Datasets:
bio-datasets
/
bigbio-ner-merged

Dataset card Data Studio Files
xet
Community
answer
stringlengths
1
16.1k
id
stringlengths
7
56
instruction
stringlengths
106
72.6k
ner_tags
list
text
stringlengths
5
72.4k
tokens
list
types
list
Patienten is an umlsterm, Angina pectoris is an umlsterm, Herzerkrankung is an umlsterm, Ballondilatation is an umlsterm, Therapieverfahren is an umlsterm, Patienten is an umlsterm, koerperliche Belastbarkeit is an umlsterm, Herzen is an umlsterm, Epikard is an umlsterm, Myokard is an umlsterm, Laserkanaele is an umlsterm, Myokard is an umlsterm, Laserenergie is an umlsterm, Herzen is an umlsterm, koerperlichen Belastbarkeit is an umlsterm, Angina pectoris is an umlsterm, Perfusion is an umlsterm
ZfuerKardiologie.00890810.ger.abstr_task0
Sentence: Fuer Patienten mit schwerer Angina pectoris aufgrund einer koronaren Herzerkrankung , bei denen aufgrund der Koronarmorphologie oder vorausgegangener Interventionen keine Moeglichkeit einer Ballondilatation oder einer Bypass-Operation mehr besteht , steht mit der transmyokardialen Laserrevaskularisation ( TMR ) ein neues Therapieverfahren zur Verfuegung . In mehreren randomisierten Studien konnte gezeigt werden , dass bei diesen Patienten durch eine TMR die klinische Symptomatik gebessert und die koerperliche Belastbarkeit gesteigert werden kann . Ein Nachteil der TMR ist die Notwendigkeit eines chirurgischen Zugangs zum Herzen , um die Kanaele vom Epikard aus in das Myokard einzubringen . Daher wurden Katheter-Systeme entwickelt , mit denen die Laserkanaele vom linksventrikulaeren Kavum aus in das Myokard eingebracht werden koennen . Diese Systeme fuer die " perkutane myokardiale Laserrevaskularisation " ( PMR ) verwenden einen Holmium-YAG-Laser , bei dem die Laserenergie ueber optische Fasern zum Herzen uebertragen werden kann . Eine PMR fuehrt zu einer aehnlichen Besserung der klinischen Symptomatik und zu einer Steigerung der koerperlichen Belastbarkeit wie die TMR . Der Schweregrad der Angina pectoris wird um ca. 1,5 CCS-Klassen gebessert , unabhaengig vom verwendeten Kathetersystem . Eine Verbesserung der myokardialen Perfusion nach PMR konnte allerdings bisher noch nicht nachgewiesen werden . Die pathophysiologischen Mechanismen der myokardialen Laserrevaskularisation sind zum jetzigen Zeitpunkt noch nicht geklaert . Experimentelle Studien deuten auf eine myokardiale Angioneogenese und auf eine myokardiale Denervierung nach TMR hin , in klinischen Studien konnte jedoch eine gesteigerte myokardiale Durchblutung bisher noch nicht nachgewiesen werden . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Fuer Patienten mit schwerer Angina pectoris aufgrund einer koronaren Herzerkrankung , bei denen aufgrund der Koronarmorphologie oder vorausgegangener Interventionen keine Moeglichkeit einer Ballondilatation oder einer Bypass-Operation mehr besteht , steht mit der transmyokardialen Laserrevaskularisation ( TMR ) ein neues Therapieverfahren zur Verfuegung . In mehreren randomisierten Studien konnte gezeigt werden , dass bei diesen Patienten durch eine TMR die klinische Symptomatik gebessert und die koerperliche Belastbarkeit gesteigert werden kann . Ein Nachteil der TMR ist die Notwendigkeit eines chirurgischen Zugangs zum Herzen , um die Kanaele vom Epikard aus in das Myokard einzubringen . Daher wurden Katheter-Systeme entwickelt , mit denen die Laserkanaele vom linksventrikulaeren Kavum aus in das Myokard eingebracht werden koennen . Diese Systeme fuer die " perkutane myokardiale Laserrevaskularisation " ( PMR ) verwenden einen Holmium-YAG-Laser , bei dem die Laserenergie ueber optische Fasern zum Herzen uebertragen werden kann . Eine PMR fuehrt zu einer aehnlichen Besserung der klinischen Symptomatik und zu einer Steigerung der koerperlichen Belastbarkeit wie die TMR . Der Schweregrad der Angina pectoris wird um ca. 1,5 CCS-Klassen gebessert , unabhaengig vom verwendeten Kathetersystem . Eine Verbesserung der myokardialen Perfusion nach PMR konnte allerdings bisher noch nicht nachgewiesen werden . Die pathophysiologischen Mechanismen der myokardialen Laserrevaskularisation sind zum jetzigen Zeitpunkt noch nicht geklaert . Experimentelle Studien deuten auf eine myokardiale Angioneogenese und auf eine myokardiale Denervierung nach TMR hin , in klinischen Studien konnte jedoch eine gesteigerte myokardiale Durchblutung bisher noch nicht nachgewiesen werden .
[ "Fuer", "Patienten", "mit", "schwerer", "Angina", "pectoris", "aufgrund", "einer", "koronaren", "Herzerkrankung", ",", "bei", "denen", "aufgrund", "der", "Koronarmorphologie", "oder", "vorausgegangener", "Interventionen", "keine", "Moeglichkeit", "einer", "Ballondilatation", "oder", "einer", "Bypass", "-", "Operation", "mehr", "besteht", ",", "steht", "mit", "der", "transmyokardialen", "Laserrevaskularisation", "(", "TMR", ")", "ein", "neues", "Therapieverfahren", "zur", "Verfuegung", ".", "In", "mehreren", "randomisierten", "Studien", "konnte", "gezeigt", "werden", ",", "dass", "bei", "diesen", "Patienten", "durch", "eine", "TMR", "die", "klinische", "Symptomatik", "gebessert", "und", "die", "koerperliche", "Belastbarkeit", "gesteigert", "werden", "kann", ".", "Ein", "Nachteil", "der", "TMR", "ist", "die", "Notwendigkeit", "eines", "chirurgischen", "Zugangs", "zum", "Herzen", ",", "um", "die", "Kanaele", "vom", "Epikard", "aus", "in", "das", "Myokard", "einzubringen", ".", "Daher", "wurden", "Katheter", "-", "Systeme", "entwickelt", ",", "mit", "denen", "die", "Laserkanaele", "vom", "linksventrikulaeren", "Kavum", "aus", "in", "das", "Myokard", "eingebracht", "werden", "koennen", ".", "Diese", "Systeme", "fuer", "die", "\"", "perkutane", "myokardiale", "Laserrevaskularisation", "\"", "(", "PMR", ")", "verwenden", "einen", "Holmium", "-", "YAG", "-", "Laser", ",", "bei", "dem", "die", "Laserenergie", "ueber", "optische", "Fasern", "zum", "Herzen", "uebertragen", "werden", "kann", ".", "Eine", "PMR", "fuehrt", "zu", "einer", "aehnlichen", "Besserung", "der", "klinischen", "Symptomatik", "und", "zu", "einer", "Steigerung", "der", "koerperlichen", "Belastbarkeit", "wie", "die", "TMR", ".", "Der", "Schweregrad", "der", "Angina", "pectoris", "wird", "um", "ca", ".", "1,5", "CCS", "-", "Klassen", "gebessert", ",", "unabhaengig", "vom", "verwendeten", "Kathetersystem", ".", "Eine", "Verbesserung", "der", "myokardialen", "Perfusion", "nach", "PMR", "konnte", "allerdings", "bisher", "noch", "nicht", "nachgewiesen", "werden", ".", "Die", "pathophysiologischen", "Mechanismen", "der", "myokardialen", "Laserrevaskularisation", "sind", "zum", "jetzigen", "Zeitpunkt", "noch", "nicht", "geklaert", ".", "Experimentelle", "Studien", "deuten", "auf", "eine", "myokardiale", "Angioneogenese", "und", "auf", "eine", "myokardiale", "Denervierung", "nach", "TMR", "hin", ",", "in", "klinischen", "Studien", "konnte", "jedoch", "eine", "gesteigerte", "myokardiale", "Durchblutung", "bisher", "noch", "nicht", "nachgewiesen", "werden", "." ]
[ "umlsterm" ]
Patienten is an umlsterm, Angina pectoris is an umlsterm, Herzerkrankung is an umlsterm, Ballondilatation is an umlsterm, Therapieverfahren is an umlsterm, Patienten is an umlsterm, koerperliche Belastbarkeit is an umlsterm, Herzen is an umlsterm, Epikard is an umlsterm, Myokard is an umlsterm, Laserkanaele is an umlsterm, Myokard is an umlsterm, Laserenergie is an umlsterm, Herzen is an umlsterm, koerperlichen Belastbarkeit is an umlsterm, Angina pectoris is an umlsterm, Perfusion is an umlsterm
ZfuerKardiologie.00890810.ger.abstr_task1
Sentence: Fuer Patienten mit schwerer Angina pectoris aufgrund einer koronaren Herzerkrankung , bei denen aufgrund der Koronarmorphologie oder vorausgegangener Interventionen keine Moeglichkeit einer Ballondilatation oder einer Bypass-Operation mehr besteht , steht mit der transmyokardialen Laserrevaskularisation ( TMR ) ein neues Therapieverfahren zur Verfuegung . In mehreren randomisierten Studien konnte gezeigt werden , dass bei diesen Patienten durch eine TMR die klinische Symptomatik gebessert und die koerperliche Belastbarkeit gesteigert werden kann . Ein Nachteil der TMR ist die Notwendigkeit eines chirurgischen Zugangs zum Herzen , um die Kanaele vom Epikard aus in das Myokard einzubringen . Daher wurden Katheter-Systeme entwickelt , mit denen die Laserkanaele vom linksventrikulaeren Kavum aus in das Myokard eingebracht werden koennen . Diese Systeme fuer die " perkutane myokardiale Laserrevaskularisation " ( PMR ) verwenden einen Holmium-YAG-Laser , bei dem die Laserenergie ueber optische Fasern zum Herzen uebertragen werden kann . Eine PMR fuehrt zu einer aehnlichen Besserung der klinischen Symptomatik und zu einer Steigerung der koerperlichen Belastbarkeit wie die TMR . Der Schweregrad der Angina pectoris wird um ca. 1,5 CCS-Klassen gebessert , unabhaengig vom verwendeten Kathetersystem . Eine Verbesserung der myokardialen Perfusion nach PMR konnte allerdings bisher noch nicht nachgewiesen werden . Die pathophysiologischen Mechanismen der myokardialen Laserrevaskularisation sind zum jetzigen Zeitpunkt noch nicht geklaert . Experimentelle Studien deuten auf eine myokardiale Angioneogenese und auf eine myokardiale Denervierung nach TMR hin , in klinischen Studien konnte jedoch eine gesteigerte myokardiale Durchblutung bisher noch nicht nachgewiesen werden . Instructions: please typing these entity words according to sentence: Patienten, Angina pectoris, Herzerkrankung, Ballondilatation, Therapieverfahren, Patienten, koerperliche Belastbarkeit, Herzen, Epikard, Myokard, Laserkanaele, Myokard, Laserenergie, Herzen, koerperlichen Belastbarkeit, Angina pectoris, Perfusion Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Fuer Patienten mit schwerer Angina pectoris aufgrund einer koronaren Herzerkrankung , bei denen aufgrund der Koronarmorphologie oder vorausgegangener Interventionen keine Moeglichkeit einer Ballondilatation oder einer Bypass-Operation mehr besteht , steht mit der transmyokardialen Laserrevaskularisation ( TMR ) ein neues Therapieverfahren zur Verfuegung . In mehreren randomisierten Studien konnte gezeigt werden , dass bei diesen Patienten durch eine TMR die klinische Symptomatik gebessert und die koerperliche Belastbarkeit gesteigert werden kann . Ein Nachteil der TMR ist die Notwendigkeit eines chirurgischen Zugangs zum Herzen , um die Kanaele vom Epikard aus in das Myokard einzubringen . Daher wurden Katheter-Systeme entwickelt , mit denen die Laserkanaele vom linksventrikulaeren Kavum aus in das Myokard eingebracht werden koennen . Diese Systeme fuer die " perkutane myokardiale Laserrevaskularisation " ( PMR ) verwenden einen Holmium-YAG-Laser , bei dem die Laserenergie ueber optische Fasern zum Herzen uebertragen werden kann . Eine PMR fuehrt zu einer aehnlichen Besserung der klinischen Symptomatik und zu einer Steigerung der koerperlichen Belastbarkeit wie die TMR . Der Schweregrad der Angina pectoris wird um ca. 1,5 CCS-Klassen gebessert , unabhaengig vom verwendeten Kathetersystem . Eine Verbesserung der myokardialen Perfusion nach PMR konnte allerdings bisher noch nicht nachgewiesen werden . Die pathophysiologischen Mechanismen der myokardialen Laserrevaskularisation sind zum jetzigen Zeitpunkt noch nicht geklaert . Experimentelle Studien deuten auf eine myokardiale Angioneogenese und auf eine myokardiale Denervierung nach TMR hin , in klinischen Studien konnte jedoch eine gesteigerte myokardiale Durchblutung bisher noch nicht nachgewiesen werden .
[ "Fuer", "Patienten", "mit", "schwerer", "Angina", "pectoris", "aufgrund", "einer", "koronaren", "Herzerkrankung", ",", "bei", "denen", "aufgrund", "der", "Koronarmorphologie", "oder", "vorausgegangener", "Interventionen", "keine", "Moeglichkeit", "einer", "Ballondilatation", "oder", "einer", "Bypass", "-", "Operation", "mehr", "besteht", ",", "steht", "mit", "der", "transmyokardialen", "Laserrevaskularisation", "(", "TMR", ")", "ein", "neues", "Therapieverfahren", "zur", "Verfuegung", ".", "In", "mehreren", "randomisierten", "Studien", "konnte", "gezeigt", "werden", ",", "dass", "bei", "diesen", "Patienten", "durch", "eine", "TMR", "die", "klinische", "Symptomatik", "gebessert", "und", "die", "koerperliche", "Belastbarkeit", "gesteigert", "werden", "kann", ".", "Ein", "Nachteil", "der", "TMR", "ist", "die", "Notwendigkeit", "eines", "chirurgischen", "Zugangs", "zum", "Herzen", ",", "um", "die", "Kanaele", "vom", "Epikard", "aus", "in", "das", "Myokard", "einzubringen", ".", "Daher", "wurden", "Katheter", "-", "Systeme", "entwickelt", ",", "mit", "denen", "die", "Laserkanaele", "vom", "linksventrikulaeren", "Kavum", "aus", "in", "das", "Myokard", "eingebracht", "werden", "koennen", ".", "Diese", "Systeme", "fuer", "die", "\"", "perkutane", "myokardiale", "Laserrevaskularisation", "\"", "(", "PMR", ")", "verwenden", "einen", "Holmium", "-", "YAG", "-", "Laser", ",", "bei", "dem", "die", "Laserenergie", "ueber", "optische", "Fasern", "zum", "Herzen", "uebertragen", "werden", "kann", ".", "Eine", "PMR", "fuehrt", "zu", "einer", "aehnlichen", "Besserung", "der", "klinischen", "Symptomatik", "und", "zu", "einer", "Steigerung", "der", "koerperlichen", "Belastbarkeit", "wie", "die", "TMR", ".", "Der", "Schweregrad", "der", "Angina", "pectoris", "wird", "um", "ca", ".", "1,5", "CCS", "-", "Klassen", "gebessert", ",", "unabhaengig", "vom", "verwendeten", "Kathetersystem", ".", "Eine", "Verbesserung", "der", "myokardialen", "Perfusion", "nach", "PMR", "konnte", "allerdings", "bisher", "noch", "nicht", "nachgewiesen", "werden", ".", "Die", "pathophysiologischen", "Mechanismen", "der", "myokardialen", "Laserrevaskularisation", "sind", "zum", "jetzigen", "Zeitpunkt", "noch", "nicht", "geklaert", ".", "Experimentelle", "Studien", "deuten", "auf", "eine", "myokardiale", "Angioneogenese", "und", "auf", "eine", "myokardiale", "Denervierung", "nach", "TMR", "hin", ",", "in", "klinischen", "Studien", "konnte", "jedoch", "eine", "gesteigerte", "myokardiale", "Durchblutung", "bisher", "noch", "nicht", "nachgewiesen", "werden", "." ]
[ "umlsterm" ]
Patienten, Angina pectoris, Herzerkrankung, Ballondilatation, Therapieverfahren, Patienten, koerperliche Belastbarkeit, Herzen, Epikard, Myokard, Laserkanaele, Myokard, Laserenergie, Herzen, koerperlichen Belastbarkeit, Angina pectoris, Perfusion
ZfuerKardiologie.00890810.ger.abstr_task2
Sentence: Fuer Patienten mit schwerer Angina pectoris aufgrund einer koronaren Herzerkrankung , bei denen aufgrund der Koronarmorphologie oder vorausgegangener Interventionen keine Moeglichkeit einer Ballondilatation oder einer Bypass-Operation mehr besteht , steht mit der transmyokardialen Laserrevaskularisation ( TMR ) ein neues Therapieverfahren zur Verfuegung . In mehreren randomisierten Studien konnte gezeigt werden , dass bei diesen Patienten durch eine TMR die klinische Symptomatik gebessert und die koerperliche Belastbarkeit gesteigert werden kann . Ein Nachteil der TMR ist die Notwendigkeit eines chirurgischen Zugangs zum Herzen , um die Kanaele vom Epikard aus in das Myokard einzubringen . Daher wurden Katheter-Systeme entwickelt , mit denen die Laserkanaele vom linksventrikulaeren Kavum aus in das Myokard eingebracht werden koennen . Diese Systeme fuer die " perkutane myokardiale Laserrevaskularisation " ( PMR ) verwenden einen Holmium-YAG-Laser , bei dem die Laserenergie ueber optische Fasern zum Herzen uebertragen werden kann . Eine PMR fuehrt zu einer aehnlichen Besserung der klinischen Symptomatik und zu einer Steigerung der koerperlichen Belastbarkeit wie die TMR . Der Schweregrad der Angina pectoris wird um ca. 1,5 CCS-Klassen gebessert , unabhaengig vom verwendeten Kathetersystem . Eine Verbesserung der myokardialen Perfusion nach PMR konnte allerdings bisher noch nicht nachgewiesen werden . Die pathophysiologischen Mechanismen der myokardialen Laserrevaskularisation sind zum jetzigen Zeitpunkt noch nicht geklaert . Experimentelle Studien deuten auf eine myokardiale Angioneogenese und auf eine myokardiale Denervierung nach TMR hin , in klinischen Studien konnte jedoch eine gesteigerte myokardiale Durchblutung bisher noch nicht nachgewiesen werden . Instructions: please extract entity words from the input sentence
[ "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Fuer Patienten mit schwerer Angina pectoris aufgrund einer koronaren Herzerkrankung , bei denen aufgrund der Koronarmorphologie oder vorausgegangener Interventionen keine Moeglichkeit einer Ballondilatation oder einer Bypass-Operation mehr besteht , steht mit der transmyokardialen Laserrevaskularisation ( TMR ) ein neues Therapieverfahren zur Verfuegung . In mehreren randomisierten Studien konnte gezeigt werden , dass bei diesen Patienten durch eine TMR die klinische Symptomatik gebessert und die koerperliche Belastbarkeit gesteigert werden kann . Ein Nachteil der TMR ist die Notwendigkeit eines chirurgischen Zugangs zum Herzen , um die Kanaele vom Epikard aus in das Myokard einzubringen . Daher wurden Katheter-Systeme entwickelt , mit denen die Laserkanaele vom linksventrikulaeren Kavum aus in das Myokard eingebracht werden koennen . Diese Systeme fuer die " perkutane myokardiale Laserrevaskularisation " ( PMR ) verwenden einen Holmium-YAG-Laser , bei dem die Laserenergie ueber optische Fasern zum Herzen uebertragen werden kann . Eine PMR fuehrt zu einer aehnlichen Besserung der klinischen Symptomatik und zu einer Steigerung der koerperlichen Belastbarkeit wie die TMR . Der Schweregrad der Angina pectoris wird um ca. 1,5 CCS-Klassen gebessert , unabhaengig vom verwendeten Kathetersystem . Eine Verbesserung der myokardialen Perfusion nach PMR konnte allerdings bisher noch nicht nachgewiesen werden . Die pathophysiologischen Mechanismen der myokardialen Laserrevaskularisation sind zum jetzigen Zeitpunkt noch nicht geklaert . Experimentelle Studien deuten auf eine myokardiale Angioneogenese und auf eine myokardiale Denervierung nach TMR hin , in klinischen Studien konnte jedoch eine gesteigerte myokardiale Durchblutung bisher noch nicht nachgewiesen werden .
[ "Fuer", "Patienten", "mit", "schwerer", "Angina", "pectoris", "aufgrund", "einer", "koronaren", "Herzerkrankung", ",", "bei", "denen", "aufgrund", "der", "Koronarmorphologie", "oder", "vorausgegangener", "Interventionen", "keine", "Moeglichkeit", "einer", "Ballondilatation", "oder", "einer", "Bypass", "-", "Operation", "mehr", "besteht", ",", "steht", "mit", "der", "transmyokardialen", "Laserrevaskularisation", "(", "TMR", ")", "ein", "neues", "Therapieverfahren", "zur", "Verfuegung", ".", "In", "mehreren", "randomisierten", "Studien", "konnte", "gezeigt", "werden", ",", "dass", "bei", "diesen", "Patienten", "durch", "eine", "TMR", "die", "klinische", "Symptomatik", "gebessert", "und", "die", "koerperliche", "Belastbarkeit", "gesteigert", "werden", "kann", ".", "Ein", "Nachteil", "der", "TMR", "ist", "die", "Notwendigkeit", "eines", "chirurgischen", "Zugangs", "zum", "Herzen", ",", "um", "die", "Kanaele", "vom", "Epikard", "aus", "in", "das", "Myokard", "einzubringen", ".", "Daher", "wurden", "Katheter", "-", "Systeme", "entwickelt", ",", "mit", "denen", "die", "Laserkanaele", "vom", "linksventrikulaeren", "Kavum", "aus", "in", "das", "Myokard", "eingebracht", "werden", "koennen", ".", "Diese", "Systeme", "fuer", "die", "\"", "perkutane", "myokardiale", "Laserrevaskularisation", "\"", "(", "PMR", ")", "verwenden", "einen", "Holmium", "-", "YAG", "-", "Laser", ",", "bei", "dem", "die", "Laserenergie", "ueber", "optische", "Fasern", "zum", "Herzen", "uebertragen", "werden", "kann", ".", "Eine", "PMR", "fuehrt", "zu", "einer", "aehnlichen", "Besserung", "der", "klinischen", "Symptomatik", "und", "zu", "einer", "Steigerung", "der", "koerperlichen", "Belastbarkeit", "wie", "die", "TMR", ".", "Der", "Schweregrad", "der", "Angina", "pectoris", "wird", "um", "ca", ".", "1,5", "CCS", "-", "Klassen", "gebessert", ",", "unabhaengig", "vom", "verwendeten", "Kathetersystem", ".", "Eine", "Verbesserung", "der", "myokardialen", "Perfusion", "nach", "PMR", "konnte", "allerdings", "bisher", "noch", "nicht", "nachgewiesen", "werden", ".", "Die", "pathophysiologischen", "Mechanismen", "der", "myokardialen", "Laserrevaskularisation", "sind", "zum", "jetzigen", "Zeitpunkt", "noch", "nicht", "geklaert", ".", "Experimentelle", "Studien", "deuten", "auf", "eine", "myokardiale", "Angioneogenese", "und", "auf", "eine", "myokardiale", "Denervierung", "nach", "TMR", "hin", ",", "in", "klinischen", "Studien", "konnte", "jedoch", "eine", "gesteigerte", "myokardiale", "Durchblutung", "bisher", "noch", "nicht", "nachgewiesen", "werden", "." ]
[ "umlsterm" ]
cephalosporins is a GROUP, aminoglycoside antibiotics is a GROUP, Cephalosporins is a GROUP, cefotaxime sodium is a DRUG
Cefotaxime_ddi_task0
Sentence: Increased nephrotoxicity has been reported following concomitant administration of cephalosporins and aminoglycoside antibiotics. Drug/Laboratory Test Interactions Cephalosporins, including cefotaxime sodium, are known to occasionally induce a positive direct Coombs test. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: GROUP, DRUG
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GROUP", "O", "B-GROUP", "I-GROUP", "O", "O", "O", "O", "O", "O", "B-GROUP", "O", "O", "B-DRUG", "I-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Increased nephrotoxicity has been reported following concomitant administration of cephalosporins and aminoglycoside antibiotics. Drug/Laboratory Test Interactions Cephalosporins, including cefotaxime sodium, are known to occasionally induce a positive direct Coombs test.
[ "Increased", "nephrotoxicity", "has", "been", "reported", "following", "concomitant", "administration", "of", "cephalosporins", "and", "aminoglycoside", "antibiotics", ".", "Drug", "/", "Laboratory", "Test", "Interactions", "Cephalosporins", ",", "including", "cefotaxime", "sodium", ",", "are", "known", "to", "occasionally", "induce", "a", "positive", "direct", "Coombs", "test", "." ]
[ "GROUP", "DRUG" ]
cephalosporins is a GROUP, aminoglycoside antibiotics is a GROUP, Cephalosporins is a GROUP, cefotaxime sodium is a DRUG
Cefotaxime_ddi_task1
Sentence: Increased nephrotoxicity has been reported following concomitant administration of cephalosporins and aminoglycoside antibiotics. Drug/Laboratory Test Interactions Cephalosporins, including cefotaxime sodium, are known to occasionally induce a positive direct Coombs test. Instructions: please typing these entity words according to sentence: cephalosporins, aminoglycoside antibiotics, Cephalosporins, cefotaxime sodium Options: GROUP, DRUG
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GROUP", "O", "B-GROUP", "I-GROUP", "O", "O", "O", "O", "O", "O", "B-GROUP", "O", "O", "B-DRUG", "I-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Increased nephrotoxicity has been reported following concomitant administration of cephalosporins and aminoglycoside antibiotics. Drug/Laboratory Test Interactions Cephalosporins, including cefotaxime sodium, are known to occasionally induce a positive direct Coombs test.
