of plywood being reformed . the thermal softening point of the plywood board is a function of the wood species comprising the plies of the plywood board , the initial cellular moisture content of the wood species , and the chemical properties of the resin adhering the plies together . as such , the amount of heat and water required in chamber 22 to increase the moisture content to the preferred range is variable . softening at as low a temperature as possible is preferred . after board b has been conditioned in chamber 22 , board b is forwarded via a conveyor 25 to a deforming press 26 . as known in the art , press 26 includes upper and lower platens 28 , 30 , which define in the closed state of press 26 a contoured mold cavity 32 . the heated , moistened board b is then pressed into a molded shape using a relatively slow , continuous closure rate of press 26 . preferably , the closure rate of press 26 is about 3 mm per minute to about 7 mm per minute , more preferably about 5 mm per minute . press 26 preferably applies between about 100 psi to about 500 psi to moistened board b during compression . in addition , platens 28 , 30 are heated to create a temperature in mold cavity 32 of between about 350 ° f . and 450 ° f ., preferably about 400 ° f . the softened board is thereby deformed using heat and pressure in press 26 . however , the preferred pressure and temperature ranges disclosed herein are not dependent on the closure rate of press 26 . as such , different pressure and temperature ranges may be appropriate depending on the type of plywood species being molded . the slow closing rate of about 5 mm per minute is preferably maintained regardless of the pressure and temperature associated with press 26 . water is driven from the plywood board during deformation , whereby excess steam is permitted to escape due to the relatively slow closure rate of press 26 . the resulting plywood door skin d is formed to have a contoured shape corresponding to contoured mold cavity 32 , as best shown in fig5 . preferably , plywood door skin d is compressed to a final thickness of between about 2 . 0 mm to about 4 mm . the post - formed plywood door skin d has a substantially uniform thickness , as well as a substantially uniform density . as best shown in fig6 the present invention is also directed to a door 50 having a peripheral interior frame f , as known in the art , and first and second door skins . at least one of the door skins is a molded plywood door skin d , as disclosed above . thus , door skin d includes at least one panel portion 10 , but may include multiple panel portions 10 . for example , door 50 has four panel portions 10 , forming panels p 1 , p 2 , p 3 and p 4 . each of molded panels p 1 - p 4 includes a panel portion 10 , a depression 12 and outer portion 14 , as described above . it will be apparent to one of ordinary skill in the art that modifications and variations can be made in construction or configuration of the present invention without departing from the scope or spirit of the invention . therefore , it is intended that the disclosed invention cover all such modifications and variations , provided they come within the scope of the following claims and their equivalents .
| 1 |
reference will now be made in detail to the preferred embodiment of the present invention . referring to fig1 - 3 , a cable connector assembly 100 for mating with a complementary connector ( not shown ) comprises a connector 6 and a cable 2 having a plurality of wires 20 . each wire 20 has a front end ( not labeled ) connected with the connector 6 . the connector 6 comprises a contact module 1 connected with the front ends of the wires 20 , a mounting ring 3 attached to the cable 2 , a shielding shell 4 attached to the mounting ring 3 , and a front shell 5 attached to the shielding shell 4 along a front - to - back direction . the shielding shell 4 and the mounting ring 3 both have a plurality of screw threads to match with each other . the mounting ring 3 is received in the shielding shell 4 . the contact module 1 comprises a mating portion 10 for mating with the complementary connector , and a connecting portion 11 connected with the wires 20 . the contact module 1 is attached to the front shell 5 . the mating portion 10 is received in the front shell 5 . the cable 2 comprises a braided layer 21 surrounding the wires 20 , and an insulative layer 22 coating on the braided layer 21 . the mounting ring 3 comprises a plurality of screwed portions 30 , and a plurality of riveting portions 31 riveted on the cable . the screwed portions 30 have a plurality of screw threads formed on an outer surface thereof for matching with the shielding shell 4 . each riveting portion 31 is disposed between adjacent two screwed portions 30 . the screwed portions 30 and the riveting portions 31 are spaced one by one along a circling direction around the cable 2 . a part of the braided layer 21 is exposed outside of the insulative layer 22 and the mounting ring 3 is riveted on said part of the braided layer 21 . the mounting ring 3 is electrically connected between the shielding shell 4 and the braided layer 21 . to install the mounting ring 3 , a part of the braided layer 21 is firstly exposed outside of the insulative layer 22 . then , make said part of the braided layer 21 bent rearwards to surround the insulative layer 22 . thirdly , install the mounting ring 3 on said part of the braided layer 21 which is bent rearwards to surround the insulative layer 22 . fourthly , rivet the riveting portions 31 to make the mounting ring 3 attached to the cable 2 . in another option , the mounting ring 3 could be directly riveted on the insulative layer 22 . the shielding shell 4 comprises a receiving room 40 recessed from a front end of the shielding shell 4 for partially receiving the cable 2 , a plurality of side walls 41 surrounding the receiving room 40 , and a thread - portion 42 located at a rear end of the receiving room 40 and having a plurality of screw threads formed on an inner surface thereof for matching with the mounting ring 3 . the thread - portion 42 has a stop - hole 44 defined at a rear end thereof behind the screwed portions 30 . the stop - hole 44 has a diameter smaller than a diameter of the mounting ring 3 and greater than a diameter of the cable 2 . referring to fig1 - 3 , the front shell 5 is attached to the shielding shell 4 along a front - to - back direction . the front shell 5 cooperates with the shielding shell 4 to form a receiving cavity therebetween for receiving the contact module 1 . the wires 20 are curly or slack within the shielding shell 4 . the front shell 5 comprises a front portion 51 receiving the mating portion 10 and a rear portion 50 attached to the shielding shell 4 . the rear portion 50 comprises a plurality of outer protrusions 501 . the shielding shell 4 comprises a plurality of slots 43 receiving the outer protrusions 501 , respectively . the front shell 5 , the shielding shell 4 and the mounting ring 3 are made of conductive material , so that the contact module 1 does not need another shielding structure for suppressing electromagnetic interference . the wires 20 are long enough to ensure that the front shell 5 and the contact module 1 do not interfere the screwing movement of the shielding shell 4 . when the connector assembly 100 is assembled well , the wires 20 are shrunk to be curly and secured in the shielding shell 4 . to manufacture the cable connector assembly 100 , firstly , provide the cable 2 with a plurality of wires 20 . secondly , provide the shielding shell 4 with the receiving room 40 and make the cable 2 pass into the shielding shell 4 through the receiving room 40 , the shielding shell 4 has a plurality of screw threads . thirdly , provide the mounting ring 3 having a plurality of screw threads for matching with the shielding shell 4 and mount the mounting ring 3 to the cable 2 . fourthly , provide the contact module 1 for mating with the complementary connector , and connect the contact module 1 with the front ends of the wires 20 . fifthly , provide the front shell 5 , and attach the contact module 1 to the front shell 5 . sixthly , screw the shielding shell 4 to the mounting ring 3 , with the front ends of the wires 20 , the front shell 5 and the contact module 1 exposed outside of the shielding shell 4 . seventhly , attach the front shell 5 to the shielding shell 4 along a front - to - back direction with the wires 20 shrunk to be curly and secured in the shielding shell 4 . it is to be understood , however , that even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description , together with details of the structure and function of the invention , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .
| 8 |
fig1 shows a plurality of users 1 - n between whom data is to be transferred , whereby for the transmission of data between the users , parameters are to be negotiated which determine how the data is to be transferred ( scanning rate , bandwidth , coding etc ., particularly codec modes for tfo ) or , for example also which options can be supported in a protocol . for this purpose , the users disclose between themselves the number of parameter sets supported by them ( number of supported codec modes , supported protocol options etc . ), the individual parameter weighting , supported parameters and the parameters presently in use in step a 1 , in order to prepare the parameter voting by means of an election method . in step a 2 , each user determines , in accordance with a predetermined method , the parameters to be used for the transmission of data to other users , taking account of parameter sets ( codecs etc .) supported by this user and by other users . for this , a weighting factor ( a number of votes ) for the parameters is first determined in step a 2 . 1 , if these are not already specified in a protocol known to all users , with the weight factors stating the number of votes a user has in each case for which parameter set ( codec ). based on the weighting factors ( negotiated or specified by a protocol ) and the parameter sets offered by this and the other user , the total number of votes per user and the number of parameter sets to be selected are determined . in step a 2 . 3 , the voting method to be used is determined on the basis of the number of votes available to a user in each case ( whereby the user in the case of the method shown in fig1 knows how many votes the users have and how they apply them ). this can , for example , be similar to the dehondt method , or another method , used to elect candidates to parliament , but used in this case for the election of parameter sets ( codec modes etc .) for transmission in a mobile radio network etc . in step a 2 . 4 , the users ( mobile stations , pda , etc .) vote ( corresponding to a parliamentary election but with a different number of votes for the voting users ), but each user 1 - n determining according to an identical method which user selects , e . g . which codec mode ( whereby , for example , in a protocol known to all users it can be determined that each user chooses the highest ( or lowest ) codec mode available to him , or codec modes are given certain votes according to their level ). in step a 2 . 5 , an election result is thus obtained in the form of a list of all the parameters used by all the users 1 - n ( e . g . mobile radio codecs ). then , in step a 3 , the parameters determined in this way by each user 1 - n are used to transmit data ( voice data etc .) between the users . in fig2 , instead of a ( vote for ) determination of the parameters in each user ( mobile station , pda etc .) in accordance with an identical method , a determination of the parameters takes place in a control centre . to do this , the information relevant to selecting the parameters is sent in step b 1 to the control centre ( for instance , the examples of information given for this purpose in fig2 ). in step b 2 , a selection of the parameters ( codecs etc .) takes place in the control centre . in step b 3 , the parameters determined in the control centre that can now be used for the transmission of data are sent to each user 1 - n . in step b 4 , the determined parameters ( the available and / or actual selected codecs ) are used by each user for the transmission of data ( voice data etc .) to another user . in fig2 , instead of a ( vote for ) determining the parameters in each user ( mobile station , pda etc . ), a determination of the parameters in a control centre takes place in accordance with an identical method . in fig4 , instead of a ( vote for ) determining the parameters in each user ( mobile station , pda etc . ), a determination of the parameters takes place in accordance with an identical method in several decision units in the network ( transcoder ( tc ), transcoder rate adaptor unit ( trau ) base station subsystem ( bss ), radio network controller ( rnc ) etc .) allocated to the users . for this purpose , in step c 1 the information relevant to selecting the parameters is sent to the decision units ( for instance , the information given as examples for this purpose in fig2 ). in step b 2 , a selection of the parameters ( codecs etc .) takes place in the decision units . in step c 3 , the parameters determined in the decision units that can now be used for the transmission of data are sent to each user 1 - n . in step c 4 , the determined parameters ( the available and / or actual selected codecs ) are used by each user for the transmission of data ( voice data etc .) to one of the other users . fig3 shows an example of an application for the use of the methods for determining codecs for a tfo communication ( amr - eb - tfo ) between users . various modes are given in fig3 a by showing their transmission rate parameters ( 6 , 65 , 8 , 85 to 23 , 85 kbits / s ). for example , the method can be defined so that the number of votes specified for this ( 2 , 4 , . . . , 1 ) are available in each case to the user that supports this mode ( for example 2 votes for the first mode , 4 for the second etc .) as shown in fig3 b , the first user ( side b ) can , for example , support the parameter sets ( codec modes 6 , 65 / 8 , 85 / 12 , 65 / 14 , 25 / 15 , 85 / 19 , 86 kbits / s ) given under scs and proposes the modes 6 , 65 / 8 , 85 / 12 , 65 / 14 , 25 shown in bold under acs , for which he receives 2 + 4 + 6 + 8 = 20 votes . as shown in fig3 c , the second user ( side a ) supports the modes 8 , 85 - 23 , 85 shown in bold under scs and proposes the modes 15 , 85 / 18 , 25 / 19 , 85 / 23 , 05 / 23 , 85 shown in bold under acs , for which he receives 10 + 9 + 7 + 3 + 1 = 30 votes . whereas ( fig3 b , mcas = 4 ) the first user ( b ) desires a maximum of four of the modes to be used , the second user ( a ), according to fig3 c ( macs = 5 ) would like a maximum of five of the modes to be supported . therefore , the number of parameters to be given ( modes ), in fig3 d , is set to the minimum number of modes receiving the maximum support from the two users ( minimum of 4 and 5 ), i . e . four , so that four parameter sets ( modes ) are to be selected from the four modes 8 , 85 / 12 , 65 / 14 , 25 / 15 , 85 / 19 , 85 , given under cscs ( common supported code set ) and known to both users ( modes shown in bold under scs in fig3 b and 3 c ). based on the number of votes determined in fig3 b and fig3 c , who has what voting right is determined , for example in accordance with the dehont or stlague / schepers method etc . in this case user a has voting right 1 and voting right 3 , but user b has voting right 3 and voting right 4 ( i . e . for the second and fourth codec mode to be selected ). in the simplest case , the voting method can be such that voting takes place alternately after the first vote . fig3 e shows that b has voted for mode 15 , 85 , which , for example , can mean that a automatically selects the largest mode ( that should be known to a control centre in accordance with fig2 or to all users in accordance with fig1 ). as shown in fig3 f , a now votes for mode 14 , 85 because , for example , it is predetermined that b votes for a mode proposed by a that is as high as possible , as a first mode . as shown in fig3 g , b now votes for mode 19 , 85 because it is predetermined that a has supported a mode , proposed by b , that is the lowest possible ( according to fig3 d ) as a cscs supported mode , with 19 , 85 being the lowest in this case . then , in fig3 h , a votes for the next highest mode proposed by a contained in the cscs set , i . e . 12 , 65 . this means that finally modes 12 , 65 , 14 , 25 , 15 , 85 and 19 , 85 have been selected and are now available or determined for the transmission of data between users . the method is very flexible and can also be used with any new codec modes introduced and be quickly adjusted to various assessments of the voice quality of the amr - wb mode by changing the number of votes for the codec mode in the voting method .
| 7 |
the invention relates to a cover for a centrifugal compressor which is intended to be fixed to a casing of a turbine engine , comprising an upstream edge and a downstream edge in the flow direction of the gases crossing the compressor , said cover comprising a plurality of openings and fixing means . this cover is characterised in that upstream fixing means are located upstream relative to the openings and can be accessed by a fixing tool through at least one of said openings in the cover . the object of facilitating assembly of the cover is achieved by the invention by means of permitting access from downstream to the fixing means when the cover is put in place . clamping means can have been pre - positioned on the fixing means , and it is then sufficient to pass the fixing tool through the opening providing access to said means in order to fix the cover against the casing by clamping . advantageously this arrangement corresponds to openings intended for air offtake . the cover is thus initially intended to participate in a high - pressure air distribution system by taking off air in the region of the compressor . in this case , there is certainty that said openings are correctly positioned and dimensioned in order not to disrupt the operation of the compressor , and there is also no need to modify the design of the cover in this region . preferably , said upstream fixing means for the cover of the centrifugal compressor comprise an outer flange and fixing holes which pierce said flange , the unit being intended to cooperate with clamping means , of the screw and nut type , which can be actuated by the fixing tool . the holes in the flange are easy to machine and to position on the flange . the screw and nut system , which is widely used , makes it possible to easily fix the cover by clamping said cover against the casing . for example , since each upstream fixing means defines an axis corresponding to the rotation of the movable clamping means for the clamping thereof , said axis passes through at least one of said openings in the cover . in particular , in the case where fixing is achieved by bolting , this makes it possible to use a spindle wrench without a complex mechanism . advantageously , said outer flange forms a wall which completely surrounds said cover . said flange , which is arranged so as to ensure a sealed circumferential connection , upstream of said openings , to a part of the casing when the fixing means are clamped , makes it possible to prevent air from the compressor , which passes through the openings in the cover , from escaping from the front during operation of the turbine engine . firstly , this prevents the space which receives the air escaping through the openings in the cover from being brought into communication with the upstream stages of the turbine engine and disrupting the operation thereof . in addition , devices already described in the documents cited above make it possible to ensure sealing of the connection between the cover and the casing in the region of the largest radius thereof , downstream of the openings . thus , during operation of the turbine engine , the fact that the flow in the compressor is brought into communication with the outside of the cover , via the openings used for allowing the fixing tools to pass through , does not have a detrimental effect on the efficiency of the compressor , since the pressure will equalise . similarly , in view of an offtake of air for uses in other equipment , the lack of leaks in this region contributes to maintaining an elevated pressure in the air distribution circuit . advantageously , each fixing hole in the flange can receive a damping screw by passing through at least one of said openings in the cover . this makes it possible , for example , to pass the screws through after installing the cover on the casing . in a variant , if the holes in the flange are positioned on studs connected to the casing , the openings make it possible to pass through nuts and to install said nuts on the studs . preferably , said flange extends close to the upstream edge of the cover . in a particular embodiment , the cover of the centrifugal compressor further comprises a downstream flange for holding against the casing of the turbine engine , which flange is fastened to the outer wall of the cover between said openings and the downstream edge and forms a sealing means . using a downstream holding flange , which is arranged so as to ensure a sealed circumferential connection against the casing , makes it possible to easily adapt the cover in order to ensure perfect sealing of the space for receiving the gases taken off , and to permit easy assembly thereof . advantageously , this flange is bolted onto the casing of the turbine engine . the invention also relates to a turbine engine comprising a centrifugal compressor having a cover as described above , the casing of which is arranged so as to form a sealed connection to the upstream flange of the cover when the clamping means are clamped . advantageously , the casing is arranged so as to form , together with said cover , at least one closed space which recovers the air passing through the openings in the cover . advantageously , at least some of the openings in the cover , and said air recovery space , are designed to participate in an air offtake system . the present invention will be more readily understood and other details , features and advantages of the present invention will become clearer upon reading the following description with reference to the accompanying drawings , in which : fig1 is an axial section of a first embodiment of a turbine engine compressor comprising a cover according to the invention . fig2 is an enlargement of fig1 , in the upstream fixing region of the cover , showing an exploded view of the screw and nut . fig3 is an axial section of the turbine engine , showing the cover of fig1 , during the assembly phase . with reference to fig1 , the invention relates to the cover 1 of a centrifugal compressor , which forms the radially outer wall of the duct in which the blades 2 of the rotor wheel 3 rotate . the unit has a rotational symmetry about an axis which is not shown but which would be horizontal with respect to fig1 , and below the parts shown . by rotating about this axis , the rotor sucks air in through its input 4 , which is axially oriented , in order to expel said air at higher pressure through its output 5 , which is radially oriented . in a general manner , said compressor discharges its compressed air into a radial recovery duct 6 which is intended to supply the combustion chamber , which is not shown but is located on the right - hand side with reference to fig1 , and is supplied upstream by an axial compressor 7 . the cover 1 is a part which rotates about the axis of symmetry of the compressor , the shape of which follows , with minimal clearance , the surface swept by the radial end of the blades 2 . in addition , the cover 1 is arranged so that the upstream leading edge 8 thereof ensures continuity in shape with the radially outer wall 9 of the duct of the axial compressor 7 , and so that the downstream trailing edge 10 thereof ensures continuity in shape with the wall 11 of the recovery duct 6 . fixing the cover on the casing of the turbine engine should make it possible to position said cover in a sufficiently precise manner in order to take account of the stresses mentioned above and to also permit the cover to move according to the operation of the turbine engine , in order to follow the deformation of the blades 2 while maintaining an optimal clearance . many types of solutions are proposed in the prior art , in particular fixing the cover by means of two flanges , such as in us2011 / 0002774 and ep2206882 , which have already been cited . with regard to holding the cover , this assembly by means of two flanges overdetermines the fixing points of the cover , which must be taken into account in the type of connections made . however , it is entirely possible to achieve an assembly of this kind , as is shown in the documents cited in the prior art . it is within the scope of the invention to use other combinations between the flanges , by adjusting the resilience of the connections they provide . a first embodiment according to the invention uses fixing of this kind , comprising two flanges . an annular flange 12 , fastened downstream in the portion of the cover 1 having the maximum radius relative to the axis of rotation , is bolted to the edge of a circumferential part 13 of the casing . in addition , the cover is also fixed in the upstream portion thereof by a flange 14 to another part 15 of the casing , over the entire circumference thereof . said flange 14 is a frustoconical part which extends radially outside the cover 1 and separates the upstream edge 8 from the downstream edge 10 over the entire circumference of the cover . said flange is fixed to the cover 1 very close to the upstream edge 8 of the cover 1 and has a small radial extension . the connection between the cover and the part 15 of the casing is therefore made very close to the upstream edge 8 . said flange 14 , on account of the position thereof , provides an additional benefit , which is set out below . in some turbine engines , the cover also participates in a function of offtake of high - pressure air in the region of the compressor , in order to introduce said air into a distribution circuit towards various equipment inside the aircraft . in the example shown , the cover 1 is pierced with a plurality of openings 16 , one of which is shown in the section in fig1 . these openings 16 are located on a ring about the axis of symmetry , having a radius which is approximately equal to the minimal radius of the cover , on the upstream edge 8 , and increased by a quarter of the difference from the maximum radius , on the downstream edge 10 . viewed in a different manner , said openings are also located in a region of maximum curvature of the axial profile of the cover 1 . in this way , said openings are located in a region where the cover fulfils a lesser role for containing the flow inside the compressor . said openings can thus be arranged to have a cross section which is sufficient to allow a fraction of the air circulating in the rotor to pass to the outer side of the cover , without causing significant deterioration in the operation of the compressor . the air taken off is recovered in a recovery space 17 , which itself is brought into communication with a distribution circuit ( not shown ). in the example shown in fig1 , said space 17 is delimited , close to the cover , by a portion of the cover 1 , by means of : in the downstream direction , the downstream flange 12 and then an annular part 13 of the casing , in the upstream direction , the upstream flange 14 then an annular part 15 of the casing . thus , as shown in fig2 , the upstream flange is fixed to the part 15 by means of systems consisting of a screw 18 and a nut 19 which pass through holes 20 and 21 , the flange 14 and the part 15 . said holes are , of course , positioned so as to be facing one another during assembly of the cover . said holes , in particular the holes 20 formed in the flange 14 , are circumferentially distributed . the holes 20 which pierce the flange 14 thus form , together with the portion of the flange 14 which surrounds them , as many fixing means fastened to the cover 1 . said fixing means 20 cooperate with the holes 21 arranged on the edge of the annular part 15 and the bolting means , 18 and 19 , in order to press the flange 14 against the part 15 . the portions in contact with the flange and the edge of the part 15 are arranged , optionally with an interposed adjustment shim 23 , so as to ensure that the connection is sealed with respect to the high - pressure air , by virtue of the pressure applied by the bolting means 18 - 19 when said means are clamped . similarly , the downstream flange 12 is bolted to the edge of the part 13 of the casing and ensures that the space 17 for receiving the air taken off is sealed on the downstream side of the cover 1 . the flange 12 generally extends radially outside the cover , which makes it possible to access , from downstream of said flange , the end thereof bolted to the casing when assembling or disassembling the cover . the difficulty in assembling this configuration lies in the fact that , in order to ensure sealing upstream of the cover , the part 15 of the casing approaches the upstream edge 8 of the cover 1 where the radius thereof is the smallest . during assembly in the turbine engine , the cover is installed downstream of the parts of the casing and of the compressor which are already assembled , as is shown in fig3 . the cover 1 , similarly to the downstream flange 12 , thus blocks access to the fixing means 20 and the bolting means 18 - 19 . in the cover according to the invention , the openings 16 in the cover 1 , which are provided for the offtake of air , have been located opposite the fixing holes 20 in the flange 14 , such that a fixing tool , for example a wrench 22 , can grip the head of the screw 18 ( not visible in fig3 ) by passing through the holes 20 in the flange 14 and the holes 21 in the part 15 of the casing , in order to screw said casing onto the nut 19 . in the example shown , the nut 19 is fixed opposite the hole 21 in the part 15 of the casing , on the upstream side thereof , and is prevented from rotating . it is thus possible to install the cover from the rear of the casing , in order to screw the screws 18 there in the nuts 19 through the holes 20 in the flange and the holes 21 in the part 15 of the casing , which holes have been aligned in advance . the offtake opening 16 permits the spindle of a wrench 22 , aligned with the axis of the fixing hole 20 , to pass through , which makes it possible to turn said wrench in order to screw the screw 18 . moreover , while still meeting the operating criterion of the compressor , this opening 16 is sufficiently large to permit the screw 18 to pass through , so as to introduce said screw into the nut 19 through the holes 20 and 21 , as well as the head of the wrench 22 which cooperates with the head of the screw 18 . in a variant , the head of the wrench 22 can be narrower than that of the screw 18 , conversely to what is shown in fig3 , if said wrench head cooperates with a hollowed pattern in the head of the screw . in this way , the screws 18 can have been pre - positioned on the fixing holes 20 of the upstream flange 14 of the cover before said cover is put into position on the casing . in this case , the cross section of the offtake opening 16 only has to permit a relatively narrow wrench 22 to pass through . in another variant , the direction of the placement of the screws 18 , or of the nuts 19 , is reversed . the screw 18 , which is prevented from rotating on the part 15 of the casing , thus forms a stud on which the hole 20 of the flange 14 comes into position , before the nut 19 is screwed .
| 5 |
the invention will be described below in relation to a communications environment . although well suited for use with circuit - switched or packet - switched networks , the invention is not limited to use with any particular type of communications system or configuration of system elements and those skilled in the art will recognize that the disclosed techniques may be used in any application in which it is desirable to provide secure feature access . for example , the systems and methods disclosed herein will also work well with sip - based communications systems and endpoints . moreover , the various endpoints described herein can be any communications device such as a telephone , speakerphone , cellular phone , sip - enabled endpoint , softphone , pda , conference system , video conference system , wired or wireless communication device , or in general any communications device that is capable of sending and / or receiving voice and / or data communications . the exemplary systems and methods of this invention will also be described in relation to software , modules , and associated hardware and network ( s ). in order to avoid unnecessarily obscuring the present invention , the following description admits well - known structures , components and devices that may be shown in block diagram form , are well known , or are otherwise summarized . for purposes of explanation , numerous details are set forth in order to provide a thorough understanding of the present invention . it should be appreciated however , that the present invention may be practiced in a variety of ways beyond the specific details set forth herein . fig1 illustrates an exemplary communications environment 100 according to this invention . in accordance with this exemplary embodiment , the communication environment is for video conferencing between a plurality of endpoints . more specifically , communications environment 100 includes a conferencing module 110 , and one or more networks 10 , and associated links 5 , connected to a video camera 102 viewing one or more conference participant endpoints 105 . the communication environment 100 also includes a web cam 115 , associated with conference participant endpoint 125 , and one or more non - video enabled conference participant endpoints 135 , connected via one or more networks 10 and links 5 , to the conference module 110 . the conference module 110 includes a messaging module 120 , an emotion detection and monitoring module 130 , a gesture reaction module 140 , a gesture recognition module 150 , a gesture analysis module 160 , processor 170 , transcript module 180 , control module 190 and storage 195 , as well as other standard conference bridge componentry which will not be illustrated for sake of clarity . in operation , a video conference is established with the cooperation of the conference module 110 . for example , video camera 102 , which may have associated audio inputs and presentation equipment , such as a display and loudspeaker , could be associated with conference participants 105 . webcam 115 is provided for conference participant 125 with audio and video therefrom being distributed to the other conference endpoints . the non - video enabled conference participants 135 either because of endpoint capabilities or user impairment are not able to receive or view video content . the capabilities of these various endpoints can be registered with the conference module 110 , and in particular the messaging module 120 , upon initiation of the video conference . alternatively , the messaging module 120 can interrogate one or more of the endpoints and determine its capabilities . in addition , one or more of each endpoint and / or a user associated with each endpoint may have a profile that not only specifies the capabilities of the endpoint but also messaging preferences . as discussed , these messaging preferences can include the types of information to be received as well as how that information should be presented . as discussed hereinafter in greater detail , the messaging module 120 forwards this information via one or more of the requested modalities to one or more of the conference endpoints . it should be appreciated that while the messaging module 120 will in general only send the description information to non - video enabled conference participants , this messaging could in general be sent to any conference participant . transcript module 180 , in cooperation with one or more of the processer 170 and storage 195 can be enacted upon the commencement of the video conference to create a conference transcript that includes one or more of the following pieces of information : participant information , emotion information , gesture information , key gesture information , reaction information , timing information , and in general any information associated with the video conference and / or one of the described modules . the conference transcript can be conference participant centric or , a “ master ” conference transcript that is capable of capturing and memorializing any one or more aspects of the video conference . upon commencement of the video conference , one or more of the video - enabled participants are monitored and one or more of their emotions and gestures recognized . in cooperation with the emotion detection monitoring module 130 and gesture recognition module 150 , once one or more of an emotion and gesture are recognized , a determination is made whether that is a reportable gesture . if it is a reportable gesture , and in cooperation with the transcript module 180 , that emotion or gesture is recorded in one or more of the appropriate transcripts . in addition , the gesture analysis module 160 analyzes the recognized gesture to determine if it is a key gesture . if the gesture is a key gesture , and in cooperation with the gesture reaction module 140 , the corresponding action associated with that key gesture is taken . the storage 195 can store , for example , a table that draws a correlation between a key gesture and a corresponding reaction . once the correlation between a key gesture and a corresponding reaction is made , the gesture reaction module 140 cooperates with the control module 190 to perform that action . as discussed , this action can in general be any action capable of being performed by any one or more of the components in the communications environment 100 and even more generally , any action associated with a video conferencing environment . the determination by the gesture recognition module 150 as to whether a gesture is reportable can be based on one or more of a “ master ” profile as well as individual profiles associated with one or more conference participants . a profile could also be associated with a group of conference participants for which common reporting action is desired . thus , the gesture recognition module 150 is capable of parallel operation ensuring the transcript module 180 receives all necessary information to ensure all desired reportable events are being recorded and / or forwarded to one or more endpoint ( s ). typical gesture information includes the raising of a hand , shaking of the head , nodding and the like , and more in generally can include any activity being performed by a monitored conference participant . emotions are generally items such as whether a conference participant is nervous , blushing , smiling , crying , or in general any emotion a conference participant may be expressing . while the above has been described in relation to a gesture reaction module it should be appreciated that comparable functionality can be provided based on the detection of one or more emotions . similarly , it should be appreciated that it could be a singular emotion or gesture that triggers a corresponding reaction , or a combination of one or more emotions and / or gestures that triggers a corresponding reaction ( s ). examples of reactions include one or more of panning , tilting , zooming , increasing microphone volume , decreasing microphone volume , increasing loud speaker volume , decreasing loud speaker volume , switching camera feeds , and in general any conference functionality . fig2 - 3 illustrate exemplary conference transcripts according to an exemplary embodiment of this invention . in conference transcript 200 , illustrated in fig2 , four illustrative conference participants ( 210 , 220 , 230 and 240 ) are participating and , as each participant speaks , their speech recognized , for example , with the use of a speech - to - text converter and logged in the transcript . in addition , there is an emotion section 250 that summarizes one or more of the various emotions and gestures recognized as time proceeds through the video conference . the emotion section 250 can be participant - centric , and can also include motion and / or gesture information for a plurality of participants that may coincidently be performing the same gesture or experiencing the same emotion . even more generally , any action taken by a conference participant could also be summarized in this emotion portion 250 , such as conference participant 1 typing during conference participant 3 speaking . as mentioned above , this conference transcript 200 and in a similar manner conference transcript 300 , can be customized based on , for example , a particular conference participant &# 39 ; s profile . this conference transcript could be presented in real - time for one or more of the conference participants and stored either in storage 195 , at an endpoint and / or forwarded to , for example , a destination specified in the profile at the conclusion of the conference , e . g . email . fig3 illustrates an optional embodiment of a conference transcript 300 . in this particular embodiment , the emotion and / or gesture information is located adjacent to the corresponding conference participant . this could be useful to assist with focusing more particularly on a particular conference participant . in addition , one or more of the conference transcript 200 and conference transcript 300 could be dynamic and , for example , selectable such that a user could return to the conference transcript after conference has finished and replay either a recoded portion of the conference and / or the particular footage associated with a recorded emotion and / or gesture . even though not illustrated , one or more of the conference transcripts 200 and 300 could also include a reaction column that provides an indication as to which one or more reactions were performed during the conference . fig4 illustrates an exemplary method of operation of providing descriptions of non - verbal communications to video telephony participants who are not video - enabled . while fig4 will generally be directed toward gestures , it should be appreciated that corresponding functionality could be applied to emotions and / or a series of emotions and gestures that , when combined , are a triggering event . in particular , control begins at step s 400 and continues to step s 410 . in step s 410 , the system can optionally assess the capabilities of one or more of the meeting participants . next , in step s 420 , and for each meeting participant that is not video - enabled , the messaging preferences and / or capabilities of one or more of the meeting participants can be determined . then , in step s 430 , a transcript template can be generated that includes , for example , portions for one or more of the conference participants , emotions , gestures , and reaction portions . control then continues to step s 440 . in step s 440 , the conference commences and transcripting optionally started . next , in step s 450 , and for each video - enabled participant , their gestures are monitored and recognized . then , in step s 460 , a determination is made whether the gesture is a reportable gesture . if the gesture is reportable , control continues to step s 470 where gesture information corresponding to a description of the gesture is one or more of provided and recorded to one or more appropriate endpoints . control then continues to step s 480 . in step s 480 , a determination is made whether a gesture , or a sequence of gestures , is a key gesture . if it is a key gesture , control continues to step s 490 with control otherwise jumping to step s 520 . in step s 490 , a control action ( s ) associated with the gesture is determined . next , in step s 500 , a determination is made whether the control action ( s ) is allowable . for example , this determination could be made based on one or more of the capabilities of one or more endpoints , information associated with a profile governing whether gestures from that particular endpoint will be recognized , and a particulars specific key gesture , or the like . if the action ( s ) is allowable , control continues to step s 510 where the action is performed . as discussed , this action could also be logged in a transcript . control then continues back to step s 520 . in step s 520 , a determination is made whether the conference has ended . if the conference has not ended , control jumps back to step s 450 where further gestures are monitored . otherwise , transcripting , if initiated , is concluded with control jumping to step s 530 where the control sequence ends . a number of variations and modifications of the invention can be used . it would be possible to provide or claims for some features of the invention without providing or claiming others . the exemplary systems and methods of this invention have been described in relation to enhancing video conferencing . however , to avoid unnecessarily obscuring the present invention , the description omits a number of known structures and devices . this omission is not to be construed as a limitation of the scope of the claimed invention . specific details are set forth to provide an understanding of the present invention . it should however be appreciated that the present invention may be practiced in a variety of ways beyond the specific detail set forth herein . furthermore , while the exemplary embodiments illustrated herein show various components of the system collocated , certain components of the system can be located remotely , at distant portions of a distributed network , such as a lan , cable network , and / or the internet , or within a dedicated system . thus , it should be appreciated , that the components of the system can be combined in to one or more devices , such as a gateway , or collocated on a particular node of a distributed network , such as an analog and / or digital communications network , a packet - switch network , a circuit - switched network or a cable network . it will be appreciated from the preceding description , and for reasons of computational efficiency , that the components of the system can be arranged at any location within a distributed network of components without affecting the operation of the system . for example , the various components can be located in a switch such as a pbx and media server , gateway , a cable provider , enterprise system , in one or more communications devices , at one or more users &# 39 ; premises , or some combination thereof . similarly , one or more functional portions of the system could be distributed between a communications device ( s ) and an associated computing device . furthermore , it should be appreciated that the various links , such as link 5 , connecting the elements can be wired or wireless links , or any combination thereof , or any other known or later developed element ( s ) that is capable of supplying and / or communicating data to and from the connected elements . these wired or wireless links can also be secure links and may be capable of communicating encrypted information . transmission media used as links , for example , can be any suitable carrier for electrical signals , including coaxial cables , copper wire and fiber optics , and may take the form of acoustic or light waves , such as those generated during radio - wave and infra - red data communications . also , while the flowcharts have been discussed and illustrated in relation to a particular sequence of events , it should be appreciated that changes , additions , and omissions to this sequence can occur without materially affecting the operation of the invention . in yet another embodiment , the systems and methods of this invention can be implemented in conjunction with a special purpose computer , a programmed microprocessor or microcontroller and peripheral integrated circuit element ( s ), an asic or other integrated circuit , a digital signal processor , a hard - wired electronic or logic circuit such as discrete element circuit , a programmable logic device or gate array such as pld , pla , fpga , pal , special purpose computer , any comparable means , or the like . in general , any device ( s ) or means capable of implementing the methodology illustrated herein can be used to implement the various aspects of this invention . exemplary hardware that can be used for the present invention includes computers , handheld devices , telephones ( e . g ., cellular , internet enabled , digital , analog , hybrids , and others ), and other hardware known in the art . some of these devices include processors ( e . g ., a single or multiple microprocessors ), memory , nonvolatile storage , input devices , and output devices . furthermore , alternative software implementations including , but not limited to , distributed processing or component / object distributed processing , parallel processing , or virtual machine processing can also be constructed to implement the methods described herein . in yet another embodiment , the disclosed methods may be readily implemented in conjunction with software using object or object - oriented software development environments that provide portable source code that can be used on a variety of computer or workstation platforms . alternatively , the disclosed system may be implemented partially or fully in hardware using standard logic circuits or vlsi design . whether software or hardware is used to implement the systems in accordance with this invention is dependent on the speed and / or efficiency requirements of the system , the particular function , and the particular software or hardware systems or microprocessor or microcomputer systems being utilized . in yet another embodiment , the disclosed methods may be partially implemented in software that can be stored on a storage medium , executed on programmed general - purpose computer with the cooperation of a controller and memory , a special purpose computer , a microprocessor , or the like . in these instances , the systems and methods of this invention can be implemented as a program embedded on personal computer such as an applet , java ® or cgi script , as a resource residing on a server or computer workstation , as a routine embedded in a dedicated measurement system , system component , or the like . the system can also be implemented by physically incorporating the system and / or method into a software and / or hardware system . although the present invention describes components and functions implemented in the embodiments with reference to particular standards and protocols , the invention is not limited to such standards and protocols . other similar standards and protocols not mentioned herein are in existence and are considered to be included in the present invention . moreover , the standards and protocols mentioned herein and other similar standards and protocols not mentioned herein are periodically superseded by faster or more effective equivalents having essentially the same functions . such replacement standards and protocols having the same functions are considered equivalents included in the present invention . the present invention , in various embodiments , configurations , and aspects , includes components , methods , processes , systems and / or apparatus substantially as depicted and described herein , including various embodiments , subcombinations , and subsets thereof . those of skill in the art will understand how to make and use the present invention after understanding the present disclosure . the present invention , in various embodiments , configurations , and aspects , includes providing devices and processes in the absence of items not depicted and / or described herein or in various embodiments , configurations , or aspects hereof , including in the absence of such items as may have been used in previous devices or processes , e . g ., for improving performance , achieving ease and \ or reducing cost of implementation . the foregoing discussion of the invention has been presented for purposes of illustration and description . the foregoing is not intended to limit the invention to the form or forms disclosed herein . in the foregoing detailed description for example , various features of the invention are grouped together in one or more embodiments , configurations , or aspects for the purpose of streamlining the disclosure . the features of the embodiments , configurations , or aspects of the invention may be combined in alternate embodiments , configurations , or aspects other than those discussed above . this method of disclosure is not to be interpreted as reflecting an intention that the claimed invention requires more features than are expressly recited in each claim . rather , as the following claims reflect , inventive aspects lie in less than all features of a single foregoing disclosed embodiment , configuration , or aspect . thus , the following claims are hereby incorporated into this detailed description , with each claim standing on its own as a separate preferred embodiment of the invention . moreover , though the description of the invention has included description of one or more embodiments , configurations , or aspects and certain variations and modifications , other variations , combinations , and modifications are within the scope of the invention , e . g ., as may be within the skill and knowledge of those in the art , after understanding the present disclosure . it is intended to obtain rights which include alternative embodiments , configurations , or aspects to the extent permitted , including alternate , interchangeable and / or equivalent structures , functions , ranges or steps to those claimed , whether or not such alternate , interchangeable and / or equivalent structures , functions , ranges or steps are disclosed herein , and without intending to publicly dedicate any patentable subject matter .
| 7 |
in the general formula ( a ) to express the photosensitive material of the present invention , the halogen represented by r 1 to r 8 is preferably chlorine , bromine or iodine , the alkyl group represented by r 1 to r 8 is preferably an alkyl group having 1 to 4 carbon atoms such as methyl , ethyl , propyl , isopropyl , n - butyl , isobutyl , secbutyl , t - butyl ; the alcoxyl group is preferably an alcoxyl group having 1 to 4 carbon atoms such as methoxy , ethoxy , hydroxyethoxy , propoxy , hydroxypropoxy , isopropoxy , n - butoxy , isobutoxy , sec - butoxy , or t - butoxy ; the aralkyl group is preferably benzyl group , phenetyl group , benzhydryl group , etc . ; the aryl group is preferably phenyl , tolyl , hydroxyphenyl , naphthyl , etc . ; the monoalkylamino group is preferably a monoalkylamino group having 1 to 4 carbon atoms such as monomethylamino , monoethylamino , monopropylamino , monoisopropylamino , mono - n - butylamino , monoisobutylamino , mono - sec - butylamino , or mono - t - butylamino ; the dialkylamino group is preferably a dialkylamino group having alkyl substitution group with 1 to 4 carbon atoms such as dimethylamino , diethylamino , dipropylamino , diisopropylamino , di - n - butylamino , diisobutylamino , di - sec - butylamino , di - t - butylamino , etc . ; the acylamino group is preferably an aliphatic substitution acylamino group having 2 to 5 carbon atoms respectively such as acetylamino , propionylamino , butyrylamino , isobutyrylamino , isovalerylamino , pivaloylamino , and an aromatic substitution acylamino group such as benzoylamino , or toluoylamino ; the alkylcarbamoyl group is preferably an alkylcarbamoyl group having 2 to 5 carbon atoms such as methylcarbamoyl , ethylcarbamoyl , propylcarbamoyl , isopropylcarbamoyl , n - butylcarbamoyl , isobutylcarbamoyl , sec - butylcarbamoyl , t - butylcarbamoyl , etc . ; the arylcarbamoyl group is preferably phenylcarbamoyl , tolylcarbamoyl , etc . ; the alkylsulfamoyl group is preferably an alkylsulfamoyl group having 1 to 4 carbon atoms such as methylsulfamoyl , ethylsulfamoyl , propylsulfamoyl , isopropylsulfamoyl , n - butylsulfamoyl , sec - butylsulfamoyl , t - butylsulfamoyl , etc . ; arylsulfamoyl group is preferably phenylsulfamoyl , tolylsulfamoyl , etc . ; the acyl group is preferably an aliphatic acyl group having 1 to 5 carbon atoms such as formyl , acetyl , propionyl , butyryl , isobutyryl , valeryl , isovaleryl , pivaloyl , etc . and an aromatic acyl group such as benzoyl , toluoyl , salicyloyl , naphthaoyl , etc . ; the alkyloxycarbonyl group is preferably an alkyloxycarbonyl group having 2 to 5 carbon atoms such as methoxycarbonyl , ethoxycarbonyl , propoxycarbonyl , isopropoxycarbonyl , n - butoxycarbonyl , isobutoxycarbonyl , sec - butoxycarbonyl , t - butoxycarbonyl , etc . ; the aryloxycarbonyl group is preferably an aryloxycarbonyl group such as phenoxycarbonyl ; the acyloxy group is preferably an aliphatic acyloxy group having 2 to 5 carbon atoms such as acetoxy , propionyloxy , butyryloxy , isobutyryloxy , valeryloxy , isovaleryloxy , pivaloyloxy , etc . and an aromatic acyloxy group such as benzoyloxy , toluoyloxy , naphthoyloxy , etc . in the above general formula ( a ), the alkyl group represented by r 9 to r 12 is preferably an alkyl group having 1 to 4 carbon atoms such as methyl , ethyl , propyl , isopropyl , butyl , isobutyl , sec - butyl , t - butyl , etc . the compound expressed by tile general formula ( a ) can be easily synthesized by condensing a derivative of spirobiindan or spirobichroman with 1 , 2 - naphthoquinonediazide - 5 - sulfonyl chloride or 1 , 2 - naphthoquinonediazide - 4 - sulfonyl chloride or mixture of these substances , whereby said derivative of spirobiindan or spirobichroman is expressed by : general formula ( b ) ## str3 ## where r 13 to r 20 each independently rtepresents hydrogen , hydroxyl group , halogen , alkyl group , alcoxyl group , aralkyl group , aryl group , amino group , monoalkylamino group , dialkylamino group , acylamino group , alkylcarbamoyl group , arylcarbamoyl group , alkylsulfamoyl group , arylsulfamoyl group , carboxyl group , cyano group , nitro group , acyl group , alkyloxycarbonyl group , aryloxycarbonyl group , or acyloxy group , and at least one of r 13 to r 20 is hydroxyl group , amino group or monoalkylamino group ; r 21 to r 24 each independently represents hydrogen or lower alkyl group , and r 21 and r 22 and / or r 23 and r 24 may form a ring ; r 25 to r 28 each independently represents hydrogen or lower alkyl group , and r 25 or r 26 and r 27 or r 28 may form a ring . however , at least one of r 25 to r 28 is a substitution group other than hydrogen ; and the compound expressed by the general formula ( b ) can be synthesized , for example , by applying the method of w . baker et al . [ j . chem . soc ., ( 1939 ), p . 195 ff .] more concretely , the compound can be obtained by dehydrated condensation of substituted or unsubstituted ( poly ) hydroxyphenyl compound and carbonyl compounmd except acetone , e . g . methylethylketone , diethylketone , methylisobutylketone , cyclohexanone , etc . in the presence of acid catalyst . in the compound thus obtained , at least one substitution group other than hydrogen is introduced at position 2 or position 2 &# 39 ; in case of spirobiindan compound , and at least one substitution group other than hydrogen is introduced at position 3 or position 3 &# 39 ; in case of spirobichroman compound . actually , a single product is not obtained by the introduced substitution group and substituting position isomer of hydroxyl group , but it is obtained as a mixture of many types of isomers . the compounds expressed by the general formula ( b ) are summarized in tables 1 to 7 but are not limited to these . table 1______________________________________no . compounds______________________________________1 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 - 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol2 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol3 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol4 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol5 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol6 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol7 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol8 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol9 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol10 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol11 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol12 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol______________________________________ table 2______________________________________no . compounds______________________________________13 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - buthyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol14 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - buthyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol15 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - buthyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol16 2 - methyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol17 2 - methyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol18 2 - methyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol19 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol20 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 4 &# 39 ;, 5 &# 39 ;, 6 &# 39 ;- hexol21 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol22 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 4 &# 39 ;, 5 &# 39 ;- tetrol23 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 5 &# 39 ;, 6 &# 39 ;- tetrol24 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 &# 39 ;, 7 &# 39 ;- tetrol25 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 5 &# 39 ;, 6 &# 39 ;- tetrol______________________________________ table 3______________________________________no . compounds______________________________________26 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol27 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 6 &# 39 ;, 7 &# 39 ;- tetrol28 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 4 &# 39 ;, 6 &# 39 ;- tetrol29 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 5 &# 39 ;, 7 &# 39 ;- tetrol30 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 5 &# 39 ;, 7 &# 39 ;- tetrol31 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 4 &# 39 ;, 6 &# 39 ;- tetrol32 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 4 &# 39 ;, 5 &# 39 ;- tetrol33 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 5 &# 39 ;, 6 &# 39 ;- tetrol34 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 &# 39 ;, 7 &# 39 ;- tetrol35 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 5 &# 39 ;, 6 &# 39 ;- tetrol36 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol37 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 6 &# 39 ;, 7 &# 39 ;- tetrol38 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 4 &# 39 ;, 6 &# 39 ;- tetrol39 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 5 &# 39 ;, 7 &# 39 ;- tetrol40 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 5 &# 39 ;, 7 &# 39 ;- tetrol______________________________________ table 4______________________________________no . compounds______________________________________41 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 4 &# 39 ;, 5 &# 39 ;- tetrol42 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 5 &# 39 ;, 6 &# 39 ;- tetrol43 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 &# 39 ;, 7 &# 39 ;- tetrol44 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 5 &# 39 ;, 6 &# 39 ;- tetrol45 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol46 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 6 &# 39 ;, 7 &# 39 ;- tetrol47 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 4 &# 39 ;, 6 &# 39 ;- tetrol48 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 5 &# 39 ;, 7 &# 39 ;- tetrol49 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 5 &# 39 ;, 7 &# 39 ;- tetrol50 2 , 2 , 3 , 3 &# 39 ;- tetramethyl - 3 , 3 &# 39 ;- di - iso - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 4 &# 39 ;, 6 &# 39 ;- tetrol51 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 4 &# 39 ;, 5 &# 39 ;- tetrol52 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 5 &# 39 ;, 6 &# 39 ;- tetrol53 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 &# 39 ;, 7 &# 39 ;- tetrol54 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 5 &# 39 ;, 6 &# 39 ;- tetrol55 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol______________________________________ table 5______________________________________no . compounds______________________________________56 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 6 &# 39 ;, 7 &# 39 ;- tetrol57 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 4 &# 39 ;, 6 &# 39 ;- tetrol58 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 5 &# 39 ;, 7 &# 39 ;- tetrol59 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 5 &# 39 ;, 7 &# 39 ;- tetrol60 2 - ethyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - propyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 4 &# 39 ;, 6 &# 39 ;- tetrol61 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 4 &# 39 ;, 5 &# 39 ;- tetrol62 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 5 &# 39 ;, 6 &# 39 ;- tetrol63 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 &# 39 ;, 7 &# 39 ;- tetrol64 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 5 &# 39 ;, 6 &# 39 ;- tetrol65 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol66 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 6 &# 39 ;, 7 &# 39 ;- tetrol67 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 4 &# 39 ;, 6 &# 39 ;- tetrol68 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 5 &# 39 ;, 7 &# 39 ;- tetrol69 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 5 &# 39 ;, 7 &# 39 ;- tetrol70 2 - n - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - n - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 4 &# 39 ;, 6 &# 39 ;- tetrol______________________________________ table 6______________________________________no . compounds______________________________________71 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 4 &# 39 ;, 5 &# 39 ;- tetrol72 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 5 &# 39 ;, 6 &# 39 ;- tetrol73 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 5 , 6 &# 39 ;, 7 &# 39 ;- tetrol74 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 5 &# 39 ;, 6 &# 39 ;- tetrol75 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol76 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 6 &# 39 ;, 7 &# 39 ;- tetrol77 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 4 &# 39 ;, 6 &# 39 ;- tetrol78 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 4 , 6 , 5 &# 39 ;, 7 &# 39 ;- tetrol79 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 5 &# 39 ;, 7 &# 39 ;- tetrol80 2 - iso - propyl - 3 , 3 &# 39 ;- dimethyl - 3 , 3 &# 39 ;- di - iso - butyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 7 , 4 &# 39 ;, 6 &# 39 ;- tetrol81 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 5 &# 39 ;- diol82 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 &# 39 ;- diol______________________________________ table 7______________________________________no . compounds______________________________________83 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 6 &# 39 ;- diol84 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 5 &# 39 ;- diol85 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 &# 39 ;- diol86 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 6 &# 39 ;- diol87 5 , 5 &# 39 ;- di - t - buthyl - 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 6 &# 39 ;- diol88 5 , 5 &# 39 ;- di - t - buthyl - 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 6 &# 39 ;- diol89 7 , 7 &# 39 ;- dibromo - 2 , 3 , 5 , 3 &# 39 ;, 5 &# 39 ;- heptamethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 6 &# 39 ;- diol90 5 , 5 &# 39 ;- diamino - 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 6 , 6 &# 39 ;- diol91 3 , 4 , 4 &# 39 ;- trimethyl - 4 , 4 &# 39 ;- diethyl - 2 , 2 &# 39 ;- spirobichroman - 6 , 7 , 6 &# 39 ; 7 &# 39 ;- tetrol92 7 , 7 &# 39 ;- dichlor - 3 , 4 , 4 &# 39 ;- trimethyl - 4 , 4 &# 39 ;- diethyl - 2 , 2 &# 39 ;- spirobichroman - 6 , 6 &# 39 ;- diol93 5 , 5 ═- dichlor - 3 , 4 , 4 &# 39 ;- trimethyl - 4 , 4 &# 39 ;- diethyl - 2 , 2 &# 39 ;- spirobichroman - 6 , 6 &# 39 ;- diol94 6 , 6 &# 39 ;- di - t - buthyl - 3 , 4 , 4 &# 39 ;- trimethyl - 4 , 4 &# 39 ;- diethyl - 2 , 2 &# 39 ;- spirobichroman - 7 , 7 &# 39 ;- diol______________________________________ the compound of the present invention can be obtained by normal esterification reaction of a part or all of hydroxyl groups of said polyhydroxy compound with 1 , 2 - naphthoquinonediazide - 5 -( and / or - 4 -) sulfonyl chloride in the presence of basic catalyst . specifically , a predetermined quantity of polyhydroxy compound and 1 , 2 - naphthoquinondiazide - 5 -( and / or - 4 -) sulfonyl chloride as well as solvents such as dioxane , acetone , methylethylketone , n - methylpyrolidone , etc . are placed in a flask , and this is condensed by dropping basic catalyst such as sodium hydroxide , sodium carbonate , sodium hydrogencarbonate , triethylamine , etc . the resultant product is rinsed with water , purified and dried . by the above esterification reaction , mixtures with different ester values and different esterification positions can be obtained . as the alkali - soluble resin used in the present invention , novolak resin , vinylphenol resin , n -( hydroxyphenyl ) maleimide ( co ) polymer , styrene - maleic acid anhydride copolymer , or metacryl or acrylic resin containing carboxyl group , sulfonyl group , or phosphonic acid group may be used . the alkali - soluble novolak resin used in the present invention can be obtained by condensation of 1 mol of phenols and 0 . 6 to 2 . 0 mols of aldehydes in the presence of acid catalyst . as the phenols , phenol , p - chlorphenol , o - cresol , m - cresol , p - cresol , ethylphenol , resorcinol , naphthol and xylenol , etc . may be used alone or in combination . as the aldehydes , formaldehyde , paraformaldehyde , acetoaldehyde or furfural , etc . may be used . as the acid catalyst , hydrochloric acid , sulfuric acid , formic acid , oxalic acid and acetic acid may be used . the novolak resin thus obtained has molecular weight of 1 , 000 to 50 , 000 and is alkali - soluble . the photosensitive material and the alkali - soluble novolak resin in the present invention are used in the following ratio : novolak resin by 100 weight parts and the photosensitive material by 5 to 100 weight parts , or more preferably , by 10 to 50 weight parts . if the ratio of the latter is used by less than 5 weight parts , the ratio of ( remaining ) film extremely decreases . if it is used by more than 100 weight parts , sensitivity and solubility to solvents decrease . in the present invention , the above photosensitive materials should be primarily used , whereas the following photosensitive materials may be used : for example , ester compound of 1 , 2 - naphthoquinonediazide - 5 - sulfonyl chloride with polyhydroxybenzophenones such as 2 , 3 , 4 - trihydroxybenzophenone , 2 , 4 , 4 &# 39 ;- trihydroxybenzophenone , 2 , 4 , 6 - trihydroxybenzophenone , 2 , 3 , 4 , 4 &# 39 ;- tetrahydroxybenzophenone , 2 , 2 &# 39 ;, 4 , 4 &# 39 ;- tetrahydroxybenzophenone , 2 , 4 , 6 , 3 &# 39 ;, 4 &# 39 ;, 5 &# 39 ;- hexahydroxybenzophenone , 2 , 3 , 4 , 3 &# 39 ;, 4 &# 39 ;, 5 &# 39 ;- hexahydroxybenzophenone , etc ., polyhydroxyphenylalkylketones such as 2 , 3 , 4 - trihydroxyacetophenone , 2 , 3 , 4 - trihydroxyphenylhexylketone , etc ., bis (( poly ) hydroxyphenyl ) alkanes such as bis ( 2 , 4 - dihydroxyphenyl ) methane , bis ( 2 , 3 , 4 - trihydroxyphenyl ) methane , bis ( 2 , 4 - dihydroxyphenyl ) propane - 1 , etc ., polyhydroxy - benzoic acid esters such as 3 , 4 , 5 - trihydroxy propyl benzoate , 3 , 4 , 5 - trihydroxy phenyl benzoate , etc . bis ( polyhydroxybenzoyl ) alkane or bis ( polyhydroxybenzoyl ) aryl such as bis ( 2 , 3 , 4 - trihydroxy - benzoyl ) methane , bis ( 2 , 3 , 4 - trihydroxybenzoyl ) benzene , etc ., alkylene - di -( polyhydroxybenzoate ) such as ethylene glycol - di -( 3 , 5 - dihydroxybenzoate ), etc . in this case , it is preferable to use the photosensitive material of the above general formula ( a ) by 100 weight parts and the above compound by less than 100 weight parts , or more preferably , less than 30 weight parts . further , in the present invention , polyhydroxy compound may be contained in order to promote dissolution in developing solution . as the preferable polyhydroxy compounds , phenols , resorcin , phloroglucin , 2 , 3 , 4 - trihydroxybenzophenone , 2 , 3 , 4 , 4 &# 39 ;- tetrahydroxybenzophenone , 2 , 3 , 4 , 3 &# 39 ;, 4 &# 39 ;, 5 &# 39 ;- hexahydroxybenzophenone , acetone - pyrogallol condensed resin , etc . may be used . as the solvents to dissolve the photosensitive materials and the alkali - soluble resin of the present invention , ketones such as methylethylketone , cyclohexanone , etc ., alcohol ethers such as ethyleneglycol - monomethylether , ethyleneglycol - monoethyl ether etc . ethers such as dioxane , ethyleneglycol - dimethyl ether , diethyleneglycoldimethyl ether , etc ., cellosolve esters such as methylcellosolve acetate , ethylcellosolve acetate , etc ., fatty acid esters such as buthyl acetate , ethyl lactate , methyl lactate , etc ., halogenated hydrocarbons such as 1 , 1 , 2 - trichloroethylene , etc . or high polar solvents such as dimethylacetoamide , n - methylpyrolidone , dimethylformamide , dimethylsulfoxide , γ - butylolactone , etc . may be used . these solvents may be used alone or in combination . to the composition for photoresist of the present invention , dyes , plasticizers , supplementary bonding agents , surface active agents , etc . may be blended . more concretely , the dyes such as methyl violet , crystal violet , malachite green , etc ., the plasticizers such as stearic acid , actal resin , phenoxy resin , alkyd resin , etc ., supplementary bonding agent such as hexamethyldisilazane , chloromethylsilane , etc ., and the surface active agents such as nonylphenoxy - poly -( ethyleneoxy ) ethanol , octylphenoxy - poly -( ethyleneoxy ) ethanol , etc . may be used . also , the compounds described in japanese patent publication laid - open 58 - 149042 or japanese patent publication laid - open 58 - 182633 may be added . when the above photoresist composition is coated on a substrate ( e . g . silicon / silicon dioxide film ) used in the manufacture of precision integrated circuit by adequate coating method such as spinner , coater , etc . and it is further exposed to light through a predetermined mask and developed , satisfactory resist can be obtained . as the developing solution for the photoresist composition of the invention , aqueoous solution of the following substances may be used : inorganic alkalis , such as sodium hydroxide , potassium hydroxide , sodium carbonate , sodium silicate , sodium metasilicate , aqueous ammonia , etc ., primary amines such as ethylamine , n - propylamine , etc ., secondary amines such as diethylamine , di - n - butylamine , tertiary amines such as triethylamine , methyldiethylamine , etc ., alcoholamine , such as dimethylethanol amine , triethanol amine , etc ., quaternary ammonium salts such as tetramethylammonium hydroxide , tetraethylammonium hydroxide , choline hydroxide , etc . or alkalis of cyclic amines such as pyrrole , piperidine , etc . further , adequate quantity of alcohols or surface active agents may be added to aqueous solution of the above alkalis . when necessary , image reversal treatment may be performed on the photosensitive resin composition of the present invention by the methods described in british patent 844 , 039 , u . s . pat . no . 4 , 104 , 070 or japanese patent publication 55 - 32088 , and negative image can be obtained . in the following , description will be given on embodiments of the present invention , while the present invention is not limited to such embodiments . the symbol &# 34 ;%&# 34 ; means weight % unless otherwise specified . first , description will be given on synthesis of the photosensitive materials and novolak resin . into a three - neck flask , 1513 . 3 g of pyrogallol , 2800 ml of acetic acid , and 2400 ml of conc . hydrochloric acid were placed , and the mixture was uniformly dissolved while stirring . it was heated in a water bath , and 1297 . 9 g of methylethylketone were dropped over a period of 6 hours 40 minutes . after heating and stirring in a water bath for 80 minutes , it was cooled down to room temperature . after cooling , the precipitates were filtered , rinsed with 10 liters of distilled water and was dried under reduced pressure . into a three - neck flask , 22 . 0 g of isomer mixture thus obtained and represented by 2 , 3 , 3 &# 39 ;- trimethyl - 3 , 3 &# 39 ;- diethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol , 80 . 6 g of 1 , 2 - naphthoquinonediazide - 5 - sulfonyl chloride , and 750 ml of acetone were placed , and these were uniformly dissolved while stirring . then , 32 . 5 g of triethylamine were gradually dropped , and this was allowed to react for 2 hours 30 minutes at room temperature . after the reaction was completed , the content was dropped into 2 . 5 % aqueous solution of acetic acid . the resultant precipitates were filtered and dried under reduced pressure , and the photosensitive material ( a ) was obtained . using pyrogallol and diethylketone , isomer mixture represented by 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol was prepared by the same procedure as the photosensitive material ( a ). into a three - neck flask , 24 . 5 g of the isomer mixture represented by 2 , 2 &# 39 ;- dimethyl - 3 , 3 , 3 &# 39 ;, 3 &# 39 ;- tetraethyl - 1 , 1 &# 39 ;- spirobiindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexol obtained above , 80 . 6 g of 1 , 2 - naphthoquinonediazide - 5 - sulfonyl chloride and 750 ml of acetone were placed , and this mixture was uniformly dissolved while stirring . then , 32 . 5 g of triethylamine was gradually dropped and this was allowed to react at room temperature for 2 hours 30 minutes . after the reaction was completed , the content was dropped into 2 . 5 % aqueous solution of acetic acid . the resultant precipitates were filtered and dried under reduced pressure , and the photosensitive material ( b ) was obtained . using 1 , 2 , 4 - triacetoxybenzene and methylethylketone , 3 , 4 , 4 &# 39 ;- trimethyl - 4 , 4 &# 39 ;- diethyl - 2 , 2 &# 39 ;- spirobichroman - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol was obtained by the same procedure as the photosensitive material ( a ). then , 22 . 0 g of 3 , 4 , 4 &# 39 ;- trimethyl - 4 , 4 &# 39 ;- diethyl - 2 , 2 &# 39 ;- spirobichroman - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol , 80 . 6 g of 1 , 2 - naphthoquinonediazide - 5 - sulfonyl chloride , and 750 ml of were placed into a three - neck flask , and the mixture was uniformly dissolved while stirring . next , 32 . 5 g of triethylamine were gradually dropped and were allowed to react at room temperature for 2 hours 30 minutes . after the reaction was completed , the content was dropped into 2 . 5 % aqueous solution of acetic acid . the resultant precipitates were filtered and dried under reduced pressure , and the photosensitive material ( c ) was prepared . into a three - neck flask , 45 g of metacresol , 55 g of paracresol , 54 . 0 g of 37 % formalin aqueous solution , and 0 . 05 g of oxalic acid were placed . this was heated up to 115 ° c . while stirring and was refluxed for 15 hours . then , the bath temperature was gradually increased to 230 ° c ., and water was distilled away . further , the pressure was reduced to 2 mmhg , and the remaining monomer was removed . the novolak resin thus obtained has average molecular weight of 6 , 600 ( converted to polystyrene ). 0 . 51 g of the photosensitive material ( a ) synthesized in ( 1 ) above and 2 . 01 g of novolak resin synthesized in ( 4 ) above were dissolved in 7 . 50 g of ethoxyethyl acetate , and the resultant mixture was filtered through 0 . 2 μm microfilter , and a resist composition was prepared . this resist composition was coated on a silicon wafer using spinner . this was dried on a vacuum adsorption type hot plate at 90 ° c . for 60 seconds , and a resist film with thickness of 1 . 2 μm was obtained . next , using a nikon reduction projection aligner ( exposure system ) ( g - ray ; numerical aperture : 0 . 48 ), exposure to light was performed through a test chart mask . the wafer thus exposed was heated on a hot plate at 120 ° c . for 60 seconds , and development was performed for one minute in aqueous solution of tetramethylammonium hydroxide of 2 . 38 weight %. then , it was rinsed with ion exchange water and a resist pattern was obtained . the resist pattern thus obtained was examined under scanning electron microscope . the sensitivity was defined by a reciprocal of the exposure to reproduce a mask pattern of 0 . 7 μm and was expressed by the relative value to the sensitivity of the comparative example described below . remaining film ratio was expressed by percentage of film thickness of non - exposed portion after development to the thickness before development . to determine heat - resistance , a silicon wafer having a resist pattern was baked for 4 minutes on a vacuum adsorption hot plate at a predetermined temperature , and heat resistance was expressed by the temperature value , at which the resist patterns began to deform . resolution was expressed by linewidth of the smallest mask pattern resolved in the exposure to reproduce a mask pattern of 0 . 7 μm . sidewall angle was expressed by an angle between the substrate and side wall of the resist pattern when cross - section of the resist pattern of 0 . 7 μm was examined from lateral direction under electron microscope . the relative sensitivity was 1 . 05 , remaining film ratio was 99 . 7 %, heat resistance was 150 ° c ., resolution was 0 . 45 μm , and sidewall angle was 89 degrees . the photosensitive materials synthesized in ( 2 ) and ( 3 ) above were used at the ratio shown in table 8 below , and resist compositions were prepared by the same procedure as in example 1 and were evaluated . the results are given in table 9 . table 8______________________________________ novolakexamples photosensitive materials resin solvents______________________________________example 2 photosensitive 0 . 49 g 1 . 99 g ethyl lactate material ( a ) 7 . 49 gexample 3 photosensitive 0 . 50 g 2 . 00 g same as material ( b ) example 1 7 . 50 gexample 4 photosensitive 0 . 49 g 1 . 98 g same as material ( c ) example 1 7 . 48 g______________________________________ table 9______________________________________ heat - side - relative resolu - remaining resis - wallexamples sensitivity tion film ratio tance angle______________________________________example 2 1 . 1 0 . 45 99 . 6 150 ° c . 89 ° example 3 1 . 0 0 . 47 99 . 8 145 ° c . 89 ° example 4 1 . 05 0 . 45 99 . 7 150 ° c . 89 ° ______________________________________ as it is evident from the above results , the photo - resist of the present invention has excellent sensitivity , high resolution , remaining film ratio and heat resistance , and sidewall angle of pattern exceeded 88 degrees in all cases . using the photosensitive materials , cresol novolak resin and solvents shown in table 10 below , resist solution was prepared by the same procedure as in example 1 and was evaluated . the results are given in table 11 . table 10__________________________________________________________________________comparativeexample photosensitive materials resin solvents__________________________________________________________________________comparative 1 , 2 - naphthoquinone - 0 . 50 g same as example 1 same as example 1example 1 diazide - 5 - sulfonic acid 1 . 99 g 7 . 48 g ester of 3 , 3 , 3 &# 39 ; 3 &# 39 ;- tetra - methyl - 1 , 1 &# 39 ;- spiro - biindan - 5 , 6 , 7 , 5 &# 39 ;, 6 &# 39 ;, 7 &# 39 ;- hexolcomparative 1 , 2 - naphthoquinone - 0 . 50 g same as example 1 ethyl lactateexample 2 diazide - 5 - sulfonic acid 2 . 01 g 7 . 51 g ester of 2 , 3 , 4 , 4 &# 39 ;- tetra - hydroxybenzophenonecomparative 1 , 2 - naphthoquinone - 0 . 50 g same as example 1 same as example 1example 3 diazide - 5 - sulfonic acid 2 . 00 g 7 . 50 g ester of 4 , 4 , 4 &# 39 ;, 4 &# 39 ;- tetramethyl - 2 , 2 &# 39 ;- spiro - bichroman - 6 , 7 , 6 &# 39 ;, 7 &# 39 ;- tetrol__________________________________________________________________________ table 11______________________________________compara - heat - side - tive relative resolu - remaining resis - wallexample sensitivity tion film ratio tance angle______________________________________compara - 1 . 0 0 . 47 99 . 5 150 ° c . 87 ° tiveexample 1compara - 0 . 8 0 . 50 98 . 9 140 ° c . 86 ° tiveexample 2compara - 0 . 9 0 . 47 99 . 0 145 ° c . 87 ° tiveexample 3______________________________________ in none of the comparative examples , sidewall angle exceeded 88 degrees .
| 6 |
for the purpose of promoting an understanding of the principles of the invention , reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . a time domain reflectometry ( tdr ) apparatus 10 of the present invention , shown in fig1 , is used to measure electrical properties of the concrete 12 . the apparatus 10 generally comprises a probe 14 , a plurality of equally spaced spike sensors 16 ( available at most local hardware stores ), a coaxial cable 18 , and a tdr tester ( such as tdr 100 tester available from campbell scientific , inc ., not shown ). an apparatus of the type described above is described in more detail in u . s . pat . no . 6 , 215 , 317 to siddiqui et al ., which patent is hereby incorporated by reference . data collected by the tdr tester is analyzed in accordance with the present invention by a general purpose computer running a specially developed computer program that implements the equations described below . a typical tdr signal and information content for tdr measurement in a material is shown in fig2 . a “ peak ” and a “ valley ” are caused by reflections and are characteristic of tdr signals measured in geomaterials . the “ peak ” is caused by the first reflection , which occurs when the electromagnetic pulse crosses the air / material interface . the “ valley ” is caused by the second reflection , which occurs when the electromagnetic pulse arrives at the end of the measurement probe . dielectric constant , and electrical conductivity are two pieces of important information that can be obtained from analysis of a tdr signal . material dielectric constant is analogous to young &# 39 ; s modulus in that it determines the electromagnetic wave speed . it can be determined from travel time analysis and is generally called apparent dielectric constant , denoted k a . k a represents the real part of the frequency dependent dielectric permittivity . equation ( 1 ) gives the mathematic expression for computing dielectric constant from tdr measurement . where l p is the length of the probe in the material and l a is the scaled horizontal distance between the two reflections , called apparent length . the electrical conductivity , ec b , causes attenuation of tdr signal and is another important piece of information that can be obtained from tdr waveforms . different approaches can be used to obtain electrical conductivity from a tdr signal . equation ( 2 ) uses an approach based on analysis of the long - term response of a tdr system to determine electrical conductivity . ec b = 1 c ( v s v f - 1 ) ( 2 ) where v s is the source voltage , v f is the long term voltage level , and c is a constant related to probe configuration , determined from equation ( 3 ) for coaxially configured probes , c = 2 π l p r s ln ( ⅆ 0 ⅆ i ) ( 3 ) in which l p equals the length of the probe in the material , r s the internal resistance of the pulse generator ( typically 50 ohms ), and d o and d i are the diameters of outer and inner coaxial conductors , respectively . water plays an important role in concrete mixtures . it serves as a necessary agent for hydration reactions , in which free water molecules become chemically bound with cement particles . the amount of water involved in these reactions is typically only a fraction of the water added to the mixture . as the result , the major factor that controls the amount of water used in concrete is to provide a mixture that can be placed and is workable . water in concrete mixtures comes from two main sources , i . e ., water added during mixing process and the adsorbed water from aggregates . the moisture contents of coarse aggregates generally range from 0 . 5 % to 2 % and those of fine aggregates range from 2 % to 6 %, which can introduce significant amount of water into the concrete mixture . currently , there is no effective approach for field measurement of water content in freshly placed concrete . the strong correlation between tdr - measured dielectric constant and the amount of water in concrete is attributed to the much larger dielectric constant of free water ( around 81 at room temperature ) as compared with the dielectric constant of air ( around 1 ) or geomaterial solids ( around 3 to 7 ). gravimetric water content and concrete dry densities can be related to concrete dielectric constant using eq . ( 4 ). k a ρ w ρ d = a + bw ( 4 ) where a and b are concrete specific constants obtained from calibration tests . for rapid determination of water content , a batch sample can be obtained and put into a cylindrical mold of known volume , from which total density of concrete in the mold , ρ t , can be determined . the relationship between total density and dry density in given by eq . ( 5 ) ρ d = ρ t 1 + w ( 5 ) substituting eq . ( 5 ) into eq . ( 4 ) and solving for the water content gives : w = k a ρ w ρ t - a b - k a ρ w ρ t ( 6 ) equation ( 6 ), with appropriate values of a and b for concrete , can be used to obtain the free water content of concrete . two different concretes were studied using a method of the present invention . the mixture proportions of the two concretes are shown in table 1 . the samples were obtained from field and put into standard 6 ′× 12 ″ plastic molds with volume of 6 . 107 × 10 − 3 m 3 . additional samples were obtained to determine oven dry water content . water contents in concrete are computed from tdr - measured dielectric constant by eq . ( 6 ). a temperature compensation factor ( eq . ( 7 )) was applied before computing water content to compensate the effects of temperature on tdr - measured dielectric constant , based on a linear relationship observed between the value of apparent dielectric constant k a at a given temperature and the value of k a at a standard temperature , e . g . 20 ° c . specifically , the value of k a obtained from the tdr signal at a given temperature is normalized to the standard temperature by multiplying the tdr - measured value of k a by a temperature compensation factor ( tcf ), where , for the above two concrete mixtures , tcf k ab = 1 0 . 0019 · t + 0 . 952 ( 7 ) physical interpretation as well as typical range of constants a and b are predominantly dependent on dielectric properties of dry solid phases and b being mostly decided by pore fluid . the values of constants a and b used in eq . ( 6 ) for the concrete tested were set to a = 1 . 0 and b = 14 . 5 . a summary of measured water contents by tdr for the fresh concrete samples are shown in table 2 . there are several observations from this table . for both of these concretes , the oven dry water content is slightly larger than the water contents calculated from batch receipts ( 0 . 4 % ( for mixture 2 ) and 0 . 3 % ( for mixture 1 )). these are equivalent to aggregates moisture content of 0 . 6 % and 0 . 8 % respectively , which are at the lower end of typical moisture range of aggregates discussed above . it is expected that the effects of aggregate moisture could be much more pronounced in other situations . table 2 shows eq . ( 6 ) provides better accuracy for water content measurement in concrete than from what can be determined from batch records because it accounts for moisture content contained in aggregate used in the concrete mixtures . water in concrete exists in two different types , i . e ., free water and chemically bound water . these two types of water show significantly different dielectric behavior . it has been established that free water has relaxation frequency of around 18 ghz while the relaxation frequency for bound water is within mhz range . ( relaxation frequency is a term that is analogous to resonant frequency for vibrating systems .) the tdr system used in the present invention has an effective frequency into the low gigahertz range and is more sensitive to the amount of free water than to bound water . thus , it is a more direct indicator of amount of free water in concrete . this makes tdr - measured dielectric constant more instructive and easier to interpret compared with the system used in the past . the plots of tdr - measured dielectric constant with time are shown in fig3 and 4 for both concretes . the dielectric constant consistently decreased with time . the tdr measured dielectric constant decreases at a high rate at the initial stage , which indicates the high intensity of hydration reactions . the rate of decrease becomes smaller with time , which reflects reduced intensity of hydration . the free water contents calculated using siddiqui - dmevich equation ( eq . ( 6 )) are also plotted in this figure , which clearly shows the decreasing amount of free water in concrete with time . after 196 days , the free water content in concrete sample from mixture 1 was around 3 . 0 % and after 166 days that mixture 2 was around 3 . 5 %. the fact that tdr measurements can be easily automated makes it an attractive tool for monitoring the free water content in concrete . the tdr - measured water content can be combined with the information of cement content from batch receipts to make an estimate of water - cement ratio . the calculated water - cement ratio of concrete samples from mixture 1 was 0 . 53 and that of mixture 2 was 0 . 52 , which are slightly higher than calculated from batch receipts ( by 0 . 1 and 0 . 4 ), respectively . as mentioned before , the moisture contents of aggregates in these concretes are believed to be at the lower end of typical moisture content range . the resulting difference in water - cement ratio can be more significant for aggregates with higher water content or in situations where water is added at the job site . while hydration causes the change of concrete mechanical structure and corresponding increase of concrete strength , it simultaneously changes concrete physico - chemical and electrical properties . thus , electrical properties of concrete and mortar , especially the electrical conductivity , are strongly related to the strength of concrete . while chemical reactions are the most important process occurring during concrete curing , the exact nature of the entire hydration process is complicated and not fully understood . generally speaking , hydration reactions take place between cement powder and water upon mixing and theoretically , the process continues forever . major products of the reactions include calcium silicate , calcium aluminate , ettringite , etc . calcium silicate is the major component affecting concrete strength and calcium aluminates predominantly determine the time of initial setting . a significant amount of heat is generated during hydration process . a direct consequence of the hydration process is a change in the microscopic structure . this results in the increase of modulus and strength . there is a strong linear correlation between concrete strength and degree of hydration . the hydration process , which significantly changes the microstructure of concrete , changes the electrical behavior of concrete as well . bulk water becomes chemically bound water , which shows significantly different dielectric behavior compared with free bulk water . the formation of solid structures by hydration reactions reduces the amount of free ions in pore solution , which results in a decrease of electrical conductivity . thus , concrete electrical behavior can be a strong indicator of the progress of the hydration process . as the hydration process directly results in the increase of concrete strength , electrical properties can thus be used to monitor strength development . the dielectric properties of concrete are dependent on factors such as the amount of water in the pore system and the concrete microstructure . the measured results of dielectric properties are also influenced by electrode configuration and measurement frequency band . optimized design , both in sensor geometry and measurement frequency range , is necessary to achieve the best measurement results . accurate measurement of dielectric properties of concrete is critical to achieving the best measurement accuracy . various technologies and system designs can be used for this purpose , including technologies based on measurement of frequency dependant behavior as obtained with an impedance analyzer or network analyzer . while these systems collect more information , measurements are generally expensive and data analysis is difficult . such systems typically are not suitable for field applications . in addition to automatically monitoring dielectric properties of the two concrete mixtures with time , strengths at 1 day , 7 days , and 28 days also were measured using specimens collected at the time of concrete placing . the compressive tests were performed in certified laboratories . fig5 and 6 show how the dielectric properties , electric conductivity and dielectric constant , change with time . dielectric constant consistently decreases with time , which is an indication of the decreasing amount of free water in concrete . due to hydration reactions , free water becomes chemically bound water , which has much smaller dielectric constant than free water . the observed changes of dielectric constant shown in fig5 are different from previous study results that found the dielectric constant first increases and then decreases with time . since the frequency used in previous studies were within the relaxation frequency range of chemically bound water , measurements were sensitive to the behaviors of both free water and chemically bound water . the previously observed increase of dielectric constant at the initial stage was the result of the dominant role played by the increasing amount of bound water . the decrease of dielectric constant in the longer term was dominated by the decreasing amount of free water . while previous studies helped to explain mechanisms of hydration in the fresh concrete mixture , they also caused difficulty in the interpretation of results since effects of bound water and free water could not be separated . the effective measurement frequency of the tdr tester used in the present invention is in the low gigahertz range , which is beyond the relaxation frequency of bound water . thus , the dielectric constant measured by tdr is predominantly influenced by the amount of free water in concrete . this makes the measurement much easier to interpret since the reduced amount of free water reflects the increased amount of bound water . the decrease of electrical conductivity as shown in fig6 is more significant , as it provides a strong indication of the structural changes and reduced amount of free ions in the concrete . the data for the initial part of the test in fig6 is replotted with an arithmetic time scale to show the behavior of freshly mixed concrete in fig7 . the electrical conductivity increases slightly after the mixing ( fig7 ), which possibly is caused by effects of consolidation and particle rearrangement . another important observation from fig6 is that for both of these concrete samples , after completion of the initial stages , the change of electrical conductivity decreases linearly with the logarithm of time . the slope of this line , which is believed to be related to rate of hydration , is similar for both concretes . at any given time after the initial stages , the electrical conductivity of the mixture 2 concrete is smaller than that of mixture 1 concrete . from fig5 - 7 , we can see that the temperature curves of the two concretes are similar . a group of tests were performed to investigate the effects of temperature on tdr measured dielectric constant and electrical conductivity . the cured concrete specimens from both mixtures were sealed and stored for 24 hours in temperature controlled room of 4 ° c . and 40 ° c ., respectively , and then allowed to return to ordinary laboratory room temperature . as the mixture temperature was being restored to room temperature , tdr and thermocouple readings were taken to monitor the change of dielectric constant and electrical conductivity with temperature . the measured values of dielectric constant and electrical conductivity for the two mixtures are normalized by those at room temperature ( 22 ° c .) and are plotted in fig8 and 9 . fig8 and 9 show that both the dielectric constant and electrical conductivity increase linearly with temperature within the temperature range of the study . the effect of temperature on electrical conductivity measurement is much more significant than that of dielectric constant as indicated by the steeper slope in fig9 . from these observations , the following temperature compensation factors ( eq . ( 8 )) are recommended to compensate for the effects of temperature on tdr measured dielectric constant and electrical conductivity . tcf k a = 1 0 . 0019 · t + 0 . 952 tcf ec b = 1 0 . 0247 · t + 0 . 453 ( 8 ) the results of compressive strength obtained from concrete cylinder testing are shown in fig1 and 11 . there is significant ( about 20 %) although not unreasonable scatter of results , which is possibly due to effects of sampling disturbance and curing process . the phenomena are common when evaluating concrete strength from cylinder samples . hyperbolic curves give good fit to the data and can be used to describe the evolution of compressive strength with time . the compressive strengths at different curing times predicted by the hyperbolic curves in fig1 and 11 are plotted against the temperature compensated tdr measured electrical conductivity in fig1 . fig1 indicates that the compressive strengths show reverse relationships with electrical conductivity , which are similar for the two concretes tested . these curves show linear trend in the middle and are slightly curved at high electrical conductivities ( initial stage ) and at low electrical conductivities ( long term ). the reverse trend between concrete strength and electrical conductivity is believed to be valid since the hydration process reduces the amount of free ions in concrete ( and thus reduces the electrical conductivity ) and at the same time increases its compressive strength . it is observed that a curve in the form of eq . ( 9 ) gives good fit to the data in fig1 and gives the reasonable strength values for extreme conditions . f c = α [ π 2 - tan - 1 ( β ( ec b - ec 0 ) ) ] p a ( 9 ) where ƒ c is compressive strength ( same units as p a ); α is an empirical constant ( no units ), β is an empirical constant ( units of m / ms ), and ec 0 ( units of ms / m ) are obtained from calibration tests ; the term ec b ( in units of ms / m ) is tdr measured electrical conductivity after temperature compensation by eq . ( 8 ); and p a is the atmospheric pressure ( p a = 0 . 098 mpa for si units and p a = 14 . 7 lb / in 2 for u . s . customary units ). using eq . ( 9 ), three curves are plotted in fig1 , one for mixture 2 concrete , one for mixture 1 concrete , and one for both concretes combined . the equation for the curve for the combined data and corresponding error bars of ± 10 % are given in the figure by the darker solid line . the combined data were also used with equations recommended in the prior art , also shown in fig1 , having a concave upward shape . from fig1 it can be seen that fitted curve by eq . ( 9 ) gives reasonable estimation of compressive strength from tdr measured electrical conductivity . the estimated strength generally falls within ± 10 % of the optimized compressive strengths from cylinder tests . equations recommended in the prior art on the other hand cannot accurately describe the data trend , especially at low electrical conductivity ( corresponding to long term strength ). the measured electrical conductivity for mixture 1 concrete was 11 . 96 ms / m after 196 days and that of mixture 2 is 11 . 95 ms / m after 166 days . the estimated strengths by eq . ( 9 ), using the parameters obtained from the combined data , are 47 . 6 mpa and 47 . 6 mpa , respectively . equations recommended in the prior art on the other hand , gives unreasonable estimated strengths of 225 . 0 mpa and 224 . 7 mpa , respectively . thus , eq . ( 9 ) is believed to be more robust for estimating compressive strength from electrical conductivity . to apply eq . ( 9 ), a group of calibration tests are needed to determine the calibration constants . the calibration involves making several cylinders for a given mix design . for one of the cylinders , the tdr probe and a temperature sensor are installed to monitor the dielectric constant , electrical conductivity , and temperature with time . compression tests are performed on the other cylinders to determine compressive strength at different ages , typically one day , seven days , and twenty eight days . the compressive strength and temperature compensated electrical conductivity are then analyzed in a spreadsheet to obtain the calibration constants in eq . ( 9 ). once the calibrations are obtained , the measured electrical conductivity , either in the field or in the laboratory , can be applied to estimate the compressive strength . fig6 shows that the electrical conductivity linearly decreases with time on a logarithmic scale after about one day , which is similar for both concretes . this can be described by eq . ( 10 ). ec b ( t ) = ec b ( t 1 ) + ( δ ec b log cycle ) log ( t ) ( 10 ) where : t is the curing time in days , ec b ( t 1 ) is the electrical conductivity measured at one day , δec b /( log cycle ) is the change in electrical conductivity over one log cycle , all in units of ms / m . for mixture 1 concrete , the corresponding values of ec b ( t 1 ) and δec b /( log cycle ) are 37 . 75 ms / m and − 5 . 05 ms / m , respectively . the corresponding values for mixture 2 concrete are 36 . 29 ms / m and − 4 . 96 ms / m , respectively . note that t in eq . ( 12 ) may have decimal values , but that values of t must not be smaller than the linear portion of the curve on the log - time plot used to establish the coefficients . for example , for the mixture 2 curve in fig6 , the value of t must be greater than approximately 0 . 5 days . once its relationship with time is established , the electrical conductivity measured at curing times sufficiently long to establish the straight line on the semi - log plot could be used to estimate long - term electrical conductivity , and consequently , the long - term compressive strength by combining eqs . ( 11 ) and ( 12 ) as shown in eq . ( 11 ). f c = α [ π 2 - tan - 1 { β [ ec b ( t 1 ) + ( δ ec b log cycle ) log ( t ) - ec 0 ] } ] p a ( 11 ) where the parameters are defined above for eqs . ( 9 ) and ( 10 ). fig1 and 14 show the predicted compressive strength versus time in days ( log scale ) by eq . ( 11 ) for both mixture 1 concrete and mixture 2 concrete . the parameters used in eq . ( 11 ) to predicted these curves are summarized in table 3 , where the values of αβ , and ec 0 are from the equation shown in fig1 ( solid curve with the thick line ) and the values of ec b ( 1 day ) and δec b ( per log cycle ) are from fitting the straight lines through the linear portion in fig6 for each of the concrete samples . the actual measured compressive strengths are also plotted for comparison . they generally fall within ± 10 % of predicted strength . even though these curves are based on tests only up to 28 days , fig1 and 14 indicates that the longer term strengths given by eq . ( 11 ) appear quite reasonable . while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected .
