Datasets:
bio-datasets
/
bigbio-ner-merged

Dataset card Data Studio Files
xet
Community
answer
stringlengths
1
16.1k
id
stringlengths
7
56
instruction
stringlengths
106
72.6k
ner_tags
list
text
stringlengths
5
72.4k
tokens
list
types
list
N - methyl - D - aspartate receptors, fibronectin
17662248_task2
Sentence: Stimulation of N-methyl-D-aspartate receptors modulates Jurkat T cell growth and adhesion to fibronectin. Instructions: please extract entity words from the input sentence
[ "O", "O", "B-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "O" ]
Stimulation of N-methyl-D-aspartate receptors modulates Jurkat T cell growth and adhesion to fibronectin.
[ "Stimulation", "of", "N", "-", "methyl", "-", "D", "-", "aspartate", "receptors", "modulates", "Jurkat", "T", "cell", "growth", "and", "adhesion", "to", "fibronectin", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
Homoeopathie is an umlsterm, Bevoelkerung is an umlsterm, Behandlung is an umlsterm, Kopfschmerzen is an umlsterm, Therapie is an umlsterm, Migraene is an umlsterm, Kopfschmerzen is an umlsterm, Migraenestudie is an umlsterm, Kopfschmerzstudie is an umlsterm, Homoeopathie is an umlsterm, Therapie is an umlsterm, Praxis is an umlsterm
DerSchmerz.60100156.ger.abstr_task0
Sentence: Homoeopathie wird in der Bevoelkerung auch und gerade zur Behandlung von Kopfschmerzen immer populaerer . Im Gegensatz hierzu steht die mangelnde wissenschaftliche Durchdringung . Wir diskutieren 3 Studien , die zur Effektivitaet von homoeopathischer Therapie bei Migraene und Kopfschmerzen durchgefuehrt wurden : die italienische und die Londoner Migraenestudie und die Muenchener Kopfschmerzstudie . Waehrend die erste von geradezu sensationellen Heilungsraten berichtet , konnten die beiden anderen Studien diese Ergebnisse nicht replizieren . Weder die Londoner noch die Muenchener Studie fanden Hinweise fuer einen Unterschied zwischen Homoeopathie und Plazebotherapie . Allerdings koennen beachtenswerte klinische Erfolge auftreten , ueber deren Zustandekommen wir derzeit wenig wissen . Auch fehlen uns Daten darueber , wie effektiv homoeopathische Therapie in der normalen , unkontrollierten Praxis ist . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O" ]
Homoeopathie wird in der Bevoelkerung auch und gerade zur Behandlung von Kopfschmerzen immer populaerer . Im Gegensatz hierzu steht die mangelnde wissenschaftliche Durchdringung . Wir diskutieren 3 Studien , die zur Effektivitaet von homoeopathischer Therapie bei Migraene und Kopfschmerzen durchgefuehrt wurden : die italienische und die Londoner Migraenestudie und die Muenchener Kopfschmerzstudie . Waehrend die erste von geradezu sensationellen Heilungsraten berichtet , konnten die beiden anderen Studien diese Ergebnisse nicht replizieren . Weder die Londoner noch die Muenchener Studie fanden Hinweise fuer einen Unterschied zwischen Homoeopathie und Plazebotherapie . Allerdings koennen beachtenswerte klinische Erfolge auftreten , ueber deren Zustandekommen wir derzeit wenig wissen . Auch fehlen uns Daten darueber , wie effektiv homoeopathische Therapie in der normalen , unkontrollierten Praxis ist .
[ "Homoeopathie", "wird", "in", "der", "Bevoelkerung", "auch", "und", "gerade", "zur", "Behandlung", "von", "Kopfschmerzen", "immer", "populaerer", ".", "Im", "Gegensatz", "hierzu", "steht", "die", "mangelnde", "wissenschaftliche", "Durchdringung", ".", "Wir", "diskutieren", "3", "Studien", ",", "die", "zur", "Effektivitaet", "von", "homoeopathischer", "Therapie", "bei", "Migraene", "und", "Kopfschmerzen", "durchgefuehrt", "wurden", ":", "die", "italienische", "und", "die", "Londoner", "Migraenestudie", "und", "die", "Muenchener", "Kopfschmerzstudie", ".", "Waehrend", "die", "erste", "von", "geradezu", "sensationellen", "Heilungsraten", "berichtet", ",", "konnten", "die", "beiden", "anderen", "Studien", "diese", "Ergebnisse", "nicht", "replizieren", ".", "Weder", "die", "Londoner", "noch", "die", "Muenchener", "Studie", "fanden", "Hinweise", "fuer", "einen", "Unterschied", "zwischen", "Homoeopathie", "und", "Plazebotherapie", ".", "Allerdings", "koennen", "beachtenswerte", "klinische", "Erfolge", "auftreten", ",", "ueber", "deren", "Zustandekommen", "wir", "derzeit", "wenig", "wissen", ".", "Auch", "fehlen", "uns", "Daten", "darueber", ",", "wie", "effektiv", "homoeopathische", "Therapie", "in", "der", "normalen", ",", "unkontrollierten", "Praxis", "ist", "." ]
[ "umlsterm" ]
Homoeopathie is an umlsterm, Bevoelkerung is an umlsterm, Behandlung is an umlsterm, Kopfschmerzen is an umlsterm, Therapie is an umlsterm, Migraene is an umlsterm, Kopfschmerzen is an umlsterm, Migraenestudie is an umlsterm, Kopfschmerzstudie is an umlsterm, Homoeopathie is an umlsterm, Therapie is an umlsterm, Praxis is an umlsterm
DerSchmerz.60100156.ger.abstr_task1
Sentence: Homoeopathie wird in der Bevoelkerung auch und gerade zur Behandlung von Kopfschmerzen immer populaerer . Im Gegensatz hierzu steht die mangelnde wissenschaftliche Durchdringung . Wir diskutieren 3 Studien , die zur Effektivitaet von homoeopathischer Therapie bei Migraene und Kopfschmerzen durchgefuehrt wurden : die italienische und die Londoner Migraenestudie und die Muenchener Kopfschmerzstudie . Waehrend die erste von geradezu sensationellen Heilungsraten berichtet , konnten die beiden anderen Studien diese Ergebnisse nicht replizieren . Weder die Londoner noch die Muenchener Studie fanden Hinweise fuer einen Unterschied zwischen Homoeopathie und Plazebotherapie . Allerdings koennen beachtenswerte klinische Erfolge auftreten , ueber deren Zustandekommen wir derzeit wenig wissen . Auch fehlen uns Daten darueber , wie effektiv homoeopathische Therapie in der normalen , unkontrollierten Praxis ist . Instructions: please typing these entity words according to sentence: Homoeopathie, Bevoelkerung, Behandlung, Kopfschmerzen, Therapie, Migraene, Kopfschmerzen, Migraenestudie, Kopfschmerzstudie, Homoeopathie, Therapie, Praxis Options: umlsterm
[ "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O" ]
Homoeopathie wird in der Bevoelkerung auch und gerade zur Behandlung von Kopfschmerzen immer populaerer . Im Gegensatz hierzu steht die mangelnde wissenschaftliche Durchdringung . Wir diskutieren 3 Studien , die zur Effektivitaet von homoeopathischer Therapie bei Migraene und Kopfschmerzen durchgefuehrt wurden : die italienische und die Londoner Migraenestudie und die Muenchener Kopfschmerzstudie . Waehrend die erste von geradezu sensationellen Heilungsraten berichtet , konnten die beiden anderen Studien diese Ergebnisse nicht replizieren . Weder die Londoner noch die Muenchener Studie fanden Hinweise fuer einen Unterschied zwischen Homoeopathie und Plazebotherapie . Allerdings koennen beachtenswerte klinische Erfolge auftreten , ueber deren Zustandekommen wir derzeit wenig wissen . Auch fehlen uns Daten darueber , wie effektiv homoeopathische Therapie in der normalen , unkontrollierten Praxis ist .
[ "Homoeopathie", "wird", "in", "der", "Bevoelkerung", "auch", "und", "gerade", "zur", "Behandlung", "von", "Kopfschmerzen", "immer", "populaerer", ".", "Im", "Gegensatz", "hierzu", "steht", "die", "mangelnde", "wissenschaftliche", "Durchdringung", ".", "Wir", "diskutieren", "3", "Studien", ",", "die", "zur", "Effektivitaet", "von", "homoeopathischer", "Therapie", "bei", "Migraene", "und", "Kopfschmerzen", "durchgefuehrt", "wurden", ":", "die", "italienische", "und", "die", "Londoner", "Migraenestudie", "und", "die", "Muenchener", "Kopfschmerzstudie", ".", "Waehrend", "die", "erste", "von", "geradezu", "sensationellen", "Heilungsraten", "berichtet", ",", "konnten", "die", "beiden", "anderen", "Studien", "diese", "Ergebnisse", "nicht", "replizieren", ".", "Weder", "die", "Londoner", "noch", "die", "Muenchener", "Studie", "fanden", "Hinweise", "fuer", "einen", "Unterschied", "zwischen", "Homoeopathie", "und", "Plazebotherapie", ".", "Allerdings", "koennen", "beachtenswerte", "klinische", "Erfolge", "auftreten", ",", "ueber", "deren", "Zustandekommen", "wir", "derzeit", "wenig", "wissen", ".", "Auch", "fehlen", "uns", "Daten", "darueber", ",", "wie", "effektiv", "homoeopathische", "Therapie", "in", "der", "normalen", ",", "unkontrollierten", "Praxis", "ist", "." ]
[ "umlsterm" ]
Homoeopathie, Bevoelkerung, Behandlung, Kopfschmerzen, Therapie, Migraene, Kopfschmerzen, Migraenestudie, Kopfschmerzstudie, Homoeopathie, Therapie, Praxis
DerSchmerz.60100156.ger.abstr_task2
Sentence: Homoeopathie wird in der Bevoelkerung auch und gerade zur Behandlung von Kopfschmerzen immer populaerer . Im Gegensatz hierzu steht die mangelnde wissenschaftliche Durchdringung . Wir diskutieren 3 Studien , die zur Effektivitaet von homoeopathischer Therapie bei Migraene und Kopfschmerzen durchgefuehrt wurden : die italienische und die Londoner Migraenestudie und die Muenchener Kopfschmerzstudie . Waehrend die erste von geradezu sensationellen Heilungsraten berichtet , konnten die beiden anderen Studien diese Ergebnisse nicht replizieren . Weder die Londoner noch die Muenchener Studie fanden Hinweise fuer einen Unterschied zwischen Homoeopathie und Plazebotherapie . Allerdings koennen beachtenswerte klinische Erfolge auftreten , ueber deren Zustandekommen wir derzeit wenig wissen . Auch fehlen uns Daten darueber , wie effektiv homoeopathische Therapie in der normalen , unkontrollierten Praxis ist . Instructions: please extract entity words from the input sentence
[ "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O" ]
Homoeopathie wird in der Bevoelkerung auch und gerade zur Behandlung von Kopfschmerzen immer populaerer . Im Gegensatz hierzu steht die mangelnde wissenschaftliche Durchdringung . Wir diskutieren 3 Studien , die zur Effektivitaet von homoeopathischer Therapie bei Migraene und Kopfschmerzen durchgefuehrt wurden : die italienische und die Londoner Migraenestudie und die Muenchener Kopfschmerzstudie . Waehrend die erste von geradezu sensationellen Heilungsraten berichtet , konnten die beiden anderen Studien diese Ergebnisse nicht replizieren . Weder die Londoner noch die Muenchener Studie fanden Hinweise fuer einen Unterschied zwischen Homoeopathie und Plazebotherapie . Allerdings koennen beachtenswerte klinische Erfolge auftreten , ueber deren Zustandekommen wir derzeit wenig wissen . Auch fehlen uns Daten darueber , wie effektiv homoeopathische Therapie in der normalen , unkontrollierten Praxis ist .
[ "Homoeopathie", "wird", "in", "der", "Bevoelkerung", "auch", "und", "gerade", "zur", "Behandlung", "von", "Kopfschmerzen", "immer", "populaerer", ".", "Im", "Gegensatz", "hierzu", "steht", "die", "mangelnde", "wissenschaftliche", "Durchdringung", ".", "Wir", "diskutieren", "3", "Studien", ",", "die", "zur", "Effektivitaet", "von", "homoeopathischer", "Therapie", "bei", "Migraene", "und", "Kopfschmerzen", "durchgefuehrt", "wurden", ":", "die", "italienische", "und", "die", "Londoner", "Migraenestudie", "und", "die", "Muenchener", "Kopfschmerzstudie", ".", "Waehrend", "die", "erste", "von", "geradezu", "sensationellen", "Heilungsraten", "berichtet", ",", "konnten", "die", "beiden", "anderen", "Studien", "diese", "Ergebnisse", "nicht", "replizieren", ".", "Weder", "die", "Londoner", "noch", "die", "Muenchener", "Studie", "fanden", "Hinweise", "fuer", "einen", "Unterschied", "zwischen", "Homoeopathie", "und", "Plazebotherapie", ".", "Allerdings", "koennen", "beachtenswerte", "klinische", "Erfolge", "auftreten", ",", "ueber", "deren", "Zustandekommen", "wir", "derzeit", "wenig", "wissen", ".", "Auch", "fehlen", "uns", "Daten", "darueber", ",", "wie", "effektiv", "homoeopathische", "Therapie", "in", "der", "normalen", ",", "unkontrollierten", "Praxis", "ist", "." ]
[ "umlsterm" ]
actin is a protein, spinophilin is a protein, actin is a protein
1.0alpha7.train.1269_task0
Sentence: These findings suggest that the actin binding region of spinophilin contains at least two distinct recognition sites for actin. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: protein
[ "O", "O", "O", "O", "O", "O", "B-protein", "O", "O", "O", "O", "B-protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein", "O" ]
These findings suggest that the actin binding region of spinophilin contains at least two distinct recognition sites for actin.
[ "These", "findings", "suggest", "that", "the", " ", "actin", "binding", "region", "of", " ", "spinophilin", "contains", "at", "least", "two", "distinct", "recognition", "sites", "for", " ", "actin", "." ]
[ "protein" ]
actin is a protein, spinophilin is a protein, actin is a protein
1.0alpha7.train.1269_task1
Sentence: These findings suggest that the actin binding region of spinophilin contains at least two distinct recognition sites for actin. Instructions: please typing these entity words according to sentence: actin, spinophilin, actin Options: protein
[ "O", "O", "O", "O", "O", "O", "B-protein", "O", "O", "O", "O", "B-protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein", "O" ]
These findings suggest that the actin binding region of spinophilin contains at least two distinct recognition sites for actin.
[ "These", "findings", "suggest", "that", "the", " ", "actin", "binding", "region", "of", " ", "spinophilin", "contains", "at", "least", "two", "distinct", "recognition", "sites", "for", " ", "actin", "." ]
[ "protein" ]
actin, spinophilin, actin
1.0alpha7.train.1269_task2
Sentence: These findings suggest that the actin binding region of spinophilin contains at least two distinct recognition sites for actin. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "B-protein", "O", "O", "O", "O", "B-protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein", "O" ]
These findings suggest that the actin binding region of spinophilin contains at least two distinct recognition sites for actin.
[ "These", "findings", "suggest", "that", "the", " ", "actin", "binding", "region", "of", " ", "spinophilin", "contains", "at", "least", "two", "distinct", "recognition", "sites", "for", " ", "actin", "." ]
[ "protein" ]
cysteinyl leukotriene is a CHEMICAL
17632548_task0
Sentence: Crystal structure of a human membrane protein involved in cysteinyl leukotriene biosynthesis. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: CHEMICAL
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "O", "O" ]
Crystal structure of a human membrane protein involved in cysteinyl leukotriene biosynthesis.
[ "Crystal", "structure", "of", "a", "human", "membrane", "protein", "involved", "in", "cysteinyl", "leukotriene", "biosynthesis", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
cysteinyl leukotriene is a CHEMICAL
17632548_task1
Sentence: Crystal structure of a human membrane protein involved in cysteinyl leukotriene biosynthesis. Instructions: please typing these entity words according to sentence: cysteinyl leukotriene Options: CHEMICAL
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "O", "O" ]
Crystal structure of a human membrane protein involved in cysteinyl leukotriene biosynthesis.
[ "Crystal", "structure", "of", "a", "human", "membrane", "protein", "involved", "in", "cysteinyl", "leukotriene", "biosynthesis", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
cysteinyl leukotriene
17632548_task2
Sentence: Crystal structure of a human membrane protein involved in cysteinyl leukotriene biosynthesis. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "O", "O" ]
Crystal structure of a human membrane protein involved in cysteinyl leukotriene biosynthesis.
[ "Crystal", "structure", "of", "a", "human", "membrane", "protein", "involved", "in", "cysteinyl", "leukotriene", "biosynthesis", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
Mediterranean diet is a Intervention_Other, high dietary acid load is a Intervention_Other, mixed nuts is a Intervention_Other, effect is a Outcome_Physical, bone metabolism is a Outcome_Physical, elderly is a Participant_Age, Two hundred thirty - eight is a Participant_Sample-size, men is a Participant_Sex, women is a Participant_Sex, 60 to 80 is a Participant_Age, cardiovascular disease is a Participant_Condition, recommended low - fat diet ( control diet group ) is a Intervention_Control, Mediterranean diet supplemented with virgin olive oil is a Intervention_Other, bone formation and resorption markers and bone mass measured is a Outcome_Physical, anthropometric , bone densitometry , and biochemical variables is a Outcome_Physical, Dietary potential renal acid load ( PRAL ) is a Outcome_Physical, daily net endogenous acid production ( NEAP ) is a Outcome_Physical, Mediterranean diet with mixed nuts is a Intervention_Other, Mediterranean diet with nuts is a Intervention_Other, parathyroid hormone ( PTH ) levels is a Outcome_Physical, urine free deoxypyridoxine : creatinine ratio is a Outcome_Physical, Mediterranean dietary pattern is a Intervention_Educational, bone metabolism biomarkers is a Outcome_Physical, PTH levels is a Outcome_Physical, Mediterranean diet without mixed nuts is a Intervention_Other
42203_task0
Sentence: Mediterranean diet and high dietary acid load associated with mixed nuts : effect on bone metabolism in elderly subjects . OBJECTIVES To analyze the effect of differing diet on the acid load content on bone metabolism . DESIGN Multicentric , randomized , single-blind , parallel-group clinical trial . SETTING Outpatient clinics . PARTICIPANTS Two hundred thirty-eight elderly men and women aged 60 to 80 at high risk for cardiovascular disease were randomly assigned to three interventional groups : a recommended low-fat diet ( control diet group ) , a Mediterranean diet supplemented with virgin olive oil , or a Mediterranean diet supplemented with mixed nuts . MEASUREMENTS Main outcomes were 12-month changes from baseline in bone formation and resorption markers and bone mass measured according to quantitative ultrasound scanning . RESULTS The baseline data on the anthropometric , bone densitometry , and biochemical variables did not differ between the three groups . Dietary potential renal acid load ( PRAL ) and daily net endogenous acid production ( NEAP ) at baseline did not differ between groups . After intervention , subjects allocated to the Mediterranean diet with mixed nuts had a significant increase of PRAL and NEAP . In comparison , subjects in the Mediterranean diet with nuts group had higher parathyroid hormone ( PTH ) levels ( 2.63 , 95 % confidence interval ( CI ) =-1.01-6.35 , P=.02 ) and a nonsignificantly higher ( 0.31 , 95 % CI=-0.13-0.74 , P=.14 ) urine free deoxypyridoxine : creatinine ratio , a marker of bone resorption , than the control group and the Mediterranean diet with virgin olive oil group . CONCLUSION A Mediterranean dietary pattern associated with a high dietary acid load derived from consumption of mixed nuts does not seem to have a much greater effect on bone metabolism biomarkers , with the exception of PTH levels , than a Mediterranean diet without mixed nuts or a control diet in elderly subjects . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Participant_Sex, Participant_Condition, Intervention_Control, Intervention_Educational, Intervention_Other, Participant_Age, Outcome_Physical, Participant_Sample-size
[ "B-Intervention_Other", "I-Intervention_Other", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "O", "B-Outcome_Physical", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "B-Participant_Age", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "O", "B-Participant_Sex", "O", "B-Participant_Sex", "O", "B-Participant_Age", "I-Participant_Age", "I-Participant_Age", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "O", "O", "O", "O", "O", "O" ]
Mediterranean diet and high dietary acid load associated with mixed nuts : effect on bone metabolism in elderly subjects . OBJECTIVES To analyze the effect of differing diet on the acid load content on bone metabolism . DESIGN Multicentric , randomized , single-blind , parallel-group clinical trial . SETTING Outpatient clinics . PARTICIPANTS Two hundred thirty-eight elderly men and women aged 60 to 80 at high risk for cardiovascular disease were randomly assigned to three interventional groups : a recommended low-fat diet ( control diet group ) , a Mediterranean diet supplemented with virgin olive oil , or a Mediterranean diet supplemented with mixed nuts . MEASUREMENTS Main outcomes were 12-month changes from baseline in bone formation and resorption markers and bone mass measured according to quantitative ultrasound scanning . RESULTS The baseline data on the anthropometric , bone densitometry , and biochemical variables did not differ between the three groups . Dietary potential renal acid load ( PRAL ) and daily net endogenous acid production ( NEAP ) at baseline did not differ between groups . After intervention , subjects allocated to the Mediterranean diet with mixed nuts had a significant increase of PRAL and NEAP . In comparison , subjects in the Mediterranean diet with nuts group had higher parathyroid hormone ( PTH ) levels ( 2.63 , 95 % confidence interval ( CI ) =-1.01-6.35 , P=.02 ) and a nonsignificantly higher ( 0.31 , 95 % CI=-0.13-0.74 , P=.14 ) urine free deoxypyridoxine : creatinine ratio , a marker of bone resorption , than the control group and the Mediterranean diet with virgin olive oil group . CONCLUSION A Mediterranean dietary pattern associated with a high dietary acid load derived from consumption of mixed nuts does not seem to have a much greater effect on bone metabolism biomarkers , with the exception of PTH levels , than a Mediterranean diet without mixed nuts or a control diet in elderly subjects .
[ "Mediterranean", "diet", "and", "high", "dietary", "acid", "load", "associated", "with", "mixed", "nuts", ":", "effect", "on", "bone", "metabolism", "in", "elderly", "subjects", ".", "OBJECTIVES", "To", "analyze", "the", "effect", "of", "differing", "diet", "on", "the", "acid", "load", "content", "on", "bone", "metabolism", ".", "DESIGN", "Multicentric", ",", "randomized", ",", "single", "-", "blind", ",", "parallel", "-", "group", "clinical", "trial", ".", "SETTING", "Outpatient", "clinics", ".", "PARTICIPANTS", "Two", "hundred", "thirty", "-", "eight", "elderly", "men", "and", "women", "aged", "60", "to", "80", "at", "high", "risk", "for", "cardiovascular", "disease", "were", "randomly", "assigned", "to", "three", "interventional", "groups", ":", "a", "recommended", "low", "-", "fat", "diet", "(", "control", "diet", "group", ")", ",", "a", "Mediterranean", "diet", "supplemented", "with", "virgin", "olive", "oil", ",", "or", "a", "Mediterranean", "diet", "supplemented", "with", "mixed", "nuts", ".", "MEASUREMENTS", "Main", "outcomes", "were", "12-month", "changes", "from", "baseline", "in", "bone", "formation", "and", "resorption", "markers", "and", "bone", "mass", "measured", "according", "to", "quantitative", "ultrasound", "scanning", ".", "RESULTS", "The", "baseline", "data", "on", "the", "anthropometric", ",", "bone", "densitometry", ",", "and", "biochemical", "variables", "did", "not", "differ", "between", "the", "three", "groups", ".", "Dietary", "potential", "renal", "acid", "load", "(", "PRAL", ")", "and", "daily", "net", "endogenous", "acid", "production", "(", "NEAP", ")", "at", "baseline", "did", "not", "differ", "between", "groups", ".", "After", "intervention", ",", "subjects", "allocated", "to", "the", "Mediterranean", "diet", "with", "mixed", "nuts", "had", "a", "significant", "increase", "of", "PRAL", "and", "NEAP", ".", "In", "comparison", ",", "subjects", "in", "the", "Mediterranean", "diet", "with", "nuts", "group", "had", "higher", "parathyroid", "hormone", "(", "PTH", ")", "levels", "(", "2.63", ",", "95", "%", "confidence", "interval", "(", "CI", ")", "=", "-1.01", "-", "6.35", ",", "P=.02", ")", "and", "a", "nonsignificantly", "higher", "(", "0.31", ",", "95", "%", "CI=-0.13", "-", "0.74", ",", "P=.14", ")", "urine", "free", "deoxypyridoxine", ":", "creatinine", "ratio", ",", "a", "marker", "of", "bone", "resorption", ",", "than", "the", "control", "group", "and", "the", "Mediterranean", "diet", "with", "virgin", "olive", "oil", "group", ".", "CONCLUSION", "A", "Mediterranean", "dietary", "pattern", "associated", "with", "a", "high", "dietary", "acid", "load", "derived", "from", "consumption", "of", "mixed", "nuts", "does", "not", "seem", "to", "have", "a", "much", "greater", "effect", "on", "bone", "metabolism", "biomarkers", ",", "with", "the", "exception", "of", "PTH", "levels", ",", "than", "a", "Mediterranean", "diet", "without", "mixed", "nuts", "or", "a", "control", "diet", "in", "elderly", "subjects", "." ]
[ "Outcome_Physical", "Intervention_Other", "Intervention_Control", "Intervention_Educational", "Participant_Sample-size", "Participant_Condition", "Participant_Age", "Participant_Sex" ]
Mediterranean diet is a Intervention_Other, high dietary acid load is a Intervention_Other, mixed nuts is a Intervention_Other, effect is a Outcome_Physical, bone metabolism is a Outcome_Physical, elderly is a Participant_Age, Two hundred thirty - eight is a Participant_Sample-size, men is a Participant_Sex, women is a Participant_Sex, 60 to 80 is a Participant_Age, cardiovascular disease is a Participant_Condition, recommended low - fat diet ( control diet group ) is a Intervention_Control, Mediterranean diet supplemented with virgin olive oil is a Intervention_Other, bone formation and resorption markers and bone mass measured is a Outcome_Physical, anthropometric , bone densitometry , and biochemical variables is a Outcome_Physical, Dietary potential renal acid load ( PRAL ) is a Outcome_Physical, daily net endogenous acid production ( NEAP ) is a Outcome_Physical, Mediterranean diet with mixed nuts is a Intervention_Other, Mediterranean diet with nuts is a Intervention_Other, parathyroid hormone ( PTH ) levels is a Outcome_Physical, urine free deoxypyridoxine : creatinine ratio is a Outcome_Physical, Mediterranean dietary pattern is a Intervention_Educational, bone metabolism biomarkers is a Outcome_Physical, PTH levels is a Outcome_Physical, Mediterranean diet without mixed nuts is a Intervention_Other
42203_task1
Sentence: Mediterranean diet and high dietary acid load associated with mixed nuts : effect on bone metabolism in elderly subjects . OBJECTIVES To analyze the effect of differing diet on the acid load content on bone metabolism . DESIGN Multicentric , randomized , single-blind , parallel-group clinical trial . SETTING Outpatient clinics . PARTICIPANTS Two hundred thirty-eight elderly men and women aged 60 to 80 at high risk for cardiovascular disease were randomly assigned to three interventional groups : a recommended low-fat diet ( control diet group ) , a Mediterranean diet supplemented with virgin olive oil , or a Mediterranean diet supplemented with mixed nuts . MEASUREMENTS Main outcomes were 12-month changes from baseline in bone formation and resorption markers and bone mass measured according to quantitative ultrasound scanning . RESULTS The baseline data on the anthropometric , bone densitometry , and biochemical variables did not differ between the three groups . Dietary potential renal acid load ( PRAL ) and daily net endogenous acid production ( NEAP ) at baseline did not differ between groups . After intervention , subjects allocated to the Mediterranean diet with mixed nuts had a significant increase of PRAL and NEAP . In comparison , subjects in the Mediterranean diet with nuts group had higher parathyroid hormone ( PTH ) levels ( 2.63 , 95 % confidence interval ( CI ) =-1.01-6.35 , P=.02 ) and a nonsignificantly higher ( 0.31 , 95 % CI=-0.13-0.74 , P=.14 ) urine free deoxypyridoxine : creatinine ratio , a marker of bone resorption , than the control group and the Mediterranean diet with virgin olive oil group . CONCLUSION A Mediterranean dietary pattern associated with a high dietary acid load derived from consumption of mixed nuts does not seem to have a much greater effect on bone metabolism biomarkers , with the exception of PTH levels , than a Mediterranean diet without mixed nuts or a control diet in elderly subjects . Instructions: please typing these entity words according to sentence: Mediterranean diet, high dietary acid load, mixed nuts, effect, bone metabolism, elderly, Two hundred thirty - eight, men, women, 60 to 80, cardiovascular disease, recommended low - fat diet ( control diet group ), Mediterranean diet supplemented with virgin olive oil, bone formation and resorption markers and bone mass measured, anthropometric , bone densitometry , and biochemical variables, Dietary potential renal acid load ( PRAL ), daily net endogenous acid production ( NEAP ), Mediterranean diet with mixed nuts, Mediterranean diet with nuts, parathyroid hormone ( PTH ) levels, urine free deoxypyridoxine : creatinine ratio, Mediterranean dietary pattern, bone metabolism biomarkers, PTH levels, Mediterranean diet without mixed nuts Options: Participant_Sex, Participant_Condition, Intervention_Control, Intervention_Educational, Intervention_Other, Participant_Age, Outcome_Physical, Participant_Sample-size
[ "B-Intervention_Other", "I-Intervention_Other", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "O", "B-Outcome_Physical", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "B-Participant_Age", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "O", "B-Participant_Sex", "O", "B-Participant_Sex", "O", "B-Participant_Age", "I-Participant_Age", "I-Participant_Age", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "O", "O", "O", "O", "O", "O" ]
Mediterranean diet and high dietary acid load associated with mixed nuts : effect on bone metabolism in elderly subjects . OBJECTIVES To analyze the effect of differing diet on the acid load content on bone metabolism . DESIGN Multicentric , randomized , single-blind , parallel-group clinical trial . SETTING Outpatient clinics . PARTICIPANTS Two hundred thirty-eight elderly men and women aged 60 to 80 at high risk for cardiovascular disease were randomly assigned to three interventional groups : a recommended low-fat diet ( control diet group ) , a Mediterranean diet supplemented with virgin olive oil , or a Mediterranean diet supplemented with mixed nuts . MEASUREMENTS Main outcomes were 12-month changes from baseline in bone formation and resorption markers and bone mass measured according to quantitative ultrasound scanning . RESULTS The baseline data on the anthropometric , bone densitometry , and biochemical variables did not differ between the three groups . Dietary potential renal acid load ( PRAL ) and daily net endogenous acid production ( NEAP ) at baseline did not differ between groups . After intervention , subjects allocated to the Mediterranean diet with mixed nuts had a significant increase of PRAL and NEAP . In comparison , subjects in the Mediterranean diet with nuts group had higher parathyroid hormone ( PTH ) levels ( 2.63 , 95 % confidence interval ( CI ) =-1.01-6.35 , P=.02 ) and a nonsignificantly higher ( 0.31 , 95 % CI=-0.13-0.74 , P=.14 ) urine free deoxypyridoxine : creatinine ratio , a marker of bone resorption , than the control group and the Mediterranean diet with virgin olive oil group . CONCLUSION A Mediterranean dietary pattern associated with a high dietary acid load derived from consumption of mixed nuts does not seem to have a much greater effect on bone metabolism biomarkers , with the exception of PTH levels , than a Mediterranean diet without mixed nuts or a control diet in elderly subjects .
[ "Mediterranean", "diet", "and", "high", "dietary", "acid", "load", "associated", "with", "mixed", "nuts", ":", "effect", "on", "bone", "metabolism", "in", "elderly", "subjects", ".", "OBJECTIVES", "To", "analyze", "the", "effect", "of", "differing", "diet", "on", "the", "acid", "load", "content", "on", "bone", "metabolism", ".", "DESIGN", "Multicentric", ",", "randomized", ",", "single", "-", "blind", ",", "parallel", "-", "group", "clinical", "trial", ".", "SETTING", "Outpatient", "clinics", ".", "PARTICIPANTS", "Two", "hundred", "thirty", "-", "eight", "elderly", "men", "and", "women", "aged", "60", "to", "80", "at", "high", "risk", "for", "cardiovascular", "disease", "were", "randomly", "assigned", "to", "three", "interventional", "groups", ":", "a", "recommended", "low", "-", "fat", "diet", "(", "control", "diet", "group", ")", ",", "a", "Mediterranean", "diet", "supplemented", "with", "virgin", "olive", "oil", ",", "or", "a", "Mediterranean", "diet", "supplemented", "with", "mixed", "nuts", ".", "MEASUREMENTS", "Main", "outcomes", "were", "12-month", "changes", "from", "baseline", "in", "bone", "formation", "and", "resorption", "markers", "and", "bone", "mass", "measured", "according", "to", "quantitative", "ultrasound", "scanning", ".", "RESULTS", "The", "baseline", "data", "on", "the", "anthropometric", ",", "bone", "densitometry", ",", "and", "biochemical", "variables", "did", "not", "differ", "between", "the", "three", "groups", ".", "Dietary", "potential", "renal", "acid", "load", "(", "PRAL", ")", "and", "daily", "net", "endogenous", "acid", "production", "(", "NEAP", ")", "at", "baseline", "did", "not", "differ", "between", "groups", ".", "After", "intervention", ",", "subjects", "allocated", "to", "the", "Mediterranean", "diet", "with", "mixed", "nuts", "had", "a", "significant", "increase", "of", "PRAL", "and", "NEAP", ".", "In", "comparison", ",", "subjects", "in", "the", "Mediterranean", "diet", "with", "nuts", "group", "had", "higher", "parathyroid", "hormone", "(", "PTH", ")", "levels", "(", "2.63", ",", "95", "%", "confidence", "interval", "(", "CI", ")", "=", "-1.01", "-", "6.35", ",", "P=.02", ")", "and", "a", "nonsignificantly", "higher", "(", "0.31", ",", "95", "%", "CI=-0.13", "-", "0.74", ",", "P=.14", ")", "urine", "free", "deoxypyridoxine", ":", "creatinine", "ratio", ",", "a", "marker", "of", "bone", "resorption", ",", "than", "the", "control", "group", "and", "the", "Mediterranean", "diet", "with", "virgin", "olive", "oil", "group", ".", "CONCLUSION", "A", "Mediterranean", "dietary", "pattern", "associated", "with", "a", "high", "dietary", "acid", "load", "derived", "from", "consumption", "of", "mixed", "nuts", "does", "not", "seem", "to", "have", "a", "much", "greater", "effect", "on", "bone", "metabolism", "biomarkers", ",", "with", "the", "exception", "of", "PTH", "levels", ",", "than", "a", "Mediterranean", "diet", "without", "mixed", "nuts", "or", "a", "control", "diet", "in", "elderly", "subjects", "." ]
[ "Outcome_Physical", "Intervention_Other", "Intervention_Control", "Intervention_Educational", "Participant_Sample-size", "Participant_Condition", "Participant_Age", "Participant_Sex" ]
Mediterranean diet, high dietary acid load, mixed nuts, effect, bone metabolism, elderly, Two hundred thirty - eight, men, women, 60 to 80, cardiovascular disease, recommended low - fat diet ( control diet group ), Mediterranean diet supplemented with virgin olive oil, bone formation and resorption markers and bone mass measured, anthropometric , bone densitometry , and biochemical variables, Dietary potential renal acid load ( PRAL ), daily net endogenous acid production ( NEAP ), Mediterranean diet with mixed nuts, Mediterranean diet with nuts, parathyroid hormone ( PTH ) levels, urine free deoxypyridoxine : creatinine ratio, Mediterranean dietary pattern, bone metabolism biomarkers, PTH levels, Mediterranean diet without mixed nuts
42203_task2
Sentence: Mediterranean diet and high dietary acid load associated with mixed nuts : effect on bone metabolism in elderly subjects . OBJECTIVES To analyze the effect of differing diet on the acid load content on bone metabolism . DESIGN Multicentric , randomized , single-blind , parallel-group clinical trial . SETTING Outpatient clinics . PARTICIPANTS Two hundred thirty-eight elderly men and women aged 60 to 80 at high risk for cardiovascular disease were randomly assigned to three interventional groups : a recommended low-fat diet ( control diet group ) , a Mediterranean diet supplemented with virgin olive oil , or a Mediterranean diet supplemented with mixed nuts . MEASUREMENTS Main outcomes were 12-month changes from baseline in bone formation and resorption markers and bone mass measured according to quantitative ultrasound scanning . RESULTS The baseline data on the anthropometric , bone densitometry , and biochemical variables did not differ between the three groups . Dietary potential renal acid load ( PRAL ) and daily net endogenous acid production ( NEAP ) at baseline did not differ between groups . After intervention , subjects allocated to the Mediterranean diet with mixed nuts had a significant increase of PRAL and NEAP . In comparison , subjects in the Mediterranean diet with nuts group had higher parathyroid hormone ( PTH ) levels ( 2.63 , 95 % confidence interval ( CI ) =-1.01-6.35 , P=.02 ) and a nonsignificantly higher ( 0.31 , 95 % CI=-0.13-0.74 , P=.14 ) urine free deoxypyridoxine : creatinine ratio , a marker of bone resorption , than the control group and the Mediterranean diet with virgin olive oil group . CONCLUSION A Mediterranean dietary pattern associated with a high dietary acid load derived from consumption of mixed nuts does not seem to have a much greater effect on bone metabolism biomarkers , with the exception of PTH levels , than a Mediterranean diet without mixed nuts or a control diet in elderly subjects . Instructions: please extract entity words from the input sentence
[ "B-Intervention_Other", "I-Intervention_Other", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "O", "B-Outcome_Physical", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "B-Participant_Age", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "O", "B-Participant_Sex", "O", "B-Participant_Sex", "O", "B-Participant_Age", "I-Participant_Age", "I-Participant_Age", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Educational", "I-Intervention_Educational", "I-Intervention_Educational", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "B-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "I-Intervention_Other", "O", "O", "O", "O", "O", "O", "O", "O" ]
Mediterranean diet and high dietary acid load associated with mixed nuts : effect on bone metabolism in elderly subjects . OBJECTIVES To analyze the effect of differing diet on the acid load content on bone metabolism . DESIGN Multicentric , randomized , single-blind , parallel-group clinical trial . SETTING Outpatient clinics . PARTICIPANTS Two hundred thirty-eight elderly men and women aged 60 to 80 at high risk for cardiovascular disease were randomly assigned to three interventional groups : a recommended low-fat diet ( control diet group ) , a Mediterranean diet supplemented with virgin olive oil , or a Mediterranean diet supplemented with mixed nuts . MEASUREMENTS Main outcomes were 12-month changes from baseline in bone formation and resorption markers and bone mass measured according to quantitative ultrasound scanning . RESULTS The baseline data on the anthropometric , bone densitometry , and biochemical variables did not differ between the three groups . Dietary potential renal acid load ( PRAL ) and daily net endogenous acid production ( NEAP ) at baseline did not differ between groups . After intervention , subjects allocated to the Mediterranean diet with mixed nuts had a significant increase of PRAL and NEAP . In comparison , subjects in the Mediterranean diet with nuts group had higher parathyroid hormone ( PTH ) levels ( 2.63 , 95 % confidence interval ( CI ) =-1.01-6.35 , P=.02 ) and a nonsignificantly higher ( 0.31 , 95 % CI=-0.13-0.74 , P=.14 ) urine free deoxypyridoxine : creatinine ratio , a marker of bone resorption , than the control group and the Mediterranean diet with virgin olive oil group . CONCLUSION A Mediterranean dietary pattern associated with a high dietary acid load derived from consumption of mixed nuts does not seem to have a much greater effect on bone metabolism biomarkers , with the exception of PTH levels , than a Mediterranean diet without mixed nuts or a control diet in elderly subjects .
[ "Mediterranean", "diet", "and", "high", "dietary", "acid", "load", "associated", "with", "mixed", "nuts", ":", "effect", "on", "bone", "metabolism", "in", "elderly", "subjects", ".", "OBJECTIVES", "To", "analyze", "the", "effect", "of", "differing", "diet", "on", "the", "acid", "load", "content", "on", "bone", "metabolism", ".", "DESIGN", "Multicentric", ",", "randomized", ",", "single", "-", "blind", ",", "parallel", "-", "group", "clinical", "trial", ".", "SETTING", "Outpatient", "clinics", ".", "PARTICIPANTS", "Two", "hundred", "thirty", "-", "eight", "elderly", "men", "and", "women", "aged", "60", "to", "80", "at", "high", "risk", "for", "cardiovascular", "disease", "were", "randomly", "assigned", "to", "three", "interventional", "groups", ":", "a", "recommended", "low", "-", "fat", "diet", "(", "control", "diet", "group", ")", ",", "a", "Mediterranean", "diet", "supplemented", "with", "virgin", "olive", "oil", ",", "or", "a", "Mediterranean", "diet", "supplemented", "with", "mixed", "nuts", ".", "MEASUREMENTS", "Main", "outcomes", "were", "12-month", "changes", "from", "baseline", "in", "bone", "formation", "and", "resorption", "markers", "and", "bone", "mass", "measured", "according", "to", "quantitative", "ultrasound", "scanning", ".", "RESULTS", "The", "baseline", "data", "on", "the", "anthropometric", ",", "bone", "densitometry", ",", "and", "biochemical", "variables", "did", "not", "differ", "between", "the", "three", "groups", ".", "Dietary", "potential", "renal", "acid", "load", "(", "PRAL", ")", "and", "daily", "net", "endogenous", "acid", "production", "(", "NEAP", ")", "at", "baseline", "did", "not", "differ", "between", "groups", ".", "After", "intervention", ",", "subjects", "allocated", "to", "the", "Mediterranean", "diet", "with", "mixed", "nuts", "had", "a", "significant", "increase", "of", "PRAL", "and", "NEAP", ".", "In", "comparison", ",", "subjects", "in", "the", "Mediterranean", "diet", "with", "nuts", "group", "had", "higher", "parathyroid", "hormone", "(", "PTH", ")", "levels", "(", "2.63", ",", "95", "%", "confidence", "interval", "(", "CI", ")", "=", "-1.01", "-", "6.35", ",", "P=.02", ")", "and", "a", "nonsignificantly", "higher", "(", "0.31", ",", "95", "%", "CI=-0.13", "-", "0.74", ",", "P=.14", ")", "urine", "free", "deoxypyridoxine", ":", "creatinine", "ratio", ",", "a", "marker", "of", "bone", "resorption", ",", "than", "the", "control", "group", "and", "the", "Mediterranean", "diet", "with", "virgin", "olive", "oil", "group", ".", "CONCLUSION", "A", "Mediterranean", "dietary", "pattern", "associated", "with", "a", "high", "dietary", "acid", "load", "derived", "from", "consumption", "of", "mixed", "nuts", "does", "not", "seem", "to", "have", "a", "much", "greater", "effect", "on", "bone", "metabolism", "biomarkers", ",", "with", "the", "exception", "of", "PTH", "levels", ",", "than", "a", "Mediterranean", "diet", "without", "mixed", "nuts", "or", "a", "control", "diet", "in", "elderly", "subjects", "." ]
[ "Outcome_Physical", "Intervention_Other", "Intervention_Control", "Intervention_Educational", "Participant_Sample-size", "Participant_Condition", "Participant_Age", "Participant_Sex" ]
glycine is a compound, N - methyl - D - aspartate receptor is a protein
DS.d965_task0
Sentence: At glutamatergic synapses, increased binding to the glycine-B site located in the N-methyl-D-aspartate receptor (NMDAR) can enhance neurotransmission via NMDARs. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: compound, protein
[ "O", "O", "O", "O", "O", "O", "O", "O", "B-compound", "O", "O", "O", "O", "O", "O", "B-protein", "I-protein", "I-protein", "I-protein", "I-protein", "I-protein", "I-protein", "I-protein", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
At glutamatergic synapses, increased binding to the glycine-B site located in the N-methyl-D-aspartate receptor (NMDAR) can enhance neurotransmission via NMDARs.
[ "At", "glutamatergic", "synapses", ",", "increased", "binding", "to", "the", "glycine", "-", "B", "site", "located", "in", "the", "N", "-", "methyl", "-", "D", "-", "aspartate", "receptor", "(", "NMDAR", ")", "can", "enhance", "neurotransmission", "via", "NMDARs", "." ]
[ "protein", "compound" ]
glycine is a compound, N - methyl - D - aspartate receptor is a protein
DS.d965_task1
Sentence: At glutamatergic synapses, increased binding to the glycine-B site located in the N-methyl-D-aspartate receptor (NMDAR) can enhance neurotransmission via NMDARs. Instructions: please typing these entity words according to sentence: glycine, N - methyl - D - aspartate receptor Options: compound, protein
[ "O", "O", "O", "O", "O", "O", "O", "O", "B-compound", "O", "O", "O", "O", "O", "O", "B-protein", "I-protein", "I-protein", "I-protein", "I-protein", "I-protein", "I-protein", "I-protein", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
At glutamatergic synapses, increased binding to the glycine-B site located in the N-methyl-D-aspartate receptor (NMDAR) can enhance neurotransmission via NMDARs.
[ "At", "glutamatergic", "synapses", ",", "increased", "binding", "to", "the", "glycine", "-", "B", "site", "located", "in", "the", "N", "-", "methyl", "-", "D", "-", "aspartate", "receptor", "(", "NMDAR", ")", "can", "enhance", "neurotransmission", "via", "NMDARs", "." ]
[ "protein", "compound" ]
glycine, N - methyl - D - aspartate receptor
DS.d965_task2
Sentence: At glutamatergic synapses, increased binding to the glycine-B site located in the N-methyl-D-aspartate receptor (NMDAR) can enhance neurotransmission via NMDARs. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "B-compound", "O", "O", "O", "O", "O", "O", "B-protein", "I-protein", "I-protein", "I-protein", "I-protein", "I-protein", "I-protein", "I-protein", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
At glutamatergic synapses, increased binding to the glycine-B site located in the N-methyl-D-aspartate receptor (NMDAR) can enhance neurotransmission via NMDARs.
[ "At", "glutamatergic", "synapses", ",", "increased", "binding", "to", "the", "glycine", "-", "B", "site", "located", "in", "the", "N", "-", "methyl", "-", "D", "-", "aspartate", "receptor", "(", "NMDAR", ")", "can", "enhance", "neurotransmission", "via", "NMDARs", "." ]
[ "protein", "compound" ]
Vene is an umlsterm, Vene is an umlsterm, Verhalten is an umlsterm, Venen is an umlsterm, Venenwand is an umlsterm, Venenklappe is an umlsterm, Vene is an umlsterm, Zugfestigkeit is an umlsterm, Venenwand is an umlsterm, Matrixproteine is an umlsterm, Vene is an umlsterm, Venenwand is an umlsterm
DerChirurg.00710300.ger.abstr_task0
Sentence: Zusammenfassung . Die Frage nach der Pathogenese der Varicen fuehrte zu Untersuchungen varicoeser V. saphena magna im Vergleich mit klinisch noch gesunder Vene und klinisch und histologisch gesunder Vene . Untersucht wurde das mechanische Verhalten und die extracellulaere Matrix . Es zeigte sich , dass die Varicenwand rigider war als die Wand normaler Venen , davon war auch die Venenwand unterhalb einer noch intakten Venenklappe betroffen . Die Veraenderung der Vene und damit die Ursache fuer die Aenderung der Zugfestigkeit lag in der Venenwand und hier insbesondere an den Bestandteilen der extracellulaeren Matrix . Die Matrixproteine lagen vermehrt vor , die elastischen Fasern waren reduziert und fragmentiert . In der Zusammenschau der mechanischen Versuche und der immunhistochemischen Ergebnisse laesst sich die Theorie der primaeren Klappenzerstoerung und der anschliessenden varicoesen Umbildung der Vene nicht bestaetigen , viel eher kommt es zunaechst zu einer Veraenderung der Venenwand und damit auch zu einer Klappeninsuffizienz . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O" ]
Zusammenfassung . Die Frage nach der Pathogenese der Varicen fuehrte zu Untersuchungen varicoeser V. saphena magna im Vergleich mit klinisch noch gesunder Vene und klinisch und histologisch gesunder Vene . Untersucht wurde das mechanische Verhalten und die extracellulaere Matrix . Es zeigte sich , dass die Varicenwand rigider war als die Wand normaler Venen , davon war auch die Venenwand unterhalb einer noch intakten Venenklappe betroffen . Die Veraenderung der Vene und damit die Ursache fuer die Aenderung der Zugfestigkeit lag in der Venenwand und hier insbesondere an den Bestandteilen der extracellulaeren Matrix . Die Matrixproteine lagen vermehrt vor , die elastischen Fasern waren reduziert und fragmentiert . In der Zusammenschau der mechanischen Versuche und der immunhistochemischen Ergebnisse laesst sich die Theorie der primaeren Klappenzerstoerung und der anschliessenden varicoesen Umbildung der Vene nicht bestaetigen , viel eher kommt es zunaechst zu einer Veraenderung der Venenwand und damit auch zu einer Klappeninsuffizienz .
[ "Zusammenfassung", ".", "Die", "Frage", "nach", "der", "Pathogenese", "der", "Varicen", "fuehrte", "zu", "Untersuchungen", "varicoeser", "V.", "saphena", "magna", "im", "Vergleich", "mit", "klinisch", "noch", "gesunder", "Vene", "und", "klinisch", "und", "histologisch", "gesunder", "Vene", ".", "Untersucht", "wurde", "das", "mechanische", "Verhalten", "und", "die", "extracellulaere", "Matrix", ".", "Es", "zeigte", "sich", ",", "dass", "die", "Varicenwand", "rigider", "war", "als", "die", "Wand", "normaler", "Venen", ",", "davon", "war", "auch", "die", "Venenwand", "unterhalb", "einer", "noch", "intakten", "Venenklappe", "betroffen", ".", "Die", "Veraenderung", "der", "Vene", "und", "damit", "die", "Ursache", "fuer", "die", "Aenderung", "der", "Zugfestigkeit", "lag", "in", "der", "Venenwand", "und", "hier", "insbesondere", "an", "den", "Bestandteilen", "der", "extracellulaeren", "Matrix", ".", "Die", "Matrixproteine", "lagen", "vermehrt", "vor", ",", "die", "elastischen", "Fasern", "waren", "reduziert", "und", "fragmentiert", ".", "In", "der", "Zusammenschau", "der", "mechanischen", "Versuche", "und", "der", "immunhistochemischen", "Ergebnisse", "laesst", "sich", "die", "Theorie", "der", "primaeren", "Klappenzerstoerung", "und", "der", "anschliessenden", "varicoesen", "Umbildung", "der", "Vene", "nicht", "bestaetigen", ",", "viel", "eher", "kommt", "es", "zunaechst", "zu", "einer", "Veraenderung", "der", "Venenwand", "und", "damit", "auch", "zu", "einer", "Klappeninsuffizienz", "." ]
[ "umlsterm" ]
Vene is an umlsterm, Vene is an umlsterm, Verhalten is an umlsterm, Venen is an umlsterm, Venenwand is an umlsterm, Venenklappe is an umlsterm, Vene is an umlsterm, Zugfestigkeit is an umlsterm, Venenwand is an umlsterm, Matrixproteine is an umlsterm, Vene is an umlsterm, Venenwand is an umlsterm
DerChirurg.00710300.ger.abstr_task1
Sentence: Zusammenfassung . Die Frage nach der Pathogenese der Varicen fuehrte zu Untersuchungen varicoeser V. saphena magna im Vergleich mit klinisch noch gesunder Vene und klinisch und histologisch gesunder Vene . Untersucht wurde das mechanische Verhalten und die extracellulaere Matrix . Es zeigte sich , dass die Varicenwand rigider war als die Wand normaler Venen , davon war auch die Venenwand unterhalb einer noch intakten Venenklappe betroffen . Die Veraenderung der Vene und damit die Ursache fuer die Aenderung der Zugfestigkeit lag in der Venenwand und hier insbesondere an den Bestandteilen der extracellulaeren Matrix . Die Matrixproteine lagen vermehrt vor , die elastischen Fasern waren reduziert und fragmentiert . In der Zusammenschau der mechanischen Versuche und der immunhistochemischen Ergebnisse laesst sich die Theorie der primaeren Klappenzerstoerung und der anschliessenden varicoesen Umbildung der Vene nicht bestaetigen , viel eher kommt es zunaechst zu einer Veraenderung der Venenwand und damit auch zu einer Klappeninsuffizienz . Instructions: please typing these entity words according to sentence: Vene, Vene, Verhalten, Venen, Venenwand, Venenklappe, Vene, Zugfestigkeit, Venenwand, Matrixproteine, Vene, Venenwand Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O" ]
Zusammenfassung . Die Frage nach der Pathogenese der Varicen fuehrte zu Untersuchungen varicoeser V. saphena magna im Vergleich mit klinisch noch gesunder Vene und klinisch und histologisch gesunder Vene . Untersucht wurde das mechanische Verhalten und die extracellulaere Matrix . Es zeigte sich , dass die Varicenwand rigider war als die Wand normaler Venen , davon war auch die Venenwand unterhalb einer noch intakten Venenklappe betroffen . Die Veraenderung der Vene und damit die Ursache fuer die Aenderung der Zugfestigkeit lag in der Venenwand und hier insbesondere an den Bestandteilen der extracellulaeren Matrix . Die Matrixproteine lagen vermehrt vor , die elastischen Fasern waren reduziert und fragmentiert . In der Zusammenschau der mechanischen Versuche und der immunhistochemischen Ergebnisse laesst sich die Theorie der primaeren Klappenzerstoerung und der anschliessenden varicoesen Umbildung der Vene nicht bestaetigen , viel eher kommt es zunaechst zu einer Veraenderung der Venenwand und damit auch zu einer Klappeninsuffizienz .
[ "Zusammenfassung", ".", "Die", "Frage", "nach", "der", "Pathogenese", "der", "Varicen", "fuehrte", "zu", "Untersuchungen", "varicoeser", "V.", "saphena", "magna", "im", "Vergleich", "mit", "klinisch", "noch", "gesunder", "Vene", "und", "klinisch", "und", "histologisch", "gesunder", "Vene", ".", "Untersucht", "wurde", "das", "mechanische", "Verhalten", "und", "die", "extracellulaere", "Matrix", ".", "Es", "zeigte", "sich", ",", "dass", "die", "Varicenwand", "rigider", "war", "als", "die", "Wand", "normaler", "Venen", ",", "davon", "war", "auch", "die", "Venenwand", "unterhalb", "einer", "noch", "intakten", "Venenklappe", "betroffen", ".", "Die", "Veraenderung", "der", "Vene", "und", "damit", "die", "Ursache", "fuer", "die", "Aenderung", "der", "Zugfestigkeit", "lag", "in", "der", "Venenwand", "und", "hier", "insbesondere", "an", "den", "Bestandteilen", "der", "extracellulaeren", "Matrix", ".", "Die", "Matrixproteine", "lagen", "vermehrt", "vor", ",", "die", "elastischen", "Fasern", "waren", "reduziert", "und", "fragmentiert", ".", "In", "der", "Zusammenschau", "der", "mechanischen", "Versuche", "und", "der", "immunhistochemischen", "Ergebnisse", "laesst", "sich", "die", "Theorie", "der", "primaeren", "Klappenzerstoerung", "und", "der", "anschliessenden", "varicoesen", "Umbildung", "der", "Vene", "nicht", "bestaetigen", ",", "viel", "eher", "kommt", "es", "zunaechst", "zu", "einer", "Veraenderung", "der", "Venenwand", "und", "damit", "auch", "zu", "einer", "Klappeninsuffizienz", "." ]
[ "umlsterm" ]
Vene, Vene, Verhalten, Venen, Venenwand, Venenklappe, Vene, Zugfestigkeit, Venenwand, Matrixproteine, Vene, Venenwand
DerChirurg.00710300.ger.abstr_task2
Sentence: Zusammenfassung . Die Frage nach der Pathogenese der Varicen fuehrte zu Untersuchungen varicoeser V. saphena magna im Vergleich mit klinisch noch gesunder Vene und klinisch und histologisch gesunder Vene . Untersucht wurde das mechanische Verhalten und die extracellulaere Matrix . Es zeigte sich , dass die Varicenwand rigider war als die Wand normaler Venen , davon war auch die Venenwand unterhalb einer noch intakten Venenklappe betroffen . Die Veraenderung der Vene und damit die Ursache fuer die Aenderung der Zugfestigkeit lag in der Venenwand und hier insbesondere an den Bestandteilen der extracellulaeren Matrix . Die Matrixproteine lagen vermehrt vor , die elastischen Fasern waren reduziert und fragmentiert . In der Zusammenschau der mechanischen Versuche und der immunhistochemischen Ergebnisse laesst sich die Theorie der primaeren Klappenzerstoerung und der anschliessenden varicoesen Umbildung der Vene nicht bestaetigen , viel eher kommt es zunaechst zu einer Veraenderung der Venenwand und damit auch zu einer Klappeninsuffizienz . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O" ]
Zusammenfassung . Die Frage nach der Pathogenese der Varicen fuehrte zu Untersuchungen varicoeser V. saphena magna im Vergleich mit klinisch noch gesunder Vene und klinisch und histologisch gesunder Vene . Untersucht wurde das mechanische Verhalten und die extracellulaere Matrix . Es zeigte sich , dass die Varicenwand rigider war als die Wand normaler Venen , davon war auch die Venenwand unterhalb einer noch intakten Venenklappe betroffen . Die Veraenderung der Vene und damit die Ursache fuer die Aenderung der Zugfestigkeit lag in der Venenwand und hier insbesondere an den Bestandteilen der extracellulaeren Matrix . Die Matrixproteine lagen vermehrt vor , die elastischen Fasern waren reduziert und fragmentiert . In der Zusammenschau der mechanischen Versuche und der immunhistochemischen Ergebnisse laesst sich die Theorie der primaeren Klappenzerstoerung und der anschliessenden varicoesen Umbildung der Vene nicht bestaetigen , viel eher kommt es zunaechst zu einer Veraenderung der Venenwand und damit auch zu einer Klappeninsuffizienz .
[ "Zusammenfassung", ".", "Die", "Frage", "nach", "der", "Pathogenese", "der", "Varicen", "fuehrte", "zu", "Untersuchungen", "varicoeser", "V.", "saphena", "magna", "im", "Vergleich", "mit", "klinisch", "noch", "gesunder", "Vene", "und", "klinisch", "und", "histologisch", "gesunder", "Vene", ".", "Untersucht", "wurde", "das", "mechanische", "Verhalten", "und", "die", "extracellulaere", "Matrix", ".", "Es", "zeigte", "sich", ",", "dass", "die", "Varicenwand", "rigider", "war", "als", "die", "Wand", "normaler", "Venen", ",", "davon", "war", "auch", "die", "Venenwand", "unterhalb", "einer", "noch", "intakten", "Venenklappe", "betroffen", ".", "Die", "Veraenderung", "der", "Vene", "und", "damit", "die", "Ursache", "fuer", "die", "Aenderung", "der", "Zugfestigkeit", "lag", "in", "der", "Venenwand", "und", "hier", "insbesondere", "an", "den", "Bestandteilen", "der", "extracellulaeren", "Matrix", ".", "Die", "Matrixproteine", "lagen", "vermehrt", "vor", ",", "die", "elastischen", "Fasern", "waren", "reduziert", "und", "fragmentiert", ".", "In", "der", "Zusammenschau", "der", "mechanischen", "Versuche", "und", "der", "immunhistochemischen", "Ergebnisse", "laesst", "sich", "die", "Theorie", "der", "primaeren", "Klappenzerstoerung", "und", "der", "anschliessenden", "varicoesen", "Umbildung", "der", "Vene", "nicht", "bestaetigen", ",", "viel", "eher", "kommt", "es", "zunaechst", "zu", "einer", "Veraenderung", "der", "Venenwand", "und", "damit", "auch", "zu", "einer", "Klappeninsuffizienz", "." ]
[ "umlsterm" ]
helicase - primase is a Protein_complex, UL5 is a Individual_protein, UL8 is a Individual_protein, UL52 is a Individual_protein, origin - binding protein is a Individual_protein, UL9 is a Individual_protein, single - stranded DNA - binding protein is a Individual_protein, ICP8 is a Individual_protein
570_task0
Sentence: On the basis of these results, we present a model for prereplicative site formation in infected cells in which the helicase-primase components (UL5, UL8, and UL52), the origin-binding protein (UL9), and the viral single-stranded DNA-binding protein (ICP8) assemble together to initiate the process. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Protein_complex, Individual_protein
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein_complex", "I-Protein_complex", "I-Protein_complex", "O", "O", "B-Individual_protein", "O", "B-Individual_protein", "O", "O", "B-Individual_protein", "O", "O", "O", "B-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "B-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O" ]
On the basis of these results, we present a model for prereplicative site formation in infected cells in which the helicase-primase components (UL5, UL8, and UL52), the origin-binding protein (UL9), and the viral single-stranded DNA-binding protein (ICP8) assemble together to initiate the process.
[ "On", "the", "basis", "of", "these", "results", ",", "we", "present", "a", "model", "for", "prereplicative", "site", "formation", "in", "infected", "cells", "in", "which", "the", "helicase", "-", "primase", "components", "(", "UL5", ",", "UL8", ",", "and", "UL52", ")", ",", "the", "origin", "-", "binding", "protein", "(", "UL9", ")", ",", "and", "the", "viral", "single", "-", "stranded", "DNA", "-", "binding", "protein", "(", "ICP8", ")", "assemble", "together", "to", "initiate", "the", "process", "." ]
[ "Individual_protein", "Protein_complex" ]
helicase - primase is a Protein_complex, UL5 is a Individual_protein, UL8 is a Individual_protein, UL52 is a Individual_protein, origin - binding protein is a Individual_protein, UL9 is a Individual_protein, single - stranded DNA - binding protein is a Individual_protein, ICP8 is a Individual_protein
570_task1
Sentence: On the basis of these results, we present a model for prereplicative site formation in infected cells in which the helicase-primase components (UL5, UL8, and UL52), the origin-binding protein (UL9), and the viral single-stranded DNA-binding protein (ICP8) assemble together to initiate the process. Instructions: please typing these entity words according to sentence: helicase - primase, UL5, UL8, UL52, origin - binding protein, UL9, single - stranded DNA - binding protein, ICP8 Options: Protein_complex, Individual_protein
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein_complex", "I-Protein_complex", "I-Protein_complex", "O", "O", "B-Individual_protein", "O", "B-Individual_protein", "O", "O", "B-Individual_protein", "O", "O", "O", "B-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "B-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O" ]
On the basis of these results, we present a model for prereplicative site formation in infected cells in which the helicase-primase components (UL5, UL8, and UL52), the origin-binding protein (UL9), and the viral single-stranded DNA-binding protein (ICP8) assemble together to initiate the process.
[ "On", "the", "basis", "of", "these", "results", ",", "we", "present", "a", "model", "for", "prereplicative", "site", "formation", "in", "infected", "cells", "in", "which", "the", "helicase", "-", "primase", "components", "(", "UL5", ",", "UL8", ",", "and", "UL52", ")", ",", "the", "origin", "-", "binding", "protein", "(", "UL9", ")", ",", "and", "the", "viral", "single", "-", "stranded", "DNA", "-", "binding", "protein", "(", "ICP8", ")", "assemble", "together", "to", "initiate", "the", "process", "." ]
[ "Individual_protein", "Protein_complex" ]
helicase - primase, UL5, UL8, UL52, origin - binding protein, UL9, single - stranded DNA - binding protein, ICP8
570_task2
Sentence: On the basis of these results, we present a model for prereplicative site formation in infected cells in which the helicase-primase components (UL5, UL8, and UL52), the origin-binding protein (UL9), and the viral single-stranded DNA-binding protein (ICP8) assemble together to initiate the process. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein_complex", "I-Protein_complex", "I-Protein_complex", "O", "O", "B-Individual_protein", "O", "B-Individual_protein", "O", "O", "B-Individual_protein", "O", "O", "O", "B-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "B-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "I-Individual_protein", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O" ]
On the basis of these results, we present a model for prereplicative site formation in infected cells in which the helicase-primase components (UL5, UL8, and UL52), the origin-binding protein (UL9), and the viral single-stranded DNA-binding protein (ICP8) assemble together to initiate the process.
[ "On", "the", "basis", "of", "these", "results", ",", "we", "present", "a", "model", "for", "prereplicative", "site", "formation", "in", "infected", "cells", "in", "which", "the", "helicase", "-", "primase", "components", "(", "UL5", ",", "UL8", ",", "and", "UL52", ")", ",", "the", "origin", "-", "binding", "protein", "(", "UL9", ")", ",", "and", "the", "viral", "single", "-", "stranded", "DNA", "-", "binding", "protein", "(", "ICP8", ")", "assemble", "together", "to", "initiate", "the", "process", "." ]
[ "Individual_protein", "Protein_complex" ]
Mann is an umlsterm, Appetitlosigkeit is an umlsterm, Kopfschmerzen is an umlsterm, Husten is an umlsterm, Atemnot is an umlsterm, Patient is an umlsterm, Notarzthubschrauber is an umlsterm, Krankenhaus is an umlsterm, Thoraxroentgen is an umlsterm, Lungenoedem is an umlsterm, Lunge is an umlsterm, Blutgasanalyse is an umlsterm, Hypoxaemie is an umlsterm, pulmonale Gasaustausch is an umlsterm, Patient is an umlsterm, Thoraxroentgen is an umlsterm, Hoehenlungenoedem is an umlsterm, Lungenoedem is an umlsterm, Hoehen is an umlsterm, Ausloesende Faktoren is an umlsterm, Belastung is an umlsterm, Hypoxaemie is an umlsterm, Hyperventilation is an umlsterm, Wasser- is an umlsterm, Elektrolythaushalt is an umlsterm, Therapie is an umlsterm, Sauerstoff is an umlsterm, Kalzium - Kanal - Blockern is an umlsterm, Nifedipin is an umlsterm, Druck is an umlsterm, pulmonalen Gasaustauschs is an umlsterm, Atemwegsdrucks is an umlsterm
DerAnaesthesist.40430183.ger.abstr_task0
Sentence: Ein 45jaehriger , trainierter , gesunder Mann ( L. J. ) stieg innerhalb eines Tages von 300 m Seehoehe auf eine in 2500 m gelegene Schutzhuette in den Tiroler Alpen auf , von der aus er Tagestouren auf Gipfel bis 3356 m unternahm . Am vierten Tag kam es zum Auftreten von Appetitlosigkeit , Kopfschmerzen , Husten und zunehmender Atemnot bis hin zu schwerster Ruhedyspnoe . Am darauffolgenden Tag wurde der Patient mit dem Notarzthubschrauber geborgen und in ein Krankenhaus im Tal gebracht . Das Thoraxroentgen zum Zeitpunkt der Aufnahme zeigte ein bilaterales , alveolaeres Lungenoedem mit staerkerer Auspraegung im Bereich der rechten Lunge . Eine kapillaere Blutgasanalyse ergab eine schwere Hypoxaemie ( PcapO2=25,7 mm Hg ) . Der pulmonale Gasaustausch normalisierte sich innerhalb weniger Stunden , nach zwei Tagen fuehlte sich der Patient beschwerdefrei . Ein weiteres Thoraxroentgen nach vier Tagen war unauffaellig . Aufgrund dieses typischen klinischen Verlaufs wurde ein Hoehenlungenoedem ( HLOE ) diagnostiziert . Das HLOE ist ein nicht kardiales Lungenoedem , das gesunde Individuen zumeist in Hoehen ueber 3000 m befaellt . Ausloesende Faktoren sind ein zu rascher Aufstieg , starke koerperliche Belastung , eine in bezug auf die bestehende Hypoxaemie zu geringe Hyperventilation , sowie Regulationsstoerungen im Wasser- und Elektrolythaushalt . Die vordringlichste und wirkungsvollste Therapie ist neben der Gabe von Sauerstoff ein rascher Abtransport ins Tal . Zusaetzlich empfohlen wird die Anwendung von Kalzium-Kanal-Blockern ( Nifedipin ) , um den beim HLOE erhoehten pulmonalarteriellen Druck zu senken . Eine deutliche Verbesserung des pulmonalen Gasaustauschs kann durch zusaetzliche Applikation eines positiven endexspiratorischen Atemwegsdrucks erreicht werden . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O" ]
Ein 45jaehriger , trainierter , gesunder Mann ( L. J. ) stieg innerhalb eines Tages von 300 m Seehoehe auf eine in 2500 m gelegene Schutzhuette in den Tiroler Alpen auf , von der aus er Tagestouren auf Gipfel bis 3356 m unternahm . Am vierten Tag kam es zum Auftreten von Appetitlosigkeit , Kopfschmerzen , Husten und zunehmender Atemnot bis hin zu schwerster Ruhedyspnoe . Am darauffolgenden Tag wurde der Patient mit dem Notarzthubschrauber geborgen und in ein Krankenhaus im Tal gebracht . Das Thoraxroentgen zum Zeitpunkt der Aufnahme zeigte ein bilaterales , alveolaeres Lungenoedem mit staerkerer Auspraegung im Bereich der rechten Lunge . Eine kapillaere Blutgasanalyse ergab eine schwere Hypoxaemie ( PcapO2=25,7 mm Hg ) . Der pulmonale Gasaustausch normalisierte sich innerhalb weniger Stunden , nach zwei Tagen fuehlte sich der Patient beschwerdefrei . Ein weiteres Thoraxroentgen nach vier Tagen war unauffaellig . Aufgrund dieses typischen klinischen Verlaufs wurde ein Hoehenlungenoedem ( HLOE ) diagnostiziert . Das HLOE ist ein nicht kardiales Lungenoedem , das gesunde Individuen zumeist in Hoehen ueber 3000 m befaellt . Ausloesende Faktoren sind ein zu rascher Aufstieg , starke koerperliche Belastung , eine in bezug auf die bestehende Hypoxaemie zu geringe Hyperventilation , sowie Regulationsstoerungen im Wasser- und Elektrolythaushalt . Die vordringlichste und wirkungsvollste Therapie ist neben der Gabe von Sauerstoff ein rascher Abtransport ins Tal . Zusaetzlich empfohlen wird die Anwendung von Kalzium-Kanal-Blockern ( Nifedipin ) , um den beim HLOE erhoehten pulmonalarteriellen Druck zu senken . Eine deutliche Verbesserung des pulmonalen Gasaustauschs kann durch zusaetzliche Applikation eines positiven endexspiratorischen Atemwegsdrucks erreicht werden .
[ "Ein", "45jaehriger", ",", "trainierter", ",", "gesunder", "Mann", "(", "L.", "J.", ")", "stieg", "innerhalb", "eines", "Tages", "von", "300", "m", "Seehoehe", "auf", "eine", "in", "2500", "m", "gelegene", "Schutzhuette", "in", "den", "Tiroler", "Alpen", "auf", ",", "von", "der", "aus", "er", "Tagestouren", "auf", "Gipfel", "bis", "3356", "m", "unternahm", ".", "Am", "vierten", "Tag", "kam", "es", "zum", "Auftreten", "von", "Appetitlosigkeit", ",", "Kopfschmerzen", ",", "Husten", "und", "zunehmender", "Atemnot", "bis", "hin", "zu", "schwerster", "Ruhedyspnoe", ".", "Am", "darauffolgenden", "Tag", "wurde", "der", "Patient", "mit", "dem", "Notarzthubschrauber", "geborgen", "und", "in", "ein", "Krankenhaus", "im", "Tal", "gebracht", ".", "Das", "Thoraxroentgen", "zum", "Zeitpunkt", "der", "Aufnahme", "zeigte", "ein", "bilaterales", ",", "alveolaeres", "Lungenoedem", "mit", "staerkerer", "Auspraegung", "im", "Bereich", "der", "rechten", "Lunge", ".", "Eine", "kapillaere", "Blutgasanalyse", "ergab", "eine", "schwere", "Hypoxaemie", "(", "PcapO2=25,7", "mm", "Hg", ")", ".", "Der", "pulmonale", "Gasaustausch", "normalisierte", "sich", "innerhalb", "weniger", "Stunden", ",", "nach", "zwei", "Tagen", "fuehlte", "sich", "der", "Patient", "beschwerdefrei", ".", "Ein", "weiteres", "Thoraxroentgen", "nach", "vier", "Tagen", "war", "unauffaellig", ".", "Aufgrund", "dieses", "typischen", "klinischen", "Verlaufs", "wurde", "ein", "Hoehenlungenoedem", "(", "HLOE", ")", "diagnostiziert", ".", "Das", "HLOE", "ist", "ein", "nicht", "kardiales", "Lungenoedem", ",", "das", "gesunde", "Individuen", "zumeist", "in", "Hoehen", "ueber", "3000", "m", "befaellt", ".", "Ausloesende", "Faktoren", "sind", "ein", "zu", "rascher", "Aufstieg", ",", "starke", "koerperliche", "Belastung", ",", "eine", "in", "bezug", "auf", "die", "bestehende", "Hypoxaemie", "zu", "geringe", "Hyperventilation", ",", "sowie", "Regulationsstoerungen", "im", "Wasser-", "und", "Elektrolythaushalt", ".", "Die", "vordringlichste", "und", "wirkungsvollste", "Therapie", "ist", "neben", "der", "Gabe", "von", "Sauerstoff", "ein", "rascher", "Abtransport", "ins", "Tal", ".", "Zusaetzlich", "empfohlen", "wird", "die", "Anwendung", "von", "Kalzium", "-", "Kanal", "-", "Blockern", "(", "Nifedipin", ")", ",", "um", "den", "beim", "HLOE", "erhoehten", "pulmonalarteriellen", "Druck", "zu", "senken", ".", "Eine", "deutliche", "Verbesserung", "des", "pulmonalen", "Gasaustauschs", "kann", "durch", "zusaetzliche", "Applikation", "eines", "positiven", "endexspiratorischen", "Atemwegsdrucks", "erreicht", "werden", "." ]
[ "umlsterm" ]
Mann is an umlsterm, Appetitlosigkeit is an umlsterm, Kopfschmerzen is an umlsterm, Husten is an umlsterm, Atemnot is an umlsterm, Patient is an umlsterm, Notarzthubschrauber is an umlsterm, Krankenhaus is an umlsterm, Thoraxroentgen is an umlsterm, Lungenoedem is an umlsterm, Lunge is an umlsterm, Blutgasanalyse is an umlsterm, Hypoxaemie is an umlsterm, pulmonale Gasaustausch is an umlsterm, Patient is an umlsterm, Thoraxroentgen is an umlsterm, Hoehenlungenoedem is an umlsterm, Lungenoedem is an umlsterm, Hoehen is an umlsterm, Ausloesende Faktoren is an umlsterm, Belastung is an umlsterm, Hypoxaemie is an umlsterm, Hyperventilation is an umlsterm, Wasser- is an umlsterm, Elektrolythaushalt is an umlsterm, Therapie is an umlsterm, Sauerstoff is an umlsterm, Kalzium - Kanal - Blockern is an umlsterm, Nifedipin is an umlsterm, Druck is an umlsterm, pulmonalen Gasaustauschs is an umlsterm, Atemwegsdrucks is an umlsterm
DerAnaesthesist.40430183.ger.abstr_task1
Sentence: Ein 45jaehriger , trainierter , gesunder Mann ( L. J. ) stieg innerhalb eines Tages von 300 m Seehoehe auf eine in 2500 m gelegene Schutzhuette in den Tiroler Alpen auf , von der aus er Tagestouren auf Gipfel bis 3356 m unternahm . Am vierten Tag kam es zum Auftreten von Appetitlosigkeit , Kopfschmerzen , Husten und zunehmender Atemnot bis hin zu schwerster Ruhedyspnoe . Am darauffolgenden Tag wurde der Patient mit dem Notarzthubschrauber geborgen und in ein Krankenhaus im Tal gebracht . Das Thoraxroentgen zum Zeitpunkt der Aufnahme zeigte ein bilaterales , alveolaeres Lungenoedem mit staerkerer Auspraegung im Bereich der rechten Lunge . Eine kapillaere Blutgasanalyse ergab eine schwere Hypoxaemie ( PcapO2=25,7 mm Hg ) . Der pulmonale Gasaustausch normalisierte sich innerhalb weniger Stunden , nach zwei Tagen fuehlte sich der Patient beschwerdefrei . Ein weiteres Thoraxroentgen nach vier Tagen war unauffaellig . Aufgrund dieses typischen klinischen Verlaufs wurde ein Hoehenlungenoedem ( HLOE ) diagnostiziert . Das HLOE ist ein nicht kardiales Lungenoedem , das gesunde Individuen zumeist in Hoehen ueber 3000 m befaellt . Ausloesende Faktoren sind ein zu rascher Aufstieg , starke koerperliche Belastung , eine in bezug auf die bestehende Hypoxaemie zu geringe Hyperventilation , sowie Regulationsstoerungen im Wasser- und Elektrolythaushalt . Die vordringlichste und wirkungsvollste Therapie ist neben der Gabe von Sauerstoff ein rascher Abtransport ins Tal . Zusaetzlich empfohlen wird die Anwendung von Kalzium-Kanal-Blockern ( Nifedipin ) , um den beim HLOE erhoehten pulmonalarteriellen Druck zu senken . Eine deutliche Verbesserung des pulmonalen Gasaustauschs kann durch zusaetzliche Applikation eines positiven endexspiratorischen Atemwegsdrucks erreicht werden . Instructions: please typing these entity words according to sentence: Mann, Appetitlosigkeit, Kopfschmerzen, Husten, Atemnot, Patient, Notarzthubschrauber, Krankenhaus, Thoraxroentgen, Lungenoedem, Lunge, Blutgasanalyse, Hypoxaemie, pulmonale Gasaustausch, Patient, Thoraxroentgen, Hoehenlungenoedem, Lungenoedem, Hoehen, Ausloesende Faktoren, Belastung, Hypoxaemie, Hyperventilation, Wasser-, Elektrolythaushalt, Therapie, Sauerstoff, Kalzium - Kanal - Blockern, Nifedipin, Druck, pulmonalen Gasaustauschs, Atemwegsdrucks Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O" ]
Ein 45jaehriger , trainierter , gesunder Mann ( L. J. ) stieg innerhalb eines Tages von 300 m Seehoehe auf eine in 2500 m gelegene Schutzhuette in den Tiroler Alpen auf , von der aus er Tagestouren auf Gipfel bis 3356 m unternahm . Am vierten Tag kam es zum Auftreten von Appetitlosigkeit , Kopfschmerzen , Husten und zunehmender Atemnot bis hin zu schwerster Ruhedyspnoe . Am darauffolgenden Tag wurde der Patient mit dem Notarzthubschrauber geborgen und in ein Krankenhaus im Tal gebracht . Das Thoraxroentgen zum Zeitpunkt der Aufnahme zeigte ein bilaterales , alveolaeres Lungenoedem mit staerkerer Auspraegung im Bereich der rechten Lunge . Eine kapillaere Blutgasanalyse ergab eine schwere Hypoxaemie ( PcapO2=25,7 mm Hg ) . Der pulmonale Gasaustausch normalisierte sich innerhalb weniger Stunden , nach zwei Tagen fuehlte sich der Patient beschwerdefrei . Ein weiteres Thoraxroentgen nach vier Tagen war unauffaellig . Aufgrund dieses typischen klinischen Verlaufs wurde ein Hoehenlungenoedem ( HLOE ) diagnostiziert . Das HLOE ist ein nicht kardiales Lungenoedem , das gesunde Individuen zumeist in Hoehen ueber 3000 m befaellt . Ausloesende Faktoren sind ein zu rascher Aufstieg , starke koerperliche Belastung , eine in bezug auf die bestehende Hypoxaemie zu geringe Hyperventilation , sowie Regulationsstoerungen im Wasser- und Elektrolythaushalt . Die vordringlichste und wirkungsvollste Therapie ist neben der Gabe von Sauerstoff ein rascher Abtransport ins Tal . Zusaetzlich empfohlen wird die Anwendung von Kalzium-Kanal-Blockern ( Nifedipin ) , um den beim HLOE erhoehten pulmonalarteriellen Druck zu senken . Eine deutliche Verbesserung des pulmonalen Gasaustauschs kann durch zusaetzliche Applikation eines positiven endexspiratorischen Atemwegsdrucks erreicht werden .
[ "Ein", "45jaehriger", ",", "trainierter", ",", "gesunder", "Mann", "(", "L.", "J.", ")", "stieg", "innerhalb", "eines", "Tages", "von", "300", "m", "Seehoehe", "auf", "eine", "in", "2500", "m", "gelegene", "Schutzhuette", "in", "den", "Tiroler", "Alpen", "auf", ",", "von", "der", "aus", "er", "Tagestouren", "auf", "Gipfel", "bis", "3356", "m", "unternahm", ".", "Am", "vierten", "Tag", "kam", "es", "zum", "Auftreten", "von", "Appetitlosigkeit", ",", "Kopfschmerzen", ",", "Husten", "und", "zunehmender", "Atemnot", "bis", "hin", "zu", "schwerster", "Ruhedyspnoe", ".", "Am", "darauffolgenden", "Tag", "wurde", "der", "Patient", "mit", "dem", "Notarzthubschrauber", "geborgen", "und", "in", "ein", "Krankenhaus", "im", "Tal", "gebracht", ".", "Das", "Thoraxroentgen", "zum", "Zeitpunkt", "der", "Aufnahme", "zeigte", "ein", "bilaterales", ",", "alveolaeres", "Lungenoedem", "mit", "staerkerer", "Auspraegung", "im", "Bereich", "der", "rechten", "Lunge", ".", "Eine", "kapillaere", "Blutgasanalyse", "ergab", "eine", "schwere", "Hypoxaemie", "(", "PcapO2=25,7", "mm", "Hg", ")", ".", "Der", "pulmonale", "Gasaustausch", "normalisierte", "sich", "innerhalb", "weniger", "Stunden", ",", "nach", "zwei", "Tagen", "fuehlte", "sich", "der", "Patient", "beschwerdefrei", ".", "Ein", "weiteres", "Thoraxroentgen", "nach", "vier", "Tagen", "war", "unauffaellig", ".", "Aufgrund", "dieses", "typischen", "klinischen", "Verlaufs", "wurde", "ein", "Hoehenlungenoedem", "(", "HLOE", ")", "diagnostiziert", ".", "Das", "HLOE", "ist", "ein", "nicht", "kardiales", "Lungenoedem", ",", "das", "gesunde", "Individuen", "zumeist", "in", "Hoehen", "ueber", "3000", "m", "befaellt", ".", "Ausloesende", "Faktoren", "sind", "ein", "zu", "rascher", "Aufstieg", ",", "starke", "koerperliche", "Belastung", ",", "eine", "in", "bezug", "auf", "die", "bestehende", "Hypoxaemie", "zu", "geringe", "Hyperventilation", ",", "sowie", "Regulationsstoerungen", "im", "Wasser-", "und", "Elektrolythaushalt", ".", "Die", "vordringlichste", "und", "wirkungsvollste", "Therapie", "ist", "neben", "der", "Gabe", "von", "Sauerstoff", "ein", "rascher", "Abtransport", "ins", "Tal", ".", "Zusaetzlich", "empfohlen", "wird", "die", "Anwendung", "von", "Kalzium", "-", "Kanal", "-", "Blockern", "(", "Nifedipin", ")", ",", "um", "den", "beim", "HLOE", "erhoehten", "pulmonalarteriellen", "Druck", "zu", "senken", ".", "Eine", "deutliche", "Verbesserung", "des", "pulmonalen", "Gasaustauschs", "kann", "durch", "zusaetzliche", "Applikation", "eines", "positiven", "endexspiratorischen", "Atemwegsdrucks", "erreicht", "werden", "." ]
[ "umlsterm" ]
Mann, Appetitlosigkeit, Kopfschmerzen, Husten, Atemnot, Patient, Notarzthubschrauber, Krankenhaus, Thoraxroentgen, Lungenoedem, Lunge, Blutgasanalyse, Hypoxaemie, pulmonale Gasaustausch, Patient, Thoraxroentgen, Hoehenlungenoedem, Lungenoedem, Hoehen, Ausloesende Faktoren, Belastung, Hypoxaemie, Hyperventilation, Wasser-, Elektrolythaushalt, Therapie, Sauerstoff, Kalzium - Kanal - Blockern, Nifedipin, Druck, pulmonalen Gasaustauschs, Atemwegsdrucks
DerAnaesthesist.40430183.ger.abstr_task2
Sentence: Ein 45jaehriger , trainierter , gesunder Mann ( L. J. ) stieg innerhalb eines Tages von 300 m Seehoehe auf eine in 2500 m gelegene Schutzhuette in den Tiroler Alpen auf , von der aus er Tagestouren auf Gipfel bis 3356 m unternahm . Am vierten Tag kam es zum Auftreten von Appetitlosigkeit , Kopfschmerzen , Husten und zunehmender Atemnot bis hin zu schwerster Ruhedyspnoe . Am darauffolgenden Tag wurde der Patient mit dem Notarzthubschrauber geborgen und in ein Krankenhaus im Tal gebracht . Das Thoraxroentgen zum Zeitpunkt der Aufnahme zeigte ein bilaterales , alveolaeres Lungenoedem mit staerkerer Auspraegung im Bereich der rechten Lunge . Eine kapillaere Blutgasanalyse ergab eine schwere Hypoxaemie ( PcapO2=25,7 mm Hg ) . Der pulmonale Gasaustausch normalisierte sich innerhalb weniger Stunden , nach zwei Tagen fuehlte sich der Patient beschwerdefrei . Ein weiteres Thoraxroentgen nach vier Tagen war unauffaellig . Aufgrund dieses typischen klinischen Verlaufs wurde ein Hoehenlungenoedem ( HLOE ) diagnostiziert . Das HLOE ist ein nicht kardiales Lungenoedem , das gesunde Individuen zumeist in Hoehen ueber 3000 m befaellt . Ausloesende Faktoren sind ein zu rascher Aufstieg , starke koerperliche Belastung , eine in bezug auf die bestehende Hypoxaemie zu geringe Hyperventilation , sowie Regulationsstoerungen im Wasser- und Elektrolythaushalt . Die vordringlichste und wirkungsvollste Therapie ist neben der Gabe von Sauerstoff ein rascher Abtransport ins Tal . Zusaetzlich empfohlen wird die Anwendung von Kalzium-Kanal-Blockern ( Nifedipin ) , um den beim HLOE erhoehten pulmonalarteriellen Druck zu senken . Eine deutliche Verbesserung des pulmonalen Gasaustauschs kann durch zusaetzliche Applikation eines positiven endexspiratorischen Atemwegsdrucks erreicht werden . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O" ]
Ein 45jaehriger , trainierter , gesunder Mann ( L. J. ) stieg innerhalb eines Tages von 300 m Seehoehe auf eine in 2500 m gelegene Schutzhuette in den Tiroler Alpen auf , von der aus er Tagestouren auf Gipfel bis 3356 m unternahm . Am vierten Tag kam es zum Auftreten von Appetitlosigkeit , Kopfschmerzen , Husten und zunehmender Atemnot bis hin zu schwerster Ruhedyspnoe . Am darauffolgenden Tag wurde der Patient mit dem Notarzthubschrauber geborgen und in ein Krankenhaus im Tal gebracht . Das Thoraxroentgen zum Zeitpunkt der Aufnahme zeigte ein bilaterales , alveolaeres Lungenoedem mit staerkerer Auspraegung im Bereich der rechten Lunge . Eine kapillaere Blutgasanalyse ergab eine schwere Hypoxaemie ( PcapO2=25,7 mm Hg ) . Der pulmonale Gasaustausch normalisierte sich innerhalb weniger Stunden , nach zwei Tagen fuehlte sich der Patient beschwerdefrei . Ein weiteres Thoraxroentgen nach vier Tagen war unauffaellig . Aufgrund dieses typischen klinischen Verlaufs wurde ein Hoehenlungenoedem ( HLOE ) diagnostiziert . Das HLOE ist ein nicht kardiales Lungenoedem , das gesunde Individuen zumeist in Hoehen ueber 3000 m befaellt . Ausloesende Faktoren sind ein zu rascher Aufstieg , starke koerperliche Belastung , eine in bezug auf die bestehende Hypoxaemie zu geringe Hyperventilation , sowie Regulationsstoerungen im Wasser- und Elektrolythaushalt . Die vordringlichste und wirkungsvollste Therapie ist neben der Gabe von Sauerstoff ein rascher Abtransport ins Tal . Zusaetzlich empfohlen wird die Anwendung von Kalzium-Kanal-Blockern ( Nifedipin ) , um den beim HLOE erhoehten pulmonalarteriellen Druck zu senken . Eine deutliche Verbesserung des pulmonalen Gasaustauschs kann durch zusaetzliche Applikation eines positiven endexspiratorischen Atemwegsdrucks erreicht werden .
[ "Ein", "45jaehriger", ",", "trainierter", ",", "gesunder", "Mann", "(", "L.", "J.", ")", "stieg", "innerhalb", "eines", "Tages", "von", "300", "m", "Seehoehe", "auf", "eine", "in", "2500", "m", "gelegene", "Schutzhuette", "in", "den", "Tiroler", "Alpen", "auf", ",", "von", "der", "aus", "er", "Tagestouren", "auf", "Gipfel", "bis", "3356", "m", "unternahm", ".", "Am", "vierten", "Tag", "kam", "es", "zum", "Auftreten", "von", "Appetitlosigkeit", ",", "Kopfschmerzen", ",", "Husten", "und", "zunehmender", "Atemnot", "bis", "hin", "zu", "schwerster", "Ruhedyspnoe", ".", "Am", "darauffolgenden", "Tag", "wurde", "der", "Patient", "mit", "dem", "Notarzthubschrauber", "geborgen", "und", "in", "ein", "Krankenhaus", "im", "Tal", "gebracht", ".", "Das", "Thoraxroentgen", "zum", "Zeitpunkt", "der", "Aufnahme", "zeigte", "ein", "bilaterales", ",", "alveolaeres", "Lungenoedem", "mit", "staerkerer", "Auspraegung", "im", "Bereich", "der", "rechten", "Lunge", ".", "Eine", "kapillaere", "Blutgasanalyse", "ergab", "eine", "schwere", "Hypoxaemie", "(", "PcapO2=25,7", "mm", "Hg", ")", ".", "Der", "pulmonale", "Gasaustausch", "normalisierte", "sich", "innerhalb", "weniger", "Stunden", ",", "nach", "zwei", "Tagen", "fuehlte", "sich", "der", "Patient", "beschwerdefrei", ".", "Ein", "weiteres", "Thoraxroentgen", "nach", "vier", "Tagen", "war", "unauffaellig", ".", "Aufgrund", "dieses", "typischen", "klinischen", "Verlaufs", "wurde", "ein", "Hoehenlungenoedem", "(", "HLOE", ")", "diagnostiziert", ".", "Das", "HLOE", "ist", "ein", "nicht", "kardiales", "Lungenoedem", ",", "das", "gesunde", "Individuen", "zumeist", "in", "Hoehen", "ueber", "3000", "m", "befaellt", ".", "Ausloesende", "Faktoren", "sind", "ein", "zu", "rascher", "Aufstieg", ",", "starke", "koerperliche", "Belastung", ",", "eine", "in", "bezug", "auf", "die", "bestehende", "Hypoxaemie", "zu", "geringe", "Hyperventilation", ",", "sowie", "Regulationsstoerungen", "im", "Wasser-", "und", "Elektrolythaushalt", ".", "Die", "vordringlichste", "und", "wirkungsvollste", "Therapie", "ist", "neben", "der", "Gabe", "von", "Sauerstoff", "ein", "rascher", "Abtransport", "ins", "Tal", ".", "Zusaetzlich", "empfohlen", "wird", "die", "Anwendung", "von", "Kalzium", "-", "Kanal", "-", "Blockern", "(", "Nifedipin", ")", ",", "um", "den", "beim", "HLOE", "erhoehten", "pulmonalarteriellen", "Druck", "zu", "senken", ".", "Eine", "deutliche", "Verbesserung", "des", "pulmonalen", "Gasaustauschs", "kann", "durch", "zusaetzliche", "Applikation", "eines", "positiven", "endexspiratorischen", "Atemwegsdrucks", "erreicht", "werden", "." ]
[ "umlsterm" ]
Vitamin D is an umlsterm, Kalzium is an umlsterm, Therapie is an umlsterm, Osteoporose is an umlsterm, Vitamin D is an umlsterm, Patienten is an umlsterm, Frakturen is an umlsterm, Patienten is an umlsterm, Langzeit - Corticoid - Therapie is an umlsterm, Kalzium is an umlsterm, Vitamin is an umlsterm, Kalzium is an umlsterm, Geschlecht is an umlsterm, Knochendichte is an umlsterm, Lendenwirbelsaeule is an umlsterm, Frakturen is an umlsterm, Therapie is an umlsterm, Knochendichte is an umlsterm, Knochendichteerhoehungen is an umlsterm, Frakturen is an umlsterm, Patienten is an umlsterm, Patienten is an umlsterm, Rueckenschmerzen is an umlsterm, Therapie is an umlsterm, Behandlung is an umlsterm, Vitamin D is an umlsterm, Therapie is an umlsterm, Osteoporose is an umlsterm
ZfuerRheumatologie.00590176.ger.abstr_task0
Sentence: Die Supplementation mit Vitamin D und Kalzium wurde bislang bevorzugt in der Therapie der Glucocorticoid-induzierten Osteoporose ( GIOP ) eingesetzt . Ziel unserer Studie war es , die Effektivitaet des D-Hormons Alfacalcidol im Vergleich zu Vitamin D bei Patienten mit manifester GIOP mit und ohne vertebralen Frakturen zu untersuchen . Patienten , die unter Langzeit-Corticoid-Therapie standen , wurden entweder mit 1µg Alfacalcidol plus 500mg Kalzium taeglich ( Gruppe A , N=43) oder 1000I . E. Vitamin D3 plus 500mg Kalzium pro Tag ( Gruppe B , N=42) therapiert . Die zwei Gruppen unterschieden sich nicht hinsichtlich soziodemographischer Parameter wie Alter , Geschlecht und Begleiterkrankungen , sowie der initialen Knochendichte ( Messwerte an der Lendenwirbelsaeule ( LWS ) und am Schenkelhals : mittlerer T-Score -3 , 28 und 3,25 resp. ) und der Anzahl vorliegender vertebraler und peripherer Frakturen . Waehrend der dreijaehrigen Therapie verzeichneten wir einen signifikanten Anstieg der Knochendichte an der LWS in der Gruppe A ( +2 , 0% , p 0,0001 ) , in Gruppe B konnten keine signifikanten Knochendichteerhoehungen sowohl an der LWS als auch am Schenkelhals registriert werden . Im dreijaehrigen Behandlungszeitraum traten 12 neue vertebrale Frakturen bei 10 Patienten in der Gruppe A und 21 bei 17 Patienten in der Gruppe B auf ns ) . ( In Uebereinstimmung damit konnte eine signifikante Abnahme der Rueckenschmerzen in der Gruppe A festgestellt werden ( p 0,0001 ) , waehrenddessen diesbezueglich keine Veraenderung der Symptomatik in der Gruppe B auftrat . Wir schlussfolgern , dass die Therapie mit Alfacalcidol der Behandlung mit Vitamin D bei der Therapie der Glucocorticoid-induzierten Osteoporose ueberlegen ist . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O" ]
Die Supplementation mit Vitamin D und Kalzium wurde bislang bevorzugt in der Therapie der Glucocorticoid-induzierten Osteoporose ( GIOP ) eingesetzt . Ziel unserer Studie war es , die Effektivitaet des D-Hormons Alfacalcidol im Vergleich zu Vitamin D bei Patienten mit manifester GIOP mit und ohne vertebralen Frakturen zu untersuchen . Patienten , die unter Langzeit-Corticoid-Therapie standen , wurden entweder mit 1µg Alfacalcidol plus 500mg Kalzium taeglich ( Gruppe A , N=43) oder 1000I . E. Vitamin D3 plus 500mg Kalzium pro Tag ( Gruppe B , N=42) therapiert . Die zwei Gruppen unterschieden sich nicht hinsichtlich soziodemographischer Parameter wie Alter , Geschlecht und Begleiterkrankungen , sowie der initialen Knochendichte ( Messwerte an der Lendenwirbelsaeule ( LWS ) und am Schenkelhals : mittlerer T-Score -3 , 28 und 3,25 resp. ) und der Anzahl vorliegender vertebraler und peripherer Frakturen . Waehrend der dreijaehrigen Therapie verzeichneten wir einen signifikanten Anstieg der Knochendichte an der LWS in der Gruppe A ( +2 , 0% , p 0,0001 ) , in Gruppe B konnten keine signifikanten Knochendichteerhoehungen sowohl an der LWS als auch am Schenkelhals registriert werden . Im dreijaehrigen Behandlungszeitraum traten 12 neue vertebrale Frakturen bei 10 Patienten in der Gruppe A und 21 bei 17 Patienten in der Gruppe B auf ns ) . ( In Uebereinstimmung damit konnte eine signifikante Abnahme der Rueckenschmerzen in der Gruppe A festgestellt werden ( p 0,0001 ) , waehrenddessen diesbezueglich keine Veraenderung der Symptomatik in der Gruppe B auftrat . Wir schlussfolgern , dass die Therapie mit Alfacalcidol der Behandlung mit Vitamin D bei der Therapie der Glucocorticoid-induzierten Osteoporose ueberlegen ist .