[ "Increased", "nephrotoxicity", "has", "been", "reported", "following", "concomitant", "administration", "of", "cephalosporins", "and", "aminoglycoside", "antibiotics", ".", "Drug", "/", "Laboratory", "Test", "Interactions", "Cephalosporins", ",", "including", "cefotaxime", "sodium", ",", "are", "known", "to", "occasionally", "induce", "a", "positive", "direct", "Coombs", "test", "." ]
[ "GROUP", "DRUG" ]
cephalosporins, aminoglycoside antibiotics, Cephalosporins, cefotaxime sodium
Cefotaxime_ddi_task2
Sentence: Increased nephrotoxicity has been reported following concomitant administration of cephalosporins and aminoglycoside antibiotics. Drug/Laboratory Test Interactions Cephalosporins, including cefotaxime sodium, are known to occasionally induce a positive direct Coombs test. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GROUP", "O", "B-GROUP", "I-GROUP", "O", "O", "O", "O", "O", "O", "B-GROUP", "O", "O", "B-DRUG", "I-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Increased nephrotoxicity has been reported following concomitant administration of cephalosporins and aminoglycoside antibiotics. Drug/Laboratory Test Interactions Cephalosporins, including cefotaxime sodium, are known to occasionally induce a positive direct Coombs test.
[ "Increased", "nephrotoxicity", "has", "been", "reported", "following", "concomitant", "administration", "of", "cephalosporins", "and", "aminoglycoside", "antibiotics", ".", "Drug", "/", "Laboratory", "Test", "Interactions", "Cephalosporins", ",", "including", "cefotaxime", "sodium", ",", "are", "known", "to", "occasionally", "induce", "a", "positive", "direct", "Coombs", "test", "." ]
[ "GROUP", "DRUG" ]
cystathionine is a CHEMICAL, cystathionine ketimine is a CHEMICAL, perhydro-1,4-thiazepine-3,5-dicarboxylic acid is a CHEMICAL, D , L - propargylglycine is a CHEMICAL
10954021_task0
Sentence: Accumulation of cystathionine, cystathionine ketimine, and perhydro-1,4-thiazepine-3,5-dicarboxylic acid in whole brain and various regions of the brain of D, L-propargylglycine-treated rats. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: CHEMICAL
[ "O", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "I-CHEMICAL", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O" ]
Accumulation of cystathionine, cystathionine ketimine, and perhydro-1,4-thiazepine-3,5-dicarboxylic acid in whole brain and various regions of the brain of D, L-propargylglycine-treated rats.
[ "Accumulation", "of", "cystathionine", ",", "cystathionine", "ketimine", ",", "and", "perhydro-1,4-thiazepine-3,5-dicarboxylic", "acid", "in", "whole", "brain", "and", "various", "regions", "of", "the", "brain", "of", "D", ",", "L", "-", "propargylglycine", "-", "treated", "rats", "." ]
[ "CHEMICAL", "GENE-Y" ]
cystathionine is a CHEMICAL, cystathionine ketimine is a CHEMICAL, perhydro-1,4-thiazepine-3,5-dicarboxylic acid is a CHEMICAL, D , L - propargylglycine is a CHEMICAL
10954021_task1
Sentence: Accumulation of cystathionine, cystathionine ketimine, and perhydro-1,4-thiazepine-3,5-dicarboxylic acid in whole brain and various regions of the brain of D, L-propargylglycine-treated rats. Instructions: please typing these entity words according to sentence: cystathionine, cystathionine ketimine, perhydro-1,4-thiazepine-3,5-dicarboxylic acid, D , L - propargylglycine Options: CHEMICAL
[ "O", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "I-CHEMICAL", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O" ]
Accumulation of cystathionine, cystathionine ketimine, and perhydro-1,4-thiazepine-3,5-dicarboxylic acid in whole brain and various regions of the brain of D, L-propargylglycine-treated rats.
[ "Accumulation", "of", "cystathionine", ",", "cystathionine", "ketimine", ",", "and", "perhydro-1,4-thiazepine-3,5-dicarboxylic", "acid", "in", "whole", "brain", "and", "various", "regions", "of", "the", "brain", "of", "D", ",", "L", "-", "propargylglycine", "-", "treated", "rats", "." ]
[ "CHEMICAL", "GENE-Y" ]
cystathionine, cystathionine ketimine, perhydro-1,4-thiazepine-3,5-dicarboxylic acid, D , L - propargylglycine
10954021_task2
Sentence: Accumulation of cystathionine, cystathionine ketimine, and perhydro-1,4-thiazepine-3,5-dicarboxylic acid in whole brain and various regions of the brain of D, L-propargylglycine-treated rats. Instructions: please extract entity words from the input sentence
[ "O", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "I-CHEMICAL", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O" ]
Accumulation of cystathionine, cystathionine ketimine, and perhydro-1,4-thiazepine-3,5-dicarboxylic acid in whole brain and various regions of the brain of D, L-propargylglycine-treated rats.
[ "Accumulation", "of", "cystathionine", ",", "cystathionine", "ketimine", ",", "and", "perhydro-1,4-thiazepine-3,5-dicarboxylic", "acid", "in", "whole", "brain", "and", "various", "regions", "of", "the", "brain", "of", "D", ",", "L", "-", "propargylglycine", "-", "treated", "rats", "." ]
[ "CHEMICAL", "GENE-Y" ]
colorectal cancer is a Cancer, lung carcinoma cells is a Cell, colorectal cancer is a Cancer, colorectal cancer is a Cancer, colorectal cancer is a Cancer, colorectal cancer tissues is a Tissue, tissues is a Tissue, primary colorectal cancer is a Cancer, tumors is a Cancer, vessel is a Multi-tissue_structure, nodal is a Multi-tissue_structure, colorectal cancer is a Cancer
PMID-19082449_task0
Sentence: Clinical significance of chicken ovalbumin upstream promoter-transcription factor II expression in human colorectal cancer. Chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) plays an essential role in angiogenesis and development. A previous study showed that the expression of COUP-TFII enhanced invasiveness of human lung carcinoma cells. However, no published data are available concerning the biological and clinical significance of COUP-TFII expression in colorectal cancer. Thus, our objective was to explore the expression of COUP-TFII in colorectal cancer as well as its association with clinicopathological features, and to evaluate the role of COUP-TFII as a prognostic indicator in colorectal cancer. We investigated the presence of COUP-TFII in human colorectal cancer tissues and adjacent normal tissues from 95 primary colorectal cancer patients by immunohistochemistry. The correlation between the expression of COUP-TFII and clinicopathologic features was investigated. The 3-year disease-free survival (DFS) and overall survival (OS) of patients with tumors expressing different levels of COUP-TFII were evaluated by the Kaplan-Meier method. No significant correlation was found between COUP-TFII expression and age at surgery, gender, histopathologic differentiation, vessel invasion, carcinoembryonic antigen (CEA), or nodal involvement. However, survival analysis showed that the COUP-TFII-positive group had a significantly better OS compared to COUP-TFII-negative group (80.4% vs. 57.7%, P=0.0491). Based on our results, COUP-TFII may represent a biomarker for good prognosis in colorectal cancer. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Tissue, Cancer, Multi-tissue_structure, Cell
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cell", "I-Cell", "I-Cell", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Tissue", "I-Tissue", "I-Tissue", "O", "O", "O", "B-Tissue", "O", "O", "B-Cancer", "I-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Multi-tissue_structure", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Multi-tissue_structure", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O" ]
Clinical significance of chicken ovalbumin upstream promoter-transcription factor II expression in human colorectal cancer. Chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) plays an essential role in angiogenesis and development. A previous study showed that the expression of COUP-TFII enhanced invasiveness of human lung carcinoma cells. However, no published data are available concerning the biological and clinical significance of COUP-TFII expression in colorectal cancer. Thus, our objective was to explore the expression of COUP-TFII in colorectal cancer as well as its association with clinicopathological features, and to evaluate the role of COUP-TFII as a prognostic indicator in colorectal cancer. We investigated the presence of COUP-TFII in human colorectal cancer tissues and adjacent normal tissues from 95 primary colorectal cancer patients by immunohistochemistry. The correlation between the expression of COUP-TFII and clinicopathologic features was investigated. The 3-year disease-free survival (DFS) and overall survival (OS) of patients with tumors expressing different levels of COUP-TFII were evaluated by the Kaplan-Meier method. No significant correlation was found between COUP-TFII expression and age at surgery, gender, histopathologic differentiation, vessel invasion, carcinoembryonic antigen (CEA), or nodal involvement. However, survival analysis showed that the COUP-TFII-positive group had a significantly better OS compared to COUP-TFII-negative group (80.4% vs. 57.7%, P=0.0491). Based on our results, COUP-TFII may represent a biomarker for good prognosis in colorectal cancer.
[ "Clinical", "significance", "of", "chicken", "ovalbumin", "upstream", "promoter", "-", "transcription", "factor", "II", "expression", "in", "human", "colorectal", "cancer", ".", "\n", "Chicken", "ovalbumin", "upstream", "promoter", "-", "transcription", "factor", "II", "(", "COUP", "-", "TFII", ")", "plays", "an", "essential", "role", "in", "angiogenesis", "and", "development", ".", "A", "previous", "study", "showed", "that", "the", "expression", "of", "COUP", "-", "TFII", "enhanced", "invasiveness", "of", "human", "lung", "carcinoma", "cells", ".", "However", ",", "no", "published", "data", "are", "available", "concerning", "the", "biological", "and", "clinical", "significance", "of", "COUP", "-", "TFII", "expression", "in", "colorectal", "cancer", ".", "Thus", ",", "our", "objective", "was", "to", "explore", "the", "expression", "of", "COUP", "-", "TFII", "in", "colorectal", "cancer", "as", "well", "as", "its", "association", "with", "clinicopathological", "features", ",", "and", "to", "evaluate", "the", "role", "of", "COUP", "-", "TFII", "as", "a", "prognostic", "indicator", "in", "colorectal", "cancer", ".", "We", "investigated", "the", "presence", "of", "COUP", "-", "TFII", "in", "human", "colorectal", "cancer", "tissues", "and", "adjacent", "normal", "tissues", "from", "95", "primary", "colorectal", "cancer", "patients", "by", "immunohistochemistry", ".", "The", "correlation", "between", "the", "expression", "of", "COUP", "-", "TFII", "and", "clinicopathologic", "features", "was", "investigated", ".", "The", "3-year", "disease", "-", "free", "survival", "(", "DFS", ")", "and", "overall", "survival", "(", "OS", ")", "of", "patients", "with", "tumors", "expressing", "different", "levels", "of", "COUP", "-", "TFII", "were", "evaluated", "by", "the", "Kaplan", "-", "Meier", "method", ".", "No", "significant", "correlation", "was", "found", "between", "COUP", "-", "TFII", "expression", "and", "age", "at", "surgery", ",", "gender", ",", "histopathologic", "differentiation", ",", "vessel", "invasion", ",", "carcinoembryonic", "antigen", "(", "CEA", ")", ",", "or", "nodal", "involvement", ".", "However", ",", "survival", "analysis", "showed", "that", "the", "COUP", "-", "TFII", "-", "positive", "group", "had", "a", "significantly", "better", "OS", "compared", "to", "COUP", "-", "TFII", "-", "negative", "group", "(", "80.4", "%", "vs", ".", "57.7", "%", ",", "P=0.0491", ")", ".", "Based", "on", "our", "results", ",", "COUP", "-", "TFII", "may", "represent", "a", "biomarker", "for", "good", "prognosis", "in", "colorectal", "cancer", ".", "\n" ]
[ "Tissue", "Cancer", "Cell", "Multi-tissue_structure" ]
colorectal cancer is a Cancer, lung carcinoma cells is a Cell, colorectal cancer is a Cancer, colorectal cancer is a Cancer, colorectal cancer is a Cancer, colorectal cancer tissues is a Tissue, tissues is a Tissue, primary colorectal cancer is a Cancer, tumors is a Cancer, vessel is a Multi-tissue_structure, nodal is a Multi-tissue_structure, colorectal cancer is a Cancer
PMID-19082449_task1
Sentence: Clinical significance of chicken ovalbumin upstream promoter-transcription factor II expression in human colorectal cancer. Chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) plays an essential role in angiogenesis and development. A previous study showed that the expression of COUP-TFII enhanced invasiveness of human lung carcinoma cells. However, no published data are available concerning the biological and clinical significance of COUP-TFII expression in colorectal cancer. Thus, our objective was to explore the expression of COUP-TFII in colorectal cancer as well as its association with clinicopathological features, and to evaluate the role of COUP-TFII as a prognostic indicator in colorectal cancer. We investigated the presence of COUP-TFII in human colorectal cancer tissues and adjacent normal tissues from 95 primary colorectal cancer patients by immunohistochemistry. The correlation between the expression of COUP-TFII and clinicopathologic features was investigated. The 3-year disease-free survival (DFS) and overall survival (OS) of patients with tumors expressing different levels of COUP-TFII were evaluated by the Kaplan-Meier method. No significant correlation was found between COUP-TFII expression and age at surgery, gender, histopathologic differentiation, vessel invasion, carcinoembryonic antigen (CEA), or nodal involvement. However, survival analysis showed that the COUP-TFII-positive group had a significantly better OS compared to COUP-TFII-negative group (80.4% vs. 57.7%, P=0.0491). Based on our results, COUP-TFII may represent a biomarker for good prognosis in colorectal cancer. Instructions: please typing these entity words according to sentence: colorectal cancer, lung carcinoma cells, colorectal cancer, colorectal cancer, colorectal cancer, colorectal cancer tissues, tissues, primary colorectal cancer, tumors, vessel, nodal, colorectal cancer Options: Tissue, Cancer, Multi-tissue_structure, Cell
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cell", "I-Cell", "I-Cell", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Tissue", "I-Tissue", "I-Tissue", "O", "O", "O", "B-Tissue", "O", "O", "B-Cancer", "I-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Multi-tissue_structure", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Multi-tissue_structure", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O" ]
Clinical significance of chicken ovalbumin upstream promoter-transcription factor II expression in human colorectal cancer. Chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) plays an essential role in angiogenesis and development. A previous study showed that the expression of COUP-TFII enhanced invasiveness of human lung carcinoma cells. However, no published data are available concerning the biological and clinical significance of COUP-TFII expression in colorectal cancer. Thus, our objective was to explore the expression of COUP-TFII in colorectal cancer as well as its association with clinicopathological features, and to evaluate the role of COUP-TFII as a prognostic indicator in colorectal cancer. We investigated the presence of COUP-TFII in human colorectal cancer tissues and adjacent normal tissues from 95 primary colorectal cancer patients by immunohistochemistry. The correlation between the expression of COUP-TFII and clinicopathologic features was investigated. The 3-year disease-free survival (DFS) and overall survival (OS) of patients with tumors expressing different levels of COUP-TFII were evaluated by the Kaplan-Meier method. No significant correlation was found between COUP-TFII expression and age at surgery, gender, histopathologic differentiation, vessel invasion, carcinoembryonic antigen (CEA), or nodal involvement. However, survival analysis showed that the COUP-TFII-positive group had a significantly better OS compared to COUP-TFII-negative group (80.4% vs. 57.7%, P=0.0491). Based on our results, COUP-TFII may represent a biomarker for good prognosis in colorectal cancer.
[ "Clinical", "significance", "of", "chicken", "ovalbumin", "upstream", "promoter", "-", "transcription", "factor", "II", "expression", "in", "human", "colorectal", "cancer", ".", "\n", "Chicken", "ovalbumin", "upstream", "promoter", "-", "transcription", "factor", "II", "(", "COUP", "-", "TFII", ")", "plays", "an", "essential", "role", "in", "angiogenesis", "and", "development", ".", "A", "previous", "study", "showed", "that", "the", "expression", "of", "COUP", "-", "TFII", "enhanced", "invasiveness", "of", "human", "lung", "carcinoma", "cells", ".", "However", ",", "no", "published", "data", "are", "available", "concerning", "the", "biological", "and", "clinical", "significance", "of", "COUP", "-", "TFII", "expression", "in", "colorectal", "cancer", ".", "Thus", ",", "our", "objective", "was", "to", "explore", "the", "expression", "of", "COUP", "-", "TFII", "in", "colorectal", "cancer", "as", "well", "as", "its", "association", "with", "clinicopathological", "features", ",", "and", "to", "evaluate", "the", "role", "of", "COUP", "-", "TFII", "as", "a", "prognostic", "indicator", "in", "colorectal", "cancer", ".", "We", "investigated", "the", "presence", "of", "COUP", "-", "TFII", "in", "human", "colorectal", "cancer", "tissues", "and", "adjacent", "normal", "tissues", "from", "95", "primary", "colorectal", "cancer", "patients", "by", "immunohistochemistry", ".", "The", "correlation", "between", "the", "expression", "of", "COUP", "-", "TFII", "and", "clinicopathologic", "features", "was", "investigated", ".", "The", "3-year", "disease", "-", "free", "survival", "(", "DFS", ")", "and", "overall", "survival", "(", "OS", ")", "of", "patients", "with", "tumors", "expressing", "different", "levels", "of", "COUP", "-", "TFII", "were", "evaluated", "by", "the", "Kaplan", "-", "Meier", "method", ".", "No", "significant", "correlation", "was", "found", "between", "COUP", "-", "TFII", "expression", "and", "age", "at", "surgery", ",", "gender", ",", "histopathologic", "differentiation", ",", "vessel", "invasion", ",", "carcinoembryonic", "antigen", "(", "CEA", ")", ",", "or", "nodal", "involvement", ".", "However", ",", "survival", "analysis", "showed", "that", "the", "COUP", "-", "TFII", "-", "positive", "group", "had", "a", "significantly", "better", "OS", "compared", "to", "COUP", "-", "TFII", "-", "negative", "group", "(", "80.4", "%", "vs", ".", "57.7", "%", ",", "P=0.0491", ")", ".", "Based", "on", "our", "results", ",", "COUP", "-", "TFII", "may", "represent", "a", "biomarker", "for", "good", "prognosis", "in", "colorectal", "cancer", ".", "\n" ]
[ "Tissue", "Cancer", "Cell", "Multi-tissue_structure" ]
colorectal cancer, lung carcinoma cells, colorectal cancer, colorectal cancer, colorectal cancer, colorectal cancer tissues, tissues, primary colorectal cancer, tumors, vessel, nodal, colorectal cancer
PMID-19082449_task2
Sentence: Clinical significance of chicken ovalbumin upstream promoter-transcription factor II expression in human colorectal cancer. Chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) plays an essential role in angiogenesis and development. A previous study showed that the expression of COUP-TFII enhanced invasiveness of human lung carcinoma cells. However, no published data are available concerning the biological and clinical significance of COUP-TFII expression in colorectal cancer. Thus, our objective was to explore the expression of COUP-TFII in colorectal cancer as well as its association with clinicopathological features, and to evaluate the role of COUP-TFII as a prognostic indicator in colorectal cancer. We investigated the presence of COUP-TFII in human colorectal cancer tissues and adjacent normal tissues from 95 primary colorectal cancer patients by immunohistochemistry. The correlation between the expression of COUP-TFII and clinicopathologic features was investigated. The 3-year disease-free survival (DFS) and overall survival (OS) of patients with tumors expressing different levels of COUP-TFII were evaluated by the Kaplan-Meier method. No significant correlation was found between COUP-TFII expression and age at surgery, gender, histopathologic differentiation, vessel invasion, carcinoembryonic antigen (CEA), or nodal involvement. However, survival analysis showed that the COUP-TFII-positive group had a significantly better OS compared to COUP-TFII-negative group (80.4% vs. 57.7%, P=0.0491). Based on our results, COUP-TFII may represent a biomarker for good prognosis in colorectal cancer. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cell", "I-Cell", "I-Cell", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Tissue", "I-Tissue", "I-Tissue", "O", "O", "O", "B-Tissue", "O", "O", "B-Cancer", "I-Cancer", "I-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Multi-tissue_structure", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Multi-tissue_structure", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Cancer", "I-Cancer", "O", "O" ]
Clinical significance of chicken ovalbumin upstream promoter-transcription factor II expression in human colorectal cancer. Chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) plays an essential role in angiogenesis and development. A previous study showed that the expression of COUP-TFII enhanced invasiveness of human lung carcinoma cells. However, no published data are available concerning the biological and clinical significance of COUP-TFII expression in colorectal cancer. Thus, our objective was to explore the expression of COUP-TFII in colorectal cancer as well as its association with clinicopathological features, and to evaluate the role of COUP-TFII as a prognostic indicator in colorectal cancer. We investigated the presence of COUP-TFII in human colorectal cancer tissues and adjacent normal tissues from 95 primary colorectal cancer patients by immunohistochemistry. The correlation between the expression of COUP-TFII and clinicopathologic features was investigated. The 3-year disease-free survival (DFS) and overall survival (OS) of patients with tumors expressing different levels of COUP-TFII were evaluated by the Kaplan-Meier method. No significant correlation was found between COUP-TFII expression and age at surgery, gender, histopathologic differentiation, vessel invasion, carcinoembryonic antigen (CEA), or nodal involvement. However, survival analysis showed that the COUP-TFII-positive group had a significantly better OS compared to COUP-TFII-negative group (80.4% vs. 57.7%, P=0.0491). Based on our results, COUP-TFII may represent a biomarker for good prognosis in colorectal cancer.
[ "Clinical", "significance", "of", "chicken", "ovalbumin", "upstream", "promoter", "-", "transcription", "factor", "II", "expression", "in", "human", "colorectal", "cancer", ".", "\n", "Chicken", "ovalbumin", "upstream", "promoter", "-", "transcription", "factor", "II", "(", "COUP", "-", "TFII", ")", "plays", "an", "essential", "role", "in", "angiogenesis", "and", "development", ".", "A", "previous", "study", "showed", "that", "the", "expression", "of", "COUP", "-", "TFII", "enhanced", "invasiveness", "of", "human", "lung", "carcinoma", "cells", ".", "However", ",", "no", "published", "data", "are", "available", "concerning", "the", "biological", "and", "clinical", "significance", "of", "COUP", "-", "TFII", "expression", "in", "colorectal", "cancer", ".", "Thus", ",", "our", "objective", "was", "to", "explore", "the", "expression", "of", "COUP", "-", "TFII", "in", "colorectal", "cancer", "as", "well", "as", "its", "association", "with", "clinicopathological", "features", ",", "and", "to", "evaluate", "the", "role", "of", "COUP", "-", "TFII", "as", "a", "prognostic", "indicator", "in", "colorectal", "cancer", ".", "We", "investigated", "the", "presence", "of", "COUP", "-", "TFII", "in", "human", "colorectal", "cancer", "tissues", "and", "adjacent", "normal", "tissues", "from", "95", "primary", "colorectal", "cancer", "patients", "by", "immunohistochemistry", ".", "The", "correlation", "between", "the", "expression", "of", "COUP", "-", "TFII", "and", "clinicopathologic", "features", "was", "investigated", ".", "The", "3-year", "disease", "-", "free", "survival", "(", "DFS", ")", "and", "overall", "survival", "(", "OS", ")", "of", "patients", "with", "tumors", "expressing", "different", "levels", "of", "COUP", "-", "TFII", "were", "evaluated", "by", "the", "Kaplan", "-", "Meier", "method", ".", "No", "significant", "correlation", "was", "found", "between", "COUP", "-", "TFII", "expression", "and", "age", "at", "surgery", ",", "gender", ",", "histopathologic", "differentiation", ",", "vessel", "invasion", ",", "carcinoembryonic", "antigen", "(", "CEA", ")", ",", "or", "nodal", "involvement", ".", "However", ",", "survival", "analysis", "showed", "that", "the", "COUP", "-", "TFII", "-", "positive", "group", "had", "a", "significantly", "better", "OS", "compared", "to", "COUP", "-", "TFII", "-", "negative", "group", "(", "80.4", "%", "vs", ".", "57.7", "%", ",", "P=0.0491", ")", ".", "Based", "on", "our", "results", ",", "COUP", "-", "TFII", "may", "represent", "a", "biomarker", "for", "good", "prognosis", "in", "colorectal", "cancer", ".", "\n" ]
[ "Tissue", "Cancer", "Cell", "Multi-tissue_structure" ]
Robotereinsatz is an umlsterm, zementfreien is an umlsterm, Prothese is an umlsterm, Graphik - Computer is an umlsterm, Robotereinsatz is an umlsterm, Patienten is an umlsterm, Unfallklinik is an umlsterm, Patienten is an umlsterm, Knochenkontaktes is an umlsterm, Knochen is an umlsterm
DerOrthopaede.70260251.ger.abstr_task0
Sentence: Der computergesteuerte Robotereinsatz bei der Implantation einer zementfreien Prothese erfordert eine exakte praeoperative Planung am dreidimensionalen Graphik-Computer ( Orthodoc ) . Erstmals ist es mit diesem Verfahren moeglich , dass die in 3 Ebenen erfolgte Planung durch den computergesteuerten Robotereinsatz am Patienten umgesetzt werden kann . Seit Herbst 1994 wird an der Berufsgenossenschaft Unfallklinik Frankfurt am Main dieses Verfahren eingesetzt . Bei bisher 465 operierten Patienten konnte in allen Faellen die praeoperative Planung intraoperativ umgesetzt werden . Es kann davon ausgegangen werden , dass aufgrund eines wesentlich verbesserten Knochenkontaktes , bedingt durch die hohe Praezision beim Fraesvorgang und der dadurch erreichbaren hohen Primaerstabilitaet ein besseres Anwachsverhalten durch den Knochen gegeben sein wird . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O" ]
Der computergesteuerte Robotereinsatz bei der Implantation einer zementfreien Prothese erfordert eine exakte praeoperative Planung am dreidimensionalen Graphik-Computer ( Orthodoc ) . Erstmals ist es mit diesem Verfahren moeglich , dass die in 3 Ebenen erfolgte Planung durch den computergesteuerten Robotereinsatz am Patienten umgesetzt werden kann . Seit Herbst 1994 wird an der Berufsgenossenschaft Unfallklinik Frankfurt am Main dieses Verfahren eingesetzt . Bei bisher 465 operierten Patienten konnte in allen Faellen die praeoperative Planung intraoperativ umgesetzt werden . Es kann davon ausgegangen werden , dass aufgrund eines wesentlich verbesserten Knochenkontaktes , bedingt durch die hohe Praezision beim Fraesvorgang und der dadurch erreichbaren hohen Primaerstabilitaet ein besseres Anwachsverhalten durch den Knochen gegeben sein wird .