| 6 |
fig1 - 4 illustrate a connector 20 formed in accordance with one embodiment of the present invention . the connector 20 is adapted to selectively attach a workpiece 22 to a power tool ( not shown ). although the workpiece 22 is illustrated as a phillips head screwdriver , other workpieces , such as a standard screwdriver and a drill bit , are also within the scope of the present invention . the connector 20 includes a first collar 24 , a spring biased ball pin assembly 26 , a shaft assembly 28 , and a second collar 30 . the workpiece 22 is suitably formed from a high strength material and includes a cylindrical drive portion of the hex stem 32 and an appropriate shaped head portion 34 . the drive portion of the hex stem 32 is sized to be slidably received within the shaft assembly 28 and is seated therein on a spring biased ball pin assembly 26 . the spring biased ball pin assembly 26 includes a coil spring 36 , a ball pin 38 , and a plug 40 . the spring biased ball pin assembly 26 is biased to selectively eject the workpiece 22 from within the connector 20 , as is described in greater detail below . the shaft assembly 28 includes a shaft 42 , collar springs 44 , a ball spring 46 , and centering balls 48 . one end of the shaft 42 is adapted to be received within a corresponding chuck of a well known power tool . the other end of the shaft 42 includes a cavity 50 adapted to lockingly receive the hex stem 32 of the workpiece 22 . three of the centering balls 48 are disposed around the shaft 42 and are received within corresponding tapered cavities 52 . the centering balls 48 are restrained within the cavities 52 by the ball spring 46 . the shaft 42 also includes a pair of tapered cavities 54 aligned along a longitudinal axis extending between the open ends of the shaft 42 , such that a forward ball 60 is located near the forward or open end of the shaft 42 . a rearward ball 62 is located substantially near a midpoint defined along a longitudinal axis extending between the opened and closed ends of the shaft 42 . still referring to fig1 - 4 , operation of the connector 20 will now be described in greater detail . to selectively couple the workpiece 22 to the connector 20 , the drive portion of the hex stem 32 of the shaft 42 is inserted into the connector 20 , such that the three centering balls 48 near the front lift up and over a lower portion 33 of the hex stem 32 and drop into a power groove 64 . continued insertion of the shaft 42 causes the centering balls 48 to lift up and over the power groove 64 and contact the drive portion of the hex stem 32 . the lower portion 33 of the hex stem 32 eventually contacts the ball pin 38 at the back of the shaft &# 39 ; s cavity 50 . the operator then continues to press the workpiece 22 into the connector 20 . this operation causes the ball pin 38 , which is tensioned forward by the coil spring 36 to react until the lower portion 33 of the hex stem 32 presses up against the plug 40 . the plug 40 retains the ball pin 38 and allows clearance for a hex pin 37 found in other optional hex stem configurations , such as the hex pin found in a reversible drill and driver manufactured by jore corporation and seen in fig1 . the ball pin 38 retracts rearwardly to allow the rearward ball 62 to drop into its corresponding tapered hole 54 and flush to the diameter of the shaft 42 . this , in turn , allows the first and second collars 24 and 30 to shift forward because it is tensioned towards the forward position . in translating forward , the collar forces the forward ball 60 to drop into its tapered hole 54 , thereby locking the hex stem 32 at the power groove 64 . the collar continues forward to contact the three centering balls 48 located at the front of the connector 20 . the internal taper 100 ( fig4 ) at the front portion of the first collar 24 forces the three centering balls 48 to contact the drive portion of the hex stem 32 and lock it into a centered position . this locking and centering operation takes place by the user simply inserting the workpiece 22 into the connector 20 . to remove the workpiece 22 , the order of operations is basically reversed . the operator pulls the collar back . with this operation , the tension is removed from the centering balls 48 and the ball locking mechanism , comprised of the forward ball 60 and the forward tapered hole 54 . at the end of its travel , the collar allows space for the rearward ball 62 to move back up out of its hole 54 in the shaft 42 . the coil spring 36 , inside the connector 20 , forces the ball pin 38 forward . this in turn forces the rearward ball 62 up and secures the collar in place . the ball pin 38 then moves forward , thus moving the workpiece 22 to a position where the three centering balls 48 , which are tensioned radially inward by the ball spring 46 , move off of the drive portion of the hex stem 32 and drop back into the power groove 64 . the three tensioned balls 48 hold the workpiece 22 at the power groove 64 with a light grip until the operator selectively removes the workpiece 22 from the connector 20 . referring now to fig5 - 9 , an alternate shaft 142 formed in accordance with the present invention will now be described in further detail . the shaft 142 of the alternate embodiment is identical in materials and operation as the shaft 42 described above with the following exception . as best seen by referring to fig9 , the aft hole 154 has been relocated to a position 180 degrees ( based on a longitudinal axis running down the center of the shaft 142 ) from its position shown in the shaft 42 of the first embodiment of fig1 - 4 . with the ball location change of this alternate embodiment , all of the ball holes are oriented symmetrically around the shaft &# 39 ; s center axis 160 . all other connector components are also symmetric about the axis 160 when in the assembled position . the radial balance of this alternate embodiment helps to minimize centripetal ( centrifugal ) forces when the connector is rotating in a power drill . minimizing the forces that result from rotation results in less vibration . this in turn helps utilize the minimized runout capabilities of the connector . less runout from the hex stem component ( drill , nut driver , power bit , etc .) results in easier use , and greater accuracy from the user &# 39 ; s standpoint . for the purposes of this invention , radial balance is defined as the center of mass for the assembly as it is aligned with the axis of rotation for the assembly . while the preferred embodiment of the invention has been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention .
| 8 |
hereinafter , certain exemplary embodiments according to the present invention will be described with reference to the accompanying drawings . here , when a first element is described as being coupled to a second element , the first element may be not only directly coupled to the second element but may also be indirectly coupled to the second element via a third element . further , some of the elements that are not essential to the complete understanding of the invention are omitted for clarity . also , like reference numerals refer to like elements throughout . fig1 is a view illustrating a comparable organic light emitting display device . referring to fig1 , the comparable organic light emitting display device includes a panel 2 , a data driver 6 , a scan driver 8 , and pixels 12 . the pixels 12 are formed at intersections ( or crossings ) between scan lines s 1 to sn and data lines d 1 to dm . the pixels 12 are selected when scan signals are supplied , charge ( or store ) a voltage corresponding to data signals , and emit light of set ( or predetermined ) brightness in response to the charged voltage . the data driver 6 supplies the data signals to the data lines d 1 to dm when the scan signals are supplied from the scan driver 8 . the scan driver 8 supplies the scan signals to the scan lines s 1 to sn sequentially . here , the scan driver 8 is formed to be mounted on the panel 2 when the pixels 12 are formed . to this end , the scan driver 8 includes input lines 20 and connecting lines 22 positioned between the input lines 20 and the scan driver 8 . the input lines 20 receive clock signals from a printed circuit board . the connecting lines 22 are electrically coupled to the input lines 20 respectively and formed parallel to the data lines d 1 to dm to supply the clock signals to various stages included in the scan driver 8 . here , the connecting lines 22 formed in the panel 2 are positioned to be overlapped with a cathode electrode 4 . when the cathode electrode 4 is overlapped with the connecting lines 22 , the connecting lines 22 and the cathode electrode 4 form capacitors so that a delay of the clock signals occurs . in order to solve the problem , according to the comparable embodiment , a plurality of flexible printed circuits ( fpc ) are installed at set or predetermined intervals to be coupled to the panel 2 and the clock signals are additionally supplied to the connecting lines 22 using the fpc . however , when the clock signals are additionally supplied using the fpc , manufacturing costs are increased and the yield is lowered . hereinafter , the embodiments of the present invention will be described such that those skilled in the art can easily practice the present invention in detail with reference to fig2 to 6 . fig2 is a view illustrating an organic light emitting display device according to a first embodiment of the present invention . referring to fig2 , the organic light emitting display device according to the first embodiment of the present invention includes a panel 120 , a data driver 106 , a scan driver 108 , and pixels 112 . the pixels 112 are formed at crossings ( or intersections ) between scan lines s 1 to sn and data lines d 1 to dm respectively . the pixels 112 are selected when scan signals are supplied , charge ( or store ) a voltage corresponding to data signals , and emit light of predetermined brightness in response to the charged voltage . the data driver 106 supplies the data signals to the data lines d 1 to dm when the scan signals are supplied from the scan driver 108 . here , the data driver 106 is made into a plurality of data integrated circuits . each of the data integrated circuits includes j ( j is a natural number ) channels such that j data signals may be supplied . the scan driver 108 sequentially supplies the scan signals to the scan lines s 1 to sn . here , the scan driver 108 is mounted on the panel 102 when the pixels 112 are formed . the scan driver 108 mounted on the panel 102 receives clock signals supplied from the outside . to this end , on the panel 102 , input lines 120 , first connecting lines 122 , second connecting lines 124 , and third connecting lines 126 are formed . the input lines 120 receive the clock signals from a printed circuit board through a channel of the data integrated circuits that are included in the data driver 106 . more specifically , some channels of the data integrated circuits having j channels are not used . the input lines 120 receive the clock signals from the printed circuit board via the unused channels . the first connecting lines 122 are formed parallel to the scan driver 108 and electrically coupled to the input lines 120 . the first connecting lines 122 supply the clock signals from the input lines 120 to the scan driver 108 . in more detail , the scan driver 108 , as illustrated in fig3 , includes n stages 109 respectively coupled to the scan lines s 1 to sn . the first connecting lines 122 supply the clock signals to the respective stages 109 such that the scan signals may be generated from the stages 109 . fig3 illustrates that each of the stages 109 is coupled to the same first connecting lines 122 , but the present invention is not limited thereto . for example , different clock signals may be supplied to odd order or even order stages 109 . that is , the present invention may be applied to various suitable forms of scan drivers 108 . also , since the first connecting lines 122 are electrically coupled to the stages 109 for forming the scan driver 108 , the first connecting lines 122 are formed close to the scan driver 108 . in this case , the first connecting lines 122 positioned close to the scan driver 108 are overlapped with a cathode electrode 104 . the second connecting lines 124 are formed parallel to the scan driver 108 and electrically coupled to the input lines 120 . the second connecting lines 124 are electrically coupled to the first connecting lines 122 via third connecting lines 126 . here , the third connecting lines 126 electrically couple the second connecting lines 124 to the first connecting lines 122 to receive each of the specific clock signals at two or more nodes . when the second connecting lines 124 and the first connecting lines 122 configured to receive same clock signals are electrically coupled to each other , resistance of the first connecting lines 122 is lowered so that delay of the clock signals may be reduced ( or minimized ). especially , the second connecting lines 124 of an embodiment of the present invention are not overlapped with the cathode electrode 104 . in this case , the second connecting lines 124 do not overlap the cathode electrode and do not form capacitors with the cathode electrode and as a result delay of the clock signals is reduced ( or minimized ). therefore , delay of the clock signals is reduced ( or minimized ) at even the first connecting lines 122 configured to receive the clock signals at some node via the second connecting lines 124 . fig4 is a view illustrating an organic light emitting display device according to a second embodiment of the present invention . in the description with reference to fig4 , same reference numerals are assigned to same elements as illustrated in fig2 and detail description will be omitted . referring to fig4 , the organic light emitting display device according to the second embodiment of the present invention further includes buffers 130 formed between the first connecting lines 122 and the second connecting lines 124 , that is , at the respectively third connecting lines 125 . the buffers 130 deliver the clock signals from the second connecting lines 124 to the first connecting lines 122 . the buffers 130 may reduce ( or minimize ) crush of the clock signals and then may guarantee driving stability . fig5 is a view illustrating an organic light emitting display device according to a third embodiment of the present invention . in the description with reference to fig5 , same reference numerals are assigned to same elements as illustrated in fig2 and detail description will be omitted . referring to fig5 , in the organic light emitting display device according to the third embodiment of the present invention , first connecting lines 127 are not coupled with the input lines 120 and receive other clock signals from the outside . in this case , the input lines 120 are coupled to the second connecting lines 124 and supply clock signals to the second connecting lines 124 . fig6 is a view illustrating an organic light emitting display device according to a fourth embodiment of the present invention . in the description with reference to fig6 , same reference numerals are assigned to same elements as illustrated in fig2 and detail description will be omitted . referring to fig6 , the organic light emitting display device according to the fourth embodiment of the present invention further includes a second scan driver 111 positioned to face the scan driver 108 . the second scan driver 111 supplies the scan signals to even order ( or odd order ) scan lines s 2 , . . . . in this case , the scan driver 108 supplies the scan signals to odd order scan lines s 1 , . . . . the second scan driver 111 is mounted on the panel . in order to supply the clock signals to the second scan driver 111 , the organic light emitting display device further includes second input lines 121 , fourth connecting lines 123 , fifth connecting lines 125 , and sixth connecting lines 128 . the second input lines 121 receive the clock signals from a printed circuit board through a channel of the data integrated circuits included in the data driver 106 . the fourth connecting lines 123 are formed parallel to the second scan driver 111 and electrically coupled to the second input lines 121 . the fourth connecting lines 123 supply the clock signals from the second input lines 121 to the second scan driver 111 . here , the fourth connecting lines 123 are overlapped with a cathode electrode 104 . the fifth connecting lines 125 are formed parallel to the second scan driver 111 and electrically coupled to the second input lines 121 . the fifth connecting lines 125 are electrically coupled to the fourth connecting lines 123 via the sixth connecting lines 128 . here , the fifth connecting lines 125 are not overlapped with the cathode electrode 104 and thus clock signals delay of which is reduced ( or minimized ) may be supplied to the fourth connecting lines 123 . the sixth connecting lines 128 electrically connect the fourth connecting lines 123 to receive specific clock signals to the fifth connecting lines 125 to receive the specific clock signals at two more nodes . the organic light emitting display device according to the fourth embodiment of the present invention is substantially the same as the organic light emitting display device illustrated in fig2 in structure and operative principle except for the scan driver 111 and the connecting lines 123 , 125 , and 128 to be coupled to the scan driver 111 . while the present invention has been described in connection with certain exemplary embodiments , it is to be understood that the invention is not limited to the disclosed embodiments , but , on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims , and equivalents thereof .
| 6 |
fig1 illustrates a window or windshield 1 for a motor vehicle , which its outline indicates is intended as a rear or front windshield . this windshield is vapor - deposited in conventional fashion with a good - conducting metal coating , so that the metal coating may be regarded as a low - resistance one . it is known to use such a metal coating for windshield heating . further , such tinted windshields inhibit entry of sunlight , and viewing of the interior of the vehicle from outside . these characteristics of the vapor - coated windshield are , however , of merely secondary significance here . upon metallic - vapor - coating of the windshield , a slot 2 of sufficient length and slight breadth is kept uncoated , essentially parallel to and at a spacing a from one edge , for example the bottom edge , of the vapor - deposited surface . current supply for heating current is applied adjacent respective slot ends 3 , 4 at other edges 5 , 6 of the vapor - deposited surface , for example the left and right edges . the edges of the metal coating itself can form supply busses 7 , 8 for such current supply . alternatively , special metal strips or the like can be affixed to serve as supply busses . in any event , the slot ends 3 , 4 remain at a minimum spacing a from the supply busses . slot ends 3 , 4 could also be angled with respect to a central region 9 of the slot , and could run parallel to supply busses 7 , 8 in order to achieve a greater overall slot length . when such a windshield is placed in the electromagnetic field of an fm broadcast transmitter , an alternating electrical field forms over the slot , and a circular alternating current flows around the slot . the length of the slot is selected to correspond approximately to the electrical value λ / 2 in the fm frequency band . this length thus depends upon the dielectric constant ε r of the glass of the windshield . the breadth of the slot can be kept very small with respect to the half - wavelength λ / 2 , while the spacing a is selected to be small with respect to half - wavelength λ / 2 . preferably , the value of the dielectric constant ε r is so selected that it is not necessary to angle the slot ends in order to obtain a slot antenna with a value on the order of λ / 2 in the fm band , because angling of the slot ends under certain circumstances degrades the flow of heating current , permitting formation of an unheated zone between the angled ends . as shown in fig1 in a first embodiment , the middle point 10 of the upper rim of slot 2 is connected to the inner conductor 12 of a coaxial cable leading to the radio receiver , while the middle point 11 of the lower rim of slot 2 is connected over a capacitance 14 to the vehicle chassis surrounding the windshield . an outer conductor 13 of this same coaxial cable is also connected to the vehicle chassis . 5 and 6 are fm ( and am ) isolator - blocks 7 is a part of the vehicle chassis and 18 is an isolator gap between the coating and the chassis fig2 illustrates a second embodiment of a slot antenna , whose electrical length in the fm or ukw band is λ / 4 . the bottom point 21 of the slot 20 ends in a circumferential free or uncoated area 22 . slot 20 preferably runs essentially vertically into the path of the heating current which is fed between left windshield edge 23 and right windshield edge 24 . the two edges of slot 20 are connected at the bottom point 21 by a coil 25 , which is also connected to an inner conductor 26 of a coaxial cable , whose outer connector 27 is again connected to the vehicle chassis . since the vapor - deposited surface is surrounded by circumferential free space 22 , coil 25 also transmits to the coaxial cable the signals in the am reception band . 28 and 29 are fm ( and am ) isolator - blocks fig3 illustrates a third embodiment , in which a circumferential free space 32 , having a whole - wavelength λ electrical length in the fm or ukw band , is left between the vapor - coated surface and the surrounding edge 31 of the windshield . if the inner conductor 33 of a coaxial cable 35 is connected to the vapor - coated surface , for example at the middle of the bottom edge as shown , and the outer conductor is connected to chassis potential , the cable will pick up signals adequate for both fm and ukw and am reception . in the fm band , the free space 32 acts as a slot antenna , since the metallic chassis rim for the windshield , as indicated at 34 , surrounds the windshield 30 . in the am band , the entire vapor - coated surface serves as the conductor , as in the fig2 embodiment . 36 and 37 are fm ( and am ) isolator - blocks . fig4 illustrates a fourth embodiment , in which a strip conductor 42 is used to connect the coaxial cable to the upper rim 41 of slot 40 . for this purpose , a t - shaped structure is left uncoated within the coated surface . the strip conductor 42 is arranged between the adjacent vertical edges 43 , 44 of the t - shaped area . as shown in more detail in fig4 a , the lower end of strip 42 is connected to the inner conductor 45 of a coaxial cable 46 . the vertical slot is covered by a metallic insulating layer 47 which , together with edges 43 , 44 , forms a capacitive coupling for a circular alternating current around the slot antenna . the metal of insulating layer 47 is connected at 48 with the chassis , as is the outer conductor 49 of coaxial cable 46 . the edges 43 , 44 can also serve as supply busses for heating current . supply leads 50 , 51 to the respective supply busses can be connected to respective coils 52 , 53 for improved reception of am signals . preferably , these coils 52 , 53 can be wound on separate portions of a common toroidal core 54 , as shown . fig5 illustrates an improved version of the slot antenna of fig1 . at a spacing h from a first slot 55 analogous to that of fig1 there is provided a second slot 56 , which in length and breadth approximately corresponds to the first slot 55 . an antenna gain in the horizontal is thereby achieved . the length of slot 56 and the spacing h from slot 55 are a function of the antenna gain and must be selected according to the desired design characteristics . various changes and modifications are possible within the scope of the inventive concept . in particular , features of any of the embodiments can be combined with features of other embodiments .
| 7 |
it was determined that under the control of the cpu , by varying the voltage sent to the positive displacement gear pump , the speed of the pump varies and controllable as to inject the desired concentrated first solution only at the suitable delivery rate into the second solution to consistently provide the drinking water at the resultant desired concentration . the actual voltage requirements were determined by trial and error in a practical environment . a vane - axle turbine driven flow rate sensor ( kobolt instrumentation ), which delivered 1 , 800 pulses per gallon , provided sufficient data points to measure low flow rates and monitor changes in flow rate . a microprocessor based controller for the generation and monitoring of an iodine supplemented livestock watering system was designed . the controller monitors the vane - axle turbine flow rate sensor and two or three thermocouples . the controller will control one or two positive displacement pumps dispensing liquor into the water feed line , along with a heater in the iodine dissolution cartridge chamber which maintains a constant temperature in the recharge chamber , preferably 80 degree . the unit included a 4 digit display for readout of liters dispensed and various other values , along with keyboard or other access for display control and user variable adjustment . control functions were implemented as detailed in the specification hereinbelow , with whatever modifications necessary after field trials . provision was made for use of an infrared or other method of external monitoring and control . with reference to fig1 , this shows generally as 10 a drinking water delivery system containing 2 – 15 ppm iodine species comprising the unit shown generally as 12 within the dotted lines . although unit 12 is essentially self - contained , it clearly requires fittings , lines and the like for it to constitute part of full working system 10 . unit 12 has a microprocessor based controller ( cpu ) 14 in data communication with a vane - axle turbine water flow rate sensor 16 , display and keyboard 18 , positive displacement gear pump 20 , heater 22 , first thermocouple 24 and second thermocouple 26 . pump 20 is shown in slightly more detail in fig4 as a magnetic coupled external gear pump ( p - series - tuthill corporation , concord , calif .) that provides positive displacement non - pulsing flow of solution over the practical range of flow rates desired . main water line 28 provides the main or second flow of water from which secondary line 30 runs off to provide first water flow under the influence of pump 20 which is controlled by cpu 14 . pump 20 feeds rechargeable cartridge 32 having a chamber 34 containing iodine flakes or prill 36 , heater 22 and temperature sensors 24 , 26 . in the embodiment shown , chamber 34 contains sufficient iodine 36 to always provide a saturated iodine species solution at the pre - selected water temperature in chamber 34 , irrespective of the magnitude water flow rate passing through chamber 34 , under commercial practical conditions for a livestock operation . if necessary , in alternative embodiments a plurality of cartridges 32 may be used as desired . saturated iodine solution at about 300 ppm and 80 ° c . leaves chamber 34 and is added to line 28 at a suitable dilution factor to provide the 2 – 15 ppm iodine species concentration in the resultant drinking water provided to the livestock . small lcd screen and keyboard 18 enable the user input and output to be displayed . the water delivery system according to the invention uses a computer based controller board to sample the flow rate of the main line water . it also senses the temperature of the incoming water and the temperature of the water in the sump . based on these variables the controller determines the speed of the dc brushless motor on a gear pump to produce the desired iodine concentration in the main line . the unit displays the following variables in a 2 second rotation ; flow rate , sump temperature , and gallons of concentrate . when the recharge is spent the controller displays a warning for the user . if there are any other errors , the controller will display these with different leds and a buzzer . the temperature sensed is used to determine the amount of power required to bring the water in the sump up to 80 ° f . if below and then controls the heater to raise the temperature in the sump to 80 ° f . the user interface is done using a pda with infrared . the pda can capture all of the system variables and store them in a file to be downloaded later . the user can change the concentration of iodine by small amounts and multiples of ppm with the pda . the user can also tune the temperature sensor to get better control of the iodine concentration . the controller also has the ability to store the system variables on a flash ram to be downloaded later , to give the user a picture of the water usage , and system performance . a more detailed embodiment is , generally as 100 , in fig3 , wherein in general , mainline water flows first through a thermistor ( the “ mainline thermistor ”) and a vane - axle turbine driven flow sensor ( the “ flow sensor ”). the thermistor is a thermally sensitive resistor that is made of a semiconductor having a resistance that varies rapidly and predictably with temperature . the mainline thermistor is used to determine the amount of energy the heater ( the heater ”) in the cartridge or recharge module needs to provide in order to bring the temperature in the recharge module up to the set point . the recharge thermistor is used to determine the temperature of the iodine saturate in the recharge module . the flow sensor outputs approximately 1 , 800 pulses per gallon of water and is used to determine the flow rate and changes in flow rate of the mainline water . the mainline thermistor , the flow sensor , and the recharge thermistor are electronically connected to the microprocessor based controller ( the “ controller ”). the controller is driven by a circuit board that continuously scans the temperature and the flow rate data that it receives from the mainline thermistor , the flow sensor , and the recharge thermistor and updates the speed of the pump and the status of the heater as changes occur . the controller reads the speed of the pump from the tachometer output signal from the pump and compares it to the desired speed . the desired speed of the pump for various flow rates from ⅛ of a gallon a minute and up have been determined on a trial and error basis . the controller then increases or decreases the speed of the pump accordingly . the desired speed of the pump is determined from an algorithm that takes into account the desired concentration of the blended aqueous iodine , the mainline flow rate , the temperature of the mainline water , the temperature of the iodine saturate in the recharge module , and the concentration of the iodine saturate . the controller is programmed to adjust this ratio in response to changes in the temperature in the recharge module . when the temperature is less than 80 ° f ., the ratio increases and when the temperature is greater than 80 ° f ., the ratio decreases . the controller has an input connector that allows the controller to be connected to a computer in order for the user to change the settings on the controller . the controller also has an infrared port that allows the user to receive and input data from an infrared device , such as a pda . the controller sends a voltage signal ( 0 – 4 vdc . 1 volt dc = 1000 rpm ) to the pump that varies the speed of the pump motor in response to calculations made in accordance with the algorithm . the controller sends a voltage signal to the heater ( 120 vac ) that determines whether the heater is on or off . the controller further provides an output to the display panel that displays flow rate , recharge module temperature , and the number of gallons through the recharge module in rotating two second intervals . when the pump is activated , water flows through the delivery system based upon positive water displacement . the controller determines the speed of the pump in relation to the desired concentration of blended aqueous iodine to be achieved in the mainline . blending is gradual and continuous so that no slugs are produced and the desired concentration is established in the mainline at all times . when the pump is inactivated , no water flows though the system . two check valves are utilized to prevent back flow . the mainline check valve is used to prevent aqueous iodine from flowing backwards in the mainline water flow and into the injection system . the recharge check valve is used to prevent iodine saturate from flowing back up to the pump in a powered down situation . this prevents the iodine saturate , which is corrosive , from entering the pump and potentially damaging the metal components of the pump . the 3 - way valve is used to purge air from the recharge module . failsafe warning signals have been incorporated into the controller . for instance , when the iodine in the recharge module is spent , based on the number of gallons of iodine saturate produced , the controller displays a warning for the user signalling the requirement to replace the recharge module . the controller also has been programmed to display other error messages with different led &# 39 ; s and a buzzer . the infrared port and the input connector allow iosolutions or the user to download information from the controller at anytime , either for billing or informational purposes . updates to the firmware on the controller also can be downloaded through the infrared port and the input connector . system variables are stored on a flash ram chip that can be downloaded later through the infrared port or input connector to give the user a picture of water usage and system performance . mechanical devices : mainline check used to prevent the iodine flowing around in valve : a loop recharge check used to prevent the iodine flowing back up to valve : the pump in a powered down situation . 3 - way valve : used to purge the air from the recharge module . flow meter sensor 16 measures the flow rate of the main line water by pulse output ; thermocouple 26 measures the temperature in cartridge 32 ; thermocouple inside heater 24 measures the temperature of the heater as a safety device to prevent heater 24 from damaging cartridge 32 ; keyboard 18 allows user to adjust variables in program . the following is a list of outputs for controller 14 , which controls or measures : pump 20 by adjusting the speed of the pump under a voltage signal ( 0 – 5 vdc ). heater 24 by controlling the temperature in cartridge 32 . on / off device 120 vac controlled through a solid - state relay . display 18 shows the through cartridge 32 and the user adjustable variables . the variables considered in the process according to the invention are shown in fig2 , wherein : f m main line flow rate . pulse input from flow meter f l desired flow rate through liquor line . calculated from f m , c u1 , and c u2 . f o stored flow rate used for comparison to f m to determine if there is a large change is the flow rate . g l gallon count through liquor line . calculated from f l , k , t sp , and t c . c u1 user input constant . allows user to make small adjustments to the pump speed . c u2 user input constant . allows user to adjust the pump speed in multiples of the default speed . k constant of the flow meter manufacturer specification in pulses / gal t sp sample period for flow meter . time allotted to count pulses . t c cycle period . time from one sample to the next . t temperature reading from the thermocouple . t h temperature reading of the heater from the thermocouple inside the heater . p input voltage signal to the pump . calculated from f l , and c t . c t temperature constant adjustment for temperatures over 80 ° f . h heater status flag true if t less than 80 ° f . else false . i indicator of the usage of the recharge . 0 if 3200 − g l & gt ; 500 1 if 3200 − g l & lt ; 500 2 if 3200 − g l & lt ; 100 e h error flag on heater . true if t h & lt ; 150 ° f . liquor line flow rate is 1 / 50 ( default concentration ) of the main line flow rate plus the user &# 39 ; s small adjustment times the user &# 39 ; s multiplier . g l = g l +( f l /( k * t sp )* t c ) gallon count is a running total of the liquor line flow rate divided by the flow meter constant and sample period times the cycle period . pump speed is a function of liquor line flow minus the adjustment due temperature . x is a function of the liquor line flow to produce a voltage output signal . this is to be determined . heater failure — if the heater temperature exceeds 150 ° f . e h is turned on and the heater h is turned off and remains off until the system is reset . a warning is shown on the display . recharge empty — if the recharge indicator i changes to 1 show a warning on the display . if the indicator changes to 2 show a different warning . once the power of the controller is turned on the user has a choice of modes , selected by the use of the keyboard . the following is a detailed description of the different modes ( start - up , user input , and normal ) of operation of the controller . the user input mode allows the user to change the two variables c u1 , and c u2 . the adjustments are made through the keyboard . the values for c u1 are ± 10 . the values of c u2 are 0 . 5 , 1 , 1 . 5 , and 2 . the start - up mode is used when a new cartridge 32 is connected to the system . heater 22 is turned off and the heater error flag is reset . the user is prompted on whether to reset the water volume count to zero . pump 20 comes on in maximum output ( 4 vdc ) to fill the recharge . user input is required to stop pump 20 when cartridge 32 is full . the normal mode is the operation that controls pump 20 due to changes in the flow rate . the temperature of both thermocouples is measured . if the temperature of t h is greater than 150 ° f . the error flag e h is set to true . if the temperature of t is less than 80 ° f . heater 22 is turned on . sample the flow meter f m . determine whether there is a large change in the flow rate to the stored rate . if there was , store the new flow rate else use the stored flow rate . calculate f l and g l . check the state of the recharge , if recharge is close to empty display the appropriate warning . calculate the speed of the pump p . output p to the pump . pause for t c and repeat . to increase the capabilities of the unit for an increased flow rate another pump is required . adding the second pump requires an increase in the dc power supply to 130 w , and a second output 0 – 5 vdc signal . although this disclosure has described and illustrated certain preferred embodiments of the invention , it is to be understood that the invention is not restricted to those particular embodiments . rather , the invention includes all embodiments which are functional or mechanical equivalence of the specific embodiments and features that have been described and illustrated .
| 0 |
embodiments of token assurance level based transaction processing are provided , with exemplary embodiments being discussed below in detail . payment tokenization is used in payment technology and mobile payments systems , including near field communication ( nfc ), host card emulation ( hce ), cloud based security ( se ) and mobile wallets / mobile point of sale ( mpos ) systems . payment tokenization attempts to ensure personal account number ( pan ) privacy for use cases including card present and card - not - present transactions , and aims to reduce fraud by masking real credit account numbers using tokens . however , not all tokens are created or treated equally . some tokens , while not real credit account numbers , may be stolen and temporarily used , leading to fraud and loss . payment tokenization is implemented using data substitution , i . e . substituting an anonymous token for a personal account number . the idea behind the token is to protect sensitive data , and to ensure that if the token is lost or stolen the data is preserved or uncompromised . a token may also include metadata , and various additional information may be included in token metadata , such as time of expiration or access policies . a token assurance level ( tal ) may be assigned to a token to allow the token service provider to indicate the confidence level of the binding between the payment token and the pan / cardholder . the token assurance level may be determined based on the type of identification and verification of the user that was performed by the merchant for the transaction , and based on the identity of the entity that performed the identification and verification . the token assurance level may be used to determine a processing priority of a transaction in a payment tokenization system . token assurance level based transaction processing may include tagging of payment tokens with a token assurance level based on ( for example ): the identity of token service providers and / or token requestors ; the security exposure of the token ( i . e ., based on , for example , merchant type , device finger printing , or personal identification number ( pin ) requirement ). a processing quality of service ( qos ) is assigned to the transaction based on the token assurance level , and may include prioritized queuing for token processing and validation ( for example , a higher token assurance level would not be subjected to any additional verification that might be required for a lower token assurance level ). in some embodiments , there may be four token assurance levels . a level 1 token assurance level indicates little or no confidence in the asserted identity &# 39 ; s validity . level 2 indicates some confidence in the asserted identity &# 39 ; s validity . level 3 indicates high confidence in the asserted identity &# 39 ; s validity , and level 4 indicates very high confidence in the asserted identity &# 39 ; s validity . each token assurance level may have a different assigned quality of service for processing . further , different levels and / or types of additional verification may be required from the user and / or the merchant for different token assurance levels . a payment tokenization system may include various components . a token service provider ( tsp ) is issues tokens corresponding to personal account numbers that are issued to users by an issuer , such as visa ™ or mastercard ™. a token vault provider ( tvp ) is usually the same entity as the tsp , and is an entity that keeps the tokens safe and has the original mapping of tokens to personal account numbers . a transaction processor gateway ( tpg ) is included at both the merchant and issuer , and receives the token for approval and processing . before processing the transaction by the transaction processor , the token needs to be de - tokenized , i . e ., converted back to the account number . token assurance level based transaction processing is implemented before de - tokenization in a payment tokenization system . turning now to fig1 , a payment tokenization system 100 for token assurance level based transaction processing generally shown . system 100 includes a collection point 101 which may be , in various embodiments , a point of sale system or an online payment interface belonging to a merchant . when a transaction is initiated at the collection point 101 , an account number is collected and encrypted with a public key belonging to the tokenization server 102 , and then the encrypted account number is sent from the collection point 101 to the tokenization server 102 . the tokenization server 102 generates a random token corresponding to the transaction and stores the generated token in the token database 103 with the account number . a single account number may be mapped to many tokens in the token database 103 ; however , each token may only be mapped to a single account number . the tokenization database also sends the token to the collection point 101 . the collection point 101 sends the token to the merchant &# 39 ; s application server 104 , which uses the token for processing the transaction instead of the account number . the application server 104 stores the token in an entry corresponding to the transaction in merchant database 105 , and also sends the token to the transaction processor 106 . the transaction processor 106 sends the token to back to the tokenization server 102 , which de - tokenizes the token , i . e ., converts the token back to the account number based on the entry in the token database 103 and sends the account number back to the transaction processor 106 . the transaction processor may then complete processing of the transaction based on the account number . therefore , no account numbers are stored in the merchant database 105 during processing of the transaction . however , in some embodiments , the token may be de - tokenized on the merchant side ( i . e ., in application server 104 ). tokenization server 102 includes a transaction assurance level based processing module 107 , which implements embodiments of token assurance level based transaction processing . in embodiments of token assurance level based transaction processing , the transaction is assigned a token assurance level . based on the assigned token assurance level , a transaction may receive expedited processing for de - tokenization , or may require additional information from the merchant and / or the holder of the card before de - tokenization is performed by the tokenization server 102 . the tokenization server 102 may perform the de - tokenization based on the assigned token assurance level , e . g ., transactions having a relatively high token assurance level may receive expedited processing at tokenization server 102 . fig1 is shown for illustrative purposes only ; a payment tokenization system may have any appropriate components that communicate in any appropriate manner . fig2 illustrates an embodiment of a system 200 for token assurance level based transaction processing . in system 200 , a customer 201 provides an account number 205 to a data capture system 202 , which include a point of sale system or web interface associated with a merchant . the data capture system 202 sends the account number 205 to the tokenization server 204 , and the tokenization server 204 sends a token 206 corresponding to the account number to both the data capture system 202 and to the settlement application 203 . the tokenization server 204 also stores the token with the account number . the settlement application 203 requests the account number from the tokenization server 204 using the token 206 . before the tokenization server returns the account number 205 to the data capture system 202 and settlement application 203 , the token assurance module 207 in the tokenization server 204 may determine a token assurance level for the transaction , and , based on the token assurance level may expedite processing of the transaction , or may request additional information 208 from the customer 201 and / or the data capture system 202 . fig2 is shown for illustrative purposes only ; a payment tokenization system may have any appropriate components that communicate in any appropriate manner . fig3 illustrates an embodiment of a method 300 for token assurance level based transaction processing . method 300 may be implemented in token assurance level based processing module 107 of fig1 , and / or token assurance module 207 of fig2 . in block 301 , a tokenization server , such as tokenization server 102 of fig1 or tokenization server 204 of fig2 , receives a de - tokenization request comprising a token that is associated with a transaction , in addition to metadata comprising additional data associated with the transaction . the additional data may include , but is not limited to , the identity of the token service provides , the identity of the token requestor , the identity or type of the merchant , and whether the collection point included device finger printing , biometric verification of the user , or a pin requirement in the transaction . the additional data may further include a mobile device type and a type of mobile software ( for example , applepay ™ or square ™) used for a mobile purchase . the additional information may further include whether the transaction is a card present or a card not present transaction . in block 302 , the tokenization server analyzes the additional information and determines a transaction assurance level for the transaction based on the additional information . in some embodiments , there may be four different token assurance levels . a level 1 token assurance level indicates little or no confidence in the asserted identity &# 39 ; s validity . level 2 indicates some confidence in the asserted identity &# 39 ; s validity . level 3 indicates high confidence in the asserted identity &# 39 ; s validity , and level 4 indicates very high confidence in the asserted identity &# 39 ; s validity . each token assurance level may have a different assigned quality of service for processing . further , different levels of additional verification may be required from the user and / or the merchant for different token assurance levels ; for example , for a level 1 transaction , multiple forms of additional verification may be required , while for a level 4 transaction , no additional verification may be required . further , a level 4 transaction may receive expedited processing . in block 303 , the tokenization server determines a quality of service for the transaction . the quality of service corresponds to a processing speed of the transaction , and includes whether to require additional information based on the token assurance level that was determined in block 302 before proceeding with the transaction ( i . e ., proceeding with de - tokenization ). the determination may be made based on the four levels described above with respect to block 302 in some embodiments . in further embodiments , a dollar amount of the transaction may be taking into account in block 303 . for example , either a user or a service provider may specify that additional verification will not be required for any transactions that are below a certain dollar amount , i . e ., a verification threshold . in block 303 , if additional verification is determined to be required for the transaction , the tokenization server requests the additional verification from the account holder and / or the merchant . it is further determined in block 303 what type of additional verification should be required . the additional verification may vary based on the token assurance level , and may include any appropriate type of verification . some examples of verification that may be required in block 303 are sending a pin to a mobile device of the user that must be submitted to the merchant , and then submitted from the merchant to transaction processor ; or sending a message to a mobile device of the user that requires a response . if it was determined in block 303 that additional verification is required for the transaction , then , in block 304 , it is indicated to the user and / or the merchant that the additional verification is required . then , in block 305 , based on successful completion of the additional verification , the de - tokenization of the transaction proceeds . if it was determined in block 303 that no additional verification is required , the de - tokenization of the transaction receives expedited processing in block 306 . in some embodiments of method 300 , the tokenization server may implement a weighted system that determines the tal of a particular transaction based on metadata associated with the transaction in block 302 . for example , the tokenization server may receive the following data for a transaction in block 301 : the metatags 1 to n may include any appropriate information regarding the transaction in various embodiments . the tokenization server may assign scores to the transaction based on the various pieces of metadata that are received with the token number . for example , the merchant id and metatag 1 may indicate that the merchant is a known or trusted merchant ( for example , a big name retailer ), and may rate a score of 20 . the device id and metatag 2 may indicate that the payment was made using a device running applepay with biometric verification ( e . g ., a fingerprint ), which may rate a score of 50 . metatag n may indicate that the tag was issued by a tier 1 token service provider ( for example , visa ), which may rate a score of 10 . the tokenization server may then add up the various scores assigned to the various pieces of metadata to determine an overall score for the transaction , and assign a tal based on the overall score . in this example , the total score would be 80 . the total score may be compared to one or more thresholds to determine the tal in block 302 ; for example , each level of tal may have a different respective threshold . the quality of service is then determined based on the tal . in such a weighted system , a transaction having less associated metadata would generally rate a lower overall score as compared to a transaction that has more associated metadata . however , some pieces of metadata ( for example , use of biometric verification ) may rate a relatively high overall score even in the absence of other metadata . further , for a transaction with a relatively large number of metatags that were populated by unknown or high risk entities , the transaction may rate a relatively low overall score . entities ( e . g ., merchants ) may be added or removed from a trusted list over time , or may have their ratings changed based on their security practices . fig4 illustrates an example of a computer 400 which may be utilized by exemplary embodiments of token assurance level based transaction processing . various operations discussed above may utilize the capabilities of the computer 400 . one or more of the capabilities of the computer 400 may be incorporated in any element , module , application , and / or component discussed herein . the computer 400 includes , but is not limited to , pcs , workstations , laptops , pdas , palm devices , servers , storages , and the like . generally , in terms of hardware architecture , the computer 400 may include one or more processors 410 , memory 420 , and one or more i / o devices 470 that are communicatively coupled via a local interface ( not shown ). the local interface can be , for example but not limited to , one or more buses or other wired or wireless connections , as is known in the art . the local interface may have additional elements , such as controllers , buffers ( caches ), drivers , repeaters , and receivers , to enable communications . further , the local interface may include address , control , and / or data connections to enable appropriate communications among the aforementioned components . the processor 410 is a hardware device for executing software that can be stored in the memory 420 . the processor 410 can be virtually any custom made or commercially available processor , a central processing unit ( cpu ), a digital signal processor ( dsp ), or an auxiliary processor among several processors associated with the computer 400 , and the processor 410 may be a semiconductor based microprocessor ( in the form of a microchip ) or a macroprocessor . the memory 420 can include any one or combination of volatile memory elements ( e . g ., random access memory ( ram ), such as dynamic random access memory ( dram ), static random access memory ( sram ), etc .) and nonvolatile memory elements ( e . g ., rom , erasable programmable read only memory ( eprom ), electronically erasable programmable read only memory ( eeprom ), programmable read only memory ( prom ), tape , compact disc read only memory ( cd - rom ), disk , diskette , cartridge , cassette or the like , etc .). moreover , the memory 420 may incorporate electronic , magnetic , optical , and / or other types of storage media . note that the memory 420 can have a distributed architecture , where various components are situated remote from one another , but can be accessed by the processor 410 . the software in the memory 420 may include one or more separate programs , each of which comprises an ordered listing of executable instructions for implementing logical functions . the software in the memory 420 includes a suitable operating system ( o / s ) 450 , compiler 440 , source code 430 , and one or more applications 460 in accordance with exemplary embodiments . as illustrated , the application 460 comprises numerous functional components for implementing the features and operations of the exemplary embodiments . the application 460 of the computer 400 may represent various applications , computational units , logic , functional units , processes , operations , virtual entities , and / or modules in accordance with exemplary embodiments , but the application 460 is not meant to be a limitation . the operating system 450 controls the execution of other computer programs , and provides scheduling , input - output control , file and data management , memory management , and communication control and related services . it is contemplated by the inventors that the application 460 for implementing exemplary embodiments may be applicable on all commercially available operating systems . application 460 may be a source program , executable program ( object code ), script , or any other entity comprising a set of instructions to be performed . when a source program , then the program is usually translated via a compiler ( such as the compiler 440 ), assembler , interpreter , or the like , which may or may not be included within the memory 420 , so as to operate properly in connection with the o / s 450 . furthermore , the application 460 can be written as an object oriented programming language , which has classes of data and methods , or a procedure programming language , which has routines , subroutines , and / or functions , for example but not limited to , c , c ++, c #, pascal , basic , api calls , html , xhtml , xml , asp scripts , fortran , cobol , perl , java , ada , . net , and the like . the i / o devices 470 may include input devices such as , for example but not limited to , a mouse , keyboard , scanner , microphone , camera , etc . furthermore , the i / o devices 470 may also include output devices , for example but not limited to a printer , display , etc . finally , the i / o devices 470 may further include devices that communicate both inputs and outputs , for instance but not limited to , a nic or modulator / demodulator ( for accessing remote devices , other files , devices , systems , or a network ), a radio frequency ( rf ) or other transceiver , a telephonic interface , a bridge , a router , etc . the i / o devices 470 also include components for communicating over various networks , such as the internet or intranet . if the computer 400 is a pc , workstation , intelligent device or the like , the software in the memory 420 may further include a basic input output system ( bios ) ( omitted for simplicity ). the bios is a set of essential software routines that initialize and test hardware at startup , start the o / s 450 , and support the transfer of data among the hardware devices . the bios is stored in some type of read - only - memory , such as rom , prom , eprom , eeprom or the like , so that the bios can be executed when the computer 400 is activated . when the computer 400 is in operation , the processor 410 is configured to execute software stored within the memory 420 , to communicate data to and from the memory 420 , and to generally control operations of the computer 400 pursuant to the software . the application 460 and the o / s 450 are read , in whole or in part , by the processor 410 , perhaps buffered within the processor 410 , and then executed . when the application 460 is implemented in software it should be noted that the application 460 can be stored on virtually any computer readable storage medium for use by or in connection with any computer related system or method . in the context of this document , a computer readable storage medium may be an electronic , magnetic , optical , or other physical device or means that can contain or store a computer program for use by or in connection with a computer related system or method . the application 460 can be embodied in any computer - readable storage medium for use by or in connection with an instruction execution system , apparatus , or device , such as a computer - based system , processor - containing system , or other system that can fetch the instructions from the instruction execution system , apparatus , or device and execute the instructions . in the context of this document , a “ computer - readable storage medium ” can be any means that can store the program for use by or in connection with the instruction execution system , apparatus , or device . the computer readable storage medium can be , for example but not limited to , an electronic , magnetic , optical , electromagnetic , or semiconductor system , apparatus , or a device . more specific examples ( a nonexhaustive list ) of the computer - readable storage medium may include the following : an electrical connection ( electronic ) having one or more wires , a portable computer diskette ( magnetic or optical ), a random access memory ( ram ) ( electronic ), a read - only memory ( rom ) ( electronic ), an erasable programmable read - only memory ( eprom , eeprom , or flash memory ) ( electronic ), an optical fiber ( optical ), and a portable compact disc memory ( cdrom , cd r / w ) ( optical ). note that the computer - readable storage medium could even be paper or another suitable medium , upon which the program is printed or punched , as the program can be electronically captured , via for instance optical scanning of the paper or other medium , then compiled , interpreted or otherwise processed in a suitable manner if necessary , and then stored in a computer memory . in exemplary embodiments , where the application 460 is implemented in hardware , the application 460 can be implemented with any one or a combination of the following technologies , which are well known in the art : a discrete logic circuit ( s ) having logic gates for implementing logic functions upon data signals , an application specific integrated circuit ( asic ) having appropriate combinational logic gates , a programmable gate array ( s ) ( pga ), a field programmable gate array ( fpga ), etc . technical effects and benefits include additional security in a payment tokenization system . the present invention may be a system , a method , and / or a computer program product . the computer program product may include a computer readable storage medium ( or media ) having computer readable program instructions thereon for causing a processor to carry out aspects of the present invention . the computer readable storage medium can be a tangible device that can retain and store instructions for use by an instruction execution device . the computer readable storage medium may be , for example , but is not limited to , an electronic storage device , a magnetic storage device , an optical storage device , an electromagnetic storage device , a semiconductor storage device , or any suitable combination of the foregoing . a non - exhaustive list of more specific examples of the computer readable storage medium includes the following : a portable computer diskette , a hard disk , a random access memory ( ram ), a read - only memory ( rom ), an erasable programmable read - only memory ( eprom or flash memory ), a static random access memory ( sram ), a portable compact disc read - only memory ( cd - rom ), a digital versatile disk ( dvd ), a memory stick , a floppy disk , a mechanically encoded device such as punch - cards or raised structures in a groove having instructions recorded thereon , and any suitable combination of the foregoing . a computer readable storage medium , as used herein , is not to be construed as being transitory signals per se , such as radio waves or other freely propagating electromagnetic waves , electromagnetic waves propagating through a waveguide or other transmission media ( e . g ., light pulses passing through a fiber - optic cable ), or electrical signals transmitted through a wire . computer readable program instructions described herein can be downloaded to respective computing / processing devices from a computer readable storage medium or to an external computer or external storage device via a network , for example , the internet , a local area network , a wide area network and / or a wireless network . the network may comprise copper transmission cables , optical transmission fibers , wireless transmission , routers , firewalls , switches , gateway computers and / or edge servers . a network adapter card or network interface in each computing / processing device receives computer readable program instructions from the network and forwards the computer readable program instructions for storage in a computer readable storage medium within the respective computing / processing device . computer readable program instructions for carrying out operations of the present invention may be assembler instructions , instruction - set - architecture ( isa ) instructions , machine instructions , machine dependent instructions , microcode , firmware instructions , state - setting data , or either source code or object code written in any combination of one or more programming languages , including an object oriented programming language such as smalltalk , c ++ or the like , and conventional procedural programming languages , such as the “ c ” programming language or similar programming languages . the computer readable program instructions may execute entirely on the user &# 39 ; s computer , partly on the user &# 39 ; s computer , as a stand - alone software package , partly on the user &# 39 ; s computer and partly on a remote computer or entirely on the remote computer or server . in the latter scenario , the remote computer may be connected to the user &# 39 ; s computer through any type of network , including a local area network ( lan ) or a wide area network ( wan ), or the connection may be made to an external computer ( for example , through the internet using an internet service provider ). in some embodiments , electronic circuitry including , for example , programmable logic circuitry , field - programmable gate arrays ( fpga ), or programmable logic arrays ( pla ) may execute the computer readable program instructions by utilizing state information of the computer readable program instructions to personalize the electronic circuitry , in order to perform aspects of the present invention aspects of the present invention are described herein with reference to flowchart illustrations and / or block diagrams of methods , apparatus ( systems ), and computer program products according to embodiments of the invention . it will be understood that each block of the flowchart illustrations and / or block diagrams , and combinations of blocks in the flowchart illustrations and / or block diagrams , can be implemented by computer readable program instructions . these computer readable program instructions may be provided to a processor of a general purpose computer , special purpose computer , or other programmable data processing apparatus to produce a machine , such that the instructions , which execute via the processor of the computer or other programmable data processing apparatus , create means for implementing the functions / acts specified in the flowchart and / or block diagram block or blocks . these computer readable program instructions may also be stored in a computer readable storage medium that can direct a computer , a programmable data processing apparatus , and / or other devices to function in a particular manner , such that the computer readable storage medium having instructions stored therein comprises an article of manufacture including instructions which implement aspects of the function / act specified in the flowchart and / or block diagram block or blocks . the computer readable program instructions may also be loaded onto a computer , other programmable data processing apparatus , or other device to cause a series of operational steps to be performed on the computer , other programmable apparatus or other device to produce a computer implemented process , such that the instructions which execute on the computer , other programmable apparatus , or other device implement the functions / acts specified in the flowchart and / or block diagram block or blocks . the flowchart and block diagrams in the figures illustrate the architecture , functionality , and operation of possible implementations of systems , methods , and computer program products according to various embodiments of the present invention . in this regard , each block in the flowchart or block diagrams may represent a module , segment , or portion of instructions , which comprises one or more executable instructions for implementing the specified logical function ( s ). in some alternative implementations , the functions noted in the block may occur out of the order noted in the figures . for example , two blocks shown in succession may , in fact , be executed substantially concurrently , or the blocks may sometimes be executed in the reverse order , depending upon the functionality involved . it will also be noted that each block of the block diagrams and / or flowchart illustration , and combinations of blocks in the block diagrams and / or flowchart illustration , can be implemented by special purpose hardware - based systems that perform the specified functions or acts or carry out combinations of special purpose hardware and computer instructions . the descriptions of the various embodiments of the present invention have been presented for purposes of illustration , but are not intended to be exhaustive or limited to the embodiments disclosed . many modifications and variations will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments . the terminology used herein was chosen to best explain the principles of the embodiments , the practical application or technical improvement over technologies found in the marketplace , or to enable others of ordinary skill in the art to understand the embodiments disclosed herein .
| 6 |
the invention is related to olodaterol or a pharmaceutically acceptable salt thereof , for use in a method of treatment of cough . preferably for use in a method of treatment of cough concomitant to viral infection , asthma , allergen - induced asthmatic reactions , cystic fibrosis , bronchitis , chronic bronchitis , chronic obstructive pulmonary disease ( copd ), adult respiratory distress syndrome ( ards ), chronic pulmonary inflammation , rhinitis , allergic rhinitis , upper respiratory tract inflammatory disorders ( urid ), ventilator induced lung injury , silicosis , talcosis , pulmonary sarcoidosis , idiopathic pulmonary fibrosis ( ipf ) or bronchopulmonary dysplasia . specific types of coughs which may be treated by compounds of the present invention , include , but are not limited to dry cough , wet cough , croupy cough , or chest cough . preferred for the above mentioned use is a pharmaceutically active salt of olodaterol , especially olodaterol hydrochloride . accordingly , in a further aspect , the present invention provides a method for treating cough in a patient comprising administering olodaterol to said patient . in a further aspect , the administration of olodaterol does not cause addiction or arrhythmia in said patient . in a further aspect , the heart rate of the patient is not increased . in a further aspect , the present invention provides a method of treating a disease treatable by a bronchoprotective medicament comprising identifying a patient in need of said medicament and at risk of arrhythmia and administering olodaterol to said patient . in a further aspect , the present invention provides a method of treating a disease treatable by a bronchoprotective medicament comprising determining that a patient in need of said medicament is also at risk of arrhythmia and administering olodaterol to said patient . in a further aspect , the present invention provides a method of treating copd in a patient comprising determining that said patient is at risk of arrhythmia and administering olodaterol to said patient . in a further aspect , the present invention provides a method of treating copd in a patient comprising identifying a patient in need of said treatment and at risk of arrhythmia and administering olodaterol to said patient . in a further aspect , the present invention provides a method of treating copd in a patient comprising determining that said patient is at risk of increased heart rate and administering olodaterol to said patient . in a further aspect , the present invention provides a method of treating copd in a patient comprising identifying a patient in need of said treatment and at risk of increased heart rate and administering olodaterol to said patient . in a further aspect , a full effective dose of olodaterol is administered to said patient . in a further aspect olodaterol is administered to said patient based on the recognition of the safety margin of olodaterol . in a further aspect , olodaterol is administered to said patient based on the ratio dose inducing side - effect / bronchoprotective fed of olodaterol . olodaterol is known as combination partner of tiotropium salts , especially tiotropium bromide , from ep 1781298 . additionally tiotropium bromide is also available for the use as a medicament for the treatment of cough ( see lung . 2008 , 186 : 369 - 74 ). thus , another aspect of the invention is olodaterol or a pharmaceutical acceptably salt thereof in combination with tiotropium or a pharmaceutical acceptable salt thereof , preferably tiotropium bromide , for use as a medicament for the treatment of cough . whereas the application of the combination can be occur as a fixed dose combination or as free dose combination simultaneously or sequentially . in the preferred use for the treatment of cough according to the invention it is particularly preferred to use preparations or pharmaceutical formulations which are suitable for inhalation . inhalable preparations include inhalable powders , propellant containing metered - dose aerosols or propellant free inhalable solutions . within the scope of the present invention , the term propellant free inhalable solutions also include concentrates or sterile ready - to - use inhalable solutions . the formulations which may be used within the scope of the present invention are known from the above mentioned prior art . the dose range of olodaterol applicable per day is usually from 0 . 01 to 50 μg , preferably from 0 . 05 to 25 μg , more preferably from 1 to 10 μg , most preferably 1 , 2 . 5 , 5 or 10 μg . olodaterol fully effective dose in human in watery solution by inhalation with respimat ( see ep1809293 ) is comprised between 2 . 5 and 10 μg / day . a once daily application of the full effective dosage of olodaterol or a salt thereof is preferred . accordingly , in one aspect of the present invention , 5 μg of olodaterol is administered daily to the patient , for example through 2 actuations from the mouthpiece of a delivery device , each actuation containing 2 . 7 μg olodaterol hydrochloride , equivalent to 2 . 5 μg olodaterol . nevertheless a dosage unit may also contain half of the fully effective dose , then a once daily treatment by sequenced application of this half dose unit is preferred . accordingly , in another aspect of the present invention , only one actuation from the mouthpiece containing 2 . 7 μg olodaterol hydrochloride , equivalent to 2 . 5 μg olodaterol , is administered to a patient daily . alternatively , in a further aspect of the present invention two actuations from the mouthpiece each containing 1 . 35 μg olodaterol hydrochloride , equivalent to 1 . 25 μg olodaterol , are administered to a patient daily . in combination with tiotropium salts the dose range of olodaterol is the same than above and the dose range of the tiotropium salt , e . g . tiotropium bromide applicable per day is usually from 1 to 50 μg , preferably from 1 to 30 μg , more preferably from 1 to 20 μg , most preferably 1 , 2 . 5 , 5 , 10 or 18 μg . tiotropium fully effective dose in combination by inhalation of a powder formulation ( e . g . handyhaler from ep 1940349 ) is 18 μg / day and in watery solution by inhalation with respimat ( see ep1940349 ) is between 2 . 5 and 5 μg / day . olodaterol fully effective dose is the same than above . a once daily application of the full effective dosage of olodaterol and tiotropium or salts thereof according to the above description is preferred . nevertheless a dosage unit may also contain half of the fully effective dose , then a once daily treatment by sequenced application of this half dose unit is preferred . the actual pharmaceutically effective amount or therapeutic dosage will of course depend on factors known by those skilled in the art such as age and weight of the patient , route of administration and severity of disease . in any case the combination will be administered at dosages and in a manner which allows a pharmaceutically effective amount to be delivered based upon patient &# 39 ; s unique condition . other features and advantages of the present invention will become apparent from the following more detailed examples which illustrate , by way of example , the principles of the invention . animals — male albino dunkin - hartley guinea pigs ( 350 - 550 g ; charles river wiga gmbh , sulzfeld , germany ) were used . the animals were housed in groups of 6 in solid floor cages and allowed free access to water and standard food . the guinea pigs were kept in rooms maintained at a constant temperature ( 22 ° c .± 2 ° c .) and humidity ( 60 %± 15 %), with a 12 h light cycle . the experiments were approved by the ethical committee regierungspräsidium tübingen , germany . ova asthma model — on days 1 and 2 , the guinea pigs were immunised by subcutaneous injection of 0 . 5 ml per animal of a solution of ovalbumin ( ova ) ( 40 μg / ml ) and aluminium hydroxide [ al ( oh ) 3 ]. on day 14 , these sensitised guinea pigs were challenged with ova by exposure to an ova aerosol ( 1 . 25 mg / ml ) for 5 minutes , using a dräger inhalette ® ( dräger medical ag & amp ; co . kgaa , lübeck , germany ). 30 minutes prior to the challenge , pyrilamine maleate ( 2 mg / kg i . p .) was administered to protect the animals against bronchospasm . on day 15 , the citric acid challenge was given to induce cough . 2 hours before the challenge , the test compound or vehicle ( saline ) was delivered by intratracheal ( i . t .) administration ( 0 . 5 ml / kg ) under anaesthesia with isoflurane ( forene ®, abbott gmbh and co . kg , wiesbaden , germany ). tested compounds were : codeine : 1 , 3 , 10 , and 30 mg / kg i . t . ( codeine was used as gold standard for the validation of the experiment ) olodaterol : 0 . 01 , 0 . 03 , 0 . 1 , 0 . 3 , 1 , and 3 μg / kg i . t . formoterol : 1 , 3 , and 10 μg / kg i . t . indacaterol : 3 , 10 , and 30 μg / kg i . t . cough recording — two hours after i . t . application , the citric acid challenge was performed . a whole body plethysmograph manufactured for guinea pigs ( buxco research systems , wilmington , n . c ., usa ) was used for the experiments . conscious animals were individually placed , unrestrained , into a whole body plethysmograph chamber . a solution of citric acid ( 0 . 4 m ) was nebulised using the aerosol delivery system ( buxco ) and administered to the animals at a rate of nebulisation of 0 . 18 ml / min for 15 min . during the challenge , airflow in the chamber was recorded by the buxco system and analysed for the transient increase in airflow produced by cough , in which rapid inspiration is followed by rapid expiration . the system was able to distinguish coughs from other expiratory responses , and the number of coughs was counted . data analysis — data from the treatment groups were compared with the vehicle group . data are expressed as mean ± sem of coughs produced by guinea pigs within each group during a 15 minutes citric acid aerosol exposure . mean values were statistically analyzed by one - way analysis of variance ( anova ) followed by the dunnett &# 39 ; s multiple comparisons test to evaluate significant differences between groups with p & lt ; 0 . 05 being considered significant . animal — male and female dunkin - harley guinea pigs were obtained from the experimental animal breeding centre of harlan winkelmann ( germany ). after fasting overnight , but with free access to drinking water , animals with body weight of 400 - 500 g are used . anesthesia and preparation — the anesthesia was induced by intraperitoneal injection of 50 mg / kg pentobarbital . anesthesia was prolonged by intravenous infusion of pentobarbital ( 15 mg / kg / h ) via the jugular vein . a tracheal cannula was introduced after tracheotomy for artificial ventilation . the internal jugular vein was cannulated for acetylcholine injection . instrumentation — bronchospasm was recorded with a modified version of the method of konzett - röβler described by walland et al , 1997 . the animals were ventilated by means of a piston pump ( starling ventilator , hugo sachs elektronik , germany ) at a stroke volume of 1 ml / 100 g body weight and at a rate of 60 strokes per min the tubing which connected the tracheal cannula with the ventilator was provided with a branch leading to the bronchospasm transducer ( bronchospasm transducer 7020 , ugo basile , italy ). lung resistance was measured as ml of overflow and was recorded , amplified and saved under notocord files ( notocord - hem , notocord , france ). blood pressure and heart rate were monitored from a carotid artery in order to check the anesthesia and the variability of the preparation . experimental protocol — 2 hours before acetylcholine challenge , guinea pigs were given the test compound or its vehicle intra - tracheally under a slight isoflurane anesthesia . 30 minutes before acetylcholine challenge , lung resistance and blood pressure were measured under anesthesia . at t : 0 , acetylcholine was injected intravenously at a fixed dose of 14 μg / kg . compounds were tested at doses of : olodaterol : 0 . 01 , 0 . 03 , 0 . 1 , 0 . 3 , and 1 μg / kg formoterol : 0 . 1 , 0 . 3 , 1 , and 3 μg / kg indacaterol : 3 , 10 , and 30 μg / kg at the end of the experiment , animals were euthanized by an overdose of pentobarbital ( 100 mg / kg i . v .). data analysis — data from the treatment groups were compared with the vehicle group . data are expressed as mean ± sd of ml of overflow . bronchoprotection was expressed as percentage of inhibition of the bronchoconstriction recorded with acetycholine at 14 μg / kg i . v . mean values were statistically analyzed by one - way analysis of variance ( anova ) followed by the dunnett &# 39 ; s multiple comparisons test to evaluate significant differences between groups with p & lt ; 0 . 05 being considered significant . in the following the heart rate is expressed as a percentage of the pre - value ( heart beats per minute ) preceding the drug administration . the increase in heart rate expressed in percent corresponds to the difference of heart rate between the vehicle group and the treated group recorded 20 minutes after drug instillation . an increase in heart rate of at least 10 % or more in the treated group compared to the vehicle group is considered to be relevant as a systemic pharmacological activity ( arrhythmia ), while an increase of less than 10 % is not considered relevant . dose inducing side - effect ( increase in heart rate ) is the first dose increasing heart rate of at least 10 % or more compared to the vehicle group recorded 20 min after administration of the drug : olodaterol : 30 μg / kg (+ 13 %); formoterol : 10 μg / kg (+ 21 %); indacaterol : 100 μg / kg (+ 15 %). anti - tussive : cough reflex is a defensive reflex aiming to expel foreign particles , therefore 20 % of the cough reflex should be maintained . fed is the first dose without side - effect and displaying 70 to 80 % efficacy : olodaterol : 0 . 1 μg / kg (+ 79 %); formoterol : 3 μg / kg (+ 71 %); indacaterol has no anti - tussive activity . bronchoprotection : bronchoconstriction is a deleterious pulmonary reaction that should be abolished completely . fed is the first dose without side - effect and displaying 80 to 100 % efficacy : olodaterol : 0 . 3 μg / kg (+ 89 %); formoterol : 3 μg / kg ( 89 %); indacaterol : 10 μg / kg ( 84 %). olodaterol : the first side - effects ( increased heart rate ) were measured at a dosage of 30 μg / kg ( 13 % increase from baseline , dose inducing side - effect ). antitussive fully effective dose ( fed ): 0 . 1 μg / kg bronchoprotective fed ( see above ): 0 . 3 μg / kg ratio dose inducing side - effect / antitussive fed : 300 ratio dose inducing side - effect / bronchoprotective fed : 100 formoterol : the first side - effects ( increased heart rate ) were measured at a dosage of 10 μg / kg ( 21 % increase from baseline , dose inducing side - effect ). antitussive fed : 3 μg / kg bronchoprotective fed : 3 μg / kg ratio dose inducing side - effect / antitussive fed : 3 . 3 ratio dose inducing side - effect / bronchoprotective fed : 3 . 3 indacaterol : the first side - effects ( increased heart rate ) were measured at a dosage of 100 μg / kg ( 15 % increase from baseline , dose inducing side - effect ). no antitussive effect bronchoprotective fed : 10 μg / kg ratio dose inducing side - effect / antitussive effect : ratio dose inducing side - effect / bronchoprotective fed : 10 thus , olodaterol does not increase the heart rate ( less than 10 % increase ) at doses including its full effective dose for bronchoprotection and at doses showing the anti - tussive effect . an increase in heart rate was observed at a dose 300 times higher than the antitussive fully effective dose ( fed ) and 100 times higher than the bronchoprotective fed ( ratios dose inducing side - effect / antitussive fed and dose inducing side - effect / bronchoprotective fed of 300 and 100 , respectively ). the high ratios shown above for olodaterol indicate that there is a high safety margin against side effects at fed for olodaterol , especially in comparison with formoterol . for indacaterol , which has no anti - tussive effect , the side effect risk in view of bronchoprotection seems to be better than formoterol but , the safety margin is nevertheless 10 times less than for olodaterol .
| 0 |
write driver circuits are used to write data into the cells of a memory array . like conventional wwtm circuit , a write driver is normally operably connected to a column of cells across the bit and not bit lines for differentially writing a value into a cell . the present invention takes advantage of the preexistence of a write driver for any memory array by incorporating into the already - existing driver the capability to also perform a weak write operation . fig2 shows a conventional write driver circuit 80 . driver circuit 80 has bit and not bit lines for connection to the corresponding bit / not bit lines of a column of memory cells . it also has a datain input , which receives a “ 0 ” or a “ 1 ” and causes it to be applied at the bit / not bit outputs for writing to the memory cell column . write driver 80 generally includes pmos transistors m 11 and m 14 , nmos transistors m 12 , m 13 , m 15 and m 16 , and inverter u 11 . transistors m 11 and m 12 are connected in a conventional static inverter gate configuration — as are m 14 and m 13 — forming driver gates for providing the write driver output signal . the gates of the m 11 and m 12 fets are jointly connected forming the input for the m 11 / m 12 driver gate . their drains are also jointly connected forming its output . likewise , the gates of the m 13 and m 14 fets are jointly connected forming the input for them 13 / m 14 driver gate , and their drains are jointly connected to form its output . the sources of m 11 and m 14 serve as the supply inputs for their respective driver gates . these supply inputs are connected to v dd . alternatively , the sources of m 12 and m 13 serve as the supply outputs for the driver gates . accordingly , they are both connected to ground . pass gate transistors m 15 and m 16 are connected between the outputs of the m 11 / m 12 and m 13 / m 14 driver gates on the one hand , and the bit and not bit outputs on the other hand , respectively . their gates are each connected to a write signal for activating the write driver by passing the differential driver gate outputs to the bit / not bit outputs . the data input node is at the input of the m 13 / m 14 driver gate , and inverter u 11 is connected between the data node and the input of the m 11 / m 12 driver gate , which causes the driver gates to generate a differential output across their outputs . in operation , when a “ 0 ” value is applied at the data node , the output of the m 11 / m 12 driver gate ( which is an inverter ) is “ 0 ”, and the output of the m 13 / m 14 driver gate is “ 1 ”. if the write input is active ( e . g ., high ), pass gates m 15 and m 16 turn on and pass these values through to the bit and not bit outputs for differentially applying a “ 0 ” at a memory cell . conversely , when a “ 1 ” is at the data input , a “ 1 ” ( or high value ) is generated at the m 11 / m 12 driver gate output , and a “ 0 ” ( low value ) is generated at the m 13 / m 14 driver gate output . if the write input is active , pass gates m 15 and m 16 turn on to pass these values through to the bit and not bit outputs for differentially applying a “ 1 ” at the memory cell . fig3 shows one embodiment of a wwtm mode capable write driver circuit 100 of the present invention . like write driver circuit 80 , circuit 100 has data and write inputs and bit and not bit outputs for either writing a data value into or weak write testing a memory cell . circuit 100 also has a not wwtm input for setting circuit 100 either to wwtm or to normal write mode . write driver circuit 100 generally includes pmos transistors m 21 and m 24 , nmos transistors m 22 , m 23 , and m 25 through m 28 , and inverter u 21 . transistors m 21 - m 26 and inverter u 21 are similarly arranged and function equivalently as their respective counterparts , m 11 - m 16 and u 11 from circuit 80 . however , rather than being connected directly to ground , the supply outputs ( m 22 and m 23 sources ) of the driver gates ( m 21 / 22 and m 23 / m 24 ) are connected to a bias node . parallel configured first and second bias transistors , m 27 and m 28 , are connected between the bias node and ground . the not wwtm input is at the gate of the first bias transistor m 27 . in contrast , the gate of the second transistor , m 28 , is connected to v dd to keep m 28 turned on . the amount of resistance between the bias node and ground proportionally affects the strength of the driver gates and thereby so affects the strength of the output signal at bit / not bit for writing or weak write testing data into a memory cell . accordingly , m 28 is designed to be very weak because it will be the only pathway to ground from the bias node when driver 100 is in weak write mode . in this way , the output signal when in weak write mode is sufficiently weak for implementing a weak write test . m 28 can have a value corresponding to that of the pull - down transistor , mb , from fig1 b . conversely , m 27 is designed to be strong ; it will be enabled when circuit 100 is in a normal write mode . in this way , the output signal is bolstered for the write mode when data is to be written into a healthy cell . for a normal write operation , the not wwtm input is active ( high ) so that both m 27 and m 28 are on . in this way , the bit and not bit lines are pulled down strongly in order to perform a write operation . alternatively , when the not wwtm input is inactive ( low ), m 27 is turned off and only the relatively weak m 28 transistor remains on . this results in a weaker bit / not bit output for performing a wwtm operation . the actual size of the strong first transistor , m 27 , is not so critical . it simply must be strong enough to allow circuit 100 to implement a write operation . however , the size of the second ( wwtm ) weak transistor , m 28 , should be selected or tweaked for a particular design so that the bit / not bit signal is strong enough to write over data in a faulty cell but weak enough to not override data in a healthy cell . the actual size of m 28 will vary from design to design depending upon the parameters of the particular circuit and associated memory array . persons of ordinary skill will recognize that any suitable devices for controllably changing the resistive path between the bias node and ground may be used . such devices could include but are not limited to transistors , pass gates , resistors , current sources and combinations thereof . in addition , with use of a controllably variable resistive pathway ( e . g ., a removably selectable strong pathway in parallel with a nominal weak path ) for controlling the drive strength of a driver gate ( s ) in a driver circuit , almost any write driver design can be modified to allow it to do both write and weak write test operations . this controllably variable pathway may be implemented in any suitable place within the circuit including within the supply input path , as well as within the supply output path . the wwtm circuitry of circuit 100 adds only two additional nmos transistors to the write driver of circuit 80 . this is a negligible addition in terms of the whole array size . the design of circuit 100 takes advantage of the fact that ma from wwtm circuit 60 does not nee to be rigorously sized . in fact , its function is the same as the function of the pmos transistors in the write circuit 80 , thus allowing the same pfet to be used in both purposes . although the present invention and its advantages have been described in detail , it should be understood that various changes , substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims . moreover , the scope of the present application is not intended to be limited to the particular embodiments of the process , machine , manufacture , composition of matter , means , methods and steps described in the specification . as one of ordinary skill in the art will readily appreciate from the disclosure of the present invention , processes , machines , manufacture , compositions of matter , means , methods , or steps , presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention . accordingly , the appended claims are intended to include within their scope such processes , machines , manufacture , compositions of matter , means , methods , or steps .
| 6 |
fig1 a and 2b show a first embodiment of a bar - type ultrasonic motor which implements the present invention . the bar - type ultrasonic motor of this embodiment is housed in upper and lower case portions 8 and 9 . a vibration member arranged in the center of the case 8 and 9 comprises two elastic bodies 1 , electrode plates 2a , 2b and 2c , piezoelectric elements ( pairs ) 3a , 3b and 3c , and a support member 4 . the components constituting the vibration member have through - holes in their respective axial centers and are secured together by a hollow bolt 5 which is screwed into internal threads of the two elastic bodies 1 . the hollow bolt 5 has an external thread on its outer circumferential surface which is screwed into internal threads of the elastic bodies 1 to connect the two elastic bodies 1 . an output shaft 10 runs through the hollow portion formed along the central axis of the hollow bolt 5 . the output shaft 10 is supported by bearings 11 that are press - fitted into the top and bottom portions of the respective case portions 8 and 9 . the case portions 8 and 9 are thus substantially sealed . the ultrasonic motor of this embodiment has two movable bodies ( contact bodies ) 12 at respective axial ends of the vibration member and a clamping member 15 integral with a spring washer 14 is press - fitted around the output shaft 10 in the vicinity of each movable body 12 . by adjusting the press - fit position of the clamping member 15 relative to the output shaft 10 , the spring washer 14 exerts pressure on a friction member 13 , having a spring feature , arranged on the end of the movable body 12 against the elastic body 1 . since a rotation stopper , though not shown , is provided between the spring washer 14 and the movable body 12 , the two components rotate integrally . the vibration member combines two bending vibrations having different phases when driving piezoelectric elements 3a and 3b are supplied with alternating signals by an unshown drive control circuit , and moves like a rope in a skipping - rope motion . any given point on the end surface of the vibration member moves in a circular or elliptical motion , and imparts a rotary force to the friction member 13 of the movable body 12 pressed into contact with the end surface of the vibration member . since the friction member 13 is fitted into the movable body 12 , the movable body 12 also rotates . the principle of the ultrasonic motor is known as disclosed in u . s . pat . no . 5 , 548 , 175 , and the discussion in detail about it is omitted here . the present invention is not limited to a driving method using a composition of two bending vibrations , as used in this embodiment . alternatively , a driving method using a composition of a vertical vibration and a torsion vibration may be used . the outer circumference of a generally cylindrical support member 4 clamped in the vibration member is welded to the junction between the case portions 8 and 9 . although the support member 4 is designed to support the vibration member , it also has a structure that facilitates generation of the vibration of the vibration member ; for example , the support member 4 provides a high rigidity about the axis but permits some degree of flexibility of the axis in a radial direction . electrode plates interposed between piezoelectric elements 3a , 3b and 3c have respective terminal portions 2a , 2b , and 2c projecting radially out from the outer diameter of the piezoelectric elements . these terminal portions 2a , 2b , and 2c extend radially , and are angularly shifted respective to each other around the axis so that they are not aligned in the axial direction , as shown in fig2 b . fig2 b is a cross - sectional view taken along a line ii -- ii in fig1 and the three electrode plate terminal portions 2a , 2b , and 2c extending from the vibration member are angularly spaced at 0 °, 90 ° and 180 ° in this embodiment . alternatively , the three electrode plate terminal portions 2a , 2b , and 2c may be equally angularly spaced by 120 °. the terminal portions 2a , 2b , and 2c are pressed , in the axial direction , into contact with conductive metal members 6a , 6b , and 6c arranged in the lower case portion 9 for electrical connection . the conductive metal members 6a , 6b , and 6c are secured to an insulating resin member 7 by means of hooks 7a arranged within the lower case portion 9 . the insulating resin member 7 has a cup - like shape with an open bottom , and is secured within the lower case portion 9 with locating projections 17 on its bottom side received in holes 9a of the lower case portion 9 . ends of the conductive metal members 6a , 6b , and 6c run to the end of lower case portion 9 , so that the ends may be connected to lead wires or a flexible printed circuit board ( not shown ), to feed a required power ( electrical signal ) to the motor . to assemble the motor of this embodiment , the vibration member , the movable bodies 12 and the output shaft 10 , all of which are pre - assembled , are together fitted into the upper case portion 8 having a bearing 11 . on the other hand , a bearing 11 , the insulating resin member 7 and the conductive metal members 6a , 6b and 6c are assembled into the lower case portion 9 . when the upper case portion 8 having the required components assembled therein is finally mated with the lower case portion 9 having the required components assembled therein , the assembly of the motor is completed with the electrode plate terminal portions 2a , 2b , and 2c respectively pressed into contact with the conductive metal members 6a , 6b , and 6c at a pressure sufficient to maintain good electrical contact therebetween . the upper case portion 8 and the lower case portion 9 are secured to each other using an adhesive agent . alternatively , electric - resistance welding , laser welding , or brazing may be used . the two case portions 8 and 9 may be manufactured using a press draw forming technique , and then connected with their joints mutually caulked . alternatively , the case portions themselves may be constructed of an insulating resin , thereby dispensing with the need to provide insulating resin member 7 . fig2 a is a view of the motor viewed from the arrow i . the three terminals of the conductive metal terminal portions 6a , 6b , and 6c and a common electrode terminal 16 ( for ground ) are projected out of the end face of the motor . the terminal 16 is connected to the lower case portion 9 , and is thus maintained at the same potential as that of the lower case portion 9 . since the lower case portion 9 is metallic in this embodiment of the present invention , it is electrically conductive . the lower case portion 9 remains in contact with the support member 4 , and is at the same potential as that of the elastic bodies 1 and the hollow bolt 5 . the two metal conductive members 6a , 6b feed power to the pair of piezoelectric elements 3a to generate in them a bending vibration in one direction , and feed power to the pair of piezoelectric elements 3b to generate in them a bending vibration perpendicular to the one direction . the conductive member 6c is used to detect a voltage generated by the pair of piezoelectric elements 3c , thereby to detect the vibration state of the vibration member . in the conventional ultrasonic motor , one movable body is arranged for one vibration member . in this embodiment , however , two movable bodies 12 are provided on respective sides of the vibration member . since the two movable bodies are also coupled to the same output shaft , the following advantages are provided in comparison with a motor with one movable body . 1 ) the starting torque is doubled . although the friction limits the pressure working between the vibration member and the movable body , the output shaft generates a torque twice as strong as that of a conventional art motor if the pressures are equal . 2 ) irregular rotation is reduced . irregular rotation is attributed to an unstable contact condition on the contact area . the unstable contact conditions are caused by an insufficient flatness of a friction surface or an insufficient roundness ( eccentricity ) of the vibration of the vibration member with respect to the axis . since these factors are chiefly attributed to machining accuracy , they are inevitable to some degree . when the two movable bodies are employed , however , the unstable contact conditions cancel out each other , and the irregular rotation is thus reduced . 3 ) a decreased internal loss in the vibration member results in an improved motor efficiency . when only a single movable body is used , one end of the vibration member with no movable body pressed against it moves freely , and the resultant vibration attenuation thereby consumes energy . suppose that a motor with two movable bodies generates power twice as high as a motor with a single movable body . this case may be interpreted as identical to the case in which torque is doubled with the rotational speed remaining unchanged . the internal losses in the two vibration members are equal to each other . thus , the overall efficiency is increased . the second embodiment is almost identical to the first embodiment in construction , and the difference therebetween is discussed below . in the second embodiment , the terminal portions 2a , 2b and 2c of the electrode plates are bent approximately at a right angle , in the axial direction . the contact portions of the conductive metal members 6a , 6b , and 6c have a step portion ( see , e . g ., 6aa in fig3 ) so that a gap is provided between the conductive metal member and the insulating resin member 7 . the gap between each of the conductive metal members 6a , 6b , and 6c and the insulating metal member 7 receives a respective one of the terminal portions 2a , 2b , and 2c in the axial direction . to assemble the motor of the second embodiment , the assembled vibration member and the support member 4 are fitted into the upper case portion 8 . the conductive metal members 6a , 6b , and 6c are attached to the insulating resin member 7 . the insulating resin member 7 is then secured into the lowers case portion 9 . finally , the upper case portion 8 with the conductive metal members 6a , 6b , and 6c and the insulating resin member 7 mounted therein is mated with the lower case portion 9 with the support member 4 clamped therebetween . the assembly of the motor is now completed . each of the terminal ends of the electrode plates 2a , 2b , and 2c is clamped between a respective one of the conductive metal members 6a , 6b , and 6c and the insulating resin member 7 to provide electrical connection therebetween . since the terminal ends of the electrode plates 2a , 2b and 2c are clamped against the insulating resin members 7 by the recovering force of the conductive metal members 6a , 6b and 6c in the second embodiment , the electrode plates are free from unstable electrical contact even under vibration conditions , and the electrical connection is reliably maintained . fig4 a and 4b show a third embodiment of the present invention . the third embodiment is almost identical in construction to the first embodiment shown in fig1 and the difference therebetween is discussed below . in the third embodiment , the terminal portions of the electrode plates 2a , 2b , and 2c extending from the vibration member respectively are twisted by 90 ° so that their width section is aligned in the axial direction . to receive these terminal portions , the end portions of the conductive metal members 6a , 6b , and 6c are bent to form a socket portion u - shaped in cross section ( see end portion 6ab in fig4 b ). the terminal portions of the electrode plates 2a , 2b , and 2c are inserted in the axial direction and maintained in press contact in the socket portions . when the lower case portion 9 is mated with the upper case portion 8 in the third embodiment , the terminal portions of the electrode plates 2a , 2b and 2c are reliably clamped in the conductive metal plates 6a , 6b , and 6c , respectively . by twisting the electrode plate terminal portions by 90 °, their rigidity in the axial direction is increased . fig5 a and 5b show a fourth embodiment of the present invention . the fourth embodiment is almost identical in construction to the first embodiment shown in fig1 and the difference therebetween is discussed below . in the fourth embodiment , the electrode plate terminal portions 2a , 2b , and 2c extend radially in the same manner as in the first embodiment , and the end portions of the conductive metal members 6a , 6b , and 6c are formed with a socket portion u - shaped in cross section and extending in a circumferential direction around the vibration member inside the insulating resin member 7 , as shown in fig5 a . in the fourth embodiment , after the lower case portion 9 is connected to the upper case portion 8 , the lower case portion 9 is rotated about its own axis so that the electrode plate terminal portions 2a , 2b , and 2c are inserted into and then press contacted to the respective socket portions to obtain electrical connection therebetween . in the above embodiments , the movable body ( contact body ) 12 is designed to rotate relative to the vibration member . the present invention is not limited to this arrangement . alternatively , the vibration member and the contact body may be moved relative to each other in a manner such that the vibration member moves relative to the contact body . in the above embodiments , as described above , the conductive metal members 6a , 6b and 6c , separate from the electrode plates , are mounted on the lower case portion 9 , and the terminal portions of the electrode plates 2a , 2b and 2c are arranged in press contact with the conductive metal members . the above arrangement provides the following advantages . 2 ) since the separate members are employed where the stress in the electrode plates is at its maximum , damage to the electrode plates is prevented , and a reliable vibrating actuator results . 3 ) the use of conductive metal members secured to the case by means of another member shortens the terminal portions of the electrode plates projecting out of the vibration member . as a result , the natural frequency of each terminal portion is raised , lowering the possibility that the terminal portion will vibrate and generate sound . 4 ) since each terminal portion is shortened as described above , a case having a small diameter may be used to obtain a small outer diameter of the vibration member . this accordingly reduces the diameter of the vibrating actuator . 5 ) the conductive metal members , secured to the case , are reliably held without aging and reliably feed power to the vibration member elements . while the present invention has been described with respect to what is presently considered to be the preferred embodiments , it is to be understood that the invention is not limited to the disclosed embodiments . to the contrary , the present invention is intended to cover various modifications and equivalent arrangements and structures included within the spirit and scope of the appended claims . the scope of the following claims is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures and functions .