[ "Die", "Supplementation", "mit", "Vitamin", "D", "und", "Kalzium", "wurde", "bislang", "bevorzugt", "in", "der", "Therapie", "der", "Glucocorticoid", "-", "induzierten", "Osteoporose", "(", "GIOP", ")", "eingesetzt", ".", "Ziel", "unserer", "Studie", "war", "es", ",", "die", "Effektivitaet", "des", "D", "-", "Hormons", "Alfacalcidol", "im", "Vergleich", "zu", "Vitamin", "D", "bei", "Patienten", "mit", "manifester", "GIOP", "mit", "und", "ohne", "vertebralen", "Frakturen", "zu", "untersuchen", ".", "Patienten", ",", "die", "unter", "Langzeit", "-", "Corticoid", "-", "Therapie", "standen", ",", "wurden", "entweder", "mit", "1", "µg", "Alfacalcidol", "plus", "500", "mg", "Kalzium", "taeglich", "(", "Gruppe", "A", ",", "N=43", ")", "oder", "1000I", ".", "E.", "Vitamin", "D3", "plus", "500", "mg", "Kalzium", "pro", "Tag", "(", "Gruppe", "B", ",", "N=42", ")", "therapiert", ".", "Die", "zwei", "Gruppen", "unterschieden", "sich", "nicht", "hinsichtlich", "soziodemographischer", "Parameter", "wie", "Alter", ",", "Geschlecht", "und", "Begleiterkrankungen", ",", "sowie", "der", "initialen", "Knochendichte", "(", "Messwerte", "an", "der", "Lendenwirbelsaeule", "(", "LWS", ")", "und", "am", "Schenkelhals", ":", "mittlerer", "T", "-", "Score", "-3", ",", "28", "und", "3,25", "resp", ".", ")", "und", "der", "Anzahl", "vorliegender", "vertebraler", "und", "peripherer", "Frakturen", ".", "Waehrend", "der", "dreijaehrigen", "Therapie", "verzeichneten", "wir", "einen", "signifikanten", "Anstieg", "der", "Knochendichte", "an", "der", "LWS", "in", "der", "Gruppe", "A", "(", "+2", ",", "0", "%", ",", "p", "0,0001", ")", ",", "in", "Gruppe", "B", "konnten", "keine", "signifikanten", "Knochendichteerhoehungen", "sowohl", "an", "der", "LWS", "als", "auch", "am", "Schenkelhals", "registriert", "werden", ".", "Im", "dreijaehrigen", "Behandlungszeitraum", "traten", "12", "neue", "vertebrale", "Frakturen", "bei", "10", "Patienten", "in", "der", "Gruppe", "A", "und", "21", "bei", "17", "Patienten", "in", "der", "Gruppe", "B", "auf", "ns", ")", ".", "(", "In", "Uebereinstimmung", "damit", "konnte", "eine", "signifikante", "Abnahme", "der", "Rueckenschmerzen", "in", "der", "Gruppe", "A", "festgestellt", "werden", "(", "p", "0,0001", ")", ",", "waehrenddessen", "diesbezueglich", "keine", "Veraenderung", "der", "Symptomatik", "in", "der", "Gruppe", "B", "auftrat", ".", "Wir", "schlussfolgern", ",", "dass", "die", "Therapie", "mit", "Alfacalcidol", "der", "Behandlung", "mit", "Vitamin", "D", "bei", "der", "Therapie", "der", "Glucocorticoid", "-", "induzierten", "Osteoporose", "ueberlegen", "ist", "." ]
[ "umlsterm" ]
Vitamin D is an umlsterm, Kalzium is an umlsterm, Therapie is an umlsterm, Osteoporose is an umlsterm, Vitamin D is an umlsterm, Patienten is an umlsterm, Frakturen is an umlsterm, Patienten is an umlsterm, Langzeit - Corticoid - Therapie is an umlsterm, Kalzium is an umlsterm, Vitamin is an umlsterm, Kalzium is an umlsterm, Geschlecht is an umlsterm, Knochendichte is an umlsterm, Lendenwirbelsaeule is an umlsterm, Frakturen is an umlsterm, Therapie is an umlsterm, Knochendichte is an umlsterm, Knochendichteerhoehungen is an umlsterm, Frakturen is an umlsterm, Patienten is an umlsterm, Patienten is an umlsterm, Rueckenschmerzen is an umlsterm, Therapie is an umlsterm, Behandlung is an umlsterm, Vitamin D is an umlsterm, Therapie is an umlsterm, Osteoporose is an umlsterm
ZfuerRheumatologie.00590176.ger.abstr_task1
Sentence: Die Supplementation mit Vitamin D und Kalzium wurde bislang bevorzugt in der Therapie der Glucocorticoid-induzierten Osteoporose ( GIOP ) eingesetzt . Ziel unserer Studie war es , die Effektivitaet des D-Hormons Alfacalcidol im Vergleich zu Vitamin D bei Patienten mit manifester GIOP mit und ohne vertebralen Frakturen zu untersuchen . Patienten , die unter Langzeit-Corticoid-Therapie standen , wurden entweder mit 1µg Alfacalcidol plus 500mg Kalzium taeglich ( Gruppe A , N=43) oder 1000I . E. Vitamin D3 plus 500mg Kalzium pro Tag ( Gruppe B , N=42) therapiert . Die zwei Gruppen unterschieden sich nicht hinsichtlich soziodemographischer Parameter wie Alter , Geschlecht und Begleiterkrankungen , sowie der initialen Knochendichte ( Messwerte an der Lendenwirbelsaeule ( LWS ) und am Schenkelhals : mittlerer T-Score -3 , 28 und 3,25 resp. ) und der Anzahl vorliegender vertebraler und peripherer Frakturen . Waehrend der dreijaehrigen Therapie verzeichneten wir einen signifikanten Anstieg der Knochendichte an der LWS in der Gruppe A ( +2 , 0% , p 0,0001 ) , in Gruppe B konnten keine signifikanten Knochendichteerhoehungen sowohl an der LWS als auch am Schenkelhals registriert werden . Im dreijaehrigen Behandlungszeitraum traten 12 neue vertebrale Frakturen bei 10 Patienten in der Gruppe A und 21 bei 17 Patienten in der Gruppe B auf ns ) . ( In Uebereinstimmung damit konnte eine signifikante Abnahme der Rueckenschmerzen in der Gruppe A festgestellt werden ( p 0,0001 ) , waehrenddessen diesbezueglich keine Veraenderung der Symptomatik in der Gruppe B auftrat . Wir schlussfolgern , dass die Therapie mit Alfacalcidol der Behandlung mit Vitamin D bei der Therapie der Glucocorticoid-induzierten Osteoporose ueberlegen ist . Instructions: please typing these entity words according to sentence: Vitamin D, Kalzium, Therapie, Osteoporose, Vitamin D, Patienten, Frakturen, Patienten, Langzeit - Corticoid - Therapie, Kalzium, Vitamin, Kalzium, Geschlecht, Knochendichte, Lendenwirbelsaeule, Frakturen, Therapie, Knochendichte, Knochendichteerhoehungen, Frakturen, Patienten, Patienten, Rueckenschmerzen, Therapie, Behandlung, Vitamin D, Therapie, Osteoporose Options: umlsterm
[ "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O" ]
Die Supplementation mit Vitamin D und Kalzium wurde bislang bevorzugt in der Therapie der Glucocorticoid-induzierten Osteoporose ( GIOP ) eingesetzt . Ziel unserer Studie war es , die Effektivitaet des D-Hormons Alfacalcidol im Vergleich zu Vitamin D bei Patienten mit manifester GIOP mit und ohne vertebralen Frakturen zu untersuchen . Patienten , die unter Langzeit-Corticoid-Therapie standen , wurden entweder mit 1µg Alfacalcidol plus 500mg Kalzium taeglich ( Gruppe A , N=43) oder 1000I . E. Vitamin D3 plus 500mg Kalzium pro Tag ( Gruppe B , N=42) therapiert . Die zwei Gruppen unterschieden sich nicht hinsichtlich soziodemographischer Parameter wie Alter , Geschlecht und Begleiterkrankungen , sowie der initialen Knochendichte ( Messwerte an der Lendenwirbelsaeule ( LWS ) und am Schenkelhals : mittlerer T-Score -3 , 28 und 3,25 resp. ) und der Anzahl vorliegender vertebraler und peripherer Frakturen . Waehrend der dreijaehrigen Therapie verzeichneten wir einen signifikanten Anstieg der Knochendichte an der LWS in der Gruppe A ( +2 , 0% , p 0,0001 ) , in Gruppe B konnten keine signifikanten Knochendichteerhoehungen sowohl an der LWS als auch am Schenkelhals registriert werden . Im dreijaehrigen Behandlungszeitraum traten 12 neue vertebrale Frakturen bei 10 Patienten in der Gruppe A und 21 bei 17 Patienten in der Gruppe B auf ns ) . ( In Uebereinstimmung damit konnte eine signifikante Abnahme der Rueckenschmerzen in der Gruppe A festgestellt werden ( p 0,0001 ) , waehrenddessen diesbezueglich keine Veraenderung der Symptomatik in der Gruppe B auftrat . Wir schlussfolgern , dass die Therapie mit Alfacalcidol der Behandlung mit Vitamin D bei der Therapie der Glucocorticoid-induzierten Osteoporose ueberlegen ist .
[ "Die", "Supplementation", "mit", "Vitamin", "D", "und", "Kalzium", "wurde", "bislang", "bevorzugt", "in", "der", "Therapie", "der", "Glucocorticoid", "-", "induzierten", "Osteoporose", "(", "GIOP", ")", "eingesetzt", ".", "Ziel", "unserer", "Studie", "war", "es", ",", "die", "Effektivitaet", "des", "D", "-", "Hormons", "Alfacalcidol", "im", "Vergleich", "zu", "Vitamin", "D", "bei", "Patienten", "mit", "manifester", "GIOP", "mit", "und", "ohne", "vertebralen", "Frakturen", "zu", "untersuchen", ".", "Patienten", ",", "die", "unter", "Langzeit", "-", "Corticoid", "-", "Therapie", "standen", ",", "wurden", "entweder", "mit", "1", "µg", "Alfacalcidol", "plus", "500", "mg", "Kalzium", "taeglich", "(", "Gruppe", "A", ",", "N=43", ")", "oder", "1000I", ".", "E.", "Vitamin", "D3", "plus", "500", "mg", "Kalzium", "pro", "Tag", "(", "Gruppe", "B", ",", "N=42", ")", "therapiert", ".", "Die", "zwei", "Gruppen", "unterschieden", "sich", "nicht", "hinsichtlich", "soziodemographischer", "Parameter", "wie", "Alter", ",", "Geschlecht", "und", "Begleiterkrankungen", ",", "sowie", "der", "initialen", "Knochendichte", "(", "Messwerte", "an", "der", "Lendenwirbelsaeule", "(", "LWS", ")", "und", "am", "Schenkelhals", ":", "mittlerer", "T", "-", "Score", "-3", ",", "28", "und", "3,25", "resp", ".", ")", "und", "der", "Anzahl", "vorliegender", "vertebraler", "und", "peripherer", "Frakturen", ".", "Waehrend", "der", "dreijaehrigen", "Therapie", "verzeichneten", "wir", "einen", "signifikanten", "Anstieg", "der", "Knochendichte", "an", "der", "LWS", "in", "der", "Gruppe", "A", "(", "+2", ",", "0", "%", ",", "p", "0,0001", ")", ",", "in", "Gruppe", "B", "konnten", "keine", "signifikanten", "Knochendichteerhoehungen", "sowohl", "an", "der", "LWS", "als", "auch", "am", "Schenkelhals", "registriert", "werden", ".", "Im", "dreijaehrigen", "Behandlungszeitraum", "traten", "12", "neue", "vertebrale", "Frakturen", "bei", "10", "Patienten", "in", "der", "Gruppe", "A", "und", "21", "bei", "17", "Patienten", "in", "der", "Gruppe", "B", "auf", "ns", ")", ".", "(", "In", "Uebereinstimmung", "damit", "konnte", "eine", "signifikante", "Abnahme", "der", "Rueckenschmerzen", "in", "der", "Gruppe", "A", "festgestellt", "werden", "(", "p", "0,0001", ")", ",", "waehrenddessen", "diesbezueglich", "keine", "Veraenderung", "der", "Symptomatik", "in", "der", "Gruppe", "B", "auftrat", ".", "Wir", "schlussfolgern", ",", "dass", "die", "Therapie", "mit", "Alfacalcidol", "der", "Behandlung", "mit", "Vitamin", "D", "bei", "der", "Therapie", "der", "Glucocorticoid", "-", "induzierten", "Osteoporose", "ueberlegen", "ist", "." ]
[ "umlsterm" ]
Vitamin D, Kalzium, Therapie, Osteoporose, Vitamin D, Patienten, Frakturen, Patienten, Langzeit - Corticoid - Therapie, Kalzium, Vitamin, Kalzium, Geschlecht, Knochendichte, Lendenwirbelsaeule, Frakturen, Therapie, Knochendichte, Knochendichteerhoehungen, Frakturen, Patienten, Patienten, Rueckenschmerzen, Therapie, Behandlung, Vitamin D, Therapie, Osteoporose
ZfuerRheumatologie.00590176.ger.abstr_task2
Sentence: Die Supplementation mit Vitamin D und Kalzium wurde bislang bevorzugt in der Therapie der Glucocorticoid-induzierten Osteoporose ( GIOP ) eingesetzt . Ziel unserer Studie war es , die Effektivitaet des D-Hormons Alfacalcidol im Vergleich zu Vitamin D bei Patienten mit manifester GIOP mit und ohne vertebralen Frakturen zu untersuchen . Patienten , die unter Langzeit-Corticoid-Therapie standen , wurden entweder mit 1µg Alfacalcidol plus 500mg Kalzium taeglich ( Gruppe A , N=43) oder 1000I . E. Vitamin D3 plus 500mg Kalzium pro Tag ( Gruppe B , N=42) therapiert . Die zwei Gruppen unterschieden sich nicht hinsichtlich soziodemographischer Parameter wie Alter , Geschlecht und Begleiterkrankungen , sowie der initialen Knochendichte ( Messwerte an der Lendenwirbelsaeule ( LWS ) und am Schenkelhals : mittlerer T-Score -3 , 28 und 3,25 resp. ) und der Anzahl vorliegender vertebraler und peripherer Frakturen . Waehrend der dreijaehrigen Therapie verzeichneten wir einen signifikanten Anstieg der Knochendichte an der LWS in der Gruppe A ( +2 , 0% , p 0,0001 ) , in Gruppe B konnten keine signifikanten Knochendichteerhoehungen sowohl an der LWS als auch am Schenkelhals registriert werden . Im dreijaehrigen Behandlungszeitraum traten 12 neue vertebrale Frakturen bei 10 Patienten in der Gruppe A und 21 bei 17 Patienten in der Gruppe B auf ns ) . ( In Uebereinstimmung damit konnte eine signifikante Abnahme der Rueckenschmerzen in der Gruppe A festgestellt werden ( p 0,0001 ) , waehrenddessen diesbezueglich keine Veraenderung der Symptomatik in der Gruppe B auftrat . Wir schlussfolgern , dass die Therapie mit Alfacalcidol der Behandlung mit Vitamin D bei der Therapie der Glucocorticoid-induzierten Osteoporose ueberlegen ist . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O" ]
Die Supplementation mit Vitamin D und Kalzium wurde bislang bevorzugt in der Therapie der Glucocorticoid-induzierten Osteoporose ( GIOP ) eingesetzt . Ziel unserer Studie war es , die Effektivitaet des D-Hormons Alfacalcidol im Vergleich zu Vitamin D bei Patienten mit manifester GIOP mit und ohne vertebralen Frakturen zu untersuchen . Patienten , die unter Langzeit-Corticoid-Therapie standen , wurden entweder mit 1µg Alfacalcidol plus 500mg Kalzium taeglich ( Gruppe A , N=43) oder 1000I . E. Vitamin D3 plus 500mg Kalzium pro Tag ( Gruppe B , N=42) therapiert . Die zwei Gruppen unterschieden sich nicht hinsichtlich soziodemographischer Parameter wie Alter , Geschlecht und Begleiterkrankungen , sowie der initialen Knochendichte ( Messwerte an der Lendenwirbelsaeule ( LWS ) und am Schenkelhals : mittlerer T-Score -3 , 28 und 3,25 resp. ) und der Anzahl vorliegender vertebraler und peripherer Frakturen . Waehrend der dreijaehrigen Therapie verzeichneten wir einen signifikanten Anstieg der Knochendichte an der LWS in der Gruppe A ( +2 , 0% , p 0,0001 ) , in Gruppe B konnten keine signifikanten Knochendichteerhoehungen sowohl an der LWS als auch am Schenkelhals registriert werden . Im dreijaehrigen Behandlungszeitraum traten 12 neue vertebrale Frakturen bei 10 Patienten in der Gruppe A und 21 bei 17 Patienten in der Gruppe B auf ns ) . ( In Uebereinstimmung damit konnte eine signifikante Abnahme der Rueckenschmerzen in der Gruppe A festgestellt werden ( p 0,0001 ) , waehrenddessen diesbezueglich keine Veraenderung der Symptomatik in der Gruppe B auftrat . Wir schlussfolgern , dass die Therapie mit Alfacalcidol der Behandlung mit Vitamin D bei der Therapie der Glucocorticoid-induzierten Osteoporose ueberlegen ist .
[ "Die", "Supplementation", "mit", "Vitamin", "D", "und", "Kalzium", "wurde", "bislang", "bevorzugt", "in", "der", "Therapie", "der", "Glucocorticoid", "-", "induzierten", "Osteoporose", "(", "GIOP", ")", "eingesetzt", ".", "Ziel", "unserer", "Studie", "war", "es", ",", "die", "Effektivitaet", "des", "D", "-", "Hormons", "Alfacalcidol", "im", "Vergleich", "zu", "Vitamin", "D", "bei", "Patienten", "mit", "manifester", "GIOP", "mit", "und", "ohne", "vertebralen", "Frakturen", "zu", "untersuchen", ".", "Patienten", ",", "die", "unter", "Langzeit", "-", "Corticoid", "-", "Therapie", "standen", ",", "wurden", "entweder", "mit", "1", "µg", "Alfacalcidol", "plus", "500", "mg", "Kalzium", "taeglich", "(", "Gruppe", "A", ",", "N=43", ")", "oder", "1000I", ".", "E.", "Vitamin", "D3", "plus", "500", "mg", "Kalzium", "pro", "Tag", "(", "Gruppe", "B", ",", "N=42", ")", "therapiert", ".", "Die", "zwei", "Gruppen", "unterschieden", "sich", "nicht", "hinsichtlich", "soziodemographischer", "Parameter", "wie", "Alter", ",", "Geschlecht", "und", "Begleiterkrankungen", ",", "sowie", "der", "initialen", "Knochendichte", "(", "Messwerte", "an", "der", "Lendenwirbelsaeule", "(", "LWS", ")", "und", "am", "Schenkelhals", ":", "mittlerer", "T", "-", "Score", "-3", ",", "28", "und", "3,25", "resp", ".", ")", "und", "der", "Anzahl", "vorliegender", "vertebraler", "und", "peripherer", "Frakturen", ".", "Waehrend", "der", "dreijaehrigen", "Therapie", "verzeichneten", "wir", "einen", "signifikanten", "Anstieg", "der", "Knochendichte", "an", "der", "LWS", "in", "der", "Gruppe", "A", "(", "+2", ",", "0", "%", ",", "p", "0,0001", ")", ",", "in", "Gruppe", "B", "konnten", "keine", "signifikanten", "Knochendichteerhoehungen", "sowohl", "an", "der", "LWS", "als", "auch", "am", "Schenkelhals", "registriert", "werden", ".", "Im", "dreijaehrigen", "Behandlungszeitraum", "traten", "12", "neue", "vertebrale", "Frakturen", "bei", "10", "Patienten", "in", "der", "Gruppe", "A", "und", "21", "bei", "17", "Patienten", "in", "der", "Gruppe", "B", "auf", "ns", ")", ".", "(", "In", "Uebereinstimmung", "damit", "konnte", "eine", "signifikante", "Abnahme", "der", "Rueckenschmerzen", "in", "der", "Gruppe", "A", "festgestellt", "werden", "(", "p", "0,0001", ")", ",", "waehrenddessen", "diesbezueglich", "keine", "Veraenderung", "der", "Symptomatik", "in", "der", "Gruppe", "B", "auftrat", ".", "Wir", "schlussfolgern", ",", "dass", "die", "Therapie", "mit", "Alfacalcidol", "der", "Behandlung", "mit", "Vitamin", "D", "bei", "der", "Therapie", "der", "Glucocorticoid", "-", "induzierten", "Osteoporose", "ueberlegen", "ist", "." ]
[ "umlsterm" ]
VLA-4 is a Protein, VCAM-1 is a Protein
685_task0
Sentence: T-lymphocytes from individuals with filarial inflammatory disease have increased transendothelial migration in vitro. The in vitro transendothelial migration of circulating filarial antigen-specific T-cells was examined in Wuchereria banerofti infection. Circulating T-cells from individuals with filaria-induced lymphatic pathology (LP) had significantly greater migration through unstimulated HUVEC monolayers than did T-cells from asymptomatic infected (MF) individuals (P = 0.04). In contrast to the MF individuals where no effect was seen, transendothelial migration of 48-hr filarial antigen stimulated T-cells from LP individuals was significantly (P = 0.01) greater than migration of 48-hr media-stimulated T-cells. In six of seven patients examined, inhibition of the VLA-4/VCAM-1 pathway resulted in greater than 50% inhibition of transendothelial migration of T-cells. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Protein
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
T-lymphocytes from individuals with filarial inflammatory disease have increased transendothelial migration in vitro. The in vitro transendothelial migration of circulating filarial antigen-specific T-cells was examined in Wuchereria banerofti infection. Circulating T-cells from individuals with filaria-induced lymphatic pathology (LP) had significantly greater migration through unstimulated HUVEC monolayers than did T-cells from asymptomatic infected (MF) individuals (P = 0.04). In contrast to the MF individuals where no effect was seen, transendothelial migration of 48-hr filarial antigen stimulated T-cells from LP individuals was significantly (P = 0.01) greater than migration of 48-hr media-stimulated T-cells. In six of seven patients examined, inhibition of the VLA-4/VCAM-1 pathway resulted in greater than 50% inhibition of transendothelial migration of T-cells.
[ "T", "-", "lymphocytes", "from", "individuals", "with", "filarial", "inflammatory", "disease", "have", "increased", "transendothelial", "migration", "in", "vitro", ".", "\n", "The", "in", "vitro", "transendothelial", "migration", "of", "circulating", "filarial", "antigen", "-", "specific", "T", "-", "cells", "was", "examined", "in", "Wuchereria", "banerofti", "infection", ".", "Circulating", "T", "-", "cells", "from", "individuals", "with", "filaria", "-", "induced", "lymphatic", "pathology", "(", "LP", ")", "had", "significantly", "greater", "migration", "through", "unstimulated", "HUVEC", "monolayers", "than", "did", "T", "-", "cells", "from", "asymptomatic", "infected", "(", "MF", ")", "individuals", "(", "P", "=", "0.04", ")", ".", "In", "contrast", "to", "the", "MF", "individuals", "where", "no", "effect", "was", "seen", ",", "transendothelial", "migration", "of", "48-hr", "filarial", "antigen", "stimulated", "T", "-", "cells", "from", "LP", "individuals", "was", "significantly", "(", "P", "=", "0.01", ")", "greater", "than", "migration", "of", "48-hr", "media", "-", "stimulated", "T", "-", "cells", ".", "In", "six", "of", "seven", "patients", "examined", ",", "inhibition", "of", "the", "VLA-4", "/", "VCAM-1", "pathway", "resulted", "in", "greater", "than", "50", "%", "inhibition", "of", "transendothelial", "migration", "of", "T", "-", "cells", "." ]
[ "Protein" ]
VLA-4 is a Protein, VCAM-1 is a Protein
685_task1
Sentence: T-lymphocytes from individuals with filarial inflammatory disease have increased transendothelial migration in vitro. The in vitro transendothelial migration of circulating filarial antigen-specific T-cells was examined in Wuchereria banerofti infection. Circulating T-cells from individuals with filaria-induced lymphatic pathology (LP) had significantly greater migration through unstimulated HUVEC monolayers than did T-cells from asymptomatic infected (MF) individuals (P = 0.04). In contrast to the MF individuals where no effect was seen, transendothelial migration of 48-hr filarial antigen stimulated T-cells from LP individuals was significantly (P = 0.01) greater than migration of 48-hr media-stimulated T-cells. In six of seven patients examined, inhibition of the VLA-4/VCAM-1 pathway resulted in greater than 50% inhibition of transendothelial migration of T-cells. Instructions: please typing these entity words according to sentence: VLA-4, VCAM-1 Options: Protein
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
T-lymphocytes from individuals with filarial inflammatory disease have increased transendothelial migration in vitro. The in vitro transendothelial migration of circulating filarial antigen-specific T-cells was examined in Wuchereria banerofti infection. Circulating T-cells from individuals with filaria-induced lymphatic pathology (LP) had significantly greater migration through unstimulated HUVEC monolayers than did T-cells from asymptomatic infected (MF) individuals (P = 0.04). In contrast to the MF individuals where no effect was seen, transendothelial migration of 48-hr filarial antigen stimulated T-cells from LP individuals was significantly (P = 0.01) greater than migration of 48-hr media-stimulated T-cells. In six of seven patients examined, inhibition of the VLA-4/VCAM-1 pathway resulted in greater than 50% inhibition of transendothelial migration of T-cells.
[ "T", "-", "lymphocytes", "from", "individuals", "with", "filarial", "inflammatory", "disease", "have", "increased", "transendothelial", "migration", "in", "vitro", ".", "\n", "The", "in", "vitro", "transendothelial", "migration", "of", "circulating", "filarial", "antigen", "-", "specific", "T", "-", "cells", "was", "examined", "in", "Wuchereria", "banerofti", "infection", ".", "Circulating", "T", "-", "cells", "from", "individuals", "with", "filaria", "-", "induced", "lymphatic", "pathology", "(", "LP", ")", "had", "significantly", "greater", "migration", "through", "unstimulated", "HUVEC", "monolayers", "than", "did", "T", "-", "cells", "from", "asymptomatic", "infected", "(", "MF", ")", "individuals", "(", "P", "=", "0.04", ")", ".", "In", "contrast", "to", "the", "MF", "individuals", "where", "no", "effect", "was", "seen", ",", "transendothelial", "migration", "of", "48-hr", "filarial", "antigen", "stimulated", "T", "-", "cells", "from", "LP", "individuals", "was", "significantly", "(", "P", "=", "0.01", ")", "greater", "than", "migration", "of", "48-hr", "media", "-", "stimulated", "T", "-", "cells", ".", "In", "six", "of", "seven", "patients", "examined", ",", "inhibition", "of", "the", "VLA-4", "/", "VCAM-1", "pathway", "resulted", "in", "greater", "than", "50", "%", "inhibition", "of", "transendothelial", "migration", "of", "T", "-", "cells", "." ]
[ "Protein" ]
VLA-4, VCAM-1
685_task2
Sentence: T-lymphocytes from individuals with filarial inflammatory disease have increased transendothelial migration in vitro. The in vitro transendothelial migration of circulating filarial antigen-specific T-cells was examined in Wuchereria banerofti infection. Circulating T-cells from individuals with filaria-induced lymphatic pathology (LP) had significantly greater migration through unstimulated HUVEC monolayers than did T-cells from asymptomatic infected (MF) individuals (P = 0.04). In contrast to the MF individuals where no effect was seen, transendothelial migration of 48-hr filarial antigen stimulated T-cells from LP individuals was significantly (P = 0.01) greater than migration of 48-hr media-stimulated T-cells. In six of seven patients examined, inhibition of the VLA-4/VCAM-1 pathway resulted in greater than 50% inhibition of transendothelial migration of T-cells. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
T-lymphocytes from individuals with filarial inflammatory disease have increased transendothelial migration in vitro. The in vitro transendothelial migration of circulating filarial antigen-specific T-cells was examined in Wuchereria banerofti infection. Circulating T-cells from individuals with filaria-induced lymphatic pathology (LP) had significantly greater migration through unstimulated HUVEC monolayers than did T-cells from asymptomatic infected (MF) individuals (P = 0.04). In contrast to the MF individuals where no effect was seen, transendothelial migration of 48-hr filarial antigen stimulated T-cells from LP individuals was significantly (P = 0.01) greater than migration of 48-hr media-stimulated T-cells. In six of seven patients examined, inhibition of the VLA-4/VCAM-1 pathway resulted in greater than 50% inhibition of transendothelial migration of T-cells.
[ "T", "-", "lymphocytes", "from", "individuals", "with", "filarial", "inflammatory", "disease", "have", "increased", "transendothelial", "migration", "in", "vitro", ".", "\n", "The", "in", "vitro", "transendothelial", "migration", "of", "circulating", "filarial", "antigen", "-", "specific", "T", "-", "cells", "was", "examined", "in", "Wuchereria", "banerofti", "infection", ".", "Circulating", "T", "-", "cells", "from", "individuals", "with", "filaria", "-", "induced", "lymphatic", "pathology", "(", "LP", ")", "had", "significantly", "greater", "migration", "through", "unstimulated", "HUVEC", "monolayers", "than", "did", "T", "-", "cells", "from", "asymptomatic", "infected", "(", "MF", ")", "individuals", "(", "P", "=", "0.04", ")", ".", "In", "contrast", "to", "the", "MF", "individuals", "where", "no", "effect", "was", "seen", ",", "transendothelial", "migration", "of", "48-hr", "filarial", "antigen", "stimulated", "T", "-", "cells", "from", "LP", "individuals", "was", "significantly", "(", "P", "=", "0.01", ")", "greater", "than", "migration", "of", "48-hr", "media", "-", "stimulated", "T", "-", "cells", ".", "In", "six", "of", "seven", "patients", "examined", ",", "inhibition", "of", "the", "VLA-4", "/", "VCAM-1", "pathway", "resulted", "in", "greater", "than", "50", "%", "inhibition", "of", "transendothelial", "migration", "of", "T", "-", "cells", "." ]
[ "Protein" ]
carcinoma microcítico is a MORFOLOGIA_NEOPLASIA, metástasis is a MORFOLOGIA_NEOPLASIA, metástasis is a MORFOLOGIA_NEOPLASIA, neoplásica is a MORFOLOGIA_NEOPLASIA
881_task0
Sentence: Anamnesis Varón de 68 años con antecedentes de hipertensión arterial, dislipemia y cardiopatía isquémica. En 2015, colocación de prótesis por aneurisma de aorta abdominal. Fumador importante con criterios clínicos de bronquitis crónica y disnea a moderados esfuerzos. En abril de 2016, es diagnosticado de carcinoma microcítico de lóbulo inferior derecho (LID), estadio IV, con metástasis ganglionares y pancreáticas. Durante el diagnóstico, marcadores tumorales: CEA 7,5 y enolasa neuroespecífica 69. Inicia tratamiento quimioterápico de primera línea con carboplatino-etopósido mostrando respuesta parcial de la masa pulmonar y las metástasis pancreáticas y ganglionares en TC tras 3 ciclos con descenso de enolasa neuroespecífica. Tras 4º ciclo, se pauta esquema de tratamiento con reducción del 20 % por toxicidad hematológica: trombopenia G1 y anemia G3. En controles adicionales por la Unidad de Medicina Paliativa, se pauta dexametasona 4 mg al día como orexígeno y oxigenoterapia domiciliaria con gafas nasales a 2 l/minuto. Como consecuencia, desarrolla hiperglucemias secundarias a tratamiento corticoide, precisando inicio de insulina subcutánea. Previamente al 6º ciclo, valorado en Urgencias por aumento de disnea, se realiza una TC dere-evaluación que objetiva progresión ganglionar mediastínica e hiliar. Masa pulmonar estable. Se suspende administración del 6º ciclo de carboplatino-etopósido, y se plantea tratamiento de segunda línea con topotecán oral que inicia en octubre de 2016. Ingresa desde Urgencias en el 5º día del primer ciclo de topotecán por neutropenia febril con probable foco respiratorio. Aunque no se evidencia infiltrado en la radiografía de tórax, se inicia tratamiento con antibioterapia de amplio espectro intravenosa: cefepima. Durante los primeros días de ingreso, el paciente refiere molestias en cavidad oral y a la exploración: mucositis G1 y muguet añadiendo fluconazol intravenoso y nistatina oral al tratamiento antibiótico. El 22 de octubre 2016 inicia cuadro de dolor intenso en región mandibular izquierda asociando edema en región maxilar izquierda y palpebral inferior ipsilateral. Exploración física Durante la exploración: exoftalmos de 3 mm en ojo izquierdo. Limitación a la supraducción del ojo con pupilas isocóricas y reactivas sin defecto pupilar aferente. No hay disminución de la agudeza visual. En cavidad oral: escara negro-grisácea en hemipaladar duro izquierdo de 3 cm de diámetro anteroposterior y 2 cm de diámetro transverso. Sin otras lesiones en cavidad oral ni adenopatías cervicales palpables. Durante la anamnesis dirigida: la lesión de paladar ha aparecido en las 24 horas previas. En fibroscopia nasal realizada por Otorrinolaringología, se objetivan restos hemáticos y perforación septal con tejido negruzco que obstruye la fosa nasal izquierda. Pruebas complementarias Se añade clindamicina para cobertura de gérmenes anaerobios y se solicita valoración y biopsia urgente de la lesión necrótica en paladar por parte de Cirugía Maxilofacial. Se realiza una TC facial urgente: muestra signos de sinusopatía etmoidal con presencia de niveles gas líquido, aumento de partes blandas a nivel de región mandibular izquierda y discontinuidad del músculo platisma del cuello. Se suspende fluconazol y se inicia tratamiento con anfotericina B liposomal 5 mg/kg de peso cada 24 horas por sospecha de mucormicosis. Diagnóstico En el cultivo de biopsia de paladar se confirma aislamiento de hongo filamentoso compatible con Rhizopus. Tratamiento Es valorado por Otorrinolaringología, donde se plantea intervención quirúrgica urgente el 24 de octubre 2016. En el protocolo quirúrgico se describe: mucormicosis que afecta a 2/3 anteriores de paladar duro, maxilar izquierdo, tabique nasal, órbita izquierda y celdas etmoidales posteriores y anteriores ipsilaterales. Se procede a exenteración orbitaria en bloque con maxilar y palatino izquierdos, importante necrosis de pared lateral nasal y de lámina papirácea. Objetivada trombosis de arterias etmoidales y mínima impronta de Mucor en base de cráneo a nivel de etmoides posterior (TC posquirúrgica). Tras la cirugía, el paciente precisa nutrición enteral por sonda nasogástrica. Se mantiene tratamiento con anfotericina B a dosis de 6 mg/kg de peso añadiendo caspofungina, comprobada la sensibilidad al tratamiento antifúngico en el estudio microbiológico de la pieza quirúrgica. Evolución Evolución posquirúrgica desfavorable, con empeoramiento clínico los días posteriores a la intervención: aumento de sensación disneica y analgesia en perfusión continua por dolor a nivel craneofacial. Progresión de lesión necrótica sobre cicatriz quirúrgica de paladar, pese al tratamiento antifúngico mantenido. En TC craneal y toracoabdominal de control se objetivan cambios posquirúrgicos de maxilectomía izquierda y exenteración de órbita con ocupación de seno frontal izquierdo, etmoidal y esfenoidal. En tórax, se describe aumento de masa pulmonar y adenopatías mediastínicas con aparición de infiltrados bilaterales difusos y derrame pleural derecho en relación a edema pulmonar o proceso infeccioso. La TC informa progresión pulmonar de la enfermedad neoplásica. Persiste importante deterioro clínico, respiratorio y global y, en vista de la mala evolución, se aumenta perfusión analgésica limitando el esfuerzo terapéutico, falleciendo a los once días de la intervención quirúrgica. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: MORFOLOGIA_NEOPLASIA
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Anamnesis Varón de 68 años con antecedentes de hipertensión arterial, dislipemia y cardiopatía isquémica. En 2015, colocación de prótesis por aneurisma de aorta abdominal. Fumador importante con criterios clínicos de bronquitis crónica y disnea a moderados esfuerzos. En abril de 2016, es diagnosticado de carcinoma microcítico de lóbulo inferior derecho (LID), estadio IV, con metástasis ganglionares y pancreáticas. Durante el diagnóstico, marcadores tumorales: CEA 7,5 y enolasa neuroespecífica 69. Inicia tratamiento quimioterápico de primera línea con carboplatino-etopósido mostrando respuesta parcial de la masa pulmonar y las metástasis pancreáticas y ganglionares en TC tras 3 ciclos con descenso de enolasa neuroespecífica. Tras 4º ciclo, se pauta esquema de tratamiento con reducción del 20 % por toxicidad hematológica: trombopenia G1 y anemia G3. En controles adicionales por la Unidad de Medicina Paliativa, se pauta dexametasona 4 mg al día como orexígeno y oxigenoterapia domiciliaria con gafas nasales a 2 l/minuto. Como consecuencia, desarrolla hiperglucemias secundarias a tratamiento corticoide, precisando inicio de insulina subcutánea. Previamente al 6º ciclo, valorado en Urgencias por aumento de disnea, se realiza una TC dere-evaluación que objetiva progresión ganglionar mediastínica e hiliar. Masa pulmonar estable. Se suspende administración del 6º ciclo de carboplatino-etopósido, y se plantea tratamiento de segunda línea con topotecán oral que inicia en octubre de 2016. Ingresa desde Urgencias en el 5º día del primer ciclo de topotecán por neutropenia febril con probable foco respiratorio. Aunque no se evidencia infiltrado en la radiografía de tórax, se inicia tratamiento con antibioterapia de amplio espectro intravenosa: cefepima. Durante los primeros días de ingreso, el paciente refiere molestias en cavidad oral y a la exploración: mucositis G1 y muguet añadiendo fluconazol intravenoso y nistatina oral al tratamiento antibiótico. El 22 de octubre 2016 inicia cuadro de dolor intenso en región mandibular izquierda asociando edema en región maxilar izquierda y palpebral inferior ipsilateral. Exploración física Durante la exploración: exoftalmos de 3 mm en ojo izquierdo. Limitación a la supraducción del ojo con pupilas isocóricas y reactivas sin defecto pupilar aferente. No hay disminución de la agudeza visual. En cavidad oral: escara negro-grisácea en hemipaladar duro izquierdo de 3 cm de diámetro anteroposterior y 2 cm de diámetro transverso. Sin otras lesiones en cavidad oral ni adenopatías cervicales palpables. Durante la anamnesis dirigida: la lesión de paladar ha aparecido en las 24 horas previas. En fibroscopia nasal realizada por Otorrinolaringología, se objetivan restos hemáticos y perforación septal con tejido negruzco que obstruye la fosa nasal izquierda. Pruebas complementarias Se añade clindamicina para cobertura de gérmenes anaerobios y se solicita valoración y biopsia urgente de la lesión necrótica en paladar por parte de Cirugía Maxilofacial. Se realiza una TC facial urgente: muestra signos de sinusopatía etmoidal con presencia de niveles gas líquido, aumento de partes blandas a nivel de región mandibular izquierda y discontinuidad del músculo platisma del cuello. Se suspende fluconazol y se inicia tratamiento con anfotericina B liposomal 5 mg/kg de peso cada 24 horas por sospecha de mucormicosis. Diagnóstico En el cultivo de biopsia de paladar se confirma aislamiento de hongo filamentoso compatible con Rhizopus. Tratamiento Es valorado por Otorrinolaringología, donde se plantea intervención quirúrgica urgente el 24 de octubre 2016. En el protocolo quirúrgico se describe: mucormicosis que afecta a 2/3 anteriores de paladar duro, maxilar izquierdo, tabique nasal, órbita izquierda y celdas etmoidales posteriores y anteriores ipsilaterales. Se procede a exenteración orbitaria en bloque con maxilar y palatino izquierdos, importante necrosis de pared lateral nasal y de lámina papirácea. Objetivada trombosis de arterias etmoidales y mínima impronta de Mucor en base de cráneo a nivel de etmoides posterior (TC posquirúrgica). Tras la cirugía, el paciente precisa nutrición enteral por sonda nasogástrica. Se mantiene tratamiento con anfotericina B a dosis de 6 mg/kg de peso añadiendo caspofungina, comprobada la sensibilidad al tratamiento antifúngico en el estudio microbiológico de la pieza quirúrgica. Evolución Evolución posquirúrgica desfavorable, con empeoramiento clínico los días posteriores a la intervención: aumento de sensación disneica y analgesia en perfusión continua por dolor a nivel craneofacial. Progresión de lesión necrótica sobre cicatriz quirúrgica de paladar, pese al tratamiento antifúngico mantenido. En TC craneal y toracoabdominal de control se objetivan cambios posquirúrgicos de maxilectomía izquierda y exenteración de órbita con ocupación de seno frontal izquierdo, etmoidal y esfenoidal. En tórax, se describe aumento de masa pulmonar y adenopatías mediastínicas con aparición de infiltrados bilaterales difusos y derrame pleural derecho en relación a edema pulmonar o proceso infeccioso. La TC informa progresión pulmonar de la enfermedad neoplásica. Persiste importante deterioro clínico, respiratorio y global y, en vista de la mala evolución, se aumenta perfusión analgésica limitando el esfuerzo terapéutico, falleciendo a los once días de la intervención quirúrgica.
[ "Anamnesis", "\n", "Varón", "de", "68", "años", "con", "antecedentes", "de", "hipertensión", "arterial", ",", "dislipemia", "y", "cardiopatía", "isquémica", ".", "En", "2015", ",", "colocación", "de", "prótesis", "por", "aneurisma", "de", "aorta", "abdominal", ".", "Fumador", "importante", "con", "criterios", "clínicos", "de", "bronquitis", "crónica", "y", "disnea", "a", "moderados", "esfuerzos", ".", "\n", "En", "abril", "de", "2016", ",", "es", "diagnosticado", "de", "carcinoma", "microcítico", "de", "lóbulo", "inferior", "derecho", "(", "LID", ")", ",", "estadio", "IV", ",", "con", "metástasis", "ganglionares", "y", "pancreáticas", ".", "Durante", "el", "diagnóstico", ",", "marcadores", "tumorales", ":", "CEA", "7,5", "y", "enolasa", "neuroespecífica", "69", ".", "\n", "Inicia", "tratamiento", "quimioterápico", "de", "primera", "línea", "con", "carboplatino", "-", "etopósido", "mostrando", "respuesta", "parcial", "de", "la", "masa", "pulmonar", "y", "las", "metástasis", "pancreáticas", "y", "ganglionares", "en", "TC", "tras", "3", "ciclos", "con", "descenso", "de", "enolasa", "neuroespecífica", ".", "Tras", "4º", "ciclo", ",", "se", "pauta", "esquema", "de", "tratamiento", "con", "reducción", "del", "20", "%", "por", "toxicidad", "hematológica", ":", "trombopenia", "G1", "y", "anemia", "G3", ".", "\n", "En", "controles", "adicionales", "por", "la", "Unidad", "de", "Medicina", "Paliativa", ",", "se", "pauta", "dexametasona", "4", "mg", "al", "día", "como", "orexígeno", "y", "oxigenoterapia", "domiciliaria", "con", "gafas", "nasales", "a", "2", "l", "/", "minuto", ".", "Como", "consecuencia", ",", "desarrolla", "hiperglucemias", "secundarias", "a", "tratamiento", "corticoide", ",", "precisando", "inicio", "de", "insulina", "subcutánea", ".", "\n", "Previamente", "al", "6º", "ciclo", ",", "valorado", "en", "Urgencias", "por", "aumento", "de", "disnea", ",", "se", "realiza", "una", "TC", "dere", "-", "evaluación", "que", "objetiva", "progresión", "ganglionar", "mediastínica", "e", "hiliar", ".", "Masa", "pulmonar", "estable", ".", "Se", "suspende", "administración", "del", "6º", "ciclo", "de", "carboplatino", "-", "etopósido", ",", "y", "se", "plantea", "tratamiento", "de", "segunda", "línea", "con", "topotecán", "oral", "que", "inicia", "en", "octubre", "de", "2016", ".", "\n", "Ingresa", "desde", "Urgencias", "en", "el", "5º", "día", "del", "primer", "ciclo", "de", "topotecán", "por", "neutropenia", "febril", "con", "probable", "foco", "respiratorio", ".", "Aunque", "no", "se", "evidencia", "infiltrado", "en", "la", "radiografía", "de", "tórax", ",", "se", "inicia", "tratamiento", "con", "antibioterapia", "de", "amplio", "espectro", "intravenosa", ":", "cefepima", ".", "\n", "Durante", "los", "primeros", "días", "de", "ingreso", ",", "el", "paciente", "refiere", "molestias", "en", "cavidad", "oral", "y", "a", "la", "exploración", ":", "mucositis", "G1", "y", "muguet", "añadiendo", "fluconazol", "intravenoso", "y", "nistatina", "oral", "al", "tratamiento", "antibiótico", ".", "\n", "El", "22", "de", "octubre", "2016", "inicia", "cuadro", "de", "dolor", "intenso", "en", "región", "mandibular", "izquierda", "asociando", "edema", "en", "región", "maxilar", "izquierda", "y", "palpebral", "inferior", "ipsilateral", ".", "\n\n", "Exploración", "física", "\n", "Durante", "la", "exploración", ":", "exoftalmos", "de", "3", "mm", "en", "ojo", "izquierdo", ".", "Limitación", "a", "la", "supraducción", "del", "ojo", "con", "pupilas", "isocóricas", "y", "reactivas", "sin", "defecto", "pupilar", "aferente", ".", "No", "hay", "disminución", "de", "la", "agudeza", "visual", ".", "En", "cavidad", "oral", ":", "escara", "negro", "-", "grisácea", "en", "hemipaladar", "duro", "izquierdo", "de", "3", "cm", "de", "diámetro", "anteroposterior", "y", "2", "cm", "de", "diámetro", "transverso", ".", "Sin", "otras", "lesiones", "en", "cavidad", "oral", "ni", "adenopatías", "cervicales", "palpables", ".", "Durante", "la", "anamnesis", "dirigida", ":", "la", "lesión", "de", "paladar", "ha", "aparecido", "en", "las", "24", "horas", "previas", ".", "En", "fibroscopia", "nasal", "realizada", "por", "Otorrinolaringología", ",", "se", "objetivan", "restos", "hemáticos", "y", "perforación", "septal", "con", "tejido", "negruzco", "que", "obstruye", "la", "fosa", "nasal", "izquierda", ".", "\n\n", "Pruebas", "complementarias", "\n", "Se", "añade", "clindamicina", "para", "cobertura", "de", "gérmenes", "anaerobios", "y", "se", "solicita", "valoración", "y", "biopsia", "urgente", "de", "la", "lesión", "necrótica", "en", "paladar", "por", "parte", "de", "Cirugía", "Maxilofacial", ".", "Se", "realiza", "una", "TC", "facial", "urgente", ":", "muestra", "signos", "de", "sinusopatía", "etmoidal", "con", "presencia", "de", "niveles", "gas", "líquido", ",", "aumento", "de", "partes", "blandas", "a", "nivel", "de", "región", "mandibular", "izquierda", "y", "discontinuidad", "del", "músculo", "platisma", "del", "cuello", ".", "Se", "suspende", "fluconazol", "y", "se", "inicia", "tratamiento", "con", "anfotericina", "B", "liposomal", "5", "mg", "/", "kg", "de", "peso", "cada", "24", "horas", "por", "sospecha", "de", "mucormicosis", ".", "\n\n", "Diagnóstico", "\n", "En", "el", "cultivo", "de", "biopsia", "de", "paladar", "se", "confirma", "aislamiento", "de", "hongo", "filamentoso", "compatible", "con", "Rhizopus", ".", "\n\n", "Tratamiento", "\n", "Es", "valorado", "por", "Otorrinolaringología", ",", "donde", "se", "plantea", "intervención", "quirúrgica", "urgente", "el", "24", "de", "octubre", "2016", ".", "\n", "En", "el", "protocolo", "quirúrgico", "se", "describe", ":", "mucormicosis", "que", "afecta", "a", "2/3", "anteriores", "de", "paladar", "duro", ",", "maxilar", "izquierdo", ",", "tabique", "nasal", ",", "órbita", "izquierda", "y", "celdas", "etmoidales", "posteriores", "y", "anteriores", "ipsilaterales", ".", "Se", "procede", "a", "exenteración", "orbitaria", "en", "bloque", "con", "maxilar", "y", "palatino", "izquierdos", ",", "importante", "necrosis", "de", "pared", "lateral", "nasal", "y", "de", "lámina", "papirácea", ".", "Objetivada", "trombosis", "de", "arterias", "etmoidales", "y", "mínima", "impronta", "de", "Mucor", "en", "base", "de", "cráneo", "a", "nivel", "de", "etmoides", "posterior", "(", "TC", "posquirúrgica", ")", ".", "\n", "Tras", "la", "cirugía", ",", "el", "paciente", "precisa", "nutrición", "enteral", "por", "sonda", "nasogástrica", ".", "Se", "mantiene", "tratamiento", "con", "anfotericina", "B", "a", "dosis", "de", "6", "mg", "/", "kg", "de", "peso", "añadiendo", "caspofungina", ",", "comprobada", "la", "sensibilidad", "al", "tratamiento", "antifúngico", "en", "el", "estudio", "microbiológico", "de", "la", "pieza", "quirúrgica", ".", "\n\n", "Evolución", "\n", "Evolución", "posquirúrgica", "desfavorable", ",", "con", "empeoramiento", "clínico", "los", "días", "posteriores", "a", "la", "intervención", ":", "aumento", "de", "sensación", "disneica", "y", "analgesia", "en", "perfusión", "continua", "por", "dolor", "a", "nivel", "craneofacial", ".", "\n", "Progresión", "de", "lesión", "necrótica", "sobre", "cicatriz", "quirúrgica", "de", "paladar", ",", "pese", "al", "tratamiento", "antifúngico", "mantenido", ".", "\n", "En", "TC", "craneal", "y", "toracoabdominal", "de", "control", "se", "objetivan", "cambios", "posquirúrgicos", "de", "maxilectomía", "izquierda", "y", "exenteración", "de", "órbita", "con", "ocupación", "de", "seno", "frontal", "izquierdo", ",", "etmoidal", "y", "esfenoidal", ".", "En", "tórax", ",", "se", "describe", "aumento", "de", "masa", "pulmonar", "y", "adenopatías", "mediastínicas", "con", "aparición", "de", "infiltrados", "bilaterales", "difusos", "y", "derrame", "pleural", "derecho", "en", "relación", "a", "edema", "pulmonar", "o", "proceso", "infeccioso", ".", "La", "TC", "informa", "progresión", "pulmonar", "de", "la", "enfermedad", "neoplásica", ".", "\n", "Persiste", "importante", "deterioro", "clínico", ",", "respiratorio", "y", "global", "y", ",", "en", "vista", "de", "la", "mala", "evolución", ",", "se", "aumenta", "perfusión", "analgésica", "limitando", "el", "esfuerzo", "terapéutico", ",", "falleciendo", "a", "los", "once", "días", "de", "la", "intervención", "quirúrgica", "." ]
[ "MORFOLOGIA_NEOPLASIA" ]
carcinoma microcítico is a MORFOLOGIA_NEOPLASIA, metástasis is a MORFOLOGIA_NEOPLASIA, metástasis is a MORFOLOGIA_NEOPLASIA, neoplásica is a MORFOLOGIA_NEOPLASIA
881_task1
Sentence: Anamnesis Varón de 68 años con antecedentes de hipertensión arterial, dislipemia y cardiopatía isquémica. En 2015, colocación de prótesis por aneurisma de aorta abdominal. Fumador importante con criterios clínicos de bronquitis crónica y disnea a moderados esfuerzos. En abril de 2016, es diagnosticado de carcinoma microcítico de lóbulo inferior derecho (LID), estadio IV, con metástasis ganglionares y pancreáticas. Durante el diagnóstico, marcadores tumorales: CEA 7,5 y enolasa neuroespecífica 69. Inicia tratamiento quimioterápico de primera línea con carboplatino-etopósido mostrando respuesta parcial de la masa pulmonar y las metástasis pancreáticas y ganglionares en TC tras 3 ciclos con descenso de enolasa neuroespecífica. Tras 4º ciclo, se pauta esquema de tratamiento con reducción del 20 % por toxicidad hematológica: trombopenia G1 y anemia G3. En controles adicionales por la Unidad de Medicina Paliativa, se pauta dexametasona 4 mg al día como orexígeno y oxigenoterapia domiciliaria con gafas nasales a 2 l/minuto. Como consecuencia, desarrolla hiperglucemias secundarias a tratamiento corticoide, precisando inicio de insulina subcutánea. Previamente al 6º ciclo, valorado en Urgencias por aumento de disnea, se realiza una TC dere-evaluación que objetiva progresión ganglionar mediastínica e hiliar. Masa pulmonar estable. Se suspende administración del 6º ciclo de carboplatino-etopósido, y se plantea tratamiento de segunda línea con topotecán oral que inicia en octubre de 2016. Ingresa desde Urgencias en el 5º día del primer ciclo de topotecán por neutropenia febril con probable foco respiratorio. Aunque no se evidencia infiltrado en la radiografía de tórax, se inicia tratamiento con antibioterapia de amplio espectro intravenosa: cefepima. Durante los primeros días de ingreso, el paciente refiere molestias en cavidad oral y a la exploración: mucositis G1 y muguet añadiendo fluconazol intravenoso y nistatina oral al tratamiento antibiótico. El 22 de octubre 2016 inicia cuadro de dolor intenso en región mandibular izquierda asociando edema en región maxilar izquierda y palpebral inferior ipsilateral. Exploración física Durante la exploración: exoftalmos de 3 mm en ojo izquierdo. Limitación a la supraducción del ojo con pupilas isocóricas y reactivas sin defecto pupilar aferente. No hay disminución de la agudeza visual. En cavidad oral: escara negro-grisácea en hemipaladar duro izquierdo de 3 cm de diámetro anteroposterior y 2 cm de diámetro transverso. Sin otras lesiones en cavidad oral ni adenopatías cervicales palpables. Durante la anamnesis dirigida: la lesión de paladar ha aparecido en las 24 horas previas. En fibroscopia nasal realizada por Otorrinolaringología, se objetivan restos hemáticos y perforación septal con tejido negruzco que obstruye la fosa nasal izquierda. Pruebas complementarias Se añade clindamicina para cobertura de gérmenes anaerobios y se solicita valoración y biopsia urgente de la lesión necrótica en paladar por parte de Cirugía Maxilofacial. Se realiza una TC facial urgente: muestra signos de sinusopatía etmoidal con presencia de niveles gas líquido, aumento de partes blandas a nivel de región mandibular izquierda y discontinuidad del músculo platisma del cuello. Se suspende fluconazol y se inicia tratamiento con anfotericina B liposomal 5 mg/kg de peso cada 24 horas por sospecha de mucormicosis. Diagnóstico En el cultivo de biopsia de paladar se confirma aislamiento de hongo filamentoso compatible con Rhizopus. Tratamiento Es valorado por Otorrinolaringología, donde se plantea intervención quirúrgica urgente el 24 de octubre 2016. En el protocolo quirúrgico se describe: mucormicosis que afecta a 2/3 anteriores de paladar duro, maxilar izquierdo, tabique nasal, órbita izquierda y celdas etmoidales posteriores y anteriores ipsilaterales. Se procede a exenteración orbitaria en bloque con maxilar y palatino izquierdos, importante necrosis de pared lateral nasal y de lámina papirácea. Objetivada trombosis de arterias etmoidales y mínima impronta de Mucor en base de cráneo a nivel de etmoides posterior (TC posquirúrgica). Tras la cirugía, el paciente precisa nutrición enteral por sonda nasogástrica. Se mantiene tratamiento con anfotericina B a dosis de 6 mg/kg de peso añadiendo caspofungina, comprobada la sensibilidad al tratamiento antifúngico en el estudio microbiológico de la pieza quirúrgica. Evolución Evolución posquirúrgica desfavorable, con empeoramiento clínico los días posteriores a la intervención: aumento de sensación disneica y analgesia en perfusión continua por dolor a nivel craneofacial. Progresión de lesión necrótica sobre cicatriz quirúrgica de paladar, pese al tratamiento antifúngico mantenido. En TC craneal y toracoabdominal de control se objetivan cambios posquirúrgicos de maxilectomía izquierda y exenteración de órbita con ocupación de seno frontal izquierdo, etmoidal y esfenoidal. En tórax, se describe aumento de masa pulmonar y adenopatías mediastínicas con aparición de infiltrados bilaterales difusos y derrame pleural derecho en relación a edema pulmonar o proceso infeccioso. La TC informa progresión pulmonar de la enfermedad neoplásica. Persiste importante deterioro clínico, respiratorio y global y, en vista de la mala evolución, se aumenta perfusión analgésica limitando el esfuerzo terapéutico, falleciendo a los once días de la intervención quirúrgica. Instructions: please typing these entity words according to sentence: carcinoma microcítico, metástasis, metástasis, neoplásica Options: MORFOLOGIA_NEOPLASIA
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Anamnesis Varón de 68 años con antecedentes de hipertensión arterial, dislipemia y cardiopatía isquémica. En 2015, colocación de prótesis por aneurisma de aorta abdominal. Fumador importante con criterios clínicos de bronquitis crónica y disnea a moderados esfuerzos. En abril de 2016, es diagnosticado de carcinoma microcítico de lóbulo inferior derecho (LID), estadio IV, con metástasis ganglionares y pancreáticas. Durante el diagnóstico, marcadores tumorales: CEA 7,5 y enolasa neuroespecífica 69. Inicia tratamiento quimioterápico de primera línea con carboplatino-etopósido mostrando respuesta parcial de la masa pulmonar y las metástasis pancreáticas y ganglionares en TC tras 3 ciclos con descenso de enolasa neuroespecífica. Tras 4º ciclo, se pauta esquema de tratamiento con reducción del 20 % por toxicidad hematológica: trombopenia G1 y anemia G3. En controles adicionales por la Unidad de Medicina Paliativa, se pauta dexametasona 4 mg al día como orexígeno y oxigenoterapia domiciliaria con gafas nasales a 2 l/minuto. Como consecuencia, desarrolla hiperglucemias secundarias a tratamiento corticoide, precisando inicio de insulina subcutánea. Previamente al 6º ciclo, valorado en Urgencias por aumento de disnea, se realiza una TC dere-evaluación que objetiva progresión ganglionar mediastínica e hiliar. Masa pulmonar estable. Se suspende administración del 6º ciclo de carboplatino-etopósido, y se plantea tratamiento de segunda línea con topotecán oral que inicia en octubre de 2016. Ingresa desde Urgencias en el 5º día del primer ciclo de topotecán por neutropenia febril con probable foco respiratorio. Aunque no se evidencia infiltrado en la radiografía de tórax, se inicia tratamiento con antibioterapia de amplio espectro intravenosa: cefepima. Durante los primeros días de ingreso, el paciente refiere molestias en cavidad oral y a la exploración: mucositis G1 y muguet añadiendo fluconazol intravenoso y nistatina oral al tratamiento antibiótico. El 22 de octubre 2016 inicia cuadro de dolor intenso en región mandibular izquierda asociando edema en región maxilar izquierda y palpebral inferior ipsilateral. Exploración física Durante la exploración: exoftalmos de 3 mm en ojo izquierdo. Limitación a la supraducción del ojo con pupilas isocóricas y reactivas sin defecto pupilar aferente. No hay disminución de la agudeza visual. En cavidad oral: escara negro-grisácea en hemipaladar duro izquierdo de 3 cm de diámetro anteroposterior y 2 cm de diámetro transverso. Sin otras lesiones en cavidad oral ni adenopatías cervicales palpables. Durante la anamnesis dirigida: la lesión de paladar ha aparecido en las 24 horas previas. En fibroscopia nasal realizada por Otorrinolaringología, se objetivan restos hemáticos y perforación septal con tejido negruzco que obstruye la fosa nasal izquierda. Pruebas complementarias Se añade clindamicina para cobertura de gérmenes anaerobios y se solicita valoración y biopsia urgente de la lesión necrótica en paladar por parte de Cirugía Maxilofacial. Se realiza una TC facial urgente: muestra signos de sinusopatía etmoidal con presencia de niveles gas líquido, aumento de partes blandas a nivel de región mandibular izquierda y discontinuidad del músculo platisma del cuello. Se suspende fluconazol y se inicia tratamiento con anfotericina B liposomal 5 mg/kg de peso cada 24 horas por sospecha de mucormicosis. Diagnóstico En el cultivo de biopsia de paladar se confirma aislamiento de hongo filamentoso compatible con Rhizopus. Tratamiento Es valorado por Otorrinolaringología, donde se plantea intervención quirúrgica urgente el 24 de octubre 2016. En el protocolo quirúrgico se describe: mucormicosis que afecta a 2/3 anteriores de paladar duro, maxilar izquierdo, tabique nasal, órbita izquierda y celdas etmoidales posteriores y anteriores ipsilaterales. Se procede a exenteración orbitaria en bloque con maxilar y palatino izquierdos, importante necrosis de pared lateral nasal y de lámina papirácea. Objetivada trombosis de arterias etmoidales y mínima impronta de Mucor en base de cráneo a nivel de etmoides posterior (TC posquirúrgica). Tras la cirugía, el paciente precisa nutrición enteral por sonda nasogástrica. Se mantiene tratamiento con anfotericina B a dosis de 6 mg/kg de peso añadiendo caspofungina, comprobada la sensibilidad al tratamiento antifúngico en el estudio microbiológico de la pieza quirúrgica. Evolución Evolución posquirúrgica desfavorable, con empeoramiento clínico los días posteriores a la intervención: aumento de sensación disneica y analgesia en perfusión continua por dolor a nivel craneofacial. Progresión de lesión necrótica sobre cicatriz quirúrgica de paladar, pese al tratamiento antifúngico mantenido. En TC craneal y toracoabdominal de control se objetivan cambios posquirúrgicos de maxilectomía izquierda y exenteración de órbita con ocupación de seno frontal izquierdo, etmoidal y esfenoidal. En tórax, se describe aumento de masa pulmonar y adenopatías mediastínicas con aparición de infiltrados bilaterales difusos y derrame pleural derecho en relación a edema pulmonar o proceso infeccioso. La TC informa progresión pulmonar de la enfermedad neoplásica. Persiste importante deterioro clínico, respiratorio y global y, en vista de la mala evolución, se aumenta perfusión analgésica limitando el esfuerzo terapéutico, falleciendo a los once días de la intervención quirúrgica.
[ "Anamnesis", "\n", "Varón", "de", "68", "años", "con", "antecedentes", "de", "hipertensión", "arterial", ",", "dislipemia", "y", "cardiopatía", "isquémica", ".", "En", "2015", ",", "colocación", "de", "prótesis", "por", "aneurisma", "de", "aorta", "abdominal", ".", "Fumador", "importante", "con", "criterios", "clínicos", "de", "bronquitis", "crónica", "y", "disnea", "a", "moderados", "esfuerzos", ".", "\n", "En", "abril", "de", "2016", ",", "es", "diagnosticado", "de", "carcinoma", "microcítico", "de", "lóbulo", "inferior", "derecho", "(", "LID", ")", ",", "estadio", "IV", ",", "con", "metástasis", "ganglionares", "y", "pancreáticas", ".", "Durante", "el", "diagnóstico", ",", "marcadores", "tumorales", ":", "CEA", "7,5", "y", "enolasa", "neuroespecífica", "69", ".", "\n", "Inicia", "tratamiento", "quimioterápico", "de", "primera", "línea", "con", "carboplatino", "-", "etopósido", "mostrando", "respuesta", "parcial", "de", "la", "masa", "pulmonar", "y", "las", "metástasis", "pancreáticas", "y", "ganglionares", "en", "TC", "tras", "3", "ciclos", "con", "descenso", "de", "enolasa", "neuroespecífica", ".", "Tras", "4º", "ciclo", ",", "se", "pauta", "esquema", "de", "tratamiento", "con", "reducción", "del", "20", "%", "por", "toxicidad", "hematológica", ":", "trombopenia", "G1", "y", "anemia", "G3", ".", "\n", "En", "controles", "adicionales", "por", "la", "Unidad", "de", "Medicina", "Paliativa", ",", "se", "pauta", "dexametasona", "4", "mg", "al", "día", "como", "orexígeno", "y", "oxigenoterapia", "domiciliaria", "con", "gafas", "nasales", "a", "2", "l", "/", "minuto", ".", "Como", "consecuencia", ",", "desarrolla", "hiperglucemias", "secundarias", "a", "tratamiento", "corticoide", ",", "precisando", "inicio", "de", "insulina", "subcutánea", ".", "\n", "Previamente", "al", "6º", "ciclo", ",", "valorado", "en", "Urgencias", "por", "aumento", "de", "disnea", ",", "se", "realiza", "una", "TC", "dere", "-", "evaluación", "que", "objetiva", "progresión", "ganglionar", "mediastínica", "e", "hiliar", ".", "Masa", "pulmonar", "estable", ".", "Se", "suspende", "administración", "del", "6º", "ciclo", "de", "carboplatino", "-", "etopósido", ",", "y", "se", "plantea", "tratamiento", "de", "segunda", "línea", "con", "topotecán", "oral", "que", "inicia", "en", "octubre", "de", "2016", ".", "\n", "Ingresa", "desde", "Urgencias", "en", "el", "5º", "día", "del", "primer", "ciclo", "de", "topotecán", "por", "neutropenia", "febril", "con", "probable", "foco", "respiratorio", ".", "Aunque", "no", "se", "evidencia", "infiltrado", "en", "la", "radiografía", "de", "tórax", ",", "se", "inicia", "tratamiento", "con", "antibioterapia", "de", "amplio", "espectro", "intravenosa", ":", "cefepima", ".", "\n", "Durante", "los", "primeros", "días", "de", "ingreso", ",", "el", "paciente", "refiere", "molestias", "en", "cavidad", "oral", "y", "a", "la", "exploración", ":", "mucositis", "G1", "y", "muguet", "añadiendo", "fluconazol", "intravenoso", "y", "nistatina", "oral", "al", "tratamiento", "antibiótico", ".", "\n", "El", "22", "de", "octubre", "2016", "inicia", "cuadro", "de", "dolor", "intenso", "en", "región", "mandibular", "izquierda", "asociando", "edema", "en", "región", "maxilar", "izquierda", "y", "palpebral", "inferior", "ipsilateral", ".", "\n\n", "Exploración", "física", "\n", "Durante", "la", "exploración", ":", "exoftalmos", "de", "3", "mm", "en", "ojo", "izquierdo", ".", "Limitación", "a", "la", "supraducción", "del", "ojo", "con", "pupilas", "isocóricas", "y", "reactivas", "sin", "defecto", "pupilar", "aferente", ".", "No", "hay", "disminución", "de", "la", "agudeza", "visual", ".", "En", "cavidad", "oral", ":", "escara", "negro", "-", "grisácea", "en", "hemipaladar", "duro", "izquierdo", "de", "3", "cm", "de", "diámetro", "anteroposterior", "y", "2", "cm", "de", "diámetro", "transverso", ".", "Sin", "otras", "lesiones", "en", "cavidad", "oral", "ni", "adenopatías", "cervicales", "palpables", ".", "Durante", "la", "anamnesis", "dirigida", ":", "la", "lesión", "de", "paladar", "ha", "aparecido", "en", "las", "24", "horas", "previas", ".", "En", "fibroscopia", "nasal", "realizada", "por", "Otorrinolaringología", ",", "se", "objetivan", "restos", "hemáticos", "y", "perforación", "septal", "con", "tejido", "negruzco", "que", "obstruye", "la", "fosa", "nasal", "izquierda", ".", "\n\n", "Pruebas", "complementarias", "\n", "Se", "añade", "clindamicina", "para", "cobertura", "de", "gérmenes", "anaerobios", "y", "se", "solicita", "valoración", "y", "biopsia", "urgente", "de", "la", "lesión", "necrótica", "en", "paladar", "por", "parte", "de", "Cirugía", "Maxilofacial", ".", "Se", "realiza", "una", "TC", "facial", "urgente", ":", "muestra", "signos", "de", "sinusopatía", "etmoidal", "con", "presencia", "de", "niveles", "gas", "líquido", ",", "aumento", "de", "partes", "blandas", "a", "nivel", "de", "región", "mandibular", "izquierda", "y", "discontinuidad", "del", "músculo", "platisma", "del", "cuello", ".", "Se", "suspende", "fluconazol", "y", "se", "inicia", "tratamiento", "con", "anfotericina", "B", "liposomal", "5", "mg", "/", "kg", "de", "peso", "cada", "24", "horas", "por", "sospecha", "de", "mucormicosis", ".", "\n\n", "Diagnóstico", "\n", "En", "el", "cultivo", "de", "biopsia", "de", "paladar", "se", "confirma", "aislamiento", "de", "hongo", "filamentoso", "compatible", "con", "Rhizopus", ".", "\n\n", "Tratamiento", "\n", "Es", "valorado", "por", "Otorrinolaringología", ",", "donde", "se", "plantea", "intervención", "quirúrgica", "urgente", "el", "24", "de", "octubre", "2016", ".", "\n", "En", "el", "protocolo", "quirúrgico", "se", "describe", ":", "mucormicosis", "que", "afecta", "a", "2/3", "anteriores", "de", "paladar", "duro", ",", "maxilar", "izquierdo", ",", "tabique", "nasal", ",", "órbita", "izquierda", "y", "celdas", "etmoidales", "posteriores", "y", "anteriores", "ipsilaterales", ".", "Se", "procede", "a", "exenteración", "orbitaria", "en", "bloque", "con", "maxilar", "y", "palatino", "izquierdos", ",", "importante", "necrosis", "de", "pared", "lateral", "nasal", "y", "de", "lámina", "papirácea", ".", "Objetivada", "trombosis", "de", "arterias", "etmoidales", "y", "mínima", "impronta", "de", "Mucor", "en", "base", "de", "cráneo", "a", "nivel", "de", "etmoides", "posterior", "(", "TC", "posquirúrgica", ")", ".", "\n", "Tras", "la", "cirugía", ",", "el", "paciente", "precisa", "nutrición", "enteral", "por", "sonda", "nasogástrica", ".", "Se", "mantiene", "tratamiento", "con", "anfotericina", "B", "a", "dosis", "de", "6", "mg", "/", "kg", "de", "peso", "añadiendo", "caspofungina", ",", "comprobada", "la", "sensibilidad", "al", "tratamiento", "antifúngico", "en", "el", "estudio", "microbiológico", "de", "la", "pieza", "quirúrgica", ".", "\n\n", "Evolución", "\n", "Evolución", "posquirúrgica", "desfavorable", ",", "con", "empeoramiento", "clínico", "los", "días", "posteriores", "a", "la", "intervención", ":", "aumento", "de", "sensación", "disneica", "y", "analgesia", "en", "perfusión", "continua", "por", "dolor", "a", "nivel", "craneofacial", ".", "\n", "Progresión", "de", "lesión", "necrótica", "sobre", "cicatriz", "quirúrgica", "de", "paladar", ",", "pese", "al", "tratamiento", "antifúngico", "mantenido", ".", "\n", "En", "TC", "craneal", "y", "toracoabdominal", "de", "control", "se", "objetivan", "cambios", "posquirúrgicos", "de", "maxilectomía", "izquierda", "y", "exenteración", "de", "órbita", "con", "ocupación", "de", "seno", "frontal", "izquierdo", ",", "etmoidal", "y", "esfenoidal", ".", "En", "tórax", ",", "se", "describe", "aumento", "de", "masa", "pulmonar", "y", "adenopatías", "mediastínicas", "con", "aparición", "de", "infiltrados", "bilaterales", "difusos", "y", "derrame", "pleural", "derecho", "en", "relación", "a", "edema", "pulmonar", "o", "proceso", "infeccioso", ".", "La", "TC", "informa", "progresión", "pulmonar", "de", "la", "enfermedad", "neoplásica", ".", "\n", "Persiste", "importante", "deterioro", "clínico", ",", "respiratorio", "y", "global", "y", ",", "en", "vista", "de", "la", "mala", "evolución", ",", "se", "aumenta", "perfusión", "analgésica", "limitando", "el", "esfuerzo", "terapéutico", ",", "falleciendo", "a", "los", "once", "días", "de", "la", "intervención", "quirúrgica", "." ]
[ "MORFOLOGIA_NEOPLASIA" ]
carcinoma microcítico, metástasis, metástasis, neoplásica
881_task2
Sentence: Anamnesis Varón de 68 años con antecedentes de hipertensión arterial, dislipemia y cardiopatía isquémica. En 2015, colocación de prótesis por aneurisma de aorta abdominal. Fumador importante con criterios clínicos de bronquitis crónica y disnea a moderados esfuerzos. En abril de 2016, es diagnosticado de carcinoma microcítico de lóbulo inferior derecho (LID), estadio IV, con metástasis ganglionares y pancreáticas. Durante el diagnóstico, marcadores tumorales: CEA 7,5 y enolasa neuroespecífica 69. Inicia tratamiento quimioterápico de primera línea con carboplatino-etopósido mostrando respuesta parcial de la masa pulmonar y las metástasis pancreáticas y ganglionares en TC tras 3 ciclos con descenso de enolasa neuroespecífica. Tras 4º ciclo, se pauta esquema de tratamiento con reducción del 20 % por toxicidad hematológica: trombopenia G1 y anemia G3. En controles adicionales por la Unidad de Medicina Paliativa, se pauta dexametasona 4 mg al día como orexígeno y oxigenoterapia domiciliaria con gafas nasales a 2 l/minuto. Como consecuencia, desarrolla hiperglucemias secundarias a tratamiento corticoide, precisando inicio de insulina subcutánea. Previamente al 6º ciclo, valorado en Urgencias por aumento de disnea, se realiza una TC dere-evaluación que objetiva progresión ganglionar mediastínica e hiliar. Masa pulmonar estable. Se suspende administración del 6º ciclo de carboplatino-etopósido, y se plantea tratamiento de segunda línea con topotecán oral que inicia en octubre de 2016. Ingresa desde Urgencias en el 5º día del primer ciclo de topotecán por neutropenia febril con probable foco respiratorio. Aunque no se evidencia infiltrado en la radiografía de tórax, se inicia tratamiento con antibioterapia de amplio espectro intravenosa: cefepima. Durante los primeros días de ingreso, el paciente refiere molestias en cavidad oral y a la exploración: mucositis G1 y muguet añadiendo fluconazol intravenoso y nistatina oral al tratamiento antibiótico. El 22 de octubre 2016 inicia cuadro de dolor intenso en región mandibular izquierda asociando edema en región maxilar izquierda y palpebral inferior ipsilateral. Exploración física Durante la exploración: exoftalmos de 3 mm en ojo izquierdo. Limitación a la supraducción del ojo con pupilas isocóricas y reactivas sin defecto pupilar aferente. No hay disminución de la agudeza visual. En cavidad oral: escara negro-grisácea en hemipaladar duro izquierdo de 3 cm de diámetro anteroposterior y 2 cm de diámetro transverso. Sin otras lesiones en cavidad oral ni adenopatías cervicales palpables. Durante la anamnesis dirigida: la lesión de paladar ha aparecido en las 24 horas previas. En fibroscopia nasal realizada por Otorrinolaringología, se objetivan restos hemáticos y perforación septal con tejido negruzco que obstruye la fosa nasal izquierda. Pruebas complementarias Se añade clindamicina para cobertura de gérmenes anaerobios y se solicita valoración y biopsia urgente de la lesión necrótica en paladar por parte de Cirugía Maxilofacial. Se realiza una TC facial urgente: muestra signos de sinusopatía etmoidal con presencia de niveles gas líquido, aumento de partes blandas a nivel de región mandibular izquierda y discontinuidad del músculo platisma del cuello. Se suspende fluconazol y se inicia tratamiento con anfotericina B liposomal 5 mg/kg de peso cada 24 horas por sospecha de mucormicosis. Diagnóstico En el cultivo de biopsia de paladar se confirma aislamiento de hongo filamentoso compatible con Rhizopus. Tratamiento Es valorado por Otorrinolaringología, donde se plantea intervención quirúrgica urgente el 24 de octubre 2016. En el protocolo quirúrgico se describe: mucormicosis que afecta a 2/3 anteriores de paladar duro, maxilar izquierdo, tabique nasal, órbita izquierda y celdas etmoidales posteriores y anteriores ipsilaterales. Se procede a exenteración orbitaria en bloque con maxilar y palatino izquierdos, importante necrosis de pared lateral nasal y de lámina papirácea. Objetivada trombosis de arterias etmoidales y mínima impronta de Mucor en base de cráneo a nivel de etmoides posterior (TC posquirúrgica). Tras la cirugía, el paciente precisa nutrición enteral por sonda nasogástrica. Se mantiene tratamiento con anfotericina B a dosis de 6 mg/kg de peso añadiendo caspofungina, comprobada la sensibilidad al tratamiento antifúngico en el estudio microbiológico de la pieza quirúrgica. Evolución Evolución posquirúrgica desfavorable, con empeoramiento clínico los días posteriores a la intervención: aumento de sensación disneica y analgesia en perfusión continua por dolor a nivel craneofacial. Progresión de lesión necrótica sobre cicatriz quirúrgica de paladar, pese al tratamiento antifúngico mantenido. En TC craneal y toracoabdominal de control se objetivan cambios posquirúrgicos de maxilectomía izquierda y exenteración de órbita con ocupación de seno frontal izquierdo, etmoidal y esfenoidal. En tórax, se describe aumento de masa pulmonar y adenopatías mediastínicas con aparición de infiltrados bilaterales difusos y derrame pleural derecho en relación a edema pulmonar o proceso infeccioso. La TC informa progresión pulmonar de la enfermedad neoplásica. Persiste importante deterioro clínico, respiratorio y global y, en vista de la mala evolución, se aumenta perfusión analgésica limitando el esfuerzo terapéutico, falleciendo a los once días de la intervención quirúrgica. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "I-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-MORFOLOGIA_NEOPLASIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Anamnesis Varón de 68 años con antecedentes de hipertensión arterial, dislipemia y cardiopatía isquémica. En 2015, colocación de prótesis por aneurisma de aorta abdominal. Fumador importante con criterios clínicos de bronquitis crónica y disnea a moderados esfuerzos. En abril de 2016, es diagnosticado de carcinoma microcítico de lóbulo inferior derecho (LID), estadio IV, con metástasis ganglionares y pancreáticas. Durante el diagnóstico, marcadores tumorales: CEA 7,5 y enolasa neuroespecífica 69. Inicia tratamiento quimioterápico de primera línea con carboplatino-etopósido mostrando respuesta parcial de la masa pulmonar y las metástasis pancreáticas y ganglionares en TC tras 3 ciclos con descenso de enolasa neuroespecífica. Tras 4º ciclo, se pauta esquema de tratamiento con reducción del 20 % por toxicidad hematológica: trombopenia G1 y anemia G3. En controles adicionales por la Unidad de Medicina Paliativa, se pauta dexametasona 4 mg al día como orexígeno y oxigenoterapia domiciliaria con gafas nasales a 2 l/minuto. Como consecuencia, desarrolla hiperglucemias secundarias a tratamiento corticoide, precisando inicio de insulina subcutánea. Previamente al 6º ciclo, valorado en Urgencias por aumento de disnea, se realiza una TC dere-evaluación que objetiva progresión ganglionar mediastínica e hiliar. Masa pulmonar estable. Se suspende administración del 6º ciclo de carboplatino-etopósido, y se plantea tratamiento de segunda línea con topotecán oral que inicia en octubre de 2016. Ingresa desde Urgencias en el 5º día del primer ciclo de topotecán por neutropenia febril con probable foco respiratorio. Aunque no se evidencia infiltrado en la radiografía de tórax, se inicia tratamiento con antibioterapia de amplio espectro intravenosa: cefepima. Durante los primeros días de ingreso, el paciente refiere molestias en cavidad oral y a la exploración: mucositis G1 y muguet añadiendo fluconazol intravenoso y nistatina oral al tratamiento antibiótico. El 22 de octubre 2016 inicia cuadro de dolor intenso en región mandibular izquierda asociando edema en región maxilar izquierda y palpebral inferior ipsilateral. Exploración física Durante la exploración: exoftalmos de 3 mm en ojo izquierdo. Limitación a la supraducción del ojo con pupilas isocóricas y reactivas sin defecto pupilar aferente. No hay disminución de la agudeza visual. En cavidad oral: escara negro-grisácea en hemipaladar duro izquierdo de 3 cm de diámetro anteroposterior y 2 cm de diámetro transverso. Sin otras lesiones en cavidad oral ni adenopatías cervicales palpables. Durante la anamnesis dirigida: la lesión de paladar ha aparecido en las 24 horas previas. En fibroscopia nasal realizada por Otorrinolaringología, se objetivan restos hemáticos y perforación septal con tejido negruzco que obstruye la fosa nasal izquierda. Pruebas complementarias Se añade clindamicina para cobertura de gérmenes anaerobios y se solicita valoración y biopsia urgente de la lesión necrótica en paladar por parte de Cirugía Maxilofacial. Se realiza una TC facial urgente: muestra signos de sinusopatía etmoidal con presencia de niveles gas líquido, aumento de partes blandas a nivel de región mandibular izquierda y discontinuidad del músculo platisma del cuello. Se suspende fluconazol y se inicia tratamiento con anfotericina B liposomal 5 mg/kg de peso cada 24 horas por sospecha de mucormicosis. Diagnóstico En el cultivo de biopsia de paladar se confirma aislamiento de hongo filamentoso compatible con Rhizopus. Tratamiento Es valorado por Otorrinolaringología, donde se plantea intervención quirúrgica urgente el 24 de octubre 2016. En el protocolo quirúrgico se describe: mucormicosis que afecta a 2/3 anteriores de paladar duro, maxilar izquierdo, tabique nasal, órbita izquierda y celdas etmoidales posteriores y anteriores ipsilaterales. Se procede a exenteración orbitaria en bloque con maxilar y palatino izquierdos, importante necrosis de pared lateral nasal y de lámina papirácea. Objetivada trombosis de arterias etmoidales y mínima impronta de Mucor en base de cráneo a nivel de etmoides posterior (TC posquirúrgica). Tras la cirugía, el paciente precisa nutrición enteral por sonda nasogástrica. Se mantiene tratamiento con anfotericina B a dosis de 6 mg/kg de peso añadiendo caspofungina, comprobada la sensibilidad al tratamiento antifúngico en el estudio microbiológico de la pieza quirúrgica. Evolución Evolución posquirúrgica desfavorable, con empeoramiento clínico los días posteriores a la intervención: aumento de sensación disneica y analgesia en perfusión continua por dolor a nivel craneofacial. Progresión de lesión necrótica sobre cicatriz quirúrgica de paladar, pese al tratamiento antifúngico mantenido. En TC craneal y toracoabdominal de control se objetivan cambios posquirúrgicos de maxilectomía izquierda y exenteración de órbita con ocupación de seno frontal izquierdo, etmoidal y esfenoidal. En tórax, se describe aumento de masa pulmonar y adenopatías mediastínicas con aparición de infiltrados bilaterales difusos y derrame pleural derecho en relación a edema pulmonar o proceso infeccioso. La TC informa progresión pulmonar de la enfermedad neoplásica. Persiste importante deterioro clínico, respiratorio y global y, en vista de la mala evolución, se aumenta perfusión analgésica limitando el esfuerzo terapéutico, falleciendo a los once días de la intervención quirúrgica.
[ "Anamnesis", "\n", "Varón", "de", "68", "años", "con", "antecedentes", "de", "hipertensión", "arterial", ",", "dislipemia", "y", "cardiopatía", "isquémica", ".", "En", "2015", ",", "colocación", "de", "prótesis", "por", "aneurisma", "de", "aorta", "abdominal", ".", "Fumador", "importante", "con", "criterios", "clínicos", "de", "bronquitis", "crónica", "y", "disnea", "a", "moderados", "esfuerzos", ".", "\n", "En", "abril", "de", "2016", ",", "es", "diagnosticado", "de", "carcinoma", "microcítico", "de", "lóbulo", "inferior", "derecho", "(", "LID", ")", ",", "estadio", "IV", ",", "con", "metástasis", "ganglionares", "y", "pancreáticas", ".", "Durante", "el", "diagnóstico", ",", "marcadores", "tumorales", ":", "CEA", "7,5", "y", "enolasa", "neuroespecífica", "69", ".", "\n", "Inicia", "tratamiento", "quimioterápico", "de", "primera", "línea", "con", "carboplatino", "-", "etopósido", "mostrando", "respuesta", "parcial", "de", "la", "masa", "pulmonar", "y", "las", "metástasis", "pancreáticas", "y", "ganglionares", "en", "TC", "tras", "3", "ciclos", "con", "descenso", "de", "enolasa", "neuroespecífica", ".", "Tras", "4º", "ciclo", ",", "se", "pauta", "esquema", "de", "tratamiento", "con", "reducción", "del", "20", "%", "por", "toxicidad", "hematológica", ":", "trombopenia", "G1", "y", "anemia", "G3", ".", "\n", "En", "controles", "adicionales", "por", "la", "Unidad", "de", "Medicina", "Paliativa", ",", "se", "pauta", "dexametasona", "4", "mg", "al", "día", "como", "orexígeno", "y", "oxigenoterapia", "domiciliaria", "con", "gafas", "nasales", "a", "2", "l", "/", "minuto", ".", "Como", "consecuencia", ",", "desarrolla", "hiperglucemias", "secundarias", "a", "tratamiento", "corticoide", ",", "precisando", "inicio", "de", "insulina", "subcutánea", ".", "\n", "Previamente", "al", "6º", "ciclo", ",", "valorado", "en", "Urgencias", "por", "aumento", "de", "disnea", ",", "se", "realiza", "una", "TC", "dere", "-", "evaluación", "que", "objetiva", "progresión", "ganglionar", "mediastínica", "e", "hiliar", ".", "Masa", "pulmonar", "estable", ".", "Se", "suspende", "administración", "del", "6º", "ciclo", "de", "carboplatino", "-", "etopósido", ",", "y", "se", "plantea", "tratamiento", "de", "segunda", "línea", "con", "topotecán", "oral", "que", "inicia", "en", "octubre", "de", "2016", ".", "\n", "Ingresa", "desde", "Urgencias", "en", "el", "5º", "día", "del", "primer", "ciclo", "de", "topotecán", "por", "neutropenia", "febril", "con", "probable", "foco", "respiratorio", ".", "Aunque", "no", "se", "evidencia", "infiltrado", "en", "la", "radiografía", "de", "tórax", ",", "se", "inicia", "tratamiento", "con", "antibioterapia", "de", "amplio", "espectro", "intravenosa", ":", "cefepima", ".", "\n", "Durante", "los", "primeros", "días", "de", "ingreso", ",", "el", "paciente", "refiere", "molestias", "en", "cavidad", "oral", "y", "a", "la", "exploración", ":", "mucositis", "G1", "y", "muguet", "añadiendo", "fluconazol", "intravenoso", "y", "nistatina", "oral", "al", "tratamiento", "antibiótico", ".", "\n", "El", "22", "de", "octubre", "2016", "inicia", "cuadro", "de", "dolor", "intenso", "en", "región", "mandibular", "izquierda", "asociando", "edema", "en", "región", "maxilar", "izquierda", "y", "palpebral", "inferior", "ipsilateral", ".", "\n\n", "Exploración", "física", "\n", "Durante", "la", "exploración", ":", "exoftalmos", "de", "3", "mm", "en", "ojo", "izquierdo", ".", "Limitación", "a", "la", "supraducción", "del", "ojo", "con", "pupilas", "isocóricas", "y", "reactivas", "sin", "defecto", "pupilar", "aferente", ".", "No", "hay", "disminución", "de", "la", "agudeza", "visual", ".", "En", "cavidad", "oral", ":", "escara", "negro", "-", "grisácea", "en", "hemipaladar", "duro", "izquierdo", "de", "3", "cm", "de", "diámetro", "anteroposterior", "y", "2", "cm", "de", "diámetro", "transverso", ".", "Sin", "otras", "lesiones", "en", "cavidad", "oral", "ni", "adenopatías", "cervicales", "palpables", ".", "Durante", "la", "anamnesis", "dirigida", ":", "la", "lesión", "de", "paladar", "ha", "aparecido", "en", "las", "24", "horas", "previas", ".", "En", "fibroscopia", "nasal", "realizada", "por", "Otorrinolaringología", ",", "se", "objetivan", "restos", "hemáticos", "y", "perforación", "septal", "con", "tejido", "negruzco", "que", "obstruye", "la", "fosa", "nasal", "izquierda", ".", "\n\n", "Pruebas", "complementarias", "\n", "Se", "añade", "clindamicina", "para", "cobertura", "de", "gérmenes", "anaerobios", "y", "se", "solicita", "valoración", "y", "biopsia", "urgente", "de", "la", "lesión", "necrótica", "en", "paladar", "por", "parte", "de", "Cirugía", "Maxilofacial", ".", "Se", "realiza", "una", "TC", "facial", "urgente", ":", "muestra", "signos", "de", "sinusopatía", "etmoidal", "con", "presencia", "de", "niveles", "gas", "líquido", ",", "aumento", "de", "partes", "blandas", "a", "nivel", "de", "región", "mandibular", "izquierda", "y", "discontinuidad", "del", "músculo", "platisma", "del", "cuello", ".", "Se", "suspende", "fluconazol", "y", "se", "inicia", "tratamiento", "con", "anfotericina", "B", "liposomal", "5", "mg", "/", "kg", "de", "peso", "cada", "24", "horas", "por", "sospecha", "de", "mucormicosis", ".", "\n\n", "Diagnóstico", "\n", "En", "el", "cultivo", "de", "biopsia", "de", "paladar", "se", "confirma", "aislamiento", "de", "hongo", "filamentoso", "compatible", "con", "Rhizopus", ".", "\n\n", "Tratamiento", "\n", "Es", "valorado", "por", "Otorrinolaringología", ",", "donde", "se", "plantea", "intervención", "quirúrgica", "urgente", "el", "24", "de", "octubre", "2016", ".", "\n", "En", "el", "protocolo", "quirúrgico", "se", "describe", ":", "mucormicosis", "que", "afecta", "a", "2/3", "anteriores", "de", "paladar", "duro", ",", "maxilar", "izquierdo", ",", "tabique", "nasal", ",", "órbita", "izquierda", "y", "celdas", "etmoidales", "posteriores", "y", "anteriores", "ipsilaterales", ".", "Se", "procede", "a", "exenteración", "orbitaria", "en", "bloque", "con", "maxilar", "y", "palatino", "izquierdos", ",", "importante", "necrosis", "de", "pared", "lateral", "nasal", "y", "de", "lámina", "papirácea", ".", "Objetivada", "trombosis", "de", "arterias", "etmoidales", "y", "mínima", "impronta", "de", "Mucor", "en", "base", "de", "cráneo", "a", "nivel", "de", "etmoides", "posterior", "(", "TC", "posquirúrgica", ")", ".", "\n", "Tras", "la", "cirugía", ",", "el", "paciente", "precisa", "nutrición", "enteral", "por", "sonda", "nasogástrica", ".", "Se", "mantiene", "tratamiento", "con", "anfotericina", "B", "a", "dosis", "de", "6", "mg", "/", "kg", "de", "peso", "añadiendo", "caspofungina", ",", "comprobada", "la", "sensibilidad", "al", "tratamiento", "antifúngico", "en", "el", "estudio", "microbiológico", "de", "la", "pieza", "quirúrgica", ".", "\n\n", "Evolución", "\n", "Evolución", "posquirúrgica", "desfavorable", ",", "con", "empeoramiento", "clínico", "los", "días", "posteriores", "a", "la", "intervención", ":", "aumento", "de", "sensación", "disneica", "y", "analgesia", "en", "perfusión", "continua", "por", "dolor", "a", "nivel", "craneofacial", ".", "\n", "Progresión", "de", "lesión", "necrótica", "sobre", "cicatriz", "quirúrgica", "de", "paladar", ",", "pese", "al", "tratamiento", "antifúngico", "mantenido", ".", "\n", "En", "TC", "craneal", "y", "toracoabdominal", "de", "control", "se", "objetivan", "cambios", "posquirúrgicos", "de", "maxilectomía", "izquierda", "y", "exenteración", "de", "órbita", "con", "ocupación", "de", "seno", "frontal", "izquierdo", ",", "etmoidal", "y", "esfenoidal", ".", "En", "tórax", ",", "se", "describe", "aumento", "de", "masa", "pulmonar", "y", "adenopatías", "mediastínicas", "con", "aparición", "de", "infiltrados", "bilaterales", "difusos", "y", "derrame", "pleural", "derecho", "en", "relación", "a", "edema", "pulmonar", "o", "proceso", "infeccioso", ".", "La", "TC", "informa", "progresión", "pulmonar", "de", "la", "enfermedad", "neoplásica", ".", "\n", "Persiste", "importante", "deterioro", "clínico", ",", "respiratorio", "y", "global", "y", ",", "en", "vista", "de", "la", "mala", "evolución", ",", "se", "aumenta", "perfusión", "analgésica", "limitando", "el", "esfuerzo", "terapéutico", ",", "falleciendo", "a", "los", "once", "días", "de", "la", "intervención", "quirúrgica", "." ]
[ "MORFOLOGIA_NEOPLASIA" ]
cofilin is a Individual_protein, actin is a Individual_protein, cofilin is a Gene/protein/RNA
444_task0
Sentence: In order to clarify cofilin-dependent regulation of actin assembly in muscle cells, cofilin tagged with fluorescence dyes was introduced into C2 myoblasts by a micro injection method. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Gene/protein/RNA, Individual_protein
[ "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "B-Gene/protein/RNA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
In order to clarify cofilin-dependent regulation of actin assembly in muscle cells, cofilin tagged with fluorescence dyes was introduced into C2 myoblasts by a micro injection method.