[ "Der", "computergesteuerte", "Robotereinsatz", "bei", "der", "Implantation", "einer", "zementfreien", "Prothese", "erfordert", "eine", "exakte", "praeoperative", "Planung", "am", "dreidimensionalen", "Graphik", "-", "Computer", "(", "Orthodoc", ")", ".", "Erstmals", "ist", "es", "mit", "diesem", "Verfahren", "moeglich", ",", "dass", "die", "in", "3", "Ebenen", "erfolgte", "Planung", "durch", "den", "computergesteuerten", "Robotereinsatz", "am", "Patienten", "umgesetzt", "werden", "kann", ".", "Seit", "Herbst", "1994", "wird", "an", "der", "Berufsgenossenschaft", "Unfallklinik", "Frankfurt", "am", "Main", "dieses", "Verfahren", "eingesetzt", ".", "Bei", "bisher", "465", "operierten", "Patienten", "konnte", "in", "allen", "Faellen", "die", "praeoperative", "Planung", "intraoperativ", "umgesetzt", "werden", ".", "Es", "kann", "davon", "ausgegangen", "werden", ",", "dass", "aufgrund", "eines", "wesentlich", "verbesserten", "Knochenkontaktes", ",", "bedingt", "durch", "die", "hohe", "Praezision", "beim", "Fraesvorgang", "und", "der", "dadurch", "erreichbaren", "hohen", "Primaerstabilitaet", "ein", "besseres", "Anwachsverhalten", "durch", "den", "Knochen", "gegeben", "sein", "wird", "." ]
[ "umlsterm" ]
Robotereinsatz is an umlsterm, zementfreien is an umlsterm, Prothese is an umlsterm, Graphik - Computer is an umlsterm, Robotereinsatz is an umlsterm, Patienten is an umlsterm, Unfallklinik is an umlsterm, Patienten is an umlsterm, Knochenkontaktes is an umlsterm, Knochen is an umlsterm
DerOrthopaede.70260251.ger.abstr_task1
Sentence: Der computergesteuerte Robotereinsatz bei der Implantation einer zementfreien Prothese erfordert eine exakte praeoperative Planung am dreidimensionalen Graphik-Computer ( Orthodoc ) . Erstmals ist es mit diesem Verfahren moeglich , dass die in 3 Ebenen erfolgte Planung durch den computergesteuerten Robotereinsatz am Patienten umgesetzt werden kann . Seit Herbst 1994 wird an der Berufsgenossenschaft Unfallklinik Frankfurt am Main dieses Verfahren eingesetzt . Bei bisher 465 operierten Patienten konnte in allen Faellen die praeoperative Planung intraoperativ umgesetzt werden . Es kann davon ausgegangen werden , dass aufgrund eines wesentlich verbesserten Knochenkontaktes , bedingt durch die hohe Praezision beim Fraesvorgang und der dadurch erreichbaren hohen Primaerstabilitaet ein besseres Anwachsverhalten durch den Knochen gegeben sein wird . Instructions: please typing these entity words according to sentence: Robotereinsatz, zementfreien, Prothese, Graphik - Computer, Robotereinsatz, Patienten, Unfallklinik, Patienten, Knochenkontaktes, Knochen Options: umlsterm
[ "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O" ]
Der computergesteuerte Robotereinsatz bei der Implantation einer zementfreien Prothese erfordert eine exakte praeoperative Planung am dreidimensionalen Graphik-Computer ( Orthodoc ) . Erstmals ist es mit diesem Verfahren moeglich , dass die in 3 Ebenen erfolgte Planung durch den computergesteuerten Robotereinsatz am Patienten umgesetzt werden kann . Seit Herbst 1994 wird an der Berufsgenossenschaft Unfallklinik Frankfurt am Main dieses Verfahren eingesetzt . Bei bisher 465 operierten Patienten konnte in allen Faellen die praeoperative Planung intraoperativ umgesetzt werden . Es kann davon ausgegangen werden , dass aufgrund eines wesentlich verbesserten Knochenkontaktes , bedingt durch die hohe Praezision beim Fraesvorgang und der dadurch erreichbaren hohen Primaerstabilitaet ein besseres Anwachsverhalten durch den Knochen gegeben sein wird .
[ "Der", "computergesteuerte", "Robotereinsatz", "bei", "der", "Implantation", "einer", "zementfreien", "Prothese", "erfordert", "eine", "exakte", "praeoperative", "Planung", "am", "dreidimensionalen", "Graphik", "-", "Computer", "(", "Orthodoc", ")", ".", "Erstmals", "ist", "es", "mit", "diesem", "Verfahren", "moeglich", ",", "dass", "die", "in", "3", "Ebenen", "erfolgte", "Planung", "durch", "den", "computergesteuerten", "Robotereinsatz", "am", "Patienten", "umgesetzt", "werden", "kann", ".", "Seit", "Herbst", "1994", "wird", "an", "der", "Berufsgenossenschaft", "Unfallklinik", "Frankfurt", "am", "Main", "dieses", "Verfahren", "eingesetzt", ".", "Bei", "bisher", "465", "operierten", "Patienten", "konnte", "in", "allen", "Faellen", "die", "praeoperative", "Planung", "intraoperativ", "umgesetzt", "werden", ".", "Es", "kann", "davon", "ausgegangen", "werden", ",", "dass", "aufgrund", "eines", "wesentlich", "verbesserten", "Knochenkontaktes", ",", "bedingt", "durch", "die", "hohe", "Praezision", "beim", "Fraesvorgang", "und", "der", "dadurch", "erreichbaren", "hohen", "Primaerstabilitaet", "ein", "besseres", "Anwachsverhalten", "durch", "den", "Knochen", "gegeben", "sein", "wird", "." ]
[ "umlsterm" ]
Robotereinsatz, zementfreien, Prothese, Graphik - Computer, Robotereinsatz, Patienten, Unfallklinik, Patienten, Knochenkontaktes, Knochen
DerOrthopaede.70260251.ger.abstr_task2
Sentence: Der computergesteuerte Robotereinsatz bei der Implantation einer zementfreien Prothese erfordert eine exakte praeoperative Planung am dreidimensionalen Graphik-Computer ( Orthodoc ) . Erstmals ist es mit diesem Verfahren moeglich , dass die in 3 Ebenen erfolgte Planung durch den computergesteuerten Robotereinsatz am Patienten umgesetzt werden kann . Seit Herbst 1994 wird an der Berufsgenossenschaft Unfallklinik Frankfurt am Main dieses Verfahren eingesetzt . Bei bisher 465 operierten Patienten konnte in allen Faellen die praeoperative Planung intraoperativ umgesetzt werden . Es kann davon ausgegangen werden , dass aufgrund eines wesentlich verbesserten Knochenkontaktes , bedingt durch die hohe Praezision beim Fraesvorgang und der dadurch erreichbaren hohen Primaerstabilitaet ein besseres Anwachsverhalten durch den Knochen gegeben sein wird . Instructions: please extract entity words from the input sentence
[ "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O" ]
Der computergesteuerte Robotereinsatz bei der Implantation einer zementfreien Prothese erfordert eine exakte praeoperative Planung am dreidimensionalen Graphik-Computer ( Orthodoc ) . Erstmals ist es mit diesem Verfahren moeglich , dass die in 3 Ebenen erfolgte Planung durch den computergesteuerten Robotereinsatz am Patienten umgesetzt werden kann . Seit Herbst 1994 wird an der Berufsgenossenschaft Unfallklinik Frankfurt am Main dieses Verfahren eingesetzt . Bei bisher 465 operierten Patienten konnte in allen Faellen die praeoperative Planung intraoperativ umgesetzt werden . Es kann davon ausgegangen werden , dass aufgrund eines wesentlich verbesserten Knochenkontaktes , bedingt durch die hohe Praezision beim Fraesvorgang und der dadurch erreichbaren hohen Primaerstabilitaet ein besseres Anwachsverhalten durch den Knochen gegeben sein wird .
[ "Der", "computergesteuerte", "Robotereinsatz", "bei", "der", "Implantation", "einer", "zementfreien", "Prothese", "erfordert", "eine", "exakte", "praeoperative", "Planung", "am", "dreidimensionalen", "Graphik", "-", "Computer", "(", "Orthodoc", ")", ".", "Erstmals", "ist", "es", "mit", "diesem", "Verfahren", "moeglich", ",", "dass", "die", "in", "3", "Ebenen", "erfolgte", "Planung", "durch", "den", "computergesteuerten", "Robotereinsatz", "am", "Patienten", "umgesetzt", "werden", "kann", ".", "Seit", "Herbst", "1994", "wird", "an", "der", "Berufsgenossenschaft", "Unfallklinik", "Frankfurt", "am", "Main", "dieses", "Verfahren", "eingesetzt", ".", "Bei", "bisher", "465", "operierten", "Patienten", "konnte", "in", "allen", "Faellen", "die", "praeoperative", "Planung", "intraoperativ", "umgesetzt", "werden", ".", "Es", "kann", "davon", "ausgegangen", "werden", ",", "dass", "aufgrund", "eines", "wesentlich", "verbesserten", "Knochenkontaktes", ",", "bedingt", "durch", "die", "hohe", "Praezision", "beim", "Fraesvorgang", "und", "der", "dadurch", "erreichbaren", "hohen", "Primaerstabilitaet", "ein", "besseres", "Anwachsverhalten", "durch", "den", "Knochen", "gegeben", "sein", "wird", "." ]
[ "umlsterm" ]
peroxidase is a protein, caffeic acid is a compound
DS.d667_task0
Sentence: In this view, this study aimed at the investigating the use of a crude peroxidase preparation from onion solid by-products for oxidising caffeic acid, a widespread o-diphenol, whose various derivatives may occur in food industry wastes, such as olive mill waste waters. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: compound, protein
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-compound", "I-compound", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
In this view, this study aimed at the investigating the use of a crude peroxidase preparation from onion solid by-products for oxidising caffeic acid, a widespread o-diphenol, whose various derivatives may occur in food industry wastes, such as olive mill waste waters.
[ "In", "this", "view", ",", "this", "study", "aimed", "at", "the", "investigating", "the", "use", "of", "a", "crude", "peroxidase", "preparation", "from", "onion", "solid", "by", "-", "products", "for", "oxidising", "caffeic", "acid", ",", "a", "widespread", "o", "-", "diphenol", ",", "whose", "various", "derivatives", "may", "occur", "in", "food", "industry", "wastes", ",", "such", "as", "olive", "mill", "waste", "waters", "." ]
[ "compound", "protein" ]
peroxidase is a protein, caffeic acid is a compound
DS.d667_task1
Sentence: In this view, this study aimed at the investigating the use of a crude peroxidase preparation from onion solid by-products for oxidising caffeic acid, a widespread o-diphenol, whose various derivatives may occur in food industry wastes, such as olive mill waste waters. Instructions: please typing these entity words according to sentence: peroxidase, caffeic acid Options: compound, protein
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-compound", "I-compound", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
In this view, this study aimed at the investigating the use of a crude peroxidase preparation from onion solid by-products for oxidising caffeic acid, a widespread o-diphenol, whose various derivatives may occur in food industry wastes, such as olive mill waste waters.
[ "In", "this", "view", ",", "this", "study", "aimed", "at", "the", "investigating", "the", "use", "of", "a", "crude", "peroxidase", "preparation", "from", "onion", "solid", "by", "-", "products", "for", "oxidising", "caffeic", "acid", ",", "a", "widespread", "o", "-", "diphenol", ",", "whose", "various", "derivatives", "may", "occur", "in", "food", "industry", "wastes", ",", "such", "as", "olive", "mill", "waste", "waters", "." ]
[ "compound", "protein" ]
peroxidase, caffeic acid
DS.d667_task2
Sentence: In this view, this study aimed at the investigating the use of a crude peroxidase preparation from onion solid by-products for oxidising caffeic acid, a widespread o-diphenol, whose various derivatives may occur in food industry wastes, such as olive mill waste waters. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-compound", "I-compound", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
In this view, this study aimed at the investigating the use of a crude peroxidase preparation from onion solid by-products for oxidising caffeic acid, a widespread o-diphenol, whose various derivatives may occur in food industry wastes, such as olive mill waste waters.
[ "In", "this", "view", ",", "this", "study", "aimed", "at", "the", "investigating", "the", "use", "of", "a", "crude", "peroxidase", "preparation", "from", "onion", "solid", "by", "-", "products", "for", "oxidising", "caffeic", "acid", ",", "a", "widespread", "o", "-", "diphenol", ",", "whose", "various", "derivatives", "may", "occur", "in", "food", "industry", "wastes", ",", "such", "as", "olive", "mill", "waste", "waters", "." ]
[ "compound", "protein" ]
ActA is a Individual_protein, actin is a Individual_protein, profilin is a Individual_protein, WASp is a Individual_protein
335_task0
Sentence: Here we show that the N-terminal domain of ActA binds one actin monomer, in a profilin-like fashion, and Arp2/3 complex and mimics the C-terminal domain of WASp family proteins in catalyzing filament barbed end branching by Arp2/3 complex. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Individual_protein
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Here we show that the N-terminal domain of ActA binds one actin monomer, in a profilin-like fashion, and Arp2/3 complex and mimics the C-terminal domain of WASp family proteins in catalyzing filament barbed end branching by Arp2/3 complex.
[ "Here", "we", "show", "that", "the", "N", "-", "terminal", "domain", "of", "ActA", "binds", "one", "actin", "monomer", ",", "in", "a", "profilin", "-", "like", "fashion", ",", "and", "Arp2/3", "complex", "and", "mimics", "the", "C", "-", "terminal", "domain", "of", "WASp", "family", "proteins", "in", "catalyzing", "filament", "barbed", "end", "branching", "by", "Arp2/3", "complex", "." ]
[ "Individual_protein" ]
ActA is a Individual_protein, actin is a Individual_protein, profilin is a Individual_protein, WASp is a Individual_protein
335_task1
Sentence: Here we show that the N-terminal domain of ActA binds one actin monomer, in a profilin-like fashion, and Arp2/3 complex and mimics the C-terminal domain of WASp family proteins in catalyzing filament barbed end branching by Arp2/3 complex. Instructions: please typing these entity words according to sentence: ActA, actin, profilin, WASp Options: Individual_protein
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Here we show that the N-terminal domain of ActA binds one actin monomer, in a profilin-like fashion, and Arp2/3 complex and mimics the C-terminal domain of WASp family proteins in catalyzing filament barbed end branching by Arp2/3 complex.
[ "Here", "we", "show", "that", "the", "N", "-", "terminal", "domain", "of", "ActA", "binds", "one", "actin", "monomer", ",", "in", "a", "profilin", "-", "like", "fashion", ",", "and", "Arp2/3", "complex", "and", "mimics", "the", "C", "-", "terminal", "domain", "of", "WASp", "family", "proteins", "in", "catalyzing", "filament", "barbed", "end", "branching", "by", "Arp2/3", "complex", "." ]
[ "Individual_protein" ]
ActA, actin, profilin, WASp
335_task2
Sentence: Here we show that the N-terminal domain of ActA binds one actin monomer, in a profilin-like fashion, and Arp2/3 complex and mimics the C-terminal domain of WASp family proteins in catalyzing filament barbed end branching by Arp2/3 complex. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Here we show that the N-terminal domain of ActA binds one actin monomer, in a profilin-like fashion, and Arp2/3 complex and mimics the C-terminal domain of WASp family proteins in catalyzing filament barbed end branching by Arp2/3 complex.
[ "Here", "we", "show", "that", "the", "N", "-", "terminal", "domain", "of", "ActA", "binds", "one", "actin", "monomer", ",", "in", "a", "profilin", "-", "like", "fashion", ",", "and", "Arp2/3", "complex", "and", "mimics", "the", "C", "-", "terminal", "domain", "of", "WASp", "family", "proteins", "in", "catalyzing", "filament", "barbed", "end", "branching", "by", "Arp2/3", "complex", "." ]
[ "Individual_protein" ]
interferon beta-1a is a DRUG, AVONEX is a BRAND, TYSABRI is a BRAND, TYSABRI is a BRAND, AVONEX is a BRAND, AVONEX is a BRAND, TYSABRI is a BRAND, TYSABRI is a BRAND, interferon beta-1a is a DRUG, AVONEX is a BRAND, glatiramer acetate is a DRUG, beta - interferon is a DRUG, glatiramer acetate is a DRUG
Natalizumab_ddi_task0
Sentence: After multiple dosing, interferon beta-1a (AVONEX 30 mcg IM once weekly) reduced TYSABRI clearance by approximately 30%. The similarity of the TYSABRI -associated adverse event profile between Study 1 (without co-administered AVONEX ) and Study 2 (with co-administered AVONEX ) indicates that this alteration in clearance does not necessitate reduction of the TYSABRI dose to maintain safety, General). Results of studies in multiple sclerosis patients taking TYSABRI and concomitant interferon beta-1a (AVONEX 30 mcg IM once weekly) or glatiramer acetate were inconclusive with regard to the need for dose adjustment of the beta-interferon or glatiramer acetate. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: BRAND, DRUG
[ "O", "O", "O", "O", "B-DRUG", "I-DRUG", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "B-DRUG", "I-DRUG", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "I-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "I-DRUG", "I-DRUG", "O", "B-DRUG", "I-DRUG", "O" ]
After multiple dosing, interferon beta-1a (AVONEX 30 mcg IM once weekly) reduced TYSABRI clearance by approximately 30%. The similarity of the TYSABRI -associated adverse event profile between Study 1 (without co-administered AVONEX ) and Study 2 (with co-administered AVONEX ) indicates that this alteration in clearance does not necessitate reduction of the TYSABRI dose to maintain safety, General). Results of studies in multiple sclerosis patients taking TYSABRI and concomitant interferon beta-1a (AVONEX 30 mcg IM once weekly) or glatiramer acetate were inconclusive with regard to the need for dose adjustment of the beta-interferon or glatiramer acetate.
[ "After", "multiple", "dosing", ",", "interferon", "beta-1a", "(", "AVONEX", " ", "30", "mcg", "IM", "once", "weekly", ")", "reduced", "TYSABRI", " ", "clearance", "by", "approximately", "30", "%", ".", "The", "similarity", "of", "the", "TYSABRI", "-associated", "adverse", "event", "profile", "between", "Study", "1", "(", "without", "co", "-", "administered", "AVONEX", ")", "and", "Study", "2", "(", "with", "co", "-", "administered", "AVONEX", ")", "indicates", "that", "this", "alteration", "in", "clearance", "does", "not", "necessitate", "reduction", "of", "the", "TYSABRI", " ", "dose", "to", "maintain", "safety", ",", "General", ")", ".", "Results", "of", "studies", "in", "multiple", "sclerosis", "patients", "taking", "TYSABRI", " ", "and", "concomitant", "interferon", "beta-1a", "(", "AVONEX", " ", "30", "mcg", "IM", "once", "weekly", ")", "or", "glatiramer", "acetate", "were", "inconclusive", "with", "regard", "to", "the", "need", "for", "dose", "adjustment", "of", "the", "beta", "-", "interferon", "or", "glatiramer", "acetate", "." ]
[ "DRUG", "BRAND" ]
interferon beta-1a is a DRUG, AVONEX is a BRAND, TYSABRI is a BRAND, TYSABRI is a BRAND, AVONEX is a BRAND, AVONEX is a BRAND, TYSABRI is a BRAND, TYSABRI is a BRAND, interferon beta-1a is a DRUG, AVONEX is a BRAND, glatiramer acetate is a DRUG, beta - interferon is a DRUG, glatiramer acetate is a DRUG
Natalizumab_ddi_task1
Sentence: After multiple dosing, interferon beta-1a (AVONEX 30 mcg IM once weekly) reduced TYSABRI clearance by approximately 30%. The similarity of the TYSABRI -associated adverse event profile between Study 1 (without co-administered AVONEX ) and Study 2 (with co-administered AVONEX ) indicates that this alteration in clearance does not necessitate reduction of the TYSABRI dose to maintain safety, General). Results of studies in multiple sclerosis patients taking TYSABRI and concomitant interferon beta-1a (AVONEX 30 mcg IM once weekly) or glatiramer acetate were inconclusive with regard to the need for dose adjustment of the beta-interferon or glatiramer acetate. Instructions: please typing these entity words according to sentence: interferon beta-1a, AVONEX, TYSABRI, TYSABRI, AVONEX, AVONEX, TYSABRI, TYSABRI, interferon beta-1a, AVONEX, glatiramer acetate, beta - interferon, glatiramer acetate Options: BRAND, DRUG
[ "O", "O", "O", "O", "B-DRUG", "I-DRUG", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "B-DRUG", "I-DRUG", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "I-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "I-DRUG", "I-DRUG", "O", "B-DRUG", "I-DRUG", "O" ]
After multiple dosing, interferon beta-1a (AVONEX 30 mcg IM once weekly) reduced TYSABRI clearance by approximately 30%. The similarity of the TYSABRI -associated adverse event profile between Study 1 (without co-administered AVONEX ) and Study 2 (with co-administered AVONEX ) indicates that this alteration in clearance does not necessitate reduction of the TYSABRI dose to maintain safety, General). Results of studies in multiple sclerosis patients taking TYSABRI and concomitant interferon beta-1a (AVONEX 30 mcg IM once weekly) or glatiramer acetate were inconclusive with regard to the need for dose adjustment of the beta-interferon or glatiramer acetate.
[ "After", "multiple", "dosing", ",", "interferon", "beta-1a", "(", "AVONEX", " ", "30", "mcg", "IM", "once", "weekly", ")", "reduced", "TYSABRI", " ", "clearance", "by", "approximately", "30", "%", ".", "The", "similarity", "of", "the", "TYSABRI", "-associated", "adverse", "event", "profile", "between", "Study", "1", "(", "without", "co", "-", "administered", "AVONEX", ")", "and", "Study", "2", "(", "with", "co", "-", "administered", "AVONEX", ")", "indicates", "that", "this", "alteration", "in", "clearance", "does", "not", "necessitate", "reduction", "of", "the", "TYSABRI", " ", "dose", "to", "maintain", "safety", ",", "General", ")", ".", "Results", "of", "studies", "in", "multiple", "sclerosis", "patients", "taking", "TYSABRI", " ", "and", "concomitant", "interferon", "beta-1a", "(", "AVONEX", " ", "30", "mcg", "IM", "once", "weekly", ")", "or", "glatiramer", "acetate", "were", "inconclusive", "with", "regard", "to", "the", "need", "for", "dose", "adjustment", "of", "the", "beta", "-", "interferon", "or", "glatiramer", "acetate", "." ]
[ "DRUG", "BRAND" ]
interferon beta-1a, AVONEX, TYSABRI, TYSABRI, AVONEX, AVONEX, TYSABRI, TYSABRI, interferon beta-1a, AVONEX, glatiramer acetate, beta - interferon, glatiramer acetate
Natalizumab_ddi_task2
Sentence: After multiple dosing, interferon beta-1a (AVONEX 30 mcg IM once weekly) reduced TYSABRI clearance by approximately 30%. The similarity of the TYSABRI -associated adverse event profile between Study 1 (without co-administered AVONEX ) and Study 2 (with co-administered AVONEX ) indicates that this alteration in clearance does not necessitate reduction of the TYSABRI dose to maintain safety, General). Results of studies in multiple sclerosis patients taking TYSABRI and concomitant interferon beta-1a (AVONEX 30 mcg IM once weekly) or glatiramer acetate were inconclusive with regard to the need for dose adjustment of the beta-interferon or glatiramer acetate. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "B-DRUG", "I-DRUG", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "B-DRUG", "I-DRUG", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "I-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "I-DRUG", "I-DRUG", "O", "B-DRUG", "I-DRUG", "O" ]
After multiple dosing, interferon beta-1a (AVONEX 30 mcg IM once weekly) reduced TYSABRI clearance by approximately 30%. The similarity of the TYSABRI -associated adverse event profile between Study 1 (without co-administered AVONEX ) and Study 2 (with co-administered AVONEX ) indicates that this alteration in clearance does not necessitate reduction of the TYSABRI dose to maintain safety, General). Results of studies in multiple sclerosis patients taking TYSABRI and concomitant interferon beta-1a (AVONEX 30 mcg IM once weekly) or glatiramer acetate were inconclusive with regard to the need for dose adjustment of the beta-interferon or glatiramer acetate.
[ "After", "multiple", "dosing", ",", "interferon", "beta-1a", "(", "AVONEX", " ", "30", "mcg", "IM", "once", "weekly", ")", "reduced", "TYSABRI", " ", "clearance", "by", "approximately", "30", "%", ".", "The", "similarity", "of", "the", "TYSABRI", "-associated", "adverse", "event", "profile", "between", "Study", "1", "(", "without", "co", "-", "administered", "AVONEX", ")", "and", "Study", "2", "(", "with", "co", "-", "administered", "AVONEX", ")", "indicates", "that", "this", "alteration", "in", "clearance", "does", "not", "necessitate", "reduction", "of", "the", "TYSABRI", " ", "dose", "to", "maintain", "safety", ",", "General", ")", ".", "Results", "of", "studies", "in", "multiple", "sclerosis", "patients", "taking", "TYSABRI", " ", "and", "concomitant", "interferon", "beta-1a", "(", "AVONEX", " ", "30", "mcg", "IM", "once", "weekly", ")", "or", "glatiramer", "acetate", "were", "inconclusive", "with", "regard", "to", "the", "need", "for", "dose", "adjustment", "of", "the", "beta", "-", "interferon", "or", "glatiramer", "acetate", "." ]
[ "DRUG", "BRAND" ]
anti - neoplastic agents is a GROUP, leucovorin is a DRUG, AVASTIN is a BRAND, Irinotecan is a DRUG, AVASTIN is a BRAND, SN38 is a DRUG_N, irinotecan is a DRUG, AVASTIN is a BRAND, AVASTIN is a BRAND, SN38 is a DRUG_N, irinotecan is a DRUG, AVASTIN is a BRAND
Bevacizumab_ddi_task0
Sentence: No formal drug interaction studies with anti-neoplastic agents have been conducted. In Study 1, patients with colorectal cancer were given irinotecan/5-FU/leucovorin (bolus-IFL) with or without AVASTIN. Irinotecan concentrations were similar in patients receiving bolus-IFL alone and in combination with AVASTIN. The concentrations of SN38, the active metabolite of irinotecan, were on average 33% higher in patients receiving bolus-IFL in combination with AVASTIN when compared with bolus-IFL alone. In Study 1, patients receiving bolus-IFL plus AVASTIN had a higher incidence of Grade 3-4 diarrhea and neutropenia. Due to high inter-patient variability and limited sampling, the extent of the increase in SN38 levels in patients receiving concurrent irinotecan and AVASTIN is uncertain. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: GROUP, DRUG_N, BRAND, DRUG
[ "O", "O", "O", "O", "O", "O", "B-GROUP", "I-GROUP", "I-GROUP", "I-GROUP", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "B-DRUG_N", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG_N", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-BRAND", "O", "O", "O" ]
No formal drug interaction studies with anti-neoplastic agents have been conducted. In Study 1, patients with colorectal cancer were given irinotecan/5-FU/leucovorin (bolus-IFL) with or without AVASTIN. Irinotecan concentrations were similar in patients receiving bolus-IFL alone and in combination with AVASTIN. The concentrations of SN38, the active metabolite of irinotecan, were on average 33% higher in patients receiving bolus-IFL in combination with AVASTIN when compared with bolus-IFL alone. In Study 1, patients receiving bolus-IFL plus AVASTIN had a higher incidence of Grade 3-4 diarrhea and neutropenia. Due to high inter-patient variability and limited sampling, the extent of the increase in SN38 levels in patients receiving concurrent irinotecan and AVASTIN is uncertain.