| 7 |
the present invention is particularly adapted to employment with a conventional syringe 11 as shown in fig1 . the syringe 11 includes a barrel 12 within which there is disposed a longitudinally movable plunger or piston 13 that may be manually operated by withdrawal to draw a fluid into the barrel at a front opening and by depression to expel fluid from the front of the barrel . conventional practice provides a disposable mounting unit 16 which is adapted for removable attachment to the forward end of the syringe barrel 12 . the unit 16 conventionally carries a hollow needle 17 extending axially forward therefrom and communicating with the front end of the syringe barrel . it will be appreciated that the retraction of the plunger 13 in the syringe 11 will produce a suction at the needle 17 so as to draw a fluid contacted by the needle 17 into the barrel of the syringe . subsequently , physical depression of the plunger 13 in the barrel 12 of the syringe 11 will cause a fluid disposed in such barrel to be forced outwardly therefrom through the adapter 16 and thence through the needle attached thereto . conventional operation of an injection or hypodermic syringe provides for loading or filling thereof by drawing a fluid therein through the needle , as described above . it has long been recognized that fluid drawn into a syringe may possibly contain contaminants which may thus be drawn into the syringe and subsequently discharged through the syringe needle into an intravenous ( iv ) solution , for example . injection of contaminants of any type or kind into an iv solution and thus eventually into the blood stream , for example , is at least injurious and may prove to be fatal . the present invention precludes this possibility with apparatus that is quite inexpensive and even more importantly is operated in exactly the same manner as conventional syringes so that the likelihood or even possibility of human error or laxness will not reduce the effectiveness of the invention . referring again to the drawing , there will be seen to be shown in fig2 and 3 a preferred embodiment of the present invention incorporated in the adapter 16 . the adapter 16 includes a housing or body 21 having a small diameter aperture or bore 22 extending therein from the front end of the adapter and dimensioned to receive and retain the rear end of the hollow needle 17 . within the body 21 the bore 22 branches into two relatively parallel passages 23 and 24 which extend to a rear opening 26 in the housing . a hollow cylindrical portion 27 extends from the rear of the housing 21 with the opening 26 conically expanding through this portion to receive a hollow conical forward extension 28 of the syringe barrel 12 . the adapter and syringe are removably joined by this mating conical or tapered connection which is commonly termed a lure lock . alternative connections may be made ; however , the one shown and described is conventional and is commonly employed by those employing disposable needles with syringes . the adapter of the present invention provides one passage 23 for drawing fluid into the syringe and a second passage 24 for ejecting fluid from the syringe . this directed flow is herein achieved by providing a one - way or check valve 31 in the passage 23 wherein such valve admits of fluid flow only into the syringe barrel and positively prevents fluid flow in the opposite direction through the passage 23 . in the passage 24 there is also provided a one - way check valve 32 which admits of fluid flow out of the syringe barrel but positively prevents fluid flow into the syringe . in accordance with the present invention there is also provided a fluid filter 33 in one of the adapter passages 23 or 24 and the filter is shown to be preferably disposed in passage 24 on the syringe side of the valve 32 . by the illustrated location of the filter 33 maximum protection is afforded by the present invention , inasmuch as any and all fluid forced into the needle from the syringe must then pass through the filter for removal of any contaminants . this filter location will be seen to provide for removal even of contaminants that might have resided in the syringe barrel before the fluid was drawn therein for ejection . the valves 31 and 32 may be formed as shown in fig3 and referring to valve 31 , it will be seen to be comprised as a disc 41 disposed in an expanded portion 42 of the passage 23 and normally resting against an annular shoulder 43 between the expanded portion 42 of the passage and a portion 44 of lesser diameter . the larger or expanded portion 42 of the passage extends from the rear opening 26 to the shoulder 43 and the small portion 44 extends therefrom to the front bore 22 in the adapter body 21 . the disc 41 is mounted to pivot or bend away from the shoulder 43 as indicated , for example , in fig4 . one part of the edge or periphery of the disc is secured to the wall of the passage portion 42 or to the shoulder 43 and the disc may be flexible to bend , as shown . the disc 41 normally seats against the shoulder 43 so as to close the passage 23 as illustrated in fig3 . any pressure exerted to the left on the disc 41 as shown in fig2 i . e ., away from the syringe end of the adapter , will only more tightly seal the disc 41 against the shoulder 43 . on the other hand a suction applied to the right side of the disc 41 as shown in fig2 as by retraction of a syringe plunger , will cause the disc 41 to pivot or bend away from the shoulder 43 to admit fluid flow through the valve 31 . the other valve 32 may be likewise formed by a disc 51 disposed in an expanded portion 52 of the passage 24 communicating with the needle bore 22 and normally disposed in sealing engagement with a shoulder 53 about the inner end of the expanded portion 52 and a smaller portion 54 of the passage 24 extending into communication with the rear opening 26 . the valve 32 is operable to pass a fluid under pressure from the syringe 11 to the needle 17 as by deflection or pivoting of the disc 51 and to positively prevent fluid flow in the opposite direction . it will be appreciated that the one - way valves of the present invention may be formed in a variety of different ways and the illustrated and described structure is only exemplary although advantageous . it is also possible to form the adapter housing in a variety of different ways and from various different materials . the preferred embodiment of the invention illustrated is formed of a plastic material that may , for example , be molded as separate halves and joined together after valve disc insertion . operation of the present invention is quite clear from the foregoing description of the elements of a preferred embodiment of the invention . there are , however , illustrated in fig4 and 5 the operations of the present invention during filling or loading of a syringe equipped with the present invention , and discharge of fluid therefrom as by injection of a medicament into a bottle containing an iv solution , for example . fig4 shows the position and relation of elements hereof during the drawing of fluid into a syringe , as from an ampule 61 that has had the top thereof broken off in conventional manner to provide access to the fluid therein . such an ampule may inadvertently contain small shards of glass from breaking the top therefrom , for example . suction in the passage 23 produced by drawing the plunger 13 rearwardly in the syringe 11 causes the disc 41 of the valve 31 to be deflected or pivoted away from the shoulder or valve seat 43 , as shown in fig4 to open the passage 23 to the flow of fluid from the ampule into the syringe . this fluid flow is indicated by the arrows in fig4 and it will be seen that the aforementioned suction serves to even more tightly seal the valve 32 in the passage 24 so that no fluid can traverse this passage . discharge of a fluid from a syringe equipped with the present invention is illustrated in fig5 wherein the plunger 13 of the syringe is being forced into the barrel as indicated by the large arrow and fluid pressure is thus being exerted in the upper ends of the adapter passages 23 and 24 . pressure applied above valve 31 in passage 23 will tightly seal the valve disc 41 against the shoulder or valve seat 43 . pressure applied above valve 32 in passage 24 will pivot or deflect the disc 51 of the valve 32 away from the shoulder or valve seat 53 to open this passage for the discharge of fluid therethrough to and thence through the needle 17 . fluid forced under pressure through adapter passage 24 must pass through the filter 33 which removes any and substantially all foreign particles from the fluid . the filter 33 may be comprised of a wide variety of different porous materials through which a fluid may be forced and which has the property of entrapping and retaining solids that may be carried by the fluid forced therethrough . it will be appreciated that the material of filter 33 need not be provided as a dimensionally stable element nor need the filter have any particular structural properties other than the general capability of filling the entire cross section of the passage 24 in order to insure that all fluid discharged from the syringe is , in fact , filtered . the filter 33 may , for example , be comprised simply of a fibrous material such as cotton or cellulosic material &# 34 ; stuffed &# 34 ; into the passage 24 and generally the filter may be most easily inserted in the upper portion 54 of the passage 24 , as shown . the present invention , as described above , will be seen to provide a simple but highly effective system for preventing the injection of impurities or foreign bodies into an iv solution or a human being , for example . in fig5 the syringe needle 17 is shown to be inserted into an iv bottle 66 through a diaphragm 67 disposed across the top thereof as an example , and the needle might also be inserted into the body of a person . even a minute particle entrained in the fluid injected into the body of a person may be seriously injurious or even fatal , and the present invention positively precludes this occurrence . of further importance is the certainty of use and proper operation of the present invention to thus insure attainment of the desired result despite the presence of human error and resistance to change . although relatively trained personnel normally are employed to fill injection syringes with fluids and to inject fluids with such syringes , it is well known that the human being is resistant to change and is prone to error in executing normal operations wherein minor changes from normal may be required . these problems are now existent in the field of the present invention wherein prior art devices intended to produce the same or similar results as the present invention fail to do so because of the human factor . failure to take certain actions or to make certain necessary adjustments or the like may and in fact does result in failure to properly filter fluids injected into iv solutions , for example in doctors &# 39 ; offices and hospitals . the present invention , on the other hand , is entirely &# 34 ; invisible &# 34 ; to the user . a technician , pharmacist , vocational nurse , registered nurse or even a medical doctor may fail to follow particular deviations in long established procedures which would ensure complete filtration of all fluids injected with prior art devices . the present invention ensures complete filtration without the operator in any way deviating from normal or standard operating procedures and in fact without any discernible change of equipment so that the operator &# 34 ; automatically &# 34 ; produces the proper results . it is indeed a practical and highly useful result that is achieved by the present invention . the present invention has been illustrated and described with respect to a particular preferred embodiment hereof ; however , it is not intended to limit the invention to the precise terms of description or details of illustration , for it will be apparent to those skilled in the art that numerous variations and modifications may be made within the spirit and scope of the invention .
| 0 |
referring to fig1 integrated turbogenerator system 12 generally includes generator 20 , power head 21 , combustor 22 , and recuperator ( or heat exchanger ) 23 . power head 21 of turbogenerator 12 includes compressor 30 , turbine 31 , and common shaft 32 . tie rod 33 to magnetic rotor 26 ( which may be a permanent magnet ) of generator 20 passes through bearing rotor 32 . compressor 30 includes compressor impeller or wheel 34 that draws air flowing from an annular air flow passage in outer cylindrical sleeve 29 around stator 27 of the generator 20 . turbine 31 includes turbine wheel or impeller 35 that receives hot exhaust gas flowing from combustor 22 . combustor 22 receives preheated air from recuperator 23 and fuel through a plurality of fuel injectors 49 . compressor wheel 34 and turbine wheel 35 are supported on common shaft or rotor 32 having radially extending air - flow bearing rotor thrust disk 36 . common shaft 32 is rotatably supported by a single air - flow journal bearing within center bearing housing 37 while bearing rotor thrust disk 36 at the compressor end of common shaft 32 is rotatably supported by a bilateral air - flow thrust bearing . generator 20 includes magnetic rotor or sleeve 26 rotatably supported within generator stator 27 by a pair of spaced journal bearings . both rotor 26 and stator 27 may include permanent magnets . air is drawn by the rotation of rotor 26 and travels between rotor 26 and stator 27 and further through an annular space formed radially outward of the stator to cool generator 20 . inner sleeve 25 serves to separate the air expelled by rotor 26 from the air being drawn in by compressor 30 , thereby preventing preheated air from being drawn in by the compressor and adversely affecting the performance of the compressor ( due to the lower density of preheated air as opposed to ambient - temperature air ). in operation , air 110 is drawn through sleeve 29 by compressor 30 , compressed , and directed to flow into recuperator 23 . recuperator 23 includes annular housing 40 with heat transfer section or core 41 , exhaust gas dome 42 , and combustor dome 43 . heat from exhaust gas 110 exiting turbine 31 is used to preheat compressed air 100 flowing through recuperator 23 before it enters combustor 22 , where the preheated air is mixed with fuel and ignited such as by electrical spark , hot surface ignition , or catalyst . the fuel may also be premixed with all or a portion of the preheated air prior to injection into the combustor . the resulting combustion gas expands in turbine 31 to drive turbine impeller 35 and , through common shaft 32 , drive compressor 30 and rotor 26 of generator 20 . expanded turbine exhaust gas 100 then exits turbine 31 and flows through recuperator 23 before being discharged from turbogenerator 12 . referring to fig2 combustor dome 43 is formed in a annular configuration to creating turbine exhaust gas passage 50 . exhaust passage 50 channels expanded turbine exhaust gas and directs it to flow towards exhaust dome 42 disposed at the end of combustor dome 43 distal of turbine 31 . exhaust dome 42 is formed with a generally semi - spherical configuration that directs exhaust gas to flow radially outward and reverse direction towards recuperator core 41 . to maximize the diffusion of exhaust gas and thus maximize the expansion ratio across turbine 31 , exhaust passage 50 is formed with a generally conical configuration that allows the exhaust gas to diffuse as it flows towards exhaust dome 42 . exhaust gas exits turbine 31 at very high speed and with a rotational directional component due to the rotation of the turbine impeller 35 . thus , the flow of exhaust gas resembles a vortex flow in which the primary or main flow travels along the outer annulus of passage 50 and the secondary flow travels in the center of passage 50 and is generally characterized as low energy or low velocity flow . in some cases the secondary flow can be in the reverse direction and travel back toward the turbine impeller . most of the mass flow discharge from the turbine is contained in the primary flow . the primary flow in effect forms an acoustic cavity around the secondary flow . due to the highly turbulent and unsteady nature of the flow , this acoustic cavity ca be excited to thereby create an acoustic resonance within the cavity created by the secondary flow . to facilitate the diffusion of the exhaust gas as it flows through passage 50 , one embodiment of the present invention provides exhaust vortex disrupter 200 disposed within exhaust passage 50 . disrupter 200 is mounted to exhaust dome 42 and extends from the exhaust dome coaxially towards turbine 31 to terminate proximal to turbine impeller 35 . in the preferred embodiment illustrated , disrupter 200 is formed in a generally conical configuration that cooperates with combustor dome 43 to define passage 50 as an annular , generally conical passage for the exhaust gas . disrupter 200 is configured and spaced from combustor dome 43 to displace the secondary core region of the flow in passage 50 and to promote a more even velocity distribution in the flow as well as sustained diffusion of the exhaust gas . a more even velocity distribution helps to reduce pressure losses created in passage 50 . by occupying the central volume of passage 50 , disrupter 200 guides the exhaust flow towards exhaust dome 42 with greater diffusion , lower pressure losses , and a consequent greater expansion ratio across the turbine and higher turbine power output . furthermore , disrupter 200 continues to direct exhaust gas as it arrives at exhaust dome 42 , encouraging the gas to flow radially outward . in conventional systems , the exhaust gas would impinge generally perpendicularly upon exhaust dome 42 before being forced radially outward by the upstream exhaust gas that is being discharged by the turbine impeller . furthermore , in conventional systems the effective flow area increases rapidly as the gas passage turns radially . the rapid area increase causes flow separation which prevents further diffusion . additionally , the momentum of the flow tends to pull the flow off the wall of combustor dome 43 as the flow turns radially outward . this flow separation increases the pressure losses in passage 50 and promotes uneven velocity distribution as the exhaust gas flows towards the recuperator inlet . thus , the base of disrupter 200 at which the disrupter is mounted to the exhaust dome is contoured with a generally conical surface to direct oncoming exhaust gas 100 radially outward and thus allow the exhaust gas to continue diffusing after it exits passage 50 . the contours of combustor dome 43 and exhaust dome 42 are designed to guide the flow radially outward through a smoothly varying cross - sectional flow area and thus prevent flow separation and promote continued diffusion through the passage . disrupter 200 further acts to more evenly distribute exhaust gas as it exits passage 50 and is reversed by exhaust dome 42 to enter recuperator core 41 , thereby enhancing the heat transfer efficiency of the recuperator . because exhaust dome 42 provides a stable platform onto which to mount disrupter 200 , there is no need for struts or similar structures to fasten and secure the disrupter . avoiding the use of such struts is highly desirable because the struts cause pressure loss and noise . noise is also reduced by the use of disrupter 200 because it displaces the potential acoustic cavity that may be created by the secondary flow downstream of the turbine and eliminates the noise associated with acoustic resonation of this cavity . an additional advantage of using disrupter 200 is that by enhancing the diffusion of exhaust gas 100 , passage 50 may be shortened and thus entire turbogenerator 12 may be constructed with a reduced footprint . having now described the invention in accordance with the requirements of the patent statutes , those skilled in the art will understand how to make changes and modifications to the present invention to meet their specific requirements or conditions . such changes and modifications may be made without departing from the scope and spirit of the invention , as defined and limited solely by the following claims .
| 5 |
referring to fig1 - 8 , an embodiment of the key - cutting device 10 is operable to produce by a punching technique one or more notches 11 in a key blank 12 . the key - cutting device includes a body comprised of foundation beam 13 elongated upon an axis 26 between forward and rearward extremities 14 and 15 , respectively , and further bounded by side surfaces 16 , upper surface 17 and lower surface 18 . a handle 19 is downwardly and rearwardly emergent from lower surface 18 adjacent rearward extremity 15 . a punch rod 20 is slidably held within a housing 21 which is removably secured upon upper surface 17 by first holding bolt 78 . said punch rod , adapted for reciprocating axial movement within housing 21 , has a rear extremity 22 and a forward extremity milled to have an upwardly directed angled apex 23 which constitutes a key - shearing punch . punch rod 20 is constrained to non - rotative movement by virtue of retaining pin 24 configured to slide within slot 25 positioned atop housing 21 in parallel coplanar alignment with axis 26 . an anvil 27 removably held upon upper surface 17 adjacent forward extremity 14 , has an aperture 28 disposed in alignment with punch 23 . said anvil is secured in place by abutment plate 29 having debris - emergent port 30 disposed forwardly of aperture 28 , and bolts 31 that treadably engage anvil 27 . a second holding bolt 32 , upwardly directed through beam 13 , threadably secures abutment plate 29 . a removable hand lever 33 , mounted by pivot bolt 34 to beam 13 adjacent handle 19 , extends to an upper extremity 35 located above upper surface 17 . said upper extremity 35 holds thrust wheel 36 adapted to rotate in the plane of lever 33 . said thrust wheel contacts rear extremity 22 of punch rod 20 . accordingly , when lever 33 is squeezed toward handle 19 , thrust wheel 36 forces punch rod 20 forwardly . a track beam 37 extends orthogonally upward from upper surface 17 and is threadably secured in place by third holding bolt 38 upwardly directed through beam 13 . a channel 43 in beam 37 allows penetrative passage of punch rod 20 . carriage 39 , slideably mounted upon beam 37 for reciprocal thereupon , is comprised of side panels 40 which laterally embrace beam 37 , top panel 41 , and forward surface 42 . the lowermost portion of panel 41 contains a passage 44 aligned with channel 43 and configured to permit passage of punch 23 . a transverse slot 45 is disposed in forward surface 42 and bounded by upper and lower straight shoulders 46 and 47 , respectively . a positioning shaft 48 is secured by plate 49 to the upper portion of forward surface 42 and axially centered within vertical plane 50 , shown in fig5 that includes axis 28 of beam 13 as shown in fig1 . the forward extremity of shaft 48 is equipped with knurled turning knob 51 , and the rearward extremity of shaft 48 has a pinion configuration having teeth 52 that protrude downwardly through the upper shoulder 46 of transverse slot 45 . the lowermost extremity of plate 49 extends downwardly below upper shoulder 46 , forming therewith a trough - like guide channel 53 . a circular positioning drum 54 is rotatively supported by removable bolt 55 upon track beam 37 , and extends rearwardly therefrom upon an axis parallel to axis 28 within plane 50 . drum 54 is provided with a plurality of numbered peripheral detents 56 of varied depth . a ball bearing 57 , disposed above drum 54 and centered within plane 50 , is adapted to enter the uppermost detent 58 . a calibration bolt 79 , threadably held by top panel 41 of carriage 39 , is positioned to abut ball bearing 57 and force it toward said uppermost detent . paired restorative coil springs 58 are interactive between top panel 41 and track beam 37 in a manner to urge carriage 39 downwardly upon track beam 37 . by said virtue of such manner of construction , rotation of drum 54 causes said carriage to be positioned at different elevations with respect to punch 23 . as will be seen , this controls the depth of cut of a given notch in a key blank , said depth being selected merely by rotation of drum 54 to a numbered position . interchangeable key - gripping vise assembly 59 is comprised of upper vise plate 60 , lower vise plate 61 and locking bolt 62 having threaded rear extremity 63 , winged forward extremity 64 , and bearing shoulder 65 . a hole 66 in upper vise plate 60 permits passage of threaded extremity 63 which then engages threaded hole 67 in lower vise plate 61 but does not penetrate said plate 61 . such disposition causes shoulder 65 to urge both plates together to grip intervening key blank 12 . a threaded spacing bolt 68 in upper vise plate 60 seats within recess 69 in the forward face 70 of lower vise plate 61 . such construction affords control over the alignment and spacing of both clamping plates . the upper edge of lower vise plate 61 is configured to slide within guide channel 53 of transverse slot 45 , and is provided with a straight rack of teeth 71 adapted to interact with pinion teeth 52 . the lower edge of forward face 70 of lower vise plate 61 is provided with a key - receiving recess 72 which accurately controls the length of the key disposed within the vise assembly , and precisely disposes the lower edge of the key blank parallel to the lower straight edge 73 of vise plate 61 . as shown in fig4 said lower straight edge 73 is provided with a series of positioning notches 74 . the distance of separation of said notches corresponds to the coded spacing of the notches to be cut into the key blank . on the rear face 75 of said rearward clamping plate 61 there is disposed a series of markings 76 which correspond to the sequence number of particular notches to be cut into a key blank . by virtue of the aforesaid construction , said key - gripping vise permits the cutting of notches in both straight edges of a key blank . in the operation of the device , a vise assembly 59 having a key blank properly gripped is pushed into transverse slot 45 , as shown in fig5 . knob 51 is then rotated , thereby sliding assembly 59 and key blank across axis 26 until the number one position is observed from the rear upon lower vise plate 61 , as shown in fig7 . the exact transverse position of the vise assembly is assured by spring urged ball 77 that protrudes through lower shoulder 47 into transverse groove 45 . with each successive transverse position of the vise assembly , corresponding to the notch number of the key blank , the depth of the notch is selected by rotating drum 54 to a numbered position . lever 33 is then squeezed , causing punch 23 to move forward and interact with anvil 27 to create a notch in the key blank . the cut out piece of metal from the key blank emerges from exit port 30 . upon release of squeezing force upon lever 33 , punch rod 20 is urged to its rearward , starting position , by the action of coil spring 80 disposed upon said punch rod and interactive between pin 24 and track beam 37 . the vise assembly 59 is sequentially advanced transversely to the carriage to perform the coded cutting or punching of notches in the key blank . the key is then removed from the clamping member and the removable vise assembly is ready to reload in preparation for cutting other keys of like code . if the next code is different , then the vise assembly is easily slid out of the transverse groove 45 , and the appropriate vise is reloaded with an option of having the key preloaded ( before installation into the transverse groove ) or loading once the vise assembly is installed onto the transverse groove . it is interesting to note that the aforesaid particular construction of the vise assembly and the means whereby the assembly is held during key cutting is such that the lower edge of the vise assembly can be pushed forward slightly before the key blank abuts the anvil . such motion is achieved by virtue of a deliberate loose fitting of the upper edge of vise plate 61 within guide channel 53 . this permits swinging forward motion of the lower edge of said rearward clamp . such movement is permitted by ball 77 which maintains accurate transverse registry of the key blank despite the fact that the lower edge of the key blank is displaced forward slightly during the punching operation . such manner of function minimize wear of the punch . furthermore , said loose fitting of the upper edge of plate 61 within guide channel 53 causes minimal interaction of pinion teeth 52 with the teeth of rack 71 . by virtue of such construction , the positioning of the vise assembly is controlled by the interaction of stopping notches 74 with ball 77 . as can be seen from the foregoing description , various vise assemblies can be utilized interactively with the device . each vise assembly is designed to hold a given style of key blank at a controlled degree of insertion , and contains the notch spacing code 74 for that particular series of keys . drum 54 , which contains the depth of cut code , can be easily removed by removal of holding bolt 27 . punch rod 20 and matching anvil 27 can be removed and replaced with a punch rod and anvil which provide a different notch - cutting angle . removal of punch rod 20 is achieved by first removing hand lever 33 , then housing 21 . while particular examples of the present invention have been shown and described , it is apparent that changes and modifications may be made therein without departing from the invention in its broadest aspects . the aim of the appended claims , therefore , is to cover all such changes and modifications as fall within the true spirit and scope of the invention .
| 8 |
referring to fig1 , a power toothbrush 10 includes a head 12 and a neck 14 . as is well known to those skilled in the art , head 12 is oscillated during brushing . an electric motor ( not shown ) oscillates the head through gearing , linkages , cranks , and / or other drive mechanisms as is well known . electrical power may be supplied to the motor by rechargeable or single use ( disposable ) batteries . further details as to how the head is oscillated will not be provided , as this aspect of the brush is not the focus of the invention . head 12 includes a generally circular support member 16 , and , extending from the support member 16 , a plurality of bristle tufts 18 . although each tuft is shown as a solid mass in the drawings , the tufts are actually each made up of a great mass of individual plastic bristles . the bristles may be made of any desired polymer , e . g ., nylon 6 . 12 or 6 . 10 , and may have any desired diameter , e . g ., 4 - 8 mil . the tufts are supported at their bases by the support member , and may be held in place by any desired tufting technique as is well known in the art , e . g ., hot tufting or a stapling process . the tufts may also be mounted to move on the support member , as is well known in the toothbrush art . head 12 further includes a cup - shaped member 20 , which can be seen clearly in fig1 a , in which some of the bristle tufts have been omitted . cup - shaped member 20 includes a side wall 22 that defines a central open area 24 . generally , the central open area 24 has a depth of from about 2 to 5 mm , measured from the highest point of the rim of the cup - shaped member to the lowest point of the central open area . cup - shaped member 20 also includes a plurality of ribs 26 that extend inwardly into the open area 24 . the cup - shaped member 20 is preferably formed of a resilient material such as an elastomer , e . g ., a thermoplastic elastomer . the material hardness for such structures may range from 10 to 70 shore a , with the preferred hardness selection depending on the design and dimensions of the cup - shaped member . the cup - shaped member 20 may be fixedly mounted on the toothbrush head , or may be rotatably mounted , so that the cup - shaped member 20 can spin about its long axis while the toothbrush head is oscillated . the spinning motion may be driven by the same motor that oscillates the head , as would be understood by those skilled in the art . if the cup - shaped member is fixedly mounted , it may be mounted by any conventional technique , e . g ., by screwing it in place or over - molding it onto the support member . as shown in fig1 b , the height of bristle tufts 18 above the top surface s of support member 16 will generally be greater than the height of the cup - shaped member 20 from surface s . this height differential allows the head to contour around each tooth , enhancing the tooth - to - tooth indexing effect mentioned above . there is also a height differential between the different bristle tufts . the end bristle tufts 18 a , i . e ., the tufts that are adjacent the long axis of the toothbrush neck 14 when the head 12 is at rest , are taller than the side tufts 18 b . for example , the height of the cup - shaped member may be from about 5 . 5 to 10 mm , with the end tufts 18 a being about 20 to 30 % taller than the cup - shaped member , e . g ., from about 6 . 6 to 13 mm in height , and the side tufts 18 b being about 5 to 15 % taller than the cup - shaped member , e . g ., about 5 . 8 to 11 . 5 mm in height . making the side tufts shorter than the end tufts allows the longer tufts to reach in between the teeth , while the shorter tufts clean along the gumline . toothbrush heads according to other embodiments are shown in fig2 - 10 . in each of these embodiments , the support members 116 are generally elliptical , rather than circular as shown in fig1 . the elliptical shape provides more room for additional bristle tufts , and thus these toothbrush heads further include curved , elongated interdental tufts 28 . in these embodiments , the cup - shaped member and bristle tufts are generally shorter than in the embodiment discussed above . in an elliptical head , the reduced height will tend to make the brush more comfortable and less “ bulky ” feeling in a user &# 39 ; s mouth . as in the embodiment discussed above , the bristle tufts are generally taller than the cup - shaped member . as shown in fig2 a , the interdental tufts 28 are also taller than the cup - shaped member , e . g ., by about 30 to 40 %. each of the embodiments shown in fig2 - 7 includes a different type of cup - shaped member . in head 112 , shown in fig2 , cup shaped member 120 includes a side wall 122 , and extending inwardly from the side wall , a plurality of ribs 30 that converge at a generally cylindrical central hub 32 . in alternate embodiments ( not shown ) the central hub may be conical or cup - shaped . in this design , as shown in fig2 b , the ribs are at the same height as the cup at the outer perimeter , and decrease in height as they approach the center . this arrangement allows the ribs to act as “ squeegees ” to clean the tooth surface . the addition of the central hub adds strength to the total structure and the ribs . if this additional strength is not required for a particular design , the central hub may be omitted , and the ribs may simply intersect each other , or may stop short of intersecting . in head 212 , shown in fig3 , cup - shaped member 220 includes a side wall 222 and , extending inwardly from the side wall , a plurality of larger ribs 34 and smaller ribs 36 . the larger ribs are longer ( i . e ., extend further into the center ), and may have a different thickness and / or height than the smaller ribs . in the embodiments shown in fig4 and 5 , the cup - shaped member is segmented , i . e ., it has a discontinuous side wall that includes a plurality of arcuate segments . the segmented structure imparts flexibility to the cup - shaped member , and may allow the cup - shaped member to conform better to the tooth surface . as can be seen in fig5 , in these embodiments the segments are defined by grooves 42 that do not extend to the bottom of the cup - shaped member . as a result , the segments are connected to form a unitary structure . in head 312 , shown in fig4 , cup - shaped member 320 includes a segmented side wall that includes four arcuate segments 40 having grooves 42 therebetween . within the open center area defined by the cup - shaped member 320 are disposed two concentrically arranged smaller inner cup - shaped members 44 and 46 . these inner cup - shaped members have the same segmented structure as the outer cup - shaped member 320 . the concentric members provide a large surface area for contact with the tooth surface , which may provide improved cleaning . in head 412 , shown in fig5 , cup - shaped member 420 again includes a segmented side wall comprised of four arcuate segments . in this embodiment , ribs 126 extend inwardly from the side wall , as in the embodiment shown in fig1 . in the embodiment shown in fig6 , head 612 includes a cup - shaped member 620 that has a wavy fringe 54 extending above its upper edge 56 . the wavy fringe is relatively soft and flexible , so that it will lay flat when pressed against the surface of the teeth . this may allow the fringe to slide under the gums and between the teeth , providing plaque removal and gum stimulation which may reduce gingivitis . generally , the fringe has a thickness of about 0 . 15 to 0 . 25 mm , measured at its top edge , and about 0 . 4 to 0 . 8 mm measured at its base ( where the fringe joins the rim of the cup - shaped member ). while four relatively large waves are shown in fig6 , if desired more waves and / or smaller waves may be used . the number and size of the waves are selected to provide desired product attributes . head 612 also differs from the designs described above in that the cup - shaped member 620 includes ribs 60 that are inclined with respect to the longitudinal axis of the cup - shaped member . in the embodiment shown in fig7 , head 512 includes a fan - shaped member 520 that has a plurality of ribs 50 extending radially from an outer surface of its side wall 52 in a fan - like arrangement . in this embodiment , the side wall 52 is generally conical . alternatively , if desired , the side wall may be cylindrical ( not shown ). in this embodiment , the fan - like structure of the cup - shaped member may enhance the foaming action of some toothpastes . the ribs may also act as “ squeegees ”, enhancing tooth - cleaning action . in the embodiment shown in fig8 , head 712 includes a textured member 720 that is comprised of a plurality of lammelae 722 that extend from a common base 724 together define a unitary structure . the lammelae 722 are arranged in different directions to give a “ textured ” feel . in this embodiment , the lammelae define a generally circular member , and are arranged in groups that are at right angles to each other in a “ woven ” pattern . however , the textured member may have any desired shape and arrangement of lamellae . it is generally preferred that the lammelae be relatively closely spaced , e . g ., that spaces 726 be less than about 0 . 75 mm wide , more preferably about 0 . 5 mm or less . in the embodiment shown in fig9 , head 812 includes a textured member 820 . textured member 820 includes a generally cylindrical base 822 and , extending from the base , a contact portion 824 that includes a central hub 826 and a plurality of ribs 828 extending radially from the hub . textured member 820 may be formed of a foam , as shown , to provide a surface texture . in the embodiment shown in fig1 , head 912 includes a textured member 920 , including a generally cylindrical base 922 and , extending from the base , a plurality of small nubs 924 that provide the member with a textured feel . a textured feel may be provided in many ways , for example by forming a resilient member of any desired shape of a material having a macroscopic surface texture , e . g ., an open celled foam , or a material having texture - imparting particles embedded in its surface . for example , while the cup - shaped member is shown in the drawings as centrally - located on the toothbrush head , if desired it may be positioned off - center . in fig2 - 10 , the support members 116 are generally elliptical , rather than circular as shown in fig1 . fig1 illustrates a generally elliptical head 116 having cup - shaped member 320 , which is positioned off - center of the elliptical head . the remaining elements are substantially the same as the similarly identified elements described with reference to fig4 . moreover , while various embodiments are shown in the drawings and described above , many other types of cup - shaped members may be used , as will be well understood by those skilled in the art . for example , the side wall of the cup - shaped member may have a tapered outer surface , or may be straight sided or have any other desired design . additionally , which the cup - shaped member is described above as being surrounded on all sides by bristle tufts , if desired the cup - shaped member may be only partially surrounded by bristle tufts . for example , if desired the side tufts 18 b in fig1 could be omitted moreover , while heads for power toothbrushes have been described above , resilient members having the features described above may be used on manual toothbrushes , if desired .
| 0 |
the invention provides new types of passively fitting prosthodontic frameworks and rapid methods for fabricating the frameworks and components thereof . fig1 shows a stone cast model of a patient &# 39 ; s mouth 150 that include six osseo - integrated oral implants at positions 160 a - f . primary abutments are shown screwed into the dental implants at positions 160 a - 160 d . the primary abutments are internally threaded so that a secondary abutment may be reversibly fixed thereto using a screw . as discussed further below , the primary abutments will later support secondary abutment sleeves of a passively fitting framework embodiment of the invention . in this embodiment , at positions 160 e and f , abutment sleeves configured to directly mount to the dental implants via screw connection ( not shown installed in fig1 ), rather than to an intermediate primary abutment , were used . fig2 shows a top view of the unitary metallic framework component 201 of a full arch embodiment of the invention positioned on hard model 150 . the dental implants ( not visible ) are disposed into the patient &# 39 ; s jawbone ( and represented in the model ) at positions 160 a - f as shown in fig1 . at this point , a primary abutment ( not visible ) is screwed into each of the dental implants at positions 160 a - d in the model . at each of positions 160 b - d , a titanium sleeve secondary abutment , 265 b - f respectively , is screw - connected to the primary abutment . at each of positions 160 e and f , an abutment sleeve configured for direct attachment to a dental implant is reversibly fixed directly into the underlying dental implant using a screw . the abutment sleeves may , for example , be circumferentially ribbed as shown or have a non - ribbed outer surface . at one end of the elongated framework component is a screw attachment portion 202 in which a hole is formed for screw attachment of the prosthesis to a primary abutment which , in turn , is attached to the underlying dental implant . proceeding from screw attachment portion 202 toward the opposite end of framework component 201 are connecting segments or “ bars ” 203 , 205 , 207 , 209 that connect screw attachment portion 202 and abutment - surrounding segments 204 , 206 , 208 , 210 / 211 to each other as shown . specifically , screw attachment portion 202 is connected to abutment - surrounding segment 204 by connecting segment 203 , abutment - surrounding segment 204 is connected to abutment - surrounding segment 206 by connecting segment 205 , abutment - surrounding segment 206 is connected to abutment - surrounding segment 208 by connecting segment 207 , abutment - surrounding segment 208 is connected to abutment - surrounding segment 210 by connecting segment 209 . as shown , implant positions 160 e and f are so close to each other that abutment connecting segments 210 and 211 are directly joined to one another by sharing a common segment there - between . viewed from the top ( or bottom ), each of the abutment connecting segments of framework component 201 is c - shaped ( inclusive of u - shaped and crescent - shaped ) having a convex side and a concave side . the shape of the abutment - surrounding segments generally defines a concavity ( or recess ) into which the titanium sleeve secondary abutment can be at least partially disposed ( the central axes of the sleeves extending in a direction from the tissue side to the occlusal side ). framework component 201 has a generally arch - shaped profile following the gum line with a convex ( facial / labial ) side and a concave ( lingual ) side . as shown , the concave side of each abutment - surrounding segment opens on the convex side of framework component 201 . each of the abutment - surrounding segments has radial protrusions from its concave surface extending radially inward ( e . g ., 214 a and 214 b in abutment connecting segment 204 ). the ribs of the titanium abutment sleeves and the radial protrusions of the abutment - surrounding members facilitate the joining of the neighboring abutment sleeves and abutment - surrounding segments using polymer resin and help to transmit forces applied to the framework in the final dental restoration down into the attached dental implants . although in framework component 201 all of the abutment - surrounding segments are commonly oriented with their openings being labial facing , the orientations of some or all of the abutment - surrounding segments could be such that their openings are lingual facing and / or labial facing and / or for abutment - surrounding segments at the end of a metallic framework component , labial - facing ( facial ), lingual - facing or opening in - line with the axis of the underlying jaw bone . screw attachment portion 202 is shown screwed to the underlying abutment at position 160 a and framework 201 is thereby able to pivot on the screw connection when the screw connection is sufficiently loose . the connecting segments of framework component 201 have longitudinal axes ( in the horizontal dimension shown ) that generally follow the gum - line , i . e ., the curvature of portion of the mandible or maxilla extensive with the restoration that is being prepared . thus , the connecting segments and the abutment - surrounding segments are mutually sized and configured in framework component 201 so that the abutment - surrounding segments are able to partially surround and approach the titanium abutment sleeves whilst the connecting segments follow the curvature of portion of the mandible or maxilla extensive with the restoration that is being prepared . a passively fitting framework is then formed in situ , in the patient &# 39 ; s mouth . abutment sleeves are reversibly attached ( directly or indirectly via an intervening abutment as planned out using the model ) to each of the dental implants in the patient &# 39 ; s jaw bone using screws . framework component 201 is attached to the dental implant corresponding to position 160 a via screw connection portion 202 and set in a final position ( by tightening the screw connection at portion 202 ) so that the abutment - surrounding segments of component 201 are facing the abutment sleeves ( similarly to the view shown for the model in fig2 ). component 201 is then joined to each of secondary abutment sleeves 265 b - f by filling in the space there - between with a hardening polymer resin such as an acrylic or a light - curable resin such as triad ® gel ( dentsply international inc ., york , pa ., usa ) or primopattern lc gel ® ( primopattern , bad homburg , germany ). the resin bonds to the surfaces of the abutment - surrounding segments and the adjacent abutment sleeves and spans the space there - between . fig3 shows the hybrid prosthodontic framework 370 so obtained , having been removed now from the patient &# 39 ; s mouth . the hybrid framework includes the metallic framework component 201 joined by hardened resin to each of titanium sleeve abutments 265 b - f . the use of a hardening / curable resin intra - orally as the joining material ensures that the resulting framework will be passively fitting . the invention also provides a related , but less preferable , method in which the hybrid framework is formed by joining the elongated component to the abutment sleeves using the resin while these members are attached to the oral model ( such as shown in fig2 ). by the term “ hybrid ,” what is meant herein is that the framework is formed of different materials joined together , namely an elongated one - piece framework component such as that described , one or more abutment sleeves and a hardened , curable polymer resin joining the elongated component and the abutment sleeve ( s ) to each other . optionally , once the resin has hardened , one or more of the abutment sleeves 265 b - f can be welded to the metallic framework component 201 using metal spanning members such as rods . hybrid framework 370 is then positioned over the dental implants in the patient &# 39 ; s mouth and reversibly fixed by screw connection . bite registration is recorded and an impression is made to create a new master model that preserves the new frame - implant position that was achieved . a tooth set - up may then be prepared on and around hybrid framework 370 , for example , by any of the methods known in the art . fig4 shows the occlusal side of the completed prosthesis . fig5 shows the tissue side of the completed prosthesis with the interior surface of each abutment sleeve 265 b - f as well as the primary abutment - interfacing surface of screw connection member 202 a visible . advantageously and in contrast to conventional frameworks , a metallic framework component according to the invention ( such as component 201 of fig2 ) may be formed from non - precious metals , for example , cobalt chromium alloys as known in the art such as argeloy n . p . special ( the argen corporation , san diego , calif ., usa ). the metal content of argeloy n . p . special is 59 . 5 % co , 31 . 5 % cr , 5 % mo , 2 % si , and less than 1 % each of mn , fe , and c . a framework component according to the invention , such as component 201 , may be formed by any means . one preferred method involves forming a model of a metallic framework component of material , such as wax and / or acrylic , which can be burned out in a lost wax ( investment ) casting procedure . since each metallic framework component is custom - made for a patient , a direct method of investment casting may be used . fig6 shows stone cast model 150 of the patient &# 39 ; s mouth with dental implants at positions 160 a - f and titanium abutment sleeves 265 b - f there - above . the burnable model 601 is composed of separate segments 602 - 611 that have been joined together by wax and / or acrylic resin and which correspond to sections 202 - 211 of the metallic framework component 201 of fig2 . segment 612 is a sacrificial portion later removed from the resulting metallic casting . connecting segments 603 , 605 , 607 , 609 and segment 612 may be formed from castable modeling wax cut to length as needed . screw attachment model portion 602 is formed of castable material and is sized and configured to precisely fit over the primary abutment screwed into the dental implant and provide surfaces for screw attachment of the corresponding cast portion to the primary abutment . castable screw attachment members such as 602 , which is essentially a castable model of a secondary abutment , are commercially available from implant and abutment manufactures or may be custom fabricated , for example from castable plastic or wax , as needed . castable wax and / or acrylic , such as pattern resin ™ ( gc america , inc ., alsip , ill ., usa ), may be used to join separate elements of the castable model to one another , such as to join the screw attachment portion of the model to the adjacent connecting segment model portion and to build up surfaces around the screw attachment portion as needed or desired . abutment - surrounding segments 604 , 606 , 608 , 610 and 611 may for example each be individually formed from acrylic resin hardened in a silicone mold or alternatively formed of wax . fig7 shows an individual castable c - shaped abutment - surrounding element of the kind that may be used to form a castable framework component model such as 601 . on the tissue side of the connecting segments ( not visible in fig6 ), additional thickness of material , such as castable molding wax , may be added to form tissue stop structures . when the castable model is completed , as shown in fig6 , it is removed from stone cast model 150 and used to cast the metallic framework component . model 601 was used to cast metallic framework component 201 of fig2 . after casting , segment 612 was removed . the surface of the casting was ground to remove various sharp edges . the surface of the casting may be roughened by sand - blasting and / or by chemical etching . the roughening of the surface facilitates later bonding to acrylic or other resin used to join the metallic framework component to the abutment sleeves as well as bonding of the metallic framework components to the tooth set - up materials . the abutment sleeves are types of abutments . it should be understood from this description that the abutment sleeves used may be secondary abutments that mount on primary abutments that in turn directly mount on underlying dental implants or the sleeves may be primary abutments themselves , i . e ., mount directly to the underlying dental implants . as exemplified herein , a combination of these types of abutment sleeves may , if desired , be used in the manufacture of a hybrid framework of the invention or exclusively one type or the other may be used as desired . similarly , although the example of the figures shows a terminal screw attachment portion of a framework component that is sized and configured to mount on a primary abutment , such portions that are sized and configured to directly mount on a dental implant may also be used . as used herein , when an abutment , such as an abutment sleeve , or a terminal screw attachment portion of a framework component is said to be fixed or connected or attached to a dental implant it may be either directly fixed or connected or attached to the implant or indirectly fixed or connected or attached to the implant via at least one , such as one , intermediate abutment . as well known in the art , abutment sleeves may be reversibly fixed to an underlying component , either another abutment or a dental implant , using a screw inserted into the shaft of the abutment sleeve and received by a threaded socket of the underlying component . all of the various abutments described herein are commercially available for commonly used dental implants . abutments are also commercially available in varying lengths and can also be readily truncated as needed . abutments or a combination of abutments are selected so that the body of the abutment sleeve ( s ) that will be joined by resin to a c - shaped abutment - surrounding member of the elongate framework component extends into the plane of thickness of the c - shaped abutment - surrounding member when the elongate framework component is fixed in its operative position with respect to the patient &# 39 ; s mouth or model thereof . without limitation , the invention also provides the following embodiments and variations thereof . one embodiment of the invention provides a one - piece , solid , such as metallic , elongated passively fitting framework component having a tissue side and an occlusal side , that includes or consists essentially of or consists of : a terminal screw attachment portion forming a hole passing from the tissue side to the occlusal side of the component ; a connecting segment , such as an elongated connecting segment , joining the terminal screw attachment portion and the c - shaped abutment - surrounding segment . the component may optionally include further c - shaped abutment - surrounding segments and at least some adjacent c - shaped abutment - surrounding segments are connected by interposed connecting segments . a related embodiment of the invention provides a one - piece , solid , such as metallic , elongated passively fitting framework component having a tissue side and an occlusal side , that includes or consists essentially of or consists of : a terminal screw attachment portion forming a hole passing from the tissue side to the occlusal side of the component ; a first connecting segment , such as a first elongated connecting segment , joining the terminal screw attachment portion and the first c - shaped abutment - surrounding segment ; a second connecting segment , such as a second elongated connecting segment , joining the first c - shaped abutment - surrounding segment and the second c - shaped abutment - surrounding segment . one embodiment of the invention provides a method for fabricating a passively fitting hybrid framework for a patient having at least two adjacent osseo - integrated dental implants in a jaw bone , there being two terminal dental implants , that includes the steps of : reversibly fixing an abutment sleeve to each dental implant other than a first one of the terminal dental implants ; providing an elongated one - piece , optionally metallic , passively fitting framework component having a tissue side and an occlusal side , that includes : a terminal screw attachment portion forming a hole passing from the tissue side to the occlusal side of the component for attachment to an abutment of a terminal dental implant , a c - shaped abutment - surrounding segment defining a concavity for attachment to an abutment of each dental implant other than the first one of the terminal dental implants , a connecting segment , such as an elongated connecting segment , joining the terminal screw attachment portion and the c - shaped abutment - surrounding segment , wherein the elongated one - piece passively fitting framework component is sized and configured so that when the terminal screw attachment portion thereof is attached to the first one of the terminal dental implants in the patient &# 39 ; s jawbone , the concavity of the c - shaped abutment - surrounding segment faces the secondary abutment sleeve ; reversibly attaching the terminal screw attachment portion of the framework component to the first one of the terminal dental implants in the patient &# 39 ; s mouth such that the c - shaped abutment - surrounding segment faces the abutment sleeve ; and joining the c - shaped abutment - surrounding segment to the secondary abutment sleeve it faces with a hardening resin . a related embodiment provides a method for fabricating a passively fitting hybrid framework in which the resin is used to joined components mounted on a model , that includes the steps of : providing a solid model of a patient &# 39 ; s mouth with at least two osseo - integrated dental implants in a jaw bone there being two terminal dental implants ; providing an elongated one - piece , optionally metallic , passively fitting framework component having a tissue side and an occlusal side that includes : a terminal screw attachment portion forming a hole passing from the tissue side to the occlusal side of the component for reversible attachment to a first terminal dental implant , a c - shaped abutment - surrounding segment defining a concavity for attachment to an abutment reversibly fixed to a dental implant other than the first terminal dental implant , and a connecting segment , such as an elongated connecting segment , joining the terminal screw attachment portion and the c - shaped abutment - surrounding segment ; reversibly attaching an abutment sleeve to a dental implant other than the first terminal dental implant in the model ; reversibly attaching the terminal screw attachment portion of the framework component to the first terminal dental implant of the model such that c - shaped abutment - surrounding segment at least partially surrounds the abutment sleeve ; and joining the c - shaped abutment - surrounding segments to the at least partially surrounded abutment sleeve with a hardening resin . in framework component embodiments including a screw attachment portion , there may be a single screw attachment portion , such as single terminal screw attachment portion , forming a hole passing from the tissue side to the occlusal side of the component of the embodiments . a screw attachment portion , such as a single screw attachment portion may also be located at a position to attach to a non - terminal dental implant where three or more dental implants are present . the invention also provides embodiments in which , rather than an initial fixation of a framework component to an underlying dental implant via a screw attachment portion , such as a terminal screw attachment portion , of the framework component , the initial attachment of the framework component for setting the orientation for subsequent fixations is also made between an abutment sleeve ( installed on a dental implant in the patient &# 39 ; s mouth or on a model thereof ), such as a secondary abutment sleeve , and a lateral face of the framework component that faces the sleeve , such as the face presented by a lateral concavity formed therein , such as the face of a lateral concavity presented by a c - shaped segment . the fabrication of a passively fitting framework according to such a method is exemplified in fig8 - 13 . fig8 shows a hard model of a patient &# 39 ; s mouth ( maxillary ), with seven dental implants installed in the maxilla . secondary abutment sleeves 865 a - 865 g , as shown , are already installed on the dental implants of the model . a unitary wax mock - up of a framework component 800 manufactured by conventional means ( e . g ., bending , cutting , filing ) provides lateral concavities that face and at least partially surround the abutment sleeves . generally , the mock - up of the framework component may be made from wax and / or acrylic , which can be burned out in a lost wax ( investment ) casting procedure to provide a corresponding metallic framework component . rather than a casting process , a mock - up of a framework component may be three - dimensionally scanned and then three - dimensionally printed in a metallic or non - metallic material , such as by methods known in the art . if it is intended that the framework mock - up is to be scanned rather than cast , the framework mock - up may be made of any easily worked material ( rather than only a material that can be burned out in a casting process ). the shape and surface features of a metal framework component obtained by casting or other methods may , for example , be further refined if desired by machining or texturizing . fig9 shows a metallic framework component 900 , which was cast from framework mock - up 800 , disposed on hard model 850 so that the abutment sleeves are laterally adjacent to and at least partially surrounded by the lateral concavities of framework 900 . fig1 shows resin 1000 c filling the space between abutment sleeve 865 c and framework 900 to join the abutment sleeve to the framework . framework 900 joined to abutment sleeve 865 c by hardened resin is then removed from the model as a unit by removing the internal screw securing abutment sleeve 865 c to the underlying dental implant in the model . fig1 shows framework 900 resin - joined to abutment sleeve 865 c now installed as a unit in the patient &# 39 ; s mouth by screw attachment of abutment sleeve 865 c to the corresponding dental implant in the patient &# 39 ; s maxilla . secondary abutment sleeves are shown already installed on the remaining dental implants in the patient &# 39 ; s jaw . as shown , the remaining abutments are laterally juxtaposed to the lateral concave faces of framework 900 . each of the remaining abutments , 1265 a - b and 1265 d - g , is then joined with hardening resin to the adjacent portion of framework 900 , with the result shown in fig1 ( resin shown at 1000 a / b and 1000 d - g , respectively ). in this manner , a passively fitting prosthodontic framework is obtained . the resulting framework including framework component 900 and abutment sleeves 865 c , 1265 a - b and 1265 d - g joined by resin to framework 900 is removed from the patient &# 39 ; s mouth by unscrewing the screw member that secures each abutment sleeve to its respective dental implant . fig1 shows the isolated passively fitting framework , which can then be further processed to provide a dental restoration including a tooth set - up . one embodiment of the invention provides a one - piece elongated passively fitting framework component having a tissue side and an occlusal side that includes or consists essentially of : a first portion selected from the group consisting of a terminal screw attachment portion forming a hole passing from the tissue side to the occlusal side of the component and a terminal c - shaped abutment - surrounding segment defining a concavity ; a second portion which is a c - shaped abutment - surrounding segment defining a concavity ; and a connecting segment , such as an elongated connecting segment , joining the first portion to the second portion . in one variation , there is a single screw attachment portion , such as a single terminal screw attachment portion , forming a hole passing from the tissue side to the occlusal side of the component . in another variation , there is no screw attachment portion forming a hole passing from the tissue side to the occlusal side of the component but there may be least two c - shaped segments . in a related variation , there is no terminal screw attachment portion forming a hole passing from the tissue side to the occlusal side of the component . another embodiment of the invention provides a one - piece , elongated passively fitting framework component having a tissue side and an occlusal side that includes or consists essentially of : a connecting segment , such as an elongated connecting segment , joining the first c - shaped abutment - surrounding segment and the second c - shaped abutment - surrounding segment or the first and second c - shaped abutment - surrounding segments being directly joined . a related embodiment of the invention provides a one - piece , elongated passively fitting framework component having a tissue side and an occlusal side that includes or consists essentially of : a plurality of c - shaped abutment - surrounding segments sequentially ordered along the framework component ; and for each pair of sequentially adjacent c - shaped abutment - surrounding segments , a connecting segment , such as an elongated connecting segment , joining sequentially adjacent c - shaped abutment - surrounding segments and / or sequentially adjacent c - shaped abutment - surrounding segments directly connected to each other or any combination thereof . a further embodiment of the invention provides a method for fabricating a passively fitting framework for a patient having at least two adjacent osseo - integrated dental implants in a jaw bone , there being two terminal dental implants , that includes the steps of : reversibly fixing an abutment sleeve to at least one of the dental implants ; providing an elongated one - piece , passively fitting framework component having a tissue side and an occlusal side that comprises : a first c - shaped abutment - surrounding segment , a second c - shaped abutment - surrounding segment , and a connecting segment , such as an elongated connecting segment , joining the first c - shaped abutment - surrounding segment and the second c - shaped abutment - surrounding segment or the first and second c - shaped abutment - surrounding segments being directly joined , wherein the elongated one - piece passively fitting framework component is sized and configured so that if a secondary abutment sleeve is installed on each dental implant , the concavity of each of the c - shaped abutment - surrounding segments of the framework will face the secondary abutment sleeve of a dental implant ; positioning the framework in the patient &# 39 ; s mouth so that the concavity of each c - shaped abutment - surrounding segment will face a secondary abutment sleeve installed on one of the dental implants ; and joining at least one of the c - shaped abutment - surrounding segment to the secondary abutment sleeve it faces with a hardening resin . still another embodiment of the invention provides a method for fabricating a passively fitting framework that includes the steps of : providing a solid model of a patient &# 39 ; s jaw with at least two osseo - integrated dental implants in a jaw bone there being two terminal dental implants ; providing an elongated one - piece , passively fitting framework component having a tissue side and an occlusal side , that includes : a first c - shaped abutment - surrounding segment , a second c - shaped abutment - surrounding segment , and a connecting segment , such as an elongated connecting segment , joining the first c - shaped abutment - surrounding segment and the second c - shaped abutment - surrounding segment or the first and second c - shaped abutment - surrounding segments being directly joined , wherein the elongated one - piece passively fitting framework component is sized and configured so that if a secondary abutment sleeve were installed on each dental implant in the model , each of the c - shaped abutment - surrounding segments of the framework would face the secondary abutment sleeve of a dental implant ; positioning the framework in the model so that if a secondary abutment sleeve were installed on each dental implant , each of the c - shaped abutment - surrounding segments of the frameworks would face the secondary abutment sleeve of a dental implant ; reversibly attaching a first abutment sleeve to a first dental implant in the model ; and joining the c - shaped abutment - surrounding segment that at least partially surrounds the first abutment sleeve with a hardening resin . detaching as a unit from the model the framework component joined by resin to the first secondary abutment sleeve ; reversibly installing a secondary abutment sleeve on each implant in the patient &# 39 ; s jawbone except for that corresponding to the first dental implant in the model ; reversibly installing the framework component joined by resin to the first secondary abutment sleeve by screw attachment of the first secondary abutment sleeve to the dental implant in the patient &# 39 ; s jawbone that corresponds to the first dental implant in the model , such that concavities of the remaining c - shaped abutment - surrounding segments of the framework component respectively face the secondary abutment sleeves reversibly installed on the remaining dental implants ; and joining each of said remaining c - shaped abutment - surrounding segments with a hardening resin to the secondary abutment sleeve that it faces . the one - piece framework components may be sized and configured so that the lateral surface - presenting abutment - facing segments thereof , such as the aforementioned c - shaped segments , are disposed so that each ( simultaneously ) is laterally adjacent to and faces the vertical projection of a dental implant ( in the model and mouth ), which projections are actualized by the attachment of abutment sleeves to the implants . the concave faces of the c - shaped segments are preferably those that are laterally adjacent to and face , and may at least partially surround , the vertical projection of the dental implant . as shown , for example , by fig8 - 13 a single concavity - presenting abutment surrounding segment of a framework compound may face and at least partially surround more than one abutment sleeve at a time . the concavity - presenting abutment surrounding segments , such as c - shaped abutment - surrounding segments , of any of the embodiments may include one or more protrusions extending radially inward from the bounding surface of the concavity . the invention also provides hybrid passively fitting frameworks that include or consist essentially or consist of : an elongated passively fitting framework component according to any one of embodiments or variations thereof described herein ; a secondary abutment sleeve disposed at least partially in and / or facing the concavity of each c - shaped abutment - surrounding segment ; and a hardened resin joining each secondary abutment sleeve to the c - shaped abutment - surrounding segment defining the concavity in which the secondary abutment sleeve is at least partially disposed ( and / or faces generally ). at least some , such as at least one or all , of the secondary abutment sleeves may be externally ribbed . non - ribbed secondary abutment sleeves may also be used . the secondary abutment sleeves may be metallic such as titanium or titanium alloy . the invention further provides dental restorations for detachable , fixed attachment to osseo - integrated dental implants that include or consist essentially of or consist of : a hybrid passively fitting framework as and any variations thereof as described herein ; and a tooth set - up attached to the hybrid passively fitting framework . in any of the aforementioned method embodiments , the hardening resin may be a light - curable resin and the joining step may then further include illuminating the resin with a light source to cure the resin . the methods of forming a hybrid framework may also optionally include a further step of : after joining the c - shaped abutment - surrounding segment to the at least partially surrounded secondary abutment sleeves with the hardening resin , welding at least one of the secondary abutment sleeves to the metallic framework component using a metallic spanning member . more particularly , the spanning member may be welded at one end to the secondary abutment sleeve and at the other end to the adjacent c - shaped abutment - surrounding segment . in each of the method embodiments described , there may also be more than two dental implants , for example , 3 , 4 , 5 , 6 , 7 , or 8 , for which the framework is being prepared . in this case , as described herein , an abutment sleeve is reversibly attached to each of the dental implants , or to each one other than the first terminal dental implant , and an elongate framework component is provided that has a c - shaped abutment - surrounding member corresponding to each of the implant - attached abutment sleeves , the framework component being sized and configured so that when the screw attachment portion is reversibly attached to the first terminal dental implant , each of the c - shaped abutment - surrounding members at least partially surrounds ( or faces , generally ) the corresponding implant - attached abutment sleeve . each of the c - shaped abutment - surrounding members can then be joined to the adjacent abutment sleeve using resin as described and , thereafter , optionally welded as described . while the above embodiments and variations thereof have been exemplified with c - shaped concavity - presenting abutment - surrounding segments , which term is intended to be construed broadly with respect to shape and is inclusive of u - shaped and crescent - shaped , the invention also provides corresponding embodiments and variations thereof in which , more generally , lateral surface - presenting abutment - facing segments may be used such as , but not limited to , lateral concavity - presenting abutment - surrounding segments , such as but not limited to c - shaped and v - shaped abutment - surrounding segments . any combination may be used according the invention . furthermore , as shown throughout the figures , the segments of the framework component to which the abutments are joined using resin are not closed , i . e ., are not closed rings which fully bound an aperture into which an abutment sleeve is disposed . like the embodiments shown in the figures , the invention provides framework component embodiments in which none of the lateral surface - presenting abutment - facing segments present fully bounded apertures for surrounding an abutment sleeve . the invention also provides framework component embodiments in which at least one , at least two , at least two sequentially adjacent , at least three , at least some , or all of the lateral surface - presenting abutment - facing segments are laterally open ( such as c - shaped or v - shaped ) rather than closed in the manner of a fully bounded aperture sized to surround an abutment sleeve . each of the patent applications , patents and other publications cited in this disclosure is incorporated by reference as if fully set forth herein . although the invention has been described in connection with specific preferred embodiments , it should be understood that the invention as claimed should not be unduly limited to these specific embodiments .
| 0 |
all patients were diagnosed according to dsm - iv criteria by at least two senior psychiatrists . inclusion criteria were normal results of physical examination , electrocardiogram , and laboratory tests for renal , hepatic , hematologic , and thyroid function . after complete description of the study to the subjects , written informed consent was obtained for a 20 - 60 ml blood donation . in all cases blood was drawn between 8 : 00 - 10 : 00 a . m . the hamilton depression inventory was administered before blood donation . the study was approved by the institutional review board . the group of 36 untreated patients with major depression consisted of 27 ( 14 female and 13 male ) patients ( average age 41 . 9 , sd = 12 . 3 , range 19 - 71 ) with hamilton score ≧ 21 , who were found to meet the inclusion criterion of ham - d ≧ 21 and 9 untreated patients with hamilton score 10 - 20 , whose beta - arrestin measures were included only in the correlation between beta - arrestin levels and ham - d . patients were examined before the initiation of treatment . the healthy volunteer group consisted of 32 subjects ( 18 female and 15 male ), average age 39 . 2 ( sd = 12 . 6 , range 20 - 75 ) years , from the staff and staff &# 39 ; s families of ben gurion university . a group of 14 untreated patients with major depression consisting of 9 female and 5 male patients ( average age 36 . 6 , sd = 15 . 3 , range 18 - 58 ) with hamilton score ≧ 18 , were examined for both beta - arrestin1 protein and mrna levels , before the initiation of treatment and at one , two and four weeks after initiation of treatment . patients were blindly assigned in advance to receive either the ssri : citalopram or the snri : venlafaxine . half of the patients ( 7 patients ) received citalopram 20 - 40 mg / d , while the other half of the patients ( 7 patients ) received venlafaxine 150 - 225 mg / d . the healthy volunteer group consisted of 14 subjects ( 9 female and 5 male ), average age 37 . 1 ( sd = 12 . 6 , range 19 - 57 ) years , from the students and staff of ben gurion university . male rats ( sprague - dawley , 250 g ) were chronically treated for 21 days by intragastrical treatment with either imipramine , desipramine or fluvoxamine , 10 mg / kg , twice daily . control rats were intragastrically treated with either distilled water or 10 % ethanol , used as vehicle for imipramine / desipramine or fluvoxamine , respectively . no significant differences were found between the two groups of control animals . on the 22 nd day , rats were decapitated , blood collected and brain regions immediately dissected . tissue homogenization was carried out in a glass - teflon homogenizer with ice - cold buffer containing 20 mm tris . cl ph 7 . 4 , 2 mm edta , 1 mm dtt and antiprotease cocktail ( sigma ). after initial centrifugation at 800 g for 5 min , the supernatant was collected and further centrifuged at 48 , 000 g for 30 min using a beckman ti80 rotor . the resulting supernatant and pellet were separated : the supernatant fraction was collected and centrifuged at 120 , 000 g for 45 min and the supernatant obtained was used for all measurements ; the pellet was resuspended in the homogenization buffer and the pellet fraction obtained was used for all measurements . serum was prepared from blood collected at the time of decapitation and kept frozen for measurement of antidepressant levels . imipramine and desipramine levels were measured by fluorescence polarization immunoassay in a tdxflx system ( abbott ). mononuclear leukocytes were isolated from 50 ml heparinized fresh blood of adult donors , using ficoll - paque gradient . cells were homogenized in 25 mm tris - hcl , ph 7 . 4 , 1 mm mg + 2 , 1 mm egta , 1 mm dithiotreitol ( dtt ) and antiprotease cocktail ( 1 : 100 ) ( sigma ). the cytolosic fraction ( supernatant ) was separated from the membrane fraction by centrifugation at 18 , 000 g for 20 min . membranes were suspended in homogenization buffer and both fractions were frozen at − 70 ° until assayed . aliquots were taken for protein concentration determination using the lowry assay . on the day of assay , cytosolic and / or membrane fraction were thawed . 10 μg total protein aliquots were taken for protein separation by sds -( 10 %) polyacrylamide gel electrophoresis . the resulting proteins were transferred to nitrocellulose paper by use of electroblotting apparatus . blots were blocked with 5 % bsa for 1 hr in tbs containing 0 . 1 % tween - 20 ( ttbs ) and incubated overnight with a monoclonal antibody to beta - arrestin1 ( transduction labs , diluted 1 : 250 ). the immune bands were detected by subsequent incubation with anti - mouse igg labeled with horseradishperoxidase using the enhanced chemiluminescence western blot detection system ( amersham ) followed by exposure to kodak x - omat film . the range of linearity of the assay as related to the protein concentration was found between 2 . 5 - 20 μg membrane - protein . peak heights of immunoreactive bands presented as arbitrary absorbance units , were determined with a computer - assisted imaging system for semi - quantitative measurements . 10 μg rat cortical membranes run in each blot as a standard reference . 2 - d isolation of rna and reverse transcriptase polymerase chain reaction ( rt - pcr ): isolation and purification of total rna from mnl was carried with ez - rna kit ( beit haemek , israel ). one - step rt - pcr ( abgene , england ) was performed with oligonucleotide primers selected from the highly conserved nucleotide sequences of beta - actin ( forward primer , 5 ′- ctacmtgagctgc gtgtgg - 3 ′( seq id no : 1 ), reverse primer , 5 ′- cgg tgaggatcttcatga - 3 ′( seq id no : 2 ), amplified product 320 bp ). to assess the specificity , beta - actin rna served as an internal control for cdna normalization . normalized cdnas were subjected to analysis of beta - arrestin1 ( forward primer , 5 ′- cmgcccttgcacctagaag - 3 ′( seq id : 3 ), reverse primer 5 ′- gttcgtgtcttcgtgcttga - 3 ′( seq id no : 4 ), 316 bp ). primers were synthesized by sigma genosys , israel . 1 μg of total rna was used for rt - pcr in 25 μl reaction volume . after a denaturation step for 5 min at 94 ° c ., thermal cycling was performed at 94 ° c . for 20 s , 50 ° c . for 30 s , 72 ° c . for 1 min , with a total number of 30 cycles for both beta - actin and beta - arrestin 1 gene products . after staining with ethidium bromide , amplified dna fragments were separated by gel electrophoresis in 1 % agarose . the relative density of the bands imprinted on the autoradiographic films was measured using a computerized image analysis system . pcr products were sequenced in both directions . rats were treated for three weeks with three types of antidepressants : the non - selective monoamine re - uptake inhibitor imipramine ; the norepinephrine specific re - uptake inhibitor desipramine ; and the serotonin specific re - uptake inhibitor fluvoxamine . beta - arrestin1 levels were measured in three rat brain areas : cortex , hippocampus and striatum . fig1 shows that both cytosolic and membrane beta - arrestin 1 were significantly elevated by all three antidepressants in the cortex and in the hippocampus , while in the striatum no alterations in beta - arrestin 1 levels could be detected . cytosolic and membrane beta - arrestin 1 in rat cortex were significantly elevated under imipramine ( cytosolic beta - arrestin - 1 : 165 . 6 % , sd14 . 3 , t = 5 . 5 , v = 32 , p & lt ; 0 . 001 ; and membrane beta - arrestin 1 : 156 . 8 %, sd26 . 3 , t = 5 . 53 , v = 27 , p & lt ; 0 . 001 , respectively , bonferroni t test for 3 treatment groups in comparison with a single control group ), desipramine ( 163 . 4 % , sd21 . 9 , t = 7 . 27 , v = 32 , p & lt ; 0 . 001 ; and 146 . 2 %, sd18 . 3 , t = 5 . 35 , v = 27 , p & lt ; 0 . 001 , respectively ) and fluvoxamine ( 172 . 8 %, sd15 . 6 , t = 10 . 3 , v = 32 , p & lt ; 0 . 001 ; and 190 . 1 %, sd37 , t = 6 . 89 , v = 27 , p & lt ; 0 . 001 , respectively ) three weeks of treatment . cytosolic and membrane beta - arrestin - 1 in rat hippocampus were significantly elevated under imipramine ( 179 . 2 % , sd 27 . 8 , t = 7 . 89 , v = 32 , p & lt ; 0 . 001 ; and 142 . 6 %, sd10 . 4 , t = 6 . 27 , v = 26 , p & lt ; 0 . 001 , respectively , bonferroni t test for 3 treatment groups in comparison with a single control group ), desipramine ( 151 . 6 %, sd21 . 7 , t = 6 . 29 , v = 32 , p & lt ; 0 . 001 ; and 162 . 9 %, sd27 . 7 , t = 5 . 3 , v = 26 , p & lt ; 0 . 001 , respectively ) and fluvoxamine ( 134 . 7 % , sd22 . 3 , t = 4 . 14 , v = 32 , p & lt ; 0 . 001 ; and 140 . 8 %, sd20 . 8 , t = 4 . 6 , v = 26 , p & lt ; 0 . 001 , respectively ) three weeks of treatment . the dynamics of antidepressant - induced increases in the levels of both cytosolic and membrane beta - arrestin - 1 indicate that the process became significant within 10 days and took 2 - 3 weeks to reach maximal increase ( fig2 & amp ; 3 ). the distinct elevations in the levels of beta - arrestin - 1 induced by antidepressant medications in rat brain areas indicate that alterations in beta - arrestin - 1 levels exist in humans suffering from a depressive episode . as it is known that beta - arrestin - 1 is expressed in mononuclear leukocytes , these cells were chosen for our human experiments . beta - arrestin - 1 levels were evaluated in mononuclear leukocytes obtained from a group of patients diagnosed with major depressive episode , before the initiation of an antidepressant treatment , and compared with a group of healthy volunteers . beta - arrestin - 1 levels in the healthy volunteers group were independent of the age ( pearson &# 39 ; s correlation coefficient =− 0 . 06 , n . s .) ( fig4 ) or gender ( average beta - arrestin - 1 levels for female and male subjects , 101 . 0 % and 99 . 0 %, respectively . us = 135 , ts = 0 . 283 , n . s ., mann - whitney u - test ) ( fig5 ) of the subjects examined . fig6 a shows that the levels of beta - arrestin - 1 were significantly reduced in mnl of patients with major depressive disorder with ratings of ham - d & gt ; 20 ( 37 . 15 %, sd = 15 . 66 %) in comparison with healthy volunteers ( 100 . 0 %, sd = 21 . 91 %). the sensitivity and specificity of the findings for diagnosing major depressive episodes were found to be 92 . 5 % and 93 . 9 %, respectively . including patients with depression with ratings on ham - d of & gt ; 16 ( fig6 b ) still resulted in high sensitivity and specificity values of 92 . 5 % and 90 . 9 %, respectively . the degree of reduction in mnl β - arrestin - 1 levels was found to significantly correlate with the severity of the depressive episode evaluated by the hamilton depression scale ( pearson &# 39 ; s correlation coefficient =− 0 . 661 ) ( fig7 ). similar to our previous findings concerning reduced g proteins levels in mnl of patients with depression the patients evaluated for g protein levels in the present study show significant reductions in both g - alpha - s levels ( 72 . 0 %, sd = 11 . 3 %) and g - alpha - i levels ( 73 . 2 %, sd = 12 . 0 %). cytosolic beta - arrestin - 1 levels correlated well with membrane g protein levels measured in the same mnl preparation of the depressed patients ( fig8 a , b ). for beta - arrestin - 1 versus g - alpha s : pearson &# 39 ; s r = 0 . 635 ; for beta - arrestin - 1 versus g alpha i : pearson &# 39 ; s r = 0 . 751 . beta - arrestin1 protein and mrna levels were evaluated in mnl obtained from a group of patients diagnosed with major depressive episode , before the initiation of an antidepressant treatment , during antidepressant treatment at 1 , 2 and 4 weeks of treatment and compared with a group of healthy volunteers . as shown by bonferroni t tests ( multiple comparisons against a single control group ) in comparison with the age - and gender - matched healthy subjects ( cytoplasmic fraction mnl beta - arrestin1 protein = 100 . 0 %, sd = 6 . 0 %; membrane fraction mnl beta - arrestin1 protein = 100 . 0 %, sd = 8 . 7 %; mnl mrna = 100 . 0 %, sd = 5 . 9 %), patients with depression , while untreated , had statistically significant lower levels of mnl beta - arrestin1 protein ( cytoplasmic beta - arrestin - 1 protein = 45 . 6 %, sd = 20 . 8 %, t = 9 . 275 , df = 65 , p & lt ; 0 . 001 ; membrane beta - arrestin - 1 protein = 37 . 4 %, sd = 26 . 4 %, t = 8 . 085 , df = 65 , p & lt ; 0 . 001 ) and significantly lower levels of mnl beta - arrestin - 1 mrna ( 46 . 9 % sd26 . 7 %, t = 5 . 01 , df = 65 , p & lt ; 0 . 001 ) ( table 5 ) . the extents of reduction in beta arrestin - 1 protein and mrna levels in untreated patients with depression were found to be correlated with the severity of depressive symptoms assessed by hamilton rating scale for depression ( for cytoplasmic beta - arrestin1 protein : pearson &# 39 ; s r =− 0 . 764 , n = 14 , t = 3 . 93 p & lt ; 0 . 005 ; for membrane beta - arrestin1 protein : pearson &# 39 ; s r =− 0 . 795 , n = 14 , t = 4 . 35 p & lt ; 0 . 002 ; for beta - arrestin1 mrna levels : pearson &# 39 ; s r =- 0 . 661 , t = 2 . 92 n = 14 , p & lt ; 0 . 02 ). fig9 shows a prototypical example comparing the dynamics of clinical response of a depressed patient to an antidepressant ( lowering of the ham - d rating ) with the dynamics of normalization of beta - arrestin levels . treatment with antidepressant medications resulted in normalization of beta - arrestin1 protein levels in mnl cytoplasmic and membrane fractions and normalization of beta - arrestin1 mrna levels ( table 5 ). the low beta - arrestin1 protein and mrna levels in mnl of the untreated patients with depression were found to be normalized by 4 weeks of antidepressant treatment in a statistically significant manner , according to paired t tests ( cytoplasmic mnl beta - arrestin1 protein level 91 . 7 %, sd = 21 . 0 %; t = 6 . 956 , df = 13 , p & lt ; 0 . 001 ; membrane mnl beta - arrestin1 protein level 97 . 2 %, sd = 18 . 3 %; t = 9 . 203 , df = 1 3 , p & lt ; 0 . 001 ; mnl beta - arrestin1 mrna level 115 . 8 %, sd = 1 0 . 0 %; t = 4 . 925 , df = 13 , p & lt ; 0 . 001 ). beta - arrestin - 1 measures after 4 weeks of antidepressant treatment were found to be not significantly different from those characterizing the group of healthy subjects , according to bonferroni t test ( for cytoplasmic beta - arrestin - 1 protein : t = 1 . 010 , df = 65 , n . s . ; for membrane beta - arrestin - 1 protein : t = 0 . 135 , df = 65 , n . s .). mnl beta - arrestin1 mrna levels after 4 weeks of antidepressant treatment were found significantly higher in comparison with levels characterizing healthy volunteers ( t = 3 . 15 , df = 65 , p & lt ; 0 . 01 ). repeated beta - arrestin1 measurements after 1 , 2 and 4 weeks of antidepressant treatment conducted alongside with clinical evaluation shows that biochemical normalization of beta - arrestin1 measures preceded clinical response by 1 - 2 weeks . the detailed dynamics of normalization of the measures of beta - arrestin1 protein and mrna levels in mnl of the depressed patients during the course of antidepressant treatment in relation to the dynamics of clinical improvement reveals that the biochemical normalization preceded clinical improvement by 1 - 2 weeks ( fig1 ). the dynamics of biochemical normalization of beta - arrestin1 protein and mrna levels was not found to significantly differ between the ssri - and snri - treated patients ( not shown ). while , after 1 week of antidepressant treatment , no significant change was observed in the severity of the depressive symptoms assessed by hamilton depression scale , beta - arrestin1 measures were significantly elevated . the low beta - arrestin1 protein and mrna levels in mnl of the untreated patients with depression were found to be significantly increased already after one week of antidepressant treatment according to paired t tests ( cytoplasmic mnl beta - arrestin1 protein level 71 . 4 %, sd = 24 . 6 %; t = 3 . 863 , df = 13 , p & lt ; 0 . 002 ; membrane mnl beta - arrestin1 protein level 86 . 6 %, sd = 26 . 0 %; t = 6 . 56 , df = 13 , p & lt ; 0 . 001 ; mnl beta - arrestin1 mrna level 74 . 8 %, sd = 24 . 5 %; t = 2 . 562 , df = 13 , p & lt ; 0 . 05 ). the expression of grk2 was measured in the mnl of 3 patients diagnosed with major depression and compared to 3 healthy subjects . protein preparations and western blotting were carried out as described under methods , using a polyclonal antibody . similarly to the findings in beta - arrestin1 measurements , the immunoreactivity level of grk2 was significantly decreased ( p & lt ; 0 . 05 , mann - whitney test ) in the cytosolic fraction of patients as compared to healthy subjects ( fig1 ). taken together these data support initial evidence for alterations in signal transduction events in depressed patients , and evidence the involvement of grk2 and β - arrestin - 1 in this process . from the above examples , one can see that beta - arrestin - 1 is a biochemical underlying target site for the mechanism of action of antidepressants . the induction by antidepressants of the expression of beta - arrestin - 1 in rat brain present a defined , general and new mechanism of action of various types of antidepressants : serotonin specific ( ssris ) norepinephrine specific ( nsris ) and non - selective reuptake inhibitors . the elevation in beta - arrestin - 1 levels induced by the various types of antidepressants afford a defined and new explanation for their well - known induction of beta - adrenergic and other receptor down - regulation through post - receptor effects . reports concerning antidepressants post - receptor effects on g proteins involve proximal effects on receptor - g protein coupling and distal effects on g protein - second messenger activation . in 1983 it was first reported that long - term administration of various antidepressants facilitated the activation of adenylyl cyclase by gs . these initial findings have been substantiated by later studies . in contrast to the facilitation of g protein - second messenger activation by antidepressants , long - term treatment with these medication was found to decrease beta adrenergic receptor - g protein coupling , as well as 5 - ht1a receptor - g protein coupling . these findings of decreased receptor - g protein coupling are consistent with one of the classic biochemical hallmarks of chronic antidepressant treatment : down - regulation of several types of neurotransmitter receptors in the brain . very recent studies suggest that chronic treatment with antidepressant drugs results in redistribution of gs , which might partially explain reduced receptor - gs coupling as well as elevated gs - adenylyl cyclase coupling . the present findings describing the induction by antidepressants of beta - arrestin - 1 expression offer a new explanation for the mechanism underlying the previously described findings . increased levels of beta - arrestin - 1 ‘ arrest ’ intracellular signaling triggered by g protein coupled transmembrane receptors . arrestin binding to receptors thus results in desensitization of g protein - mediated signaling by preventing interaction of receptors with g proteins . thus proximal antidepressant effects at the level of receptor g protein are expected to show receptor g protein uncoupling due to the increased expression of beta - arrestin - 1 . indeed the “ proximal ” findings on receptor g protein uncoupling support the described above . this receptor g protein uncoupling induced by antidepressants through beta - arrestin - 1 induction may be the cause for redistribution of gs and for the “ distal ” elevated gs adenylyl cyclase coupling also described above . the dynamics of antidepressant - induced increases in the levels of beta - arrestin - 1 in rat brain indicate that the process became significant within 10 days and took 2 - 3 weeks to reach maximal increase . also , our findings show that both cytoplasmic and membrane beta - arrestin1 levels are reduced in mnl of patients with depression , suggesting that the protein is under - expressed in depression . indeed , the reduction in mrna levels in mnl of patients with depression confirms under - expression of beta - arrestin1 protein in mnl of patients with depression . similarly , the effects of antidepressants treatment of elevating both cytoplasmic and membrane beta - arrestin1 protein and mrna levels point to a possible biochemical mechanism of action of antidepressants through increased expression of beta - arrestin1 protein . the time frame of antidepressant induced increase in beta - arrestin - 1 levels correlated well with the time frame of antidepressant induced beta - adrenergic and other receptor down - regulation , as well as with the time frame of the clinical response . these findings lend further support to the clinical relevance of the antidepressant effects on the expression of beta - arrestin - 1 . the dynamics of normalization by antidepressant treatment of the biochemical measures of beta - arrestin1 levels in mnl of patients with depression did not follow , and thus reflect the clinical improvement of the patients , but rather preceded clinical improvement . the biochemical normalization , which was significant after one week , preceded clinical improvement by 1 - 2 weeks . it is very difficult to monitor the extent of specific clinical improvement in the early period of the first and second week after initiation of antidepressant treatment . since clinical response to antidepressant treatments is due both to the specific biochemical antidepressant effects of the medication agent , as well as placebo effects , and since the placebo effect is usually more pronounced during the early period of treatment initiation , it is very difficult to assess in these early days the specific antidepressant effects of antidepressant treatments . beta - arrestin1 measurements in peripheral blood cells of patients with mood disorder , as a state dependent characteristic , may afford biochemical monitoring of antidepressant effects and prediction of clinical response to antidepressant by 1 - 2 weeks in advance . comparing between the findings of reduced beta - arrestin - 1 levels with simultaneous findings of reduced g alpha - s and g alpha - i levels in mnl of patients with depression it is clear that the extend of reduction was found to be more prominent by two to three folds , with respect to beta - arrestin levels . while beta - arrestin - 1 levels were reduced by 62 . 9 %, g alpha - s and g alpha - i protein levels were reduced by 28 % and 27 %, respectively , in unipolar outpatients with depression in the present study . similar extent of reductions of g protein levels were observed by us in previous studies : reductions of g - alpha - s and g - alpha - i by 21 % and 23 %, respectively in unipolar depressed patients ; by 29 % and 39 %, respectively in hospitalised depressed patients before the application of ect in a previous study ; by 28 % and 20 %, respectively in sad outpatients with winter depression and by 21 % and 17 %, respectively for bipolar depressed patients ( table 4 ). thus , it can be concluded that beta - arrestin - 1 measurements in mnl of patients with depression is a better diagnostic assay for detecting depression . indeed the sensitivity and specificity of the beta - arrestin - 1 test were found to be 92 . 5 % and 93 . 9 %, respectively . these values are far greater than the values previously described for the immunoreactive g protein assay : 73 % and 81 %, respectively . from the results documented in the above examples it will be realized that the present invention , inter alia enables and provides for : ( i ) a new target for the mechanism of action of antidepressant drugs acting on beta - arrestin and / or grk2 levels and / or functioning and the ability to design new antidepressant medication through this mechanism of action , using similar techniques of measurements in animal brain and human peripheral models . ( ii ) the use of genetic polymorphism at the beta - arrestin 1 or grk - 2 locci in the pharmacogenetics of molecular predictions of response to treatment in mood disorders . ( iii ) the possibility to diagnose major depressive episode in a yet untreated subject using the beta - arrestin - 1 and / or grk2 assay , which has proven far better sensitivity and specificity than the previous g protein assays . ( iv ) the possibility to monitor and / or predicting treatment response or treatment resistance to antidepressant medications . it will be evident to those skilled in the art that the invention is not limited to the details of the foregoing illustrative examples and that the present invention may be embodied in other specific forms without departing from the essential attributes thereof , and it is therefore desired that the present embodiments and examples be considered in all respects as illustrative and not restrictive , reference being made to the appended claims , rather than to the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein . avissar s , schreiber g : towards molecular diagnostics of mood disorders in psychiatry . trends in molecular medicine . 8 : 294 - 300 , 2002 . schreiber g , avissar s : application of g proteins in the molecular diagnosis of psychiatric disorders . expert rev mol diagn . 3 : 89 - 100 , 2003 .