[ "In", "order", "to", "clarify", "cofilin", "-", "dependent", "regulation", "of", "actin", "assembly", "in", "muscle", "cells", ",", "cofilin", "tagged", "with", "fluorescence", "dyes", "was", "introduced", "into", "C2", "myoblasts", "by", "a", "micro", "injection", "method", "." ]
[ "Individual_protein", "Gene/protein/RNA" ]
cofilin is a Individual_protein, actin is a Individual_protein, cofilin is a Gene/protein/RNA
444_task1
Sentence: In order to clarify cofilin-dependent regulation of actin assembly in muscle cells, cofilin tagged with fluorescence dyes was introduced into C2 myoblasts by a micro injection method. Instructions: please typing these entity words according to sentence: cofilin, actin, cofilin Options: Gene/protein/RNA, Individual_protein
[ "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "B-Gene/protein/RNA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
In order to clarify cofilin-dependent regulation of actin assembly in muscle cells, cofilin tagged with fluorescence dyes was introduced into C2 myoblasts by a micro injection method.
[ "In", "order", "to", "clarify", "cofilin", "-", "dependent", "regulation", "of", "actin", "assembly", "in", "muscle", "cells", ",", "cofilin", "tagged", "with", "fluorescence", "dyes", "was", "introduced", "into", "C2", "myoblasts", "by", "a", "micro", "injection", "method", "." ]
[ "Individual_protein", "Gene/protein/RNA" ]
cofilin, actin, cofilin
444_task2
Sentence: In order to clarify cofilin-dependent regulation of actin assembly in muscle cells, cofilin tagged with fluorescence dyes was introduced into C2 myoblasts by a micro injection method. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "B-Gene/protein/RNA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
In order to clarify cofilin-dependent regulation of actin assembly in muscle cells, cofilin tagged with fluorescence dyes was introduced into C2 myoblasts by a micro injection method.
[ "In", "order", "to", "clarify", "cofilin", "-", "dependent", "regulation", "of", "actin", "assembly", "in", "muscle", "cells", ",", "cofilin", "tagged", "with", "fluorescence", "dyes", "was", "introduced", "into", "C2", "myoblasts", "by", "a", "micro", "injection", "method", "." ]
[ "Individual_protein", "Gene/protein/RNA" ]
rat is a species, rat is a species, human is a species, mice is a species, rat is a species, mice is a species, mice is a species, rat is a species, rats is a species, horse is a species, rat is a species, rat is a species, human is a species, bovine is a species, human is a species, human is a species, human is a species
84_task0
Sentence: Down-regulation of the M6P/IGF-II receptor increases cell proliferation and reduces apoptosis in neonatal rat cardiac myocytes Abstract Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a multi-functional protein that has been implicated in regulation of cell growth and apoptosis. Cardiac myocytes express relatively high levels of M6P/IGF2R, and cardiomyocyte apoptosis has been identified in a variety of cardiovascular disorders, such as myocardial infarction and heart failure. However, involvement of M6P/IGF2R in the pathogenesis of these conditions has not been determined. Thus, the objective of this study was to determine the role of M6P/IGF2R in regulation of cardiac myocyte growth and apoptosis. Results We down-regulated the expression of M6P/IGF2R in neonatal rat cardiac myocytes and examined the effect on cell proliferation and apoptosis. Infection of neonatal cardiomyocytes with an adenovirus expressing a ribozyme targeted against the M6P/IGF2R significantly reduced the level of M6P/IGF2R mRNA, as determined by RT-PCR and Ribonuclease Protection Assay (RPA). M6P-containing protein binding and endocytosis as well as the M6P/IGF2R-mediated internalization of 125I-IGF-II were lower in the ribozyme-treated cells than the control myocytes, indicating that the number of functional M6P/IGF2R in the ribozyme treated cells was reduced. Accordingly, a marked increase in cell proliferation and a reduced cell susceptibility to hypoxia- and TNF-induced apoptosis were observed in the ribozyme-treated cells. Conclusions These findings suggest that M6P/IGF2R may play a role in regulation of cardiac myocyte growth and apoptosis. Down regulation of this gene in cardiac tissues might be a new approach to prevention of cell death or promotion of mitogenesis for certain heart diseases. Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a unique protein that interacts with multiple ligands, some of which are important growth regulatory factors [1]. The M6P/IGF2R participates in internalization and lysosomal degradation of IGF-II, a mitogen normally acting through the IGF-I receptor to stimulate cell proliferation [2]. The M6P/IGF2 receptor is required for the activation of TGF-β [3], a potent growth inhibitor for many cell types. This receptor is also involved in the binding, transport and activation of newly-synthesized lysosomal enzymes, such as cathepsins [4,5], which have been recently implicated in the induction of apoptosis [6]. On the basis of these functions, the M6P/IGF2R has been proposed to play a significant role in regulation of cell growth and apoptosis [7]. Apoptosis, or programmed cell death, is a tightly regulated process used to remove excess, hazardous or damaged somatic cells, and is crucial for the development, maintenance and survival of an organism. However, alterations in the control of apoptosis have also been shown to contribute to human diseases. In fact, morphological and biochemical markers of apoptosis have been identified in a wide variety of cardiovascular disorders, including myocardial infarction and heart failure. This suggests that activation of apoptotic pathways contributes to cardiomyocyte loss and subsequent cardiac dysfunction in these conditions. A number of factors involved in cardiomyocyte apoptosis are currently known and include insulin-like growth factor-I (IGF-I), stress-activated protein kinases (SAPKs) and the anti-apoptotic Bcl-2 family [8]. There are indications that other factors may be involved in induction and regulation of cardiac apoptosis. However, these potential factors and their corresponding mechanisms have not been identified. Several lines of evidence point to the potential involvement of M6P/IGF2R in cardiac myocyte proliferation and apoptosis. Cardiac myocytes express relatively high levels of M6P/IGF2R and transgenic mice containing a homologous deletion of the M6P/IGF2R gene manifest ventricular hyperplasia due to an increase in cell number [9,10], suggesting that the M6P/IGF2R normally acts to suppress cardiac myocyte cell growth. It has also been shown that TGF-β, a potent growth suppressor whose activation requires the binding of latent TGF-β to M6P/IGF2R [3], is commonly upregulated in chronic heart failure [11]. Additional evidence for the involvement of M6P/IGF2R in regulation of apoptosis comes from studies of tumorigenesis. It has been shown that M6P/IGF2R expression is significantly reduced in a variety of tumors and loss of heterozygocity (LOH) at the M6P/IGF2R gene locus 6q26 have been found in breast, liver cancers and squamous cell carcinoma of the lung [12-15]. Although several studies have examined the effect of M6P/IGF2R over-expression on cell growth [7], it is not known whether down-regulation of this receptor protein leads to cellular protection against apoptosis. Ribozymes are catalytic RNA molecules that cleave a complementary mRNA sequence [16], thereby inactivating specific mRNAs and suppressing gene expression in vitro and in vivo [17,18]. Ribozymes have been shown to be highly specific, efficient and stable. They can be packaged into viral vectors to enhance transfer into cells and to achieve longer expression compared with naked oligonucleotides. In the present study, we employed ribozyme technology to study the role of M6P/IGF2R in regulation of cardiac myocyte cell growth. A hammerhead ribozyme against the M6P/IGF2R mRNA was constructed and packaged in an adenoviral vector. We then examined the effect of ribozyme-mediated down-regulation of M6P/IGF2R expression on cell growth and hypoxia- and TNF-induced apoptosis. Results Cleavage reaction of the ribozyme in vitro The M6P/IGF2R ribozyme we constructed has 13-bp binding arms complementary to the target site of M6P/IGF2R mRNA, and a catalytic core (Fig. 1A). To evaluate the bioactivity of the ribozyme and the accessibility of the target site, a cleavage reaction was performed in vitro. The substrates, [α-32P] labeled RNA transcripts containing 45 bp of M6P/IGF2R mRNA or an unmatched sequence, were incubated with the ribozyme as described (see Materials and Methods). The ribozyme cleaved only the specific M6P/IGF2R mRNA into the expected products. In the assay of time course, the hammerhead ribozyme was able to cleave 24.2% of the M6P/IGF2R target within 10 minutes of incubation, 50.3% of the M6P/IGF2R target within 40 minutes of incubation, and by 640 minutes, 80.8% of the M6P/IGF2R target was converted to the expected products (Fig. 1B). This ribozyme did not digest the unmatched sequence (Fig. 1B). These results indicate a high efficiency and specificity of the ribozyme in vitro. Ribozymes down-regulate M6P/IGF2R expression in cardiac myocytes To examine the ability of the ribozyme to reduce levels of M6P/IGF2R mRNA in cultured cardiac myocytes, total RNA was extracted from cells infected with Ad-GFP/IGF2R-Rz or Ad-GFP, and subjected to RT-PCR using M6P/IGF2R-specific primers. Primers specific for β-actin were added to a parallel reaction to serve as an internal standard. Cells were used 4 days after infection, with average infection efficiency of 70–80% (for which a viral dose used had minimal cytotoxicity). The RT-PCR product of M6P/IGF2R was 856 bp, and the β-actin product was 285 bp. As shown in Fig. 2A, the Ad-GFP/IGF2R-Rz-infected cells exhibited a significantly lower level of M6P/IGF2R mRNA than Ad-GFP-infected cells, with a reduction of about 50%. This result was confirmed by ribonuclease protection assay (RPA), in which GAPDH was used as a control (Fig. 2C &2D). There was no significant difference in the level of M6P/IGF2R mRNA between Ad-GFP-infected cells and uninfected cells (data not shown), indicating that infection with the adenovirus itself did not alter the endogenous M6P/IGF2R mRNA level. The results demonstrated that the ribozyme was highly effective in suppressing M6P/IGF2R expression in cultured cardiac myocytes. Effect of ribozyme expression on the functional activity of M6P/IGF2R To determine the effect of the ribozyme on the functional activity of M6P/IGF2R, binding and internalization of exogenous 125I-IGF-II was measured in cells infected with Ad-GFP/IGF2R-Rz. As shown in Fig. 3A, cells infected with Ad-GFP/IGF2R-Rz showed a 54% reduction in 125I-IGF-II internalization when compared with the control cells (infected with Ad-GFP). We also examined the effect of the ribozyme on the M6P-binding activity of the M6P/IGF2R using the M6P-bearing lysosomal enzyme, β-glucuronidase, as a probe. The results showed that the maximal M6P-binding capacity of cells treated with the ribozyme was about 50% less than that of controls (Fig. 3B). Furthermore, we assessed the ability of cells to internalize exogenous β-glucuronidase after treatment with ribozyme. Similarly, the M6P-inhibitable endocytosis of β-glucuronidase by ribozyme-treated cells was about 52% less than that of control cells (Fig. 3C). These results confirm that the number of functional M6P/IGF2R in ribozyme-treated cells was reduced. Adenoviral delivery of ribozymes increases the proliferation of cardiac myocytes We examined the effects of the ribozyme on the growth of cultured neonatal rat cardiac myocytes. Morphological evaluation showed a remarkable difference in growth pattern between Ad-GFP/IGF2R-Rz-infected cells and the control cells: the ribozyme-expressing cells formed larger and more spread colonies (Fig. 4). Assessment of cell proliferative activity by the MTT assay and counts of viable cells showed that the number of cardiac myocytes in ribozyme-expressing cultures was significantly higher than in control cultures (Fig. 5). These results indicate that treatment with M6P/IGF2R-ribozyme can promote cardiac myocyte proliferation. Effect of M6P/IGF2R-ribozyme expression on apoptosis of cardiac myocytes We examined the effects of ribozyme expression on TNF-α and hypoxia-induced apoptosis of cultured cardiac myocytes. After a 24 hr challenge with hypoxia, the number of apoptotic cells in M6P/IGF2R-Rz expressing cultures was 38% lower than in control cultures as determined by Hoechst staining (which highlights the nuclei of apoptotic cells) and ELISA (Fig. 6A, 7A). MTT analysis showed that the number of viable cells in ribozyme-treated cultures was 40% higher than in control cultures (Fig. 7A). After treatment with TNF-α, as shown in Fig. 6B, a large number of control cells underwent apoptosis, as indicated by morphological changes (small round shape) and bright blue nuclear staining. There were significantly more apoptotic cells in control cultures than in cultures expressing the Ad-GFP/IGF2R-Rz. The number of apoptotic cells, as measured by the cell death ELISA assay, in cultures infected with Ad-GFP/IGF2R-Rz was significantly (about 40%) lower than in cultures infected with Ad-GFP (Fig. 7B). Accordingly, the number of viable cells, as measured by MTT analysis, in cultures infected with Ad-GFP/IGF2R-Rz was significantly (about 45%) higher than in cultures infected with Ad-GFP (Fig. 7B). These results are consistent with the hypothesis that decreasing M6P/IGF2R expression by ribozyme treatment can reduce cell apoptosis. Discussion Some 62,000,000 Americans have one or more types of cardiovascular disease (CVD) and CVD is the leading cause (40.1%) of death in the United States. Myocardial infarction and heart failure, conditions accompanied by cardiac myocyte apoptosis, represent 23% of all CVDs and are a growing clinical challenge in need of novel therapeutic strategies. In this study, we investigated the M6P/IGF2R as a potential new therapeutic target for reduction of cardiac apoptosis and cardiac injury in these conditions. Using ribozyme technology we down-regulated the expression of the M6P/IGF2R in neonatal cardiac myocytes. We then examined cell proliferation and apoptosis under normal conditions and post challenge with either hypoxia, a model of ischemia-reperfusion, or TNF-α, a cytokine implicated in the pathogenesis of chronic heart failure [19]. Our results demonstrate an association of a decrease in the expression and function of the M6P/IGF2R with increased cell proliferation and decreased cell susceptibility to hypoxia- and TNF-induced apoptosis. Expression of the ribozyme targeted against the M6P/IGF2R in cardiomyocytes resulted in down-regulation of M6P/IGF2R expression, as measured by RT-PCR and RPA, and of M6P/IGF2R function, as indicated by a decrease in internalization of 125I-IGF-II, and β-glucuronidase binding and endocytosis. MTT analysis and viable cell counts showed that ribozyme-mediated down-regulation of M6P/IGF2R resulted in a marked increase in cell proliferation of cardiomyocytes, which normally express high levels of M6P/IGF2R [20] and have limited proliferative capabilities [21]. These results are consistent with the findings of previous knockout studies [9,10]. Since the M6P/IGF2R has multiple actions on cell growth, its proliferative effect on the heart cells observed in this study might involve multiple mechanisms. However, it is likely that unchecked IGF-II stimulation plays a key role in the effect. Because the M6P/IGF2R is believed to sequester and degrade IGF-II [2], a decrease in M6P/IGF2R expression and function could result in decreased degradation and hence increased bioavailability of IGF-II to the IGF-I receptor, which mediates the growth-promoting effect of IGF-II. Supporting evidence for the involvement of IGF-II in the proliferative effect resulting from loss of M6P/IGF2R function comes from studies of M6P/IGF2R knock-out mice. M6P/IGF2R-null mice display global hyperplasia that coincides with elevated levels of IGF-II. Most importantly, however, the lethal nature of an M6P/IGF2R-null phenotype is reversed in an IGF-II-null background [9]. Our results showing that ribozyme-mediated down-regulation of M6P/IGF2R lead to a decrease in IGF-II internalization support the above possibility. However, further investigation to confirm this mechanism is warranted. More importantly, our results also showed that M6P/IGF2R down-regulation resulted in decreased sensitivity of cardiomyocytes to hypoxia- and TNF-induced apoptosis. There is evidence that lysosomal enzymes, such as cathepsins B and D contribute to hypoxia- and TNF-induced apoptosis in vitro [22-25] and in vivo [26,27]. The M6P/IGF2R has been shown to be involved in binding, transport and activation of lysosomal enzymes, including cathepsins [4,5]. Therefore, it is possible that down-regulation of the M6P/IGF2R results in improper trafficking and activation of cathepsins. This, in turn would eliminate the apoptotic cascades triggered by these enzymes under hypoxia and TNF stimulation and result in decreased sensitivity of cardiomyocytes to apoptosis. It has also been shown that TNF stimulation involves the activation of TGF-β [28-30], a ligand of M6P/IGF2R that has been implicated in the progression of chronic heart failure [11,31]. Therefore, down-regulation of M6P/IGF2R expression could also lead to a decreased bioavailability of activated TGF-β, thereby decreasing the sensitivity of cardiomyocytes to the TNF/TGF-β apoptotic pathway. The detailed mechanism of the observed effects is unknown and requires further investigation. Conclusions The present study demonstrates that ribozyme-mediated down-regulation of expression and functional activity of the M6P/IGF2R results in a decrease in the susceptibility of cardiac myocytes to apoptotic stimuli. These findings suggest that this receptor might be involved in cardiac cell growth and apoptosis. The ability of the M6P/IGF2R ribozyme to reduce M6P/IGF2R expression and function in transfected cells verifies the utility of the ribozyme in studying the role of M6P/IGF2R in cardiomyocyte growth and apoptosis. In addition to its utility as a research tool, the ribozyme, with further exploration and development, might have potential application as a therapeutic agent to prevent cell death or promote mitogenesis for certain clinical conditions, such as, myocardial infarction and chronic heart failure. Methods Construction of recombinant M6P/IGF2R-RZ adenoviral vector The nucleotide numbers of the rat M6P/IGF2R sequence targeted by the hammerhead ribozyme is 1147–1160 after coding site (exon 9). The structure of the M6P/IGF2R hammerhead ribozyme is shown in Fig. 1. A 49 bp M6P/IGF2R ribozyme oligonucleotide, 5'-GAATTCCCC ACACTG ATGAGCCGCTTCGGCGGCGAAACATTCAAC GCGT-3' and the corresponding reverse complementary strand were synthesized. The fragments were subcloned to produce a plasmid containing a ribozyme against M6P/IGF2R. For construction of the recombinant adenovirus containing the M6P/IGF2R-ribozyme (pAd-GFP/IGF2R-Rz), the segments containing the ribozymes were amplified by PCR and cloned into a pAdTrack-CMV vector and then recombined homologously with an adenoviral backbone pAdEasy 1 vector to generate (pAd-GFP/IGF2R-Rz), following the protocol described by He et al. [32]. The pAd-GFP/IGF2R-Rz carries both the IGF2R-Rz and GFP (as reporter) genes, each under the control of separate cytomegalovirus (CMV) promoters. Another viral vector, pAd-GFP, which carries the GFP gene only under the control of the CMV promoter, was generated and used as a control vector. The adenoviral vector DNA were linerized with Pac I and transfected into the replication-permissive 293 cells (E1A transcomplementing cell line) by using Lipofectamine (Life Technologies) to produce E1-deleted, replication-defective recombinant adenovirus as described previously [33]. Large-scale amplification of recombinant adenovirus in 293 cells was followed by purification using a discontinuous CsCl gradient. The constructs were confirmed by enzymatic digestion and DNA sequencing. Transcription and cleavage reaction of ribozyme in vitro Plasmids containing the ribozyme or the substrate (either 45 bp of M6P/IGF2R mRNA or an unmatched sequence 5'-GTGCTGTCTGTATG-3') were linearized with MluI, respectively. All transcripts were generated with T7 RNA polymerase (Promega). Substrate transcripts were labeled by incorporation of [α-32P] UTP (NEN Life Science Products, Inc.). Specific activity of the [α-32P] UTP (10 μCi/μl) and the base composition of each substrate molecule were used to calculate the substrate concentration. Ribozyme transcripts were quantified spectrophotometrically. (The half-life of the M6P/IGF2R target is about 280 minutes). Cleavage reaction mixture contained substrate RNA (40 nM), increasing amounts of ribozyme (60 nM), 20 mM MgCl2 and 20 mM Tris-HCl, pH8.0, in a final volume of 10 μl. The mixture was incubated at 37°C for a time-course of cleavage reaction from 0, 5, 10, 20, 40, 80, 160, 320, to 640 minutes and the cleavage reaction was stopped by addition of loading buffer (80% formamide, 10 mM Na2EDTA, pH 8.0, and 1 mg/ml each bromophenol blue and xylene cyanol). Cleavage products were analyzed on a 15% polyacrylamide and 8M urea gel. Product and substrate fragments were quantitated by using NIH Imager. Cell cultures and infection with Ad-GFP/Rz-IGF2R and Ad-GFP Cardiac myocytes were isolated from 1-day-old newborn rats using the Neonatal Cardiomyocyte Isolation System (Worthington). The isolated cells were plated in 6-well plates and cultured in F-10 medium containing 5% (vol/vol) FBS and 10% (vol/vol) horse serum at 37°C in a tissue culture incubator with 5% CO2 and 98% relative humidity. Cells were used for experiments after 2–3 days of culture. Viral infections were carried out by adding viral particles at various concentrations (usually, 2 × 108 virus particles/ml) to culture medium containing 2% (vol/vol) FBS. Initially, optimal viral concentration was determined by using Ad-GFP to achieve an optimal balance of high gene expression and low viral titer to minimize cytotoxicity. After 24 hours of incubation, the infection medium was replaced with normal (15% vol/vol serum) culture medium. For treatment with IGF-II, cells were incubated with 50 ng/ml IGF-II after 24 hours infection with Ad-GFP/IGF2R-Rz or Ad-GFP. Four days after infection, cells were used for analysis of gene expression of M6P/IGF2R and its effect on cell growth and apoptosis. Analysis of gene expression in cardiac myocytes The M6P/IGF2R transcripts were determined by both RT-PCR and Ribonuclease Protection Assay (RPA). RT-PCR was performed using the GeneAmp EZ rTth RNA PCR kit (Roche). Total RNA was extracted from cultured cells using an RNA isolation kit (Qiagen,), according to the manufacturer's protocol. M6P/IGF2R transcripts were amplified using the primers (5'-GACAGGCTCGTTCTGACTTA-3') and (5'-CTTCCACTCTTATCCACAGC-3') specific to the M6P/IGF2R. Each RT-PCR assay was performed in triplicate and product levels varied by less than 3.2% for each RNA sample. Primers specific for β-actin cDNA were added to a parallel reaction to standardize for variations in PCR between samples. PCR products were resolved on a 1.0% agarose gel, visualized under UV light and quantitated using NIH Imager. RPA was performed using the RPA III kit (Ambion, Austin, TX). Briefly, total RNA was extracted from cultured cells using a total RNA isolation reagent (TRIzol, Gibco BRL) according to the manufacturer's protocol. The plasmid containing the rat M6P/IGF2R gene was linearized and used as a transcription template. Antisense RNA probes were transcribed in vitro using [33P]-UTP, T7 polymerase (Riboprobea System T7 kit, Promega), hybridized with the total RNA extracted from the rat cardiomyocytes, and digested with ribonuclease to remove non-hybridized RNA and probe. The protected RNA·RNA was resolved on a denaturing 5% sequence gel and subjected to autoradiography. A probe targeting the GAPDH gene was used as an internal control. Measurement of 125I-IGF-II internalization Cells were incubated at 37°C for 2 hrs in serum-free F-10 culture medium containing 125I-labeled IGF-II (0.5 ng/ml) with or without excess unlabeled IGF-II (2 μg/ml). Following the incubation, the cells were washed three times with ice-cold PBS, and cell-associated radioactivity was determined by a γ counter. Specific internalized 125I-IGF-II was calculated by subtracting the count of samples with excessive unlabeled IGF-II from that without unlabeled IGF-II, and normalized to protein contents. Beta-glucuronidase binding assay Binding of β-glucuronidase was assayed as described previously [34,35]. Briefly, cells were permeabilized with 0.25% saponin in 50 mM Hepes (pH 7.0), 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, and 10 mM mannose-6-phosphate (M6P) for 30 minutes on ice. The cells were washed three times with ice-cold PBS containing 0.05% saponin. They were incubated with 20,000 units/ml β-glucuronidase from bovine liver (Sigma) in 50 mM Hepes (pH 7.5) containing 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, 0.5% saponin with or without 10 mM M6P overnight on ice. Cells were washed five times with ice-cold PBS containing 0.05% saponin and sonicated in 100 mM sodium acetate (pH 4.6). The protein concentration of solubilized cell extract was measured and enzyme activity was assayed as follows: for each reaction 50 ul cell extract were added to 500 ul of 100 mM sodium acetate (pH 4.0) containing 1 mM paranitrophenyl (PNP)-β-glucuronide (Sigma) as substrate. After an incubation period of 3 hours at 37°C, 500 ul 1 M Na2CO3 were added to each reaction and the absorbance was measured at 400 nm. Experimental values were compared to a standard curve that was constructed using 1–100 nM solutions of PNP (Sigma) in 500 ul 100 mM sodium acetate and 500 u1 1 M Na2CO3. Specific activity was calculated as nM of PNP produced/hour/mg of protein. Beta-glucuronidase endocytosis assay Beta-glucuronidase endocytosis assay was carried out as described previously [36]. Briefly, confluent cell cultures were washed twice with pre-warmed serum-free DMEM followed by incubation with DMEM containing 5 mg/ml human serum albumin and 10 mM M6P for 20 minutes. Following incubation cells were washed 3 times with pre-warmed DMEM. Cells were then incubated in DMEM containing 5 mg/ml human serum albumin alone or 4000 units β-glucuronidase with or without 10 mM M6P for 2 hours at 37°C. Following the incubation, the cells were washed 5 times with ice-cold PBS and subjected to enzyme activity assay as described above. Cell proliferation assay (MTT assay and cell counts) Cardiac myocytes were grown in culture plates (tissue culture grade, 12 wells, flat bottom) in a final volume of 1 ml serum-containing culture medium per well, in a humidified atmosphere (37°C and 5% C02) for 3 days. After infection with Ad-GFP/IGF2R-Rz or Ad-GFP, cells were incubated with or without 50 ng/ml IGF-II for 4 days. Following supplementation with IGF-II, 100 μl MTT labeling reagent (Roche) were added to each well and cells were incubated for 4 hours, followed by addition of 1 ml solubilization solution into each well. The plate was placed in an incubator at 37°C overnight. Spectrophotometrical absorbency of the samples was measured using an UV-visible Recording Spectrophotometer with wavelength of 550–690 nm. In addition, the total number of viable cells in each treatment was counted by trypan blue exclusion method using a hemocytometer. Induction and analysis of cell apoptosis Cells were infected with Ad-GFP or Ad-GFP/IGF2R-Rz. Seventy-two hours post infection, cells were treated with TNF (0.1 ng/ml) for 24 hrs or subjected to hypoxia. For induction of apoptosis by hypoxia, cell culture medium was changed to serum-free F-10 saturated with 95% N2/5% CO2 and cells were placed in a 37°C airtight box saturated with 95% N2/5% CO2 for 24 hrs. For normoxic controls, culture medium was changed to F-10/5%F BS/10% HS and cells were placed in a 37°C/5% CO2 incubator for 24 hrs before analysis. Apoptotic cells were identified by Hoechst staining using the Vybrant™ Apoptosis Kit #5 (Molecular Probes) according to the manufacturer's protocol. In addition, after infection with Ad-GFP or Ad-GFP/IGF2R-Rz and challenge with either TNF or hypoxia, cell viability was assessed using the MTT assay Kit (Roche Molecular Biochemicals) and cell apoptosis was determined using the Cell Death Detection ELISA Kit assay (Roche Molecular Biochemicals) according to the manufacturer's protocol. Statistical analysis Students' t-test was used to evaluate the difference between two values. Each experiment was repeated at least three times. Statistical significance was accepted at the level of p < 0.05. List of abbreviations used Ad-GFP, adenovirus carrying GFP gene; Ad-GFP/IGF2R-Rz, adenovirus carrying both the ribozyme against M6P/IGF2R and the GFP gene; GFP, green fluorescent protein; IGF-II, insulin-like growth factor II; M6P/IGF2R, mannose 6-phosphate/insulin-like growth factor II receptor; Rz, ribozyme. Authors' contributions ZC carried out construction of the ribozyme, production of the viruses, cellular experiments, biochemical assays and data analysis. YG carried out the RPA assay and participated in the molecular biological studies. JXK conceived of the study, participated in its design and coordination, and drafted the manuscript. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: species
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Down-regulation of the M6P/IGF-II receptor increases cell proliferation and reduces apoptosis in neonatal rat cardiac myocytes Abstract Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a multi-functional protein that has been implicated in regulation of cell growth and apoptosis. Cardiac myocytes express relatively high levels of M6P/IGF2R, and cardiomyocyte apoptosis has been identified in a variety of cardiovascular disorders, such as myocardial infarction and heart failure. However, involvement of M6P/IGF2R in the pathogenesis of these conditions has not been determined. Thus, the objective of this study was to determine the role of M6P/IGF2R in regulation of cardiac myocyte growth and apoptosis. Results We down-regulated the expression of M6P/IGF2R in neonatal rat cardiac myocytes and examined the effect on cell proliferation and apoptosis. Infection of neonatal cardiomyocytes with an adenovirus expressing a ribozyme targeted against the M6P/IGF2R significantly reduced the level of M6P/IGF2R mRNA, as determined by RT-PCR and Ribonuclease Protection Assay (RPA). M6P-containing protein binding and endocytosis as well as the M6P/IGF2R-mediated internalization of 125I-IGF-II were lower in the ribozyme-treated cells than the control myocytes, indicating that the number of functional M6P/IGF2R in the ribozyme treated cells was reduced. Accordingly, a marked increase in cell proliferation and a reduced cell susceptibility to hypoxia- and TNF-induced apoptosis were observed in the ribozyme-treated cells. Conclusions These findings suggest that M6P/IGF2R may play a role in regulation of cardiac myocyte growth and apoptosis. Down regulation of this gene in cardiac tissues might be a new approach to prevention of cell death or promotion of mitogenesis for certain heart diseases. Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a unique protein that interacts with multiple ligands, some of which are important growth regulatory factors [1]. The M6P/IGF2R participates in internalization and lysosomal degradation of IGF-II, a mitogen normally acting through the IGF-I receptor to stimulate cell proliferation [2]. The M6P/IGF2 receptor is required for the activation of TGF-β [3], a potent growth inhibitor for many cell types. This receptor is also involved in the binding, transport and activation of newly-synthesized lysosomal enzymes, such as cathepsins [4,5], which have been recently implicated in the induction of apoptosis [6]. On the basis of these functions, the M6P/IGF2R has been proposed to play a significant role in regulation of cell growth and apoptosis [7]. Apoptosis, or programmed cell death, is a tightly regulated process used to remove excess, hazardous or damaged somatic cells, and is crucial for the development, maintenance and survival of an organism. However, alterations in the control of apoptosis have also been shown to contribute to human diseases. In fact, morphological and biochemical markers of apoptosis have been identified in a wide variety of cardiovascular disorders, including myocardial infarction and heart failure. This suggests that activation of apoptotic pathways contributes to cardiomyocyte loss and subsequent cardiac dysfunction in these conditions. A number of factors involved in cardiomyocyte apoptosis are currently known and include insulin-like growth factor-I (IGF-I), stress-activated protein kinases (SAPKs) and the anti-apoptotic Bcl-2 family [8]. There are indications that other factors may be involved in induction and regulation of cardiac apoptosis. However, these potential factors and their corresponding mechanisms have not been identified. Several lines of evidence point to the potential involvement of M6P/IGF2R in cardiac myocyte proliferation and apoptosis. Cardiac myocytes express relatively high levels of M6P/IGF2R and transgenic mice containing a homologous deletion of the M6P/IGF2R gene manifest ventricular hyperplasia due to an increase in cell number [9,10], suggesting that the M6P/IGF2R normally acts to suppress cardiac myocyte cell growth. It has also been shown that TGF-β, a potent growth suppressor whose activation requires the binding of latent TGF-β to M6P/IGF2R [3], is commonly upregulated in chronic heart failure [11]. Additional evidence for the involvement of M6P/IGF2R in regulation of apoptosis comes from studies of tumorigenesis. It has been shown that M6P/IGF2R expression is significantly reduced in a variety of tumors and loss of heterozygocity (LOH) at the M6P/IGF2R gene locus 6q26 have been found in breast, liver cancers and squamous cell carcinoma of the lung [12-15]. Although several studies have examined the effect of M6P/IGF2R over-expression on cell growth [7], it is not known whether down-regulation of this receptor protein leads to cellular protection against apoptosis. Ribozymes are catalytic RNA molecules that cleave a complementary mRNA sequence [16], thereby inactivating specific mRNAs and suppressing gene expression in vitro and in vivo [17,18]. Ribozymes have been shown to be highly specific, efficient and stable. They can be packaged into viral vectors to enhance transfer into cells and to achieve longer expression compared with naked oligonucleotides. In the present study, we employed ribozyme technology to study the role of M6P/IGF2R in regulation of cardiac myocyte cell growth. A hammerhead ribozyme against the M6P/IGF2R mRNA was constructed and packaged in an adenoviral vector. We then examined the effect of ribozyme-mediated down-regulation of M6P/IGF2R expression on cell growth and hypoxia- and TNF-induced apoptosis. Results Cleavage reaction of the ribozyme in vitro The M6P/IGF2R ribozyme we constructed has 13-bp binding arms complementary to the target site of M6P/IGF2R mRNA, and a catalytic core (Fig. 1A). To evaluate the bioactivity of the ribozyme and the accessibility of the target site, a cleavage reaction was performed in vitro. The substrates, [α-32P] labeled RNA transcripts containing 45 bp of M6P/IGF2R mRNA or an unmatched sequence, were incubated with the ribozyme as described (see Materials and Methods). The ribozyme cleaved only the specific M6P/IGF2R mRNA into the expected products. In the assay of time course, the hammerhead ribozyme was able to cleave 24.2% of the M6P/IGF2R target within 10 minutes of incubation, 50.3% of the M6P/IGF2R target within 40 minutes of incubation, and by 640 minutes, 80.8% of the M6P/IGF2R target was converted to the expected products (Fig. 1B). This ribozyme did not digest the unmatched sequence (Fig. 1B). These results indicate a high efficiency and specificity of the ribozyme in vitro. Ribozymes down-regulate M6P/IGF2R expression in cardiac myocytes To examine the ability of the ribozyme to reduce levels of M6P/IGF2R mRNA in cultured cardiac myocytes, total RNA was extracted from cells infected with Ad-GFP/IGF2R-Rz or Ad-GFP, and subjected to RT-PCR using M6P/IGF2R-specific primers. Primers specific for β-actin were added to a parallel reaction to serve as an internal standard. Cells were used 4 days after infection, with average infection efficiency of 70–80% (for which a viral dose used had minimal cytotoxicity). The RT-PCR product of M6P/IGF2R was 856 bp, and the β-actin product was 285 bp. As shown in Fig. 2A, the Ad-GFP/IGF2R-Rz-infected cells exhibited a significantly lower level of M6P/IGF2R mRNA than Ad-GFP-infected cells, with a reduction of about 50%. This result was confirmed by ribonuclease protection assay (RPA), in which GAPDH was used as a control (Fig. 2C &2D). There was no significant difference in the level of M6P/IGF2R mRNA between Ad-GFP-infected cells and uninfected cells (data not shown), indicating that infection with the adenovirus itself did not alter the endogenous M6P/IGF2R mRNA level. The results demonstrated that the ribozyme was highly effective in suppressing M6P/IGF2R expression in cultured cardiac myocytes. Effect of ribozyme expression on the functional activity of M6P/IGF2R To determine the effect of the ribozyme on the functional activity of M6P/IGF2R, binding and internalization of exogenous 125I-IGF-II was measured in cells infected with Ad-GFP/IGF2R-Rz. As shown in Fig. 3A, cells infected with Ad-GFP/IGF2R-Rz showed a 54% reduction in 125I-IGF-II internalization when compared with the control cells (infected with Ad-GFP). We also examined the effect of the ribozyme on the M6P-binding activity of the M6P/IGF2R using the M6P-bearing lysosomal enzyme, β-glucuronidase, as a probe. The results showed that the maximal M6P-binding capacity of cells treated with the ribozyme was about 50% less than that of controls (Fig. 3B). Furthermore, we assessed the ability of cells to internalize exogenous β-glucuronidase after treatment with ribozyme. Similarly, the M6P-inhibitable endocytosis of β-glucuronidase by ribozyme-treated cells was about 52% less than that of control cells (Fig. 3C). These results confirm that the number of functional M6P/IGF2R in ribozyme-treated cells was reduced. Adenoviral delivery of ribozymes increases the proliferation of cardiac myocytes We examined the effects of the ribozyme on the growth of cultured neonatal rat cardiac myocytes. Morphological evaluation showed a remarkable difference in growth pattern between Ad-GFP/IGF2R-Rz-infected cells and the control cells: the ribozyme-expressing cells formed larger and more spread colonies (Fig. 4). Assessment of cell proliferative activity by the MTT assay and counts of viable cells showed that the number of cardiac myocytes in ribozyme-expressing cultures was significantly higher than in control cultures (Fig. 5). These results indicate that treatment with M6P/IGF2R-ribozyme can promote cardiac myocyte proliferation. Effect of M6P/IGF2R-ribozyme expression on apoptosis of cardiac myocytes We examined the effects of ribozyme expression on TNF-α and hypoxia-induced apoptosis of cultured cardiac myocytes. After a 24 hr challenge with hypoxia, the number of apoptotic cells in M6P/IGF2R-Rz expressing cultures was 38% lower than in control cultures as determined by Hoechst staining (which highlights the nuclei of apoptotic cells) and ELISA (Fig. 6A, 7A). MTT analysis showed that the number of viable cells in ribozyme-treated cultures was 40% higher than in control cultures (Fig. 7A). After treatment with TNF-α, as shown in Fig. 6B, a large number of control cells underwent apoptosis, as indicated by morphological changes (small round shape) and bright blue nuclear staining. There were significantly more apoptotic cells in control cultures than in cultures expressing the Ad-GFP/IGF2R-Rz. The number of apoptotic cells, as measured by the cell death ELISA assay, in cultures infected with Ad-GFP/IGF2R-Rz was significantly (about 40%) lower than in cultures infected with Ad-GFP (Fig. 7B). Accordingly, the number of viable cells, as measured by MTT analysis, in cultures infected with Ad-GFP/IGF2R-Rz was significantly (about 45%) higher than in cultures infected with Ad-GFP (Fig. 7B). These results are consistent with the hypothesis that decreasing M6P/IGF2R expression by ribozyme treatment can reduce cell apoptosis. Discussion Some 62,000,000 Americans have one or more types of cardiovascular disease (CVD) and CVD is the leading cause (40.1%) of death in the United States. Myocardial infarction and heart failure, conditions accompanied by cardiac myocyte apoptosis, represent 23% of all CVDs and are a growing clinical challenge in need of novel therapeutic strategies. In this study, we investigated the M6P/IGF2R as a potential new therapeutic target for reduction of cardiac apoptosis and cardiac injury in these conditions. Using ribozyme technology we down-regulated the expression of the M6P/IGF2R in neonatal cardiac myocytes. We then examined cell proliferation and apoptosis under normal conditions and post challenge with either hypoxia, a model of ischemia-reperfusion, or TNF-α, a cytokine implicated in the pathogenesis of chronic heart failure [19]. Our results demonstrate an association of a decrease in the expression and function of the M6P/IGF2R with increased cell proliferation and decreased cell susceptibility to hypoxia- and TNF-induced apoptosis. Expression of the ribozyme targeted against the M6P/IGF2R in cardiomyocytes resulted in down-regulation of M6P/IGF2R expression, as measured by RT-PCR and RPA, and of M6P/IGF2R function, as indicated by a decrease in internalization of 125I-IGF-II, and β-glucuronidase binding and endocytosis. MTT analysis and viable cell counts showed that ribozyme-mediated down-regulation of M6P/IGF2R resulted in a marked increase in cell proliferation of cardiomyocytes, which normally express high levels of M6P/IGF2R [20] and have limited proliferative capabilities [21]. These results are consistent with the findings of previous knockout studies [9,10]. Since the M6P/IGF2R has multiple actions on cell growth, its proliferative effect on the heart cells observed in this study might involve multiple mechanisms. However, it is likely that unchecked IGF-II stimulation plays a key role in the effect. Because the M6P/IGF2R is believed to sequester and degrade IGF-II [2], a decrease in M6P/IGF2R expression and function could result in decreased degradation and hence increased bioavailability of IGF-II to the IGF-I receptor, which mediates the growth-promoting effect of IGF-II. Supporting evidence for the involvement of IGF-II in the proliferative effect resulting from loss of M6P/IGF2R function comes from studies of M6P/IGF2R knock-out mice. M6P/IGF2R-null mice display global hyperplasia that coincides with elevated levels of IGF-II. Most importantly, however, the lethal nature of an M6P/IGF2R-null phenotype is reversed in an IGF-II-null background [9]. Our results showing that ribozyme-mediated down-regulation of M6P/IGF2R lead to a decrease in IGF-II internalization support the above possibility. However, further investigation to confirm this mechanism is warranted. More importantly, our results also showed that M6P/IGF2R down-regulation resulted in decreased sensitivity of cardiomyocytes to hypoxia- and TNF-induced apoptosis. There is evidence that lysosomal enzymes, such as cathepsins B and D contribute to hypoxia- and TNF-induced apoptosis in vitro [22-25] and in vivo [26,27]. The M6P/IGF2R has been shown to be involved in binding, transport and activation of lysosomal enzymes, including cathepsins [4,5]. Therefore, it is possible that down-regulation of the M6P/IGF2R results in improper trafficking and activation of cathepsins. This, in turn would eliminate the apoptotic cascades triggered by these enzymes under hypoxia and TNF stimulation and result in decreased sensitivity of cardiomyocytes to apoptosis. It has also been shown that TNF stimulation involves the activation of TGF-β [28-30], a ligand of M6P/IGF2R that has been implicated in the progression of chronic heart failure [11,31]. Therefore, down-regulation of M6P/IGF2R expression could also lead to a decreased bioavailability of activated TGF-β, thereby decreasing the sensitivity of cardiomyocytes to the TNF/TGF-β apoptotic pathway. The detailed mechanism of the observed effects is unknown and requires further investigation. Conclusions The present study demonstrates that ribozyme-mediated down-regulation of expression and functional activity of the M6P/IGF2R results in a decrease in the susceptibility of cardiac myocytes to apoptotic stimuli. These findings suggest that this receptor might be involved in cardiac cell growth and apoptosis. The ability of the M6P/IGF2R ribozyme to reduce M6P/IGF2R expression and function in transfected cells verifies the utility of the ribozyme in studying the role of M6P/IGF2R in cardiomyocyte growth and apoptosis. In addition to its utility as a research tool, the ribozyme, with further exploration and development, might have potential application as a therapeutic agent to prevent cell death or promote mitogenesis for certain clinical conditions, such as, myocardial infarction and chronic heart failure. Methods Construction of recombinant M6P/IGF2R-RZ adenoviral vector The nucleotide numbers of the rat M6P/IGF2R sequence targeted by the hammerhead ribozyme is 1147–1160 after coding site (exon 9). The structure of the M6P/IGF2R hammerhead ribozyme is shown in Fig. 1. A 49 bp M6P/IGF2R ribozyme oligonucleotide, 5'-GAATTCCCC ACACTG ATGAGCCGCTTCGGCGGCGAAACATTCAAC GCGT-3' and the corresponding reverse complementary strand were synthesized. The fragments were subcloned to produce a plasmid containing a ribozyme against M6P/IGF2R. For construction of the recombinant adenovirus containing the M6P/IGF2R-ribozyme (pAd-GFP/IGF2R-Rz), the segments containing the ribozymes were amplified by PCR and cloned into a pAdTrack-CMV vector and then recombined homologously with an adenoviral backbone pAdEasy 1 vector to generate (pAd-GFP/IGF2R-Rz), following the protocol described by He et al. [32]. The pAd-GFP/IGF2R-Rz carries both the IGF2R-Rz and GFP (as reporter) genes, each under the control of separate cytomegalovirus (CMV) promoters. Another viral vector, pAd-GFP, which carries the GFP gene only under the control of the CMV promoter, was generated and used as a control vector. The adenoviral vector DNA were linerized with Pac I and transfected into the replication-permissive 293 cells (E1A transcomplementing cell line) by using Lipofectamine (Life Technologies) to produce E1-deleted, replication-defective recombinant adenovirus as described previously [33]. Large-scale amplification of recombinant adenovirus in 293 cells was followed by purification using a discontinuous CsCl gradient. The constructs were confirmed by enzymatic digestion and DNA sequencing. Transcription and cleavage reaction of ribozyme in vitro Plasmids containing the ribozyme or the substrate (either 45 bp of M6P/IGF2R mRNA or an unmatched sequence 5'-GTGCTGTCTGTATG-3') were linearized with MluI, respectively. All transcripts were generated with T7 RNA polymerase (Promega). Substrate transcripts were labeled by incorporation of [α-32P] UTP (NEN Life Science Products, Inc.). Specific activity of the [α-32P] UTP (10 μCi/μl) and the base composition of each substrate molecule were used to calculate the substrate concentration. Ribozyme transcripts were quantified spectrophotometrically. (The half-life of the M6P/IGF2R target is about 280 minutes). Cleavage reaction mixture contained substrate RNA (40 nM), increasing amounts of ribozyme (60 nM), 20 mM MgCl2 and 20 mM Tris-HCl, pH8.0, in a final volume of 10 μl. The mixture was incubated at 37°C for a time-course of cleavage reaction from 0, 5, 10, 20, 40, 80, 160, 320, to 640 minutes and the cleavage reaction was stopped by addition of loading buffer (80% formamide, 10 mM Na2EDTA, pH 8.0, and 1 mg/ml each bromophenol blue and xylene cyanol). Cleavage products were analyzed on a 15% polyacrylamide and 8M urea gel. Product and substrate fragments were quantitated by using NIH Imager. Cell cultures and infection with Ad-GFP/Rz-IGF2R and Ad-GFP Cardiac myocytes were isolated from 1-day-old newborn rats using the Neonatal Cardiomyocyte Isolation System (Worthington). The isolated cells were plated in 6-well plates and cultured in F-10 medium containing 5% (vol/vol) FBS and 10% (vol/vol) horse serum at 37°C in a tissue culture incubator with 5% CO2 and 98% relative humidity. Cells were used for experiments after 2–3 days of culture. Viral infections were carried out by adding viral particles at various concentrations (usually, 2 × 108 virus particles/ml) to culture medium containing 2% (vol/vol) FBS. Initially, optimal viral concentration was determined by using Ad-GFP to achieve an optimal balance of high gene expression and low viral titer to minimize cytotoxicity. After 24 hours of incubation, the infection medium was replaced with normal (15% vol/vol serum) culture medium. For treatment with IGF-II, cells were incubated with 50 ng/ml IGF-II after 24 hours infection with Ad-GFP/IGF2R-Rz or Ad-GFP. Four days after infection, cells were used for analysis of gene expression of M6P/IGF2R and its effect on cell growth and apoptosis. Analysis of gene expression in cardiac myocytes The M6P/IGF2R transcripts were determined by both RT-PCR and Ribonuclease Protection Assay (RPA). RT-PCR was performed using the GeneAmp EZ rTth RNA PCR kit (Roche). Total RNA was extracted from cultured cells using an RNA isolation kit (Qiagen,), according to the manufacturer's protocol. M6P/IGF2R transcripts were amplified using the primers (5'-GACAGGCTCGTTCTGACTTA-3') and (5'-CTTCCACTCTTATCCACAGC-3') specific to the M6P/IGF2R. Each RT-PCR assay was performed in triplicate and product levels varied by less than 3.2% for each RNA sample. Primers specific for β-actin cDNA were added to a parallel reaction to standardize for variations in PCR between samples. PCR products were resolved on a 1.0% agarose gel, visualized under UV light and quantitated using NIH Imager. RPA was performed using the RPA III kit (Ambion, Austin, TX). Briefly, total RNA was extracted from cultured cells using a total RNA isolation reagent (TRIzol, Gibco BRL) according to the manufacturer's protocol. The plasmid containing the rat M6P/IGF2R gene was linearized and used as a transcription template. Antisense RNA probes were transcribed in vitro using [33P]-UTP, T7 polymerase (Riboprobea System T7 kit, Promega), hybridized with the total RNA extracted from the rat cardiomyocytes, and digested with ribonuclease to remove non-hybridized RNA and probe. The protected RNA·RNA was resolved on a denaturing 5% sequence gel and subjected to autoradiography. A probe targeting the GAPDH gene was used as an internal control. Measurement of 125I-IGF-II internalization Cells were incubated at 37°C for 2 hrs in serum-free F-10 culture medium containing 125I-labeled IGF-II (0.5 ng/ml) with or without excess unlabeled IGF-II (2 μg/ml). Following the incubation, the cells were washed three times with ice-cold PBS, and cell-associated radioactivity was determined by a γ counter. Specific internalized 125I-IGF-II was calculated by subtracting the count of samples with excessive unlabeled IGF-II from that without unlabeled IGF-II, and normalized to protein contents. Beta-glucuronidase binding assay Binding of β-glucuronidase was assayed as described previously [34,35]. Briefly, cells were permeabilized with 0.25% saponin in 50 mM Hepes (pH 7.0), 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, and 10 mM mannose-6-phosphate (M6P) for 30 minutes on ice. The cells were washed three times with ice-cold PBS containing 0.05% saponin. They were incubated with 20,000 units/ml β-glucuronidase from bovine liver (Sigma) in 50 mM Hepes (pH 7.5) containing 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, 0.5% saponin with or without 10 mM M6P overnight on ice. Cells were washed five times with ice-cold PBS containing 0.05% saponin and sonicated in 100 mM sodium acetate (pH 4.6). The protein concentration of solubilized cell extract was measured and enzyme activity was assayed as follows: for each reaction 50 ul cell extract were added to 500 ul of 100 mM sodium acetate (pH 4.0) containing 1 mM paranitrophenyl (PNP)-β-glucuronide (Sigma) as substrate. After an incubation period of 3 hours at 37°C, 500 ul 1 M Na2CO3 were added to each reaction and the absorbance was measured at 400 nm. Experimental values were compared to a standard curve that was constructed using 1–100 nM solutions of PNP (Sigma) in 500 ul 100 mM sodium acetate and 500 u1 1 M Na2CO3. Specific activity was calculated as nM of PNP produced/hour/mg of protein. Beta-glucuronidase endocytosis assay Beta-glucuronidase endocytosis assay was carried out as described previously [36]. Briefly, confluent cell cultures were washed twice with pre-warmed serum-free DMEM followed by incubation with DMEM containing 5 mg/ml human serum albumin and 10 mM M6P for 20 minutes. Following incubation cells were washed 3 times with pre-warmed DMEM. Cells were then incubated in DMEM containing 5 mg/ml human serum albumin alone or 4000 units β-glucuronidase with or without 10 mM M6P for 2 hours at 37°C. Following the incubation, the cells were washed 5 times with ice-cold PBS and subjected to enzyme activity assay as described above. Cell proliferation assay (MTT assay and cell counts) Cardiac myocytes were grown in culture plates (tissue culture grade, 12 wells, flat bottom) in a final volume of 1 ml serum-containing culture medium per well, in a humidified atmosphere (37°C and 5% C02) for 3 days. After infection with Ad-GFP/IGF2R-Rz or Ad-GFP, cells were incubated with or without 50 ng/ml IGF-II for 4 days. Following supplementation with IGF-II, 100 μl MTT labeling reagent (Roche) were added to each well and cells were incubated for 4 hours, followed by addition of 1 ml solubilization solution into each well. The plate was placed in an incubator at 37°C overnight. Spectrophotometrical absorbency of the samples was measured using an UV-visible Recording Spectrophotometer with wavelength of 550–690 nm. In addition, the total number of viable cells in each treatment was counted by trypan blue exclusion method using a hemocytometer. Induction and analysis of cell apoptosis Cells were infected with Ad-GFP or Ad-GFP/IGF2R-Rz. Seventy-two hours post infection, cells were treated with TNF (0.1 ng/ml) for 24 hrs or subjected to hypoxia. For induction of apoptosis by hypoxia, cell culture medium was changed to serum-free F-10 saturated with 95% N2/5% CO2 and cells were placed in a 37°C airtight box saturated with 95% N2/5% CO2 for 24 hrs. For normoxic controls, culture medium was changed to F-10/5%F BS/10% HS and cells were placed in a 37°C/5% CO2 incubator for 24 hrs before analysis. Apoptotic cells were identified by Hoechst staining using the Vybrant™ Apoptosis Kit #5 (Molecular Probes) according to the manufacturer's protocol. In addition, after infection with Ad-GFP or Ad-GFP/IGF2R-Rz and challenge with either TNF or hypoxia, cell viability was assessed using the MTT assay Kit (Roche Molecular Biochemicals) and cell apoptosis was determined using the Cell Death Detection ELISA Kit assay (Roche Molecular Biochemicals) according to the manufacturer's protocol. Statistical analysis Students' t-test was used to evaluate the difference between two values. Each experiment was repeated at least three times. Statistical significance was accepted at the level of p < 0.05. List of abbreviations used Ad-GFP, adenovirus carrying GFP gene; Ad-GFP/IGF2R-Rz, adenovirus carrying both the ribozyme against M6P/IGF2R and the GFP gene; GFP, green fluorescent protein; IGF-II, insulin-like growth factor II; M6P/IGF2R, mannose 6-phosphate/insulin-like growth factor II receptor; Rz, ribozyme. Authors' contributions ZC carried out construction of the ribozyme, production of the viruses, cellular experiments, biochemical assays and data analysis. YG carried out the RPA assay and participated in the molecular biological studies. JXK conceived of the study, participated in its design and coordination, and drafted the manuscript.
[ "Down", "-", "regulation", "of", "the", "M6P", "/", "IGF", "-", "II", "receptor", "increases", "cell", "proliferation", "and", "reduces", "apoptosis", "in", "neonatal", "rat", "cardiac", "myocytes", "\n", "Abstract", "\n", "Background", "\n", "The", "mannose", "6-phosphate", "/", "insulin", "-", "like", "growth", "factor", "-", "II", "receptor", "(", "M6P", "/", "IGF2R", ")", "is", "a", "multi", "-", "functional", "protein", "that", "has", "been", "implicated", "in", "regulation", "of", "cell", "growth", "and", "apoptosis", ".", "Cardiac", "myocytes", "express", "relatively", "high", "levels", "of", "M6P", "/", "IGF2R", ",", "and", "cardiomyocyte", "apoptosis", "has", "been", "identified", "in", "a", "variety", "of", "cardiovascular", "disorders", ",", "such", "as", "myocardial", "infarction", "and", "heart", "failure", ".", "However", ",", "involvement", "of", "M6P", "/", "IGF2R", "in", "the", "pathogenesis", "of", "these", "conditions", "has", "not", "been", "determined", ".", "Thus", ",", "the", "objective", "of", "this", "study", "was", "to", "determine", "the", "role", "of", "M6P", "/", "IGF2R", "in", "regulation", "of", "cardiac", "myocyte", "growth", "and", "apoptosis", ".", "\n\n", "Results", "\n", "We", "down", "-", "regulated", "the", "expression", "of", "M6P", "/", "IGF2R", "in", "neonatal", "rat", "cardiac", "myocytes", "and", "examined", "the", "effect", "on", "cell", "proliferation", "and", "apoptosis", ".", "Infection", "of", "neonatal", "cardiomyocytes", "with", "an", "adenovirus", "expressing", "a", "ribozyme", "targeted", "against", "the", "M6P", "/", "IGF2R", "significantly", "reduced", "the", "level", "of", "M6P", "/", "IGF2R", "mRNA", ",", "as", "determined", "by", "RT", "-", "PCR", "and", "Ribonuclease", "Protection", "Assay", "(", "RPA", ")", ".", "M6P", "-", "containing", "protein", "binding", "and", "endocytosis", "as", "well", "as", "the", "M6P", "/", "IGF2R", "-", "mediated", "internalization", "of", "125I", "-", "IGF", "-", "II", "were", "lower", "in", "the", "ribozyme", "-", "treated", "cells", "than", "the", "control", "myocytes", ",", "indicating", "that", "the", "number", "of", "functional", "M6P", "/", "IGF2R", "in", "the", "ribozyme", "treated", "cells", "was", "reduced", ".", "Accordingly", ",", "a", "marked", "increase", "in", "cell", "proliferation", "and", "a", "reduced", "cell", "susceptibility", "to", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", "were", "observed", "in", "the", "ribozyme", "-", "treated", "cells", ".", "\n\n", "Conclusions", "\n", "These", "findings", "suggest", "that", "M6P", "/", "IGF2R", "may", "play", "a", "role", "in", "regulation", "of", "cardiac", "myocyte", "growth", "and", "apoptosis", ".", "Down", "regulation", "of", "this", "gene", "in", "cardiac", "tissues", "might", "be", "a", "new", "approach", "to", "prevention", "of", "cell", "death", "or", "promotion", "of", "mitogenesis", "for", "certain", "heart", "diseases", ".", "\n\n\n\n", "Background", "\n", "The", "mannose", "6-phosphate", "/", "insulin", "-", "like", "growth", "factor", "-", "II", "receptor", "(", "M6P", "/", "IGF2R", ")", "is", "a", "unique", "protein", "that", "interacts", "with", "multiple", "ligands", ",", "some", "of", "which", "are", "important", "growth", "regulatory", "factors", "[", "1", "]", ".", "The", "M6P", "/", "IGF2R", "participates", "in", "internalization", "and", "lysosomal", "degradation", "of", "IGF", "-", "II", ",", "a", "mitogen", "normally", "acting", "through", "the", "IGF", "-", "I", "receptor", "to", "stimulate", "cell", "proliferation", "[", "2", "]", ".", "The", "M6P", "/", "IGF2", "receptor", "is", "required", "for", "the", "activation", "of", "TGF", "-", "β", "[", "3", "]", ",", "a", "potent", "growth", "inhibitor", "for", "many", "cell", "types", ".", "This", "receptor", "is", "also", "involved", "in", "the", "binding", ",", "transport", "and", "activation", "of", "newly", "-", "synthesized", "lysosomal", "enzymes", ",", "such", "as", "cathepsins", "[", "4,5", "]", ",", "which", "have", "been", "recently", "implicated", "in", "the", "induction", "of", "apoptosis", "[", "6", "]", ".", "On", "the", "basis", "of", "these", "functions", ",", "the", "M6P", "/", "IGF2R", "has", "been", "proposed", "to", "play", "a", "significant", "role", "in", "regulation", "of", "cell", "growth", "and", "apoptosis", "[", "7", "]", ".", "\n", "Apoptosis", ",", "or", "programmed", "cell", "death", ",", "is", "a", "tightly", "regulated", "process", "used", "to", "remove", "excess", ",", "hazardous", "or", "damaged", "somatic", "cells", ",", "and", "is", "crucial", "for", "the", "development", ",", "maintenance", "and", "survival", "of", "an", "organism", ".", "However", ",", "alterations", "in", "the", "control", "of", "apoptosis", "have", "also", "been", "shown", "to", "contribute", "to", "human", "diseases", ".", "In", "fact", ",", "morphological", "and", "biochemical", "markers", "of", "apoptosis", "have", "been", "identified", "in", "a", "wide", "variety", "of", "cardiovascular", "disorders", ",", "including", "myocardial", "infarction", "and", "heart", "failure", ".", "This", "suggests", "that", "activation", "of", "apoptotic", "pathways", "contributes", "to", "cardiomyocyte", "loss", "and", "subsequent", "cardiac", "dysfunction", "in", "these", "conditions", ".", "A", "number", "of", "factors", "involved", "in", "cardiomyocyte", "apoptosis", "are", "currently", "known", "and", "include", "insulin", "-", "like", "growth", "factor", "-", "I", "(", "IGF", "-", "I", ")", ",", "stress", "-", "activated", "protein", "kinases", "(", "SAPKs", ")", "and", "the", "anti", "-", "apoptotic", "Bcl-2", "family", "[", "8", "]", ".", "There", "are", "indications", "that", "other", "factors", "may", "be", "involved", "in", "induction", "and", "regulation", "of", "cardiac", "apoptosis", ".", "However", ",", "these", "potential", "factors", "and", "their", "corresponding", "mechanisms", "have", "not", "been", "identified", ".", "\n", "Several", "lines", "of", "evidence", "point", "to", "the", "potential", "involvement", "of", "M6P", "/", "IGF2R", "in", "cardiac", "myocyte", "proliferation", "and", "apoptosis", ".", "Cardiac", "myocytes", "express", "relatively", "high", "levels", "of", "M6P", "/", "IGF2R", "and", "transgenic", "mice", "containing", "a", "homologous", "deletion", "of", "the", "M6P", "/", "IGF2R", "gene", "manifest", "ventricular", "hyperplasia", "due", "to", "an", "increase", "in", "cell", "number", "[", "9,10", "]", ",", "suggesting", "that", "the", "M6P", "/", "IGF2R", "normally", "acts", "to", "suppress", "cardiac", "myocyte", "cell", "growth", ".", "It", "has", "also", "been", "shown", "that", "TGF", "-", "β", ",", "a", "potent", "growth", "suppressor", "whose", "activation", "requires", "the", "binding", "of", "latent", "TGF", "-", "β", "to", "M6P", "/", "IGF2R", "[", "3", "]", ",", "is", "commonly", "upregulated", "in", "chronic", "heart", "failure", "[", "11", "]", ".", "Additional", "evidence", "for", "the", "involvement", "of", "M6P", "/", "IGF2R", "in", "regulation", "of", "apoptosis", "comes", "from", "studies", "of", "tumorigenesis", ".", "It", "has", "been", "shown", "that", "M6P", "/", "IGF2R", "expression", "is", "significantly", "reduced", "in", "a", "variety", "of", "tumors", "and", "loss", "of", "heterozygocity", "(", "LOH", ")", "at", "the", "M6P", "/", "IGF2R", "gene", "locus", "6q26", "have", "been", "found", "in", "breast", ",", "liver", "cancers", "and", "squamous", "cell", "carcinoma", "of", "the", "lung", "[", "12", "-", "15", "]", ".", "Although", "several", "studies", "have", "examined", "the", "effect", "of", "M6P", "/", "IGF2R", "over", "-", "expression", "on", "cell", "growth", "[", "7", "]", ",", "it", "is", "not", "known", "whether", "down", "-", "regulation", "of", "this", "receptor", "protein", "leads", "to", "cellular", "protection", "against", "apoptosis", ".", "\n", "Ribozymes", "are", "catalytic", "RNA", "molecules", "that", "cleave", "a", "complementary", "mRNA", "sequence", "[", "16", "]", ",", "thereby", "inactivating", "specific", "mRNAs", "and", "suppressing", "gene", "expression", "in", "vitro", "and", "in", "vivo", "[", "17,18", "]", ".", "Ribozymes", "have", "been", "shown", "to", "be", "highly", "specific", ",", "efficient", "and", "stable", ".", "They", "can", "be", "packaged", "into", "viral", "vectors", "to", "enhance", "transfer", "into", "cells", "and", "to", "achieve", "longer", "expression", "compared", "with", "naked", "oligonucleotides", ".", "In", "the", "present", "study", ",", "we", "employed", "ribozyme", "technology", "to", "study", "the", "role", "of", "M6P", "/", "IGF2R", "in", "regulation", "of", "cardiac", "myocyte", "cell", "growth", ".", "A", "hammerhead", "ribozyme", "against", "the", "M6P", "/", "IGF2R", "mRNA", "was", "constructed", "and", "packaged", "in", "an", "adenoviral", "vector", ".", "We", "then", "examined", "the", "effect", "of", "ribozyme", "-", "mediated", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "expression", "on", "cell", "growth", "and", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", ".", "\n\n", "Results", "\n", "Cleavage", "reaction", "of", "the", "ribozyme", "in", "vitro", "\n", "The", "M6P", "/", "IGF2R", "ribozyme", "we", "constructed", "has", "13-bp", "binding", "arms", "complementary", "to", "the", "target", "site", "of", "M6P", "/", "IGF2R", "mRNA", ",", "and", "a", "catalytic", "core", "(", "Fig", ".", "1A", ")", ".", "To", "evaluate", "the", "bioactivity", "of", "the", "ribozyme", "and", "the", "accessibility", "of", "the", "target", "site", ",", "a", "cleavage", "reaction", "was", "performed", "in", "vitro", ".", "The", "substrates", ",", "[", "α-32P", "]", "labeled", "RNA", "transcripts", "containing", "45", "bp", "of", "M6P", "/", "IGF2R", "mRNA", "or", "an", "unmatched", "sequence", ",", "were", "incubated", "with", "the", "ribozyme", "as", "described", "(", "see", "Materials", "and", "Methods", ")", ".", "The", "ribozyme", "cleaved", "only", "the", "specific", "M6P", "/", "IGF2R", "mRNA", "into", "the", "expected", "products", ".", "In", "the", "assay", "of", "time", "course", ",", "the", "hammerhead", "ribozyme", "was", "able", "to", "cleave", "24.2", "%", "of", "the", "M6P", "/", "IGF2R", "target", "within", "10", "minutes", "of", "incubation", ",", "50.3", "%", "of", "the", "M6P", "/", "IGF2R", "target", "within", "40", "minutes", "of", "incubation", ",", "and", "by", "640", "minutes", ",", "80.8", "%", "of", "the", "M6P", "/", "IGF2R", "target", "was", "converted", "to", "the", "expected", "products", "(", "Fig", ".", "1B", ")", ".", "This", "ribozyme", "did", "not", "digest", "the", "unmatched", "sequence", "(", "Fig", ".", "1B", ")", ".", "These", "results", "indicate", "a", "high", "efficiency", "and", "specificity", "of", "the", "ribozyme", "in", "vitro", ".", "\n\n", "Ribozymes", "down", "-", "regulate", "M6P", "/", "IGF2R", "expression", "in", "cardiac", "myocytes", "\n", "To", "examine", "the", "ability", "of", "the", "ribozyme", "to", "reduce", "levels", "of", "M6P", "/", "IGF2R", "mRNA", "in", "cultured", "cardiac", "myocytes", ",", "total", "RNA", "was", "extracted", "from", "cells", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "or", "Ad", "-", "GFP", ",", "and", "subjected", "to", "RT", "-", "PCR", "using", "M6P", "/", "IGF2R", "-", "specific", "primers", ".", "Primers", "specific", "for", "β", "-", "actin", "were", "added", "to", "a", "parallel", "reaction", "to", "serve", "as", "an", "internal", "standard", ".", "Cells", "were", "used", "4", "days", "after", "infection", ",", "with", "average", "infection", "efficiency", "of", "70–80", "%", "(", "for", "which", "a", "viral", "dose", "used", "had", "minimal", "cytotoxicity", ")", ".", "The", "RT", "-", "PCR", "product", "of", "M6P", "/", "IGF2R", "was", "856", "bp", ",", "and", "the", "β", "-", "actin", "product", "was", "285", "bp", ".", "As", "shown", "in", "Fig", ".", "2A", ",", "the", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "-", "infected", "cells", "exhibited", "a", "significantly", "lower", "level", "of", "M6P", "/", "IGF2R", "mRNA", "than", "Ad", "-", "GFP", "-", "infected", "cells", ",", "with", "a", "reduction", "of", "about", "50", "%", ".", "This", "result", "was", "confirmed", "by", "ribonuclease", "protection", "assay", "(", "RPA", ")", ",", "in", "which", "GAPDH", "was", "used", "as", "a", "control", "(", "Fig", ".", "2C", "&", "2D", ")", ".", "There", "was", "no", "significant", "difference", "in", "the", "level", "of", "M6P", "/", "IGF2R", "mRNA", "between", "Ad", "-", "GFP", "-", "infected", "cells", "and", "uninfected", "cells", "(", "data", "not", "shown", ")", ",", "indicating", "that", "infection", "with", "the", "adenovirus", "itself", "did", "not", "alter", "the", "endogenous", "M6P", "/", "IGF2R", "mRNA", "level", ".", "The", "results", "demonstrated", "that", "the", "ribozyme", "was", "highly", "effective", "in", "suppressing", "M6P", "/", "IGF2R", "expression", "in", "cultured", "cardiac", "myocytes", ".", "\n\n", "Effect", "of", "ribozyme", "expression", "on", "the", "functional", "activity", "of", "M6P", "/", "IGF2R", "\n", "To", "determine", "the", "effect", "of", "the", "ribozyme", "on", "the", "functional", "activity", "of", "M6P", "/", "IGF2R", ",", "binding", "and", "internalization", "of", "exogenous", "125I", "-", "IGF", "-", "II", "was", "measured", "in", "cells", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", ".", "As", "shown", "in", "Fig", ".", "3A", ",", "cells", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "showed", "a", "54", "%", "reduction", "in", "125I", "-", "IGF", "-", "II", "internalization", "when", "compared", "with", "the", "control", "cells", "(", "infected", "with", "Ad", "-", "GFP", ")", ".", "We", "also", "examined", "the", "effect", "of", "the", "ribozyme", "on", "the", "M6P", "-", "binding", "activity", "of", "the", "M6P", "/", "IGF2R", "using", "the", "M6P", "-", "bearing", "lysosomal", "enzyme", ",", "β", "-", "glucuronidase", ",", "as", "a", "probe", ".", "The", "results", "showed", "that", "the", "maximal", "M6P", "-", "binding", "capacity", "of", "cells", "treated", "with", "the", "ribozyme", "was", "about", "50", "%", "less", "than", "that", "of", "controls", "(", "Fig", ".", "3B", ")", ".", "Furthermore", ",", "we", "assessed", "the", "ability", "of", "cells", "to", "internalize", "exogenous", "β", "-", "glucuronidase", "after", "treatment", "with", "ribozyme", ".", "Similarly", ",", "the", "M6P", "-", "inhibitable", "endocytosis", "of", "β", "-", "glucuronidase", "by", "ribozyme", "-", "treated", "cells", "was", "about", "52", "%", "less", "than", "that", "of", "control", "cells", "(", "Fig", ".", "3C", ")", ".", "These", "results", "confirm", "that", "the", "number", "of", "functional", "M6P", "/", "IGF2R", "in", "ribozyme", "-", "treated", "cells", "was", "reduced", ".", "\n\n", "Adenoviral", "delivery", "of", "ribozymes", "increases", "the", "proliferation", "of", "cardiac", "myocytes", "\n", "We", "examined", "the", "effects", "of", "the", "ribozyme", "on", "the", "growth", "of", "cultured", "neonatal", "rat", "cardiac", "myocytes", ".", "Morphological", "evaluation", "showed", "a", "remarkable", "difference", "in", "growth", "pattern", "between", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "-", "infected", "cells", "and", "the", "control", "cells", ":", "the", "ribozyme", "-", "expressing", "cells", "formed", "larger", "and", "more", "spread", "colonies", "(", "Fig", ".", "4", ")", ".", "Assessment", "of", "cell", "proliferative", "activity", "by", "the", "MTT", "assay", "and", "counts", "of", "viable", "cells", "showed", "that", "the", "number", "of", "cardiac", "myocytes", "in", "ribozyme", "-", "expressing", "cultures", "was", "significantly", "higher", "than", "in", "control", "cultures", "(", "Fig", ".", "5", ")", ".", "These", "results", "indicate", "that", "treatment", "with", "M6P", "/", "IGF2R", "-", "ribozyme", "can", "promote", "cardiac", "myocyte", "proliferation", ".", "\n\n", "Effect", "of", "M6P", "/", "IGF2R", "-", "ribozyme", "expression", "on", "apoptosis", "of", "cardiac", "myocytes", "\n", "We", "examined", "the", "effects", "of", "ribozyme", "expression", "on", "TNF", "-", "α", "and", "hypoxia", "-", "induced", "apoptosis", "of", "cultured", "cardiac", "myocytes", ".", "After", "a", "24", "hr", "challenge", "with", "hypoxia", ",", "the", "number", "of", "apoptotic", "cells", "in", "M6P", "/", "IGF2R", "-", "Rz", "expressing", "cultures", "was", "38", "%", "lower", "than", "in", "control", "cultures", "as", "determined", "by", "Hoechst", "staining", "(", "which", "highlights", "the", "nuclei", "of", "apoptotic", "cells", ")", "and", "ELISA", "(", "Fig", ".", "6A", ",", "7A", ")", ".", "MTT", "analysis", "showed", "that", "the", "number", "of", "viable", "cells", "in", "ribozyme", "-", "treated", "cultures", "was", "40", "%", "higher", "than", "in", "control", "cultures", "(", "Fig", ".", "7A", ")", ".", "\n", "After", "treatment", "with", "TNF", "-", "α", ",", "as", "shown", "in", "Fig", ".", "6B", ",", "a", "large", "number", "of", "control", "cells", "underwent", "apoptosis", ",", "as", "indicated", "by", "morphological", "changes", "(", "small", "round", "shape", ")", "and", "bright", "blue", "nuclear", "staining", ".", "There", "were", "significantly", "more", "apoptotic", "cells", "in", "control", "cultures", "than", "in", "cultures", "expressing", "the", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", ".", "The", "number", "of", "apoptotic", "cells", ",", "as", "measured", "by", "the", "cell", "death", "ELISA", "assay", ",", "in", "cultures", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "was", "significantly", "(", "about", "40", "%", ")", "lower", "than", "in", "cultures", "infected", "with", "Ad", "-", "GFP", "(", "Fig", ".", "7B", ")", ".", "Accordingly", ",", "the", "number", "of", "viable", "cells", ",", "as", "measured", "by", "MTT", "analysis", ",", "in", "cultures", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "was", "significantly", "(", "about", "45", "%", ")", "higher", "than", "in", "cultures", "infected", "with", "Ad", "-", "GFP", "(", "Fig", ".", "7B", ")", ".", "These", "results", "are", "consistent", "with", "the", "hypothesis", "that", "decreasing", "M6P", "/", "IGF2R", "expression", "by", "ribozyme", "treatment", "can", "reduce", "cell", "apoptosis", ".", "\n\n\n", "Discussion", "\n", "Some", "62,000,000", "Americans", "have", "one", "or", "more", "types", "of", "cardiovascular", "disease", "(", "CVD", ")", "and", "CVD", "is", "the", "leading", "cause", "(", "40.1", "%", ")", "of", "death", "in", "the", "United", "States", ".", "Myocardial", "infarction", "and", "heart", "failure", ",", "conditions", "accompanied", "by", "cardiac", "myocyte", "apoptosis", ",", "represent", "23", "%", "of", "all", "CVDs", "and", "are", "a", "growing", "clinical", "challenge", "in", "need", "of", "novel", "therapeutic", "strategies", ".", "In", "this", "study", ",", "we", "investigated", "the", "M6P", "/", "IGF2R", "as", "a", "potential", "new", "therapeutic", "target", "for", "reduction", "of", "cardiac", "apoptosis", "and", "cardiac", "injury", "in", "these", "conditions", ".", "\n", "Using", "ribozyme", "technology", "we", "down", "-", "regulated", "the", "expression", "of", "the", "M6P", "/", "IGF2R", "in", "neonatal", "cardiac", "myocytes", ".", "We", "then", "examined", "cell", "proliferation", "and", "apoptosis", "under", "normal", "conditions", "and", "post", "challenge", "with", "either", "hypoxia", ",", "a", "model", "of", "ischemia", "-", "reperfusion", ",", "or", "TNF", "-", "α", ",", "a", "cytokine", "implicated", "in", "the", "pathogenesis", "of", "chronic", "heart", "failure", "[", "19", "]", ".", "Our", "results", "demonstrate", "an", "association", "of", "a", "decrease", "in", "the", "expression", "and", "function", "of", "the", "M6P", "/", "IGF2R", "with", "increased", "cell", "proliferation", "and", "decreased", "cell", "susceptibility", "to", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", ".", "Expression", "of", "the", "ribozyme", "targeted", "against", "the", "M6P", "/", "IGF2R", "in", "cardiomyocytes", "resulted", "in", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "expression", ",", "as", "measured", "by", "RT", "-", "PCR", "and", "RPA", ",", "and", "of", "M6P", "/", "IGF2R", "function", ",", "as", "indicated", "by", "a", "decrease", "in", "internalization", "of", "125I", "-", "IGF", "-", "II", ",", "and", "β", "-", "glucuronidase", "binding", "and", "endocytosis", ".", "\n", "MTT", "analysis", "and", "viable", "cell", "counts", "showed", "that", "ribozyme", "-", "mediated", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "resulted", "in", "a", "marked", "increase", "in", "cell", "proliferation", "of", "cardiomyocytes", ",", "which", "normally", "express", "high", "levels", "of", "M6P", "/", "IGF2R", "[", "20", "]", "and", "have", "limited", "proliferative", "capabilities", "[", "21", "]", ".", "These", "results", "are", "consistent", "with", "the", "findings", "of", "previous", "knockout", "studies", "[", "9,10", "]", ".", "Since", "the", "M6P", "/", "IGF2R", "has", "multiple", "actions", "on", "cell", "growth", ",", "its", "proliferative", "effect", "on", "the", "heart", "cells", "observed", "in", "this", "study", "might", "involve", "multiple", "mechanisms", ".", "However", ",", "it", "is", "likely", "that", "unchecked", "IGF", "-", "II", "stimulation", "plays", "a", "key", "role", "in", "the", "effect", ".", "Because", "the", "M6P", "/", "IGF2R", "is", "believed", "to", "sequester", "and", "degrade", "IGF", "-", "II", "[", "2", "]", ",", "a", "decrease", "in", "M6P", "/", "IGF2R", "expression", "and", "function", "could", "result", "in", "decreased", "degradation", "and", "hence", "increased", "bioavailability", "of", "IGF", "-", "II", "to", "the", "IGF", "-", "I", "receptor", ",", "which", "mediates", "the", "growth", "-", "promoting", "effect", "of", "IGF", "-", "II", ".", "Supporting", "evidence", "for", "the", "involvement", "of", "IGF", "-", "II", "in", "the", "proliferative", "effect", "resulting", "from", "loss", "of", "M6P", "/", "IGF2R", "function", "comes", "from", "studies", "of", "M6P", "/", "IGF2R", "knock", "-", "out", "mice", ".", "M6P", "/", "IGF2R", "-", "null", "mice", "display", "global", "hyperplasia", "that", "coincides", "with", "elevated", "levels", "of", "IGF", "-", "II", ".", "Most", "importantly", ",", "however", ",", "the", "lethal", "nature", "of", "an", "M6P", "/", "IGF2R", "-", "null", "phenotype", "is", "reversed", "in", "an", "IGF", "-", "II", "-", "null", "background", "[", "9", "]", ".", "Our", "results", "showing", "that", "ribozyme", "-", "mediated", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "lead", "to", "a", "decrease", "in", "IGF", "-", "II", "internalization", "support", "the", "above", "possibility", ".", "However", ",", "further", "investigation", "to", "confirm", "this", "mechanism", "is", "warranted", ".", "\n", "More", "importantly", ",", "our", "results", "also", "showed", "that", "M6P", "/", "IGF2R", "down", "-", "regulation", "resulted", "in", "decreased", "sensitivity", "of", "cardiomyocytes", "to", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", ".", "There", "is", "evidence", "that", "lysosomal", "enzymes", ",", "such", "as", "cathepsins", "B", "and", "D", "contribute", "to", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", "in", "vitro", "[", "22", "-", "25", "]", "and", "in", "vivo", "[", "26,27", "]", ".", "The", "M6P", "/", "IGF2R", "has", "been", "shown", "to", "be", "involved", "in", "binding", ",", "transport", "and", "activation", "of", "lysosomal", "enzymes", ",", "including", "cathepsins", "[", "4,5", "]", ".", "Therefore", ",", "it", "is", "possible", "that", "down", "-", "regulation", "of", "the", "M6P", "/", "IGF2R", "results", "in", "improper", "trafficking", "and", "activation", "of", "cathepsins", ".", "This", ",", "in", "turn", "would", "eliminate", "the", "apoptotic", "cascades", "triggered", "by", "these", "enzymes", "under", "hypoxia", "and", "TNF", "stimulation", "and", "result", "in", "decreased", "sensitivity", "of", "cardiomyocytes", "to", "apoptosis", ".", "\n", "It", "has", "also", "been", "shown", "that", "TNF", "stimulation", "involves", "the", "activation", "of", "TGF", "-", "β", "[", "28", "-", "30", "]", ",", "a", "ligand", "of", "M6P", "/", "IGF2R", "that", "has", "been", "implicated", "in", "the", "progression", "of", "chronic", "heart", "failure", "[", "11,31", "]", ".", "Therefore", ",", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "expression", "could", "also", "lead", "to", "a", "decreased", "bioavailability", "of", "activated", "TGF", "-", "β", ",", "thereby", "decreasing", "the", "sensitivity", "of", "cardiomyocytes", "to", "the", "TNF", "/", "TGF", "-", "β", "apoptotic", "pathway", ".", "The", "detailed", "mechanism", "of", "the", "observed", "effects", "is", "unknown", "and", "requires", "further", "investigation", ".", "\n\n", "Conclusions", "\n", "The", "present", "study", "demonstrates", "that", "ribozyme", "-", "mediated", "down", "-", "regulation", "of", "expression", "and", "functional", "activity", "of", "the", "M6P", "/", "IGF2R", "results", "in", "a", "decrease", "in", "the", "susceptibility", "of", "cardiac", "myocytes", "to", "apoptotic", "stimuli", ".", "These", "findings", "suggest", "that", "this", "receptor", "might", "be", "involved", "in", "cardiac", "cell", "growth", "and", "apoptosis", ".", "The", "ability", "of", "the", "M6P", "/", "IGF2R", "ribozyme", "to", "reduce", "M6P", "/", "IGF2R", "expression", "and", "function", "in", "transfected", "cells", "verifies", "the", "utility", "of", "the", "ribozyme", "in", "studying", "the", "role", "of", "M6P", "/", "IGF2R", "in", "cardiomyocyte", "growth", "and", "apoptosis", ".", "In", "addition", "to", "its", "utility", "as", "a", "research", "tool", ",", "the", "ribozyme", ",", "with", "further", "exploration", "and", "development", ",", "might", "have", "potential", "application", "as", "a", "therapeutic", "agent", "to", "prevent", "cell", "death", "or", "promote", "mitogenesis", "for", "certain", "clinical", "conditions", ",", "such", "as", ",", "myocardial", "infarction", "and", "chronic", "heart", "failure", ".", "\n\n", "Methods", "\n", "Construction", "of", "recombinant", "M6P", "/", "IGF2R", "-", "RZ", "adenoviral", "vector", "\n", "The", "nucleotide", "numbers", "of", "the", "rat", "M6P", "/", "IGF2R", "sequence", "targeted", "by", "the", "hammerhead", "ribozyme", "is", "1147–1160", "after", "coding", "site", "(", "exon", "9", ")", ".", "The", "structure", "of", "the", "M6P", "/", "IGF2R", "hammerhead", "ribozyme", "is", "shown", "in", "Fig", ".", "1", ".", "A", "49", "bp", "M6P", "/", "IGF2R", "ribozyme", "oligonucleotide", ",", "5'-GAATTCCCC", "ACACTG", "ATGAGCCGCTTCGGCGGCGAAACATTCAAC", "GCGT-3", "'", "and", "the", "corresponding", "reverse", "complementary", "strand", "were", "synthesized", ".", "The", "fragments", "were", "subcloned", "to", "produce", "a", "plasmid", "containing", "a", "ribozyme", "against", "M6P", "/", "IGF2R.", "For", "construction", "of", "the", "recombinant", "adenovirus", "containing", "the", "M6P", "/", "IGF2R", "-", "ribozyme", "(", "pAd", "-", "GFP", "/", "IGF2R", "-", "Rz", ")", ",", "the", "segments", "containing", "the", "ribozymes", "were", "amplified", "by", "PCR", "and", "cloned", "into", "a", "pAdTrack", "-", "CMV", "vector", "and", "then", "recombined", "homologously", "with", "an", "adenoviral", "backbone", "pAdEasy", "1", "vector", "to", "generate", "(", "pAd", "-", "GFP", "/", "IGF2R", "-", "Rz", ")", ",", "following", "the", "protocol", "described", "by", "He", "et", "al", ".", "[", "32", "]", ".", "The", "pAd", "-", "GFP", "/", "IGF2R", "-", "Rz", "carries", "both", "the", "IGF2R", "-", "Rz", "and", "GFP", "(", "as", "reporter", ")", "genes", ",", "each", "under", "the", "control", "of", "separate", "cytomegalovirus", "(", "CMV", ")", "promoters", ".", "Another", "viral", "vector", ",", "pAd", "-", "GFP", ",", "which", "carries", "the", "GFP", "gene", "only", "under", "the", "control", "of", "the", "CMV", "promoter", ",", "was", "generated", "and", "used", "as", "a", "control", "vector", ".", "The", "adenoviral", "vector", "DNA", "were", "linerized", "with", "Pac", "I", "and", "transfected", "into", "the", "replication", "-", "permissive", "293", "cells", "(", "E1A", "transcomplementing", "cell", "line", ")", "by", "using", "Lipofectamine", "(", "Life", "Technologies", ")", "to", "produce", "E1-deleted", ",", "replication", "-", "defective", "recombinant", "adenovirus", "as", "described", "previously", "[", "33", "]", ".", "Large", "-", "scale", "amplification", "of", "recombinant", "adenovirus", "in", "293", "cells", "was", "followed", "by", "purification", "using", "a", "discontinuous", "CsCl", "gradient", ".", "The", "constructs", "were", "confirmed", "by", "enzymatic", "digestion", "and", "DNA", "sequencing", ".", "\n\n", "Transcription", "and", "cleavage", "reaction", "of", "ribozyme", "in", "vitro", "\n", "Plasmids", "containing", "the", "ribozyme", "or", "the", "substrate", "(", "either", "45", "bp", "of", "M6P", "/", "IGF2R", "mRNA", "or", "an", "unmatched", "sequence", "5'-GTGCTGTCTGTATG-3", "'", ")", "were", "linearized", "with", "MluI", ",", "respectively", ".", "All", "transcripts", "were", "generated", "with", "T7", "RNA", "polymerase", "(", "Promega", ")", ".", "Substrate", "transcripts", "were", "labeled", "by", "incorporation", "of", "[", "α-32P", "]", "UTP", "(", "NEN", "Life", "Science", "Products", ",", "Inc", ".", ")", ".", "Specific", "activity", "of", "the", "[", "α-32P", "]", "UTP", "(", "10", "μCi", "/", "μl", ")", "and", "the", "base", "composition", "of", "each", "substrate", "molecule", "were", "used", "to", "calculate", "the", "substrate", "concentration", ".", "Ribozyme", "transcripts", "were", "quantified", "spectrophotometrically", ".", "(", "The", "half", "-", "life", "of", "the", "M6P", "/", "IGF2R", "target", "is", "about", "280", "minutes", ")", ".", "\n", "Cleavage", "reaction", "mixture", "contained", "substrate", "RNA", "(", "40", "nM", ")", ",", "increasing", "amounts", "of", "ribozyme", "(", "60", "nM", ")", ",", "20", "mM", "MgCl2", "and", "20", "mM", "Tris", "-", "HCl", ",", "pH8.0", ",", "in", "a", "final", "volume", "of", "10", "μl", ".", "The", "mixture", "was", "incubated", "at", "37", "°", "C", "for", "a", "time", "-", "course", "of", "cleavage", "reaction", "from", "0", ",", "5", ",", "10", ",", "20", ",", "40", ",", "80", ",", "160", ",", "320", ",", "to", "640", "minutes", "and", "the", "cleavage", "reaction", "was", "stopped", "by", "addition", "of", "loading", "buffer", "(", "80", "%", "formamide", ",", "10", "mM", "Na2EDTA", ",", "pH", "8.0", ",", "and", "1", "mg", "/", "ml", "each", "bromophenol", "blue", "and", "xylene", "cyanol", ")", ".", "Cleavage", "products", "were", "analyzed", "on", "a", "15", "%", "polyacrylamide", "and", "8", "M", "urea", "gel", ".", "Product", "and", "substrate", "fragments", "were", "quantitated", "by", "using", "NIH", "Imager", ".", "\n\n", "Cell", "cultures", "and", "infection", "with", "Ad", "-", "GFP", "/", "Rz", "-", "IGF2R", "and", "Ad", "-", "GFP", "\n", "Cardiac", "myocytes", "were", "isolated", "from", "1-day", "-", "old", "newborn", "rats", "using", "the", "Neonatal", "Cardiomyocyte", "Isolation", "System", "(", "Worthington", ")", ".", "The", "isolated", "cells", "were", "plated", "in", "6-well", "plates", "and", "cultured", "in", "F-10", "medium", "containing", "5", "%", "(", "vol", "/", "vol", ")", "FBS", "and", "10", "%", "(", "vol", "/", "vol", ")", "horse", "serum", "at", "37", "°", "C", "in", "a", "tissue", "culture", "incubator", "with", "5", "%", "CO2", "and", "98", "%", "relative", "humidity", ".", "Cells", "were", "used", "for", "experiments", "after", "2–3", "days", "of", "culture", ".", "Viral", "infections", "were", "carried", "out", "by", "adding", "viral", "particles", "at", "various", "concentrations", "(", "usually", ",", "2", "×", "108", "virus", "particles", "/", "ml", ")", "to", "culture", "medium", "containing", "2", "%", "(", "vol", "/", "vol", ")", "FBS", ".", "Initially", ",", "optimal", "viral", "concentration", "was", "determined", "by", "using", "Ad", "-", "GFP", "to", "achieve", "an", "optimal", "balance", "of", "high", "gene", "expression", "and", "low", "viral", "titer", "to", "minimize", "cytotoxicity", ".", "After", "24", "hours", "of", "incubation", ",", "the", "infection", "medium", "was", "replaced", "with", "normal", "(", "15", "%", "vol", "/", "vol", "serum", ")", "culture", "medium", ".", "For", "treatment", "with", "IGF", "-", "II", ",", "cells", "were", "incubated", "with", "50", "ng", "/", "ml", "IGF", "-", "II", "after", "24", "hours", "infection", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "or", "Ad", "-", "GFP", ".", "Four", "days", "after", "infection", ",", "cells", "were", "used", "for", "analysis", "of", "gene", "expression", "of", "M6P", "/", "IGF2R", "and", "its", "effect", "on", "cell", "growth", "and", "apoptosis", ".", "\n\n", "Analysis", "of", "gene", "expression", "in", "cardiac", "myocytes", "\n", "The", "M6P", "/", "IGF2R", "transcripts", "were", "determined", "by", "both", "RT", "-", "PCR", "and", "Ribonuclease", "Protection", "Assay", "(", "RPA", ")", ".", "RT", "-", "PCR", "was", "performed", "using", "the", "GeneAmp", "EZ", "rTth", "RNA", "PCR", "kit", "(", "Roche", ")", ".", "Total", "RNA", "was", "extracted", "from", "cultured", "cells", "using", "an", "RNA", "isolation", "kit", "(", "Qiagen", ",", ")", ",", "according", "to", "the", "manufacturer", "'s", "protocol", ".", "M6P", "/", "IGF2R", "transcripts", "were", "amplified", "using", "the", "primers", "(", "5'-GACAGGCTCGTTCTGACTTA-3", "'", ")", "and", "(", "5'-CTTCCACTCTTATCCACAGC-3", "'", ")", "specific", "to", "the", "M6P", "/", "IGF2R.", "Each", "RT", "-", "PCR", "assay", "was", "performed", "in", "triplicate", "and", "product", "levels", "varied", "by", "less", "than", "3.2", "%", "for", "each", "RNA", "sample", ".", "Primers", "specific", "for", "β", "-", "actin", "cDNA", "were", "added", "to", "a", "parallel", "reaction", "to", "standardize", "for", "variations", "in", "PCR", "between", "samples", ".", "PCR", "products", "were", "resolved", "on", "a", "1.0", "%", "agarose", "gel", ",", "visualized", "under", "UV", "light", "and", "quantitated", "using", "NIH", "Imager", ".", "\n", "RPA", "was", "performed", "using", "the", "RPA", "III", "kit", "(", "Ambion", ",", "Austin", ",", "TX", ")", ".", "Briefly", ",", "total", "RNA", "was", "extracted", "from", "cultured", "cells", "using", "a", "total", "RNA", "isolation", "reagent", "(", "TRIzol", ",", "Gibco", "BRL", ")", "according", "to", "the", "manufacturer", "'s", "protocol", ".", "The", "plasmid", "containing", "the", "rat", "M6P", "/", "IGF2R", "gene", "was", "linearized", "and", "used", "as", "a", "transcription", "template", ".", "Antisense", "RNA", "probes", "were", "transcribed", "in", "vitro", "using", "[", "33P]-UTP", ",", "T7", "polymerase", "(", "Riboprobea", "System", "T7", "kit", ",", "Promega", ")", ",", "hybridized", "with", "the", "total", "RNA", "extracted", "from", "the", "rat", "cardiomyocytes", ",", "and", "digested", "with", "ribonuclease", "to", "remove", "non", "-", "hybridized", "RNA", "and", "probe", ".", "The", "protected", "RNA·RNA", "was", "resolved", "on", "a", "denaturing", "5", "%", "sequence", "gel", "and", "subjected", "to", "autoradiography", ".", "A", "probe", "targeting", "the", "GAPDH", "gene", "was", "used", "as", "an", "internal", "control", ".", "\n\n", "Measurement", "of", "125I", "-", "IGF", "-", "II", "internalization", "\n", "Cells", "were", "incubated", "at", "37", "°", "C", "for", "2", "hrs", "in", "serum", "-", "free", "F-10", "culture", "medium", "containing", "125I", "-", "labeled", "IGF", "-", "II", "(", "0.5", "ng", "/", "ml", ")", "with", "or", "without", "excess", "unlabeled", "IGF", "-", "II", "(", "2", "μg", "/", "ml", ")", ".", "Following", "the", "incubation", ",", "the", "cells", "were", "washed", "three", "times", "with", "ice", "-", "cold", "PBS", ",", "and", "cell", "-", "associated", "radioactivity", "was", "determined", "by", "a", "γ", "counter", ".", "Specific", "internalized", "125I", "-", "IGF", "-", "II", "was", "calculated", "by", "subtracting", "the", "count", "of", "samples", "with", "excessive", "unlabeled", "IGF", "-", "II", "from", "that", "without", "unlabeled", "IGF", "-", "II", ",", "and", "normalized", "to", "protein", "contents", ".", "\n\n", "Beta", "-", "glucuronidase", "binding", "assay", "\n", "Binding", "of", "β", "-", "glucuronidase", "was", "assayed", "as", "described", "previously", "[", "34,35", "]", ".", "Briefly", ",", "cells", "were", "permeabilized", "with", "0.25", "%", "saponin", "in", "50", "mM", "Hepes", "(", "pH", "7.0", ")", ",", "150", "mM", "NaCl", ",", "5", "mM", "β", "-", "glycerophosphate", ",", "0.5", "%", "human", "serum", "albumin", ",", "and", "10", "mM", "mannose-6-phosphate", "(", "M6P", ")", "for", "30", "minutes", "on", "ice", ".", "The", "cells", "were", "washed", "three", "times", "with", "ice", "-", "cold", "PBS", "containing", "0.05", "%", "saponin", ".", "They", "were", "incubated", "with", "20,000", "units", "/", "ml", "β", "-", "glucuronidase", "from", "bovine", "liver", "(", "Sigma", ")", "in", "50", "mM", "Hepes", "(", "pH", "7.5", ")", "containing", "150", "mM", "NaCl", ",", "5", "mM", "β", "-", "glycerophosphate", ",", "0.5", "%", "human", "serum", "albumin", ",", "0.5", "%", "saponin", "with", "or", "without", "10", "mM", "M6P", "overnight", "on", "ice", ".", "Cells", "were", "washed", "five", "times", "with", "ice", "-", "cold", "PBS", "containing", "0.05", "%", "saponin", "and", "sonicated", "in", "100", "mM", "sodium", "acetate", "(", "pH", "4.6", ")", ".", "The", "protein", "concentration", "of", "solubilized", "cell", "extract", "was", "measured", "and", "enzyme", "activity", "was", "assayed", "as", "follows", ":", "for", "each", "reaction", "50", "ul", "cell", "extract", "were", "added", "to", "500", "ul", "of", "100", "mM", "sodium", "acetate", "(", "pH", "4.0", ")", "containing", "1", "mM", "paranitrophenyl", "(", "PNP)-β", "-", "glucuronide", "(", "Sigma", ")", "as", "substrate", ".", "After", "an", "incubation", "period", "of", "3", "hours", "at", "37", "°", "C", ",", "500", "ul", "1", "M", "Na2CO3", "were", "added", "to", "each", "reaction", "and", "the", "absorbance", "was", "measured", "at", "400", "nm", ".", "Experimental", "values", "were", "compared", "to", "a", "standard", "curve", "that", "was", "constructed", "using", "1–100", "nM", "solutions", "of", "PNP", "(", "Sigma", ")", "in", "500", "ul", "100", "mM", "sodium", "acetate", "and", "500", "u1", "1", "M", "Na2CO3", ".", "Specific", "activity", "was", "calculated", "as", "nM", "of", "PNP", "produced", "/", "hour", "/", "mg", "of", "protein", ".", "\n\n", "Beta", "-", "glucuronidase", "endocytosis", "assay", "\n", "Beta", "-", "glucuronidase", "endocytosis", "assay", "was", "carried", "out", "as", "described", "previously", "[", "36", "]", ".", "Briefly", ",", "confluent", "cell", "cultures", "were", "washed", "twice", "with", "pre", "-", "warmed", "serum", "-", "free", "DMEM", "followed", "by", "incubation", "with", "DMEM", "containing", "5", "mg", "/", "ml", "human", "serum", "albumin", "and", "10", "mM", "M6P", "for", "20", "minutes", ".", "Following", "incubation", "cells", "were", "washed", "3", "times", "with", "pre", "-", "warmed", "DMEM", ".", "Cells", "were", "then", "incubated", "in", "DMEM", "containing", "5", "mg", "/", "ml", "human", "serum", "albumin", "alone", "or", "4000", "units", "β", "-", "glucuronidase", "with", "or", "without", "10", "mM", "M6P", "for", "2", "hours", "at", "37", "°", "C", ".", "Following", "the", "incubation", ",", "the", "cells", "were", "washed", "5", "times", "with", "ice", "-", "cold", "PBS", "and", "subjected", "to", "enzyme", "activity", "assay", "as", "described", "above", ".", "\n\n", "Cell", "proliferation", "assay", "(", "MTT", "assay", "and", "cell", "counts", ")", "\n", "Cardiac", "myocytes", "were", "grown", "in", "culture", "plates", "(", "tissue", "culture", "grade", ",", "12", "wells", ",", "flat", "bottom", ")", "in", "a", "final", "volume", "of", "1", "ml", "serum", "-", "containing", "culture", "medium", "per", "well", ",", "in", "a", "humidified", "atmosphere", "(", "37", "°", "C", "and", "5", "%", "C02", ")", "for", "3", "days", ".", "After", "infection", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "or", "Ad", "-", "GFP", ",", "cells", "were", "incubated", "with", "or", "without", "50", "ng", "/", "ml", "IGF", "-", "II", "for", "4", "days", ".", "Following", "supplementation", "with", "IGF", "-", "II", ",", "100", "μl", "MTT", "labeling", "reagent", "(", "Roche", ")", "were", "added", "to", "each", "well", "and", "cells", "were", "incubated", "for", "4", "hours", ",", "followed", "by", "addition", "of", "1", "ml", "solubilization", "solution", "into", "each", "well", ".", "The", "plate", "was", "placed", "in", "an", "incubator", "at", "37", "°", "C", "overnight", ".", "Spectrophotometrical", "absorbency", "of", "the", "samples", "was", "measured", "using", "an", "UV", "-", "visible", "Recording", "Spectrophotometer", "with", "wavelength", "of", "550–690", "nm", ".", "In", "addition", ",", "the", "total", "number", "of", "viable", "cells", "in", "each", "treatment", "was", "counted", "by", "trypan", "blue", "exclusion", "method", "using", "a", "hemocytometer", ".", "\n\n", "Induction", "and", "analysis", "of", "cell", "apoptosis", "\n", "Cells", "were", "infected", "with", "Ad", "-", "GFP", "or", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", ".", "Seventy", "-", "two", "hours", "post", "infection", ",", "cells", "were", "treated", "with", "TNF", "(", "0.1", "ng", "/", "ml", ")", "for", "24", "hrs", "or", "subjected", "to", "hypoxia", ".", "For", "induction", "of", "apoptosis", "by", "hypoxia", ",", "cell", "culture", "medium", "was", "changed", "to", "serum", "-", "free", "F-10", "saturated", "with", "95", "%", "N2/5", "%", "CO2", "and", "cells", "were", "placed", "in", "a", "37", "°", "C", "airtight", "box", "saturated", "with", "95", "%", "N2/5", "%", "CO2", "for", "24", "hrs", ".", "For", "normoxic", "controls", ",", "culture", "medium", "was", "changed", "to", "F-10/5%F", "BS/10", "%", "HS", "and", "cells", "were", "placed", "in", "a", "37", "°", "C/5", "%", "CO2", "incubator", "for", "24", "hrs", "before", "analysis", ".", "\n", "Apoptotic", "cells", "were", "identified", "by", "Hoechst", "staining", "using", "the", "Vybrant", "™", "Apoptosis", "Kit", "#", "5", "(", "Molecular", "Probes", ")", "according", "to", "the", "manufacturer", "'s", "protocol", ".", "In", "addition", ",", "after", "infection", "with", "Ad", "-", "GFP", "or", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "and", "challenge", "with", "either", "TNF", "or", "hypoxia", ",", "cell", "viability", "was", "assessed", "using", "the", "MTT", "assay", "Kit", "(", "Roche", "Molecular", "Biochemicals", ")", "and", "cell", "apoptosis", "was", "determined", "using", "the", "Cell", "Death", "Detection", "ELISA", "Kit", "assay", "(", "Roche", "Molecular", "Biochemicals", ")", "according", "to", "the", "manufacturer", "'s", "protocol", ".", "\n\n", "Statistical", "analysis", "\n", "Students", "'", "t", "-", "test", "was", "used", "to", "evaluate", "the", "difference", "between", "two", "values", ".", "Each", "experiment", "was", "repeated", "at", "least", "three", "times", ".", "Statistical", "significance", "was", "accepted", "at", "the", "level", "of", "p", "<", "0.05", ".", "\n\n\n", "List", "of", "abbreviations", "used", "\n", "Ad", "-", "GFP", ",", "adenovirus", "carrying", "GFP", "gene", ";", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", ",", "adenovirus", "carrying", "both", "the", "ribozyme", "against", "M6P", "/", "IGF2R", "and", "the", "GFP", "gene", ";", "GFP", ",", "green", "fluorescent", "protein", ";", "IGF", "-", "II", ",", "insulin", "-", "like", "growth", "factor", "II", ";", "M6P", "/", "IGF2R", ",", "mannose", "6-phosphate", "/", "insulin", "-", "like", "growth", "factor", "II", "receptor", ";", "Rz", ",", "ribozyme", ".", "\n\n", "Authors", "'", "contributions", "\n", "ZC", "carried", "out", "construction", "of", "the", "ribozyme", ",", "production", "of", "the", "viruses", ",", "cellular", "experiments", ",", "biochemical", "assays", "and", "data", "analysis", ".", "\n", "YG", "carried", "out", "the", "RPA", "assay", "and", "participated", "in", "the", "molecular", "biological", "studies", ".", "\n", "JXK", "conceived", "of", "the", "study", ",", "participated", "in", "its", "design", "and", "coordination", ",", "and", "drafted", "the", "manuscript", ".", "\n\n\n" ]