[ "No", "formal", "drug", "interaction", "studies", "with", "anti", "-", "neoplastic", "agents", "have", "been", "conducted", ".", "In", "Study", "1", ",", "patients", "with", "colorectal", "cancer", "were", "given", "irinotecan/5-FU", "/", "leucovorin", "(", "bolus", "-", "IFL", ")", "with", "or", "without", "AVASTIN", ".", "Irinotecan", "concentrations", "were", "similar", "in", "patients", "receiving", "bolus", "-", "IFL", "alone", "and", "in", "combination", "with", "AVASTIN", ".", "The", "concentrations", "of", "SN38", ",", "the", "active", "metabolite", "of", "irinotecan", ",", "were", "on", "average", "33", "%", "higher", "in", "patients", "receiving", "bolus", "-", "IFL", "in", "combination", "with", "AVASTIN", "when", "compared", "with", "bolus", "-", "IFL", "alone", ".", "In", "Study", "1", ",", "patients", "receiving", "bolus", "-", "IFL", "plus", "AVASTIN", "had", "a", "higher", "incidence", "of", "Grade", "3", "-", "4", "diarrhea", "and", "neutropenia", ".", "Due", "to", "high", "inter", "-", "patient", "variability", "and", "limited", "sampling", ",", "the", "extent", "of", "the", "increase", "in", "SN38", "levels", "in", "patients", "receiving", "concurrent", "irinotecan", "and", "AVASTIN", "is", "uncertain", "." ]
[ "GROUP", "DRUG", "BRAND", "DRUG_N" ]
anti - neoplastic agents is a GROUP, leucovorin is a DRUG, AVASTIN is a BRAND, Irinotecan is a DRUG, AVASTIN is a BRAND, SN38 is a DRUG_N, irinotecan is a DRUG, AVASTIN is a BRAND, AVASTIN is a BRAND, SN38 is a DRUG_N, irinotecan is a DRUG, AVASTIN is a BRAND
Bevacizumab_ddi_task1
Sentence: No formal drug interaction studies with anti-neoplastic agents have been conducted. In Study 1, patients with colorectal cancer were given irinotecan/5-FU/leucovorin (bolus-IFL) with or without AVASTIN. Irinotecan concentrations were similar in patients receiving bolus-IFL alone and in combination with AVASTIN. The concentrations of SN38, the active metabolite of irinotecan, were on average 33% higher in patients receiving bolus-IFL in combination with AVASTIN when compared with bolus-IFL alone. In Study 1, patients receiving bolus-IFL plus AVASTIN had a higher incidence of Grade 3-4 diarrhea and neutropenia. Due to high inter-patient variability and limited sampling, the extent of the increase in SN38 levels in patients receiving concurrent irinotecan and AVASTIN is uncertain. Instructions: please typing these entity words according to sentence: anti - neoplastic agents, leucovorin, AVASTIN, Irinotecan, AVASTIN, SN38, irinotecan, AVASTIN, AVASTIN, SN38, irinotecan, AVASTIN Options: GROUP, DRUG_N, BRAND, DRUG
[ "O", "O", "O", "O", "O", "O", "B-GROUP", "I-GROUP", "I-GROUP", "I-GROUP", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "B-DRUG_N", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG_N", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-BRAND", "O", "O", "O" ]
No formal drug interaction studies with anti-neoplastic agents have been conducted. In Study 1, patients with colorectal cancer were given irinotecan/5-FU/leucovorin (bolus-IFL) with or without AVASTIN. Irinotecan concentrations were similar in patients receiving bolus-IFL alone and in combination with AVASTIN. The concentrations of SN38, the active metabolite of irinotecan, were on average 33% higher in patients receiving bolus-IFL in combination with AVASTIN when compared with bolus-IFL alone. In Study 1, patients receiving bolus-IFL plus AVASTIN had a higher incidence of Grade 3-4 diarrhea and neutropenia. Due to high inter-patient variability and limited sampling, the extent of the increase in SN38 levels in patients receiving concurrent irinotecan and AVASTIN is uncertain.
[ "No", "formal", "drug", "interaction", "studies", "with", "anti", "-", "neoplastic", "agents", "have", "been", "conducted", ".", "In", "Study", "1", ",", "patients", "with", "colorectal", "cancer", "were", "given", "irinotecan/5-FU", "/", "leucovorin", "(", "bolus", "-", "IFL", ")", "with", "or", "without", "AVASTIN", ".", "Irinotecan", "concentrations", "were", "similar", "in", "patients", "receiving", "bolus", "-", "IFL", "alone", "and", "in", "combination", "with", "AVASTIN", ".", "The", "concentrations", "of", "SN38", ",", "the", "active", "metabolite", "of", "irinotecan", ",", "were", "on", "average", "33", "%", "higher", "in", "patients", "receiving", "bolus", "-", "IFL", "in", "combination", "with", "AVASTIN", "when", "compared", "with", "bolus", "-", "IFL", "alone", ".", "In", "Study", "1", ",", "patients", "receiving", "bolus", "-", "IFL", "plus", "AVASTIN", "had", "a", "higher", "incidence", "of", "Grade", "3", "-", "4", "diarrhea", "and", "neutropenia", ".", "Due", "to", "high", "inter", "-", "patient", "variability", "and", "limited", "sampling", ",", "the", "extent", "of", "the", "increase", "in", "SN38", "levels", "in", "patients", "receiving", "concurrent", "irinotecan", "and", "AVASTIN", "is", "uncertain", "." ]
[ "GROUP", "DRUG", "BRAND", "DRUG_N" ]
anti - neoplastic agents, leucovorin, AVASTIN, Irinotecan, AVASTIN, SN38, irinotecan, AVASTIN, AVASTIN, SN38, irinotecan, AVASTIN
Bevacizumab_ddi_task2
Sentence: No formal drug interaction studies with anti-neoplastic agents have been conducted. In Study 1, patients with colorectal cancer were given irinotecan/5-FU/leucovorin (bolus-IFL) with or without AVASTIN. Irinotecan concentrations were similar in patients receiving bolus-IFL alone and in combination with AVASTIN. The concentrations of SN38, the active metabolite of irinotecan, were on average 33% higher in patients receiving bolus-IFL in combination with AVASTIN when compared with bolus-IFL alone. In Study 1, patients receiving bolus-IFL plus AVASTIN had a higher incidence of Grade 3-4 diarrhea and neutropenia. Due to high inter-patient variability and limited sampling, the extent of the increase in SN38 levels in patients receiving concurrent irinotecan and AVASTIN is uncertain. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "B-GROUP", "I-GROUP", "I-GROUP", "I-GROUP", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "B-DRUG_N", "O", "O", "O", "O", "O", "B-DRUG", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-BRAND", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-DRUG_N", "O", "O", "O", "O", "O", "B-DRUG", "O", "B-BRAND", "O", "O", "O" ]
No formal drug interaction studies with anti-neoplastic agents have been conducted. In Study 1, patients with colorectal cancer were given irinotecan/5-FU/leucovorin (bolus-IFL) with or without AVASTIN. Irinotecan concentrations were similar in patients receiving bolus-IFL alone and in combination with AVASTIN. The concentrations of SN38, the active metabolite of irinotecan, were on average 33% higher in patients receiving bolus-IFL in combination with AVASTIN when compared with bolus-IFL alone. In Study 1, patients receiving bolus-IFL plus AVASTIN had a higher incidence of Grade 3-4 diarrhea and neutropenia. Due to high inter-patient variability and limited sampling, the extent of the increase in SN38 levels in patients receiving concurrent irinotecan and AVASTIN is uncertain.
[ "No", "formal", "drug", "interaction", "studies", "with", "anti", "-", "neoplastic", "agents", "have", "been", "conducted", ".", "In", "Study", "1", ",", "patients", "with", "colorectal", "cancer", "were", "given", "irinotecan/5-FU", "/", "leucovorin", "(", "bolus", "-", "IFL", ")", "with", "or", "without", "AVASTIN", ".", "Irinotecan", "concentrations", "were", "similar", "in", "patients", "receiving", "bolus", "-", "IFL", "alone", "and", "in", "combination", "with", "AVASTIN", ".", "The", "concentrations", "of", "SN38", ",", "the", "active", "metabolite", "of", "irinotecan", ",", "were", "on", "average", "33", "%", "higher", "in", "patients", "receiving", "bolus", "-", "IFL", "in", "combination", "with", "AVASTIN", "when", "compared", "with", "bolus", "-", "IFL", "alone", ".", "In", "Study", "1", ",", "patients", "receiving", "bolus", "-", "IFL", "plus", "AVASTIN", "had", "a", "higher", "incidence", "of", "Grade", "3", "-", "4", "diarrhea", "and", "neutropenia", ".", "Due", "to", "high", "inter", "-", "patient", "variability", "and", "limited", "sampling", ",", "the", "extent", "of", "the", "increase", "in", "SN38", "levels", "in", "patients", "receiving", "concurrent", "irinotecan", "and", "AVASTIN", "is", "uncertain", "." ]
[ "GROUP", "DRUG", "BRAND", "DRUG_N" ]
Prior is a Temporal, investigational is a Qualifier, anti - HIV vaccine is a Drug, Ongoing is a Temporal, therapy is a Procedure, Systemic corticosteroids . Short course less than or equal to 21 days of corticosteroids is allowed ; Systemic chemotherapeutic agents ; Nephrotoxic systemic agents , including aminoglycosides , amphotericin B , cidofovir , cisplatin , foscarnet , pentamidine ; Immunomodulatory treatments including Interleukin-2 ; Investigational agents is a Scope, allergy is a Condition, sensitivity is a Condition, hypersensitivity is a Condition, components of study drugs ( ART ) or their formulations is a Scope, Active is a Temporal, drug or alcohol use or dependence is a Scope, would interfere with adherence to study requirements is a Qualifier, Serious is a Qualifier, medical or psychiatric illness is a Scope, would interfere with the ability to adhere to study requirements is a Qualifier, acute hepatitis B infection is a Condition, female hormonal products is a Drug, estrogen or derivatives is a Scope
NCT01815580_exc_task0
Sentence: Prior receipt of investigational anti-HIV vaccine Ongoing therapy with any of the following: Systemic corticosteroids. Short course less than or equal to 21 days of corticosteroids is allowed; Systemic chemotherapeutic agents; Nephrotoxic systemic agents, including aminoglycosides, amphotericin B, cidofovir, cisplatin, foscarnet, pentamidine; Immunomodulatory treatments including Interleukin-2; Investigational agents Known allergy/sensitivity or any hypersensitivity to components of study drugs (ART) or their formulations Active drug or alcohol use or dependence that would interfere with adherence to study requirements Serious medical or psychiatric illness that would interfere with the ability to adhere to study requirements Chronic or acute hepatitis B infection Use of female hormonal products based on estrogen or derivatives Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Temporal, Condition, Qualifier, Procedure, Scope, Drug
[ "B-Temporal", "O", "O", "B-Qualifier", "B-Drug", "I-Drug", "I-Drug", "I-Drug", "O", "B-Temporal", "B-Procedure", "O", "O", "O", "O", "O", "O", "B-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "O", "O", "B-Condition", "O", "B-Condition", "O", "O", "B-Condition", "O", "B-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "O", "B-Temporal", "B-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "O", "B-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "O", "B-Qualifier", "B-Scope", "I-Scope", "I-Scope", "I-Scope", "O", "B-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "O", "O", "O", "B-Condition", "I-Condition", "I-Condition", "I-Condition", "O", "O", "O", "B-Drug", "I-Drug", "I-Drug", "O", "O", "B-Scope", "I-Scope", "I-Scope", "O" ]
Prior receipt of investigational anti-HIV vaccine Ongoing therapy with any of the following: Systemic corticosteroids. Short course less than or equal to 21 days of corticosteroids is allowed; Systemic chemotherapeutic agents; Nephrotoxic systemic agents, including aminoglycosides, amphotericin B, cidofovir, cisplatin, foscarnet, pentamidine; Immunomodulatory treatments including Interleukin-2; Investigational agents Known allergy/sensitivity or any hypersensitivity to components of study drugs (ART) or their formulations Active drug or alcohol use or dependence that would interfere with adherence to study requirements Serious medical or psychiatric illness that would interfere with the ability to adhere to study requirements Chronic or acute hepatitis B infection Use of female hormonal products based on estrogen or derivatives
[ "Prior", "receipt", "of", "investigational", "anti", "-", "HIV", "vaccine", "\n", "Ongoing", "therapy", "with", "any", "of", "the", "following", ":", "Systemic", "corticosteroids", ".", "Short", "course", "less", "than", "or", "equal", "to", "21", "days", "of", "corticosteroids", "is", "allowed", ";", "Systemic", "chemotherapeutic", "agents", ";", "Nephrotoxic", "systemic", "agents", ",", "including", "aminoglycosides", ",", "amphotericin", "B", ",", "cidofovir", ",", "cisplatin", ",", "foscarnet", ",", "pentamidine", ";", "Immunomodulatory", "treatments", "including", "Interleukin-2", ";", "Investigational", "agents", "\n", "Known", "allergy", "/", "sensitivity", "or", "any", "hypersensitivity", "to", "components", "of", "study", "drugs", "(", "ART", ")", "or", "their", "formulations", "\n", "Active", "drug", "or", "alcohol", "use", "or", "dependence", "that", "would", "interfere", "with", "adherence", "to", "study", "requirements", "\n", "Serious", "medical", "or", "psychiatric", "illness", "that", "would", "interfere", "with", "the", "ability", "to", "adhere", "to", "study", "requirements", "\n", "Chronic", "or", "acute", "hepatitis", "B", "infection", "\n", "Use", "of", "female", "hormonal", "products", "based", "on", "estrogen", "or", "derivatives", "\n" ]
[ "Scope", "Qualifier", "Drug", "Multiplier", "Procedure", "Condition", "Negation", "Temporal" ]
Prior is a Temporal, investigational is a Qualifier, anti - HIV vaccine is a Drug, Ongoing is a Temporal, therapy is a Procedure, Systemic corticosteroids . Short course less than or equal to 21 days of corticosteroids is allowed ; Systemic chemotherapeutic agents ; Nephrotoxic systemic agents , including aminoglycosides , amphotericin B , cidofovir , cisplatin , foscarnet , pentamidine ; Immunomodulatory treatments including Interleukin-2 ; Investigational agents is a Scope, allergy is a Condition, sensitivity is a Condition, hypersensitivity is a Condition, components of study drugs ( ART ) or their formulations is a Scope, Active is a Temporal, drug or alcohol use or dependence is a Scope, would interfere with adherence to study requirements is a Qualifier, Serious is a Qualifier, medical or psychiatric illness is a Scope, would interfere with the ability to adhere to study requirements is a Qualifier, acute hepatitis B infection is a Condition, female hormonal products is a Drug, estrogen or derivatives is a Scope
NCT01815580_exc_task1
Sentence: Prior receipt of investigational anti-HIV vaccine Ongoing therapy with any of the following: Systemic corticosteroids. Short course less than or equal to 21 days of corticosteroids is allowed; Systemic chemotherapeutic agents; Nephrotoxic systemic agents, including aminoglycosides, amphotericin B, cidofovir, cisplatin, foscarnet, pentamidine; Immunomodulatory treatments including Interleukin-2; Investigational agents Known allergy/sensitivity or any hypersensitivity to components of study drugs (ART) or their formulations Active drug or alcohol use or dependence that would interfere with adherence to study requirements Serious medical or psychiatric illness that would interfere with the ability to adhere to study requirements Chronic or acute hepatitis B infection Use of female hormonal products based on estrogen or derivatives Instructions: please typing these entity words according to sentence: Prior, investigational, anti - HIV vaccine, Ongoing, therapy, Systemic corticosteroids . Short course less than or equal to 21 days of corticosteroids is allowed ; Systemic chemotherapeutic agents ; Nephrotoxic systemic agents , including aminoglycosides , amphotericin B , cidofovir , cisplatin , foscarnet , pentamidine ; Immunomodulatory treatments including Interleukin-2 ; Investigational agents, allergy, sensitivity, hypersensitivity, components of study drugs ( ART ) or their formulations, Active, drug or alcohol use or dependence, would interfere with adherence to study requirements, Serious, medical or psychiatric illness, would interfere with the ability to adhere to study requirements, acute hepatitis B infection, female hormonal products, estrogen or derivatives Options: Temporal, Condition, Qualifier, Procedure, Scope, Drug
[ "B-Temporal", "O", "O", "B-Qualifier", "B-Drug", "I-Drug", "I-Drug", "I-Drug", "O", "B-Temporal", "B-Procedure", "O", "O", "O", "O", "O", "O", "B-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "O", "O", "B-Condition", "O", "B-Condition", "O", "O", "B-Condition", "O", "B-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "O", "B-Temporal", "B-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "O", "B-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "O", "B-Qualifier", "B-Scope", "I-Scope", "I-Scope", "I-Scope", "O", "B-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "O", "O", "O", "B-Condition", "I-Condition", "I-Condition", "I-Condition", "O", "O", "O", "B-Drug", "I-Drug", "I-Drug", "O", "O", "B-Scope", "I-Scope", "I-Scope", "O" ]
Prior receipt of investigational anti-HIV vaccine Ongoing therapy with any of the following: Systemic corticosteroids. Short course less than or equal to 21 days of corticosteroids is allowed; Systemic chemotherapeutic agents; Nephrotoxic systemic agents, including aminoglycosides, amphotericin B, cidofovir, cisplatin, foscarnet, pentamidine; Immunomodulatory treatments including Interleukin-2; Investigational agents Known allergy/sensitivity or any hypersensitivity to components of study drugs (ART) or their formulations Active drug or alcohol use or dependence that would interfere with adherence to study requirements Serious medical or psychiatric illness that would interfere with the ability to adhere to study requirements Chronic or acute hepatitis B infection Use of female hormonal products based on estrogen or derivatives
[ "Prior", "receipt", "of", "investigational", "anti", "-", "HIV", "vaccine", "\n", "Ongoing", "therapy", "with", "any", "of", "the", "following", ":", "Systemic", "corticosteroids", ".", "Short", "course", "less", "than", "or", "equal", "to", "21", "days", "of", "corticosteroids", "is", "allowed", ";", "Systemic", "chemotherapeutic", "agents", ";", "Nephrotoxic", "systemic", "agents", ",", "including", "aminoglycosides", ",", "amphotericin", "B", ",", "cidofovir", ",", "cisplatin", ",", "foscarnet", ",", "pentamidine", ";", "Immunomodulatory", "treatments", "including", "Interleukin-2", ";", "Investigational", "agents", "\n", "Known", "allergy", "/", "sensitivity", "or", "any", "hypersensitivity", "to", "components", "of", "study", "drugs", "(", "ART", ")", "or", "their", "formulations", "\n", "Active", "drug", "or", "alcohol", "use", "or", "dependence", "that", "would", "interfere", "with", "adherence", "to", "study", "requirements", "\n", "Serious", "medical", "or", "psychiatric", "illness", "that", "would", "interfere", "with", "the", "ability", "to", "adhere", "to", "study", "requirements", "\n", "Chronic", "or", "acute", "hepatitis", "B", "infection", "\n", "Use", "of", "female", "hormonal", "products", "based", "on", "estrogen", "or", "derivatives", "\n" ]
[ "Scope", "Qualifier", "Drug", "Multiplier", "Procedure", "Condition", "Negation", "Temporal" ]
Prior, investigational, anti - HIV vaccine, Ongoing, therapy, Systemic corticosteroids . Short course less than or equal to 21 days of corticosteroids is allowed ; Systemic chemotherapeutic agents ; Nephrotoxic systemic agents , including aminoglycosides , amphotericin B , cidofovir , cisplatin , foscarnet , pentamidine ; Immunomodulatory treatments including Interleukin-2 ; Investigational agents, allergy, sensitivity, hypersensitivity, components of study drugs ( ART ) or their formulations, Active, drug or alcohol use or dependence, would interfere with adherence to study requirements, Serious, medical or psychiatric illness, would interfere with the ability to adhere to study requirements, acute hepatitis B infection, female hormonal products, estrogen or derivatives
NCT01815580_exc_task2
Sentence: Prior receipt of investigational anti-HIV vaccine Ongoing therapy with any of the following: Systemic corticosteroids. Short course less than or equal to 21 days of corticosteroids is allowed; Systemic chemotherapeutic agents; Nephrotoxic systemic agents, including aminoglycosides, amphotericin B, cidofovir, cisplatin, foscarnet, pentamidine; Immunomodulatory treatments including Interleukin-2; Investigational agents Known allergy/sensitivity or any hypersensitivity to components of study drugs (ART) or their formulations Active drug or alcohol use or dependence that would interfere with adherence to study requirements Serious medical or psychiatric illness that would interfere with the ability to adhere to study requirements Chronic or acute hepatitis B infection Use of female hormonal products based on estrogen or derivatives Instructions: please extract entity words from the input sentence
[ "B-Temporal", "O", "O", "B-Qualifier", "B-Drug", "I-Drug", "I-Drug", "I-Drug", "O", "B-Temporal", "B-Procedure", "O", "O", "O", "O", "O", "O", "B-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "O", "O", "B-Condition", "O", "B-Condition", "O", "O", "B-Condition", "O", "B-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "O", "B-Temporal", "B-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "O", "B-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "O", "B-Qualifier", "B-Scope", "I-Scope", "I-Scope", "I-Scope", "O", "B-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "I-Qualifier", "O", "O", "O", "B-Condition", "I-Condition", "I-Condition", "I-Condition", "O", "O", "O", "B-Drug", "I-Drug", "I-Drug", "O", "O", "B-Scope", "I-Scope", "I-Scope", "O" ]
Prior receipt of investigational anti-HIV vaccine Ongoing therapy with any of the following: Systemic corticosteroids. Short course less than or equal to 21 days of corticosteroids is allowed; Systemic chemotherapeutic agents; Nephrotoxic systemic agents, including aminoglycosides, amphotericin B, cidofovir, cisplatin, foscarnet, pentamidine; Immunomodulatory treatments including Interleukin-2; Investigational agents Known allergy/sensitivity or any hypersensitivity to components of study drugs (ART) or their formulations Active drug or alcohol use or dependence that would interfere with adherence to study requirements Serious medical or psychiatric illness that would interfere with the ability to adhere to study requirements Chronic or acute hepatitis B infection Use of female hormonal products based on estrogen or derivatives
[ "Prior", "receipt", "of", "investigational", "anti", "-", "HIV", "vaccine", "\n", "Ongoing", "therapy", "with", "any", "of", "the", "following", ":", "Systemic", "corticosteroids", ".", "Short", "course", "less", "than", "or", "equal", "to", "21", "days", "of", "corticosteroids", "is", "allowed", ";", "Systemic", "chemotherapeutic", "agents", ";", "Nephrotoxic", "systemic", "agents", ",", "including", "aminoglycosides", ",", "amphotericin", "B", ",", "cidofovir", ",", "cisplatin", ",", "foscarnet", ",", "pentamidine", ";", "Immunomodulatory", "treatments", "including", "Interleukin-2", ";", "Investigational", "agents", "\n", "Known", "allergy", "/", "sensitivity", "or", "any", "hypersensitivity", "to", "components", "of", "study", "drugs", "(", "ART", ")", "or", "their", "formulations", "\n", "Active", "drug", "or", "alcohol", "use", "or", "dependence", "that", "would", "interfere", "with", "adherence", "to", "study", "requirements", "\n", "Serious", "medical", "or", "psychiatric", "illness", "that", "would", "interfere", "with", "the", "ability", "to", "adhere", "to", "study", "requirements", "\n", "Chronic", "or", "acute", "hepatitis", "B", "infection", "\n", "Use", "of", "female", "hormonal", "products", "based", "on", "estrogen", "or", "derivatives", "\n" ]
[ "Scope", "Qualifier", "Drug", "Multiplier", "Procedure", "Condition", "Negation", "Temporal" ]
afatinib is a Intervention_Pharmacological, cetuximab is a Intervention_Pharmacological, metastatic or recurrent squamous cell carcinoma of the head and neck is a Participant_Condition, antitumor activity is a Outcome_Physical, recurrent or metastatic ( R / M ) head and neck squamous cell carcinoma ( HNSCC ) patients is a Participant_Condition, disease has progressed after platinum - containing therapy is a Participant_Condition, 124 patients is a Participant_Sample-size, tumor shrinkage before crossover assessed by investigator is a Outcome_Other, independent central review ( ICR ) is a Outcome_Other, 121 patients is a Participant_Sample-size, 61 afatinib is a Participant_Sample-size, 60 cetuximab is a Participant_Sample-size, 68 crossed over to stage II is a Participant_Sample-size, 32 is a Participant_Sample-size, 36 is a Participant_Sample-size, mean tumor shrinkage by IR / ICR is a Outcome_Physical, Comparable disease control rates is a Outcome_Other
66140_task0
Sentence: A randomized , phase II study of afatinib versus cetuximab in metastatic or recurrent squamous cell carcinoma of the head and neck . BACKGROUND Afatinib is an oral , irreversible ErbB family blocker that has shown activity in epidermal growth factor receptor ( EGFR ) -mutated lung cancer . We hypothesized that the agent would have greater antitumor activity compared with cetuximab in recurrent or metastatic ( R/M ) head and neck squamous cell carcinoma ( HNSCC ) patients , whose disease has progressed after platinum-containing therapy . PATIENTS AND METHODS An open-label , randomized , phase II trial was conducted in 43 centers ; 124 patients were randomized ( 1 : 1 ) to either afatinib ( 50 mg/day ) or cetuximab ( 250 mg/m ( 2 ) /week ) until disease progression or intolerable adverse events ( AEs ) ( stage I ) , with optional crossover ( stage II ) . The primary end point was tumor shrinkage before crossover assessed by investigator ( IR ) and independent central review ( ICR ) . RESULTS A total of 121 patients were treated ( 61 afatinib , 60 cetuximab ) and 68 crossed over to stage II ( 32 and 36 respectively ) . In stage I , mean tumor shrinkage by IR/ICR was 10.4 % /16.6 % with afatinib and 5.4 % /10.1 % with cetuximab ( P = 0.46/0.30 ) . Objective response rate was 16.1 % /8.1 % with afatinib and 6.5 % /9.7 % with cetuximab ( IR/ICR ) . Comparable disease control rates were observed with afatinib ( 50 % ) and cetuximab ( 56.5 % ) by IR ; similar results were seen by ICR . Most common grade ≥3 drug-related AEs ( DRAEs ) were rash/acne ( 18 % versus 8.3 % ) , diarrhea ( 14.8 % versus 0 % ) , and stomatitis/mucositis ( 11.5 % versus 0 % ) with afatinib and cetuximab , respectively . Patients with DRAEs leading to treatment discontinuation were 23 % with afatinib and 5 % with cetuximab . In stage II , disease control rate ( IR/ICR ) was 38.9 % /33.3 % with afatinib and 18.8 % /18.8 % with cetuximab . CONCLUSION Afatinib showed antitumor activity comparable to cetuximab in R/M HNSCC in this exploratory phase II trial , although more patients on afatinib discontinued treatment due to AEs . Sequential EGFR/ErbB treatment with afatinib and cetuximab provided sustained clinical benefit in patients after crossover , suggesting a lack of cross-resistance . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Intervention_Pharmacological, Participant_Condition, Outcome_Physical, Participant_Sample-size, Outcome_Other
[ "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "O", "B-Intervention_Pharmacological", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "O", "B-Participant_Sample-size", "O", "B-Participant_Sample-size", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
A randomized , phase II study of afatinib versus cetuximab in metastatic or recurrent squamous cell carcinoma of the head and neck . BACKGROUND Afatinib is an oral , irreversible ErbB family blocker that has shown activity in epidermal growth factor receptor ( EGFR ) -mutated lung cancer . We hypothesized that the agent would have greater antitumor activity compared with cetuximab in recurrent or metastatic ( R/M ) head and neck squamous cell carcinoma ( HNSCC ) patients , whose disease has progressed after platinum-containing therapy . PATIENTS AND METHODS An open-label , randomized , phase II trial was conducted in 43 centers ; 124 patients were randomized ( 1 : 1 ) to either afatinib ( 50 mg/day ) or cetuximab ( 250 mg/m ( 2 ) /week ) until disease progression or intolerable adverse events ( AEs ) ( stage I ) , with optional crossover ( stage II ) . The primary end point was tumor shrinkage before crossover assessed by investigator ( IR ) and independent central review ( ICR ) . RESULTS A total of 121 patients were treated ( 61 afatinib , 60 cetuximab ) and 68 crossed over to stage II ( 32 and 36 respectively ) . In stage I , mean tumor shrinkage by IR/ICR was 10.4 % /16.6 % with afatinib and 5.4 % /10.1 % with cetuximab ( P = 0.46/0.30 ) . Objective response rate was 16.1 % /8.1 % with afatinib and 6.5 % /9.7 % with cetuximab ( IR/ICR ) . Comparable disease control rates were observed with afatinib ( 50 % ) and cetuximab ( 56.5 % ) by IR ; similar results were seen by ICR . Most common grade ≥3 drug-related AEs ( DRAEs ) were rash/acne ( 18 % versus 8.3 % ) , diarrhea ( 14.8 % versus 0 % ) , and stomatitis/mucositis ( 11.5 % versus 0 % ) with afatinib and cetuximab , respectively . Patients with DRAEs leading to treatment discontinuation were 23 % with afatinib and 5 % with cetuximab . In stage II , disease control rate ( IR/ICR ) was 38.9 % /33.3 % with afatinib and 18.8 % /18.8 % with cetuximab . CONCLUSION Afatinib showed antitumor activity comparable to cetuximab in R/M HNSCC in this exploratory phase II trial , although more patients on afatinib discontinued treatment due to AEs . Sequential EGFR/ErbB treatment with afatinib and cetuximab provided sustained clinical benefit in patients after crossover , suggesting a lack of cross-resistance .