| 2 |
the alkyl glycoside reaction product of the present invention is obtained by a commonly known method . for example , it may be obtained either by directly reacting a sugar with a higher alcohol in the presence of an acid catalyst , or by preliminarily reacting a sugar with a lower alcohol ( for example , methanol , ethanol , propanol , butanol ) to thereby provide a lower alkyl glycoside , which is then reacted with a higher alcohol . the higher alcohol for use in the process of the present invention is represented by formula ( ii ) wherein r 1 represents a straight or branched alkyl , alkenyl , or alkylphenyl group having from 6 to 22 carbon atoms ; r 2 represents an alkylene group having from 2 to 4 carbon atoms ; and x indicates a mean value and is a number equal to 0 to 5 . specific examples of the higher alcohol represented by formula ( ii ) include a straight or branched alkanol such as hexanol , heptanol , octanol , nonanol , decanol , dodecanol , tridecanol , tetradecanol , pentadecanol , hexadecanol , heptadecanol , octadecanol , methylpentanol , methylhexanol , methylheptanol , methyloctanol , methyldecanol , methylundecanol , methyltridecanol , methylheptadecanol , ethylhexanol , ethyloctanol , ethyldecanol , ethyldodecanol , 2 - heptanol , 2 - nonanol , 2 - undecanol , 2 - tridecanol , 2 - pentadecanol , 2 - heptadecanol , 2 - butyloctanol , 2 - hexyloctanol , 2 - octyloctanol , 2 - hexyldecanol and 2 - octyldecanol ; an alkenol such as hexenol , heptenol , octenol , nonenol , decenol , undecenol , dodecenol , tridecenol , tetradecenol , pentadecenol , hexadecenol , heptadecenol and octadecenol ; and alkylphenols such as octylphenol and nonylphenol . these alcohols or alkylphenols may be used either alone or a mixture of two or more of them . further , an alkylene oxide adduct of these alcohols or alkylphenols can be used . the sugar for use as the starting material for the production of the alkyl glycoside according to the present invention may be selected from monosaccharides , oligosaccharides , and polysaccharides . examples of the monosaccharides include aldoses such as allose , altrose , glucose , mannose , gulose , idose , galactose , talose , ribose , arabinose , xylose , lyxose . examples of the oligosaccharides include maltose , lactose , sucrose and maltotriose . examples of the polysaccharides include hemicellulose , insulin , dextrin , dextran , xylan , starch and hydrolyzed starch . in the present invention , the production of an alkyl glycoside may be conducted with the use of the above - mentioned starting materials under known conditions ( for example , catalyst , temperature ) as disclosed , for example , in jp - b - 47 - 24532 ( the term &# 34 ; jp - b &# 34 ; as used herein means an &# 34 ; examined japanese patent publication &# 34 ;) ( corresponding to u . s . pat . no . 3 , 598 , 865 ), u . s . pat . no . 3 , 839 , 318 , european patent 092355 , jp - a - 59 - 139397 , and jp - a - 58 - 189195 . as the alkyl glycoside to be decolored according to the process of the present invention , those represented by formula ( iii ) are particularly preferable : wherein r 1 is an alkyl , alkenyl , or alkylphenyl group having from 6 to 22 carbon atoms ; r 2 is an alkylene group having from 2 to 4 carbon atoms ; g is a residual group originating from a reducing sugar having 5 or 6 carbon atoms ; x indicates a mean value and is a number equal to 0 to 5 ; and y indicates a mean value and is a number equal to 1 to 10 . in the present invention , the decoloring of the alkyl glycoside with hydrogen peroxide can be efficiently conducted in a system wherein the ph value is maintained within an alkaline region . the amount of the hydrogen peroxide to be used in the decoloring may range from 0 . 05 to 10 % by weight , based on the dry solid alkyl glycoside content , and preferably from 0 . 1 to 5 % by weight . the alkyl glycoside to be decolored is used in the form of an aqueous solution of the alkyl glycoside containing 15 to 75 % by weight , and preferably 35 to 65 % by weight , based on the dry solid alkyl glycoside content . in the process of the present invention , it is preferable to and still more preferably from about 8 . 5 to 12 , from the viewpoints of the color and odor of the alkyl glycoside . the treatment with hydrogen peroxide is accompanied by a decrease in the ph value of the alkyl glycoside aqueous solution . therefore an alkali may be optionally added to the system throughout the treatment to thereby maintain the ph value of the system at about 8 . 5 or above . examples of the alkali to be used for maintaining the ph value at the desired level include alkali metal hydroxides ( for example , sodium hydroxide , potassium hydroxide ) or alkali metal carbonates ( for example , sodium carbonate , potassium carbonate ) and each may be used in the form of either a solid or an aqueous solution . the treatment with hydrogen peroxide in the process of the present invention may be effected by adding a required amount of hydrogen peroxide to the alkyl glycoside aqueous solution followed by stirring or aging for 30 minutes or longer , preferably for one hour or longer . the hydrogen peroxide is usually added in the form of a 3 to 60 % by weight aqueous solution , though the present invention is not restricted thereto . the hydrogen peroxide may be added either at once or by portions . this treatment may generally be conducted at from 5 to 100 ° c ., preferably at from 20 to 80 ° c ., and still more preferably at from 30 to 70 ° c . examples of the metal / hydrogen complex of the formula ( i ) to be used in the present invention include lithium borohydride , sodium borohydride , potassium borohydride , tetramethylammonium borohydride , calcium borohydride and zinc borohydride . among these substances , sodium borohydride is particularly preferable . the metal / hydrogen complex of the formula ( i ) to be used in the present invention may be added to the alkyl glycoside aqueous solution , which has been decolored with hydrogen peroxide , either as such ( i . e ., in the form of a powder ) or in the form of an aqueous solution or an alkaline aqueous solution . the amount of the metal / hydrogen complex to be added generally ranges from 0 . 05 to 2 mole equivalents , and preferably from 0 . 3 to 1 mole equivalent , with respect to the hydrogen peroxide used for the decoloring . this treatment is generally conducted at from 10 to 80 ° c ., and preferably at from 20 to 50 ° c . this treatment is generally conducted for from 0 . 25 to 5 hours , and preferably for from 0 . 5 to 1 hour , at a ph value of from about 7 to 12 , and preferably from about 8 to 10 . the ph value may be adjusted to the desired level by adding an appropriate base ( for example , sodium hydroxide ) prior to the addition of the metal / hydrogen complex . next , the excess metal / hydrogen complex remaining in the system is decomposed with an acid , to thereby complete the treatment . examples of the acid include sulfuric acid and p - toluenesulfonic acid . an acid is slowly added while stirring to the alkyl glycoside aqueous solution containing the excess metal / hydrogen complex so as to maintain the ph value of the system weakly acidic . the decomposition of the metal / hydrogen complex requires approximately 0 . 5 hour . after the completion of the decomposition , the ph value is adjusted to neutral by adding an appropriate base , for example , sodium hydroxide . thus , the hydrogen peroxide remaining in the alkyl glycoside aqueous solution can be completely decomposed and eliminated . the amount of the hydrogen peroxide remaining in the system can be readily determined by , for example , iodometric titration ( eisei shiken chu - kai , editted by pharmaceutical society of japan , p . 192 ( 1973 )). the present invention is characterized by treating an alkyl glycoside aqueous solution , which has been decolored with hydrogen peroxide , with a metal / hydrogen complex of the formula ( i ). this treatment brings about a surprising effect of maintaining the hue and odor of the obtained alkyl glycoside excellent for a prolonged period of time . to further illustrate the present invention , and not by way of limitation , the following examples are described . unless otherwise indicated , all percents are by weight . ( a ) 1140 g ( 72 . 0 mol ) of decyl alcohol , 3240 g ( 18 . 0 mol ) of anhydrous glucose and 96 g ( 0 . 5 mol ) of p - toluene - sulfonic acid monohydrate were heated and stirred in a 30 liter reaction vessel . after heating to 95 ° c ., the pressure in the reaction system was adjusted to 40 mmhg , and then dehydration was initiated . then n 2 was blown into the reaction mixture at a rate of 0 . 3 nm 3 / h so as to efficiently remove the water formed during the reaction . after five hours , it was confirmed that the reaction mixture had turned transparency , namly the solid glucose had been completely consumed . next , the reduced pressure was relieved and the reaction mixture was cooled and neutralized with 20 g of naoh . after filtering the polysaccharides formed as by - products , 4270 g of the alkyl glycoside was separated from 8460 g of the unreacted alcohol by distillation at 130 ° c . under 0 . 4 mmhg . next , some portion of the solid matters was dissolved in water to thereby prepare a 50 % aqueous solution of a dark red color . ( hue : gardner 8 ) ( b ) 400 g of this aqueous solution of the alkyl glycoside was heated to 45 ° c . and 10 g of a 3 % aqueous solution of naoh was added thereto to thereby adjust the ph value to 9 . then 4 g of a 30 % aqueous solution of hydrogen peroxide ( h 2 o 2 ) was added thereto and the mixture was stirred at 45 ° c . for 30 minutes . during this period , the ph value was maintained at 8 . 7 to 9 . 3 by appropriately adding a 3 % aqueous solution of naoh . next , 0 . 67 g of sodium borohydride was added thereto , and the mixture was stirred for 30 minutes at room temperature . then the ph value was adjusted to 5 by adding a 5 % aqueous solution of p - toluenesulfonic acid . after stirring for 30 minutes , the ph value was adjusted to 7 by adding a 3 % aqueous solution of naoh . the amount of the h 2 o 2 remaining in the alkyl glycoside aqueous solution was so small that it could not be determined by iodometric titration . the procedure of example 1 was repeated except that the sodium borohydride was replaced by 1 . 2 g of calcium borohydride , to thereby provide an alkyl glycoside aqueous solution . the procedure of example 1 was repeated except that no sodium borohydride treatment was conducted , to thereby provide an aqueous solution . in this case , 0 . 14 % by weight of h 2 o 2 remained . 400 g of the aqueous solution of alkyl glycoside prepared in example 1 ( a ) was heated to 45 ° c . and 10 g of 3 % aqueous solution of naoh was added thereto to adjust the ph value to 9 . then , 4 g of 30 % aqueous solution of hydrogen peroxide was added thereto and the resulting mixture was stirred at 45 ° c . during this period , the ph value of the reaction mixture was not adjusted further , and the ph values after 10 minutes and 30 minutes were 7 . 8 and 7 . 7 , respectively . next , 0 . 67 g of sodium borohydride was added thereto and the mixture was stirred at room temperature for 30 minutes . after stirring , the ph value of the mixture was adjusted to 5 by adding a 5 % aqueous solution of p - toluenesulfonic acid . after stirring for 30 minutes , the ph value of the mixture was adjusted to 7 by adding a 3 % aqueous solution of naoh . the amount of the hydrogen peroxide remaining in the alkyl glycoside aqueous solution was so small that it could not be determined by iodometric titration . the procedure of example 1 was repeated except that the sodium borohydride was replaced by 0 . 38 g of sodium sulfite , to thereby provide an alkyl glycoside aqueous solution . an alkyl glycoside was decolored according to the process of jp - a - 1 - 290692 . namely , a 50 % aqueous solution of an alkyl glycoside of a dark red color was prepared by the same method as described in example 1 -( a ). 200 g of the alkyl glycoside aqueous solution thus obtained was completely mixed with 4 . 2 g of a 14 n naoh solution containing 12 % by weight of sodium borohydride . the mixture obtained was then allowed to stand at room temperature for 4 days . each of the alkyl glycoside aqueous solutions obtained examples 1 and 2 and comparative examples 1 to 4 was used to an alkyl glycoside content of 30 % by weight . then storage stability of each product was evaluated in air at 50 ° c . for 120 hours . table 1 summarizes the results . in table 1 , a lower gardner value shows the better hue . each odor was evaluated by five panelists , and the one of which most of the panelists have detected are indicated in the table . table 1__________________________________________________________________________chemical treatment for aqueous solution of alkylglycoside quality evaluation of aqueous solutioncondition at metal / of alkylglycosideh . sub . 2 o . sub . 2 treatment hydrogen at the initiation after temperature complex remaining h . sub . 2 o . sub . 2 odor 120 hoursexample no . ph (° c .) (% by wt .) ( gardner ) hue ( gardner ) hue odor__________________________________________________________________________example 1 8 . 7 to 9 45 sodium undetectable 1 no 1 noborohydride example 2 8 . 7 to 9 45 calcium undetectable 1 no 1 noborohydride comparative 8 . 7 to 9 45 not used 0 . 14 1 no 3 aldehyde - example 1 like comparative 9 to 7 45 sodium undetectable 7 no 7 no example 2 borohydride comparative 8 . 7 to 9 45 sodium sulfite undetectable 1 no 6 sulfur - example 3 likecomparative not treated sodium 0 . 00 8 no 8 alkali - example 4 borohydride like__________________________________________________________________________ table 1 indicates that an alkyl glycoside having excellently stabilized hue and odor can be obtained by the process of the present invention . 28260 g of one mole ethylene oxide adduct of diadol 18g ( manufactured by mitsubishi kasei corporation ) ( 90 mol ), 3240 g of anhydrous galactose ( 18 mol ) and 96 g of p - toluenesulfonic acid monohydrate ( 0 . 5 mol ) were heated to 95 ° c . and stirred under 40 mmhg , and dehydration was initiated , while blowing in nitrogen gas at a rate of 0 . 3 nm 3 / h so as to efficiently distill off the water thus formed . after confirming that the reaction mixture had turned transparency , namely the solid galactose had been completely consumed , the reduced pressure was relieved and the reaction mixture was cooled and neutralized with 20 g of naoh . after filtering the polysaccharides formed as by - products , 7880 g of alkyl galactoside was separated from 23600 g of the unreacted alcohol by distillation at 200 ° c . under the pressure of 0 . 3 mmhg . next , some portion of the solid matters was dissolved in water to thereby prepare a 50 % aqueous solution of a dark red color . ( hue : gardner 10 ) the thus obtained solution was decolored by hydrogen peroxide in the same manner as in example 1 ( b ) and then treated with sodium borohydride . an alkyl glycoside solution was obtained in the same manner in example 3 , except that sodium borohydride was not used . the amount of hydrogen peroxide remaining in the alkyl glycoside solution was 0 . 15 % by weight . the procedure of example 3 was repeated to prepare an alkyl glycoside aqueous solution , except that the ph value , which had been adjusted to 9 . 0 at the initiation of the treatment , was not adjusted further . the ph value after 10 minutes and 30 minutes were 7 . 6 and 7 . 5 , respectively . each of the alkyl glycoside aqueous solutions obtained in example 3 and comparative examples 5 and 6 was adjusted to an alkyl glycoside content of 30 % by weight . then , the storage stability of each product was evaluated in air at 50 ° c . for 120 hours . table 2 summarizes the results . table 2______________________________________ at the initiation remaining after 120 hours h . sub . 2 o . sub . 2 hue hue example no . (% by wt .) ( gardner ) odor ( gardner ) odor______________________________________example 3 undetectable 2 no 2 no comparative 0 . 15 2 no 4 aldehyde - example 5 like comparative undetectable 7 no 7 no example 6______________________________________ table 2 indicates that an alkyl glycoside having excellently stabilized hue and odor can be obtained by the process of the present invention . while the invention has been described in detail and with reference to specific examples thereof , it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof .
| 2 |
referring to fig1 and 2 of the drawings , a construction line reel 10 of the invention can be seen having an elongated main body member 11 with oppositely disposed line engagement end surfaces 12 and 13 , each having respective upstanding line retainment guides 12 a , 12 b , 13 a and 13 b thereon . the main body member 11 has spaced parallel side surfaces 14 and 15 with respective interconnecting flat front surface 16 and oppositely disposed co - planar rear surface 17 as best seen in fig2 and 4 of the drawings . the side surface 14 has an offset handle support portion 18 with an enlarged aperture at 19 therein defining a static handle grip for the line reel 10 of the invention . a rotating handle assembly 20 extends from the handle support section 18 at an aligned midway point of the elongated body member 11 . the handle assembly 20 has a handle support rod 21 transversely through the main body member 11 and extending through the corresponding side surface 15 with a threaded rod end 21 a retained by washer and nut combination 21 b thereon . an elongated handle 22 is rotatably secured on the support rod &# 39 ; s free end 21 c so as to extend from the corresponding offset handle support section 18 . it will be seen that the defined orientation of the rotatable handle 22 from the main body member 11 will enable line reel rotation about the handle &# 39 ; s axis aiding in deployment and recovery of line l illustrated graphically in fig2 of the drawings as it is wound and unwound around the line reel respective line engagement end surfaces 12 and 13 as will be understood by those skilled in the art . an end line retention notch 23 is formed in a side support angular transition surface 18 a which will effectively hold the end of the line in place . referring back to the main body member 11 , it will be seen that a pair of enlarged openings 11 a and 11 b therein in elongated spaced aligned orientation to one another between the respective line retaining end surfaces 12 and 13 and between the correspondingly hereinbefore described respective side surfaces 14 and 15 . it will be seen that the pair of enlarged openings 11 a and 11 b in the main body member 11 by their orientation and design define a bracket configuration for retention and storage of the line during use . referring back now to fig2 of the drawings , it will be seen that the transverse midline placement of the rotatable handle assembly 20 between the enlarged openings 11 a and 11 b within the main body member 11 affords ease of use and free rotation and greatly reduces the physical stress on the user , not shown . it additionally be noted that the corresponding orientation and utilization of the rotatable handle assembly 20 and static hand grip opening at 19 reduces the time required to deploy and retrieve large lengths of construction line required for use in the industry . the construction line reel 10 main body member can be formed of a variety of compliant materials by common and well known manufacturing methods including , but not limited to injection plastic resin molding , medal dye cast or dye cut stamping , as required . the hereinbefore described and illustrated construction line reel 10 of the invention can be conveniently and safely utilized therefore to dispense construction cord by a construction worker with minimum attention directed to the process of dispensing the line and maximum attention directed to his or her free and safe support during use . the above described construction line reel 10 of the invention has further advantage in that the construction line can be conveniently wound and rewound with a minimum of tangle and snagging of the construction line . furthermore , the described construction line reel significantly speeds , as noted , the process of rewinding the construction line most significantly by the deployment of the ergonomically designed handle assembly 20 in conjunction with the added speed of rewinding the construction line greatly reduces the physical stress upon the construction worker &# 39 ; s forearm and wrist muscle , not shown , thereby enhancing the safety and physical wellness of the user . it will thus be seen that a new and novel construction line reel has been illustrated and described and it will be apparent to those skilled in the art that various changes and modifications may be made thereto without departing from the spirit of the invention . therefore i claim :
| 1 |
referring more specifically to the pomological details of this new and distinct variety of peach tree , the following has been observed during the growing years 1999 , and 2000 under the ecological conditions prevailing near the town of fowler , county of fresno , state of california . all major color code designations are by reference to the r . h . s . colour chart ( copyright 1995 , third edition ) provided by the royal horticultural society of great britain . size .— generally — average to above average as compared to other common peach cultivars . figure .— the original seedling was trained in a central leader configuration with a moderate spread in the crown of the tree . the tree is considered upright to upright spreading in form . height .— the original seedling had a height dimension of 3 . 99 m at the end of the 1999 growing season . width .— the original seedling tree had a width of 2 . 10 m at the end of the 1999 growing season . current season growth .— the current season growth for the new variety was approximately 0 . 73 - 0 . 88 m . regularity of bearing .— regular , and considered hardy under typical central san joaquin valley conditions . diameter .— approximately 13 . 7 cm in diameter when measured at a distance of approximately 15 . 24 cm above the soil level , at the end of the 2000 growing season . bark texture .— considered moderately rough with numerous folds of papery scarf skin being present . lenticels .— numerous flat , oval lenticels are present . the lenticels range in size from approximately 3 . 0 to 7 . 0 millimeters in width and from approximately 1 to 2 millimeters in height . bark coloration .— variable , but it is generally considered to be a grey - brown ( rhs greyed - orange group 175 b ). diameter .— the branches have a diameter of about 4 . 3 to 5 . 5 cm when measured during the 4 th year after grafting . surface texture .— average , and appearing furrowed on wood which is several years old . crotch angles .— variable between about 41 ° to 48 ° from the horizontal axis for scaffold limbs . this is not distinctive of the variety , however . color of mature branches .— medium brown , rhs greyed orange group ( 174 c to greyed - green group 192 b ). current season shoots .— color — light green , rhs yellow green group ( 144 c ), with some reddish - brown coloration appearing on exposed exterior shoots , ( rhs greyed red group 181 b ). the color of new shoot tips is considered a bright and shiny green , ( rhs green group 143 b ). size .— considered average for the species . leaf measurements have been taken from vigorous upright current season growth at mid - shoot . mid - vein .— color — light yellow green , ( rhs yellow green group 153 b ). leaf margins .— form — considered crenate , occasionally doubly crenate . uniformity — considered generally uniform . leaf petioles .— size — considered medium . length — approximately 6 to 9 millimeters . diameter — approximately 1 . 5 to 2 millimeters . color — pale green , ( rhs yellow green group 144 c ). leaf glands .— size — approximately one to two millimeters in height and two to three millimeters in width . numbers — generally 1 - 2 per side , occasionally two per side . type — reniform . small . color — greenish brown , ( rhs grey brown 199 c ). leaf stipules .— size — medium for the variety . length — approximately 6 to 9 millimeters . form — lanceolate in form with a serrated margin . color — green , ( rhs yellow - green 148a ) when young but graduating to yellow - brown ( rhs greyed - orange group n167a ) with advancing senescence . the stipules are considered to be early deciduous . number — typically 2 stipules per leaf bud and up to 6 per shoot tip are observed . flower buds .— generally — the floral buds are considered to be small in size , plump to slightly pointed in form , and slightly appressed , relative to the bearing shoot . flower buds .— color — the bud scales are gray - brown , ( approximately rhs greyed orange group 177 b ). the buds are considered hardy under typical central san joaquin valley climatic conditions . blooming type .— considered average in relation to other peach cultivars commonly growing in the central san joaquin valley . date of full bloom was mar . 8 , 1998 . flower type .— the variety is considered to be a showy type flower . flower size .— flower diameter at full bloom is approximately 32 to 37 millimeters . flower bud frequency .— normally 1 to 2 buds appear per node , although 1 bud per node is more common . petal size .— generally — considered medium large for the species . length — approximately 15 to 17 millimeters . width — approximately 12 to 15 millimeters . petal color .— light pink when young , ( approximately rhs red purple group 68 b ), and with advancing senescence to a very pale pink , ( rhs red purple group 68 d ). the lower portion of the flower petal is rhs red - purple 167d . petal claw .— form — the claw is considered truncate in shape and has small size when compared to other similar varieties . length — approximately 1 . 5 to 2 millimeters . width — approximately 1 millimeter . petal margins .— generally — considered variable , from nearly smooth , to moderately undulate . flower pedicel .— length — considered medium - short , and having an average length of approximately 2 . 0 to 3 . 0 millimeters . diameter — considered average , approximately 2 millimeters . color — bright green , ( rhs yellow green group 144 d ). floral nectaries .— color — dull , orange , and occasionally orange - gold , ( approximately rhs greyed orange group 168 b ). the color of the nectaries become more dull and slightly darker with advancing senescence . calyx .— surface texture — generally glabrous , with slight ribbing . color — a dull red , ( approximately rhs greyed purple group 184 a ). sepals .— surface texture — the surface has a medium length , wooly , and gray colored pubescence ( rhs greyed - purple group 183a ). size — average , and ovate in form . color — a dull red , ( approximately rhs greyed red group 178 a ). number — generally 5 per flower . typically 5 . 0 millimeters wide and 6 . 0 millimeters in length . anthers . — generally — average in size . approximately 14 . 0 millimeters in width , and 1 . 0 millimeters in length . color — red to reddish - orange dorsally , ( approximately rhs greyed purple group 187 d ). pollen production — pollen is abundant , and has a yellow - gold color , ( approximately rhs orange 26 a ). filaments .— size — variable in length , approximately 14 to 16 millimeters . color — rhs red purple group 69 d . pistil .— generally — average in size . length — approximately 15 to 17 millimeters , including the ovary . color — considered a very pale green , at mid - bloom , ( approximately rhs yellow green group 151 d ). surface texture — the variety has a long , pale green to white pubescent pistil . fruit : maturity when described : the present variety of fruit is described , as it would be found in its firm ripe condition at full commercial maturity . in this regard , the fruit of the present variety was first picked on approximately aug . 30 , 1998 . the date of last pick of the same fruit in 1998 was approximately sep . 7 , 1998 under the ecological conditions prevailing in the san joaquin valley of central california . fruit form .— generally — globose in its lateral aspect . the fruit is generally uniform in symmetry with a rounded and somewhat oblate form when viewed from the apical aspect . fruit suture .— generally — the suture appears as a thin line and slightly depressed , and which extends from the base to the apex , and appears slightly deeper , basally , within the stem well , and apically on both sides of the pistil point . no apparent callousing or stitching exists along the suture line . suture .— color — the suture normally is the same color as the underlying blush , both where the orange - yellow background , ( rhs orange group n25 d ) and the red orange color , ( rhs greyed red group 179 a to 179 b ) occur . stem cavity .— size — considered moderate for the species . width — approximately 19 - 21 millimeters . length — approximately 27 - 30 millimeters . depth — approximately 10 to 11 millimeters . form — considered narrowly oval . fruit apex .— generally — considered depressed and usually recessed below the height of the apical shoulders . fruit stem .— generally — considered medium in length , approximately 9 to 10 millimeters . diameter — approximately 3 to 4 millimeters . color — generally a pale yellow - green , ( approximately rhs yellow green group 145 b ). fruit skin .— generally — considered medium or average in thickness . surface texture — the variety has a short fine pubescent surface . skin acidity — considered neutral . skin color .— generally — variable , with approximately 70 % to 80 % of the fruit surface covered with a deep crimson red blush . blush color .— the blush color is generally more prevalent apically . this red blush color ranges from a dark red , ( rhs greyed red group 179 a and b , to rhs red group 45 b ), with many degrees of shading and blending between these colorations . skin ground color .— this is generally present in variable percentages covering approximately 20 % to 30 % of the fruit &# 39 ; s surface , and which is a yellow - golden , ( rhs yellow orange group 22 a to 28 b ). flesh color .— generally — considered variable , from a yellow / orange , ( rhs yellow orange group 20 b to 22 c ), occasionally areas of red radiate into the flesh from the pit area . this reddish color in the flesh ranges from ( rhs red group 46 a to yellow - orange group 22 b and 22c ). flesh fibers .— generally — present , numerous , fine and lightly colored . these fibers are present throughout the flesh . stone cavity .— color — pink red , ( from approximately rhs red group 52 a and red group 46 a , to a yellow orange , approximately rhs yellow orange group 18 b ). flesh texture .— generally — the flesh is considered firm and fine at commercial maturity . considered firm melting . flavor .— considered sweet and having moderate acidity . the flavor is considered both pleasant and balanced . eating quality .— generally — considered good and well above average when compared to older common varieties . attachment .— generally — the stone is considered a freestone with a little air space at the cavity margin . fibers .— generally — a few medium length fibers are attached along the entire surface of the stone . stone form .— generally — the stone is considered rounded to slightly oval . base angle .— the base angle of the stone is variable , but generally is considered oblique to the stone axis . hilum .— generally — considered medium in size , and moderately defined . the hilum is approximately 5 to 7 millimeters long and approximately 3 to 4 millimeters wide . form — considered oval . apex .— shape — the stone apex is raised and has an acute tip . stone shape .— considered variable . the stone is normally equal although occasionally may appear nearly unequal . stone surface .— surface texture — generally considered medium in roughness and exhibits substantial pitting laterally . substantial grooving is apparent over the apical shoulders . surface pitting is prominent generally . ridges — numerous fine ridges are present basally and converge towards the base of the stone . ventral edge .— width — considered medium and prominent , and having a dimension of approximately 4 to 6 millimeters at mid - suture with the wings being most prominent over the basal area . dorsal edge .— full , heavily grooved with jagged edges . dorsal edge moderately eroded over the apical shoulder . kernel .— kernel is mature when the fruit is ripe . form — oval . length — approximately 20 . 0 millimeters . width — approximately 16 . 0 millimeters . thickness — approximately 5 . 0 millimeters . pellicle — considered pubescent . color — rhs greyed - orange group 166 c . stone color .— the color of the dry stone is approximately a light to medium brown , ( rhs orange red group 34 c ). use .— the subject variety ‘ burpeacheight ’ is considered to be a peach of mid - season maturity , having a very firm flesh , highly attractive color and which is useful for both local , long diatance , and export shipping . keeping quality .— fruit has appeared to store well for as long as 18 days after harvest at temperatures of about 1 . 0 ° c . although this new variety of peach tree possesses the described characteristics noted above , as a result of the growing conditions prevailing in the central part of the san joaquin valley of central california , it is to be understood that variations of the usual magnitude and characteristics incident to changes in growing conditions , fertilization , pruning and pest control are to be expected .
| 0 |
as shown in fig1 - 3 , each lift element 1 comprises a base plate 3 of originally square cross - section . at two opposite corners , perpendicular to a base plate surface 2 , two guide arms 4 protrude therefrom . the guide arms 4 , as shown , are substantially prismatic . they are preferably integral with the base plate 3 so that their outer edges are defined by an extension of diagonally opposite corner portions of the base plate 3 . each of the two guide arms 4 has a guide surface 8 extending normal to the base plate surface 2 and parallel to the diagonal of the base plate connecting the corners thereof not extended to form the guide arms 4 . at these corners the edges of the base plate 3 are cut parallel to the diagonal which connects the two guide arm corners to form guide surfaces 6 . the length and spacing apart of the guide surfaces 6 correspond to the width and distance apart of the guide arm surfaces 8 . the base plate 3 has a base plate bore 10 , preferably centrally located , which may be plugged at one or both base plate surfaces 2 and 16 by an easily displaced plug ( not shown ). in each of the guide arms 4 a continuous bore 12 extends normal to planes 2 and 16 . a bore 14 in the base plate 3 intersects both the base plate bore 10 and the bore 12 in one of the guide arms . this bore 14 may be drilled or otherwise formed inwardly from the corner edge of the base plate , and may then be plugged at its outer end . the base plate surface 2 preferably is formed with a concentric circular groove 18 , whose inner edge is rounded . the lift elements 1 are advantageously made of plastic ; and the plugs which close the ends of the bore 10 can be removed or displaced when necessary . fig4 shows convenient form of bladder 20 . it consists of two superimposed circular sheets or films , preferably of plastic , which are sealed together at their edges , for example by heat sealing . thus an edge zone 22 is formed . the inside diameter of the edge zone 22 is somewhat larger than the inside diameter of the circular groove 18 in the base plate 3 . thereby the bladder 20 is protected from fold damages at its marginal areas , as these marginal areas , as shown for example in fig7 can be received in the open circular grooves 18 of the base plate 3 . one of the circular films forming the bladder has an opening 24 which is preferably centrally located . fig5 and 6 show how in principle a pair of lift elements 1 are mated together as a force - lift unit with a bladder 20 . the two lift elements 1 are interengaged with their respective surfaces 2 toward each other , and they are rotated by 90 ° relative to each other so that the guide surfaces 8 of the guide arms 4 of one lift element 1 engage with the guide surfaces 6 at the edges of the base plate 3 of the other element 1 . thereby the two elements 1 are movable toward and away from each other but are guided in such motion ay the guide arms 4 and guide surfaces 6 . between the two base plate surfaces 2 a bladder 20 is inserted . the area around the central bladder opening 24 is sealed , for example by a bilaterally adhesive washer or by an adhesive applied directly , to the base plate surface 2 of the adjacent lift element 1 in such a way that the central opening 24 communicates with the bore 10 of the lift element . alternatively the bladder may be formed with a nipple which sealingly engages in the bore 10 . however the connection is made , a fluid under pressure , such as compressed air , may flow into the bladder 24 through the bores 12 and 14 and the bore 10 , as indicated by the arrows in fig5 . the opening of the bore 12 not needed for introducing compressed air is closed with a plug 26 . similar plugs may close the ends of the other bores , and such plugs may be punched out whenever and wherever it is necessary to open the bores to the exterior . as the bladder 12 is inflated , the upper lift element 1 rises from the lower . the force exerted depends on the pressure of the medium and on the pneumatically active surface area of the bladder 20 . if the compressed air supply is released , the bladder 20 collapses and the lift elements may move back toward each other . due to the dimensions of the bladder 20 and of the circular grooves 18 , not all air necessarily escapes from the bladder 20 as it collapses . an annular portion of the bladder 20 may remain distended in the groove 18 . thus the inner edge of the bladder edge zone 22 , which is usually subject to alternating stress , is protected from excessive loading . some combinations of pairs of lift elements and their specific effects are described below . in fig7 three groups each of two lift units , are arranged one above the other . the lowermost supports on its guide arms 4 the underside 16 of the base plate of the lower element of the unit next above ; and this in turn supports on its guide arms 4 the underside 16 of the lower element uppermost of the three units . the mutually aligned bores 12 are connected fluid - tight by sealing sleeves 36 inserted in the bores 12 where the lift elements adjoin . instead of being inserted into the bores 12 , the connecting sleeves 36 may comprise collars or nipples arranged to connect the bores 12 of two abutted lift elements 1 tightly with one another . the lowermost of the elements 1 supports on the upper side 2 of its base plate a bladder 20 , which in turn supports the base plate 3 of a lift element which is rotated in relation to the lowermost by 90 ° and is mated therewith as shown in fig5 and 6 . the same arrangement of a bladder 20 and of a lift element 1 rotated by 90 ° is repeated in each of the second and third of the superimposed free lift units , with the downwardly directed guide arms 4 of these elements bearing respectively on the upwardly facing surface 1 of the corresponding lift element next below . the bores 10 of three elements 1 are open at the base plate top surface 2 and are adhesively sealed to the area around the central openings 24 of the bladders 20 . the triad of lift elements 1 with their guide arms 4 directed upwardly is assembled so that one aligned set of bores 12 is connected by the channels 14 with the bores 10 . the uppermost of such set of bores is closed by a seal plug 50 . through the lower opening of this aligned set of bores , a pressure medium such as compressed air is delivered through the channels 12 and 14 and through the base plate bores 10 into the bladders 20 , as indicated by the arrows . a nipple ( not shown ) at the base plate surface 16 may provide for connecting the pressure source to the channel 12 . the three lift elements 1 overlying the bladders 20 form one movement group . by admitting the pressure medium , this movement group , ( having downwardly pointing guide arms 4 ) is lifted with a force which is equivalent to three times the force which one bladder would effect at equal pressure of the medium . when external forces act on one of the movement groups , it is readily possible , when necessary , to connect such group together by bolts ( not shown ) which pass through the aligned bores 12 . such bolts fit loosely enough in the bores so that a free passage remains between the walls of the bores 12 and the bolts to allow the pressure medium to flow to the bladders . by coupling a relatively large number of elements 1 and bladders 20 in this manner to form larger movement groups , it becomes possible to create very large resultant lift forces , without altering the size or active surface area of the lift elements or increasing the medium pressure . the total force is then essentially proportional to the product of the number of working bladders and the force of a single bladder . in fig8 a first bladder 200 is inserted between two lower lift elements 100 which are mated by being directed against each other and rotated by 90 degrees . the upper of this pair of lift elements 100 carries on its side 116 the corresponding side 116 of another element . between the upper side 102 of the last named element 100 and the corresponding side 102 of another element 100 ( again rotated by 90 °), is a second bladder 200 . this fourth lift element 100 carries in turn on its side 116 the underside 116 of a fifth element 100 , between whose upper side 102 and the corresponding side 102 of a sixth element 100 a third bladder 200 is located . the first and second , the third and fourth , and the fifth and sixth lift elements , respectively in this assembly each form a lift group so that in the structures of fig8 three lift groups exist . the base plate bore 110 of the lower most element 100 is open at the base plate surface 102 and , as has been described , is sealingly connected with the central aperture 240 of the lowermost bladder 200 . the normally unperforated upper side of this bladder 200 is , in this combination , provided with a second central opening 240 which is sealingly connected with the bore 110 of the second lift element 100 . the bores 110 of the second and third from the bottom of the elements 100 are tightly connected by a sealing sleeve 35 . the bore 110 of the third element 100 opens through the corresponding central aperture 240 of the second bladder 200 into the latter . this second bladder 200 , like the first , is perforated on both sides . its second central aperture 240 is sealingly connected with the central bore 110 of the fourth lift element 100 , which is connected by a sealing sleeve 35 with the central bore 110 of the fifth lift element 100 . this bore 110 of the fifth lift element 100 opens by a central aperture 240 into an unilaterally perforated upper bladder 200 . the entire arrangement is fed with a pressure medium , e . g compressed air , as indicated by the arrows in fig8 through the bore 12 of the lowermost lift element 100 , which is connected with bore 110 by a channel 14 . as the second , third , fourth and fifth lift elements 100 have no channels 14 , the pressure medium flows into them through the bladders 200 connected in series . for this application it is advantageous to use lift elements which ( except for the lowermost no channels 14 , but if such channels 14 are present in all the lift elements , the intersecting bores 12 must be tightly closed to the outside with plugs . as the three lift groups are axially displaceable relatively to each other , there acts on each the force which is caused by a single bladder 200 . but the lift distance traversed by the uppermost element 1 is three times the lift distance which a single bladder 200 would cause at the same medium pressure . in fig9 the lowermost and uppermost lift elements 1 are set up with their guide arms 4 facing and abutting one another . in the space between them two additional lift elements 1 which are rotated 90 degrees into mated relation with the upper and lower elements , respectively , and are disposed with their sides 16 abutting one another . the two outer lift elements 1 are clamped together by bolts 48 which pass through the aligned bores 12 of the lift element guide arms 4 . the bolt dimensions are such that a free passage remains between the walls of bores 12 and the bolts 48 . the bores 12 are sealed at their ends by packing washers 49 . between the two inner lift elements 1 and the outer lift elements with which they are mated are two bladders 20 . the upper bladder is fed through the bore 10 , which opens into it through the upper lift element base plate surface 2 . the lower bladder 20 is fed similarly by the base plate bore 10 of the lowermost lift element 1 . the outer lift elements 1 are stacked so that the channel 14 of each opens into a different aligned pair of bores 12 ; for example the channel 14 of the lowermost element opens into the left bore 12 , and that of the upper lift element 1 opens into the right bore 12 . in this arrangement the two inner lift elements must move together , either up or down depending on which of the two bladders 20 is being charged with a pressure medium . in other words , this is a positive acting controlled reset . the line bores 12 can be charged with pressure medium through feed apertures 60 in the guide arms 4 . generally the distance through which the lifts may operate depends to a large extent on the dimensions of the guide arms 4 with respect to the thickness of the base plate 3 ; but it is readily possible to vary the lift ranges , and the space into which the lift elements may be fitted , by adding spacer pieces either to the guide arms or to the base plate top surface 2 . depending on their use , these spacer pieces ( not shown ) may be provided with bores to extend the length of the bores 12 or of the bores 10 . in liftadding assemblies as described for example with reference to fig8 additional lateral guiding means may be provided when a considerable number of lift element pairs are combined . the lift elements may alternatively have other cross - section forms than shown ( for example , they may be of circular form ), and they may be provided with more than two ( e . g . three ) guide arms each . the square cross - section form of the base plate , however , is advantageous . fig1 shows in axial section a modified form of lift unit , with fractions of the adjacent lift units assembled with it being also shown . in this modification one lift element 62 comprises a divided base plate 64 having an inner part 65 and an outer part 66 . the interface between the two parts 65 and 66 is indicated at 67 . axial bores 68 are provided in the guide arms , as well as channels 70 of rectangular cross - section which are connected at tone end with the bore or bores 68 and at the other end with a base plate bore 72 . the successive lift elements of like function are interconnected rigidly by sleeves 74 sealingly connecting the respective bores 68 of the elements 62 . secured to one of the lift elements 62 is a roll membrane 76 which is fixed in place by means of a bead 77 and a holding sleeve 79 . the cooperating lift element 62 comprises a base plate 81 which carries a piston 83 resting on the membrane 76 in the manner shown in fig1 . between the membrane 76 and the rigid inner part 65 is a bladder space 85 which is connected with a pressure medium source through the base plate bore 72 , the rectangular channel 70 and the bores 68 . when a pressure medium is delivered into the bladder space 85 the piston 83 with the base plate 81 and the remainder ( not shown ) of the lift element associated with it is raised . the maximum lift of this element in the assembly shown , is indicated at 87 . this design offers the advantage that it can be used for relatively large , single stage lifts . the formation of the channels 70 , when the parts are made by plastic injection molding , is extremely simple . the inner part 65 may in such case be joined to the outer part 66 at the interface 67 by gluing . the herein described force - lift unit has the advantage that various combinations of possibilities can be assembled readily , e . g . combinations of force and lift multipliers . reset of the assembly can be effected by springs or by hydraulic or pneumatic bellows or bladders . the same units can be easily assembled for force and / or lift addition . in consequence of the provision of internal connecting lines such as the axial bores 12 and the base plate bores 10 , it is possible to make assemblies with a minimum of external connecting means such as rubber tubes . the pressure forces of the bladder 20 , which act on the corresponding lift elements , ensures that the seal connection of the bladder to the base plate by a bilaterally adhesive ring actually is improved with increasing pressure . as the lift elements can be made of plastic , the cost of manufacture and of stockkeeping is minimal , compared with conventional constructions designed for similar purposes .
| 5 |
the identification plates illustrated in fig1 to 4 have different antenna and coupling variants . the identification plate according to fig1 shows a chip module 10 and an antenna module 12 . the chip module 10 comprises a chip 14 and a coupling loop 16 connected to the chip 14 . the antenna module 12 comprises an antenna lead 18 inductively coupled to the coupling loop 16 . the chip module 10 made of the chip 14 and the coupling loop 16 , as well as the antenna module 12 with the antenna lead 18 , are situated on a support platform 20 , wherein the latter is a plastic film in this case . the antenna lead 18 is an insulated wire attached mechanically to the support platform 20 by means of a laying technique using heat and pressure . the antenna lead 18 is structured in the form of a loop having the shape of a rectangle . a loop 24 is constructed on an arm 22 of the antenna lead 18 , wherein the arm is adjacent to the chip module 10 , and the loop 24 produces a close coupling of the antenna loop to the coupling loop 16 of the chip module 10 . two arms 26 , 28 of the antenna lead 18 , the arms lying opposite each other and completing the arm 22 at right angles thereto , are designed with a curved shape . the curved shape produces an electrical extension of a mechanically truncated antenna . on an arm 30 of the antenna loop which lies opposite the arm 22 and the chip module 10 , end regions 32 , 34 of the antenna lead 18 are positioned parallel , overlapping , and at a small distance to each other , but are not electrically connected . the identification plate illustrated in fig2 differs from that shown in fig1 in the design of its antenna module 36 . the antenna module 36 comprises an antenna lead 38 which is arranged and attached on a support platform 20 by means of a laying technique , wherein the support platform 20 comprises a plastic film . the antenna lead 38 has multiple windings , wherein the ends 42 , 44 thereof are routed to a chip 46 for the hf range , and the ends 42 , 44 are welded to the terminals of the chip 46 . the windings of the loop formed by the antenna lead 38 likewise have a rectangular structure . on the side which lies opposite the chip 46 , regions of the windings are routed as a loop 48 . similarly to fig1 , the chip module 10 is positioned and attached to the support platform 20 in such a manner that the coupling loop 16 is enclosed by the loop 48 . the multiple windings of the antenna lead 38 behave like a single - winding antenna for the chip module 10 in the uhf range due to the capacitive connection , similarly to the illustration in fig1 in the illustration in fig3 , an antenna module 50 comprises a circuit path which functions as the antenna lead 52 and which is produced by means of an etching technique . the circuit path is produced on a support platform 54 comprised of a printed circuit board . the antenna lead 52 forms a closed antenna loop . a loop 58 is formed on an arm 56 of the antenna lead 52 , wherein the arm is adjacent to the chip module 10 . this loop 58 provides a close coupling of the antenna loop to the coupling loop 16 of the chip module 10 . the coupling is realized inductively via a magnetic coupling field . the illustration in fig4 differs from fig3 in the manner of the coupling . the antenna lead 52 forms an open antenna loop . instead of an inductive coupling , as in fig1 to 3 , a capacitive coupling is included which works via an electrical coupling field . a coupling element 60 comprises two vanes 17 connected to the chip 14 . these vanes 17 are situated opposite interrupted segments of an antenna lead 52 of an antenna module 50 , and run parallel to the same . all of the illustrations in fig1 to 4 have in common that a field 62 is present , the same being drawn with a dashed line and bounding the coupling element 60 . this field 62 illustrates a region in which the damping of the coupling loop 16 and / or the coupling element 60 takes effect as a result of the insertion of a damping element . fig5 a to 5 c show an identification plate according to fig1 , having a damping element 64 in various positions above a field 62 . the damping element 64 comprises an electrically conductive surface which is oriented parallel to the support platform 20 , 54 . the damping element 64 can be displaced relative to the field 62 and parallel to the support platform 20 , 54 . the adjustment between the chip 14 and the antenna lead 18 , 38 , 52 is altered by means of a different width of shielding of the field 62 with the coupling loop 16 and / or the coupling element 60 , the former and the latter being situated in the field 62 . this adjustment becomes worse as the shielding of the field 62 increases , leading to a damping of the identification plate and a reduction in the reading range . three different damping positions are illustrated in fig5 a to 5 c . fig5 a shows a minimal shielding and therefore a minimal damping . fig5 b shows a moderate shielding and therefore a moderate damping . fig5 c shows a strong shielding and therefore a strong damping . with no damping element 64 , no damping effect exists . the damping element 64 in this case can be a sticker which can be adhered on the respective marked positions . this configuration is relevant for both an identification plate which can be removed from a guide or from a support holder , and also an identification plate in the form of a sticker which can be fixed to a windshield . fig6 shows a support platform of one of the previous embodiments of an identification plate , having different position marks 66 , 68 , 70 . numbers are displayed at the position marks 66 , 68 70 , and display the degree of reduction of the maximum reading range when the damping element 64 is positioned accordingly . in practice , the position marks are determined by undertaking reading range measurements at the levels associated with each of the marks , and determining the positions of the damping elements at each mark . fig7 shows a support holder 72 for a support platform 20 , 54 with an identification plate , as is used in practice in a motor vehicle . a damping element 64 which can be moved is situated on the support holder 72 . a spring - loaded latch 74 is arranged on the damping element 64 and can snap into place in one of the locking grooves 76 in the support holder 72 according to the position thereof relative to the support holder 72 . when a support platform 20 , 54 with an identification plate is inserted into a support holder 72 , the coupling loop 16 and / or the coupling element 60 is then automatically shielded to the degree necessary , thereby achieving the desired damping . the identification plate has its full range when outside of the support holder 72 . fig8 shows a supplementary card 78 with a damping element 64 . this supplementary card 78 is inserted into a support holder 72 together with a support platform 20 , 54 having an identification plate . a region of the coupling loop 16 and / or the coupling element 60 is then likewise shielded , and the desired damping thereby realized . three supplementary cards 78 are available , wherein the damping element 64 is arranged at different positions therein . corresponding number indications show the degree of reduction in range at a prespecified position of the damping element 64 . while the invention has been specifically described in connection with specific embodiments thereof , it is to be understood that this is by way of illustration and not of limitation , and the scope of the appended claims should be construed as broadly as the prior art will permit .
| 7 |
referring now to fig1 there is shown a block - diagram of a scatterometric measurement system 10 having a light source 12 , illumination optics 14 , beamsplitter 16 , detectors 20 and means for computation 18 for measuring an object under test or inspection 24 . the light source 12 may be a lamp , a laser , a super - continuum laser , a battery of lasers etc ., wherein any of these different light sources may produce depending on the measurement test being performed delivers either a continuous or pulsed beam of light for processing through the illumination optics 14 . referring once again to fig1 , the illumination optics 14 receives the beam of light and transforms the beam by performing optical amplitude shaping for the beam and in addition may perform polarization control , spatial control , angular control , phase control , spectral control for the same beam . it should be understood that the illumination optics 14 may be placed in a field conjugate plane ( referred to as “ object conjugate ”), a pupil conjugate plane ( which is the fourier transform of an object plane ), or anywhere in between . therefore , any combination may be possible depending on the type of measurement being performed . by way of example and not of limitation the optical amplitude beam shaping may be performed by any known number of techniques such as utilizing apertures , apodizers , spatial light modulators or filters ( e . g to control overall power — this may also be achieved by cross polarization techniques ). the polarization control may also performed by any known number of techniques such as utilizing polarizers ( linear , circular , elliptic , radial / tangential ), waveplates , nematic liquid crystals or other any known prior art spatial polarization controllers . the angular control may be performed by magnification optical techniques using apertures , spatial light modulators or apodizers . if phase control is needed as part of the measured data required to be collected , phase modulators may be used ( e . g . electrooptic , acoustoopticoptical path modifiers ( e . g . glass plates of various thicknesses , wedges on a translation stage , window on a rotation stage ) or spatial phase modulators ( e . g . liquid crystals ). lastly , if spectral control of the beam is needed than filters or spectral shapers may be used ( e . g . a combination of a grating with a spatial light modulator that enables specific on the fly ( e . g . in closed loop ) tailoring of the optical spectrum ). spectral control may also be performed using shutters ( when a battery of lasers is used — these can control which are used at a specific measurement ). turning once again to fig1 , the beam splitter 16 receives the processed beam of light from the illumination optics 14 and directs this light to the object under inspection 24 through optional optics 23 that may include for example an objective lens ( not shown ). the beam splitter 16 also enables light from the illumination optics 14 to go into a first detector 20 and additionally pass through collection optics into a second detector 21 . the first and second detectors 20 and 21 respectively , may be any of the following : a power meter , energy meter ( when a pulsed light is delivered ), a camera , or a field detection system such as a hartman - shack sensor . the first detector may be used for illumination beam monitoring when a modeling algorithm is needed for producing measurement results . the first detector 20 may also be used for power monitoring for safety reasons or to enable closed loop operation with the illumination optics 14 ( e . g . as in adaptive optics system ) that shapes the illumination according to specified criteria . the object under inspection 24 may be any type of tissue or sample that requires testing . the collection optics 23 includes all required optics to complete a measurement test according to specific measurement metrics which may be by way of example only any of the following metrics : amplitude shaping ( for example apodization of different types in either field plane ( object plane ) or pupil plane ( fourier transform plane )), phase control , angular control , spatial control ( e . g . a collection field stop ), polarization control ( e . g . a polarizer for cross polarization measurement ), spectral control ( e . g . a grating to separate the spectrum ). it should be understood that all the components that were mentioned with regards to the illumination optics 14 may also all be used here as well , along with any other known prior art components . lastly , the second detector 21 transfers the signal received from the beam splitter 16 through the collection optics 22 into a computation unit that calculates the require output according to an algorithm for a given measurement test . referring now to fig2 there is shown a block diagram for the scatterometeric measurement system of fig1 used for performing an eye examination . in accordance with a preferred embodiment of the invention , a human eye is the most suitable organ for using the scattometeric measurement system of fig1 . this is due in part that an eye examination is the type of measurement test that may be non - intrusively performed using an optical system . furthermore , it shows the most promise in a variety of test applications when it comes to this organ . referring once again to fig2 , the following scatterometeric system 11 shows a simple measurement of the angular distribution of the scattering and reflection from the human eye 26 and especially the retina . therefore , fig2 illustrates one example using the invention for the triage of eye disease . as shown in fig2 , the light source 12 with respect to an eye test may use any one of the following device ( s ): a laser , a set of lasers , a supercontinuum laser , a lamp or a lamp with different filters for transmitting a beam to the illumination optics 14 . as previously described , the illumination optics shapes the beam to be either uniformly distributed , gaussian or other known prior art shapes of intensity and phase . the polarization state may also be controlled . the beam is made such that it covers a known portion of the eye &# 39 ; s pupil 27 , particularly the entire pupil . the direct illumination beam goes into the first detector 20 that is used to monitor power delivered by the light source 12 ( i . e . a laser ) for further analysis and for safety reasons . turning once again to fig2 , a vision camera 28 is directed at the eye 26 to measure pupil size during an eye examination test . it could be done by various means e . g . placing a ruler next to the eye or using geometrical calculations . the vision camera 28 may also be used to determine the pupil location and orientation and include a light source that does not interfere with the test itself ( e . g . an infrared led light ). the deflected beam 29 from the beam splitter 16 enters the eye 26 ( which optics uses as an objective for the collimated input beam ) and is reflected / scattered from it . the eye 26 is held at a specific location and orientation by using for example a head and chin rest ( not shown ). the returned signal 25 is then brought into the collection optics 22 that consists of a focusing element such as a lens ( that may by example be either achromatic , a concave mirror or a parabolic mirror ). as stated before , filters may also be included in the collection optics 22 , wherein said filters may include spectral or spatial filters , apertures or stops . for an eye examination in accordance with the invention , the second detector is a camera 24 placed at the focus plane of this element to read the signal . the camera 24 is connected to a computation unit that uses special algorithms as described before to compute the desired outcome . an example here would be a comparison to a database of known signals for different pathologies . another example would be to use an eye model to find the main tissues that cause the signal to be as it is measured . the computation includes all data collected from the measurement including but not limited to : a signal from the vision camera 28 , a signal from the first detector 20 , an input illumination profile ( not shown ), a signal from the main camera 24 or knowledge and pre - measurement of the scatterometeric measurement system 11 properties , etc . in some instances it may be important to differentiate the signal from different parts of the eye , for example the reflection from the cornea . this may be done by optical means in the collection optics 22 ( e . g . filters or plates ), by indirect measurement and computation ( for example separate measurement of the cornea and subtraction of the measurement from the given signal , or by use of different optical parameters for measurement ( e . g . use of different wavelengths for reducing or eliminating corneal effects ). in this case the measurement may be done for a single wavelength or for a multitude of wavelengths either sequentially or simultaneously . further information may be derived from the spectral response of the device . another option would be to use “ white ” light as the light source 12 and replace the main camera 24 with a spectrometer to determine the spectral distribution of the signal . in this case the illumination optics 14 might also include apertures and other optical devices to determine the spatial and angular content of the input signal to the eye 26 and the collection optics 22 might also include such apertures and other optics to choose from the signals the desired portions ( angular or spatial ) to be measured . it should be appreciated that using the scatterometeric measurement system 11 shown in fig2 , it is important to have control of several parameters wherein three of the most important are the pupil size of the eye ( affected by ambient light , age , different illnesses / pathologies , treatments of different types e . g . pupil dilation drops ), the angle at which the patient is looking or at which the illumination light enters the eye and the accommodation state of the human lens . the latter two may be controlled by placing accommodation targets ( e . g . concentric circles , this target may also be made in a way that it glows in the dark when a dark measurements are required ) at different distances and locations ( lateral — these will convert into angles ). referring now to fig3 there is shown a block diagram for the scatterometeric measurement system 30 of fig2 used for performing an eye examination by incorporating a refractive power measurement system 32 ( referred to as a “ refractometer ”) into the system 30 for the accommodation measurement . a tilting mechanism ( not shown ) to control the angle of incidence of the illumination light upon the pupil 27 may also be incorporated . turning once again to fig3 , refractometer 32 is incorporated into the scatterometeric measurement system 30 as follows : a specific light source may be used or the measurement light source 12 could be used . the beam from the collection optics 22 is split to the refractometer part of the system . it passes through a refractometer lens 34 ( or other collimating optics ( e . g . concave mirror , parabolic mirror ) and through a refractometer aperture 36 . this aperture 36 is placed in a plane conjugate to that of the eye pupil . a refractometer camera 38 then uses the distance between the two generated spots to measure the refractive power of the eye 36 . for an emmetropic eye the center of the two spots is the same as the distance between the two holes in the refractometer aperture 36 since it is expected that the beam will be parallel . for hyperopia , the distance between the spots will increase and for myopia the distance will decrease . using ray tracing techniques and the geometry of the scatterometeric measurement system 30 enables the determination of the optical power of the eye 26 . referring now to fig4 there is shown a block diagram of another preferred embodiment for the scatterometeric measurement system 40 of fig2 used for performing an eye examination by incorporating a scanning laser ophthalmoscope ( slo ) 42 since it could benefit from the scanning capabilities of such a system ( measurement of different locations of the retina ). also , the scatterometeric measurement system 11 shown in fig2 incorporates into an slo system 40 in a relatively simple way . here the beam scans the retina ( by entering the eye at different angles ) and the data received on the slo detector 42 is used as the slo signal . referring now to fig5 there is shown a block diagram of yet another preferred embodiment for a scatterometeric measurement system 50 used for performing an eye examination by incorporating an adaptive optics system into the scatterometeric measurement system 11 of fig2 . the scatterometeric measurement system 50 cancels wavefront aberration that might be due to imperfections in the optics of the system or the optics of the eye . this will enable direct measurement of the retina itself without contribution from other optical elements . there is a risk though here that the correction might cause the signal to be distorted and not completely describe the actual status of the retinal tissue . here the first detector is replaced ( or in most cases it will be used in conjunction ) with a wavefront sensor 52 ( e . g . a hartmann - shack sensor ) wherein the wavefront distortion is measured — this may be done by an auxiliary light source dedicated for this purpose or by the scatterometer light source . the wavefront signal is then processed by a feedback system 54 that is connected to a slm in the illumination optics 14 ( e . g . a deformable mirror or mems system ). the feedback is processed until a defined distortion level or structure is achieved . the designed illumination is then used as the illumination for the scatterometric measurement . the measured signal may be compared to a population - wide standard for detection of different anomalies . another option would be to compare the measured signal to a modeled signal according to some models of the tested tissue with specific qualities and quantities that will help detect abnormalities . lastly , a third option would be to compare the tested signal to a library of signals ( either measured or modeled ) and find the most suitable anomaly resulting from the library comparison . in summary , use of scatterometry for triage benefits from all the properties of optical imaging such as the use of different wavelengths , different polarizations , and different phase and amplitude of the optical signal . the use of medical scatterometry may be applied to any tissue in the human body ( or other ) ( permitting a suitable wavelength that can reach it ). it should be noted that eyes and retinas are of particular suitability for the method of the present invention due to their transmission in the visible and near ir regions of the spectrum .
| 0 |
as shown in fig1 each pita loaf is formed to be substantially circular with perforations therein , preferably along a chord or the diameter thereof . in this manner a perforated pita bread is formed which can be easily separated into two sections by simply tearing them apart . if the perforations are provided along the diameter , each section has its pocket exposed so that it can be filled or stuffed with various foods according to its customary use . if the perforations are provided along a chord near the perimeter of the pita loaf , a single loaf having a large pocket is created . a second function of the perforations is to allow hot air and gases which are formed during baking to escape so that while the perforated pita bread rises and the pocket is filled with gases during its formation there is no rupturing of any of the surface of the perforated pita bread , even along the perforated line , because the gases can escape through the existing holes formed in the loaf by the invented apparatus before any such rupturing can occur . as shown in fig1 a standard conveyor system which is used for the manufacture of pita bread is disclosed in which there is first shown a hopper 11 in which the pita dough made in a separate assembly is placed . the dough may be filled therein to a desired level so that a proper flow of pita dough is fed to the remainder of the system . the dough travels through the hopper 11 to an auger 14 having spiral threads 16 thereon . the auger 14 is driven by a motor drive 15 which drives the dough 18 through chute 17 onto conveyor 20 . the pita then goes under roller 22 which flattens the dough 18a into a flat sheet of predetermined thickness . roller 24 disposed further along conveyor 20 flattens the dough 18b to approximately the desired thickness prior to baking . the resultng dough 18b from roller 24 is then passed under roller 32 which cuts the pita loaves 19 out of the dough 18b . as shown in fig4 the pita cutter 30 comprises a circular , oval or substantially circular blade 33 with a sawtooth shaped blade 34 disposed therein along the diameter thereof . the teeth of each pita cutter 34 as shown in fig4 are preferably 1 / 16 to 1 / 8 inches deep and there are approximately 6 teeth per inch across a diameter of 4 to 5 inches . the teeth are preferably rounded or flat , rather than pointed at the top thereof . of course the frequency , size and shape of the teeth can vary greatly , with the understanding that they are intended to be of sufficient depth and geometry so as to prevent rupturing of the pita loaf along the perforated line during baking . of course , it will be appreciated that it is not necessary for the perforations to be provided along the diameter and that they can in fact , be provided along a chord of the substantially circular or oval pita bread if a larger size pita pocket is desired . as shown in fig7 the perforating blade 42 of the pita cutter 40 is disposed along a chord displaced from the diameter of the pita cutter . as shown in fig1 pita cutters 30 are disposed in alignment across rows along roller 32 and each row contains three pita cutters . it will be obvious from one skilled in the art that the precise placement and spacing of the pita cutters can vary without departing the spirit or scope of the present invention . after the perforated pita loaves are cut from the dough , the remainder of the dough 18c can be removed and recycled into the 12 or otherwise disposed of . the cut loaves 19 are then run through a pita oven as is standard in the art and the pita loaves are allowed to rise and form pockets therein accordingly . it would be obvious to a person of ordinary skill in the art that a number of changes and modifications can be made to the existing apparatus and process without departing from the spirit and scope of the present invention . it is contemplated that the present invention is encompased by the claims as presented herein and by all variations thereof coming within the scope of equivalents accorded thereto . fig5 and 6 illustrate an alternate embodiment of the present invention in which the pita dough is separately perforated on the conveyor belt and cut into pita loafs . as shown in fig5 the apparatus is substantially the same as the apparatus shown in fig1 except that the pita cutters 30 lack the perforating blade 34 , and a perforating means 44 is provided . in fig5 the perforating means is provided prior to the pita cutter , although it will be appreciated by a person of ordinary skill in the art that the perforating means can be disposed along the conveyor system subsequent to the pita cutter . as shown in fig6 the perforating means 44 comprises a horizontal support bar 45 , vertical support bars 46 and saw toothed wheels 47 disposed on spindles 48 so that they can freely rotate from the force applied by the dough thereon .
| 0 |
this specification describes exemplary embodiments that incorporate features of the invention . the embodiment ( s ) described , and references in this specification to “ one embodiment ”, “ an embodiment ”, “ an example embodiment ”, etc ., indicate that the embodiment ( s ) described may include a particular feature , structure , or characteristic , but every embodiment may not necessarily include the particular feature , structure , or characteristic . thus , the invention includes more subject matter than may be shown in a single exemplary embodiment . moreover , such phrases are not necessarily referring to the same embodiment . when a particular feature , structure , or characteristic is described in connection with an embodiment , it is understood that it is within the knowledge of one skilled in the art to effect such feature , structure , or characteristic in connection with other embodiments whether or not explicitly described . an embodiment of the present invention is now described . while specific methods and configurations are discussed , it should be understood that this is done for illustration purposes only . a person skilled in the art to which the invention pertains will recognize that other configurations and procedures may be used without departing from the spirit and scope of the invention . fig1 illustrates an exemplary network 100 in which notebooks 103 and 109 may operate . network 100 may include a personal computer 101 , a server 105 , a data hub 107 , a docking station 111 , and a network switch 110 . switch 110 enables computer 101 to communicate with notebook 103 , server 105 , or hub 107 . switch 110 also enables notebook 103 , server 105 , and hub 107 to communicate with any other computer systems connected to the switch . although not shown , computers 101 and 103 , server 105 , or hub 107 can be connected to other network systems such as lan , wan , or the internet . on a high level , when data is received by switch 110 from computer 101 , the data is examined to determine the data &# 39 ; s destination address . once the destination address and sending instructions are extracted , switch 110 makes a decision on where to send the received data . for example , computer 101 may want to send data only to server 105 . in such a case , switch 110 will forward data received from computer 101 to server 105 . in another example , computer 101 may want to send data to computer 103 and server 105 . in this scenario , switch 110 will forward data transmitted by computer 101 to both the computer 103 and server 105 . one skilled in the art will recognize other scenarios based on the discussion given herein . there are various types of switching devices . each type of switching device is specifically designed to function at a particular osi layer . at layer 1 , these switching devices are usually called “ hubs ” or “ repeaters ”. the main function of a hub or a repeater is to broadcast incoming data to one or more ports or spokes of the hub . in addition to data broadcasting , the repeater also amplifies the original signal for re - transmission . at layer 2 , the switching device is often called a multiport bridge or more commonly a switch . switches are designed to forward data based on a physical address known as media access controller ( mac ) address embedded in the header of a data frame . each network interface component ( nic ) of a computer system or a switch has a unique 48 - bit long mac address that may look like “ 2e id ac 01 00 01 .” using the mac address , a switch is able to route data to other switches or to a computer system with a matching mac addresses . a layer 3 switching device is called a router . routers forward data packages based on their destination network address or internet protocol ( ep ) address . similar to layer 2 switches , layer 3 routers are capable of learning addresses and maintaining address tables for referencing data packages with corresponding destinations . notebook 103 may be connected to network 100 using a rj45 network port or through a wireless ethernet port . notebook 109 is similarly configured , but is also configured to connect to network 100 through a docking station 111 , which also has a rj - 45 port connected to network 100 . fig2 illustrates an exemplary computer system 200 that includes a notebook motherboard 210 and a docking station 250 . motherboard 210 includes physical layer device ( phy ) 212 , a switch 214 , an isolation magnetic circuit 216 , a rj - 45 connector port 218 , and a link sensor 220 . as shown , motherboard 210 is being implemented on notebook 109 , but could also be implemented on notebook 103 . phy 212 is responsible for transmitting and receiving data signals for the motherboard 210 . during transmission , data signals that are received by switch 214 are either forwarded to rj - 45 port 218 or a docking station communication port 222 ( shown as 222 a and 222 b in fig2 ). typically , a notebook motherboard includes a signal sensor , such as sensor 220 , to detect the presence of an active link , either at the rj - 45 connector 218 or at the docking station through the connector 222 a . when sensor 220 detects an active link at communication port 222 a , it notifies switch 214 to exclusively switch data signals between phy 212 and communication port 222 a for transmission via the docking station . it should be noted that sensor 220 may also be integrated into switch 214 . similarly , when sensor 220 detects an active link at port 218 , switch 214 is instructed to switch all data signals between phy 212 and port 218 . to protect phy 212 and other components of motherboard 210 , data signals between phy 212 and communication port 218 are filtered through an isolation magnetic circuit 216 . in this manner , high voltage signals from the twisted pair cables may be filtered . as shown in fig2 , docking station 250 includes communication port 222 b , isolation magnetic circuit 252 , and rj - 45 port 254 . communication port 222 b is configured to mate with port 222 a of motherboard 210 . similar to isolation magnetic circuit 216 , isolation magnetic circuit 252 protects phy 212 from potentially high voltage signals at port 254 . fig3 illustrates a block diagram of a system 300 according to an embodiment of the present invention . system 300 includes a gigabit controller microprocessor 310 , isolation magnetic circuits 316 a - b , a rj - 45 port 318 , and a docking station communication port 322 . isolation magnetic circuits 316 a - b are coupled to input / output ( v / o ) ports 312 a and 312 b of gigabit controller 310 . in this way , gigabit controller 310 is protected from high voltage signals at port 318 or port 322 and from other voltage anomalies . alternatively , isolation magnetic circuit 316 b can be physically located in the docking station instead of in system 300 . gigabit controller 310 includes a media access controller ( mac ) 330 , a phy digital signal processing ( dsp ) module 332 , a digital switch 340 , a first phy analog front end ( afe ) circuit 342 , and a second phy analog front end circuit 344 . afe circuits 342 and 344 are coupled to 1 / 0 ports 312 a and 312 b , respectively . digital switch 340 is coupled between phy dsp module 332 and afe circuits 342 and 344 . switch 340 includes a first i / o port 341 a , a second i / o port 341 b , and a third p / o port 341 c . i / o port 341 a is coupled to phy dsp 332 . i / o port 341 b is coupled to afe circuit 342 , and p / o port 341 c is coupled to afe circuit 344 . in an embodiment , phy dsp module 332 comprises a physical coding sublayer ( pcs ) in accordance to the ieee 802 . 3 standard . in gigabit controller 310 , afe circuits 342 and 344 constantly monitor i / o ports 312 a and 312 b for link energy to determine which port is active . if a link energy is detected on port 312 a , switch 340 will forward data between phy dsp 332 and afe circuit 342 . if a link energy is detected on port 312 b , switch 340 will forward data between phy dsp 332 and afe circuit 344 . switch 340 is a bidirectional digital switch . in this way , data may be transferred from phy dsp 332 to afe circuit 342 or from afe circuit 342 to phy dsp 332 . switch 340 may have more than 2 possible switching paths , as opposed to only 2 switching paths shown . for example , gigabit controller 310 may have “ n ” number of communication port similar to port 312 ( collectively including ports 312 a and 312 b ). in this scenario , gigabit controller 310 would have a corresponding “ n ” number of afe , one for each communication port . further , switch 340 may be implemented to work with a 10base - t , 100base - tx , 1000base - t ethernet system , or other communication standards . in an embodiment , switch 340 is a bidirectional digital multiplexer . it should be noted that other switching implementations could also be used to switch digital signals between phy dsp 332 and afe 342 or afe 344 . the implementation of a digital switch to switch digital signals between a first circuit and a plurality of second circuits should be apparent to one skilled in the relevant art . the design of system 300 eliminates the need for an off - chip switch 214 between gigabit controller 310 and ports 318 and 322 . the elimination of switch 214 reduces power consumption and the cost of system 300 . further , without the off - chip switch , circuit designers no longer have to worry about impedance mismatch at the interface of the phy &# 39 ; s afe and the off - chip switch , which may cause signal distortions and amplitude lost , for example . additionally , when an off - chip switch is used , the phy has to be driven at a higher power level to offset for amplitude lost . further , the integrated switch of system 300 allows gigabit controller 310 to achieve higher cable reach as compared to system 200 , which is partly contributed by the elimination of hybrid mismatch and transmit distortion caused by an off - chip switch . in an alternative embodiment , system 300 further includes a connection sensor or a mechanical switch ( not shown ) and a link energy detector 325 . the connection switch detects whether system 300 is connected to a docking station . link energy detector 325 monitors each communication port to determine whether the link is active . if a port is determined to be inactive , system 300 may power down dedicated components for that communication port . for example , if communication port 312 is inactive , gigabit controller 310 may power down phy afe 342 and other support components such as a digital lock loop ( not shown ) dedicated to communication port 312 a . in this way , system 300 may save power by minimizing the power usage of gigabit controller 310 . in system 300 , special methods are used during the powering down or up process of the afes and related components to provide noiseless data switching between phy dsp 332 and one of the plurality of afes 312 a - n ( 312 c - n are not shown ). as mentioned above , n corresponds to the number of communication ports that gigabit controller 310 has . fig4 illustrates a method 400 for noiseless switching of data from phy dsp 332 to a communication port a then subsequently redirecting data transfer to and from dsp 332 and communication port b . method 400 begins at step 405 . prior to reading data from a connection sensor or switch ( not shown ), the connection switch is first de - bounced . the connection switch purpose is to detect the presence of the docking station . typically , this connection switch is a mechanical switch , which tends to bounce for several microseconds prior to stabilizing at a closed state . to insure glitch free switching , data from the connection switch are not collected until the connection switch is de - bounced . this may be accomplished using commonly known switch de - bouncing circuitry or by executing a software module . although a mechanical switch is described , other types of switches may also be used in place of the mechanical switch such as an optical switch or an electrical switch . in step 410 , system 300 may also override the phy dsp register bit to minimize the amount of registers from resetting due to noises or to false switching instruction from the connection switch . in step 415 , system 300 constantly monitors the connection switch for any status change . in step 420 , system 300 enters a loop and constantly cycles through steps 415 and 420 until the status of connection switch is changed . once the control state or status of the connection switch is confirmed the process proceeds to step 425 . in step 425 , if the connection switch indicates that the control state has changed ( e . g . from port a to b , or b to a , or a to n ) to port b for example , then dedicated devices for communication port b are powered up . for example , let &# 39 ; s assume that the control state changes from port a to port b , then dedicated afe 344 and dll ( not shown ) for port b are powered up to prepare and support port b for communication . in step 430 , system 300 executes a wait for approximately 40 microseconds . this allows the dll time to power up and stabilizes . the wait time does not have to be 40 microseconds , other amount of times ( e . g . 5 or 10 microseconds ) could also be used as long as the dll has stabilized or does not produce noise . in step 435 , digital switch 340 is configured to switch to port b , meaning port b is enabled . alternatively , if a separate digital switch is used for each port , then the digital switch for port b is enabled . in step 440 , system 300 executes another wait for approximately 10 microseconds . this allows the switch to be properly enabled . in step 445 , system 300 forces switch 340 to enable the port b . this force switching procedure is executed regardless of whether port b of switch 340 has been enabled or not . if port b of switch 340 has already been enabled , this force enabling procedure would still be executed but would not have any negative effect . method 400 continues to step 450 . in step 450 , system 300 or gigabit controller 310 powers down dedicated devices to the previously enabled port . for example , when system 300 switches from port a to port b , dedicated dll and afe for port a are shutdown . this allows system 300 to operate efficiently . in step 455 , phy dsp 332 is reinitialized to send and receive data from port b . fig5 illustrates a method 500 that may be implemented in system 300 to switch from one port to another . method 500 commences at step 510 . in step 510 , system 300 is powered up . in step 520 , system 300 initializes essential systems for communication with one of the ports 312 a - b . for example , phy dsp 332 is initialized by preprogramming all proper registers and port a is also selected as the default communication port , as shown in step 530 . further , smart switching mode is enabled , which includes the implementation of smart delays as outlined in method 500 . in step 540 , the communication link of port a is tested for link energy . this function is performed by link detector 325 . if link energy is not detected within 10 seconds , the process proceeds to step 550 . if link energy is detected , port a remains as the selected and active port . further , system 300 continuously tests the link at port a for activity ( whether link energy is present ). although 10 seconds is used as the test wait time , other test wait times could also be implemented such as 2 . 61 ms up to 171 seconds . step 550 is executed if the wait time allotted has passed and link energy is not detected . if link energy is not detected at port a after 10 seconds ( whatever the setting may be ) then gigabit controller 310 switches to communication port b or any other port with a detected link energy . as mentioned , gigabit controller 310 may have multiple communication ports 312 a - n . once port b is selected at step 560 , gigabit controller enters a loop , at step 570 , to continuously test whether port b is active or has detectable link energy . if a link energy is detected , gigabit controller 310 continues to select port b as the communication switch . if no link energy is detected , gigabit controller 310 switches to the new active port . as an example , port a has detectable link energy , thus gigabit controller switches to port a at step 580 . once this occurred , the link energy test loop , as outlined in steps 540 and 530 , starts again . system 300 is also configured to prioritize which communication port to use as the default data switching port when more than one communication ports are active . for example , system 300 may have two or more active ports such as port a and b . in an embodiment , port a is a rj45 data port from a notebook and port b is a rj45 port in a docking station . in this example , the notebook is docked to the docking station and both rj45 ports are connected to an active external network . an example priority rule may stipulate that data is to be switched from the mac to the first i / o port whenever the first i / o port is active . this rule applies regardless of the status of the second i / o port . alternatively , the priority rule may stipulate that data is to be switched from the mac to the second i / o port whenever the first i / o port is active , regardless of the second i / o port status . another exemplary priority rule may stipulate that data is to be switched from the mac to the second i / o port when the following condition ( s ) is met : a ) the second i / o port has a connected and active status while the first i / o port has an unconnected status ; or b ) the second i / o port has a connected and active status while the first i / o port has a connected but inactive status . other priority rules could be also implemented that would not depart from the spirit and scope of this invention . fig6 illustrates a method 600 for switching data between a docking station i / o port and a stand - alone connector port within a gigabit controller , without the need for a separate lan switch . in step 610 , gigabit controller 310 monitors at least one of its input and output ( i / o ) ports . in an embodiment , gigabit controller 310 only monitors i / o port 312 b , which is coupled to a notebook docking station . alternatively , gigabit controller 310 may monitor all of its i / o ports . in step 620 , gigabit controller 310 determines whether i / o port 312 b is active by measuring the energy level of the port . this may be done by measuring the voltage level of port 312 b , for example . in step 630 , gigabit controller 310 switches data between gigabit mac 330 and i / o port 312 b if it has determined that port 312 b is active . in step 630 , gigabit controller 310 switches data between gigabit mac 330 and i / o port 312 a if it has determined that port 312 b is inactive . in this way , the need for an off - chip switch between gigabit controller 310 and ports 318 and 322 is eliminated . this helps to reduce power consumption and cost . as a further benefit to internal switching , gigabit controller 310 may achieve higher cable reach as compared to system 200 . while various embodiments of the present invention have been described above , it should be understood that they have been presented by way of example only , and not limitation . it will be apparent to persons skilled in the relevant art that various changes in form and detail can be made therein without departing from the spirit and scope of the invention . thus , the breadth and scope of the present invention should not be limited by any of the above - described exemplary embodiments , but should be defined only in accordance with the following claims and their equivalents .
| 7 |
now the present invention will be described in detail with reference to the accompanying drawings . fig3 is a schematic view showing one embodiment of the biochip reader in accordance with the present invention . in the figure , elements identical to those shown in fig1 are referenced alike and excluded from the description hereinafter presented . in fig3 , numeral 10 denotes a microlens substrate , numeral 11 denotes a microlens , numeral 12 denotes a barrier filter , and numeral 20 denotes a telecentric zoom lens . on microlens substrate 10 , a plurality of microlenses 11 are arranged at equal pitch p 1 . zoom lens 20 comprises lens 21 with focal length f 1 and lens 21 with focal length f 2 , where both focal length f 1 and focal length f 2 are variable . zoom lens 20 is located between dichroic mirror 4 and specimen 6 . note that although each of lenses 21 and 22 is illustrated as a single lens for the sake of convenience , these lenses are usually composed of multiple lenses . barrier filter 12 , which is located between dichroic mirror 4 and lens 8 , has the effect of letting fluorescent light arising from specimen 6 to pass through and rejecting light with wavelengths other than that of the fluorescent light . in such an apparatus configuration as described above , excitation light projected from the topside of microlens substrate 10 is transformed into a multibeam by means of a plurality of microlenses 11 , and perpendicularly enters zoom lens 20 . in this case , light transformed into a beam with microlens 11 converges onto the focal point of microlens 11 ( the pitch between points of convergence is defined as p 1 ), and then diverges again and enters zoom lens 20 . each beam vertically projected from the lens 22 of zoom lens 20 is condensed ( the pitch between points of convergence is defined as p 2 ) and spot - irradiates the surface of specimen 6 . at this point , it is possible to change the ratio of pitch p 1 to pitch p 2 between beams of excitation light by adjusting the zoom lens and thereby changing the ratio between focal lengths f 1 and f 2 it is also possible to vertically shift the position of the specimen so that the excitation light beams applied to the surface of the specimen become out of focus . when defocused , the spot of excitation light irradiated at the surface of the specimen becomes larger , thereby flattening the light intensity distribution within the specimen &# 39 ; s surface . this means that samples on the specimen are irradiated with a uniform energy of luminance . it should be noted that the above - described embodiments of the present invention are to be considered as illustrative and not restrictive . accordingly , it should be understood that all modifications falling within the spirit and scope of the present invention are covered by the appended claims . for example , the zoom lens may be a non - telecentric lens , as shown in fig4 . in this case , excitation light beams projected from the zoom lens do not vertically enter the specimen &# 39 ; s surface , but diverge as shown in fig4 ( a ) or converge as shown in fig4 ( b ). this modification does not pose any problem provided the beams are for the purpose of exciting the biochip . as another modification , the portion ranging from dichroic mirror 4 to camera 9 of the apparatus of fig3 may be located between lens 22 and specimen 6 . note that also in these modifications , the excitation light beams may be defocused to irradiate the specimen with a uniform energy of luminance . ( 1 ) since a specimen is irradiated with a multibeam , there is no need for moving a stage as has been conventionally done , resulting in a simpler apparatus configuration compared with the prior art apparatus . ( 2 ) since excitation light has been transformed into a multibeam , the light may be made weaker , in inverse proportion to the number of beams , than that used for optical scanning , if a comparison is made with reference to the same readout time . since there is no need for irradiating high - intensity laser light as has been conventionally done , the apparatus of the present invention avoids the risk of bleaching of fluorescent dyes . in addition , it is possible to measure even weak fluorescent light . ( 3 ) since the pitch between spots of excitation light being irradiated at a specimen can be freely varied by adjusting the zoom lens , the pitch between samples on the specimen need not be fixed . consequently , it is possible to read biochips of different kinds or for different purposes with just one biochip reader . ( 4 ) by vertically shifting the position of a specimen , it is possible to easily defocus excitation light beams being irradiated at the specimen . consequently , it is possible to irradiate the entire surface of each sample on the specimen with a virtually uniform energy of luminance . ( 5 ) for the zoom lens , not only a telecentric lens but also a non - telecentric lens may be used . even if beams being irradiated at samples diverge or converge and , therefore , obliquely enter the lens in the case of a non - telecentric lens , this poses no problems since the beams are for the purpose of exciting the biochip . fig5 is a schematic view showing one embodiment of the fluorometric imaging apparatus in accordance with the present invention . in fig5 , elements identical to those shown in fig2 are referenced alike and excluded from the description hereinafter presented . fig5 differs from fig2 in that the illumination system composed of light source 114 and lens 115 and the spots - of - light observation system composed of beam splitter 107 and lens 110 are excluded , and lens 121 and camera 122 having a two - dimensional photoreceptor device are included instead . lens 121 condenses excitation light passing through specimen 109 onto the photoreceptive surface of camera 122 . thus , samples on the specimen arranged in a two - dimensional manner are irradiated with multiple beams of excitation light , enabling the image of the specimen to be observed on camera 122 . in this case , it is also possible to observe the entire image of specimen 109 rather than images of the slices thereof . note that since each specimen 109 is scanned with condensed multiple beams , no speckle noise is produced in images observed on camera 122 even if a laser is used as the light source . a conventional confocal fluorescence microscope does not make use of excitation light passing through specimen 109 . in contrast , the present invention makes use of the light in order to position specimen 109 . this is one of the characteristics of the present invention . positioning of specimen 109 in the xy direction is performed while checking images observed on camera 122 . positioning in the z direction can be achieved by means of an auto - focusing mechanism ( not shown in the figure ). note that the present invention is not limited to moving only the specimen in the x , y and z directions . alternatively , the excitation light side of the apparatus may be moved by moving objective lens 108 in the x , y and z directions . as an auto - focusing mechanism based on , for example , a maximum contrast method , it is possible to adopt a mechanism for automatically controlling the movement of the specimen in the z direction so that the difference between the darkest and brightest points in images observed on camera 122 is maximum . fig6 is a schematic view showing another embodiment of the present invention . in contrast to the optically scanned confocal microscope of fig5 , fig6 shows a non - optically - scanned ( scanless ) microscope . in fig6 , elements identical to those shown in fig5 are referenced alike and excluded from the explanation hereafter presented . in fig6 , numeral 10 denotes a microlens substrate where a plurality of microlenses 11 are arranged on a transparent substrate . numeral 109 denotes a specimen , for which a dna chip on which samples are arranged in a two - dimensional manner or a dna microarray , for example , may be adopted . in this case , each microlens 11 and each site of specimen 109 are arranged in a one - to - one positional relationship . in such an apparatus configuration as described above , each laser beam ( excitation light ) projected from the topside of microlens substrate 21 is condensed by each microlens 22 , and each site of specimen 109 is irradiated with the condensed laser beam . the subsequent steps are the same as those explained with reference to fig5 . that is , fluorescent light emitted from specimen 109 is reflected by dichroic mirror 103 , enters lens 111 and is condensed thereby , passes through barrier filter 112 , and forms an image on the photoreceptor device of camera 113 . on the other hand , excitation light passing through specimen 109 converges onto the surface of the photoreceptor device of camera 132 by means of lens 131 . specimen 109 is positioned according to images observed on the photoreceptor device surface . specimen positioning is the same as in the case of fig5 . that is , positioning in the xy direction is performed while checking images observed on camera 132 . for positioning in the z direction , the specimen is automatically positioned by means of an auto - focusing mechanism that functions according to observed images . in such a scanless fluorescence microscope , the positions of each beam and each site must agree with each other . for this reason , the aforementioned method of positioning is extremely useful for the apparatus configuration of fig6 . note that markers for xyz positioning may be provided on specimen 109 , so that positioning in the xyz directions is achieved on the basis of these markers . fig7 is a schematic view showing yet another embodiment in accordance with the present invention . unlike the scanless reflecting fluorescence microscope of fig6 , the apparatus of fig7 is a scanless transmission fluorescence microscope . in fig7 , elements identical to those shown in fig6 are referenced alike . fluorescent light produced in specimen 109 passes therethrough to enter lens 141 , wherein the light is collimated , and enters lens 142 . during this process , other types of light ( known as background light ) with wavelengths other than that of the fluorescent light are removed by barrier filter 112 inserted between lenses 141 and 142 . the fluorescent light wherefrom background light has been removed is condensed by lens 142 and forms an image on the photoreceptor device surface of camera 113 . catoptric light ( excitation light ), which reflects from specimen 109 and is used to position the specimen , reflects off beam splitter 7 to enter lens 131 , whereby the light is focused , and converges onto the photoreceptor device surface of camera 132 . by applying such an apparatus configuration as described above , specimen positioning can be achieved in the same way as in the case of fig6 , according to images of the specimen &# 39 ; s surface observed on the photoreceptor device . as described heretofore , the following advantageous effects are provided by the present invention . ( 1 ) specimen positioning can be easily achieved by using excitation light that passes through or reflects from a specimen and has not been made use of in the prior art . ( 2 ) the mechanism for specimen positioning is simpler and more economical compared with the prior art , and makes it possible to easily realize a fluorometric imaging apparatus with superior maneuverability . ( 3 ) the present invention is applicable to either a scanning or scanless fluorescence microscope , as well as to either a transmission or reflecting fluorescence microscope . thus , the present invention is significantly effective when used in practice . ( 4 ) by combining the zooming system shown in fig3 with the apparatus configuration shown in fig6 or fig7 , it is possible to easily measure even specimens that have different pitches between the sites thereof .