[ "species" ]
rat is a species, rat is a species, human is a species, mice is a species, rat is a species, mice is a species, mice is a species, rat is a species, rats is a species, horse is a species, rat is a species, rat is a species, human is a species, bovine is a species, human is a species, human is a species, human is a species
84_task1
Sentence: Down-regulation of the M6P/IGF-II receptor increases cell proliferation and reduces apoptosis in neonatal rat cardiac myocytes Abstract Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a multi-functional protein that has been implicated in regulation of cell growth and apoptosis. Cardiac myocytes express relatively high levels of M6P/IGF2R, and cardiomyocyte apoptosis has been identified in a variety of cardiovascular disorders, such as myocardial infarction and heart failure. However, involvement of M6P/IGF2R in the pathogenesis of these conditions has not been determined. Thus, the objective of this study was to determine the role of M6P/IGF2R in regulation of cardiac myocyte growth and apoptosis. Results We down-regulated the expression of M6P/IGF2R in neonatal rat cardiac myocytes and examined the effect on cell proliferation and apoptosis. Infection of neonatal cardiomyocytes with an adenovirus expressing a ribozyme targeted against the M6P/IGF2R significantly reduced the level of M6P/IGF2R mRNA, as determined by RT-PCR and Ribonuclease Protection Assay (RPA). M6P-containing protein binding and endocytosis as well as the M6P/IGF2R-mediated internalization of 125I-IGF-II were lower in the ribozyme-treated cells than the control myocytes, indicating that the number of functional M6P/IGF2R in the ribozyme treated cells was reduced. Accordingly, a marked increase in cell proliferation and a reduced cell susceptibility to hypoxia- and TNF-induced apoptosis were observed in the ribozyme-treated cells. Conclusions These findings suggest that M6P/IGF2R may play a role in regulation of cardiac myocyte growth and apoptosis. Down regulation of this gene in cardiac tissues might be a new approach to prevention of cell death or promotion of mitogenesis for certain heart diseases. Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a unique protein that interacts with multiple ligands, some of which are important growth regulatory factors [1]. The M6P/IGF2R participates in internalization and lysosomal degradation of IGF-II, a mitogen normally acting through the IGF-I receptor to stimulate cell proliferation [2]. The M6P/IGF2 receptor is required for the activation of TGF-β [3], a potent growth inhibitor for many cell types. This receptor is also involved in the binding, transport and activation of newly-synthesized lysosomal enzymes, such as cathepsins [4,5], which have been recently implicated in the induction of apoptosis [6]. On the basis of these functions, the M6P/IGF2R has been proposed to play a significant role in regulation of cell growth and apoptosis [7]. Apoptosis, or programmed cell death, is a tightly regulated process used to remove excess, hazardous or damaged somatic cells, and is crucial for the development, maintenance and survival of an organism. However, alterations in the control of apoptosis have also been shown to contribute to human diseases. In fact, morphological and biochemical markers of apoptosis have been identified in a wide variety of cardiovascular disorders, including myocardial infarction and heart failure. This suggests that activation of apoptotic pathways contributes to cardiomyocyte loss and subsequent cardiac dysfunction in these conditions. A number of factors involved in cardiomyocyte apoptosis are currently known and include insulin-like growth factor-I (IGF-I), stress-activated protein kinases (SAPKs) and the anti-apoptotic Bcl-2 family [8]. There are indications that other factors may be involved in induction and regulation of cardiac apoptosis. However, these potential factors and their corresponding mechanisms have not been identified. Several lines of evidence point to the potential involvement of M6P/IGF2R in cardiac myocyte proliferation and apoptosis. Cardiac myocytes express relatively high levels of M6P/IGF2R and transgenic mice containing a homologous deletion of the M6P/IGF2R gene manifest ventricular hyperplasia due to an increase in cell number [9,10], suggesting that the M6P/IGF2R normally acts to suppress cardiac myocyte cell growth. It has also been shown that TGF-β, a potent growth suppressor whose activation requires the binding of latent TGF-β to M6P/IGF2R [3], is commonly upregulated in chronic heart failure [11]. Additional evidence for the involvement of M6P/IGF2R in regulation of apoptosis comes from studies of tumorigenesis. It has been shown that M6P/IGF2R expression is significantly reduced in a variety of tumors and loss of heterozygocity (LOH) at the M6P/IGF2R gene locus 6q26 have been found in breast, liver cancers and squamous cell carcinoma of the lung [12-15]. Although several studies have examined the effect of M6P/IGF2R over-expression on cell growth [7], it is not known whether down-regulation of this receptor protein leads to cellular protection against apoptosis. Ribozymes are catalytic RNA molecules that cleave a complementary mRNA sequence [16], thereby inactivating specific mRNAs and suppressing gene expression in vitro and in vivo [17,18]. Ribozymes have been shown to be highly specific, efficient and stable. They can be packaged into viral vectors to enhance transfer into cells and to achieve longer expression compared with naked oligonucleotides. In the present study, we employed ribozyme technology to study the role of M6P/IGF2R in regulation of cardiac myocyte cell growth. A hammerhead ribozyme against the M6P/IGF2R mRNA was constructed and packaged in an adenoviral vector. We then examined the effect of ribozyme-mediated down-regulation of M6P/IGF2R expression on cell growth and hypoxia- and TNF-induced apoptosis. Results Cleavage reaction of the ribozyme in vitro The M6P/IGF2R ribozyme we constructed has 13-bp binding arms complementary to the target site of M6P/IGF2R mRNA, and a catalytic core (Fig. 1A). To evaluate the bioactivity of the ribozyme and the accessibility of the target site, a cleavage reaction was performed in vitro. The substrates, [α-32P] labeled RNA transcripts containing 45 bp of M6P/IGF2R mRNA or an unmatched sequence, were incubated with the ribozyme as described (see Materials and Methods). The ribozyme cleaved only the specific M6P/IGF2R mRNA into the expected products. In the assay of time course, the hammerhead ribozyme was able to cleave 24.2% of the M6P/IGF2R target within 10 minutes of incubation, 50.3% of the M6P/IGF2R target within 40 minutes of incubation, and by 640 minutes, 80.8% of the M6P/IGF2R target was converted to the expected products (Fig. 1B). This ribozyme did not digest the unmatched sequence (Fig. 1B). These results indicate a high efficiency and specificity of the ribozyme in vitro. Ribozymes down-regulate M6P/IGF2R expression in cardiac myocytes To examine the ability of the ribozyme to reduce levels of M6P/IGF2R mRNA in cultured cardiac myocytes, total RNA was extracted from cells infected with Ad-GFP/IGF2R-Rz or Ad-GFP, and subjected to RT-PCR using M6P/IGF2R-specific primers. Primers specific for β-actin were added to a parallel reaction to serve as an internal standard. Cells were used 4 days after infection, with average infection efficiency of 70–80% (for which a viral dose used had minimal cytotoxicity). The RT-PCR product of M6P/IGF2R was 856 bp, and the β-actin product was 285 bp. As shown in Fig. 2A, the Ad-GFP/IGF2R-Rz-infected cells exhibited a significantly lower level of M6P/IGF2R mRNA than Ad-GFP-infected cells, with a reduction of about 50%. This result was confirmed by ribonuclease protection assay (RPA), in which GAPDH was used as a control (Fig. 2C &2D). There was no significant difference in the level of M6P/IGF2R mRNA between Ad-GFP-infected cells and uninfected cells (data not shown), indicating that infection with the adenovirus itself did not alter the endogenous M6P/IGF2R mRNA level. The results demonstrated that the ribozyme was highly effective in suppressing M6P/IGF2R expression in cultured cardiac myocytes. Effect of ribozyme expression on the functional activity of M6P/IGF2R To determine the effect of the ribozyme on the functional activity of M6P/IGF2R, binding and internalization of exogenous 125I-IGF-II was measured in cells infected with Ad-GFP/IGF2R-Rz. As shown in Fig. 3A, cells infected with Ad-GFP/IGF2R-Rz showed a 54% reduction in 125I-IGF-II internalization when compared with the control cells (infected with Ad-GFP). We also examined the effect of the ribozyme on the M6P-binding activity of the M6P/IGF2R using the M6P-bearing lysosomal enzyme, β-glucuronidase, as a probe. The results showed that the maximal M6P-binding capacity of cells treated with the ribozyme was about 50% less than that of controls (Fig. 3B). Furthermore, we assessed the ability of cells to internalize exogenous β-glucuronidase after treatment with ribozyme. Similarly, the M6P-inhibitable endocytosis of β-glucuronidase by ribozyme-treated cells was about 52% less than that of control cells (Fig. 3C). These results confirm that the number of functional M6P/IGF2R in ribozyme-treated cells was reduced. Adenoviral delivery of ribozymes increases the proliferation of cardiac myocytes We examined the effects of the ribozyme on the growth of cultured neonatal rat cardiac myocytes. Morphological evaluation showed a remarkable difference in growth pattern between Ad-GFP/IGF2R-Rz-infected cells and the control cells: the ribozyme-expressing cells formed larger and more spread colonies (Fig. 4). Assessment of cell proliferative activity by the MTT assay and counts of viable cells showed that the number of cardiac myocytes in ribozyme-expressing cultures was significantly higher than in control cultures (Fig. 5). These results indicate that treatment with M6P/IGF2R-ribozyme can promote cardiac myocyte proliferation. Effect of M6P/IGF2R-ribozyme expression on apoptosis of cardiac myocytes We examined the effects of ribozyme expression on TNF-α and hypoxia-induced apoptosis of cultured cardiac myocytes. After a 24 hr challenge with hypoxia, the number of apoptotic cells in M6P/IGF2R-Rz expressing cultures was 38% lower than in control cultures as determined by Hoechst staining (which highlights the nuclei of apoptotic cells) and ELISA (Fig. 6A, 7A). MTT analysis showed that the number of viable cells in ribozyme-treated cultures was 40% higher than in control cultures (Fig. 7A). After treatment with TNF-α, as shown in Fig. 6B, a large number of control cells underwent apoptosis, as indicated by morphological changes (small round shape) and bright blue nuclear staining. There were significantly more apoptotic cells in control cultures than in cultures expressing the Ad-GFP/IGF2R-Rz. The number of apoptotic cells, as measured by the cell death ELISA assay, in cultures infected with Ad-GFP/IGF2R-Rz was significantly (about 40%) lower than in cultures infected with Ad-GFP (Fig. 7B). Accordingly, the number of viable cells, as measured by MTT analysis, in cultures infected with Ad-GFP/IGF2R-Rz was significantly (about 45%) higher than in cultures infected with Ad-GFP (Fig. 7B). These results are consistent with the hypothesis that decreasing M6P/IGF2R expression by ribozyme treatment can reduce cell apoptosis. Discussion Some 62,000,000 Americans have one or more types of cardiovascular disease (CVD) and CVD is the leading cause (40.1%) of death in the United States. Myocardial infarction and heart failure, conditions accompanied by cardiac myocyte apoptosis, represent 23% of all CVDs and are a growing clinical challenge in need of novel therapeutic strategies. In this study, we investigated the M6P/IGF2R as a potential new therapeutic target for reduction of cardiac apoptosis and cardiac injury in these conditions. Using ribozyme technology we down-regulated the expression of the M6P/IGF2R in neonatal cardiac myocytes. We then examined cell proliferation and apoptosis under normal conditions and post challenge with either hypoxia, a model of ischemia-reperfusion, or TNF-α, a cytokine implicated in the pathogenesis of chronic heart failure [19]. Our results demonstrate an association of a decrease in the expression and function of the M6P/IGF2R with increased cell proliferation and decreased cell susceptibility to hypoxia- and TNF-induced apoptosis. Expression of the ribozyme targeted against the M6P/IGF2R in cardiomyocytes resulted in down-regulation of M6P/IGF2R expression, as measured by RT-PCR and RPA, and of M6P/IGF2R function, as indicated by a decrease in internalization of 125I-IGF-II, and β-glucuronidase binding and endocytosis. MTT analysis and viable cell counts showed that ribozyme-mediated down-regulation of M6P/IGF2R resulted in a marked increase in cell proliferation of cardiomyocytes, which normally express high levels of M6P/IGF2R [20] and have limited proliferative capabilities [21]. These results are consistent with the findings of previous knockout studies [9,10]. Since the M6P/IGF2R has multiple actions on cell growth, its proliferative effect on the heart cells observed in this study might involve multiple mechanisms. However, it is likely that unchecked IGF-II stimulation plays a key role in the effect. Because the M6P/IGF2R is believed to sequester and degrade IGF-II [2], a decrease in M6P/IGF2R expression and function could result in decreased degradation and hence increased bioavailability of IGF-II to the IGF-I receptor, which mediates the growth-promoting effect of IGF-II. Supporting evidence for the involvement of IGF-II in the proliferative effect resulting from loss of M6P/IGF2R function comes from studies of M6P/IGF2R knock-out mice. M6P/IGF2R-null mice display global hyperplasia that coincides with elevated levels of IGF-II. Most importantly, however, the lethal nature of an M6P/IGF2R-null phenotype is reversed in an IGF-II-null background [9]. Our results showing that ribozyme-mediated down-regulation of M6P/IGF2R lead to a decrease in IGF-II internalization support the above possibility. However, further investigation to confirm this mechanism is warranted. More importantly, our results also showed that M6P/IGF2R down-regulation resulted in decreased sensitivity of cardiomyocytes to hypoxia- and TNF-induced apoptosis. There is evidence that lysosomal enzymes, such as cathepsins B and D contribute to hypoxia- and TNF-induced apoptosis in vitro [22-25] and in vivo [26,27]. The M6P/IGF2R has been shown to be involved in binding, transport and activation of lysosomal enzymes, including cathepsins [4,5]. Therefore, it is possible that down-regulation of the M6P/IGF2R results in improper trafficking and activation of cathepsins. This, in turn would eliminate the apoptotic cascades triggered by these enzymes under hypoxia and TNF stimulation and result in decreased sensitivity of cardiomyocytes to apoptosis. It has also been shown that TNF stimulation involves the activation of TGF-β [28-30], a ligand of M6P/IGF2R that has been implicated in the progression of chronic heart failure [11,31]. Therefore, down-regulation of M6P/IGF2R expression could also lead to a decreased bioavailability of activated TGF-β, thereby decreasing the sensitivity of cardiomyocytes to the TNF/TGF-β apoptotic pathway. The detailed mechanism of the observed effects is unknown and requires further investigation. Conclusions The present study demonstrates that ribozyme-mediated down-regulation of expression and functional activity of the M6P/IGF2R results in a decrease in the susceptibility of cardiac myocytes to apoptotic stimuli. These findings suggest that this receptor might be involved in cardiac cell growth and apoptosis. The ability of the M6P/IGF2R ribozyme to reduce M6P/IGF2R expression and function in transfected cells verifies the utility of the ribozyme in studying the role of M6P/IGF2R in cardiomyocyte growth and apoptosis. In addition to its utility as a research tool, the ribozyme, with further exploration and development, might have potential application as a therapeutic agent to prevent cell death or promote mitogenesis for certain clinical conditions, such as, myocardial infarction and chronic heart failure. Methods Construction of recombinant M6P/IGF2R-RZ adenoviral vector The nucleotide numbers of the rat M6P/IGF2R sequence targeted by the hammerhead ribozyme is 1147–1160 after coding site (exon 9). The structure of the M6P/IGF2R hammerhead ribozyme is shown in Fig. 1. A 49 bp M6P/IGF2R ribozyme oligonucleotide, 5'-GAATTCCCC ACACTG ATGAGCCGCTTCGGCGGCGAAACATTCAAC GCGT-3' and the corresponding reverse complementary strand were synthesized. The fragments were subcloned to produce a plasmid containing a ribozyme against M6P/IGF2R. For construction of the recombinant adenovirus containing the M6P/IGF2R-ribozyme (pAd-GFP/IGF2R-Rz), the segments containing the ribozymes were amplified by PCR and cloned into a pAdTrack-CMV vector and then recombined homologously with an adenoviral backbone pAdEasy 1 vector to generate (pAd-GFP/IGF2R-Rz), following the protocol described by He et al. [32]. The pAd-GFP/IGF2R-Rz carries both the IGF2R-Rz and GFP (as reporter) genes, each under the control of separate cytomegalovirus (CMV) promoters. Another viral vector, pAd-GFP, which carries the GFP gene only under the control of the CMV promoter, was generated and used as a control vector. The adenoviral vector DNA were linerized with Pac I and transfected into the replication-permissive 293 cells (E1A transcomplementing cell line) by using Lipofectamine (Life Technologies) to produce E1-deleted, replication-defective recombinant adenovirus as described previously [33]. Large-scale amplification of recombinant adenovirus in 293 cells was followed by purification using a discontinuous CsCl gradient. The constructs were confirmed by enzymatic digestion and DNA sequencing. Transcription and cleavage reaction of ribozyme in vitro Plasmids containing the ribozyme or the substrate (either 45 bp of M6P/IGF2R mRNA or an unmatched sequence 5'-GTGCTGTCTGTATG-3') were linearized with MluI, respectively. All transcripts were generated with T7 RNA polymerase (Promega). Substrate transcripts were labeled by incorporation of [α-32P] UTP (NEN Life Science Products, Inc.). Specific activity of the [α-32P] UTP (10 μCi/μl) and the base composition of each substrate molecule were used to calculate the substrate concentration. Ribozyme transcripts were quantified spectrophotometrically. (The half-life of the M6P/IGF2R target is about 280 minutes). Cleavage reaction mixture contained substrate RNA (40 nM), increasing amounts of ribozyme (60 nM), 20 mM MgCl2 and 20 mM Tris-HCl, pH8.0, in a final volume of 10 μl. The mixture was incubated at 37°C for a time-course of cleavage reaction from 0, 5, 10, 20, 40, 80, 160, 320, to 640 minutes and the cleavage reaction was stopped by addition of loading buffer (80% formamide, 10 mM Na2EDTA, pH 8.0, and 1 mg/ml each bromophenol blue and xylene cyanol). Cleavage products were analyzed on a 15% polyacrylamide and 8M urea gel. Product and substrate fragments were quantitated by using NIH Imager. Cell cultures and infection with Ad-GFP/Rz-IGF2R and Ad-GFP Cardiac myocytes were isolated from 1-day-old newborn rats using the Neonatal Cardiomyocyte Isolation System (Worthington). The isolated cells were plated in 6-well plates and cultured in F-10 medium containing 5% (vol/vol) FBS and 10% (vol/vol) horse serum at 37°C in a tissue culture incubator with 5% CO2 and 98% relative humidity. Cells were used for experiments after 2–3 days of culture. Viral infections were carried out by adding viral particles at various concentrations (usually, 2 × 108 virus particles/ml) to culture medium containing 2% (vol/vol) FBS. Initially, optimal viral concentration was determined by using Ad-GFP to achieve an optimal balance of high gene expression and low viral titer to minimize cytotoxicity. After 24 hours of incubation, the infection medium was replaced with normal (15% vol/vol serum) culture medium. For treatment with IGF-II, cells were incubated with 50 ng/ml IGF-II after 24 hours infection with Ad-GFP/IGF2R-Rz or Ad-GFP. Four days after infection, cells were used for analysis of gene expression of M6P/IGF2R and its effect on cell growth and apoptosis. Analysis of gene expression in cardiac myocytes The M6P/IGF2R transcripts were determined by both RT-PCR and Ribonuclease Protection Assay (RPA). RT-PCR was performed using the GeneAmp EZ rTth RNA PCR kit (Roche). Total RNA was extracted from cultured cells using an RNA isolation kit (Qiagen,), according to the manufacturer's protocol. M6P/IGF2R transcripts were amplified using the primers (5'-GACAGGCTCGTTCTGACTTA-3') and (5'-CTTCCACTCTTATCCACAGC-3') specific to the M6P/IGF2R. Each RT-PCR assay was performed in triplicate and product levels varied by less than 3.2% for each RNA sample. Primers specific for β-actin cDNA were added to a parallel reaction to standardize for variations in PCR between samples. PCR products were resolved on a 1.0% agarose gel, visualized under UV light and quantitated using NIH Imager. RPA was performed using the RPA III kit (Ambion, Austin, TX). Briefly, total RNA was extracted from cultured cells using a total RNA isolation reagent (TRIzol, Gibco BRL) according to the manufacturer's protocol. The plasmid containing the rat M6P/IGF2R gene was linearized and used as a transcription template. Antisense RNA probes were transcribed in vitro using [33P]-UTP, T7 polymerase (Riboprobea System T7 kit, Promega), hybridized with the total RNA extracted from the rat cardiomyocytes, and digested with ribonuclease to remove non-hybridized RNA and probe. The protected RNA·RNA was resolved on a denaturing 5% sequence gel and subjected to autoradiography. A probe targeting the GAPDH gene was used as an internal control. Measurement of 125I-IGF-II internalization Cells were incubated at 37°C for 2 hrs in serum-free F-10 culture medium containing 125I-labeled IGF-II (0.5 ng/ml) with or without excess unlabeled IGF-II (2 μg/ml). Following the incubation, the cells were washed three times with ice-cold PBS, and cell-associated radioactivity was determined by a γ counter. Specific internalized 125I-IGF-II was calculated by subtracting the count of samples with excessive unlabeled IGF-II from that without unlabeled IGF-II, and normalized to protein contents. Beta-glucuronidase binding assay Binding of β-glucuronidase was assayed as described previously [34,35]. Briefly, cells were permeabilized with 0.25% saponin in 50 mM Hepes (pH 7.0), 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, and 10 mM mannose-6-phosphate (M6P) for 30 minutes on ice. The cells were washed three times with ice-cold PBS containing 0.05% saponin. They were incubated with 20,000 units/ml β-glucuronidase from bovine liver (Sigma) in 50 mM Hepes (pH 7.5) containing 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, 0.5% saponin with or without 10 mM M6P overnight on ice. Cells were washed five times with ice-cold PBS containing 0.05% saponin and sonicated in 100 mM sodium acetate (pH 4.6). The protein concentration of solubilized cell extract was measured and enzyme activity was assayed as follows: for each reaction 50 ul cell extract were added to 500 ul of 100 mM sodium acetate (pH 4.0) containing 1 mM paranitrophenyl (PNP)-β-glucuronide (Sigma) as substrate. After an incubation period of 3 hours at 37°C, 500 ul 1 M Na2CO3 were added to each reaction and the absorbance was measured at 400 nm. Experimental values were compared to a standard curve that was constructed using 1–100 nM solutions of PNP (Sigma) in 500 ul 100 mM sodium acetate and 500 u1 1 M Na2CO3. Specific activity was calculated as nM of PNP produced/hour/mg of protein. Beta-glucuronidase endocytosis assay Beta-glucuronidase endocytosis assay was carried out as described previously [36]. Briefly, confluent cell cultures were washed twice with pre-warmed serum-free DMEM followed by incubation with DMEM containing 5 mg/ml human serum albumin and 10 mM M6P for 20 minutes. Following incubation cells were washed 3 times with pre-warmed DMEM. Cells were then incubated in DMEM containing 5 mg/ml human serum albumin alone or 4000 units β-glucuronidase with or without 10 mM M6P for 2 hours at 37°C. Following the incubation, the cells were washed 5 times with ice-cold PBS and subjected to enzyme activity assay as described above. Cell proliferation assay (MTT assay and cell counts) Cardiac myocytes were grown in culture plates (tissue culture grade, 12 wells, flat bottom) in a final volume of 1 ml serum-containing culture medium per well, in a humidified atmosphere (37°C and 5% C02) for 3 days. After infection with Ad-GFP/IGF2R-Rz or Ad-GFP, cells were incubated with or without 50 ng/ml IGF-II for 4 days. Following supplementation with IGF-II, 100 μl MTT labeling reagent (Roche) were added to each well and cells were incubated for 4 hours, followed by addition of 1 ml solubilization solution into each well. The plate was placed in an incubator at 37°C overnight. Spectrophotometrical absorbency of the samples was measured using an UV-visible Recording Spectrophotometer with wavelength of 550–690 nm. In addition, the total number of viable cells in each treatment was counted by trypan blue exclusion method using a hemocytometer. Induction and analysis of cell apoptosis Cells were infected with Ad-GFP or Ad-GFP/IGF2R-Rz. Seventy-two hours post infection, cells were treated with TNF (0.1 ng/ml) for 24 hrs or subjected to hypoxia. For induction of apoptosis by hypoxia, cell culture medium was changed to serum-free F-10 saturated with 95% N2/5% CO2 and cells were placed in a 37°C airtight box saturated with 95% N2/5% CO2 for 24 hrs. For normoxic controls, culture medium was changed to F-10/5%F BS/10% HS and cells were placed in a 37°C/5% CO2 incubator for 24 hrs before analysis. Apoptotic cells were identified by Hoechst staining using the Vybrant™ Apoptosis Kit #5 (Molecular Probes) according to the manufacturer's protocol. In addition, after infection with Ad-GFP or Ad-GFP/IGF2R-Rz and challenge with either TNF or hypoxia, cell viability was assessed using the MTT assay Kit (Roche Molecular Biochemicals) and cell apoptosis was determined using the Cell Death Detection ELISA Kit assay (Roche Molecular Biochemicals) according to the manufacturer's protocol. Statistical analysis Students' t-test was used to evaluate the difference between two values. Each experiment was repeated at least three times. Statistical significance was accepted at the level of p < 0.05. List of abbreviations used Ad-GFP, adenovirus carrying GFP gene; Ad-GFP/IGF2R-Rz, adenovirus carrying both the ribozyme against M6P/IGF2R and the GFP gene; GFP, green fluorescent protein; IGF-II, insulin-like growth factor II; M6P/IGF2R, mannose 6-phosphate/insulin-like growth factor II receptor; Rz, ribozyme. Authors' contributions ZC carried out construction of the ribozyme, production of the viruses, cellular experiments, biochemical assays and data analysis. YG carried out the RPA assay and participated in the molecular biological studies. JXK conceived of the study, participated in its design and coordination, and drafted the manuscript. Instructions: please typing these entity words according to sentence: rat, rat, human, mice, rat, mice, mice, rat, rats, horse, rat, rat, human, bovine, human, human, human Options: species
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Down-regulation of the M6P/IGF-II receptor increases cell proliferation and reduces apoptosis in neonatal rat cardiac myocytes Abstract Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a multi-functional protein that has been implicated in regulation of cell growth and apoptosis. Cardiac myocytes express relatively high levels of M6P/IGF2R, and cardiomyocyte apoptosis has been identified in a variety of cardiovascular disorders, such as myocardial infarction and heart failure. However, involvement of M6P/IGF2R in the pathogenesis of these conditions has not been determined. Thus, the objective of this study was to determine the role of M6P/IGF2R in regulation of cardiac myocyte growth and apoptosis. Results We down-regulated the expression of M6P/IGF2R in neonatal rat cardiac myocytes and examined the effect on cell proliferation and apoptosis. Infection of neonatal cardiomyocytes with an adenovirus expressing a ribozyme targeted against the M6P/IGF2R significantly reduced the level of M6P/IGF2R mRNA, as determined by RT-PCR and Ribonuclease Protection Assay (RPA). M6P-containing protein binding and endocytosis as well as the M6P/IGF2R-mediated internalization of 125I-IGF-II were lower in the ribozyme-treated cells than the control myocytes, indicating that the number of functional M6P/IGF2R in the ribozyme treated cells was reduced. Accordingly, a marked increase in cell proliferation and a reduced cell susceptibility to hypoxia- and TNF-induced apoptosis were observed in the ribozyme-treated cells. Conclusions These findings suggest that M6P/IGF2R may play a role in regulation of cardiac myocyte growth and apoptosis. Down regulation of this gene in cardiac tissues might be a new approach to prevention of cell death or promotion of mitogenesis for certain heart diseases. Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a unique protein that interacts with multiple ligands, some of which are important growth regulatory factors [1]. The M6P/IGF2R participates in internalization and lysosomal degradation of IGF-II, a mitogen normally acting through the IGF-I receptor to stimulate cell proliferation [2]. The M6P/IGF2 receptor is required for the activation of TGF-β [3], a potent growth inhibitor for many cell types. This receptor is also involved in the binding, transport and activation of newly-synthesized lysosomal enzymes, such as cathepsins [4,5], which have been recently implicated in the induction of apoptosis [6]. On the basis of these functions, the M6P/IGF2R has been proposed to play a significant role in regulation of cell growth and apoptosis [7]. Apoptosis, or programmed cell death, is a tightly regulated process used to remove excess, hazardous or damaged somatic cells, and is crucial for the development, maintenance and survival of an organism. However, alterations in the control of apoptosis have also been shown to contribute to human diseases. In fact, morphological and biochemical markers of apoptosis have been identified in a wide variety of cardiovascular disorders, including myocardial infarction and heart failure. This suggests that activation of apoptotic pathways contributes to cardiomyocyte loss and subsequent cardiac dysfunction in these conditions. A number of factors involved in cardiomyocyte apoptosis are currently known and include insulin-like growth factor-I (IGF-I), stress-activated protein kinases (SAPKs) and the anti-apoptotic Bcl-2 family [8]. There are indications that other factors may be involved in induction and regulation of cardiac apoptosis. However, these potential factors and their corresponding mechanisms have not been identified. Several lines of evidence point to the potential involvement of M6P/IGF2R in cardiac myocyte proliferation and apoptosis. Cardiac myocytes express relatively high levels of M6P/IGF2R and transgenic mice containing a homologous deletion of the M6P/IGF2R gene manifest ventricular hyperplasia due to an increase in cell number [9,10], suggesting that the M6P/IGF2R normally acts to suppress cardiac myocyte cell growth. It has also been shown that TGF-β, a potent growth suppressor whose activation requires the binding of latent TGF-β to M6P/IGF2R [3], is commonly upregulated in chronic heart failure [11]. Additional evidence for the involvement of M6P/IGF2R in regulation of apoptosis comes from studies of tumorigenesis. It has been shown that M6P/IGF2R expression is significantly reduced in a variety of tumors and loss of heterozygocity (LOH) at the M6P/IGF2R gene locus 6q26 have been found in breast, liver cancers and squamous cell carcinoma of the lung [12-15]. Although several studies have examined the effect of M6P/IGF2R over-expression on cell growth [7], it is not known whether down-regulation of this receptor protein leads to cellular protection against apoptosis. Ribozymes are catalytic RNA molecules that cleave a complementary mRNA sequence [16], thereby inactivating specific mRNAs and suppressing gene expression in vitro and in vivo [17,18]. Ribozymes have been shown to be highly specific, efficient and stable. They can be packaged into viral vectors to enhance transfer into cells and to achieve longer expression compared with naked oligonucleotides. In the present study, we employed ribozyme technology to study the role of M6P/IGF2R in regulation of cardiac myocyte cell growth. A hammerhead ribozyme against the M6P/IGF2R mRNA was constructed and packaged in an adenoviral vector. We then examined the effect of ribozyme-mediated down-regulation of M6P/IGF2R expression on cell growth and hypoxia- and TNF-induced apoptosis. Results Cleavage reaction of the ribozyme in vitro The M6P/IGF2R ribozyme we constructed has 13-bp binding arms complementary to the target site of M6P/IGF2R mRNA, and a catalytic core (Fig. 1A). To evaluate the bioactivity of the ribozyme and the accessibility of the target site, a cleavage reaction was performed in vitro. The substrates, [α-32P] labeled RNA transcripts containing 45 bp of M6P/IGF2R mRNA or an unmatched sequence, were incubated with the ribozyme as described (see Materials and Methods). The ribozyme cleaved only the specific M6P/IGF2R mRNA into the expected products. In the assay of time course, the hammerhead ribozyme was able to cleave 24.2% of the M6P/IGF2R target within 10 minutes of incubation, 50.3% of the M6P/IGF2R target within 40 minutes of incubation, and by 640 minutes, 80.8% of the M6P/IGF2R target was converted to the expected products (Fig. 1B). This ribozyme did not digest the unmatched sequence (Fig. 1B). These results indicate a high efficiency and specificity of the ribozyme in vitro. Ribozymes down-regulate M6P/IGF2R expression in cardiac myocytes To examine the ability of the ribozyme to reduce levels of M6P/IGF2R mRNA in cultured cardiac myocytes, total RNA was extracted from cells infected with Ad-GFP/IGF2R-Rz or Ad-GFP, and subjected to RT-PCR using M6P/IGF2R-specific primers. Primers specific for β-actin were added to a parallel reaction to serve as an internal standard. Cells were used 4 days after infection, with average infection efficiency of 70–80% (for which a viral dose used had minimal cytotoxicity). The RT-PCR product of M6P/IGF2R was 856 bp, and the β-actin product was 285 bp. As shown in Fig. 2A, the Ad-GFP/IGF2R-Rz-infected cells exhibited a significantly lower level of M6P/IGF2R mRNA than Ad-GFP-infected cells, with a reduction of about 50%. This result was confirmed by ribonuclease protection assay (RPA), in which GAPDH was used as a control (Fig. 2C &2D). There was no significant difference in the level of M6P/IGF2R mRNA between Ad-GFP-infected cells and uninfected cells (data not shown), indicating that infection with the adenovirus itself did not alter the endogenous M6P/IGF2R mRNA level. The results demonstrated that the ribozyme was highly effective in suppressing M6P/IGF2R expression in cultured cardiac myocytes. Effect of ribozyme expression on the functional activity of M6P/IGF2R To determine the effect of the ribozyme on the functional activity of M6P/IGF2R, binding and internalization of exogenous 125I-IGF-II was measured in cells infected with Ad-GFP/IGF2R-Rz. As shown in Fig. 3A, cells infected with Ad-GFP/IGF2R-Rz showed a 54% reduction in 125I-IGF-II internalization when compared with the control cells (infected with Ad-GFP). We also examined the effect of the ribozyme on the M6P-binding activity of the M6P/IGF2R using the M6P-bearing lysosomal enzyme, β-glucuronidase, as a probe. The results showed that the maximal M6P-binding capacity of cells treated with the ribozyme was about 50% less than that of controls (Fig. 3B). Furthermore, we assessed the ability of cells to internalize exogenous β-glucuronidase after treatment with ribozyme. Similarly, the M6P-inhibitable endocytosis of β-glucuronidase by ribozyme-treated cells was about 52% less than that of control cells (Fig. 3C). These results confirm that the number of functional M6P/IGF2R in ribozyme-treated cells was reduced. Adenoviral delivery of ribozymes increases the proliferation of cardiac myocytes We examined the effects of the ribozyme on the growth of cultured neonatal rat cardiac myocytes. Morphological evaluation showed a remarkable difference in growth pattern between Ad-GFP/IGF2R-Rz-infected cells and the control cells: the ribozyme-expressing cells formed larger and more spread colonies (Fig. 4). Assessment of cell proliferative activity by the MTT assay and counts of viable cells showed that the number of cardiac myocytes in ribozyme-expressing cultures was significantly higher than in control cultures (Fig. 5). These results indicate that treatment with M6P/IGF2R-ribozyme can promote cardiac myocyte proliferation. Effect of M6P/IGF2R-ribozyme expression on apoptosis of cardiac myocytes We examined the effects of ribozyme expression on TNF-α and hypoxia-induced apoptosis of cultured cardiac myocytes. After a 24 hr challenge with hypoxia, the number of apoptotic cells in M6P/IGF2R-Rz expressing cultures was 38% lower than in control cultures as determined by Hoechst staining (which highlights the nuclei of apoptotic cells) and ELISA (Fig. 6A, 7A). MTT analysis showed that the number of viable cells in ribozyme-treated cultures was 40% higher than in control cultures (Fig. 7A). After treatment with TNF-α, as shown in Fig. 6B, a large number of control cells underwent apoptosis, as indicated by morphological changes (small round shape) and bright blue nuclear staining. There were significantly more apoptotic cells in control cultures than in cultures expressing the Ad-GFP/IGF2R-Rz. The number of apoptotic cells, as measured by the cell death ELISA assay, in cultures infected with Ad-GFP/IGF2R-Rz was significantly (about 40%) lower than in cultures infected with Ad-GFP (Fig. 7B). Accordingly, the number of viable cells, as measured by MTT analysis, in cultures infected with Ad-GFP/IGF2R-Rz was significantly (about 45%) higher than in cultures infected with Ad-GFP (Fig. 7B). These results are consistent with the hypothesis that decreasing M6P/IGF2R expression by ribozyme treatment can reduce cell apoptosis. Discussion Some 62,000,000 Americans have one or more types of cardiovascular disease (CVD) and CVD is the leading cause (40.1%) of death in the United States. Myocardial infarction and heart failure, conditions accompanied by cardiac myocyte apoptosis, represent 23% of all CVDs and are a growing clinical challenge in need of novel therapeutic strategies. In this study, we investigated the M6P/IGF2R as a potential new therapeutic target for reduction of cardiac apoptosis and cardiac injury in these conditions. Using ribozyme technology we down-regulated the expression of the M6P/IGF2R in neonatal cardiac myocytes. We then examined cell proliferation and apoptosis under normal conditions and post challenge with either hypoxia, a model of ischemia-reperfusion, or TNF-α, a cytokine implicated in the pathogenesis of chronic heart failure [19]. Our results demonstrate an association of a decrease in the expression and function of the M6P/IGF2R with increased cell proliferation and decreased cell susceptibility to hypoxia- and TNF-induced apoptosis. Expression of the ribozyme targeted against the M6P/IGF2R in cardiomyocytes resulted in down-regulation of M6P/IGF2R expression, as measured by RT-PCR and RPA, and of M6P/IGF2R function, as indicated by a decrease in internalization of 125I-IGF-II, and β-glucuronidase binding and endocytosis. MTT analysis and viable cell counts showed that ribozyme-mediated down-regulation of M6P/IGF2R resulted in a marked increase in cell proliferation of cardiomyocytes, which normally express high levels of M6P/IGF2R [20] and have limited proliferative capabilities [21]. These results are consistent with the findings of previous knockout studies [9,10]. Since the M6P/IGF2R has multiple actions on cell growth, its proliferative effect on the heart cells observed in this study might involve multiple mechanisms. However, it is likely that unchecked IGF-II stimulation plays a key role in the effect. Because the M6P/IGF2R is believed to sequester and degrade IGF-II [2], a decrease in M6P/IGF2R expression and function could result in decreased degradation and hence increased bioavailability of IGF-II to the IGF-I receptor, which mediates the growth-promoting effect of IGF-II. Supporting evidence for the involvement of IGF-II in the proliferative effect resulting from loss of M6P/IGF2R function comes from studies of M6P/IGF2R knock-out mice. M6P/IGF2R-null mice display global hyperplasia that coincides with elevated levels of IGF-II. Most importantly, however, the lethal nature of an M6P/IGF2R-null phenotype is reversed in an IGF-II-null background [9]. Our results showing that ribozyme-mediated down-regulation of M6P/IGF2R lead to a decrease in IGF-II internalization support the above possibility. However, further investigation to confirm this mechanism is warranted. More importantly, our results also showed that M6P/IGF2R down-regulation resulted in decreased sensitivity of cardiomyocytes to hypoxia- and TNF-induced apoptosis. There is evidence that lysosomal enzymes, such as cathepsins B and D contribute to hypoxia- and TNF-induced apoptosis in vitro [22-25] and in vivo [26,27]. The M6P/IGF2R has been shown to be involved in binding, transport and activation of lysosomal enzymes, including cathepsins [4,5]. Therefore, it is possible that down-regulation of the M6P/IGF2R results in improper trafficking and activation of cathepsins. This, in turn would eliminate the apoptotic cascades triggered by these enzymes under hypoxia and TNF stimulation and result in decreased sensitivity of cardiomyocytes to apoptosis. It has also been shown that TNF stimulation involves the activation of TGF-β [28-30], a ligand of M6P/IGF2R that has been implicated in the progression of chronic heart failure [11,31]. Therefore, down-regulation of M6P/IGF2R expression could also lead to a decreased bioavailability of activated TGF-β, thereby decreasing the sensitivity of cardiomyocytes to the TNF/TGF-β apoptotic pathway. The detailed mechanism of the observed effects is unknown and requires further investigation. Conclusions The present study demonstrates that ribozyme-mediated down-regulation of expression and functional activity of the M6P/IGF2R results in a decrease in the susceptibility of cardiac myocytes to apoptotic stimuli. These findings suggest that this receptor might be involved in cardiac cell growth and apoptosis. The ability of the M6P/IGF2R ribozyme to reduce M6P/IGF2R expression and function in transfected cells verifies the utility of the ribozyme in studying the role of M6P/IGF2R in cardiomyocyte growth and apoptosis. In addition to its utility as a research tool, the ribozyme, with further exploration and development, might have potential application as a therapeutic agent to prevent cell death or promote mitogenesis for certain clinical conditions, such as, myocardial infarction and chronic heart failure. Methods Construction of recombinant M6P/IGF2R-RZ adenoviral vector The nucleotide numbers of the rat M6P/IGF2R sequence targeted by the hammerhead ribozyme is 1147–1160 after coding site (exon 9). The structure of the M6P/IGF2R hammerhead ribozyme is shown in Fig. 1. A 49 bp M6P/IGF2R ribozyme oligonucleotide, 5'-GAATTCCCC ACACTG ATGAGCCGCTTCGGCGGCGAAACATTCAAC GCGT-3' and the corresponding reverse complementary strand were synthesized. The fragments were subcloned to produce a plasmid containing a ribozyme against M6P/IGF2R. For construction of the recombinant adenovirus containing the M6P/IGF2R-ribozyme (pAd-GFP/IGF2R-Rz), the segments containing the ribozymes were amplified by PCR and cloned into a pAdTrack-CMV vector and then recombined homologously with an adenoviral backbone pAdEasy 1 vector to generate (pAd-GFP/IGF2R-Rz), following the protocol described by He et al. [32]. The pAd-GFP/IGF2R-Rz carries both the IGF2R-Rz and GFP (as reporter) genes, each under the control of separate cytomegalovirus (CMV) promoters. Another viral vector, pAd-GFP, which carries the GFP gene only under the control of the CMV promoter, was generated and used as a control vector. The adenoviral vector DNA were linerized with Pac I and transfected into the replication-permissive 293 cells (E1A transcomplementing cell line) by using Lipofectamine (Life Technologies) to produce E1-deleted, replication-defective recombinant adenovirus as described previously [33]. Large-scale amplification of recombinant adenovirus in 293 cells was followed by purification using a discontinuous CsCl gradient. The constructs were confirmed by enzymatic digestion and DNA sequencing. Transcription and cleavage reaction of ribozyme in vitro Plasmids containing the ribozyme or the substrate (either 45 bp of M6P/IGF2R mRNA or an unmatched sequence 5'-GTGCTGTCTGTATG-3') were linearized with MluI, respectively. All transcripts were generated with T7 RNA polymerase (Promega). Substrate transcripts were labeled by incorporation of [α-32P] UTP (NEN Life Science Products, Inc.). Specific activity of the [α-32P] UTP (10 μCi/μl) and the base composition of each substrate molecule were used to calculate the substrate concentration. Ribozyme transcripts were quantified spectrophotometrically. (The half-life of the M6P/IGF2R target is about 280 minutes). Cleavage reaction mixture contained substrate RNA (40 nM), increasing amounts of ribozyme (60 nM), 20 mM MgCl2 and 20 mM Tris-HCl, pH8.0, in a final volume of 10 μl. The mixture was incubated at 37°C for a time-course of cleavage reaction from 0, 5, 10, 20, 40, 80, 160, 320, to 640 minutes and the cleavage reaction was stopped by addition of loading buffer (80% formamide, 10 mM Na2EDTA, pH 8.0, and 1 mg/ml each bromophenol blue and xylene cyanol). Cleavage products were analyzed on a 15% polyacrylamide and 8M urea gel. Product and substrate fragments were quantitated by using NIH Imager. Cell cultures and infection with Ad-GFP/Rz-IGF2R and Ad-GFP Cardiac myocytes were isolated from 1-day-old newborn rats using the Neonatal Cardiomyocyte Isolation System (Worthington). The isolated cells were plated in 6-well plates and cultured in F-10 medium containing 5% (vol/vol) FBS and 10% (vol/vol) horse serum at 37°C in a tissue culture incubator with 5% CO2 and 98% relative humidity. Cells were used for experiments after 2–3 days of culture. Viral infections were carried out by adding viral particles at various concentrations (usually, 2 × 108 virus particles/ml) to culture medium containing 2% (vol/vol) FBS. Initially, optimal viral concentration was determined by using Ad-GFP to achieve an optimal balance of high gene expression and low viral titer to minimize cytotoxicity. After 24 hours of incubation, the infection medium was replaced with normal (15% vol/vol serum) culture medium. For treatment with IGF-II, cells were incubated with 50 ng/ml IGF-II after 24 hours infection with Ad-GFP/IGF2R-Rz or Ad-GFP. Four days after infection, cells were used for analysis of gene expression of M6P/IGF2R and its effect on cell growth and apoptosis. Analysis of gene expression in cardiac myocytes The M6P/IGF2R transcripts were determined by both RT-PCR and Ribonuclease Protection Assay (RPA). RT-PCR was performed using the GeneAmp EZ rTth RNA PCR kit (Roche). Total RNA was extracted from cultured cells using an RNA isolation kit (Qiagen,), according to the manufacturer's protocol. M6P/IGF2R transcripts were amplified using the primers (5'-GACAGGCTCGTTCTGACTTA-3') and (5'-CTTCCACTCTTATCCACAGC-3') specific to the M6P/IGF2R. Each RT-PCR assay was performed in triplicate and product levels varied by less than 3.2% for each RNA sample. Primers specific for β-actin cDNA were added to a parallel reaction to standardize for variations in PCR between samples. PCR products were resolved on a 1.0% agarose gel, visualized under UV light and quantitated using NIH Imager. RPA was performed using the RPA III kit (Ambion, Austin, TX). Briefly, total RNA was extracted from cultured cells using a total RNA isolation reagent (TRIzol, Gibco BRL) according to the manufacturer's protocol. The plasmid containing the rat M6P/IGF2R gene was linearized and used as a transcription template. Antisense RNA probes were transcribed in vitro using [33P]-UTP, T7 polymerase (Riboprobea System T7 kit, Promega), hybridized with the total RNA extracted from the rat cardiomyocytes, and digested with ribonuclease to remove non-hybridized RNA and probe. The protected RNA·RNA was resolved on a denaturing 5% sequence gel and subjected to autoradiography. A probe targeting the GAPDH gene was used as an internal control. Measurement of 125I-IGF-II internalization Cells were incubated at 37°C for 2 hrs in serum-free F-10 culture medium containing 125I-labeled IGF-II (0.5 ng/ml) with or without excess unlabeled IGF-II (2 μg/ml). Following the incubation, the cells were washed three times with ice-cold PBS, and cell-associated radioactivity was determined by a γ counter. Specific internalized 125I-IGF-II was calculated by subtracting the count of samples with excessive unlabeled IGF-II from that without unlabeled IGF-II, and normalized to protein contents. Beta-glucuronidase binding assay Binding of β-glucuronidase was assayed as described previously [34,35]. Briefly, cells were permeabilized with 0.25% saponin in 50 mM Hepes (pH 7.0), 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, and 10 mM mannose-6-phosphate (M6P) for 30 minutes on ice. The cells were washed three times with ice-cold PBS containing 0.05% saponin. They were incubated with 20,000 units/ml β-glucuronidase from bovine liver (Sigma) in 50 mM Hepes (pH 7.5) containing 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, 0.5% saponin with or without 10 mM M6P overnight on ice. Cells were washed five times with ice-cold PBS containing 0.05% saponin and sonicated in 100 mM sodium acetate (pH 4.6). The protein concentration of solubilized cell extract was measured and enzyme activity was assayed as follows: for each reaction 50 ul cell extract were added to 500 ul of 100 mM sodium acetate (pH 4.0) containing 1 mM paranitrophenyl (PNP)-β-glucuronide (Sigma) as substrate. After an incubation period of 3 hours at 37°C, 500 ul 1 M Na2CO3 were added to each reaction and the absorbance was measured at 400 nm. Experimental values were compared to a standard curve that was constructed using 1–100 nM solutions of PNP (Sigma) in 500 ul 100 mM sodium acetate and 500 u1 1 M Na2CO3. Specific activity was calculated as nM of PNP produced/hour/mg of protein. Beta-glucuronidase endocytosis assay Beta-glucuronidase endocytosis assay was carried out as described previously [36]. Briefly, confluent cell cultures were washed twice with pre-warmed serum-free DMEM followed by incubation with DMEM containing 5 mg/ml human serum albumin and 10 mM M6P for 20 minutes. Following incubation cells were washed 3 times with pre-warmed DMEM. Cells were then incubated in DMEM containing 5 mg/ml human serum albumin alone or 4000 units β-glucuronidase with or without 10 mM M6P for 2 hours at 37°C. Following the incubation, the cells were washed 5 times with ice-cold PBS and subjected to enzyme activity assay as described above. Cell proliferation assay (MTT assay and cell counts) Cardiac myocytes were grown in culture plates (tissue culture grade, 12 wells, flat bottom) in a final volume of 1 ml serum-containing culture medium per well, in a humidified atmosphere (37°C and 5% C02) for 3 days. After infection with Ad-GFP/IGF2R-Rz or Ad-GFP, cells were incubated with or without 50 ng/ml IGF-II for 4 days. Following supplementation with IGF-II, 100 μl MTT labeling reagent (Roche) were added to each well and cells were incubated for 4 hours, followed by addition of 1 ml solubilization solution into each well. The plate was placed in an incubator at 37°C overnight. Spectrophotometrical absorbency of the samples was measured using an UV-visible Recording Spectrophotometer with wavelength of 550–690 nm. In addition, the total number of viable cells in each treatment was counted by trypan blue exclusion method using a hemocytometer. Induction and analysis of cell apoptosis Cells were infected with Ad-GFP or Ad-GFP/IGF2R-Rz. Seventy-two hours post infection, cells were treated with TNF (0.1 ng/ml) for 24 hrs or subjected to hypoxia. For induction of apoptosis by hypoxia, cell culture medium was changed to serum-free F-10 saturated with 95% N2/5% CO2 and cells were placed in a 37°C airtight box saturated with 95% N2/5% CO2 for 24 hrs. For normoxic controls, culture medium was changed to F-10/5%F BS/10% HS and cells were placed in a 37°C/5% CO2 incubator for 24 hrs before analysis. Apoptotic cells were identified by Hoechst staining using the Vybrant™ Apoptosis Kit #5 (Molecular Probes) according to the manufacturer's protocol. In addition, after infection with Ad-GFP or Ad-GFP/IGF2R-Rz and challenge with either TNF or hypoxia, cell viability was assessed using the MTT assay Kit (Roche Molecular Biochemicals) and cell apoptosis was determined using the Cell Death Detection ELISA Kit assay (Roche Molecular Biochemicals) according to the manufacturer's protocol. Statistical analysis Students' t-test was used to evaluate the difference between two values. Each experiment was repeated at least three times. Statistical significance was accepted at the level of p < 0.05. List of abbreviations used Ad-GFP, adenovirus carrying GFP gene; Ad-GFP/IGF2R-Rz, adenovirus carrying both the ribozyme against M6P/IGF2R and the GFP gene; GFP, green fluorescent protein; IGF-II, insulin-like growth factor II; M6P/IGF2R, mannose 6-phosphate/insulin-like growth factor II receptor; Rz, ribozyme. Authors' contributions ZC carried out construction of the ribozyme, production of the viruses, cellular experiments, biochemical assays and data analysis. YG carried out the RPA assay and participated in the molecular biological studies. JXK conceived of the study, participated in its design and coordination, and drafted the manuscript.
[ "Down", "-", "regulation", "of", "the", "M6P", "/", "IGF", "-", "II", "receptor", "increases", "cell", "proliferation", "and", "reduces", "apoptosis", "in", "neonatal", "rat", "cardiac", "myocytes", "\n", "Abstract", "\n", "Background", "\n", "The", "mannose", "6-phosphate", "/", "insulin", "-", "like", "growth", "factor", "-", "II", "receptor", "(", "M6P", "/", "IGF2R", ")", "is", "a", "multi", "-", "functional", "protein", "that", "has", "been", "implicated", "in", "regulation", "of", "cell", "growth", "and", "apoptosis", ".", "Cardiac", "myocytes", "express", "relatively", "high", "levels", "of", "M6P", "/", "IGF2R", ",", "and", "cardiomyocyte", "apoptosis", "has", "been", "identified", "in", "a", "variety", "of", "cardiovascular", "disorders", ",", "such", "as", "myocardial", "infarction", "and", "heart", "failure", ".", "However", ",", "involvement", "of", "M6P", "/", "IGF2R", "in", "the", "pathogenesis", "of", "these", "conditions", "has", "not", "been", "determined", ".", "Thus", ",", "the", "objective", "of", "this", "study", "was", "to", "determine", "the", "role", "of", "M6P", "/", "IGF2R", "in", "regulation", "of", "cardiac", "myocyte", "growth", "and", "apoptosis", ".", "\n\n", "Results", "\n", "We", "down", "-", "regulated", "the", "expression", "of", "M6P", "/", "IGF2R", "in", "neonatal", "rat", "cardiac", "myocytes", "and", "examined", "the", "effect", "on", "cell", "proliferation", "and", "apoptosis", ".", "Infection", "of", "neonatal", "cardiomyocytes", "with", "an", "adenovirus", "expressing", "a", "ribozyme", "targeted", "against", "the", "M6P", "/", "IGF2R", "significantly", "reduced", "the", "level", "of", "M6P", "/", "IGF2R", "mRNA", ",", "as", "determined", "by", "RT", "-", "PCR", "and", "Ribonuclease", "Protection", "Assay", "(", "RPA", ")", ".", "M6P", "-", "containing", "protein", "binding", "and", "endocytosis", "as", "well", "as", "the", "M6P", "/", "IGF2R", "-", "mediated", "internalization", "of", "125I", "-", "IGF", "-", "II", "were", "lower", "in", "the", "ribozyme", "-", "treated", "cells", "than", "the", "control", "myocytes", ",", "indicating", "that", "the", "number", "of", "functional", "M6P", "/", "IGF2R", "in", "the", "ribozyme", "treated", "cells", "was", "reduced", ".", "Accordingly", ",", "a", "marked", "increase", "in", "cell", "proliferation", "and", "a", "reduced", "cell", "susceptibility", "to", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", "were", "observed", "in", "the", "ribozyme", "-", "treated", "cells", ".", "\n\n", "Conclusions", "\n", "These", "findings", "suggest", "that", "M6P", "/", "IGF2R", "may", "play", "a", "role", "in", "regulation", "of", "cardiac", "myocyte", "growth", "and", "apoptosis", ".", "Down", "regulation", "of", "this", "gene", "in", "cardiac", "tissues", "might", "be", "a", "new", "approach", "to", "prevention", "of", "cell", "death", "or", "promotion", "of", "mitogenesis", "for", "certain", "heart", "diseases", ".", "\n\n\n\n", "Background", "\n", "The", "mannose", "6-phosphate", "/", "insulin", "-", "like", "growth", "factor", "-", "II", "receptor", "(", "M6P", "/", "IGF2R", ")", "is", "a", "unique", "protein", "that", "interacts", "with", "multiple", "ligands", ",", "some", "of", "which", "are", "important", "growth", "regulatory", "factors", "[", "1", "]", ".", "The", "M6P", "/", "IGF2R", "participates", "in", "internalization", "and", "lysosomal", "degradation", "of", "IGF", "-", "II", ",", "a", "mitogen", "normally", "acting", "through", "the", "IGF", "-", "I", "receptor", "to", "stimulate", "cell", "proliferation", "[", "2", "]", ".", "The", "M6P", "/", "IGF2", "receptor", "is", "required", "for", "the", "activation", "of", "TGF", "-", "β", "[", "3", "]", ",", "a", "potent", "growth", "inhibitor", "for", "many", "cell", "types", ".", "This", "receptor", "is", "also", "involved", "in", "the", "binding", ",", "transport", "and", "activation", "of", "newly", "-", "synthesized", "lysosomal", "enzymes", ",", "such", "as", "cathepsins", "[", "4,5", "]", ",", "which", "have", "been", "recently", "implicated", "in", "the", "induction", "of", "apoptosis", "[", "6", "]", ".", "On", "the", "basis", "of", "these", "functions", ",", "the", "M6P", "/", "IGF2R", "has", "been", "proposed", "to", "play", "a", "significant", "role", "in", "regulation", "of", "cell", "growth", "and", "apoptosis", "[", "7", "]", ".", "\n", "Apoptosis", ",", "or", "programmed", "cell", "death", ",", "is", "a", "tightly", "regulated", "process", "used", "to", "remove", "excess", ",", "hazardous", "or", "damaged", "somatic", "cells", ",", "and", "is", "crucial", "for", "the", "development", ",", "maintenance", "and", "survival", "of", "an", "organism", ".", "However", ",", "alterations", "in", "the", "control", "of", "apoptosis", "have", "also", "been", "shown", "to", "contribute", "to", "human", "diseases", ".", "In", "fact", ",", "morphological", "and", "biochemical", "markers", "of", "apoptosis", "have", "been", "identified", "in", "a", "wide", "variety", "of", "cardiovascular", "disorders", ",", "including", "myocardial", "infarction", "and", "heart", "failure", ".", "This", "suggests", "that", "activation", "of", "apoptotic", "pathways", "contributes", "to", "cardiomyocyte", "loss", "and", "subsequent", "cardiac", "dysfunction", "in", "these", "conditions", ".", "A", "number", "of", "factors", "involved", "in", "cardiomyocyte", "apoptosis", "are", "currently", "known", "and", "include", "insulin", "-", "like", "growth", "factor", "-", "I", "(", "IGF", "-", "I", ")", ",", "stress", "-", "activated", "protein", "kinases", "(", "SAPKs", ")", "and", "the", "anti", "-", "apoptotic", "Bcl-2", "family", "[", "8", "]", ".", "There", "are", "indications", "that", "other", "factors", "may", "be", "involved", "in", "induction", "and", "regulation", "of", "cardiac", "apoptosis", ".", "However", ",", "these", "potential", "factors", "and", "their", "corresponding", "mechanisms", "have", "not", "been", "identified", ".", "\n", "Several", "lines", "of", "evidence", "point", "to", "the", "potential", "involvement", "of", "M6P", "/", "IGF2R", "in", "cardiac", "myocyte", "proliferation", "and", "apoptosis", ".", "Cardiac", "myocytes", "express", "relatively", "high", "levels", "of", "M6P", "/", "IGF2R", "and", "transgenic", "mice", "containing", "a", "homologous", "deletion", "of", "the", "M6P", "/", "IGF2R", "gene", "manifest", "ventricular", "hyperplasia", "due", "to", "an", "increase", "in", "cell", "number", "[", "9,10", "]", ",", "suggesting", "that", "the", "M6P", "/", "IGF2R", "normally", "acts", "to", "suppress", "cardiac", "myocyte", "cell", "growth", ".", "It", "has", "also", "been", "shown", "that", "TGF", "-", "β", ",", "a", "potent", "growth", "suppressor", "whose", "activation", "requires", "the", "binding", "of", "latent", "TGF", "-", "β", "to", "M6P", "/", "IGF2R", "[", "3", "]", ",", "is", "commonly", "upregulated", "in", "chronic", "heart", "failure", "[", "11", "]", ".", "Additional", "evidence", "for", "the", "involvement", "of", "M6P", "/", "IGF2R", "in", "regulation", "of", "apoptosis", "comes", "from", "studies", "of", "tumorigenesis", ".", "It", "has", "been", "shown", "that", "M6P", "/", "IGF2R", "expression", "is", "significantly", "reduced", "in", "a", "variety", "of", "tumors", "and", "loss", "of", "heterozygocity", "(", "LOH", ")", "at", "the", "M6P", "/", "IGF2R", "gene", "locus", "6q26", "have", "been", "found", "in", "breast", ",", "liver", "cancers", "and", "squamous", "cell", "carcinoma", "of", "the", "lung", "[", "12", "-", "15", "]", ".", "Although", "several", "studies", "have", "examined", "the", "effect", "of", "M6P", "/", "IGF2R", "over", "-", "expression", "on", "cell", "growth", "[", "7", "]", ",", "it", "is", "not", "known", "whether", "down", "-", "regulation", "of", "this", "receptor", "protein", "leads", "to", "cellular", "protection", "against", "apoptosis", ".", "\n", "Ribozymes", "are", "catalytic", "RNA", "molecules", "that", "cleave", "a", "complementary", "mRNA", "sequence", "[", "16", "]", ",", "thereby", "inactivating", "specific", "mRNAs", "and", "suppressing", "gene", "expression", "in", "vitro", "and", "in", "vivo", "[", "17,18", "]", ".", "Ribozymes", "have", "been", "shown", "to", "be", "highly", "specific", ",", "efficient", "and", "stable", ".", "They", "can", "be", "packaged", "into", "viral", "vectors", "to", "enhance", "transfer", "into", "cells", "and", "to", "achieve", "longer", "expression", "compared", "with", "naked", "oligonucleotides", ".", "In", "the", "present", "study", ",", "we", "employed", "ribozyme", "technology", "to", "study", "the", "role", "of", "M6P", "/", "IGF2R", "in", "regulation", "of", "cardiac", "myocyte", "cell", "growth", ".", "A", "hammerhead", "ribozyme", "against", "the", "M6P", "/", "IGF2R", "mRNA", "was", "constructed", "and", "packaged", "in", "an", "adenoviral", "vector", ".", "We", "then", "examined", "the", "effect", "of", "ribozyme", "-", "mediated", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "expression", "on", "cell", "growth", "and", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", ".", "\n\n", "Results", "\n", "Cleavage", "reaction", "of", "the", "ribozyme", "in", "vitro", "\n", "The", "M6P", "/", "IGF2R", "ribozyme", "we", "constructed", "has", "13-bp", "binding", "arms", "complementary", "to", "the", "target", "site", "of", "M6P", "/", "IGF2R", "mRNA", ",", "and", "a", "catalytic", "core", "(", "Fig", ".", "1A", ")", ".", "To", "evaluate", "the", "bioactivity", "of", "the", "ribozyme", "and", "the", "accessibility", "of", "the", "target", "site", ",", "a", "cleavage", "reaction", "was", "performed", "in", "vitro", ".", "The", "substrates", ",", "[", "α-32P", "]", "labeled", "RNA", "transcripts", "containing", "45", "bp", "of", "M6P", "/", "IGF2R", "mRNA", "or", "an", "unmatched", "sequence", ",", "were", "incubated", "with", "the", "ribozyme", "as", "described", "(", "see", "Materials", "and", "Methods", ")", ".", "The", "ribozyme", "cleaved", "only", "the", "specific", "M6P", "/", "IGF2R", "mRNA", "into", "the", "expected", "products", ".", "In", "the", "assay", "of", "time", "course", ",", "the", "hammerhead", "ribozyme", "was", "able", "to", "cleave", "24.2", "%", "of", "the", "M6P", "/", "IGF2R", "target", "within", "10", "minutes", "of", "incubation", ",", "50.3", "%", "of", "the", "M6P", "/", "IGF2R", "target", "within", "40", "minutes", "of", "incubation", ",", "and", "by", "640", "minutes", ",", "80.8", "%", "of", "the", "M6P", "/", "IGF2R", "target", "was", "converted", "to", "the", "expected", "products", "(", "Fig", ".", "1B", ")", ".", "This", "ribozyme", "did", "not", "digest", "the", "unmatched", "sequence", "(", "Fig", ".", "1B", ")", ".", "These", "results", "indicate", "a", "high", "efficiency", "and", "specificity", "of", "the", "ribozyme", "in", "vitro", ".", "\n\n", "Ribozymes", "down", "-", "regulate", "M6P", "/", "IGF2R", "expression", "in", "cardiac", "myocytes", "\n", "To", "examine", "the", "ability", "of", "the", "ribozyme", "to", "reduce", "levels", "of", "M6P", "/", "IGF2R", "mRNA", "in", "cultured", "cardiac", "myocytes", ",", "total", "RNA", "was", "extracted", "from", "cells", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "or", "Ad", "-", "GFP", ",", "and", "subjected", "to", "RT", "-", "PCR", "using", "M6P", "/", "IGF2R", "-", "specific", "primers", ".", "Primers", "specific", "for", "β", "-", "actin", "were", "added", "to", "a", "parallel", "reaction", "to", "serve", "as", "an", "internal", "standard", ".", "Cells", "were", "used", "4", "days", "after", "infection", ",", "with", "average", "infection", "efficiency", "of", "70–80", "%", "(", "for", "which", "a", "viral", "dose", "used", "had", "minimal", "cytotoxicity", ")", ".", "The", "RT", "-", "PCR", "product", "of", "M6P", "/", "IGF2R", "was", "856", "bp", ",", "and", "the", "β", "-", "actin", "product", "was", "285", "bp", ".", "As", "shown", "in", "Fig", ".", "2A", ",", "the", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "-", "infected", "cells", "exhibited", "a", "significantly", "lower", "level", "of", "M6P", "/", "IGF2R", "mRNA", "than", "Ad", "-", "GFP", "-", "infected", "cells", ",", "with", "a", "reduction", "of", "about", "50", "%", ".", "This", "result", "was", "confirmed", "by", "ribonuclease", "protection", "assay", "(", "RPA", ")", ",", "in", "which", "GAPDH", "was", "used", "as", "a", "control", "(", "Fig", ".", "2C", "&", "2D", ")", ".", "There", "was", "no", "significant", "difference", "in", "the", "level", "of", "M6P", "/", "IGF2R", "mRNA", "between", "Ad", "-", "GFP", "-", "infected", "cells", "and", "uninfected", "cells", "(", "data", "not", "shown", ")", ",", "indicating", "that", "infection", "with", "the", "adenovirus", "itself", "did", "not", "alter", "the", "endogenous", "M6P", "/", "IGF2R", "mRNA", "level", ".", "The", "results", "demonstrated", "that", "the", "ribozyme", "was", "highly", "effective", "in", "suppressing", "M6P", "/", "IGF2R", "expression", "in", "cultured", "cardiac", "myocytes", ".", "\n\n", "Effect", "of", "ribozyme", "expression", "on", "the", "functional", "activity", "of", "M6P", "/", "IGF2R", "\n", "To", "determine", "the", "effect", "of", "the", "ribozyme", "on", "the", "functional", "activity", "of", "M6P", "/", "IGF2R", ",", "binding", "and", "internalization", "of", "exogenous", "125I", "-", "IGF", "-", "II", "was", "measured", "in", "cells", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", ".", "As", "shown", "in", "Fig", ".", "3A", ",", "cells", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "showed", "a", "54", "%", "reduction", "in", "125I", "-", "IGF", "-", "II", "internalization", "when", "compared", "with", "the", "control", "cells", "(", "infected", "with", "Ad", "-", "GFP", ")", ".", "We", "also", "examined", "the", "effect", "of", "the", "ribozyme", "on", "the", "M6P", "-", "binding", "activity", "of", "the", "M6P", "/", "IGF2R", "using", "the", "M6P", "-", "bearing", "lysosomal", "enzyme", ",", "β", "-", "glucuronidase", ",", "as", "a", "probe", ".", "The", "results", "showed", "that", "the", "maximal", "M6P", "-", "binding", "capacity", "of", "cells", "treated", "with", "the", "ribozyme", "was", "about", "50", "%", "less", "than", "that", "of", "controls", "(", "Fig", ".", "3B", ")", ".", "Furthermore", ",", "we", "assessed", "the", "ability", "of", "cells", "to", "internalize", "exogenous", "β", "-", "glucuronidase", "after", "treatment", "with", "ribozyme", ".", "Similarly", ",", "the", "M6P", "-", "inhibitable", "endocytosis", "of", "β", "-", "glucuronidase", "by", "ribozyme", "-", "treated", "cells", "was", "about", "52", "%", "less", "than", "that", "of", "control", "cells", "(", "Fig", ".", "3C", ")", ".", "These", "results", "confirm", "that", "the", "number", "of", "functional", "M6P", "/", "IGF2R", "in", "ribozyme", "-", "treated", "cells", "was", "reduced", ".", "\n\n", "Adenoviral", "delivery", "of", "ribozymes", "increases", "the", "proliferation", "of", "cardiac", "myocytes", "\n", "We", "examined", "the", "effects", "of", "the", "ribozyme", "on", "the", "growth", "of", "cultured", "neonatal", "rat", "cardiac", "myocytes", ".", "Morphological", "evaluation", "showed", "a", "remarkable", "difference", "in", "growth", "pattern", "between", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "-", "infected", "cells", "and", "the", "control", "cells", ":", "the", "ribozyme", "-", "expressing", "cells", "formed", "larger", "and", "more", "spread", "colonies", "(", "Fig", ".", "4", ")", ".", "Assessment", "of", "cell", "proliferative", "activity", "by", "the", "MTT", "assay", "and", "counts", "of", "viable", "cells", "showed", "that", "the", "number", "of", "cardiac", "myocytes", "in", "ribozyme", "-", "expressing", "cultures", "was", "significantly", "higher", "than", "in", "control", "cultures", "(", "Fig", ".", "5", ")", ".", "These", "results", "indicate", "that", "treatment", "with", "M6P", "/", "IGF2R", "-", "ribozyme", "can", "promote", "cardiac", "myocyte", "proliferation", ".", "\n\n", "Effect", "of", "M6P", "/", "IGF2R", "-", "ribozyme", "expression", "on", "apoptosis", "of", "cardiac", "myocytes", "\n", "We", "examined", "the", "effects", "of", "ribozyme", "expression", "on", "TNF", "-", "α", "and", "hypoxia", "-", "induced", "apoptosis", "of", "cultured", "cardiac", "myocytes", ".", "After", "a", "24", "hr", "challenge", "with", "hypoxia", ",", "the", "number", "of", "apoptotic", "cells", "in", "M6P", "/", "IGF2R", "-", "Rz", "expressing", "cultures", "was", "38", "%", "lower", "than", "in", "control", "cultures", "as", "determined", "by", "Hoechst", "staining", "(", "which", "highlights", "the", "nuclei", "of", "apoptotic", "cells", ")", "and", "ELISA", "(", "Fig", ".", "6A", ",", "7A", ")", ".", "MTT", "analysis", "showed", "that", "the", "number", "of", "viable", "cells", "in", "ribozyme", "-", "treated", "cultures", "was", "40", "%", "higher", "than", "in", "control", "cultures", "(", "Fig", ".", "7A", ")", ".", "\n", "After", "treatment", "with", "TNF", "-", "α", ",", "as", "shown", "in", "Fig", ".", "6B", ",", "a", "large", "number", "of", "control", "cells", "underwent", "apoptosis", ",", "as", "indicated", "by", "morphological", "changes", "(", "small", "round", "shape", ")", "and", "bright", "blue", "nuclear", "staining", ".", "There", "were", "significantly", "more", "apoptotic", "cells", "in", "control", "cultures", "than", "in", "cultures", "expressing", "the", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", ".", "The", "number", "of", "apoptotic", "cells", ",", "as", "measured", "by", "the", "cell", "death", "ELISA", "assay", ",", "in", "cultures", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "was", "significantly", "(", "about", "40", "%", ")", "lower", "than", "in", "cultures", "infected", "with", "Ad", "-", "GFP", "(", "Fig", ".", "7B", ")", ".", "Accordingly", ",", "the", "number", "of", "viable", "cells", ",", "as", "measured", "by", "MTT", "analysis", ",", "in", "cultures", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "was", "significantly", "(", "about", "45", "%", ")", "higher", "than", "in", "cultures", "infected", "with", "Ad", "-", "GFP", "(", "Fig", ".", "7B", ")", ".", "These", "results", "are", "consistent", "with", "the", "hypothesis", "that", "decreasing", "M6P", "/", "IGF2R", "expression", "by", "ribozyme", "treatment", "can", "reduce", "cell", "apoptosis", ".", "\n\n\n", "Discussion", "\n", "Some", "62,000,000", "Americans", "have", "one", "or", "more", "types", "of", "cardiovascular", "disease", "(", "CVD", ")", "and", "CVD", "is", "the", "leading", "cause", "(", "40.1", "%", ")", "of", "death", "in", "the", "United", "States", ".", "Myocardial", "infarction", "and", "heart", "failure", ",", "conditions", "accompanied", "by", "cardiac", "myocyte", "apoptosis", ",", "represent", "23", "%", "of", "all", "CVDs", "and", "are", "a", "growing", "clinical", "challenge", "in", "need", "of", "novel", "therapeutic", "strategies", ".", "In", "this", "study", ",", "we", "investigated", "the", "M6P", "/", "IGF2R", "as", "a", "potential", "new", "therapeutic", "target", "for", "reduction", "of", "cardiac", "apoptosis", "and", "cardiac", "injury", "in", "these", "conditions", ".", "\n", "Using", "ribozyme", "technology", "we", "down", "-", "regulated", "the", "expression", "of", "the", "M6P", "/", "IGF2R", "in", "neonatal", "cardiac", "myocytes", ".", "We", "then", "examined", "cell", "proliferation", "and", "apoptosis", "under", "normal", "conditions", "and", "post", "challenge", "with", "either", "hypoxia", ",", "a", "model", "of", "ischemia", "-", "reperfusion", ",", "or", "TNF", "-", "α", ",", "a", "cytokine", "implicated", "in", "the", "pathogenesis", "of", "chronic", "heart", "failure", "[", "19", "]", ".", "Our", "results", "demonstrate", "an", "association", "of", "a", "decrease", "in", "the", "expression", "and", "function", "of", "the", "M6P", "/", "IGF2R", "with", "increased", "cell", "proliferation", "and", "decreased", "cell", "susceptibility", "to", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", ".", "Expression", "of", "the", "ribozyme", "targeted", "against", "the", "M6P", "/", "IGF2R", "in", "cardiomyocytes", "resulted", "in", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "expression", ",", "as", "measured", "by", "RT", "-", "PCR", "and", "RPA", ",", "and", "of", "M6P", "/", "IGF2R", "function", ",", "as", "indicated", "by", "a", "decrease", "in", "internalization", "of", "125I", "-", "IGF", "-", "II", ",", "and", "β", "-", "glucuronidase", "binding", "and", "endocytosis", ".", "\n", "MTT", "analysis", "and", "viable", "cell", "counts", "showed", "that", "ribozyme", "-", "mediated", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "resulted", "in", "a", "marked", "increase", "in", "cell", "proliferation", "of", "cardiomyocytes", ",", "which", "normally", "express", "high", "levels", "of", "M6P", "/", "IGF2R", "[", "20", "]", "and", "have", "limited", "proliferative", "capabilities", "[", "21", "]", ".", "These", "results", "are", "consistent", "with", "the", "findings", "of", "previous", "knockout", "studies", "[", "9,10", "]", ".", "Since", "the", "M6P", "/", "IGF2R", "has", "multiple", "actions", "on", "cell", "growth", ",", "its", "proliferative", "effect", "on", "the", "heart", "cells", "observed", "in", "this", "study", "might", "involve", "multiple", "mechanisms", ".", "However", ",", "it", "is", "likely", "that", "unchecked", "IGF", "-", "II", "stimulation", "plays", "a", "key", "role", "in", "the", "effect", ".", "Because", "the", "M6P", "/", "IGF2R", "is", "believed", "to", "sequester", "and", "degrade", "IGF", "-", "II", "[", "2", "]", ",", "a", "decrease", "in", "M6P", "/", "IGF2R", "expression", "and", "function", "could", "result", "in", "decreased", "degradation", "and", "hence", "increased", "bioavailability", "of", "IGF", "-", "II", "to", "the", "IGF", "-", "I", "receptor", ",", "which", "mediates", "the", "growth", "-", "promoting", "effect", "of", "IGF", "-", "II", ".", "Supporting", "evidence", "for", "the", "involvement", "of", "IGF", "-", "II", "in", "the", "proliferative", "effect", "resulting", "from", "loss", "of", "M6P", "/", "IGF2R", "function", "comes", "from", "studies", "of", "M6P", "/", "IGF2R", "knock", "-", "out", "mice", ".", "M6P", "/", "IGF2R", "-", "null", "mice", "display", "global", "hyperplasia", "that", "coincides", "with", "elevated", "levels", "of", "IGF", "-", "II", ".", "Most", "importantly", ",", "however", ",", "the", "lethal", "nature", "of", "an", "M6P", "/", "IGF2R", "-", "null", "phenotype", "is", "reversed", "in", "an", "IGF", "-", "II", "-", "null", "background", "[", "9", "]", ".", "Our", "results", "showing", "that", "ribozyme", "-", "mediated", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "lead", "to", "a", "decrease", "in", "IGF", "-", "II", "internalization", "support", "the", "above", "possibility", ".", "However", ",", "further", "investigation", "to", "confirm", "this", "mechanism", "is", "warranted", ".", "\n", "More", "importantly", ",", "our", "results", "also", "showed", "that", "M6P", "/", "IGF2R", "down", "-", "regulation", "resulted", "in", "decreased", "sensitivity", "of", "cardiomyocytes", "to", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", ".", "There", "is", "evidence", "that", "lysosomal", "enzymes", ",", "such", "as", "cathepsins", "B", "and", "D", "contribute", "to", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", "in", "vitro", "[", "22", "-", "25", "]", "and", "in", "vivo", "[", "26,27", "]", ".", "The", "M6P", "/", "IGF2R", "has", "been", "shown", "to", "be", "involved", "in", "binding", ",", "transport", "and", "activation", "of", "lysosomal", "enzymes", ",", "including", "cathepsins", "[", "4,5", "]", ".", "Therefore", ",", "it", "is", "possible", "that", "down", "-", "regulation", "of", "the", "M6P", "/", "IGF2R", "results", "in", "improper", "trafficking", "and", "activation", "of", "cathepsins", ".", "This", ",", "in", "turn", "would", "eliminate", "the", "apoptotic", "cascades", "triggered", "by", "these", "enzymes", "under", "hypoxia", "and", "TNF", "stimulation", "and", "result", "in", "decreased", "sensitivity", "of", "cardiomyocytes", "to", "apoptosis", ".", "\n", "It", "has", "also", "been", "shown", "that", "TNF", "stimulation", "involves", "the", "activation", "of", "TGF", "-", "β", "[", "28", "-", "30", "]", ",", "a", "ligand", "of", "M6P", "/", "IGF2R", "that", "has", "been", "implicated", "in", "the", "progression", "of", "chronic", "heart", "failure", "[", "11,31", "]", ".", "Therefore", ",", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "expression", "could", "also", "lead", "to", "a", "decreased", "bioavailability", "of", "activated", "TGF", "-", "β", ",", "thereby", "decreasing", "the", "sensitivity", "of", "cardiomyocytes", "to", "the", "TNF", "/", "TGF", "-", "β", "apoptotic", "pathway", ".", "The", "detailed", "mechanism", "of", "the", "observed", "effects", "is", "unknown", "and", "requires", "further", "investigation", ".", "\n\n", "Conclusions", "\n", "The", "present", "study", "demonstrates", "that", "ribozyme", "-", "mediated", "down", "-", "regulation", "of", "expression", "and", "functional", "activity", "of", "the", "M6P", "/", "IGF2R", "results", "in", "a", "decrease", "in", "the", "susceptibility", "of", "cardiac", "myocytes", "to", "apoptotic", "stimuli", ".", "These", "findings", "suggest", "that", "this", "receptor", "might", "be", "involved", "in", "cardiac", "cell", "growth", "and", "apoptosis", ".", "The", "ability", "of", "the", "M6P", "/", "IGF2R", "ribozyme", "to", "reduce", "M6P", "/", "IGF2R", "expression", "and", "function", "in", "transfected", "cells", "verifies", "the", "utility", "of", "the", "ribozyme", "in", "studying", "the", "role", "of", "M6P", "/", "IGF2R", "in", "cardiomyocyte", "growth", "and", "apoptosis", ".", "In", "addition", "to", "its", "utility", "as", "a", "research", "tool", ",", "the", "ribozyme", ",", "with", "further", "exploration", "and", "development", ",", "might", "have", "potential", "application", "as", "a", "therapeutic", "agent", "to", "prevent", "cell", "death", "or", "promote", "mitogenesis", "for", "certain", "clinical", "conditions", ",", "such", "as", ",", "myocardial", "infarction", "and", "chronic", "heart", "failure", ".", "\n\n", "Methods", "\n", "Construction", "of", "recombinant", "M6P", "/", "IGF2R", "-", "RZ", "adenoviral", "vector", "\n", "The", "nucleotide", "numbers", "of", "the", "rat", "M6P", "/", "IGF2R", "sequence", "targeted", "by", "the", "hammerhead", "ribozyme", "is", "1147–1160", "after", "coding", "site", "(", "exon", "9", ")", ".", "The", "structure", "of", "the", "M6P", "/", "IGF2R", "hammerhead", "ribozyme", "is", "shown", "in", "Fig", ".", "1", ".", "A", "49", "bp", "M6P", "/", "IGF2R", "ribozyme", "oligonucleotide", ",", "5'-GAATTCCCC", "ACACTG", "ATGAGCCGCTTCGGCGGCGAAACATTCAAC", "GCGT-3", "'", "and", "the", "corresponding", "reverse", "complementary", "strand", "were", "synthesized", ".", "The", "fragments", "were", "subcloned", "to", "produce", "a", "plasmid", "containing", "a", "ribozyme", "against", "M6P", "/", "IGF2R.", "For", "construction", "of", "the", "recombinant", "adenovirus", "containing", "the", "M6P", "/", "IGF2R", "-", "ribozyme", "(", "pAd", "-", "GFP", "/", "IGF2R", "-", "Rz", ")", ",", "the", "segments", "containing", "the", "ribozymes", "were", "amplified", "by", "PCR", "and", "cloned", "into", "a", "pAdTrack", "-", "CMV", "vector", "and", "then", "recombined", "homologously", "with", "an", "adenoviral", "backbone", "pAdEasy", "1", "vector", "to", "generate", "(", "pAd", "-", "GFP", "/", "IGF2R", "-", "Rz", ")", ",", "following", "the", "protocol", "described", "by", "He", "et", "al", ".", "[", "32", "]", ".", "The", "pAd", "-", "GFP", "/", "IGF2R", "-", "Rz", "carries", "both", "the", "IGF2R", "-", "Rz", "and", "GFP", "(", "as", "reporter", ")", "genes", ",", "each", "under", "the", "control", "of", "separate", "cytomegalovirus", "(", "CMV", ")", "promoters", ".", "Another", "viral", "vector", ",", "pAd", "-", "GFP", ",", "which", "carries", "the", "GFP", "gene", "only", "under", "the", "control", "of", "the", "CMV", "promoter", ",", "was", "generated", "and", "used", "as", "a", "control", "vector", ".", "The", "adenoviral", "vector", "DNA", "were", "linerized", "with", "Pac", "I", "and", "transfected", "into", "the", "replication", "-", "permissive", "293", "cells", "(", "E1A", "transcomplementing", "cell", "line", ")", "by", "using", "Lipofectamine", "(", "Life", "Technologies", ")", "to", "produce", "E1-deleted", ",", "replication", "-", "defective", "recombinant", "adenovirus", "as", "described", "previously", "[", "33", "]", ".", "Large", "-", "scale", "amplification", "of", "recombinant", "adenovirus", "in", "293", "cells", "was", "followed", "by", "purification", "using", "a", "discontinuous", "CsCl", "gradient", ".", "The", "constructs", "were", "confirmed", "by", "enzymatic", "digestion", "and", "DNA", "sequencing", ".", "\n\n", "Transcription", "and", "cleavage", "reaction", "of", "ribozyme", "in", "vitro", "\n", "Plasmids", "containing", "the", "ribozyme", "or", "the", "substrate", "(", "either", "45", "bp", "of", "M6P", "/", "IGF2R", "mRNA", "or", "an", "unmatched", "sequence", "5'-GTGCTGTCTGTATG-3", "'", ")", "were", "linearized", "with", "MluI", ",", "respectively", ".", "All", "transcripts", "were", "generated", "with", "T7", "RNA", "polymerase", "(", "Promega", ")", ".", "Substrate", "transcripts", "were", "labeled", "by", "incorporation", "of", "[", "α-32P", "]", "UTP", "(", "NEN", "Life", "Science", "Products", ",", "Inc", ".", ")", ".", "Specific", "activity", "of", "the", "[", "α-32P", "]", "UTP", "(", "10", "μCi", "/", "μl", ")", "and", "the", "base", "composition", "of", "each", "substrate", "molecule", "were", "used", "to", "calculate", "the", "substrate", "concentration", ".", "Ribozyme", "transcripts", "were", "quantified", "spectrophotometrically", ".", "(", "The", "half", "-", "life", "of", "the", "M6P", "/", "IGF2R", "target", "is", "about", "280", "minutes", ")", ".", "\n", "Cleavage", "reaction", "mixture", "contained", "substrate", "RNA", "(", "40", "nM", ")", ",", "increasing", "amounts", "of", "ribozyme", "(", "60", "nM", ")", ",", "20", "mM", "MgCl2", "and", "20", "mM", "Tris", "-", "HCl", ",", "pH8.0", ",", "in", "a", "final", "volume", "of", "10", "μl", ".", "The", "mixture", "was", "incubated", "at", "37", "°", "C", "for", "a", "time", "-", "course", "of", "cleavage", "reaction", "from", "0", ",", "5", ",", "10", ",", "20", ",", "40", ",", "80", ",", "160", ",", "320", ",", "to", "640", "minutes", "and", "the", "cleavage", "reaction", "was", "stopped", "by", "addition", "of", "loading", "buffer", "(", "80", "%", "formamide", ",", "10", "mM", "Na2EDTA", ",", "pH", "8.0", ",", "and", "1", "mg", "/", "ml", "each", "bromophenol", "blue", "and", "xylene", "cyanol", ")", ".", "Cleavage", "products", "were", "analyzed", "on", "a", "15", "%", "polyacrylamide", "and", "8", "M", "urea", "gel", ".", "Product", "and", "substrate", "fragments", "were", "quantitated", "by", "using", "NIH", "Imager", ".", "\n\n", "Cell", "cultures", "and", "infection", "with", "Ad", "-", "GFP", "/", "Rz", "-", "IGF2R", "and", "Ad", "-", "GFP", "\n", "Cardiac", "myocytes", "were", "isolated", "from", "1-day", "-", "old", "newborn", "rats", "using", "the", "Neonatal", "Cardiomyocyte", "Isolation", "System", "(", "Worthington", ")", ".", "The", "isolated", "cells", "were", "plated", "in", "6-well", "plates", "and", "cultured", "in", "F-10", "medium", "containing", "5", "%", "(", "vol", "/", "vol", ")", "FBS", "and", "10", "%", "(", "vol", "/", "vol", ")", "horse", "serum", "at", "37", "°", "C", "in", "a", "tissue", "culture", "incubator", "with", "5", "%", "CO2", "and", "98", "%", "relative", "humidity", ".", "Cells", "were", "used", "for", "experiments", "after", "2–3", "days", "of", "culture", ".", "Viral", "infections", "were", "carried", "out", "by", "adding", "viral", "particles", "at", "various", "concentrations", "(", "usually", ",", "2", "×", "108", "virus", "particles", "/", "ml", ")", "to", "culture", "medium", "containing", "2", "%", "(", "vol", "/", "vol", ")", "FBS", ".", "Initially", ",", "optimal", "viral", "concentration", "was", "determined", "by", "using", "Ad", "-", "GFP", "to", "achieve", "an", "optimal", "balance", "of", "high", "gene", "expression", "and", "low", "viral", "titer", "to", "minimize", "cytotoxicity", ".", "After", "24", "hours", "of", "incubation", ",", "the", "infection", "medium", "was", "replaced", "with", "normal", "(", "15", "%", "vol", "/", "vol", "serum", ")", "culture", "medium", ".", "For", "treatment", "with", "IGF", "-", "II", ",", "cells", "were", "incubated", "with", "50", "ng", "/", "ml", "IGF", "-", "II", "after", "24", "hours", "infection", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "or", "Ad", "-", "GFP", ".", "Four", "days", "after", "infection", ",", "cells", "were", "used", "for", "analysis", "of", "gene", "expression", "of", "M6P", "/", "IGF2R", "and", "its", "effect", "on", "cell", "growth", "and", "apoptosis", ".", "\n\n", "Analysis", "of", "gene", "expression", "in", "cardiac", "myocytes", "\n", "The", "M6P", "/", "IGF2R", "transcripts", "were", "determined", "by", "both", "RT", "-", "PCR", "and", "Ribonuclease", "Protection", "Assay", "(", "RPA", ")", ".", "RT", "-", "PCR", "was", "performed", "using", "the", "GeneAmp", "EZ", "rTth", "RNA", "PCR", "kit", "(", "Roche", ")", ".", "Total", "RNA", "was", "extracted", "from", "cultured", "cells", "using", "an", "RNA", "isolation", "kit", "(", "Qiagen", ",", ")", ",", "according", "to", "the", "manufacturer", "'s", "protocol", ".", "M6P", "/", "IGF2R", "transcripts", "were", "amplified", "using", "the", "primers", "(", "5'-GACAGGCTCGTTCTGACTTA-3", "'", ")", "and", "(", "5'-CTTCCACTCTTATCCACAGC-3", "'", ")", "specific", "to", "the", "M6P", "/", "IGF2R.", "Each", "RT", "-", "PCR", "assay", "was", "performed", "in", "triplicate", "and", "product", "levels", "varied", "by", "less", "than", "3.2", "%", "for", "each", "RNA", "sample", ".", "Primers", "specific", "for", "β", "-", "actin", "cDNA", "were", "added", "to", "a", "parallel", "reaction", "to", "standardize", "for", "variations", "in", "PCR", "between", "samples", ".", "PCR", "products", "were", "resolved", "on", "a", "1.0", "%", "agarose", "gel", ",", "visualized", "under", "UV", "light", "and", "quantitated", "using", "NIH", "Imager", ".", "\n", "RPA", "was", "performed", "using", "the", "RPA", "III", "kit", "(", "Ambion", ",", "Austin", ",", "TX", ")", ".", "Briefly", ",", "total", "RNA", "was", "extracted", "from", "cultured", "cells", "using", "a", "total", "RNA", "isolation", "reagent", "(", "TRIzol", ",", "Gibco", "BRL", ")", "according", "to", "the", "manufacturer", "'s", "protocol", ".", "The", "plasmid", "containing", "the", "rat", "M6P", "/", "IGF2R", "gene", "was", "linearized", "and", "used", "as", "a", "transcription", "template", ".", "Antisense", "RNA", "probes", "were", "transcribed", "in", "vitro", "using", "[", "33P]-UTP", ",", "T7", "polymerase", "(", "Riboprobea", "System", "T7", "kit", ",", "Promega", ")", ",", "hybridized", "with", "the", "total", "RNA", "extracted", "from", "the", "rat", "cardiomyocytes", ",", "and", "digested", "with", "ribonuclease", "to", "remove", "non", "-", "hybridized", "RNA", "and", "probe", ".", "The", "protected", "RNA·RNA", "was", "resolved", "on", "a", "denaturing", "5", "%", "sequence", "gel", "and", "subjected", "to", "autoradiography", ".", "A", "probe", "targeting", "the", "GAPDH", "gene", "was", "used", "as", "an", "internal", "control", ".", "\n\n", "Measurement", "of", "125I", "-", "IGF", "-", "II", "internalization", "\n", "Cells", "were", "incubated", "at", "37", "°", "C", "for", "2", "hrs", "in", "serum", "-", "free", "F-10", "culture", "medium", "containing", "125I", "-", "labeled", "IGF", "-", "II", "(", "0.5", "ng", "/", "ml", ")", "with", "or", "without", "excess", "unlabeled", "IGF", "-", "II", "(", "2", "μg", "/", "ml", ")", ".", "Following", "the", "incubation", ",", "the", "cells", "were", "washed", "three", "times", "with", "ice", "-", "cold", "PBS", ",", "and", "cell", "-", "associated", "radioactivity", "was", "determined", "by", "a", "γ", "counter", ".", "Specific", "internalized", "125I", "-", "IGF", "-", "II", "was", "calculated", "by", "subtracting", "the", "count", "of", "samples", "with", "excessive", "unlabeled", "IGF", "-", "II", "from", "that", "without", "unlabeled", "IGF", "-", "II", ",", "and", "normalized", "to", "protein", "contents", ".", "\n\n", "Beta", "-", "glucuronidase", "binding", "assay", "\n", "Binding", "of", "β", "-", "glucuronidase", "was", "assayed", "as", "described", "previously", "[", "34,35", "]", ".", "Briefly", ",", "cells", "were", "permeabilized", "with", "0.25", "%", "saponin", "in", "50", "mM", "Hepes", "(", "pH", "7.0", ")", ",", "150", "mM", "NaCl", ",", "5", "mM", "β", "-", "glycerophosphate", ",", "0.5", "%", "human", "serum", "albumin", ",", "and", "10", "mM", "mannose-6-phosphate", "(", "M6P", ")", "for", "30", "minutes", "on", "ice", ".", "The", "cells", "were", "washed", "three", "times", "with", "ice", "-", "cold", "PBS", "containing", "0.05", "%", "saponin", ".", "They", "were", "incubated", "with", "20,000", "units", "/", "ml", "β", "-", "glucuronidase", "from", "bovine", "liver", "(", "Sigma", ")", "in", "50", "mM", "Hepes", "(", "pH", "7.5", ")", "containing", "150", "mM", "NaCl", ",", "5", "mM", "β", "-", "glycerophosphate", ",", "0.5", "%", "human", "serum", "albumin", ",", "0.5", "%", "saponin", "with", "or", "without", "10", "mM", "M6P", "overnight", "on", "ice", ".", "Cells", "were", "washed", "five", "times", "with", "ice", "-", "cold", "PBS", "containing", "0.05", "%", "saponin", "and", "sonicated", "in", "100", "mM", "sodium", "acetate", "(", "pH", "4.6", ")", ".", "The", "protein", "concentration", "of", "solubilized", "cell", "extract", "was", "measured", "and", "enzyme", "activity", "was", "assayed", "as", "follows", ":", "for", "each", "reaction", "50", "ul", "cell", "extract", "were", "added", "to", "500", "ul", "of", "100", "mM", "sodium", "acetate", "(", "pH", "4.0", ")", "containing", "1", "mM", "paranitrophenyl", "(", "PNP)-β", "-", "glucuronide", "(", "Sigma", ")", "as", "substrate", ".", "After", "an", "incubation", "period", "of", "3", "hours", "at", "37", "°", "C", ",", "500", "ul", "1", "M", "Na2CO3", "were", "added", "to", "each", "reaction", "and", "the", "absorbance", "was", "measured", "at", "400", "nm", ".", "Experimental", "values", "were", "compared", "to", "a", "standard", "curve", "that", "was", "constructed", "using", "1–100", "nM", "solutions", "of", "PNP", "(", "Sigma", ")", "in", "500", "ul", "100", "mM", "sodium", "acetate", "and", "500", "u1", "1", "M", "Na2CO3", ".", "Specific", "activity", "was", "calculated", "as", "nM", "of", "PNP", "produced", "/", "hour", "/", "mg", "of", "protein", ".", "\n\n", "Beta", "-", "glucuronidase", "endocytosis", "assay", "\n", "Beta", "-", "glucuronidase", "endocytosis", "assay", "was", "carried", "out", "as", "described", "previously", "[", "36", "]", ".", "Briefly", ",", "confluent", "cell", "cultures", "were", "washed", "twice", "with", "pre", "-", "warmed", "serum", "-", "free", "DMEM", "followed", "by", "incubation", "with", "DMEM", "containing", "5", "mg", "/", "ml", "human", "serum", "albumin", "and", "10", "mM", "M6P", "for", "20", "minutes", ".", "Following", "incubation", "cells", "were", "washed", "3", "times", "with", "pre", "-", "warmed", "DMEM", ".", "Cells", "were", "then", "incubated", "in", "DMEM", "containing", "5", "mg", "/", "ml", "human", "serum", "albumin", "alone", "or", "4000", "units", "β", "-", "glucuronidase", "with", "or", "without", "10", "mM", "M6P", "for", "2", "hours", "at", "37", "°", "C", ".", "Following", "the", "incubation", ",", "the", "cells", "were", "washed", "5", "times", "with", "ice", "-", "cold", "PBS", "and", "subjected", "to", "enzyme", "activity", "assay", "as", "described", "above", ".", "\n\n", "Cell", "proliferation", "assay", "(", "MTT", "assay", "and", "cell", "counts", ")", "\n", "Cardiac", "myocytes", "were", "grown", "in", "culture", "plates", "(", "tissue", "culture", "grade", ",", "12", "wells", ",", "flat", "bottom", ")", "in", "a", "final", "volume", "of", "1", "ml", "serum", "-", "containing", "culture", "medium", "per", "well", ",", "in", "a", "humidified", "atmosphere", "(", "37", "°", "C", "and", "5", "%", "C02", ")", "for", "3", "days", ".", "After", "infection", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "or", "Ad", "-", "GFP", ",", "cells", "were", "incubated", "with", "or", "without", "50", "ng", "/", "ml", "IGF", "-", "II", "for", "4", "days", ".", "Following", "supplementation", "with", "IGF", "-", "II", ",", "100", "μl", "MTT", "labeling", "reagent", "(", "Roche", ")", "were", "added", "to", "each", "well", "and", "cells", "were", "incubated", "for", "4", "hours", ",", "followed", "by", "addition", "of", "1", "ml", "solubilization", "solution", "into", "each", "well", ".", "The", "plate", "was", "placed", "in", "an", "incubator", "at", "37", "°", "C", "overnight", ".", "Spectrophotometrical", "absorbency", "of", "the", "samples", "was", "measured", "using", "an", "UV", "-", "visible", "Recording", "Spectrophotometer", "with", "wavelength", "of", "550–690", "nm", ".", "In", "addition", ",", "the", "total", "number", "of", "viable", "cells", "in", "each", "treatment", "was", "counted", "by", "trypan", "blue", "exclusion", "method", "using", "a", "hemocytometer", ".", "\n\n", "Induction", "and", "analysis", "of", "cell", "apoptosis", "\n", "Cells", "were", "infected", "with", "Ad", "-", "GFP", "or", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", ".", "Seventy", "-", "two", "hours", "post", "infection", ",", "cells", "were", "treated", "with", "TNF", "(", "0.1", "ng", "/", "ml", ")", "for", "24", "hrs", "or", "subjected", "to", "hypoxia", ".", "For", "induction", "of", "apoptosis", "by", "hypoxia", ",", "cell", "culture", "medium", "was", "changed", "to", "serum", "-", "free", "F-10", "saturated", "with", "95", "%", "N2/5", "%", "CO2", "and", "cells", "were", "placed", "in", "a", "37", "°", "C", "airtight", "box", "saturated", "with", "95", "%", "N2/5", "%", "CO2", "for", "24", "hrs", ".", "For", "normoxic", "controls", ",", "culture", "medium", "was", "changed", "to", "F-10/5%F", "BS/10", "%", "HS", "and", "cells", "were", "placed", "in", "a", "37", "°", "C/5", "%", "CO2", "incubator", "for", "24", "hrs", "before", "analysis", ".", "\n", "Apoptotic", "cells", "were", "identified", "by", "Hoechst", "staining", "using", "the", "Vybrant", "™", "Apoptosis", "Kit", "#", "5", "(", "Molecular", "Probes", ")", "according", "to", "the", "manufacturer", "'s", "protocol", ".", "In", "addition", ",", "after", "infection", "with", "Ad", "-", "GFP", "or", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "and", "challenge", "with", "either", "TNF", "or", "hypoxia", ",", "cell", "viability", "was", "assessed", "using", "the", "MTT", "assay", "Kit", "(", "Roche", "Molecular", "Biochemicals", ")", "and", "cell", "apoptosis", "was", "determined", "using", "the", "Cell", "Death", "Detection", "ELISA", "Kit", "assay", "(", "Roche", "Molecular", "Biochemicals", ")", "according", "to", "the", "manufacturer", "'s", "protocol", ".", "\n\n", "Statistical", "analysis", "\n", "Students", "'", "t", "-", "test", "was", "used", "to", "evaluate", "the", "difference", "between", "two", "values", ".", "Each", "experiment", "was", "repeated", "at", "least", "three", "times", ".", "Statistical", "significance", "was", "accepted", "at", "the", "level", "of", "p", "<", "0.05", ".", "\n\n\n", "List", "of", "abbreviations", "used", "\n", "Ad", "-", "GFP", ",", "adenovirus", "carrying", "GFP", "gene", ";", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", ",", "adenovirus", "carrying", "both", "the", "ribozyme", "against", "M6P", "/", "IGF2R", "and", "the", "GFP", "gene", ";", "GFP", ",", "green", "fluorescent", "protein", ";", "IGF", "-", "II", ",", "insulin", "-", "like", "growth", "factor", "II", ";", "M6P", "/", "IGF2R", ",", "mannose", "6-phosphate", "/", "insulin", "-", "like", "growth", "factor", "II", "receptor", ";", "Rz", ",", "ribozyme", ".", "\n\n", "Authors", "'", "contributions", "\n", "ZC", "carried", "out", "construction", "of", "the", "ribozyme", ",", "production", "of", "the", "viruses", ",", "cellular", "experiments", ",", "biochemical", "assays", "and", "data", "analysis", ".", "\n", "YG", "carried", "out", "the", "RPA", "assay", "and", "participated", "in", "the", "molecular", "biological", "studies", ".", "\n", "JXK", "conceived", "of", "the", "study", ",", "participated", "in", "its", "design", "and", "coordination", ",", "and", "drafted", "the", "manuscript", ".", "\n\n\n" ]