[ "A", "randomized", ",", "phase", "II", "study", "of", "afatinib", "versus", "cetuximab", "in", "metastatic", "or", "recurrent", "squamous", "cell", "carcinoma", "of", "the", "head", "and", "neck", ".", "BACKGROUND", "Afatinib", "is", "an", "oral", ",", "irreversible", "ErbB", "family", "blocker", "that", "has", "shown", "activity", "in", "epidermal", "growth", "factor", "receptor", "(", "EGFR", ")", "-mutated", "lung", "cancer", ".", "We", "hypothesized", "that", "the", "agent", "would", "have", "greater", "antitumor", "activity", "compared", "with", "cetuximab", "in", "recurrent", "or", "metastatic", "(", "R", "/", "M", ")", "head", "and", "neck", "squamous", "cell", "carcinoma", "(", "HNSCC", ")", "patients", ",", "whose", "disease", "has", "progressed", "after", "platinum", "-", "containing", "therapy", ".", "PATIENTS", "AND", "METHODS", "An", "open", "-", "label", ",", "randomized", ",", "phase", "II", "trial", "was", "conducted", "in", "43", "centers", ";", "124", "patients", "were", "randomized", "(", "1", ":", "1", ")", "to", "either", "afatinib", "(", "50", "mg", "/", "day", ")", "or", "cetuximab", "(", "250", "mg", "/", "m", "(", "2", ")", "/week", ")", "until", "disease", "progression", "or", "intolerable", "adverse", "events", "(", "AEs", ")", "(", "stage", "I", ")", ",", "with", "optional", "crossover", "(", "stage", "II", ")", ".", "The", "primary", "end", "point", "was", "tumor", "shrinkage", "before", "crossover", "assessed", "by", "investigator", "(", "IR", ")", "and", "independent", "central", "review", "(", "ICR", ")", ".", "RESULTS", "A", "total", "of", "121", "patients", "were", "treated", "(", "61", "afatinib", ",", "60", "cetuximab", ")", "and", "68", "crossed", "over", "to", "stage", "II", "(", "32", "and", "36", "respectively", ")", ".", "In", "stage", "I", ",", "mean", "tumor", "shrinkage", "by", "IR", "/", "ICR", "was", "10.4", "%", "/16.6", "%", "with", "afatinib", "and", "5.4", "%", "/10.1", "%", "with", "cetuximab", "(", "P", "=", "0.46/0.30", ")", ".", "Objective", "response", "rate", "was", "16.1", "%", "/8.1", "%", "with", "afatinib", "and", "6.5", "%", "/9.7", "%", "with", "cetuximab", "(", "IR", "/", "ICR", ")", ".", "Comparable", "disease", "control", "rates", "were", "observed", "with", "afatinib", "(", "50", "%", ")", "and", "cetuximab", "(", "56.5", "%", ")", "by", "IR", ";", "similar", "results", "were", "seen", "by", "ICR", ".", "Most", "common", "grade", "≥3", "drug", "-", "related", "AEs", "(", "DRAEs", ")", "were", "rash", "/", "acne", "(", "18", "%", "versus", "8.3", "%", ")", ",", "diarrhea", "(", "14.8", "%", "versus", "0", "%", ")", ",", "and", "stomatitis", "/", "mucositis", "(", "11.5", "%", "versus", "0", "%", ")", "with", "afatinib", "and", "cetuximab", ",", "respectively", ".", "Patients", "with", "DRAEs", "leading", "to", "treatment", "discontinuation", "were", "23", "%", "with", "afatinib", "and", "5", "%", "with", "cetuximab", ".", "In", "stage", "II", ",", "disease", "control", "rate", "(", "IR", "/", "ICR", ")", "was", "38.9", "%", "/33.3", "%", "with", "afatinib", "and", "18.8", "%", "/18.8", "%", "with", "cetuximab", ".", "CONCLUSION", "Afatinib", "showed", "antitumor", "activity", "comparable", "to", "cetuximab", "in", "R", "/", "M", "HNSCC", "in", "this", "exploratory", "phase", "II", "trial", ",", "although", "more", "patients", "on", "afatinib", "discontinued", "treatment", "due", "to", "AEs", ".", "Sequential", "EGFR", "/", "ErbB", "treatment", "with", "afatinib", "and", "cetuximab", "provided", "sustained", "clinical", "benefit", "in", "patients", "after", "crossover", ",", "suggesting", "a", "lack", "of", "cross", "-", "resistance", "." ]
[ "Participant_Condition", "Outcome_Other", "Outcome_Physical", "Participant_Sample-size", "Intervention_Pharmacological" ]
afatinib is a Intervention_Pharmacological, cetuximab is a Intervention_Pharmacological, metastatic or recurrent squamous cell carcinoma of the head and neck is a Participant_Condition, antitumor activity is a Outcome_Physical, recurrent or metastatic ( R / M ) head and neck squamous cell carcinoma ( HNSCC ) patients is a Participant_Condition, disease has progressed after platinum - containing therapy is a Participant_Condition, 124 patients is a Participant_Sample-size, tumor shrinkage before crossover assessed by investigator is a Outcome_Other, independent central review ( ICR ) is a Outcome_Other, 121 patients is a Participant_Sample-size, 61 afatinib is a Participant_Sample-size, 60 cetuximab is a Participant_Sample-size, 68 crossed over to stage II is a Participant_Sample-size, 32 is a Participant_Sample-size, 36 is a Participant_Sample-size, mean tumor shrinkage by IR / ICR is a Outcome_Physical, Comparable disease control rates is a Outcome_Other
66140_task1
Sentence: A randomized , phase II study of afatinib versus cetuximab in metastatic or recurrent squamous cell carcinoma of the head and neck . BACKGROUND Afatinib is an oral , irreversible ErbB family blocker that has shown activity in epidermal growth factor receptor ( EGFR ) -mutated lung cancer . We hypothesized that the agent would have greater antitumor activity compared with cetuximab in recurrent or metastatic ( R/M ) head and neck squamous cell carcinoma ( HNSCC ) patients , whose disease has progressed after platinum-containing therapy . PATIENTS AND METHODS An open-label , randomized , phase II trial was conducted in 43 centers ; 124 patients were randomized ( 1 : 1 ) to either afatinib ( 50 mg/day ) or cetuximab ( 250 mg/m ( 2 ) /week ) until disease progression or intolerable adverse events ( AEs ) ( stage I ) , with optional crossover ( stage II ) . The primary end point was tumor shrinkage before crossover assessed by investigator ( IR ) and independent central review ( ICR ) . RESULTS A total of 121 patients were treated ( 61 afatinib , 60 cetuximab ) and 68 crossed over to stage II ( 32 and 36 respectively ) . In stage I , mean tumor shrinkage by IR/ICR was 10.4 % /16.6 % with afatinib and 5.4 % /10.1 % with cetuximab ( P = 0.46/0.30 ) . Objective response rate was 16.1 % /8.1 % with afatinib and 6.5 % /9.7 % with cetuximab ( IR/ICR ) . Comparable disease control rates were observed with afatinib ( 50 % ) and cetuximab ( 56.5 % ) by IR ; similar results were seen by ICR . Most common grade ≥3 drug-related AEs ( DRAEs ) were rash/acne ( 18 % versus 8.3 % ) , diarrhea ( 14.8 % versus 0 % ) , and stomatitis/mucositis ( 11.5 % versus 0 % ) with afatinib and cetuximab , respectively . Patients with DRAEs leading to treatment discontinuation were 23 % with afatinib and 5 % with cetuximab . In stage II , disease control rate ( IR/ICR ) was 38.9 % /33.3 % with afatinib and 18.8 % /18.8 % with cetuximab . CONCLUSION Afatinib showed antitumor activity comparable to cetuximab in R/M HNSCC in this exploratory phase II trial , although more patients on afatinib discontinued treatment due to AEs . Sequential EGFR/ErbB treatment with afatinib and cetuximab provided sustained clinical benefit in patients after crossover , suggesting a lack of cross-resistance . Instructions: please typing these entity words according to sentence: afatinib, cetuximab, metastatic or recurrent squamous cell carcinoma of the head and neck, antitumor activity, recurrent or metastatic ( R / M ) head and neck squamous cell carcinoma ( HNSCC ) patients, disease has progressed after platinum - containing therapy, 124 patients, tumor shrinkage before crossover assessed by investigator, independent central review ( ICR ), 121 patients, 61 afatinib, 60 cetuximab, 68 crossed over to stage II, 32, 36, mean tumor shrinkage by IR / ICR, Comparable disease control rates Options: Intervention_Pharmacological, Participant_Condition, Outcome_Physical, Participant_Sample-size, Outcome_Other
[ "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "O", "B-Intervention_Pharmacological", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "O", "B-Participant_Sample-size", "O", "B-Participant_Sample-size", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
A randomized , phase II study of afatinib versus cetuximab in metastatic or recurrent squamous cell carcinoma of the head and neck . BACKGROUND Afatinib is an oral , irreversible ErbB family blocker that has shown activity in epidermal growth factor receptor ( EGFR ) -mutated lung cancer . We hypothesized that the agent would have greater antitumor activity compared with cetuximab in recurrent or metastatic ( R/M ) head and neck squamous cell carcinoma ( HNSCC ) patients , whose disease has progressed after platinum-containing therapy . PATIENTS AND METHODS An open-label , randomized , phase II trial was conducted in 43 centers ; 124 patients were randomized ( 1 : 1 ) to either afatinib ( 50 mg/day ) or cetuximab ( 250 mg/m ( 2 ) /week ) until disease progression or intolerable adverse events ( AEs ) ( stage I ) , with optional crossover ( stage II ) . The primary end point was tumor shrinkage before crossover assessed by investigator ( IR ) and independent central review ( ICR ) . RESULTS A total of 121 patients were treated ( 61 afatinib , 60 cetuximab ) and 68 crossed over to stage II ( 32 and 36 respectively ) . In stage I , mean tumor shrinkage by IR/ICR was 10.4 % /16.6 % with afatinib and 5.4 % /10.1 % with cetuximab ( P = 0.46/0.30 ) . Objective response rate was 16.1 % /8.1 % with afatinib and 6.5 % /9.7 % with cetuximab ( IR/ICR ) . Comparable disease control rates were observed with afatinib ( 50 % ) and cetuximab ( 56.5 % ) by IR ; similar results were seen by ICR . Most common grade ≥3 drug-related AEs ( DRAEs ) were rash/acne ( 18 % versus 8.3 % ) , diarrhea ( 14.8 % versus 0 % ) , and stomatitis/mucositis ( 11.5 % versus 0 % ) with afatinib and cetuximab , respectively . Patients with DRAEs leading to treatment discontinuation were 23 % with afatinib and 5 % with cetuximab . In stage II , disease control rate ( IR/ICR ) was 38.9 % /33.3 % with afatinib and 18.8 % /18.8 % with cetuximab . CONCLUSION Afatinib showed antitumor activity comparable to cetuximab in R/M HNSCC in this exploratory phase II trial , although more patients on afatinib discontinued treatment due to AEs . Sequential EGFR/ErbB treatment with afatinib and cetuximab provided sustained clinical benefit in patients after crossover , suggesting a lack of cross-resistance .
[ "A", "randomized", ",", "phase", "II", "study", "of", "afatinib", "versus", "cetuximab", "in", "metastatic", "or", "recurrent", "squamous", "cell", "carcinoma", "of", "the", "head", "and", "neck", ".", "BACKGROUND", "Afatinib", "is", "an", "oral", ",", "irreversible", "ErbB", "family", "blocker", "that", "has", "shown", "activity", "in", "epidermal", "growth", "factor", "receptor", "(", "EGFR", ")", "-mutated", "lung", "cancer", ".", "We", "hypothesized", "that", "the", "agent", "would", "have", "greater", "antitumor", "activity", "compared", "with", "cetuximab", "in", "recurrent", "or", "metastatic", "(", "R", "/", "M", ")", "head", "and", "neck", "squamous", "cell", "carcinoma", "(", "HNSCC", ")", "patients", ",", "whose", "disease", "has", "progressed", "after", "platinum", "-", "containing", "therapy", ".", "PATIENTS", "AND", "METHODS", "An", "open", "-", "label", ",", "randomized", ",", "phase", "II", "trial", "was", "conducted", "in", "43", "centers", ";", "124", "patients", "were", "randomized", "(", "1", ":", "1", ")", "to", "either", "afatinib", "(", "50", "mg", "/", "day", ")", "or", "cetuximab", "(", "250", "mg", "/", "m", "(", "2", ")", "/week", ")", "until", "disease", "progression", "or", "intolerable", "adverse", "events", "(", "AEs", ")", "(", "stage", "I", ")", ",", "with", "optional", "crossover", "(", "stage", "II", ")", ".", "The", "primary", "end", "point", "was", "tumor", "shrinkage", "before", "crossover", "assessed", "by", "investigator", "(", "IR", ")", "and", "independent", "central", "review", "(", "ICR", ")", ".", "RESULTS", "A", "total", "of", "121", "patients", "were", "treated", "(", "61", "afatinib", ",", "60", "cetuximab", ")", "and", "68", "crossed", "over", "to", "stage", "II", "(", "32", "and", "36", "respectively", ")", ".", "In", "stage", "I", ",", "mean", "tumor", "shrinkage", "by", "IR", "/", "ICR", "was", "10.4", "%", "/16.6", "%", "with", "afatinib", "and", "5.4", "%", "/10.1", "%", "with", "cetuximab", "(", "P", "=", "0.46/0.30", ")", ".", "Objective", "response", "rate", "was", "16.1", "%", "/8.1", "%", "with", "afatinib", "and", "6.5", "%", "/9.7", "%", "with", "cetuximab", "(", "IR", "/", "ICR", ")", ".", "Comparable", "disease", "control", "rates", "were", "observed", "with", "afatinib", "(", "50", "%", ")", "and", "cetuximab", "(", "56.5", "%", ")", "by", "IR", ";", "similar", "results", "were", "seen", "by", "ICR", ".", "Most", "common", "grade", "≥3", "drug", "-", "related", "AEs", "(", "DRAEs", ")", "were", "rash", "/", "acne", "(", "18", "%", "versus", "8.3", "%", ")", ",", "diarrhea", "(", "14.8", "%", "versus", "0", "%", ")", ",", "and", "stomatitis", "/", "mucositis", "(", "11.5", "%", "versus", "0", "%", ")", "with", "afatinib", "and", "cetuximab", ",", "respectively", ".", "Patients", "with", "DRAEs", "leading", "to", "treatment", "discontinuation", "were", "23", "%", "with", "afatinib", "and", "5", "%", "with", "cetuximab", ".", "In", "stage", "II", ",", "disease", "control", "rate", "(", "IR", "/", "ICR", ")", "was", "38.9", "%", "/33.3", "%", "with", "afatinib", "and", "18.8", "%", "/18.8", "%", "with", "cetuximab", ".", "CONCLUSION", "Afatinib", "showed", "antitumor", "activity", "comparable", "to", "cetuximab", "in", "R", "/", "M", "HNSCC", "in", "this", "exploratory", "phase", "II", "trial", ",", "although", "more", "patients", "on", "afatinib", "discontinued", "treatment", "due", "to", "AEs", ".", "Sequential", "EGFR", "/", "ErbB", "treatment", "with", "afatinib", "and", "cetuximab", "provided", "sustained", "clinical", "benefit", "in", "patients", "after", "crossover", ",", "suggesting", "a", "lack", "of", "cross", "-", "resistance", "." ]
[ "Participant_Condition", "Outcome_Other", "Outcome_Physical", "Participant_Sample-size", "Intervention_Pharmacological" ]
afatinib, cetuximab, metastatic or recurrent squamous cell carcinoma of the head and neck, antitumor activity, recurrent or metastatic ( R / M ) head and neck squamous cell carcinoma ( HNSCC ) patients, disease has progressed after platinum - containing therapy, 124 patients, tumor shrinkage before crossover assessed by investigator, independent central review ( ICR ), 121 patients, 61 afatinib, 60 cetuximab, 68 crossed over to stage II, 32, 36, mean tumor shrinkage by IR / ICR, Comparable disease control rates
66140_task2
Sentence: A randomized , phase II study of afatinib versus cetuximab in metastatic or recurrent squamous cell carcinoma of the head and neck . BACKGROUND Afatinib is an oral , irreversible ErbB family blocker that has shown activity in epidermal growth factor receptor ( EGFR ) -mutated lung cancer . We hypothesized that the agent would have greater antitumor activity compared with cetuximab in recurrent or metastatic ( R/M ) head and neck squamous cell carcinoma ( HNSCC ) patients , whose disease has progressed after platinum-containing therapy . PATIENTS AND METHODS An open-label , randomized , phase II trial was conducted in 43 centers ; 124 patients were randomized ( 1 : 1 ) to either afatinib ( 50 mg/day ) or cetuximab ( 250 mg/m ( 2 ) /week ) until disease progression or intolerable adverse events ( AEs ) ( stage I ) , with optional crossover ( stage II ) . The primary end point was tumor shrinkage before crossover assessed by investigator ( IR ) and independent central review ( ICR ) . RESULTS A total of 121 patients were treated ( 61 afatinib , 60 cetuximab ) and 68 crossed over to stage II ( 32 and 36 respectively ) . In stage I , mean tumor shrinkage by IR/ICR was 10.4 % /16.6 % with afatinib and 5.4 % /10.1 % with cetuximab ( P = 0.46/0.30 ) . Objective response rate was 16.1 % /8.1 % with afatinib and 6.5 % /9.7 % with cetuximab ( IR/ICR ) . Comparable disease control rates were observed with afatinib ( 50 % ) and cetuximab ( 56.5 % ) by IR ; similar results were seen by ICR . Most common grade ≥3 drug-related AEs ( DRAEs ) were rash/acne ( 18 % versus 8.3 % ) , diarrhea ( 14.8 % versus 0 % ) , and stomatitis/mucositis ( 11.5 % versus 0 % ) with afatinib and cetuximab , respectively . Patients with DRAEs leading to treatment discontinuation were 23 % with afatinib and 5 % with cetuximab . In stage II , disease control rate ( IR/ICR ) was 38.9 % /33.3 % with afatinib and 18.8 % /18.8 % with cetuximab . CONCLUSION Afatinib showed antitumor activity comparable to cetuximab in R/M HNSCC in this exploratory phase II trial , although more patients on afatinib discontinued treatment due to AEs . Sequential EGFR/ErbB treatment with afatinib and cetuximab provided sustained clinical benefit in patients after crossover , suggesting a lack of cross-resistance . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "O", "B-Intervention_Pharmacological", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "B-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "I-Participant_Condition", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "O", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "O", "O", "B-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "I-Participant_Sample-size", "O", "B-Participant_Sample-size", "O", "B-Participant_Sample-size", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "I-Outcome_Other", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
A randomized , phase II study of afatinib versus cetuximab in metastatic or recurrent squamous cell carcinoma of the head and neck . BACKGROUND Afatinib is an oral , irreversible ErbB family blocker that has shown activity in epidermal growth factor receptor ( EGFR ) -mutated lung cancer . We hypothesized that the agent would have greater antitumor activity compared with cetuximab in recurrent or metastatic ( R/M ) head and neck squamous cell carcinoma ( HNSCC ) patients , whose disease has progressed after platinum-containing therapy . PATIENTS AND METHODS An open-label , randomized , phase II trial was conducted in 43 centers ; 124 patients were randomized ( 1 : 1 ) to either afatinib ( 50 mg/day ) or cetuximab ( 250 mg/m ( 2 ) /week ) until disease progression or intolerable adverse events ( AEs ) ( stage I ) , with optional crossover ( stage II ) . The primary end point was tumor shrinkage before crossover assessed by investigator ( IR ) and independent central review ( ICR ) . RESULTS A total of 121 patients were treated ( 61 afatinib , 60 cetuximab ) and 68 crossed over to stage II ( 32 and 36 respectively ) . In stage I , mean tumor shrinkage by IR/ICR was 10.4 % /16.6 % with afatinib and 5.4 % /10.1 % with cetuximab ( P = 0.46/0.30 ) . Objective response rate was 16.1 % /8.1 % with afatinib and 6.5 % /9.7 % with cetuximab ( IR/ICR ) . Comparable disease control rates were observed with afatinib ( 50 % ) and cetuximab ( 56.5 % ) by IR ; similar results were seen by ICR . Most common grade ≥3 drug-related AEs ( DRAEs ) were rash/acne ( 18 % versus 8.3 % ) , diarrhea ( 14.8 % versus 0 % ) , and stomatitis/mucositis ( 11.5 % versus 0 % ) with afatinib and cetuximab , respectively . Patients with DRAEs leading to treatment discontinuation were 23 % with afatinib and 5 % with cetuximab . In stage II , disease control rate ( IR/ICR ) was 38.9 % /33.3 % with afatinib and 18.8 % /18.8 % with cetuximab . CONCLUSION Afatinib showed antitumor activity comparable to cetuximab in R/M HNSCC in this exploratory phase II trial , although more patients on afatinib discontinued treatment due to AEs . Sequential EGFR/ErbB treatment with afatinib and cetuximab provided sustained clinical benefit in patients after crossover , suggesting a lack of cross-resistance .