| 6 |
in the drawings and description that follows , like parts are marked throughout the specification and drawings with the same reference numerals , respectively . the drawing figures are not necessarily to scale . certain features of the invention may be shown exaggerated in scale or in somewhat schematic form and some details of conventional elements may not be shown in the interest of clarity and conciseness . the present invention is susceptible to embodiments of different forms . specific embodiments are described in detail and are shown in the drawings , with the understanding that the present disclosure is to be considered an exemplification of the principles of the invention , and is not intended to limit the invention to that illustrated and described herein . it is to be fully recognized that the different teachings of the embodiments discussed below may be employed separately or in any suitable combination to produce desired results . any use of any form of the terms “ connect ”, “ engage ”, “ couple ”, “ attach ”, or any other term describing an interaction between elements is not meant to limit the interaction to direct interaction between the elements and may also include indirect interaction between the elements described . the various characteristics mentioned above , as well as other features and characteristics described in more detail below , will be readily apparent to those skilled in the art upon reading the following detailed description of the embodiments , and by referring to the accompanying drawing . while specific embodiments have been shown and described , modifications can be made by one skilled in the art without departing from the spirit or teaching of this invention . the embodiments as described are exemplary only and are not limiting many variations and modifications are possible and are within the scope of the invention . accordingly , the scope of protection is not limited to the embodiments described , but is only limited by the claims that follow , the scope of which shall include all equivalents of the subject matter of the claims . the apparatus and methods for measurement of conductivity described herein can be used in an open , uncased borehole or cased borehole in oil , gas , and / or water wells . additionally , water conductivity measurements can be measured continuously or periodically . the apparatus and methods can be used with various conveyance configurations , including wireline , electrical line , pipeline , tubing , coiled tubing , or any similar means , installed permanently downhole , deployed as a separate tool , incorporated in a string of tools , or integrated into a tool as a sensor . the apparatus and methods can also be used for tool calibration . the apparatus and methods can be used in a well that is flowing or a well that is shut - in and engaged in stationary or dynamic conditions . the apparatus and methods can also be used to identify fluid being produced at every level of production . fig1 illustrates an embodiment of the conductivity tool 100 that can measure the conductivity of borehole fluid . the conductivity of the borehole fluid may optionally then be used to identify the fluid type . the conductivity tool 100 includes a housing 103 including a tool top connection 105 and a tool bottom connection 150 that allows for conveyance of the conductivity tool 100 downhole alone or in connection with a string of tools , pipe , or tubing . power can be supplied to the tool 100 by either an electrical line extending from the surface or through a self - contained battery located downhole . as shown , the conductivity tool 100 includes a power supply and control 115 that controls a signal processing circuit 110 . the signal processing circuit 110 may be an oscillator that generates an electric signal . in addition to being an oscillator , the signal processing circuit 110 may also be a receiver signal processing circuit as described in further detail below . when activated by the power supply and control 115 , the signal processing circuit 110 modulates an electric current into a signal and transmits the signal to a transmitter driver circuit 125 . the transmitter driver circuit 125 in turn drives a means for transmitting electromagnetic waves such as transmitter coil 130 , which transmits electromagnetic radiation at a selected power and frequency based on the signal sent to the transmitter driver circuit 125 . the selected frequency may be correlated to the frequency generated by a fluid of known conductivity , such as water . fig1 illustrates that the tool 100 also includes a borehole fluid contact 136 configured as a slot where the borehole fluid can enter the conductivity tool 100 and receive electromagnetic radiation from the transmitter coil 130 . the borehole fluid 135 can be wholly contained in the conductivity tool 100 , partially contained in the conductivity tool 100 , or contacted with the conductivity tool 100 in a variety of contact formations . regardless , the borehole fluid contact 136 allows the transmitted electromagnetic radiation to pass through the borehole fluid 135 . the transmitter coil 130 creates electromagnetic radiation that includes a primary magnetic field , which induces electrical current loops within the borehole fluid 135 at the borehole fluid contact 136 , creating a secondary magnetic field in the borehole fluid 135 . the currents induced in the borehole fluid are related to both the induced electrical field at each particular point and the conductivity of the borehole fluid 135 . both the primary magnetic field produced by the transmitter coil 130 , and the secondary magnetic field , produced by the borehole fluid 135 , induce a corresponding electric current in the receiver coil 140 , creating a received signal that is a function of the borehole fluid conductivity . thus , the borehole fluid 135 acts as a receiver with regards to the transmitter coil 130 and as a transmitter with regards to the receiver coil 140 . in this and other embodiments the transmitter coil 130 , borehole fluid contact 136 , and receiver coil 140 can be arranged in a variety of configurations . single or multiple transmitter coils 130 and receiver coils 140 can be employed with single or multiple borehole contacts 136 . fig1 illustrates the borehole fluid contact 136 as being a slot in the tool housing 103 . however , as previously mentioned , the borehole fluid contact may be in any suitable form such that the transmitter coil 130 and the receiver coil 140 are in electromagnetic communication through the borehole fluid . this includes electromagnetic communication through borehole fluid in the housing 103 as well as outside the housing 103 but within the borehole . the induced electric signal in the receiver coil 140 travels to and is amplified by the signal processing circuit 110 . the induced signal is then compared to the transmitter signal through a phase sensitive detector in the signal processing circuit 110 and undesired signals are cancelled out . further modification of the signal , such as required amplification of a known gain may also be performed . the induced electric signal in the receiver coil 140 may be sent up hole in the form of voltage or current . or , the signal may be stored in the conductivity tool 100 with a time mark , for example during slick line operations . in the case of electric line operations , e . g ., surface read out , the signal can also be multiplexed along with the other sensor signals used in a production logging . telemetry is used for the multiplexing and a transmitter circuit is used for driving the electric line . in case of memory logging , which is normally done using a slick line or coil tubing , the tool 100 electronics may be powered using a battery and the output data may also be stored inside the tool memory along with the event time . when the tool 100 is retrieved after the survey , the time based data may be converted to depth based using the depth to time converter recorded at the surface . the depth based log may be produced similar to electric line logging . comparison of the conductivity of the borehole fluid with fluids of known conductivity may then be performed to determine the bore hole fluid type . the tool 100 is also calibrated with different solutions of known conductivity before being deployed downhole such that any measurement offset will be corrected . for an example , the calibration can be done once a year in the factory using three different nacl ( common salt ) solutions . the actual conductivity of the nacl solution is measured using a precision conductivity measuring devise available in the market and then the apparatus output is plotted with respect to these conductivities . for oil field applications , the following example ranges of conductivity can be used for calibration with the apparatus response being linear . 0 . 5 to 1 siemens per meter — low conductivity range ; 5 to 10 siemens per meter — medium conductivity range , and 20 to 40 siemens per meter — high conductivity range . the gain and offset of the calibration is used to convert the apparatus output to conductivity . the conductivity tool 100 limits the conductivity measurement to measurement of conductivity of the borehole fluid and not the casing , if applicable , or formation . to do so , the conductivity tool 100 uses a set of tuned coils for transmitter and receiver having specific size and inductance , operating frequency , operating power . the spacing of the transmitter coil 103 and the receiver coil 140 is also selected to limit the distance the electromagnetic radiation is transmitted . for example , the spacing of between the transmitter coil 130 and the receiver coil 140 may be set at an appropriate distance to effect measurement of the conductivity of the fluid in the borehole . the spacing may be less than 1 inch to ensure that the conductivity measured comes from the fluid inside the borehole , and not the casing or the formation . other spacing distances may also be used , however . also , higher frequencies may help to ensure a smaller depth of investigation . for example , a frequency approximately greater than 20 khz and / or at least 100 khz may be used . in addition to measuring the conductivity of the fluids in the borehole to determine fluid conductivity and / or type , the conductivity tool 100 may also be used in the measurement of the salinity of any water in the borehole . fluids of differing salinity have different conductivity , i . e ., salt water has a higher salinity than fresh water and thus has a higher conductivity . using this principle , the present apparatus and methods can also be used to differentiate water types of differing salinity . for example , the conductivity tool 100 may be used to differentiate injected water from native water or indicate when water has entered the borehole , thus increasing the accuracy in correcting any borehole effect that may alter measurements made by other downhole tools . the present apparatus and methods can also be used to differentiate between fresh water and salt water . measuring borehole fluid conductivity can also be used in oil recovery methods employing water injection into the reservoir . injected water will be of a different salinity than water produced naturally from the formation into the borehole . thus , even though a producing well is producing native water of a certain salinity , injected water from a nearby injection well may migrate from the injection well and be produced through the producing well . changes in conductivity measurements would indicate if injected water from a nearby injection well has entered the borehole . once the conductivity measurements have been used to identify the borehole fluids , they can also be used to correct the borehole effect on other sensors . the borehole effect is any anomaly in measurement that is induced by measuring the borehole fluid itself . the conductivity of the borehole fluid as determined by the conductivity tool 100 can be used to correct measurements of saturation of oil , native water , and fresh water in the formation . this would allow for correction in direct measurement to help calibrate other tools . for example , the measured borehole fluid conductivity could be used to correct the measurement taken with a pulse neutron tool . these conductivity measurements could also be used in order to better predict reservoir characteristics . the conductivity tool 100 can also be used in conjunction with different downhole tools or sensors . for example , the conductivity tool 100 may be used with other downhole tools or sensors for measurement of water holdup for a production logging application , measurement of formation fluid salinity in cased and open hole logging such as testing the formation with a downhole formation tester , measurement of borehole fluid conductivity for a measurement - while - drilling tool , and measurement of water production in an open hole and / or cased hole sampling tool . fig2 illustrates an embodiment of a conductivity tool 265 used in measurement of water holdup in conjunction with production logging . the conductivity tool 265 is configured as discussed in the embodiment of fig1 , with the conductivity tool 265 being connected and working in conjunction with other production tools instead of standing alone . as illustrated , a production tubing 240 is installed in a borehole with casing 200 . a packer 235 isolates the annulus between the tubing 240 and the casing 200 that is above the packer 235 from the area below the packer 235 . below the packer 235 , the casing 200 is perforated with perforations 220 to allow fluid from the formation to flow into the borehole and be produced by flowing up the tubing 240 . a tool string 230 is conveyed through the tubing 240 by connection to a wireline or slick line 250 . the tool string 230 may also be conveyed by any other suitable means such as coiled tubing . the conductivity tool 265 is connected to the production logging tool 260 by its tool top connector 264 and to another production logging tool 270 by its bottom tool connector 265 . in an embodiment , the conductivity tool 265 can be used in this manner as a water holdup tool or water salinity tool in conjunction with the other production logging tools , 260 , 270 during a production log run . fig3 illustrates an embodiment of the conductivity used inside a borehole fluid sampling tool 360 in a well 300 . a portion of the well 300 may be cased and include perforations 320 , and a portion of the well may be open hole 310 . the borehole fluid sample tool 360 is conveyed through well tubing 340 by connection to a wireline or slick line 350 or any suitable conveyance means . a conductivity tool 365 is configured as discussed in the embodiment of fig1 with the conductivity tool 365 being integrated into the borehole fluid sample tool 360 . the tool 365 may alternatively act as a sensor embodied in the borehole fluid sample tool 360 instead of standing alone , in an embodiment , the conductivity tool 365 uses a sample chamber 370 of the borehole fluid sample tool 360 as a fluid contact to measure the conductivity of the borehole fluid sampled . fig4 illustrates an embodiment used inside a formation tester tool 460 in an open hole 410 . the formation tester tool 460 is conveyed by connection to a wireline , slick line 450 , or any other suitable means . a conductivity tool 465 is configured as discussed in the embodiment of fig1 with the conductivity tool 465 being integrated into the formation tester tool 460 or acting as a sensor embodied in formation tester tool 460 instead of standing alone . in an embodiment , the conductivity tool 465 can be used along with the formation tester tool 460 to measure the produced water salinity while sampling borehole fluid or formation fluid . while specific embodiments have been shown and described , modifications can be made by one skilled in the art without departing from the spirit or teaching of this invention . the embodiments as described are exemplary only and are not limiting . many variations and modifications are possible and are within the scope of the invention . accordingly , the scope of protection is not limited to the embodiments described , but is only limited by the claims that follow , the scope of which shall include all equivalents of the subject matter of the claims .
| 6 |
referring now to the figures of the drawings in detail and first , particularly to fig1 thereof , there is shown a mechanism for the growth of a silicon dioxide layer as proposed by r . gordon et al . disposed on a process area 1 are hydroxyl groups 2 that can react with trimethylaluminum as reactive component . in this case , two methyl groups of the trimethylaluminum are replaced by the oxygen atoms of the hydroxyl groups 2 ; two methane molecules are liberated per molecule of trimethylaluminum . given an excess of trimethylaluminum , the reaction proceeds until all the hydroxyl groups 2 on the process area 1 have reacted . a monolayer of a starter layer thus forms which , with the methyl groups that are still bonded to the aluminum , has leaving groups for the hydroxyl groups of the tris ( tert - butoxy ) silanol . once any excess trimethylaluminum has been removed from the process space , tris ( tert - butoxy ) silanol is then introduced . the hydroxyl group of the tris ( tert - butoxy ) silanol reacts with the aluminum atom of the starter layer , the methyl group that has remained on the aluminum in each case being displaced with cleavage of a molecule of methane . if an excess of tris ( tert - butoxy ) silanol is offered , further tris ( tert - butoxy ) silanol molecules may be intercalated into the aluminum - oxygen bond , so that a chain lengthening occurs with cleavage of tert - butanol . a repeated intercalation of tris ( tert - butoxy ) silanol molecules leads to the formation of siloxane chains on the process area 1 . fig1 b schematically shows the configuration of these siloxane chains 3 . the chains all have an identical extent . since the individual tris ( tert - butoxy ) silanol molecules are in each case intercalated into the aluminum - oxygen bond at the process area 1 , the chain growth is largely insensitive to fluctuations in the concentration of the tris ( tert - butoxy ) silanol over the process area 1 . the tert - butyl groups bonded to a silicon atom can be cleaved thermally , with cleavage of isobutene and liberation of a hydroxyl group at the silicon . the mechanism is illustrated in fig1 c . the liberated hydroxyl group can then attach to a silicon atom of an adjacent siloxane chain , so that a crosslinking of the chains takes place with cleavage of tert - butanol . if hydroxyl groups are liberated in adjacent siloxane chains , the chains can likewise crosslink with cleavage of water . possible mechanisms for the crosslinking of adjacent siloxane chains are illustrated in fig1 d . finally , a layer made of silicon dioxide is obtained as a result of the increasing crosslinking . since no more tris ( tert - butoxy ) silanol can diffuse through the silicon dioxide layer , the chain growth comes to a standstill . if the layer thickness is to be increased further , therefore , a monolayer is produced anew from trimethylaluminum as starter layer , and the layer thickness growth is continued , as described above , by the subsequent introduction of tris ( tert - butoxy ) silanol . fig2 a to fig2 e show successive process steps in the fabrication of a collar made of silicon dioxide at the upper section of a trench introduced into a substrate . a substrate 6 including a semiconductor substrate 4 and an auxiliary layer 5 disposed on the semiconductor substrate 4 has a horizontal substrate surface 7 , from which a trench 8 extends into the substrate 6 in a direction perpendicular to the substrate surface 7 as far as a relief depth 9 . the trench wall 10 forms process areas 11 perpendicular to the substrate surface 7 . a coverage depth 12 , up to which the relief formed by the trench 8 is to be covered with a layer of silicon dioxide that is to be formed subsequently , is prescribed between the substrate surface 7 and the relief depth 9 . the coverage depth 12 divides the trench 8 into an upper trench region 13 oriented toward the substrate surface 7 and a lower trench region 14 . in accordance with the trench regions 13 , 14 , upper sections 15 of the process area 11 are disposed between the substrate surface 7 and the coverage depth 12 and lower sections 16 of the process area 11 are disposed between the coverage depth 12 and the relief depth 9 . the trench 8 is firstly lined completely with a thin covering layer 17 having a thickness of approximately 2 nm . the covering layer 17 may , for example , include silicon dioxide and be produced by thermal oxidation if the substrate 6 is constructed from silicon . as an alternative , by way of example , it is also possible to employ an ald or cvd method in order to produce the covering layer 17 made of silicon dioxide from suitable precursor compounds . in accordance with the method according to the invention , a starter layer 18 is produced on those sections of the covering layer 17 that are disposed on the substrate surface 7 and the upper sections 15 . due to the high sticking coefficient of the reactive component , the starter layer 18 grows proceeding from the substrate surface 7 in the direction of the relief depth 9 . the growth of the starter layer 18 in the direction of the relief depth 9 is restricted . by way of example , for this purpose a process quantity of the reactive component is restricted , so that the starter layer 18 grows no further than as far as the coverage depth 12 . the process of depositing the starter layer 18 also can be terminated upon reaching the coverage depth 12 , for example by reactive component that is still present in the process space being pumped away . a formation of a starter layer 18 as illustrated in fig2 c results in both cases . the starter layer 18 extends as a uniform monolayer above the coverage depth 12 . virtually no deposition of the reactive component takes place below the coverage depth 12 . after the reactive component has been pumped away from the process space , tris ( tert - butoxy ) silanol is introduced into the process space . in this case , the tris ( tert - butoxy ) silanol is offered in a concentration at which the formation of a siloxane layer 19 does not proceed in a diffusion - controlled manner . the trench 8 is thus completely filled with gaseous tris ( tert - butoxy ) silanol . however , a deposition of the tris ( tert - butoxy ) silanol takes place only in those sections of the process area 11 that are covered by the starter layer 18 . therefore , the siloxane layer 19 is formed only in the upper section 15 of the process area , whereas no reaction takes place in the lower section 16 of the trench 8 . the siloxane layer 19 thus extends uniformly and with a uniform layer thickness above the coverage depth 12 . no layer thickness growth takes place below the coverage depth 12 . the formation of a starter layer 18 in a first process step and afterward the formation of a siloxane layer 19 in a second process step is repeated a number of times , so that the thickness of the silicon dioxide layer formed in the upper section 15 increases to the desired extent . the state illustrated in fig2 e is obtained . a silicon dioxide layer 20 has been produced in the upper section 15 of the trench 8 by repeated deposition of a starter layer 18 and of a siloxane layer 19 . after the crosslinking of the siloxane layers 19 , the layer 20 is substantially formed from silicon dioxide , with which are admixed small quantities of aluminum , for example , which have resulted from the starter layer 18 . the silicon dioxide layer 20 typically contains proportions of aluminum ions in the region of approximately 1 %. afterward , the covering layer 17 is removed in the lower section 16 of the trench 8 by etching using dilute hydrofluoric acid and the layer 20 is removed on the substrate surface 7 by anisotropic etching . the construction illustrated in fig2 f is obtained . a collar formed from the silicon dioxide layer 20 is disposed in the upper section 15 of the process area 11 or of the trench 8 . the collar extends with uniform layer thickness from the substrate surface 7 as far as a coverage depth 12 . the silicon dioxide layer 20 , which is doped with aluminum ions , for example , is separated from the substrate 6 by a covering layer 17 made of silicon dioxide . the wall of the trench 8 is uncovered again in the lower section 16 of the process area 11 in the region of the trench 8 between the coverage depth 12 and the relief depth 9 . from the construction illustrated in fig2 f , a capacitor can then be constructed in a customary manner in further sections , for example by the semiconductor substrate 4 being selectively doped by vapor phase doping in the lower sections 16 . in the application in the fabrication of dt ( deep trench ) dram memory cells , the doped region thus produced corresponds to a low - impedance connection of an outer electrode ( buried plate ). after a dielectric has been deposited in the lower sections 16 , the remaining inner space of the trench 8 can be filled with highly doped polysilicon , for example , in order to obtain a counterelectrode . the schematic construction of such a trench capacitor is illustrated in fig2 g . vapor phase doping has resulted in doped regions 21 in the semiconductor substrate 4 , which form the outer electrode of the capacitor . disposed on the doped regions 21 is a layer 22 of a dielectric that extends below the collar 23 along the wall . the remaining space is filled with highly doped polysilicon in order to obtain a counterelectrode 24 . the counterelectrode 24 can be connected to a transistor ( not illustrated ) in subsequent work steps in order to control the charge state of the trench capacitor .
| 2 |
embodiments of the present invention replace the radioactive element of the standard ionization - type smoke detector with a field emission or field ionization ion source that is non - radioactive and uses no radioactive materials . the field emission ion source will operate at atmospheric pressures and will operate over a wide temperature range . what is described in detail below are embodiments that use carbon nanotubes as the field ionizer material , but there are many other materials that could be used for this application : 1 . functionalized or coated carbon nanotubes may be used to improve durability and lifetime and also reduce operating voltage . one example of this would be alkali - metal coated or alkali - salt coated carbon nanotubes . 2 . nanotubes or nanowires of other materials , such as si , zno , gaas , etc . these nanowires may also be functionalized or coated . 3 . metal or semiconducting microtips may be used , such as w or mo ( metals ) or si or ge ( semiconductors ). it may be possible that a spindt microtip configuration may be used with an emitter structure and a gate electrode . an electric field on the order of several megavolts / cm (˜ several 100 v / μm ) is sufficient to produce electron emission from materials . one way to achieve these fields practically is to use conducting or semiconducting structures , or materials that have very high aspect ratios ( they are tall and thin ), and place them in an electric field . because the high aspect ratios will concentrate the electric fields at the ends or tips of the structure , electron field emission can be achieved with applied electric fields as low as 1 - 10 v / μm since the electric field at the tips of these high aspect features can be as high as 100 - 1000 v / μm . fig3 a illustrates how a high aspect ratio ( h / r ) conductor concentrates the applied electric field ( f 0 ) so that the field at the tip of the conductor ( f ) is magnified . fig3 b illustrates a diode - type ( anode sued cathode electrodes only ) field emission display structure using carbon nanotube emitters . see , tonegawa et al ., “ development of large size cnt - fed ,” idw / ad &# 39 ; 05 , takamatsu , japan , p . 1659 . initially , metal or si microtip structures were designed and built to be used for field emission applications . see , c . a . spindt and l . n . heynick , u . s . pat . no . 3 , 665 , 241 , may 23 , 1972 . the first field ionization experiments were performed by müller . see , e . w . müller , phys . rev . vol . 102 , p . 618 ( 1956 ). there are two cases or methods to use field emitter structures as gas ionization sources : case 1 ) electrically bias the structures negatively such that electrons are pulled from the field emitters into the gas environment ( producing ions by electron - impact or electron capture ); or case 2 ) electrically bias the structures positively ( the reverse of above ) such that electrons are pulled from the gas molecules into the tips of the structures , thus producing positive ions . in both cases , it is well documented ( see , robert gomer , field emission and field ionization , pub . by the am . inst . of physics , 1993 , pp . 1 - 31 and 64 - 102 ) that the phenomenon that controls the behavior is quantum mechanical tunneling of electrons from the conduction band of the metal into the vacuum or gas environment as a result of high local electric fields ( case 1 ), or the reverse , electrons tunneling from the gas molecules into the metal ( case 2 ) from similar applied electric fields but polarized in the opposite direction . there are issues that are considered for implementing embodiments of the present invention : gas adsorption and changing work function of the tip emitters : since these emitters will operate in air , gas can form physical and chemical bonds to the surface , changing work function and aspect ratio and degrading emission properties . carbon nanotubes are relatively inert compared to most metals ( i . e ., an oxide layer is not formed on the surface ). they are flexible yet strong , ( young &# 39 ; s mod . of swnt = 1 tpa , max tensile strength = 30 gpa . see , m .- f . yu et al ., phys . rev . lett . 84 , 5552 ( 2000 )) and have high thermal conductivity . see , savas berber et al ., “ unusually high thermal conductivity of carbon nanotubes ”, prl , v84 , p . 4613 , ( 2000 ). based on these properties , the carbon nanotube is a good choice , as it is expected to be the most stable . ion erosion of the emitter : water or oxygen ions may attach to the carbon nanotube material , converting it to co or co 2 . this may limit the life of the carbon emitters . it is found that this is true in high vacuum conditions . see , l . h . thuesen , r . l . fink , et al ., j . vac . sci . technol . b 18 ( 2 ), p . 968 , march / april 2000 . for embodiments herein , the electrons are emitted into air at atmospheric pressure at low energy ; thus , the electrons do not gain significant energy before impacting a molecule . therefore , ions are created by electron capture ( i . e ., they are negative ions ) and are repelled from the cnt electrode . the only concern may be positive ions . positive ions can be created if the electron energy striking the molecule is high . embodiments herein may adjust both the gap between the electrodes and the bias of the electrodes to change the electron impact energy and tune it for optimal performance . furthermore , the impact of ions on the cnt emitters may be limited because ion energy will be imparted to other molecules as a result of high collision rates at atmospheric pressure . there are examples of using carbon emitters as gas ionization sources in the literature . dong et al . and choi et al . used cnt emitters in ionization vacuum gauges . see , c . dong et al ., apl ., 84 , p . 5443 , 2004 , and in - mook choi , et al ., apl ., 87 , p . 173104 , 2005 . they operated their devices in partial vacuum , different from the proposed approach , and with much higher electron impact energy than proposed herein . riley et al . used multiwall carbon nanotubes to ionize he . see , d . j . riley et al ., “ helium detection via field ionization from carbon nanotubes ,” nanoletters , 3 , p . 1455 ( 2003 ). they were successful in ionizing he atoms at low pressures ( 4 × 10 − 5 mbar ). peterson et al . measured the performance of both carbon nanotubes and polycrystalline diamond as a gas ionizer at atmospheric pressure and in the case 1 mode , very similar to what is disclosed here . see , m . s . peterson , w . zhang , et al ., plasma source sc . and technol ., vol . 14 , pp . 654 - 660 . ( 2005 ). first , using the highly graphitic polycrystalline diamond material , they were able to generate a current between 5 pa and 10 μa with voltages of 20 v and 340 v respectively , using a gap of 10 μm . they were able to maintain the current in one case over 40 hours in continuous dc mode . this demonstrates that oxygen ions did not significantly degrade the performance of the carbon - based electron source operating in air . fig4 illustrates a first embodiment , which may be easiest to make and may be the lowest cost to manufacture of all the designs . it comprises two conductor plates or metal coated glass panels 404 , 405 . one conductor 404 is coated with cnts 403 . air 407 is allowed to flow in between the plates 404 , 405 . either dc or ac voltage may be applied between the electrodes . it is also possible to bias die electrodes with an ac voltage having a dc offset . in dc mode or with a dc offset , ions created will drift toward an electrode ; the direction of the drift will depend on the charge of the ion . an alternative ( not shown ) is that both sides may be coated with a cnt film to take advantage of the ac swing that may be needed to neutralize ion drift . the substrates are shown as glass that is metallized . it in fact may also be a metal foil or other conducting sheet of material . gas may be forced through the gap in one direction or there may be no forced flow at all and left open to the prevailing air currents in the room , entering the gap from any direction . sensor electronics 406 are coupled to the electrodes 404 , 405 to detect changes in the current and set off an alarm if a threshold of smoke particles are detected . fig4 b illustrates a second embodiment that is similar except the sensor electrodes ( electrode rings 424 and 425 ) are separate and independent of the gas ionization electrodes ( 404 and 405 ) although they may be formed or deposited onto the same substrate 426 . the substrate material in this case is insulating , such as ceramic materials or glass . in this embodiment , ions are created in a similar manner as in fig4 , but here the ion current is measured by collecting the negative ions oil the positive electrode ( 425 ) and by collecting the positive ions oil the negative electrode ( 424 ). these electrodes can be various shapes and sizes but they are in close proximity to the ion source so that they measure the ions created in the gap between electrodes 404 and 405 . as described before , the parameters of the ion source electrodes can be adjusted to create positive ions , negative ions or both . sensor electronics 406 are coupled to the electrodes 424 and 425 to detect changes in the current and set off an alarm if a threshold of smoke particles is detected . fig5 illustrates a third embodiment that is similar except it has a smaller area and thus the capacitance will be lower . the + and − lines may be easily patterned using standard photoresist - patterned metal lines 504 , 505 on glass substrates , or by screen printing . design factors , such as the gap between electrode plates and the spacing between the electrodes on the same plate , may be varied . the drive parameters , such as the bias level , frequency and duty factor , may be easily varied to achieve optimal conditions . the electrodes 504 , 505 may be operated in dc or ac mode , or in an ac mode with a dc offset . in this design , an insulating substrate may be required to maintain the potentials on the separate electrodes . gas 507 may be forced through the gap in one direction or there may be no forced flow at all and left open to the prevailing air currents in the room , entering the gap from any direction . a cnt coating 503 is deposited on the electrodes 504 , 505 in a desired manner . fig6 a illustrates two metal grids 601 , 602 that are parallel to each other ; one or both may be coated with cnts 603 . if the other grid is coated , then the coating would face the coating on the other grid . the gas flow 607 is through the grids 601 , 602 . once the grid material is chosen , the only mechanical parameter that may be changed is the gap between the grids 601 , 602 . as with extraction grids used for vacuum microelectronics , such as displays and x - ray tubes , a good rule of thumb is that the grid dimension ( size of grid openings ) is about the same as the gap between the grids . the metal grids 601 , 602 or electrodes may be operated in dc or ac mode , or in an ac mode with a dc offset . the drive parameters , such as dc voltage bias level , ac or dc potential and frequency of ac signal may also be optimized . this design allows for easy flow of gas through the grid . fig6 b illustrates an embodiment similar to the embodiment illustrated in fig6 a except there is only one “ grid ” that comprises cnt coated wires 610 , 611 that are biased relative to each other . referring to fig7 , several grids may be used , spaced apart from each other similar to the 2 - grid design shown in fig6 a . the grids may be biased opposite each other (+ then − then + and so on ). fig7 shows the cnt coating on selected surfaces , but the cnt coating may be on both sides of the grid . the bias between the grids may be dc , or it may be ac or could be ac with a dc offset . the embodiments described herein detect smoke in the same way that the prior art detects smoke , but from monitoring the change in current through one or more of the grids or electrodes . for example , if electrons are emitted into the gas on a negative electrode , this would create negative ions that would be collected at the positive grid or electrode . however , if there is smoke present , then the negative ions may react with the smoke particles ( typically carbon particles or hydrocarbon aerosols ) and neutralize or mask the negative charge to create neutral particles ; thus no current would arrive at the positive electrode . the current at each electrode may be monitored , and if a current decreases below a set value , an alarm may be triggered . fig8 illustrates a block diagram of sensor electronics 406 that may be utilized within each of the embodiments illustrated in fig4 , 5 , 6 a , 6 b . 7 and 11 . fig9 illustrates a detailed circuit diagram of the sensor electronics of fig8 . fig1 illustrates a detailed circuit diagram of the analog comparator 802 within the sensor electronics 406 . fig1 illustrates a detailed circuit diagram of the digital latch 803 of the sensor electronics 406 . as can be seen from fig8 - 11 , any of the embodiments of the smoke detector described above may be coupled to the sensor electronics 406 at the sensor inputs 801 . an alarm 804 or some other type of external output 805 may be the result for output from the sensor electronics 406 when a threshold current level is detected at senor input 801 , as predetermined by a threshold detection set point 806 . a further description of the sensor electronics 406 , including the component parts of the analog comparator 802 and digital latch 803 are not further described herein for reasons of brevity . the sensor electronics 406 are to be designed to receive an input from a smoke detector using cnt coatings , as described herein , and provide an appropriate output in order to make the smoke detector practically effective . the design of such sensor electronics is not pertinent to an understanding of the present invention . other sensor electronics may be substituted in order to arrive at the same result . fig1 illuminates a combination smoke detector that combines the cnt - based ionization smoke detector ( see fig4 . 5 , 6 a , 6 b , and 7 ) with one or more other sensors or smoke detector technologies . some fires give off gases as incipient indicators of a fire . the smoke from the fire may be different depending on what is burning . some fires give off heavy black smoke ; other fires may give of a gray smoke or very little at all . the combination of tie different sensors will help sense a fire faster while at the same time lower the chances of a false alarm . the combination sensor will also have the lo possibility of determining what kind of fire is present and relay this information to 911 or a subscription security service . a number of embodiments of the invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention .
| 6 |
an aqueous solution containing 4 - 8 % glacial acetic acid is commercially available in drug stores as vinegar ( ch 3 cooh + h 2 o ). it is theorized that the vinegar will upset the physiological balance of the insect and may also be effective in upsetting the circulatory system . particularly when the vinegar is combined with limonene extract and particularly the mint extract which appears to be more effective , this mixture penetrates the spiracles causing an insult to the body systems of the insect which is incompatible with life . the oil acts as a carrier for the mixture to enable penetration through the spiracles . a collection of 672 active honey bees were taken from a hive and placed in an 11 . 97 ml glass container with an 11 . 43 cm diameter opening . the container was covered with a cotton mesh to allow for ventilation . some bees clustered at various areas of the container while others flew about . a great buzzing noise was audible from the container . the bees were then sprayed through the mesh opening with the named solution i . within twenty seconds , most of the bees flew to the bottom of the container and after two minutes , forty seconds , two bees maintained flying ability . at three minutes , 22 seconds , only one bee was flying . at four minutes , none of the bees had flying ability . buzzing noise remained strong . at six minutes , abdomens having rapid in - and - out movement ( one hundred ten over a one minute count ) exhibited great inability to walk and buzzing noise was less audible . all of the bees exhibited the same behavior , some sooner than others . some attempted to fly but could only flap their wings . some attempted to walk but could not hold themselves up and collapsed . they formed an almost perfect ring on the outer portion of the base of the container , piling up on one another . the stronger and more resilient went toward the center base and attempted normal activity . after fifty - two minutes , none of the bees were able to walk and many appeared dead . the active bees continued to crawl over one another , some still attempting to spread their wings . prior to their death , they took a supine position , had rapid erratic movement of their extremities and curled the distal portion of their bodies inward once or twice . they gradually become more inactive and passive . total cessation of all movement of the 672 bees took three and one - half hours . a collection of 127 active honey bees were taken from a hive and placed in a 3 . 78 liter container with a 9 . 53 cm opening that was covered with cotton mesh to allow for ventilation . twenty - five bees clung to the mesh covering , others clustered at various areas of the container . the named solution was sprayed through the mesh opening . the bees at the mesh opening rapidly dropped ; some hanging on to one another forming a chain . all but seven bees dropped to the bottom of the container and exhibited the same behavior as described in example 1 . after twenty minutes , three bees remained at the mesh opening . after thirty minutes , one bee remained at the opening . after fifty minutes , the last bee dropped to the bottom of the container . prior to death , all exhibited the same behavior as described in example 1 . when named spray was used outdoors and sprayed directly at the vespa ( wasp , yellow jacket ) and apis ( bee ), they became disoriented and had erratic flying behavior . they were unable to fly straight , some dropping to the ground and others attempting to fly away . they seemed to communicate the danger to one another . visible insects would not come near the sprayed area . during the late summer , the vespa ( wasp , yellow jacket ) were more aggressive , especially when humans would dine outside . they were more difficult to control so spraying became more effective when the dining or sitting area was sprayed prior to human use . when the spray solution was used in this manner , there seemed to be an invisible wall and when the vespa ( wasp , yellow jacket ) or apis ( bee ) would come close , the area seemed to have an invisible wall which made the insects fly away as soon as they came in contact with the sprayed area . occasionally one or two bees or wasps would penetrate the sprayed area but would leave immediately when sprayed again , either by dropping or flying away . it was also noted in the open outdoor area that the spray was effective against other insects , including the mosquito which was effected in apparently the same manner in which the honey bees and yellow jackets were effected , although clinical studies were not conducted thereon . one hundred thirty - eight ( 138 ) active bees were taken from a hive and were placed in a 3 . 78 ml . glass container with a 9 . 53 cm diameter opening that was covered with cotton gauze to allow ventilation . the bees were flying about . a loud buzzing noise was audible . the bees were mist sprayed once with a solution ii : after 5 seconds , bees were dropping and flying to base of container . after 1 minute , eleven ( 11 ) of the bees were at the center of base of container . the remaining bees formed a ring at the outer aspects of the base of container and took a supine position . after 2 minutes , all the bees were exhibiting the same pre - death behavior as described in example number 1 . after 3 minutes , all but six ( 6 ) of the bees appear dead . these six bees had slight movement of extremities . after 9 minutes , two ( 2 ) bees continue slight movement of extremities . after 10 minutes there was no movement . they had a shrivelled appearance . death was instant for all but six of the bees . the anise mixture had a very pleasant aroma . one hundred twenty - seven ( 127 ) honey bees were taken from a hive and placed in a 3 . 78 ml . glass container with a 9 . 53 cm diameter opening that was covered with cotton gauze to allow ventilation . the bees were loudly buzzing and flying about . solution iii consisted of : 10 cc of 70 % solution of c 2 h 5 oh . this mixture was further blended with 10 cc 5 % acetic acid and 10 cc of h 2 o . the mixture , while not foul smelling , did not have a pleasant aroma . the bees were mist sprayed with solution iii . after 2 minutes , all bees remain active . six ( 6 ) bees remain at top of container at gauze opening . after 3 minutes , bees were sprayed a second time . two remain at top of container . most remain active . one bee attempting to fly . all bees have rapid erratic movement . after 7 minutes , two ( 2 ) bees remain at gauze of container opening . one ( 1 ) bee was attempting to fly . after 9 minutes , no bees at top of container . buzzing noise less audible . the bees formed a ring at outer aspects of base of container . after 10 minutes faint buzzing noise audible . after 20 minutes ring formation at base of container unchanged . all of the bees appear to be dying . all are in supine position exhibiting the same pre - death behavior as described in example number 1 . after 36 minutes the bees appear to be shrivelling , all in a supine position . after 90 minutes , eight ( 8 ) bees have slight movement . one ( 1 ) bee attempted to walk . all others are dead . one hundred twenty - one ( 121 ) active honey bees were taken from a hive and placed in a glass 3 . 78 ml . container with a 9 . 53 cm diameter opening that was covered with cotton gauze to allow ventilation . loud buzzing noise was audible . bees were then sprayed with solution iv : 1 part glacial acetic acid . within five ( 5 ) minutes the buzzing noise decreased . some bees attempted flying . bees were mist sprayed a second time . fourteen ( 14 ) minutes later , bees had formed a ring at base of container and exhibited the same behavior prior to death as described in example number 1 . after 41 minutes all bees were dead . one hundred twenty - eight ( 128 ) active honey bees were taken from a hive and placed in a 3 . 78 ml . glass container with a 9 . 53 cm diameter opening that was covered with cotton gauze to allow ventilation . loud buzzing sound was audible . the bees were then sprayed with solution v : 50 % pure mint and pure peppermint extract ( essential oils in ethyl alcohol solution ) and 50 % h 2 o . after 3 minutes , loud buzzing noise was audible and some bees attempted to fly . after 5 minutes buzzing continued . activity slowed , but all bees are active . after 1 minute activity resumed . within 30 minutes bees actively flying about . one hundred twenty - one ( 121 ) active honey bees were taken from a hive and placed in a 3 . 78 ml . glass container that was covered with cotton gauze to allow ventilation . bees were then sprayed with solution vi : after spraying bees , noise remained loud . all the bees were active , none were flying , some were falling to base of container . after 1 minute , bees were given three mist sprays . all bees were active , crawling on all areas of jar making a great humming noise ; none are grouped together . after 3 minutes some bees are clustering on bottom of container . after 5 minutes , more bees dropped to base of container . noise very audible . bees continue to drop , cluster , and crawl over one another , remaining active . many remain at top of container opening clinging to gauze . after 13 minutes , more bees clustering at base grouping together at left of base , some bees flying . after 25 minutes , all but eleven ( 11 ) bees were at the base of container . after 26 minutes , fifteen ( 15 ) bees actively climbing sides of container ; none are flying . seven ( 7 ) bees remain at top of container ; buzzing noise decreasing . after 29 minutes most of bees at base of container , crawling over one another . after 30 minutes , five ( 5 ) bees at top of container clinging to cotton gauze . after 34 minutes , one ( 1 ) active bee at top of container , buzzing audible , some bees attempting to fly . after 36 minutes , one ( 1 ) bee flying and one ( 1 ) bee remaining at cotton gauze . after 38 minutes , seven ( 7 ) bees attempting to crawl up sides of container . after 39 minutes , bees clustering in an oval formation at container base and up one side of container . after 46 minutes all bees clustered together . one bee attempting to fly . after 54 minutes , three ( 3 ) bees attempting activity . all remaining bees clustered at base . after 57 minutes , four ( 4 ) bees away from group attempting normal activity . after 64 minutes , eight ( 8 ) bees left cluster and attempted activity . bees were given 10 mist sprays . one bee attempted flying , nine ( 9 ) bees attempting activity . all other bees clustered on half of base of container . after 1 hour 17 minutes , one ( 1 ) bee attempting great activity , two ( 2 ) bees attempting activity . all other bees forming smaller clusters . after 1 hour 22 minutes , clustering in two groups at base of container - some attempting to leave their cluster and trying to attempt normal activity . after 1 hour 25 minutes , seven ( 7 ) bees attempting activity , they remained clustered at base , many have movement . after 1 hour 38 minutes , seven ( 7 ) bees still attempting activity , remaining bees have little movement . one bee is flying . after 1 hour 55 minutes , the bees are gradually making recovery . bees are moving and clustering up side of container . after 6 hours bees becoming more active with greater attempt at normal activity . no bees appear dead . after 9 hours 30 minutes all bees have fully attained and resumed normal activity , flying about and buzzing loudly . one hundred fifty - three ( 153 ) active honey bees were taken from a hive and placed in a 3 . 78 ml . glass container with 9 . 53 diameter opening which was covered with cotton gauze to allow ventilation . solution vii : 1 cc pure olive oil was dissolved in 5 cc of 190 % proof pure c 2 h 5 oh . this mixture was further combined with 5 cc pure glacial acetic acid and 200 cc of h 2 o . after 1 minute all bees sat in the base of container . after 4 minutes , five ( 5 ) bees returned to top of container . after 6 minutes bees have less activity , very audible buzzing noise . after 10 minutes , two ( 2 ) bees at top of container . remaining bees formed two clusters at base of container . noise less audible . after 17 minutes , one bee attempted flying . many attempting to spread wings . after 25 minutes exhibiting less activity . one bee flying . twelve bees are now in one cluster , remaining bees had clustered at opposite side of container . eight bees are attempting activity . after 34 minutes , six bees are attempting activity . two bees attempting to fly in short spans . after 35 minutes bees were sprayed again . fourteen bees attempted to climb opposite side of container where bees are clustered . after 45 minutes , all bees clustered on one side of container . two bees attempting activity . one bee attempting to fly . after 1 hour 10 minutes , three bees appeared dead in supine position , exhibiting the same pre - death behavior as described in example number 1 . after 1 hour 20 minutes , all bees completely immobilized , all grouped together at outer aspects of base of container having very little movement . after 4 hours 40 minutes , three bees died . all remaining 150 bees resumed normal activity , flying about and buzzing loudly . bees were then placed outside to fly away . some bees did not leave container . some flew away and three bees died after leaving container . approximately 90 active honey bees were taken from a hive and were placed in a 3 . 78 ml glass container that was covered with cotton gauze to allow for ventilation . bees were mist sprayed with this solution . many of the bees flew to the base of the container . many bees clung to gauze at the top of the container . bees remained active at base of container . none flying . after 1 minute , three additional mist sprays were given . bees very active , crawling over all areas of container . audibly loud buzzing . none of the bees grouped . after 3 minutes , some bees were clustered at the base of the container . none are flying . after 5 minutes , bees continue to drop from cotton gauze covering to the base of the container . many still remain clinging to cotton gauze . after 14 minutes , more bees clustering at one side of base . more of the bees are grouped together . some flying activity . after 30 minutes , recovery activity increasing . ten ( 10 ) mist sprays given through mesh gauze . all but nine ( 9 ) bees flew and fell to the base of container . grouping and crawling over one another . after 50 minutes , no bees at top of container . one bee attempting to fly . two bees attempting activity . after 1 hour , bees are clustered and quiet . three bees away from others -- attempting normal activity . no flying ability . bees moving in a cluster up one side of glass container . after 2 hours 30 minutes , bees becoming more active . normal activity increasing . none of the bees appear dead . after 3 hours 30 minutes , all of the bees have recovered . flying about container , buzzing loudly . normal activity resumed . the initial spray of this solution repelled the bees . additional sprays immobilized them . bees were taken outside to fly away . two bees stayed initially in the glass container ; three bees flew out of container to the ground and died . the remaining bees flew into the environment . one hundred twenty - four ( 124 ) active honey bees were taken from a hive and placed in a 3 . 78 ml glass container with an opening of 9 . 53 cm that was covered with cotton gauze to allow for ventilation . bees very active , buzzing loudly and flying about glass container . within five ( 5 ) seconds , bees dropped and flew to the base of container forming a ring at the outer aspects of container . all of the bees took a supine position . after 1 minute 50 seconds , all of the bees were exhibiting pre - death behavior . after 2 minutes 45 seconds , five ( 5 ) bees have slight movement of their extremities ; remaining bees appear dead . after 4 minutes , three ( 3 ) bees continue to have slight movement of extremities . after 8 minutes , all movement had ceased . all of the bees had a shriveled appearance . with one mist spray of above described solution , death was instant for all but five ( 5 ) bees , who maintained slight movement .
| 0 |
the present invention relates to compressed air systems . in particular , the present invention relates to an air compressor that uses lubricating oil and to a method and apparatus for preventing migration of oil from the compressor to the compressed air output . the present invention is applicable to air systems of differing constructions . as representative of the invention , fig1 illustrates schematically an air system 10 that is a first embodiment of the invention . the system 10 includes a compressor 12 for compressing inlet air from an inlet line 14 . compressed air from the compressor 12 flows through a discharge line 16 line to a reservoir 18 . the reservoir 18 is connected to various system devices as shown schematically at 20 , such as vehicle brake chambers , that use compressed air to operate . a governor 22 is operative to control operation ( loading and unloading ) of the compressor 12 , in response to sensed pressure in a line 26 from the reservoir 18 , via a control line 24 . fig2 shows schematically the compressor 12 and an apparatus 60 for removing oil from the compressed air output of the compressor 12 , being a first embodiment of the invention . the compressor 14 includes a block 32 and a cylinder head 34 . the cylinder head 34 includes portions not shown including an inlet passage connected with an inlet port , and a discharge passage connected with a discharge port . the inlet passage and the discharge passage are connected in fluid communication with the swept volume of a cylinder 36 in the block 32 . a piston 38 is reciprocable in the cylinder 36 , upon rotation of a crankshaft 40 , to compress air flowing between the inlet port and the discharge port . the compressor 12 has an unloader valve 50 that is normally closed . when the unloader valve 50 is closed , it blocks flow of air out of the cylinder 36 through an unloader passage 52 , so that the air in the cylinder 36 can be compressed by the piston 38 . the compressor 12 has an unloader port 54 for receiving an air pressure unloader signal over the control line 24 , to open ( actuate ) the unloader valve 50 . when the unloader valve 50 is actuated , in conjunction with operation of a discharge valve shut - off system , air can flow out of the cylinder 36 through the unloader passage 52 , thus disabling the flow of compressed air out of the compressor to the vehicle braking system air even when the piston 38 continues to reciprocate . the unloader port 24 also communicates with a discharge port shut - off valve to shut off the discharge port when in the unloaded mode . the compressor 12 , including the piston 38 and cylinder 36 , is lubricated by a lubricant ( not shown ) from a source , such as engine oil from the engine lubrication system 10 . typically a small amount of the lubricating oil flows out of the cylinder 36 ( migrates ) into the compressed air output of the compressor 12 . the system 10 includes an apparatus 60 for removing oil from the air in the system . in the illustrated embodiments , the apparatus 60 is shown as associated with the compressor 12 ; in other embodiments , the apparatus 60 could be located or associated elsewhere in the system 10 . the apparatus 60 includes an unloaded mode delivery chamber or oil removal chamber 62 . the chamber 62 is a volume defined by chamber walls 64 . the chamber 62 is in fluid communication with the unloader passage 52 when the unloader valve 50 is open as shown in fig2 . the chamber walls 64 may be formed as one piece with the compressor block 32 , as shown in fig2 . alternatively , the chamber walls 64 may be formed separately from the cylinder block 32 . a drain port or passage 66 at the bottom of the chamber 62 communicates with the compressor crank case 68 . a condensed oil drain valve 70 is located between the oil removal chamber 62 and the compressor crank case 68 . the valve 70 is controlled by an air pressure unloader signal from the governor 22 over the control line 24 . in the embodiment shown in fig2 , a filter element 74 is located in the chamber 62 . the filter element 74 may be any element suitable for filtering or coalescing oil from air . a regenerative aluminum filter is one example . when the pressure in the reservoir 18 is high enough that further supply of compressed air is not needed for the devices 20 , the discharge valve of the compressor 12 is closed , and air pressure is applied at the unloader port 54 , opening ( actuating ) the unloader valve 50 . air that would otherwise be compressed in the cylinder 36 and delivered out the discharge port is not so compressed . instead , air from the cylinder 36 is , on the piston up - stroke , delivered to the oil removal chamber 62 via the unloader passage 52 , which is open because of the opening of the unloader valve 50 . the air flows into the oil removal chamber 62 . as the air expands into the oil removal chamber 62 , it cools . some of the oil in the air condenses out and collects in the chamber 62 . the chamber 62 is preferably maintained at a lower temperature than the cylinder 36 , by being external to the cylinder . this can aid in the condensing of the oil . in addition , oil in the air can be filtered , that is , physically captured by the filter element 74 . on the piston down stroke of the piston 38 , the air in the chamber 62 expands back into the cylinder 36 . this process repeats with each cycle of the piston 38 . when the compressor 12 is thus in the unloaded mode , the pressure in the oil removal chamber 62 cycles constantly , at the frequency of the compressor operation , from one atmosphere to about 4 - 6 atmospheres . in this manner , at least a portion of the oil is removed from the air that is discharged from the cylinder 36 on the piston up - stroke . this can reduce or minimize the amount of oil that migrates into the air flowing into the downstream parts of the system 10 . when the compressor 12 is in the loaded mode , the unloader valve 50 is closed and compressed air is delivered out of the discharge port . during the loaded cycle , oil that was entrained in the filter 74 , as well as oil collected in the chamber 62 , can drain back into the crank case 68 . specifically , when the compressor 12 is loaded , the unloader valve 50 is closed and the drain valve 70 is opened . oil collected in the chamber 62 is allowed to drain from the chamber to the compressor crank case 68 . fig3 and 4 illustrate oil removal apparatus 60 that are other embodiments of the invention . features or alternatives shown in these embodiments can be substituted for or combined with , in any suitable combination , features of the embodiment of fig2 . fig3 illustrates an oil removal apparatus 60 a associated with a compressor 12 a . parts of the apparatus 60 a and the compressor 12 a that are the same as , or similar to , parts of the apparatus 60 and compressor 12 , are given the same reference numerals with the suffix “ a ” attached . in the embodiment of fig3 , the oil removal chamber 62 a is defined by walls 64 a that are formed separately from the compressor block 32 a . in addition , the chamber walls 64 a are spaced apart from the cylinder block 32 a to define a space or air gap 80 between them . this air gap 80 helps to cool the chamber 62 a . further , the chamber walls 64 a are provided with cooling fins 82 to help promote cooling of the chamber 62 a . greater temperature differential between the chamber 62 a and the cylinder 36 a can help to increase oil removal . the apparatus 60 a also includes an oil drain passage 66 a that does not connect the chamber 62 a with the compressor crank case 68 a . rather , the oil drain passage 66 a opens to a port 84 on the exterior of the compressor 12 a . an oil line ( not shown ) can be connected to the port 84 to deliver removed oil back to the lubrication system from which it came , for example , the engine lubrication system . fig4 illustrates an oil removal apparatus 60 b associated with a compressor 12 b . parts of the apparatus 60 b and the compressor 12 b that are the same as , or similar to , parts of the apparatus 60 and compressor 12 , are given the same reference numerals with the suffix “ b ” attached . in the embodiment of fig4 , the oil removal chamber 62 b is defined by walls 64 b that are formed separately from the compressor block 32 b . in addition , the walls 64 b are spaced apart from the cylinder block 32 b . a water jacket 86 at least partially surrounds the chamber walls 64 b . the water jacket 86 can be connected with the cooling system of the compressor 12 itself . the water jacket 86 helps to cool the chamber 62 b . the water jacket 86 is one example of a cooling system that can be used . from the above description of the invention , those skilled in the art will perceive improvements , changes , and modifications in the invention . such improvements , changes , and modifications within the skill of the art are intended to be included within the scope of the appended claims .
| 5 |
hereinafter the preferred embodiments of the present invention will be described with reference to the appended drawings . in this specification , not only does recording mean a process for forming various kinds of images , whether the images have a meaning or not , or whether or not the images are visible , that is , whether or not the images can be detected by the human eye . in other words , it means the process for forming various kinds of images , including the process of treating recording medium itself . the meaning of “ recording medium ” is not limited to the paper used by an ordinary recording apparatus . that is , it includes a much wider range of medium , for example , fabric , plastic , film , metallic plate , glass , ceramic , lumber , leather , etc . in other words , it means anything on which an image can be formed with the use of ink . hereafter , “ recording medium ” may sometimes be referred to as “ paper ”. further , “ ink ” or “ liquid ” should be as widely interpreted as the above described meaning of recording . they include any liquid which can form images , that is , meaningful and meaningless patterns , can treat recording mediums , and / or can treat ink itself or recording medium ( for example , improve images in terms of fixation , quality , color development , durability , etc ., by solidifying coloring ingredient of ink deposited onto recording medium ). fig1 is a perspective view of the ink container in the first embodiment as seen from the bottom side , and fig2 ( a ) and 2 ( b ) are side and bottom plan views of the ink container in the first embodiment . fig3 is a sectional view of the ink container , at a plane parallel to the side walls of the ink container . it should be noted here that in the following description of the preferred embodiments of the present invention , the front surface of an ink container means the surface which a user faces to operate the apparatus ( to mount or dismount ink container , or the like operation ). the ink container 1 in this embodiment has a to supporting member ( latching lever ) 3 attached to the bottom of the front surface . the latching lever 3 is an integral part of the ink container 1 , and is formed of resin . it is formed with the container proper of the ink container 1 . it is structured so that it can be elastically deformed toward the container proper of the ink container 1 as the ink container 1 is mounted into the ink container mount ( which hereinafter may sometimes be referred to as holder ) of a recording apparatus , or as the like operation is carried out . the ink container mount of a recording apparatus will be described later . the ink container 1 also has first and second projections 5 and 6 , which engage with the counterparts of the ink container holder . the first and second projections 5 and 6 are located on the back and front sides , respectively , of the ink container 1 . in this embodiment , the second projection 6 is an integral part of the latching lever 3 . the ink container 1 is securely anchored to the ink container holder by the engagement between the projections 5 and 6 of the ink container 1 and their counterparts of the ink container holder . the procedure for mounting the ink container 1 into the ink container holder will be described later referring to fig4 . the bottom wall of the ink container 1 is provided with an ink outlet 7 through which ink is released . the ink outlet 7 couples with the ink inlet of a recording head as the ink container 1 is mounted into the ink container holder . the recording head will be described later . the corner portion of the ink container 1 where the front and bottom walls of the container 1 meet is shaped as if it were chamfered ; the front and bottom walls are connected with a slanted wall 130 , the angle of which is roughly 45 °. the angle of this slanted wall is roughly the same as the angle at which the latching lever 3 extends from the bottom of the front surface . to this slanted wall 130 , an information storage medium 104 and a circuit board 100 are attached . the information storage medium 104 stores the information about the ink container itself . the circuit board 100 has multiple contact pads 102 as electrical contacts electrically connectible to the connector of the holder . in the case of the ink container shown in fig3 , the information storage medium 104 was sealed with protective sealant after it was attached to the circuit board 100 . referring to fig2 and 3 , the external surface of the slanted wall 130 of the ink container 1 , to which contact pad 102 is attached , is one of the surfaces of the ink container 1 which are not suitable as the surface on which the ink container 1 is rested . in other words , the contact pad 102 is attached to the surface of the ink container 1 , which is not suitable as the surface on which the ink container 1 is rested . therefore , attaching the contact pad 102 to the external surface of the slanted wall 130 is expedient from the standpoint of preventing such a problem as an accidental damage to the contact pad 102 . in addition , providing the ink container 1 with this slanted wall 130 gives the bottom wall of the ink chamber 11 a slanted portion , which will conceivably impel the ink toward the ink outlet 13 , contributing to the minimization of the amount of the ink which fail to be drawn out of the ink chamber 11 . in this embodiment , the angle of the slanted wall 130 is 45 °. in the case that the ink container 1 is structured so that the ink outlet 7 thereof protrudes outward as shown in fig3 , the slanted wall 130 does not come into contact with the surface of a desk or the like on which the ink container 1 might be placed , whether the ink container 1 is placed on the desk or the like so that the wall having the ink outlet faces downward , or the latching lever 3 faces downward ( obviously , this is only hypothetical because it is impossible to place the ink container in this manner because of presence of latching lever 3 ). further , as will be described later in detail , an angle of 45 ° is the best angle in that the vertical and horizontal components of the contact pressure between the contact pad 102 and the connector 152 of the holder 150 best balance with each other . the angle of the slanted wall 130 may be varied within a range in which the above described effect can be expected . however , in consideration of practicality , the amount of the deviation is desired to be within ñ5 °. as the ink container 1 is mounted into the ink jet recording apparatus , it becomes possible for the contents ( for example , expiration date of ink , amount of ink in container , ink color , etc ., usable for controlling various aspects of image forming process related to ink container ) of the information storage medium 104 to be transmitted to the ink jet recording apparatus . this information can be used by the ink jet recording apparatus for various purposes . for example , the information regarding the expiration date of the ink container 1 can be used to suggest that a user replace the ink container 1 in order to prevent the recording failure attributable to the discoloration of the ink , and increase in the viscosity of the ink . the information regarding the remaining amount of the ink can be used for informing a user of the insufficiency of the amount of the ink in the ink container , in order to prevent the user from suffering from the inconvenience of the interruption of a recording operation ( ink ejection ) attributable to ink depletion , during recording . further , the information regarding the color of the ink in the ink container 1 can be used for preventing unsatisfactory recording by informing a user of the mounting of an ink container containing ink different in color from the intended one . in other words , with such information as the above described in the information storage means being available to the recording apparatus , it is possible to always obtain a high quality recording . as the information storage medium 104 , various means can be used , for example , a magnetic medium , an photo - magnetic medium , an electrical storage medium , a mechanical switch as a dip switch , etc ., in other words , any means capable of storing information that can be exchanged between itself and an ink jet recording apparatus by being placed in contact with the contact portion of the ink jet recording apparatus . further , it may be a flush memory , or an instantly writable magnetic medium . however , when it is desired that not only is the information storage medium 104 capable of providing the recording apparatus with the information , but also , the information from the recording apparatus ( for example , the amount of ink remainder , ink usage , etc ., estimated based on image formation data ) can be written into the information medium 104 , or the information therein can be modified or erased , it is possible to employ an eeprom ( electrically erasable programmable rom ). referring to fig3 , the internal space of the ink container 1 is divided into the ink storage chambers 11 and 12 . the ink storage chamber 11 is on the front side where the cartridge anchoring latching lever 3 and circuit board 100 are located , whereas the ink storage chamber 12 is on the back side , and has the ink outlet 7 . the two ink storage chambers 11 and 12 are connected through a hole 13 . the ink storage chamber 11 is an empty space in which nothing but ink is stored . however , the ink storage chamber 12 is completely filled with an ink absorbent member 15 formed of sponge or the like , or completely packed with fine fiber , or the like , and ink is stored in the ink storage chamber 12 by being absorbed into the ink absorbent member 15 . the ink absorbent member 15 is for generating negative pressure by the amount in the range in which the negative pressure is large enough to prevent ink from leaking from the ink ejecting portion , in coordination with the ink retaining force of the meniscuses formed in the ink ejection nozzles of the recording head , and yet , small enough to allow the recording head to eject ink . the structure of the ink container 1 does not need to be limited to the above described one in which the internal space of the ink container 1 is divided into the ink storage chamber completely filled with the ink absorbent member , and the ink storage chamber which is nothing but an empty space . for example , it may be such that virtually the entirety of the internal space of the ink container 1 is completely filled up with the ink absorbent member . further , instead of employing an ink absorbent member as a negative pressure generating means , ink may be directly filled into a pouch , which is formed of elastic substance such as rubber , the resiliency of which acts in the direction to stretch the pouch wall so that its internal space increases . in such a case , the negative force is generated by the tensile force of the pouch . further , the ink container 1 may be in the form of an ink pouch , a part of the wall of which is formed of elastic material , and which is directly filled with ink . in this case , the negative pressure is generated by the resiliency of the elastic wall portion of the ink container . further , the ink container 1 may be a combination of a container proper and a pressure adjustment mechanism ( for example , one - way valve which opens as internal pressure of container proper falls below predetermined level ). in this case , ink is directly stored in the entirety of the internal space of the container proper , and the internal pressure of the container proper is maintained at a predetermined level by the pressure adjustment mechanism . referring to fig1 and 3 , the bottom wall of the ink chamber 11 is provided with an ink level detecting portion 17 , which is positioned so that it opposes the ink remainder detection sensor ( which will be described later ) of the main assembly of the recording apparatus when the ink container 1 is in the main assembly . in this embodiment , the ink remainder amount detection sensor is an optical sensor made up of a combination of a light emitting portion and a light receiving portion . the ink remainder amount detection portion 17 is formed of transparent or semitransparent material . more specifically , it is in the form of a prism , the shape and apex angles , etc ., of which are predetermined so that when no ink is in the ink storage chamber 11 , the beam of light emitted from the light emitting portion is accurately reflected to the light receiving portion ( which will also be described later ). fig4 ( a )-( c ) are schematic drawings for depicting the ink container mount ( holder ) of the recording head unit , into which the ink container is mounted , and the procedure for mounting the ink container into the mount ( holder ). generally , the recording head unit 105 is made up of the holder 150 which removably holds ink containers , and a recording head 105 a located under the bottom wall of the holder 150 . as the ink container 1 is inserted into the holder 150 , the ink container anchoring first and second projections 5 and 6 of the ink container 1 engage with the ink container anchoring portions 155 and 156 , respectively , of the holder 150 which is an integral part of the recording head unit 105 comprising the recording head 105 a . as a result , the ink container 1 is firmly anchored to the holder 150 . at the same time , the ink inlet 107 of the recording head , which is located at the bottom of the holder 150 , couples with the ink outlet 7 of the ink container 1 , creating thereby an ink passage between the recording head 105 a and ink container 1 . also during the insertion of the ink container 1 into the holder 150 , the connector 152 of the holder 150 comes into contact with the contact pad 102 on the outwardly facing surface of the circuit board 100 , establishing electrical connection between the holder 150 and ink container 1 . next , the process through which the ink container 1 is precisely positioned relative to the holder 150 as the ink container 1 is mounted into the holder 150 will be described . when mounting the ink container 1 into the recording head unit 105 , the ink container 1 is to be inserted into the ink container compartment of the holder 150 from above ( fig4 ( a )) so that the ink container anchoring first projection 5 on the back surface of the ink container 1 will be inserted into the ink container anchoring first portion 155 , in the form a through hole , on the back wall of the holder 150 , and also , so that the ink container anchoring projection 6 of the latching lever 3 rests on the top edge of the front wall of the holder 150 ( fig4 ( b )). then , the ink container 1 is to be pressed down by the top front end of the ink container 1 in the direction indicated by an arrow mark p . as the ink container is pressed , the ink container 1 rotates in the direction indicated by an arrow mark r , with the contact point between the ink container anchoring first projection 5 of the ink container 1 and the ink container anchoring first portion 155 of the holder 150 serving as the center of rotation . as a result , the front side of the ink container 1 moves downward faster than the back side of the ink container 1 . while the ink container 1 is downwardly moving as described above , the latching lever 3 on the front side of the ink container 1 , is elastically deformed in the direction indicated by an arrow mark q , because the front surface of the ink container anchoring second projection 6 of the latching lever 3 of the ink container 1 remaining in contact with the top front edge of the front wall of the holder 150 , being therefore pressed by the reaction force generated as the ink container 1 is pressed . then , as the top edge of the ink container anchoring second projection 6 of the ink container 1 is moved past the top edge of the front wall of the holder 150 , and brought to the hole 157 located below the top edge of the front wall of the holder 150 , the latching lever 3 elastically deforms in the direction indicated by a arrow mark q ′ due to its own resiliency , snapping into the hole 157 . as a result , the projection 6 becomes locked with the top edge of the hole 157 ( top edge of hole 157 constitutes ink container anchoring second portion 156 ). obviously , the ink container anchoring second portion 156 may be the top edge of the hole of the front wall of the holder 150 as it is in this embodiment , or the front wall of the holder 150 may be provided with a small rib or projection capable of anchoring the projection 6 of the ink container 1 . when the ink container 1 is in the state shown in fig4 ( c ), the ink container 1 is kept pressured in the horizontal direction ( direction indicated by an arrow mark y ) by the ink container anchoring second portion 156 , more specifically , the resiliency of the latching lever 3 sandwiched between the container proper of the ink container 1 and the font wall of the holder 150 . as a result , the back wall of the ink container 1 is kept in contact with the back wall of the holder 150 . as for the angles of the back walls of the ink container 1 and holder 150 , the walls have only to be intersectional to the direction in which the ink container 1 is kept pressured by the latching lever 3 . however , from the standpoint of the level of preciseness with which the ink container 1 is positioned relative to the holder 150 , the walls are desired to be perpendicular to the direction in which the ink container 1 is kept pressured by the latching lever 3 . further , as the ink outlet 7 of the ink container 1 couples with the ink inlet 107 of the recording head 105 a , the elastic ink absorbent member in the ink outlet 7 comes into contact with the ink inlet of the recording head 105 a , being thereby compressed . as a result , the ink container 1 is subjected to the pressure generated by the absorbent member in the ink outlet 7 in the direction indicated by an arrow mark z in fig4 ( c ), that is , the upward pressure . however , this upward pressure generated by the ink absorbent member is negated by the ink container anchoring first portion 155 in engagement with the ink container anchoring first portion 5 , and the ink container anchoring second portion 156 in engagement with the ink container anchoring second projection 6 . in other words , the state of the ink container 1 shown in fig4 ( c ) is the state of the ink container 1 at the completion of the mounting of the ink container 1 into the recording head unit 105 . in this state , the ink outlet 7 and ink inlet 107 are in contact with each other , and so are the pad 102 and connector 152 . as described above , during the mounting of the ink container 1 , the above described reactive force acts on the ink container . therefore , if the ink container 1 is released before the ink container anchoring second portion 6 of the latching lever 3 engages with the ink container anchoring second portion 156 , in other words , before the mounting of the ink container 1 is completed , the ink container 1 will pop up from the holder 150 because of the pressure generated by the ink absorbent member in the direction indicated by the arrow mark z , that is , the direction to push the ink container 1 upward , informing an operator of the incomplete mounting of the ink container 1 , and therefore , ensuring that the ink container 1 is satisfactorily mounted . in addition , the fact that the surface of the ink container anchoring portion 6 , which remains in contact with the top edge of the back wall of the holder 150 , is tilted so that the closer to the bottom wall of the ink container 1 , that is , the wall having the ink outlet 7 , a given point of the surface is , the closer to the container proper the given point of the surface is , also contributes more or less to the upward force which causes the ink container 1 to pop up if the ink container 1 is released before the completion of the mounting of the ink container 1 . also when the ink container 1 is in the state shown in fig4 ( c ), the ink remainder detection portion 17 , in the form of a prism , of the bottom wall of the ink container 1 opposes the ink remainder amount detection sensor of the main assembly ( holder 150 ) of the recording apparatus . thus , it is possible for the beam of the light emitted from the light emitting portion to enter the ink remainder detecting portion 17 in the form of a prism , be reflected ( deflected ) by the first surface of the portion 17 , be reflected ( deflected ) by the second surface of the portion 17 , and then , enter the light receiving portion of the sensor . to describe the movement of the ink container 1 , shown in fig4 ( c ), which occurs during the mounting of the ink container 1 into the recording head unit 105 , compared to the principle of action of a lever , the contact point between the ink container anchoring first portion 5 of the ink container 1 and the ink container anchoring first portion of the holder 150 constitutes the fulcrum , and the point of the front side of the ink container 1 , by which the ink container 1 is pressed by an operator constitutes the force application point . further , the contact point ( area ) between the ink outlet 7 and ink inlet 107 constitutes the point of action , which is located between the point of force application and fulcrum , preferably being near the fulcrum so that as the ink container 1 is rotationally moved into the holder 150 , the ink outlet 7 is pressed onto the ink inlet 107 by a substantial amount of force . generally , the joint portion ( opening ) of the ink outlet 107 is fitted with a combination of a filter and a relatively flexible and elastic member , such as a piece of absorbent material , a seal , or the like , in order to ensure that ink is allowed to flow from the ink container 1 to the recording head 105 a , and that ink does not leak from the joint between the ink container 1 and recording head 105 a . in view of the purpose of mounting the ink container 1 into the recording head unit 105 ( holder 150 ), it is desirable to employ such a structural arrangement and an ink container mounting process as those described above for applying a relatively large amount of force in order to elastically deform the portions of the ink container 1 relevant to the formation of the ink passage between the ink container 1 and recording head 105 a , and the prevention of ink leakage from the joint between the ink outlet 7 and ink inlet 107 . further , after the completion of the mounting of the ink container 1 into the recording head unit 105 , the ink container 1 is prevented from becoming loose from the holder 150 , by the ink container anchoring first portion 5 having engaged with the ink container anchoring first portion 155 , and the ink container anchoring second portion 6 having engaged with the ink container anchoring second portion 156 . therefore , the aforementioned elastic members remain properly compressed ( elastically deformed ); for example , the absorbent member in the ink outlet 7 remains optimally compressed by the ink inlet 107 ( combination of filter and tip of ink outlet , if tip of ink inlet 107 is fitted with filter ), or the sealing member fitted around the tip of the ink inlet 107 remains optimally compressed by the ink outlet 17 ( if the tip of the ink inlet 107 is fitted with the sealing member ). on one hand , the pad 102 and connector 152 are metallic members which are relatively high in rigidity , and highly conductive of electricity , and a high level of electrical conductivity must be established between them . on the other hand , applying an excessive amount of pressure to achieve such a level of conductivity is not desirable from the standpoint of damages and durability . thus , in this embodiment , the pad 102 and connector 152 are placed as far away as possible from the fulcrum , that is , they are placed in the adjacencies of the front wall of the ink container 1 , in order to optimize the contact pressure between them , that is , make the contact pressure as small as possible without jeopardizing the conductivity . more specifically , the contact pad 102 is disposed on the external surface of the slanted wall 130 extending from the farthest point of the bottom wall of the ink container 1 from the ink container anchoring first portion 5 . therefore , when mounting the ink container 1 into the holder 150 , the contact pad 102 comes into contact with the connector 152 right at the end of the process of mounting of the ink container 1 into the holder 150 . with the provision of the above described structural arrangement , the force generated by the contact pressure between the contact pad 102 and connector 152 in the direction of the ink container anchoring first portion 5 ( direction of arrow mark y ) is a component of the force f generated by the contact pressure between the contact pad 102 and connector 152 in the direction perpendicular to the slanted wall 130 . in other words , the above described structural arrangement can minimize the problem , mentioned in the description of the japanese laid - open patent application 2001 - 253087 , that is attributable to the relationship between the amount of the resiliency of the latching lever and the amount of the contact pressure between the contact pad 102 and connector 152 ; it virtually eliminates the problem , ensuring that the contact pad 102 and connector 152 are correctly connected to each other in terms of electrical conductivity . in addition , according to the above described structural arrangement , the relationship between the positional relationship between the contact pad 102 and the ink container anchoring second portion 6 of the latching lever 3 , and the positional relationship between the connector 152 of the holder 105 and the ink container anchoring second portion , is such that the contact pad 102 comes into contact with the connector 152 immediately before the completion of the process of mounting the ink container 1 into the holder 150 , causing thereby the contact pressure between the contact pad 102 and connector 152 to be generated after the completion of the process ( after completion of engagement between ink container anchoring second portion 6 and ink container anchoring second portion 106 of holder 150 ). therefore , it is extremely unlikely that the ink container 1 will fail to be precisely positioned in the holder 150 as described above , and / or that ink fail to be satisfactorily supplied to the recording head due to the misalignment between the ink outlet 7 of the ink container 1 with the ink inlet 107 of the holder 107 . in addition , the above described structural arrangement ensures that the ink container 1 is precisely positioned relative to the electrical contacts of the connector . therefore , the contact pressure remains stable , eliminating the possibility that connective failure will occur in terms of electrical conductivity . further , the above described structural arrangement prevents the ink remainder detecting portion 17 in the form of a prism from deviating in position . therefore , the possibility is extremely small that the ink remainder amount will not be detected at all or will be incorrectly detected due to the misalignment between the light path and light receiving portion of the ink remainder detecting portion 17 . further , the above described structural arrangement in accordance with the present invention can solve the problems that occur when the structural arrangement disclosed in japanese laid - open patent application 2 - 178050 is employed without modifications , that is , the problem that occurs as the information storage medium and / or contact pad is placed on the bottom surface of an ink container , in other words , the problems that during the mounting of an ink container , the ink outlet comes into contact with the connector ; and / or that short circuit occurs because of the ink leakage from the ink outlet , or the like . the reason why the abovementioned problems are solved is all because the connector 152 in this embodiment is located at a level which is a step higher from the bottom wall of the holder 150 . moreover , in the case that the information storage medium and / or compact pad is placed on the bottom surface of the ink container , even if they are positioned as far as possible from the first ink container anchoring portion , that is , in the immediate adjacencies of the front wall of the ink container , the electrical contacts of the ink container and the electrical contacts of the holder come into contact with each other , while squarely facing each other , immediately before the completion of the process of mounting the ink container . in this case , therefore , in order to ensure that the satisfactory electrical connection is established between the ink container and holder regardless of the surface conditions of the electrical contacts on both sides , the ink container must be mounted with the application of a substantial amount of pressure , and the application of a large amount of pressure may result in the application of an excessive amount of pressure on the electrical contacts . in comparison , in the case of the structural arrangement in this embodiment , strictly in terms the balance between the amount of the reactive force ( generated in vertical direction ) applied to the pad 102 by the connector 152 , at the contact point between the pad 102 and connector 152 as a certain amount of force is applied to the ink container 1 in order to move the ink container 1 vertically downward , and the amount of the force applied to the ink container 1 , the reactive force to which the pad 102 is subjected is the component of the force generated ( in the direction perpendicular to the slanted surface 130 ) by the contact pressure between the connector 152 and pad 102 . therefore , the amount by which the pressure being applied downward to the ink container 1 increases at the end of the process of mounting the ink container 1 when electrical connection is established between the electrical contacts of the circuit board and the electrical contacts of the holder , is small , and therefore , does not drastically reduce the efficiency with which the ink container 1 is mounted by a user . also , according to the structural arrangement in this embodiment , as the ink container 1 is pressed to be placed into the final position ( in which ink container anchoring first and second portion 5 and 6 of ink container engage with ink container anchoring first and second portions 105 and 106 , respectively , of holder 150 ), a component force ( which causes pad 102 to slide on connector 152 ) is generated by the pressure applied to the ink container 1 in the direction parallel to the primary flat surface of the circuit board 100 , ensuring that the process for mounting the ink container 1 ends as satisfactory electrical connection is established between the pad 102 and connector 152 . also in the case of the structural arrangement in this embodiment , the contact pressure between the pad 102 and connector 152 does not occur until immediately before the completion of the mounting of the ink container , in other words , until the very end of the precise positioning of the ink container 1 . therefore , if the operation for mounting the ink container 1 is stopped before the ink container anchoring second projection 6 of the latching lever 3 reaches the hole 157 ( ink container anchoring second portion ) of the holder 150 , the ink container 1 is popped up by the combination of the component force of the force generated by the resiliency of the latching lever 3 , the slanted surface ( of ink container anchoring second projection 6 ) of which is in contact with the top edge of the front wall of the holder 150 , and the reactive force resulting from the pressing of the ink outlet 7 upon the ink inlet 107 . therefore , should the ink container 1 be incompletely mounted , a user will be informed that the ink container 1 has not been completely mounted . as described above , according to this embodiment of the present invention , the ink container 1 is provided with the resilient member ( latching lever ), which keeps the ink container pressured toward the referential point ( ink container anchoring first portion , or contact point between ink container anchoring first portion and corresponding portion of holder ) on the back surface of the ink container , and the circuit board having the information storage medium , and / or contact pad , is positioned between the referential point and resilient member , in terms of the horizontal direction . therefore , the ink container is more precisely positioned relative to the holder , ensuring that the connector and contact pad are precisely positioned relative to each other . therefore , the electrical contacts of the ink container are reliably connected to the electrical contacts of the holder , in terms of electrical conductivity . this , in turn , makes it possible to minimize the size of the contact pad , making it thereby possible to reduce the size of the circuit board on which the information storage medium is mounted . in other words , it is quite reasonable to say that the structural arrangement in this embodiment is superior to that in accordance with the prior art , in consideration of various factors in the design of the ink container and the holder therefor , for example , the amount of force necessary to be applied to an ink container when mounting the ink container , operability of an ink container , reliability in the state of electrical contact , protection of electrical contacts from ink leak , etc . fig1 shows another embodiment . an aspect of the present invention is particularly directed to the position of the contact pad 102 . in this embodiment of the present invention , the information storing medium 104 is disposed at another place , more particularly , at a top side , in use , or at a position facing the supporting member . in such a case , an electrode 103 or lead is extended from the information medium 104 to the contact pad 102 which is located at the position according to the aspect of the present invention . next , an example of a recording head , and also , an example of an ink jet recording apparatus , in which the ink container in the above described first embodiment is mountable , will be described . fig5 is a perspective view of an example of a recording head unit structured so that the ink container in the first embodiment of the present invention is removably mountable , and fig6 is a perspective view of a set of ink containers removably mountable in the recording head unit shown in fig5 . fig7 is an external perspective view of an example of an ink jet recording apparatus in which the recording head unit shown in fig5 and the set of ink containers shown in fig6 are mounted for recording , and fig8 is a perspective view of the ink jet recording apparatus shown in fig7 , the main assembly cover of which is open . generally , the recording head unit 105 is made up of the holder 150 for removably holding four ink containers 1 k , 1 c , 1 m , and 1 y , which correspond to inks of black , cyan , magenta , and yellow colors , respectively , and the recording head 105 a attached to the underside of the holder 150 to eject the four color inks . as any of the four ink containers is mounted into the holder 150 , the ink outlet 7 of the ink container couples with the ink inlet 107 of the recording head attached to the underside of the recording head unit 105 , creating an ink passage between the ink container and recording head unit 105 . as the recording head 105 a , it is possible to employ a recording head in which electrothermal transducing elements are disposed within the nozzles ( liquid paths ), and the pressure resulting from the change in the phase of ink , that is , the pressure resulting from the bubbling ( boiling ) of ink , caused by the application of thermal energy generated by applying electrical pulse to the electrothermal transducing elements is used for ink ejection . as for the transmission of the electrical pulses to the electrothermal transducing elements of the recording head 105 a , the electrical contacts ( unshown ), with which the carriage 205 , which will be described later , is provided for the signal transmission are placed in contact with the electrical contacts portion 157 of the recording head unit 105 , making it possible for recording signals to be transmitted through the wiring 158 to the circuit of the recording head 105 a for driving the electrothermal transducing elements of the recording head unit 105 . designated by a referential number 159 is a set of wires extending from the electrical contacts 157 to the connector 152 . the four ink containers of the ink container set are virtually the same , except that they are different in the color of the inks they store , and also , that the ink container 1 k for storing black ink is larger in the widthwise dimension than the other three . more specifically , each ink container has a latching lever 3 having an ink container anchoring second portion ( rib ) 6 attached to the front surface of the ink container 1 , an ink outlet 7 with which the bottom wall of the ink container 1 is provided , an ink remainder amount detecting portion 17 , in the form of a prism , with which the bottom wall of the ink container 1 is provided , a circuit board 100 and / or contact pad attached to the external surface of the slanted wall 130 connecting the bottom and front wall of the ink container 1 , and an ink container anchoring first portion ( projection , or rib ) 5 projecting from the rear wall of the ink container . these ink containers 1 k , 1 c , 1 m , and 1 y are removably and independently mountable in the holder 150 . fig7 is an external perspective view of the ink jet printer 200 in which the above described ink containers are mounted for recording . fig8 is an external perspective view of the ink jet printer 20 , shown in fig7 , the main assembly cover of which is open . referring to fig7 , the printer 200 in this embodiment comprises a recording unit 105 , ink containers 1 , a main assembly , a delivery tray 203 , and an automatic sheet feeding apparatus 202 . the main assembly comprises : the carriage 205 on which the recording unit 105 and ink containers 1 are mounted ; mechanism for reciprocally moving the carriage , for recording ; a main assembly cover 201 ; and various portions of external casing , which cover the mechanism for reciprocally moving the carriage . it also comprise a display panel , which is visible whether the main assembly cover is open or closed , and a control panel 213 having a power switch and a reset switch . referring to fig8 , when the main assembly cover 201 is open , a user can see the recording head unit 105 , ink containers 1 k , 1 y , 1 m , and 1 c , carriage 205 having an ic , moving range of the carriage 205 , and their adjacencies . in reality , as the main assembly cover 201 is opened , the sequence for moving the carriage 205 to roughly the center ( which hereinafter may be referred to as container replacement position ) of its moving range is automatically carried out , making it possible for the user to replace any or all of the ink containers . the recording head unit 105 of the printer in this embodiment is provided with four recording heads 105 a ( fig4 ) corresponding to four inks , one for one , different in color . recording is made as the four recording heads 105 a borne on the carriage 205 are reciprocally moved by the reciprocal movement of the carriage 205 along the surface of the recording medium such recording paper while ejecting ink in response to recording signals . more specifically , the carriage 205 is engaged with a guiding shaft 207 extended in the moving direction of the carriage 205 , being enabled to slide along the guiding shaft 207 , and is reciprocally moved by the combination of the carriage motor and driving force transmitting mechanism . the black , cyan , magenta , and yellow inks are ejected from the corresponding recording heads according to the ejection data sent from the control circuit of the main assembly through a flexible cable 206 . further , the main assembly is provided with a paper conveying mechanism comprising paper conveying rollers , discharge rollers , etc ., being enabled to convey recording mediums ( unshown ) fed from the automatic sheet feeding apparatus 202 , to the delivery tray 203 . the carriage 205 is structured so that the recording head unit 105 integral with the ink container holder is removably mountable on the carriage 205 . the ink containers 1 are removably mountable into the recording head 105 . as for the recording operation of this printer , while the recording head is moved by the above described movement of the carriage 205 , in a manner to scan the surface of the recording medium , it ejects ink therefrom , recording thereby on the recording medium by a predetermined width matching the length of the line of ejection orifices of the recording head . during the interval between a given scanning movement of the recording head unit 105 in the direction perpendicular to the direction in which recording medium is to be conveyed , and the following scanning movement of the recording head unit 105 , the recording medium is conveyed in the direction perpendicular to the direction in which the recording head unit 105 is reciprocally moved , by a distance equal to the scanning width of the recording head unit 105 in terms of the direction parallel to the recording medium conveyance direction . as a result , recording is incrementally made on the recording medium by the width equal to the scanning width of the recording head unit 105 . the main assembly is provided with an ejection performance recovery unit comprising a cap for covering the surface of each recording head having the ejection orifices . the ejection performance recovery unit is located at one end of the range across which the recording head unit 105 is moved by the movement of the carriage 205 . the recording head unit 105 is moved for every predetermined length of time to the position in which it opposes the recovery unit , and in which it is subjected to the performance recovery procedure such as preliminary ejection . the number of ink containers employed by an ink jet recording head , manner in which color ink is stored in an ink container , structures of a recording head and an ink jet recording apparatus to which ink containers are attached , do not need to be limited to the above described ones . for example , referring to fig9 , an ink jet recording apparatus may be structured so that three ( for example , three containers for cyan , magenta , and yellow inks , one for one ) of the four color ink containers such as those in the first embodiment are mounted in the same holder , or attached to the same recording head unit . further , referring to fig1 , an ink container may be provided with two ink outlets 7 a and 7 b . in this case , the internal space of the ink container may be divided into two separate ink chambers , in which two inks different in tone are stored one for one . in this case , obviously , the structures of the holder and recording head unit have to be modified to accommodate such an ink container . further , referring to fig1 , the ink outlet of an ink container may be off - center , as long as it can be satisfactorily connected to the ink inlet of a recording head unit . regarding the tone of ink , single ink with a specific tone , or two or more inks which are identical in color , but different in tone , may be used . when using multiple inks different in color , the number of inks different in color may be four as it was in the above described embodiment , or may be just three . further , two or more inks which are the same in color , but different in tone , may be employed for each color component , in addition to , or in place of , inks different in color ; for example , cyan and magenta inks which are lighter in tone . further , inks different in color from the abovementioned ones may be employed in addition to the abovementioned one ; for example , red , green , and blue inks . regarding the type of liquid to be stored in an ink container , such ink ( liquid ) that contains ingredients for better fixing an image to recording medium , improving color development , and / or improving image durability , may be stored , in addition to the ordinary ink , that is , liquid which contains coloring ingredients . the above described embodiment of the present invention is not intended to limit the scope of the present invention . rather , the present invention can be embodied in various forms within the intent of the present invention . in the above described first embodiment , the ink container is provided with a springy latching member as the ink container anchoring second member which extends diagonally upward from the bottom portion of the external surface of the front wall of the ink container . as the ink container is mounted into the holder , the latching member is elastically deformed by the force applied to mount the ink container into the holder , keeping thereby the ink container pressured toward a predetermined referential point for mounting the ink container . however , the position , shape , direction in which force is generated by the latching member , of the latching member are optional . fig1 ( a )-( c ) are schematic sectional views of the combination of the ink container and holder in another embodiment of the present invention , showing the springy latching member thereof for keeping the ink container pressured toward the predetermined referential point for mounting the ink container , being different in structure from the one in the first embodiment , and also , showing the operation for mounting the ink container into the holder . in the case of this combination , the latching member 303 as a member for keeping the ink container 301 pressured toward the predetermined referential point extends diagonally downward from the top end portion of the front wall of the ink container 301 to take the force applied to mount the ink container . the latching member 303 is resiliently deformable in the direction indicated by an arrow mark c in fig1 ( a ). the ink container 301 is also provided with an ink container anchoring first portion 305 , which is on the external surface of the back wall of the ink container 301 , and an ink container anchoring second portion 306 , which is on the free end portion of the latching member 303 . designated by a referential symbol 303 g is a rib which can be used by a user to manipulate the ink container 301 when the user mounts the ink container 303 . the bottom wall of the ink container 301 is provided with an ink outlet 307 . the bottom portion of the front end of the ink container 301 are structured so that the front and bottom walls of the ink container 301 are connected by a slanted wall 430 , to the external surface of which a circuit board and a contact pad are attached . in fig1 ( a ), the virtually the entirety of the internal space of the ink container 301 is filled with a porous member 315 capable of absorbing and retaining ink , although the ink container 301 may be structured so that the porous member 315 occupies a part of the internal space of the ink container 301 as in the first embodiment . referring to fig1 ( b ) and 12 ( c ), the recording head unit 405 in this embodiment is structured so that its ink passage between the ink inlet 407 and the recording head 405 a vertically extends downward from the ink inlet 405 and then , horizontally bends , and also , so that the ink is virtually horizontally ejected from the recording head 405 . however , the direction in which ink is to be ejected is optional . the procedure for mounting the ink container 301 into the holder 450 of the recording head unit 405 is as follows : first , the ink container 301 is to be inserted into the ink holder 450 from above ( fig4 ( a )) so that the ink container anchoring first portion 305 in the form of a projection is put through the ink container anchoring portion 455 , that is , a through hole , of the holder 450 . then , the ink container 301 is to be pushed down in the direction indicated by an arrow mark p by the top end of the front wall of the ink container 301 , with the latching lever 303 being rotating in the direction indicated by an arrow mark c by pressing the rib 303 g in order to prevent the ink container anchoring second portion 306 from interfering with the ink container anchoring second portion 456 of the holder 450 . further , in order to allow the ink container 303 to smoothly rotate about the ink container anchoring first portion 305 in the direction indicated by an arrow mark r , it is possible to have the tip of the ink container anchoring second portion 306 and the tip of the ink container anchoring second portion 456 chamfered . as the ink container anchoring second portion 306 is lowered to the recess 457 located below the ink container anchoring second portion 456 , the former is fitted into the latter by the resiliency of the latching lever 303 , anchoring thereby the ink container 301 while the resiliency of the latching lever 303 keeping the ink container 301 pressured toward the back wall of the holder 450 , keeping thereby the ink container in contact with the back wall of the holder 450 . during this process of mounting the ink container 301 into the holder 450 , which is similar to that in the first embodiment , the ink outlet 307 of the ink container 301 is coupled with the ink inlet 407 of the recording head unit ( holder 450 ), and the circuit board or contact pad 402 disposed on the external surface of the slanted wall 430 of the ink container 301 is reliably placed in contact with the connector 452 disposed on the internal surface of the slanted wall portion 456 of the recording head unit ( holder 450 ). the shape of the springy member , or latching lever , for keeping the ink container pressured does not need to be in the form of a cantilever like the one in the second embodiment ; it is optional . fig1 shows one of the optional forms for the springy member . in this case , the springy latching lever 30 is virtually the same in shape as the latching lever 3 in the first embodiment , having the ink container anchoring second portion 6 , except that the free end of the latching lever 30 is connected to the ink container 301 with a flexible member . in the preceding embodiments , the resilient latching levers were structured so that the ink container was pressured by the resiliency of the latching lever straight toward the referential point ( ink container anchoring first portion of holder , or internal surface of back wall of holder ) for mounting an ink container . however , the direction in which pressure is to be applied by the resiliency of the latching member is optional ; it should be determined according to the position , structure , etc ., of the referential portion . fig1 shows one of the optional structural arrangements for an ink container and holder therefor . it is roughly the same as the one shown in fig1 , except that the latching portion 306 a as the ink container anchoring second portion of the latching lever 303 a of the ink container 301 , and the ink container anchoring second portion 456 a of the holder 450 , are structured so that the former fits into the recess 457 a of the latter from outward side of the holder to anchor the ink container 301 to the holder . further , in the preceding embodiments , the ink container was to be inserted vertically downward into the holder . however , the direction in which the ink container is to be inserted is also optional . fig1 shows one of these options . in this case , the ink container 1 identical in structure to the one in the first embodiment is to be horizontally pushed into the holder 550 of the recording head unit 505 . the positional relationship between the various portions of the ink container and the ink container anchoring first portion 5 is the same as that in the first embodiment , and so are the manner in which the contact pad 102 is placed in contact with the connector 552 of the holder through the rotational movement of the ink container 1 in the direction indicated by an arrow mark r about the ink container anchoring first portion 5 put through the ink container anchoring first portion of the holder , the manner in which the ink outlet 7 of the ink container 1 is coupled with the ink inlet 507 of the recording head unit 505 , and the manner in which the ink container anchoring second portion 6 of the ink container 1 fits into the recess 157 of the back wall of the holder 550 , are also the same as those in the first embodiment . incidentally , this recording head unit 505 ejects ink vertically downward , and the ink passage from the ink inlet 507 of the recording head unit 505 to the recording head 505 a is bent as indicated by the dotted line . also in the case of the structural arrangement shown in fig1 , the contact pad 102 is located above the level of the point of ink leakage from the ink outlet 7 , eliminating the possibility that the leaked ink will travel to the contact pad 102 . further , in the preceding embodiments , the springy latching member for keeping the ink container pressured toward the referential portion for mounting the ink container is provided on the ink container side . however , it may be a third member independent from the ink container and recording head unit . more specifically , it may be such an independent member which is v - shaped in cross section , having a first arm portion which is to be placed in contact with the external surface of the front wall of an ink container and has a latching portion , and a second arm portion which has a latching portion to latch with the catch portion on the internal surface of the front wall of the holder . the amount of its resiliency is determined by the angle formed by the two arm portions . it is to be inserted into the gap between the front wall of the ink container and the front wall of the holder , at the end of the process of mounting the ink container . or , it may be such an independent third member as the one disclosed in japanese laid - open patent application 8 - 230206 , which is independent from an ink container , and keeps the ink container pressured downward in coordination with a recording head unit . also in the preceding embodiments , the circuit board or contact pad was disposed on the external surface of the slanted connective wall , which appears as if it were formed by chamfering the bottom front corner of the ink container , between the front and bottom walls of the ink container . however , as long as the force applied to the ink container to mount the ink container can be made to act in the proper direction to establish reliable electrical connection between the ink container and holder , and as long as ink leakage is not concerned , the ink container 1 may be provided with an contact pad mount protruding from the edge between the top and bottom walls of the ink container , as shown in fig1 , and the contact pad 502 may be disposed on the end surface of the contact pad mount . also in the preceding embodiments , the information storage element was disposed on the opposite surface of the circuit board from the surface on which the contact pad is located . however , the information storage element and contact pad may be disposed on the same surface of the circuit board , as long as the information storage element does not interfere while the contact pad is being placed with the connector of the recording head unit . further , if the preferable location for the circuit board or information storage element is different from the preferable location for the contact pad because of the structure of the ink container and / or the portions thereof for attaching the ink container , the circuit board with the information storage element and the contact pad may be separately disposed on the optimal locations therefor , and connected with wiring . in other words , it is not mandatory that both the information storage and the contact pad are integrally placed on the circuit board . also in the preceding embodiments , the ink container was removably mounted into the recording head unit having the ink container holder . however , the ink container and recording head may be structured to be inseparable . in such a case , the inseparable combination of ink container and recording head is removably mounted in the carriage . the structural arrangement , in the preceding embodiment , for the electrical contacts through which recording signals are transmitted to the recording head , and also , through which the electrical signal reflecting the conditions of the ink container and recording head are exchanged between the combination of the ink container and recording head , and the main assembly , in order to display the conditions , is also applicable , with just as preferable results as those obtained by the preceding embodiments , to the inseparable combination of an ink container and recording head , and the holder therefor . also in the preceding embodiments , the information regarding the ink containers was displayed through the electrical connection between the ink container and main assembly of an ink jet recording apparatus . however , the present invention is also applicable to any mechanical connection , as long as the information regarding the ink containers can be displayed to a user through the mechanical contact between the electrical contacts of the ink containers and those of the main assembly . for example , the mechanical contact between the ink container and main assembly may be for magnetically transmitting information . in such a case , the contact pad is replaced with a magnetic storage means , and the connector is replaced with a magnetic head . the preceding embodiments are not intended to limit the structures of the anchoring portions of the ink container and the structure of the holder , to those in the embodiments . for example , instead of providing the holder of the recording head unit with the ink container anchoring second portion and connector , the carriage may be provided with the ink container anchoring second portion and connector . in other words , the ink container anchoring second portion 156 , connector 152 , and wiring 159 for the connector , may be attached to the carriage . in the case of such a structural arrangement , as the recording head unit is mounted into the carriage , the entirety of the anchoring portion of the ink container is realized , and the process of coupling the ink outlet with the ink inlet , and the process of placing the pad in contact with the connector , are completed through the same movement of the ink container as that shown in fig4 . further , the addition of the following features , which will be described next , to the ink container in accordance with the present invention further improves an ink jet printer in usability . generally , an ink container is filled with ordinary ink . the ink to be filled into an ink container may be pigment ink or dye ink . the color of the ink to be filled into an ink container may be red , green , blue , etc ., in addition to black , yellow , magenta , and cyan . regarding the tone of ink , cyan and magenta inks lighter in tone than the ordinary cyan and magenta inks may be employed in addition to the abovementioned ones . further , an ink container may be filled with solution for treating ink and / recording medium for improving ink and recording medium in fixation , color development , durability , and the like properties . an ink jet printer designed so that it can employ three to eight ink containers among the abovementioned ink containers different in the color and tone of the inks they store can yield an image comparable to a photographic image . incidentally , in the case of an ink container , such as the one shown in fig3 , the internal space of which is divided into a first chamber in which ink is directly stored , and a second chamber in which ink is stored in the ink absorbent member packed in the chamber , if the ink absorbent member is made up of two pieces of ink absorbent members which are vertically stacked ( interface of which is located above passage through which gas ( air ) is introduced from the second chamber to the first chamber ), the ink container is desired to be filled with ink by an amount enough for the ink to completely fill the entirety of the bottom piece of the absorbent member and reach the interface between the top and bottom pieces . filling the ink container by the amount described above can prevent the occurrence of such a situation , during the distribution of an ink container , that the ink in the first chamber travels into the second chamber and leaks out of the ink container through the air vent of the ink container . while the invention has been described with reference to the structures disclosed herein , it is not confined to the details set forth , and this application is intended to cover such modifications or changes as may come within the purposes of the improvements or the scope of the following claims . this application claims priority from japanese patent application no . 435940 / 2003 filed dec . 26 , 2003 , which is hereby incorporated by reference .