[ "species" ]
rat, rat, human, mice, rat, mice, mice, rat, rats, horse, rat, rat, human, bovine, human, human, human
84_task2
Sentence: Down-regulation of the M6P/IGF-II receptor increases cell proliferation and reduces apoptosis in neonatal rat cardiac myocytes Abstract Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a multi-functional protein that has been implicated in regulation of cell growth and apoptosis. Cardiac myocytes express relatively high levels of M6P/IGF2R, and cardiomyocyte apoptosis has been identified in a variety of cardiovascular disorders, such as myocardial infarction and heart failure. However, involvement of M6P/IGF2R in the pathogenesis of these conditions has not been determined. Thus, the objective of this study was to determine the role of M6P/IGF2R in regulation of cardiac myocyte growth and apoptosis. Results We down-regulated the expression of M6P/IGF2R in neonatal rat cardiac myocytes and examined the effect on cell proliferation and apoptosis. Infection of neonatal cardiomyocytes with an adenovirus expressing a ribozyme targeted against the M6P/IGF2R significantly reduced the level of M6P/IGF2R mRNA, as determined by RT-PCR and Ribonuclease Protection Assay (RPA). M6P-containing protein binding and endocytosis as well as the M6P/IGF2R-mediated internalization of 125I-IGF-II were lower in the ribozyme-treated cells than the control myocytes, indicating that the number of functional M6P/IGF2R in the ribozyme treated cells was reduced. Accordingly, a marked increase in cell proliferation and a reduced cell susceptibility to hypoxia- and TNF-induced apoptosis were observed in the ribozyme-treated cells. Conclusions These findings suggest that M6P/IGF2R may play a role in regulation of cardiac myocyte growth and apoptosis. Down regulation of this gene in cardiac tissues might be a new approach to prevention of cell death or promotion of mitogenesis for certain heart diseases. Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a unique protein that interacts with multiple ligands, some of which are important growth regulatory factors [1]. The M6P/IGF2R participates in internalization and lysosomal degradation of IGF-II, a mitogen normally acting through the IGF-I receptor to stimulate cell proliferation [2]. The M6P/IGF2 receptor is required for the activation of TGF-β [3], a potent growth inhibitor for many cell types. This receptor is also involved in the binding, transport and activation of newly-synthesized lysosomal enzymes, such as cathepsins [4,5], which have been recently implicated in the induction of apoptosis [6]. On the basis of these functions, the M6P/IGF2R has been proposed to play a significant role in regulation of cell growth and apoptosis [7]. Apoptosis, or programmed cell death, is a tightly regulated process used to remove excess, hazardous or damaged somatic cells, and is crucial for the development, maintenance and survival of an organism. However, alterations in the control of apoptosis have also been shown to contribute to human diseases. In fact, morphological and biochemical markers of apoptosis have been identified in a wide variety of cardiovascular disorders, including myocardial infarction and heart failure. This suggests that activation of apoptotic pathways contributes to cardiomyocyte loss and subsequent cardiac dysfunction in these conditions. A number of factors involved in cardiomyocyte apoptosis are currently known and include insulin-like growth factor-I (IGF-I), stress-activated protein kinases (SAPKs) and the anti-apoptotic Bcl-2 family [8]. There are indications that other factors may be involved in induction and regulation of cardiac apoptosis. However, these potential factors and their corresponding mechanisms have not been identified. Several lines of evidence point to the potential involvement of M6P/IGF2R in cardiac myocyte proliferation and apoptosis. Cardiac myocytes express relatively high levels of M6P/IGF2R and transgenic mice containing a homologous deletion of the M6P/IGF2R gene manifest ventricular hyperplasia due to an increase in cell number [9,10], suggesting that the M6P/IGF2R normally acts to suppress cardiac myocyte cell growth. It has also been shown that TGF-β, a potent growth suppressor whose activation requires the binding of latent TGF-β to M6P/IGF2R [3], is commonly upregulated in chronic heart failure [11]. Additional evidence for the involvement of M6P/IGF2R in regulation of apoptosis comes from studies of tumorigenesis. It has been shown that M6P/IGF2R expression is significantly reduced in a variety of tumors and loss of heterozygocity (LOH) at the M6P/IGF2R gene locus 6q26 have been found in breast, liver cancers and squamous cell carcinoma of the lung [12-15]. Although several studies have examined the effect of M6P/IGF2R over-expression on cell growth [7], it is not known whether down-regulation of this receptor protein leads to cellular protection against apoptosis. Ribozymes are catalytic RNA molecules that cleave a complementary mRNA sequence [16], thereby inactivating specific mRNAs and suppressing gene expression in vitro and in vivo [17,18]. Ribozymes have been shown to be highly specific, efficient and stable. They can be packaged into viral vectors to enhance transfer into cells and to achieve longer expression compared with naked oligonucleotides. In the present study, we employed ribozyme technology to study the role of M6P/IGF2R in regulation of cardiac myocyte cell growth. A hammerhead ribozyme against the M6P/IGF2R mRNA was constructed and packaged in an adenoviral vector. We then examined the effect of ribozyme-mediated down-regulation of M6P/IGF2R expression on cell growth and hypoxia- and TNF-induced apoptosis. Results Cleavage reaction of the ribozyme in vitro The M6P/IGF2R ribozyme we constructed has 13-bp binding arms complementary to the target site of M6P/IGF2R mRNA, and a catalytic core (Fig. 1A). To evaluate the bioactivity of the ribozyme and the accessibility of the target site, a cleavage reaction was performed in vitro. The substrates, [α-32P] labeled RNA transcripts containing 45 bp of M6P/IGF2R mRNA or an unmatched sequence, were incubated with the ribozyme as described (see Materials and Methods). The ribozyme cleaved only the specific M6P/IGF2R mRNA into the expected products. In the assay of time course, the hammerhead ribozyme was able to cleave 24.2% of the M6P/IGF2R target within 10 minutes of incubation, 50.3% of the M6P/IGF2R target within 40 minutes of incubation, and by 640 minutes, 80.8% of the M6P/IGF2R target was converted to the expected products (Fig. 1B). This ribozyme did not digest the unmatched sequence (Fig. 1B). These results indicate a high efficiency and specificity of the ribozyme in vitro. Ribozymes down-regulate M6P/IGF2R expression in cardiac myocytes To examine the ability of the ribozyme to reduce levels of M6P/IGF2R mRNA in cultured cardiac myocytes, total RNA was extracted from cells infected with Ad-GFP/IGF2R-Rz or Ad-GFP, and subjected to RT-PCR using M6P/IGF2R-specific primers. Primers specific for β-actin were added to a parallel reaction to serve as an internal standard. Cells were used 4 days after infection, with average infection efficiency of 70–80% (for which a viral dose used had minimal cytotoxicity). The RT-PCR product of M6P/IGF2R was 856 bp, and the β-actin product was 285 bp. As shown in Fig. 2A, the Ad-GFP/IGF2R-Rz-infected cells exhibited a significantly lower level of M6P/IGF2R mRNA than Ad-GFP-infected cells, with a reduction of about 50%. This result was confirmed by ribonuclease protection assay (RPA), in which GAPDH was used as a control (Fig. 2C &2D). There was no significant difference in the level of M6P/IGF2R mRNA between Ad-GFP-infected cells and uninfected cells (data not shown), indicating that infection with the adenovirus itself did not alter the endogenous M6P/IGF2R mRNA level. The results demonstrated that the ribozyme was highly effective in suppressing M6P/IGF2R expression in cultured cardiac myocytes. Effect of ribozyme expression on the functional activity of M6P/IGF2R To determine the effect of the ribozyme on the functional activity of M6P/IGF2R, binding and internalization of exogenous 125I-IGF-II was measured in cells infected with Ad-GFP/IGF2R-Rz. As shown in Fig. 3A, cells infected with Ad-GFP/IGF2R-Rz showed a 54% reduction in 125I-IGF-II internalization when compared with the control cells (infected with Ad-GFP). We also examined the effect of the ribozyme on the M6P-binding activity of the M6P/IGF2R using the M6P-bearing lysosomal enzyme, β-glucuronidase, as a probe. The results showed that the maximal M6P-binding capacity of cells treated with the ribozyme was about 50% less than that of controls (Fig. 3B). Furthermore, we assessed the ability of cells to internalize exogenous β-glucuronidase after treatment with ribozyme. Similarly, the M6P-inhibitable endocytosis of β-glucuronidase by ribozyme-treated cells was about 52% less than that of control cells (Fig. 3C). These results confirm that the number of functional M6P/IGF2R in ribozyme-treated cells was reduced. Adenoviral delivery of ribozymes increases the proliferation of cardiac myocytes We examined the effects of the ribozyme on the growth of cultured neonatal rat cardiac myocytes. Morphological evaluation showed a remarkable difference in growth pattern between Ad-GFP/IGF2R-Rz-infected cells and the control cells: the ribozyme-expressing cells formed larger and more spread colonies (Fig. 4). Assessment of cell proliferative activity by the MTT assay and counts of viable cells showed that the number of cardiac myocytes in ribozyme-expressing cultures was significantly higher than in control cultures (Fig. 5). These results indicate that treatment with M6P/IGF2R-ribozyme can promote cardiac myocyte proliferation. Effect of M6P/IGF2R-ribozyme expression on apoptosis of cardiac myocytes We examined the effects of ribozyme expression on TNF-α and hypoxia-induced apoptosis of cultured cardiac myocytes. After a 24 hr challenge with hypoxia, the number of apoptotic cells in M6P/IGF2R-Rz expressing cultures was 38% lower than in control cultures as determined by Hoechst staining (which highlights the nuclei of apoptotic cells) and ELISA (Fig. 6A, 7A). MTT analysis showed that the number of viable cells in ribozyme-treated cultures was 40% higher than in control cultures (Fig. 7A). After treatment with TNF-α, as shown in Fig. 6B, a large number of control cells underwent apoptosis, as indicated by morphological changes (small round shape) and bright blue nuclear staining. There were significantly more apoptotic cells in control cultures than in cultures expressing the Ad-GFP/IGF2R-Rz. The number of apoptotic cells, as measured by the cell death ELISA assay, in cultures infected with Ad-GFP/IGF2R-Rz was significantly (about 40%) lower than in cultures infected with Ad-GFP (Fig. 7B). Accordingly, the number of viable cells, as measured by MTT analysis, in cultures infected with Ad-GFP/IGF2R-Rz was significantly (about 45%) higher than in cultures infected with Ad-GFP (Fig. 7B). These results are consistent with the hypothesis that decreasing M6P/IGF2R expression by ribozyme treatment can reduce cell apoptosis. Discussion Some 62,000,000 Americans have one or more types of cardiovascular disease (CVD) and CVD is the leading cause (40.1%) of death in the United States. Myocardial infarction and heart failure, conditions accompanied by cardiac myocyte apoptosis, represent 23% of all CVDs and are a growing clinical challenge in need of novel therapeutic strategies. In this study, we investigated the M6P/IGF2R as a potential new therapeutic target for reduction of cardiac apoptosis and cardiac injury in these conditions. Using ribozyme technology we down-regulated the expression of the M6P/IGF2R in neonatal cardiac myocytes. We then examined cell proliferation and apoptosis under normal conditions and post challenge with either hypoxia, a model of ischemia-reperfusion, or TNF-α, a cytokine implicated in the pathogenesis of chronic heart failure [19]. Our results demonstrate an association of a decrease in the expression and function of the M6P/IGF2R with increased cell proliferation and decreased cell susceptibility to hypoxia- and TNF-induced apoptosis. Expression of the ribozyme targeted against the M6P/IGF2R in cardiomyocytes resulted in down-regulation of M6P/IGF2R expression, as measured by RT-PCR and RPA, and of M6P/IGF2R function, as indicated by a decrease in internalization of 125I-IGF-II, and β-glucuronidase binding and endocytosis. MTT analysis and viable cell counts showed that ribozyme-mediated down-regulation of M6P/IGF2R resulted in a marked increase in cell proliferation of cardiomyocytes, which normally express high levels of M6P/IGF2R [20] and have limited proliferative capabilities [21]. These results are consistent with the findings of previous knockout studies [9,10]. Since the M6P/IGF2R has multiple actions on cell growth, its proliferative effect on the heart cells observed in this study might involve multiple mechanisms. However, it is likely that unchecked IGF-II stimulation plays a key role in the effect. Because the M6P/IGF2R is believed to sequester and degrade IGF-II [2], a decrease in M6P/IGF2R expression and function could result in decreased degradation and hence increased bioavailability of IGF-II to the IGF-I receptor, which mediates the growth-promoting effect of IGF-II. Supporting evidence for the involvement of IGF-II in the proliferative effect resulting from loss of M6P/IGF2R function comes from studies of M6P/IGF2R knock-out mice. M6P/IGF2R-null mice display global hyperplasia that coincides with elevated levels of IGF-II. Most importantly, however, the lethal nature of an M6P/IGF2R-null phenotype is reversed in an IGF-II-null background [9]. Our results showing that ribozyme-mediated down-regulation of M6P/IGF2R lead to a decrease in IGF-II internalization support the above possibility. However, further investigation to confirm this mechanism is warranted. More importantly, our results also showed that M6P/IGF2R down-regulation resulted in decreased sensitivity of cardiomyocytes to hypoxia- and TNF-induced apoptosis. There is evidence that lysosomal enzymes, such as cathepsins B and D contribute to hypoxia- and TNF-induced apoptosis in vitro [22-25] and in vivo [26,27]. The M6P/IGF2R has been shown to be involved in binding, transport and activation of lysosomal enzymes, including cathepsins [4,5]. Therefore, it is possible that down-regulation of the M6P/IGF2R results in improper trafficking and activation of cathepsins. This, in turn would eliminate the apoptotic cascades triggered by these enzymes under hypoxia and TNF stimulation and result in decreased sensitivity of cardiomyocytes to apoptosis. It has also been shown that TNF stimulation involves the activation of TGF-β [28-30], a ligand of M6P/IGF2R that has been implicated in the progression of chronic heart failure [11,31]. Therefore, down-regulation of M6P/IGF2R expression could also lead to a decreased bioavailability of activated TGF-β, thereby decreasing the sensitivity of cardiomyocytes to the TNF/TGF-β apoptotic pathway. The detailed mechanism of the observed effects is unknown and requires further investigation. Conclusions The present study demonstrates that ribozyme-mediated down-regulation of expression and functional activity of the M6P/IGF2R results in a decrease in the susceptibility of cardiac myocytes to apoptotic stimuli. These findings suggest that this receptor might be involved in cardiac cell growth and apoptosis. The ability of the M6P/IGF2R ribozyme to reduce M6P/IGF2R expression and function in transfected cells verifies the utility of the ribozyme in studying the role of M6P/IGF2R in cardiomyocyte growth and apoptosis. In addition to its utility as a research tool, the ribozyme, with further exploration and development, might have potential application as a therapeutic agent to prevent cell death or promote mitogenesis for certain clinical conditions, such as, myocardial infarction and chronic heart failure. Methods Construction of recombinant M6P/IGF2R-RZ adenoviral vector The nucleotide numbers of the rat M6P/IGF2R sequence targeted by the hammerhead ribozyme is 1147–1160 after coding site (exon 9). The structure of the M6P/IGF2R hammerhead ribozyme is shown in Fig. 1. A 49 bp M6P/IGF2R ribozyme oligonucleotide, 5'-GAATTCCCC ACACTG ATGAGCCGCTTCGGCGGCGAAACATTCAAC GCGT-3' and the corresponding reverse complementary strand were synthesized. The fragments were subcloned to produce a plasmid containing a ribozyme against M6P/IGF2R. For construction of the recombinant adenovirus containing the M6P/IGF2R-ribozyme (pAd-GFP/IGF2R-Rz), the segments containing the ribozymes were amplified by PCR and cloned into a pAdTrack-CMV vector and then recombined homologously with an adenoviral backbone pAdEasy 1 vector to generate (pAd-GFP/IGF2R-Rz), following the protocol described by He et al. [32]. The pAd-GFP/IGF2R-Rz carries both the IGF2R-Rz and GFP (as reporter) genes, each under the control of separate cytomegalovirus (CMV) promoters. Another viral vector, pAd-GFP, which carries the GFP gene only under the control of the CMV promoter, was generated and used as a control vector. The adenoviral vector DNA were linerized with Pac I and transfected into the replication-permissive 293 cells (E1A transcomplementing cell line) by using Lipofectamine (Life Technologies) to produce E1-deleted, replication-defective recombinant adenovirus as described previously [33]. Large-scale amplification of recombinant adenovirus in 293 cells was followed by purification using a discontinuous CsCl gradient. The constructs were confirmed by enzymatic digestion and DNA sequencing. Transcription and cleavage reaction of ribozyme in vitro Plasmids containing the ribozyme or the substrate (either 45 bp of M6P/IGF2R mRNA or an unmatched sequence 5'-GTGCTGTCTGTATG-3') were linearized with MluI, respectively. All transcripts were generated with T7 RNA polymerase (Promega). Substrate transcripts were labeled by incorporation of [α-32P] UTP (NEN Life Science Products, Inc.). Specific activity of the [α-32P] UTP (10 μCi/μl) and the base composition of each substrate molecule were used to calculate the substrate concentration. Ribozyme transcripts were quantified spectrophotometrically. (The half-life of the M6P/IGF2R target is about 280 minutes). Cleavage reaction mixture contained substrate RNA (40 nM), increasing amounts of ribozyme (60 nM), 20 mM MgCl2 and 20 mM Tris-HCl, pH8.0, in a final volume of 10 μl. The mixture was incubated at 37°C for a time-course of cleavage reaction from 0, 5, 10, 20, 40, 80, 160, 320, to 640 minutes and the cleavage reaction was stopped by addition of loading buffer (80% formamide, 10 mM Na2EDTA, pH 8.0, and 1 mg/ml each bromophenol blue and xylene cyanol). Cleavage products were analyzed on a 15% polyacrylamide and 8M urea gel. Product and substrate fragments were quantitated by using NIH Imager. Cell cultures and infection with Ad-GFP/Rz-IGF2R and Ad-GFP Cardiac myocytes were isolated from 1-day-old newborn rats using the Neonatal Cardiomyocyte Isolation System (Worthington). The isolated cells were plated in 6-well plates and cultured in F-10 medium containing 5% (vol/vol) FBS and 10% (vol/vol) horse serum at 37°C in a tissue culture incubator with 5% CO2 and 98% relative humidity. Cells were used for experiments after 2–3 days of culture. Viral infections were carried out by adding viral particles at various concentrations (usually, 2 × 108 virus particles/ml) to culture medium containing 2% (vol/vol) FBS. Initially, optimal viral concentration was determined by using Ad-GFP to achieve an optimal balance of high gene expression and low viral titer to minimize cytotoxicity. After 24 hours of incubation, the infection medium was replaced with normal (15% vol/vol serum) culture medium. For treatment with IGF-II, cells were incubated with 50 ng/ml IGF-II after 24 hours infection with Ad-GFP/IGF2R-Rz or Ad-GFP. Four days after infection, cells were used for analysis of gene expression of M6P/IGF2R and its effect on cell growth and apoptosis. Analysis of gene expression in cardiac myocytes The M6P/IGF2R transcripts were determined by both RT-PCR and Ribonuclease Protection Assay (RPA). RT-PCR was performed using the GeneAmp EZ rTth RNA PCR kit (Roche). Total RNA was extracted from cultured cells using an RNA isolation kit (Qiagen,), according to the manufacturer's protocol. M6P/IGF2R transcripts were amplified using the primers (5'-GACAGGCTCGTTCTGACTTA-3') and (5'-CTTCCACTCTTATCCACAGC-3') specific to the M6P/IGF2R. Each RT-PCR assay was performed in triplicate and product levels varied by less than 3.2% for each RNA sample. Primers specific for β-actin cDNA were added to a parallel reaction to standardize for variations in PCR between samples. PCR products were resolved on a 1.0% agarose gel, visualized under UV light and quantitated using NIH Imager. RPA was performed using the RPA III kit (Ambion, Austin, TX). Briefly, total RNA was extracted from cultured cells using a total RNA isolation reagent (TRIzol, Gibco BRL) according to the manufacturer's protocol. The plasmid containing the rat M6P/IGF2R gene was linearized and used as a transcription template. Antisense RNA probes were transcribed in vitro using [33P]-UTP, T7 polymerase (Riboprobea System T7 kit, Promega), hybridized with the total RNA extracted from the rat cardiomyocytes, and digested with ribonuclease to remove non-hybridized RNA and probe. The protected RNA·RNA was resolved on a denaturing 5% sequence gel and subjected to autoradiography. A probe targeting the GAPDH gene was used as an internal control. Measurement of 125I-IGF-II internalization Cells were incubated at 37°C for 2 hrs in serum-free F-10 culture medium containing 125I-labeled IGF-II (0.5 ng/ml) with or without excess unlabeled IGF-II (2 μg/ml). Following the incubation, the cells were washed three times with ice-cold PBS, and cell-associated radioactivity was determined by a γ counter. Specific internalized 125I-IGF-II was calculated by subtracting the count of samples with excessive unlabeled IGF-II from that without unlabeled IGF-II, and normalized to protein contents. Beta-glucuronidase binding assay Binding of β-glucuronidase was assayed as described previously [34,35]. Briefly, cells were permeabilized with 0.25% saponin in 50 mM Hepes (pH 7.0), 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, and 10 mM mannose-6-phosphate (M6P) for 30 minutes on ice. The cells were washed three times with ice-cold PBS containing 0.05% saponin. They were incubated with 20,000 units/ml β-glucuronidase from bovine liver (Sigma) in 50 mM Hepes (pH 7.5) containing 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, 0.5% saponin with or without 10 mM M6P overnight on ice. Cells were washed five times with ice-cold PBS containing 0.05% saponin and sonicated in 100 mM sodium acetate (pH 4.6). The protein concentration of solubilized cell extract was measured and enzyme activity was assayed as follows: for each reaction 50 ul cell extract were added to 500 ul of 100 mM sodium acetate (pH 4.0) containing 1 mM paranitrophenyl (PNP)-β-glucuronide (Sigma) as substrate. After an incubation period of 3 hours at 37°C, 500 ul 1 M Na2CO3 were added to each reaction and the absorbance was measured at 400 nm. Experimental values were compared to a standard curve that was constructed using 1–100 nM solutions of PNP (Sigma) in 500 ul 100 mM sodium acetate and 500 u1 1 M Na2CO3. Specific activity was calculated as nM of PNP produced/hour/mg of protein. Beta-glucuronidase endocytosis assay Beta-glucuronidase endocytosis assay was carried out as described previously [36]. Briefly, confluent cell cultures were washed twice with pre-warmed serum-free DMEM followed by incubation with DMEM containing 5 mg/ml human serum albumin and 10 mM M6P for 20 minutes. Following incubation cells were washed 3 times with pre-warmed DMEM. Cells were then incubated in DMEM containing 5 mg/ml human serum albumin alone or 4000 units β-glucuronidase with or without 10 mM M6P for 2 hours at 37°C. Following the incubation, the cells were washed 5 times with ice-cold PBS and subjected to enzyme activity assay as described above. Cell proliferation assay (MTT assay and cell counts) Cardiac myocytes were grown in culture plates (tissue culture grade, 12 wells, flat bottom) in a final volume of 1 ml serum-containing culture medium per well, in a humidified atmosphere (37°C and 5% C02) for 3 days. After infection with Ad-GFP/IGF2R-Rz or Ad-GFP, cells were incubated with or without 50 ng/ml IGF-II for 4 days. Following supplementation with IGF-II, 100 μl MTT labeling reagent (Roche) were added to each well and cells were incubated for 4 hours, followed by addition of 1 ml solubilization solution into each well. The plate was placed in an incubator at 37°C overnight. Spectrophotometrical absorbency of the samples was measured using an UV-visible Recording Spectrophotometer with wavelength of 550–690 nm. In addition, the total number of viable cells in each treatment was counted by trypan blue exclusion method using a hemocytometer. Induction and analysis of cell apoptosis Cells were infected with Ad-GFP or Ad-GFP/IGF2R-Rz. Seventy-two hours post infection, cells were treated with TNF (0.1 ng/ml) for 24 hrs or subjected to hypoxia. For induction of apoptosis by hypoxia, cell culture medium was changed to serum-free F-10 saturated with 95% N2/5% CO2 and cells were placed in a 37°C airtight box saturated with 95% N2/5% CO2 for 24 hrs. For normoxic controls, culture medium was changed to F-10/5%F BS/10% HS and cells were placed in a 37°C/5% CO2 incubator for 24 hrs before analysis. Apoptotic cells were identified by Hoechst staining using the Vybrant™ Apoptosis Kit #5 (Molecular Probes) according to the manufacturer's protocol. In addition, after infection with Ad-GFP or Ad-GFP/IGF2R-Rz and challenge with either TNF or hypoxia, cell viability was assessed using the MTT assay Kit (Roche Molecular Biochemicals) and cell apoptosis was determined using the Cell Death Detection ELISA Kit assay (Roche Molecular Biochemicals) according to the manufacturer's protocol. Statistical analysis Students' t-test was used to evaluate the difference between two values. Each experiment was repeated at least three times. Statistical significance was accepted at the level of p < 0.05. List of abbreviations used Ad-GFP, adenovirus carrying GFP gene; Ad-GFP/IGF2R-Rz, adenovirus carrying both the ribozyme against M6P/IGF2R and the GFP gene; GFP, green fluorescent protein; IGF-II, insulin-like growth factor II; M6P/IGF2R, mannose 6-phosphate/insulin-like growth factor II receptor; Rz, ribozyme. Authors' contributions ZC carried out construction of the ribozyme, production of the viruses, cellular experiments, biochemical assays and data analysis. YG carried out the RPA assay and participated in the molecular biological studies. JXK conceived of the study, participated in its design and coordination, and drafted the manuscript. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Down-regulation of the M6P/IGF-II receptor increases cell proliferation and reduces apoptosis in neonatal rat cardiac myocytes Abstract Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a multi-functional protein that has been implicated in regulation of cell growth and apoptosis. Cardiac myocytes express relatively high levels of M6P/IGF2R, and cardiomyocyte apoptosis has been identified in a variety of cardiovascular disorders, such as myocardial infarction and heart failure. However, involvement of M6P/IGF2R in the pathogenesis of these conditions has not been determined. Thus, the objective of this study was to determine the role of M6P/IGF2R in regulation of cardiac myocyte growth and apoptosis. Results We down-regulated the expression of M6P/IGF2R in neonatal rat cardiac myocytes and examined the effect on cell proliferation and apoptosis. Infection of neonatal cardiomyocytes with an adenovirus expressing a ribozyme targeted against the M6P/IGF2R significantly reduced the level of M6P/IGF2R mRNA, as determined by RT-PCR and Ribonuclease Protection Assay (RPA). M6P-containing protein binding and endocytosis as well as the M6P/IGF2R-mediated internalization of 125I-IGF-II were lower in the ribozyme-treated cells than the control myocytes, indicating that the number of functional M6P/IGF2R in the ribozyme treated cells was reduced. Accordingly, a marked increase in cell proliferation and a reduced cell susceptibility to hypoxia- and TNF-induced apoptosis were observed in the ribozyme-treated cells. Conclusions These findings suggest that M6P/IGF2R may play a role in regulation of cardiac myocyte growth and apoptosis. Down regulation of this gene in cardiac tissues might be a new approach to prevention of cell death or promotion of mitogenesis for certain heart diseases. Background The mannose 6-phosphate/insulin-like growth factor-II receptor (M6P/IGF2R) is a unique protein that interacts with multiple ligands, some of which are important growth regulatory factors [1]. The M6P/IGF2R participates in internalization and lysosomal degradation of IGF-II, a mitogen normally acting through the IGF-I receptor to stimulate cell proliferation [2]. The M6P/IGF2 receptor is required for the activation of TGF-β [3], a potent growth inhibitor for many cell types. This receptor is also involved in the binding, transport and activation of newly-synthesized lysosomal enzymes, such as cathepsins [4,5], which have been recently implicated in the induction of apoptosis [6]. On the basis of these functions, the M6P/IGF2R has been proposed to play a significant role in regulation of cell growth and apoptosis [7]. Apoptosis, or programmed cell death, is a tightly regulated process used to remove excess, hazardous or damaged somatic cells, and is crucial for the development, maintenance and survival of an organism. However, alterations in the control of apoptosis have also been shown to contribute to human diseases. In fact, morphological and biochemical markers of apoptosis have been identified in a wide variety of cardiovascular disorders, including myocardial infarction and heart failure. This suggests that activation of apoptotic pathways contributes to cardiomyocyte loss and subsequent cardiac dysfunction in these conditions. A number of factors involved in cardiomyocyte apoptosis are currently known and include insulin-like growth factor-I (IGF-I), stress-activated protein kinases (SAPKs) and the anti-apoptotic Bcl-2 family [8]. There are indications that other factors may be involved in induction and regulation of cardiac apoptosis. However, these potential factors and their corresponding mechanisms have not been identified. Several lines of evidence point to the potential involvement of M6P/IGF2R in cardiac myocyte proliferation and apoptosis. Cardiac myocytes express relatively high levels of M6P/IGF2R and transgenic mice containing a homologous deletion of the M6P/IGF2R gene manifest ventricular hyperplasia due to an increase in cell number [9,10], suggesting that the M6P/IGF2R normally acts to suppress cardiac myocyte cell growth. It has also been shown that TGF-β, a potent growth suppressor whose activation requires the binding of latent TGF-β to M6P/IGF2R [3], is commonly upregulated in chronic heart failure [11]. Additional evidence for the involvement of M6P/IGF2R in regulation of apoptosis comes from studies of tumorigenesis. It has been shown that M6P/IGF2R expression is significantly reduced in a variety of tumors and loss of heterozygocity (LOH) at the M6P/IGF2R gene locus 6q26 have been found in breast, liver cancers and squamous cell carcinoma of the lung [12-15]. Although several studies have examined the effect of M6P/IGF2R over-expression on cell growth [7], it is not known whether down-regulation of this receptor protein leads to cellular protection against apoptosis. Ribozymes are catalytic RNA molecules that cleave a complementary mRNA sequence [16], thereby inactivating specific mRNAs and suppressing gene expression in vitro and in vivo [17,18]. Ribozymes have been shown to be highly specific, efficient and stable. They can be packaged into viral vectors to enhance transfer into cells and to achieve longer expression compared with naked oligonucleotides. In the present study, we employed ribozyme technology to study the role of M6P/IGF2R in regulation of cardiac myocyte cell growth. A hammerhead ribozyme against the M6P/IGF2R mRNA was constructed and packaged in an adenoviral vector. We then examined the effect of ribozyme-mediated down-regulation of M6P/IGF2R expression on cell growth and hypoxia- and TNF-induced apoptosis. Results Cleavage reaction of the ribozyme in vitro The M6P/IGF2R ribozyme we constructed has 13-bp binding arms complementary to the target site of M6P/IGF2R mRNA, and a catalytic core (Fig. 1A). To evaluate the bioactivity of the ribozyme and the accessibility of the target site, a cleavage reaction was performed in vitro. The substrates, [α-32P] labeled RNA transcripts containing 45 bp of M6P/IGF2R mRNA or an unmatched sequence, were incubated with the ribozyme as described (see Materials and Methods). The ribozyme cleaved only the specific M6P/IGF2R mRNA into the expected products. In the assay of time course, the hammerhead ribozyme was able to cleave 24.2% of the M6P/IGF2R target within 10 minutes of incubation, 50.3% of the M6P/IGF2R target within 40 minutes of incubation, and by 640 minutes, 80.8% of the M6P/IGF2R target was converted to the expected products (Fig. 1B). This ribozyme did not digest the unmatched sequence (Fig. 1B). These results indicate a high efficiency and specificity of the ribozyme in vitro. Ribozymes down-regulate M6P/IGF2R expression in cardiac myocytes To examine the ability of the ribozyme to reduce levels of M6P/IGF2R mRNA in cultured cardiac myocytes, total RNA was extracted from cells infected with Ad-GFP/IGF2R-Rz or Ad-GFP, and subjected to RT-PCR using M6P/IGF2R-specific primers. Primers specific for β-actin were added to a parallel reaction to serve as an internal standard. Cells were used 4 days after infection, with average infection efficiency of 70–80% (for which a viral dose used had minimal cytotoxicity). The RT-PCR product of M6P/IGF2R was 856 bp, and the β-actin product was 285 bp. As shown in Fig. 2A, the Ad-GFP/IGF2R-Rz-infected cells exhibited a significantly lower level of M6P/IGF2R mRNA than Ad-GFP-infected cells, with a reduction of about 50%. This result was confirmed by ribonuclease protection assay (RPA), in which GAPDH was used as a control (Fig. 2C &2D). There was no significant difference in the level of M6P/IGF2R mRNA between Ad-GFP-infected cells and uninfected cells (data not shown), indicating that infection with the adenovirus itself did not alter the endogenous M6P/IGF2R mRNA level. The results demonstrated that the ribozyme was highly effective in suppressing M6P/IGF2R expression in cultured cardiac myocytes. Effect of ribozyme expression on the functional activity of M6P/IGF2R To determine the effect of the ribozyme on the functional activity of M6P/IGF2R, binding and internalization of exogenous 125I-IGF-II was measured in cells infected with Ad-GFP/IGF2R-Rz. As shown in Fig. 3A, cells infected with Ad-GFP/IGF2R-Rz showed a 54% reduction in 125I-IGF-II internalization when compared with the control cells (infected with Ad-GFP). We also examined the effect of the ribozyme on the M6P-binding activity of the M6P/IGF2R using the M6P-bearing lysosomal enzyme, β-glucuronidase, as a probe. The results showed that the maximal M6P-binding capacity of cells treated with the ribozyme was about 50% less than that of controls (Fig. 3B). Furthermore, we assessed the ability of cells to internalize exogenous β-glucuronidase after treatment with ribozyme. Similarly, the M6P-inhibitable endocytosis of β-glucuronidase by ribozyme-treated cells was about 52% less than that of control cells (Fig. 3C). These results confirm that the number of functional M6P/IGF2R in ribozyme-treated cells was reduced. Adenoviral delivery of ribozymes increases the proliferation of cardiac myocytes We examined the effects of the ribozyme on the growth of cultured neonatal rat cardiac myocytes. Morphological evaluation showed a remarkable difference in growth pattern between Ad-GFP/IGF2R-Rz-infected cells and the control cells: the ribozyme-expressing cells formed larger and more spread colonies (Fig. 4). Assessment of cell proliferative activity by the MTT assay and counts of viable cells showed that the number of cardiac myocytes in ribozyme-expressing cultures was significantly higher than in control cultures (Fig. 5). These results indicate that treatment with M6P/IGF2R-ribozyme can promote cardiac myocyte proliferation. Effect of M6P/IGF2R-ribozyme expression on apoptosis of cardiac myocytes We examined the effects of ribozyme expression on TNF-α and hypoxia-induced apoptosis of cultured cardiac myocytes. After a 24 hr challenge with hypoxia, the number of apoptotic cells in M6P/IGF2R-Rz expressing cultures was 38% lower than in control cultures as determined by Hoechst staining (which highlights the nuclei of apoptotic cells) and ELISA (Fig. 6A, 7A). MTT analysis showed that the number of viable cells in ribozyme-treated cultures was 40% higher than in control cultures (Fig. 7A). After treatment with TNF-α, as shown in Fig. 6B, a large number of control cells underwent apoptosis, as indicated by morphological changes (small round shape) and bright blue nuclear staining. There were significantly more apoptotic cells in control cultures than in cultures expressing the Ad-GFP/IGF2R-Rz. The number of apoptotic cells, as measured by the cell death ELISA assay, in cultures infected with Ad-GFP/IGF2R-Rz was significantly (about 40%) lower than in cultures infected with Ad-GFP (Fig. 7B). Accordingly, the number of viable cells, as measured by MTT analysis, in cultures infected with Ad-GFP/IGF2R-Rz was significantly (about 45%) higher than in cultures infected with Ad-GFP (Fig. 7B). These results are consistent with the hypothesis that decreasing M6P/IGF2R expression by ribozyme treatment can reduce cell apoptosis. Discussion Some 62,000,000 Americans have one or more types of cardiovascular disease (CVD) and CVD is the leading cause (40.1%) of death in the United States. Myocardial infarction and heart failure, conditions accompanied by cardiac myocyte apoptosis, represent 23% of all CVDs and are a growing clinical challenge in need of novel therapeutic strategies. In this study, we investigated the M6P/IGF2R as a potential new therapeutic target for reduction of cardiac apoptosis and cardiac injury in these conditions. Using ribozyme technology we down-regulated the expression of the M6P/IGF2R in neonatal cardiac myocytes. We then examined cell proliferation and apoptosis under normal conditions and post challenge with either hypoxia, a model of ischemia-reperfusion, or TNF-α, a cytokine implicated in the pathogenesis of chronic heart failure [19]. Our results demonstrate an association of a decrease in the expression and function of the M6P/IGF2R with increased cell proliferation and decreased cell susceptibility to hypoxia- and TNF-induced apoptosis. Expression of the ribozyme targeted against the M6P/IGF2R in cardiomyocytes resulted in down-regulation of M6P/IGF2R expression, as measured by RT-PCR and RPA, and of M6P/IGF2R function, as indicated by a decrease in internalization of 125I-IGF-II, and β-glucuronidase binding and endocytosis. MTT analysis and viable cell counts showed that ribozyme-mediated down-regulation of M6P/IGF2R resulted in a marked increase in cell proliferation of cardiomyocytes, which normally express high levels of M6P/IGF2R [20] and have limited proliferative capabilities [21]. These results are consistent with the findings of previous knockout studies [9,10]. Since the M6P/IGF2R has multiple actions on cell growth, its proliferative effect on the heart cells observed in this study might involve multiple mechanisms. However, it is likely that unchecked IGF-II stimulation plays a key role in the effect. Because the M6P/IGF2R is believed to sequester and degrade IGF-II [2], a decrease in M6P/IGF2R expression and function could result in decreased degradation and hence increased bioavailability of IGF-II to the IGF-I receptor, which mediates the growth-promoting effect of IGF-II. Supporting evidence for the involvement of IGF-II in the proliferative effect resulting from loss of M6P/IGF2R function comes from studies of M6P/IGF2R knock-out mice. M6P/IGF2R-null mice display global hyperplasia that coincides with elevated levels of IGF-II. Most importantly, however, the lethal nature of an M6P/IGF2R-null phenotype is reversed in an IGF-II-null background [9]. Our results showing that ribozyme-mediated down-regulation of M6P/IGF2R lead to a decrease in IGF-II internalization support the above possibility. However, further investigation to confirm this mechanism is warranted. More importantly, our results also showed that M6P/IGF2R down-regulation resulted in decreased sensitivity of cardiomyocytes to hypoxia- and TNF-induced apoptosis. There is evidence that lysosomal enzymes, such as cathepsins B and D contribute to hypoxia- and TNF-induced apoptosis in vitro [22-25] and in vivo [26,27]. The M6P/IGF2R has been shown to be involved in binding, transport and activation of lysosomal enzymes, including cathepsins [4,5]. Therefore, it is possible that down-regulation of the M6P/IGF2R results in improper trafficking and activation of cathepsins. This, in turn would eliminate the apoptotic cascades triggered by these enzymes under hypoxia and TNF stimulation and result in decreased sensitivity of cardiomyocytes to apoptosis. It has also been shown that TNF stimulation involves the activation of TGF-β [28-30], a ligand of M6P/IGF2R that has been implicated in the progression of chronic heart failure [11,31]. Therefore, down-regulation of M6P/IGF2R expression could also lead to a decreased bioavailability of activated TGF-β, thereby decreasing the sensitivity of cardiomyocytes to the TNF/TGF-β apoptotic pathway. The detailed mechanism of the observed effects is unknown and requires further investigation. Conclusions The present study demonstrates that ribozyme-mediated down-regulation of expression and functional activity of the M6P/IGF2R results in a decrease in the susceptibility of cardiac myocytes to apoptotic stimuli. These findings suggest that this receptor might be involved in cardiac cell growth and apoptosis. The ability of the M6P/IGF2R ribozyme to reduce M6P/IGF2R expression and function in transfected cells verifies the utility of the ribozyme in studying the role of M6P/IGF2R in cardiomyocyte growth and apoptosis. In addition to its utility as a research tool, the ribozyme, with further exploration and development, might have potential application as a therapeutic agent to prevent cell death or promote mitogenesis for certain clinical conditions, such as, myocardial infarction and chronic heart failure. Methods Construction of recombinant M6P/IGF2R-RZ adenoviral vector The nucleotide numbers of the rat M6P/IGF2R sequence targeted by the hammerhead ribozyme is 1147–1160 after coding site (exon 9). The structure of the M6P/IGF2R hammerhead ribozyme is shown in Fig. 1. A 49 bp M6P/IGF2R ribozyme oligonucleotide, 5'-GAATTCCCC ACACTG ATGAGCCGCTTCGGCGGCGAAACATTCAAC GCGT-3' and the corresponding reverse complementary strand were synthesized. The fragments were subcloned to produce a plasmid containing a ribozyme against M6P/IGF2R. For construction of the recombinant adenovirus containing the M6P/IGF2R-ribozyme (pAd-GFP/IGF2R-Rz), the segments containing the ribozymes were amplified by PCR and cloned into a pAdTrack-CMV vector and then recombined homologously with an adenoviral backbone pAdEasy 1 vector to generate (pAd-GFP/IGF2R-Rz), following the protocol described by He et al. [32]. The pAd-GFP/IGF2R-Rz carries both the IGF2R-Rz and GFP (as reporter) genes, each under the control of separate cytomegalovirus (CMV) promoters. Another viral vector, pAd-GFP, which carries the GFP gene only under the control of the CMV promoter, was generated and used as a control vector. The adenoviral vector DNA were linerized with Pac I and transfected into the replication-permissive 293 cells (E1A transcomplementing cell line) by using Lipofectamine (Life Technologies) to produce E1-deleted, replication-defective recombinant adenovirus as described previously [33]. Large-scale amplification of recombinant adenovirus in 293 cells was followed by purification using a discontinuous CsCl gradient. The constructs were confirmed by enzymatic digestion and DNA sequencing. Transcription and cleavage reaction of ribozyme in vitro Plasmids containing the ribozyme or the substrate (either 45 bp of M6P/IGF2R mRNA or an unmatched sequence 5'-GTGCTGTCTGTATG-3') were linearized with MluI, respectively. All transcripts were generated with T7 RNA polymerase (Promega). Substrate transcripts were labeled by incorporation of [α-32P] UTP (NEN Life Science Products, Inc.). Specific activity of the [α-32P] UTP (10 μCi/μl) and the base composition of each substrate molecule were used to calculate the substrate concentration. Ribozyme transcripts were quantified spectrophotometrically. (The half-life of the M6P/IGF2R target is about 280 minutes). Cleavage reaction mixture contained substrate RNA (40 nM), increasing amounts of ribozyme (60 nM), 20 mM MgCl2 and 20 mM Tris-HCl, pH8.0, in a final volume of 10 μl. The mixture was incubated at 37°C for a time-course of cleavage reaction from 0, 5, 10, 20, 40, 80, 160, 320, to 640 minutes and the cleavage reaction was stopped by addition of loading buffer (80% formamide, 10 mM Na2EDTA, pH 8.0, and 1 mg/ml each bromophenol blue and xylene cyanol). Cleavage products were analyzed on a 15% polyacrylamide and 8M urea gel. Product and substrate fragments were quantitated by using NIH Imager. Cell cultures and infection with Ad-GFP/Rz-IGF2R and Ad-GFP Cardiac myocytes were isolated from 1-day-old newborn rats using the Neonatal Cardiomyocyte Isolation System (Worthington). The isolated cells were plated in 6-well plates and cultured in F-10 medium containing 5% (vol/vol) FBS and 10% (vol/vol) horse serum at 37°C in a tissue culture incubator with 5% CO2 and 98% relative humidity. Cells were used for experiments after 2–3 days of culture. Viral infections were carried out by adding viral particles at various concentrations (usually, 2 × 108 virus particles/ml) to culture medium containing 2% (vol/vol) FBS. Initially, optimal viral concentration was determined by using Ad-GFP to achieve an optimal balance of high gene expression and low viral titer to minimize cytotoxicity. After 24 hours of incubation, the infection medium was replaced with normal (15% vol/vol serum) culture medium. For treatment with IGF-II, cells were incubated with 50 ng/ml IGF-II after 24 hours infection with Ad-GFP/IGF2R-Rz or Ad-GFP. Four days after infection, cells were used for analysis of gene expression of M6P/IGF2R and its effect on cell growth and apoptosis. Analysis of gene expression in cardiac myocytes The M6P/IGF2R transcripts were determined by both RT-PCR and Ribonuclease Protection Assay (RPA). RT-PCR was performed using the GeneAmp EZ rTth RNA PCR kit (Roche). Total RNA was extracted from cultured cells using an RNA isolation kit (Qiagen,), according to the manufacturer's protocol. M6P/IGF2R transcripts were amplified using the primers (5'-GACAGGCTCGTTCTGACTTA-3') and (5'-CTTCCACTCTTATCCACAGC-3') specific to the M6P/IGF2R. Each RT-PCR assay was performed in triplicate and product levels varied by less than 3.2% for each RNA sample. Primers specific for β-actin cDNA were added to a parallel reaction to standardize for variations in PCR between samples. PCR products were resolved on a 1.0% agarose gel, visualized under UV light and quantitated using NIH Imager. RPA was performed using the RPA III kit (Ambion, Austin, TX). Briefly, total RNA was extracted from cultured cells using a total RNA isolation reagent (TRIzol, Gibco BRL) according to the manufacturer's protocol. The plasmid containing the rat M6P/IGF2R gene was linearized and used as a transcription template. Antisense RNA probes were transcribed in vitro using [33P]-UTP, T7 polymerase (Riboprobea System T7 kit, Promega), hybridized with the total RNA extracted from the rat cardiomyocytes, and digested with ribonuclease to remove non-hybridized RNA and probe. The protected RNA·RNA was resolved on a denaturing 5% sequence gel and subjected to autoradiography. A probe targeting the GAPDH gene was used as an internal control. Measurement of 125I-IGF-II internalization Cells were incubated at 37°C for 2 hrs in serum-free F-10 culture medium containing 125I-labeled IGF-II (0.5 ng/ml) with or without excess unlabeled IGF-II (2 μg/ml). Following the incubation, the cells were washed three times with ice-cold PBS, and cell-associated radioactivity was determined by a γ counter. Specific internalized 125I-IGF-II was calculated by subtracting the count of samples with excessive unlabeled IGF-II from that without unlabeled IGF-II, and normalized to protein contents. Beta-glucuronidase binding assay Binding of β-glucuronidase was assayed as described previously [34,35]. Briefly, cells were permeabilized with 0.25% saponin in 50 mM Hepes (pH 7.0), 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, and 10 mM mannose-6-phosphate (M6P) for 30 minutes on ice. The cells were washed three times with ice-cold PBS containing 0.05% saponin. They were incubated with 20,000 units/ml β-glucuronidase from bovine liver (Sigma) in 50 mM Hepes (pH 7.5) containing 150 mM NaCl, 5 mM β-glycerophosphate, 0.5% human serum albumin, 0.5% saponin with or without 10 mM M6P overnight on ice. Cells were washed five times with ice-cold PBS containing 0.05% saponin and sonicated in 100 mM sodium acetate (pH 4.6). The protein concentration of solubilized cell extract was measured and enzyme activity was assayed as follows: for each reaction 50 ul cell extract were added to 500 ul of 100 mM sodium acetate (pH 4.0) containing 1 mM paranitrophenyl (PNP)-β-glucuronide (Sigma) as substrate. After an incubation period of 3 hours at 37°C, 500 ul 1 M Na2CO3 were added to each reaction and the absorbance was measured at 400 nm. Experimental values were compared to a standard curve that was constructed using 1–100 nM solutions of PNP (Sigma) in 500 ul 100 mM sodium acetate and 500 u1 1 M Na2CO3. Specific activity was calculated as nM of PNP produced/hour/mg of protein. Beta-glucuronidase endocytosis assay Beta-glucuronidase endocytosis assay was carried out as described previously [36]. Briefly, confluent cell cultures were washed twice with pre-warmed serum-free DMEM followed by incubation with DMEM containing 5 mg/ml human serum albumin and 10 mM M6P for 20 minutes. Following incubation cells were washed 3 times with pre-warmed DMEM. Cells were then incubated in DMEM containing 5 mg/ml human serum albumin alone or 4000 units β-glucuronidase with or without 10 mM M6P for 2 hours at 37°C. Following the incubation, the cells were washed 5 times with ice-cold PBS and subjected to enzyme activity assay as described above. Cell proliferation assay (MTT assay and cell counts) Cardiac myocytes were grown in culture plates (tissue culture grade, 12 wells, flat bottom) in a final volume of 1 ml serum-containing culture medium per well, in a humidified atmosphere (37°C and 5% C02) for 3 days. After infection with Ad-GFP/IGF2R-Rz or Ad-GFP, cells were incubated with or without 50 ng/ml IGF-II for 4 days. Following supplementation with IGF-II, 100 μl MTT labeling reagent (Roche) were added to each well and cells were incubated for 4 hours, followed by addition of 1 ml solubilization solution into each well. The plate was placed in an incubator at 37°C overnight. Spectrophotometrical absorbency of the samples was measured using an UV-visible Recording Spectrophotometer with wavelength of 550–690 nm. In addition, the total number of viable cells in each treatment was counted by trypan blue exclusion method using a hemocytometer. Induction and analysis of cell apoptosis Cells were infected with Ad-GFP or Ad-GFP/IGF2R-Rz. Seventy-two hours post infection, cells were treated with TNF (0.1 ng/ml) for 24 hrs or subjected to hypoxia. For induction of apoptosis by hypoxia, cell culture medium was changed to serum-free F-10 saturated with 95% N2/5% CO2 and cells were placed in a 37°C airtight box saturated with 95% N2/5% CO2 for 24 hrs. For normoxic controls, culture medium was changed to F-10/5%F BS/10% HS and cells were placed in a 37°C/5% CO2 incubator for 24 hrs before analysis. Apoptotic cells were identified by Hoechst staining using the Vybrant™ Apoptosis Kit #5 (Molecular Probes) according to the manufacturer's protocol. In addition, after infection with Ad-GFP or Ad-GFP/IGF2R-Rz and challenge with either TNF or hypoxia, cell viability was assessed using the MTT assay Kit (Roche Molecular Biochemicals) and cell apoptosis was determined using the Cell Death Detection ELISA Kit assay (Roche Molecular Biochemicals) according to the manufacturer's protocol. Statistical analysis Students' t-test was used to evaluate the difference between two values. Each experiment was repeated at least three times. Statistical significance was accepted at the level of p < 0.05. List of abbreviations used Ad-GFP, adenovirus carrying GFP gene; Ad-GFP/IGF2R-Rz, adenovirus carrying both the ribozyme against M6P/IGF2R and the GFP gene; GFP, green fluorescent protein; IGF-II, insulin-like growth factor II; M6P/IGF2R, mannose 6-phosphate/insulin-like growth factor II receptor; Rz, ribozyme. Authors' contributions ZC carried out construction of the ribozyme, production of the viruses, cellular experiments, biochemical assays and data analysis. YG carried out the RPA assay and participated in the molecular biological studies. JXK conceived of the study, participated in its design and coordination, and drafted the manuscript.
[ "Down", "-", "regulation", "of", "the", "M6P", "/", "IGF", "-", "II", "receptor", "increases", "cell", "proliferation", "and", "reduces", "apoptosis", "in", "neonatal", "rat", "cardiac", "myocytes", "\n", "Abstract", "\n", "Background", "\n", "The", "mannose", "6-phosphate", "/", "insulin", "-", "like", "growth", "factor", "-", "II", "receptor", "(", "M6P", "/", "IGF2R", ")", "is", "a", "multi", "-", "functional", "protein", "that", "has", "been", "implicated", "in", "regulation", "of", "cell", "growth", "and", "apoptosis", ".", "Cardiac", "myocytes", "express", "relatively", "high", "levels", "of", "M6P", "/", "IGF2R", ",", "and", "cardiomyocyte", "apoptosis", "has", "been", "identified", "in", "a", "variety", "of", "cardiovascular", "disorders", ",", "such", "as", "myocardial", "infarction", "and", "heart", "failure", ".", "However", ",", "involvement", "of", "M6P", "/", "IGF2R", "in", "the", "pathogenesis", "of", "these", "conditions", "has", "not", "been", "determined", ".", "Thus", ",", "the", "objective", "of", "this", "study", "was", "to", "determine", "the", "role", "of", "M6P", "/", "IGF2R", "in", "regulation", "of", "cardiac", "myocyte", "growth", "and", "apoptosis", ".", "\n\n", "Results", "\n", "We", "down", "-", "regulated", "the", "expression", "of", "M6P", "/", "IGF2R", "in", "neonatal", "rat", "cardiac", "myocytes", "and", "examined", "the", "effect", "on", "cell", "proliferation", "and", "apoptosis", ".", "Infection", "of", "neonatal", "cardiomyocytes", "with", "an", "adenovirus", "expressing", "a", "ribozyme", "targeted", "against", "the", "M6P", "/", "IGF2R", "significantly", "reduced", "the", "level", "of", "M6P", "/", "IGF2R", "mRNA", ",", "as", "determined", "by", "RT", "-", "PCR", "and", "Ribonuclease", "Protection", "Assay", "(", "RPA", ")", ".", "M6P", "-", "containing", "protein", "binding", "and", "endocytosis", "as", "well", "as", "the", "M6P", "/", "IGF2R", "-", "mediated", "internalization", "of", "125I", "-", "IGF", "-", "II", "were", "lower", "in", "the", "ribozyme", "-", "treated", "cells", "than", "the", "control", "myocytes", ",", "indicating", "that", "the", "number", "of", "functional", "M6P", "/", "IGF2R", "in", "the", "ribozyme", "treated", "cells", "was", "reduced", ".", "Accordingly", ",", "a", "marked", "increase", "in", "cell", "proliferation", "and", "a", "reduced", "cell", "susceptibility", "to", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", "were", "observed", "in", "the", "ribozyme", "-", "treated", "cells", ".", "\n\n", "Conclusions", "\n", "These", "findings", "suggest", "that", "M6P", "/", "IGF2R", "may", "play", "a", "role", "in", "regulation", "of", "cardiac", "myocyte", "growth", "and", "apoptosis", ".", "Down", "regulation", "of", "this", "gene", "in", "cardiac", "tissues", "might", "be", "a", "new", "approach", "to", "prevention", "of", "cell", "death", "or", "promotion", "of", "mitogenesis", "for", "certain", "heart", "diseases", ".", "\n\n\n\n", "Background", "\n", "The", "mannose", "6-phosphate", "/", "insulin", "-", "like", "growth", "factor", "-", "II", "receptor", "(", "M6P", "/", "IGF2R", ")", "is", "a", "unique", "protein", "that", "interacts", "with", "multiple", "ligands", ",", "some", "of", "which", "are", "important", "growth", "regulatory", "factors", "[", "1", "]", ".", "The", "M6P", "/", "IGF2R", "participates", "in", "internalization", "and", "lysosomal", "degradation", "of", "IGF", "-", "II", ",", "a", "mitogen", "normally", "acting", "through", "the", "IGF", "-", "I", "receptor", "to", "stimulate", "cell", "proliferation", "[", "2", "]", ".", "The", "M6P", "/", "IGF2", "receptor", "is", "required", "for", "the", "activation", "of", "TGF", "-", "β", "[", "3", "]", ",", "a", "potent", "growth", "inhibitor", "for", "many", "cell", "types", ".", "This", "receptor", "is", "also", "involved", "in", "the", "binding", ",", "transport", "and", "activation", "of", "newly", "-", "synthesized", "lysosomal", "enzymes", ",", "such", "as", "cathepsins", "[", "4,5", "]", ",", "which", "have", "been", "recently", "implicated", "in", "the", "induction", "of", "apoptosis", "[", "6", "]", ".", "On", "the", "basis", "of", "these", "functions", ",", "the", "M6P", "/", "IGF2R", "has", "been", "proposed", "to", "play", "a", "significant", "role", "in", "regulation", "of", "cell", "growth", "and", "apoptosis", "[", "7", "]", ".", "\n", "Apoptosis", ",", "or", "programmed", "cell", "death", ",", "is", "a", "tightly", "regulated", "process", "used", "to", "remove", "excess", ",", "hazardous", "or", "damaged", "somatic", "cells", ",", "and", "is", "crucial", "for", "the", "development", ",", "maintenance", "and", "survival", "of", "an", "organism", ".", "However", ",", "alterations", "in", "the", "control", "of", "apoptosis", "have", "also", "been", "shown", "to", "contribute", "to", "human", "diseases", ".", "In", "fact", ",", "morphological", "and", "biochemical", "markers", "of", "apoptosis", "have", "been", "identified", "in", "a", "wide", "variety", "of", "cardiovascular", "disorders", ",", "including", "myocardial", "infarction", "and", "heart", "failure", ".", "This", "suggests", "that", "activation", "of", "apoptotic", "pathways", "contributes", "to", "cardiomyocyte", "loss", "and", "subsequent", "cardiac", "dysfunction", "in", "these", "conditions", ".", "A", "number", "of", "factors", "involved", "in", "cardiomyocyte", "apoptosis", "are", "currently", "known", "and", "include", "insulin", "-", "like", "growth", "factor", "-", "I", "(", "IGF", "-", "I", ")", ",", "stress", "-", "activated", "protein", "kinases", "(", "SAPKs", ")", "and", "the", "anti", "-", "apoptotic", "Bcl-2", "family", "[", "8", "]", ".", "There", "are", "indications", "that", "other", "factors", "may", "be", "involved", "in", "induction", "and", "regulation", "of", "cardiac", "apoptosis", ".", "However", ",", "these", "potential", "factors", "and", "their", "corresponding", "mechanisms", "have", "not", "been", "identified", ".", "\n", "Several", "lines", "of", "evidence", "point", "to", "the", "potential", "involvement", "of", "M6P", "/", "IGF2R", "in", "cardiac", "myocyte", "proliferation", "and", "apoptosis", ".", "Cardiac", "myocytes", "express", "relatively", "high", "levels", "of", "M6P", "/", "IGF2R", "and", "transgenic", "mice", "containing", "a", "homologous", "deletion", "of", "the", "M6P", "/", "IGF2R", "gene", "manifest", "ventricular", "hyperplasia", "due", "to", "an", "increase", "in", "cell", "number", "[", "9,10", "]", ",", "suggesting", "that", "the", "M6P", "/", "IGF2R", "normally", "acts", "to", "suppress", "cardiac", "myocyte", "cell", "growth", ".", "It", "has", "also", "been", "shown", "that", "TGF", "-", "β", ",", "a", "potent", "growth", "suppressor", "whose", "activation", "requires", "the", "binding", "of", "latent", "TGF", "-", "β", "to", "M6P", "/", "IGF2R", "[", "3", "]", ",", "is", "commonly", "upregulated", "in", "chronic", "heart", "failure", "[", "11", "]", ".", "Additional", "evidence", "for", "the", "involvement", "of", "M6P", "/", "IGF2R", "in", "regulation", "of", "apoptosis", "comes", "from", "studies", "of", "tumorigenesis", ".", "It", "has", "been", "shown", "that", "M6P", "/", "IGF2R", "expression", "is", "significantly", "reduced", "in", "a", "variety", "of", "tumors", "and", "loss", "of", "heterozygocity", "(", "LOH", ")", "at", "the", "M6P", "/", "IGF2R", "gene", "locus", "6q26", "have", "been", "found", "in", "breast", ",", "liver", "cancers", "and", "squamous", "cell", "carcinoma", "of", "the", "lung", "[", "12", "-", "15", "]", ".", "Although", "several", "studies", "have", "examined", "the", "effect", "of", "M6P", "/", "IGF2R", "over", "-", "expression", "on", "cell", "growth", "[", "7", "]", ",", "it", "is", "not", "known", "whether", "down", "-", "regulation", "of", "this", "receptor", "protein", "leads", "to", "cellular", "protection", "against", "apoptosis", ".", "\n", "Ribozymes", "are", "catalytic", "RNA", "molecules", "that", "cleave", "a", "complementary", "mRNA", "sequence", "[", "16", "]", ",", "thereby", "inactivating", "specific", "mRNAs", "and", "suppressing", "gene", "expression", "in", "vitro", "and", "in", "vivo", "[", "17,18", "]", ".", "Ribozymes", "have", "been", "shown", "to", "be", "highly", "specific", ",", "efficient", "and", "stable", ".", "They", "can", "be", "packaged", "into", "viral", "vectors", "to", "enhance", "transfer", "into", "cells", "and", "to", "achieve", "longer", "expression", "compared", "with", "naked", "oligonucleotides", ".", "In", "the", "present", "study", ",", "we", "employed", "ribozyme", "technology", "to", "study", "the", "role", "of", "M6P", "/", "IGF2R", "in", "regulation", "of", "cardiac", "myocyte", "cell", "growth", ".", "A", "hammerhead", "ribozyme", "against", "the", "M6P", "/", "IGF2R", "mRNA", "was", "constructed", "and", "packaged", "in", "an", "adenoviral", "vector", ".", "We", "then", "examined", "the", "effect", "of", "ribozyme", "-", "mediated", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "expression", "on", "cell", "growth", "and", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", ".", "\n\n", "Results", "\n", "Cleavage", "reaction", "of", "the", "ribozyme", "in", "vitro", "\n", "The", "M6P", "/", "IGF2R", "ribozyme", "we", "constructed", "has", "13-bp", "binding", "arms", "complementary", "to", "the", "target", "site", "of", "M6P", "/", "IGF2R", "mRNA", ",", "and", "a", "catalytic", "core", "(", "Fig", ".", "1A", ")", ".", "To", "evaluate", "the", "bioactivity", "of", "the", "ribozyme", "and", "the", "accessibility", "of", "the", "target", "site", ",", "a", "cleavage", "reaction", "was", "performed", "in", "vitro", ".", "The", "substrates", ",", "[", "α-32P", "]", "labeled", "RNA", "transcripts", "containing", "45", "bp", "of", "M6P", "/", "IGF2R", "mRNA", "or", "an", "unmatched", "sequence", ",", "were", "incubated", "with", "the", "ribozyme", "as", "described", "(", "see", "Materials", "and", "Methods", ")", ".", "The", "ribozyme", "cleaved", "only", "the", "specific", "M6P", "/", "IGF2R", "mRNA", "into", "the", "expected", "products", ".", "In", "the", "assay", "of", "time", "course", ",", "the", "hammerhead", "ribozyme", "was", "able", "to", "cleave", "24.2", "%", "of", "the", "M6P", "/", "IGF2R", "target", "within", "10", "minutes", "of", "incubation", ",", "50.3", "%", "of", "the", "M6P", "/", "IGF2R", "target", "within", "40", "minutes", "of", "incubation", ",", "and", "by", "640", "minutes", ",", "80.8", "%", "of", "the", "M6P", "/", "IGF2R", "target", "was", "converted", "to", "the", "expected", "products", "(", "Fig", ".", "1B", ")", ".", "This", "ribozyme", "did", "not", "digest", "the", "unmatched", "sequence", "(", "Fig", ".", "1B", ")", ".", "These", "results", "indicate", "a", "high", "efficiency", "and", "specificity", "of", "the", "ribozyme", "in", "vitro", ".", "\n\n", "Ribozymes", "down", "-", "regulate", "M6P", "/", "IGF2R", "expression", "in", "cardiac", "myocytes", "\n", "To", "examine", "the", "ability", "of", "the", "ribozyme", "to", "reduce", "levels", "of", "M6P", "/", "IGF2R", "mRNA", "in", "cultured", "cardiac", "myocytes", ",", "total", "RNA", "was", "extracted", "from", "cells", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "or", "Ad", "-", "GFP", ",", "and", "subjected", "to", "RT", "-", "PCR", "using", "M6P", "/", "IGF2R", "-", "specific", "primers", ".", "Primers", "specific", "for", "β", "-", "actin", "were", "added", "to", "a", "parallel", "reaction", "to", "serve", "as", "an", "internal", "standard", ".", "Cells", "were", "used", "4", "days", "after", "infection", ",", "with", "average", "infection", "efficiency", "of", "70–80", "%", "(", "for", "which", "a", "viral", "dose", "used", "had", "minimal", "cytotoxicity", ")", ".", "The", "RT", "-", "PCR", "product", "of", "M6P", "/", "IGF2R", "was", "856", "bp", ",", "and", "the", "β", "-", "actin", "product", "was", "285", "bp", ".", "As", "shown", "in", "Fig", ".", "2A", ",", "the", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "-", "infected", "cells", "exhibited", "a", "significantly", "lower", "level", "of", "M6P", "/", "IGF2R", "mRNA", "than", "Ad", "-", "GFP", "-", "infected", "cells", ",", "with", "a", "reduction", "of", "about", "50", "%", ".", "This", "result", "was", "confirmed", "by", "ribonuclease", "protection", "assay", "(", "RPA", ")", ",", "in", "which", "GAPDH", "was", "used", "as", "a", "control", "(", "Fig", ".", "2C", "&", "2D", ")", ".", "There", "was", "no", "significant", "difference", "in", "the", "level", "of", "M6P", "/", "IGF2R", "mRNA", "between", "Ad", "-", "GFP", "-", "infected", "cells", "and", "uninfected", "cells", "(", "data", "not", "shown", ")", ",", "indicating", "that", "infection", "with", "the", "adenovirus", "itself", "did", "not", "alter", "the", "endogenous", "M6P", "/", "IGF2R", "mRNA", "level", ".", "The", "results", "demonstrated", "that", "the", "ribozyme", "was", "highly", "effective", "in", "suppressing", "M6P", "/", "IGF2R", "expression", "in", "cultured", "cardiac", "myocytes", ".", "\n\n", "Effect", "of", "ribozyme", "expression", "on", "the", "functional", "activity", "of", "M6P", "/", "IGF2R", "\n", "To", "determine", "the", "effect", "of", "the", "ribozyme", "on", "the", "functional", "activity", "of", "M6P", "/", "IGF2R", ",", "binding", "and", "internalization", "of", "exogenous", "125I", "-", "IGF", "-", "II", "was", "measured", "in", "cells", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", ".", "As", "shown", "in", "Fig", ".", "3A", ",", "cells", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "showed", "a", "54", "%", "reduction", "in", "125I", "-", "IGF", "-", "II", "internalization", "when", "compared", "with", "the", "control", "cells", "(", "infected", "with", "Ad", "-", "GFP", ")", ".", "We", "also", "examined", "the", "effect", "of", "the", "ribozyme", "on", "the", "M6P", "-", "binding", "activity", "of", "the", "M6P", "/", "IGF2R", "using", "the", "M6P", "-", "bearing", "lysosomal", "enzyme", ",", "β", "-", "glucuronidase", ",", "as", "a", "probe", ".", "The", "results", "showed", "that", "the", "maximal", "M6P", "-", "binding", "capacity", "of", "cells", "treated", "with", "the", "ribozyme", "was", "about", "50", "%", "less", "than", "that", "of", "controls", "(", "Fig", ".", "3B", ")", ".", "Furthermore", ",", "we", "assessed", "the", "ability", "of", "cells", "to", "internalize", "exogenous", "β", "-", "glucuronidase", "after", "treatment", "with", "ribozyme", ".", "Similarly", ",", "the", "M6P", "-", "inhibitable", "endocytosis", "of", "β", "-", "glucuronidase", "by", "ribozyme", "-", "treated", "cells", "was", "about", "52", "%", "less", "than", "that", "of", "control", "cells", "(", "Fig", ".", "3C", ")", ".", "These", "results", "confirm", "that", "the", "number", "of", "functional", "M6P", "/", "IGF2R", "in", "ribozyme", "-", "treated", "cells", "was", "reduced", ".", "\n\n", "Adenoviral", "delivery", "of", "ribozymes", "increases", "the", "proliferation", "of", "cardiac", "myocytes", "\n", "We", "examined", "the", "effects", "of", "the", "ribozyme", "on", "the", "growth", "of", "cultured", "neonatal", "rat", "cardiac", "myocytes", ".", "Morphological", "evaluation", "showed", "a", "remarkable", "difference", "in", "growth", "pattern", "between", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "-", "infected", "cells", "and", "the", "control", "cells", ":", "the", "ribozyme", "-", "expressing", "cells", "formed", "larger", "and", "more", "spread", "colonies", "(", "Fig", ".", "4", ")", ".", "Assessment", "of", "cell", "proliferative", "activity", "by", "the", "MTT", "assay", "and", "counts", "of", "viable", "cells", "showed", "that", "the", "number", "of", "cardiac", "myocytes", "in", "ribozyme", "-", "expressing", "cultures", "was", "significantly", "higher", "than", "in", "control", "cultures", "(", "Fig", ".", "5", ")", ".", "These", "results", "indicate", "that", "treatment", "with", "M6P", "/", "IGF2R", "-", "ribozyme", "can", "promote", "cardiac", "myocyte", "proliferation", ".", "\n\n", "Effect", "of", "M6P", "/", "IGF2R", "-", "ribozyme", "expression", "on", "apoptosis", "of", "cardiac", "myocytes", "\n", "We", "examined", "the", "effects", "of", "ribozyme", "expression", "on", "TNF", "-", "α", "and", "hypoxia", "-", "induced", "apoptosis", "of", "cultured", "cardiac", "myocytes", ".", "After", "a", "24", "hr", "challenge", "with", "hypoxia", ",", "the", "number", "of", "apoptotic", "cells", "in", "M6P", "/", "IGF2R", "-", "Rz", "expressing", "cultures", "was", "38", "%", "lower", "than", "in", "control", "cultures", "as", "determined", "by", "Hoechst", "staining", "(", "which", "highlights", "the", "nuclei", "of", "apoptotic", "cells", ")", "and", "ELISA", "(", "Fig", ".", "6A", ",", "7A", ")", ".", "MTT", "analysis", "showed", "that", "the", "number", "of", "viable", "cells", "in", "ribozyme", "-", "treated", "cultures", "was", "40", "%", "higher", "than", "in", "control", "cultures", "(", "Fig", ".", "7A", ")", ".", "\n", "After", "treatment", "with", "TNF", "-", "α", ",", "as", "shown", "in", "Fig", ".", "6B", ",", "a", "large", "number", "of", "control", "cells", "underwent", "apoptosis", ",", "as", "indicated", "by", "morphological", "changes", "(", "small", "round", "shape", ")", "and", "bright", "blue", "nuclear", "staining", ".", "There", "were", "significantly", "more", "apoptotic", "cells", "in", "control", "cultures", "than", "in", "cultures", "expressing", "the", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", ".", "The", "number", "of", "apoptotic", "cells", ",", "as", "measured", "by", "the", "cell", "death", "ELISA", "assay", ",", "in", "cultures", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "was", "significantly", "(", "about", "40", "%", ")", "lower", "than", "in", "cultures", "infected", "with", "Ad", "-", "GFP", "(", "Fig", ".", "7B", ")", ".", "Accordingly", ",", "the", "number", "of", "viable", "cells", ",", "as", "measured", "by", "MTT", "analysis", ",", "in", "cultures", "infected", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "was", "significantly", "(", "about", "45", "%", ")", "higher", "than", "in", "cultures", "infected", "with", "Ad", "-", "GFP", "(", "Fig", ".", "7B", ")", ".", "These", "results", "are", "consistent", "with", "the", "hypothesis", "that", "decreasing", "M6P", "/", "IGF2R", "expression", "by", "ribozyme", "treatment", "can", "reduce", "cell", "apoptosis", ".", "\n\n\n", "Discussion", "\n", "Some", "62,000,000", "Americans", "have", "one", "or", "more", "types", "of", "cardiovascular", "disease", "(", "CVD", ")", "and", "CVD", "is", "the", "leading", "cause", "(", "40.1", "%", ")", "of", "death", "in", "the", "United", "States", ".", "Myocardial", "infarction", "and", "heart", "failure", ",", "conditions", "accompanied", "by", "cardiac", "myocyte", "apoptosis", ",", "represent", "23", "%", "of", "all", "CVDs", "and", "are", "a", "growing", "clinical", "challenge", "in", "need", "of", "novel", "therapeutic", "strategies", ".", "In", "this", "study", ",", "we", "investigated", "the", "M6P", "/", "IGF2R", "as", "a", "potential", "new", "therapeutic", "target", "for", "reduction", "of", "cardiac", "apoptosis", "and", "cardiac", "injury", "in", "these", "conditions", ".", "\n", "Using", "ribozyme", "technology", "we", "down", "-", "regulated", "the", "expression", "of", "the", "M6P", "/", "IGF2R", "in", "neonatal", "cardiac", "myocytes", ".", "We", "then", "examined", "cell", "proliferation", "and", "apoptosis", "under", "normal", "conditions", "and", "post", "challenge", "with", "either", "hypoxia", ",", "a", "model", "of", "ischemia", "-", "reperfusion", ",", "or", "TNF", "-", "α", ",", "a", "cytokine", "implicated", "in", "the", "pathogenesis", "of", "chronic", "heart", "failure", "[", "19", "]", ".", "Our", "results", "demonstrate", "an", "association", "of", "a", "decrease", "in", "the", "expression", "and", "function", "of", "the", "M6P", "/", "IGF2R", "with", "increased", "cell", "proliferation", "and", "decreased", "cell", "susceptibility", "to", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", ".", "Expression", "of", "the", "ribozyme", "targeted", "against", "the", "M6P", "/", "IGF2R", "in", "cardiomyocytes", "resulted", "in", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "expression", ",", "as", "measured", "by", "RT", "-", "PCR", "and", "RPA", ",", "and", "of", "M6P", "/", "IGF2R", "function", ",", "as", "indicated", "by", "a", "decrease", "in", "internalization", "of", "125I", "-", "IGF", "-", "II", ",", "and", "β", "-", "glucuronidase", "binding", "and", "endocytosis", ".", "\n", "MTT", "analysis", "and", "viable", "cell", "counts", "showed", "that", "ribozyme", "-", "mediated", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "resulted", "in", "a", "marked", "increase", "in", "cell", "proliferation", "of", "cardiomyocytes", ",", "which", "normally", "express", "high", "levels", "of", "M6P", "/", "IGF2R", "[", "20", "]", "and", "have", "limited", "proliferative", "capabilities", "[", "21", "]", ".", "These", "results", "are", "consistent", "with", "the", "findings", "of", "previous", "knockout", "studies", "[", "9,10", "]", ".", "Since", "the", "M6P", "/", "IGF2R", "has", "multiple", "actions", "on", "cell", "growth", ",", "its", "proliferative", "effect", "on", "the", "heart", "cells", "observed", "in", "this", "study", "might", "involve", "multiple", "mechanisms", ".", "However", ",", "it", "is", "likely", "that", "unchecked", "IGF", "-", "II", "stimulation", "plays", "a", "key", "role", "in", "the", "effect", ".", "Because", "the", "M6P", "/", "IGF2R", "is", "believed", "to", "sequester", "and", "degrade", "IGF", "-", "II", "[", "2", "]", ",", "a", "decrease", "in", "M6P", "/", "IGF2R", "expression", "and", "function", "could", "result", "in", "decreased", "degradation", "and", "hence", "increased", "bioavailability", "of", "IGF", "-", "II", "to", "the", "IGF", "-", "I", "receptor", ",", "which", "mediates", "the", "growth", "-", "promoting", "effect", "of", "IGF", "-", "II", ".", "Supporting", "evidence", "for", "the", "involvement", "of", "IGF", "-", "II", "in", "the", "proliferative", "effect", "resulting", "from", "loss", "of", "M6P", "/", "IGF2R", "function", "comes", "from", "studies", "of", "M6P", "/", "IGF2R", "knock", "-", "out", "mice", ".", "M6P", "/", "IGF2R", "-", "null", "mice", "display", "global", "hyperplasia", "that", "coincides", "with", "elevated", "levels", "of", "IGF", "-", "II", ".", "Most", "importantly", ",", "however", ",", "the", "lethal", "nature", "of", "an", "M6P", "/", "IGF2R", "-", "null", "phenotype", "is", "reversed", "in", "an", "IGF", "-", "II", "-", "null", "background", "[", "9", "]", ".", "Our", "results", "showing", "that", "ribozyme", "-", "mediated", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "lead", "to", "a", "decrease", "in", "IGF", "-", "II", "internalization", "support", "the", "above", "possibility", ".", "However", ",", "further", "investigation", "to", "confirm", "this", "mechanism", "is", "warranted", ".", "\n", "More", "importantly", ",", "our", "results", "also", "showed", "that", "M6P", "/", "IGF2R", "down", "-", "regulation", "resulted", "in", "decreased", "sensitivity", "of", "cardiomyocytes", "to", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", ".", "There", "is", "evidence", "that", "lysosomal", "enzymes", ",", "such", "as", "cathepsins", "B", "and", "D", "contribute", "to", "hypoxia-", "and", "TNF", "-", "induced", "apoptosis", "in", "vitro", "[", "22", "-", "25", "]", "and", "in", "vivo", "[", "26,27", "]", ".", "The", "M6P", "/", "IGF2R", "has", "been", "shown", "to", "be", "involved", "in", "binding", ",", "transport", "and", "activation", "of", "lysosomal", "enzymes", ",", "including", "cathepsins", "[", "4,5", "]", ".", "Therefore", ",", "it", "is", "possible", "that", "down", "-", "regulation", "of", "the", "M6P", "/", "IGF2R", "results", "in", "improper", "trafficking", "and", "activation", "of", "cathepsins", ".", "This", ",", "in", "turn", "would", "eliminate", "the", "apoptotic", "cascades", "triggered", "by", "these", "enzymes", "under", "hypoxia", "and", "TNF", "stimulation", "and", "result", "in", "decreased", "sensitivity", "of", "cardiomyocytes", "to", "apoptosis", ".", "\n", "It", "has", "also", "been", "shown", "that", "TNF", "stimulation", "involves", "the", "activation", "of", "TGF", "-", "β", "[", "28", "-", "30", "]", ",", "a", "ligand", "of", "M6P", "/", "IGF2R", "that", "has", "been", "implicated", "in", "the", "progression", "of", "chronic", "heart", "failure", "[", "11,31", "]", ".", "Therefore", ",", "down", "-", "regulation", "of", "M6P", "/", "IGF2R", "expression", "could", "also", "lead", "to", "a", "decreased", "bioavailability", "of", "activated", "TGF", "-", "β", ",", "thereby", "decreasing", "the", "sensitivity", "of", "cardiomyocytes", "to", "the", "TNF", "/", "TGF", "-", "β", "apoptotic", "pathway", ".", "The", "detailed", "mechanism", "of", "the", "observed", "effects", "is", "unknown", "and", "requires", "further", "investigation", ".", "\n\n", "Conclusions", "\n", "The", "present", "study", "demonstrates", "that", "ribozyme", "-", "mediated", "down", "-", "regulation", "of", "expression", "and", "functional", "activity", "of", "the", "M6P", "/", "IGF2R", "results", "in", "a", "decrease", "in", "the", "susceptibility", "of", "cardiac", "myocytes", "to", "apoptotic", "stimuli", ".", "These", "findings", "suggest", "that", "this", "receptor", "might", "be", "involved", "in", "cardiac", "cell", "growth", "and", "apoptosis", ".", "The", "ability", "of", "the", "M6P", "/", "IGF2R", "ribozyme", "to", "reduce", "M6P", "/", "IGF2R", "expression", "and", "function", "in", "transfected", "cells", "verifies", "the", "utility", "of", "the", "ribozyme", "in", "studying", "the", "role", "of", "M6P", "/", "IGF2R", "in", "cardiomyocyte", "growth", "and", "apoptosis", ".", "In", "addition", "to", "its", "utility", "as", "a", "research", "tool", ",", "the", "ribozyme", ",", "with", "further", "exploration", "and", "development", ",", "might", "have", "potential", "application", "as", "a", "therapeutic", "agent", "to", "prevent", "cell", "death", "or", "promote", "mitogenesis", "for", "certain", "clinical", "conditions", ",", "such", "as", ",", "myocardial", "infarction", "and", "chronic", "heart", "failure", ".", "\n\n", "Methods", "\n", "Construction", "of", "recombinant", "M6P", "/", "IGF2R", "-", "RZ", "adenoviral", "vector", "\n", "The", "nucleotide", "numbers", "of", "the", "rat", "M6P", "/", "IGF2R", "sequence", "targeted", "by", "the", "hammerhead", "ribozyme", "is", "1147–1160", "after", "coding", "site", "(", "exon", "9", ")", ".", "The", "structure", "of", "the", "M6P", "/", "IGF2R", "hammerhead", "ribozyme", "is", "shown", "in", "Fig", ".", "1", ".", "A", "49", "bp", "M6P", "/", "IGF2R", "ribozyme", "oligonucleotide", ",", "5'-GAATTCCCC", "ACACTG", "ATGAGCCGCTTCGGCGGCGAAACATTCAAC", "GCGT-3", "'", "and", "the", "corresponding", "reverse", "complementary", "strand", "were", "synthesized", ".", "The", "fragments", "were", "subcloned", "to", "produce", "a", "plasmid", "containing", "a", "ribozyme", "against", "M6P", "/", "IGF2R.", "For", "construction", "of", "the", "recombinant", "adenovirus", "containing", "the", "M6P", "/", "IGF2R", "-", "ribozyme", "(", "pAd", "-", "GFP", "/", "IGF2R", "-", "Rz", ")", ",", "the", "segments", "containing", "the", "ribozymes", "were", "amplified", "by", "PCR", "and", "cloned", "into", "a", "pAdTrack", "-", "CMV", "vector", "and", "then", "recombined", "homologously", "with", "an", "adenoviral", "backbone", "pAdEasy", "1", "vector", "to", "generate", "(", "pAd", "-", "GFP", "/", "IGF2R", "-", "Rz", ")", ",", "following", "the", "protocol", "described", "by", "He", "et", "al", ".", "[", "32", "]", ".", "The", "pAd", "-", "GFP", "/", "IGF2R", "-", "Rz", "carries", "both", "the", "IGF2R", "-", "Rz", "and", "GFP", "(", "as", "reporter", ")", "genes", ",", "each", "under", "the", "control", "of", "separate", "cytomegalovirus", "(", "CMV", ")", "promoters", ".", "Another", "viral", "vector", ",", "pAd", "-", "GFP", ",", "which", "carries", "the", "GFP", "gene", "only", "under", "the", "control", "of", "the", "CMV", "promoter", ",", "was", "generated", "and", "used", "as", "a", "control", "vector", ".", "The", "adenoviral", "vector", "DNA", "were", "linerized", "with", "Pac", "I", "and", "transfected", "into", "the", "replication", "-", "permissive", "293", "cells", "(", "E1A", "transcomplementing", "cell", "line", ")", "by", "using", "Lipofectamine", "(", "Life", "Technologies", ")", "to", "produce", "E1-deleted", ",", "replication", "-", "defective", "recombinant", "adenovirus", "as", "described", "previously", "[", "33", "]", ".", "Large", "-", "scale", "amplification", "of", "recombinant", "adenovirus", "in", "293", "cells", "was", "followed", "by", "purification", "using", "a", "discontinuous", "CsCl", "gradient", ".", "The", "constructs", "were", "confirmed", "by", "enzymatic", "digestion", "and", "DNA", "sequencing", ".", "\n\n", "Transcription", "and", "cleavage", "reaction", "of", "ribozyme", "in", "vitro", "\n", "Plasmids", "containing", "the", "ribozyme", "or", "the", "substrate", "(", "either", "45", "bp", "of", "M6P", "/", "IGF2R", "mRNA", "or", "an", "unmatched", "sequence", "5'-GTGCTGTCTGTATG-3", "'", ")", "were", "linearized", "with", "MluI", ",", "respectively", ".", "All", "transcripts", "were", "generated", "with", "T7", "RNA", "polymerase", "(", "Promega", ")", ".", "Substrate", "transcripts", "were", "labeled", "by", "incorporation", "of", "[", "α-32P", "]", "UTP", "(", "NEN", "Life", "Science", "Products", ",", "Inc", ".", ")", ".", "Specific", "activity", "of", "the", "[", "α-32P", "]", "UTP", "(", "10", "μCi", "/", "μl", ")", "and", "the", "base", "composition", "of", "each", "substrate", "molecule", "were", "used", "to", "calculate", "the", "substrate", "concentration", ".", "Ribozyme", "transcripts", "were", "quantified", "spectrophotometrically", ".", "(", "The", "half", "-", "life", "of", "the", "M6P", "/", "IGF2R", "target", "is", "about", "280", "minutes", ")", ".", "\n", "Cleavage", "reaction", "mixture", "contained", "substrate", "RNA", "(", "40", "nM", ")", ",", "increasing", "amounts", "of", "ribozyme", "(", "60", "nM", ")", ",", "20", "mM", "MgCl2", "and", "20", "mM", "Tris", "-", "HCl", ",", "pH8.0", ",", "in", "a", "final", "volume", "of", "10", "μl", ".", "The", "mixture", "was", "incubated", "at", "37", "°", "C", "for", "a", "time", "-", "course", "of", "cleavage", "reaction", "from", "0", ",", "5", ",", "10", ",", "20", ",", "40", ",", "80", ",", "160", ",", "320", ",", "to", "640", "minutes", "and", "the", "cleavage", "reaction", "was", "stopped", "by", "addition", "of", "loading", "buffer", "(", "80", "%", "formamide", ",", "10", "mM", "Na2EDTA", ",", "pH", "8.0", ",", "and", "1", "mg", "/", "ml", "each", "bromophenol", "blue", "and", "xylene", "cyanol", ")", ".", "Cleavage", "products", "were", "analyzed", "on", "a", "15", "%", "polyacrylamide", "and", "8", "M", "urea", "gel", ".", "Product", "and", "substrate", "fragments", "were", "quantitated", "by", "using", "NIH", "Imager", ".", "\n\n", "Cell", "cultures", "and", "infection", "with", "Ad", "-", "GFP", "/", "Rz", "-", "IGF2R", "and", "Ad", "-", "GFP", "\n", "Cardiac", "myocytes", "were", "isolated", "from", "1-day", "-", "old", "newborn", "rats", "using", "the", "Neonatal", "Cardiomyocyte", "Isolation", "System", "(", "Worthington", ")", ".", "The", "isolated", "cells", "were", "plated", "in", "6-well", "plates", "and", "cultured", "in", "F-10", "medium", "containing", "5", "%", "(", "vol", "/", "vol", ")", "FBS", "and", "10", "%", "(", "vol", "/", "vol", ")", "horse", "serum", "at", "37", "°", "C", "in", "a", "tissue", "culture", "incubator", "with", "5", "%", "CO2", "and", "98", "%", "relative", "humidity", ".", "Cells", "were", "used", "for", "experiments", "after", "2–3", "days", "of", "culture", ".", "Viral", "infections", "were", "carried", "out", "by", "adding", "viral", "particles", "at", "various", "concentrations", "(", "usually", ",", "2", "×", "108", "virus", "particles", "/", "ml", ")", "to", "culture", "medium", "containing", "2", "%", "(", "vol", "/", "vol", ")", "FBS", ".", "Initially", ",", "optimal", "viral", "concentration", "was", "determined", "by", "using", "Ad", "-", "GFP", "to", "achieve", "an", "optimal", "balance", "of", "high", "gene", "expression", "and", "low", "viral", "titer", "to", "minimize", "cytotoxicity", ".", "After", "24", "hours", "of", "incubation", ",", "the", "infection", "medium", "was", "replaced", "with", "normal", "(", "15", "%", "vol", "/", "vol", "serum", ")", "culture", "medium", ".", "For", "treatment", "with", "IGF", "-", "II", ",", "cells", "were", "incubated", "with", "50", "ng", "/", "ml", "IGF", "-", "II", "after", "24", "hours", "infection", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "or", "Ad", "-", "GFP", ".", "Four", "days", "after", "infection", ",", "cells", "were", "used", "for", "analysis", "of", "gene", "expression", "of", "M6P", "/", "IGF2R", "and", "its", "effect", "on", "cell", "growth", "and", "apoptosis", ".", "\n\n", "Analysis", "of", "gene", "expression", "in", "cardiac", "myocytes", "\n", "The", "M6P", "/", "IGF2R", "transcripts", "were", "determined", "by", "both", "RT", "-", "PCR", "and", "Ribonuclease", "Protection", "Assay", "(", "RPA", ")", ".", "RT", "-", "PCR", "was", "performed", "using", "the", "GeneAmp", "EZ", "rTth", "RNA", "PCR", "kit", "(", "Roche", ")", ".", "Total", "RNA", "was", "extracted", "from", "cultured", "cells", "using", "an", "RNA", "isolation", "kit", "(", "Qiagen", ",", ")", ",", "according", "to", "the", "manufacturer", "'s", "protocol", ".", "M6P", "/", "IGF2R", "transcripts", "were", "amplified", "using", "the", "primers", "(", "5'-GACAGGCTCGTTCTGACTTA-3", "'", ")", "and", "(", "5'-CTTCCACTCTTATCCACAGC-3", "'", ")", "specific", "to", "the", "M6P", "/", "IGF2R.", "Each", "RT", "-", "PCR", "assay", "was", "performed", "in", "triplicate", "and", "product", "levels", "varied", "by", "less", "than", "3.2", "%", "for", "each", "RNA", "sample", ".", "Primers", "specific", "for", "β", "-", "actin", "cDNA", "were", "added", "to", "a", "parallel", "reaction", "to", "standardize", "for", "variations", "in", "PCR", "between", "samples", ".", "PCR", "products", "were", "resolved", "on", "a", "1.0", "%", "agarose", "gel", ",", "visualized", "under", "UV", "light", "and", "quantitated", "using", "NIH", "Imager", ".", "\n", "RPA", "was", "performed", "using", "the", "RPA", "III", "kit", "(", "Ambion", ",", "Austin", ",", "TX", ")", ".", "Briefly", ",", "total", "RNA", "was", "extracted", "from", "cultured", "cells", "using", "a", "total", "RNA", "isolation", "reagent", "(", "TRIzol", ",", "Gibco", "BRL", ")", "according", "to", "the", "manufacturer", "'s", "protocol", ".", "The", "plasmid", "containing", "the", "rat", "M6P", "/", "IGF2R", "gene", "was", "linearized", "and", "used", "as", "a", "transcription", "template", ".", "Antisense", "RNA", "probes", "were", "transcribed", "in", "vitro", "using", "[", "33P]-UTP", ",", "T7", "polymerase", "(", "Riboprobea", "System", "T7", "kit", ",", "Promega", ")", ",", "hybridized", "with", "the", "total", "RNA", "extracted", "from", "the", "rat", "cardiomyocytes", ",", "and", "digested", "with", "ribonuclease", "to", "remove", "non", "-", "hybridized", "RNA", "and", "probe", ".", "The", "protected", "RNA·RNA", "was", "resolved", "on", "a", "denaturing", "5", "%", "sequence", "gel", "and", "subjected", "to", "autoradiography", ".", "A", "probe", "targeting", "the", "GAPDH", "gene", "was", "used", "as", "an", "internal", "control", ".", "\n\n", "Measurement", "of", "125I", "-", "IGF", "-", "II", "internalization", "\n", "Cells", "were", "incubated", "at", "37", "°", "C", "for", "2", "hrs", "in", "serum", "-", "free", "F-10", "culture", "medium", "containing", "125I", "-", "labeled", "IGF", "-", "II", "(", "0.5", "ng", "/", "ml", ")", "with", "or", "without", "excess", "unlabeled", "IGF", "-", "II", "(", "2", "μg", "/", "ml", ")", ".", "Following", "the", "incubation", ",", "the", "cells", "were", "washed", "three", "times", "with", "ice", "-", "cold", "PBS", ",", "and", "cell", "-", "associated", "radioactivity", "was", "determined", "by", "a", "γ", "counter", ".", "Specific", "internalized", "125I", "-", "IGF", "-", "II", "was", "calculated", "by", "subtracting", "the", "count", "of", "samples", "with", "excessive", "unlabeled", "IGF", "-", "II", "from", "that", "without", "unlabeled", "IGF", "-", "II", ",", "and", "normalized", "to", "protein", "contents", ".", "\n\n", "Beta", "-", "glucuronidase", "binding", "assay", "\n", "Binding", "of", "β", "-", "glucuronidase", "was", "assayed", "as", "described", "previously", "[", "34,35", "]", ".", "Briefly", ",", "cells", "were", "permeabilized", "with", "0.25", "%", "saponin", "in", "50", "mM", "Hepes", "(", "pH", "7.0", ")", ",", "150", "mM", "NaCl", ",", "5", "mM", "β", "-", "glycerophosphate", ",", "0.5", "%", "human", "serum", "albumin", ",", "and", "10", "mM", "mannose-6-phosphate", "(", "M6P", ")", "for", "30", "minutes", "on", "ice", ".", "The", "cells", "were", "washed", "three", "times", "with", "ice", "-", "cold", "PBS", "containing", "0.05", "%", "saponin", ".", "They", "were", "incubated", "with", "20,000", "units", "/", "ml", "β", "-", "glucuronidase", "from", "bovine", "liver", "(", "Sigma", ")", "in", "50", "mM", "Hepes", "(", "pH", "7.5", ")", "containing", "150", "mM", "NaCl", ",", "5", "mM", "β", "-", "glycerophosphate", ",", "0.5", "%", "human", "serum", "albumin", ",", "0.5", "%", "saponin", "with", "or", "without", "10", "mM", "M6P", "overnight", "on", "ice", ".", "Cells", "were", "washed", "five", "times", "with", "ice", "-", "cold", "PBS", "containing", "0.05", "%", "saponin", "and", "sonicated", "in", "100", "mM", "sodium", "acetate", "(", "pH", "4.6", ")", ".", "The", "protein", "concentration", "of", "solubilized", "cell", "extract", "was", "measured", "and", "enzyme", "activity", "was", "assayed", "as", "follows", ":", "for", "each", "reaction", "50", "ul", "cell", "extract", "were", "added", "to", "500", "ul", "of", "100", "mM", "sodium", "acetate", "(", "pH", "4.0", ")", "containing", "1", "mM", "paranitrophenyl", "(", "PNP)-β", "-", "glucuronide", "(", "Sigma", ")", "as", "substrate", ".", "After", "an", "incubation", "period", "of", "3", "hours", "at", "37", "°", "C", ",", "500", "ul", "1", "M", "Na2CO3", "were", "added", "to", "each", "reaction", "and", "the", "absorbance", "was", "measured", "at", "400", "nm", ".", "Experimental", "values", "were", "compared", "to", "a", "standard", "curve", "that", "was", "constructed", "using", "1–100", "nM", "solutions", "of", "PNP", "(", "Sigma", ")", "in", "500", "ul", "100", "mM", "sodium", "acetate", "and", "500", "u1", "1", "M", "Na2CO3", ".", "Specific", "activity", "was", "calculated", "as", "nM", "of", "PNP", "produced", "/", "hour", "/", "mg", "of", "protein", ".", "\n\n", "Beta", "-", "glucuronidase", "endocytosis", "assay", "\n", "Beta", "-", "glucuronidase", "endocytosis", "assay", "was", "carried", "out", "as", "described", "previously", "[", "36", "]", ".", "Briefly", ",", "confluent", "cell", "cultures", "were", "washed", "twice", "with", "pre", "-", "warmed", "serum", "-", "free", "DMEM", "followed", "by", "incubation", "with", "DMEM", "containing", "5", "mg", "/", "ml", "human", "serum", "albumin", "and", "10", "mM", "M6P", "for", "20", "minutes", ".", "Following", "incubation", "cells", "were", "washed", "3", "times", "with", "pre", "-", "warmed", "DMEM", ".", "Cells", "were", "then", "incubated", "in", "DMEM", "containing", "5", "mg", "/", "ml", "human", "serum", "albumin", "alone", "or", "4000", "units", "β", "-", "glucuronidase", "with", "or", "without", "10", "mM", "M6P", "for", "2", "hours", "at", "37", "°", "C", ".", "Following", "the", "incubation", ",", "the", "cells", "were", "washed", "5", "times", "with", "ice", "-", "cold", "PBS", "and", "subjected", "to", "enzyme", "activity", "assay", "as", "described", "above", ".", "\n\n", "Cell", "proliferation", "assay", "(", "MTT", "assay", "and", "cell", "counts", ")", "\n", "Cardiac", "myocytes", "were", "grown", "in", "culture", "plates", "(", "tissue", "culture", "grade", ",", "12", "wells", ",", "flat", "bottom", ")", "in", "a", "final", "volume", "of", "1", "ml", "serum", "-", "containing", "culture", "medium", "per", "well", ",", "in", "a", "humidified", "atmosphere", "(", "37", "°", "C", "and", "5", "%", "C02", ")", "for", "3", "days", ".", "After", "infection", "with", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "or", "Ad", "-", "GFP", ",", "cells", "were", "incubated", "with", "or", "without", "50", "ng", "/", "ml", "IGF", "-", "II", "for", "4", "days", ".", "Following", "supplementation", "with", "IGF", "-", "II", ",", "100", "μl", "MTT", "labeling", "reagent", "(", "Roche", ")", "were", "added", "to", "each", "well", "and", "cells", "were", "incubated", "for", "4", "hours", ",", "followed", "by", "addition", "of", "1", "ml", "solubilization", "solution", "into", "each", "well", ".", "The", "plate", "was", "placed", "in", "an", "incubator", "at", "37", "°", "C", "overnight", ".", "Spectrophotometrical", "absorbency", "of", "the", "samples", "was", "measured", "using", "an", "UV", "-", "visible", "Recording", "Spectrophotometer", "with", "wavelength", "of", "550–690", "nm", ".", "In", "addition", ",", "the", "total", "number", "of", "viable", "cells", "in", "each", "treatment", "was", "counted", "by", "trypan", "blue", "exclusion", "method", "using", "a", "hemocytometer", ".", "\n\n", "Induction", "and", "analysis", "of", "cell", "apoptosis", "\n", "Cells", "were", "infected", "with", "Ad", "-", "GFP", "or", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", ".", "Seventy", "-", "two", "hours", "post", "infection", ",", "cells", "were", "treated", "with", "TNF", "(", "0.1", "ng", "/", "ml", ")", "for", "24", "hrs", "or", "subjected", "to", "hypoxia", ".", "For", "induction", "of", "apoptosis", "by", "hypoxia", ",", "cell", "culture", "medium", "was", "changed", "to", "serum", "-", "free", "F-10", "saturated", "with", "95", "%", "N2/5", "%", "CO2", "and", "cells", "were", "placed", "in", "a", "37", "°", "C", "airtight", "box", "saturated", "with", "95", "%", "N2/5", "%", "CO2", "for", "24", "hrs", ".", "For", "normoxic", "controls", ",", "culture", "medium", "was", "changed", "to", "F-10/5%F", "BS/10", "%", "HS", "and", "cells", "were", "placed", "in", "a", "37", "°", "C/5", "%", "CO2", "incubator", "for", "24", "hrs", "before", "analysis", ".", "\n", "Apoptotic", "cells", "were", "identified", "by", "Hoechst", "staining", "using", "the", "Vybrant", "™", "Apoptosis", "Kit", "#", "5", "(", "Molecular", "Probes", ")", "according", "to", "the", "manufacturer", "'s", "protocol", ".", "In", "addition", ",", "after", "infection", "with", "Ad", "-", "GFP", "or", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", "and", "challenge", "with", "either", "TNF", "or", "hypoxia", ",", "cell", "viability", "was", "assessed", "using", "the", "MTT", "assay", "Kit", "(", "Roche", "Molecular", "Biochemicals", ")", "and", "cell", "apoptosis", "was", "determined", "using", "the", "Cell", "Death", "Detection", "ELISA", "Kit", "assay", "(", "Roche", "Molecular", "Biochemicals", ")", "according", "to", "the", "manufacturer", "'s", "protocol", ".", "\n\n", "Statistical", "analysis", "\n", "Students", "'", "t", "-", "test", "was", "used", "to", "evaluate", "the", "difference", "between", "two", "values", ".", "Each", "experiment", "was", "repeated", "at", "least", "three", "times", ".", "Statistical", "significance", "was", "accepted", "at", "the", "level", "of", "p", "<", "0.05", ".", "\n\n\n", "List", "of", "abbreviations", "used", "\n", "Ad", "-", "GFP", ",", "adenovirus", "carrying", "GFP", "gene", ";", "Ad", "-", "GFP", "/", "IGF2R", "-", "Rz", ",", "adenovirus", "carrying", "both", "the", "ribozyme", "against", "M6P", "/", "IGF2R", "and", "the", "GFP", "gene", ";", "GFP", ",", "green", "fluorescent", "protein", ";", "IGF", "-", "II", ",", "insulin", "-", "like", "growth", "factor", "II", ";", "M6P", "/", "IGF2R", ",", "mannose", "6-phosphate", "/", "insulin", "-", "like", "growth", "factor", "II", "receptor", ";", "Rz", ",", "ribozyme", ".", "\n\n", "Authors", "'", "contributions", "\n", "ZC", "carried", "out", "construction", "of", "the", "ribozyme", ",", "production", "of", "the", "viruses", ",", "cellular", "experiments", ",", "biochemical", "assays", "and", "data", "analysis", ".", "\n", "YG", "carried", "out", "the", "RPA", "assay", "and", "participated", "in", "the", "molecular", "biological", "studies", ".", "\n", "JXK", "conceived", "of", "the", "study", ",", "participated", "in", "its", "design", "and", "coordination", ",", "and", "drafted", "the", "manuscript", ".", "\n\n\n" ]
[ "species" ]
Oxysterols is a CHEMICAL
23500545_task0
Sentence: Oxysterols in cancer cell proliferation and death. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: CHEMICAL
[ "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O" ]
Oxysterols in cancer cell proliferation and death.