[ "A", "randomized", ",", "phase", "II", "study", "of", "afatinib", "versus", "cetuximab", "in", "metastatic", "or", "recurrent", "squamous", "cell", "carcinoma", "of", "the", "head", "and", "neck", ".", "BACKGROUND", "Afatinib", "is", "an", "oral", ",", "irreversible", "ErbB", "family", "blocker", "that", "has", "shown", "activity", "in", "epidermal", "growth", "factor", "receptor", "(", "EGFR", ")", "-mutated", "lung", "cancer", ".", "We", "hypothesized", "that", "the", "agent", "would", "have", "greater", "antitumor", "activity", "compared", "with", "cetuximab", "in", "recurrent", "or", "metastatic", "(", "R", "/", "M", ")", "head", "and", "neck", "squamous", "cell", "carcinoma", "(", "HNSCC", ")", "patients", ",", "whose", "disease", "has", "progressed", "after", "platinum", "-", "containing", "therapy", ".", "PATIENTS", "AND", "METHODS", "An", "open", "-", "label", ",", "randomized", ",", "phase", "II", "trial", "was", "conducted", "in", "43", "centers", ";", "124", "patients", "were", "randomized", "(", "1", ":", "1", ")", "to", "either", "afatinib", "(", "50", "mg", "/", "day", ")", "or", "cetuximab", "(", "250", "mg", "/", "m", "(", "2", ")", "/week", ")", "until", "disease", "progression", "or", "intolerable", "adverse", "events", "(", "AEs", ")", "(", "stage", "I", ")", ",", "with", "optional", "crossover", "(", "stage", "II", ")", ".", "The", "primary", "end", "point", "was", "tumor", "shrinkage", "before", "crossover", "assessed", "by", "investigator", "(", "IR", ")", "and", "independent", "central", "review", "(", "ICR", ")", ".", "RESULTS", "A", "total", "of", "121", "patients", "were", "treated", "(", "61", "afatinib", ",", "60", "cetuximab", ")", "and", "68", "crossed", "over", "to", "stage", "II", "(", "32", "and", "36", "respectively", ")", ".", "In", "stage", "I", ",", "mean", "tumor", "shrinkage", "by", "IR", "/", "ICR", "was", "10.4", "%", "/16.6", "%", "with", "afatinib", "and", "5.4", "%", "/10.1", "%", "with", "cetuximab", "(", "P", "=", "0.46/0.30", ")", ".", "Objective", "response", "rate", "was", "16.1", "%", "/8.1", "%", "with", "afatinib", "and", "6.5", "%", "/9.7", "%", "with", "cetuximab", "(", "IR", "/", "ICR", ")", ".", "Comparable", "disease", "control", "rates", "were", "observed", "with", "afatinib", "(", "50", "%", ")", "and", "cetuximab", "(", "56.5", "%", ")", "by", "IR", ";", "similar", "results", "were", "seen", "by", "ICR", ".", "Most", "common", "grade", "≥3", "drug", "-", "related", "AEs", "(", "DRAEs", ")", "were", "rash", "/", "acne", "(", "18", "%", "versus", "8.3", "%", ")", ",", "diarrhea", "(", "14.8", "%", "versus", "0", "%", ")", ",", "and", "stomatitis", "/", "mucositis", "(", "11.5", "%", "versus", "0", "%", ")", "with", "afatinib", "and", "cetuximab", ",", "respectively", ".", "Patients", "with", "DRAEs", "leading", "to", "treatment", "discontinuation", "were", "23", "%", "with", "afatinib", "and", "5", "%", "with", "cetuximab", ".", "In", "stage", "II", ",", "disease", "control", "rate", "(", "IR", "/", "ICR", ")", "was", "38.9", "%", "/33.3", "%", "with", "afatinib", "and", "18.8", "%", "/18.8", "%", "with", "cetuximab", ".", "CONCLUSION", "Afatinib", "showed", "antitumor", "activity", "comparable", "to", "cetuximab", "in", "R", "/", "M", "HNSCC", "in", "this", "exploratory", "phase", "II", "trial", ",", "although", "more", "patients", "on", "afatinib", "discontinued", "treatment", "due", "to", "AEs", ".", "Sequential", "EGFR", "/", "ErbB", "treatment", "with", "afatinib", "and", "cetuximab", "provided", "sustained", "clinical", "benefit", "in", "patients", "after", "crossover", ",", "suggesting", "a", "lack", "of", "cross", "-", "resistance", "." ]
[ "Participant_Condition", "Outcome_Other", "Outcome_Physical", "Participant_Sample-size", "Intervention_Pharmacological" ]
kinesin is a protein-family, MTs is an organelle, LC is a protein-domain, HC is a protein-domain
1.0alpha7.train.1334_task0
Sentence: However, an inhibition of kinesin's binding to MTs has not been directly demonstrated, a correlation of the folded conformation with the inhibited state has not been established, and the LC and HC domains responsible for the postulated inhibition have not been identified. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: protein-domain, protein-family, organelle
[ "O", "O", "O", "O", "O", "B-protein-family", "O", "O", "O", "B-organelle", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein-domain", "O", "B-protein-domain", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
However, an inhibition of kinesin's binding to MTs has not been directly demonstrated, a correlation of the folded conformation with the inhibited state has not been established, and the LC and HC domains responsible for the postulated inhibition have not been identified.
[ "However", ",", "an", "inhibition", "of", "kinesin", "'s", "binding", "to", "MTs", "has", "not", "been", "directly", "demonstrated", ",", "a", "correlation", "of", "the", "folded", "conformation", "with", "the", "inhibited", "state", "has", "not", "been", "established", ",", "and", "the", "LC", "and", "HC", "domains", "responsible", "for", "the", "postulated", "inhibition", "have", "not", "been", "identified", "." ]
[ "protein-family", "organelle", "protein-domain" ]
kinesin is a protein-family, MTs is an organelle, LC is a protein-domain, HC is a protein-domain
1.0alpha7.train.1334_task1
Sentence: However, an inhibition of kinesin's binding to MTs has not been directly demonstrated, a correlation of the folded conformation with the inhibited state has not been established, and the LC and HC domains responsible for the postulated inhibition have not been identified. Instructions: please typing these entity words according to sentence: kinesin, MTs, LC, HC Options: protein-domain, protein-family, organelle
[ "O", "O", "O", "O", "O", "B-protein-family", "O", "O", "O", "B-organelle", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein-domain", "O", "B-protein-domain", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
However, an inhibition of kinesin's binding to MTs has not been directly demonstrated, a correlation of the folded conformation with the inhibited state has not been established, and the LC and HC domains responsible for the postulated inhibition have not been identified.
[ "However", ",", "an", "inhibition", "of", "kinesin", "'s", "binding", "to", "MTs", "has", "not", "been", "directly", "demonstrated", ",", "a", "correlation", "of", "the", "folded", "conformation", "with", "the", "inhibited", "state", "has", "not", "been", "established", ",", "and", "the", "LC", "and", "HC", "domains", "responsible", "for", "the", "postulated", "inhibition", "have", "not", "been", "identified", "." ]
[ "protein-family", "organelle", "protein-domain" ]
kinesin, MTs, LC, HC
1.0alpha7.train.1334_task2
Sentence: However, an inhibition of kinesin's binding to MTs has not been directly demonstrated, a correlation of the folded conformation with the inhibited state has not been established, and the LC and HC domains responsible for the postulated inhibition have not been identified. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "B-protein-family", "O", "O", "O", "B-organelle", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-protein-domain", "O", "B-protein-domain", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
However, an inhibition of kinesin's binding to MTs has not been directly demonstrated, a correlation of the folded conformation with the inhibited state has not been established, and the LC and HC domains responsible for the postulated inhibition have not been identified.
[ "However", ",", "an", "inhibition", "of", "kinesin", "'s", "binding", "to", "MTs", "has", "not", "been", "directly", "demonstrated", ",", "a", "correlation", "of", "the", "folded", "conformation", "with", "the", "inhibited", "state", "has", "not", "been", "established", ",", "and", "the", "LC", "and", "HC", "domains", "responsible", "for", "the", "postulated", "inhibition", "have", "not", "been", "identified", "." ]
[ "protein-family", "organelle", "protein-domain" ]
Patienten is an umlsterm, Biopsie is an umlsterm, Hirnangiographie is an umlsterm, Tumor is an umlsterm, Biopsie is an umlsterm
DerRadiologe.60360867.ger.abstr_task0
Sentence: 21 Patienten wurden in Zusammenhang mit einer stereotaktischen Biopsie CT-angiographisch untersucht . Dazu wurde eine Duennschicht-Spiral-CT mit einer Kollimatorschichtdicke von 1 mm ( Tischvorschub 1 : 1 ) durchgefuehrt . Es wurden multiplanare Rekonstruktionen sowie mit semiautomatischen Verfahren Maximumintensitaetsprojektionen ( MIP ) und 3D-Oberflaechendarstellungen ( SSD ) angefertigt . Die Darstellung der zerebralen Gefaesse war so detailreich , dass in allen Faellen auf eine konventionelle Hirnangiographie verzichtet werden konnte . Zusaetzlich ergaben sich wertvolle Informationen ueber Lokalisation und Ausdehnung der Laesionen sowie ueber die Beziehungen zwischen Tumor und Gefaessen . In der Kontroll-CT nach der Biopsie fanden sich in keinem Fall Blutungskomplikationen . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O" ]
21 Patienten wurden in Zusammenhang mit einer stereotaktischen Biopsie CT-angiographisch untersucht . Dazu wurde eine Duennschicht-Spiral-CT mit einer Kollimatorschichtdicke von 1 mm ( Tischvorschub 1 : 1 ) durchgefuehrt . Es wurden multiplanare Rekonstruktionen sowie mit semiautomatischen Verfahren Maximumintensitaetsprojektionen ( MIP ) und 3D-Oberflaechendarstellungen ( SSD ) angefertigt . Die Darstellung der zerebralen Gefaesse war so detailreich , dass in allen Faellen auf eine konventionelle Hirnangiographie verzichtet werden konnte . Zusaetzlich ergaben sich wertvolle Informationen ueber Lokalisation und Ausdehnung der Laesionen sowie ueber die Beziehungen zwischen Tumor und Gefaessen . In der Kontroll-CT nach der Biopsie fanden sich in keinem Fall Blutungskomplikationen .
[ "21", "Patienten", "wurden", "in", "Zusammenhang", "mit", "einer", "stereotaktischen", "Biopsie", "CT", "-", "angiographisch", "untersucht", ".", "Dazu", "wurde", "eine", "Duennschicht", "-", "Spiral", "-", "CT", "mit", "einer", "Kollimatorschichtdicke", "von", "1", "mm", "(", "Tischvorschub", "1", ":", "1", ")", "durchgefuehrt", ".", "Es", "wurden", "multiplanare", "Rekonstruktionen", "sowie", "mit", "semiautomatischen", "Verfahren", "Maximumintensitaetsprojektionen", "(", "MIP", ")", "und", "3D", "-", "Oberflaechendarstellungen", "(", "SSD", ")", "angefertigt", ".", "Die", "Darstellung", "der", "zerebralen", "Gefaesse", "war", "so", "detailreich", ",", "dass", "in", "allen", "Faellen", "auf", "eine", "konventionelle", "Hirnangiographie", "verzichtet", "werden", "konnte", ".", "Zusaetzlich", "ergaben", "sich", "wertvolle", "Informationen", "ueber", "Lokalisation", "und", "Ausdehnung", "der", "Laesionen", "sowie", "ueber", "die", "Beziehungen", "zwischen", "Tumor", "und", "Gefaessen", ".", "In", "der", "Kontroll", "-", "CT", "nach", "der", "Biopsie", "fanden", "sich", "in", "keinem", "Fall", "Blutungskomplikationen", "." ]
[ "umlsterm" ]
Patienten is an umlsterm, Biopsie is an umlsterm, Hirnangiographie is an umlsterm, Tumor is an umlsterm, Biopsie is an umlsterm
DerRadiologe.60360867.ger.abstr_task1
Sentence: 21 Patienten wurden in Zusammenhang mit einer stereotaktischen Biopsie CT-angiographisch untersucht . Dazu wurde eine Duennschicht-Spiral-CT mit einer Kollimatorschichtdicke von 1 mm ( Tischvorschub 1 : 1 ) durchgefuehrt . Es wurden multiplanare Rekonstruktionen sowie mit semiautomatischen Verfahren Maximumintensitaetsprojektionen ( MIP ) und 3D-Oberflaechendarstellungen ( SSD ) angefertigt . Die Darstellung der zerebralen Gefaesse war so detailreich , dass in allen Faellen auf eine konventionelle Hirnangiographie verzichtet werden konnte . Zusaetzlich ergaben sich wertvolle Informationen ueber Lokalisation und Ausdehnung der Laesionen sowie ueber die Beziehungen zwischen Tumor und Gefaessen . In der Kontroll-CT nach der Biopsie fanden sich in keinem Fall Blutungskomplikationen . Instructions: please typing these entity words according to sentence: Patienten, Biopsie, Hirnangiographie, Tumor, Biopsie Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O" ]
21 Patienten wurden in Zusammenhang mit einer stereotaktischen Biopsie CT-angiographisch untersucht . Dazu wurde eine Duennschicht-Spiral-CT mit einer Kollimatorschichtdicke von 1 mm ( Tischvorschub 1 : 1 ) durchgefuehrt . Es wurden multiplanare Rekonstruktionen sowie mit semiautomatischen Verfahren Maximumintensitaetsprojektionen ( MIP ) und 3D-Oberflaechendarstellungen ( SSD ) angefertigt . Die Darstellung der zerebralen Gefaesse war so detailreich , dass in allen Faellen auf eine konventionelle Hirnangiographie verzichtet werden konnte . Zusaetzlich ergaben sich wertvolle Informationen ueber Lokalisation und Ausdehnung der Laesionen sowie ueber die Beziehungen zwischen Tumor und Gefaessen . In der Kontroll-CT nach der Biopsie fanden sich in keinem Fall Blutungskomplikationen .
[ "21", "Patienten", "wurden", "in", "Zusammenhang", "mit", "einer", "stereotaktischen", "Biopsie", "CT", "-", "angiographisch", "untersucht", ".", "Dazu", "wurde", "eine", "Duennschicht", "-", "Spiral", "-", "CT", "mit", "einer", "Kollimatorschichtdicke", "von", "1", "mm", "(", "Tischvorschub", "1", ":", "1", ")", "durchgefuehrt", ".", "Es", "wurden", "multiplanare", "Rekonstruktionen", "sowie", "mit", "semiautomatischen", "Verfahren", "Maximumintensitaetsprojektionen", "(", "MIP", ")", "und", "3D", "-", "Oberflaechendarstellungen", "(", "SSD", ")", "angefertigt", ".", "Die", "Darstellung", "der", "zerebralen", "Gefaesse", "war", "so", "detailreich", ",", "dass", "in", "allen", "Faellen", "auf", "eine", "konventionelle", "Hirnangiographie", "verzichtet", "werden", "konnte", ".", "Zusaetzlich", "ergaben", "sich", "wertvolle", "Informationen", "ueber", "Lokalisation", "und", "Ausdehnung", "der", "Laesionen", "sowie", "ueber", "die", "Beziehungen", "zwischen", "Tumor", "und", "Gefaessen", ".", "In", "der", "Kontroll", "-", "CT", "nach", "der", "Biopsie", "fanden", "sich", "in", "keinem", "Fall", "Blutungskomplikationen", "." ]
[ "umlsterm" ]
Patienten, Biopsie, Hirnangiographie, Tumor, Biopsie
DerRadiologe.60360867.ger.abstr_task2
Sentence: 21 Patienten wurden in Zusammenhang mit einer stereotaktischen Biopsie CT-angiographisch untersucht . Dazu wurde eine Duennschicht-Spiral-CT mit einer Kollimatorschichtdicke von 1 mm ( Tischvorschub 1 : 1 ) durchgefuehrt . Es wurden multiplanare Rekonstruktionen sowie mit semiautomatischen Verfahren Maximumintensitaetsprojektionen ( MIP ) und 3D-Oberflaechendarstellungen ( SSD ) angefertigt . Die Darstellung der zerebralen Gefaesse war so detailreich , dass in allen Faellen auf eine konventionelle Hirnangiographie verzichtet werden konnte . Zusaetzlich ergaben sich wertvolle Informationen ueber Lokalisation und Ausdehnung der Laesionen sowie ueber die Beziehungen zwischen Tumor und Gefaessen . In der Kontroll-CT nach der Biopsie fanden sich in keinem Fall Blutungskomplikationen . Instructions: please extract entity words from the input sentence
[ "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O" ]
21 Patienten wurden in Zusammenhang mit einer stereotaktischen Biopsie CT-angiographisch untersucht . Dazu wurde eine Duennschicht-Spiral-CT mit einer Kollimatorschichtdicke von 1 mm ( Tischvorschub 1 : 1 ) durchgefuehrt . Es wurden multiplanare Rekonstruktionen sowie mit semiautomatischen Verfahren Maximumintensitaetsprojektionen ( MIP ) und 3D-Oberflaechendarstellungen ( SSD ) angefertigt . Die Darstellung der zerebralen Gefaesse war so detailreich , dass in allen Faellen auf eine konventionelle Hirnangiographie verzichtet werden konnte . Zusaetzlich ergaben sich wertvolle Informationen ueber Lokalisation und Ausdehnung der Laesionen sowie ueber die Beziehungen zwischen Tumor und Gefaessen . In der Kontroll-CT nach der Biopsie fanden sich in keinem Fall Blutungskomplikationen .
[ "21", "Patienten", "wurden", "in", "Zusammenhang", "mit", "einer", "stereotaktischen", "Biopsie", "CT", "-", "angiographisch", "untersucht", ".", "Dazu", "wurde", "eine", "Duennschicht", "-", "Spiral", "-", "CT", "mit", "einer", "Kollimatorschichtdicke", "von", "1", "mm", "(", "Tischvorschub", "1", ":", "1", ")", "durchgefuehrt", ".", "Es", "wurden", "multiplanare", "Rekonstruktionen", "sowie", "mit", "semiautomatischen", "Verfahren", "Maximumintensitaetsprojektionen", "(", "MIP", ")", "und", "3D", "-", "Oberflaechendarstellungen", "(", "SSD", ")", "angefertigt", ".", "Die", "Darstellung", "der", "zerebralen", "Gefaesse", "war", "so", "detailreich", ",", "dass", "in", "allen", "Faellen", "auf", "eine", "konventionelle", "Hirnangiographie", "verzichtet", "werden", "konnte", ".", "Zusaetzlich", "ergaben", "sich", "wertvolle", "Informationen", "ueber", "Lokalisation", "und", "Ausdehnung", "der", "Laesionen", "sowie", "ueber", "die", "Beziehungen", "zwischen", "Tumor", "und", "Gefaessen", ".", "In", "der", "Kontroll", "-", "CT", "nach", "der", "Biopsie", "fanden", "sich", "in", "keinem", "Fall", "Blutungskomplikationen", "." ]
[ "umlsterm" ]
Germany is an umlsterm, propofol is an umlsterm, multicentre study is an umlsterm, Bias is an umlsterm, blood is an umlsterm, concentrations is an umlsterm, propofol is an umlsterm, patients is an umlsterm, propofol is an umlsterm, device is an umlsterm
DerAnaesthesist.80470663.eng.abstr_task0
Sentence: In Germany a TCI-system for propofol ( Disoprifusor-TCI ) has been commercially available since spring 1997. We investigated the prediction error and precision of this TCI system as part of a multicentre study . Bias , precision , blood concentrations and dosage of propofol were compared with patients receiving propofol via a manually controlled infusion device . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O" ]
In Germany a TCI-system for propofol ( Disoprifusor-TCI ) has been commercially available since spring 1997. We investigated the prediction error and precision of this TCI system as part of a multicentre study . Bias , precision , blood concentrations and dosage of propofol were compared with patients receiving propofol via a manually controlled infusion device .
[ "In", "Germany", "a", "TCI", "-", "system", "for", "propofol", "(", "Disoprifusor", "-", "TCI", ")", "has", "been", "commercially", "available", "since", "spring", "1997", ".", "We", "investigated", "the", "prediction", "error", "and", "precision", "of", "this", "TCI", "system", "as", "part", "of", "a", "multicentre", "study", ".", "Bias", ",", "precision", ",", "blood", "concentrations", "and", "dosage", "of", "propofol", "were", "compared", "with", "patients", "receiving", "propofol", "via", "a", "manually", "controlled", "infusion", "device", "." ]
[ "umlsterm" ]
Germany is an umlsterm, propofol is an umlsterm, multicentre study is an umlsterm, Bias is an umlsterm, blood is an umlsterm, concentrations is an umlsterm, propofol is an umlsterm, patients is an umlsterm, propofol is an umlsterm, device is an umlsterm
DerAnaesthesist.80470663.eng.abstr_task1
Sentence: In Germany a TCI-system for propofol ( Disoprifusor-TCI ) has been commercially available since spring 1997. We investigated the prediction error and precision of this TCI system as part of a multicentre study . Bias , precision , blood concentrations and dosage of propofol were compared with patients receiving propofol via a manually controlled infusion device . Instructions: please typing these entity words according to sentence: Germany, propofol, multicentre study, Bias, blood, concentrations, propofol, patients, propofol, device Options: umlsterm
[ "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O" ]
In Germany a TCI-system for propofol ( Disoprifusor-TCI ) has been commercially available since spring 1997. We investigated the prediction error and precision of this TCI system as part of a multicentre study . Bias , precision , blood concentrations and dosage of propofol were compared with patients receiving propofol via a manually controlled infusion device .
[ "In", "Germany", "a", "TCI", "-", "system", "for", "propofol", "(", "Disoprifusor", "-", "TCI", ")", "has", "been", "commercially", "available", "since", "spring", "1997", ".", "We", "investigated", "the", "prediction", "error", "and", "precision", "of", "this", "TCI", "system", "as", "part", "of", "a", "multicentre", "study", ".", "Bias", ",", "precision", ",", "blood", "concentrations", "and", "dosage", "of", "propofol", "were", "compared", "with", "patients", "receiving", "propofol", "via", "a", "manually", "controlled", "infusion", "device", "." ]
[ "umlsterm" ]
Germany, propofol, multicentre study, Bias, blood, concentrations, propofol, patients, propofol, device
DerAnaesthesist.80470663.eng.abstr_task2
Sentence: In Germany a TCI-system for propofol ( Disoprifusor-TCI ) has been commercially available since spring 1997. We investigated the prediction error and precision of this TCI system as part of a multicentre study . Bias , precision , blood concentrations and dosage of propofol were compared with patients receiving propofol via a manually controlled infusion device . Instructions: please extract entity words from the input sentence
[ "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O" ]
In Germany a TCI-system for propofol ( Disoprifusor-TCI ) has been commercially available since spring 1997. We investigated the prediction error and precision of this TCI system as part of a multicentre study . Bias , precision , blood concentrations and dosage of propofol were compared with patients receiving propofol via a manually controlled infusion device .
[ "In", "Germany", "a", "TCI", "-", "system", "for", "propofol", "(", "Disoprifusor", "-", "TCI", ")", "has", "been", "commercially", "available", "since", "spring", "1997", ".", "We", "investigated", "the", "prediction", "error", "and", "precision", "of", "this", "TCI", "system", "as", "part", "of", "a", "multicentre", "study", ".", "Bias", ",", "precision", ",", "blood", "concentrations", "and", "dosage", "of", "propofol", "were", "compared", "with", "patients", "receiving", "propofol", "via", "a", "manually", "controlled", "infusion", "device", "." ]
[ "umlsterm" ]
CD26 is a Individual_protein, adenosine deaminase is a Individual_protein, dipeptidyl peptidase IV is a Individual_protein
180_task0
Sentence: CD26 is a T cell activation antigen known to bind adenosine deaminase and have dipeptidyl peptidase IV activity. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Individual_protein
[ "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Individual_protein", "I-Individual_protein", "O", "O", "B-Individual_protein", "I-Individual_protein", "I-Individual_protein", "O", "O" ]
CD26 is a T cell activation antigen known to bind adenosine deaminase and have dipeptidyl peptidase IV activity.
[ "CD26", "is", "a", "T", "cell", "activation", "antigen", "known", "to", "bind", "adenosine", "deaminase", "and", "have", "dipeptidyl", "peptidase", "IV", "activity", "." ]
[ "Individual_protein" ]
CD26 is a Individual_protein, adenosine deaminase is a Individual_protein, dipeptidyl peptidase IV is a Individual_protein
180_task1
Sentence: CD26 is a T cell activation antigen known to bind adenosine deaminase and have dipeptidyl peptidase IV activity. Instructions: please typing these entity words according to sentence: CD26, adenosine deaminase, dipeptidyl peptidase IV Options: Individual_protein
[ "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Individual_protein", "I-Individual_protein", "O", "O", "B-Individual_protein", "I-Individual_protein", "I-Individual_protein", "O", "O" ]
CD26 is a T cell activation antigen known to bind adenosine deaminase and have dipeptidyl peptidase IV activity.
[ "CD26", "is", "a", "T", "cell", "activation", "antigen", "known", "to", "bind", "adenosine", "deaminase", "and", "have", "dipeptidyl", "peptidase", "IV", "activity", "." ]
[ "Individual_protein" ]
CD26, adenosine deaminase, dipeptidyl peptidase IV
180_task2
Sentence: CD26 is a T cell activation antigen known to bind adenosine deaminase and have dipeptidyl peptidase IV activity. Instructions: please extract entity words from the input sentence
[ "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Individual_protein", "I-Individual_protein", "O", "O", "B-Individual_protein", "I-Individual_protein", "I-Individual_protein", "O", "O" ]
CD26 is a T cell activation antigen known to bind adenosine deaminase and have dipeptidyl peptidase IV activity.
[ "CD26", "is", "a", "T", "cell", "activation", "antigen", "known", "to", "bind", "adenosine", "deaminase", "and", "have", "dipeptidyl", "peptidase", "IV", "activity", "." ]
[ "Individual_protein" ]
epoetin alfa is a Intervention_Pharmacological, dosing is a Intervention_Pharmacological, reticulocytosis is a Outcome_Physical, six dosing epoetin alfa regimens is a Intervention_Pharmacological, 40,000 IU once weekly is a Intervention_Pharmacological, subcutaneously is a Intervention_Pharmacological, 15,000 IU every other day , subcutaneously is a Intervention_Pharmacological, 40,000 IU day is a Intervention_Pharmacological, Serum erythropoietin concentration is a Outcome_Physical, absolute reticulocyte count is a Outcome_Physical, adverse events is a Outcome_Adverse-effects, Erythropoietin exposure is a Intervention_Physical, subcutaneous dosing is a Intervention_Pharmacological, Mean absolute reticulocyte count is a Outcome_Physical, pyrexia is a Outcome_Adverse-effects, hypokalemia is a Outcome_Adverse-effects, hypophosphatemia is a Outcome_Adverse-effects, pharmacodynamic response is a Outcome_Physical
39327_task0
Sentence: Pharmacokinetics and pharmacodynamics of six epoetin alfa dosing regimens in anemic critically ill patients without acute blood loss . OBJECTIVE To describe the pharmacokinetic profiles of six different dosing regimens for epoetin alfa , and whether more rapid and robust reticulocytosis can be elicited with more frequent administration of epoetin alfa in anemic critically ill patients . DESIGN Randomized , open-label , multicenter , 28-day clinical trial . SETTING Ten centers in the United States . PATIENTS Adult ( age > or=18 years ) critically ill patients with hemoglobin < or=12 g/dL , expected hospitalization of > or=7 days , with no ongoing acute blood loss . INTERVENTIONS One of six dosing epoetin alfa regimens for 15 days , as follows : 40,000 IU once weekly , subcutaneously ( group A ) or intravenously ( IV ) ( group B ) ; 15,000 IU every other day , subcutaneously ( group C ) or IV ( group D ) ; or 40,000 IU day 1 and 3 , subcutaneously ( group E ) or IV ( group F ) , followed by 15,000 IU once every other day on [ corrected ] days 5-15 [ corrected ] MEASUREMENTS Serum erythropoietin concentration , absolute reticulocyte count , and adverse events . MAIN RESULTS Of the 60 patients who were enrolled ( 60 % men , mean age 53 years , mean Acute Physiology and Chronic Health Evaluation II score , 19.5 ) , 30 were evaluable for both pharmacokinetics and pharmacodynamics ( 50 % ) . Erythropoietin exposure was approximately ten times greater for IV dosing than for subcutaneous dosing . Mean absolute reticulocyte count peaked at day 11 or 15 in each group and appeared to be greater for subcutaneous dosing ( mean peak response 149-169 x 10 ( 9 ) /L ) compared with IV dosing ( mean peak response 138-147 x 10 ( 9 ) /L ) at most visits . The most frequently reported adverse events were pyrexia ( 18 % ) , hypokalemia ( 15 % ) , and hypophosphatemia ( 15 % ) . CONCLUSIONS In this study of anemic critically ill patients treated with epoetin alfa , all dosing regimens were well tolerated and appeared to effect reticulocytosis , with a peak at day 11 or 15 in most patients . The pharmacokinetics of epoetin alfa did not predict pharmacodynamic response in anemic critically ill patients . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Intervention_Physical, Intervention_Pharmacological, Outcome_Physical, Outcome_Adverse-effects
[ "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O" ]
Pharmacokinetics and pharmacodynamics of six epoetin alfa dosing regimens in anemic critically ill patients without acute blood loss . OBJECTIVE To describe the pharmacokinetic profiles of six different dosing regimens for epoetin alfa , and whether more rapid and robust reticulocytosis can be elicited with more frequent administration of epoetin alfa in anemic critically ill patients . DESIGN Randomized , open-label , multicenter , 28-day clinical trial . SETTING Ten centers in the United States . PATIENTS Adult ( age > or=18 years ) critically ill patients with hemoglobin < or=12 g/dL , expected hospitalization of > or=7 days , with no ongoing acute blood loss . INTERVENTIONS One of six dosing epoetin alfa regimens for 15 days , as follows : 40,000 IU once weekly , subcutaneously ( group A ) or intravenously ( IV ) ( group B ) ; 15,000 IU every other day , subcutaneously ( group C ) or IV ( group D ) ; or 40,000 IU day 1 and 3 , subcutaneously ( group E ) or IV ( group F ) , followed by 15,000 IU once every other day on [ corrected ] days 5-15 [ corrected ] MEASUREMENTS Serum erythropoietin concentration , absolute reticulocyte count , and adverse events . MAIN RESULTS Of the 60 patients who were enrolled ( 60 % men , mean age 53 years , mean Acute Physiology and Chronic Health Evaluation II score , 19.5 ) , 30 were evaluable for both pharmacokinetics and pharmacodynamics ( 50 % ) . Erythropoietin exposure was approximately ten times greater for IV dosing than for subcutaneous dosing . Mean absolute reticulocyte count peaked at day 11 or 15 in each group and appeared to be greater for subcutaneous dosing ( mean peak response 149-169 x 10 ( 9 ) /L ) compared with IV dosing ( mean peak response 138-147 x 10 ( 9 ) /L ) at most visits . The most frequently reported adverse events were pyrexia ( 18 % ) , hypokalemia ( 15 % ) , and hypophosphatemia ( 15 % ) . CONCLUSIONS In this study of anemic critically ill patients treated with epoetin alfa , all dosing regimens were well tolerated and appeared to effect reticulocytosis , with a peak at day 11 or 15 in most patients . The pharmacokinetics of epoetin alfa did not predict pharmacodynamic response in anemic critically ill patients .