| 1 |
further elaboration of the present disclosure combined with specific examples are as follows . to be understood , these examples are only to illustrate the present disclosure and not to limit the scope of the present disclosure . in addition to be understood , after reading the contents of the teaching of the disclosure , a variety of changes or modifications on disclosure can be made by the technicians in this field , which equivalent forms also falls in the defined range in the appended claims . 0 . 8 mg silica supported au nanoparticles ( aunps / sio 2 ) and 22 mg feso 4 . 7h 2 o were suspended in 2 ml acetonitrile containing 0 . 8 mmol h 2 o 2 aqueous solution in air under stirring at 30 ° c . after 4 h of reaction , a visual color of the suspension was gradually changed from wine red to pale green , and the solid product was obtained by centrifuging and drying , which was proved to be silica supported aucn . fig1 is a xrd pattern related to aucn preparation , which shows the solid product was pure aucn . aunps were fully transformed to aucn , and no ferricyanide was formed . 0 . 8 mg aunps / sio 2 and 22 mg feso 4 . 7h 2 o were suspended in 2 ml acetonitrile containing 0 . 8 mmol h 2 o 2 and 50 ul 1 mol / l hcl aqueous solution in air under stirring at 30 ° c . after 10 h of reaction , no aucn was formed with the solid color unchanged , indicating that aucn cannot be prepared through this method under an acid solution . 0 . 8 mg aunps / sio 2 and 22 mg feso 4 . 7h 2 o were suspended in 2 ml acetonitrile containing 0 . 8 mmol h 2 o 2 and 50 ul 1 mol / l naoh aqueous solution in air under stirring at 30 ° c . after 10 h of reaction , the visual color of the solid was gradually changed from wine red to deep blue . the solid product was obtained by centrifuging and drying , which was proved to be au — aucn complex with aunps partially transformed to aucn . fig2 is a xrd pattern related to au — aucn complex preparation . this result indicated that the efficiency of fenton &# 39 ; s reagent decreased under a base solution and aunps may not be completely transformed to aucn . uv method for metal cyanide preparation , cn 102274740 a , which is incorporated herein by reference 0 . 8 mg aunps / sio 2 and 22 mg feso 4 . 7h 2 o were suspended in 2 ml acetonitrile containing 0 . 8 mmol h 2 o 2 aqueous solution under stirring with uv irradiation of 350 w mercury lamp . after 3 h of reaction , the visual color of the solid was gradually changed from wine red to yellow . au 3 + was detected on the surface of the obtained product by xps characterization , indicating the metal au is over oxidation . no iron cyanide was detected . 2 mg aunps / sio 2 and 3 mg feso 4 . 7h 2 o were suspended in 3 ml acetonitrile containing 1 mmol h 2 o 2 aqueous solution in air under stirring at 70 ° c . after 30 min of reaction , the visual color of the solid was gradually changed from wine red to pale green . the solid product was obtained by centrifuging and drying , which was proved to be silica supported aucn . fig3 is the tem picture related to aucn preparation . no iron cyanide was detected . 10 mg aunps / sio 2 and 30 mg feso 4 . 7h 2 o were suspended in 1 . 3 ml acetonitrile containing 21 mmol h 2 o 2 aqueous solution in air under stirring at 10 ° c . after 48 h of reaction , the visual color of the solid was gradually changed from wine red to pale green . the solid product was obtained by centrifuging and drying , which was proved to be silica supported aucn . fig4 is the xps pattern related to aucn preparation , with two peaks ( au4f 5 / 2 and au4f 7 / 2 ) ascribed to au ( i ). no iron cyanide was detected . 20 mg agno 3 / mgo and 150 mg feso 4 . 7h 2 o were suspended in 3 . 5 ml acetonitrile containing 50 mmol h 2 o 2 aqueous solution in air under stirring at 30 ° c . after 6 h of reaction , the solid product was obtained by centrifuging and drying , which was proved to be mgo supported agcn ( agcn / mgo ). fig5 is the xrd pattern related to agcn preparation , which showed the solid product was pure agcn . no iron cyanide was detected . 20 mg agnps / zno and 100 mg feso 4 . 7h 2 o were suspended in 4 ml acetonitrile containing 72 mmol h 2 o 2 aqueous solution in air under stirring at 50 ° c . after 2 h of reaction , the visual color of the solid fades gradually . the solid product was obtained by centrifuging and drying , which was proved to be zno supported agcn ( agcn / zno ). fig6 is the xps pattern related to agcn preparation , with two peaks ( ag4f 3 / 2 and ag4f 5 / 2 ) ascribed to ag ( i ). no iron cyanide was detected . 60 mg active carbon supported au nanoparticles ( aunps / c ) and 200 mg h 2 o . fe 2 ( so 4 ) 3 were suspended in 10 ml propanenitrile containing 150 mmol h 2 o 2 aqueous solution in air under stirring at 10 ° c . after 48 h of reaction , the visual color of the solid was gradually changed from wine red to pale green . the solid product was obtained by centrifuging and drying , which was proved to be carbon supported aucn ( aucn / c ). no iron cyanide was detected . 30 mg titanium oxide supported nano ag 2 o ( ag 2 o / tio 2 ) and 100 mg feso 4 . 7h 2 o were suspended in 4 ml acetonitrile containing 22 mmol h 2 o 2 aqueous solution in air under stirring at room temperature . after 4 h of reaction , the visual color of the solid was gradually changed from black to grey . the solid product was obtained by centrifuging and drying , which was proved to be titanium oxide supported agcn ( agcn / tio 2 ). no iron cyanide was detected . 6 mg carbon supported au nanoparticles ( aunps / c ) and 8 mg feso 4 . 7h 2 o were suspended in 14 ml acetonitrile containing 2 . 4 mmol h 2 o 2 aqueous solution in air under stirring at 70 ° c . after 2 h of reaction , the visual color of the solid was gradually changed from wine red to pale green . the solid product was obtained by centrifuging and drying , which was proved to be carbon supported aucn . no iron cyanide was detected . 5 mg supported ptnps and 20 mg feso 4 . 7h 2 o were suspended in 4 ml acetonitrile containing 6 mmol h 2 o 2 aqueous solution in air under stirring at 50 ° c . after 20 h of reaction , the solid product was obtained by centrifuging and drying , which was proved to be supported pt ( cn ) 4 . no iron cyanide was detected . 5 mg supported pdnps and 20 mg feso 4 . 7h 2 o were suspended in 4 ml acetonitrile containing 7 mmol h 2 o 2 aqueous solution in air under stirring at 50 ° c . after 20 h of reaction , the solid product was obtained by centrifuging and drying , which was proved to be carbon supported pd ( cn ) 2 . no iron cyanide was detected . 5 mg runps / c and 20 mg feso 4 . 7h 2 o were suspended in 4 ml acetonitrile containing 7 mmol h 2 o 2 aqueous solution in air under stirring at 30 ° c . after 24 h of reaction , the solid product was obtained by centrifuging and drying , which was proved to be carbon supported ru ( cn ) 4 . no iron cyanide was detected . 5 mg supported aunps and 12 mg ni ( no 3 ) 2 . 6h 2 o were suspended in 4 ml acetonitrile containing 7 mmol h 2 o 2 aqueous solution in air under stirring at 50 ° c . after 2 h of reaction , the solid product was obtained by centrifuging and drying , which was proved to be supported aucn . 5 mg supported agno 3 and 12 mg co ( no 3 ) 2 . 6h 2 o were suspended in 4 ml acetonitrile containing 7 mmol h 2 o 2 aqueous solution in air under stirring at 30 ° c . after 6 h of reaction , the solid product was obtained by centrifuging and drying , which was proved to be supported agcn . 5 mg supported aunps and 3 mg cu ( no 3 ) 2 . 3h 2 o were suspended in 4 ml acetonitrile containing 7 mmol h 2 o 2 aqueous solution in air under stirring at 30 ° c . after 3 h of reaction , the solid product ( supported au 2 / 3 cu 1 / 3 cn ) was obtained by centrifuging and drying . if the reaction time was prolonged to 10 h , supported copper aurocyanide ( cuau 2 ( cn ) 4 ) would be obtained after centrifuging and drying . xrd pattern of copper aurocyanide is shown in fig7 . 5 mg supported aunps and 10 mg mnso 4 were suspended in 4 ml acetonitrile containing 7 mmol h 2 o 2 aqueous solution in air under stirring at 30 ° c . after 6 h of reaction , aucn / c solid product was obtained by centrifuging and drying . 3 mg aunps / sio 2 , 2 . 6 mg supported agno 3 and 22 mg feso 4 . 7h 2 o were suspended in 4 ml acetonitrile containing 0 . 8 mmol h 2 o 2 aqueous solution in air under stirring at 30 ° c . after 4 h of reaction , the visual color of the solid was gradually changed from red to pale grey . the solid product was obtained by centrifuging and drying , which was proved to be silica supported au 0 . 5 ag 0 . 5 cn . fig8 is the xrd pattern of as obtained solid product , and it can be assigned to au 0 . 5 ag 0 . 5 cn according to literature ( journal of the american chemical society 2012 , 134 , 16387 - 16400 ). 3 . 0 mg aunps / sio 2 and 2 . 6 mg supported agno 3 were suspended in 4 ml acetonitrile containing 0 . 8 mmol h 2 o 2 aqueous solution in air under stirring under uv - irradiation of 350 w mercury lamp . after 4 h of reaction , the visual color of the solid is changed from wine red to green . the solid product was obtained by centrifuging and drying , which was proved to be the mixture of aucn and agcn rather than au 0 . 5 ag 0 . 5 cn by xrd characterization . 12 mg supported agno 3 and 13 mg cu ( no 3 ) 2 . 3h 2 o were suspended in 4 ml acetonitrile containing 2 mmol h 2 o 2 aqueous solution in air under stirring at 30 ° c . after 8 h of reaction , the visual color of the solid was gradually changed from wine red to pale grey . the solid product was obtained by centrifuging and drying , which was proved to be silica supported ag 0 . 5 cu 0 . 5 cn ( ag 0 . 5 cu 0 . 5 cn / sio 2 ). 12 mg supported agno 3 and 13 mg cu ( no 3 ) 2 . 3h 2 o were suspended in 4 ml acetonitrile containing 2 mmol h 2 o 2 aqueous solution in air under stirring with uv - irridiation of 350 w mercury lamp . after 4 h of reaction , the solid product was obtained by centrifuging and drying . xrd results indicated that agcn without ag — cu bi - metal cyanide was formed . 3 mg silica supported aunps , 2 . 6 mg agno 3 and 4 mg cu ( no 3 ) 2 . 3h 2 o were suspended in 5 ml acetonitrile containing 1 . 5 mmol h 2 o 2 aqueous solution in air under stirring at 30 ° c . after 4 h of reaction , the visual color of the solid was gradually changed from red to grass green . the solid product was obtained by centrifuging and drying , which was proved to be silica supported au 1 / 3 ag 1 / 3 cu 1 / 3 cn . fig9 is the ft - ir spectra related to au 1 / 3 ag 1 / 3 cu 1 / 3 cn preparation . 6 mg silica supported aunps , 2 . 6 mg agno 3 and 22 mg feso 4 . 7h 2 o were suspended in 4 ml acetonitrile containing 1 . 2 mmol h 2 o 2 aqueous solution in air under stirring at 30 ° c . after 7 h of reaction , the visual color of the solid was gradually changed from red to pale grey . the solid product was obtained by centrifuging and drying , which was proved to be silica supported au 2 / 3 ag 1 / 3 cn . no iron cyanide was detected . 2 mg silica supported agno 3 and 13 mg cu ( no 3 ) 2 . 3h 2 o were suspended in 4 ml acetonitrile containing 2 mmol h 2 o 2 aqueous solution in air under stirring at 30 ° c . after 40 h of reaction , the visual color of the solid was gradually changed from red to pale grey . the solid product was obtained by centrifuging and drying , which was proved to be silica supported ag 1 / 6 cu 5 / 6 cn ( ag 1 / 6 cu 5 / 6 cn / sio 2 ). 12 mg aunps / sio 2 , 2 . 6 mg agno 3 and 4 mg cu ( no 3 ) 2 . 3h 2 o were suspended in 4 ml acetonitrile containing 1 . 5 mmol h 2 o 2 aqueous solution in air under stirring at 60 ° c . after 1 h of reaction , the visual color of the solid was gradually changed from red to grass green . the solid product was obtained by centrifuging and drying , which was proved to be silica supported au 2 / 3 ag 1 / 6 cu 1 / 6 cn . 6 mg aunps / sio 2 , 1 . 3 mg agno 3 and 8 mg ni ( no 3 ) 2 . 6h 2 o were suspended in 4 ml acetonitrile containing 1 . 2 mmol h 2 o 2 aqueous solution in air under stirring at 50 ° c . after 3 h of reaction , the visual color of the solid was gradually changed from red to grey . the solid product was obtained by centrifuging and drying , which was proved to be silica supported au 4 / 5 ag 1 / 5 cn . 40 mg aunps / sio 2 and 100 mg feso 4 . 7h 2 o were suspended in 15 ml acetonitrile and 5 ml propionitrile containing 12 mmol h 2 o 2 aqueous solution in air under stirring at 20 ° c . after 48 h of reaction , the visual color of the solid was gradually changed from red to grass green . the solid product was obtained by centrifuging and drying , which was proved to be aucn / sio 2 . no iron cyanide was detected . 12 mg ptnps / sio 2 and 80 mg co ( no 3 ) 2 . 6h 2 o were suspended in 10 ml acetonitrile containing 5 mmol h 2 o 2 aqueous solution in air under stirring at 37 ° c . after 25 h of reaction , the solid product was obtained by centrifuging and drying , which was proved to be silica supported pt ( cn ) 4 ( pt ( cn ) 4 / sio 2 ).
| 1 |
certain exemplary embodiments will now be described to provide an overall understanding of the principles of the methods and devices disclosed herein . one or more examples of these embodiments are illustrated in the accompanying drawings . those skilled in the art will understand that the methods and devices specifically described herein and illustrated in the accompanying drawings are non - limiting exemplary embodiments and that the scope of the present invention is defined solely by the claims . the features illustrated or described in connection with one exemplary embodiment may be combined with the features of other embodiments . such modifications and variations are intended to be included within the scope of the present invention . in one form , the gaussian lens equation ( for variable media ) can be written as follows : where s is the object distance from the lens , s ″ is the image distance from the lens , tc is central lens thickness and the first surface of radius ( r1 ) is separating a first medium of refractive index ( n ) from a second medium of refractive index ( n ′) and the second surface of radius ( r2 ) is separating the second medium ( n ′) from a third medium of refractive index ( n ″). the above equation can be used for a case where an air lens is disposed within the environment of the eye . in this case , the index ( n ) of the aqueous fluid on one side of the air chamber as well as the index ( n ″) of the aqueous fluid on the other side of the air chamber are each about 1 . 34 while the refractive index ( n ′) for air within the lens chamber is substantially lower ( n = 1 . 0 ). in this embodiment , the lens structure according to the invention is a bubble of air inside lens capsule of the eye , which is otherwise filled with aqueous humor . by employing the general equation above , it is noted that the terms ( n ′- n ) and ( n ″- n ′) are both reversed in sign from a typical case , where ( n ′) is the highest index , such as a simple glass lens in air . as a consequence , the focal length of the lens also has a changed sign from the typical case . however , the sign is reversed again by simply changing the sign of the radius of curvatures of the two surfaces . thus , a biconcave low index air lens that is immersed in a higher index medium behaves like a converging lens . according to the invention , a converging concave ( or preferably biconcave ) lens is built out of air and configured to be placed within the higher refractive index environment of the eye as a replacement for the natural lens to provide the same degree of accommodation ( nominally from about 14 to about 30 diopters depending upon the individual ). additionally , because the air chamber is deformable , radial forces exerted by the cilliary processes on the capsule can be used to change the shape of the air chamber . by changing the curvature of the front or anterior surface ( closest to the pupil ), the rear or posterior surface ( closest to the retina ) or both , the overall power of the lens can also be modified to provide focal accommodation . in fig1 a an accommodative iol device 10 according to the invention is shown including a flexible shell 14 defining an air chamber and a haptic 12 that at least partially surrounds the air chamber . fig1 b shows the device 10 of fig1 a in a second configuration in which the haptic has been flatten ( elongated in a radial direction ) causing a deformation of the flexible shell 14 . fig2 a and 2b provide cross - sectional views of the configurations of fig1 a and 1b , respectively . the flexible shell 14 of the air chamber has an anterior surface with a radius of curvature r 1 and a posterior surface with a radius of curvature r 2 . flattening of the iol device 10 causes an increase in both radii of curvature , e . g ., less concavity , thereby reducing the overall converging power of the air lens . in fig3 a an alternative accommodative iol device 30 according to the invention is shown including a flexible shell 34 defining an air chamber 36 and a haptic 32 that partially surrounds the air chamber . fig3 b shows the device 30 of fig3 a in a second configuration in which the haptic has again been flatten ( elongated in a radial direction ) causing a deformation of the flexible shell 34 . fig4 a and 4b provide cross - sectional views of the configurations of fig3 a and 3b , respectively . the flexible shell 34 of the air chamber 36 has an anterior surface with a radius of curvature r 1 and a posterior surface with a radius of curvature r 2 . flattening of the iol device 30 again causes an increase in both radii of curvature , e . g ., less concavity , thereby reducing the overall converging power of the air lens . fig5 a and 5b provide cross - sectional views of yet another alternative accommodative iol device 50 according to the invention again including a flexible shell 54 defining an air chamber 56 and a haptic 52 that at least partially surrounds the air chamber . in the device of fig5 a and 5b , a second optic 51 of conventional construction is used to supplement the converging power of the air lens . because r 1 is now fixed ( by coupling of the anterior surface of the flexible shell 54 to solid lens 51 ), flattening of the iol device 50 causes an increase in radius of curvature r 2 only , as shown in cross - sectional view 5 b , which nonetheless reduces the overall converging power of the air lens . it should be clear that other dual optic configurations can likewise be readily implemented by those skilled the art . a convention lens can be disposed on the posterior surface of the deformable shell 54 ( alone or in tandem with the anterior lens 51 ). additionally , the power of one or both lens can be negative or positive by appropriate lens shape choices . for additional details on air lens structures , see , u . s . pat . no . 6 , 785 , 061 issued to smith on aug . 31 , 2004 ; u . s . pat . no . 6 , 473 , 238 issued to daniell on oct . 29 , 2002 , both of which are incorporated by reference in their entirety . all of the embodiments described above are non - limiting examples of the present invention only . in addition , all papers and publications cited herein are hereby incorporated by reference in their entirety . one of skill in the art will appreciate further features and advantages of the invention based on the above - described embodiments . accordingly , the invention is not to be limited by what has been particularly shown and described , except as indicated by the appended claims .
| 0 |
the following description and the drawings sufficiently illustrate specific embodiments to enable those skilled in the art to practice them . other embodiments may incorporate structural , logical , electrical , process , and other changes . examples merely typify possible variations . portions and features of some embodiments may be included in , or substituted for , those of other embodiments . embodiments set forth in the claims encompass all available equivalents of those claims . fig1 is a top view of a jar opener in accordance with some embodiments . jar opener 100 is configured for loosening a jar lid using human force and includes first and second leveraging elements 102 and 104 , a threaded rod 106 coupling the leveraging elements 102 and 104 and a dual - axis hinge assembly 108 . the leveraging elements 102 and 104 have a handle end 114 and the dual - axis hinge assembly 108 couples the first and second leveraging elements 102 and 104 opposite the handle end 114 . the first and second leveraging elements 102 and 104 have at least two sets of oppositely positioned curved cut - out regions 110 a and 110 b located between the threaded rod 106 and the dual - axis hinge assembly 108 . the two sets of oppositely positioned curved cut - out regions 110 a and 110 b accept jar lids of different sizes . threaded rod 106 is at least partially threaded and is provided through elongated holes 122 and 124 in the first and second leveraging elements 102 and 104 . the elongated holes 122 and 124 are located between the curved cut - out regions 110 a and 110 b and the handle ends 114 of the first and second leveraging elements 102 and 104 . as illustrated in fig1 , both the elongated holes 122 and 124 have a greater elongation toward the insides 118 of the first and second leveraging elements 102 and 104 and have a lesser elongation toward the outsides 116 of the first and second leveraging elements 102 and 104 . the greater elongation on the insides 118 of the first and second leveraging elements 102 and 104 may allow for the threaded rod 106 to pass through both the first and second leveraging elements 102 and 104 as the first and second leveraging elements 102 and 104 are separated to accept jar lids of different sizes . the first and second leveraging elements 102 and 104 have a length selected to provide sufficient leverage to rotate a jar lid when the jar lid is tight . to loosen a jar lid , one hand may be placed on one of the leveraging elements and another hand may be placed on the jar . the leveraging element may be rotated counterclockwise with respect to the jar . once the jar lid is loosened , the jar lid may easily be removed . the operation of jar opener 100 is described in more detail below . in the embodiments illustrated in fig1 , the first set of the curved cut - out regions 110 a that is located closer to the dual - axis hinge assembly 108 has a greater concave curvature for smaller - diameter jar lids . the second set of cut - out regions 110 b that is located further from the dual - axis hinge assembly 108 has a lesser concave curvature for larger - diameter jar lids . in these embodiments , either the first set of the second set of the curved cut - out regions is selectable by an operator depending on the size of the jar lid . the dual - axis hinge assembly 108 includes a connecting member with bolts 111 provided therethrough to provide dual pivot points . in some embodiments , the dual - axis hinge assembly 108 includes three jar - size selection holes 109 , which may be arranged in a straight line . two furthest apart of the jar - size selection holes 109 are selectable for use as pivot points for larger - diameter jar lids . two closer of the jar - size selection holes 109 are selectable for use as pivot points for smaller - diameter jar lids . as illustrated in fig1 , the furthest apart jar - size selection holes have been selected and bolts 111 are illustrated as being provided through the furthest apart jar - size selection holes 109 leaving the center jar - size selection hole 109 open . in some embodiments , each of the opposite positioned curved cut - out regions 110 a and 110 b have gripping surfaces 112 comprising a gripping material disposed thereon . the gripping material may comprise a rubber - like or soft plastic material to help prevent slippage on the jar lid during operation . an adhesive may be used to adhere the gripping material to the leveraging elements 102 and 104 . in some embodiments , the threaded rod 106 may have a hooked - end to inhibit passage through the first leveraging element 102 . the leveraging elements 102 and 104 may be at least eighteen inches long to provide sufficient leverage . a rubber or plastic washer 126 and a wing nut 128 may be provided on the threaded rod 106 opposite the hooked end . rotation and tightening of the wing nut 128 may bring the first and second leveraging elements 102 and 104 closer together . in this way , when a jar lid is positioned within one set of the opposite positioned curved cut - out regions ( e . g ., region 110 a ) and when the wing nut 128 is tightened , the leveraging elements 102 and 104 are configured to tightly squeeze the jar lid to allow the leveraging elements to be rotated by human force to loosen the jar lid from a jar without slippage of the jar lid . accordingly , an elderly person or a person with arthritic hands does not need to have the strength to grip the lid of a jar , but simply needs to rotate one of the leveraging elements . the rubber or plastic washer 126 may help to prevent the wing nut 128 from loosening during use . fig2 is a side view of the jar opener of fig1 in accordance with some embodiments . the side view of the jar opener illustrated in fig2 shows the outside 116 of first leveraging element 102 and the dual - axis hinge assembly 108 . as illustrated in fig2 , the elongated hole 122 through the first leveraging element 102 has a greater elongation 208 toward an inside of the first leveraging element 102 and has a lesser elongation 206 toward the outside 116 of the first leveraging element 102 . similarly , for second leveraging element 104 ( not illustrated in fig2 ), elongated hole 124 ( fig1 ) provided through the second leveraging element 104 has a greater elongation toward an inside of the second leveraging element 104 ( fig1 ) and has a lesser elongation toward the outside 116 ( fig1 ) of the second leveraging element 104 . the dual - axis hinge assembly 108 includes a connecting member 209 and bolts 111 to provide for the dual pivot points . the dual - axis hinge assembly 108 also includes metal washers 214 and nuts 212 to retain bolts 111 . the elongation of the elongated holes 122 and 124 in conjunction with the dual pivot points allows the threaded rod 106 ( fig1 ) to pass through both the first and the second leveraging elements 102 and 104 when the jar - size selection holes 109 are selected for either the smaller - diameter jar lids or the larger - diameter jar lids . the selection of the jar - size selection holes 109 on the dual - axis hinge assembly 108 comprises inserting a bolt 111 through each of the selected jar - size selection holes 109 and further inserting each bolt 111 through a hole in each one of the leveraging elements to provide the dual pivot points . fig3 illustrates the operation of the jar opener 100 of fig1 in accordance with some embodiments . a lid 302 of a jar 304 is positioned within one set of the opposite positioned curved cut - out regions . the wing nut is tightened and the first and second leveraging elements may tightly squeeze the jar lid 302 to allow the leveraging elements to be rotated by human force to loosen the jar lid 302 from the jar 304 without slippage of the jar lid 302 . to loosen the jar lid 302 , one hand may be placed on one of the leveraging elements and another hand may be placed on the jar 304 and the leveraging element may be rotated counterclockwise with respect to the jar 304 . in the example illustrated in fig3 , the lid 302 is positioned within the opposite positioned curved cut - out region that is further from dual - axis hinge assembly 108 . the two closer of the jar - size selection holes 109 have been selected for use as pivot points as having bolts 111 provided therethrough . the combination of the three jar - size selection holes 109 and the two sets of opposite positioned curved cut - out regions 110 a and 110 b ( fig1 ) provide up to four different configurations to accept jar lids that greatly vary in size . for example , smaller jar lids may be positioned between curved cut - out regions 110 a and the two closer jar - size selection holes 109 may be selected . for slightly larger jar lids , curved cut - out regions 110 b may be used with the two closer the jar - size selection holes 109 . for larger jar lids , curved cut - out regions 110 a may be used with the two further apart jar - size selection holes 109 . for even larger jar lids , curved cut - out regions 110 b may be used with the two further apart jar - size selection holes 109 . as can be appreciated , jar opener 100 is suitable for loosening a wide range of sizes of jar lids . referring to fig1 through 3 , in some embodiments , a method of loosening a jar lid with a jar opener , such as jar opener 100 , is disclosed herein . the method includes positioning the jar lid 302 within one set of the opposite positioned curved cut - out regions ( e . g ., region 110 a ), and tightening the wing nut 126 to cause the first and second leveraging elements 102 and 104 to tightly squeeze the jar lid 302 . the method also includes rotating one of the leveraging elements by human force to loosen the jar lid 302 from a jar 304 without slippage of the jar lid 302 . the method may include placing one hand on only one of the leveraging elements and gripping the jar with another hand while rotating one leveraging element . in some embodiments , the method of loosening the jar lid may also include selecting a first set of the curved cut - out regions 110 a located closer to the dual - axis hinge assembly 108 with a greater concave curvature for smaller - diameter jar lids , or selecting a second of the curved cut - out regions 110 b located further from the dual - axis hinge assembly 108 with has a lesser concave curvature for larger - diameter jar lids . in some embodiments , the method of loosening the jar lid may also include selecting two furthest apart of the jar - size selection holes 109 for use as pivot points for larger - diameter jar lids , and selecting two closer of the jar - size selection holes 109 for use as pivot points for smaller - diameter jar lids . selecting of the jar - size selection holes 109 of the dual - axis hinge assembly 108 may include inserting a bolt 111 through each of the selected jar - size selection holes 109 , and inserting each bolt through one of the leveraging elements to provide two pivot points . the abstract is provided to comply with 37 c . f . r . section 1 . 72 ( b ) requiring an abstract that will allow the reader to ascertain the nature and gist of the technical disclosure . it is submitted with the understanding that it will not be used to limit or interpret the scope or meaning of the claims . the following claims are hereby incorporated into the detailed description , with each claim standing on its own as a separate embodiment .
| 1 |
the making and using of the embodiments of the present disclosure are discussed in detail below . it should be appreciated , however , that the embodiments provide many applicable inventive concepts that can be embodied in a wide variety of specific contexts . the specific embodiments discussed are merely illustrative of specific ways to make and use the disclosure , and do not limit the scope of the disclosure . fig1 is a schematic diagram illustrating an embodiment of a light device 100 . the light device 100 comprises a controller 110 and a light module 120 . the light module 120 comprises light areas l 1 , l 2 and l 3 , and each of the light areas l 1 , l 2 and l 3 is arranged axisymmetrically about the x - axis or y - axis . the controller 110 may selectively activate different light areas for adjusting the brightness of the light module 120 . for example , the light module 120 may generate the maximum brightness when the controller 110 activates the light areas l 1 , l 2 and l 3 , the light module 120 may generate the second maximum brightness when the controller 110 activates the light areas l 1 and l 2 , similarly , and the light module 120 may generate the minimum brightness when the controller 110 activates the light area l 1 . thus , the controller 110 can perform brightness adjusting . in another embodiment , the controller 110 may further comprise a brightness adjust unit 112 , wherein the brightness adjust unit 112 may be any component which can indicate a value , such as a control pad , a variable resistor , and a digital value adjustment unit . also , the controller 110 may selectively activate different light areas according to the value indicated by the brightness adjust unit 112 . thus , the controller 110 can perform brightness adjusting via the brightness adjust unit 112 . note that the relation between the brightness of the light module 120 and the value of the brightness adjust unit 112 is not limited thereto , but based on design of a user , for example , the threshold of the value indicated by the brightness adjust unit 112 can be set , or the smallest value of brightness adjust unit 112 can indicate the maximum brightness of the light module 120 . refer to the embodiment of fig1 , wherein each of the light area is not only arranged axisymmetrically about the x - axis or y - axis , but also arranged axisymmetrically about both the x - axis and y - axis . in other words , each of the light area is arranged in point symmetry around the intersection point of the x - axis and y - axis . in the embodiment , the light area may be arranged axisymmetrically about only one axis according to requirements . although the light areas are arranged as a rectangle and rectangular rings as shown in fig1 , the light areas still can be arranged as different shapes , and the amount of the light areas can be different according to design . for example , the light module has light areas l 1 ˜ l 8 arranged as a triangle and triangular rings as shown in fig2 a , the light module has light areas l 1 ˜ l 8 arranged as a circle and circular rings as shown in fig2 b , and the light module has light areas l 1 ˜ l 8 arranged axisymmetrically and discretely as shown in fig2 c . in the embodiment of fig2 c , each of the light areas has the same amount of light cells ( 32 ). in the embodiments , a different brightness adjusting scheme with more brightness levels can be achieved based on the arrangement of the light areas l 1 ˜ l 3 . since each of the light area is arranged axisymmetrically , and the light areas are activated in order from the inside to the outside and are deactivated in order from the outside to the inside , stable and uniform light can be produced at each brightness levels , and the brightness may be adjusted to prevent high frequency flicking which occurs when the pwm is used for brightness adjustment . for the pwm that is currently used for adjusting brightness , when the image sensor ccd or cmos has a scan frequency higher than that of the pwm , the image captured by the image sensor has dark ripples , which causes the image on the display to also have dark ripples , and adversely affects quality of the displayed image on the display . however the effect can be avoided in the embodiment . in addition , the led cells of the light area can be manufactured by the thin film led packages ( tfp ) process , such that the positioning accuracy of die bond is not limited , the gap between the light areas is reduced , and the non - uniform brightness or color of the light area is reduced . it should be noted , in another embodiment , the order of turning light areas on / off is not limited to tuning light areas on from the inside to outside or turning light areas off from the outside to inside , and can be designed according to the application or requirements . in an embodiment , each of the light areas l 1 , l 2 and l 3 of the light module 120 is composed of a plurality of light cells , such as a light cell of a micro - led array , or a led cell . in an embodiment , the light cells of the light module 120 may be a multi - chip led array , and the integrated multi - chip led array can be produced by the technique of die bond - welding line or a manufacturing process method of ac / hv led . the led cell can be produced by the manufacturing process of an led chip . for example , after the led cells manufacturing process of the light area on a sapphire substrate having led epitaxial layer is performed , the sapphire substrate is integrated with a packaged substrate . the integration can be in the form of a flip chip or similar thin - film led which has only a single - sided electrode junction with the packaged substrate . after the integration is finished , the sapphire substrate is removed by using laser stripping technology ( laser lift - off ). thus , independently activated pins of each led cells can be achieved by the wiring of the packaged substrate . in the case of a similar thin - film led which has only a single - sided electrode junction with the packaged substrate , independently activated pins of each led cells can be produced by the transparent electrode and the packaged substrate electrode manufacturing process . in an embodiment , in order to achieve the uniformity of the brightness difference , each of the light areas l 1 , l 2 and l 3 has the same amount of light cells or has the same dimension of lighting area , as shown in fig2 c . also , due to the light area l 1 being arranged inside of the light area l 2 and the light area l 2 being arranged outside of the light area l 1 , the average distance between the light cells of the light area l 1 and x - axis ( or y - axis ) is shorter than the average distance between the light cells of the light area l 2 and x - axis ( or y - axis ). fig3 is a block diagram illustrating an embodiment of a light device 300 . the light device 300 comprises a power supply pw , a controller ctrl , switches sw 1 , sw 2 and sw 3 , linear regulators lr 1 , lr 2 and lr 3 , light area l 1 with light cells l 1 ( 1 )˜ l 1 ( m ) connected in series , light area l 2 with light cells l 2 ( 1 )˜ l 2 ( m ) connectcd in series , and light area l 3 with light cells l 3 ( 1 )˜ l 3 ( m ) connected in series . general speaking , the light cell may be an led . in an embodiment , the light cells connected in series may be designed according the grid voltage , such that the component with high surge current capability can shrink , and the integration and digitalization can be achieved . the power supply pw provides a driving voltage to the switch sw 1 , the linear regulator lr 1 , and the light cells l 1 ( 1 )˜ l 1 ( m ). if the light cells l 1 ( 1 )˜ l 1 ( m ) of light area l 1 need to be turned on , the user can transmit an activate signal to the switch sw 1 by the controller ctrl . when the switch sw 1 turns on , the linear regulator lr 1 generates a fixed current to the light cells l 1 ( 1 )˜ l 1 ( m ) according to the driving voltage provided from the power supply pw . due to the linear regulator lr 1 maintaining the driving of the fixed current within a large range of the working voltage , voltage error caused by the light cells with different driving voltages integrated in the silicon substrate can be overcome . on the other hand , if the light cells l 1 ( 1 )˜ l 1 ( m ) of light area l 1 need to be turned off , the user can transmit an inactivate signal to the switch sw 1 by the controller ctrl . in addition , the switches sw 2 and sw 3 , the linear regulators lr 2 and lr 3 , the light area l 2 with light cells l 2 ( 1 )˜ l 2 ( m ) connected in series , and the light area l 3 with the light cells l 3 ( 1 )˜ l 3 ( m ) connected in series operate in same way as the switch sw 1 , the linear regulator lr 1 , and the light cells l 1 ( 1 )˜ l 1 ( m ). by this , the controller ctrl can control the on / off states of the light areas l 1 , l 2 and l 3 individually . as described in the embodiment of fig1 , the light areas are arranged axisymmetrically , and the light areas are activated in order from the inside to the outside and are deactivated in order from the outside to the inside . this allows stable and uniform light to be produced at each brightness level , and the brightness may be adjusted to prevent high frequency flicking which occurs when pwm is used for brightness adjustment . in some embodiments , the switches sw 1 , sw 2 and sw 3 can be mos - controlled thyristors . thus , once the switch receives an enable signal ( such as high voltage impulse signal ), the switch keeps turning on , instead of being provided a continual enable signal , such that the power consumption is reduced . on the other hand , once the turn - on switch receives a disable signal , the switch turns off . in addition , fig3 merely discloses a simple embodiment of the circuit connection , wherein the light areas l 1 , l 2 and l 3 are still arranged axisymmetrically in this embodiment . although the embodiment merely discloses three light areas , more light areas can be set and controlled . in an embodiment , the components shown in fig3 can be integrated in a silicon substrate , and the silicon substrate further is integrated with a protection component . when one of the light cells fails , the protection component can change the current loop to bypass the failed light cell , such that the other light cells can still work . it will be apparent to those skilled in the art that various modifications and variations can be made to the structure of the disclosed embodiments without departing from the scope or spirit of the disclosure . in view of the foregoing , it is intended that the disclosure cover modifications and variations of this disclosure provided they fall within the scope of the following claims and their equivalents .
| 7 |
as required , preferred embodiments of the present invention are described herein ; however , the disclosed embodiments are merely exemplary of the invention that may be embodied in various forms . the figures are not necessarily to scale ; some features may be exaggerated to show details of particular components . specific structural and functional details disclosed herein are therefore not to be interpreted as limiting , but as a basis for the claims and as a representative basis for teaching one skilled in the art to variously employ the present invention . referring to the drawings , at least one embodiment of the apparatus and one method of the present invention may be appreciated for sensing patient distance . fig1 shows the preferred embodiment of an apparatus for sensing patient distance 5 where a force - responsive distance sensing apparatus 205 having a force sensing element 70 coupled to a force transmitting member 65 is functionally cooperating with a heterodyning proximation detector apparatus 105 , and a light - responsive distance sensing apparatus 30 to regulate the air pressure within an air mattress 15 accordingly . fig2 illustrates one embodiment of a force - responsive distance sensing apparatus 205 comprising a force sensing element 70 horizontally positioned within a force transmitting member 65 . fig3 illustrates a preferred method for regulating the air flow of an air mattress 15 using data obtained from a heterodyning proximation detector apparatus 105 . fig4 features one embodiment of a light - responsive distance sensing apparatus 30 comprising a light emitter 125 and a light detector 135 positioned at the opposing ends of a deformable inflatable chamber 150 . fig5 and 6 illustrates an alternative embodiment of a light - responsive distance sensing apparatus 30 incorporating a pliable covering 175 to cover and secure the light emitter 125 and the light detector 135 to the chamber 150 . fig7 shows various exemplary deformation configurations to which a light - responsive distance sensing apparatus 30 might be subjected . with reference to each of these illustrated embodiments , however , it should be understood by those ordinarily skilled in the art that various other apparatus and methods could be incorporated without departing from the scope of the present invention . referring to fig1 there is shown a patient 10 positioned partially atop an apparatus for sensing patient distance 5 above a patient support surface . as shown , an apparatus for sensing distance 5 of the present invention includes an air mattress 15 which defines a patient support surface , and is preferably supported by a conventional bed frame 25 . frame 25 typically comprises more than one articulatable section , and is preferably mounted on castors for ease of movement in the hospital environment . to rotate or elevate the patient thereon , frame 25 may include hydraulic lifting mechanisms for raising and lowering portions of the frame 25 , including the articulatable sections of the frame 25 . frame 25 may further be constructed of radiolucent materials , such as lexan , that are ideally suited for taking x - rays . a preferred air mattress 15 includes a series of air cells 31 which define an upper surface 20 and a lower surface 21 of the air mattress 15 . in its preferred embodiment , patient 10 primary support and cushioning is provided by a series of air cells 31 , however , the present invention is operable with an air mattress 15 comprising a single air cell 31 . the upper and lower surfaces 20 , 21 may be constructed of water permeable material which acts to draw moisture away from the patient 10 and , thus , assist in maintaining a sanitary environment . for therapeutic purposes , air cells 30 , 31 can be constructed using an air permeable material to facilitate a gradual flow of air through the upper and lower surfaces 20 , 21 of each air cell 30 , 31 , and thereby provide patient 10 with an air mattress 15 having a preferred therapeutic air pressure . in accordance with the present invention , each air cell 30 , 31 receives inflation pressure from at least one blower 40 that is connected thereto by a fluid conduit , not shown , or the like . fig1 illustrates a preferred embodiment of the present invention featuring a heterodyning proximation detector apparatus 105 ; a force - responsive distance sensing apparatus 205 ; and a light - responsive distance sensing apparatus 30 . as shown , the force - responsive distance sensing apparatus 205 includes a force transmitting member 65 and force sensing element 70 contained within at least one air cell 31 . a force transmitting member 65 is preferably constructed of a complaint cushioning material such as , but not limited to , foam , plastic or cloth batting . as will be appreciated , the force transmitting member 65 provides the present invention with a two - fold effect . first , the force transmitting member 65 defines an element of the force - responsive distance sensing apparatus 205 for detecting changes in the height of the upper surface 20 relative to the lower surface 21 as a patient is positioned atop the air mattress 15 . more particularly , changes in the patient 10 distance relative to the lower surface 21 are detected in real - time via a force sensing element 70 which measures a variable range of compressive forces exerted by the force transmitting member 65 in response to the compressive forces of a patient 10 resting thereon . second , the thickness of the force transmitting member 65 provides an air mattress 15 with extra support cushioning in the event air mattress &# 39 ; s 15 inflation pressure is reduced below that required to prevent the patient from bottoming - out , thus reducing the risk for patient injury . fig2 illustrates the preferred spatial relationship between the force sensing element 70 and the force transmitting member 65 of the force - responsive distance sensing apparatus 205 . as shown , the force sensing resistor 70 , which might be a force - sensitive resistor , piezoelectric crystal , or the like , is coupled to the force transmitting member 65 along a horizontal plane 85 ; however , situating such sensors on other spatial planes is contemplated as well . as will be understood be one skilled in the art , the force transmitting member 65 can be formed using a multiplicity of segmented members , which may differ in size and shape , to allow cooperative ease of movement in tandem with the air mattress 15 . moreover , at least one force sensing element 70 , which transfers the signal through the control wire 71 , may be coupled to at least one segmented force transmitting member 65 or throughout a non - segmented force transmitting member 65 to provide an array of sensors suited for detecting compressive forces from various parts of the body . the force sensing element 70 may also be placed and coupled to the either the upper or lower surface of the force transmitting member 65 , within the force transmitting member 65 , or generally wherever the height of the patient above the frame 25 is desired to be known . further illustrated in fig2 is an embodiment of the force transmitting member 65 configured as a trapezoidal prism . it should be understood that other configurations can be used without departing from the scope of the invention . other chosen configurations , however , should facilitate patient comfort , support and stability . as can be appreciated from fig1 compression of the force transmitting member 65 generates a resulting voltage across the force sensing element 70 which is representative of the compression exerted on the force sensing element 70 by the force transmitting member 65 . following compression of the force transmitting member 65 , the resulting voltage is delivered to a controller 75 where the received voltage is compared to a preset calibrating signal . deviations in the voltage signal as compared to the preset calibrating signal are then directed across a buffer amplifier 80 which modifies the voltage signal into a speed control voltage . the speed control voltage is then directed to a blower 40 or fluid regulating valve thereby either increasing or decreasing the rate of inflation air into the air mattress 15 . controller 75 can also be configured to communicate with a microprocessor 60 which stores and compares various voltage values , and is operable to regulate blower 40 or fluid regulating valve in response to changes in patient height distance . as shown schematically in fig1 a heterodyning proximation detector apparatus 5 includes an antenna 36 connected to a tank circuit and oscillator mock - up 45 which is in communication with detector 50 . in its preferred embodiment , tank circuit and oscillator mock - up 45 comprises a capacitor and variable inductor operatively connected to a frequency oscillator . frequency signals received by detector 50 are sent through a low pass filter 55 which operates to filter out high frequency signals , and emit only low frequency signals for conversion by a frequency - to - voltage converter 56 . the frequency - to - voltage converter 56 transforms the low frequency signals into a speed control voltage which activates a blower 40 or fluid regulating valve to provide inflation pressure to the air mattress 15 . detector 50 may also be configured with a microprocessor 60 for storing and comparing various voltage values to provide blower 40 speed control . in use , the heterodyning proximation detector apparatus 5 detects interactions between the electrical field pattern of the antenna 36 and the patient &# 39 ; s 10 electrical signature which is characteristic of that patient &# 39 ; s 10 dielectric constant . more particularly , the tank circuit and oscillator mock - up 45 operates to induce an electrical field within the antenna 36 which is responsive to a patient &# 39 ; s 10 electrical signature characterized by the particular dielectric constant of that patient . upon interaction with antenna &# 39 ; s 36 induced electrical field , a resulting change in the natural frequency of the oscillator is detected . the altered frequency is sent to detector 50 which functions to compare the altered frequency to a preset reference frequency . detected alterations in frequency signals are then transmitted through a low pass filter , and the resulting difference frequency is sent to a frequency - to - voltage converter 56 and / or servo control circuit which , in turn , communicates a generated speed control voltage to a blower 40 or fluid regulating valve . the generated heterodyning proximation detector frequency is compared to a frequency generated by a calibrating tank circuit and oscillator for any deviations between the two frequencies via a product detector 50 . a deviation in frequency represents any change in the patient &# 39 ; s relative position from the heterodyning detector apparatus 105 as compared to the calibrating , optimal therapeutic air pressure for the air mattress 15 . the deviation frequency from the product detector 50 is sent through a low pass filter 55 to allow only low frequency signals to pass as preparation for entering through a frequency - to - voltage converter 56 . the preferred method for regulating the inflation of an air mattress 15 of the present invention is shown in fig3 . initially , air mattress 15 is set to a deflated position 90 . while in a deflated position 90 , a patient is furthest away from the antenna 36 and air mattress 15 . referring to fig3 the antenna 36 and air mattress 15 are collectively depicted as the heterodyning proximation detector apparatus 105 ; thus , data representing the distance where the patient is furthest away from the heterodyning proximation detector apparatus 105 is recorded at the deflated position 90 . as the patient approaches the antenna 36 , the heterodyning proximation detector apparatus 105 detects the patient and signals blower 40 to begin delivering inflation pressure to the air mattress 15 . this step enables a sufficient amount of inflation pressure to be delivered into the air mattress 15 so as to inflate the air mattress 15 and prevent the possibility of patient bottoming - out as the patient is positioned atop the air mattress 15 . the air mattress 15 continues to inflate to a fully inflated position 95 so long as the patient remains positioned atop the upper surface 20 of the air mattress 15 . after the air mattress 15 reaches a fully inflated position 95 , data representing the patient &# 39 ; s closest distance away from the heterodyning proximation detector apparatus 105 is recorded . the patient &# 39 ; s optimal height distance 100 is then calibrated using the stored distances from the deflated and fully inflated positions 90 , 95 which are based upon the individual &# 39 ; s reactance as detected by the heterodyning proximation detector apparatus 105 . the air supply is continuously monitored and controlled 110 by the heterodyning proximation detector apparatus 105 to maintain the optimal height distance 100 . as the patient &# 39 ; s distance from the heterodyning proximation detector apparatus 105 increases or decreases , the air supply to the air mattress 15 is accordingly increased 115 or decreased 120 by control means specifically contemplated by this invention or the like . additionally , other methods would provide a force - responsive distance sensing apparatus 205 , a light - responsive distance sensing apparatus 30 or any other sensing means to cooperate and be included within the heterodyning proximation detector apparatus 105 to assist in controlling and monitoring the air supply of the air mattress 15 . fig4 illustrates one embodiment of the light - responsive distance sensing apparatus 30 of the present invention . the light - responsive distance sensing apparatus 30 comprises at least one inflatable chamber 150 forming an outer chamber surface 195 and a sealed inner chamber surface 200 . in a preferred embodiment , the inner chamber surface 200 is constructed of light diffusing materials , such as polyurethane , that are ideally suited to diffuse light within the inflatable chamber 150 . such inflatable chambers 150 may be arranged singularly , perpendicular to one another , in parallel or in any other preferred configuration that defines an inflatable air mattress 15 for providing primary cushioning and support . it is preferred that the inflatable chambers 150 be constructed of a flexible and pliable material that is receptive to a wide range of compressive forces , especially those forces generated by a patient positioned atop the upper surface 20 of the air mattress 15 . though other geometric shapes may be contemplated for the inflatable chamber 150 , fig4 depicts the chamber 150 as having a preferred cylindrical shape . as shown , the chamber 150 is constructed having a light emitter 125 releasably or permanently attached to the light emitter end 130 of the chamber 150 using fastening means , such as adhesives , tape , velcro , or any other fastening method known to one skilled in the art . a light detector 135 is attached to the light detector end 140 of the chamber 150 using the various fastening methods known in the art . the light emitter 125 and light detector 135 can be an infrared light emitting diode ( irled ) and a photo - transistor , respectively . however , it should be understood to someone skilled in the art that various other light emitters and detectors can be chosen without departing from the scope of the invention . in use , the chamber 150 of the light - responsive distance sensing apparatus 30 is inflated to an initial preset shape 165 , and the light emitter 125 and light detector 135 are activated to detect any deviation from the chamber &# 39 ; s preset shape . as illustrated in fig4 a chamber deformation 160 between the light emitter 125 and the light detector 135 is caused by compressive forces of the patient 10 when positioned on the upper surface 20 of the air mattress 15 . as shown , chamber deformation 160 causes the inner chamber surface 200 to scatter the emitted light , and , thus , results in less emitted light being received and detected by the light detector 135 . the resulting voltage output from the light detector 135 is transmitted through signal line 100 to a controller 170 which compares the light detector 135 voltage output to a preset calibrating voltage . any deviation away from the preset calibrating voltage represents a material disparity in air supply within the monitored chamber 150 . as shown in the embodiment of fig4 a microprocessor 60 may be configured along with the controller 170 to store and compare the various voltage values . where a material disparity in air supply is detected , the controller 170 and / or microprocessor 60 respond by delivering a voltage signal that activates a blower 40 or a regulating valve , not shown , to adjust the air supply accordingly . fig5 and 6 refer to an alternative embodiment of the light - responsive distance sensing apparatus 30 constructed with a pliable covering 175 . in this embodiment , the light emitter 125 and light detector 135 are situated outside of the outer chamber surface 195 at the light emitter end 130 and the light detector end 140 , respectively . other embodiments of the light - responsive distance sensing apparatus 30 position the light emitter 125 and light detector 135 within the chamber 150 , embedded along the chamber &# 39 ; s surface or any variation thereof . a pliable covering 175 having an inner surface 185 and an outer surface 180 is mated to the outer chamber surface 195 either along the entirety of the chamber 150 or substantially near the light emitter 125 or the light detector 135 . as shown in fig6 the pliable covering &# 39 ; s inner surface 185 is mated to the outer chamber surface 195 forming a pouch 145 for receiving the light emitter 125 or the light detector 135 therein . in effect , the pouch 145 seals and secures the light emitter 125 and the light detector 135 to the chamber 150 by restricting relative movement therein ; and the pouch 145 , with its pliable covering , aesthetically conceals the light emitter 125 and the light detector 135 . additionally ; the pouch 145 may be provided with releasable closings to facilitate either insertion or removal of the light emitter 125 or the light detector 135 into or out of the pouch 145 during maintenance or cleaning . fig5 and 6 show a chamber &# 39 ; s surface which partially forms a pouch 190 as constructed of either transparent or translucent material to accommodate as well as modify the projection of light from the light emitter 125 to the light detector 135 through the chamber 150 . to further facilitate the transmission of light through the chamber 150 , the inner surface 185 of the pliable covering which partially forms the pouch 145 may be constructed of opaque or reflective material . fig7 shows in detail the chamber &# 39 ; s deformation 160 in response to compressive forces exerted by the patient 10 when the patient 10 is resting on the upper surface 20 of the air mattress 15 . fig7 a . shows a possible chamber deformation 160 towards the light emitter end 130 . fig7 b . shows a possible chamber deformation 160 centered between the light emitter end 130 and the light detector end 140 of the chamber 150 . accordingly , one advantage of the present invention is that a deformation is detectable along the entire length of the light - responsive distance sensing apparatus 30 , and , thus , precludes the need for a vast and costly array of sensors along the length of the chamber 150 . as shown in fig4 and 5 , the light emitter 125 and light detector 135 are preferably situated at the opposing ends of the cylindrical chamber 150 . positioning the chamber 150 transversely across the frame 25 thus enables the caregiver to obtain patient x - rays along the length of the air mattress 15 without any x - ray interference from the light emitter 125 and light detector 135 . while the description given herein reflects the best mode known to the inventor , those who are reasonably skilled in the art will quickly recognize that there are many omissions , additions , substitutions , modifications and alternate embodiments may be made of the teachings herein . recognizing that those of reasonable skill in the art will easily see such alternate embodiments , they have in most cases not been described herein in order to preserve clarity .