[ "Oxysterols", "in", "cancer", "cell", "proliferation", "and", "death", "." ]
[ "GENE-Y", "GENE-N", "CHEMICAL" ]
Oxysterols is a CHEMICAL
23500545_task1
Sentence: Oxysterols in cancer cell proliferation and death. Instructions: please typing these entity words according to sentence: Oxysterols Options: CHEMICAL
[ "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O" ]
Oxysterols in cancer cell proliferation and death.
[ "Oxysterols", "in", "cancer", "cell", "proliferation", "and", "death", "." ]
[ "GENE-Y", "GENE-N", "CHEMICAL" ]
Oxysterols
23500545_task2
Sentence: Oxysterols in cancer cell proliferation and death. Instructions: please extract entity words from the input sentence
[ "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O" ]
Oxysterols in cancer cell proliferation and death.
[ "Oxysterols", "in", "cancer", "cell", "proliferation", "and", "death", "." ]
[ "GENE-Y", "GENE-N", "CHEMICAL" ]
Need for is a Mood, long - term oral anticoagulation is a Procedure
NCT02247128_inc_task0
Sentence: Need for long-term oral anticoagulation; Patient has provided written informed consent. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Procedure, Mood
[ "B-Mood", "I-Mood", "B-Procedure", "I-Procedure", "I-Procedure", "I-Procedure", "I-Procedure", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Need for long-term oral anticoagulation; Patient has provided written informed consent.
[ "Need", "for", "long", "-", "term", "oral", "anticoagulation", ";", "\n", "Patient", "has", "provided", "written", "informed", "consent", ".", "\n" ]
[ "Procedure", "Mood" ]
Need for is a Mood, long - term oral anticoagulation is a Procedure
NCT02247128_inc_task1
Sentence: Need for long-term oral anticoagulation; Patient has provided written informed consent. Instructions: please typing these entity words according to sentence: Need for, long - term oral anticoagulation Options: Procedure, Mood
[ "B-Mood", "I-Mood", "B-Procedure", "I-Procedure", "I-Procedure", "I-Procedure", "I-Procedure", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Need for long-term oral anticoagulation; Patient has provided written informed consent.
[ "Need", "for", "long", "-", "term", "oral", "anticoagulation", ";", "\n", "Patient", "has", "provided", "written", "informed", "consent", ".", "\n" ]
[ "Procedure", "Mood" ]
Need for, long - term oral anticoagulation
NCT02247128_inc_task2
Sentence: Need for long-term oral anticoagulation; Patient has provided written informed consent. Instructions: please extract entity words from the input sentence
[ "B-Mood", "I-Mood", "B-Procedure", "I-Procedure", "I-Procedure", "I-Procedure", "I-Procedure", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Need for long-term oral anticoagulation; Patient has provided written informed consent.
[ "Need", "for", "long", "-", "term", "oral", "anticoagulation", ";", "\n", "Patient", "has", "provided", "written", "informed", "consent", ".", "\n" ]
[ "Procedure", "Mood" ]
Knochendefekten is an umlsterm, Aetiologie is an umlsterm, Therapieverfahren is an umlsterm, Patienten is an umlsterm, Suggestionen is an umlsterm, Gesamttherapiekonzept is an umlsterm, Hauttransplantationen is an umlsterm, Lappenplastiken is an umlsterm, Fernlappenplastiken is an umlsterm, Gewebetransplantationen is an umlsterm, Koerperregionen is an umlsterm, Vakuumversiegelung is an umlsterm, Therapieverfahren is an umlsterm, Hautdistraktion is an umlsterm, Gesamttherapieplan is an umlsterm
DerOrthopaede.70260470.ger.abstr_task0
Sentence: Posttraumatische Weichteildefekte , die nicht primaer verschlossen werden koennen , isoliert oder in Kombination mit Knochendefekten , stellen wegen ihrer unterschiedlichen Aetiologie und Auspraegungen ein komplexes diagnostisches und therapeutisches Problem dar . Um aus der Vielzahl der moeglichen Therapieverfahren das fuer den Patienten optimale herauszusuchen und nicht Modeerscheinungen oder irrealen Suggestionen zu erliegen , bedarf es einer exakten Beschreibung des vorliegenden Defekts , der richtigen Wahl des Operationszeitpunktes und der Kenntnis aller therapeutischen Moeglichkeiten . Das vorgestellte Gesamttherapiekonzept spiegelt unsere Erfahrung im Bereich der Weichteildeckung im Zeitraum von 1981-1995 nach ueber 5000 Hauttransplantationen , 3000 lokale Lappenplastiken , 200 gestielte Fernlappenplastiken und 1200 freie mikrovaskulaeren Gewebetransplantationen zu allen Koerperregionen wieder . Neue Vakuumversiegelung ) ( oder wiederentdeckte Therapieverfahren ( progressive Hautdistraktion ) ersetzen nicht die bisherigen komplett , sondern sind in den Gesamttherapieplan realistisch integriert . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O" ]
Posttraumatische Weichteildefekte , die nicht primaer verschlossen werden koennen , isoliert oder in Kombination mit Knochendefekten , stellen wegen ihrer unterschiedlichen Aetiologie und Auspraegungen ein komplexes diagnostisches und therapeutisches Problem dar . Um aus der Vielzahl der moeglichen Therapieverfahren das fuer den Patienten optimale herauszusuchen und nicht Modeerscheinungen oder irrealen Suggestionen zu erliegen , bedarf es einer exakten Beschreibung des vorliegenden Defekts , der richtigen Wahl des Operationszeitpunktes und der Kenntnis aller therapeutischen Moeglichkeiten . Das vorgestellte Gesamttherapiekonzept spiegelt unsere Erfahrung im Bereich der Weichteildeckung im Zeitraum von 1981-1995 nach ueber 5000 Hauttransplantationen , 3000 lokale Lappenplastiken , 200 gestielte Fernlappenplastiken und 1200 freie mikrovaskulaeren Gewebetransplantationen zu allen Koerperregionen wieder . Neue Vakuumversiegelung ) ( oder wiederentdeckte Therapieverfahren ( progressive Hautdistraktion ) ersetzen nicht die bisherigen komplett , sondern sind in den Gesamttherapieplan realistisch integriert .
[ "Posttraumatische", "Weichteildefekte", ",", "die", "nicht", "primaer", "verschlossen", "werden", "koennen", ",", "isoliert", "oder", "in", "Kombination", "mit", "Knochendefekten", ",", "stellen", "wegen", "ihrer", "unterschiedlichen", "Aetiologie", "und", "Auspraegungen", "ein", "komplexes", "diagnostisches", "und", "therapeutisches", "Problem", "dar", ".", "Um", "aus", "der", "Vielzahl", "der", "moeglichen", "Therapieverfahren", "das", "fuer", "den", "Patienten", "optimale", "herauszusuchen", "und", "nicht", "Modeerscheinungen", "oder", "irrealen", "Suggestionen", "zu", "erliegen", ",", "bedarf", "es", "einer", "exakten", "Beschreibung", "des", "vorliegenden", "Defekts", ",", "der", "richtigen", "Wahl", "des", "Operationszeitpunktes", "und", "der", "Kenntnis", "aller", "therapeutischen", "Moeglichkeiten", ".", "Das", "vorgestellte", "Gesamttherapiekonzept", "spiegelt", "unsere", "Erfahrung", "im", "Bereich", "der", "Weichteildeckung", "im", "Zeitraum", "von", "1981", "-", "1995", "nach", "ueber", "5000", "Hauttransplantationen", ",", "3000", "lokale", "Lappenplastiken", ",", "200", "gestielte", "Fernlappenplastiken", "und", "1200", "freie", "mikrovaskulaeren", "Gewebetransplantationen", "zu", "allen", "Koerperregionen", "wieder", ".", "Neue", "Vakuumversiegelung", ")", "(", "oder", "wiederentdeckte", "Therapieverfahren", "(", "progressive", "Hautdistraktion", ")", "ersetzen", "nicht", "die", "bisherigen", "komplett", ",", "sondern", "sind", "in", "den", "Gesamttherapieplan", "realistisch", "integriert", "." ]
[ "umlsterm" ]
Knochendefekten is an umlsterm, Aetiologie is an umlsterm, Therapieverfahren is an umlsterm, Patienten is an umlsterm, Suggestionen is an umlsterm, Gesamttherapiekonzept is an umlsterm, Hauttransplantationen is an umlsterm, Lappenplastiken is an umlsterm, Fernlappenplastiken is an umlsterm, Gewebetransplantationen is an umlsterm, Koerperregionen is an umlsterm, Vakuumversiegelung is an umlsterm, Therapieverfahren is an umlsterm, Hautdistraktion is an umlsterm, Gesamttherapieplan is an umlsterm
DerOrthopaede.70260470.ger.abstr_task1
Sentence: Posttraumatische Weichteildefekte , die nicht primaer verschlossen werden koennen , isoliert oder in Kombination mit Knochendefekten , stellen wegen ihrer unterschiedlichen Aetiologie und Auspraegungen ein komplexes diagnostisches und therapeutisches Problem dar . Um aus der Vielzahl der moeglichen Therapieverfahren das fuer den Patienten optimale herauszusuchen und nicht Modeerscheinungen oder irrealen Suggestionen zu erliegen , bedarf es einer exakten Beschreibung des vorliegenden Defekts , der richtigen Wahl des Operationszeitpunktes und der Kenntnis aller therapeutischen Moeglichkeiten . Das vorgestellte Gesamttherapiekonzept spiegelt unsere Erfahrung im Bereich der Weichteildeckung im Zeitraum von 1981-1995 nach ueber 5000 Hauttransplantationen , 3000 lokale Lappenplastiken , 200 gestielte Fernlappenplastiken und 1200 freie mikrovaskulaeren Gewebetransplantationen zu allen Koerperregionen wieder . Neue Vakuumversiegelung ) ( oder wiederentdeckte Therapieverfahren ( progressive Hautdistraktion ) ersetzen nicht die bisherigen komplett , sondern sind in den Gesamttherapieplan realistisch integriert . Instructions: please typing these entity words according to sentence: Knochendefekten, Aetiologie, Therapieverfahren, Patienten, Suggestionen, Gesamttherapiekonzept, Hauttransplantationen, Lappenplastiken, Fernlappenplastiken, Gewebetransplantationen, Koerperregionen, Vakuumversiegelung, Therapieverfahren, Hautdistraktion, Gesamttherapieplan Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O" ]
Posttraumatische Weichteildefekte , die nicht primaer verschlossen werden koennen , isoliert oder in Kombination mit Knochendefekten , stellen wegen ihrer unterschiedlichen Aetiologie und Auspraegungen ein komplexes diagnostisches und therapeutisches Problem dar . Um aus der Vielzahl der moeglichen Therapieverfahren das fuer den Patienten optimale herauszusuchen und nicht Modeerscheinungen oder irrealen Suggestionen zu erliegen , bedarf es einer exakten Beschreibung des vorliegenden Defekts , der richtigen Wahl des Operationszeitpunktes und der Kenntnis aller therapeutischen Moeglichkeiten . Das vorgestellte Gesamttherapiekonzept spiegelt unsere Erfahrung im Bereich der Weichteildeckung im Zeitraum von 1981-1995 nach ueber 5000 Hauttransplantationen , 3000 lokale Lappenplastiken , 200 gestielte Fernlappenplastiken und 1200 freie mikrovaskulaeren Gewebetransplantationen zu allen Koerperregionen wieder . Neue Vakuumversiegelung ) ( oder wiederentdeckte Therapieverfahren ( progressive Hautdistraktion ) ersetzen nicht die bisherigen komplett , sondern sind in den Gesamttherapieplan realistisch integriert .
[ "Posttraumatische", "Weichteildefekte", ",", "die", "nicht", "primaer", "verschlossen", "werden", "koennen", ",", "isoliert", "oder", "in", "Kombination", "mit", "Knochendefekten", ",", "stellen", "wegen", "ihrer", "unterschiedlichen", "Aetiologie", "und", "Auspraegungen", "ein", "komplexes", "diagnostisches", "und", "therapeutisches", "Problem", "dar", ".", "Um", "aus", "der", "Vielzahl", "der", "moeglichen", "Therapieverfahren", "das", "fuer", "den", "Patienten", "optimale", "herauszusuchen", "und", "nicht", "Modeerscheinungen", "oder", "irrealen", "Suggestionen", "zu", "erliegen", ",", "bedarf", "es", "einer", "exakten", "Beschreibung", "des", "vorliegenden", "Defekts", ",", "der", "richtigen", "Wahl", "des", "Operationszeitpunktes", "und", "der", "Kenntnis", "aller", "therapeutischen", "Moeglichkeiten", ".", "Das", "vorgestellte", "Gesamttherapiekonzept", "spiegelt", "unsere", "Erfahrung", "im", "Bereich", "der", "Weichteildeckung", "im", "Zeitraum", "von", "1981", "-", "1995", "nach", "ueber", "5000", "Hauttransplantationen", ",", "3000", "lokale", "Lappenplastiken", ",", "200", "gestielte", "Fernlappenplastiken", "und", "1200", "freie", "mikrovaskulaeren", "Gewebetransplantationen", "zu", "allen", "Koerperregionen", "wieder", ".", "Neue", "Vakuumversiegelung", ")", "(", "oder", "wiederentdeckte", "Therapieverfahren", "(", "progressive", "Hautdistraktion", ")", "ersetzen", "nicht", "die", "bisherigen", "komplett", ",", "sondern", "sind", "in", "den", "Gesamttherapieplan", "realistisch", "integriert", "." ]
[ "umlsterm" ]
Knochendefekten, Aetiologie, Therapieverfahren, Patienten, Suggestionen, Gesamttherapiekonzept, Hauttransplantationen, Lappenplastiken, Fernlappenplastiken, Gewebetransplantationen, Koerperregionen, Vakuumversiegelung, Therapieverfahren, Hautdistraktion, Gesamttherapieplan
DerOrthopaede.70260470.ger.abstr_task2
Sentence: Posttraumatische Weichteildefekte , die nicht primaer verschlossen werden koennen , isoliert oder in Kombination mit Knochendefekten , stellen wegen ihrer unterschiedlichen Aetiologie und Auspraegungen ein komplexes diagnostisches und therapeutisches Problem dar . Um aus der Vielzahl der moeglichen Therapieverfahren das fuer den Patienten optimale herauszusuchen und nicht Modeerscheinungen oder irrealen Suggestionen zu erliegen , bedarf es einer exakten Beschreibung des vorliegenden Defekts , der richtigen Wahl des Operationszeitpunktes und der Kenntnis aller therapeutischen Moeglichkeiten . Das vorgestellte Gesamttherapiekonzept spiegelt unsere Erfahrung im Bereich der Weichteildeckung im Zeitraum von 1981-1995 nach ueber 5000 Hauttransplantationen , 3000 lokale Lappenplastiken , 200 gestielte Fernlappenplastiken und 1200 freie mikrovaskulaeren Gewebetransplantationen zu allen Koerperregionen wieder . Neue Vakuumversiegelung ) ( oder wiederentdeckte Therapieverfahren ( progressive Hautdistraktion ) ersetzen nicht die bisherigen komplett , sondern sind in den Gesamttherapieplan realistisch integriert . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O" ]
Posttraumatische Weichteildefekte , die nicht primaer verschlossen werden koennen , isoliert oder in Kombination mit Knochendefekten , stellen wegen ihrer unterschiedlichen Aetiologie und Auspraegungen ein komplexes diagnostisches und therapeutisches Problem dar . Um aus der Vielzahl der moeglichen Therapieverfahren das fuer den Patienten optimale herauszusuchen und nicht Modeerscheinungen oder irrealen Suggestionen zu erliegen , bedarf es einer exakten Beschreibung des vorliegenden Defekts , der richtigen Wahl des Operationszeitpunktes und der Kenntnis aller therapeutischen Moeglichkeiten . Das vorgestellte Gesamttherapiekonzept spiegelt unsere Erfahrung im Bereich der Weichteildeckung im Zeitraum von 1981-1995 nach ueber 5000 Hauttransplantationen , 3000 lokale Lappenplastiken , 200 gestielte Fernlappenplastiken und 1200 freie mikrovaskulaeren Gewebetransplantationen zu allen Koerperregionen wieder . Neue Vakuumversiegelung ) ( oder wiederentdeckte Therapieverfahren ( progressive Hautdistraktion ) ersetzen nicht die bisherigen komplett , sondern sind in den Gesamttherapieplan realistisch integriert .
[ "Posttraumatische", "Weichteildefekte", ",", "die", "nicht", "primaer", "verschlossen", "werden", "koennen", ",", "isoliert", "oder", "in", "Kombination", "mit", "Knochendefekten", ",", "stellen", "wegen", "ihrer", "unterschiedlichen", "Aetiologie", "und", "Auspraegungen", "ein", "komplexes", "diagnostisches", "und", "therapeutisches", "Problem", "dar", ".", "Um", "aus", "der", "Vielzahl", "der", "moeglichen", "Therapieverfahren", "das", "fuer", "den", "Patienten", "optimale", "herauszusuchen", "und", "nicht", "Modeerscheinungen", "oder", "irrealen", "Suggestionen", "zu", "erliegen", ",", "bedarf", "es", "einer", "exakten", "Beschreibung", "des", "vorliegenden", "Defekts", ",", "der", "richtigen", "Wahl", "des", "Operationszeitpunktes", "und", "der", "Kenntnis", "aller", "therapeutischen", "Moeglichkeiten", ".", "Das", "vorgestellte", "Gesamttherapiekonzept", "spiegelt", "unsere", "Erfahrung", "im", "Bereich", "der", "Weichteildeckung", "im", "Zeitraum", "von", "1981", "-", "1995", "nach", "ueber", "5000", "Hauttransplantationen", ",", "3000", "lokale", "Lappenplastiken", ",", "200", "gestielte", "Fernlappenplastiken", "und", "1200", "freie", "mikrovaskulaeren", "Gewebetransplantationen", "zu", "allen", "Koerperregionen", "wieder", ".", "Neue", "Vakuumversiegelung", ")", "(", "oder", "wiederentdeckte", "Therapieverfahren", "(", "progressive", "Hautdistraktion", ")", "ersetzen", "nicht", "die", "bisherigen", "komplett", ",", "sondern", "sind", "in", "den", "Gesamttherapieplan", "realistisch", "integriert", "." ]
[ "umlsterm" ]
etodolac is a DRUG, etodolac is a DRUG, Etodolac is a DRUG, Etodolac is a DRUG, etodolac is a DRUG, etodolac is a DRUG, etodolac is a DRUG, etodolac is a DRUG
7744123_task0
Sentence: Pharmacokinetic profile of etodolac in special populations. The pharmacokinetics of etodolac in healthy normal volunteers has been extensively studied and is well described. Etodolac is characterised by a high oral bioavailability, low clearance, a small volume of distribution, and a 7-hour half-life. It is essentially completely metabolised, therefore little is excreted unchanged. Etodolac is highly protein bound. To investigate the effect of disease states or concomitant drug administration on a patient's response to etodolac, additional pharmacokinetic studies were carried out in special populations. Since etodolac has a well-defined pharmacokinetic-pharmacodynamic relationship, measurement of pharmacokinetic parameters is clinically relevant. Data from studies to date show that disease states, underlying conditions, and concomitantly administered highly protein-bound drugs have essentially no effect on etodolac pharmacokinetics. Therefore, etodolac can generally be given without the need for dosage modifications in special populations such as uncompromised elderly patients, those with moderate renal impairment, and patients with stable hepatic disease. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: DRUG
[ "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Pharmacokinetic profile of etodolac in special populations. The pharmacokinetics of etodolac in healthy normal volunteers has been extensively studied and is well described. Etodolac is characterised by a high oral bioavailability, low clearance, a small volume of distribution, and a 7-hour half-life. It is essentially completely metabolised, therefore little is excreted unchanged. Etodolac is highly protein bound. To investigate the effect of disease states or concomitant drug administration on a patient's response to etodolac, additional pharmacokinetic studies were carried out in special populations. Since etodolac has a well-defined pharmacokinetic-pharmacodynamic relationship, measurement of pharmacokinetic parameters is clinically relevant. Data from studies to date show that disease states, underlying conditions, and concomitantly administered highly protein-bound drugs have essentially no effect on etodolac pharmacokinetics. Therefore, etodolac can generally be given without the need for dosage modifications in special populations such as uncompromised elderly patients, those with moderate renal impairment, and patients with stable hepatic disease.
[ "Pharmacokinetic", "profile", "of", "etodolac", "in", "special", "populations", ".", "The", "pharmacokinetics", "of", "etodolac", "in", "healthy", "normal", "volunteers", "has", "been", "extensively", "studied", "and", "is", "well", "described", ".", "Etodolac", "is", "characterised", "by", "a", "high", "oral", "bioavailability", ",", "low", "clearance", ",", "a", "small", "volume", "of", "distribution", ",", "and", "a", "7-hour", "half", "-", "life", ".", "It", "is", "essentially", "completely", "metabolised", ",", "therefore", "little", "is", "excreted", "unchanged", ".", "Etodolac", "is", "highly", "protein", "bound", ".", "To", "investigate", "the", "effect", "of", "disease", "states", "or", "concomitant", "drug", "administration", "on", "a", "patient", "'s", "response", "to", "etodolac", ",", "additional", "pharmacokinetic", "studies", "were", "carried", "out", "in", "special", "populations", ".", "Since", "etodolac", "has", "a", "well", "-", "defined", "pharmacokinetic", "-", "pharmacodynamic", "relationship", ",", "measurement", "of", "pharmacokinetic", "parameters", "is", "clinically", "relevant", ".", "Data", "from", "studies", "to", "date", "show", "that", "disease", "states", ",", "underlying", "conditions", ",", "and", "concomitantly", "administered", "highly", "protein", "-", "bound", "drugs", "have", "essentially", "no", "effect", "on", "etodolac", "pharmacokinetics", ".", "Therefore", ",", "etodolac", "can", "generally", "be", "given", "without", "the", "need", "for", "dosage", "modifications", "in", "special", "populations", "such", "as", "uncompromised", "elderly", "patients", ",", "those", "with", "moderate", "renal", "impairment", ",", "and", "patients", "with", "stable", "hepatic", "disease", "." ]
[ "DRUG" ]
etodolac is a DRUG, etodolac is a DRUG, Etodolac is a DRUG, Etodolac is a DRUG, etodolac is a DRUG, etodolac is a DRUG, etodolac is a DRUG, etodolac is a DRUG
7744123_task1
Sentence: Pharmacokinetic profile of etodolac in special populations. The pharmacokinetics of etodolac in healthy normal volunteers has been extensively studied and is well described. Etodolac is characterised by a high oral bioavailability, low clearance, a small volume of distribution, and a 7-hour half-life. It is essentially completely metabolised, therefore little is excreted unchanged. Etodolac is highly protein bound. To investigate the effect of disease states or concomitant drug administration on a patient's response to etodolac, additional pharmacokinetic studies were carried out in special populations. Since etodolac has a well-defined pharmacokinetic-pharmacodynamic relationship, measurement of pharmacokinetic parameters is clinically relevant. Data from studies to date show that disease states, underlying conditions, and concomitantly administered highly protein-bound drugs have essentially no effect on etodolac pharmacokinetics. Therefore, etodolac can generally be given without the need for dosage modifications in special populations such as uncompromised elderly patients, those with moderate renal impairment, and patients with stable hepatic disease. Instructions: please typing these entity words according to sentence: etodolac, etodolac, Etodolac, Etodolac, etodolac, etodolac, etodolac, etodolac Options: DRUG
[ "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Pharmacokinetic profile of etodolac in special populations. The pharmacokinetics of etodolac in healthy normal volunteers has been extensively studied and is well described. Etodolac is characterised by a high oral bioavailability, low clearance, a small volume of distribution, and a 7-hour half-life. It is essentially completely metabolised, therefore little is excreted unchanged. Etodolac is highly protein bound. To investigate the effect of disease states or concomitant drug administration on a patient's response to etodolac, additional pharmacokinetic studies were carried out in special populations. Since etodolac has a well-defined pharmacokinetic-pharmacodynamic relationship, measurement of pharmacokinetic parameters is clinically relevant. Data from studies to date show that disease states, underlying conditions, and concomitantly administered highly protein-bound drugs have essentially no effect on etodolac pharmacokinetics. Therefore, etodolac can generally be given without the need for dosage modifications in special populations such as uncompromised elderly patients, those with moderate renal impairment, and patients with stable hepatic disease.
[ "Pharmacokinetic", "profile", "of", "etodolac", "in", "special", "populations", ".", "The", "pharmacokinetics", "of", "etodolac", "in", "healthy", "normal", "volunteers", "has", "been", "extensively", "studied", "and", "is", "well", "described", ".", "Etodolac", "is", "characterised", "by", "a", "high", "oral", "bioavailability", ",", "low", "clearance", ",", "a", "small", "volume", "of", "distribution", ",", "and", "a", "7-hour", "half", "-", "life", ".", "It", "is", "essentially", "completely", "metabolised", ",", "therefore", "little", "is", "excreted", "unchanged", ".", "Etodolac", "is", "highly", "protein", "bound", ".", "To", "investigate", "the", "effect", "of", "disease", "states", "or", "concomitant", "drug", "administration", "on", "a", "patient", "'s", "response", "to", "etodolac", ",", "additional", "pharmacokinetic", "studies", "were", "carried", "out", "in", "special", "populations", ".", "Since", "etodolac", "has", "a", "well", "-", "defined", "pharmacokinetic", "-", "pharmacodynamic", "relationship", ",", "measurement", "of", "pharmacokinetic", "parameters", "is", "clinically", "relevant", ".", "Data", "from", "studies", "to", "date", "show", "that", "disease", "states", ",", "underlying", "conditions", ",", "and", "concomitantly", "administered", "highly", "protein", "-", "bound", "drugs", "have", "essentially", "no", "effect", "on", "etodolac", "pharmacokinetics", ".", "Therefore", ",", "etodolac", "can", "generally", "be", "given", "without", "the", "need", "for", "dosage", "modifications", "in", "special", "populations", "such", "as", "uncompromised", "elderly", "patients", ",", "those", "with", "moderate", "renal", "impairment", ",", "and", "patients", "with", "stable", "hepatic", "disease", "." ]
[ "DRUG" ]
etodolac, etodolac, Etodolac, Etodolac, etodolac, etodolac, etodolac, etodolac
7744123_task2
Sentence: Pharmacokinetic profile of etodolac in special populations. The pharmacokinetics of etodolac in healthy normal volunteers has been extensively studied and is well described. Etodolac is characterised by a high oral bioavailability, low clearance, a small volume of distribution, and a 7-hour half-life. It is essentially completely metabolised, therefore little is excreted unchanged. Etodolac is highly protein bound. To investigate the effect of disease states or concomitant drug administration on a patient's response to etodolac, additional pharmacokinetic studies were carried out in special populations. Since etodolac has a well-defined pharmacokinetic-pharmacodynamic relationship, measurement of pharmacokinetic parameters is clinically relevant. Data from studies to date show that disease states, underlying conditions, and concomitantly administered highly protein-bound drugs have essentially no effect on etodolac pharmacokinetics. Therefore, etodolac can generally be given without the need for dosage modifications in special populations such as uncompromised elderly patients, those with moderate renal impairment, and patients with stable hepatic disease. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Pharmacokinetic profile of etodolac in special populations. The pharmacokinetics of etodolac in healthy normal volunteers has been extensively studied and is well described. Etodolac is characterised by a high oral bioavailability, low clearance, a small volume of distribution, and a 7-hour half-life. It is essentially completely metabolised, therefore little is excreted unchanged. Etodolac is highly protein bound. To investigate the effect of disease states or concomitant drug administration on a patient's response to etodolac, additional pharmacokinetic studies were carried out in special populations. Since etodolac has a well-defined pharmacokinetic-pharmacodynamic relationship, measurement of pharmacokinetic parameters is clinically relevant. Data from studies to date show that disease states, underlying conditions, and concomitantly administered highly protein-bound drugs have essentially no effect on etodolac pharmacokinetics. Therefore, etodolac can generally be given without the need for dosage modifications in special populations such as uncompromised elderly patients, those with moderate renal impairment, and patients with stable hepatic disease.
[ "Pharmacokinetic", "profile", "of", "etodolac", "in", "special", "populations", ".", "The", "pharmacokinetics", "of", "etodolac", "in", "healthy", "normal", "volunteers", "has", "been", "extensively", "studied", "and", "is", "well", "described", ".", "Etodolac", "is", "characterised", "by", "a", "high", "oral", "bioavailability", ",", "low", "clearance", ",", "a", "small", "volume", "of", "distribution", ",", "and", "a", "7-hour", "half", "-", "life", ".", "It", "is", "essentially", "completely", "metabolised", ",", "therefore", "little", "is", "excreted", "unchanged", ".", "Etodolac", "is", "highly", "protein", "bound", ".", "To", "investigate", "the", "effect", "of", "disease", "states", "or", "concomitant", "drug", "administration", "on", "a", "patient", "'s", "response", "to", "etodolac", ",", "additional", "pharmacokinetic", "studies", "were", "carried", "out", "in", "special", "populations", ".", "Since", "etodolac", "has", "a", "well", "-", "defined", "pharmacokinetic", "-", "pharmacodynamic", "relationship", ",", "measurement", "of", "pharmacokinetic", "parameters", "is", "clinically", "relevant", ".", "Data", "from", "studies", "to", "date", "show", "that", "disease", "states", ",", "underlying", "conditions", ",", "and", "concomitantly", "administered", "highly", "protein", "-", "bound", "drugs", "have", "essentially", "no", "effect", "on", "etodolac", "pharmacokinetics", ".", "Therefore", ",", "etodolac", "can", "generally", "be", "given", "without", "the", "need", "for", "dosage", "modifications", "in", "special", "populations", "such", "as", "uncompromised", "elderly", "patients", ",", "those", "with", "moderate", "renal", "impairment", ",", "and", "patients", "with", "stable", "hepatic", "disease", "." ]
[ "DRUG" ]
ovarian cancer is a DISEASE, ovarian cancer is a DISEASE, ovarian cancer is a DISEASE, cellular toxicity is a ADVERSE
example-126_task0
Sentence: Lentiviral short hairpin RNA screen of genes associated with multidrug resistance identifies PRP-4 as a new regulator of chemoresistance in human ovarian cancer. Published reports implicate a variety of mechanisms that may contribute to drug resistance in ovarian cancer. The chief aim of this study is to understand the relationship between overexpression of drug resistance associated genes and multidrug resistance in ovarian cancer. Using lentiviral short hairpin RNA collections targeting 132 genes identified from transcriptional profiling of drug-resistant cancer cell lines, individual knockdown experiments were done in the presence of sublethal doses of paclitaxel. Specific genes whose knockdown was found to be associated with cellular toxicity included MDR1 (ABCB1), survivin, and pre-mRNA processing factor-4 (PRP-4). These genes, when repressed, can reverse paclitaxel resistance in the multidrug-resistant cell line SKOV-3(TR) and OVCAR8(TR). Both MDR1 and survivin have been reported previously to play a role in multidrug resistance and chemotherapy-induced apoptosis; however, the effect of PRP-4 expression on drug sensitivity is currently unrecognized. PRP-4 belongs to the serine/threonine protein kinase family, plays a role in pre-mRNA splicing and cell mitosis, and interacts with CLK1. Northern analysis shows that PRP-4 is overexpressed in several paclitaxel-resistant cell lines and confirms that PRP-4 expression could be significantly repressed by PRP-4 lentiviral short hairpin RNA. Both clonogenic and MTT assays confirm that transcriptional repression of PRP-4 could reverse paclitaxel resistance 5-10-fold in SKOV-3(TR). Finally, overexpression of PRP-4 in drug-sensitive cells could induce a modest level of drug resistance to paclitaxel, doxorubicin, and vincristine. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: ADVERSE, DISEASE
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DISEASE", "I-DISEASE", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DISEASE", "I-DISEASE", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DISEASE", "I-DISEASE", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ADVERSE", "I-ADVERSE", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Lentiviral short hairpin RNA screen of genes associated with multidrug resistance identifies PRP-4 as a new regulator of chemoresistance in human ovarian cancer. Published reports implicate a variety of mechanisms that may contribute to drug resistance in ovarian cancer. The chief aim of this study is to understand the relationship between overexpression of drug resistance associated genes and multidrug resistance in ovarian cancer. Using lentiviral short hairpin RNA collections targeting 132 genes identified from transcriptional profiling of drug-resistant cancer cell lines, individual knockdown experiments were done in the presence of sublethal doses of paclitaxel. Specific genes whose knockdown was found to be associated with cellular toxicity included MDR1 (ABCB1), survivin, and pre-mRNA processing factor-4 (PRP-4). These genes, when repressed, can reverse paclitaxel resistance in the multidrug-resistant cell line SKOV-3(TR) and OVCAR8(TR). Both MDR1 and survivin have been reported previously to play a role in multidrug resistance and chemotherapy-induced apoptosis; however, the effect of PRP-4 expression on drug sensitivity is currently unrecognized. PRP-4 belongs to the serine/threonine protein kinase family, plays a role in pre-mRNA splicing and cell mitosis, and interacts with CLK1. Northern analysis shows that PRP-4 is overexpressed in several paclitaxel-resistant cell lines and confirms that PRP-4 expression could be significantly repressed by PRP-4 lentiviral short hairpin RNA. Both clonogenic and MTT assays confirm that transcriptional repression of PRP-4 could reverse paclitaxel resistance 5-10-fold in SKOV-3(TR). Finally, overexpression of PRP-4 in drug-sensitive cells could induce a modest level of drug resistance to paclitaxel, doxorubicin, and vincristine.
[ "Lentiviral", "short", "hairpin", "RNA", "screen", "of", "genes", "associated", "with", "multidrug", "resistance", "identifies", "PRP-4", "as", "a", "new", "regulator", "of", "chemoresistance", "in", "human", "ovarian", "cancer", ".", " ", "Published", "reports", "implicate", "a", "variety", "of", "mechanisms", "that", "may", "contribute", "to", "drug", "resistance", "in", "ovarian", "cancer", ".", "The", "chief", "aim", "of", "this", "study", "is", "to", "understand", "the", "relationship", "between", "overexpression", "of", "drug", "resistance", "associated", "genes", "and", "multidrug", "resistance", "in", "ovarian", "cancer", ".", "Using", "lentiviral", "short", "hairpin", "RNA", "collections", "targeting", "132", "genes", "identified", "from", "transcriptional", "profiling", "of", "drug", "-", "resistant", "cancer", "cell", "lines", ",", "individual", "knockdown", "experiments", "were", "done", "in", "the", "presence", "of", "sublethal", "doses", "of", "paclitaxel", ".", "Specific", "genes", "whose", "knockdown", "was", "found", "to", "be", "associated", "with", "cellular", "toxicity", "included", "MDR1", "(", "ABCB1", ")", ",", "survivin", ",", "and", "pre", "-", "mRNA", "processing", "factor-4", "(", "PRP-4", ")", ".", "These", "genes", ",", "when", "repressed", ",", "can", "reverse", "paclitaxel", "resistance", "in", "the", "multidrug", "-", "resistant", "cell", "line", "SKOV-3(TR", ")", "and", "OVCAR8(TR", ")", ".", "Both", "MDR1", "and", "survivin", "have", "been", "reported", "previously", "to", "play", "a", "role", "in", "multidrug", "resistance", "and", "chemotherapy", "-", "induced", "apoptosis", ";", "however", ",", "the", "effect", "of", "PRP-4", "expression", "on", "drug", "sensitivity", "is", "currently", "unrecognized", ".", "PRP-4", "belongs", "to", "the", "serine", "/", "threonine", "protein", "kinase", "family", ",", "plays", "a", "role", "in", "pre", "-", "mRNA", "splicing", "and", "cell", "mitosis", ",", "and", "interacts", "with", "CLK1", ".", "Northern", "analysis", "shows", "that", "PRP-4", "is", "overexpressed", "in", "several", "paclitaxel", "-", "resistant", "cell", "lines", "and", "confirms", "that", "PRP-4", "expression", "could", "be", "significantly", "repressed", "by", "PRP-4", "lentiviral", "short", "hairpin", "RNA", ".", "Both", "clonogenic", "and", "MTT", "assays", "confirm", "that", "transcriptional", "repression", "of", "PRP-4", "could", "reverse", "paclitaxel", "resistance", "5", "-", "10-fold", "in", "SKOV-3(TR", ")", ".", "Finally", ",", "overexpression", "of", "PRP-4", "in", "drug", "-", "sensitive", "cells", "could", "induce", "a", "modest", "level", "of", "drug", "resistance", "to", "paclitaxel", ",", "doxorubicin", ",", "and", "vincristine", "." ]
[ "ADVERSE", "DISEASE" ]
ovarian cancer is a DISEASE, ovarian cancer is a DISEASE, ovarian cancer is a DISEASE, cellular toxicity is a ADVERSE
example-126_task1
Sentence: Lentiviral short hairpin RNA screen of genes associated with multidrug resistance identifies PRP-4 as a new regulator of chemoresistance in human ovarian cancer. Published reports implicate a variety of mechanisms that may contribute to drug resistance in ovarian cancer. The chief aim of this study is to understand the relationship between overexpression of drug resistance associated genes and multidrug resistance in ovarian cancer. Using lentiviral short hairpin RNA collections targeting 132 genes identified from transcriptional profiling of drug-resistant cancer cell lines, individual knockdown experiments were done in the presence of sublethal doses of paclitaxel. Specific genes whose knockdown was found to be associated with cellular toxicity included MDR1 (ABCB1), survivin, and pre-mRNA processing factor-4 (PRP-4). These genes, when repressed, can reverse paclitaxel resistance in the multidrug-resistant cell line SKOV-3(TR) and OVCAR8(TR). Both MDR1 and survivin have been reported previously to play a role in multidrug resistance and chemotherapy-induced apoptosis; however, the effect of PRP-4 expression on drug sensitivity is currently unrecognized. PRP-4 belongs to the serine/threonine protein kinase family, plays a role in pre-mRNA splicing and cell mitosis, and interacts with CLK1. Northern analysis shows that PRP-4 is overexpressed in several paclitaxel-resistant cell lines and confirms that PRP-4 expression could be significantly repressed by PRP-4 lentiviral short hairpin RNA. Both clonogenic and MTT assays confirm that transcriptional repression of PRP-4 could reverse paclitaxel resistance 5-10-fold in SKOV-3(TR). Finally, overexpression of PRP-4 in drug-sensitive cells could induce a modest level of drug resistance to paclitaxel, doxorubicin, and vincristine. Instructions: please typing these entity words according to sentence: ovarian cancer, ovarian cancer, ovarian cancer, cellular toxicity Options: ADVERSE, DISEASE
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DISEASE", "I-DISEASE", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DISEASE", "I-DISEASE", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DISEASE", "I-DISEASE", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ADVERSE", "I-ADVERSE", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Lentiviral short hairpin RNA screen of genes associated with multidrug resistance identifies PRP-4 as a new regulator of chemoresistance in human ovarian cancer. Published reports implicate a variety of mechanisms that may contribute to drug resistance in ovarian cancer. The chief aim of this study is to understand the relationship between overexpression of drug resistance associated genes and multidrug resistance in ovarian cancer. Using lentiviral short hairpin RNA collections targeting 132 genes identified from transcriptional profiling of drug-resistant cancer cell lines, individual knockdown experiments were done in the presence of sublethal doses of paclitaxel. Specific genes whose knockdown was found to be associated with cellular toxicity included MDR1 (ABCB1), survivin, and pre-mRNA processing factor-4 (PRP-4). These genes, when repressed, can reverse paclitaxel resistance in the multidrug-resistant cell line SKOV-3(TR) and OVCAR8(TR). Both MDR1 and survivin have been reported previously to play a role in multidrug resistance and chemotherapy-induced apoptosis; however, the effect of PRP-4 expression on drug sensitivity is currently unrecognized. PRP-4 belongs to the serine/threonine protein kinase family, plays a role in pre-mRNA splicing and cell mitosis, and interacts with CLK1. Northern analysis shows that PRP-4 is overexpressed in several paclitaxel-resistant cell lines and confirms that PRP-4 expression could be significantly repressed by PRP-4 lentiviral short hairpin RNA. Both clonogenic and MTT assays confirm that transcriptional repression of PRP-4 could reverse paclitaxel resistance 5-10-fold in SKOV-3(TR). Finally, overexpression of PRP-4 in drug-sensitive cells could induce a modest level of drug resistance to paclitaxel, doxorubicin, and vincristine.
[ "Lentiviral", "short", "hairpin", "RNA", "screen", "of", "genes", "associated", "with", "multidrug", "resistance", "identifies", "PRP-4", "as", "a", "new", "regulator", "of", "chemoresistance", "in", "human", "ovarian", "cancer", ".", " ", "Published", "reports", "implicate", "a", "variety", "of", "mechanisms", "that", "may", "contribute", "to", "drug", "resistance", "in", "ovarian", "cancer", ".", "The", "chief", "aim", "of", "this", "study", "is", "to", "understand", "the", "relationship", "between", "overexpression", "of", "drug", "resistance", "associated", "genes", "and", "multidrug", "resistance", "in", "ovarian", "cancer", ".", "Using", "lentiviral", "short", "hairpin", "RNA", "collections", "targeting", "132", "genes", "identified", "from", "transcriptional", "profiling", "of", "drug", "-", "resistant", "cancer", "cell", "lines", ",", "individual", "knockdown", "experiments", "were", "done", "in", "the", "presence", "of", "sublethal", "doses", "of", "paclitaxel", ".", "Specific", "genes", "whose", "knockdown", "was", "found", "to", "be", "associated", "with", "cellular", "toxicity", "included", "MDR1", "(", "ABCB1", ")", ",", "survivin", ",", "and", "pre", "-", "mRNA", "processing", "factor-4", "(", "PRP-4", ")", ".", "These", "genes", ",", "when", "repressed", ",", "can", "reverse", "paclitaxel", "resistance", "in", "the", "multidrug", "-", "resistant", "cell", "line", "SKOV-3(TR", ")", "and", "OVCAR8(TR", ")", ".", "Both", "MDR1", "and", "survivin", "have", "been", "reported", "previously", "to", "play", "a", "role", "in", "multidrug", "resistance", "and", "chemotherapy", "-", "induced", "apoptosis", ";", "however", ",", "the", "effect", "of", "PRP-4", "expression", "on", "drug", "sensitivity", "is", "currently", "unrecognized", ".", "PRP-4", "belongs", "to", "the", "serine", "/", "threonine", "protein", "kinase", "family", ",", "plays", "a", "role", "in", "pre", "-", "mRNA", "splicing", "and", "cell", "mitosis", ",", "and", "interacts", "with", "CLK1", ".", "Northern", "analysis", "shows", "that", "PRP-4", "is", "overexpressed", "in", "several", "paclitaxel", "-", "resistant", "cell", "lines", "and", "confirms", "that", "PRP-4", "expression", "could", "be", "significantly", "repressed", "by", "PRP-4", "lentiviral", "short", "hairpin", "RNA", ".", "Both", "clonogenic", "and", "MTT", "assays", "confirm", "that", "transcriptional", "repression", "of", "PRP-4", "could", "reverse", "paclitaxel", "resistance", "5", "-", "10-fold", "in", "SKOV-3(TR", ")", ".", "Finally", ",", "overexpression", "of", "PRP-4", "in", "drug", "-", "sensitive", "cells", "could", "induce", "a", "modest", "level", "of", "drug", "resistance", "to", "paclitaxel", ",", "doxorubicin", ",", "and", "vincristine", "." ]
[ "ADVERSE", "DISEASE" ]
ovarian cancer, ovarian cancer, ovarian cancer, cellular toxicity
example-126_task2
Sentence: Lentiviral short hairpin RNA screen of genes associated with multidrug resistance identifies PRP-4 as a new regulator of chemoresistance in human ovarian cancer. Published reports implicate a variety of mechanisms that may contribute to drug resistance in ovarian cancer. The chief aim of this study is to understand the relationship between overexpression of drug resistance associated genes and multidrug resistance in ovarian cancer. Using lentiviral short hairpin RNA collections targeting 132 genes identified from transcriptional profiling of drug-resistant cancer cell lines, individual knockdown experiments were done in the presence of sublethal doses of paclitaxel. Specific genes whose knockdown was found to be associated with cellular toxicity included MDR1 (ABCB1), survivin, and pre-mRNA processing factor-4 (PRP-4). These genes, when repressed, can reverse paclitaxel resistance in the multidrug-resistant cell line SKOV-3(TR) and OVCAR8(TR). Both MDR1 and survivin have been reported previously to play a role in multidrug resistance and chemotherapy-induced apoptosis; however, the effect of PRP-4 expression on drug sensitivity is currently unrecognized. PRP-4 belongs to the serine/threonine protein kinase family, plays a role in pre-mRNA splicing and cell mitosis, and interacts with CLK1. Northern analysis shows that PRP-4 is overexpressed in several paclitaxel-resistant cell lines and confirms that PRP-4 expression could be significantly repressed by PRP-4 lentiviral short hairpin RNA. Both clonogenic and MTT assays confirm that transcriptional repression of PRP-4 could reverse paclitaxel resistance 5-10-fold in SKOV-3(TR). Finally, overexpression of PRP-4 in drug-sensitive cells could induce a modest level of drug resistance to paclitaxel, doxorubicin, and vincristine. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DISEASE", "I-DISEASE", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DISEASE", "I-DISEASE", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DISEASE", "I-DISEASE", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ADVERSE", "I-ADVERSE", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Lentiviral short hairpin RNA screen of genes associated with multidrug resistance identifies PRP-4 as a new regulator of chemoresistance in human ovarian cancer. Published reports implicate a variety of mechanisms that may contribute to drug resistance in ovarian cancer. The chief aim of this study is to understand the relationship between overexpression of drug resistance associated genes and multidrug resistance in ovarian cancer. Using lentiviral short hairpin RNA collections targeting 132 genes identified from transcriptional profiling of drug-resistant cancer cell lines, individual knockdown experiments were done in the presence of sublethal doses of paclitaxel. Specific genes whose knockdown was found to be associated with cellular toxicity included MDR1 (ABCB1), survivin, and pre-mRNA processing factor-4 (PRP-4). These genes, when repressed, can reverse paclitaxel resistance in the multidrug-resistant cell line SKOV-3(TR) and OVCAR8(TR). Both MDR1 and survivin have been reported previously to play a role in multidrug resistance and chemotherapy-induced apoptosis; however, the effect of PRP-4 expression on drug sensitivity is currently unrecognized. PRP-4 belongs to the serine/threonine protein kinase family, plays a role in pre-mRNA splicing and cell mitosis, and interacts with CLK1. Northern analysis shows that PRP-4 is overexpressed in several paclitaxel-resistant cell lines and confirms that PRP-4 expression could be significantly repressed by PRP-4 lentiviral short hairpin RNA. Both clonogenic and MTT assays confirm that transcriptional repression of PRP-4 could reverse paclitaxel resistance 5-10-fold in SKOV-3(TR). Finally, overexpression of PRP-4 in drug-sensitive cells could induce a modest level of drug resistance to paclitaxel, doxorubicin, and vincristine.
[ "Lentiviral", "short", "hairpin", "RNA", "screen", "of", "genes", "associated", "with", "multidrug", "resistance", "identifies", "PRP-4", "as", "a", "new", "regulator", "of", "chemoresistance", "in", "human", "ovarian", "cancer", ".", " ", "Published", "reports", "implicate", "a", "variety", "of", "mechanisms", "that", "may", "contribute", "to", "drug", "resistance", "in", "ovarian", "cancer", ".", "The", "chief", "aim", "of", "this", "study", "is", "to", "understand", "the", "relationship", "between", "overexpression", "of", "drug", "resistance", "associated", "genes", "and", "multidrug", "resistance", "in", "ovarian", "cancer", ".", "Using", "lentiviral", "short", "hairpin", "RNA", "collections", "targeting", "132", "genes", "identified", "from", "transcriptional", "profiling", "of", "drug", "-", "resistant", "cancer", "cell", "lines", ",", "individual", "knockdown", "experiments", "were", "done", "in", "the", "presence", "of", "sublethal", "doses", "of", "paclitaxel", ".", "Specific", "genes", "whose", "knockdown", "was", "found", "to", "be", "associated", "with", "cellular", "toxicity", "included", "MDR1", "(", "ABCB1", ")", ",", "survivin", ",", "and", "pre", "-", "mRNA", "processing", "factor-4", "(", "PRP-4", ")", ".", "These", "genes", ",", "when", "repressed", ",", "can", "reverse", "paclitaxel", "resistance", "in", "the", "multidrug", "-", "resistant", "cell", "line", "SKOV-3(TR", ")", "and", "OVCAR8(TR", ")", ".", "Both", "MDR1", "and", "survivin", "have", "been", "reported", "previously", "to", "play", "a", "role", "in", "multidrug", "resistance", "and", "chemotherapy", "-", "induced", "apoptosis", ";", "however", ",", "the", "effect", "of", "PRP-4", "expression", "on", "drug", "sensitivity", "is", "currently", "unrecognized", ".", "PRP-4", "belongs", "to", "the", "serine", "/", "threonine", "protein", "kinase", "family", ",", "plays", "a", "role", "in", "pre", "-", "mRNA", "splicing", "and", "cell", "mitosis", ",", "and", "interacts", "with", "CLK1", ".", "Northern", "analysis", "shows", "that", "PRP-4", "is", "overexpressed", "in", "several", "paclitaxel", "-", "resistant", "cell", "lines", "and", "confirms", "that", "PRP-4", "expression", "could", "be", "significantly", "repressed", "by", "PRP-4", "lentiviral", "short", "hairpin", "RNA", ".", "Both", "clonogenic", "and", "MTT", "assays", "confirm", "that", "transcriptional", "repression", "of", "PRP-4", "could", "reverse", "paclitaxel", "resistance", "5", "-", "10-fold", "in", "SKOV-3(TR", ")", ".", "Finally", ",", "overexpression", "of", "PRP-4", "in", "drug", "-", "sensitive", "cells", "could", "induce", "a", "modest", "level", "of", "drug", "resistance", "to", "paclitaxel", ",", "doxorubicin", ",", "and", "vincristine", "." ]
[ "ADVERSE", "DISEASE" ]
epidermal growth factor receptor is a GENE-Y, EGFR is a GENE-Y, anaplastic lymphoma kinase is a GENE-Y, ALK is a GENE-Y, EGFR is a GENE-Y, tyrosine kinase is a GENE-N, crizotinib is a CHEMICAL, ROS is a GENE-Y, c - MET is a GENE-Y, FGFR is a GENE-N, mTOR is a GENE-Y, IGFR is a GENE-Y, RET is a GENE-Y, K - RAS is a GENE-Y
11472_task0
Sentence: Novel therapeutic targets in non-small cell lung cancer. Oncogenic driver mutations frequently occur in lung cancer and play role in carcinogenesis. These mutations are usually associated with distinct clinical and histological features and are attractive targets for anticancer therapy. Recently, several molecularly distinct phenotypes of NSCLC based on specific and mutually exclusive genetic derangements have been described. Few targets like epidermal growth factor receptor (EGFR) mutations and anaplastic lymphoma kinase (ALK) gene rearrangements have successfully been targeted with EGFR tyrosine kinase inhibitors (TKIs) and crizotinib, respectively. Many more inhibitors of specific driver mutations involving genes like ROS, c-MET, FGFR, mTOR, IGFR and RET are currently under development. However, efforts to target some mutated genes like K-RAS have been unsuccessful. Moreover, the emerging challenge of acquired resistance to initially effective therapy is becoming another major concern. In this review recent data on novel molecular targets and their future prospects are discussed. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: CHEMICAL, GENE-Y, GENE-N
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "B-GENE-Y", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "B-GENE-N", "I-GENE-N", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "B-GENE-N", "O", "B-GENE-Y", "O", "B-GENE-Y", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Novel therapeutic targets in non-small cell lung cancer. Oncogenic driver mutations frequently occur in lung cancer and play role in carcinogenesis. These mutations are usually associated with distinct clinical and histological features and are attractive targets for anticancer therapy. Recently, several molecularly distinct phenotypes of NSCLC based on specific and mutually exclusive genetic derangements have been described. Few targets like epidermal growth factor receptor (EGFR) mutations and anaplastic lymphoma kinase (ALK) gene rearrangements have successfully been targeted with EGFR tyrosine kinase inhibitors (TKIs) and crizotinib, respectively. Many more inhibitors of specific driver mutations involving genes like ROS, c-MET, FGFR, mTOR, IGFR and RET are currently under development. However, efforts to target some mutated genes like K-RAS have been unsuccessful. Moreover, the emerging challenge of acquired resistance to initially effective therapy is becoming another major concern. In this review recent data on novel molecular targets and their future prospects are discussed.
[ "Novel", "therapeutic", "targets", "in", "non", "-", "small", "cell", "lung", "cancer", ".", "\n", "Oncogenic", "driver", "mutations", "frequently", "occur", "in", "lung", "cancer", "and", "play", "role", "in", "carcinogenesis", ".", "These", "mutations", "are", "usually", "associated", "with", "distinct", "clinical", "and", "histological", "features", "and", "are", "attractive", "targets", "for", "anticancer", "therapy", ".", "Recently", ",", "several", "molecularly", "distinct", "phenotypes", "of", "NSCLC", "based", "on", "specific", "and", "mutually", "exclusive", "genetic", "derangements", "have", "been", "described", ".", "Few", "targets", "like", "epidermal", "growth", "factor", "receptor", "(", "EGFR", ")", "mutations", "and", "anaplastic", "lymphoma", "kinase", "(", "ALK", ")", "gene", "rearrangements", "have", "successfully", "been", "targeted", "with", "EGFR", "tyrosine", "kinase", "inhibitors", "(", "TKIs", ")", "and", "crizotinib", ",", "respectively", ".", "Many", "more", "inhibitors", "of", "specific", "driver", "mutations", "involving", "genes", "like", "ROS", ",", "c", "-", "MET", ",", "FGFR", ",", "mTOR", ",", "IGFR", "and", "RET", "are", "currently", "under", "development", ".", "However", ",", "efforts", "to", "target", "some", "mutated", "genes", "like", "K", "-", "RAS", "have", "been", "unsuccessful", ".", "Moreover", ",", "the", "emerging", "challenge", "of", "acquired", "resistance", "to", "initially", "effective", "therapy", "is", "becoming", "another", "major", "concern", ".", "In", "this", "review", "recent", "data", "on", "novel", "molecular", "targets", "and", "their", "future", "prospects", "are", "discussed", "." ]
[ "GENE-Y", "GENE-N", "CHEMICAL" ]
epidermal growth factor receptor is a GENE-Y, EGFR is a GENE-Y, anaplastic lymphoma kinase is a GENE-Y, ALK is a GENE-Y, EGFR is a GENE-Y, tyrosine kinase is a GENE-N, crizotinib is a CHEMICAL, ROS is a GENE-Y, c - MET is a GENE-Y, FGFR is a GENE-N, mTOR is a GENE-Y, IGFR is a GENE-Y, RET is a GENE-Y, K - RAS is a GENE-Y
11472_task1
Sentence: Novel therapeutic targets in non-small cell lung cancer. Oncogenic driver mutations frequently occur in lung cancer and play role in carcinogenesis. These mutations are usually associated with distinct clinical and histological features and are attractive targets for anticancer therapy. Recently, several molecularly distinct phenotypes of NSCLC based on specific and mutually exclusive genetic derangements have been described. Few targets like epidermal growth factor receptor (EGFR) mutations and anaplastic lymphoma kinase (ALK) gene rearrangements have successfully been targeted with EGFR tyrosine kinase inhibitors (TKIs) and crizotinib, respectively. Many more inhibitors of specific driver mutations involving genes like ROS, c-MET, FGFR, mTOR, IGFR and RET are currently under development. However, efforts to target some mutated genes like K-RAS have been unsuccessful. Moreover, the emerging challenge of acquired resistance to initially effective therapy is becoming another major concern. In this review recent data on novel molecular targets and their future prospects are discussed. Instructions: please typing these entity words according to sentence: epidermal growth factor receptor, EGFR, anaplastic lymphoma kinase, ALK, EGFR, tyrosine kinase, crizotinib, ROS, c - MET, FGFR, mTOR, IGFR, RET, K - RAS Options: CHEMICAL, GENE-Y, GENE-N
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "B-GENE-Y", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "B-GENE-N", "I-GENE-N", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "B-GENE-N", "O", "B-GENE-Y", "O", "B-GENE-Y", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Novel therapeutic targets in non-small cell lung cancer. Oncogenic driver mutations frequently occur in lung cancer and play role in carcinogenesis. These mutations are usually associated with distinct clinical and histological features and are attractive targets for anticancer therapy. Recently, several molecularly distinct phenotypes of NSCLC based on specific and mutually exclusive genetic derangements have been described. Few targets like epidermal growth factor receptor (EGFR) mutations and anaplastic lymphoma kinase (ALK) gene rearrangements have successfully been targeted with EGFR tyrosine kinase inhibitors (TKIs) and crizotinib, respectively. Many more inhibitors of specific driver mutations involving genes like ROS, c-MET, FGFR, mTOR, IGFR and RET are currently under development. However, efforts to target some mutated genes like K-RAS have been unsuccessful. Moreover, the emerging challenge of acquired resistance to initially effective therapy is becoming another major concern. In this review recent data on novel molecular targets and their future prospects are discussed.
[ "Novel", "therapeutic", "targets", "in", "non", "-", "small", "cell", "lung", "cancer", ".", "\n", "Oncogenic", "driver", "mutations", "frequently", "occur", "in", "lung", "cancer", "and", "play", "role", "in", "carcinogenesis", ".", "These", "mutations", "are", "usually", "associated", "with", "distinct", "clinical", "and", "histological", "features", "and", "are", "attractive", "targets", "for", "anticancer", "therapy", ".", "Recently", ",", "several", "molecularly", "distinct", "phenotypes", "of", "NSCLC", "based", "on", "specific", "and", "mutually", "exclusive", "genetic", "derangements", "have", "been", "described", ".", "Few", "targets", "like", "epidermal", "growth", "factor", "receptor", "(", "EGFR", ")", "mutations", "and", "anaplastic", "lymphoma", "kinase", "(", "ALK", ")", "gene", "rearrangements", "have", "successfully", "been", "targeted", "with", "EGFR", "tyrosine", "kinase", "inhibitors", "(", "TKIs", ")", "and", "crizotinib", ",", "respectively", ".", "Many", "more", "inhibitors", "of", "specific", "driver", "mutations", "involving", "genes", "like", "ROS", ",", "c", "-", "MET", ",", "FGFR", ",", "mTOR", ",", "IGFR", "and", "RET", "are", "currently", "under", "development", ".", "However", ",", "efforts", "to", "target", "some", "mutated", "genes", "like", "K", "-", "RAS", "have", "been", "unsuccessful", ".", "Moreover", ",", "the", "emerging", "challenge", "of", "acquired", "resistance", "to", "initially", "effective", "therapy", "is", "becoming", "another", "major", "concern", ".", "In", "this", "review", "recent", "data", "on", "novel", "molecular", "targets", "and", "their", "future", "prospects", "are", "discussed", "." ]
[ "GENE-Y", "GENE-N", "CHEMICAL" ]
epidermal growth factor receptor, EGFR, anaplastic lymphoma kinase, ALK, EGFR, tyrosine kinase, crizotinib, ROS, c - MET, FGFR, mTOR, IGFR, RET, K - RAS
11472_task2
Sentence: Novel therapeutic targets in non-small cell lung cancer. Oncogenic driver mutations frequently occur in lung cancer and play role in carcinogenesis. These mutations are usually associated with distinct clinical and histological features and are attractive targets for anticancer therapy. Recently, several molecularly distinct phenotypes of NSCLC based on specific and mutually exclusive genetic derangements have been described. Few targets like epidermal growth factor receptor (EGFR) mutations and anaplastic lymphoma kinase (ALK) gene rearrangements have successfully been targeted with EGFR tyrosine kinase inhibitors (TKIs) and crizotinib, respectively. Many more inhibitors of specific driver mutations involving genes like ROS, c-MET, FGFR, mTOR, IGFR and RET are currently under development. However, efforts to target some mutated genes like K-RAS have been unsuccessful. Moreover, the emerging challenge of acquired resistance to initially effective therapy is becoming another major concern. In this review recent data on novel molecular targets and their future prospects are discussed. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "B-GENE-Y", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "B-GENE-N", "I-GENE-N", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "B-GENE-N", "O", "B-GENE-Y", "O", "B-GENE-Y", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "I-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Novel therapeutic targets in non-small cell lung cancer. Oncogenic driver mutations frequently occur in lung cancer and play role in carcinogenesis. These mutations are usually associated with distinct clinical and histological features and are attractive targets for anticancer therapy. Recently, several molecularly distinct phenotypes of NSCLC based on specific and mutually exclusive genetic derangements have been described. Few targets like epidermal growth factor receptor (EGFR) mutations and anaplastic lymphoma kinase (ALK) gene rearrangements have successfully been targeted with EGFR tyrosine kinase inhibitors (TKIs) and crizotinib, respectively. Many more inhibitors of specific driver mutations involving genes like ROS, c-MET, FGFR, mTOR, IGFR and RET are currently under development. However, efforts to target some mutated genes like K-RAS have been unsuccessful. Moreover, the emerging challenge of acquired resistance to initially effective therapy is becoming another major concern. In this review recent data on novel molecular targets and their future prospects are discussed.
[ "Novel", "therapeutic", "targets", "in", "non", "-", "small", "cell", "lung", "cancer", ".", "\n", "Oncogenic", "driver", "mutations", "frequently", "occur", "in", "lung", "cancer", "and", "play", "role", "in", "carcinogenesis", ".", "These", "mutations", "are", "usually", "associated", "with", "distinct", "clinical", "and", "histological", "features", "and", "are", "attractive", "targets", "for", "anticancer", "therapy", ".", "Recently", ",", "several", "molecularly", "distinct", "phenotypes", "of", "NSCLC", "based", "on", "specific", "and", "mutually", "exclusive", "genetic", "derangements", "have", "been", "described", ".", "Few", "targets", "like", "epidermal", "growth", "factor", "receptor", "(", "EGFR", ")", "mutations", "and", "anaplastic", "lymphoma", "kinase", "(", "ALK", ")", "gene", "rearrangements", "have", "successfully", "been", "targeted", "with", "EGFR", "tyrosine", "kinase", "inhibitors", "(", "TKIs", ")", "and", "crizotinib", ",", "respectively", ".", "Many", "more", "inhibitors", "of", "specific", "driver", "mutations", "involving", "genes", "like", "ROS", ",", "c", "-", "MET", ",", "FGFR", ",", "mTOR", ",", "IGFR", "and", "RET", "are", "currently", "under", "development", ".", "However", ",", "efforts", "to", "target", "some", "mutated", "genes", "like", "K", "-", "RAS", "have", "been", "unsuccessful", ".", "Moreover", ",", "the", "emerging", "challenge", "of", "acquired", "resistance", "to", "initially", "effective", "therapy", "is", "becoming", "another", "major", "concern", ".", "In", "this", "review", "recent", "data", "on", "novel", "molecular", "targets", "and", "their", "future", "prospects", "are", "discussed", "." ]
[ "GENE-Y", "GENE-N", "CHEMICAL" ]
Adults is a Person, age is a Person, World Health Organization Group 2 is a Qualifier, Pulmonary Hypertension is a Condition, ( Mean pulmonary artery pressure is a Measurement, = 25 mmHg is a Value, pulmonary capillary wedge pressure is a Measurement, = 15 mmHg is a Value, New York Heart Association is a Measurement, class II - IV is a Value, symptoms is a Condition, Left ventricular ejection fraction ( LVEF ) is a Measurement, = 45 % is a Value
NCT02053246_inc_task0
Sentence: Adults (= 18 years of age) with World Health Organization Group 2 Pulmonary Hypertension (Mean pulmonary artery pressure = 25 mmHg and pulmonary capillary wedge pressure = 15 mmHg) New York Heart Association class II-IV symptoms Left ventricular ejection fraction (LVEF) = 45% Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Condition, Qualifier, Value, Person, Measurement
[ "B-Person", "O", "O", "O", "O", "B-Person", "O", "O", "B-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "B-Condition", "I-Condition", "B-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "B-Value", "I-Value", "I-Value", "O", "B-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "B-Value", "I-Value", "I-Value", "O", "O", "B-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "B-Value", "I-Value", "I-Value", "I-Value", "B-Condition", "O", "B-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "B-Value", "I-Value", "I-Value", "O" ]
Adults (= 18 years of age) with World Health Organization Group 2 Pulmonary Hypertension (Mean pulmonary artery pressure = 25 mmHg and pulmonary capillary wedge pressure = 15 mmHg) New York Heart Association class II-IV symptoms Left ventricular ejection fraction (LVEF) = 45%
[ "Adults", "(=", "18", "years", "of", "age", ")", "with", "World", "Health", "Organization", "Group", "2", "Pulmonary", "Hypertension", "(", "Mean", "pulmonary", "artery", "pressure", "=", "25", "mmHg", "and", "pulmonary", "capillary", "wedge", "pressure", "=", "15", "mmHg", ")", "\n", "New", "York", "Heart", "Association", "class", "II", "-", "IV", "symptoms", "\n", "Left", "ventricular", "ejection", "fraction", "(", "LVEF", ")", "=", "45", "%", "\n" ]
[ "Measurement", "Qualifier", "Condition", "Value", "Person" ]
Adults is a Person, age is a Person, World Health Organization Group 2 is a Qualifier, Pulmonary Hypertension is a Condition, ( Mean pulmonary artery pressure is a Measurement, = 25 mmHg is a Value, pulmonary capillary wedge pressure is a Measurement, = 15 mmHg is a Value, New York Heart Association is a Measurement, class II - IV is a Value, symptoms is a Condition, Left ventricular ejection fraction ( LVEF ) is a Measurement, = 45 % is a Value
NCT02053246_inc_task1
Sentence: Adults (= 18 years of age) with World Health Organization Group 2 Pulmonary Hypertension (Mean pulmonary artery pressure = 25 mmHg and pulmonary capillary wedge pressure = 15 mmHg) New York Heart Association class II-IV symptoms Left ventricular ejection fraction (LVEF) = 45% Instructions: please typing these entity words according to sentence: Adults, age, World Health Organization Group 2, Pulmonary Hypertension, ( Mean pulmonary artery pressure, = 25 mmHg, pulmonary capillary wedge pressure, = 15 mmHg, New York Heart Association, class II - IV, symptoms, Left ventricular ejection fraction ( LVEF ), = 45 % Options: Condition, Qualifier, Value, Person, Measurement
[ "B-Person", "O", "O", "O", "O", "B-Person", "O", "O", "B-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "B-Condition", "I-Condition", "B-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "B-Value", "I-Value", "I-Value", "O", "B-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "B-Value", "I-Value", "I-Value", "O", "O", "B-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "B-Value", "I-Value", "I-Value", "I-Value", "B-Condition", "O", "B-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "B-Value", "I-Value", "I-Value", "O" ]
Adults (= 18 years of age) with World Health Organization Group 2 Pulmonary Hypertension (Mean pulmonary artery pressure = 25 mmHg and pulmonary capillary wedge pressure = 15 mmHg) New York Heart Association class II-IV symptoms Left ventricular ejection fraction (LVEF) = 45%
[ "Adults", "(=", "18", "years", "of", "age", ")", "with", "World", "Health", "Organization", "Group", "2", "Pulmonary", "Hypertension", "(", "Mean", "pulmonary", "artery", "pressure", "=", "25", "mmHg", "and", "pulmonary", "capillary", "wedge", "pressure", "=", "15", "mmHg", ")", "\n", "New", "York", "Heart", "Association", "class", "II", "-", "IV", "symptoms", "\n", "Left", "ventricular", "ejection", "fraction", "(", "LVEF", ")", "=", "45", "%", "\n" ]
[ "Measurement", "Qualifier", "Condition", "Value", "Person" ]
Adults, age, World Health Organization Group 2, Pulmonary Hypertension, ( Mean pulmonary artery pressure, = 25 mmHg, pulmonary capillary wedge pressure, = 15 mmHg, New York Heart Association, class II - IV, symptoms, Left ventricular ejection fraction ( LVEF ), = 45 %
NCT02053246_inc_task2
Sentence: Adults (= 18 years of age) with World Health Organization Group 2 Pulmonary Hypertension (Mean pulmonary artery pressure = 25 mmHg and pulmonary capillary wedge pressure = 15 mmHg) New York Heart Association class II-IV symptoms Left ventricular ejection fraction (LVEF) = 45% Instructions: please extract entity words from the input sentence
[ "B-Person", "O", "O", "O", "O", "B-Person", "O", "O", "B-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "B-Condition", "I-Condition", "B-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "B-Value", "I-Value", "I-Value", "O", "B-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "B-Value", "I-Value", "I-Value", "O", "O", "B-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "B-Value", "I-Value", "I-Value", "I-Value", "B-Condition", "O", "B-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "I-Measurement", "B-Value", "I-Value", "I-Value", "O" ]
Adults (= 18 years of age) with World Health Organization Group 2 Pulmonary Hypertension (Mean pulmonary artery pressure = 25 mmHg and pulmonary capillary wedge pressure = 15 mmHg) New York Heart Association class II-IV symptoms Left ventricular ejection fraction (LVEF) = 45%
[ "Adults", "(=", "18", "years", "of", "age", ")", "with", "World", "Health", "Organization", "Group", "2", "Pulmonary", "Hypertension", "(", "Mean", "pulmonary", "artery", "pressure", "=", "25", "mmHg", "and", "pulmonary", "capillary", "wedge", "pressure", "=", "15", "mmHg", ")", "\n", "New", "York", "Heart", "Association", "class", "II", "-", "IV", "symptoms", "\n", "Left", "ventricular", "ejection", "fraction", "(", "LVEF", ")", "=", "45", "%", "\n" ]
[ "Measurement", "Qualifier", "Condition", "Value", "Person" ]
sCD44v6 expression is a Outcome_Physical, gastric carcinoma is a Participant_Condition, weitai capsule is a Intervention_Pharmacological, serum level of soluble CD44v6 ( sCD44v6 ) is a Outcome_Physical, histologic parameters is a Outcome_Physical, Weitai capsule ( WTC ) is a Intervention_Pharmacological, TCM typing is a Outcome_Physical, 30 is a Participant_Sample-size, 32 is a Participant_Sample-size, chemotherapy is a Intervention_Pharmacological, degree of cancer cell differentiation , infiltration and lymph node metastasis is a Outcome_Physical, Level of sCD44v6 is a Outcome_Physical, blood stasis type is a Participant_Condition, Pi - deficiency type or of damp - heat type is a Participant_Condition, level of sCD44v6 is a Outcome_Physical, Serum level of sCD44v6 is a Outcome_Physical, development and prognosis of gastric cancer is a Outcome_Physical, TCM type of blood stasis and Pi - deficiency is a Outcome_Physical, expression of serum sCD44v6 is a Outcome_Physical
20551_task0
Sentence: [ Relationship between sCD44v6 expression and TCM differentiation type of gastric carcinoma patients and influence of weitai capsule on the expression ] . OBJECTIVE To explore the relationship of TCM type with serum level of soluble CD44v6 ( sCD44v6 ) and different histologic parameters in gastric carcinoma patients and to observe the influence of Weitai capsule ( WTC ) on the sCD44v6 expression . METHODS TCM typing and sCD44v6 expression were determined in all the enrolled patients ( 30 in the control and 32 in the trial group ) before operation , and 3-4 courses of chemotherapy was applied to them from 3-4 weeks after operation . To the patients of trial group , oral administration of WTC was given additionally with 4 capsules , 3 times a day for consecutive 3 months . RESULTS sCD44v6 was significantly positive correlated with the degree of cancer cell differentiation , infiltration and lymph node metastasis ; ( 2 ) Level of sCD44v6 was the highest in patients of blood stasis type , as compared with that in the patients of Pi-deficiency type or of damp-heat type , the difference was significant ; ( 3 ) After ending treatment , level of sCD44v6 in the trial group was significantly lower than that in the control group . CONCLUSION ( 1 ) Serum level of sCD44v6 could be taken as the criterion for evaluating the development and prognosis of gastric cancer , as well as the therapeutic target for anti-metastasis treatment ; ( 2 ) Serum level of sCD44v6 is related to some extent with TCM type of blood stasis and Pi-deficiency ; ( 3 ) WTC combined with chemotherapy could further inhibit the expression of serum sCD44v6 in gastric carcinoma patients . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Intervention_Pharmacological, Outcome_Physical, Participant_Condition, Participant_Sample-size
[ "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "O", "O", "O", "O", "B-Participant_Sample-size", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O" ]
[ Relationship between sCD44v6 expression and TCM differentiation type of gastric carcinoma patients and influence of weitai capsule on the expression ] . OBJECTIVE To explore the relationship of TCM type with serum level of soluble CD44v6 ( sCD44v6 ) and different histologic parameters in gastric carcinoma patients and to observe the influence of Weitai capsule ( WTC ) on the sCD44v6 expression . METHODS TCM typing and sCD44v6 expression were determined in all the enrolled patients ( 30 in the control and 32 in the trial group ) before operation , and 3-4 courses of chemotherapy was applied to them from 3-4 weeks after operation . To the patients of trial group , oral administration of WTC was given additionally with 4 capsules , 3 times a day for consecutive 3 months . RESULTS sCD44v6 was significantly positive correlated with the degree of cancer cell differentiation , infiltration and lymph node metastasis ; ( 2 ) Level of sCD44v6 was the highest in patients of blood stasis type , as compared with that in the patients of Pi-deficiency type or of damp-heat type , the difference was significant ; ( 3 ) After ending treatment , level of sCD44v6 in the trial group was significantly lower than that in the control group . CONCLUSION ( 1 ) Serum level of sCD44v6 could be taken as the criterion for evaluating the development and prognosis of gastric cancer , as well as the therapeutic target for anti-metastasis treatment ; ( 2 ) Serum level of sCD44v6 is related to some extent with TCM type of blood stasis and Pi-deficiency ; ( 3 ) WTC combined with chemotherapy could further inhibit the expression of serum sCD44v6 in gastric carcinoma patients .