[ "Pharmacokinetics", "and", "pharmacodynamics", "of", "six", "epoetin", "alfa", "dosing", "regimens", "in", "anemic", "critically", "ill", "patients", "without", "acute", "blood", "loss", ".", "OBJECTIVE", "To", "describe", "the", "pharmacokinetic", "profiles", "of", "six", "different", "dosing", "regimens", "for", "epoetin", "alfa", ",", "and", "whether", "more", "rapid", "and", "robust", "reticulocytosis", "can", "be", "elicited", "with", "more", "frequent", "administration", "of", "epoetin", "alfa", "in", "anemic", "critically", "ill", "patients", ".", "DESIGN", "Randomized", ",", "open", "-", "label", ",", "multicenter", ",", "28-day", "clinical", "trial", ".", "SETTING", "Ten", "centers", "in", "the", "United", "States", ".", "PATIENTS", "Adult", "(", "age", ">", "or=18", "years", ")", "critically", "ill", "patients", "with", "hemoglobin", "<", "or=12", "g", "/", "dL", ",", "expected", "hospitalization", "of", ">", "or=7", "days", ",", "with", "no", "ongoing", "acute", "blood", "loss", ".", "INTERVENTIONS", "One", "of", "six", "dosing", "epoetin", "alfa", "regimens", "for", "15", "days", ",", "as", "follows", ":", "40,000", "IU", "once", "weekly", ",", "subcutaneously", "(", "group", "A", ")", "or", "intravenously", "(", "IV", ")", "(", "group", "B", ")", ";", "15,000", "IU", "every", "other", "day", ",", "subcutaneously", "(", "group", "C", ")", "or", "IV", "(", "group", "D", ")", ";", "or", "40,000", "IU", "day", "1", "and", "3", ",", "subcutaneously", "(", "group", "E", ")", "or", "IV", "(", "group", "F", ")", ",", "followed", "by", "15,000", "IU", "once", "every", "other", "day", "on", "[", "corrected", "]", "days", "5", "-", "15", "[", "corrected", "]", "MEASUREMENTS", "Serum", "erythropoietin", "concentration", ",", "absolute", "reticulocyte", "count", ",", "and", "adverse", "events", ".", "MAIN", "RESULTS", "Of", "the", "60", "patients", "who", "were", "enrolled", "(", "60", "%", "men", ",", "mean", "age", "53", "years", ",", "mean", "Acute", "Physiology", "and", "Chronic", "Health", "Evaluation", "II", "score", ",", "19.5", ")", ",", "30", "were", "evaluable", "for", "both", "pharmacokinetics", "and", "pharmacodynamics", "(", "50", "%", ")", ".", "Erythropoietin", "exposure", "was", "approximately", "ten", "times", "greater", "for", "IV", "dosing", "than", "for", "subcutaneous", "dosing", ".", "Mean", "absolute", "reticulocyte", "count", "peaked", "at", "day", "11", "or", "15", "in", "each", "group", "and", "appeared", "to", "be", "greater", "for", "subcutaneous", "dosing", "(", "mean", "peak", "response", "149", "-", "169", "x", "10", "(", "9", ")", "/L", ")", "compared", "with", "IV", "dosing", "(", "mean", "peak", "response", "138", "-", "147", "x", "10", "(", "9", ")", "/L", ")", "at", "most", "visits", ".", "The", "most", "frequently", "reported", "adverse", "events", "were", "pyrexia", "(", "18", "%", ")", ",", "hypokalemia", "(", "15", "%", ")", ",", "and", "hypophosphatemia", "(", "15", "%", ")", ".", "CONCLUSIONS", "In", "this", "study", "of", "anemic", "critically", "ill", "patients", "treated", "with", "epoetin", "alfa", ",", "all", "dosing", "regimens", "were", "well", "tolerated", "and", "appeared", "to", "effect", "reticulocytosis", ",", "with", "a", "peak", "at", "day", "11", "or", "15", "in", "most", "patients", ".", "The", "pharmacokinetics", "of", "epoetin", "alfa", "did", "not", "predict", "pharmacodynamic", "response", "in", "anemic", "critically", "ill", "patients", "." ]
[ "Intervention_Pharmacological", "Outcome_Physical", "Intervention_Physical", "Outcome_Adverse-effects" ]
epoetin alfa is a Intervention_Pharmacological, dosing is a Intervention_Pharmacological, reticulocytosis is a Outcome_Physical, six dosing epoetin alfa regimens is a Intervention_Pharmacological, 40,000 IU once weekly is a Intervention_Pharmacological, subcutaneously is a Intervention_Pharmacological, 15,000 IU every other day , subcutaneously is a Intervention_Pharmacological, 40,000 IU day is a Intervention_Pharmacological, Serum erythropoietin concentration is a Outcome_Physical, absolute reticulocyte count is a Outcome_Physical, adverse events is a Outcome_Adverse-effects, Erythropoietin exposure is a Intervention_Physical, subcutaneous dosing is a Intervention_Pharmacological, Mean absolute reticulocyte count is a Outcome_Physical, pyrexia is a Outcome_Adverse-effects, hypokalemia is a Outcome_Adverse-effects, hypophosphatemia is a Outcome_Adverse-effects, pharmacodynamic response is a Outcome_Physical
39327_task1
Sentence: Pharmacokinetics and pharmacodynamics of six epoetin alfa dosing regimens in anemic critically ill patients without acute blood loss . OBJECTIVE To describe the pharmacokinetic profiles of six different dosing regimens for epoetin alfa , and whether more rapid and robust reticulocytosis can be elicited with more frequent administration of epoetin alfa in anemic critically ill patients . DESIGN Randomized , open-label , multicenter , 28-day clinical trial . SETTING Ten centers in the United States . PATIENTS Adult ( age > or=18 years ) critically ill patients with hemoglobin < or=12 g/dL , expected hospitalization of > or=7 days , with no ongoing acute blood loss . INTERVENTIONS One of six dosing epoetin alfa regimens for 15 days , as follows : 40,000 IU once weekly , subcutaneously ( group A ) or intravenously ( IV ) ( group B ) ; 15,000 IU every other day , subcutaneously ( group C ) or IV ( group D ) ; or 40,000 IU day 1 and 3 , subcutaneously ( group E ) or IV ( group F ) , followed by 15,000 IU once every other day on [ corrected ] days 5-15 [ corrected ] MEASUREMENTS Serum erythropoietin concentration , absolute reticulocyte count , and adverse events . MAIN RESULTS Of the 60 patients who were enrolled ( 60 % men , mean age 53 years , mean Acute Physiology and Chronic Health Evaluation II score , 19.5 ) , 30 were evaluable for both pharmacokinetics and pharmacodynamics ( 50 % ) . Erythropoietin exposure was approximately ten times greater for IV dosing than for subcutaneous dosing . Mean absolute reticulocyte count peaked at day 11 or 15 in each group and appeared to be greater for subcutaneous dosing ( mean peak response 149-169 x 10 ( 9 ) /L ) compared with IV dosing ( mean peak response 138-147 x 10 ( 9 ) /L ) at most visits . The most frequently reported adverse events were pyrexia ( 18 % ) , hypokalemia ( 15 % ) , and hypophosphatemia ( 15 % ) . CONCLUSIONS In this study of anemic critically ill patients treated with epoetin alfa , all dosing regimens were well tolerated and appeared to effect reticulocytosis , with a peak at day 11 or 15 in most patients . The pharmacokinetics of epoetin alfa did not predict pharmacodynamic response in anemic critically ill patients . Instructions: please typing these entity words according to sentence: epoetin alfa, dosing, reticulocytosis, six dosing epoetin alfa regimens, 40,000 IU once weekly, subcutaneously, 15,000 IU every other day , subcutaneously, 40,000 IU day, Serum erythropoietin concentration, absolute reticulocyte count, adverse events, Erythropoietin exposure, subcutaneous dosing, Mean absolute reticulocyte count, pyrexia, hypokalemia, hypophosphatemia, pharmacodynamic response Options: Intervention_Physical, Intervention_Pharmacological, Outcome_Physical, Outcome_Adverse-effects
[ "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O" ]
Pharmacokinetics and pharmacodynamics of six epoetin alfa dosing regimens in anemic critically ill patients without acute blood loss . OBJECTIVE To describe the pharmacokinetic profiles of six different dosing regimens for epoetin alfa , and whether more rapid and robust reticulocytosis can be elicited with more frequent administration of epoetin alfa in anemic critically ill patients . DESIGN Randomized , open-label , multicenter , 28-day clinical trial . SETTING Ten centers in the United States . PATIENTS Adult ( age > or=18 years ) critically ill patients with hemoglobin < or=12 g/dL , expected hospitalization of > or=7 days , with no ongoing acute blood loss . INTERVENTIONS One of six dosing epoetin alfa regimens for 15 days , as follows : 40,000 IU once weekly , subcutaneously ( group A ) or intravenously ( IV ) ( group B ) ; 15,000 IU every other day , subcutaneously ( group C ) or IV ( group D ) ; or 40,000 IU day 1 and 3 , subcutaneously ( group E ) or IV ( group F ) , followed by 15,000 IU once every other day on [ corrected ] days 5-15 [ corrected ] MEASUREMENTS Serum erythropoietin concentration , absolute reticulocyte count , and adverse events . MAIN RESULTS Of the 60 patients who were enrolled ( 60 % men , mean age 53 years , mean Acute Physiology and Chronic Health Evaluation II score , 19.5 ) , 30 were evaluable for both pharmacokinetics and pharmacodynamics ( 50 % ) . Erythropoietin exposure was approximately ten times greater for IV dosing than for subcutaneous dosing . Mean absolute reticulocyte count peaked at day 11 or 15 in each group and appeared to be greater for subcutaneous dosing ( mean peak response 149-169 x 10 ( 9 ) /L ) compared with IV dosing ( mean peak response 138-147 x 10 ( 9 ) /L ) at most visits . The most frequently reported adverse events were pyrexia ( 18 % ) , hypokalemia ( 15 % ) , and hypophosphatemia ( 15 % ) . CONCLUSIONS In this study of anemic critically ill patients treated with epoetin alfa , all dosing regimens were well tolerated and appeared to effect reticulocytosis , with a peak at day 11 or 15 in most patients . The pharmacokinetics of epoetin alfa did not predict pharmacodynamic response in anemic critically ill patients .
[ "Pharmacokinetics", "and", "pharmacodynamics", "of", "six", "epoetin", "alfa", "dosing", "regimens", "in", "anemic", "critically", "ill", "patients", "without", "acute", "blood", "loss", ".", "OBJECTIVE", "To", "describe", "the", "pharmacokinetic", "profiles", "of", "six", "different", "dosing", "regimens", "for", "epoetin", "alfa", ",", "and", "whether", "more", "rapid", "and", "robust", "reticulocytosis", "can", "be", "elicited", "with", "more", "frequent", "administration", "of", "epoetin", "alfa", "in", "anemic", "critically", "ill", "patients", ".", "DESIGN", "Randomized", ",", "open", "-", "label", ",", "multicenter", ",", "28-day", "clinical", "trial", ".", "SETTING", "Ten", "centers", "in", "the", "United", "States", ".", "PATIENTS", "Adult", "(", "age", ">", "or=18", "years", ")", "critically", "ill", "patients", "with", "hemoglobin", "<", "or=12", "g", "/", "dL", ",", "expected", "hospitalization", "of", ">", "or=7", "days", ",", "with", "no", "ongoing", "acute", "blood", "loss", ".", "INTERVENTIONS", "One", "of", "six", "dosing", "epoetin", "alfa", "regimens", "for", "15", "days", ",", "as", "follows", ":", "40,000", "IU", "once", "weekly", ",", "subcutaneously", "(", "group", "A", ")", "or", "intravenously", "(", "IV", ")", "(", "group", "B", ")", ";", "15,000", "IU", "every", "other", "day", ",", "subcutaneously", "(", "group", "C", ")", "or", "IV", "(", "group", "D", ")", ";", "or", "40,000", "IU", "day", "1", "and", "3", ",", "subcutaneously", "(", "group", "E", ")", "or", "IV", "(", "group", "F", ")", ",", "followed", "by", "15,000", "IU", "once", "every", "other", "day", "on", "[", "corrected", "]", "days", "5", "-", "15", "[", "corrected", "]", "MEASUREMENTS", "Serum", "erythropoietin", "concentration", ",", "absolute", "reticulocyte", "count", ",", "and", "adverse", "events", ".", "MAIN", "RESULTS", "Of", "the", "60", "patients", "who", "were", "enrolled", "(", "60", "%", "men", ",", "mean", "age", "53", "years", ",", "mean", "Acute", "Physiology", "and", "Chronic", "Health", "Evaluation", "II", "score", ",", "19.5", ")", ",", "30", "were", "evaluable", "for", "both", "pharmacokinetics", "and", "pharmacodynamics", "(", "50", "%", ")", ".", "Erythropoietin", "exposure", "was", "approximately", "ten", "times", "greater", "for", "IV", "dosing", "than", "for", "subcutaneous", "dosing", ".", "Mean", "absolute", "reticulocyte", "count", "peaked", "at", "day", "11", "or", "15", "in", "each", "group", "and", "appeared", "to", "be", "greater", "for", "subcutaneous", "dosing", "(", "mean", "peak", "response", "149", "-", "169", "x", "10", "(", "9", ")", "/L", ")", "compared", "with", "IV", "dosing", "(", "mean", "peak", "response", "138", "-", "147", "x", "10", "(", "9", ")", "/L", ")", "at", "most", "visits", ".", "The", "most", "frequently", "reported", "adverse", "events", "were", "pyrexia", "(", "18", "%", ")", ",", "hypokalemia", "(", "15", "%", ")", ",", "and", "hypophosphatemia", "(", "15", "%", ")", ".", "CONCLUSIONS", "In", "this", "study", "of", "anemic", "critically", "ill", "patients", "treated", "with", "epoetin", "alfa", ",", "all", "dosing", "regimens", "were", "well", "tolerated", "and", "appeared", "to", "effect", "reticulocytosis", ",", "with", "a", "peak", "at", "day", "11", "or", "15", "in", "most", "patients", ".", "The", "pharmacokinetics", "of", "epoetin", "alfa", "did", "not", "predict", "pharmacodynamic", "response", "in", "anemic", "critically", "ill", "patients", "." ]
[ "Intervention_Pharmacological", "Outcome_Physical", "Intervention_Physical", "Outcome_Adverse-effects" ]
epoetin alfa, dosing, reticulocytosis, six dosing epoetin alfa regimens, 40,000 IU once weekly, subcutaneously, 15,000 IU every other day , subcutaneously, 40,000 IU day, Serum erythropoietin concentration, absolute reticulocyte count, adverse events, Erythropoietin exposure, subcutaneous dosing, Mean absolute reticulocyte count, pyrexia, hypokalemia, hypophosphatemia, pharmacodynamic response
39327_task2
Sentence: Pharmacokinetics and pharmacodynamics of six epoetin alfa dosing regimens in anemic critically ill patients without acute blood loss . OBJECTIVE To describe the pharmacokinetic profiles of six different dosing regimens for epoetin alfa , and whether more rapid and robust reticulocytosis can be elicited with more frequent administration of epoetin alfa in anemic critically ill patients . DESIGN Randomized , open-label , multicenter , 28-day clinical trial . SETTING Ten centers in the United States . PATIENTS Adult ( age > or=18 years ) critically ill patients with hemoglobin < or=12 g/dL , expected hospitalization of > or=7 days , with no ongoing acute blood loss . INTERVENTIONS One of six dosing epoetin alfa regimens for 15 days , as follows : 40,000 IU once weekly , subcutaneously ( group A ) or intravenously ( IV ) ( group B ) ; 15,000 IU every other day , subcutaneously ( group C ) or IV ( group D ) ; or 40,000 IU day 1 and 3 , subcutaneously ( group E ) or IV ( group F ) , followed by 15,000 IU once every other day on [ corrected ] days 5-15 [ corrected ] MEASUREMENTS Serum erythropoietin concentration , absolute reticulocyte count , and adverse events . MAIN RESULTS Of the 60 patients who were enrolled ( 60 % men , mean age 53 years , mean Acute Physiology and Chronic Health Evaluation II score , 19.5 ) , 30 were evaluable for both pharmacokinetics and pharmacodynamics ( 50 % ) . Erythropoietin exposure was approximately ten times greater for IV dosing than for subcutaneous dosing . Mean absolute reticulocyte count peaked at day 11 or 15 in each group and appeared to be greater for subcutaneous dosing ( mean peak response 149-169 x 10 ( 9 ) /L ) compared with IV dosing ( mean peak response 138-147 x 10 ( 9 ) /L ) at most visits . The most frequently reported adverse events were pyrexia ( 18 % ) , hypokalemia ( 15 % ) , and hypophosphatemia ( 15 % ) . CONCLUSIONS In this study of anemic critically ill patients treated with epoetin alfa , all dosing regimens were well tolerated and appeared to effect reticulocytosis , with a peak at day 11 or 15 in most patients . The pharmacokinetics of epoetin alfa did not predict pharmacodynamic response in anemic critically ill patients . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "B-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "B-Outcome_Adverse-effects", "I-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Physical", "I-Intervention_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Intervention_Pharmacological", "I-Intervention_Pharmacological", "O", "B-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "B-Outcome_Adverse-effects", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Outcome_Physical", "I-Outcome_Physical", "O", "O", "O", "O", "O", "O" ]
Pharmacokinetics and pharmacodynamics of six epoetin alfa dosing regimens in anemic critically ill patients without acute blood loss . OBJECTIVE To describe the pharmacokinetic profiles of six different dosing regimens for epoetin alfa , and whether more rapid and robust reticulocytosis can be elicited with more frequent administration of epoetin alfa in anemic critically ill patients . DESIGN Randomized , open-label , multicenter , 28-day clinical trial . SETTING Ten centers in the United States . PATIENTS Adult ( age > or=18 years ) critically ill patients with hemoglobin < or=12 g/dL , expected hospitalization of > or=7 days , with no ongoing acute blood loss . INTERVENTIONS One of six dosing epoetin alfa regimens for 15 days , as follows : 40,000 IU once weekly , subcutaneously ( group A ) or intravenously ( IV ) ( group B ) ; 15,000 IU every other day , subcutaneously ( group C ) or IV ( group D ) ; or 40,000 IU day 1 and 3 , subcutaneously ( group E ) or IV ( group F ) , followed by 15,000 IU once every other day on [ corrected ] days 5-15 [ corrected ] MEASUREMENTS Serum erythropoietin concentration , absolute reticulocyte count , and adverse events . MAIN RESULTS Of the 60 patients who were enrolled ( 60 % men , mean age 53 years , mean Acute Physiology and Chronic Health Evaluation II score , 19.5 ) , 30 were evaluable for both pharmacokinetics and pharmacodynamics ( 50 % ) . Erythropoietin exposure was approximately ten times greater for IV dosing than for subcutaneous dosing . Mean absolute reticulocyte count peaked at day 11 or 15 in each group and appeared to be greater for subcutaneous dosing ( mean peak response 149-169 x 10 ( 9 ) /L ) compared with IV dosing ( mean peak response 138-147 x 10 ( 9 ) /L ) at most visits . The most frequently reported adverse events were pyrexia ( 18 % ) , hypokalemia ( 15 % ) , and hypophosphatemia ( 15 % ) . CONCLUSIONS In this study of anemic critically ill patients treated with epoetin alfa , all dosing regimens were well tolerated and appeared to effect reticulocytosis , with a peak at day 11 or 15 in most patients . The pharmacokinetics of epoetin alfa did not predict pharmacodynamic response in anemic critically ill patients .
[ "Pharmacokinetics", "and", "pharmacodynamics", "of", "six", "epoetin", "alfa", "dosing", "regimens", "in", "anemic", "critically", "ill", "patients", "without", "acute", "blood", "loss", ".", "OBJECTIVE", "To", "describe", "the", "pharmacokinetic", "profiles", "of", "six", "different", "dosing", "regimens", "for", "epoetin", "alfa", ",", "and", "whether", "more", "rapid", "and", "robust", "reticulocytosis", "can", "be", "elicited", "with", "more", "frequent", "administration", "of", "epoetin", "alfa", "in", "anemic", "critically", "ill", "patients", ".", "DESIGN", "Randomized", ",", "open", "-", "label", ",", "multicenter", ",", "28-day", "clinical", "trial", ".", "SETTING", "Ten", "centers", "in", "the", "United", "States", ".", "PATIENTS", "Adult", "(", "age", ">", "or=18", "years", ")", "critically", "ill", "patients", "with", "hemoglobin", "<", "or=12", "g", "/", "dL", ",", "expected", "hospitalization", "of", ">", "or=7", "days", ",", "with", "no", "ongoing", "acute", "blood", "loss", ".", "INTERVENTIONS", "One", "of", "six", "dosing", "epoetin", "alfa", "regimens", "for", "15", "days", ",", "as", "follows", ":", "40,000", "IU", "once", "weekly", ",", "subcutaneously", "(", "group", "A", ")", "or", "intravenously", "(", "IV", ")", "(", "group", "B", ")", ";", "15,000", "IU", "every", "other", "day", ",", "subcutaneously", "(", "group", "C", ")", "or", "IV", "(", "group", "D", ")", ";", "or", "40,000", "IU", "day", "1", "and", "3", ",", "subcutaneously", "(", "group", "E", ")", "or", "IV", "(", "group", "F", ")", ",", "followed", "by", "15,000", "IU", "once", "every", "other", "day", "on", "[", "corrected", "]", "days", "5", "-", "15", "[", "corrected", "]", "MEASUREMENTS", "Serum", "erythropoietin", "concentration", ",", "absolute", "reticulocyte", "count", ",", "and", "adverse", "events", ".", "MAIN", "RESULTS", "Of", "the", "60", "patients", "who", "were", "enrolled", "(", "60", "%", "men", ",", "mean", "age", "53", "years", ",", "mean", "Acute", "Physiology", "and", "Chronic", "Health", "Evaluation", "II", "score", ",", "19.5", ")", ",", "30", "were", "evaluable", "for", "both", "pharmacokinetics", "and", "pharmacodynamics", "(", "50", "%", ")", ".", "Erythropoietin", "exposure", "was", "approximately", "ten", "times", "greater", "for", "IV", "dosing", "than", "for", "subcutaneous", "dosing", ".", "Mean", "absolute", "reticulocyte", "count", "peaked", "at", "day", "11", "or", "15", "in", "each", "group", "and", "appeared", "to", "be", "greater", "for", "subcutaneous", "dosing", "(", "mean", "peak", "response", "149", "-", "169", "x", "10", "(", "9", ")", "/L", ")", "compared", "with", "IV", "dosing", "(", "mean", "peak", "response", "138", "-", "147", "x", "10", "(", "9", ")", "/L", ")", "at", "most", "visits", ".", "The", "most", "frequently", "reported", "adverse", "events", "were", "pyrexia", "(", "18", "%", ")", ",", "hypokalemia", "(", "15", "%", ")", ",", "and", "hypophosphatemia", "(", "15", "%", ")", ".", "CONCLUSIONS", "In", "this", "study", "of", "anemic", "critically", "ill", "patients", "treated", "with", "epoetin", "alfa", ",", "all", "dosing", "regimens", "were", "well", "tolerated", "and", "appeared", "to", "effect", "reticulocytosis", ",", "with", "a", "peak", "at", "day", "11", "or", "15", "in", "most", "patients", ".", "The", "pharmacokinetics", "of", "epoetin", "alfa", "did", "not", "predict", "pharmacodynamic", "response", "in", "anemic", "critically", "ill", "patients", "." ]
[ "Intervention_Pharmacological", "Outcome_Physical", "Intervention_Physical", "Outcome_Adverse-effects" ]
Rueckenmarks is an umlsterm, radiologischer is an umlsterm, Myelitis is an umlsterm, Patienten is an umlsterm, Aetiologie is an umlsterm, Patient is an umlsterm, Herpes simplex is an umlsterm, Herpes zoster is an umlsterm, Zytomegalie is an umlsterm, Tuberkulose is an umlsterm, Syphilis is an umlsterm, Infektionen is an umlsterm, Patient is an umlsterm, bakteriellen Infektionen is an umlsterm, Sarkoidose is an umlsterm, Myelitis is an umlsterm, Infektionen is an umlsterm, Differentialdiagnose is an umlsterm, Myelitis is an umlsterm, Radikulitis is an umlsterm
DerRadiologe.60360897.ger.abstr_task0
Sentence: Entzuendliche Erkrankungen des Rueckenmarks und der Nervenwurzeln werden aus klinischer und radiologischer Sicht in eine ( Meningo ) -Myeloradikulitis und eine Meningoradikulo- ( Myelitis ) beim immunsupprimierten und immunkompetenten Patienten eingeteilt , was teilweise Rueckschluesse auf die zugrundeliegende Aetiologie erlaubt . Der immunsupprimierte Patient leidet vor allem an viralen ( Herpes simplex , Herpes zoster Zytomegalie , HIV-Virus ) sowie an bakteriellen ( Tuberkulose , , selten Syphilis ) , aber nur selten an parasitaeren Infektionen . Der immunkompetente Patient erkrankt vor allem an bakteriellen Infektionen ( Borreliose ) sowie an immunologisch bedingten entzuendlichen Erkrankungen ( Sarkoidose ) und an demyelinisierenden Laesionen . Haeufig ist auch die idiopathische Myelitis . Virale Infektionen sind selten . Die MRT-Morphologie der entzuendlichen Laesionen wird durch sekundaere ischaemische und demyelinisierende Veraenderungen kompliziert , wodurch die Differentialdiagnose sehr erschwert sein kann , da das gesamte Spektrum von demyelinisierenden bzw. ischaemischen und entzuendlichen Erkrankungen miteinbezogen werden muss . Zudem koennen auch tumoroese Prozesse eine Myelitis bzw. Radikulitis nachahmen . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "I-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O" ]
Entzuendliche Erkrankungen des Rueckenmarks und der Nervenwurzeln werden aus klinischer und radiologischer Sicht in eine ( Meningo ) -Myeloradikulitis und eine Meningoradikulo- ( Myelitis ) beim immunsupprimierten und immunkompetenten Patienten eingeteilt , was teilweise Rueckschluesse auf die zugrundeliegende Aetiologie erlaubt . Der immunsupprimierte Patient leidet vor allem an viralen ( Herpes simplex , Herpes zoster Zytomegalie , HIV-Virus ) sowie an bakteriellen ( Tuberkulose , , selten Syphilis ) , aber nur selten an parasitaeren Infektionen . Der immunkompetente Patient erkrankt vor allem an bakteriellen Infektionen ( Borreliose ) sowie an immunologisch bedingten entzuendlichen Erkrankungen ( Sarkoidose ) und an demyelinisierenden Laesionen . Haeufig ist auch die idiopathische Myelitis . Virale Infektionen sind selten . Die MRT-Morphologie der entzuendlichen Laesionen wird durch sekundaere ischaemische und demyelinisierende Veraenderungen kompliziert , wodurch die Differentialdiagnose sehr erschwert sein kann , da das gesamte Spektrum von demyelinisierenden bzw. ischaemischen und entzuendlichen Erkrankungen miteinbezogen werden muss . Zudem koennen auch tumoroese Prozesse eine Myelitis bzw. Radikulitis nachahmen .