| 8 |
in the following paragraphs , the present invention will be described in detail by way of example with reference to the attached drawings . while this invention is capable of embodiment in many different forms , there is shown in the drawings and will herein be described in detail specific embodiments , with the understanding that the present disclosure is to be considered as an example of the principles of the invention and not intended to limit the invention to the specific embodiments shown and described . that is , throughout this description , the embodiments and examples shown should be considered as exemplars , rather than as limitations on the present invention . as used herein , the “ present invention ” refers to any one of the embodiments of the invention described herein , and any equivalents . furthermore , reference to various feature ( s ) of the “ present invention ” throughout this document does not mean that all claimed embodiments or methods must include the referenced feature ( s ). in order to improve wireless communication system performance and allow a single device to move from one type of system to another , while still maintaining superior performance , the systems and methods described herein provide various communication methodologies that enhance performance of transmitters and receivers with regard to various common problems that afflict such systems and that allow the transmitters and / or receivers to be reconfigured for optimal performance in a variety of systems . accordingly , the systems and methods described herein define a channel access protocol that uses a common wideband communication channel for all communication cells . the wideband channel , however , is then divided into a plurality of sub - channels . different sub - channels are then assigned to one or more users within each cell . but the base station , or service access point , within each cell transmits one message that occupies the entire bandwidth of the wideband channel . each user &# 39 ; s communication device receives the entire message , but only decodes those portions of the message that reside in sub - channels assigned to the user . for a point - to - point system , for example , a single user may be assigned all sub - channels and , therefore , has the full wide band channel available to them . in a wireless wan , on the other hand , the sub - channels may be divided among a plurality of users . in the descriptions of example embodiments that follow , implementation differences , or unique concerns , relating to different types of systems will be pointed out to the extent possible . but it should be understood that the systems and methods described herein are applicable to any type of communication systems . in addition , terms such as communication cell , base station , service access point , etc . are used interchangeably to refer to the common aspects of networks at these different levels . to begin illustrating the advantages of the systems and methods described herein , one can start by looking at the multipath effects for a single wideband communication channel 100 of bandwidth b as shown in fig1 . communications sent over channel 100 in a traditional wireless communication system will comprise digital data bits , or symbols , that are encoded and modulated onto a rf carrier that is centered at frequency f c and occupies bandwidth b . generally , the width of the symbols ( or the symbol duration ) t is defined as 1 / b . thus , if the bandwidth b is equal to 100 mhz , then the symbol duration t is defined by the following equation : when a receiver receives the communication , demodulates it , and then decodes it , it will recreate a stream 104 of data symbols 106 as illustrated in fig2 . but the receiver will also receive multipath versions 108 of the same data stream . because multipath data streams 108 are delayed in time relative to the data stream 104 by delays d 1 , d 2 , d 3 , and d 4 , for example , they may combine destructively with data stream 104 . a delay spread d s is defined as the delay from reception of data stream 104 to the reception of the last multipath data stream 108 that interferes with the reception of data stream 104 . thus , in the example illustrated in fig2 , the delay spread d s is equal to delay d 4 . the delay spread d s will vary for different environments . an environment with a lot of obstacles will create a lot of multipath reflections . thus , the delay spread d s will be longer . experiments have shown that for outdoor wan type environments , the delay spread d s can be as long as 20 microseconds . using the 10 ns symbol duration of equation ( 1 ), this translates to 2000 symbols . thus , with a very large bandwidth , such as 100 mhz , multipath interference can cause a significant amount of interference at the symbol level for which adequate compensation is difficult to achieve . this is true even for indoor environments . for indoor lan type systems , the delay spread d s is significantly shorter , typically about 1 microsecond . for a 10 ns symbol duration , this is equivalent to 100 symbols , which is more manageable but still significant . by segmenting the bandwidth b into a plurality of sub - channels 202 , as illustrated in fig2 , and generating a distinct data stream for each sub - channel , the multipath effect can be reduced to a much more manageable level . for example , if the bandwidth b of each sub - channel 202 is 500 khz , then the symbol duration is 2 microseconds . thus , the delay spread d s for each sub - channel is equivalent to only 10 symbols ( outdoor ) or half a symbol ( indoor ). thus , by breaking up a message that occupies the entire bandwidth b into discrete messages , each occupying the bandwidth b of sub - channels 202 , a very wideband signal that suffers from relatively minor multipath effects is created . before discussing further features and advantages of using a wideband communication channel segmented into a plurality of sub - channels as described , certain aspects of the sub - channels will be explained in more detail . referring back to fig3 , the overall bandwidth b is segmented into n sub - channels center at frequencies f o to f n - 1 . thus , the sub - channel 202 that is immediately to the right of f c is offset from f c by b / 2 , where b is the bandwidth of each sub - channel 202 . the next sub - channel 202 is offset by 3b / 2 , the next by 5b / 2 , and so on . to the left of fc , each sub - channel 202 is offset by − b / 2 , − 3b / 2 , − 5b / 2 , etc . preferably , sub - channels 202 are non - overlapping as this allows each sub - channel to be processed independently in the receiver . to accomplish this , a roll - off factor is preferably applied to the signals in each sub - channel in a pulse - shaping step . the effect of such a pulse - shaping step is illustrated in fig2 by the non - rectangular shape of the pulses in each sub - channel 202 . thus , the bandwidth b of each sub - channel can be represented by an equation such as the following : without the roll - off factor , i . e ., b = 1 / t , the pulse shape would be rectangular in the frequency domain , which corresponds to a ( sin x )/ x function in the time domain . the time domain signal for a ( sin x )/ x signal 400 is shown in fig4 in order to illustrate the problems associated with a rectangular pulse shape and the need to use a roll - off factor . as can be seen , main lobe 402 comprises almost all of signal 400 . but some of the signal also resides in side lobes 404 , which stretch out indefinitely in both directions from main lobe 402 . side lobes 404 make processing signal 400 much more difficult , which increases the complexity of the receiver . applying a roll - off factor r , as in equation ( 2 ), causes signal 400 to decay faster , reducing the number of side lobes 404 . thus , increasing the roll - off factor decreases the length of signal 400 , i . e ., signal 400 becomes shorter in time . but including the roll - off factor also decreases the available bandwidth in each sub - channel 202 . therefore , r must be selected so as to reduce the number of side lobes 404 to a sufficient number , e . g ., 15 , while still maximizing the available bandwidth in each sub - channel 202 . thus , the overall bandwidth b for communication channel 200 is given by the following equation : for efficiency purposes related to transmitter design , it is preferable that r is chosen so that m in equation ( 5 ) is an integer . choosing r so that m is an integer allows for more efficient transmitters designs using , for example , inverse fast fourier transform ( ifft ) techniques . since m = n + n ( r ), and n is always an integer , this means that r must be chosen so that n ( r ) is an integer . generally , it is preferable for r to be between 0 . 1 and 0 . 5 . therefore , if n is 16 , for example , then 0 . 5 could be selected for r so that n ( r ) is an integer . alternatively , if a value for r is chosen in the above example so that n ( r ) is not an integer , b can be made slightly wider than m / t to compensate . in this case , it is still preferable that r be chosen so that n ( r ) is approximately an integer . with the above in mind , fig6 illustrates an example communication system 600 comprising a plurality of cells 602 that each use a common wideband communication channel to communicate with communication devices 604 within each cell 602 . the common communication channel is a wideband communication channel as described above . each communication cell 602 is defined as the coverage area of a base station , or service access point , 606 within the cell . one such base station 606 is shown for illustration in fig6 . for purposes of this specification and the claims that follow , the term base station will be used generically to refer to a device that provides wireless access to the wireless communication system for a plurality of communication devices , whether the system is a line of sight , indoor , or outdoor system . because each cell 602 uses the same communication channel , signals in one cell 602 must be distinguishable from signals in adjacent cells 602 . to differentiate signals from one cell 602 to another , adjacent base stations 606 use different synchronization codes according to a code reuse plan . in fig6 , system 600 uses a synchronization code reuse factor of 4 , although the reuse factor can vary depending on the application . preferably , the synchronization code is periodically inserted into a communication from a base station 606 to a communication device 604 as illustrated in fig6 . after a predetermined number of data packets 702 , in this case two , the particular synchronization code 704 is inserted into the information being transmitted by each base station 606 . a synchronization code is a sequence of data bits known to both the base station 606 and any communication devices 604 with which it is communicating . the synchronization code allows such a communication device 604 to synchronize its timing to that of base station 606 , which , in turn , allows device 604 to decode the data properly . thus , in cell 1 ( see lightly shaded cells 602 in fig6 ), for example , synchronization code 1 ( sync 1 ) is inserted into data stream 706 , which is generated by base station 606 in cell 1 , after every two packets 702 ; in cell 2 sync 2 is inserted after every two packets 702 ; in cell 3 sync 3 is inserted ; and in cell 4 sync 4 is inserted . use of the synchronization codes is discussed in more detail below . in fig5 a , an example wideband communication channel 500 for use in communication system 600 is divided into 16 sub - channels 502 , centered at frequencies f o to f 15 . a base station 606 at the center of each communication cell 602 transmits a single packet occupying the whole bandwidth b of wideband channel 500 . such a packet is illustrated by packet 504 in fig5 b . packet 504 comprises sub - packets 506 that are encoded with a frequency offset corresponding to one of sub - channels 502 . sub - packets 506 in effect define available time slots in packet 504 . similarly , sub - channels 502 can be said to define available frequency bins in communication channel 500 . therefore , the resources available in communication cell 602 are time slots 506 and frequency bins 502 , which can be assigned to different communication devices 604 within each cell 602 . thus , for example , frequency bins 502 and time slots 506 can be assigned to 4 different communication devices 604 within a cell 602 as shown in fig5 . each communication device 604 receives the entire packet 504 , but only processes those frequency bins 502 and / or timeslots 506 that are assigned to it . preferably , each device 604 is assigned non - adjacent frequency bins 502 , as in fig5 a . this way , if interference corrupts the information in a portion of communication channel 500 , then the effects are spread across all devices 604 within a cell 602 . hopefully , by spreading out the effects of interference in this manner the effects are minimized and the entire information sent to each device 604 can still be recreated from the unaffected information received in other frequency bins . for example , if interference , such as fading , corrupted the information in bins f o - f 4 , then each user 1 - 4 loses one packet of data . but each user potentially receives three unaffected packets from the other bins assigned to them . hopefully , the unaffected data in the other three bins provides enough information to recreate the entire message for each user . thus , frequency diversity can be achieved by assigning non - adjacent bins to each of multiple users . ensuring that the bins assigned to one user are separated by more than the coherence bandwidth ensures frequency diversity . as discussed above , the coherence bandwidth is approximately equal to 1 / d s . for outdoor systems , where d s is typically 1 microsecond , 1 / d s = 1 / 1 microsecond = 1 mega hertz ( mhz ). thus , the non - adjacent frequency bands assigned to a user are preferably separated by at least 1 mhz . it is even more preferable , however , if the coherence bandwidth plus some guard band to ensure sufficient frequency diversity separate the non - adjacent bins assigned to each user . for example , it is preferable in certain implementations to ensure that at least 5 times the coherence bandwidth , or 5 mhz in the above example , separates the non - adjacent bins . another way to provide frequency diversity is to repeat blocks of data in frequency bins assigned to a particular user that are separated by more than the coherence bandwidth . in other words , if 4 sub - channels 202 are assigned to a user , then data block a can be repeated in the first and third sub - channels 202 and data block b can be repeated in the second and fourth sub - channels 202 , provided the sub - channels are sufficiently separated in frequency . in this case , the system can be said to be using a diversity length factor of 2 . the system can similarly be configured to implement other diversity lengths , e . g ., 3 , 4 , . . . , 1 . it should be noted that spatial diversity can also be included depending on the embodiment . spatial diversity can comprise transmit spatial diversity , receive spatial diversity , or both . in transmit spatial diversity , the transmitter uses a plurality of separate transmitters and a plurality of separate antennas to transmit each message . in other words , each transmitter transmits the same message in parallel . the messages are then received from the transmitters and combined in the receiver . because the parallel transmissions travel different paths , if one is affected by fading , the others will likely not be affected . thus , when they are combined in the receiver , the message should be recoverable even if one or more of the other transmission paths experienced severe fading . receive spatial diversity uses a plurality of separate receivers and a plurality of separate antennas to receive a single message . if an adequate distance separates the antennas , then the transmission path for the signals received by the antennas will be different . again , this difference in the transmission paths will provide imperviousness to fading when the signals from the receivers are combined . transmit and receive spatial diversity can also be combined within a system such as system 600 so that two antennas are used to transmit and two antennas are used to receive . thus , each base station 606 transmitter can include two antennas , for transmit spatial diversity , and each communication device 604 receiver can include two antennas , for receive spatial diversity . if only transmit spatial diversity is implemented in system 600 , then it can be implemented in base stations 606 or in communication devices 604 . similarly , if only receive spatial diversity is included in system 600 , then it can be implemented in base stations 606 or communication devices 604 . the number of communication devices 604 assigned frequency bins 502 and / or time slots 506 in each cell 602 is preferably programmable in real time . in other words , the resource allocation within a communication cell 602 is preferably programmable in the face of varying external conditions , i . e ., multipath or adjacent cell interference , and varying requirements , i . e ., bandwidth requirements for various users within the cell . thus , if user 1 requires the whole bandwidth to download a large video file , for example , then the allocation of bins 502 can be adjust to provide user 1 with more , or even all , of bins 502 . once user 1 no longer requires such large amounts of bandwidth , the allocation of bins 502 can be readjusted among all of users 1 - 4 . it should also be noted that all of the bins assigned to a particular user can be used for both the forward and reverse link . alternatively , some bins 502 can be assigned as the forward link and some can be assigned for use on the reverse link , depending on the implementation . to increase capacity , the entire bandwidth b is preferably reused in each communication cell 602 , with each cell 602 being differentiated by a unique synchronization code ( see discussion below ). thus , system 600 provides increased immunity to multipath and fading as well as increased bandwidth due to the elimination of frequency reuse requirements . fig8 illustrates an example embodiment of a synchronization code correlator 800 . when a device 604 in cell 1 ( see fig6 ), for example , receives an incoming communication from the cell 1 base station 606 , it compares the incoming data with sync 1 in correlator 800 . essentially , the device scans the incoming data trying to correlate the data with the known synchronization code , in this case sync 1 . once correlator 800 matches the incoming data to sync 1 it generates a correlation peak 804 at the output . multipath versions of the data will also generate correlation peaks 806 , although these peaks 806 are generally smaller than correlation peak 804 . the device can then use the correlation peaks to perform channel estimation , which allows the device to adjust for the multipath using an equalizer . thus , in cell 1 , if correlator 800 receives a data stream comprising sync 1 , it will generate correlation peaks 804 and 806 . if , on the other hand , the data stream comprises sync 2 , for example , then no peaks will be generated and the device will essentially ignore the incoming communication . even though a data stream that comprises sync 2 will not create any correlation peaks , it can create noise in correlator 800 that can prevent detection of correlation peaks 804 and 806 . several steps can be taken to prevent this from occurring . one way to minimize the noise created in correlator 800 by signals from adjacent cells 602 , is to configure system 600 so that each base station 606 transmits at the same time . this way , the synchronization codes can preferably be generated in such a manner that only the synchronization codes 704 of adjacent cell data streams , e . g ., streams 708 , 710 , and 712 , as opposed to packets 702 within those streams , will interfere with detection of the correct synchronization code 704 , e . g ., sync 1 . the synchronization codes can then be further configured to eliminate or reduce the interference . for example , the noise or interference caused by an incorrect synchronization code is a function of the cross correlation of that synchronization code with respect to the correct code . the better the cross correlation between the two , the lower the noise level . when the cross correlation is ideal , then the noise level will be virtually zero as illustrated in fig9 by noise level 902 . therefore , a preferred embodiment of system 600 uses synchronization codes that exhibit ideal cross correlation , i . e ., zero . preferably , the ideal cross correlation of the synchronization codes covers a period l that is sufficient to allow accurate detection of multipath 906 as well as multipath correlation peaks 904 . this is important so that accurate channel estimation and equalization can take place . outside of period 1 , the noise level 908 goes up , because the data in packets 702 is random and will exhibit low cross correlation with the synchronization code , e . g ., sync 1 . preferably , period 1 is actually slightly longer then the multipath length in order to ensure that the multipath can be detected . conventional systems use orthogonal codes to achieve cross correlation in correlator 800 . in system 600 for example , sync 1 , sync 2 , sync 3 , and sync 4 , corresponding to cells 1 - 4 ( see lightly shaded cells 602 of fig5 ) respectively , will all need to be generated in such a manner that they will have ideal cross correlation with each other . in one embodiment , if the data streams involved comprise high and low data bits , then the value “ 1 ” can be assigned to the high data bits and “− 1 ” to the low data bits . orthogonal data sequences are then those that produce a “ 0 ” output when they are exclusively ored ( xored ) together in correlator 800 . the following example illustrates this point for orthogonal sequences 1 and 2 : thus , when the results of xoring each bit pair are added , the result is “ 0 ”. but in system 600 , for example , each code must have ideal , or zero , cross correlation with each of the other codes used in adjacent cells 602 . therefore , in one example embodiment of a method for generating synchronization codes exhibiting the properties described above , the process begins by selecting a “ perfect sequence ” to be used as the basis for the codes . a perfect sequence is one that when correlated with itself produces a number equal to the number of bits in the sequence . for example : but each time a perfect sequence is cyclically shifted by one bit , the new sequence is orthogonal with the original sequence . thus , for example , if perfect sequence 1 is cyclically shifted by one bit and then correlated with the original , the correlation produces a “ 0 ” as in the following example ; if the perfect sequence 1 is again cyclically shifted by one bit , and again correlated with the original , then it will produce a “ 0 ”. in general , you can cyclically shift a perfect sequence by any number of bits up to its length and correlate the shifted sequence with the original to obtain a “ 0 ”. once a perfect sequence of the correct length is selected , the first synchronization code is preferably generated in one embodiment by repeating the sequence 4 times . thus , if perfect sequence 1 is being used , then a first synchronization code y would be the following : repeating the perfect sequence allows correlator 800 a better opportunity to detect the synchronization code and allows generation of other uncorrelated frequencies as well . repeating has the effect of sampling in the frequency domain . this effect is illustrated by the graphs in fig1 . thus , in trace 1 , which corresponds to synchronization code y , a sample 1002 is generated every fourth sample bin 1000 . each sample bin is separated by 1 /( 4l × t ), where t is the symbol duration . thus , in the above example , where l = 4 , each sample bin is separated by 1 /( 16 × t ) in the frequency domain . traces 2 - 4 illustrate the next three synchronization codes . as can be seen , the samples for each subsequent synchronization code are shifted by one sample bin relative to the samples for the previous sequence . therefore , none of the sequences interfere with each other . to generate the subsequent sequences , corresponding to traces 2 - 4 , sequence y must be shifted in frequency . this can be accomplished using the following equation : z r ( m )= y ( m )* exp ( j * 2 * π * r * m /( n * l )), ( 5 ) for r = 1 to l (# of sequences ) and m = 0 to 4 * l - 1 ( time ); and y ( m )= the first sequence ; and n = the number of times the sequence is repeated . it will be understood that multiplying by an exp ( j2π ( r * m / n )) factor , where n is equal to the number of times the sequence is repeated n multiplied by the length of the underlying perfect sequence l , in the time domain results in a shift in the frequency domain . equation ( 5 ) results in the desired shift as illustrated in fig1 for each of synchronization codes 2 - 4 , relative to synchronization code 1 . the final step in generating each synchronization code is to append the copies of the last m samples , where m is the length of the multipath , to the front of each code . this is done to make the convolution with the multipath cyclic and to allow easier detection of the multipath . it should be noted that synchronization codes can be generated from more than one perfect sequence using the same methodology . for example , a perfect sequence can be generated and repeated four times and then a second perfect sequence can be generated and repeated four times to get a n factor equal to eight . the resulting sequence can then be shifted as described above to create the synchronization codes . therefore , when a communication device is at the edge of a cell , it will receive signals from multiple base stations and , therefore , will be decoding several synchronization codes at the same time . this can be illustrated with the help of fig1 , which illustrates another example embodiment of a wireless communication system 1100 comprising communication cells 1102 , 1104 , and 1106 as well as communication device 1108 , which is in communication with base station 1110 of cell 1102 but also receiving communication from base stations 1112 and 1114 of cells 1104 and 1106 , respectively . if communications from base station 1110 comprise synchronization code sync 1 and communications from base station 1112 and 1114 comprise sync 2 and sync 3 respectively , then device 1108 will effectively receive the sum of these three synchronization codes . this is because , as explained above , base stations 1110 , 1112 , and 1114 are configured to transmit at the same time . also , the synchronization codes arrive at device 1108 at almost the same time because they are generated in accordance with the description above . again as described above , the synchronization codes sync 1 , sync 2 , and sync 3 exhibit ideal cross correlation . therefore , when device 1108 correlates the sum x of codes sync 1 , sync 2 , and sync 3 , the latter two will not interfere with proper detection of sync 1 by device 1108 . importantly , the sum x can also be used to determine important signal characteristics , because the sum x is equal to the sum of the synchronization code signal in accordance with the following equation : therefore , when sync 1 is removed , the sum of sync 2 and sync 3 is left , as shown in the following : the energy computed from the sum ( sync 2 + sync 3 ) is equal to the noise or interference seen by device 1108 . since the purpose of correlating the synchronization code in device 1106 is to extract the energy in sync 1 , device 1108 also has the energy in the signal from base station 1110 , i . e ., the energy represented by sync 1 . therefore , device 1106 can use the energy of sync 1 and of ( sync 2 + sync 3 ) to perform a signal - to - interference measurement for the communication channel over which it is communicating with base station 1110 . the result of the measurement is preferably a signal - to - interference ratio ( sir ). the sir measurement can then be communicated back to base station 1110 for purposes that will be discussed below . the ideal cross correlation of the synchronization codes , also allows device 1108 to perform extremely accurate determinations of the channel impulse response ( cir ), or channel estimation , from the correlation produced by correlator 800 . this allows for highly accurate equalization using low cost , low complexity equalizers , thus overcoming a significant draw back of conventional systems . as mentioned , the sir as determined by device 1108 can be communicated back to base station 1110 for use in the assignment of channels 502 . in one embodiment , due to the fact that each sub - channel 502 is processed independently , the sir for each sub - channel 502 can be measured and communicated back to base station 1110 . in such an embodiment , therefore , sub - channels 502 can be divided into groups and a sir measurement for each group can be sent to base station 1110 . this is illustrated in fig1 a , which shows a wideband communication channel 1200 segmented into sub - channels fo to f 5 . sub - channels fo to f 15 are then grouped into 8 groups g 1 to g 8 . thus , in one embodiment , device 1108 and base station 1110 communicate over a channel such as channel 1200 . sub - channels in the same group are preferably separated by as many sub - channels as possible to ensure diversity . in fig1 a for example , sub - channels within the same group are 7 sub - channels apart , e . g ., group g 1 comprises f 0 and f 8 . device 1102 reports a sir measurement for each of the groups g 1 to g 8 . these sir measurements are preferably compared with a threshold value to determine which sub - channels groups are useable by device 1108 . this comparison can occur in device 1108 or base station 1110 . if it occurs in device 1108 , then device 1108 can simply report to base station 1110 which sub - channels groups are useable by device 1108 . sir reporting will be simultaneously occurring for a plurality of devices within cell 1102 . thus , fig1 b illustrates the situation where two communication devices corresponding to user 1 and user 2 report sir levels above the threshold for groups g 1 , g 3 , g 5 , and g 7 . base station 1110 preferably then assigns sub - channel groups to user 1 and user 2 based on the sir reporting as illustrated in fig1 b . when assigning the “ good ” sub - channel groups to user 1 and user 2 , base station 1110 also preferably assigns them based on the principles of frequency diversity . in fig1 b , therefore , user 1 and user 2 are alternately assigned every other “ good ” sub - channel . the assignment of sub - channels in the frequency domain is equivalent to the assignment of time slots in the time domain . therefore , as illustrated in fig1 , two users , user 1 and user 2 , receive packet 1302 transmitted over communication channel 1200 . fig1 also illustrated the sub - channel assignment of fig1 b . while fig1 and 13 illustrate sub - channel / time slot assignment based on sir for two users , the principles illustrated can be extended for any number of users . thus , a packet within cell 1102 can be received by 3 or more users . although , as the number of available sub - channels is reduced due to high sir , so is the available bandwidth . in other words , as available channels are reduced , the number of users that can gain access to communication channel 1200 is also reduced . poor sir can be caused for a variety of reasons , but frequently it results from a device at the edge of a cell receiving communication signals from adjacent cells . because each cell is using the same bandwidth b , the adjacent cell signals will eventually raise the noise level and degrade sir for certain sub - channels . in certain embodiments , therefore , sub - channel assignment can be coordinated between cells , such as cells 1102 , 1104 , and 1106 in fig1 , in order to prevent interference from adjacent cells . thus , if communication device 1108 is near the edge of cell 1102 , and device 1118 is near the edge of cell 1106 , then the two can interfere with each other . as a result , the sir measurements that device 1108 and 1118 report back to base stations 1110 and 1114 , respectively , will indicate that the interference level is too high . base station 1110 can then be configured to assign only the odd groups , i . e ., g 1 , g 3 , g 5 , etc ., to device 1108 , while base station 1114 can be configured to assign the even groups to device 1118 . the two devices 1108 and 1118 will then not interfere with each other due to the coordinated assignment of sub - channel groups . assigning the sub - channels in this manner reduces the overall bandwidth available to devices 1108 and 1118 , respectively . in this case the bandwidth is reduced by a factor of two . but it should be remembered that devices operating closer to each base station 1110 and 1114 , respectively , will still be able to use all channels if needed . thus , it is only devices , such as device 1108 , that are near the edge of a cell that will have the available bandwidth reduced . contrast this with a cdma system , for example , in which the bandwidth for all users is reduced , due to the spreading techniques used in such systems , by approximately a factor of 10 at all times . it can be seen , therefore , that the systems and methods for wireless communication over a wide bandwidth channel using a plurality of sub - channels not only improves the quality of service , but can also increase the available bandwidth significantly . when there are three devices 1108 , 1118 , and 1116 near the edge of their respective adjacent cells 1102 , 1104 , and 1106 , the sub - channels can be divided by three . thus , device 1108 , for example , can be assigned groups g 1 , g 4 , etc ., device 1118 can be assigned groups g 2 , g 5 , etc ., and device 1116 can be assigned groups g 3 , g 6 , etc . in this case the available bandwidth for these devices , i . e ., devices near the edges of cells 1102 , 1104 , and 1106 , is reduced by a factor of 3 , but this is still better than a cdma system , for example . the manner in which such a coordinated assignment of sub - channels can work is illustrated by the flow chart in fig1 . first in step 1402 , a communication device , such as device 1108 , reports the sir for all sub - channel groups g 1 to g 8 . the sirs reported are then compared , in step 1404 , to a threshold to determine if the sir is sufficiently low for each group . alternatively , device 1108 can make the determination and simply report which groups are above or below the sir threshold . if the sir levels are good for each group , then base station 1110 can make each group available to device 1108 , in step 1406 . periodically , device 1108 preferably measures the sir level and updates base station 1110 in case the sir as deteriorated . for example , device 1108 may move from near the center of cell 1102 toward the edge , where interference from an adjacent cell may affect the sir for device 1108 . if the comparison in step 1404 reveals that the sir levels are not good , then base station 1110 can be preprogrammed to assign either the odd groups or the even groups only to device 1108 , which it will do in step 1408 . device 1108 then reports the sir measurements for the odd or even groups it is assigned in step 1410 , and they are again compared to a sir threshold in step 1412 . it is assumed that the poor sir level is due to the fact that device 1108 is operating at the edge of cell 1102 and is therefore being interfered with by a device such as device 1118 . but device 1108 will be interfering with device 1118 at the same time . therefore , the assignment of odd or even groups in step 1408 preferably corresponds with the assignment of the opposite groups to device 1118 , by base station 1114 . accordingly , when device 1108 reports the sir measurements for whichever groups , odd or even , are assigned to it , the comparison in step 1410 should reveal that the sir levels are now below the threshold level . thus , base station 1110 makes the assigned groups available to device 1108 in step 1414 . again , device 1108 preferably periodically updates the sir measurements by returning to step 1402 . it is possible for the comparison of step 1410 to reveal that the sir levels are still above the threshold , which should indicate that a third device , e . g ., device 1116 is still interfering with device 1108 . in this case , base station 1110 can be preprogrammed to assign every third group to device 1108 in step 1416 . this should correspond with the corresponding assignments of non - interfering channels to devices 1118 and 1116 by base stations 1114 and 1112 , respectively . thus , device 1108 should be able to operate on the sub - channel groups assigned , i . e ., g 1 , g 4 , etc ., without undue interference . again , device 1108 preferably periodically updates the sir measurements by returning to step 1402 . optionally , a third comparison step ( not shown ) can be implemented after step 1416 , to ensure that the groups assigned to device 1408 posses an adequate sir level for proper operation . moreover , if there are more adjacent cells , i . e ., if it is possible for devices in a 4 th or even a 5 th adjacent cell to interfere with device 1108 , then the process of fig1 would continue and the sub - channel groups would be divided even further to ensure adequate sir levels on the sub - channels assigned to device 1108 . even though the process of fig1 reduces the bandwidth available to devices at the edge of cells 1102 , 1104 , and 1106 , the sir measurements can be used in such a manner as to increase the data rate and therefore restore or even increase bandwidth . to accomplish this , the transmitters and receivers used in base stations 1102 , 1104 , and 1106 , and in devices in communication therewith , e . g ., devices 1108 , 1114 , and 1116 respectively , must be capable of dynamically changing the symbol mapping schemes used for some or all of the sub - channel . for example , in some embodiments , the symbol mapping scheme can be dynamically changed among bpsk , qpsk , 8psk , 16qam , 32qam , etc . as the symbol mapping scheme moves higher , i . e ., toward 32qam , the sir level required for proper operation moves higher , i . e ., less and less interference can be withstood . therefore , once the sir levels are determined for each group , the base station , e . g ., base station 1110 , can then determine what symbol mapping scheme can be supported for each sub - channel group and can change the modulation scheme accordingly . device 1108 must also change the symbol mapping scheme to correspond to that of the base stations . the change can be effected for all groups uniformly , or it can be effected for individual groups . moreover , the symbol mapping scheme can be changed on just the forward link , just the reverse link , or both , depending on the embodiment . thus , by maintaining the capability to dynamically assign sub - channels and to dynamically change the symbol mapping scheme used for assigned sub - channels , the systems and methods described herein provide the ability to maintain higher available bandwidths with higher performance levels than conventional systems . to fully realize the benefits described , however , the systems and methods described thus far must be capable of implementation in a cost effect and convenient manner . moreover , the implementation must include reconfigurability so that a single device can move between different types of communication systems and still maintain optimum performance in accordance with the systems and methods described herein . the following descriptions detail example high level embodiments of hardware implementations configured to operate in accordance with the systems and methods described herein in such a manner as to provide the capability just described above . fig1 is logical block diagram illustrating an example embodiment of a transmitter 1500 configured for wireless communication in accordance with the systems and methods described above . the transmitter could , for example be within a base station , e . g ., base station 606 , or within a communication device , such as device 604 . transmitter 1500 is provided to illustrate logical components that can be included in a transmitter configured in accordance with the systems and methods described herein . it is not intended to limit the systems and methods for wireless communication over a wide bandwidth channel using a plurality of sub - channels to any particular transmitter configuration or any particular wireless communication system . with this in mind , it can be seen that transmitter 1500 comprises a serial - to - parallel converter 1504 configured to receive a serial data stream 1502 comprising a data rate r . serial - to - parallel converter 1504 converts data stream 1502 into n parallel data streams 1504 , where n is the number of sub - channels 202 . it should be noted that while the discussion that follows assumes that a single serial data stream is used , more than one serial data stream can also be used if required or desired . in any case , the data rate of each parallel data stream 1504 is then r / n . each data stream 1504 is then sent to a scrambler , encoder , and interleaver block 1506 . scrambling , encoding , and interleaving are common techniques implemented in many wireless communication transmitters and help to provide robust , secure communication . examples of these techniques will be briefly explained for illustrative purposes . scrambling breaks up the data to be transmitted in an effort to smooth out the spectral density of the transmitted data . for example , if the data comprises a long string of “ 1 ” s , there will be a spike in the spectral density . this spike can cause greater interference within the wireless communication system . by breaking up the data , the spectral density can be smoothed out to avoid any such peaks . often , scrambling is achieved by xoring the data with a random sequence . encoding , or coding , the parallel bit streams 1504 can , for example , provide forward error correction ( fec ). the purpose of fec is to improve the capacity of a communication channel by adding some carefully designed redundant information to the data being transmitted through the channel . the process of adding this redundant information is known as channel coding . convolutional coding and block coding are the two major forms of channel coding . convolutional codes operate on serial data , one or a few bits at a time . block codes operate on relatively large ( typically , up to a couple of hundred bytes ) message blocks . there are a variety of useful convolutional and block codes , and a variety of algorithms for decoding the received coded information sequences to recover the original data . for example , convolutional encoding or turbo coding with viterbi decoding is a fec technique that is particularly suited to a channel in which the transmitted signal is corrupted mainly by additive white gaussian noise ( awgn ) or even a channel that simply experiences fading . convolutional codes are usually described using two parameters : the code rate and the constraint length . the code rate , k / n , is expressed as a ratio of the number of bits into the convolutional encoder ( k ) to the number of channel symbols ( n ) output by the convolutional encoder in a given encoder cycle . a common code rate is ½ , which means that 2 symbols are produced for every 1 - bit input into the coder . the constraint length parameter , k , denotes the “ length ” of the convolutional encoder , i . e . how many k - bit stages are available to feed the combinatorial logic that produces the output symbols . closely related to k is the parameter m , which indicates how many encoder cycles an input bit is retained and used for encoding after it first appears at the input to the convolutional encoder . the m parameter can be thought of as the memory length of the encoder . interleaving is used to reduce the effects of fading . interleaving mixes up the order of the data so that if a fade interferes with a portion of the transmitted signal , the overall message will not be affected . this is because once the message is de - interleaved and decoded in the receiver , the data lost will comprise non - contiguous portions of the overall message . in other words , the fade will interfere with a contiguous portion of the interleaved message , but when the message is de - interleaved , the interfered with portion is spread throughout the overall message . using techniques such as fec , the missing information can then be filled in , or the impact of the lost data may just be negligible . after blocks 1506 , each parallel data stream 1504 is sent to symbol mappers 1508 . symbol mappers 1508 apply the requisite symbol mapping , e . g ., bpsk , qpsk , etc ., to each parallel data stream 1504 . symbol mappers 1508 are preferably programmable so that the modulation applied to parallel data streams can be changed , for example , in response to the sir reported for each sub - channel 202 . it is also preferable , that each symbol mapper 1508 be separately programmable so that the optimum symbol mapping scheme for each sub - channel can be selected and applied to each parallel data stream 1504 . after symbol mappers 1508 , parallel data streams 1504 are sent to modulators 1510 . important aspects and features of example embodiments of modulators 1510 are described below . after modulators 1510 , parallel data streams 1504 are sent to summer 1512 , which is configured to sum the parallel data streams and thereby generate a single serial data stream 1518 comprising each of the individually processed parallel data streams 1504 . serial data stream 1518 is then sent to radio module 1512 , where it is modulated with an rf carrier , amplified , and transmitted via antenna 1516 according to known techniques . the transmitted signal occupies the entire bandwidth b of communication channel 100 and comprises each of the discrete parallel data streams 1504 encoded onto their respective sub - channels 102 within bandwidth b . encoding parallel data streams 1504 onto the appropriate sub - channels 102 requires that each parallel data stream 1504 be shifted in frequency by an appropriate offset . this is achieved in modulator 1510 . fig1 is a logical block diagram of an example embodiment of a modulator 1600 in accordance with the systems and methods described herein . importantly , modulator 1600 takes parallel data streams 1602 performs time division modulation ( tdm ) or frequency division modulation ( fdm ) on each data stream 1602 , filters them using filters 1612 , and then shifts each data stream in frequency using frequency shifter 1614 so that they occupy the appropriate sub - channel . filters 1612 apply the required pulse shaping , i . e ., they apply the roll - off factor described in section 1 . the frequency shifted parallel data streams 1602 are then summed and transmitted . modulator 1600 can also include rate controller 1604 , frequency encoder 1606 , and interpolators 1610 . all of the components shown in fig1 are described in more detail in the following paragraphs and in conjunction with fig1 - 22 . fig1 illustrates one example embodiment of a rate controller 1700 in accordance with the systems and methods described herein . rate control 1700 is used to control the data rate of each parallel data stream 1602 . in rate controller 1700 , the data rate is halved by repeating data streams d ( 0 ) to d ( 7 ), for example , producing streams a ( 0 ) to a ( 15 ) in which a ( 0 ) is the same as a ( 8 ), a ( 1 ) is the same as a ( 9 ), etc . fig1 also illustrates that the effect of repeating the data streams in this manner is to take the data streams that are encoded onto the first 8 sub - channels 1702 , and duplicate them on the next 8 sub - channels 1702 . as can be seen , 7 sub - channels separate sub - channels 1702 comprising the same , or duplicate , data streams . thus , if fading effects one sub - channel 1702 , for example , the other sub - channels 1702 carrying the same data will likely not be effected , i . e ., there is frequency diversity between the duplicate data streams . so by sacrificing data rate , in this case half the data rate , more robust transmission is achieved . moreover , the robustness provided by duplicating the data streams d ( 0 ) to d ( 7 ) can be further enhanced by applying scrambling to the duplicated data streams via scramblers 1708 . it should be noted that the data rate can be reduced by more than half , e . g ., by four or more . alternatively , the data rate can also be reduced by an amount other than half . for example if information from n data stream is encoded onto m sub - channels , where m & gt ; n . thus , to decrease the rate by ⅔ , information from one data stream can be encoded on a first sub - channel , information from a second data stream can be encoded on a second data channel , and the sum or difference of the two data streams can be encoded on a third channel . in which case , proper scaling will need to be applied to the power in the third channel . otherwise , for example , the power in the third channel can be twice the power in the first two . preferably , rate controller 1700 is programmable so that the data rate can be changed responsive to certain operational factors . for example , if the sir reported for sub - channels 1702 is low , then rate controller 1700 can be programmed to provide more robust transmission via repetition to ensure that no data is lost due to interference . additionally , different types of wireless communication system , e . g ., indoor , outdoor , line - of - sight , may require varying degrees of robustness . thus , rate controller 1700 can be adjusted to provide the minimum required robustness for the particular type of communication system . this type of programmability not only ensures robust communication , it can also be used to allow a single device to move between communication systems and maintain superior performance . fig1 illustrates an alternative example embodiment of a rate controller 1800 in accordance with the systems and methods described . in rate controller 1800 the data rate is increased instead of decreased . this is accomplished using serial - to - parallel converters 1802 to convert each data streams d ( 0 ) to d ( 15 ), for example , into two data streams . delay circuits 1804 then delay one of the two data streams generated by each serial - to - parallel converter 1802 by ½ a symbol . thus , data streams d ( 0 ) to d ( 15 ) are transformed into data streams a ( 0 ) to a ( 31 ). the data streams generated by a particular serial - to - parallel converter 1802 and associate delay circuit 1804 must then be summed and encoded onto the appropriate sub - channel . for example , data streams a ( 0 ) and a ( 1 ) must be summed and encoded onto the first sub - channel . preferably , the data streams are summed subsequent to each data stream being pulsed shaped by a filter 1612 . thus , rate controller 1604 is preferably programmable so that the data rate can be increased , as in rate controller 1800 , or decreased , as in rate controller 1700 , as required by a particular type of wireless communication system , or as required by the communication channel conditions or sub - channel conditions . in the event that the data rate is increased , filters 1612 are also preferably programmable so that they can be configured to apply pulse shaping to data streams a ( 0 ) to a ( 31 ), for example , and then sum the appropriate streams to generate the appropriate number of parallel data streams to send to frequency shifter 1614 . the advantage of increasing the data rate in the manner illustrated in fig1 is that higher symbol mapping rates can essentially be achieved , without changing the symbol mapping used in symbol mappers 1508 . once the data streams are summed , the summed streams are shifted in frequency so that they reside in the appropriate sub - channel . but because the number of bits per each symbol has been doubled , the symbol mapping rate has been doubled . thus , for example , a 4qam symbol mapping can be converted to a 16qam symbol mapping , even if the sir is too high for 16qam symbol mapping to otherwise be applied . in other words , programming rate controller 1800 to increase the data rate in the manner illustrated in fig1 can increase the symbol mapping even when channel conditions would otherwise not allow it , which in turn can allow a communication device to maintain adequate or even superior performance regardless of the type of communication system . the draw back to increasing the data rate as illustrated in fig1 is that interference is increased , as is receiver complexity . the former is due to the increased amount of data . the latter is due to the fact that each symbol cannot be processed independently because of the ½ symbol overlap . thus , these concerns must be balanced against the increase symbol mapping ability when implementing a rate controller such as rate controller 1800 . fig1 illustrates one example embodiment of a frequency encoder 1900 in accordance with the systems and methods described herein . similar to rate encoding , frequency encoding is preferably used to provide increased communication robustness . in frequency encoder 1900 the sum or difference of multiple data streams are encoded onto each sub - channel . this is accomplished using adders 1902 to sum data streams d ( 0 ) to d ( 7 ) with data streams d ( 8 ) to d ( 15 ), respectively , while adders 1904 subtract data streams d ( 0 ) to d ( 7 ) from data streams d ( 8 ) to d ( 15 ), respectively , as shown . thus , data streams a ( 0 ) to a ( 15 ) generated by adders 1902 and 1904 comprise information related to more than one data streams d ( 0 ) to d ( 15 ). for example , a ( 0 ) comprises the sum of d ( 0 ) and d ( 8 ), i . e ., d ( 0 )+ d ( 8 ), while a ( 8 ) comprises d ( 8 )- d ( 0 ). therefore , if either a ( 0 ) or a ( 8 ) is not received due to fading , for example , then both of data streams d ( 0 ) and d ( 8 ) can still be retrieved from data stream a ( 8 ). essentially , the relationship between data stream d ( 0 ) to d ( 15 ) and a ( 0 ) to a ( 15 ) is a matrix relationship . thus , if the receiver knows the correct matrix to apply , it can recover the sums and differences of d ( 0 ) to d ( 15 ) from a ( 0 ) to a ( 15 ). preferably , frequency encoder 1900 is programmable , so that it can be enabled and disabled in order to provided robustness when required . preferable , adders 1902 and 1904 are programmable also so that different matrices can be applied to d ( 0 ) to d ( 15 ). after frequency encoding , if it is included , data streams 1602 are sent to tdm / fdm blocks 1608 . tdm / fdm blocks 1608 perform tdm or fdm on the data streams as required by the particular embodiment . fig2 illustrates an example embodiment of a tdm / fdm block 2000 configured to perform tdm on a data stream . tdm / fdm block 2000 is provided to illustrate the logical components that can be included in a tdm / fdm block configured to perform tdm on a data stream . depending on the actual implementation , some of the logical components may or may not be included . tdm / fdm block 2000 comprises a sub - block repeater 2002 , a sub - block scrambler 2004 , a sub - block terminator 2006 , a sub - block repeater 2008 , and a sync inserter 2010 . sub - block repeater 2002 is configured to receive a sub - block of data , such as block 2012 comprising bits a ( 0 ) to a ( 3 ) for example . sub - block repeater is then configured to repeat block 2012 to provide repetition , which in turn leads to more robust communication . thus , sub - block repeater 2002 generates block 2014 , which comprises 2 blocks 2012 . sub - block scrambler 2004 is then configured to receive block 2014 and to scramble it , thus generating block 2016 . one method of scrambling can be to invert half of block 2014 as illustrated in block 2016 . but other scrambling methods can also be implemented depending on the embodiment . sub - block terminator 2006 takes block 2016 generated by sub - block scrambler 2004 and adds a termination block 2034 to the front of block 2016 to form block 2018 . termination block 2034 ensures that each block can be processed independently in the receiver . without termination block 2034 , some blocks may be delayed due to multipath , for example , and they would therefore overlap part of the next block of data . but by including termination block 2034 , the delayed block can be prevented from overlapping any of the actual data in the next block . termination block 2034 can be a cyclic prefix termination 2036 . a cyclic prefix termination 2036 simply repeats the last few symbols of block 2018 . thus , for example , if cyclic prefix termination 2036 is three symbols long , then it would simply repeat the last three symbols of block 2018 . alternatively , termination block 2034 can comprise a sequence of symbols that are known to both the transmitter and receiver . the selection of what type of block termination 2034 to use can impact what type of equalizer is used in the receiver . therefore , receiver complexity and choice of equalizers must be considered when determining what type of termination block 2034 to use in tdm / fdm block 2000 . after sub - block terminator 2006 , tdm / fdm block 2000 can include a sub - block repeater 2008 configured to perform a second block repetition step in which block 2018 is repeated to form block 2020 . in certain embodiments , sub - block repeater can be configured to perform a second block scrambling step as well . after sub - block repeater 2008 , if included , tdm / fdm block 2000 comprises a sync inserter 210 configured to periodically insert an appropriate synchronization code 2032 after a predetermined number of blocks 2020 and / or to insert known symbols into each block . the purpose of synchronization code 2032 is discussed in section 3 . fig2 , on the other hand , illustrates an example embodiment of a tdm / fdm block 2100 configured for fdm , which comprises sub - block repeater 2102 , sub - block scrambler 2104 , block coder 2106 , sub - block transformer 2108 , sub - block terminator 2110 , and sync inserter 2112 . as with tdm / fdm block 2000 , sub - block repeater 2102 repeats block 2114 and generates block 2116 . sub - block scrambler then scrambles block 2116 , generating block 2118 . sub - block coder 2106 takes block 2118 and codes it , generating block 2120 . coding block correlates the data symbols together and generates symbols b . this requires joint demodulation in the receiver , which is more robust but also more complex . sub - block transformer 2108 then performs a transformation on block 2120 , generating block 2122 . preferably , the transformation is an ifft of block 2120 , which allows for more efficient equalizers to be used in the receiver . next , sub - block terminator 2110 terminates block 2122 , generating block 2124 and sync inserter 2112 periodically inserts a synchronization code 2126 after a certain number of blocks 2124 and / or insert known symbols into each block . preferably , sub - block terminator 2110 only uses cyclic prefix termination as described above . again this allows for more efficient receiver designs . tdm / fdm block 2100 is provided to illustrate the logical components that can be included in a tdm / fdm block configured to perform fdm on a data stream . depending on the actual implementation , some of the logical components may or may not be included . moreover , tdm / fdm block 2000 and 2100 are preferably programmable so that the appropriate logical components can be included as required by a particular implementation . this allows a device that incorporates one of blocks 2000 or 2100 to move between different systems with different requirements . further , it is preferable that tdm / fdm block 1608 in fig1 be programmable so that it can be programmed to perform tdm , such as described in conjunction with block 2000 , or fdm , such as described in conjunction with block 2100 , as required by a particular communication system . after tdm / fdm blocks 1608 , in fig1 , the parallel data streams are preferably passed to interpolators 1610 . after interpolators 1610 , the parallel data streams are passed to filters 1612 , which apply the pulse shaping described in conjunction with the roll - off factor of equation ( 2 ) in section 1 . then the parallel data streams are sent to frequency shifter 1614 , which is configured to shift each parallel data stream by the frequency offset associated with the sub - channel to which the particular parallel data stream is associated . fig2 illustrates an example embodiment of a frequency shifter 2200 in accordance with the systems and methods described herein . as can be seen , frequency shifter 2200 comprises multipliers 2202 configured to multiply each parallel data stream by the appropriate exponential to achieve the required frequency shift . each exponential is of the form : exp ( j2πd c nt / rm ), where c is the corresponding sub - channel , e . g ., c = 0 to n − 1 , and n is time . preferably , frequency shifter 1614 in fig1 is programmable so that various channel / sub - channel configurations can be accommodated for various different systems . alternatively , an ifft block can replace shifter 1614 and filtering can be done after the ifft block . this type of implementation can be more efficient depending on the implementation . after the parallel data streams are shifted , they are summed , e . g ., in summer 1512 of fig1 . the summed data stream is then transmitted using the entire bandwidth b of the communication channel being used . but the transmitted data stream also comprises each of the parallel data streams shifted in frequency such that they occupy the appropriate sub - channel . thus , each sub - channel may be assigned to one user , or each sub - channel may carry a data stream intended for different users . the assignment of sub - channels is described in section 3 b . regardless of how the sub - channels are assigned , however , each user will receive the entire bandwidth , comprising all the sub - channels , but will only decode those sub - channels assigned to the user . fig2 illustrates an example embodiment of a receiver 2300 that can be configured in accordance with the present invention . receiver 2300 comprises an antenna 2302 configured to receive a message transmitted by a transmitter , such as transmitter 1500 . thus , antenna 2302 is configured to receive a wide band message comprising the entire bandwidth b of a wide band channel that is divided into sub - channels of bandwidth b . as described above , the wide band message comprises a plurality of messages each encoded onto each of a corresponding sub - channel . all of the sub - channels may or may not be assigned to a device that includes receiver 2300 ; therefore , receiver 2300 may or may not be required to decode all of the sub - channels . after the message is received by antenna 2300 , it is sent to radio receiver 2304 , which is configured to remove the carrier associated with the wide band communication channel and extract a baseband signal comprising the data stream transmitted by the transmitter . the baseband signal is then sent to correlator 2306 and demodulator 2308 . correlator 2306 is configured to correlated with a synchronization code inserted in the data stream as described in section 3 . it is also preferably configured to perform sir and multipath estimations as described in section 3 ( b ). demodulator 2308 is configured to extract the parallel data streams from each sub - channel assigned to the device comprising receiver 2300 and to generate a single data stream therefrom . fig2 illustrates an example embodiment of a demodulator 2400 in accordance with the systems and methods described herein . demodulator 2402 comprises a frequency shifter 2402 , which is configured to apply a frequency offset to the baseband data stream so that parallel data streams comprising the baseband data stream can be independently processed in receiver 2400 . thus , the output of frequency shifter 2402 is a plurality of parallel data streams , which are then preferably filtered by filters 2404 . filters 2404 apply a filter to each parallel data stream that corresponds to the pulse shape applied in the transmitter , e . g ., transmitter 1500 . alternatively , an ifft block can replace shifter 1614 and filtering can be done after the ifft block . this type of implementation can be more efficient depending on the implementation . next , receiver 2400 preferably includes decimators 2406 configured to decimate the data rate of the parallel bit streams . sampling at higher rates helps to ensure accurate recreation of the data . but the higher the data rate , the larger and more complex equalizer 2408 becomes . thus , the sampling rate , and therefore the number of samples , can be reduced by decimators 2406 to an adequate level that allows for a smaller and less costly equalizer 2408 . equalizer 2408 is configured to reduce the effects of multipath in receiver 2300 . its operation will be discussed more fully below . after equalizer 2408 , the parallel data streams are sent to de - scrambler , decoder , and de - interleaver 2410 , which perform the opposite operations of scrambler , encoder , and interleaver 1506 so as to reproduce the original data generated in the transmitter . the parallel data streams are then sent to parallel to serial converter 2412 , which generates a single serial data stream from the parallel data streams . equalizer 2408 uses the multipath estimates provided by correlator 2306 to equalize the effects of multipath in receiver 2300 . in one embodiment , equalizer 2408 comprises single - in single - out ( siso ) equalizers operating on each parallel data stream in demodulator 2400 . in this case , each siso equalizer comprising equalizer 2408 receives a single input and generates a single equalized output . alternatively , each equalizer can be a multiple - in multiple - out ( mimo ) or a multiple - in single - out ( miso ) equalizer . multiple inputs can be required for example , when a frequency encoder or rate controller , such as frequency encoder 1900 , is included in the transmitter . because frequency encoder 1900 encodes information from more than one parallel data stream onto each sub - channel , each equalizers comprising equalizer 2408 need to equalize more than one sub - channel . thus , for example , if a parallel data stream in demodulator 2400 comprises d ( 1 )+ d ( 8 ), then equalizer 2408 will need to equalize both d ( 1 ) and d ( 8 ) together . equalizer 2408 can then generate a single output corresponding to d ( 1 ) or d ( 8 ) ( miso ) or it can generate both d ( 1 ) and d ( 8 ) ( mimo ). equalizer 2408 can also be a time domain equalizer ( tde ) or a frequency domain equalizer ( fde ) depending on the embodiment . generally , equalizer 2408 is a tde if the modulator in the transmitter performs tdm on the parallel data streams , and a fde if the modulator performs fdm . but equalizer 2408 can be an fde even if tdm is used in the transmitter . therefore , the preferred equalizer type should be taken into consideration when deciding what type of block termination to use in the transmitter . because of power requirements , it is often preferable to use fdm on the forward link and tdm on the reverse link in a wireless communication system . as with transmitter 1500 , the various components comprising demodulator 2400 are preferably programmable , so that a single device can operate in a plurality of different systems and still maintain superior performance , which is a primary advantage of the systems and methods described herein . accordingly , the above discussion provides systems and methods for implementing a channel access protocol that allows the transmitter and receiver hardware to be reprogrammed slightly depending on the communication system . thus , when a device moves from one system to another , it preferably reconfigures the hardware , i . e . transmitter and receiver , as required and switches to a protocol stack corresponding to the new system . an important part of reconfiguring the receiver is reconfiguring , or programming , the equalizer because multipath is a main problem for each type of system . the multipath , however , varies depending on the type of system , which previously has meant that a different equalizer is required for different types of communication systems . the channel access protocol described in the preceding sections , however , allows for equalizers to be used that need only be reconfigured slightly for operation in various systems . fig2 illustrates an example embodiment of a receiver 2500 illustrating one way to configure equalizers 2506 in accordance with the systems and methods described herein . before discussing the configuration of receiver 2500 , it should be noted that one way to configure equalizers 2506 is to simply include one equalizer per channel ( for the systems and methods described herein , a channel is the equivalent of a sub - channel as described above ). a correlator , such as correlator 2306 ( fig2 ), can then provide equalizers 2506 with an estimate of the number , amplitude , and phase of any multipaths present , up to some maximum number . this is also known as the channel impulse response ( cir ). the maximum number of multipaths is determined based on design criteria for a particular implementation . the more multipaths included in the cir the more path diversity the receiver has and the more robust communication in the system will be . path diversity is discussed a little more fully below . if there is one equalizer 2506 per channel , the cir is preferably provided directly to equalizers 2506 from the correlator ( not shown ). if such a correlator configuration is used , then equalizers 2506 can be run at a slow rate , but the overall equalization process is relatively fast . for systems with a relatively small number of channels , such a configuration is therefore preferable . the problem , however , is that there is large variances in the number of channels used in different types of communication systems . for example , an outdoor system can have has many as 256 channels . this would require 256 equalizers 2506 , which would make the receiver design too complex and costly . thus , for systems with a lot of channels , the configuration illustrated in fig2 is preferable . in receiver 2500 , multiple channels share each equalizer 2506 . for example , each equalizer can be shared by 4 channels , e . g ., ch1 - ch4 , ch5 - ch8 , etc ., as illustrated in fig2 . in which case , receiver 2500 preferably comprises a memory 2502 configured to store information arriving on each channel . memory 2502 is preferably divided into sub - sections 2504 , which are each configured to store information for a particular subset of channels . information for each channel in each subset is then alternately sent to the appropriate equalizer 2506 , which equalizes the information based on the cir provided for that channel . in this case , each equalizer must run much faster than it would if there was simply one equalizer per channel . for example , equalizers 2506 would need to run 4 or more times as fast in order to effectively equalize 4 channels as opposed to 1 . in addition , extra memory 2502 is required to buffer the channel information . but overall , the complexity of receiver 2500 is reduced , because there are fewer equalizers . this should also lower the overall cost to implement receiver 2500 . preferably , memory 2502 and the number of channels that are sent to a particular equalizer is programmable . in this way , receiver 2500 can be reconfigured for the most optimum operation for a given system . thus , if receiver 2500 were moved from an outdoor system to an indoor system with fewer channels , then receiver 2500 can preferably be reconfigured so that there are fewer , even as few as 1 , channel per equalizer . the rate at which equalizers 2506 are run is also preferably programmable such that equalizers 2506 can be run at the optimum rate for the number of channels being equalized . in addition , if each equalizer 2506 is equalizing multiple channels , then the cir for those multiple paths must alternately be provided to each equalizer 2506 . preferably , therefore , a memory ( not shown ) is also included to buffer the cir information for each channel . the appropriate cir information is then sent to each equalizer from the cir memory ( not shown ) when the corresponding channel information is being equalized . the cir memory ( not shown ) is also preferably programmable to ensure optimum operation regardless of what type of system receiver 2500 is operating in . returning to the issue of path diversity , the number of paths used by equalizers 2506 must account for the delay spread d s in the system . for example , if the system is an outdoor system operating in the 5 giga hertz ( ghz ) range , the communication channel can comprise a bandwidth of 125 mega hertz ( mhz ), e . g ., the channel can extend from 5 . 725 ghz to 5 . 85 ghz . if the channel is divided into 512 sub - channels with a roll - off factor r of 0 . 125 , then each subchannel will have a bandwidth of approximately 215 kilohertz ( khz ), which provides approximately a 4 . 6 microsecond symbol duration . since the worst case delay spread d s is 20 microseconds , the number of paths used by equalizers 2504 can be set to a maximum of 5 . thus , there would be a first path p 1 at zero microseconds , a second path p 2 at 4 . 6 microseconds , a third path p 3 at 9 . 2 microseconds , a fourth path p 4 at 13 . 8 microseconds , and fifth path p 5 at 18 . 4 microseconds , which is close to the delay spread d s . in another embodiment , a sixth path can be included so as to completely cover the delay spread d s ; however , 20 microseconds is the worst case . in fact , a delay spread d s of 3 microseconds is a more typical value . in most instances , therefore , the delay spread d s will actually be shorter and an extra path is not needed . alternatively , fewer sub - channels can be used , thus providing a larger symbol duration , instead of using an extra path . but again , this would typically not be needed . as explained above , equalizers 2506 are preferably configurable so that they can be reconfigured for various communication systems . thus , for example , the number of paths used must be sufficient regardless of the type of communication system . but this is also dependent on the number of sub - channels used . if , for example , receiver 2500 went from operating in the above described outdoor system to an indoor system , where the delay spread d s is on the order of 1 microsecond , then receiver 2500 can preferably be reconfigured for 32 sub - channels and 5 paths . assuming the same overall bandwidth of 125 mhz , the bandwidth of each sub - channel is approximately 4 mhz and the symbol duration is approximately 250 nanoseconds . therefore , there will be a first path p 1 at zero microseconds and subsequent paths p 2 to p 5 at 250 ns , 500 ns , 750 ns , and 1 microsecond , respectively . thus , the delay spread d s should be covered for the indoor environment . again , the 1 microsecond delay spread d s is worst case so the 1 microsecond delay spread d s provided in the above example will often be more than is actually required . this is preferable , however , for indoor systems , because it can allow operation to extend outside of the inside environment , e . g ., just outside the building in which the inside environment operates . for campus style environments , where a user is likely to be traveling between buildings , this can be advantageous . fig2 illustrates an example embodiment of a wireless communication device in accordance with the systems and methods described herein . device 2600 is , for example , a portable communication device configured for operation in a plurality of indoor and outdoor communication systems . thus , device 2600 comprises an antenna 2602 for transmitting and receiving wireless communication signals over a wireless communication channel 2618 . duplexor 2604 , or switch , can be included so that transmitter 2606 and receiver 2608 can both use antenna 2602 , while being isolated from each other . duplexors , or switches used for this purpose , are well known and will not be explained herein . transmitter 2606 is a configurable transmitter configured to implement the channel access protocol described above . thus , transmitter 2606 is capable of transmitting and encoding a wideband communication signal comprising a plurality of sub - channels . moreover , transmitter 2606 is configured such that the various sub - components that comprise transmitter 2606 can be reconfigured , or programmed , as described in section 5 . similarly , receiver 2608 is configured to implement the channel access protocol described above and is , therefore , also configured such that the various sub - components comprising receiver 2608 can be reconfigured , or reprogrammed , as described in section 6 . transmitter 2606 and receiver 2608 are interfaced with processor 2610 , which can comprise various processing , controller , and / or digital signal processing ( dsp ) circuits . processor 2610 controls the operation of device 2600 including encoding signals to be transmitted by transmitter 2606 and decoding signals received by receiver 2608 . device 2610 can also include memory 2612 , which can be configured to store operating instructions , e . g ., firmware / software , used by processor 2610 to control the operation of device 2600 . processor 2610 is also preferably configured to reprogram transmitter 2606 and receiver 2608 via control interfaces 2614 and 2616 , respectively , as required by the wireless communication system in which device 2600 is operating . thus , for example , device 2600 can be configured to periodically ascertain the availability is a preferred communication system . if the system is detected , then processor 2610 can be configured to load the corresponding operating instruction from memory 2612 and reconfigure transmitter 2606 and receiver 2608 for operation in the preferred system . for example , it may preferable for device 2600 to switch to an indoor wireless lan if it is available . so device 2600 may be operating in a wireless wan where no wireless lan is available , while periodically searching for the availability of an appropriate wireless lan . once the wireless lan is detected , processor 2610 will load the operating instructions , e . g ., the appropriate protocol stack , for the wireless lan environment and will reprogram transmitter 2606 and receiver 2608 accordingly . in this manner , device 2600 can move from one type of communication system to another , while maintaining superior performance . it should be noted that a base station configured in accordance with the systems and methods herein will operate in a similar manner as device 2600 ; however , because the base station does not move from one type of system to another , there is generally no need to configure processor 2610 to reconfigure transmitter 2606 and receiver 2608 for operation in accordance with the operating instruction for a different type of system . but processor 2610 can still be configured to reconfigure , or reprogram the sub - components of transmitter 2606 and / or receiver 2608 as required by the operating conditions within the system as reported by communication devices in communication with the base station . moreover , such a base station can be configured in accordance with the systems and methods described herein to implement more than one mode of operation . in which case , controller 2610 can be configured to reprogram transmitter 2606 and receiver 2608 to implement the appropriate mode of operation . while embodiments and implementations of the invention have been shown and described , it should be apparent that many more embodiments and implementations are within the scope of the invention . accordingly , the invention is not to be restricted , except in light of the claims and their equivalents .
| 7 |
the signal transmission system represented in the figure in a general way by the reference 1 comprises three independent devices for the emission of signals identified by the references 2 , 3 and 4 , as well as three independent devices for the reception of signals referenced respectively 5 , 6 and 7 . these emission devices and these reception devices are , in the example , connected by means of radio . in the example , the emission devices are intended to transmit respectively binary signals b 0 , b 1 , b 2 . each one of these binary signals is composed of a condition one and of a condition zero , this binary signal or a succession of binary signals representing information or messages to be transmitted . the emission device 2 comprises an oscillator circuit 8 connected to an emitting antenna 9 . it comprises an input 10 for the binary signal b 0 , which is connected to a switch 11 , which is itself connected to a command input 12 of the oscillator circuit 8 . the emission device 2 operates in the following manner . when the binary signal b 0 is in its condition one , the switch 11 switches the oscillator circuit 8 in amplitude . this circuit 8 is controlled in such a manner as to oscillate on a frequency f 0 and the antenna 9 radiates this frequency f 0 . when the binary signal b 0 is in its condition zero , the oscillator circuit 8 is blocked and the antenna 9 does not radiate . thus , the antenna 9 radiates the binary signal b 0 on the frequency f 0 . just like the emission device 2 , the emission device 3 comprises an oscillator circuit 13 connected to an emitting antenna 14 , an input 15 for the binary signal b 1 , which input is connected to a switch 16 , which is itself connected to a command input 17 of the oscillator circuit 13 . as in the case of the emission device 2 , the oscillator circuit 13 is switched in amplitude by the binary signal b 1 and emits on the same frequency f 0 as the oscillator circuit 8 of the device 2 . thus , the antenna 14 radiates on the frequency f 0 when the binary signal b 1 is in its condition one . the emission device 3 further comprises a second oscillator circuit 18 , the output of which is likewise connected to the antenna 14 , a switch 19 which is connected to the switching input 20 of the oscillator circuit 18 as well as an inverter 21 which connects the input 15 to the switch 19 . when the binary signal b 1 input by the input 15 is in its condition zero , this condition is inverted by the inverter 21 and the switch 19 switches in amplitude the oscillator circuit 18 , which is controlled in order to oscillate on a frequency f 1 different from f 0 , so that the antenna 14 radiates on this frequency f 1 . accordingly , the emission device 3 is constructed in such a manner that its antenna 14 emits on the frequency f 0 when the binary signal b 1 is in its condition one and emits on the frequency f 1 when the binary signal b 1 is in its condition zero . this mode of operation appears in fig2 . thus , the emission device 3 is adapted to emit simultaneously the binary signal b 1 and its inverse , on two different channels . the emission device 4 differs from the emission device 3 in that it comprises only a single oscillator circuit 22 which , on this occasion , is a frequency hopping oscillator circuit , the output of which is connected to an antenna 23 and the command input 24 of which is connected to an input 25 by which the binary signal b 2 is input . the oscillator circuit 22 is controlled in such a manner as to oscillate at the same frequency f 1 as the oscillator circuit 18 of the emission device 3 when the binary signal b 2 is in its condition one . on the other hand , when the binary signal b 2 is in its condition zero , the oscillator circuit 22 oscillates at a frequency f 2 different from f 0 and f 1 . these frequencies f 1 and f 2 are radiated by the antenna 23 . the emission device 4 is therefore likewise adapted to emit simultaneously the binary signal b 2 and its inverse , on two different channels . the reception device 5 comprises an antenna 26 which is connected to the input of a reception circuit 27 , which comprises a filter 28 and a detector 29 , its output being connected to a signal output 30 . this reception circuit 27 is locked or controlled in order to be sensitive to the radio signals appearing on the frequency f 0 in such a manner that it is sensitive to the signals emitted by the emission devices 2 and 3 on this frequency . thus , the reception device 5 is capable of receiving and of supplying at its output 30 the binary signal b 0 emitted by the emission device 2 and likewise the binary signal b 1 emitted by the emission device 3 . the reception device 6 comprises an antenna 31 which is connected to two independent reception circuits 32 and 33 which comprise respectively filters 34 and 35 and detectors 36 and 37 . the detection circuit 32 is locked in order to be sensitive to the radio signals appearing on the frequency f 0 , while the detection circuit 33 is locked in order to be sensitive to the radio signals appearing on the frequency f 1 . the output of the detection circuit 32 is connected to a signal output 40 , while the output of the detection circuit 33 is connected to a second output 39 . just like the reception device 5 , the reception device 6 is capable of receiving , by virtue of its detection circuit 32 locked to the frequency f 0 , the signal b 0 emitted by the emission device 2 and the signal b 1 emitted by the emission device 3 and of supplying at its output 40 these binary signals b 0 and b 1 . furthermore , the reception device 6 is capable of receiving , by virtue of its reception circuit 33 locked to the frequency f 1 , the inverse of the binary signal b 1 emitted by the emission device 3 and of supplying this inverse at the output 39 . it should be observed that the signal b 1 and its inverse which are simultaneously emitted by the emission device 3 are simultaneously received by the reception device 6 and the reception device 6 is capable of supplying the signal b 1 or its inverse on the basis of the reception of a single one of the conditions of the signal b 1 via one of the frequencies f 0 or f 1 . as has been seen , the emission device 4 emits likewise on the frequency f 1 to transmit the binary signal b 2 . as the reception device 6 is sensitive to this , it is likewise capable of receiving and of supplying at its output 39 the signal b 2 emitted by the emission device 4 . the reception device 6 likewise comprises an and gate 41 , the two inputs of which are respectively connected to the output of the reception circuits 32 and 33 and the output of which is connected to the input of a time delay circuit 42 connected to a command signal output 43 . when the two detection circuits 32 and 33 are excited at the same time during the duration of the time delay of the time delay circuit 42 , a command signal appears at the output 43 of the reception device 6 . the appearance of this command signal signifies that the transmission channels associated with the frequencies f 0 and f 1 to which the detection circuits 32 and 33 are respectively sensitive , are excited simultaneously and that in consequence no signal detection is validly capable of being carried out . the reception device 7 is of a type different from that of the reception device 6 but exhibits the same functions . it is a scanning or frequency scrutinizing detection device which comprises an antenna 44 which is connected to the input of a frequency mixer 45 , the output of which is connected to an intermediate frequency detection circuit 46 comprising a filter 47 and a detector 48 . the output of this detection circuit 46 is connected to the input of a processing , command and feedback control circuit 49 , one output of which is connected to the command input of a frequency controlled oscillator 50 which supplies the various local frequencies to the mixer 45 . the circuit 49 exhibits a received signal output 51a and a command signal output 51b . this reception device 7 is controlled or locked in such a manner as to be able to detect the radio signals appearing on the frequencies f 1 and f 2 . it is therefore capable of supplying at its output 51a the inverse of the binary signal b 1 and the binary signal b 2 emitted respectively by the emission devices 3 and 4 on the frequency f 1 as well as the inverse of the binary signal b 2 emitted by the emission device 4 on the frequency f 2 . it is moreover adapted to supply a command signal on its output 51b when the two transmission channels associated with the frequencies f 1 and f 2 are excited simultaneously for a determined duration , this function being performed by the processing circuit 49 . the transmission system 1 described hereinabove exhibits numerous advantages . in fact , its structure permits , in particular , the assurance , in a simple manner , of a very reliable transmission of signals and detection of when it is impossible to receive signals which are desired to be transmitted . in fact , the binary signal b 1 or its inverse passes by means of radio from the emission device 3 to the reception device 6 through two independent transmission channels associated with the frequencies f 0 and f 1 , and this takes place simultaneously , so that if one of the transmission channels is disturbed , the binary signal b 1 or its inverse is nevertheless transmitted by the other transmission channel . this same objective is likewise achieved by the pair formed by the emission device 4 and the reception device 7 , since the binary signal b 2 or its inverse may pass independently through the transmission channels associated with the frequencies f 1 and f 2 . furthermore , if the two transmission channels associated with the frequencies f 0 and f 1 are excited simultaneously for a duration at least equal to the delay time of the time delay circuit 42 , this means that these two channels are at the same time disturbed or unavailable and that the transmission of the binary signal b 1 between the emission device 3 and the reception device 6 is impossible , this fact being indicated by the appearance of a command signal at the output 43 of this reception device 6 . the pair formed by the emission device 4 and the reception device 7 likewise ensures this objective . the binary signal b 0 emitted by the emission device 2 may be received by the reception devices 5 and 6 , the binary signal b 1 or its inverse emitted by the emission device 3 may be received by the reception devices 5 , 6 and 7 and the binary signal b 2 or its inverse emitted by the emission device 4 may be received by the reception devices 6 and 7 , these links by means of radio utilizing only three transmission channels associated with the frequencies f 0 , f 1 and f 2 . the objectives and advantages of the transmission system 1 which have been described hereinabove are particularly beneficial in the following application , in which a multiplicity of independent emitters may emit in a random and / or simultaneous manner . the transmission system 1 may , in fact , constitute a system of linkage by means of radio to a plurality of networks , for example a network for the monitoring and control of household appliances and a network for the security of assets and of persons , this security system being , in a general way , an alarm system . in this case , the binary signals b 1 and b 2 might be generated by detectors linked to the security of the property and persons and the signal b 0 might be generated by emitters linked to the monitoring and to the control of household appliances . as is evident from the aforegoing , a security signal , for example the signal b 1 or the signal b 2 , would be transmitted simultaneously and in a reliable and redundant manner on two transmission channels , it being possible for one channel to be disturbed or blocked without consequence upon the transmission of the said security signal . if the two transmission channels linked to this security signal are , for example , jammed at the same time , what is then involved would with a high degree of probability be a deliberate jamming and the command signal generated would then constitute an alarm command signal . the detection of jamming is not necessary where what is involved is the transmission of the signal b 0 , concerning which it can be considered that the function is less important than the function of the signals b 1 and b 2 which are linked to security . the present invention is not limited to what has just been described . in particular , the transmission system 1 might comprise other emission devices and other reception devices . the signals b 0 , b 1 and b 2 might be signals having more than two conditions or concerning messages or concerning a repetition of messages each composed of a succession of signals , each one of these conditions or messages being capable of passing simultaneously or successively through more than two transmission channels , as might be done by the frequency hopping oscillator 22 in association with synchronized receivers , each channel permitting the reconstruction of the entirety of the message or of the information emitted . each binary signal might , for example , be multiplexed between more than two transmission channels , each channel permitting the independent reconstruction of the entirety of the message or of the information emitted .
| 7 |
now , a first example of the semiconductor composite device according to an embodiment of the present invention will be described below , referring to the schematic configuration sectional diagram shown in fig1 . as shown in fig1 , a semiconductor device 21 is formed on a substrate 11 . the semiconductor device 21 is composed , for example , of a semiconductor device such as transistor , capacitor , thyristor , etc . in the example shown in the figure , the semiconductor device 21 is a transistor formed in a device forming region isolated by device isolation regions 12 formed on the substrate 11 . in addition , the semiconductor device 21 is covered by an insulating film 41 . a microelectromechanical system 31 is formed on the insulating film 41 . further , first plugs 51 for connection with the semiconductor device 21 , the substrate 11 , and the like are formed in the insulating film 41 . the semiconductor device 21 and the microelectromechanical system 31 are connected to each other through a wiring , the plugs , and the like which are formed in a wiring layer 50 . incidentally , though a wiring for direct connection between the semiconductor device 21 and the microelectromechanical system 31 is not shown in the figure , they are connected to each other through the wiring , the plugs , and the like in a region not appearing in the figure . the wiring layer 50 has a three - layer wiring structure , for example . the wiring layer 50 includes , for example , the first plugs 51 ; a first wiring 52 formed on the insulating film 41 and connected to the first plugs 51 ; a first layer insulating film 53 covering the first wiring 52 ; second plugs 54 formed in the first layer insulating film 53 and connected to the first wiring 52 , the microelectromechanical system 31 , and the like ; a second wiring 55 formed on the first layer insulating film 53 and connected to the second plugs 54 ; a second layer insulating film 56 covering the second wiring 55 ; third plugs 57 formed in the second layer insulating film 56 and connected to the second wiring 55 ; and a third wiring 58 formed on the second layer insulating film 56 and connected to the third plugs 57 . the microelectromechanical system 31 is exposed to the exterior from the first layer insulating film 53 and the second layer insulating film 56 of the wiring layer 50 . for example , the microelectromechanical system 31 is exposed by removing the first layer insulating film 53 and the second layer insulating film 56 of the wiring layer 50 formed on the microelectromechanical system 31 . as will be detailed in the description of the manufacturing method later , at the time of removing the first layer insulating film 53 and the second layer insulating film 56 , a sacrificing film used in forming the microelectromechanical system 31 is also removed , whereby a space ( the voided portion in the figure ) for the microelectromechanical system is formed . in the semiconductor composite device 1 , the semiconductor device 21 and the microelectromechanical system 31 are formed on the same substrate 11 , and the wiring layer 50 in connection with the semiconductor device 21 and the microelectromechanical system 31 is formed . therefore , the microelectromechanical system 31 which has hitherto been a single functional device can be provided with a composite function , for example , the function of a semiconductor electronic circuit 20 composed of the semiconductor device 21 and the wiring layer 50 . for example , in the case of an rf ( radio frequency ) front end module hitherto produced by combining discrete component parts or the like module , the functions equivalent to those of the module can be realized on a one - chip basis by producing such rf component parts as filter , switch , mixer , oscillator , etc . as mems on chip . this has various merits such as a large reduction in the module size , suppression of power consumption , a reduction in the manufacturing cost , an increase in the degree of freedom in product design , etc . in the next place , a second example of the embodiment of the semiconductor composite device in the present invention will be described below , referring to the schematic configuration sectional diagram shown in fig2 . as shown in fig2 , a semiconductor device 21 is formed on a substrate 11 . the semiconductor device 21 is composed , for example , of a semiconductor device such as transistor , capacitor , thyristor , etc . in the example shown in the figure , the semiconductor device 21 is a transistor formed in a device forming region isolated by device isolation regions 12 formed on the substrate 11 . a microelectromechanical system 31 is formed on an insulating film 41 . first plugs 51 connected to the semiconductor device 21 , the substrate 11 , and the like are formed in the insulating film 41 . the semiconductor device 21 and the microelectromechanical system 31 are connected by wirings , plugs , and the like which are formed in a wiring layer 50 . incidentally , though a wiring for direct connection between the semiconductor device 21 and the microelectromechanical system 31 is not shown in the figure , they are connected to each other by a wiring , plugs , and the like which do not appear in the figure . the wiring layer 50 has a three - layer wiring structure , for example . the wiring layer 50 includes , for example , the first plugs 51 ; a first wiring 52 formed on the insulating film 41 and connected to the first plugs 51 ; a first layer insulating film 53 covering the first wiring 52 ; second plugs 54 formed in the first layer insulating film 53 and connected to the first wiring 52 , the microelectromechanical system 31 , and the like ; a second wiring 55 formed on the first layer insulating film 53 and connected to the second plugs 54 ; a second layer insulating film 56 covering the second wiring 55 ; third plugs 57 formed in the second layer insulating film 56 and connected to the second wiring 55 ; and a third wiring 58 formed on the second layer insulating film 56 and connected to the third plugs 57 . the microelectromechanical system 31 is enveloped by a protective film 33 , with a space 32 at a part therebetween . the first layer insulating film 53 is formed on the protective film 33 . in this semiconductor composite device 2 , the semiconductor device 21 and the microelectromechanical system 31 are formed on the same substrate 11 , and the wiring layer 50 connected to the semiconductor device 21 and the microelectromechanical system 31 is formed . therefor , the microelectromechanical system 31 which has hitherto been a single functional device can be provided with a composite function , for example , the function of a semiconductor electronic circuit 20 composed of the semiconductor device 21 and the wiring layer 50 . for example , in the case of an rf ( radio frequency ) front end module which has hitherto been produced by combining discrete component parts or the like module , the functions equivalent to those of the module can be realized on a one - chip basis by forming an rf component part such as filter , switch , mixer , oscillator , etc . as mems on chip . this gives various merits such as a large reduction of module size , suppression of power consumption , a reduction in the manufacturing cost , an increase in the degree of freedom in product design , etc . further , since the microelectromechanical system 31 is enveloped by the protective film 33 with the air layer 32 therebetween and the microelectromechanical system 31 is therefore not exposed to the exterior , reliability is enhanced , and the need for a gas - tight package is eliminated . now , a third example of the embodiment of the semiconductor composite device in the present invention will be described below , referring to the schematic configuration sectional diagram shown in fig3 . as shown in fig3 , a semiconductor device 21 is formed on a substrate 11 . the semiconductor device 21 is composed , for example , of a semiconductor device such as transistor , capacitor , thyristor , etc . in the example shown in the figure , the semiconductor device 21 is a transistor having a device forming region isolated by device isolation regions 12 formed on the substrate 11 . in addition , a microelectromechanical system 31 is formed on the substrate 11 . the microelectromechanical system 31 is enveloped by a protective film 33 with a space 32 at a part therebetween . besides , the semiconductor device 21 and the protective film 33 are covered with an insulating film 41 . further , first plugs 51 connected to the semiconductor device 21 , the substrate 11 , the microelectromechanical system 31 , and the like are formed in the insulating film 41 . the semiconductor device 21 and the microelectromechanical system 31 are connected to each other by a wiring , plugs , and the like in a wiring layer 50 . incidentally , though a wiring for direct connection between the semiconductor device 21 and the microelectromechanical system 31 is not shown in the figure , they are connected to each other by a wiring , plugs , and the like in the portion not appearing in the figure . the wiring layer 50 has a three - layer wiring structure , for example . the wiring layer 50 includes , for example , the first plugs 51 ; a first wiring 52 formed on the insulating film 41 and connected to the first plugs 51 ; a first layer insulating film 53 covering the first wiring 52 ; second plugs 54 formed in the first layer insulating film 53 and connected to the first wiring 52 , the microelectromechanical system 31 , and the like ; a second wiring 55 formed on the first layer insulating film 53 and connected to the second plugs 54 ; a second layer insulating film 56 covering the second wiring 55 ; third plugs 57 formed in the second layer insulating film 56 and connected to the second wiring 55 ; and a third wiring 58 formed on the second layer insulating film 56 and connected to the third plugs 57 . in this semiconductor composite device 3 , the semiconductor device 21 and the microelectromechanical system 31 are formed on the same substrate 11 , and the wiring layer 50 in connection with the semiconductor device 21 and the microelectromechanical system 31 is formed . therefore , the microelectromechanical system 31 which has hitherto been a single functional device can be provided with a composite function , for example , the function of a semiconductor electronic circuit 20 composed of the semiconductor device 21 and the wiring layer 50 . for example , in the case of an rf ( radio frequency ) front end module hitherto produced by combining discrete component parts or the like module , the functions equivalent to those of the module can be realized on a one - chip basis by forming an rf component part such as filter , switch , mixer , oscillator , etc . as mems on chip . this gives a variety of merits such as a large reduction in module size , suppression of power consumption , a reduction in the manufacturing cost , an increase in the degree of freedom in product design , etc . in addition , since the microelectromechanical system 31 is enveloped by the protective film 33 with the air layer 32 therebetween and the microelectromechanical system 31 is therefore not exposed to the exterior , reliability is enhanced , and the need for a gas - tight package is eliminated . further , since the semiconductor device 21 and the microelectromechanical system 31 are mounted together on substantially the same layer , this configuration is effective in the case where the microelectromechanical system 31 has a large stepped portion and the like cases . now , a first example of an embodiment of the method of manufacturing a semiconductor composite device in the present invention will be described below , referring to manufacturing step sectional diagrams shown in fig4 a to 4 c . here , as an example , the manufacturing steps of the semiconductor composite device 1 described referring to fig1 above are shown . as shown in fig4 a , device isolation regions 12 are formed on a substrate 11 , to demarcate a device forming region . next , a semiconductor device 21 is formed in the device forming region . the semiconductor device 21 is composed , for example , of a transistor , a capacitor , a resistor , a thyristor or the like . in the example shown in the figure , the semiconductor device 21 is composed of a transistor . the method of manufacturing the semiconductor device 21 may be an existing manufacturing method . next , the semiconductor device 21 is covered with an insulating film 41 . subsequently , as shown in fig4 b , a microelectromechanical system 31 is formed on the insulating film 41 . the microelectromechanical system 31 can be manufactured by an existing manufacturing method . in this case , a sacrificing film 61 is preliminarily formed at least in the area for forming a space for the microelectromechanical system 31 . the sacrificing film 61 is removed in a later step , whereby the space for the microelectromechanical system 31 is formed . in addition , those component parts of the microelectromechanical system 31 which are located in other regions than the region where the microelectromechanical system 31 is to be formed are removed . in this example of the embodiment , signal lines for the microelectromechanical system 31 and the semiconductor device 21 can be composed of polycrystalline silicon with phosphorus ( p ) doped thereto as an impurity . in this case , a heat treatment at a high temperature may be necessary to activate polycrystalline silicon , the heat treatment produces no problem on the manufacturing basis , since it is conducted before the formation of the wiring layer which will be described below . next , as shown in fig4 c , a wiring layer 50 connected to the semiconductor device 21 and the microelectromechanical system 31 is formed . the wiring layer 50 can be formed by an ordinary multi - layer wiring technology . here , the wiring layer 50 has a three - layer wiring structure , for example . first , first plugs 51 in connection with the semiconductor device 21 , the substrate 11 , and the like are formed in the insulating film 41 . next , a first wiring 52 for connection with the first plugs 51 is formed on the insulating film 41 . subsequently , a first layer insulating film 53 covering the first wiring 52 is formed . next , second plugs 54 connected to the first wiring 52 , the microelectromechanical system 31 , and the like is formed in the first layer insulating film 53 . subsequently , a second wiring 55 connected to the second plugs 54 is formed on the first layer insulating film 53 . further , by utilizing a part of the second wiring 55 , an mim capacitor 71 is formed . next , a second layer insulating film 56 covering the second wiring 55 , the mim capacitor 71 , and the like is formed . subsequently , third plugs 57 connected to the second wiring 55 are formed in the second layer insulating film 56 . next , a third wiring 58 in connection with the third plugs 57 is formed on the second layer insulating film 56 . the first , second , and third plugs 51 , 54 , and 57 can be formed by an existing plug forming technique . for example , the plugs can be composed of tungsten plugs , polysilicon plugs , or the like . the first , second , and third wirings 52 , 55 , and 58 can be formed by an existing wiring forming technique . for example , the wirings can be composed of metallic wirings of aluminum , an aluminum alloy , or the like , polysilicon wirings , or the like . the first and second layer insulating films 53 and 56 can be formed by an existing layer insulating film forming technique . for example , the layer insulating films can be composed of a silicon oxide film formed by a chemical vapor deposition ( cvd ) method . besides , in order to reduce the parasitic capacitance between the wirings , a so - called low dielectric constant film formed of a material lower than silicon oxide in dielectric constant may be adopted . in addition , the layer insulating films may be composed of a layered film of a low dielectric constant film with an inorganic film such as a silicon oxide film . incidentally , a wiring for direct connection between the semiconductor device 21 and the microelectromechanical system 31 is not shown in the figure , they are connected to each other by a wiring , plugs , and the like in the portion not appearing in the figure . thereafter , the sacrificing film 61 [ see fig4 b ], the first and second layer insulating films 53 and 56 and the like on the microelectromechanical system 31 and in the surroundings thereof are removed , to form a space 34 for the microelectromechanical system 31 . this removal can be conducted , for example , by use of a hydrofluoric acid based wet etching in the case where the sacrificing film 61 , the first and second layer insulating films 53 and 56 and the like are composed of silicon oxide based films . in this method of manufacturing the semiconductor composite device 1 , the semiconductor device 21 and the microelectromechanical system 31 are formed on the same substrate 11 , so that the microelectromechanical system 31 which has hitherto been a single functional device can be provided with a composite function . for example , in the case of an rf ( radio frequency ) front end module which has hitherto been produced by combining discrete component parts or the like module , the functions equivalent to those of the module can be realized on a one - chip basis by forming the rf component parts such as filter , switch , mixer , oscillator , etc . as microelectromechanical system 31 on chip . this gives various merits such as a large reduction of module size , suppression of power consumption , a reduction in the manufacturing cost , an increase in the degree of freedom in product design , etc . now , a second example of the embodiment of the method of manufacturing a semiconductor composite device in the present invention will be described below , referring to fig4 a and fig2 . here , as an example , the manufacturing steps of the semiconductor composite device 2 shown in fig2 will be described . as shown in fig4 a , device isolation regions 12 are formed on a substrate 11 , to demarcate a device forming region . next , a semiconductor device 21 is formed in the device forming region . the semiconductor device 21 is composed , for example , of a transistor , a capacitor , a resistor , a thyristor , or the like . in the example shown in the figure , the semiconductor device 21 is composed of a transistor . the semiconductor device 21 can be produced by an existing manufacturing method . subsequently , the semiconductor device 21 is covered with an insulating film 41 . next , as shown in fig2 , a microelectromechanical system 31 is formed on the insulating film 41 . the microelectromechanical system 31 can be formed by an existing manufacturing method . in this case , a sacrificing film ( not shown ) is preliminarily formed at least in the area for forming a space for the microelectromechanical system 31 . in addition , a protective film 33 is formed on the upper side of the microelectromechanical system 31 , with a sacrificing film ( not shown ) therebetween . thereafter , a part of the protective film 33 is opened , the sacrificing films are removed so as to form a space 34 for the microelectromechanical system 31 and to form a space 32 between the microelectromechanical system 31 and the protective film 33 . where the sacrificing films are composed of silicon oxide based films , they can be removed by a hydrofluoric acid based wet etching , for example . in this example of the embodiment , signal lines for the microelectromechanical system 31 and the semiconductor device 21 can be composed of polycrystalline silicon with phosphor ( p ) added thereto as an impurity . in this case , a heat treatment at a high temperature may be necessary to activate the polycrystalline silicon , but the heat treatment produces no problem on a manufacturing basis , since it is conducted before the formation of a wiring layer which will be described below . subsequently , a wiring layer 50 connected to the semiconductor device 21 and the microelectromechanical system 31 is formed . the wiring layer 50 can be formed by an ordinary multi - layer wiring technique . here , the wiring layer 50 has a three - layer wiring structure , for example . first , first plugs 51 connected to the semiconductor device 21 , the substrate 11 , and the like are formed in the insulating film 41 . next , a first wiring 52 connected to the first plugs 51 is formed on the insulating film 41 . subsequently , a first layer insulating film 53 covering the first wiring 52 , the protective film 33 , and the like is formed . next , second plugs 54 connected to the first wiring 52 , the microelectromechanical system 31 , and the like are formed in the first layer insulating film 53 . subsequently , a second wiring 55 connected to the second plugs 54 is formed on the first layer insulating film 53 . further , by utilizing a part of the second wiring 55 , an mim capacitor 71 is formed . next , a second layer insulating film 56 covering the second wiring 55 , the mim capacitor 71 , and the like is formed . subsequently , third plugs 57 connected to the second wiring 55 are formed in the second layer insulating film 56 . next , a third wiring 58 connected to the third plugs 57 is formed on the second layer insulating film 56 . the first , second , and third plugs 51 , 54 , and 57 can be formed by an existing plug forming technique . for example , the plugs may be composed of tungsten plugs , polysilicon plugs , or the like . the first , second , and third wirings 52 , 55 , and 58 can be formed by an existing wiring forming technique . for example , the wirings may be composed of metallic wirings of aluminum , an aluminum alloy , or the like , polysilicon wirings , or the like . the first and second layer insulating films 53 and 56 can be formed by an existing layer insulating film forming technique . for example , the layer insulating films may be composed of silicon oxide films formed by a chemical vapor deposition ( cvd ) method . besides , in order to reduce the parasitic capacitance between the wirings , a so - called low dielectric constant film may be adopted which is formed of a material lower than silicon oxide in dielectric constant . in addition , a layered film of a low dielectric constant film with an inorganic film of silicon oxide or the like may also be adopted . incidentally , though a wiring for direct connection between the semiconductor device 21 and the microelectromechanical system 31 is not shown in the figure , they are connected to each other through a wiring , plugs , or the like in an area not appearing in the figure . in this method of manufacturing the semiconductor composite device 2 , the semiconductor device 21 and the microelectromechanical system 31 are formed on the same substrate 11 , so that the microelectromechanical system 31 which has hitherto been a single functional device can be provided with a composite function . for example , in the case of an rf ( radio frequency ) front end module which has hitherto been produced by combining discrete component parts or the like module , the functions equivalent to those of the module can be realized on a one - chip basis by forming the rf component parts such as filter , switch , mixer , oscillator , etc . as microelectromechanical system 31 on chip . this gives various merits such as a large reduction in module size , suppression of power consumption , a reduction in the manufacturing cost , an increase in the degree of freedom in product design , etc . further , since the microelectromechanical system 31 is enveloped by the protective film 33 with the air layer 32 therebetween and the microelectromechanical system 31 is therefore not exposed to the exterior , reliability is enhanced , and the need for a gas - tight package is eliminated . now , a third example of the embodiment of the method of manufacturing a semiconductor composite device in the present invention will be described below , referring to fig4 a and fig3 . here , as an example , manufacturing steps of the semiconductor composite device 3 shown in fig3 will be described . as shown in fig4 a , device isolation regions 12 are formed on a substrate 11 , to demarcate a device forming region . next , a semiconductor device 21 is formed in the device forming region . the semiconductor device 21 is composed , for example , of a transistor , a capacitor , a resistor , a thyristor , or the like . in the example shown in the figure , the semiconductor device 21 is composed of a transistor . the semiconductor device 21 can be produced by an existing manufacturing method . next , as shown in fig3 , a microelectromechanical system 31 is formed on the substrate 11 . the microelectromechanical system 31 can be formed by an existing manufacturing method . in this case , a sacrificing film ( not shown ) is preliminarily formed at least in the area for forming a space for the microelectromechanical system 31 . in addition , a protective film 33 is formed on the upper side of the microelectromechanical system 31 , with a sacrificing film ( not shown ) therebetween . thereafter , a part of the protective film 33 is opened , the sacrificing films are removed so as to form a space 34 for the microelectromechanical system 31 and to form a space 32 between the microelectromechanical system 31 and the protective film 33 . where the sacrificing films are composed of silicon oxide based films , they can be removed by a hydrofluoric acid based wet etching , for example . in this example of the embodiment , signal lines for the microelectromechanical system 31 and the semiconductor device 21 can be composed of polycrystalline silicon with phosphor ( p ) added thereto as an impurity . in this case , a heat treatment at a high temperature may be necessary to activate the polycrystalline silicon , but the heat treatment produces no problem on a manufacturing basis , since it is conducted before the formation of a wiring layer which will be described below . subsequently , an insulating film 41 covering the semiconductor device 21 and the protective film 33 is formed . next , a wiring layer 50 connected to the semiconductor device 21 and the microelectromechanical system 31 is formed . the wiring layer 50 can be formed by an ordinary multi - layer wiring technique . here , the wiring layer 50 has a three - layer wiring structure , for example . first , first plugs 51 connected to the semiconductor device 21 , the substrate 11 , the microelectromechanical system 31 , and the like are formed in the insulating film 41 . next , a first wiring 52 connected to the first plugs 51 is formed on the insulating film 41 . subsequently , a first layer insulating film 53 covering the first wiring 52 is formed . next , second plugs 54 connected to the first wiring 52 are formed in the first layer insulating film 53 . subsequently , a second wiring 55 connected to the second plugs 54 is formed on the first layer insulating film 53 . further , by utilizing a part of the second wiring 55 , an mim capacitor 71 is formed . next , a second layer insulating film 56 covering the second wiring 55 , the mim capacitor 71 , and the like is formed . subsequently , third plugs 57 connected to the second wiring 55 and the mim capacitor 71 are formed in the second layer insulating film 56 . next , a third wiring 58 connected to the third plugs 57 is formed on the second layer insulating film 56 . the first , second , and third plugs 51 , 54 , and 57 can be formed by an existing plug forming technique . for example , the plugs may be composed of tungsten plugs , polysilicon plugs , or the like . the first , second , and third wirings 52 , 55 , and 58 can be formed by an existing wiring forming technique . for example , the wirings may be composed of metallic wirings of aluminum , an aluminum alloy , or the like , polysilicon wirings , or the like . the first and second layer insulating films 53 and 56 can be formed by an existing layer insulating film forming technique . for example , the layer insulating films may be composed of silicon oxide films formed by a chemical vapor deposition ( cvd ) method . besides , in order to reduce the parasitic capacitance between the wirings , a so - called low dielectric constant film may be adopted which is formed of a material lower than silicon oxide in dielectric constant . in addition , a layered film of a low dielectric constant film with an inorganic film of silicon oxide or the like may also be adopted . incidentally , though a wiring for direct connection between the semiconductor device 21 and the microelectromechanical system 31 is not shown in the figure , they are connected to each other through a wiring , plugs , or the like in an area not appearing in the figure . in this method of manufacturing the semiconductor composite device 3 , the semiconductor device 21 and the microelectromechanical system 31 are formed on the same substrate 11 , so that the microelectromechanical system 31 which has hitherto been a single functional device can be provided with a composite function . for example , in the case of an rf ( radio frequency ) front end module which has hitherto been produced by combining discrete component parts or the like module , the functions equivalent to those of the module can be realized on a one - chip basis by forming the rf component parts such as filter , switch , mixer , oscillator , etc . as microelectromechanical system 31 on chip . this gives various merits such as a large reduction in module size , suppression of power consumption , a reduction in the manufacturing cost , an increase in the degree of freedom in product design , etc . in addition , since the microelectromechanical system 31 is enveloped by the protective film 33 with the air layer 32 therebetween and is therefore not exposed to the exterior , reliability is enhanced , and the need for a gas - tight package is eliminated . further , since the microelectromechanical system 31 is formed in substantially the same layer as the semiconductor device 21 , this configuration is effective in the case where the microelectromechanical system 31 has a large stepped portion and the like cases . now , as an application example based on the configurations described in the embodiments above , a high - frequency band pass filter using a beam type mems resonator will be described below , referring to a schematic configuration perspective diagram of a beam type mems resonator , shown in fig5 a , and a plan layout diagram of the high - frequency band pass filter using the beam type mems resonator , shown in fig5 b . the beam type mems resonator 131 shown in fig5 a includes an input line 132 , an output line 133 disposed in parallel to the input line 132 , and an oscillator electrode 135 supported at both ends thereof , with predetermined spaces 134 between itself and the input line 132 and the output line 133 . when a high - frequency input signal is impressed on the input line 132 , a beam ( oscillating portion ) 135 a of the oscillator electrode 135 provided on the upper side of the output line 133 with the space 134 therebetween is mechanically resonated by a high - frequency signal conforming to its natural frequency , whereby the parasitic capacitance of a capacitor composed of the space 134 between the output line 133 and the beam ( oscillating portion ) 135 a is varied , and the variation is outputted through the output line 133 as a filtered signal . the high - frequency band pass filter using the beam type mems resonator , shown in fig5 b , is so configured that a signal inputted from pads 111 on the left in the drawing is filtered when passing through a microelectromechanical system ( high - frequency band pass filter 141 ) composed of mems resonators 131 connected in a lattice form , the filtered signal is amplified by a semiconductor electronic circuit ( amplifier 151 ) at the following stage , and the amplified signal is outputted to pads 171 on the right in the drawing . according to the related art , the components of the high - frequency band pass filter 141 composed of the amplifier 151 and the mems resonator 131 are individually produced , and they are connected by wire bonding or the like at the time of mounting . according to an embodiment of the present invention , on the other hand , the high - frequency band pass filter 141 can be produced as a device in which the component parts are mounted on the same substrate on a one - chip basis . the resonance characteristic of a beam type resonator which has been mounted together with other device ( s ) through the manufacturing steps described referring to fig4 a to 4 c above is shown in fig6 . on the other hand , the resonance characteristic of a resonator produced as a single device is shown in fig7 . a comparison between the resonance characteristics shown respectively in fig6 and in fig7 shows that comparable characteristics are obtained , from the viewpoints of resonance frequency , transmission characteristic , and the like . incidentally , s 21 on the axis of ordinates in fig6 and 7 represents the power transmission level of signal , and the axis of abscissas represents frequency . in addition , the output characteristic of an emitter follower ( e / f ) circuit mounted together with the microelectromechanical system ( mems ) 31 is shown in fig8 . it is seen that a gain as designed is obtained , and the step of forming the microelectromechanical system 31 at a high temperature has little influenced the semiconductor electronic circuit 20 mounted together with the microelectromechanical system 31 . incidentally , s 21 on the axis of ordinates in fig8 represents the power transmission level of signal , and the axis of abscissas represents frequency . as has been described above , the semiconductor composite devices 1 to 3 in the present invention include the semiconductor electronic circuit 20 and the microelectromechanical system ( mems ) 31 mounted together on the same substrate 11 , and the layout can be appropriately modified according to the desired characteristics , sizes , and the like of the semiconductor electronic circuit 20 , the semiconductor device 21 , and the microelectromechanical system 31 which are mounted together on the same substrate 11 . besides , the microelectromechanical system 31 described above can be used to constitute not only the high - frequency band pass filter in which the system is used as a resonator as above - mentioned but also analog devices for high - frequency use , for example , switch , oscillator , mixer , inductor , variable capacitor , or the like . the present invention is not limited to the details of the above - described preferred embodiments . the scope of the invention is defined by the appended claims and all changes and modifications as fall within the equivalence of the scope of the claims are therefore to be embraced by the invention .
| 1 |
in the alloy type thermal fuse of the invention , a circular wire having an outer diameter of 200 to 600 μmφ , preferably , 250 to 350 μmφ , or a flat wire having the same sectional area as that of the circular wire may be used as a fuse element . the fuse element of the thermal fuse of the invention can be produced by drawing a base material of an alloy or by the in - rotating liquid spinning method , and used with remaining to have a circular shape or with being further subjected to a compression process to be flattened . when the fuse element is to be produced by the in - rotating liquid spinning method , an in - rotating liquid spinning apparatus shown in fig1 can be used . referring to fig1 , 61 denotes a rotary drum in which one end of a circular drum wall is closed by a vertical wall , and a flange wall is disposed on the inner periphery of the other end of the circular drum wall . the reference numeral 62 denotes cooling liquid which is , for example , an organic solvent such as isopropyl alcohol . the reference numeral 63 denotes a nozzle which is made of a heat - resistant material such as quartz , and which has a heater . the fuse element is produced by the in - rotating liquid spinning method in the following manner . a molten material jet 20 ejected from the quartz nozzle 63 is introduced into a cooling liquid layer 621 which is formed and held to the inner peripheral face of the rotary drum 61 by a centrifugal force , in the same degree and direction as the peripheral speed of the cooling liquid layer . the introduced jet is rapidly cooled and solidified in the cooling liquid layer 621 to spin a fuse element . in this case , the jet in the space between the nozzle and the cooling liquid layer retains the circular shape of the nozzle by means of the surface tension of the molten metal to have a circular section , and , in the cooling liquid layer , is slightly flattened by the dynamic pressure . when the peripheral speed of the cooling liquid layer , and the angle at which the jet enters the cooling liquid layer are adjusted so that the circle retaining force due to a centrifugal force of the jet is made larger than the flattening pressure due to the dynamic pressure of the cooling liquid layer , however , the jet entering the cooling liquid layer is cooled and solidified while retaining the circular section shape , whereby a fuse element having a substantially true circular section can be obtained . when the alloy type thermal fuse is formed so as to have a tape - type shape , the alloy type thermal fuse can be thinned , and preferably used as a thermoprotector for a secondary battery such as a lithium - ion battery . fig2 shows an alloy type thermal fuse of the tape type . in the fuse , strip lead conductors 1 are fixed by an adhesive agent or fusion bonding to a plastic base film 41 , a fuse element 2 is connected between the strip lead conductors , a flux 3 is applied to the fuse element 2 , and the flux - applied fuse element is sealed by means of fixation of a plastic cover film 42 by an adhesive agent or fusion bonding . the alloy type thermal fuse of the invention may be realized in the form of a fuse of the case type , the substrate type , or the resin dipping type . fig3 shows a fuse of the cylindrical case type . a low - melting fusible alloy piece 2 is connected between a pair of lead wires 1 , and a flux 3 is applied onto the low - melting fusible alloy piece 2 . the flux - applied low - melting fusible alloy piece is passed through an insulating tube 4 which is excellent in heat resistance and thermal conductivity , for example , a ceramic tube . gaps between the ends of the insulating tube 4 and the lead wires 1 are sealingly closed by a cold - setting adhesive agent 5 such as an epoxy resin . fig4 shows a fuse of the radial case type . a fuse element 2 is bonded between tip ends of parallel lead conductors 1 by welding , and a flux 3 is applied to the fuse element 2 . the flux - applied fuse element is enclosed by an insulating case 4 in which one end is opened , for example , a ceramic case . the opening of the insulating case 4 is sealingly closed by a sealing agent 5 such as an epoxy resin . fig5 shows a fuse of the substrate type . a pair of film electrodes 1 are formed on an insulating substrate 4 such as a ceramic substrate by printing of conductive paste ( for example , silver paste ). lead conductors 11 are connected respectively to the electrodes 1 by welding or the like . a fuse element 2 is bonded between the electrodes 1 by welding , and a flux 3 is applied to the fuse element 2 . the flux - applied fuse element is coveted by a sealing agent 5 such as an epoxy resin . fig6 shows a fuse of the radial resin dipping type . a fuse element 2 is bonded between tip ends of parallel lead conductors 1 by welding , and a flux 3 is applied to the fuse element 2 . the flux - applied fuse element is dipped into a resin solution to seal the element by an insulative sealing agent 5 such as an epoxy resin . the invention may be realized in the form of a fuse having an electric heating element , such as a substrate type fuse having a resistor in which , for example , a resistor ( film resistor ) is additionally disposed on an insulating substrate of an alloy type thermal fuse of the substrate type , and , when an apparatus is in an abnormal state , the resistor is energized to generate heat so that a low - melting fusible alloy piece is blown out by the generated heat . as the flux , a flux having a melting point which is lower than that of the fuse element is generally used . for example , useful is a flux containing 90 to 60 weight parts of rosin , 10 to 40 weight parts of stearic acid , and 0 to 3 weight parts of an activating agent . in this case , as the rosin , a natural rosin , a modified rosin ( for example , a hydrogenated rosin , an inhomogeneous rosin , or a polymerized rosin ), or a purified rosin thereof can be used . as the activating agent , hydrochloride of diethylamine , hydrobromide of diethylamine , or the like can be used . as seen from dsc curves of examples which will be described later , the operating temperature of the alloy type thermal fuse of the invention is about 100 ° c . or slightly lower than 100 ° c . the thermal fuse is attached to a case of a secondary battery so as to thermally contact with the case , whereby the fuse is used as a thermoprotector ( when the temperature of the battery reaches a value of about 100 ° c . or slightly lower than 100 ° c ., the thermal fuse operates to disconnect the battery from a load ). in examples and comparative examples which will be described later , 30 specimens were used , each of the specimens was immersed into an oil bath in which the temperature was raised at a rate of 0 . 5 ° c ./ min ., and , while supplying a current of 0 . 1 a to the specimen , the temperature of the oil when the current supply was interrupted by blowing - out was measured . furthermore , the standard deviation of operating temperatures was obtained . dispersion of the operating temperature was evaluated in the following manner . when the standard deviation is 1 or smaller , the dispersion is judged acceptable , and , when the standard deviation is larger than 1 , the dispersion is judged unacceptable . in a dsc [ in which a reference sample ( unchanged ) and a measuring sample are housed in a nitrogen - filled vessel , an electric power is supplied to a heater of the vessel to heat the samples at a constant rate , and a variation of the heat energy input amount due to a thermal change of the measuring sample is detected by a differential thermocouple ], the heating rate was 5 ° c ./ min . and the sampling time interval was 0 . 5 s . the elimination of a slow transformation in the melt completion in a dsc curve was evaluated in the following manner . when the change width is 50 % or more of the width of the solid - liquid coexisting region ( see fig1 ), the elimination is judged x ( failure ); when the change width is 50 to 10 % ( see fig1 ), the elimination is judged δ ( poor ); when a slow transformation is not observed , the elimination is judged ⊚ ( excellent ); and , when a slow transformation is observed but the change width is small ( 10 % or less ), the elimination is judged ◯ ( fair ). a fuse element was produced by the in - rotating liquid spinning method . the nozzle diameter was set to 300 μmφ , the rotation speed of the drum was set to 200 rpm , and the injection pressure was set to 1 . 0 kg / cm 2 . in an obtained fuse element , a section has an aspect ratio of about 0 . 8 and an average diameter is about 300 μm . an alloy type thermal fuse was formed as that of the tape type . polyethylene telephtalate films having a thickness of 200 μm , a width of 5 mm , and a length of 10 mm were used as the resin films 41 and 42 shown in fig2 . copper conductors having a thickness of 150 μm , a width of 3 mm , and a length of 20 mm were used as the strip lead conductors 1 . the fuse element 2 has a length of 4 mm . the end portions of the strip lead conductors 1 , and the fuse element which is connected between the strip lead conductors were placed on a base while the fuse element is sandwiched between the resin films 41 and 42 . edge portions of the cover resin films which are in contact with the strip lead conductors were pressurized by a ceramic chip , and portions of the strip lead conductors which are immediately below the ceramic chip were then heated by an electromagnetic induction heating apparatus disposed in an insulative base to fusingly seal gaps between the strip lead conductors and the films . thereafter , the films are fusingly sealed by ultrasonic fusion . a flux has a composition of 70 weight parts of rosin , 30 weight parts of armide ht , and 5 weight parts of adipic acid . in each of the examples and the comparative examples , 30 alloy type thermal fuses were produced . alloy type thermal fuses having a composition of 52 % in , 40 % sn , and 8 % bi were produced . a dsc curve was measured . fig7 shows the obtained dsc curve . the dsc evaluation was ⊚. the operating temperatures of the alloy type thermal fuses were measured . as a result , the average temperature was 102 . 63 ° c ., the highest temperature was 104 . 1 ° c ., the lowest temperature was 101 . 6 ° c ., and the standard deviation was 0 . 53 . dispersion of the operating temperatures was evaluated as acceptable . the resistances of the alloy type thermal fuses were measured before the measurement of the operating temperature . as a result , the average resistance was 13 . 35 mω , thereby causing no problem . in the period from the production of fuse elements to the measurement of the operating temperature , none of the fuse elements was broken , and hence there was no problem in strength . it was confirmed that , when 0 . 01 to 7 weight parts of one or both of ag and cu were added to 100 weight parts of the composition of example 1 in order to realize a low melting point , reduction of the resistance , and the like , the dsc evaluation is changed to ◯ from ⊚ in the case of no addition , but there is no problem in strength . alloy type thermal fuses having a composition of 52 % in , 38 % sn , and 10 % bi were produced . a dsc curve was measured . fig8 shows the obtained dsc curve . the dsc evaluation was ⊚. the operating temperatures of the alloy type thermal fuses were measured . as a result , the average temperature was 98 . 00 ° c ., the highest temperature was 99 . 7 ° c ., the lowest temperature was 96 . 6 ° c ., and the standard deviation was 0 . 76 . dispersion of the operating temperatures was evaluated as acceptable . the resistances of the alloy type thermal fuses were measured before the measurement of the operating temperature . as a result , the average resistance was 14 . 27 mω , thereby causing no problem . in the period from the production of fuse elements to the measurement of the operating temperature , none of the fuse elements was broken , and hence there was no problem in strength . it was confirmed that , when 0 . 01 to 7 weight parts of one or both of ag and cu were added to 100 weight parts of the composition of example 2 in order to realize a low melting point , reduction of the resistance , and the like , the dsc evaluation is changed to ◯ from ⊚ in the case of no addition , but there is no problem in strength . alloy type thermal fuses having a composition of 52 % in , 36 % sn , and 12 % bi were produced . a dsc curve was measured . fig9 shows the obtained dsc curve . the dsc evaluation was ⊚. the operating temperatures of alloy type thermal fuses of the tape type were measured . as a result , the average temperature was 94 . 15 ° c ., the highest temperature was 95 . 9 ° c ., the lowest temperature was 93 . 0 ° c ., and the standard deviation was 0 . 74 . dispersion of the operating temperatures was evaluated as acceptable . the resistances of the alloy type thermal fuses were measured before the measurement of the operating temperature . as a result , the average resistance was 15 . 28 mω , thereby causing no problem . in the period from the production of fuse elements to the measurement of the operating temperature , none of the fuse elements was broken , and hence there was no problem in strength . it was confirmed that , when 0 . 01 to 7 weight parts of one or both of ag and cu were added to 100 weight parts of the composition of example 3 in order to realize a low melting point , reduction of the resistance , and the like , the dsc evaluation is changed to ◯ from ⊚ in the case of no addition , but there is no problem in strength . fig1 shows relationships between the operating temperature and the amount of bi which are obtained from examples 1 to 3 . it will be seen that , when the amount of bi is increased by 1 % and that of sn is reduced by 1 %, the operating temperature of an alloy type thermal fuse can be lowered by 2 ° c . alloy type thermal fuses having a composition of 52 % in , 34 % sn , and 14 % bi were produced . a dsc curve was measured . fig1 shows the obtained dsc curve . the dsc evaluation was ⊚. the standard deviation of operating temperatures of alloy type thermal fuses was measured , with the result that the standard deviation was equal to or smaller than 1 . dispersion of the operating temperatures was evaluated as acceptable . the alloy type thermal fuses had no problem in the resistances and mechanical strength . it was confirmed that , when 0 . 01 to 7 weight parts of one or both of ag and cu were added to 100 weight parts of the composition of example 4 in order to realize a low melting point , reduction of the resistance , and the like , the dsc evaluation is ◯, but there is no problem in strength . from the dsc measurements of the examples , it is apparent that , when x = 8 to 14 in 52in -( 48 - x ) sn - xbi , occurrence of a slow change in a dsc curve can be completely eliminated ( the dsc evaluation is ⊚). it was confirmed that , also when x = 14 to 16 , the same is attained . moreover , it was confirmed that , when x = 15 to 25 , the dsc evaluation can be made ◯. it was seen that , when x is smaller than 8 , the dsc evaluation can be made ⊚ or ◯ but the conditions of the operating temperature cannot be satisfied ( in the case of x = 0 or 52in - 48sn , about 118 ° c . ), and , when x is larger than 25 , the dsc evaluation is δ or x and the specific resistance is excessively raised . alloy type thermal fuses having a composition of 50 % in , 43 % sn , and 7 % bi were produced . a dsc curve was measured . fig1 shows the obtained dsc curve . the dsc evaluation was δ . alloy type thermal fuses having a composition of 48 % in , 45 % sn , and 7 % bi were produced . a dsc curve was measured . fig1 shows the obtained dsc curve . the dsc evaluation was x . alloy type thermal fuses having a composition of 52 % in , 33 % sn , 3 % ag , and 12 % bi were produced . a dsc curve was measured . fig1 shows the obtained dsc curve . the dsc evaluation was ⊚. when compared with the dsc curve ( 52 % in , 36 % sn , and 12 % bi ) of example 3 shown in fig9 , it is expected that the operating temperature is lowered by 4 to 5 ° c . the standard deviation of operating temperatures of alloy type thermal fuses of the tape type was measured , with the result that the standard deviation was equal to or smaller than 1 . dispersion of the operating temperatures was evaluated as acceptable . the alloy type thermal fuses had no problem in the resistances and mechanical strength . alloy type thermal fuses having a composition of 52 % in , 34 % sn , 2 % ag , and 12 % bi were produced . a dsc curve was measured . the dsc evaluation was ⊚. when compared with the case of 52 % in , 36 % sn , and 12 % bi , it is expected that the operating temperature is lowered by 3 to 4 ° c . the standard deviation of operating temperatures of the alloy type thermal fuses was measured , with the result that the standard deviation was equal to or smaller than 1 . dispersion of the operating temperatures was evaluated as acceptable . the alloy type thermal fuses had no problem in the resistances and mechanical strength . alloy type thermal fuses having a composition of 52 % in , 35 % sn , 1 % ag , and 12 % bi were produced . a dsc curve was measured . the dsc evaluation was ⊚. when compared with the case of 52 % in , 36 % sn , and 12 % bi , it is expected that the operating temperature is lowered by 2 to 3 ° c . the standard deviation of operating temperatures of the alloy type thermal fuses was measured , with the result that the standard deviation was equal to or smaller than 1 . dispersion of the operating temperatures was evaluated as acceptable . the alloy type thermal fuses had no problem in the resistances and mechanical strength . alloy type thermal fuses having a composition of 52 % in , 37 % sn , 3 % ag , and 8 % bi were produced . a dsc curve was measured . fig1 shows the obtained dsc curve . the dsc evaluation was ⊚. when compared with the dsc curve ( 52 % in , 40 % sn , and 8 % bi ) of example 1 shown in fig7 , it is expected that the operating temperature is lowered by 4 to 5 ° c . the standard deviation of operating temperatures of alloy type thermal fuses was measured , with the result that the standard deviation was equal to or smaller than 1 . dispersion of the operating temperatures was evaluated as acceptable . the alloy type thermal fuses had no problem in the resistances and mechanical strength . alloy type thermal fuses having a composition of 52 % in , 38 % sn , 2 % ag , and 8 % bi were produced . a dsc curve was measured . the dsc evaluation was ⊚. when compared with the case of 52 % in , 40 % sn , and 8 % bi , it is expected that the operating temperature is lowered by 3 to 4 ° c . the standard deviation of operating temperatures of the alloy type thermal fuses was measured , with the result that the standard deviation was equal to or smaller than 1 . dispersion of the operating temperatures was evaluated as acceptable . the alloy type thermal fuses had no problem in the resistances and mechanical strength . alloy type thermal fuses having a composition of 52 % in , 39 % sn , 1 % ag , and 8 % bi were produced . a dsc curve was measured . the dsc evaluation was ⊚. when compared with the case of 52 % in , 40 % sn , and 8 % bi , it is expected that the operating temperature is lowered by . 2 to 3 ° c . the standard deviation of operating temperatures of the alloy type thermal fuses was measured , with the result that the standard deviation was equal to or smaller than 1 . dispersion of the operating temperatures was evaluated as acceptable . the alloy type thermal fuses had no problem in the resistances and mechanical strength . furthermore , dsc evaluation was performed while changing the amount of ag . by contrast to the conditions of 52in -( 48 - x ) sn - xbi where x = 8 to 16 , when y of 52in -( 48 - xy ) sn - xbi - yag where x = 8 to 16 is 0 . 01 to 7 . 0 %, the slow change in the melt completion of a dsc curve could be surely eliminated although ag was added . the entire disclosure of japanese patent application no . 2002 - 130364 filed on may 2 , 2002 including specification , claims , drawings and summary are incorporated herein by reference in its entirety .