[ "[", "Relationship", "between", "sCD44v6", "expression", "and", "TCM", "differentiation", "type", "of", "gastric", "carcinoma", "patients", "and", "influence", "of", "weitai", "capsule", "on", "the", "expression", "]", ".", "OBJECTIVE", "To", "explore", "the", "relationship", "of", "TCM", "type", "with", "serum", "level", "of", "soluble", "CD44v6", "(", "sCD44v6", ")", "and", "different", "histologic", "parameters", "in", "gastric", "carcinoma", "patients", "and", "to", "observe", "the", "influence", "of", "Weitai", "capsule", "(", "WTC", ")", "on", "the", "sCD44v6", "expression", ".", "METHODS", "TCM", "typing", "and", "sCD44v6", "expression", "were", "determined", "in", "all", "the", "enrolled", "patients", "(", "30", "in", "the", "control", "and", "32", "in", "the", "trial", "group", ")", "before", "operation", ",", "and", "3", "-", "4", "courses", "of", "chemotherapy", "was", "applied", "to", "them", "from", "3", "-", "4", "weeks", "after", "operation", ".", "To", "the", "patients", "of", "trial", "group", ",", "oral", "administration", "of", "WTC", "was", "given", "additionally", "with", "4", "capsules", ",", "3", "times", "a", "day", "for", "consecutive", "3", "months", ".", "RESULTS", "sCD44v6", "was", "significantly", "positive", "correlated", "with", "the", "degree", "of", "cancer", "cell", "differentiation", ",", "infiltration", "and", "lymph", "node", "metastasis", ";", "(", "2", ")", "Level", "of", "sCD44v6", "was", "the", "highest", "in", "patients", "of", "blood", "stasis", "type", ",", "as", "compared", "with", "that", "in", "the", "patients", "of", "Pi", "-", "deficiency", "type", "or", "of", "damp", "-", "heat", "type", ",", "the", "difference", "was", "significant", ";", "(", "3", ")", "After", "ending", "treatment", ",", "level", "of", "sCD44v6", "in", "the", "trial", "group", "was", "significantly", "lower", "than", "that", "in", "the", "control", "group", ".", "CONCLUSION", "(", "1", ")", "Serum", "level", "of", "sCD44v6", "could", "be", "taken", "as", "the", "criterion", "for", "evaluating", "the", "development", "and", "prognosis", "of", "gastric", "cancer", ",", "as", "well", "as", "the", "therapeutic", "target", "for", "anti", "-", "metastasis", "treatment", ";", "(", "2", ")", "Serum", "level", "of", "sCD44v6", "is", "related", "to", "some", "extent", "with", "TCM", "type", "of", "blood", "stasis", "and", "Pi", "-", "deficiency", ";", "(", "3", ")", "WTC", "combined", "with", "chemotherapy", "could", "further", "inhibit", "the", "expression", "of", "serum", "sCD44v6", "in", "gastric", "carcinoma", "patients", "." ]
[ "Outcome_Physical", "Participant_Condition", "Intervention_Pharmacological", "Participant_Sample-size" ]
sCD44v6 expression is a Outcome_Physical, gastric carcinoma is a Participant_Condition, weitai capsule is a Intervention_Pharmacological, serum level of soluble CD44v6 ( sCD44v6 ) is a Outcome_Physical, histologic parameters is a Outcome_Physical, Weitai capsule ( WTC ) is a Intervention_Pharmacological, TCM typing is a Outcome_Physical, 30 is a Participant_Sample-size, 32 is a Participant_Sample-size, chemotherapy is a Intervention_Pharmacological, degree of cancer cell differentiation , infiltration and lymph node metastasis is a Outcome_Physical, Level of sCD44v6 is a Outcome_Physical, blood stasis type is a Participant_Condition, Pi - deficiency type or of damp - heat type is a Participant_Condition, level of sCD44v6 is a Outcome_Physical, Serum level of sCD44v6 is a Outcome_Physical, development and prognosis of gastric cancer is a Outcome_Physical, TCM type of blood stasis and Pi - deficiency is a Outcome_Physical, expression of serum sCD44v6 is a Outcome_Physical
20551_task1
Sentence: [ Relationship between sCD44v6 expression and TCM differentiation type of gastric carcinoma patients and influence of weitai capsule on the expression ] . OBJECTIVE To explore the relationship of TCM type with serum level of soluble CD44v6 ( sCD44v6 ) and different histologic parameters in gastric carcinoma patients and to observe the influence of Weitai capsule ( WTC ) on the sCD44v6 expression . METHODS TCM typing and sCD44v6 expression were determined in all the enrolled patients ( 30 in the control and 32 in the trial group ) before operation , and 3-4 courses of chemotherapy was applied to them from 3-4 weeks after operation . To the patients of trial group , oral administration of WTC was given additionally with 4 capsules , 3 times a day for consecutive 3 months . RESULTS sCD44v6 was significantly positive correlated with the degree of cancer cell differentiation , infiltration and lymph node metastasis ; ( 2 ) Level of sCD44v6 was the highest in patients of blood stasis type , as compared with that in the patients of Pi-deficiency type or of damp-heat type , the difference was significant ; ( 3 ) After ending treatment , level of sCD44v6 in the trial group was significantly lower than that in the control group . CONCLUSION ( 1 ) Serum level of sCD44v6 could be taken as the criterion for evaluating the development and prognosis of gastric cancer , as well as the therapeutic target for anti-metastasis treatment ; ( 2 ) Serum level of sCD44v6 is related to some extent with TCM type of blood stasis and Pi-deficiency ; ( 3 ) WTC combined with chemotherapy could further inhibit the expression of serum sCD44v6 in gastric carcinoma patients . Instructions: please typing these entity words according to sentence: sCD44v6 expression, gastric carcinoma, weitai capsule, serum level of soluble CD44v6 ( sCD44v6 ), histologic parameters, Weitai capsule ( WTC ), TCM typing, 30, 32, chemotherapy, degree of cancer cell differentiation , infiltration and lymph node metastasis, Level of sCD44v6, blood stasis type, Pi - deficiency type or of damp - heat type, level of sCD44v6, Serum level of sCD44v6, development and prognosis of gastric cancer, TCM type of blood stasis and Pi - deficiency, expression of serum sCD44v6 Options: Intervention_Pharmacological, Outcome_Physical, Participant_Condition, Participant_Sample-size
[ "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "O", "O", "O", "O", "B-Participant_Sample-size", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O" ]
[ Relationship between sCD44v6 expression and TCM differentiation type of gastric carcinoma patients and influence of weitai capsule on the expression ] . OBJECTIVE To explore the relationship of TCM type with serum level of soluble CD44v6 ( sCD44v6 ) and different histologic parameters in gastric carcinoma patients and to observe the influence of Weitai capsule ( WTC ) on the sCD44v6 expression . METHODS TCM typing and sCD44v6 expression were determined in all the enrolled patients ( 30 in the control and 32 in the trial group ) before operation , and 3-4 courses of chemotherapy was applied to them from 3-4 weeks after operation . To the patients of trial group , oral administration of WTC was given additionally with 4 capsules , 3 times a day for consecutive 3 months . RESULTS sCD44v6 was significantly positive correlated with the degree of cancer cell differentiation , infiltration and lymph node metastasis ; ( 2 ) Level of sCD44v6 was the highest in patients of blood stasis type , as compared with that in the patients of Pi-deficiency type or of damp-heat type , the difference was significant ; ( 3 ) After ending treatment , level of sCD44v6 in the trial group was significantly lower than that in the control group . CONCLUSION ( 1 ) Serum level of sCD44v6 could be taken as the criterion for evaluating the development and prognosis of gastric cancer , as well as the therapeutic target for anti-metastasis treatment ; ( 2 ) Serum level of sCD44v6 is related to some extent with TCM type of blood stasis and Pi-deficiency ; ( 3 ) WTC combined with chemotherapy could further inhibit the expression of serum sCD44v6 in gastric carcinoma patients .
[ "[", "Relationship", "between", "sCD44v6", "expression", "and", "TCM", "differentiation", "type", "of", "gastric", "carcinoma", "patients", "and", "influence", "of", "weitai", "capsule", "on", "the", "expression", "]", ".", "OBJECTIVE", "To", "explore", "the", "relationship", "of", "TCM", "type", "with", "serum", "level", "of", "soluble", "CD44v6", "(", "sCD44v6", ")", "and", "different", "histologic", "parameters", "in", "gastric", "carcinoma", "patients", "and", "to", "observe", "the", "influence", "of", "Weitai", "capsule", "(", "WTC", ")", "on", "the", "sCD44v6", "expression", ".", "METHODS", "TCM", "typing", "and", "sCD44v6", "expression", "were", "determined", "in", "all", "the", "enrolled", "patients", "(", "30", "in", "the", "control", "and", "32", "in", "the", "trial", "group", ")", "before", "operation", ",", "and", "3", "-", "4", "courses", "of", "chemotherapy", "was", "applied", "to", "them", "from", "3", "-", "4", "weeks", "after", "operation", ".", "To", "the", "patients", "of", "trial", "group", ",", "oral", "administration", "of", "WTC", "was", "given", "additionally", "with", "4", "capsules", ",", "3", "times", "a", "day", "for", "consecutive", "3", "months", ".", "RESULTS", "sCD44v6", "was", "significantly", "positive", "correlated", "with", "the", "degree", "of", "cancer", "cell", "differentiation", ",", "infiltration", "and", "lymph", "node", "metastasis", ";", "(", "2", ")", "Level", "of", "sCD44v6", "was", "the", "highest", "in", "patients", "of", "blood", "stasis", "type", ",", "as", "compared", "with", "that", "in", "the", "patients", "of", "Pi", "-", "deficiency", "type", "or", "of", "damp", "-", "heat", "type", ",", "the", "difference", "was", "significant", ";", "(", "3", ")", "After", "ending", "treatment", ",", "level", "of", "sCD44v6", "in", "the", "trial", "group", "was", "significantly", "lower", "than", "that", "in", "the", "control", "group", ".", "CONCLUSION", "(", "1", ")", "Serum", "level", "of", "sCD44v6", "could", "be", "taken", "as", "the", "criterion", "for", "evaluating", "the", "development", "and", "prognosis", "of", "gastric", "cancer", ",", "as", "well", "as", "the", "therapeutic", "target", "for", "anti", "-", "metastasis", "treatment", ";", "(", "2", ")", "Serum", "level", "of", "sCD44v6", "is", "related", "to", "some", "extent", "with", "TCM", "type", "of", "blood", "stasis", "and", "Pi", "-", "deficiency", ";", "(", "3", ")", "WTC", "combined", "with", "chemotherapy", "could", "further", "inhibit", "the", "expression", "of", "serum", "sCD44v6", "in", "gastric", "carcinoma", "patients", "." ]
[ "Outcome_Physical", "Participant_Condition", "Intervention_Pharmacological", "Participant_Sample-size" ]
sCD44v6 expression, gastric carcinoma, weitai capsule, serum level of soluble CD44v6 ( sCD44v6 ), histologic parameters, Weitai capsule ( WTC ), TCM typing, 30, 32, chemotherapy, degree of cancer cell differentiation , infiltration and lymph node metastasis, Level of sCD44v6, blood stasis type, Pi - deficiency type or of damp - heat type, level of sCD44v6, Serum level of sCD44v6, development and prognosis of gastric cancer, TCM type of blood stasis and Pi - deficiency, expression of serum sCD44v6
20551_task2
Sentence: [ Relationship between sCD44v6 expression and TCM differentiation type of gastric carcinoma patients and influence of weitai capsule on the expression ] . OBJECTIVE To explore the relationship of TCM type with serum level of soluble CD44v6 ( sCD44v6 ) and different histologic parameters in gastric carcinoma patients and to observe the influence of Weitai capsule ( WTC ) on the sCD44v6 expression . METHODS TCM typing and sCD44v6 expression were determined in all the enrolled patients ( 30 in the control and 32 in the trial group ) before operation , and 3-4 courses of chemotherapy was applied to them from 3-4 weeks after operation . To the patients of trial group , oral administration of WTC was given additionally with 4 capsules , 3 times a day for consecutive 3 months . RESULTS sCD44v6 was significantly positive correlated with the degree of cancer cell differentiation , infiltration and lymph node metastasis ; ( 2 ) Level of sCD44v6 was the highest in patients of blood stasis type , as compared with that in the patients of Pi-deficiency type or of damp-heat type , the difference was significant ; ( 3 ) After ending treatment , level of sCD44v6 in the trial group was significantly lower than that in the control group . CONCLUSION ( 1 ) Serum level of sCD44v6 could be taken as the criterion for evaluating the development and prognosis of gastric cancer , as well as the therapeutic target for anti-metastasis treatment ; ( 2 ) Serum level of sCD44v6 is related to some extent with TCM type of blood stasis and Pi-deficiency ; ( 3 ) WTC combined with chemotherapy could further inhibit the expression of serum sCD44v6 in gastric carcinoma patients . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "O", "O", "O", "O", "B-Participant_Sample-size", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O" ]
[ Relationship between sCD44v6 expression and TCM differentiation type of gastric carcinoma patients and influence of weitai capsule on the expression ] . OBJECTIVE To explore the relationship of TCM type with serum level of soluble CD44v6 ( sCD44v6 ) and different histologic parameters in gastric carcinoma patients and to observe the influence of Weitai capsule ( WTC ) on the sCD44v6 expression . METHODS TCM typing and sCD44v6 expression were determined in all the enrolled patients ( 30 in the control and 32 in the trial group ) before operation , and 3-4 courses of chemotherapy was applied to them from 3-4 weeks after operation . To the patients of trial group , oral administration of WTC was given additionally with 4 capsules , 3 times a day for consecutive 3 months . RESULTS sCD44v6 was significantly positive correlated with the degree of cancer cell differentiation , infiltration and lymph node metastasis ; ( 2 ) Level of sCD44v6 was the highest in patients of blood stasis type , as compared with that in the patients of Pi-deficiency type or of damp-heat type , the difference was significant ; ( 3 ) After ending treatment , level of sCD44v6 in the trial group was significantly lower than that in the control group . CONCLUSION ( 1 ) Serum level of sCD44v6 could be taken as the criterion for evaluating the development and prognosis of gastric cancer , as well as the therapeutic target for anti-metastasis treatment ; ( 2 ) Serum level of sCD44v6 is related to some extent with TCM type of blood stasis and Pi-deficiency ; ( 3 ) WTC combined with chemotherapy could further inhibit the expression of serum sCD44v6 in gastric carcinoma patients .
[ "[", "Relationship", "between", "sCD44v6", "expression", "and", "TCM", "differentiation", "type", "of", "gastric", "carcinoma", "patients", "and", "influence", "of", "weitai", "capsule", "on", "the", "expression", "]", ".", "OBJECTIVE", "To", "explore", "the", "relationship", "of", "TCM", "type", "with", "serum", "level", "of", "soluble", "CD44v6", "(", "sCD44v6", ")", "and", "different", "histologic", "parameters", "in", "gastric", "carcinoma", "patients", "and", "to", "observe", "the", "influence", "of", "Weitai", "capsule", "(", "WTC", ")", "on", "the", "sCD44v6", "expression", ".", "METHODS", "TCM", "typing", "and", "sCD44v6", "expression", "were", "determined", "in", "all", "the", "enrolled", "patients", "(", "30", "in", "the", "control", "and", "32", "in", "the", "trial", "group", ")", "before", "operation", ",", "and", "3", "-", "4", "courses", "of", "chemotherapy", "was", "applied", "to", "them", "from", "3", "-", "4", "weeks", "after", "operation", ".", "To", "the", "patients", "of", "trial", "group", ",", "oral", "administration", "of", "WTC", "was", "given", "additionally", "with", "4", "capsules", ",", "3", "times", "a", "day", "for", "consecutive", "3", "months", ".", "RESULTS", "sCD44v6", "was", "significantly", "positive", "correlated", "with", "the", "degree", "of", "cancer", "cell", "differentiation", ",", "infiltration", "and", "lymph", "node", "metastasis", ";", "(", "2", ")", "Level", "of", "sCD44v6", "was", "the", "highest", "in", "patients", "of", "blood", "stasis", "type", ",", "as", "compared", "with", "that", "in", "the", "patients", "of", "Pi", "-", "deficiency", "type", "or", "of", "damp", "-", "heat", "type", ",", "the", "difference", "was", "significant", ";", "(", "3", ")", "After", "ending", "treatment", ",", "level", "of", "sCD44v6", "in", "the", "trial", "group", "was", "significantly", "lower", "than", "that", "in", "the", "control", "group", ".", "CONCLUSION", "(", "1", ")", "Serum", "level", "of", "sCD44v6", "could", "be", "taken", "as", "the", "criterion", "for", "evaluating", "the", "development", "and", "prognosis", "of", "gastric", "cancer", ",", "as", "well", "as", "the", "therapeutic", "target", "for", "anti", "-", "metastasis", "treatment", ";", "(", "2", ")", "Serum", "level", "of", "sCD44v6", "is", "related", "to", "some", "extent", "with", "TCM", "type", "of", "blood", "stasis", "and", "Pi", "-", "deficiency", ";", "(", "3", ")", "WTC", "combined", "with", "chemotherapy", "could", "further", "inhibit", "the", "expression", "of", "serum", "sCD44v6", "in", "gastric", "carcinoma", "patients", "." ]
[ "Outcome_Physical", "Participant_Condition", "Intervention_Pharmacological", "Participant_Sample-size" ]
arachidonic acid is a CHEMICAL, cytochrome p450 monooxygenases is a GENE-N
23139020_task0
Sentence: Determination of the dominant arachidonic acid cytochrome p450 monooxygenases in rat heart, lung, kidney, and liver: protein expression and metabolite kinetics. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: GENE-N, CHEMICAL
[ "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "B-GENE-N", "I-GENE-N", "I-GENE-N", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Determination of the dominant arachidonic acid cytochrome p450 monooxygenases in rat heart, lung, kidney, and liver: protein expression and metabolite kinetics.
[ "Determination", "of", "the", "dominant", "arachidonic", "acid", "cytochrome", "p450", "monooxygenases", "in", "rat", "heart", ",", "lung", ",", "kidney", ",", "and", "liver", ":", "protein", "expression", "and", "metabolite", "kinetics", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
arachidonic acid is a CHEMICAL, cytochrome p450 monooxygenases is a GENE-N
23139020_task1
Sentence: Determination of the dominant arachidonic acid cytochrome p450 monooxygenases in rat heart, lung, kidney, and liver: protein expression and metabolite kinetics. Instructions: please typing these entity words according to sentence: arachidonic acid, cytochrome p450 monooxygenases Options: GENE-N, CHEMICAL
[ "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "B-GENE-N", "I-GENE-N", "I-GENE-N", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Determination of the dominant arachidonic acid cytochrome p450 monooxygenases in rat heart, lung, kidney, and liver: protein expression and metabolite kinetics.
[ "Determination", "of", "the", "dominant", "arachidonic", "acid", "cytochrome", "p450", "monooxygenases", "in", "rat", "heart", ",", "lung", ",", "kidney", ",", "and", "liver", ":", "protein", "expression", "and", "metabolite", "kinetics", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
arachidonic acid, cytochrome p450 monooxygenases
23139020_task2
Sentence: Determination of the dominant arachidonic acid cytochrome p450 monooxygenases in rat heart, lung, kidney, and liver: protein expression and metabolite kinetics. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "B-GENE-N", "I-GENE-N", "I-GENE-N", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Determination of the dominant arachidonic acid cytochrome p450 monooxygenases in rat heart, lung, kidney, and liver: protein expression and metabolite kinetics.
[ "Determination", "of", "the", "dominant", "arachidonic", "acid", "cytochrome", "p450", "monooxygenases", "in", "rat", "heart", ",", "lung", ",", "kidney", ",", "and", "liver", ":", "protein", "expression", "and", "metabolite", "kinetics", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
Germany is an umlsterm, ethics committees is an umlsterm, medical faculties is an umlsterm, universities is an umlsterm, Physicians is an umlsterm, research is an umlsterm, human is an umlsterm, law is an umlsterm, guidelines is an umlsterm, research is an umlsterm, regulations is an umlsterm, Institutional Review Boards is an umlsterm, ethics committee is an umlsterm
IntensiveMedizin.70340352.eng.abstr_task0
Sentence: In Germany , ethics committees are established at the medical faculties of universities as well as at the Chamber of Physicians of the different states ( Landesaerztekam-mern ) . They are independent institutions which review for approval of research projects in human subjects , according to the law and to the declaration of Helsinki and the guidelines of " good clinical practice " ( GCP ) . They examine the research project on the basis of ethical and scientific principles and the legal regulations . Thus they are mainly comparable to the " Institutional Review Boards " in the USA and not to the " ethics committee " . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O" ]
In Germany , ethics committees are established at the medical faculties of universities as well as at the Chamber of Physicians of the different states ( Landesaerztekam-mern ) . They are independent institutions which review for approval of research projects in human subjects , according to the law and to the declaration of Helsinki and the guidelines of " good clinical practice " ( GCP ) . They examine the research project on the basis of ethical and scientific principles and the legal regulations . Thus they are mainly comparable to the " Institutional Review Boards " in the USA and not to the " ethics committee " .
[ "In", "Germany", ",", "ethics", "committees", "are", "established", "at", "the", "medical", "faculties", "of", "universities", "as", "well", "as", "at", "the", "Chamber", "of", "Physicians", "of", "the", "different", "states", "(", "Landesaerztekam", "-", "mern", ")", ".", "They", "are", "independent", "institutions", "which", "review", "for", "approval", "of", "research", "projects", "in", "human", "subjects", ",", "according", "to", "the", "law", "and", "to", "the", "declaration", "of", "Helsinki", "and", "the", "guidelines", "of", "\"", "good", "clinical", "practice", "\"", "(", "GCP", ")", ".", "They", "examine", "the", "research", "project", "on", "the", "basis", "of", "ethical", "and", "scientific", "principles", "and", "the", "legal", "regulations", ".", "Thus", "they", "are", "mainly", "comparable", "to", "the", "\"", "Institutional", "Review", "Boards", "\"", "in", "the", "USA", "and", "not", "to", "the", "\"", "ethics", "committee", "\"", "." ]
[ "umlsterm" ]
Germany is an umlsterm, ethics committees is an umlsterm, medical faculties is an umlsterm, universities is an umlsterm, Physicians is an umlsterm, research is an umlsterm, human is an umlsterm, law is an umlsterm, guidelines is an umlsterm, research is an umlsterm, regulations is an umlsterm, Institutional Review Boards is an umlsterm, ethics committee is an umlsterm
IntensiveMedizin.70340352.eng.abstr_task1
Sentence: In Germany , ethics committees are established at the medical faculties of universities as well as at the Chamber of Physicians of the different states ( Landesaerztekam-mern ) . They are independent institutions which review for approval of research projects in human subjects , according to the law and to the declaration of Helsinki and the guidelines of " good clinical practice " ( GCP ) . They examine the research project on the basis of ethical and scientific principles and the legal regulations . Thus they are mainly comparable to the " Institutional Review Boards " in the USA and not to the " ethics committee " . Instructions: please typing these entity words according to sentence: Germany, ethics committees, medical faculties, universities, Physicians, research, human, law, guidelines, research, regulations, Institutional Review Boards, ethics committee Options: umlsterm
[ "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O" ]
In Germany , ethics committees are established at the medical faculties of universities as well as at the Chamber of Physicians of the different states ( Landesaerztekam-mern ) . They are independent institutions which review for approval of research projects in human subjects , according to the law and to the declaration of Helsinki and the guidelines of " good clinical practice " ( GCP ) . They examine the research project on the basis of ethical and scientific principles and the legal regulations . Thus they are mainly comparable to the " Institutional Review Boards " in the USA and not to the " ethics committee " .
[ "In", "Germany", ",", "ethics", "committees", "are", "established", "at", "the", "medical", "faculties", "of", "universities", "as", "well", "as", "at", "the", "Chamber", "of", "Physicians", "of", "the", "different", "states", "(", "Landesaerztekam", "-", "mern", ")", ".", "They", "are", "independent", "institutions", "which", "review", "for", "approval", "of", "research", "projects", "in", "human", "subjects", ",", "according", "to", "the", "law", "and", "to", "the", "declaration", "of", "Helsinki", "and", "the", "guidelines", "of", "\"", "good", "clinical", "practice", "\"", "(", "GCP", ")", ".", "They", "examine", "the", "research", "project", "on", "the", "basis", "of", "ethical", "and", "scientific", "principles", "and", "the", "legal", "regulations", ".", "Thus", "they", "are", "mainly", "comparable", "to", "the", "\"", "Institutional", "Review", "Boards", "\"", "in", "the", "USA", "and", "not", "to", "the", "\"", "ethics", "committee", "\"", "." ]
[ "umlsterm" ]
Germany, ethics committees, medical faculties, universities, Physicians, research, human, law, guidelines, research, regulations, Institutional Review Boards, ethics committee
IntensiveMedizin.70340352.eng.abstr_task2
Sentence: In Germany , ethics committees are established at the medical faculties of universities as well as at the Chamber of Physicians of the different states ( Landesaerztekam-mern ) . They are independent institutions which review for approval of research projects in human subjects , according to the law and to the declaration of Helsinki and the guidelines of " good clinical practice " ( GCP ) . They examine the research project on the basis of ethical and scientific principles and the legal regulations . Thus they are mainly comparable to the " Institutional Review Boards " in the USA and not to the " ethics committee " . Instructions: please extract entity words from the input sentence
[ "O", "B-umlsterm", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O" ]
In Germany , ethics committees are established at the medical faculties of universities as well as at the Chamber of Physicians of the different states ( Landesaerztekam-mern ) . They are independent institutions which review for approval of research projects in human subjects , according to the law and to the declaration of Helsinki and the guidelines of " good clinical practice " ( GCP ) . They examine the research project on the basis of ethical and scientific principles and the legal regulations . Thus they are mainly comparable to the " Institutional Review Boards " in the USA and not to the " ethics committee " .
[ "In", "Germany", ",", "ethics", "committees", "are", "established", "at", "the", "medical", "faculties", "of", "universities", "as", "well", "as", "at", "the", "Chamber", "of", "Physicians", "of", "the", "different", "states", "(", "Landesaerztekam", "-", "mern", ")", ".", "They", "are", "independent", "institutions", "which", "review", "for", "approval", "of", "research", "projects", "in", "human", "subjects", ",", "according", "to", "the", "law", "and", "to", "the", "declaration", "of", "Helsinki", "and", "the", "guidelines", "of", "\"", "good", "clinical", "practice", "\"", "(", "GCP", ")", ".", "They", "examine", "the", "research", "project", "on", "the", "basis", "of", "ethical", "and", "scientific", "principles", "and", "the", "legal", "regulations", ".", "Thus", "they", "are", "mainly", "comparable", "to", "the", "\"", "Institutional", "Review", "Boards", "\"", "in", "the", "USA", "and", "not", "to", "the", "\"", "ethics", "committee", "\"", "." ]
[ "umlsterm" ]
Laura is a NOMBRE_SUJETO_ASISTENCIA, Gutiérrez Simón is a NOMBRE_SUJETO_ASISTENCIA, 7346582 is a ID_SUJETO_ASISTENCIA, 37 45673567 04 is a ID_ASEGURAMIENTO, Sevilla is a TERRITORIO, 41009 is a TERRITORIO, 10/10/1981 is a FECHAS, España is a PAIS, 35 años is a EDAD_SUJETO_ASISTENCIA, 01/03/2017 is a FECHAS, Cristina Campos Martín is a NOMBRE_PERSONAL_SANITARIO, 41 41 50236 is a ID_TITULACION_PERSONAL_SANITARIO, 35 años is a EDAD_SUJETO_ASISTENCIA, Cristina Campos Martín is a NOMBRE_PERSONAL_SANITARIO, 41009 is a TERRITORIO, Sevilla is a TERRITORIO, smaradigna@hotmail.com is a CORREO_ELECTRONICO
139_task0
Sentence: Datos del paciente. Nombre: Laura. Apellidos: Gutiérrez Simón. NHC: Calle Alférez Luis Martín Vidales, 2, 8 C. NASS: 7346582. Domicilio: 37 45673567 04. Localidad/ Provincia: Sevilla. CP: 41009. Datos asistenciales. Fecha de nacimiento: 10/10/1981. País de nacimiento: España. Edad: 35 años Sexo: M. Fecha de Ingreso: 01/03/2017. Médico: Cristina Campos Martín NºCol: 41 41 50236. Informe clínico del paciente: Presentamos el caso de una paciente de 35 años. Acude remitida a nuestra Unidad tras su tercer ingreso hospitalario en los 18 meses previos por ascitis quilosa de repetición. Sin antecedentes de interés, ingresa por primera vez con cuadro de ascitis y edemas leves en miembros inferiores de un mes y medio de evolución, practicándosele laparotomía exploradora ante la sospecha de neoplasia de ovario. Se evacuaron 12 litros de líquido ascítico de características quilosas, sin apreciarse anomalías en ovarios ni carcinomatosis peritoneal. Dada de alta con tratamiento diurético con espironolactona 100 mg y prednisona 40 mg en pauta descendente, a los 5 meses reingresa, extrayéndose 9 litros de líquido quiloso mediante paracentesis evacuadora. En un nuevo ingreso, 6 meses después, durante los cuales la sintomatología había ido reapareciendo progresivamente, se evacuan 14 litros más de líquido peritoneal. A lo largo de su estancia en hospitalización, se le realizan las siguientes pruebas complementarias: hemograma, con discreta leucocitosis y fórmula normal, estudio del hierro sin alteraciones; perfil bioquímico, con hipoproteinemia e hipoalbuminemia, hipocalcemia. Las determinaciones de perfil celíaco, AgHBs, AcVHC, marcadores tumorales, y Mantoux, fueron negativas. Niveles de ASLO, proteína C reactiva y a-1 antitripsina sérica, normales. Estudio de función tiroidea dentro de la normalidad. El proteinograma en suero mostró valores descendidos de albúmina y gammaglobulinas. El líquido ascítico extraído presentaba características de exudado y aspecto quiloso. Su cultivo fue negativo. El TAC toracoabdominal puso de manifiesto tórax normal, ascitis en todos los compartimentos peritoneales, edemas en asas de intestino delgado. En la ecografía abdominal se observó abundante líquido ascítico peritoneal, con hígado, porta, grandes vasos, vesícula y bazo normales. La fibroenteroscopia, alcanzando ciego, muestra desde bulbo hasta los tramos de yeyuno explorados, irregularidad en el patrón vellositario, edema de pliegues y numerosas linfangiectasias puntiformes. Se realiza ileoscopia, presentando el íleon terminal una mucosa extremadamente irregular, con placas blanquecinas y friables a la toma de biopsias. La capsuloendoscopia evidencia afectación difusa de intestino delgado, con formaciones puntiformes "en grano de mijo" y pliegues edematosos y congestivos. La biopsia de mucosa intestinal fue informada como hiperplasia folicular linfoide, linfangiectasia focal; y la de mucosa gástrica, duodenal y yeyunal no evidenció alteraciones significativas. Se inicia tratamiento con diuréticos y albúmina intravenosa, presentando un evolución clínica favorable, siendo dada de alta con el diagnóstico de linfangiectasia intestinal primaria, pautándose tratamiento domiciliario con Furosemida 40 mg, Espironolactona 100 mg y Prednisona 30 mg, siendo derivada a la Unidad de Nutrición Clínica y Dietética para su valoración y seguimiento. La exploración en Consultas muestra una talla de 1,65 m, peso 53,5 kg, con IMC 19,3 kg/m2, tras evacuación de 14 L de líquido ascítico durante su ingreso; subjetivamente se encuentra más delgada que antes del inicio de la sintomatología. Presenta palidez cutánea, dedos de las manos longilíneos, discretos edemas maleolares simétricos. El resto de la exploración física es normal. No refiere sintomatología gastrointestinal habitual, salvo 1-2 deposiciones al día con aspecto algo graso. Realiza una dieta variada, evitando alimentos excesivamente grasos desde siempre, por intolerancia. Niega hábitos tóxicos. Nuligesta. Analíticamente, presentaba valores séricos de proteínas totales 3,4 g/dL, albúmina 2,1 g/dL, calcio 7,3 mg/dL. El resto de bioquímica básica, lipidograma, y hemograma fueron normales. Decidimos instaurar tratamiento dietético. Se elabora una dieta personalizada, de 2.200 kcal en 24 horas y la siguiente distribución de nutrientes: 52% hidratos de carbono, 30% lípidos, 18% proteínas. El aporte de grasas procedentes de los alimentos se restringe, y se aportan los lípidos en forma de aceite MCT, utilizando la cantidad de 85 ml al día, introducidos en la dieta de manera progresiva para evitar intolerancias. Los aportes proteicos de la dieta se completan con 400 ml de fórmula hiperproteica para nutrición enteral y 20 g de módulo proteico en polvo. Además se agrega un complemento vitamínico-mineral. La paciente es colaboradora y presenta un estricto cumplimiento de las pautas recomendadas, con buena adaptación y excelente tolerancia. Tras 11 meses de seguimiento, ha logrado ganancia ponderal, con un peso de 59,3 kg e IMC 21,4. Los parámetros analíticos han experimentado una mejora significativa, siendo los valores séricos de proteínas totales 5,2 g/L, albúmina 3,7 g/L, calcio 8,5 mg/dL. No presenta síntomas gastrointestinales. El perímetro de cintura es de 78 cm, y en ecografía abdominal de control no se observa líquido libre en abdomen. No ha presentado nuevos episodios de ascitis ni ha precisado ingresos hospitalarios durante este período. Responsable clínico: Dra. Cristina Campos Martín. C/ Fedra, 3, 3º B. 41009 Sevilla. E-mail: smaradigna@hotmail.com Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: TERRITORIO, ID_SUJETO_ASISTENCIA, FECHAS, CORREO_ELECTRONICO, PAIS, EDAD_SUJETO_ASISTENCIA, ID_ASEGURAMIENTO, ID_TITULACION_PERSONAL_SANITARIO, NOMBRE_SUJETO_ASISTENCIA, NOMBRE_PERSONAL_SANITARIO
[ "O", "O", "O", "O", "O", "O", "O", "B-NOMBRE_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-NOMBRE_SUJETO_ASISTENCIA", "I-NOMBRE_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ID_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-ID_ASEGURAMIENTO", "I-ID_ASEGURAMIENTO", "I-ID_ASEGURAMIENTO", "O", "O", "O", "O", "O", "B-TERRITORIO", "O", "O", "O", "O", "B-TERRITORIO", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-FECHAS", "O", "O", "O", "O", "O", "O", "B-PAIS", "O", "O", "O", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "B-FECHAS", "O", "O", "O", "O", "B-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "O", "O", "O", "O", "B-ID_TITULACION_PERSONAL_SANITARIO", "I-ID_TITULACION_PERSONAL_SANITARIO", "I-ID_TITULACION_PERSONAL_SANITARIO", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "O", "O", "O", "O", "O", "O", "O", "O", "B-TERRITORIO", "B-TERRITORIO", "O", "O", "O", "O", "O", "B-CORREO_ELECTRONICO", "O" ]
Datos del paciente. Nombre: Laura. Apellidos: Gutiérrez Simón. NHC: Calle Alférez Luis Martín Vidales, 2, 8 C. NASS: 7346582. Domicilio: 37 45673567 04. Localidad/ Provincia: Sevilla. CP: 41009. Datos asistenciales. Fecha de nacimiento: 10/10/1981. País de nacimiento: España. Edad: 35 años Sexo: M. Fecha de Ingreso: 01/03/2017. Médico: Cristina Campos Martín NºCol: 41 41 50236. Informe clínico del paciente: Presentamos el caso de una paciente de 35 años. Acude remitida a nuestra Unidad tras su tercer ingreso hospitalario en los 18 meses previos por ascitis quilosa de repetición. Sin antecedentes de interés, ingresa por primera vez con cuadro de ascitis y edemas leves en miembros inferiores de un mes y medio de evolución, practicándosele laparotomía exploradora ante la sospecha de neoplasia de ovario. Se evacuaron 12 litros de líquido ascítico de características quilosas, sin apreciarse anomalías en ovarios ni carcinomatosis peritoneal. Dada de alta con tratamiento diurético con espironolactona 100 mg y prednisona 40 mg en pauta descendente, a los 5 meses reingresa, extrayéndose 9 litros de líquido quiloso mediante paracentesis evacuadora. En un nuevo ingreso, 6 meses después, durante los cuales la sintomatología había ido reapareciendo progresivamente, se evacuan 14 litros más de líquido peritoneal. A lo largo de su estancia en hospitalización, se le realizan las siguientes pruebas complementarias: hemograma, con discreta leucocitosis y fórmula normal, estudio del hierro sin alteraciones; perfil bioquímico, con hipoproteinemia e hipoalbuminemia, hipocalcemia. Las determinaciones de perfil celíaco, AgHBs, AcVHC, marcadores tumorales, y Mantoux, fueron negativas. Niveles de ASLO, proteína C reactiva y a-1 antitripsina sérica, normales. Estudio de función tiroidea dentro de la normalidad. El proteinograma en suero mostró valores descendidos de albúmina y gammaglobulinas. El líquido ascítico extraído presentaba características de exudado y aspecto quiloso. Su cultivo fue negativo. El TAC toracoabdominal puso de manifiesto tórax normal, ascitis en todos los compartimentos peritoneales, edemas en asas de intestino delgado. En la ecografía abdominal se observó abundante líquido ascítico peritoneal, con hígado, porta, grandes vasos, vesícula y bazo normales. La fibroenteroscopia, alcanzando ciego, muestra desde bulbo hasta los tramos de yeyuno explorados, irregularidad en el patrón vellositario, edema de pliegues y numerosas linfangiectasias puntiformes. Se realiza ileoscopia, presentando el íleon terminal una mucosa extremadamente irregular, con placas blanquecinas y friables a la toma de biopsias. La capsuloendoscopia evidencia afectación difusa de intestino delgado, con formaciones puntiformes "en grano de mijo" y pliegues edematosos y congestivos. La biopsia de mucosa intestinal fue informada como hiperplasia folicular linfoide, linfangiectasia focal; y la de mucosa gástrica, duodenal y yeyunal no evidenció alteraciones significativas. Se inicia tratamiento con diuréticos y albúmina intravenosa, presentando un evolución clínica favorable, siendo dada de alta con el diagnóstico de linfangiectasia intestinal primaria, pautándose tratamiento domiciliario con Furosemida 40 mg, Espironolactona 100 mg y Prednisona 30 mg, siendo derivada a la Unidad de Nutrición Clínica y Dietética para su valoración y seguimiento. La exploración en Consultas muestra una talla de 1,65 m, peso 53,5 kg, con IMC 19,3 kg/m2, tras evacuación de 14 L de líquido ascítico durante su ingreso; subjetivamente se encuentra más delgada que antes del inicio de la sintomatología. Presenta palidez cutánea, dedos de las manos longilíneos, discretos edemas maleolares simétricos. El resto de la exploración física es normal. No refiere sintomatología gastrointestinal habitual, salvo 1-2 deposiciones al día con aspecto algo graso. Realiza una dieta variada, evitando alimentos excesivamente grasos desde siempre, por intolerancia. Niega hábitos tóxicos. Nuligesta. Analíticamente, presentaba valores séricos de proteínas totales 3,4 g/dL, albúmina 2,1 g/dL, calcio 7,3 mg/dL. El resto de bioquímica básica, lipidograma, y hemograma fueron normales. Decidimos instaurar tratamiento dietético. Se elabora una dieta personalizada, de 2.200 kcal en 24 horas y la siguiente distribución de nutrientes: 52% hidratos de carbono, 30% lípidos, 18% proteínas. El aporte de grasas procedentes de los alimentos se restringe, y se aportan los lípidos en forma de aceite MCT, utilizando la cantidad de 85 ml al día, introducidos en la dieta de manera progresiva para evitar intolerancias. Los aportes proteicos de la dieta se completan con 400 ml de fórmula hiperproteica para nutrición enteral y 20 g de módulo proteico en polvo. Además se agrega un complemento vitamínico-mineral. La paciente es colaboradora y presenta un estricto cumplimiento de las pautas recomendadas, con buena adaptación y excelente tolerancia. Tras 11 meses de seguimiento, ha logrado ganancia ponderal, con un peso de 59,3 kg e IMC 21,4. Los parámetros analíticos han experimentado una mejora significativa, siendo los valores séricos de proteínas totales 5,2 g/L, albúmina 3,7 g/L, calcio 8,5 mg/dL. No presenta síntomas gastrointestinales. El perímetro de cintura es de 78 cm, y en ecografía abdominal de control no se observa líquido libre en abdomen. No ha presentado nuevos episodios de ascitis ni ha precisado ingresos hospitalarios durante este período. Responsable clínico: Dra. Cristina Campos Martín. C/ Fedra, 3, 3º B. 41009 Sevilla. E-mail: smaradigna@hotmail.com
[ "Datos", "del", "paciente", ".", "\n", "Nombre", ":", "Laura", ".", "\n", "Apellidos", ":", "Gutiérrez", "Simón", ".", "\n", "NHC", ":", "Calle", "Alférez", "Luis", "Martín", "Vidales", ",", "2", ",", "8", "C.", "\n", "NASS", ":", "7346582", ".", "\n", "Domicilio", ":", "37", "45673567", "04", ".", "\n", "Localidad/", "Provincia", ":", "Sevilla", ".", "\n", "CP", ":", "41009", ".", "\n", "Datos", "asistenciales", ".", "\n", "Fecha", "de", "nacimiento", ":", "10/10/1981", ".", "\n", "País", "de", "nacimiento", ":", "España", ".", "\n", "Edad", ":", "35", "años", "Sexo", ":", "M.", "\n", "Fecha", "de", "Ingreso", ":", "01/03/2017", ".", "\n", "Médico", ":", "Cristina", "Campos", "Martín", " ", "NºCol", ":", " ", "41", "41", "50236", ".", "\n", "Informe", "clínico", "del", "paciente", ":", "Presentamos", "el", "caso", "de", "una", "paciente", "de", "35", "años", ".", "Acude", "remitida", "a", "nuestra", "Unidad", "tras", "su", "tercer", "ingreso", "hospitalario", "en", "los", "18", "meses", "previos", "por", "ascitis", "quilosa", "de", "repetición", ".", "Sin", "antecedentes", "de", "interés", ",", "ingresa", "por", "primera", "vez", "con", "cuadro", "de", "ascitis", "y", "edemas", "leves", "en", "miembros", "inferiores", "de", "un", "mes", "y", "medio", "de", "evolución", ",", "practicándosele", "laparotomía", "exploradora", "ante", "la", "sospecha", "de", "neoplasia", "de", "ovario", ".", "Se", "evacuaron", "12", "litros", "de", "líquido", "ascítico", "de", "características", "quilosas", ",", "sin", "apreciarse", "anomalías", "en", "ovarios", "ni", "carcinomatosis", "peritoneal", ".", "\n", "Dada", "de", "alta", "con", "tratamiento", "diurético", "con", "espironolactona", "100", "mg", "y", "prednisona", "40", "mg", "en", "pauta", "descendente", ",", "a", "los", "5", "meses", "reingresa", ",", "extrayéndose", "9", "litros", "de", "líquido", "quiloso", "mediante", "paracentesis", "evacuadora", ".", "En", "un", "nuevo", "ingreso", ",", "6", "meses", "después", ",", "durante", "los", "cuales", "la", "sintomatología", "había", "ido", "reapareciendo", "progresivamente", ",", "se", "evacuan", "14", "litros", "más", "de", "líquido", "peritoneal", ".", "\n", "A", "lo", "largo", "de", "su", "estancia", "en", "hospitalización", ",", "se", "le", "realizan", "las", "siguientes", "pruebas", "complementarias", ":", "hemograma", ",", "con", "discreta", "leucocitosis", "y", "fórmula", "normal", ",", "estudio", "del", "hierro", "sin", "alteraciones", ";", "perfil", "bioquímico", ",", "con", "hipoproteinemia", "e", "hipoalbuminemia", ",", "hipocalcemia", ".", "Las", "determinaciones", "de", "perfil", "celíaco", ",", "AgHBs", ",", "AcVHC", ",", "marcadores", "tumorales", ",", "y", "Mantoux", ",", "fueron", "negativas", ".", "Niveles", "de", "ASLO", ",", "proteína", "C", "reactiva", "y", "a-1", "antitripsina", "sérica", ",", "normales", ".", "Estudio", "de", "función", "tiroidea", "dentro", "de", "la", "normalidad", ".", "El", "proteinograma", "en", "suero", "mostró", "valores", "descendidos", "de", "albúmina", "y", "gammaglobulinas", ".", "\n", "El", "líquido", "ascítico", "extraído", "presentaba", "características", "de", "exudado", "y", "aspecto", "quiloso", ".", "Su", "cultivo", "fue", "negativo", ".", "\n", "El", "TAC", "toracoabdominal", "puso", "de", "manifiesto", "tórax", "normal", ",", "ascitis", "en", "todos", "los", "compartimentos", "peritoneales", ",", "edemas", "en", "asas", "de", "intestino", "delgado", ".", "En", "la", "ecografía", "abdominal", "se", "observó", "abundante", "líquido", "ascítico", "peritoneal", ",", "con", "hígado", ",", "porta", ",", "grandes", "vasos", ",", "vesícula", "y", "bazo", "normales", ".", "La", "fibroenteroscopia", ",", "alcanzando", "ciego", ",", "muestra", "desde", "bulbo", "hasta", "los", "tramos", "de", "yeyuno", "explorados", ",", "irregularidad", "en", "el", "patrón", "vellositario", ",", "edema", "de", "pliegues", "y", "numerosas", "linfangiectasias", "puntiformes", ".", "Se", "realiza", "ileoscopia", ",", "presentando", "el", "íleon", "terminal", "una", "mucosa", "extremadamente", "irregular", ",", "con", "placas", "blanquecinas", "y", "friables", "a", "la", "toma", "de", "biopsias", ".", "La", "capsuloendoscopia", "evidencia", "afectación", "difusa", "de", "intestino", "delgado", ",", "con", "formaciones", "puntiformes", "\"", "en", "grano", "de", "mijo", "\"", "y", "pliegues", "edematosos", "y", "congestivos", ".", "La", "biopsia", "de", "mucosa", "intestinal", "fue", "informada", "como", "hiperplasia", "folicular", "linfoide", ",", "linfangiectasia", "focal", ";", "y", "la", "de", "mucosa", "gástrica", ",", "duodenal", "y", "yeyunal", "no", "evidenció", "alteraciones", "significativas", ".", "\n", "Se", "inicia", "tratamiento", "con", "diuréticos", "y", "albúmina", "intravenosa", ",", "presentando", "un", "evolución", "clínica", "favorable", ",", "siendo", "dada", "de", "alta", "con", "el", "diagnóstico", "de", "linfangiectasia", "intestinal", "primaria", ",", "pautándose", "tratamiento", "domiciliario", "con", "Furosemida", "40", "mg", ",", "Espironolactona", "100", "mg", "y", "Prednisona", "30", "mg", ",", "siendo", "derivada", "a", "la", "Unidad", "de", "Nutrición", "Clínica", "y", "Dietética", "para", "su", "valoración", "y", "seguimiento", ".", "\n", "La", "exploración", "en", "Consultas", "muestra", "una", "talla", "de", "1,65", "m", ",", "peso", "53,5", "kg", ",", "con", "IMC", "19,3", "kg", "/", "m2", ",", "tras", "evacuación", "de", "14", "L", "de", "líquido", "ascítico", "durante", "su", "ingreso", ";", "subjetivamente", "se", "encuentra", "más", "delgada", "que", "antes", "del", "inicio", "de", "la", "sintomatología", ".", "Presenta", "palidez", "cutánea", ",", "dedos", "de", "las", "manos", "longilíneos", ",", "discretos", "edemas", "maleolares", "simétricos", ".", "El", "resto", "de", "la", "exploración", "física", "es", "normal", ".", "\n", "No", "refiere", "sintomatología", "gastrointestinal", "habitual", ",", "salvo", "1", "-", "2", "deposiciones", "al", "día", "con", "aspecto", "algo", "graso", ".", "Realiza", "una", "dieta", "variada", ",", "evitando", "alimentos", "excesivamente", "grasos", "desde", "siempre", ",", "por", "intolerancia", ".", "Niega", "hábitos", "tóxicos", ".", "Nuligesta", ".", "\n", "Analíticamente", ",", "presentaba", "valores", "séricos", "de", "proteínas", "totales", "3,4", "g", "/", "dL", ",", "albúmina", "2,1", "g", "/", "dL", ",", "calcio", "7,3", "mg", "/", "dL.", "El", "resto", "de", "bioquímica", "básica", ",", "lipidograma", ",", "y", "hemograma", "fueron", "normales", ".", "\n", "Decidimos", "instaurar", "tratamiento", "dietético", ".", "Se", "elabora", "una", "dieta", "personalizada", ",", "de", "2.200", "kcal", "en", "24", "horas", "y", "la", "siguiente", "distribución", "de", "nutrientes", ":", "52", "%", "hidratos", "de", "carbono", ",", "30", "%", "lípidos", ",", "18", "%", "proteínas", ".", "El", "aporte", "de", "grasas", "procedentes", "de", "los", "alimentos", "se", "restringe", ",", "y", "se", "aportan", "los", "lípidos", "en", "forma", "de", "aceite", "MCT", ",", "utilizando", "la", "cantidad", "de", "85", "ml", "al", "día", ",", "introducidos", "en", "la", "dieta", "de", "manera", "progresiva", "para", "evitar", "intolerancias", ".", "Los", "aportes", "proteicos", "de", "la", "dieta", "se", "completan", "con", "400", "ml", "de", "fórmula", "hiperproteica", "para", "nutrición", "enteral", "y", "20", "g", "de", "módulo", "proteico", "en", "polvo", ".", "Además", "se", "agrega", "un", "complemento", "vitamínico", "-", "mineral", ".", "\n", "La", "paciente", "es", "colaboradora", "y", "presenta", "un", "estricto", "cumplimiento", "de", "las", "pautas", "recomendadas", ",", "con", "buena", "adaptación", "y", "excelente", "tolerancia", ".", "\n", "Tras", "11", "meses", "de", "seguimiento", ",", "ha", "logrado", "ganancia", "ponderal", ",", "con", "un", "peso", "de", "59,3", "kg", "e", "IMC", "21,4", ".", "Los", "parámetros", "analíticos", "han", "experimentado", "una", "mejora", "significativa", ",", "siendo", "los", "valores", "séricos", "de", "proteínas", "totales", "5,2", "g", "/", "L", ",", "albúmina", "3,7", "g", "/", "L", ",", "calcio", "8,5", "mg", "/", "dL.", "No", "presenta", "síntomas", "gastrointestinales", ".", "El", "perímetro", "de", "cintura", "es", "de", "78", "cm", ",", "y", "en", "ecografía", "abdominal", "de", "control", "no", "se", "observa", "líquido", "libre", "en", "abdomen", ".", "No", "ha", "presentado", "nuevos", "episodios", "de", "ascitis", "ni", "ha", "precisado", "ingresos", "hospitalarios", "durante", "este", "período", ".", "\n", "Responsable", "clínico", ":", "Dra", ".", "Cristina", "Campos", "Martín", ".", "C/", "Fedra", ",", "3", ",", "3º", "B.", "41009", "Sevilla", ".", "E", "-", "mail", ":", "smaradigna@hotmail.com", "\n" ]
[ "CALLE", "CORREO_ELECTRONICO", "NOMBRE_PERSONAL_SANITARIO", "NOMBRE_SUJETO_ASISTENCIA", "ID_ASEGURAMIENTO", "ID_TITULACION_PERSONAL_SANITARIO", "FECHAS", "TERRITORIO", "EDAD_SUJETO_ASISTENCIA", "ID_SUJETO_ASISTENCIA", "PAIS", "SEXO_SUJETO_ASISTENCIA" ]
Laura is a NOMBRE_SUJETO_ASISTENCIA, Gutiérrez Simón is a NOMBRE_SUJETO_ASISTENCIA, 7346582 is a ID_SUJETO_ASISTENCIA, 37 45673567 04 is a ID_ASEGURAMIENTO, Sevilla is a TERRITORIO, 41009 is a TERRITORIO, 10/10/1981 is a FECHAS, España is a PAIS, 35 años is a EDAD_SUJETO_ASISTENCIA, 01/03/2017 is a FECHAS, Cristina Campos Martín is a NOMBRE_PERSONAL_SANITARIO, 41 41 50236 is a ID_TITULACION_PERSONAL_SANITARIO, 35 años is a EDAD_SUJETO_ASISTENCIA, Cristina Campos Martín is a NOMBRE_PERSONAL_SANITARIO, 41009 is a TERRITORIO, Sevilla is a TERRITORIO, smaradigna@hotmail.com is a CORREO_ELECTRONICO
139_task1
Sentence: Datos del paciente. Nombre: Laura. Apellidos: Gutiérrez Simón. NHC: Calle Alférez Luis Martín Vidales, 2, 8 C. NASS: 7346582. Domicilio: 37 45673567 04. Localidad/ Provincia: Sevilla. CP: 41009. Datos asistenciales. Fecha de nacimiento: 10/10/1981. País de nacimiento: España. Edad: 35 años Sexo: M. Fecha de Ingreso: 01/03/2017. Médico: Cristina Campos Martín NºCol: 41 41 50236. Informe clínico del paciente: Presentamos el caso de una paciente de 35 años. Acude remitida a nuestra Unidad tras su tercer ingreso hospitalario en los 18 meses previos por ascitis quilosa de repetición. Sin antecedentes de interés, ingresa por primera vez con cuadro de ascitis y edemas leves en miembros inferiores de un mes y medio de evolución, practicándosele laparotomía exploradora ante la sospecha de neoplasia de ovario. Se evacuaron 12 litros de líquido ascítico de características quilosas, sin apreciarse anomalías en ovarios ni carcinomatosis peritoneal. Dada de alta con tratamiento diurético con espironolactona 100 mg y prednisona 40 mg en pauta descendente, a los 5 meses reingresa, extrayéndose 9 litros de líquido quiloso mediante paracentesis evacuadora. En un nuevo ingreso, 6 meses después, durante los cuales la sintomatología había ido reapareciendo progresivamente, se evacuan 14 litros más de líquido peritoneal. A lo largo de su estancia en hospitalización, se le realizan las siguientes pruebas complementarias: hemograma, con discreta leucocitosis y fórmula normal, estudio del hierro sin alteraciones; perfil bioquímico, con hipoproteinemia e hipoalbuminemia, hipocalcemia. Las determinaciones de perfil celíaco, AgHBs, AcVHC, marcadores tumorales, y Mantoux, fueron negativas. Niveles de ASLO, proteína C reactiva y a-1 antitripsina sérica, normales. Estudio de función tiroidea dentro de la normalidad. El proteinograma en suero mostró valores descendidos de albúmina y gammaglobulinas. El líquido ascítico extraído presentaba características de exudado y aspecto quiloso. Su cultivo fue negativo. El TAC toracoabdominal puso de manifiesto tórax normal, ascitis en todos los compartimentos peritoneales, edemas en asas de intestino delgado. En la ecografía abdominal se observó abundante líquido ascítico peritoneal, con hígado, porta, grandes vasos, vesícula y bazo normales. La fibroenteroscopia, alcanzando ciego, muestra desde bulbo hasta los tramos de yeyuno explorados, irregularidad en el patrón vellositario, edema de pliegues y numerosas linfangiectasias puntiformes. Se realiza ileoscopia, presentando el íleon terminal una mucosa extremadamente irregular, con placas blanquecinas y friables a la toma de biopsias. La capsuloendoscopia evidencia afectación difusa de intestino delgado, con formaciones puntiformes "en grano de mijo" y pliegues edematosos y congestivos. La biopsia de mucosa intestinal fue informada como hiperplasia folicular linfoide, linfangiectasia focal; y la de mucosa gástrica, duodenal y yeyunal no evidenció alteraciones significativas. Se inicia tratamiento con diuréticos y albúmina intravenosa, presentando un evolución clínica favorable, siendo dada de alta con el diagnóstico de linfangiectasia intestinal primaria, pautándose tratamiento domiciliario con Furosemida 40 mg, Espironolactona 100 mg y Prednisona 30 mg, siendo derivada a la Unidad de Nutrición Clínica y Dietética para su valoración y seguimiento. La exploración en Consultas muestra una talla de 1,65 m, peso 53,5 kg, con IMC 19,3 kg/m2, tras evacuación de 14 L de líquido ascítico durante su ingreso; subjetivamente se encuentra más delgada que antes del inicio de la sintomatología. Presenta palidez cutánea, dedos de las manos longilíneos, discretos edemas maleolares simétricos. El resto de la exploración física es normal. No refiere sintomatología gastrointestinal habitual, salvo 1-2 deposiciones al día con aspecto algo graso. Realiza una dieta variada, evitando alimentos excesivamente grasos desde siempre, por intolerancia. Niega hábitos tóxicos. Nuligesta. Analíticamente, presentaba valores séricos de proteínas totales 3,4 g/dL, albúmina 2,1 g/dL, calcio 7,3 mg/dL. El resto de bioquímica básica, lipidograma, y hemograma fueron normales. Decidimos instaurar tratamiento dietético. Se elabora una dieta personalizada, de 2.200 kcal en 24 horas y la siguiente distribución de nutrientes: 52% hidratos de carbono, 30% lípidos, 18% proteínas. El aporte de grasas procedentes de los alimentos se restringe, y se aportan los lípidos en forma de aceite MCT, utilizando la cantidad de 85 ml al día, introducidos en la dieta de manera progresiva para evitar intolerancias. Los aportes proteicos de la dieta se completan con 400 ml de fórmula hiperproteica para nutrición enteral y 20 g de módulo proteico en polvo. Además se agrega un complemento vitamínico-mineral. La paciente es colaboradora y presenta un estricto cumplimiento de las pautas recomendadas, con buena adaptación y excelente tolerancia. Tras 11 meses de seguimiento, ha logrado ganancia ponderal, con un peso de 59,3 kg e IMC 21,4. Los parámetros analíticos han experimentado una mejora significativa, siendo los valores séricos de proteínas totales 5,2 g/L, albúmina 3,7 g/L, calcio 8,5 mg/dL. No presenta síntomas gastrointestinales. El perímetro de cintura es de 78 cm, y en ecografía abdominal de control no se observa líquido libre en abdomen. No ha presentado nuevos episodios de ascitis ni ha precisado ingresos hospitalarios durante este período. Responsable clínico: Dra. Cristina Campos Martín. C/ Fedra, 3, 3º B. 41009 Sevilla. E-mail: smaradigna@hotmail.com Instructions: please typing these entity words according to sentence: Laura, Gutiérrez Simón, 7346582, 37 45673567 04, Sevilla, 41009, 10/10/1981, España, 35 años, 01/03/2017, Cristina Campos Martín, 41 41 50236, 35 años, Cristina Campos Martín, 41009, Sevilla, smaradigna@hotmail.com Options: TERRITORIO, ID_SUJETO_ASISTENCIA, FECHAS, CORREO_ELECTRONICO, PAIS, EDAD_SUJETO_ASISTENCIA, ID_ASEGURAMIENTO, ID_TITULACION_PERSONAL_SANITARIO, NOMBRE_SUJETO_ASISTENCIA, NOMBRE_PERSONAL_SANITARIO
[ "O", "O", "O", "O", "O", "O", "O", "B-NOMBRE_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-NOMBRE_SUJETO_ASISTENCIA", "I-NOMBRE_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ID_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-ID_ASEGURAMIENTO", "I-ID_ASEGURAMIENTO", "I-ID_ASEGURAMIENTO", "O", "O", "O", "O", "O", "B-TERRITORIO", "O", "O", "O", "O", "B-TERRITORIO", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-FECHAS", "O", "O", "O", "O", "O", "O", "B-PAIS", "O", "O", "O", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "B-FECHAS", "O", "O", "O", "O", "B-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "O", "O", "O", "O", "B-ID_TITULACION_PERSONAL_SANITARIO", "I-ID_TITULACION_PERSONAL_SANITARIO", "I-ID_TITULACION_PERSONAL_SANITARIO", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "O", "O", "O", "O", "O", "O", "O", "O", "B-TERRITORIO", "B-TERRITORIO", "O", "O", "O", "O", "O", "B-CORREO_ELECTRONICO", "O" ]
Datos del paciente. Nombre: Laura. Apellidos: Gutiérrez Simón. NHC: Calle Alférez Luis Martín Vidales, 2, 8 C. NASS: 7346582. Domicilio: 37 45673567 04. Localidad/ Provincia: Sevilla. CP: 41009. Datos asistenciales. Fecha de nacimiento: 10/10/1981. País de nacimiento: España. Edad: 35 años Sexo: M. Fecha de Ingreso: 01/03/2017. Médico: Cristina Campos Martín NºCol: 41 41 50236. Informe clínico del paciente: Presentamos el caso de una paciente de 35 años. Acude remitida a nuestra Unidad tras su tercer ingreso hospitalario en los 18 meses previos por ascitis quilosa de repetición. Sin antecedentes de interés, ingresa por primera vez con cuadro de ascitis y edemas leves en miembros inferiores de un mes y medio de evolución, practicándosele laparotomía exploradora ante la sospecha de neoplasia de ovario. Se evacuaron 12 litros de líquido ascítico de características quilosas, sin apreciarse anomalías en ovarios ni carcinomatosis peritoneal. Dada de alta con tratamiento diurético con espironolactona 100 mg y prednisona 40 mg en pauta descendente, a los 5 meses reingresa, extrayéndose 9 litros de líquido quiloso mediante paracentesis evacuadora. En un nuevo ingreso, 6 meses después, durante los cuales la sintomatología había ido reapareciendo progresivamente, se evacuan 14 litros más de líquido peritoneal. A lo largo de su estancia en hospitalización, se le realizan las siguientes pruebas complementarias: hemograma, con discreta leucocitosis y fórmula normal, estudio del hierro sin alteraciones; perfil bioquímico, con hipoproteinemia e hipoalbuminemia, hipocalcemia. Las determinaciones de perfil celíaco, AgHBs, AcVHC, marcadores tumorales, y Mantoux, fueron negativas. Niveles de ASLO, proteína C reactiva y a-1 antitripsina sérica, normales. Estudio de función tiroidea dentro de la normalidad. El proteinograma en suero mostró valores descendidos de albúmina y gammaglobulinas. El líquido ascítico extraído presentaba características de exudado y aspecto quiloso. Su cultivo fue negativo. El TAC toracoabdominal puso de manifiesto tórax normal, ascitis en todos los compartimentos peritoneales, edemas en asas de intestino delgado. En la ecografía abdominal se observó abundante líquido ascítico peritoneal, con hígado, porta, grandes vasos, vesícula y bazo normales. La fibroenteroscopia, alcanzando ciego, muestra desde bulbo hasta los tramos de yeyuno explorados, irregularidad en el patrón vellositario, edema de pliegues y numerosas linfangiectasias puntiformes. Se realiza ileoscopia, presentando el íleon terminal una mucosa extremadamente irregular, con placas blanquecinas y friables a la toma de biopsias. La capsuloendoscopia evidencia afectación difusa de intestino delgado, con formaciones puntiformes "en grano de mijo" y pliegues edematosos y congestivos. La biopsia de mucosa intestinal fue informada como hiperplasia folicular linfoide, linfangiectasia focal; y la de mucosa gástrica, duodenal y yeyunal no evidenció alteraciones significativas. Se inicia tratamiento con diuréticos y albúmina intravenosa, presentando un evolución clínica favorable, siendo dada de alta con el diagnóstico de linfangiectasia intestinal primaria, pautándose tratamiento domiciliario con Furosemida 40 mg, Espironolactona 100 mg y Prednisona 30 mg, siendo derivada a la Unidad de Nutrición Clínica y Dietética para su valoración y seguimiento. La exploración en Consultas muestra una talla de 1,65 m, peso 53,5 kg, con IMC 19,3 kg/m2, tras evacuación de 14 L de líquido ascítico durante su ingreso; subjetivamente se encuentra más delgada que antes del inicio de la sintomatología. Presenta palidez cutánea, dedos de las manos longilíneos, discretos edemas maleolares simétricos. El resto de la exploración física es normal. No refiere sintomatología gastrointestinal habitual, salvo 1-2 deposiciones al día con aspecto algo graso. Realiza una dieta variada, evitando alimentos excesivamente grasos desde siempre, por intolerancia. Niega hábitos tóxicos. Nuligesta. Analíticamente, presentaba valores séricos de proteínas totales 3,4 g/dL, albúmina 2,1 g/dL, calcio 7,3 mg/dL. El resto de bioquímica básica, lipidograma, y hemograma fueron normales. Decidimos instaurar tratamiento dietético. Se elabora una dieta personalizada, de 2.200 kcal en 24 horas y la siguiente distribución de nutrientes: 52% hidratos de carbono, 30% lípidos, 18% proteínas. El aporte de grasas procedentes de los alimentos se restringe, y se aportan los lípidos en forma de aceite MCT, utilizando la cantidad de 85 ml al día, introducidos en la dieta de manera progresiva para evitar intolerancias. Los aportes proteicos de la dieta se completan con 400 ml de fórmula hiperproteica para nutrición enteral y 20 g de módulo proteico en polvo. Además se agrega un complemento vitamínico-mineral. La paciente es colaboradora y presenta un estricto cumplimiento de las pautas recomendadas, con buena adaptación y excelente tolerancia. Tras 11 meses de seguimiento, ha logrado ganancia ponderal, con un peso de 59,3 kg e IMC 21,4. Los parámetros analíticos han experimentado una mejora significativa, siendo los valores séricos de proteínas totales 5,2 g/L, albúmina 3,7 g/L, calcio 8,5 mg/dL. No presenta síntomas gastrointestinales. El perímetro de cintura es de 78 cm, y en ecografía abdominal de control no se observa líquido libre en abdomen. No ha presentado nuevos episodios de ascitis ni ha precisado ingresos hospitalarios durante este período. Responsable clínico: Dra. Cristina Campos Martín. C/ Fedra, 3, 3º B. 41009 Sevilla. E-mail: smaradigna@hotmail.com
[ "Datos", "del", "paciente", ".", "\n", "Nombre", ":", "Laura", ".", "\n", "Apellidos", ":", "Gutiérrez", "Simón", ".", "\n", "NHC", ":", "Calle", "Alférez", "Luis", "Martín", "Vidales", ",", "2", ",", "8", "C.", "\n", "NASS", ":", "7346582", ".", "\n", "Domicilio", ":", "37", "45673567", "04", ".", "\n", "Localidad/", "Provincia", ":", "Sevilla", ".", "\n", "CP", ":", "41009", ".", "\n", "Datos", "asistenciales", ".", "\n", "Fecha", "de", "nacimiento", ":", "10/10/1981", ".", "\n", "País", "de", "nacimiento", ":", "España", ".", "\n", "Edad", ":", "35", "años", "Sexo", ":", "M.", "\n", "Fecha", "de", "Ingreso", ":", "01/03/2017", ".", "\n", "Médico", ":", "Cristina", "Campos", "Martín", " ", "NºCol", ":", " ", "41", "41", "50236", ".", "\n", "Informe", "clínico", "del", "paciente", ":", "Presentamos", "el", "caso", "de", "una", "paciente", "de", "35", "años", ".", "Acude", "remitida", "a", "nuestra", "Unidad", "tras", "su", "tercer", "ingreso", "hospitalario", "en", "los", "18", "meses", "previos", "por", "ascitis", "quilosa", "de", "repetición", ".", "Sin", "antecedentes", "de", "interés", ",", "ingresa", "por", "primera", "vez", "con", "cuadro", "de", "ascitis", "y", "edemas", "leves", "en", "miembros", "inferiores", "de", "un", "mes", "y", "medio", "de", "evolución", ",", "practicándosele", "laparotomía", "exploradora", "ante", "la", "sospecha", "de", "neoplasia", "de", "ovario", ".", "Se", "evacuaron", "12", "litros", "de", "líquido", "ascítico", "de", "características", "quilosas", ",", "sin", "apreciarse", "anomalías", "en", "ovarios", "ni", "carcinomatosis", "peritoneal", ".", "\n", "Dada", "de", "alta", "con", "tratamiento", "diurético", "con", "espironolactona", "100", "mg", "y", "prednisona", "40", "mg", "en", "pauta", "descendente", ",", "a", "los", "5", "meses", "reingresa", ",", "extrayéndose", "9", "litros", "de", "líquido", "quiloso", "mediante", "paracentesis", "evacuadora", ".", "En", "un", "nuevo", "ingreso", ",", "6", "meses", "después", ",", "durante", "los", "cuales", "la", "sintomatología", "había", "ido", "reapareciendo", "progresivamente", ",", "se", "evacuan", "14", "litros", "más", "de", "líquido", "peritoneal", ".", "\n", "A", "lo", "largo", "de", "su", "estancia", "en", "hospitalización", ",", "se", "le", "realizan", "las", "siguientes", "pruebas", "complementarias", ":", "hemograma", ",", "con", "discreta", "leucocitosis", "y", "fórmula", "normal", ",", "estudio", "del", "hierro", "sin", "alteraciones", ";", "perfil", "bioquímico", ",", "con", "hipoproteinemia", "e", "hipoalbuminemia", ",", "hipocalcemia", ".", "Las", "determinaciones", "de", "perfil", "celíaco", ",", "AgHBs", ",", "AcVHC", ",", "marcadores", "tumorales", ",", "y", "Mantoux", ",", "fueron", "negativas", ".", "Niveles", "de", "ASLO", ",", "proteína", "C", "reactiva", "y", "a-1", "antitripsina", "sérica", ",", "normales", ".", "Estudio", "de", "función", "tiroidea", "dentro", "de", "la", "normalidad", ".", "El", "proteinograma", "en", "suero", "mostró", "valores", "descendidos", "de", "albúmina", "y", "gammaglobulinas", ".", "\n", "El", "líquido", "ascítico", "extraído", "presentaba", "características", "de", "exudado", "y", "aspecto", "quiloso", ".", "Su", "cultivo", "fue", "negativo", ".", "\n", "El", "TAC", "toracoabdominal", "puso", "de", "manifiesto", "tórax", "normal", ",", "ascitis", "en", "todos", "los", "compartimentos", "peritoneales", ",", "edemas", "en", "asas", "de", "intestino", "delgado", ".", "En", "la", "ecografía", "abdominal", "se", "observó", "abundante", "líquido", "ascítico", "peritoneal", ",", "con", "hígado", ",", "porta", ",", "grandes", "vasos", ",", "vesícula", "y", "bazo", "normales", ".", "La", "fibroenteroscopia", ",", "alcanzando", "ciego", ",", "muestra", "desde", "bulbo", "hasta", "los", "tramos", "de", "yeyuno", "explorados", ",", "irregularidad", "en", "el", "patrón", "vellositario", ",", "edema", "de", "pliegues", "y", "numerosas", "linfangiectasias", "puntiformes", ".", "Se", "realiza", "ileoscopia", ",", "presentando", "el", "íleon", "terminal", "una", "mucosa", "extremadamente", "irregular", ",", "con", "placas", "blanquecinas", "y", "friables", "a", "la", "toma", "de", "biopsias", ".", "La", "capsuloendoscopia", "evidencia", "afectación", "difusa", "de", "intestino", "delgado", ",", "con", "formaciones", "puntiformes", "\"", "en", "grano", "de", "mijo", "\"", "y", "pliegues", "edematosos", "y", "congestivos", ".", "La", "biopsia", "de", "mucosa", "intestinal", "fue", "informada", "como", "hiperplasia", "folicular", "linfoide", ",", "linfangiectasia", "focal", ";", "y", "la", "de", "mucosa", "gástrica", ",", "duodenal", "y", "yeyunal", "no", "evidenció", "alteraciones", "significativas", ".", "\n", "Se", "inicia", "tratamiento", "con", "diuréticos", "y", "albúmina", "intravenosa", ",", "presentando", "un", "evolución", "clínica", "favorable", ",", "siendo", "dada", "de", "alta", "con", "el", "diagnóstico", "de", "linfangiectasia", "intestinal", "primaria", ",", "pautándose", "tratamiento", "domiciliario", "con", "Furosemida", "40", "mg", ",", "Espironolactona", "100", "mg", "y", "Prednisona", "30", "mg", ",", "siendo", "derivada", "a", "la", "Unidad", "de", "Nutrición", "Clínica", "y", "Dietética", "para", "su", "valoración", "y", "seguimiento", ".", "\n", "La", "exploración", "en", "Consultas", "muestra", "una", "talla", "de", "1,65", "m", ",", "peso", "53,5", "kg", ",", "con", "IMC", "19,3", "kg", "/", "m2", ",", "tras", "evacuación", "de", "14", "L", "de", "líquido", "ascítico", "durante", "su", "ingreso", ";", "subjetivamente", "se", "encuentra", "más", "delgada", "que", "antes", "del", "inicio", "de", "la", "sintomatología", ".", "Presenta", "palidez", "cutánea", ",", "dedos", "de", "las", "manos", "longilíneos", ",", "discretos", "edemas", "maleolares", "simétricos", ".", "El", "resto", "de", "la", "exploración", "física", "es", "normal", ".", "\n", "No", "refiere", "sintomatología", "gastrointestinal", "habitual", ",", "salvo", "1", "-", "2", "deposiciones", "al", "día", "con", "aspecto", "algo", "graso", ".", "Realiza", "una", "dieta", "variada", ",", "evitando", "alimentos", "excesivamente", "grasos", "desde", "siempre", ",", "por", "intolerancia", ".", "Niega", "hábitos", "tóxicos", ".", "Nuligesta", ".", "\n", "Analíticamente", ",", "presentaba", "valores", "séricos", "de", "proteínas", "totales", "3,4", "g", "/", "dL", ",", "albúmina", "2,1", "g", "/", "dL", ",", "calcio", "7,3", "mg", "/", "dL.", "El", "resto", "de", "bioquímica", "básica", ",", "lipidograma", ",", "y", "hemograma", "fueron", "normales", ".", "\n", "Decidimos", "instaurar", "tratamiento", "dietético", ".", "Se", "elabora", "una", "dieta", "personalizada", ",", "de", "2.200", "kcal", "en", "24", "horas", "y", "la", "siguiente", "distribución", "de", "nutrientes", ":", "52", "%", "hidratos", "de", "carbono", ",", "30", "%", "lípidos", ",", "18", "%", "proteínas", ".", "El", "aporte", "de", "grasas", "procedentes", "de", "los", "alimentos", "se", "restringe", ",", "y", "se", "aportan", "los", "lípidos", "en", "forma", "de", "aceite", "MCT", ",", "utilizando", "la", "cantidad", "de", "85", "ml", "al", "día", ",", "introducidos", "en", "la", "dieta", "de", "manera", "progresiva", "para", "evitar", "intolerancias", ".", "Los", "aportes", "proteicos", "de", "la", "dieta", "se", "completan", "con", "400", "ml", "de", "fórmula", "hiperproteica", "para", "nutrición", "enteral", "y", "20", "g", "de", "módulo", "proteico", "en", "polvo", ".", "Además", "se", "agrega", "un", "complemento", "vitamínico", "-", "mineral", ".", "\n", "La", "paciente", "es", "colaboradora", "y", "presenta", "un", "estricto", "cumplimiento", "de", "las", "pautas", "recomendadas", ",", "con", "buena", "adaptación", "y", "excelente", "tolerancia", ".", "\n", "Tras", "11", "meses", "de", "seguimiento", ",", "ha", "logrado", "ganancia", "ponderal", ",", "con", "un", "peso", "de", "59,3", "kg", "e", "IMC", "21,4", ".", "Los", "parámetros", "analíticos", "han", "experimentado", "una", "mejora", "significativa", ",", "siendo", "los", "valores", "séricos", "de", "proteínas", "totales", "5,2", "g", "/", "L", ",", "albúmina", "3,7", "g", "/", "L", ",", "calcio", "8,5", "mg", "/", "dL.", "No", "presenta", "síntomas", "gastrointestinales", ".", "El", "perímetro", "de", "cintura", "es", "de", "78", "cm", ",", "y", "en", "ecografía", "abdominal", "de", "control", "no", "se", "observa", "líquido", "libre", "en", "abdomen", ".", "No", "ha", "presentado", "nuevos", "episodios", "de", "ascitis", "ni", "ha", "precisado", "ingresos", "hospitalarios", "durante", "este", "período", ".", "\n", "Responsable", "clínico", ":", "Dra", ".", "Cristina", "Campos", "Martín", ".", "C/", "Fedra", ",", "3", ",", "3º", "B.", "41009", "Sevilla", ".", "E", "-", "mail", ":", "smaradigna@hotmail.com", "\n" ]
[ "CALLE", "CORREO_ELECTRONICO", "NOMBRE_PERSONAL_SANITARIO", "NOMBRE_SUJETO_ASISTENCIA", "ID_ASEGURAMIENTO", "ID_TITULACION_PERSONAL_SANITARIO", "FECHAS", "TERRITORIO", "EDAD_SUJETO_ASISTENCIA", "ID_SUJETO_ASISTENCIA", "PAIS", "SEXO_SUJETO_ASISTENCIA" ]
Laura, Gutiérrez Simón, 7346582, 37 45673567 04, Sevilla, 41009, 10/10/1981, España, 35 años, 01/03/2017, Cristina Campos Martín, 41 41 50236, 35 años, Cristina Campos Martín, 41009, Sevilla, smaradigna@hotmail.com
139_task2
Sentence: Datos del paciente. Nombre: Laura. Apellidos: Gutiérrez Simón. NHC: Calle Alférez Luis Martín Vidales, 2, 8 C. NASS: 7346582. Domicilio: 37 45673567 04. Localidad/ Provincia: Sevilla. CP: 41009. Datos asistenciales. Fecha de nacimiento: 10/10/1981. País de nacimiento: España. Edad: 35 años Sexo: M. Fecha de Ingreso: 01/03/2017. Médico: Cristina Campos Martín NºCol: 41 41 50236. Informe clínico del paciente: Presentamos el caso de una paciente de 35 años. Acude remitida a nuestra Unidad tras su tercer ingreso hospitalario en los 18 meses previos por ascitis quilosa de repetición. Sin antecedentes de interés, ingresa por primera vez con cuadro de ascitis y edemas leves en miembros inferiores de un mes y medio de evolución, practicándosele laparotomía exploradora ante la sospecha de neoplasia de ovario. Se evacuaron 12 litros de líquido ascítico de características quilosas, sin apreciarse anomalías en ovarios ni carcinomatosis peritoneal. Dada de alta con tratamiento diurético con espironolactona 100 mg y prednisona 40 mg en pauta descendente, a los 5 meses reingresa, extrayéndose 9 litros de líquido quiloso mediante paracentesis evacuadora. En un nuevo ingreso, 6 meses después, durante los cuales la sintomatología había ido reapareciendo progresivamente, se evacuan 14 litros más de líquido peritoneal. A lo largo de su estancia en hospitalización, se le realizan las siguientes pruebas complementarias: hemograma, con discreta leucocitosis y fórmula normal, estudio del hierro sin alteraciones; perfil bioquímico, con hipoproteinemia e hipoalbuminemia, hipocalcemia. Las determinaciones de perfil celíaco, AgHBs, AcVHC, marcadores tumorales, y Mantoux, fueron negativas. Niveles de ASLO, proteína C reactiva y a-1 antitripsina sérica, normales. Estudio de función tiroidea dentro de la normalidad. El proteinograma en suero mostró valores descendidos de albúmina y gammaglobulinas. El líquido ascítico extraído presentaba características de exudado y aspecto quiloso. Su cultivo fue negativo. El TAC toracoabdominal puso de manifiesto tórax normal, ascitis en todos los compartimentos peritoneales, edemas en asas de intestino delgado. En la ecografía abdominal se observó abundante líquido ascítico peritoneal, con hígado, porta, grandes vasos, vesícula y bazo normales. La fibroenteroscopia, alcanzando ciego, muestra desde bulbo hasta los tramos de yeyuno explorados, irregularidad en el patrón vellositario, edema de pliegues y numerosas linfangiectasias puntiformes. Se realiza ileoscopia, presentando el íleon terminal una mucosa extremadamente irregular, con placas blanquecinas y friables a la toma de biopsias. La capsuloendoscopia evidencia afectación difusa de intestino delgado, con formaciones puntiformes "en grano de mijo" y pliegues edematosos y congestivos. La biopsia de mucosa intestinal fue informada como hiperplasia folicular linfoide, linfangiectasia focal; y la de mucosa gástrica, duodenal y yeyunal no evidenció alteraciones significativas. Se inicia tratamiento con diuréticos y albúmina intravenosa, presentando un evolución clínica favorable, siendo dada de alta con el diagnóstico de linfangiectasia intestinal primaria, pautándose tratamiento domiciliario con Furosemida 40 mg, Espironolactona 100 mg y Prednisona 30 mg, siendo derivada a la Unidad de Nutrición Clínica y Dietética para su valoración y seguimiento. La exploración en Consultas muestra una talla de 1,65 m, peso 53,5 kg, con IMC 19,3 kg/m2, tras evacuación de 14 L de líquido ascítico durante su ingreso; subjetivamente se encuentra más delgada que antes del inicio de la sintomatología. Presenta palidez cutánea, dedos de las manos longilíneos, discretos edemas maleolares simétricos. El resto de la exploración física es normal. No refiere sintomatología gastrointestinal habitual, salvo 1-2 deposiciones al día con aspecto algo graso. Realiza una dieta variada, evitando alimentos excesivamente grasos desde siempre, por intolerancia. Niega hábitos tóxicos. Nuligesta. Analíticamente, presentaba valores séricos de proteínas totales 3,4 g/dL, albúmina 2,1 g/dL, calcio 7,3 mg/dL. El resto de bioquímica básica, lipidograma, y hemograma fueron normales. Decidimos instaurar tratamiento dietético. Se elabora una dieta personalizada, de 2.200 kcal en 24 horas y la siguiente distribución de nutrientes: 52% hidratos de carbono, 30% lípidos, 18% proteínas. El aporte de grasas procedentes de los alimentos se restringe, y se aportan los lípidos en forma de aceite MCT, utilizando la cantidad de 85 ml al día, introducidos en la dieta de manera progresiva para evitar intolerancias. Los aportes proteicos de la dieta se completan con 400 ml de fórmula hiperproteica para nutrición enteral y 20 g de módulo proteico en polvo. Además se agrega un complemento vitamínico-mineral. La paciente es colaboradora y presenta un estricto cumplimiento de las pautas recomendadas, con buena adaptación y excelente tolerancia. Tras 11 meses de seguimiento, ha logrado ganancia ponderal, con un peso de 59,3 kg e IMC 21,4. Los parámetros analíticos han experimentado una mejora significativa, siendo los valores séricos de proteínas totales 5,2 g/L, albúmina 3,7 g/L, calcio 8,5 mg/dL. No presenta síntomas gastrointestinales. El perímetro de cintura es de 78 cm, y en ecografía abdominal de control no se observa líquido libre en abdomen. No ha presentado nuevos episodios de ascitis ni ha precisado ingresos hospitalarios durante este período. Responsable clínico: Dra. Cristina Campos Martín. C/ Fedra, 3, 3º B. 41009 Sevilla. E-mail: smaradigna@hotmail.com Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "B-NOMBRE_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-NOMBRE_SUJETO_ASISTENCIA", "I-NOMBRE_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ID_SUJETO_ASISTENCIA", "O", "O", "O", "O", "B-ID_ASEGURAMIENTO", "I-ID_ASEGURAMIENTO", "I-ID_ASEGURAMIENTO", "O", "O", "O", "O", "O", "B-TERRITORIO", "O", "O", "O", "O", "B-TERRITORIO", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-FECHAS", "O", "O", "O", "O", "O", "O", "B-PAIS", "O", "O", "O", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "B-FECHAS", "O", "O", "O", "O", "B-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "O", "O", "O", "O", "B-ID_TITULACION_PERSONAL_SANITARIO", "I-ID_TITULACION_PERSONAL_SANITARIO", "I-ID_TITULACION_PERSONAL_SANITARIO", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-EDAD_SUJETO_ASISTENCIA", "I-EDAD_SUJETO_ASISTENCIA", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "I-NOMBRE_PERSONAL_SANITARIO", "O", "O", "O", "O", "O", "O", "O", "O", "B-TERRITORIO", "B-TERRITORIO", "O", "O", "O", "O", "O", "B-CORREO_ELECTRONICO", "O" ]
Datos del paciente. Nombre: Laura. Apellidos: Gutiérrez Simón. NHC: Calle Alférez Luis Martín Vidales, 2, 8 C. NASS: 7346582. Domicilio: 37 45673567 04. Localidad/ Provincia: Sevilla. CP: 41009. Datos asistenciales. Fecha de nacimiento: 10/10/1981. País de nacimiento: España. Edad: 35 años Sexo: M. Fecha de Ingreso: 01/03/2017. Médico: Cristina Campos Martín NºCol: 41 41 50236. Informe clínico del paciente: Presentamos el caso de una paciente de 35 años. Acude remitida a nuestra Unidad tras su tercer ingreso hospitalario en los 18 meses previos por ascitis quilosa de repetición. Sin antecedentes de interés, ingresa por primera vez con cuadro de ascitis y edemas leves en miembros inferiores de un mes y medio de evolución, practicándosele laparotomía exploradora ante la sospecha de neoplasia de ovario. Se evacuaron 12 litros de líquido ascítico de características quilosas, sin apreciarse anomalías en ovarios ni carcinomatosis peritoneal. Dada de alta con tratamiento diurético con espironolactona 100 mg y prednisona 40 mg en pauta descendente, a los 5 meses reingresa, extrayéndose 9 litros de líquido quiloso mediante paracentesis evacuadora. En un nuevo ingreso, 6 meses después, durante los cuales la sintomatología había ido reapareciendo progresivamente, se evacuan 14 litros más de líquido peritoneal. A lo largo de su estancia en hospitalización, se le realizan las siguientes pruebas complementarias: hemograma, con discreta leucocitosis y fórmula normal, estudio del hierro sin alteraciones; perfil bioquímico, con hipoproteinemia e hipoalbuminemia, hipocalcemia. Las determinaciones de perfil celíaco, AgHBs, AcVHC, marcadores tumorales, y Mantoux, fueron negativas. Niveles de ASLO, proteína C reactiva y a-1 antitripsina sérica, normales. Estudio de función tiroidea dentro de la normalidad. El proteinograma en suero mostró valores descendidos de albúmina y gammaglobulinas. El líquido ascítico extraído presentaba características de exudado y aspecto quiloso. Su cultivo fue negativo. El TAC toracoabdominal puso de manifiesto tórax normal, ascitis en todos los compartimentos peritoneales, edemas en asas de intestino delgado. En la ecografía abdominal se observó abundante líquido ascítico peritoneal, con hígado, porta, grandes vasos, vesícula y bazo normales. La fibroenteroscopia, alcanzando ciego, muestra desde bulbo hasta los tramos de yeyuno explorados, irregularidad en el patrón vellositario, edema de pliegues y numerosas linfangiectasias puntiformes. Se realiza ileoscopia, presentando el íleon terminal una mucosa extremadamente irregular, con placas blanquecinas y friables a la toma de biopsias. La capsuloendoscopia evidencia afectación difusa de intestino delgado, con formaciones puntiformes "en grano de mijo" y pliegues edematosos y congestivos. La biopsia de mucosa intestinal fue informada como hiperplasia folicular linfoide, linfangiectasia focal; y la de mucosa gástrica, duodenal y yeyunal no evidenció alteraciones significativas. Se inicia tratamiento con diuréticos y albúmina intravenosa, presentando un evolución clínica favorable, siendo dada de alta con el diagnóstico de linfangiectasia intestinal primaria, pautándose tratamiento domiciliario con Furosemida 40 mg, Espironolactona 100 mg y Prednisona 30 mg, siendo derivada a la Unidad de Nutrición Clínica y Dietética para su valoración y seguimiento. La exploración en Consultas muestra una talla de 1,65 m, peso 53,5 kg, con IMC 19,3 kg/m2, tras evacuación de 14 L de líquido ascítico durante su ingreso; subjetivamente se encuentra más delgada que antes del inicio de la sintomatología. Presenta palidez cutánea, dedos de las manos longilíneos, discretos edemas maleolares simétricos. El resto de la exploración física es normal. No refiere sintomatología gastrointestinal habitual, salvo 1-2 deposiciones al día con aspecto algo graso. Realiza una dieta variada, evitando alimentos excesivamente grasos desde siempre, por intolerancia. Niega hábitos tóxicos. Nuligesta. Analíticamente, presentaba valores séricos de proteínas totales 3,4 g/dL, albúmina 2,1 g/dL, calcio 7,3 mg/dL. El resto de bioquímica básica, lipidograma, y hemograma fueron normales. Decidimos instaurar tratamiento dietético. Se elabora una dieta personalizada, de 2.200 kcal en 24 horas y la siguiente distribución de nutrientes: 52% hidratos de carbono, 30% lípidos, 18% proteínas. El aporte de grasas procedentes de los alimentos se restringe, y se aportan los lípidos en forma de aceite MCT, utilizando la cantidad de 85 ml al día, introducidos en la dieta de manera progresiva para evitar intolerancias. Los aportes proteicos de la dieta se completan con 400 ml de fórmula hiperproteica para nutrición enteral y 20 g de módulo proteico en polvo. Además se agrega un complemento vitamínico-mineral. La paciente es colaboradora y presenta un estricto cumplimiento de las pautas recomendadas, con buena adaptación y excelente tolerancia. Tras 11 meses de seguimiento, ha logrado ganancia ponderal, con un peso de 59,3 kg e IMC 21,4. Los parámetros analíticos han experimentado una mejora significativa, siendo los valores séricos de proteínas totales 5,2 g/L, albúmina 3,7 g/L, calcio 8,5 mg/dL. No presenta síntomas gastrointestinales. El perímetro de cintura es de 78 cm, y en ecografía abdominal de control no se observa líquido libre en abdomen. No ha presentado nuevos episodios de ascitis ni ha precisado ingresos hospitalarios durante este período. Responsable clínico: Dra. Cristina Campos Martín. C/ Fedra, 3, 3º B. 41009 Sevilla. E-mail: smaradigna@hotmail.com
[ "Datos", "del", "paciente", ".", "\n", "Nombre", ":", "Laura", ".", "\n", "Apellidos", ":", "Gutiérrez", "Simón", ".", "\n", "NHC", ":", "Calle", "Alférez", "Luis", "Martín", "Vidales", ",", "2", ",", "8", "C.", "\n", "NASS", ":", "7346582", ".", "\n", "Domicilio", ":", "37", "45673567", "04", ".", "\n", "Localidad/", "Provincia", ":", "Sevilla", ".", "\n", "CP", ":", "41009", ".", "\n", "Datos", "asistenciales", ".", "\n", "Fecha", "de", "nacimiento", ":", "10/10/1981", ".", "\n", "País", "de", "nacimiento", ":", "España", ".", "\n", "Edad", ":", "35", "años", "Sexo", ":", "M.", "\n", "Fecha", "de", "Ingreso", ":", "01/03/2017", ".", "\n", "Médico", ":", "Cristina", "Campos", "Martín", " ", "NºCol", ":", " ", "41", "41", "50236", ".", "\n", "Informe", "clínico", "del", "paciente", ":", "Presentamos", "el", "caso", "de", "una", "paciente", "de", "35", "años", ".", "Acude", "remitida", "a", "nuestra", "Unidad", "tras", "su", "tercer", "ingreso", "hospitalario", "en", "los", "18", "meses", "previos", "por", "ascitis", "quilosa", "de", "repetición", ".", "Sin", "antecedentes", "de", "interés", ",", "ingresa", "por", "primera", "vez", "con", "cuadro", "de", "ascitis", "y", "edemas", "leves", "en", "miembros", "inferiores", "de", "un", "mes", "y", "medio", "de", "evolución", ",", "practicándosele", "laparotomía", "exploradora", "ante", "la", "sospecha", "de", "neoplasia", "de", "ovario", ".", "Se", "evacuaron", "12", "litros", "de", "líquido", "ascítico", "de", "características", "quilosas", ",", "sin", "apreciarse", "anomalías", "en", "ovarios", "ni", "carcinomatosis", "peritoneal", ".", "\n", "Dada", "de", "alta", "con", "tratamiento", "diurético", "con", "espironolactona", "100", "mg", "y", "prednisona", "40", "mg", "en", "pauta", "descendente", ",", "a", "los", "5", "meses", "reingresa", ",", "extrayéndose", "9", "litros", "de", "líquido", "quiloso", "mediante", "paracentesis", "evacuadora", ".", "En", "un", "nuevo", "ingreso", ",", "6", "meses", "después", ",", "durante", "los", "cuales", "la", "sintomatología", "había", "ido", "reapareciendo", "progresivamente", ",", "se", "evacuan", "14", "litros", "más", "de", "líquido", "peritoneal", ".", "\n", "A", "lo", "largo", "de", "su", "estancia", "en", "hospitalización", ",", "se", "le", "realizan", "las", "siguientes", "pruebas", "complementarias", ":", "hemograma", ",", "con", "discreta", "leucocitosis", "y", "fórmula", "normal", ",", "estudio", "del", "hierro", "sin", "alteraciones", ";", "perfil", "bioquímico", ",", "con", "hipoproteinemia", "e", "hipoalbuminemia", ",", "hipocalcemia", ".", "Las", "determinaciones", "de", "perfil", "celíaco", ",", "AgHBs", ",", "AcVHC", ",", "marcadores", "tumorales", ",", "y", "Mantoux", ",", "fueron", "negativas", ".", "Niveles", "de", "ASLO", ",", "proteína", "C", "reactiva", "y", "a-1", "antitripsina", "sérica", ",", "normales", ".", "Estudio", "de", "función", "tiroidea", "dentro", "de", "la", "normalidad", ".", "El", "proteinograma", "en", "suero", "mostró", "valores", "descendidos", "de", "albúmina", "y", "gammaglobulinas", ".", "\n", "El", "líquido", "ascítico", "extraído", "presentaba", "características", "de", "exudado", "y", "aspecto", "quiloso", ".", "Su", "cultivo", "fue", "negativo", ".", "\n", "El", "TAC", "toracoabdominal", "puso", "de", "manifiesto", "tórax", "normal", ",", "ascitis", "en", "todos", "los", "compartimentos", "peritoneales", ",", "edemas", "en", "asas", "de", "intestino", "delgado", ".", "En", "la", "ecografía", "abdominal", "se", "observó", "abundante", "líquido", "ascítico", "peritoneal", ",", "con", "hígado", ",", "porta", ",", "grandes", "vasos", ",", "vesícula", "y", "bazo", "normales", ".", "La", "fibroenteroscopia", ",", "alcanzando", "ciego", ",", "muestra", "desde", "bulbo", "hasta", "los", "tramos", "de", "yeyuno", "explorados", ",", "irregularidad", "en", "el", "patrón", "vellositario", ",", "edema", "de", "pliegues", "y", "numerosas", "linfangiectasias", "puntiformes", ".", "Se", "realiza", "ileoscopia", ",", "presentando", "el", "íleon", "terminal", "una", "mucosa", "extremadamente", "irregular", ",", "con", "placas", "blanquecinas", "y", "friables", "a", "la", "toma", "de", "biopsias", ".", "La", "capsuloendoscopia", "evidencia", "afectación", "difusa", "de", "intestino", "delgado", ",", "con", "formaciones", "puntiformes", "\"", "en", "grano", "de", "mijo", "\"", "y", "pliegues", "edematosos", "y", "congestivos", ".", "La", "biopsia", "de", "mucosa", "intestinal", "fue", "informada", "como", "hiperplasia", "folicular", "linfoide", ",", "linfangiectasia", "focal", ";", "y", "la", "de", "mucosa", "gástrica", ",", "duodenal", "y", "yeyunal", "no", "evidenció", "alteraciones", "significativas", ".", "\n", "Se", "inicia", "tratamiento", "con", "diuréticos", "y", "albúmina", "intravenosa", ",", "presentando", "un", "evolución", "clínica", "favorable", ",", "siendo", "dada", "de", "alta", "con", "el", "diagnóstico", "de", "linfangiectasia", "intestinal", "primaria", ",", "pautándose", "tratamiento", "domiciliario", "con", "Furosemida", "40", "mg", ",", "Espironolactona", "100", "mg", "y", "Prednisona", "30", "mg", ",", "siendo", "derivada", "a", "la", "Unidad", "de", "Nutrición", "Clínica", "y", "Dietética", "para", "su", "valoración", "y", "seguimiento", ".", "\n", "La", "exploración", "en", "Consultas", "muestra", "una", "talla", "de", "1,65", "m", ",", "peso", "53,5", "kg", ",", "con", "IMC", "19,3", "kg", "/", "m2", ",", "tras", "evacuación", "de", "14", "L", "de", "líquido", "ascítico", "durante", "su", "ingreso", ";", "subjetivamente", "se", "encuentra", "más", "delgada", "que", "antes", "del", "inicio", "de", "la", "sintomatología", ".", "Presenta", "palidez", "cutánea", ",", "dedos", "de", "las", "manos", "longilíneos", ",", "discretos", "edemas", "maleolares", "simétricos", ".", "El", "resto", "de", "la", "exploración", "física", "es", "normal", ".", "\n", "No", "refiere", "sintomatología", "gastrointestinal", "habitual", ",", "salvo", "1", "-", "2", "deposiciones", "al", "día", "con", "aspecto", "algo", "graso", ".", "Realiza", "una", "dieta", "variada", ",", "evitando", "alimentos", "excesivamente", "grasos", "desde", "siempre", ",", "por", "intolerancia", ".", "Niega", "hábitos", "tóxicos", ".", "Nuligesta", ".", "\n", "Analíticamente", ",", "presentaba", "valores", "séricos", "de", "proteínas", "totales", "3,4", "g", "/", "dL", ",", "albúmina", "2,1", "g", "/", "dL", ",", "calcio", "7,3", "mg", "/", "dL.", "El", "resto", "de", "bioquímica", "básica", ",", "lipidograma", ",", "y", "hemograma", "fueron", "normales", ".", "\n", "Decidimos", "instaurar", "tratamiento", "dietético", ".", "Se", "elabora", "una", "dieta", "personalizada", ",", "de", "2.200", "kcal", "en", "24", "horas", "y", "la", "siguiente", "distribución", "de", "nutrientes", ":", "52", "%", "hidratos", "de", "carbono", ",", "30", "%", "lípidos", ",", "18", "%", "proteínas", ".", "El", "aporte", "de", "grasas", "procedentes", "de", "los", "alimentos", "se", "restringe", ",", "y", "se", "aportan", "los", "lípidos", "en", "forma", "de", "aceite", "MCT", ",", "utilizando", "la", "cantidad", "de", "85", "ml", "al", "día", ",", "introducidos", "en", "la", "dieta", "de", "manera", "progresiva", "para", "evitar", "intolerancias", ".", "Los", "aportes", "proteicos", "de", "la", "dieta", "se", "completan", "con", "400", "ml", "de", "fórmula", "hiperproteica", "para", "nutrición", "enteral", "y", "20", "g", "de", "módulo", "proteico", "en", "polvo", ".", "Además", "se", "agrega", "un", "complemento", "vitamínico", "-", "mineral", ".", "\n", "La", "paciente", "es", "colaboradora", "y", "presenta", "un", "estricto", "cumplimiento", "de", "las", "pautas", "recomendadas", ",", "con", "buena", "adaptación", "y", "excelente", "tolerancia", ".", "\n", "Tras", "11", "meses", "de", "seguimiento", ",", "ha", "logrado", "ganancia", "ponderal", ",", "con", "un", "peso", "de", "59,3", "kg", "e", "IMC", "21,4", ".", "Los", "parámetros", "analíticos", "han", "experimentado", "una", "mejora", "significativa", ",", "siendo", "los", "valores", "séricos", "de", "proteínas", "totales", "5,2", "g", "/", "L", ",", "albúmina", "3,7", "g", "/", "L", ",", "calcio", "8,5", "mg", "/", "dL.", "No", "presenta", "síntomas", "gastrointestinales", ".", "El", "perímetro", "de", "cintura", "es", "de", "78", "cm", ",", "y", "en", "ecografía", "abdominal", "de", "control", "no", "se", "observa", "líquido", "libre", "en", "abdomen", ".", "No", "ha", "presentado", "nuevos", "episodios", "de", "ascitis", "ni", "ha", "precisado", "ingresos", "hospitalarios", "durante", "este", "período", ".", "\n", "Responsable", "clínico", ":", "Dra", ".", "Cristina", "Campos", "Martín", ".", "C/", "Fedra", ",", "3", ",", "3º", "B.", "41009", "Sevilla", ".", "E", "-", "mail", ":", "smaradigna@hotmail.com", "\n" ]
[ "CALLE", "CORREO_ELECTRONICO", "NOMBRE_PERSONAL_SANITARIO", "NOMBRE_SUJETO_ASISTENCIA", "ID_ASEGURAMIENTO", "ID_TITULACION_PERSONAL_SANITARIO", "FECHAS", "TERRITORIO", "EDAD_SUJETO_ASISTENCIA", "ID_SUJETO_ASISTENCIA", "PAIS", "SEXO_SUJETO_ASISTENCIA" ]
IPI-926 is a CHEMICAL
23527529_task0
Sentence: The pre-clinical absorption, distribution, metabolism and excretion properties of IPI-926, an orally bioavailable antagonist of the hedgehog signal transduction pathway. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: CHEMICAL
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
The pre-clinical absorption, distribution, metabolism and excretion properties of IPI-926, an orally bioavailable antagonist of the hedgehog signal transduction pathway.