| 7 |
as shown in the schematic representation of fig1 , the parallel hybrid electric vehicle transmission of the instant invention comprises a compound planetary gear set ( shown generally at 10 ), an engine 20 , an engine input shaft 21 , a combined electric motor and generator 30 , an output shaft 50 , and four torque transfer devices 61 , 62 , 63 , and 64 . torque transfer devices 61 and 62 preferably comprise multi - disk clutches , and torque transfer devices 63 and 64 preferably comprise band clutches . however , other similarly configured torque transfer devices , such as one - way clutches , may likewise be used without departing from the spirit and scope of the instant invention . compound planetary gear set 10 more particularly comprises an input planetary gear train ( shown generally at 100 ) and an output planetary gear train ( shown generally at 200 ). each of planetary gear trains 100 and 200 share a compound sun gear 101 . input planetary gear train 100 further comprises a ring gear 102 and a plurality of planetary gears 103 . likewise , output planetary gear train 200 further comprises a ring gear 202 and a plurality of planetary gears 203 . the output shaft 50 interconnects ring gear 102 of input planetary gear train 100 with the carrier 204 of planetary gears 203 of output planetary gear train 200 . electric motor 30 is integrated coaxially with compound sun gear 101 . engine input shaft 21 is affixed to hub 151 , which may in turn be operatively connected to the compound planetary gear train 10 by engaging either or both of multi - disk clutches 61 and 62 . when clutch 61 is engaged , engine input shaft 21 is coupled to the compounded sun gear 101 of input planetary gear train 100 and output planetary gear train 200 through hub 152 . likewise , when clutch 62 is engaged , engine input shaft 21 is coupled to carrier 104 of input planetary gear train 100 . band clutches 63 and 64 are used to ground ring gear 202 and sun gear 101 to the transmission case ( not shown ), and can be used to reduce the mobility of the transmission from the two degree - of - freedom to one degree - of - freedom operation . more particulary , sixteen useful operational modes are available from the parallel hybrid transmission of the instant invention using different combinations of the four clutches and operating the electric motor as either a motor or generator or allowing it to freewheel in the off condition . the sixteen useful modes of operation may be summarized by the following table 1 , and are discussed in greater detail below : the first mode of operation of the parallel hybrid transmission of the instant invention is motor - only mode in which the electric motor provides all of the power to drive the vehicle , in the forward or reverse direction , at a low - speed gear reduction . the motor - only mode is used to initially move the vehicle from a standstill and for low speed driving in city traffic . band clutch member 63 is the only clutch member engaged , grounding ring gear 202 to the transmission case . as a result , the transmission becomes a single degree - of - freedom transmission operable solely through the torque produced by electric motor 30 . as shown , power is directed from electric motor 30 , sun gear 101 , and planetary gears 203 ( and their carrier 204 ) to output shaft 50 . ring gear 202 serves as a reaction member . in this operational mode , the input planetary gear train spins freely . another feature of the motor - only mode of operation of the transmission of the instant invention is that a vehicle operator may start engine 20 without an electric starter , as is traditionally required . when operating in motor - only mode , the vehicle operator need only engage clutch 61 , and thus shift from the motor - only mode to the first combined engine and motor mode , which process will in turn pull the engine up to operating speed as would a traditional , separate electric starter . the next group of modes of operation of the parallel hybrid transmission of the instant invention are power - summing combination modes which combine torque from the engine and motor to drive the vehicle , at different gear reductions . the power - summing combination modes are used for maximum acceleration or hill climbing . in the first power - summing combination mode , band clutch 63 and multi - disk clutch 61 are engaged , and all other clutches are disengaged . ring gear 202 is grounded to the transmission case and serves as a reaction member . with multi - disk clutch 61 engaged , torque from the engine enters through sun gear 101 to output planetary gears 203 and carrier 204 to output shaft 50 . likewise , torque from the motor enters through sun gear 101 to output planetary gears 203 and carrier 204 to output shaft 50 . thus , the torque from the engine and motor are summed at the sun gear and directed to output shaft 50 . in the second power - summing combination mode , multi - disk clutch 62 is engaged , along with band clutch 63 , and all others are disengaged . with clutch 62 engaged , torque from the engine enters from shaft 21 through input carrier 104 , to planetary gears 103 , where it is split between the sun gear 101 and the ring gear 102 . the portion of engine power entering sun gear 101 is combined with the motor power at sun gear 101 . the combined torque on the sun gear enters planetary gears 203 and carrier 204 to the output shaft 50 . the remainder of the engine power entering ring gear 102 is added to the other combined engine and motor power on the output shaft 50 to power the vehicle , at less gear reduction than the first combined power - summing mode . in the third power - summing combination mode , multi - disk clutches 61 and 62 are engaged and all other clutches are disengaged . under this condition , the input and output planetary gear trains lock together and rotate as a single unit , providing a direct drive power - summing mode . torque from the engine is transferred from hub 151 to both input planetary gear carrier 104 and hub 152 . from planetary gear carrier 104 , torque is transferred to planetary gears 103 , and in turn to ring gear 102 and sun gear 101 , and ultimately to output shaft 50 . torque from hub 152 is likewise transferred through sun gear 101 , ultimately to output shaft 50 . finally , motor torque is also transferred through sun gear to output shaft 50 . the engine torque and motor torque are summed in the locked planetary gear set 10 to power the output shaft 50 . under this configuration , the engine and motor rotate at the same speed . the next group of modes of operation of the parallel hybrid transmission of the instant invention are engine - only modes which are utilized during highway cruising conditions in which it is highly desirable to power the vehicle directly from the heat engine with no power assist from the motor . the varying clutch arrangements made available by the configuration of the instant invention offer four distinct engine - only modes , namely , two reduction modes , one direct drive mode , and one overdrive gear ratio mode . in the first reduction gear ratio engine - only mode , multi - disk clutch 61 and band clutch 63 are engaged , and the motor is free - wheeling in the off condition . with band clutch 63 engaged , ring gear 202 serves as a reaction member , and the input shaft 21 is coupled to the output planetary gear train 200 . the electric motor is switched to a neutral condition . in this configuration , engine torque is transferred through hub 151 , then hub 152 , through sun gear 101 , to output planetary gear train carrier 204 , to output shaft 50 . in the second reduction gear ratio engine - only mode , clutches 62 and 63 are engaged and all others are disengaged . with clutch 62 engaged , torque from the engine enters from shaft 21 through input carrier 104 , to planetary gears 103 , where it is split between the sun gear 101 and the ring gear 102 . the motor 30 is free - wheeling in the off condition . the portion of engine power entering sun gear 101 is transferred through planetary gears 203 to output shaft 50 . the remainder of the engine power entering ring gear 102 is added to the other engine power on output shaft 50 to power the vehicle , at less gear reduction than the first engine - only mode . in the direct drive engine - only mode , multi - disk clutches 61 and 62 are engaged , and all remaining clutches are disengaged . the motor is allowed to free - wheel in the off condition . under this condition , the input and output planetary gear trains lock together and rotate as a single unit , providing a direct drive engine - only mode . torque from the engine is transferred from hub 151 to both input planetary gear carrier 104 and hub 152 . from planetary gear carrier 104 , torque is transferred to planetary gears 103 , and in turn to ring gear 102 and sun gear 101 , and ultimately to output shaft 50 . torque from hub 152 is likewise transferred through sun gear 101 , ultimately to output shaft 50 . in the overdrive engine - only mode , multi - disk clutch 62 and band clutch 64 are engaged , and all other clutches are disengaged . prevented from rotating due to band clutch 64 , sun gear 101 becomes the reaction member , and the output planetary gear train carries no load . engine torque is transferred through hub 151 , input planetary gear train carrier 104 , planetary gears 103 , ring gear 102 , to output shaft 50 . the next mode of operation of the parallel hybrid transmission of the instant invention is engine charging modes which enable the engine to power the vehicle and power the electric motor generator assembly simultaneously . the generator in turn charges the vehicle batteries when the battery state - of - charge is low and the power requirement for cruising is low . the varying clutch arrangements made available by the configuration of the instant invention offer four distinct engine charge modes , namely two reduction modes , one direct drive mode , and one continuously variable transmission ( cvt ) mode . in the first reduction engine charging mode , band clutch 63 and multi - disk clutch 61 are engaged , and all other clutches are disengaged . ring gear 202 is grounded to the transmission case and serves as a reaction member . the power flow in this mode is similar to that of the first reduction power - summing mode , except motor 30 is operated as a generator to charge vehicle batteries or power vehicle accessories . in the second reduction engine charging mode , multi - disk clutch 62 is engaged , along with band clutch 63 , and all others are disengaged . ring gear 202 is grounded to the transmission case and serves as a reaction member . the power flow in this mode is similar to that of the second power - summing mode , except motor 30 is operated as a generator to charge vehicle batteries or power vehicle accessories . in the direct - drive engine charging mode , multi - disk clutches 61 and 62 are engaged , and all remaining clutches are disengaged . the power flow in this mode is similar to that of the direct - drive power - summing mode , except motor 30 is operated as a generator to charge vehicle batteries or power vehicle accessories . in the continuously variable transmission engine charging mode , multi - disk clutch 62 is engaged , and torque from the engine is transferred through hub 151 and input planetary gear train carrier 104 to input planetary gears 103 , where the torque is split . most of the torque is used to drive the vehicle as it is transferred from planetary gears 103 through ring gear 102 , and to output shaft 50 , while the remainder is used to power the motor / generator for charging the batteries and powering vehicle electric accessories through sun gear 101 . for this operating mode , the motor is operated as a generator . for a given output shaft speed , the engine can be operated at a speed yielding peak efficiency while the vehicle speed is regulated by varying the speed of the generator . in this regard , the transmission functions as a continuous variable transmission . as indicated in table 1 above , four regenerative braking modes are also made available through the parallel hybrid transmission of the instant invention . during braking events , the electric motor is operated as a generator to charge the batteries . the output shaft becomes an input shaft , and kinetic energy of the vehicle that would otherwise have been lost through the brakes is stored for later use . the first regenerative braking mode is identical to the clutch condition in motor - only mode , except that the motor is operated as a generator . in this regenerative braking mode the engine is off . the power flow is the reverse of motor - only mode . in this condition , only the generator provides braking torque . the second regenerative braking mode is identical to the clutch condition in power - summing combination mode 1 , except that the motor is operated as a generator . both the engine and the generator provide braking torque . the power flow is the reverse of power - summing mode 1 . the third regenerative braking mode is identical to the clutch condition in power - summing combination mode 2 , except that the motor is once again operated as a generator . again , both the engine and generator provide braking torque . the power flow is the reverse of power - summing mode 2 . finally , the fourth regenerative braking mode is identical to the direct - drive power - summing mode , except that the motor is operated as a generator . again , both the engine and generator provide braking torque . the power flow is the reverse of power - summing mode 3 . alternative similar hybrid transmission mechanisms may also be provided . in general , a hybrid transmission is preferably comprised of two basic planetary gear trains with four torque transfer devices and a coaxially integrated motor / generator unit . using different combinations of the four clutches and operating the electric motor as either a motor or generator or allowing it to freewheel in the off condition , motor - only , power - summing , engine - only , engine charge , and regenerative braking operating modes are capable . having now fully set forth the preferred embodiments and certain modifications of the concept underlying the present invention , various other embodiments as well as certain variations and modifications of the embodiments herein shown and described will obviously occur to those skilled in the art upon becoming familiar with said underlying concept . it should be understood , therefore , that the invention may be practiced otherwise than as specifically set forth herein .
| 8 |
a turbine fuel pump for a vehicle includes : an upper casing 100 including an upper channel groove 120 formed in a lower surface thereof so as to allow fuel to flow therethrough and a fuel discharge port 110 connected to the upper channel groove 120 , formed to penetrate through upper and lower surfaces thereof , and discharging the fuel therethrough ; a lower casing 300 joined to a lower part of the upper casing 100 and including a lower channel groove 320 formed in an upper surface thereof so as to allow the fuel to flow therethrough and a fuel suction port 310 connected to the lower channel groove 320 , formed to penetrate through upper and lower surfaces thereof , and introducing the fuel thereinto ; and an impeller 200 provided between the upper casing 100 and the lower casing 300 , having a disk shape , and including a plurality of blades 230 formed along an outer circumferential surface in an outer direction of the outer circumferential surface and blade chambers 240 each formed between the blades 230 so as to penetrate through upper and lower surfaces thereof to allow the fuel to be discharged and introduced in upper and lower parts of the blades 230 , respectively , wherein the upper casing 100 includes an upper inner channel 140 formed to be spaced apart from a shaft penetration hole 130 formed at the center thereof by a predetermined distance and penetrate through the upper and lower surfaces thereof , the impeller 200 includes an impeller channel 260 formed to be spaced apart from a shaft fixation hole 220 formed at the center thereof by a predetermined distance and penetrate through the upper and lower surfaces thereof , and the lower casing 300 includes a lower inner channel 340 formed at the center of the upper surface thereof and a lower connection groove 350 connecting the lower inner channel 340 and the lower channel groove 320 to each other , such that a separate channel is formed so that the fuel suctioned into the fuel suction port 310 flows along the lower channel groove 320 by rotation of the impeller 200 , is introduced into the lower inner channel 340 through the lower connection groove 350 , and passes through the impeller channel 260 to be discharged through the upper inner channel 140 . hereinafter , the respective components will be described in more detail with reference to the accompanying drawings . fig5 is a partial exploded perspective view illustrating a turbine fuel pump for a vehicle according to an exemplary embodiment . as shown in fig5 , in the turbine fuel pump 1000 for a vehicle according to the exemplary embodiment , an upper casing 100 and a lower casing 300 are joined to a lower end part of a motor housing 60 constituting the fuel pump and an impeller 200 is interposed therebetween . in this case , the impeller 200 is configured to rotate in contact with the lower surface of the upper casing 100 and the upper surface of the lower casing 300 , and a rotational shaft 21 of a motor 2 is joined to the impeller while penetrating through a shaft penetration hole 130 formed at the center of the upper casing 100 and penetrating through a shaft fixation hole 220 formed at the center of an impeller body 210 of the impeller 200 , such that the impeller 200 rotates in accordance with rotation of the rotational shaft 21 of the motor 20 . in addition , a lower part of the rotational shaft 21 penetrating through the shaft fixation hole 220 of the impeller body 210 is inserted into a shaft support groove 330 formed at the center of the lower casing 300 and a lower end surface of the rotational shaft 21 contacts a ball 360 joined to the shaft support groove 330 and is supported by the ball 360 . in addition , referring to fig5 and 6 , the impeller 200 has a disk shape and includes a plurality of blades 230 formed along an outer circumferential surface in an outer direction of the outer circumferential surface , a side ring 250 formed on an outer surface of the plurality of blades 230 , and blade chambers 240 each formed between the blades 230 so as to penetrate through upper and lower surfaces thereof to allow the fuel to be discharged and introduced in upper and lower parts of the blades 230 , respectively . further , the lower casing 300 includes a lower channel groove 320 formed in an upper surface thereof so as to allow the fuel to flow therethrough and a fuel suction port 310 connected to the lower channel groove 320 , formed to penetrate through upper and lower surfaces thereof and introducing the fuel thereinto , and the upper casing 100 includes an upper channel groove 120 formed in a lower surface thereof and having fuel flowing therethrough and a fuel discharge port 110 connected to the upper channel groove 120 , formed to penetrate through upper and lower surfaces thereof , and discharging the fuel therethrough . in this case , a start portion of the upper channel groove 120 is formed to be opposite to a start portion of the lower channel groove 320 , and an end portion of the upper channel groove 120 is formed to be opposite to an end portion of the lower channel groove 320 . therefore , as the impeller 200 rotates , a pressure difference is generated , such that fuel is suctioned into the fuel suction port 310 of the lower casing 300 and some of the fuel passes through the blade chamber 240 of the impeller 200 and flows along the upper channel groove 120 positioned in the upper part of the blade chamber 240 to be discharged through the fuel discharge port 110 and the rest of the fuel flows along the lower channel groove 320 positioned in the lower part of the blade chamber 240 and passes through the blade chamber 240 at the end portion of the lower channel groove 320 to be discharged through the fuel discharge port 110 . that is , the rotation flow is formed in each of the upper part and the lower part of the blade chamber 240 with the rotation of the impeller 200 , such that the fuel suctioned into the fuel suction port 310 flows along each of the upper channel groove 120 and the lower channel groove 320 and passes through the blade chamber 240 of the impeller 200 at the end portion of the lower channel groove 320 to be joined and discharged in the fuel discharge port 110 . the turbine fuel pump for a vehicle that has the above structure and where fuel flows is called a side channel type and the fuel that flows along the lower channel groove 320 in the suctioned fuel is configured to be discharged through the fuel discharge port 110 only when it passes through the blade chamber 240 at the end portion of the lower channel groove 320 . here , the upper casing 100 includes an upper inner channel 140 formed to be spaced apart from a shaft penetration hole 130 formed at the center thereof by a predetermined distance and penetrate through the upper and lower surfaces thereof , the impeller 200 includes an impeller channel 260 formed to be spaced apart from a shaft fixation hole 220 formed at the center thereof by a predetermined distance and penetrate through the upper and lower surfaces thereof , and the lower casing 300 includes a lower inner channel 340 formed at the center of the upper surface thereof and a lower connection groove 350 connecting the lower inner channel 340 and the lower channel groove 320 to each other here , the respective channels 140 , 260 , and 340 are passages formed so that fuel may flow , and the lower connection groove 350 is a passage formed so that fuel flows by connecting the lower channel groove 320 and the lower inner channel 340 to each other . further , one side of the lower connection groove 350 is connected to the lower inner channel 340 and the other side of the lower connection groove 350 is connected to the lower channel groove 320 , and one side of the lower connection groove 350 is connected to an opposite end of the lower channel groove 320 connected to the fuel suction port 310 . that is , the lower connection groove 350 is preferably formed so that the end portion of the lower channel groove 320 and the lower inner channel 340 are connected to each other . in this case , the upper inner channel 140 is formed to be positioned between the shaft penetration hole 130 formed at the center of the upper casing 100 and the upper channel groove 120 formed outside the upper casing 100 and is formed so as not to be connected to the upper channel groove 120 . in addition , the impeller channel 260 is formed to be positioned between the shaft fixation hole 220 formed at the center of the impeller body 210 of the impeller 200 and the blade chamber 240 formed outside the impeller body 210 and formed so as not to be connected to the blade chamber 240 . therefore , a separate channel is formed so that the fuel suctioned into the fuel suction port 310 flows along the lower channel groove 320 by rotation of the impeller 200 , is introduced into the lower inner channel 340 through the lower connection groove 350 , and passes through the impeller channel 260 to be discharged through the upper inner channel 140 . that is , as shown in fig6 , when the fuel is introduced into the fuel suction port 310 formed in the lower casing 300 , some of the introduced fuel passes through the blade chamber 240 and flows along the upper channel groove 120 to be discharged through the fuel discharge port 110 of the upper casing 100 and the rest of the fuel flows along the lower channel groove 320 without passing through the blade chamber 240 , is introduced into the lower inner channel 340 through the lower connection groove 350 , and passes through the impeller channel 260 of the impeller 200 positioned in the upper part to be discharged through the upper inner channel 140 . therefore , the fuel that flows along the lower channel groove 320 flows along the separate channel to be discharged without passing through the blade chamber 240 of the impeller 200 to reduce rotation resistance of the impeller 200 and damage of the rotation flow formed in the fuel that flows along the lower channel groove 320 , thereby making it possible to reduce pressure instability of the fuel pump and increase efficiency . as set forth above , according to the exemplary embodiment of the present invention , pressure instability can be solved by reducing flow resistance caused due to collision of fuel by allowing fuel to pass through the separate channel without passing through the impeller blade by forming the separate independent channel in the lower casing , the impeller , and the upper casing where channels of fuel are formed . further , damage of a fuel rotation flow caused by the impeller decreases to improve efficiency of a fuel pump . the present invention is not limited to the aforementioned exemplary embodiment and an application range is various and it is apparent that various modifications can be made to those skilled in the art without departing from the spirit of the present invention described in the appended claims .
| 5 |
wherever the term &# 34 ; shaft &# 34 ; is used herein it means any other elongated threaded body such as a bolt or shaft , as well as a spindle . a wheel axle spindle is shown as the presently best - known use of this invention , and is encompassed by the term &# 34 ; shaft &# 34 ; herein . the shaft has an external thread 15 on which the lock nut is to be threaded and locked . lock nut 10 has a central axis coaxial with axis 12 and includes a thrust washer 20 . the thrust washer has a central disc portion 21 which is flat , with a face 22 adapted to bear against ring 14 and an inner face 23 which will react with another portion of the lock nut as will later be appreciated . the disc portion has a central aperture 24 , through which the shaft is to pass . a tang 25 is integral with the disc portion and projects into the opening in order to enter the shaft keyway so as to hold the thrust washer against rotation relative to the shaft . a peripheral skirt 26 is integral with the disc and extends upwardly and axially away from it . three axially extending skirt keyways 27 are formed in the skirt and this formation is enabled by a group of slits 28 which facilitate the formation of the thrust washer by stamping from a single piece of metal . the slits form tabs 29 in which the keyways are formed . these tabs are a convenience in assembling the lock nut , because they can spring over tangs on a lock ring to be described , and this forms the lock nut as an integral assembly . inside the skirt there is a nut ring 30 which has a central neck 31 that extends axially and has an internal thread 32 to thread onto the thread on the shaft . the nut ring extends to a bearing face 33 which bears against inner face 23 of the thrust washers so as to transmit thrust against it . the nut ring also has an overhanging shoulder 34 which has on its surface facing toward disc portion , a plurality of teeth 35 . also , there is a plurality of recesses 36 which pass through the shoulder and expose a portion of the mechanism yet to be described . these are torque tool engaging recesses which have edges 37 and 38 that are adapted to receive torque from the tool to turn the nut ring . between the nut ring and the disc portion , or more specifically between the overhanging ( shoulder ) and the disc portion , there is disposed a lock ring 40 . the lock ring has an internal opening 41 which is shorter than that of the outer portion of the neck . the lock ring includes a plurality of teeth 42 which face toward teeth 35 and are complementary therewith . the lock ring also includes three tangs 43 which extend into respective ones of the skirt keyways to restrain the lock ring against substantial rotation , but which permit substantial axial movement of the lock ring . bias spring 45 , preferably in the form of a circular wave spring , extends around the neck and bears between the disc portion and the lock ring so as to bias the lock ring toward and against the overhanging shoulder of the nut ring . the shape of teeth 35 and 42 is of importance to this invention . in all embodiments , the teeth have camming surfaces 46 and 47 which extend in each direction , and meet at an apex . the apex can be flat , sharp , or gently crested , chosen with respect to the material of construction so that they will not be locking surfaces , and provide a desired resistance to camming . this is to say that they do not fall within the locking angle of the material , but are such as to allow camming action , still with sufficient locking action . this means that with sufficient torque applied to the nut ring the surfaces 46 and 47 will ride over one another , and because the nut ring is engaged to a thread , the result will be to displace the lock ring against the bias force and permit the lock ring either to cam itself on or off the nut ring , even without the application of an axial force from the torque tool . this enables the lock nut to be applied and removed with or without a special tool . however , it is best practice to utilize a tool , especially in shop or manufacturing operations . such a tool 50 is shown in fig1 and 2 . it is preferably tubular , and includes four prongs 51 , which are adapted to be inserted into recesses 36 . the width of recesses 36 and the width of the prongs is such that the prongs can bridge at least a plurality of the teeth so that at any angular position , at least one tooth will always be borne against by a respective prong . accordingly , when the tool is used , its shoulder 52 will be pressed against the lock nut and its prongs against the tips of teeth of the locking ring so as to displace it , and the nut ring can be installed or removed without requiring a camming action to occur . the teeth will simply clear each other by virtue of the applied force from the tool . while the teeth may be symmetrical , with both faces making the same angle with an axial reference , important advantages can be obtained if they are different . in fig8 the preferred embodiment is shown . torquing faces 62 , 63 on parts 30 and 40 , respectively form an angle 61 with a tangent 64 to an axial line 65 . unlocking faces 70 , 71 are formed on parts 30 and 40 , respectively . these form an angle 60 between such a tangent and axial line . these are shown for a right hand thread nut whose direction of tightening is shown by arrow 75 . angle 60 is larger than angle 61 . an example is 45 ° and 30 °, respectively . if nut ring 30 is to back off , its camming angle at faces 70 and 71 is steeper , and this makes unlocking more difficult than tightening , because the camming angle is lesser for torquing . it is believed that the operation of the device will be evident from the foregoing . as best shown in fig1 the nut is applied to the shaft and turned down with or without the use of the tool . when the final tightening occurs , the tool will be pressed in as shown in fig2 so as to displace the lock ring and enable the tightening to occur without having to have a camming action . the nut ring will bear against the disc portion to transmit the axial force from the thread interaction . then as shown in fig3 the tool is withdrawn , and the nut ring will , if necessary , cam itself back to the intimate complementary engagement shown in fig3 . reversal may be the reverse of the foregoing or may be accomplished simply by applying any torque tool which need not displace the lock ring and simply turning the nut off while camming the rings apart by virtue of the shape of the teeth . the face of the teeth usually will be flat , but need not be . they could instead be wave - like . if the nut uses a left - hand thread , the orientation of the torquing and unlocking faces will be reversed . this invention is not to be limited to the embodiments shown in the drawings and described in the description , which are given by way of example and not of limitation , but only in accordance with the scope of the appended claims .
| 5 |
it is to be understood and appreciated that the process steps and structures described below do not cover a complete process flow . the present invention can be practiced in conjunction with various integrated circuit fabrication techniques that are used in the art , and only so much of the commonly practiced process steps are included herein as are necessary to provide an understanding of the present invention . the present invention will be described in detail with reference to the accompanying drawings . it should be noted that the drawings are in greatly simplified form and they are not drawn to scale . moreover , dimensions have been exaggerated in order to provide a clear illustration and understanding of the present invention . referring to fig1 a substrate 100 having a photoresist layer 102 thereon is shown . the substrate 100 can be a semiconductor substrate , such as a silicon wafer , but it is not necessary a semiconductor substrate . the substrate 100 can also comprises either a dielectric layer or a conductive layer thereon . in fact , the substrate 100 depends on the need of analysis . the photoresist layer 102 can be any photoresist material used in modern semiconductor industry . moreover , the photoresist layer 102 can be formed over the substrate 100 via conventional methods in the art , for example , a spin coating method . referring to fig2 a , in order to find the profile of a developed photoresist layer in the formation of a contact hole or a via hole , a hole pattern is transferred into the photoresist layer 102 to expose the substrate 100 by a conventional photolithography process . after developing the photoresist layer 102 , the hole is formed . more particularly , owing to the standing wave effect , the sidewall of the hole has a profile shown in fig2 b . the profile can only be found via a tem analysis having a resolution about 1 . 4 angstrom to about 1 . 8 angstrom because the dimensions of the caves of the profile is tiny if the width of the hole shown in fig2 b is less than about 0 . 2 micron . it is apparent that the profile is crucial if one need measuring the width of the hole precisely . referring to fig3 a conductive layer 104 is formed over the photoresist layer 102 and the bottom of the hole shown in fig2 a and a dielectric layer 106 is sequentially formed thereon . the conductive layer 104 can be a platinum layer , a gold layer , a copper layer , an aluminum layer and a titanium layer , and it is preferably a platinum layer . platinum is chose because it is a kind of stable or noble metal and it can be formed with a very thin thickness . the conductive layer 104 is preferably formed via a physical vapor deposition ( pvd ) process , for example , a dc sputtering process performing at about 20 ° c . to about 30 ° c . the temperature of the pvd process is necessarily low because a high temperature environment would render the photoresist material shrinking or shape change . in fact , not only the formation temperature of the conductive layer cannot be over a certain temperature at which the photoresist layer starts to shrink or change its shape , but also the temperature of the entire tem photoresist sample preparation process cannot exceed the certain temperature . the thickness of the conductive layer 104 is between about 50 to about 200 angstroms , and is preferably about 100 angstroms . as shown in fig3 the conductive layer 104 fails to fill the hole due to the tiny dimension of the hole and the limited step coverage ability of the pvd process . however , this profile is not crucial for this invention . the conductive layer 104 is used to isolate the photoresist layer 102 from moisture environment and prevent the photoresist layer 102 from oxidation . furthermore , the conductive layer 104 can also avoid the charging effect resulting from the use of electron or ion beams . moreover , the conductive layer 104 is very helpful to clarify the interface between the photoresist layer 102 and the dielectric layer 106 . the dielectric layer 106 can be either a silicon dioxide layer or a silicon nitride layer , and is preferably a silicon dioxide layer . the dielectric layer 106 is formed via a physical vapor deposition process , and preferably a dc sputtering process . the sputtering process is performed via an ion miller used in the conventional tem sample preparation . by accelerating argon ion ( ar + ) plasma , silicon dioxide or silicon nitride molecules are sputtered from a quartz glass target or a silicon nitride target . the sputtering process is performed at a pressure of about 10 − 6 torr . this sputtering process is also performed at about 20 ° c . to about 30 ° c . the thickness of the dielectric layer 106 is between about 500 angstroms to about 1 micron , and is preferably 1000 angstroms . the dielectric layer 106 is used to protect the photoresist layer 102 from being damage amid the sample slicing process by a focused ion beam ( fib ) technique used gallium ions ( ga + ). it is found that the damage thickness of a common focused ion beam slicing is about 500 angstroms . the thickness of the protective dielectric layer must exceed 500 angstroms . after forming the dielectric layer 102 , the substrate 100 such as a silicon wafer is sliced by using a fib to form tem samples 200 having dimensions of about 10 micron × about 5 micron × about 0 . 2 micron as shown in fig4 wherein the length is about 10 micron , the width is about 5 micron and the thickness is about 0 . 2 micron . in order to observe the tem sample prepared by the method of the invention , the tem sample 200 is then placed on a copper net having a carbon film coated thereon via an electrostatic pick up method used a glass needle having a tiny tip of about 1 micron . the method of the tem sample preparation set forth is used to prepare a photoresist sample having via or contact holes therein . however , this method can also be used to prepare a photoresist sample having other structure . for example , as shown in fig5 the photoresist layer 102 is used to define a gate electrode and the substrate 100 can be a conductive layer such as a polysilicon layer . in every embodiment of this invention , the conductive layer 104 and the dielectric layer 106 can protect the photoresist layer 102 and isolate the photoresist layer 102 from a moisture and oxygen - contained environment . moreover , the contraction of the photoresist layer 102 amid the bombardments by electron beams of a tem or a fib will be avoided effectively . the conductive layer 104 is mainly used to release the charges resulting from the electron beams of a tem or a fib . because the sample 200 observed is placed on a carbon film on a copper net , the conductive layer 104 may be omitted . other embodiments of the invention will appear to those skilled in the art from consideration of the specification and practice of the invention disclosed herein . it is intended that the specification and examples to be considered as exemplary only , with a true scope and spirit of the invention being indicated by the following claims .
| 6 |
before specific embodiments of the present application will be described below , first of all an attempt is made to describe the basic idea underlying the embodiments described below . the embodiments described below are , for example , suitable for enabling mapping of several light patterns onto different geometries or set distances . a specific case thereof is maintaining a unique light pattern according to mapping scale across an enlarged distance range . this can be referred to as extending the depth of focus . for illustrating the principles underlying the embodiments described below , this specific case will be discussed first . mapping characteristics of an array projector or a multi - aperture projection display are the basis . due to the two - dimensional arrangement of micro projectors or projection optics typically having an aperture d single & lt ; 1 mm , a comparatively large depth of focus results for the individual projector , i . e . an individual projection channel , compared to a single channel projector having an overall aperture equivalent to the array . for typical projection distances of more than 300 mm , hyperfocal mapping of each projection channel exists , i . e ., no real far distance l f of the depth of focus range exists . starting point of the subsequent embodiments is the generation of specific object structures or single images within the object plane of the projection optics whose image - side superposition resulting from the optical mappings of all projection optics constructively contribute to the overall image in the desired depth of focus range . a multichannel projection display according to fig4 b is considered as specific example . the projection display is exemplarily set to a screen distance of 400 mm . set in that way , each projection channel has a depth of focus range extending from , for example , 200 mm to infinity . as described above , the whole array has , analogous to a single aperture projector having entrance pupils size d ( cf . fig1 ), an expansion of the whole optics array , merely a depth of focus extending from 350 . . . 450 mm . it is the object to make better use of the depth of focus of the individual channels and still maintain the brightness of a multichannel projection display . the following embodiments use the following approach : when an image to be projected is viewed within the intended depth of focus range and tracing back for each projection distance within the depth of focus range to which object structure the same corresponds in the object plane of the projection channel , it can be seen that there are areas in the object planes of the projection channels that contribute to the image to be projected at any distance within the intended depth of focus range . the following embodiments utilize this fact by manipulating each channel - specific contribution to the overall image such that the image information for the image to be projected is maintained for all desired distances within the depth of focus range . for this , as will be explained below , locations in the object planes of the projection channels where the object structures of the back projection of the image to be projected exist only partly at the varying distances within the depth of focus range , i . e ., not all of them overlap , are darkened or even removed , i . e . for example the shadow mask is shaded there , such that , as the following statements will show , the depth of focus range can actually be significantly increased . however , this tough procedure corresponding to an and - operation could also be modified . as the following embodiments will show , the images to be projected at the different distances are not limited to images to be projected that are self - similar or that can be converted into one another according to the optical projection . rather , any image content can be obtained at the different projection distances . first , based on fig1 to 2 , the train of thought or the construction instruction for the single image content of the individual object structures , that are channel dependent , will be described based on the specific case of the extended depth of focus . first , the description is made based on the projection of a bright object , here a letter “ f ” onto two perpendicular screen planes . an extension to any number of ( intermediate ) distances is obvious and will also be described mathematically below . thus , the image content of the individual object structures or single images is channel - dependent . the construction instruction of the same will be described in more detail , first , based on the specific case of the extended depth of focus , but then , the description and the indication that different image contents can be generated at different projection distances will follow . first of all , fig1 shows the structure of a multi - aperture projection display according to an embodiment . the multi - aperture projection display includes a plurality of laterally adjacent projection channels 12 , i . e ., a projection channel array . each projection channel has a single image generator 14 for generating a respective single image and optics 16 for mapping the respective single image residing in an object plane 42 of the optics 16 into a projection direction 18 of the multi - aperture projection display 10 . the single image generators 14 are , for example , shadow masks that can be backlit . the same can be formed , for example , of parts of a common shadow mask . the single image generators 14 , however , can also be self - luminous elements , such as oleds having illuminating areas corresponding to the respective single image of the respective channel 12 . the single image generators could also be displays , for example , that are able to display varying image content , wherein in this case a control 20 would exist for adjusting the image content of the single image generators to the respective single images , as will be described in more detail below . for backlighting , if present , a planar light source 22 as shown exemplarily in fig . could be used , or one light source per channel 12 . the planar light source 22 is , for example , an oled , an led array or the same . the planar light source 22 could be implemented to emit an already pre - collimated backlighting light . in the projection direction 18 , planar light source 22 , image generator 14 and optics 16 are connected in series , such that the backlighting passes through transmissive portions of the single images of the single image generator 14 and the bright portions of the single images are mapped by the optics 16 into the projection direction 18 , where the same are superposed in a suitable manner so as to result in an image to be projected , as will also be described in more detail below . for obtaining köhler backlighting , optionally , one collimator 24 can be provided per projection channel 12 ; in this way , the light flux through the channels 12 and , hence , the light yield can be increased . fig2 shows a top view of the array of channels 12 with array of optics 16 , whose apertures 26 are shown here exemplarily as squares and whose entrance pupil positions 28 are exemplarily indicated by stars . as can be seen in fig2 , the optics can be arranged regularly in an array of rows and columns , but any other arrangement is also possible . additionally , the entrance pupils 28 can be arranged centrally to the respective apertures 26 but variation options exist here as well . fig2 also shows the array of single images 30 of the single image generators . the same also form a lateral arrangement . in particular , the single images 30 are positioned in a lateral arrangement which is geometrically similar to the lateral arrangement of the entrance pupils 28 . in the case of fig1 , the same results from a centric extension around a center 32 of the array of entrance pupils 28 from the arrangement of entrance pupils 28 . optionally , a translatory offset relative to the array of entrance pupils 28 can be added . here , the center of the single image arrays and the center of the entrance pupil array coincide . the optical axis 34 of the multi - aperture projection displays 10 , as indicated in fig1 , passes through the just stated centers . deviations from the geometric similarity would also be possible , for example , for performing adaptations to curved screen geometries . this is not the case in fig2 . before continuing with the further description , some general statements will be made . in fig1 it has been exemplarily assumed that the single image generators are shadow masks 14 , such as chrome masks having dark portions or blocking portions and bright portions or transmissive portions . however , it is also possible to use a reflectivity of masks instead of backlighting . in other words , the single image generators 14 could also be reflective masks having bright or reflective portions and dark or non - reflective portions . the front lighting could be realized by a light conductor plate which is arranged between optics array and single image generator array , is illuminated from the side and transmits reflective light to the optics 16 at the reflective portions of the masks 14 on its side facing the single image generators 14 . in the case of self - luminous single image generators , in a similar manner , also bright or self - luminous portions exist and dark or non - luminous portions and , in the following , the bright portions are sometimes called non - zero - valued portions and the dark portions zero - valued portions . oleds would be an option for forming fixed single images and displays or imagers , such as lcds or the same , examples for adjustable single image generators that can change their respective image content . as mentioned , the single image generators 14 can also represent different parts of an individual single image array generator , such as an array of portions of a mask , an array of portions of an imager . the distance of the projection optics 16 to the single images or single image generators 14 or the distance between the array of optics 16 and the array of single images 13 or the array of single image generators 14 indicated exemplarily by d in fig1 , corresponds approximately to the focal length f of the individual projection optics 16 . thus , with relation to each individual channel 12 , the single images 26 are mapped along the optical axis 36 specific for the respective channel 12 with a very large depth of focus reaching to infinity . in the case that all single images 30 are equal to one another , a focused image would result at a projection distance l 1 which depends , and described above , on the center distance difference δp between single images 30 and entrance pupils 28 . as will be defined in more detail below , according to embodiments of fig1 , the single images 26 are not equal to one another but , rather , the same are designed in a suitable manner such that the mappings of the single images 30 of the projection channels 12 are superposed at at least two different projection distances l 1 and l 2 to respectively one projected image 38 or 40 , wherein the single images are darkened more with respect to a positive superposition at locations where non - zero - valued portions of the projected images at least partly reside when back - projected via the optics 16 of the projection channels 12 into the object plane 42 , where the single images 30 lie , but no superposition of all of them , than at locations where the non - zero - valued portions of the projected images 38 and 40 are all superposed with one another when back - projected via the optics 16 into the object plane 42 . in the following , this will be explained in more detail but , for the time being : if a screen is held in front of the projection display 10 , such that the screen is arranged behind the projection display 10 in mapping direction 18 , it can be seen that the image projected onto this screen has a maximum focus at the distances l 1 and l 2 from the projection display 10 . the single images 30 are specifically designed for these distances , as will be described in more detail below . these are set distances . these images have bright portions 44 and dark portions 46 . in the case of fig1 , this is exemplarily the depth of focus extension case and , hence , the case where the projected images 38 and 40 are those that can be converted into one another by centric extension or projection onto the point 32 , i . e ., the intersection between optical axis 34 and entrance pupil plane but , in the following , it will be described that this is merely an example . if the back projection of these projected images 38 and 40 is considered separately , each of these projected images 38 or 40 will generate bright portions and dark portions , i . e ., non - zero - valued and zero - valued portions in the object plane 42 , where the single images lie . the non - zero - valued portions of the back projection of the different images 38 and 40 overlap only to a certain extent . at locations where at least one non - zero - valued portion of one of the images 38 and 40 lies due to back projection , but these non - zero - valued portions do not completely overlap , i . e ., not from all images 38 and 40 , i . e ., at locations onto which a bright portion 44 of only one of the images 38 or 40 is back - projected , the single images 30 of the single image generators 14 are now darkened , namely darkened compared to the comparative case where the back projections were combined additively or by an or - operation for obtaining positive superposition . the above described matter will be illustrated in more detail based on the specific example as illustrated in fig1 , namely based on the projection of a bright object , here a letter “ f ” onto two perpendicular planes at the distances l 1 and l 2 , in the following sometimes called “ screen planes ” for simplicity reasons . and extension to any number of ( intermediate ) distances by other images is obvious . first , the set distances l 1 : l 2 = 1 : 2 , are considered , where the desired superposition figures are to occur . according to equation ( 3 ), a unique slide array or an array of provisional single images results for both set distances . due to the logic and - operation ( intersection ) of the transmissive areas of both slide arrays , merely those area elements are maintained which provide a constructive contribution to the overall image at both projection distances . fig3 shows exemplarily a top view of the result of a back projection of the two projected images 38 and 40 shown in fig1 at the distances l 1 and l 2 onto the object plane 42 , wherein circles in fig3 exemplarily indicate the position of the optics apertures 26 . here , the same are exemplarily illustrated as lying adjacent to one another in a hexagonal arrangement which is tightly packed . above this , fig3 exemplarily assumes a lower single image center distance compared to the aperture center distance , wherein such embodiments will be described below . the basic idea of fig3 , however , also applies to the embodiment of fig1 , namely that the back projection of the bright portions 44 of the closer image 38 having the distance l 1 results in the non - zero - valued or bright portion 48 in the object plane 42 in the individual channels , wherein those portions 48 are illustrated in fig3 in a shaded manner from the right top to the left bottom , while the bright portions 44 of the projected image 40 at the greater distance l 2 results in non - zero - valued or bright portions 50 in the object plane 42 in the channels 12 , which are illustrated in a shaded manner in fig3 from the left top to the right bottom . due to the greater distance l 2 , the images 50 resulting from the back projection of the image 40 have a lower center distance to one another than the images 48 resulting from the back projection of the image 38 at the lower distance l 1 . for this reason , the intersection or overlap where the bright areas 48 and 50 overlap differs from channel to channel . as can be seen in fig3 , the overlap has a smaller area the further the respective channel is apart from the optical axis 34 of the multi - aperture projection display . the intersection areas where both non - zero - valued portions 48 and 50 in the respective channels overlap are illustrated in fig3 by the dark areas 52 . according to an embodiment , each single image 30 is selected such that the areas 48 and 50 beyond the intersection areas 52 are darkened . thus , in the mask embodiment , the masks are not transmissive there . the same are merely transmissive in the overlapping area 52 . this is again described in fig4 a which shows , like fig3 , a top view of the object plane 42 , i . e ., a top view of the resulting single images 30 , whose non - zero - valued portions , e . g ., transmissive portions correspond to the intersection areas 52 of fig3 . fig4 b shows exemplarily the contribution or the bright area 53 resulting by an exemplarily taken channel 12 ′ at the distance l 1 , in relation to the bright portion 44 as it results by superposition of the single images or the bright portions 52 of all channels in the image 38 at this distance l 1 . in the attempt of explaining why the area 44 at the distance l 1 in the image 38 still forms a “ fine ” “ f ”, fig4 c shows the contribution resulting from the transmissive area of the single image 30 of any other arbitrary channel 12 ″, wherein this area is again indicated by 53 in its relative position in the overall area 44 . obviously , the same covers other parts of the area 44 than the channel 12 ′ at the distance l 1 . fig4 d and 4 e show the contribution 53 for the exemplarily selected channels 12 ′ and 12 ″ according to their contributions 53 to the bright area 44 of the projected image 40 in the distance l 2 , fig4 d for the channel 12 ′ and fig4 e for the channel 12 ″. again they cover different parts of the image or the bright area 54 of the image 40 . again , other channels cover other zones of the areas 44 in the images 38 and 40 which results exactly in the desired areas 44 . in other words , according to the just described embodiments , for obtaining the mask array of fig4 a , first , it is checked for all elements of the overall object structure , i . e ., for the transmissive areas of the mask array of masks 14 whether the same provide a transmissive portion for all patterns belonging to the projection distances l 1 and l 2 , i . e ., whether the same lie within the overlap area 53 . if this check is positive , the same will be maintained , otherwise the same will be removed from the resulting object structure or the masks , i . e ., such locations are darkened or made non - transmissive . mathematically , this corresponds to an element or location selective and - operation , i . e ., the intersection 52 of all object structures 48 , 50 , each allocated to a projection distance . thus , fig4 a shows the resulting mask structure according to the just described intersection check . in other words , according to the above embodiment , a unique stamp or transmissive structure is generated in each channel , which provides at both or several set distances or even in a continuous projection depth area such a contribution to the overall overlap that the contours of the respective set images or the set image are maintained at the respective set distances . a consistent description of both the image projection variable according to distance and the extended depth of focus will follow . the object structure plane is considered and the coordinate origin is placed at its center . pattern l k ( i , j ) ∪ r 2 describes , for the lenslet or channel 12 ( i , j ), wherein , as illustrated in fig5 ( i , j ) indicates exemplarily the lateral position measured from the positon relative to the optical axis 38 measured in units p , the pattern to be mapped for the distance or the geometry l k ε . for the array projector of [ 2 ] | |= 1 , i . e ., there is only one geometry onto which mapping is to be performed in a focused manner . the present invention allows the generation of a focused image for two or more geometries ={ l 1 , . . . , l n }. this can be the same pattern ( depth of focus extension ) or also different patterns for different distances . a desired image image lk is given for a specific projection distance l k ( here , simplified : perpendicular screen ). generalization to freeform screen geometries is possible according to [ 3 ]. according to the mapping rules ( equation ( 3 )), the following slide or object structure pattern lk ( i , j ) results for an array ( image 13 ) arranged in a square on the object side for the individual channel ( i , j ): pattern l k ( i , j ) = { ( x , y ) ∈ ℝ 2 : ∃ ( x 0 , y 0 ) ∈ image l k : x = x 0 m k + j · ( δ p x ( l k ) + p x ) and y = y 0 m k + i · ( δ p y ( l k ) + p y ) } is the mapping scale for the k - th projection distance p x = p y = p of the distance of the lenses of this array and δ p ( l k ) = δ p x ( l k ) = δ p y ( l k ) = s l k · p = 1 m k · p is the projection distance dependent center distance difference . now , by pattern intersection ( i , j ) those area ( s ) are described that result in the channel ( i , j ) by the following and operation : pattern intersection ( i , j ):=∩ l k ε pattern l k ( i , j ) and ={ l 1 , . . . , l n }. the overall transmission of such a projection system is proportional to the sum of the transmissive areas of the individual slides . here , for the illuminated area content of a channel a pattern ( i , j ) the following applies : a pattern ( i , j ):=∫∫ i pattern intersection ( i , j ) ( x , y ) dxdy here , i is the indicator function ( or also characteristic function ) and is defined as follows : is significant for the overall transmission of a projector arrangement generated according to this method . as example 1 , a centered rectangle is described which is , in the screen plane , ( l 1 = 400 mm the measure width × height = b 1 × h 1 = 5 mm × 20 mm and in l 2 = 800 mm according to the screen distance ratios l 2 : l 1 = 2 : 1 ) b 2 × h 2 = 2 ·( b 1 × h 1 )= 10 mm × 40 mm ( fig6 ). for ( i , j )=( 2 , 4 ), ={ 400 mm , 800 mm } and p = 0 . 8 mm ( with array structure of fig5 ) for the following rectangle , object structures analogous to fig7 result : pattern intersection ( 2 , 4 )={( x , y ) ε 2 : 3 . 2035 mm ≦ x ≦ 3 . 2205 mm and 1 . 558 mm ≦ y ≦ 1 . 654 mm } this describes the transmissive area ( cf . fig7 ) for the lenslet ( 2 , 4 ). for the transmissive area of this exemplarily selected projector lenslet , the following results : a pattern ( 2 , 4 ):=∫∫ i pattern intersecion ( 2 , 4 ) ( x , y ) dxdy = 1 . 632 · 10 − 3 mm 2 . if the transmissive area of the entire array projector is compared to the extended depth of focus with the one of a conventional one according to [ 2 ], a relative light loss of 26 % results . the depth dependent mapping characteristics of an array projector with manipulated object structures according to the invention depends heavily on the light patterns to be projected and differs fundamentally from the ones of a conventional single channel projection system . exemplarily , a greatly simplified example will show below in as much the mapping of a simple bright - dark edge behaves for the different optical systems to subsequently be able to compare two equivalent systems . in the following , it is examined based on a bright - dark edge how the optical mapping of an array projector differs from the one of a conventional single channel projector or array projector with single set distance . here , a differentiation is to be made in : a ) the projection distance of the individual channels l foc , given by the back focal lengths of the projection optics ( in the example 533 mm ) and b ) the set distances at which a focused image is to be generated by the above described arrangement or method ( in the example : 400 mm and 800 mm ). fig8 shows the result of an analytical simulation of the mapping of a bright - dark edge for a conventional projector ( curve 60 ) and an array projector with extended depth of focus ( edof ). in particular , fig8 shows a comparison of the mapping characteristics of a bright - dark edge by a conventional projector ( curve 60 ) and an array projector with edof ( curve 62 ) at 400 mm , 533 mm and 800 mm . the abscissa in the diagram corresponds to the lateral coordinate in the image space . an area having an expansion of 10 mm is illustrated . the single channel projector has a lateral expansion of 8 . 8 × 8 . 8 mm ( square aperture ), while the array of 11 × 11 individual projector lenslets consists of a single expansion of 0 . 8 × 0 . 8 mm . the back focal length of each projector lenslet is set to 533 mm according to mapping equation . the set distances of the array projector with edof are at 400 mm and 800 mm . from the analysis , it can be seen that the suggested arrangement can improve the visibility of image edges across a wide projection distance range . in the images , it becomes clear that in contrary to the classic single channel projector both an asymmetric blur behavior when mapping at non - set distances as well as a shift of the edge center k center occurs . this results in the ( relative ) intensity of the superposition of all channels by considering the washout occurring due to defocusing . due to the asymmetric edge expansion behavior in the image space it is necessitated to differentiate the following cases : the margin of the edge expanding into illuminated areas , is referred to by k bright . analogously , k dark characterizes the margin of the edge into dark image areas : these equations apply for the exemplarily selected bright - dark distribution ( left - dark , right - bright ). the inverse case results analogously . for the selected projection distances , here exemplarily 400 mm , 533 , 800 mm , fig9 shows at the top the area of the dark edge area 66 and the bright edge area 68 . at the bottom , the blur behavior of a conventional projector is illustrated with dotted lines and an array projector with edof ( areas ). both systems have an identical overall aperture of 8 . 8 × 8 . 8 mm 2 . both the asymmetric edge washout ( curves 70 , 72 ) and the edge shift ( curve 74 ) are clearly visible . the illustrated shift of the edge positions can be counteracted by adapting the light patterns at the set distances . the effect is as follows : a conventional single channel projector is defined by the following parameters : aperture : d = 8 . 8 mm ( square ), focal length : l foc = 533 mm , and in the following it will be examined how much its pupil would have to be reduced in order to have the same blur behavior with respect to the suggested arrangement at a distance of 400 mm and 800 mm . the evaluation of equation ( 3 ) shows that the pupil of the single channel projector would have to be limited to 1 . 46 mm , which corresponds to a reduction of the light flux to approximately 3 %. by using the arrangement suggested herein for extension of depth of focus ( edof ), this value is opposed by a light flux of approximately 74 % ( example : bright rectangle , see above ). here , it should be noted that this transmission loss of the suggested system heavily depends on the image to be projected or the selected set distances . for typical image contents and projection distances , values of & gt ; 60 % are to be expected . with reference to the above statements , fig1 shows an embodiment for a single image generator for a multi - aperture projection display having a plurality of projection channels . generally , the single image generator is indicated by reference number 80 . the single image generator 80 of fig1 includes an image data input 82 for receiving image data 84 representing at least two images to be projected at different projection distances , such as the images 38 and 40 at the distances l 1 and l 2 . further , the single image generator 80 includes a single image calculator 86 that is implemented to calculate , for each of the at least two images to be projected , a provisional single image per projection channel 12 of the multi - aperture projection display such as , for example , exactly those images 48 and 50 . a combiner 88 of the single image generator 80 combines , for each projection channel , the provisional single images of the respective projection channel calculated for the at least two images to be projected to a final single image for the respective projection channel , such as exactly those final single images as illustrated in fig4 a . as mentioned , extensions to more images to be projected etc ., is also possible . basically , fig1 also represents the steps of a respective single image generation method , namely receiving image data at 82 , calculating provisional single images at 86 and combining the same at 88 . the following detailed function description is thus also understood as a description of the respective method . before the image generation according to fig1 will also be described in more detail , it should be noted that the image generation according to fig1 can be performed offline or online . this means the following . single image generation , for example in the embodiment of fig1 , could be performed within the control 20 . then , it would be possible to feed in image data 84 indicating the desired images 38 and 40 , and the single image generation then controls the single image generators 14 of fig1 accordingly , such that the same indicate the finally calculated single images . however , the single image generator or the single image generation method of fig1 , can also be a pure design tool or part of a production method for producing the single image generators 14 , such as the masks , in the case that the single image generators 14 are formed of masks . the latter alternatives are summed up in a dotted box 90 in fig1 , which is indicated by “ single image generation ”. thus , the same can be a mask generator or mask generation . as an alternative , the result of combining 88 could also be outputting data , for example in stored form , on a suitable data carrier , which represents the arrangement of single images 30 as it results from the combination . a simple case as described above is that the image data 84 represent the at least two images 38 and 40 to be projected in a binary manner , i . e ., exclusively comprising merely bright areas 44 and dark areas 46 . in this case , the single image calculation in the calculator 86 calculates , for example , for each of the images 38 or 40 to be projected , the array of provisional single images 30 such that , for each image 38 or 40 to be projected , the respective array of provisional single images or the provisional single images themselves represent a back projection via the array of optics 14 into the object plane 42 . the result would be binary provisional single images , as indicated exemplarily in fig3 at 48 or 50 . this means the calculation would be performed by using optical parameters of the multi - aperture projection display 10 , such as optical mapping parameters , such as the projection distances l 1 , l 2 , the aperture center distances p , the object distance d and possibly optionally further parameters . however , the calculation can also be more complex . in particular , the same does not have to be unique . for example , it would be possible to perform the calculation for projection planes that are not perpendicular to the optical axis 34 or even curved , for which reference is made exemplarily to [ 3 ]. image portions can be distributed differently to the channels , such as for increasing the focus . then , the combiner 88 performs the combination of the binary provisional single images or the arrangement of binary valued provisional single images , such as by the above mentioned logic operation , namely an and - operation in the case that the logic 1 corresponds to the bright portions and a logic or - operation in the case that the logic 1 corresponds to the dark portions . the result would thus be a final binary single image per channel or an arrangement of such final single images with dark or bright portions which can represent , for example , transmissive , reflective or self - luminous portions , as described above . in the case of transmissive masks , respective chrome masks would be produced as has also been described above . otherwise , a pixelated imager is controlled in a suitable manner for indicating the bright or dark areas . another option is that the images to be projected 38 or 40 are not represented in a binary manner by the image data 84 . thus , the same can have a higher value , they can , for example , be trivalent . in this case , the single image calculator 86 distributes , for example , the differently valued portions of the images 38 and 40 to a different amount of channels 12 in its calculation , such that per image to be projected 38 , the calculated provisional single images are binary , but , when the same are superposed , result in the multi - valued image to be projected 38 at the respective projection distance . the combination in the combiner 88 then functions again exactly as in the case of purely binary images to be projected 38 or 40 . it should be noted that it is an advantage of embodiments of the present invention that a maximum of a difference amount between the at least two different projection distances l k , i . e ., max ({∀ i , j ≦ number of projection distances l i - l j } ) o r max l i , l j ∈ ℒ ( l i - l j ) , can be greater than the commonly obtainable depth of focus of the projection display for , for example , the average projection distance l of all projection distances l k , i . e ., greater than wherein d is , overall , a pupil expansion of the optics of the projection channels , l an average value of the different projection distances and β = 0 . 005 . thus , this is particularly interesting for the case that the images to be projected are indicated by the image data 84 such that the same actually result from one another due to centric extension at the intersection of optical axis 34 and entrance pupil plane , which has been described above as depth of focus extension . here , for example , the image data 84 can be already designed such that they exist in a format according to which , in the image data 84 of the different projection distances , only one image is contained , from which the at least two images to be projected result by the central extension in dependence on the respective projection distance . merely for the sake of completeness , fig1 and 12 also show that , according to other embodiments , a multi - aperture projection display having the advantages as described above might also be implemented as head - up - display for fading - in the images 38 and 40 as virtual images in the sight of a person via a suitable fading - in area , such as a window 92 of a vehicle or as near - eye display for fading in the images 38 or 40 as virtual images into the sight of the eye 94 of the viewer , such as in the form of electronic glasses . in the case of fig1 , the single image generators 14 are , for example , portions of a common mask or portions of a common display . contrary to fig1 , merely the entrance pupil center distance is greater than the single image center distance in the case of fig1 , wherein the expansion of the display , i . e ., the area covered all - in - all by the projection optics aperture is determined by the expansion d ( cf . fig1 ) of the solid angle area where the display can indicate the images 38 or 40 to the user . in the case of fig1 , the individual channels 12 serve to cover the eye motion box of the person in the sight of whom fading - in is performed . in the case of fig1 , exemplarily , reflectively operating single image generators 14 are provided , such as reflective masks . illumination is performed via a beam splitter 94 between the optics 16 and the single image generators 14 . a light source 22 is formed by a divergent light source 96 and a collimator 98 , which introduce collimated light laterally into the beam splitter 94 , such that the reflective single image generators 14 are illuminated and reflect , at the positions defined by the single images , light by the beam splitter and the optics 16 into the eye 94 , where the mappings of the single images are superposed in the retina for forming the virtual images 38 or 40 . the following remarks are made with regard to the above embodiments for eliminating the impression that the embodiments as described above cannot be extended or amended . 1 ) the above embodiments are particularly suited for projecting binary light patterns , but can also be extended to gray - level images by : superposing different binary images having a defined number superposing suitable gray value slides having a defined number 2 ) generating colored image contents can be performed analogously to point 1 ). possibly , the light pattern is to be separated into its primary color portions before performing the mathematical operations . 3 ) according to the de morgan law ( a ∪ b )= a ∩ b ), the described operation can also be applied to the absorbing parts of the object structures resulting respectively for all set distances . instead of an and - operation , a logic or - operation results . in the above embodiments , compared to a projection system of conventional technology as described in the introductory part of the description , there is the inherent option of projecting an alternating light pattern across the projection distance without further mechanical means . as a specific case maintaining a light pattern across a defined distance range will result . if the optical analogon to this is considered ( depth of focus extension ), compared to classical systems , a drastic gain of system transmission and , hence , efficiency increase will result . the above embodiments provide these advantages or the mapping characteristic of generating different patterns on different geometries or projection distances without the necessity of a separate control or control circuit . thus , above embodiments allow optical imaging of a plurality of high - contrast light patterns at different projection distances or screen geometries . a specific case , which is also covered by the described examples , is the maintenance of a fixed light pattern across varying project distances or geometries . while no technical solution is known when generating alternating image content , the significant technical advantage of increasing the depth of focus is a drastic increase of the effective system transmission . for generating the described mapping characteristics , no mechanical changes of lenses or pupils are necessitated . merely the object structures are manipulated , in which the exact technical design has been described above . the restriction to the manipulation of image content allows the realization of simple , compact and robust protection systems . possible fields of application of the above embodiments for distance - dependent representation of different image contents and for extending the depth of focus are , for example , 3d measurement technology as well as structured illumination and information display . while some aspects have been described in the context of an apparatus , it is obvious that these aspects also represent a description of the respective method , such that a block or device from an apparatus can also be seen as a respective method step or as a feature of a method step . analogously , aspects described in the context of a method step or as a method step also represent a description of a corresponding block or detail or feature of a corresponding apparatus . some or all of the method steps may be executed by ( or using ) a hardware apparatus , like for example , a microprocessor , a programmable computer or an electronic circuit . in some embodiments , some or several of the most important method steps may be executed by such an apparatus . depending on certain implementation requirements , embodiments of the invention can be implemented in hardware or in software . the implementation can be performed using a digital storage medium , for example a floppy disk , a dvd , a blu - ray , a cd , a rom , a prom , an eprom , an eeprom or a flash memory , a hard drive or other magnetic or optical memory having electronically readable control signals stored thereon , which can cooperate or cooperate with a programmable computer system such that the respective method is performed . therefore , the digital storage medium may be computer readable . some embodiments according to the invention comprise a data carrier having electronically readable control signals , which are capable of cooperating with a programmable computer system , such that one of the methods described herein is performed . generally , embodiments of the present invention can be implemented as a computer program product with a program code , the program code being operative for performing one of the methods when the computer program product runs on a computer . the program code may for example be stored on a machine readable carrier . other embodiments comprise the computer program for performing one of the methods described herein , wherein the computer program is stored on a machine readable carrier . in other words , an embodiment of the inventive method is , therefore , a computer program having a program code for performing one of the methods described herein , when the computer program runs on a computer . a further embodiment of the inventive methods is , therefore , a data carrier ( or a digital storage medium , or a computer - readable medium ) comprising , recorded thereon , the computer program for performing one of the methods described herein . a further embodiment of the inventive method is , therefore , a data stream or a sequence of signals representing the computer program for performing one of the methods described herein . the data stream or the sequence of signals may for example be configured to be transferred via a data communication connection , for example via the internet . a further embodiment comprises a processing means , for example a computer , or a programmable logic device , configured to or adapted to perform one of the methods described herein . a further embodiment comprises a computer having installed thereon the computer program for performing one of the methods described herein . a further embodiment according to the invention comprises an apparatus or a system configured to transfer a computer program for performing one of the methods described herein to a receiver . the transmission can be electronical or optical . the receiver may , for example , be a computer , a mobile device , a memory device or the like . the apparatus or system may , for example , comprise a file server for transferring the computer program to the receiver . in some embodiments , a programmable logic device ( for example a field programmable gate array ) may be used to perform some or all of the functionalities of the methods described herein . in some embodiments , a field programmable gate array may cooperate with a microprocessor in order to perform one of the methods described herein . generally , in some embodiments , the methods are performed by any hardware apparatus . the same can be a universally usable hardware , such as a computer processor ( cpu ) or hardware specific for the method , such as an asic . while this invention has been described in terms of several advantageous embodiments , there are alterations , permutations , and equivalents which fall within the scope of this invention . it should also be noted that there are many alternative ways of implementing the methods and compositions of the present invention . it is therefore intended that the following appended claims be interpreted as including all such alterations , permutations , and equivalents as fall within the true spirit and scope of the present invention . marcel sieler , peter schreiber , peter dannberg , andreas bräuer , and andreas tünnermann , “ ultraslim fixed pattern projectors with inherent homogenization of illumination ,” appl . opt . 51 , 64 - 74 ( 2012 ).
| 6 |
fig1 a illustrates an embodiment of a network enabled alarm clock of the present invention , herein referred to as an alarm clock , displaying a time of day . an alarm clock 100 can comprise : a touch screen 102 ; a button 104 ; one or more speakers 106 ; one or more connective capabilities ( e . g . nonvolatile memory card reader , usb connector , or other connective capability ) 108 ; a power supply ( not shown ); and one or more receivers ( not shown ) to receive fm signals , am signals , television signals , cellular signals , 802 . 11 signals , bluetooth signals , or any other communications signals . the touch screen 102 can be used to display a time , a user interface , an image , a video , a webpage , multimedia content , or other images . the touch screen can also be used by a user to input commands to the user interface , and to manage the other functionalities of the network enabled alarm clock . the displayed time can be set using the touch screen . the time can also be automatically synchronized with another clock via a network or over the air broadcast . the button 104 can be used as what is traditionally referred to as a “ snooze ” button . similarly to a traditional snooze button , this button can turn off an alarm for a predefined amount of time . furthermore , the snooze button can be used for additional functionality based upon the number of times the snooze button is pressed in succession within a specified period of time ( e . g . within five seconds of the first time the button is pressed ), the length of each button pressed , or a combination of the number of times the button is pressed within a specified period of time and the relative length each time the button is held down . for instance , when an alarm turns on , the snooze button can be pressed once to turn off the alarm for a predefined amount of time ( e . g . 5 minutes ). if the snooze button is pressed twice within a predefined amount of time ( e . g . 5 seconds ), then the alarm may be turned off for a predefined amount of time ( e . g . 10 minutes ). if the snooze button is pressed three times within a predefined amount of time ( e . g . 5 seconds ), then the alarm may be turned off until the user turns it back on or a next alarm turns on . another example can take into account the amount of time the snooze button is pressed down . for instance , if the snooze button is pressed down for a predefined amount of time ( e . g . 5 seconds ), then the volume of the alarm can decrease by half . the longer the snooze button is held down , the more the volume of the alarm will be decreased . the volume can be decreased proportionally , exponentially , or in other factors in relation to the amount of time the snooze button is held down . it will be appreciated that the snooze button can be a multifunctional button that can be implemented in software or physically implemented in hardware . furthermore , the snooze button can also be used to scroll through various navigation menus of the network enabled alarm clock . the snooze button &# 39 ; s functionality is not exclusive to the alarm function of the alarm clock . for instance , the snooze button can be used to navigate a menu . with respect to a navigation menu of the user interface , the snooze button can be pressed to cycle through the various submenus and items . when a desired menu or item is reached , the snooze button can be pressed for a specified amount of time to select that menu or item . alternatively , a predefined number of taps of the snooze button can be used to select a specific desired menu or item . the alarm clock 100 can also have various connective capabilities 108 . an alarm clock &# 39 ; s connective capabilities may refer to the capability of the alarm clock to download content through a variety of technologies , such as through the internet via a wired broadband connection , a wireless broadband connection , a telephone connection , or a satellite connection , a multimedia card reader , a universal serial bus (“ usb ”) connection , and other types of connections . these connective capabilities may be physically integrated , in whole or in part , with the alarm clock or may be , in whole or in part , implemented in a physically separate unit that is connected to the alarm clock . in the preferred embodiments , a wi - fi connection or other wireless connection may be used . the alarm clock 100 can have various power sources to supply power to the alarm clock . the alarm clock may have a storage area to insert primary batteries and / or secondary batteries into the alarm clock . the alarm clock can also be powered via an external alternating current (“ a / c ”) power supply or an external direct current (“ dc ”) power supply . the alarm clock 100 may have one or more speakers physically integrated in the alarm clock to play sounds for alarms , radio broadcasts , television broadcasts , multimedia content , or other content . additionally , the alarm clock can connect to remote speakers through its various connective capabilities , or through a dedicated audio output connection . the alarm clock 100 can comprise of one or more receivers and one more transmitters , including a radio receiver for fm and am signals , a television receiver for analog and digital signals , an 802 . 11x receiver and transmitter ( e . g . 802 . 11a , b , g , and other standards which are based on 802 . 11 ), a bluetooth receiver and transmitter , and other signal receivers and transmitters . fig1 b illustrates a network enabled alarm clock of the present invention displaying a navigation menu used for managing the network enabled alarm clock . the alarm clock 100 can display a user interface (“ ui ”) for a user to manage the user device . this user interface can be a text based ui , a pictorial / icon based ui , or a combination of both ( i . e . text based and pictorial / icon based ui ). for instance , the ui can comprise of icons 106 and 107 , where those icons can display illustrations to symbolize the various items and menus that icon is linked with , including menus to manage a content manager , a personal information manager (“ pim ”) software , fm / am settings , video settings , network settings , alarm settings , sounds settings , image and audio settings , and other settings , menus , or managers . once the navigation menu is displayed , the user can use the touch screen on the alarm clock to select an icon by pressing the icon on the touch screen . from there , the submenus for that icon can be displayed . in particular , the content manager can manage the various content stored locally ( e . g . via a usb connection , a nonvolatile memory device , an internal storage device of the alarm clock , or other storage devices ). the content manager can be programmed to access various ip addresses to download content to be displayed on the alarm clock . the programming of the content manager can be performed locally using the alarm clock or can be performed remotely using a computer connected to the alarm clock . with respect to selecting content to download , the alarm clock can access any resource located on a network , preferably on the internet . for instance , a web feed ( e . g . rss feed , podcasts , and other web feed formats ) can be inputted into the alarm clock such that an alarm clock can subscribe to a web feed by storing the feed &# 39 ; s resource locater ( e . g . uri , url , ip address , or other location means ) in the alarm clock &# 39 ; s manager . the alarm clock can then regularly check the user &# 39 ; s subscribed feeds for new work / content and new publications . when new work or publications are found , it is downloaded to the alarm clock . the downloaded content can be displayed and / or played on the alarm clock at scheduled times . the alarm clock can be programmed to automatically display and play the feeds when new works are found , or it can periodically display the feeds on a user specified schedule . the alarm clock can also download images from one or more photo sharing sites via a network ( e . g . the internet ). the resource location and the login information can be inputted to the alarm clock , such that the software on the alarm clock can access the resource via the network . this information can include the following : the names and / or locations of the one or more photo sharing sites , such as the domain names or the internet protocol addresses of the one or more photo sharing sites , the associated user name and user password for each of the one or more photo sharing sites , and a selection of one or more photos from each of the one or more photo sharing sites to add to the selected content . examples of photo sharing sites are flickr , mac web gallery , atpic , kodak easy share gallery , photobucket , picasa , snapfish , and others photo sharing websites . one or more video sharing sites can be inputted in a similar manner for downloading content from those sites to the alarm clock . the names and / or locations of the one or more video sharing sites , such as the domain names or the ip addresses of the one or more video sharing sites , the associated user login and user password , if any , for the video sharing site , and one or more videos to add to the selected content , can be inputted to the alarm clock to access these sites . examples of video sharing sites are youtube , veoh , crunchyroll , and other video sharing sites . with respect to downloading news items , resource locations of the news items , such as the domain names or ip addresses , can be inputted by a user to download content . the locations may be for a specific news article or contain multiple articles which the alarm clock user can scroll through . weather information can be displayed on the alarm clock . an alarm clock user can select one or more geographic locations for which weather information is to be displayed . one or more geographic locations can be identified by zip code , mailing address , city and state , longitude and latitude , by a pointer to a map location , or any other means to identify geographic location to retrieve the associated weather for that location via a network . similarly one or more stock quotes can be selected for display on the alarm clock by inputting the associated company name , company stock symbol , or other identifier of the company for each of the selected stock quotes in the download manager . it will be appreciated that the alarm clock can download content ( such as music , video games , flash games , and other content ) via a network from a network storage device . once specified content has been downloaded , a user can specify when to display the downloaded content on the alarm clock by inputting a date and time for displaying of such content . alternatively , the alarm clock can have predefined settings to display the content . for instance , a broadcasted video can be downloaded , and then be displayed at a user specified time ( e . g . 10 p . m .) every night for a specified amount of time ( e . g . 1 hour ). therefore , this allows the user to set up a schedule to view a broadcasted video without having to remember to manually download it every night , and then play it on the alarm clock . the content manager can also be used to manage content stored locally on the alarm clock . for instance , the content manager can rename files , delete files , move files from one folder to another , and manage other aspects of the stored data on the local storage . in addition to the various components of an alarm clock , the alarm clock can comprise a web server , such that the web server can be programmed to automatically undertake certain actions . for instance , the web server can be programmed to download certain content every morning . the user can input personal information into the pim software to store on the alarm clock &# 39 ; s local storage . personal information can include personal notes / journals , address book , a tasks list , significant calendar dates ( e . g . birthdays , anniversaries , and appointments and meetings ), reminders , email archives , and other information . the personal information can be used to set up various alarms based on that personal information . for instance , for every inputted birthday , the alarm clock will display alerts at a predefined amount of time before the actual birthday . the alarm can also display information associated with that birthday such as whose birthday it is and what day the birthday is on . similarly , the user can setup up other alerts based on inputted information . the fm and am settings can also be set via the user interface . the touch screen can be used to set various fm and am stations in memory for future retrieval . the video settings can similarly be set up where the user can preset channels for later retrieval . video content can be provided to an alarm clock via over the air analog signals , over the air digital signals , cable signals , satellite signals , a slingbox , or other means for receiving video content . the network settings menu can be used to manage the various network connections to the alarm clock via wi - fi , bluetooth , or other connective means . the alarm settings can be used to set alarms at specified events with specified content . the specified events can be a user specified date and time or can be an event . events can be triggered by the content manager or the pim software . for instance , an alarm can be triggered when new content from a subscribed rss feed is retrieved , or if new images have been downloaded from a network . as already stated , the pim software can automatically generate alarms based upon personal information stored on the alarm clock . for instance , birthday information inputted into the pim software can be used to generate alerts for those birthdays . once an alarm is specified , the content to be displayed and / or played during the alarm can also be specified . the content can be retrieved from a local storage device , can be downloaded from a network , preferably the internet , or can be provided by the content manager . for instance , if an alarm is set to wake up a user , then instead of playing the radio or a beeping sound , the alarm clock can be specified to download and play a podcast that reports on the current traffic conditions . also , an alarm can also retrieve locally stored content . for instance , a user can set the alarm to play specific music ( e . g . hannah montana , jonas brothers , or other artists ) stored on the local storage . it will be appreciated that any user specified content can be used as the means of conveying an alarm to the user during a specified event . the alarm can also be used to communicate to other devices . for instance , the alarm can send information from the alarm to any devices that are connected to the alarm clock . the alarm clock can send a sms text message to a user &# 39 ; s cellular phone to alert the user of the alarm . the sound settings can be used to manage various speakers for the alarm clock . those speakers can be physically integrated into the alarm clock , or can be remote from the alarm clock and be driven by the alarm clock remotely , either by way of a wireless connection or a wired connection . for instance , an alarm clock can be in a parent &# 39 ; s room , and the speakers for an alarm can be set to speakers in the child &# 39 ; s room , 100 feet away . or alternatively , the speakers can be connected via a network and be located 1000 miles away . fig2 illustrates a system of the present invention of an alarm clock connected to various content providers via a network . the system can comprise an alarm clock 200 , a computer 202 , a user 204 , and one or more content providers via one or more servers 206 and 208 . the user 204 can remotely manage the alarm clock from the computer 202 . additionally , the alarm clock 200 can download content from the content providers 206 and 208 . the content providers 206 and 208 can include email servers , video providers , mp3 providers , and so forth . the alarm clock can also control other devices based on the alarm . fig3 illustrates a system of the present invention where a network enabled alarm clock is connected to various devices via a home network . the system comprises a multimedia enabled alarm clock 300 , a user 302 , a computer 304 , a home heating system 305 , a coffee machine 306 , a home surveillance system 308 , a sprinkler system 310 , and a lightning system 311 . the alarm clock &# 39 ; s alarm function can be used to turn on devices at specified dates and time . for instance , an alarm can be set to turn on the coffee machine 306 at 6 a . m ., such that a user can wake up to freshly brewed coffee . the home surveillance system 308 can have different surveillance modes based on the time of day . the homes lightening system 311 can also be set such that the specified lights are turned on during the evening hours and early morning hours , and automatically turned off during the day hours . a home sprinkler system 310 can be set to turn on at a specified time via the alarm clock . furthermore , the home heating system 305 can be controlled by the alarm clock 300 . the alarm clock 300 can set the temperature to a first predefined temperature during the day time , and a second predefined temperature during the night time to conserve energy ( or for any other purpose ). for instance , in the cold winter months , the heating system 305 may be set at 50 degrees during the day when the home is not occupied , and can be set at 68 degrees during the night when the occupants arrive home . in an embodiment of the present invention , an alarm clock having a snooze button and wireless wi - fi connection is disclosed . here , the programming of the alarm clock can be performed via a web server . the alarm clock may be programmed with specific rss feeds , podcasts , internet radio programs , traditional radio stations ( e . g ., digital , satellite , or am / fm ), video sites ( e . g . features of the day ), news programming , etc . up to a certain number of programs , where one set of programs may be programmed for the morning hours and a second set of programs may be programmed for the evening hours ( e . g . when going to bed ). thus , the user may enjoy time - depending information according to the time of the day . furthermore , in one implementation , the snooze button can be programmed such that a double tap ( i . e . tapping twice ) can scroll through the available modes ( e . g . alarm mode to the program - play mode to the select - play mode to the free - program mode to the normal mode , etc .). while in each mode , a single tap can be programmed to scroll through a pre - defined list . for example , in the alarm mode , when the alarm goes off , one tap will provide additional time for sleeping and a double tap will change it to the next mode ( e . g . the program - play mode ). the alarm mode will play programs depending on the time of the day . in this example , there can be a morning program ( user - scrollable through a pre - defined number of programs or auto - scroll and auto - play each program for a pre - defined amount of time ( e . g . 2 minutes ). in the program - play mode , the pre - programs can be scrolled through ( by a single tap ) and the programs can be listened . in the select - program mode , a long list of programs previously entered can be scrolled through , selected , and played . additionally , a select program can be moved to the alarm mode . in the free - program mode , a small keyboard can be provided on the touch screen where a browser can be directed to fetch web pages and content . in the normal mode , the clock is displayed . in this embodiment , there is only the touch screen , the snooze button , the case encasing the speaker , the circuit board , and the power supply — a minimal number of physical parts . this alarm clock , with portable power and durable ( and water - resistant ) casing , may be taken from the bedroom to the bathroom . other than being programmable by using a browser , this alarm clock may be programmed via the touch screen . while the present invention has been described with reference to certain preferred embodiments or methods , it is to be understood that the present invention is not limited to such specific embodiments or methods . rather , it is the inventor &# 39 ; s contention that the invention be understood and construed in its broadest meaning as reflected by the following claims . thus , these claims are to be understood as incorporating not only the preferred methods described herein but all those other and further alterations and modifications as would be apparent to those of ordinary skilled in the art .
| 6 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.