[ "The", "pre", "-", "clinical", "absorption", ",", "distribution", ",", "metabolism", "and", "excretion", "properties", "of", "IPI-926", ",", "an", "orally", "bioavailable", "antagonist", "of", "the", "hedgehog", "signal", "transduction", "pathway", "." ]
[ "GENE-N", "CHEMICAL" ]
IPI-926 is a CHEMICAL
23527529_task1
Sentence: The pre-clinical absorption, distribution, metabolism and excretion properties of IPI-926, an orally bioavailable antagonist of the hedgehog signal transduction pathway. Instructions: please typing these entity words according to sentence: IPI-926 Options: CHEMICAL
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
The pre-clinical absorption, distribution, metabolism and excretion properties of IPI-926, an orally bioavailable antagonist of the hedgehog signal transduction pathway.
[ "The", "pre", "-", "clinical", "absorption", ",", "distribution", ",", "metabolism", "and", "excretion", "properties", "of", "IPI-926", ",", "an", "orally", "bioavailable", "antagonist", "of", "the", "hedgehog", "signal", "transduction", "pathway", "." ]
[ "GENE-N", "CHEMICAL" ]
IPI-926
23527529_task2
Sentence: The pre-clinical absorption, distribution, metabolism and excretion properties of IPI-926, an orally bioavailable antagonist of the hedgehog signal transduction pathway. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
The pre-clinical absorption, distribution, metabolism and excretion properties of IPI-926, an orally bioavailable antagonist of the hedgehog signal transduction pathway.
[ "The", "pre", "-", "clinical", "absorption", ",", "distribution", ",", "metabolism", "and", "excretion", "properties", "of", "IPI-926", ",", "an", "orally", "bioavailable", "antagonist", "of", "the", "hedgehog", "signal", "transduction", "pathway", "." ]
[ "GENE-N", "CHEMICAL" ]
CD40 is a Protein
181_task0
Sentence: Immunoprecipitations Immunoprecipitation of CD40 was performed by activated receptor capture, as previously described [6]. Briefly, 3x107 cells (A20.2J and derivatives) were incubated for 60 minutes at room temperature with 10 microl magnetic protein G beads (Dynal) pre-coated with 10 microg goat anti-rat IgG (Jackson), and 10 microg anti-CD40 (1C10) or an isotype control antibody (mAb72). Cells/beads were then pelleted by centrifugation and lysed in buffer containing 1% Triton X100. Beads were washed with lysis buffer to remove unbound material. In some experiments, material associated with the beads was dephosphorylated with lambda phosphatase (New England BioLabs) as per manufacturer's instructions. Beads were resuspended in 2X SDS-PAGE sample buffer and heated for 5 minutes at 95degreesC. Material eluted from the beads was fractionated by SDS-PAGE and transferred to PVDF membranes for Western blotting. In some experiments, cells were cultured for 6 hrs with 25 microM antennapedia-linked SMAC-N7 peptide (Calbiochem) or an appropriate volume of the solvent used for the peptide (DMSO). After incubation, cells (in peptide- or DMSO-containing medium) were stimulated with antibody-coated beads as outlined above. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Protein
[ "O", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Immunoprecipitations Immunoprecipitation of CD40 was performed by activated receptor capture, as previously described [6]. Briefly, 3x107 cells (A20.2J and derivatives) were incubated for 60 minutes at room temperature with 10 microl magnetic protein G beads (Dynal) pre-coated with 10 microg goat anti-rat IgG (Jackson), and 10 microg anti-CD40 (1C10) or an isotype control antibody (mAb72). Cells/beads were then pelleted by centrifugation and lysed in buffer containing 1% Triton X100. Beads were washed with lysis buffer to remove unbound material. In some experiments, material associated with the beads was dephosphorylated with lambda phosphatase (New England BioLabs) as per manufacturer's instructions. Beads were resuspended in 2X SDS-PAGE sample buffer and heated for 5 minutes at 95degreesC. Material eluted from the beads was fractionated by SDS-PAGE and transferred to PVDF membranes for Western blotting. In some experiments, cells were cultured for 6 hrs with 25 microM antennapedia-linked SMAC-N7 peptide (Calbiochem) or an appropriate volume of the solvent used for the peptide (DMSO). After incubation, cells (in peptide- or DMSO-containing medium) were stimulated with antibody-coated beads as outlined above.
[ "Immunoprecipitations", "\n", "Immunoprecipitation", "of", "CD40", "was", "performed", "by", "activated", "receptor", "capture", ",", "as", "previously", "described", "[", "6", "]", ".", "Briefly", ",", "3x107", "cells", "(", "A20.2J", "and", "derivatives", ")", "were", "incubated", "for", "60", "minutes", "at", "room", "temperature", "with", "10", "microl", "magnetic", "protein", "G", "beads", "(", "Dynal", ")", "pre", "-", "coated", "with", "10", "microg", "goat", "anti", "-", "rat", "IgG", "(", "Jackson", ")", ",", "and", "10", "microg", "anti", "-", "CD40", "(", "1C10", ")", "or", "an", "isotype", "control", "antibody", "(", "mAb72", ")", ".", "Cells", "/", "beads", "were", "then", "pelleted", "by", "centrifugation", "and", "lysed", "in", "buffer", "containing", "1", "%", "Triton", "X100", ".", "Beads", "were", "washed", "with", "lysis", "buffer", "to", "remove", "unbound", "material", ".", "In", "some", "experiments", ",", "material", "associated", "with", "the", "beads", "was", "dephosphorylated", "with", "lambda", "phosphatase", "(", "New", "England", "BioLabs", ")", "as", "per", "manufacturer", "'s", "instructions", ".", "Beads", "were", "resuspended", "in", "2X", "SDS", "-", "PAGE", "sample", "buffer", "and", "heated", "for", "5", "minutes", "at", "95degreesC.", "Material", "eluted", "from", "the", "beads", "was", "fractionated", "by", "SDS", "-", "PAGE", "and", "transferred", "to", "PVDF", "membranes", "for", "Western", "blotting", ".", "In", "some", "experiments", ",", "cells", "were", "cultured", "for", "6", "hrs", "with", "25", "microM", "antennapedia", "-", "linked", "SMAC", "-", "N7", "peptide", "(", "Calbiochem", ")", "or", "an", "appropriate", "volume", "of", "the", "solvent", "used", "for", "the", "peptide", "(", "DMSO", ")", ".", "After", "incubation", ",", "cells", "(", "in", "peptide-", "or", "DMSO", "-", "containing", "medium", ")", "were", "stimulated", "with", "antibody", "-", "coated", "beads", "as", "outlined", "above", "." ]
[ "Protein" ]
CD40 is a Protein
181_task1
Sentence: Immunoprecipitations Immunoprecipitation of CD40 was performed by activated receptor capture, as previously described [6]. Briefly, 3x107 cells (A20.2J and derivatives) were incubated for 60 minutes at room temperature with 10 microl magnetic protein G beads (Dynal) pre-coated with 10 microg goat anti-rat IgG (Jackson), and 10 microg anti-CD40 (1C10) or an isotype control antibody (mAb72). Cells/beads were then pelleted by centrifugation and lysed in buffer containing 1% Triton X100. Beads were washed with lysis buffer to remove unbound material. In some experiments, material associated with the beads was dephosphorylated with lambda phosphatase (New England BioLabs) as per manufacturer's instructions. Beads were resuspended in 2X SDS-PAGE sample buffer and heated for 5 minutes at 95degreesC. Material eluted from the beads was fractionated by SDS-PAGE and transferred to PVDF membranes for Western blotting. In some experiments, cells were cultured for 6 hrs with 25 microM antennapedia-linked SMAC-N7 peptide (Calbiochem) or an appropriate volume of the solvent used for the peptide (DMSO). After incubation, cells (in peptide- or DMSO-containing medium) were stimulated with antibody-coated beads as outlined above. Instructions: please typing these entity words according to sentence: CD40 Options: Protein
[ "O", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Immunoprecipitations Immunoprecipitation of CD40 was performed by activated receptor capture, as previously described [6]. Briefly, 3x107 cells (A20.2J and derivatives) were incubated for 60 minutes at room temperature with 10 microl magnetic protein G beads (Dynal) pre-coated with 10 microg goat anti-rat IgG (Jackson), and 10 microg anti-CD40 (1C10) or an isotype control antibody (mAb72). Cells/beads were then pelleted by centrifugation and lysed in buffer containing 1% Triton X100. Beads were washed with lysis buffer to remove unbound material. In some experiments, material associated with the beads was dephosphorylated with lambda phosphatase (New England BioLabs) as per manufacturer's instructions. Beads were resuspended in 2X SDS-PAGE sample buffer and heated for 5 minutes at 95degreesC. Material eluted from the beads was fractionated by SDS-PAGE and transferred to PVDF membranes for Western blotting. In some experiments, cells were cultured for 6 hrs with 25 microM antennapedia-linked SMAC-N7 peptide (Calbiochem) or an appropriate volume of the solvent used for the peptide (DMSO). After incubation, cells (in peptide- or DMSO-containing medium) were stimulated with antibody-coated beads as outlined above.
[ "Immunoprecipitations", "\n", "Immunoprecipitation", "of", "CD40", "was", "performed", "by", "activated", "receptor", "capture", ",", "as", "previously", "described", "[", "6", "]", ".", "Briefly", ",", "3x107", "cells", "(", "A20.2J", "and", "derivatives", ")", "were", "incubated", "for", "60", "minutes", "at", "room", "temperature", "with", "10", "microl", "magnetic", "protein", "G", "beads", "(", "Dynal", ")", "pre", "-", "coated", "with", "10", "microg", "goat", "anti", "-", "rat", "IgG", "(", "Jackson", ")", ",", "and", "10", "microg", "anti", "-", "CD40", "(", "1C10", ")", "or", "an", "isotype", "control", "antibody", "(", "mAb72", ")", ".", "Cells", "/", "beads", "were", "then", "pelleted", "by", "centrifugation", "and", "lysed", "in", "buffer", "containing", "1", "%", "Triton", "X100", ".", "Beads", "were", "washed", "with", "lysis", "buffer", "to", "remove", "unbound", "material", ".", "In", "some", "experiments", ",", "material", "associated", "with", "the", "beads", "was", "dephosphorylated", "with", "lambda", "phosphatase", "(", "New", "England", "BioLabs", ")", "as", "per", "manufacturer", "'s", "instructions", ".", "Beads", "were", "resuspended", "in", "2X", "SDS", "-", "PAGE", "sample", "buffer", "and", "heated", "for", "5", "minutes", "at", "95degreesC.", "Material", "eluted", "from", "the", "beads", "was", "fractionated", "by", "SDS", "-", "PAGE", "and", "transferred", "to", "PVDF", "membranes", "for", "Western", "blotting", ".", "In", "some", "experiments", ",", "cells", "were", "cultured", "for", "6", "hrs", "with", "25", "microM", "antennapedia", "-", "linked", "SMAC", "-", "N7", "peptide", "(", "Calbiochem", ")", "or", "an", "appropriate", "volume", "of", "the", "solvent", "used", "for", "the", "peptide", "(", "DMSO", ")", ".", "After", "incubation", ",", "cells", "(", "in", "peptide-", "or", "DMSO", "-", "containing", "medium", ")", "were", "stimulated", "with", "antibody", "-", "coated", "beads", "as", "outlined", "above", "." ]
[ "Protein" ]
CD40
181_task2
Sentence: Immunoprecipitations Immunoprecipitation of CD40 was performed by activated receptor capture, as previously described [6]. Briefly, 3x107 cells (A20.2J and derivatives) were incubated for 60 minutes at room temperature with 10 microl magnetic protein G beads (Dynal) pre-coated with 10 microg goat anti-rat IgG (Jackson), and 10 microg anti-CD40 (1C10) or an isotype control antibody (mAb72). Cells/beads were then pelleted by centrifugation and lysed in buffer containing 1% Triton X100. Beads were washed with lysis buffer to remove unbound material. In some experiments, material associated with the beads was dephosphorylated with lambda phosphatase (New England BioLabs) as per manufacturer's instructions. Beads were resuspended in 2X SDS-PAGE sample buffer and heated for 5 minutes at 95degreesC. Material eluted from the beads was fractionated by SDS-PAGE and transferred to PVDF membranes for Western blotting. In some experiments, cells were cultured for 6 hrs with 25 microM antennapedia-linked SMAC-N7 peptide (Calbiochem) or an appropriate volume of the solvent used for the peptide (DMSO). After incubation, cells (in peptide- or DMSO-containing medium) were stimulated with antibody-coated beads as outlined above. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Immunoprecipitations Immunoprecipitation of CD40 was performed by activated receptor capture, as previously described [6]. Briefly, 3x107 cells (A20.2J and derivatives) were incubated for 60 minutes at room temperature with 10 microl magnetic protein G beads (Dynal) pre-coated with 10 microg goat anti-rat IgG (Jackson), and 10 microg anti-CD40 (1C10) or an isotype control antibody (mAb72). Cells/beads were then pelleted by centrifugation and lysed in buffer containing 1% Triton X100. Beads were washed with lysis buffer to remove unbound material. In some experiments, material associated with the beads was dephosphorylated with lambda phosphatase (New England BioLabs) as per manufacturer's instructions. Beads were resuspended in 2X SDS-PAGE sample buffer and heated for 5 minutes at 95degreesC. Material eluted from the beads was fractionated by SDS-PAGE and transferred to PVDF membranes for Western blotting. In some experiments, cells were cultured for 6 hrs with 25 microM antennapedia-linked SMAC-N7 peptide (Calbiochem) or an appropriate volume of the solvent used for the peptide (DMSO). After incubation, cells (in peptide- or DMSO-containing medium) were stimulated with antibody-coated beads as outlined above.
[ "Immunoprecipitations", "\n", "Immunoprecipitation", "of", "CD40", "was", "performed", "by", "activated", "receptor", "capture", ",", "as", "previously", "described", "[", "6", "]", ".", "Briefly", ",", "3x107", "cells", "(", "A20.2J", "and", "derivatives", ")", "were", "incubated", "for", "60", "minutes", "at", "room", "temperature", "with", "10", "microl", "magnetic", "protein", "G", "beads", "(", "Dynal", ")", "pre", "-", "coated", "with", "10", "microg", "goat", "anti", "-", "rat", "IgG", "(", "Jackson", ")", ",", "and", "10", "microg", "anti", "-", "CD40", "(", "1C10", ")", "or", "an", "isotype", "control", "antibody", "(", "mAb72", ")", ".", "Cells", "/", "beads", "were", "then", "pelleted", "by", "centrifugation", "and", "lysed", "in", "buffer", "containing", "1", "%", "Triton", "X100", ".", "Beads", "were", "washed", "with", "lysis", "buffer", "to", "remove", "unbound", "material", ".", "In", "some", "experiments", ",", "material", "associated", "with", "the", "beads", "was", "dephosphorylated", "with", "lambda", "phosphatase", "(", "New", "England", "BioLabs", ")", "as", "per", "manufacturer", "'s", "instructions", ".", "Beads", "were", "resuspended", "in", "2X", "SDS", "-", "PAGE", "sample", "buffer", "and", "heated", "for", "5", "minutes", "at", "95degreesC.", "Material", "eluted", "from", "the", "beads", "was", "fractionated", "by", "SDS", "-", "PAGE", "and", "transferred", "to", "PVDF", "membranes", "for", "Western", "blotting", ".", "In", "some", "experiments", ",", "cells", "were", "cultured", "for", "6", "hrs", "with", "25", "microM", "antennapedia", "-", "linked", "SMAC", "-", "N7", "peptide", "(", "Calbiochem", ")", "or", "an", "appropriate", "volume", "of", "the", "solvent", "used", "for", "the", "peptide", "(", "DMSO", ")", ".", "After", "incubation", ",", "cells", "(", "in", "peptide-", "or", "DMSO", "-", "containing", "medium", ")", "were", "stimulated", "with", "antibody", "-", "coated", "beads", "as", "outlined", "above", "." ]
[ "Protein" ]
Entzuendung is an umlsterm, Arterien is an umlsterm, Venen is an umlsterm, Aetiologie is an umlsterm, Tabakkonsum is an umlsterm, Literatur is an umlsterm, Ischaemie is an umlsterm, Patienten is an umlsterm, Thrombangiitis obliterans is an umlsterm, Therapieansaetze is an umlsterm
DerHautarzt.00510604.ger.abstr_task0
Sentence: Die Thrombangiitis obliterans Morbus Winiwarter-Buerger ) ( ist eine seltene Gefaesserkrankung , die durch eine segmentale , multilokulaere , nichtarteriosklerotische , thrombosierende Entzuendung der kleinen und mittleren Arterien und/oder Venen und Nerven charakterisiert ist . Die Aetiologie ist bis heute unklar . Es besteht ein kausaler Zusammenhang mit starkem Tabakkonsum . In der Literatur werden autoimmunologische immungenetische , infektioese oder haemostaseologische Ursachen , diskutiert . Klinisch zeigt sich oftmals das Bild einer distalen arteriellen Ischaemie mit einer akral gelegenen Ulzeration ohne Heilungstendenz . Viele Patienten suchen im Laufe einer progredienten , noch nicht diagnostizierten Thrombangiitis obliterans eine fachdermatologische Einrichtung auf . Anhand zweier Kasuistiken werden das Krankheitsbild , die differentialdiagnostische Bandbreite und die moeglichen Therapieansaetze dargestellt . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O" ]
Die Thrombangiitis obliterans Morbus Winiwarter-Buerger ) ( ist eine seltene Gefaesserkrankung , die durch eine segmentale , multilokulaere , nichtarteriosklerotische , thrombosierende Entzuendung der kleinen und mittleren Arterien und/oder Venen und Nerven charakterisiert ist . Die Aetiologie ist bis heute unklar . Es besteht ein kausaler Zusammenhang mit starkem Tabakkonsum . In der Literatur werden autoimmunologische immungenetische , infektioese oder haemostaseologische Ursachen , diskutiert . Klinisch zeigt sich oftmals das Bild einer distalen arteriellen Ischaemie mit einer akral gelegenen Ulzeration ohne Heilungstendenz . Viele Patienten suchen im Laufe einer progredienten , noch nicht diagnostizierten Thrombangiitis obliterans eine fachdermatologische Einrichtung auf . Anhand zweier Kasuistiken werden das Krankheitsbild , die differentialdiagnostische Bandbreite und die moeglichen Therapieansaetze dargestellt .
[ "Die", "Thrombangiitis", "obliterans", "Morbus", "Winiwarter", "-", "Buerger", ")", "(", "ist", "eine", "seltene", "Gefaesserkrankung", ",", "die", "durch", "eine", "segmentale", ",", "multilokulaere", ",", "nichtarteriosklerotische", ",", "thrombosierende", "Entzuendung", "der", "kleinen", "und", "mittleren", "Arterien", "und", "/", "oder", "Venen", "und", "Nerven", "charakterisiert", "ist", ".", "Die", "Aetiologie", "ist", "bis", "heute", "unklar", ".", "Es", "besteht", "ein", "kausaler", "Zusammenhang", "mit", "starkem", "Tabakkonsum", ".", "In", "der", "Literatur", "werden", "autoimmunologische", "immungenetische", ",", "infektioese", "oder", "haemostaseologische", "Ursachen", ",", "diskutiert", ".", "Klinisch", "zeigt", "sich", "oftmals", "das", "Bild", "einer", "distalen", "arteriellen", "Ischaemie", "mit", "einer", "akral", "gelegenen", "Ulzeration", "ohne", "Heilungstendenz", ".", "Viele", "Patienten", "suchen", "im", "Laufe", "einer", "progredienten", ",", "noch", "nicht", "diagnostizierten", "Thrombangiitis", "obliterans", "eine", "fachdermatologische", "Einrichtung", "auf", ".", "Anhand", "zweier", "Kasuistiken", "werden", "das", "Krankheitsbild", ",", "die", "differentialdiagnostische", "Bandbreite", "und", "die", "moeglichen", "Therapieansaetze", "dargestellt", "." ]
[ "umlsterm" ]
Entzuendung is an umlsterm, Arterien is an umlsterm, Venen is an umlsterm, Aetiologie is an umlsterm, Tabakkonsum is an umlsterm, Literatur is an umlsterm, Ischaemie is an umlsterm, Patienten is an umlsterm, Thrombangiitis obliterans is an umlsterm, Therapieansaetze is an umlsterm
DerHautarzt.00510604.ger.abstr_task1
Sentence: Die Thrombangiitis obliterans Morbus Winiwarter-Buerger ) ( ist eine seltene Gefaesserkrankung , die durch eine segmentale , multilokulaere , nichtarteriosklerotische , thrombosierende Entzuendung der kleinen und mittleren Arterien und/oder Venen und Nerven charakterisiert ist . Die Aetiologie ist bis heute unklar . Es besteht ein kausaler Zusammenhang mit starkem Tabakkonsum . In der Literatur werden autoimmunologische immungenetische , infektioese oder haemostaseologische Ursachen , diskutiert . Klinisch zeigt sich oftmals das Bild einer distalen arteriellen Ischaemie mit einer akral gelegenen Ulzeration ohne Heilungstendenz . Viele Patienten suchen im Laufe einer progredienten , noch nicht diagnostizierten Thrombangiitis obliterans eine fachdermatologische Einrichtung auf . Anhand zweier Kasuistiken werden das Krankheitsbild , die differentialdiagnostische Bandbreite und die moeglichen Therapieansaetze dargestellt . Instructions: please typing these entity words according to sentence: Entzuendung, Arterien, Venen, Aetiologie, Tabakkonsum, Literatur, Ischaemie, Patienten, Thrombangiitis obliterans, Therapieansaetze Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O" ]
Die Thrombangiitis obliterans Morbus Winiwarter-Buerger ) ( ist eine seltene Gefaesserkrankung , die durch eine segmentale , multilokulaere , nichtarteriosklerotische , thrombosierende Entzuendung der kleinen und mittleren Arterien und/oder Venen und Nerven charakterisiert ist . Die Aetiologie ist bis heute unklar . Es besteht ein kausaler Zusammenhang mit starkem Tabakkonsum . In der Literatur werden autoimmunologische immungenetische , infektioese oder haemostaseologische Ursachen , diskutiert . Klinisch zeigt sich oftmals das Bild einer distalen arteriellen Ischaemie mit einer akral gelegenen Ulzeration ohne Heilungstendenz . Viele Patienten suchen im Laufe einer progredienten , noch nicht diagnostizierten Thrombangiitis obliterans eine fachdermatologische Einrichtung auf . Anhand zweier Kasuistiken werden das Krankheitsbild , die differentialdiagnostische Bandbreite und die moeglichen Therapieansaetze dargestellt .
[ "Die", "Thrombangiitis", "obliterans", "Morbus", "Winiwarter", "-", "Buerger", ")", "(", "ist", "eine", "seltene", "Gefaesserkrankung", ",", "die", "durch", "eine", "segmentale", ",", "multilokulaere", ",", "nichtarteriosklerotische", ",", "thrombosierende", "Entzuendung", "der", "kleinen", "und", "mittleren", "Arterien", "und", "/", "oder", "Venen", "und", "Nerven", "charakterisiert", "ist", ".", "Die", "Aetiologie", "ist", "bis", "heute", "unklar", ".", "Es", "besteht", "ein", "kausaler", "Zusammenhang", "mit", "starkem", "Tabakkonsum", ".", "In", "der", "Literatur", "werden", "autoimmunologische", "immungenetische", ",", "infektioese", "oder", "haemostaseologische", "Ursachen", ",", "diskutiert", ".", "Klinisch", "zeigt", "sich", "oftmals", "das", "Bild", "einer", "distalen", "arteriellen", "Ischaemie", "mit", "einer", "akral", "gelegenen", "Ulzeration", "ohne", "Heilungstendenz", ".", "Viele", "Patienten", "suchen", "im", "Laufe", "einer", "progredienten", ",", "noch", "nicht", "diagnostizierten", "Thrombangiitis", "obliterans", "eine", "fachdermatologische", "Einrichtung", "auf", ".", "Anhand", "zweier", "Kasuistiken", "werden", "das", "Krankheitsbild", ",", "die", "differentialdiagnostische", "Bandbreite", "und", "die", "moeglichen", "Therapieansaetze", "dargestellt", "." ]
[ "umlsterm" ]
Entzuendung, Arterien, Venen, Aetiologie, Tabakkonsum, Literatur, Ischaemie, Patienten, Thrombangiitis obliterans, Therapieansaetze
DerHautarzt.00510604.ger.abstr_task2
Sentence: Die Thrombangiitis obliterans Morbus Winiwarter-Buerger ) ( ist eine seltene Gefaesserkrankung , die durch eine segmentale , multilokulaere , nichtarteriosklerotische , thrombosierende Entzuendung der kleinen und mittleren Arterien und/oder Venen und Nerven charakterisiert ist . Die Aetiologie ist bis heute unklar . Es besteht ein kausaler Zusammenhang mit starkem Tabakkonsum . In der Literatur werden autoimmunologische immungenetische , infektioese oder haemostaseologische Ursachen , diskutiert . Klinisch zeigt sich oftmals das Bild einer distalen arteriellen Ischaemie mit einer akral gelegenen Ulzeration ohne Heilungstendenz . Viele Patienten suchen im Laufe einer progredienten , noch nicht diagnostizierten Thrombangiitis obliterans eine fachdermatologische Einrichtung auf . Anhand zweier Kasuistiken werden das Krankheitsbild , die differentialdiagnostische Bandbreite und die moeglichen Therapieansaetze dargestellt . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O" ]
Die Thrombangiitis obliterans Morbus Winiwarter-Buerger ) ( ist eine seltene Gefaesserkrankung , die durch eine segmentale , multilokulaere , nichtarteriosklerotische , thrombosierende Entzuendung der kleinen und mittleren Arterien und/oder Venen und Nerven charakterisiert ist . Die Aetiologie ist bis heute unklar . Es besteht ein kausaler Zusammenhang mit starkem Tabakkonsum . In der Literatur werden autoimmunologische immungenetische , infektioese oder haemostaseologische Ursachen , diskutiert . Klinisch zeigt sich oftmals das Bild einer distalen arteriellen Ischaemie mit einer akral gelegenen Ulzeration ohne Heilungstendenz . Viele Patienten suchen im Laufe einer progredienten , noch nicht diagnostizierten Thrombangiitis obliterans eine fachdermatologische Einrichtung auf . Anhand zweier Kasuistiken werden das Krankheitsbild , die differentialdiagnostische Bandbreite und die moeglichen Therapieansaetze dargestellt .
[ "Die", "Thrombangiitis", "obliterans", "Morbus", "Winiwarter", "-", "Buerger", ")", "(", "ist", "eine", "seltene", "Gefaesserkrankung", ",", "die", "durch", "eine", "segmentale", ",", "multilokulaere", ",", "nichtarteriosklerotische", ",", "thrombosierende", "Entzuendung", "der", "kleinen", "und", "mittleren", "Arterien", "und", "/", "oder", "Venen", "und", "Nerven", "charakterisiert", "ist", ".", "Die", "Aetiologie", "ist", "bis", "heute", "unklar", ".", "Es", "besteht", "ein", "kausaler", "Zusammenhang", "mit", "starkem", "Tabakkonsum", ".", "In", "der", "Literatur", "werden", "autoimmunologische", "immungenetische", ",", "infektioese", "oder", "haemostaseologische", "Ursachen", ",", "diskutiert", ".", "Klinisch", "zeigt", "sich", "oftmals", "das", "Bild", "einer", "distalen", "arteriellen", "Ischaemie", "mit", "einer", "akral", "gelegenen", "Ulzeration", "ohne", "Heilungstendenz", ".", "Viele", "Patienten", "suchen", "im", "Laufe", "einer", "progredienten", ",", "noch", "nicht", "diagnostizierten", "Thrombangiitis", "obliterans", "eine", "fachdermatologische", "Einrichtung", "auf", ".", "Anhand", "zweier", "Kasuistiken", "werden", "das", "Krankheitsbild", ",", "die", "differentialdiagnostische", "Bandbreite", "und", "die", "moeglichen", "Therapieansaetze", "dargestellt", "." ]
[ "umlsterm" ]
R124C is a ProteinMutation
1335_task0
Sentence: Anticipation in familial lattice corneal dystrophy type I with R124C mutation in the TGFBI (BIGH3) gene. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: ProteinMutation
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ProteinMutation", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Anticipation in familial lattice corneal dystrophy type I with R124C mutation in the TGFBI (BIGH3) gene.
[ "Anticipation", "in", "familial", "lattice", "corneal", "dystrophy", "type", "I", "with", "R124C", "mutation", "in", "the", "TGFBI", "(", "BIGH3", ")", "gene", "." ]
[ "ProteinMutation", "DNAMutation" ]
R124C is a ProteinMutation
1335_task1
Sentence: Anticipation in familial lattice corneal dystrophy type I with R124C mutation in the TGFBI (BIGH3) gene. Instructions: please typing these entity words according to sentence: R124C Options: ProteinMutation
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ProteinMutation", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Anticipation in familial lattice corneal dystrophy type I with R124C mutation in the TGFBI (BIGH3) gene.
[ "Anticipation", "in", "familial", "lattice", "corneal", "dystrophy", "type", "I", "with", "R124C", "mutation", "in", "the", "TGFBI", "(", "BIGH3", ")", "gene", "." ]
[ "ProteinMutation", "DNAMutation" ]
R124C
1335_task2
Sentence: Anticipation in familial lattice corneal dystrophy type I with R124C mutation in the TGFBI (BIGH3) gene. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ProteinMutation", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Anticipation in familial lattice corneal dystrophy type I with R124C mutation in the TGFBI (BIGH3) gene.
[ "Anticipation", "in", "familial", "lattice", "corneal", "dystrophy", "type", "I", "with", "R124C", "mutation", "in", "the", "TGFBI", "(", "BIGH3", ")", "gene", "." ]
[ "ProteinMutation", "DNAMutation" ]
profilin is a Individual_protein, actin is a Individual_protein, actin is a Individual_protein
469_task0
Sentence: In this model, profilin can bind both to actin monomers with a Kd of about 5 microM and to the barbed end of actin filaments with a Kd of about 50-100 microM. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Individual_protein
[ "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
In this model, profilin can bind both to actin monomers with a Kd of about 5 microM and to the barbed end of actin filaments with a Kd of about 50-100 microM.
[ "In", "this", "model", ",", "profilin", "can", "bind", "both", "to", "actin", "monomers", "with", "a", "Kd", "of", "about", "5", "microM", "and", "to", "the", "barbed", "end", "of", "actin", "filaments", "with", "a", "Kd", "of", "about", "50", "-", "100", "microM." ]
[ "Individual_protein" ]
profilin is a Individual_protein, actin is a Individual_protein, actin is a Individual_protein
469_task1
Sentence: In this model, profilin can bind both to actin monomers with a Kd of about 5 microM and to the barbed end of actin filaments with a Kd of about 50-100 microM. Instructions: please typing these entity words according to sentence: profilin, actin, actin Options: Individual_protein
[ "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
In this model, profilin can bind both to actin monomers with a Kd of about 5 microM and to the barbed end of actin filaments with a Kd of about 50-100 microM.
[ "In", "this", "model", ",", "profilin", "can", "bind", "both", "to", "actin", "monomers", "with", "a", "Kd", "of", "about", "5", "microM", "and", "to", "the", "barbed", "end", "of", "actin", "filaments", "with", "a", "Kd", "of", "about", "50", "-", "100", "microM." ]
[ "Individual_protein" ]
profilin, actin, actin
469_task2
Sentence: In this model, profilin can bind both to actin monomers with a Kd of about 5 microM and to the barbed end of actin filaments with a Kd of about 50-100 microM. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
In this model, profilin can bind both to actin monomers with a Kd of about 5 microM and to the barbed end of actin filaments with a Kd of about 50-100 microM.
[ "In", "this", "model", ",", "profilin", "can", "bind", "both", "to", "actin", "monomers", "with", "a", "Kd", "of", "about", "5", "microM", "and", "to", "the", "barbed", "end", "of", "actin", "filaments", "with", "a", "Kd", "of", "about", "50", "-", "100", "microM." ]
[ "Individual_protein" ]
Angiomyolipomas is an umlsterm, hamartomas is an umlsterm, tuberous sclerosis is an umlsterm, tumor is an umlsterm, hemorrhage is an umlsterm, symptoms is an umlsterm, fat is an umlsterm, tumor is an umlsterm, computed tomography is an umlsterm, procedures is an umlsterm, case reports is an umlsterm, therapeutic is an umlsterm, literature is an umlsterm
DerChirurg.80690098.eng.abstr_task0
Sentence: Angiomyolipomas are hamartomas that may be found sporadically or associated with tuberous sclerosis ( M. Bourneville-Pringle ) . Clinically , this long-term asymptomatic tumor becomes evident as an acute retroperitoneal hemorrhage or by symptoms of a flank mass . Due to the high percentage of fat components in this tumor type , computed tomography is far superior to other radiological procedures . In view of two of our own case reports , the therapeutic strategies are discussed , paying regard to the actual literature in this field . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O" ]
Angiomyolipomas are hamartomas that may be found sporadically or associated with tuberous sclerosis ( M. Bourneville-Pringle ) . Clinically , this long-term asymptomatic tumor becomes evident as an acute retroperitoneal hemorrhage or by symptoms of a flank mass . Due to the high percentage of fat components in this tumor type , computed tomography is far superior to other radiological procedures . In view of two of our own case reports , the therapeutic strategies are discussed , paying regard to the actual literature in this field .
[ "Angiomyolipomas", "are", "hamartomas", "that", "may", "be", "found", "sporadically", "or", "associated", "with", "tuberous", "sclerosis", "(", "M.", "Bourneville", "-", "Pringle", ")", ".", "Clinically", ",", "this", "long", "-", "term", "asymptomatic", "tumor", "becomes", "evident", "as", "an", "acute", "retroperitoneal", "hemorrhage", "or", "by", "symptoms", "of", "a", "flank", "mass", ".", "Due", "to", "the", "high", "percentage", "of", "fat", "components", "in", "this", "tumor", "type", ",", "computed", "tomography", "is", "far", "superior", "to", "other", "radiological", "procedures", ".", "In", "view", "of", "two", "of", "our", "own", "case", "reports", ",", "the", "therapeutic", "strategies", "are", "discussed", ",", "paying", "regard", "to", "the", "actual", "literature", "in", "this", "field", "." ]
[ "umlsterm" ]
Angiomyolipomas is an umlsterm, hamartomas is an umlsterm, tuberous sclerosis is an umlsterm, tumor is an umlsterm, hemorrhage is an umlsterm, symptoms is an umlsterm, fat is an umlsterm, tumor is an umlsterm, computed tomography is an umlsterm, procedures is an umlsterm, case reports is an umlsterm, therapeutic is an umlsterm, literature is an umlsterm
DerChirurg.80690098.eng.abstr_task1
Sentence: Angiomyolipomas are hamartomas that may be found sporadically or associated with tuberous sclerosis ( M. Bourneville-Pringle ) . Clinically , this long-term asymptomatic tumor becomes evident as an acute retroperitoneal hemorrhage or by symptoms of a flank mass . Due to the high percentage of fat components in this tumor type , computed tomography is far superior to other radiological procedures . In view of two of our own case reports , the therapeutic strategies are discussed , paying regard to the actual literature in this field . Instructions: please typing these entity words according to sentence: Angiomyolipomas, hamartomas, tuberous sclerosis, tumor, hemorrhage, symptoms, fat, tumor, computed tomography, procedures, case reports, therapeutic, literature Options: umlsterm
[ "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O" ]
Angiomyolipomas are hamartomas that may be found sporadically or associated with tuberous sclerosis ( M. Bourneville-Pringle ) . Clinically , this long-term asymptomatic tumor becomes evident as an acute retroperitoneal hemorrhage or by symptoms of a flank mass . Due to the high percentage of fat components in this tumor type , computed tomography is far superior to other radiological procedures . In view of two of our own case reports , the therapeutic strategies are discussed , paying regard to the actual literature in this field .
[ "Angiomyolipomas", "are", "hamartomas", "that", "may", "be", "found", "sporadically", "or", "associated", "with", "tuberous", "sclerosis", "(", "M.", "Bourneville", "-", "Pringle", ")", ".", "Clinically", ",", "this", "long", "-", "term", "asymptomatic", "tumor", "becomes", "evident", "as", "an", "acute", "retroperitoneal", "hemorrhage", "or", "by", "symptoms", "of", "a", "flank", "mass", ".", "Due", "to", "the", "high", "percentage", "of", "fat", "components", "in", "this", "tumor", "type", ",", "computed", "tomography", "is", "far", "superior", "to", "other", "radiological", "procedures", ".", "In", "view", "of", "two", "of", "our", "own", "case", "reports", ",", "the", "therapeutic", "strategies", "are", "discussed", ",", "paying", "regard", "to", "the", "actual", "literature", "in", "this", "field", "." ]
[ "umlsterm" ]
Angiomyolipomas, hamartomas, tuberous sclerosis, tumor, hemorrhage, symptoms, fat, tumor, computed tomography, procedures, case reports, therapeutic, literature
DerChirurg.80690098.eng.abstr_task2
Sentence: Angiomyolipomas are hamartomas that may be found sporadically or associated with tuberous sclerosis ( M. Bourneville-Pringle ) . Clinically , this long-term asymptomatic tumor becomes evident as an acute retroperitoneal hemorrhage or by symptoms of a flank mass . Due to the high percentage of fat components in this tumor type , computed tomography is far superior to other radiological procedures . In view of two of our own case reports , the therapeutic strategies are discussed , paying regard to the actual literature in this field . Instructions: please extract entity words from the input sentence
[ "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O" ]
Angiomyolipomas are hamartomas that may be found sporadically or associated with tuberous sclerosis ( M. Bourneville-Pringle ) . Clinically , this long-term asymptomatic tumor becomes evident as an acute retroperitoneal hemorrhage or by symptoms of a flank mass . Due to the high percentage of fat components in this tumor type , computed tomography is far superior to other radiological procedures . In view of two of our own case reports , the therapeutic strategies are discussed , paying regard to the actual literature in this field .
[ "Angiomyolipomas", "are", "hamartomas", "that", "may", "be", "found", "sporadically", "or", "associated", "with", "tuberous", "sclerosis", "(", "M.", "Bourneville", "-", "Pringle", ")", ".", "Clinically", ",", "this", "long", "-", "term", "asymptomatic", "tumor", "becomes", "evident", "as", "an", "acute", "retroperitoneal", "hemorrhage", "or", "by", "symptoms", "of", "a", "flank", "mass", ".", "Due", "to", "the", "high", "percentage", "of", "fat", "components", "in", "this", "tumor", "type", ",", "computed", "tomography", "is", "far", "superior", "to", "other", "radiological", "procedures", ".", "In", "view", "of", "two", "of", "our", "own", "case", "reports", ",", "the", "therapeutic", "strategies", "are", "discussed", ",", "paying", "regard", "to", "the", "actual", "literature", "in", "this", "field", "." ]
[ "umlsterm" ]
HO-1 is a protein, YC-1 is a compound, ODQ is a compound, pyrimidin-4-ylamine is a compound, BAY 41 - 2272 is a compound
DS.d1711_task0
Sentence: The induction of HO-1 by YC-1 was unchanged by the sGC inhibitor, 1H-(1,2,4)oxadiazolo(4,3-alpha)quinozalin-1-one (ODQ) or by the protein kinase pyrimidin-4-ylamine (BAY 41-2272). Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: compound, protein
[ "O", "O", "O", "B-protein", "O", "B-compound", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-compound", "O", "O", "O", "O", "O", "O", "B-compound", "O", "B-compound", "I-compound", "I-compound", "I-compound", "O", "O" ]
The induction of HO-1 by YC-1 was unchanged by the sGC inhibitor, 1H-(1,2,4)oxadiazolo(4,3-alpha)quinozalin-1-one (ODQ) or by the protein kinase pyrimidin-4-ylamine (BAY 41-2272).
[ "The", "induction", "of", "HO-1", "by", "YC-1", "was", "unchanged", "by", "the", "sGC", "inhibitor", ",", "1H-(1,2,4)oxadiazolo(4,3-alpha)quinozalin-1-one", "(", "ODQ", ")", "or", "by", "the", "protein", "kinase", "pyrimidin-4-ylamine", "(", "BAY", "41", "-", "2272", ")", "." ]
[ "compound", "protein" ]
HO-1 is a protein, YC-1 is a compound, ODQ is a compound, pyrimidin-4-ylamine is a compound, BAY 41 - 2272 is a compound
DS.d1711_task1
Sentence: The induction of HO-1 by YC-1 was unchanged by the sGC inhibitor, 1H-(1,2,4)oxadiazolo(4,3-alpha)quinozalin-1-one (ODQ) or by the protein kinase pyrimidin-4-ylamine (BAY 41-2272). Instructions: please typing these entity words according to sentence: HO-1, YC-1, ODQ, pyrimidin-4-ylamine, BAY 41 - 2272 Options: compound, protein
[ "O", "O", "O", "B-protein", "O", "B-compound", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-compound", "O", "O", "O", "O", "O", "O", "B-compound", "O", "B-compound", "I-compound", "I-compound", "I-compound", "O", "O" ]
The induction of HO-1 by YC-1 was unchanged by the sGC inhibitor, 1H-(1,2,4)oxadiazolo(4,3-alpha)quinozalin-1-one (ODQ) or by the protein kinase pyrimidin-4-ylamine (BAY 41-2272).
[ "The", "induction", "of", "HO-1", "by", "YC-1", "was", "unchanged", "by", "the", "sGC", "inhibitor", ",", "1H-(1,2,4)oxadiazolo(4,3-alpha)quinozalin-1-one", "(", "ODQ", ")", "or", "by", "the", "protein", "kinase", "pyrimidin-4-ylamine", "(", "BAY", "41", "-", "2272", ")", "." ]
[ "compound", "protein" ]
HO-1, YC-1, ODQ, pyrimidin-4-ylamine, BAY 41 - 2272
DS.d1711_task2
Sentence: The induction of HO-1 by YC-1 was unchanged by the sGC inhibitor, 1H-(1,2,4)oxadiazolo(4,3-alpha)quinozalin-1-one (ODQ) or by the protein kinase pyrimidin-4-ylamine (BAY 41-2272). Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "B-protein", "O", "B-compound", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-compound", "O", "O", "O", "O", "O", "O", "B-compound", "O", "B-compound", "I-compound", "I-compound", "I-compound", "O", "O" ]
The induction of HO-1 by YC-1 was unchanged by the sGC inhibitor, 1H-(1,2,4)oxadiazolo(4,3-alpha)quinozalin-1-one (ODQ) or by the protein kinase pyrimidin-4-ylamine (BAY 41-2272).
[ "The", "induction", "of", "HO-1", "by", "YC-1", "was", "unchanged", "by", "the", "sGC", "inhibitor", ",", "1H-(1,2,4)oxadiazolo(4,3-alpha)quinozalin-1-one", "(", "ODQ", ")", "or", "by", "the", "protein", "kinase", "pyrimidin-4-ylamine", "(", "BAY", "41", "-", "2272", ")", "." ]
[ "compound", "protein" ]
Patienten is an umlsterm, peripheren Nervensystems is an umlsterm, Patienten is an umlsterm, Hemiparese is an umlsterm, Patienten is an umlsterm, Komabeginn is an umlsterm, Patienten is an umlsterm, Polyneuropathie is an umlsterm, Armmuskeln is an umlsterm, Noxen is an umlsterm, Komplikationen is an umlsterm, Sepsis is an umlsterm, Polyneuropathie is an umlsterm, Respirator is an umlsterm, Patienten is an umlsterm, EMG is an umlsterm
DerNervenarzt.70680659.ger.abstr_task0
Sentence: In einer prospektiv geplanten Studie wurden ueber einen Zeitraum von 31 Monaten alle ueber mehr als 14 Tage intensivmedizinisch behandelten Patienten klinisch und elektrophysiologisch zur Erfassung von Schaedigungen des peripheren Nervensystems untersucht . 78 Patienten wurden in die Studie eingeschlossen . Bei 54 Untersuchten war elektromyographisch beidseitige pathologische Spontanaktivitaet als Hinweis auf eine Denervierung nachweisbar . Bei weiteren 10 bestand isoliert auf der Seite der spastischen Hemiparese pathologische Spontanaktivitaet . Von den 51 Patienten , die vor dem 26. Krankheitstag nach Komabeginn untersucht wurden , wiesen 35 pathologische Spontanaktivitaet auf , offenbar Zeichen einer Schaedigung in der initialen Krankheitsphase . Bei 19 dieser Patienten bestand ein fuer eine Polyneuropathie ungewoehnliches Verteilungsmuster mit Bevorzugung proximaler Armmuskeln . Deshalb muessen neben Noxen , die direkt auf periphere Neurone wirken , auch transsynaptische Schaedigungsmechanismen erwogen werden . Die Schwere der elektromyographischen Veraenderungen korrelierte mit der Schwere des Krankheitsverlaufes und Komplikationen durch Sepsis und Multiorganversagen . Klinische Hinweise auf eine Polyneuropathie und Schwierigkeiten bei der Entwoehnung vom Respirator fanden sich nur bei weniger als der Haelfte der Patienten mit pathologischer Spontanaktivitaet im EMG . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O" ]
In einer prospektiv geplanten Studie wurden ueber einen Zeitraum von 31 Monaten alle ueber mehr als 14 Tage intensivmedizinisch behandelten Patienten klinisch und elektrophysiologisch zur Erfassung von Schaedigungen des peripheren Nervensystems untersucht . 78 Patienten wurden in die Studie eingeschlossen . Bei 54 Untersuchten war elektromyographisch beidseitige pathologische Spontanaktivitaet als Hinweis auf eine Denervierung nachweisbar . Bei weiteren 10 bestand isoliert auf der Seite der spastischen Hemiparese pathologische Spontanaktivitaet . Von den 51 Patienten , die vor dem 26. Krankheitstag nach Komabeginn untersucht wurden , wiesen 35 pathologische Spontanaktivitaet auf , offenbar Zeichen einer Schaedigung in der initialen Krankheitsphase . Bei 19 dieser Patienten bestand ein fuer eine Polyneuropathie ungewoehnliches Verteilungsmuster mit Bevorzugung proximaler Armmuskeln . Deshalb muessen neben Noxen , die direkt auf periphere Neurone wirken , auch transsynaptische Schaedigungsmechanismen erwogen werden . Die Schwere der elektromyographischen Veraenderungen korrelierte mit der Schwere des Krankheitsverlaufes und Komplikationen durch Sepsis und Multiorganversagen . Klinische Hinweise auf eine Polyneuropathie und Schwierigkeiten bei der Entwoehnung vom Respirator fanden sich nur bei weniger als der Haelfte der Patienten mit pathologischer Spontanaktivitaet im EMG .
[ "In", "einer", "prospektiv", "geplanten", "Studie", "wurden", "ueber", "einen", "Zeitraum", "von", "31", "Monaten", "alle", "ueber", "mehr", "als", "14", "Tage", "intensivmedizinisch", "behandelten", "Patienten", "klinisch", "und", "elektrophysiologisch", "zur", "Erfassung", "von", "Schaedigungen", "des", "peripheren", "Nervensystems", "untersucht", ".", "78", "Patienten", "wurden", "in", "die", "Studie", "eingeschlossen", ".", "Bei", "54", "Untersuchten", "war", "elektromyographisch", "beidseitige", "pathologische", "Spontanaktivitaet", "als", "Hinweis", "auf", "eine", "Denervierung", "nachweisbar", ".", "Bei", "weiteren", "10", "bestand", "isoliert", "auf", "der", "Seite", "der", "spastischen", "Hemiparese", "pathologische", "Spontanaktivitaet", ".", "Von", "den", "51", "Patienten", ",", "die", "vor", "dem", "26", ".", "Krankheitstag", "nach", "Komabeginn", "untersucht", "wurden", ",", "wiesen", "35", "pathologische", "Spontanaktivitaet", "auf", ",", "offenbar", "Zeichen", "einer", "Schaedigung", "in", "der", "initialen", "Krankheitsphase", ".", "Bei", "19", "dieser", "Patienten", "bestand", "ein", "fuer", "eine", "Polyneuropathie", "ungewoehnliches", "Verteilungsmuster", "mit", "Bevorzugung", "proximaler", "Armmuskeln", ".", "Deshalb", "muessen", "neben", "Noxen", ",", "die", "direkt", "auf", "periphere", "Neurone", "wirken", ",", "auch", "transsynaptische", "Schaedigungsmechanismen", "erwogen", "werden", ".", "Die", "Schwere", "der", "elektromyographischen", "Veraenderungen", "korrelierte", "mit", "der", "Schwere", "des", "Krankheitsverlaufes", "und", "Komplikationen", "durch", "Sepsis", "und", "Multiorganversagen", ".", "Klinische", "Hinweise", "auf", "eine", "Polyneuropathie", "und", "Schwierigkeiten", "bei", "der", "Entwoehnung", "vom", "Respirator", "fanden", "sich", "nur", "bei", "weniger", "als", "der", "Haelfte", "der", "Patienten", "mit", "pathologischer", "Spontanaktivitaet", "im", "EMG", "." ]
[ "umlsterm" ]
Patienten is an umlsterm, peripheren Nervensystems is an umlsterm, Patienten is an umlsterm, Hemiparese is an umlsterm, Patienten is an umlsterm, Komabeginn is an umlsterm, Patienten is an umlsterm, Polyneuropathie is an umlsterm, Armmuskeln is an umlsterm, Noxen is an umlsterm, Komplikationen is an umlsterm, Sepsis is an umlsterm, Polyneuropathie is an umlsterm, Respirator is an umlsterm, Patienten is an umlsterm, EMG is an umlsterm
DerNervenarzt.70680659.ger.abstr_task1
Sentence: In einer prospektiv geplanten Studie wurden ueber einen Zeitraum von 31 Monaten alle ueber mehr als 14 Tage intensivmedizinisch behandelten Patienten klinisch und elektrophysiologisch zur Erfassung von Schaedigungen des peripheren Nervensystems untersucht . 78 Patienten wurden in die Studie eingeschlossen . Bei 54 Untersuchten war elektromyographisch beidseitige pathologische Spontanaktivitaet als Hinweis auf eine Denervierung nachweisbar . Bei weiteren 10 bestand isoliert auf der Seite der spastischen Hemiparese pathologische Spontanaktivitaet . Von den 51 Patienten , die vor dem 26. Krankheitstag nach Komabeginn untersucht wurden , wiesen 35 pathologische Spontanaktivitaet auf , offenbar Zeichen einer Schaedigung in der initialen Krankheitsphase . Bei 19 dieser Patienten bestand ein fuer eine Polyneuropathie ungewoehnliches Verteilungsmuster mit Bevorzugung proximaler Armmuskeln . Deshalb muessen neben Noxen , die direkt auf periphere Neurone wirken , auch transsynaptische Schaedigungsmechanismen erwogen werden . Die Schwere der elektromyographischen Veraenderungen korrelierte mit der Schwere des Krankheitsverlaufes und Komplikationen durch Sepsis und Multiorganversagen . Klinische Hinweise auf eine Polyneuropathie und Schwierigkeiten bei der Entwoehnung vom Respirator fanden sich nur bei weniger als der Haelfte der Patienten mit pathologischer Spontanaktivitaet im EMG . Instructions: please typing these entity words according to sentence: Patienten, peripheren Nervensystems, Patienten, Hemiparese, Patienten, Komabeginn, Patienten, Polyneuropathie, Armmuskeln, Noxen, Komplikationen, Sepsis, Polyneuropathie, Respirator, Patienten, EMG Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O" ]
In einer prospektiv geplanten Studie wurden ueber einen Zeitraum von 31 Monaten alle ueber mehr als 14 Tage intensivmedizinisch behandelten Patienten klinisch und elektrophysiologisch zur Erfassung von Schaedigungen des peripheren Nervensystems untersucht . 78 Patienten wurden in die Studie eingeschlossen . Bei 54 Untersuchten war elektromyographisch beidseitige pathologische Spontanaktivitaet als Hinweis auf eine Denervierung nachweisbar . Bei weiteren 10 bestand isoliert auf der Seite der spastischen Hemiparese pathologische Spontanaktivitaet . Von den 51 Patienten , die vor dem 26. Krankheitstag nach Komabeginn untersucht wurden , wiesen 35 pathologische Spontanaktivitaet auf , offenbar Zeichen einer Schaedigung in der initialen Krankheitsphase . Bei 19 dieser Patienten bestand ein fuer eine Polyneuropathie ungewoehnliches Verteilungsmuster mit Bevorzugung proximaler Armmuskeln . Deshalb muessen neben Noxen , die direkt auf periphere Neurone wirken , auch transsynaptische Schaedigungsmechanismen erwogen werden . Die Schwere der elektromyographischen Veraenderungen korrelierte mit der Schwere des Krankheitsverlaufes und Komplikationen durch Sepsis und Multiorganversagen . Klinische Hinweise auf eine Polyneuropathie und Schwierigkeiten bei der Entwoehnung vom Respirator fanden sich nur bei weniger als der Haelfte der Patienten mit pathologischer Spontanaktivitaet im EMG .
[ "In", "einer", "prospektiv", "geplanten", "Studie", "wurden", "ueber", "einen", "Zeitraum", "von", "31", "Monaten", "alle", "ueber", "mehr", "als", "14", "Tage", "intensivmedizinisch", "behandelten", "Patienten", "klinisch", "und", "elektrophysiologisch", "zur", "Erfassung", "von", "Schaedigungen", "des", "peripheren", "Nervensystems", "untersucht", ".", "78", "Patienten", "wurden", "in", "die", "Studie", "eingeschlossen", ".", "Bei", "54", "Untersuchten", "war", "elektromyographisch", "beidseitige", "pathologische", "Spontanaktivitaet", "als", "Hinweis", "auf", "eine", "Denervierung", "nachweisbar", ".", "Bei", "weiteren", "10", "bestand", "isoliert", "auf", "der", "Seite", "der", "spastischen", "Hemiparese", "pathologische", "Spontanaktivitaet", ".", "Von", "den", "51", "Patienten", ",", "die", "vor", "dem", "26", ".", "Krankheitstag", "nach", "Komabeginn", "untersucht", "wurden", ",", "wiesen", "35", "pathologische", "Spontanaktivitaet", "auf", ",", "offenbar", "Zeichen", "einer", "Schaedigung", "in", "der", "initialen", "Krankheitsphase", ".", "Bei", "19", "dieser", "Patienten", "bestand", "ein", "fuer", "eine", "Polyneuropathie", "ungewoehnliches", "Verteilungsmuster", "mit", "Bevorzugung", "proximaler", "Armmuskeln", ".", "Deshalb", "muessen", "neben", "Noxen", ",", "die", "direkt", "auf", "periphere", "Neurone", "wirken", ",", "auch", "transsynaptische", "Schaedigungsmechanismen", "erwogen", "werden", ".", "Die", "Schwere", "der", "elektromyographischen", "Veraenderungen", "korrelierte", "mit", "der", "Schwere", "des", "Krankheitsverlaufes", "und", "Komplikationen", "durch", "Sepsis", "und", "Multiorganversagen", ".", "Klinische", "Hinweise", "auf", "eine", "Polyneuropathie", "und", "Schwierigkeiten", "bei", "der", "Entwoehnung", "vom", "Respirator", "fanden", "sich", "nur", "bei", "weniger", "als", "der", "Haelfte", "der", "Patienten", "mit", "pathologischer", "Spontanaktivitaet", "im", "EMG", "." ]
[ "umlsterm" ]
Patienten, peripheren Nervensystems, Patienten, Hemiparese, Patienten, Komabeginn, Patienten, Polyneuropathie, Armmuskeln, Noxen, Komplikationen, Sepsis, Polyneuropathie, Respirator, Patienten, EMG
DerNervenarzt.70680659.ger.abstr_task2
Sentence: In einer prospektiv geplanten Studie wurden ueber einen Zeitraum von 31 Monaten alle ueber mehr als 14 Tage intensivmedizinisch behandelten Patienten klinisch und elektrophysiologisch zur Erfassung von Schaedigungen des peripheren Nervensystems untersucht . 78 Patienten wurden in die Studie eingeschlossen . Bei 54 Untersuchten war elektromyographisch beidseitige pathologische Spontanaktivitaet als Hinweis auf eine Denervierung nachweisbar . Bei weiteren 10 bestand isoliert auf der Seite der spastischen Hemiparese pathologische Spontanaktivitaet . Von den 51 Patienten , die vor dem 26. Krankheitstag nach Komabeginn untersucht wurden , wiesen 35 pathologische Spontanaktivitaet auf , offenbar Zeichen einer Schaedigung in der initialen Krankheitsphase . Bei 19 dieser Patienten bestand ein fuer eine Polyneuropathie ungewoehnliches Verteilungsmuster mit Bevorzugung proximaler Armmuskeln . Deshalb muessen neben Noxen , die direkt auf periphere Neurone wirken , auch transsynaptische Schaedigungsmechanismen erwogen werden . Die Schwere der elektromyographischen Veraenderungen korrelierte mit der Schwere des Krankheitsverlaufes und Komplikationen durch Sepsis und Multiorganversagen . Klinische Hinweise auf eine Polyneuropathie und Schwierigkeiten bei der Entwoehnung vom Respirator fanden sich nur bei weniger als der Haelfte der Patienten mit pathologischer Spontanaktivitaet im EMG . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O" ]
In einer prospektiv geplanten Studie wurden ueber einen Zeitraum von 31 Monaten alle ueber mehr als 14 Tage intensivmedizinisch behandelten Patienten klinisch und elektrophysiologisch zur Erfassung von Schaedigungen des peripheren Nervensystems untersucht . 78 Patienten wurden in die Studie eingeschlossen . Bei 54 Untersuchten war elektromyographisch beidseitige pathologische Spontanaktivitaet als Hinweis auf eine Denervierung nachweisbar . Bei weiteren 10 bestand isoliert auf der Seite der spastischen Hemiparese pathologische Spontanaktivitaet . Von den 51 Patienten , die vor dem 26. Krankheitstag nach Komabeginn untersucht wurden , wiesen 35 pathologische Spontanaktivitaet auf , offenbar Zeichen einer Schaedigung in der initialen Krankheitsphase . Bei 19 dieser Patienten bestand ein fuer eine Polyneuropathie ungewoehnliches Verteilungsmuster mit Bevorzugung proximaler Armmuskeln . Deshalb muessen neben Noxen , die direkt auf periphere Neurone wirken , auch transsynaptische Schaedigungsmechanismen erwogen werden . Die Schwere der elektromyographischen Veraenderungen korrelierte mit der Schwere des Krankheitsverlaufes und Komplikationen durch Sepsis und Multiorganversagen . Klinische Hinweise auf eine Polyneuropathie und Schwierigkeiten bei der Entwoehnung vom Respirator fanden sich nur bei weniger als der Haelfte der Patienten mit pathologischer Spontanaktivitaet im EMG .
[ "In", "einer", "prospektiv", "geplanten", "Studie", "wurden", "ueber", "einen", "Zeitraum", "von", "31", "Monaten", "alle", "ueber", "mehr", "als", "14", "Tage", "intensivmedizinisch", "behandelten", "Patienten", "klinisch", "und", "elektrophysiologisch", "zur", "Erfassung", "von", "Schaedigungen", "des", "peripheren", "Nervensystems", "untersucht", ".", "78", "Patienten", "wurden", "in", "die", "Studie", "eingeschlossen", ".", "Bei", "54", "Untersuchten", "war", "elektromyographisch", "beidseitige", "pathologische", "Spontanaktivitaet", "als", "Hinweis", "auf", "eine", "Denervierung", "nachweisbar", ".", "Bei", "weiteren", "10", "bestand", "isoliert", "auf", "der", "Seite", "der", "spastischen", "Hemiparese", "pathologische", "Spontanaktivitaet", ".", "Von", "den", "51", "Patienten", ",", "die", "vor", "dem", "26", ".", "Krankheitstag", "nach", "Komabeginn", "untersucht", "wurden", ",", "wiesen", "35", "pathologische", "Spontanaktivitaet", "auf", ",", "offenbar", "Zeichen", "einer", "Schaedigung", "in", "der", "initialen", "Krankheitsphase", ".", "Bei", "19", "dieser", "Patienten", "bestand", "ein", "fuer", "eine", "Polyneuropathie", "ungewoehnliches", "Verteilungsmuster", "mit", "Bevorzugung", "proximaler", "Armmuskeln", ".", "Deshalb", "muessen", "neben", "Noxen", ",", "die", "direkt", "auf", "periphere", "Neurone", "wirken", ",", "auch", "transsynaptische", "Schaedigungsmechanismen", "erwogen", "werden", ".", "Die", "Schwere", "der", "elektromyographischen", "Veraenderungen", "korrelierte", "mit", "der", "Schwere", "des", "Krankheitsverlaufes", "und", "Komplikationen", "durch", "Sepsis", "und", "Multiorganversagen", ".", "Klinische", "Hinweise", "auf", "eine", "Polyneuropathie", "und", "Schwierigkeiten", "bei", "der", "Entwoehnung", "vom", "Respirator", "fanden", "sich", "nur", "bei", "weniger", "als", "der", "Haelfte", "der", "Patienten", "mit", "pathologischer", "Spontanaktivitaet", "im", "EMG", "." ]
[ "umlsterm" ]
placebo - controlled is a Intervention_Control, restenosis is a Outcome_Physical, in - stent restenosis is a Participant_Condition, Sirolimus is a Intervention_Pharmacological, ISR is a Participant_Condition, neointimal hyperplasia is a Outcome_Physical, Three hundred is a Participant_Sample-size, symptomatic patients with ISR is a Participant_Condition, usual - dose or high - dose sirolimus is a Intervention_Pharmacological, Angiographic restenosis at 6-month angiography is a Outcome_Physical, Restenosis is a Outcome_Physical, need for target vessel revascularization is a Outcome_Other, The sirolimus blood concentration is a Outcome_Physical, angiographic parameters of restenosis . is a Outcome_Physical
18135_task0
Sentence: Randomized , double-blind , placebo-controlled trial of oral sirolimus for restenosis prevention in patients with in-stent restenosis : the Oral Sirolimus to Inhibit Recurrent In-stent Stenosis ( OSIRIS ) trial . BACKGROUND Despite recent advances in interventional cardiology , including the introduction of drug-eluting stents for de novo coronary lesions , the treatment of in-stent restenosis ( ISR ) remains a challenging clinical issue . Given the efficacy of systemic sirolimus administration to prevent neointimal hyperplasia in animal models and to halt and even reverse the progression of allograft vasculopathy , the aim of the present double-blind , placebo-controlled study was to evaluate the efficacy of a 10-day oral sirolimus treatment with 2 different loading regimens for the prevention of recurrent restenosis in patients with ISR . METHODS AND RESULTS Three hundred symptomatic patients with ISR were randomly assigned to 1 of 3 treatment arms : placebo or usual-dose or high-dose sirolimus . Patients received a cumulative loading dose of 0 , 8 , or 24 mg of sirolimus 2 days before and the day of repeat intervention followed by maintenance therapy of 2 mg/d for 7 days . Angiographic restenosis at 6-month angiography was the primary end point of the study . Restenosis was significantly reduced from 42.2 % to 38.6 % and to 22.1 % in the placebo , usual-dose , and high-dose sirolimus groups , respectively ( P=0.005 ) . Similarly , the need for target vessel revascularization was reduced from 25.5 % to 24.2 % and to 15.2 % in the placebo , usual-dose , and high-dose groups , respectively ( P=0.08 ) . The sirolimus blood concentration on the day of the procedure correlated significantly with the late lumen loss at follow-up ( P < 0.001 ) . CONCLUSIONS In patients with ISR , an oral adjunctive sirolimus treatment with an intensified loading regimen before coronary intervention resulted in a significant improvement in the angiographic parameters of restenosis . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Intervention_Pharmacological, Participant_Condition, Intervention_Control, Outcome_Physical, Participant_Sample-size, Outcome_Other
[ "O", "O", "O", "O", "O", "O", "B-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "O", "O", "O", "O", "O", "B-Outcome_Physical", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical" ]
Randomized , double-blind , placebo-controlled trial of oral sirolimus for restenosis prevention in patients with in-stent restenosis : the Oral Sirolimus to Inhibit Recurrent In-stent Stenosis ( OSIRIS ) trial . BACKGROUND Despite recent advances in interventional cardiology , including the introduction of drug-eluting stents for de novo coronary lesions , the treatment of in-stent restenosis ( ISR ) remains a challenging clinical issue . Given the efficacy of systemic sirolimus administration to prevent neointimal hyperplasia in animal models and to halt and even reverse the progression of allograft vasculopathy , the aim of the present double-blind , placebo-controlled study was to evaluate the efficacy of a 10-day oral sirolimus treatment with 2 different loading regimens for the prevention of recurrent restenosis in patients with ISR . METHODS AND RESULTS Three hundred symptomatic patients with ISR were randomly assigned to 1 of 3 treatment arms : placebo or usual-dose or high-dose sirolimus . Patients received a cumulative loading dose of 0 , 8 , or 24 mg of sirolimus 2 days before and the day of repeat intervention followed by maintenance therapy of 2 mg/d for 7 days . Angiographic restenosis at 6-month angiography was the primary end point of the study . Restenosis was significantly reduced from 42.2 % to 38.6 % and to 22.1 % in the placebo , usual-dose , and high-dose sirolimus groups , respectively ( P=0.005 ) . Similarly , the need for target vessel revascularization was reduced from 25.5 % to 24.2 % and to 15.2 % in the placebo , usual-dose , and high-dose groups , respectively ( P=0.08 ) . The sirolimus blood concentration on the day of the procedure correlated significantly with the late lumen loss at follow-up ( P < 0.001 ) . CONCLUSIONS In patients with ISR , an oral adjunctive sirolimus treatment with an intensified loading regimen before coronary intervention resulted in a significant improvement in the angiographic parameters of restenosis .
[ "Randomized", ",", "double", "-", "blind", ",", "placebo", "-", "controlled", "trial", "of", "oral", "sirolimus", "for", "restenosis", "prevention", "in", "patients", "with", "in", "-", "stent", "restenosis", ":", "the", "Oral", "Sirolimus", "to", "Inhibit", "Recurrent", "In", "-", "stent", "Stenosis", "(", "OSIRIS", ")", "trial", ".", "BACKGROUND", "Despite", "recent", "advances", "in", "interventional", "cardiology", ",", "including", "the", "introduction", "of", "drug", "-", "eluting", "stents", "for", "de", "novo", "coronary", "lesions", ",", "the", "treatment", "of", "in", "-", "stent", "restenosis", "(", "ISR", ")", "remains", "a", "challenging", "clinical", "issue", ".", "Given", "the", "efficacy", "of", "systemic", "sirolimus", "administration", "to", "prevent", "neointimal", "hyperplasia", "in", "animal", "models", "and", "to", "halt", "and", "even", "reverse", "the", "progression", "of", "allograft", "vasculopathy", ",", "the", "aim", "of", "the", "present", "double", "-", "blind", ",", "placebo", "-", "controlled", "study", "was", "to", "evaluate", "the", "efficacy", "of", "a", "10-day", "oral", "sirolimus", "treatment", "with", "2", "different", "loading", "regimens", "for", "the", "prevention", "of", "recurrent", "restenosis", "in", "patients", "with", "ISR", ".", "METHODS", "AND", "RESULTS", "Three", "hundred", "symptomatic", "patients", "with", "ISR", "were", "randomly", "assigned", "to", "1", "of", "3", "treatment", "arms", ":", "placebo", "or", "usual", "-", "dose", "or", "high", "-", "dose", "sirolimus", ".", "Patients", "received", "a", "cumulative", "loading", "dose", "of", "0", ",", "8", ",", "or", "24", "mg", "of", "sirolimus", "2", "days", "before", "and", "the", "day", "of", "repeat", "intervention", "followed", "by", "maintenance", "therapy", "of", "2", "mg", "/", "d", "for", "7", "days", ".", "Angiographic", "restenosis", "at", "6-month", "angiography", "was", "the", "primary", "end", "point", "of", "the", "study", ".", "Restenosis", "was", "significantly", "reduced", "from", "42.2", "%", "to", "38.6", "%", "and", "to", "22.1", "%", "in", "the", "placebo", ",", "usual", "-", "dose", ",", "and", "high", "-", "dose", "sirolimus", "groups", ",", "respectively", "(", "P=0.005", ")", ".", "Similarly", ",", "the", "need", "for", "target", "vessel", "revascularization", "was", "reduced", "from", "25.5", "%", "to", "24.2", "%", "and", "to", "15.2", "%", "in", "the", "placebo", ",", "usual", "-", "dose", ",", "and", "high", "-", "dose", "groups", ",", "respectively", "(", "P=0.08", ")", ".", "The", "sirolimus", "blood", "concentration", "on", "the", "day", "of", "the", "procedure", "correlated", "significantly", "with", "the", "late", "lumen", "loss", "at", "follow", "-", "up", "(", "P", "<", "0.001", ")", ".", "CONCLUSIONS", "In", "patients", "with", "ISR", ",", "an", "oral", "adjunctive", "sirolimus", "treatment", "with", "an", "intensified", "loading", "regimen", "before", "coronary", "intervention", "resulted", "in", "a", "significant", "improvement", "in", "the", "angiographic", "parameters", "of", "restenosis", "." ]
[ "Outcome_Physical", "Outcome_Other", "Intervention_Pharmacological", "Participant_Condition", "Intervention_Physical", "Intervention_Control", "Participant_Sample-size" ]
placebo - controlled is a Intervention_Control, restenosis is a Outcome_Physical, in - stent restenosis is a Participant_Condition, Sirolimus is a Intervention_Pharmacological, ISR is a Participant_Condition, neointimal hyperplasia is a Outcome_Physical, Three hundred is a Participant_Sample-size, symptomatic patients with ISR is a Participant_Condition, usual - dose or high - dose sirolimus is a Intervention_Pharmacological, Angiographic restenosis at 6-month angiography is a Outcome_Physical, Restenosis is a Outcome_Physical, need for target vessel revascularization is a Outcome_Other, The sirolimus blood concentration is a Outcome_Physical, angiographic parameters of restenosis . is a Outcome_Physical
18135_task1
Sentence: Randomized , double-blind , placebo-controlled trial of oral sirolimus for restenosis prevention in patients with in-stent restenosis : the Oral Sirolimus to Inhibit Recurrent In-stent Stenosis ( OSIRIS ) trial . BACKGROUND Despite recent advances in interventional cardiology , including the introduction of drug-eluting stents for de novo coronary lesions , the treatment of in-stent restenosis ( ISR ) remains a challenging clinical issue . Given the efficacy of systemic sirolimus administration to prevent neointimal hyperplasia in animal models and to halt and even reverse the progression of allograft vasculopathy , the aim of the present double-blind , placebo-controlled study was to evaluate the efficacy of a 10-day oral sirolimus treatment with 2 different loading regimens for the prevention of recurrent restenosis in patients with ISR . METHODS AND RESULTS Three hundred symptomatic patients with ISR were randomly assigned to 1 of 3 treatment arms : placebo or usual-dose or high-dose sirolimus . Patients received a cumulative loading dose of 0 , 8 , or 24 mg of sirolimus 2 days before and the day of repeat intervention followed by maintenance therapy of 2 mg/d for 7 days . Angiographic restenosis at 6-month angiography was the primary end point of the study . Restenosis was significantly reduced from 42.2 % to 38.6 % and to 22.1 % in the placebo , usual-dose , and high-dose sirolimus groups , respectively ( P=0.005 ) . Similarly , the need for target vessel revascularization was reduced from 25.5 % to 24.2 % and to 15.2 % in the placebo , usual-dose , and high-dose groups , respectively ( P=0.08 ) . The sirolimus blood concentration on the day of the procedure correlated significantly with the late lumen loss at follow-up ( P < 0.001 ) . CONCLUSIONS In patients with ISR , an oral adjunctive sirolimus treatment with an intensified loading regimen before coronary intervention resulted in a significant improvement in the angiographic parameters of restenosis . Instructions: please typing these entity words according to sentence: placebo - controlled, restenosis, in - stent restenosis, Sirolimus, ISR, neointimal hyperplasia, Three hundred, symptomatic patients with ISR, usual - dose or high - dose sirolimus, Angiographic restenosis at 6-month angiography, Restenosis, need for target vessel revascularization, The sirolimus blood concentration, angiographic parameters of restenosis . Options: Intervention_Pharmacological, Participant_Condition, Intervention_Control, Outcome_Physical, Participant_Sample-size, Outcome_Other
[ "O", "O", "O", "O", "O", "O", "B-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "O", "O", "O", "O", "O", "B-Outcome_Physical", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical" ]
Randomized , double-blind , placebo-controlled trial of oral sirolimus for restenosis prevention in patients with in-stent restenosis : the Oral Sirolimus to Inhibit Recurrent In-stent Stenosis ( OSIRIS ) trial . BACKGROUND Despite recent advances in interventional cardiology , including the introduction of drug-eluting stents for de novo coronary lesions , the treatment of in-stent restenosis ( ISR ) remains a challenging clinical issue . Given the efficacy of systemic sirolimus administration to prevent neointimal hyperplasia in animal models and to halt and even reverse the progression of allograft vasculopathy , the aim of the present double-blind , placebo-controlled study was to evaluate the efficacy of a 10-day oral sirolimus treatment with 2 different loading regimens for the prevention of recurrent restenosis in patients with ISR . METHODS AND RESULTS Three hundred symptomatic patients with ISR were randomly assigned to 1 of 3 treatment arms : placebo or usual-dose or high-dose sirolimus . Patients received a cumulative loading dose of 0 , 8 , or 24 mg of sirolimus 2 days before and the day of repeat intervention followed by maintenance therapy of 2 mg/d for 7 days . Angiographic restenosis at 6-month angiography was the primary end point of the study . Restenosis was significantly reduced from 42.2 % to 38.6 % and to 22.1 % in the placebo , usual-dose , and high-dose sirolimus groups , respectively ( P=0.005 ) . Similarly , the need for target vessel revascularization was reduced from 25.5 % to 24.2 % and to 15.2 % in the placebo , usual-dose , and high-dose groups , respectively ( P=0.08 ) . The sirolimus blood concentration on the day of the procedure correlated significantly with the late lumen loss at follow-up ( P < 0.001 ) . CONCLUSIONS In patients with ISR , an oral adjunctive sirolimus treatment with an intensified loading regimen before coronary intervention resulted in a significant improvement in the angiographic parameters of restenosis .
[ "Randomized", ",", "double", "-", "blind", ",", "placebo", "-", "controlled", "trial", "of", "oral", "sirolimus", "for", "restenosis", "prevention", "in", "patients", "with", "in", "-", "stent", "restenosis", ":", "the", "Oral", "Sirolimus", "to", "Inhibit", "Recurrent", "In", "-", "stent", "Stenosis", "(", "OSIRIS", ")", "trial", ".", "BACKGROUND", "Despite", "recent", "advances", "in", "interventional", "cardiology", ",", "including", "the", "introduction", "of", "drug", "-", "eluting", "stents", "for", "de", "novo", "coronary", "lesions", ",", "the", "treatment", "of", "in", "-", "stent", "restenosis", "(", "ISR", ")", "remains", "a", "challenging", "clinical", "issue", ".", "Given", "the", "efficacy", "of", "systemic", "sirolimus", "administration", "to", "prevent", "neointimal", "hyperplasia", "in", "animal", "models", "and", "to", "halt", "and", "even", "reverse", "the", "progression", "of", "allograft", "vasculopathy", ",", "the", "aim", "of", "the", "present", "double", "-", "blind", ",", "placebo", "-", "controlled", "study", "was", "to", "evaluate", "the", "efficacy", "of", "a", "10-day", "oral", "sirolimus", "treatment", "with", "2", "different", "loading", "regimens", "for", "the", "prevention", "of", "recurrent", "restenosis", "in", "patients", "with", "ISR", ".", "METHODS", "AND", "RESULTS", "Three", "hundred", "symptomatic", "patients", "with", "ISR", "were", "randomly", "assigned", "to", "1", "of", "3", "treatment", "arms", ":", "placebo", "or", "usual", "-", "dose", "or", "high", "-", "dose", "sirolimus", ".", "Patients", "received", "a", "cumulative", "loading", "dose", "of", "0", ",", "8", ",", "or", "24", "mg", "of", "sirolimus", "2", "days", "before", "and", "the", "day", "of", "repeat", "intervention", "followed", "by", "maintenance", "therapy", "of", "2", "mg", "/", "d", "for", "7", "days", ".", "Angiographic", "restenosis", "at", "6-month", "angiography", "was", "the", "primary", "end", "point", "of", "the", "study", ".", "Restenosis", "was", "significantly", "reduced", "from", "42.2", "%", "to", "38.6", "%", "and", "to", "22.1", "%", "in", "the", "placebo", ",", "usual", "-", "dose", ",", "and", "high", "-", "dose", "sirolimus", "groups", ",", "respectively", "(", "P=0.005", ")", ".", "Similarly", ",", "the", "need", "for", "target", "vessel", "revascularization", "was", "reduced", "from", "25.5", "%", "to", "24.2", "%", "and", "to", "15.2", "%", "in", "the", "placebo", ",", "usual", "-", "dose", ",", "and", "high", "-", "dose", "groups", ",", "respectively", "(", "P=0.08", ")", ".", "The", "sirolimus", "blood", "concentration", "on", "the", "day", "of", "the", "procedure", "correlated", "significantly", "with", "the", "late", "lumen", "loss", "at", "follow", "-", "up", "(", "P", "<", "0.001", ")", ".", "CONCLUSIONS", "In", "patients", "with", "ISR", ",", "an", "oral", "adjunctive", "sirolimus", "treatment", "with", "an", "intensified", "loading", "regimen", "before", "coronary", "intervention", "resulted", "in", "a", "significant", "improvement", "in", "the", "angiographic", "parameters", "of", "restenosis", "." ]
[ "Outcome_Physical", "Outcome_Other", "Intervention_Pharmacological", "Participant_Condition", "Intervention_Physical", "Intervention_Control", "Participant_Sample-size" ]
placebo - controlled, restenosis, in - stent restenosis, Sirolimus, ISR, neointimal hyperplasia, Three hundred, symptomatic patients with ISR, usual - dose or high - dose sirolimus, Angiographic restenosis at 6-month angiography, Restenosis, need for target vessel revascularization, The sirolimus blood concentration, angiographic parameters of restenosis .
18135_task2
Sentence: Randomized , double-blind , placebo-controlled trial of oral sirolimus for restenosis prevention in patients with in-stent restenosis : the Oral Sirolimus to Inhibit Recurrent In-stent Stenosis ( OSIRIS ) trial . BACKGROUND Despite recent advances in interventional cardiology , including the introduction of drug-eluting stents for de novo coronary lesions , the treatment of in-stent restenosis ( ISR ) remains a challenging clinical issue . Given the efficacy of systemic sirolimus administration to prevent neointimal hyperplasia in animal models and to halt and even reverse the progression of allograft vasculopathy , the aim of the present double-blind , placebo-controlled study was to evaluate the efficacy of a 10-day oral sirolimus treatment with 2 different loading regimens for the prevention of recurrent restenosis in patients with ISR . METHODS AND RESULTS Three hundred symptomatic patients with ISR were randomly assigned to 1 of 3 treatment arms : placebo or usual-dose or high-dose sirolimus . Patients received a cumulative loading dose of 0 , 8 , or 24 mg of sirolimus 2 days before and the day of repeat intervention followed by maintenance therapy of 2 mg/d for 7 days . Angiographic restenosis at 6-month angiography was the primary end point of the study . Restenosis was significantly reduced from 42.2 % to 38.6 % and to 22.1 % in the placebo , usual-dose , and high-dose sirolimus groups , respectively ( P=0.005 ) . Similarly , the need for target vessel revascularization was reduced from 25.5 % to 24.2 % and to 15.2 % in the placebo , usual-dose , and high-dose groups , respectively ( P=0.08 ) . The sirolimus blood concentration on the day of the procedure correlated significantly with the late lumen loss at follow-up ( P < 0.001 ) . CONCLUSIONS In patients with ISR , an oral adjunctive sirolimus treatment with an intensified loading regimen before coronary intervention resulted in a significant improvement in the angiographic parameters of restenosis . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "B-Intervention_Control", "I-Intervention_Control", "I-Intervention_Control", "O", "O", "O", "O", "O", "B-Outcome_Physical", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical" ]
Randomized , double-blind , placebo-controlled trial of oral sirolimus for restenosis prevention in patients with in-stent restenosis : the Oral Sirolimus to Inhibit Recurrent In-stent Stenosis ( OSIRIS ) trial . BACKGROUND Despite recent advances in interventional cardiology , including the introduction of drug-eluting stents for de novo coronary lesions , the treatment of in-stent restenosis ( ISR ) remains a challenging clinical issue . Given the efficacy of systemic sirolimus administration to prevent neointimal hyperplasia in animal models and to halt and even reverse the progression of allograft vasculopathy , the aim of the present double-blind , placebo-controlled study was to evaluate the efficacy of a 10-day oral sirolimus treatment with 2 different loading regimens for the prevention of recurrent restenosis in patients with ISR . METHODS AND RESULTS Three hundred symptomatic patients with ISR were randomly assigned to 1 of 3 treatment arms : placebo or usual-dose or high-dose sirolimus . Patients received a cumulative loading dose of 0 , 8 , or 24 mg of sirolimus 2 days before and the day of repeat intervention followed by maintenance therapy of 2 mg/d for 7 days . Angiographic restenosis at 6-month angiography was the primary end point of the study . Restenosis was significantly reduced from 42.2 % to 38.6 % and to 22.1 % in the placebo , usual-dose , and high-dose sirolimus groups , respectively ( P=0.005 ) . Similarly , the need for target vessel revascularization was reduced from 25.5 % to 24.2 % and to 15.2 % in the placebo , usual-dose , and high-dose groups , respectively ( P=0.08 ) . The sirolimus blood concentration on the day of the procedure correlated significantly with the late lumen loss at follow-up ( P < 0.001 ) . CONCLUSIONS In patients with ISR , an oral adjunctive sirolimus treatment with an intensified loading regimen before coronary intervention resulted in a significant improvement in the angiographic parameters of restenosis .
[ "Randomized", ",", "double", "-", "blind", ",", "placebo", "-", "controlled", "trial", "of", "oral", "sirolimus", "for", "restenosis", "prevention", "in", "patients", "with", "in", "-", "stent", "restenosis", ":", "the", "Oral", "Sirolimus", "to", "Inhibit", "Recurrent", "In", "-", "stent", "Stenosis", "(", "OSIRIS", ")", "trial", ".", "BACKGROUND", "Despite", "recent", "advances", "in", "interventional", "cardiology", ",", "including", "the", "introduction", "of", "drug", "-", "eluting", "stents", "for", "de", "novo", "coronary", "lesions", ",", "the", "treatment", "of", "in", "-", "stent", "restenosis", "(", "ISR", ")", "remains", "a", "challenging", "clinical", "issue", ".", "Given", "the", "efficacy", "of", "systemic", "sirolimus", "administration", "to", "prevent", "neointimal", "hyperplasia", "in", "animal", "models", "and", "to", "halt", "and", "even", "reverse", "the", "progression", "of", "allograft", "vasculopathy", ",", "the", "aim", "of", "the", "present", "double", "-", "blind", ",", "placebo", "-", "controlled", "study", "was", "to", "evaluate", "the", "efficacy", "of", "a", "10-day", "oral", "sirolimus", "treatment", "with", "2", "different", "loading", "regimens", "for", "the", "prevention", "of", "recurrent", "restenosis", "in", "patients", "with", "ISR", ".", "METHODS", "AND", "RESULTS", "Three", "hundred", "symptomatic", "patients", "with", "ISR", "were", "randomly", "assigned", "to", "1", "of", "3", "treatment", "arms", ":", "placebo", "or", "usual", "-", "dose", "or", "high", "-", "dose", "sirolimus", ".", "Patients", "received", "a", "cumulative", "loading", "dose", "of", "0", ",", "8", ",", "or", "24", "mg", "of", "sirolimus", "2", "days", "before", "and", "the", "day", "of", "repeat", "intervention", "followed", "by", "maintenance", "therapy", "of", "2", "mg", "/", "d", "for", "7", "days", ".", "Angiographic", "restenosis", "at", "6-month", "angiography", "was", "the", "primary", "end", "point", "of", "the", "study", ".", "Restenosis", "was", "significantly", "reduced", "from", "42.2", "%", "to", "38.6", "%", "and", "to", "22.1", "%", "in", "the", "placebo", ",", "usual", "-", "dose", ",", "and", "high", "-", "dose", "sirolimus", "groups", ",", "respectively", "(", "P=0.005", ")", ".", "Similarly", ",", "the", "need", "for", "target", "vessel", "revascularization", "was", "reduced", "from", "25.5", "%", "to", "24.2", "%", "and", "to", "15.2", "%", "in", "the", "placebo", ",", "usual", "-", "dose", ",", "and", "high", "-", "dose", "groups", ",", "respectively", "(", "P=0.08", ")", ".", "The", "sirolimus", "blood", "concentration", "on", "the", "day", "of", "the", "procedure", "correlated", "significantly", "with", "the", "late", "lumen", "loss", "at", "follow", "-", "up", "(", "P", "<", "0.001", ")", ".", "CONCLUSIONS", "In", "patients", "with", "ISR", ",", "an", "oral", "adjunctive", "sirolimus", "treatment", "with", "an", "intensified", "loading", "regimen", "before", "coronary", "intervention", "resulted", "in", "a", "significant", "improvement", "in", "the", "angiographic", "parameters", "of", "restenosis", "." ]
[ "Outcome_Physical", "Outcome_Other", "Intervention_Pharmacological", "Participant_Condition", "Intervention_Physical", "Intervention_Control", "Participant_Sample-size" ]