[ "Entzuendliche", "Erkrankungen", "des", "Rueckenmarks", "und", "der", "Nervenwurzeln", "werden", "aus", "klinischer", "und", "radiologischer", "Sicht", "in", "eine", "(", "Meningo", ")", "-Myeloradikulitis", "und", "eine", "Meningoradikulo-", "(", "Myelitis", ")", "beim", "immunsupprimierten", "und", "immunkompetenten", "Patienten", "eingeteilt", ",", "was", "teilweise", "Rueckschluesse", "auf", "die", "zugrundeliegende", "Aetiologie", "erlaubt", ".", "Der", "immunsupprimierte", "Patient", "leidet", "vor", "allem", "an", "viralen", "(", "Herpes", "simplex", ",", "Herpes", "zoster", "Zytomegalie", ",", "HIV", "-", "Virus", ")", "sowie", "an", "bakteriellen", "(", "Tuberkulose", ",", ",", "selten", "Syphilis", ")", ",", "aber", "nur", "selten", "an", "parasitaeren", "Infektionen", ".", "Der", "immunkompetente", "Patient", "erkrankt", "vor", "allem", "an", "bakteriellen", "Infektionen", "(", "Borreliose", ")", "sowie", "an", "immunologisch", "bedingten", "entzuendlichen", "Erkrankungen", "(", "Sarkoidose", ")", "und", "an", "demyelinisierenden", "Laesionen", ".", "Haeufig", "ist", "auch", "die", "idiopathische", "Myelitis", ".", "Virale", "Infektionen", "sind", "selten", ".", "Die", "MRT", "-", "Morphologie", "der", "entzuendlichen", "Laesionen", "wird", "durch", "sekundaere", "ischaemische", "und", "demyelinisierende", "Veraenderungen", "kompliziert", ",", "wodurch", "die", "Differentialdiagnose", "sehr", "erschwert", "sein", "kann", ",", "da", "das", "gesamte", "Spektrum", "von", "demyelinisierenden", "bzw", ".", "ischaemischen", "und", "entzuendlichen", "Erkrankungen", "miteinbezogen", "werden", "muss", ".", "Zudem", "koennen", "auch", "tumoroese", "Prozesse", "eine", "Myelitis", "bzw", ".", "Radikulitis", "nachahmen", "." ]
[ "umlsterm" ]
Rueckenmarks is an umlsterm, radiologischer is an umlsterm, Myelitis is an umlsterm, Patienten is an umlsterm, Aetiologie is an umlsterm, Patient is an umlsterm, Herpes simplex is an umlsterm, Herpes zoster is an umlsterm, Zytomegalie is an umlsterm, Tuberkulose is an umlsterm, Syphilis is an umlsterm, Infektionen is an umlsterm, Patient is an umlsterm, bakteriellen Infektionen is an umlsterm, Sarkoidose is an umlsterm, Myelitis is an umlsterm, Infektionen is an umlsterm, Differentialdiagnose is an umlsterm, Myelitis is an umlsterm, Radikulitis is an umlsterm
DerRadiologe.60360897.ger.abstr_task1
Sentence: Entzuendliche Erkrankungen des Rueckenmarks und der Nervenwurzeln werden aus klinischer und radiologischer Sicht in eine ( Meningo ) -Myeloradikulitis und eine Meningoradikulo- ( Myelitis ) beim immunsupprimierten und immunkompetenten Patienten eingeteilt , was teilweise Rueckschluesse auf die zugrundeliegende Aetiologie erlaubt . Der immunsupprimierte Patient leidet vor allem an viralen ( Herpes simplex , Herpes zoster Zytomegalie , HIV-Virus ) sowie an bakteriellen ( Tuberkulose , , selten Syphilis ) , aber nur selten an parasitaeren Infektionen . Der immunkompetente Patient erkrankt vor allem an bakteriellen Infektionen ( Borreliose ) sowie an immunologisch bedingten entzuendlichen Erkrankungen ( Sarkoidose ) und an demyelinisierenden Laesionen . Haeufig ist auch die idiopathische Myelitis . Virale Infektionen sind selten . Die MRT-Morphologie der entzuendlichen Laesionen wird durch sekundaere ischaemische und demyelinisierende Veraenderungen kompliziert , wodurch die Differentialdiagnose sehr erschwert sein kann , da das gesamte Spektrum von demyelinisierenden bzw. ischaemischen und entzuendlichen Erkrankungen miteinbezogen werden muss . Zudem koennen auch tumoroese Prozesse eine Myelitis bzw. Radikulitis nachahmen . Instructions: please typing these entity words according to sentence: Rueckenmarks, radiologischer, Myelitis, Patienten, Aetiologie, Patient, Herpes simplex, Herpes zoster, Zytomegalie, Tuberkulose, Syphilis, Infektionen, Patient, bakteriellen Infektionen, Sarkoidose, Myelitis, Infektionen, Differentialdiagnose, Myelitis, Radikulitis Options: umlsterm
[ "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "I-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O" ]
Entzuendliche Erkrankungen des Rueckenmarks und der Nervenwurzeln werden aus klinischer und radiologischer Sicht in eine ( Meningo ) -Myeloradikulitis und eine Meningoradikulo- ( Myelitis ) beim immunsupprimierten und immunkompetenten Patienten eingeteilt , was teilweise Rueckschluesse auf die zugrundeliegende Aetiologie erlaubt . Der immunsupprimierte Patient leidet vor allem an viralen ( Herpes simplex , Herpes zoster Zytomegalie , HIV-Virus ) sowie an bakteriellen ( Tuberkulose , , selten Syphilis ) , aber nur selten an parasitaeren Infektionen . Der immunkompetente Patient erkrankt vor allem an bakteriellen Infektionen ( Borreliose ) sowie an immunologisch bedingten entzuendlichen Erkrankungen ( Sarkoidose ) und an demyelinisierenden Laesionen . Haeufig ist auch die idiopathische Myelitis . Virale Infektionen sind selten . Die MRT-Morphologie der entzuendlichen Laesionen wird durch sekundaere ischaemische und demyelinisierende Veraenderungen kompliziert , wodurch die Differentialdiagnose sehr erschwert sein kann , da das gesamte Spektrum von demyelinisierenden bzw. ischaemischen und entzuendlichen Erkrankungen miteinbezogen werden muss . Zudem koennen auch tumoroese Prozesse eine Myelitis bzw. Radikulitis nachahmen .
[ "Entzuendliche", "Erkrankungen", "des", "Rueckenmarks", "und", "der", "Nervenwurzeln", "werden", "aus", "klinischer", "und", "radiologischer", "Sicht", "in", "eine", "(", "Meningo", ")", "-Myeloradikulitis", "und", "eine", "Meningoradikulo-", "(", "Myelitis", ")", "beim", "immunsupprimierten", "und", "immunkompetenten", "Patienten", "eingeteilt", ",", "was", "teilweise", "Rueckschluesse", "auf", "die", "zugrundeliegende", "Aetiologie", "erlaubt", ".", "Der", "immunsupprimierte", "Patient", "leidet", "vor", "allem", "an", "viralen", "(", "Herpes", "simplex", ",", "Herpes", "zoster", "Zytomegalie", ",", "HIV", "-", "Virus", ")", "sowie", "an", "bakteriellen", "(", "Tuberkulose", ",", ",", "selten", "Syphilis", ")", ",", "aber", "nur", "selten", "an", "parasitaeren", "Infektionen", ".", "Der", "immunkompetente", "Patient", "erkrankt", "vor", "allem", "an", "bakteriellen", "Infektionen", "(", "Borreliose", ")", "sowie", "an", "immunologisch", "bedingten", "entzuendlichen", "Erkrankungen", "(", "Sarkoidose", ")", "und", "an", "demyelinisierenden", "Laesionen", ".", "Haeufig", "ist", "auch", "die", "idiopathische", "Myelitis", ".", "Virale", "Infektionen", "sind", "selten", ".", "Die", "MRT", "-", "Morphologie", "der", "entzuendlichen", "Laesionen", "wird", "durch", "sekundaere", "ischaemische", "und", "demyelinisierende", "Veraenderungen", "kompliziert", ",", "wodurch", "die", "Differentialdiagnose", "sehr", "erschwert", "sein", "kann", ",", "da", "das", "gesamte", "Spektrum", "von", "demyelinisierenden", "bzw", ".", "ischaemischen", "und", "entzuendlichen", "Erkrankungen", "miteinbezogen", "werden", "muss", ".", "Zudem", "koennen", "auch", "tumoroese", "Prozesse", "eine", "Myelitis", "bzw", ".", "Radikulitis", "nachahmen", "." ]
[ "umlsterm" ]
Rueckenmarks, radiologischer, Myelitis, Patienten, Aetiologie, Patient, Herpes simplex, Herpes zoster, Zytomegalie, Tuberkulose, Syphilis, Infektionen, Patient, bakteriellen Infektionen, Sarkoidose, Myelitis, Infektionen, Differentialdiagnose, Myelitis, Radikulitis
DerRadiologe.60360897.ger.abstr_task2
Sentence: Entzuendliche Erkrankungen des Rueckenmarks und der Nervenwurzeln werden aus klinischer und radiologischer Sicht in eine ( Meningo ) -Myeloradikulitis und eine Meningoradikulo- ( Myelitis ) beim immunsupprimierten und immunkompetenten Patienten eingeteilt , was teilweise Rueckschluesse auf die zugrundeliegende Aetiologie erlaubt . Der immunsupprimierte Patient leidet vor allem an viralen ( Herpes simplex , Herpes zoster Zytomegalie , HIV-Virus ) sowie an bakteriellen ( Tuberkulose , , selten Syphilis ) , aber nur selten an parasitaeren Infektionen . Der immunkompetente Patient erkrankt vor allem an bakteriellen Infektionen ( Borreliose ) sowie an immunologisch bedingten entzuendlichen Erkrankungen ( Sarkoidose ) und an demyelinisierenden Laesionen . Haeufig ist auch die idiopathische Myelitis . Virale Infektionen sind selten . Die MRT-Morphologie der entzuendlichen Laesionen wird durch sekundaere ischaemische und demyelinisierende Veraenderungen kompliziert , wodurch die Differentialdiagnose sehr erschwert sein kann , da das gesamte Spektrum von demyelinisierenden bzw. ischaemischen und entzuendlichen Erkrankungen miteinbezogen werden muss . Zudem koennen auch tumoroese Prozesse eine Myelitis bzw. Radikulitis nachahmen . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "I-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O" ]
Entzuendliche Erkrankungen des Rueckenmarks und der Nervenwurzeln werden aus klinischer und radiologischer Sicht in eine ( Meningo ) -Myeloradikulitis und eine Meningoradikulo- ( Myelitis ) beim immunsupprimierten und immunkompetenten Patienten eingeteilt , was teilweise Rueckschluesse auf die zugrundeliegende Aetiologie erlaubt . Der immunsupprimierte Patient leidet vor allem an viralen ( Herpes simplex , Herpes zoster Zytomegalie , HIV-Virus ) sowie an bakteriellen ( Tuberkulose , , selten Syphilis ) , aber nur selten an parasitaeren Infektionen . Der immunkompetente Patient erkrankt vor allem an bakteriellen Infektionen ( Borreliose ) sowie an immunologisch bedingten entzuendlichen Erkrankungen ( Sarkoidose ) und an demyelinisierenden Laesionen . Haeufig ist auch die idiopathische Myelitis . Virale Infektionen sind selten . Die MRT-Morphologie der entzuendlichen Laesionen wird durch sekundaere ischaemische und demyelinisierende Veraenderungen kompliziert , wodurch die Differentialdiagnose sehr erschwert sein kann , da das gesamte Spektrum von demyelinisierenden bzw. ischaemischen und entzuendlichen Erkrankungen miteinbezogen werden muss . Zudem koennen auch tumoroese Prozesse eine Myelitis bzw. Radikulitis nachahmen .
[ "Entzuendliche", "Erkrankungen", "des", "Rueckenmarks", "und", "der", "Nervenwurzeln", "werden", "aus", "klinischer", "und", "radiologischer", "Sicht", "in", "eine", "(", "Meningo", ")", "-Myeloradikulitis", "und", "eine", "Meningoradikulo-", "(", "Myelitis", ")", "beim", "immunsupprimierten", "und", "immunkompetenten", "Patienten", "eingeteilt", ",", "was", "teilweise", "Rueckschluesse", "auf", "die", "zugrundeliegende", "Aetiologie", "erlaubt", ".", "Der", "immunsupprimierte", "Patient", "leidet", "vor", "allem", "an", "viralen", "(", "Herpes", "simplex", ",", "Herpes", "zoster", "Zytomegalie", ",", "HIV", "-", "Virus", ")", "sowie", "an", "bakteriellen", "(", "Tuberkulose", ",", ",", "selten", "Syphilis", ")", ",", "aber", "nur", "selten", "an", "parasitaeren", "Infektionen", ".", "Der", "immunkompetente", "Patient", "erkrankt", "vor", "allem", "an", "bakteriellen", "Infektionen", "(", "Borreliose", ")", "sowie", "an", "immunologisch", "bedingten", "entzuendlichen", "Erkrankungen", "(", "Sarkoidose", ")", "und", "an", "demyelinisierenden", "Laesionen", ".", "Haeufig", "ist", "auch", "die", "idiopathische", "Myelitis", ".", "Virale", "Infektionen", "sind", "selten", ".", "Die", "MRT", "-", "Morphologie", "der", "entzuendlichen", "Laesionen", "wird", "durch", "sekundaere", "ischaemische", "und", "demyelinisierende", "Veraenderungen", "kompliziert", ",", "wodurch", "die", "Differentialdiagnose", "sehr", "erschwert", "sein", "kann", ",", "da", "das", "gesamte", "Spektrum", "von", "demyelinisierenden", "bzw", ".", "ischaemischen", "und", "entzuendlichen", "Erkrankungen", "miteinbezogen", "werden", "muss", ".", "Zudem", "koennen", "auch", "tumoroese", "Prozesse", "eine", "Myelitis", "bzw", ".", "Radikulitis", "nachahmen", "." ]
[ "umlsterm" ]
maennlichen is an umlsterm, Leukoplakie is an umlsterm, Diagnosestellung is an umlsterm, Patienten is an umlsterm, Komplikationen is an umlsterm, Prognose is an umlsterm, maennliche is an umlsterm, Zwillinge is an umlsterm, Haut is an umlsterm, Narben is an umlsterm, Haenden is an umlsterm, Atrophie is an umlsterm, Mundschleimhaut is an umlsterm, Splenomegalie is an umlsterm, Panzytopenie is an umlsterm, Markaplasie is an umlsterm, Arbeit is an umlsterm, Differentialdiagnosen is an umlsterm
DerHautarzt.40450249.ger.abstr_task0
Sentence: Zusammenfassung . Die Dyskeratosis congenita ( DC ) ist eine sehr seltene Genodermatose mit variablem Erscheinungsbild und ueberwiegend maennlichen Betroffenen . Leitsymptome sind Poikilodermie Onychodystrophie und Leukoplakie . , Zusaetzlich finden sich zahlreiche weitere kutane und systemische Manifestationsformen . Eine fruehzeitige Diagnosestellung und regelmaessige engmaschige Ueberwachung der Patienten ist von grosser Bedeutung , um moegliche Komplikationen rechtzeitig zu erkennen und so zur Verbesserung der Prognose beizutragen . Es wird ueber monozygote 13jaehrige maennliche Zwillinge berichtet , die neben den typischen Leitsymptomen erhoehte Verletzbarkeit der Haut , zahlreiche Narben an den Haenden und Atrophie der Mundschleimhaut sowie extrakutane Symptome wie Splenomegalie , Panzytopenie mit hochgradiger Markaplasie und aseptische Hueftkopfnekrose aufweisen . Beide Brueder zeigen einen nahezu identischen Krankheitsverlauf . Die vorliegende Arbeit gibt eine Uebersicht ueber Klinik , Pathogenese , Differentialdiagnosen und genetische Aspekte der DC . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O" ]
Zusammenfassung . Die Dyskeratosis congenita ( DC ) ist eine sehr seltene Genodermatose mit variablem Erscheinungsbild und ueberwiegend maennlichen Betroffenen . Leitsymptome sind Poikilodermie Onychodystrophie und Leukoplakie . , Zusaetzlich finden sich zahlreiche weitere kutane und systemische Manifestationsformen . Eine fruehzeitige Diagnosestellung und regelmaessige engmaschige Ueberwachung der Patienten ist von grosser Bedeutung , um moegliche Komplikationen rechtzeitig zu erkennen und so zur Verbesserung der Prognose beizutragen . Es wird ueber monozygote 13jaehrige maennliche Zwillinge berichtet , die neben den typischen Leitsymptomen erhoehte Verletzbarkeit der Haut , zahlreiche Narben an den Haenden und Atrophie der Mundschleimhaut sowie extrakutane Symptome wie Splenomegalie , Panzytopenie mit hochgradiger Markaplasie und aseptische Hueftkopfnekrose aufweisen . Beide Brueder zeigen einen nahezu identischen Krankheitsverlauf . Die vorliegende Arbeit gibt eine Uebersicht ueber Klinik , Pathogenese , Differentialdiagnosen und genetische Aspekte der DC .
[ "Zusammenfassung", ".", "Die", "Dyskeratosis", "congenita", "(", "DC", ")", "ist", "eine", "sehr", "seltene", "Genodermatose", "mit", "variablem", "Erscheinungsbild", "und", "ueberwiegend", "maennlichen", "Betroffenen", ".", "Leitsymptome", "sind", "Poikilodermie", "Onychodystrophie", "und", "Leukoplakie", ".", ",", "Zusaetzlich", "finden", "sich", "zahlreiche", "weitere", "kutane", "und", "systemische", "Manifestationsformen", ".", "Eine", "fruehzeitige", "Diagnosestellung", "und", "regelmaessige", "engmaschige", "Ueberwachung", "der", "Patienten", "ist", "von", "grosser", "Bedeutung", ",", "um", "moegliche", "Komplikationen", "rechtzeitig", "zu", "erkennen", "und", "so", "zur", "Verbesserung", "der", "Prognose", "beizutragen", ".", "Es", "wird", "ueber", "monozygote", "13jaehrige", "maennliche", "Zwillinge", "berichtet", ",", "die", "neben", "den", "typischen", "Leitsymptomen", "erhoehte", "Verletzbarkeit", "der", "Haut", ",", "zahlreiche", "Narben", "an", "den", "Haenden", "und", "Atrophie", "der", "Mundschleimhaut", "sowie", "extrakutane", "Symptome", "wie", "Splenomegalie", ",", "Panzytopenie", "mit", "hochgradiger", "Markaplasie", "und", "aseptische", "Hueftkopfnekrose", "aufweisen", ".", "Beide", "Brueder", "zeigen", "einen", "nahezu", "identischen", "Krankheitsverlauf", ".", "Die", "vorliegende", "Arbeit", "gibt", "eine", "Uebersicht", "ueber", "Klinik", ",", "Pathogenese", ",", "Differentialdiagnosen", "und", "genetische", "Aspekte", "der", "DC", "." ]
[ "umlsterm" ]
maennlichen is an umlsterm, Leukoplakie is an umlsterm, Diagnosestellung is an umlsterm, Patienten is an umlsterm, Komplikationen is an umlsterm, Prognose is an umlsterm, maennliche is an umlsterm, Zwillinge is an umlsterm, Haut is an umlsterm, Narben is an umlsterm, Haenden is an umlsterm, Atrophie is an umlsterm, Mundschleimhaut is an umlsterm, Splenomegalie is an umlsterm, Panzytopenie is an umlsterm, Markaplasie is an umlsterm, Arbeit is an umlsterm, Differentialdiagnosen is an umlsterm
DerHautarzt.40450249.ger.abstr_task1
Sentence: Zusammenfassung . Die Dyskeratosis congenita ( DC ) ist eine sehr seltene Genodermatose mit variablem Erscheinungsbild und ueberwiegend maennlichen Betroffenen . Leitsymptome sind Poikilodermie Onychodystrophie und Leukoplakie . , Zusaetzlich finden sich zahlreiche weitere kutane und systemische Manifestationsformen . Eine fruehzeitige Diagnosestellung und regelmaessige engmaschige Ueberwachung der Patienten ist von grosser Bedeutung , um moegliche Komplikationen rechtzeitig zu erkennen und so zur Verbesserung der Prognose beizutragen . Es wird ueber monozygote 13jaehrige maennliche Zwillinge berichtet , die neben den typischen Leitsymptomen erhoehte Verletzbarkeit der Haut , zahlreiche Narben an den Haenden und Atrophie der Mundschleimhaut sowie extrakutane Symptome wie Splenomegalie , Panzytopenie mit hochgradiger Markaplasie und aseptische Hueftkopfnekrose aufweisen . Beide Brueder zeigen einen nahezu identischen Krankheitsverlauf . Die vorliegende Arbeit gibt eine Uebersicht ueber Klinik , Pathogenese , Differentialdiagnosen und genetische Aspekte der DC . Instructions: please typing these entity words according to sentence: maennlichen, Leukoplakie, Diagnosestellung, Patienten, Komplikationen, Prognose, maennliche, Zwillinge, Haut, Narben, Haenden, Atrophie, Mundschleimhaut, Splenomegalie, Panzytopenie, Markaplasie, Arbeit, Differentialdiagnosen Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O" ]
Zusammenfassung . Die Dyskeratosis congenita ( DC ) ist eine sehr seltene Genodermatose mit variablem Erscheinungsbild und ueberwiegend maennlichen Betroffenen . Leitsymptome sind Poikilodermie Onychodystrophie und Leukoplakie . , Zusaetzlich finden sich zahlreiche weitere kutane und systemische Manifestationsformen . Eine fruehzeitige Diagnosestellung und regelmaessige engmaschige Ueberwachung der Patienten ist von grosser Bedeutung , um moegliche Komplikationen rechtzeitig zu erkennen und so zur Verbesserung der Prognose beizutragen . Es wird ueber monozygote 13jaehrige maennliche Zwillinge berichtet , die neben den typischen Leitsymptomen erhoehte Verletzbarkeit der Haut , zahlreiche Narben an den Haenden und Atrophie der Mundschleimhaut sowie extrakutane Symptome wie Splenomegalie , Panzytopenie mit hochgradiger Markaplasie und aseptische Hueftkopfnekrose aufweisen . Beide Brueder zeigen einen nahezu identischen Krankheitsverlauf . Die vorliegende Arbeit gibt eine Uebersicht ueber Klinik , Pathogenese , Differentialdiagnosen und genetische Aspekte der DC .
[ "Zusammenfassung", ".", "Die", "Dyskeratosis", "congenita", "(", "DC", ")", "ist", "eine", "sehr", "seltene", "Genodermatose", "mit", "variablem", "Erscheinungsbild", "und", "ueberwiegend", "maennlichen", "Betroffenen", ".", "Leitsymptome", "sind", "Poikilodermie", "Onychodystrophie", "und", "Leukoplakie", ".", ",", "Zusaetzlich", "finden", "sich", "zahlreiche", "weitere", "kutane", "und", "systemische", "Manifestationsformen", ".", "Eine", "fruehzeitige", "Diagnosestellung", "und", "regelmaessige", "engmaschige", "Ueberwachung", "der", "Patienten", "ist", "von", "grosser", "Bedeutung", ",", "um", "moegliche", "Komplikationen", "rechtzeitig", "zu", "erkennen", "und", "so", "zur", "Verbesserung", "der", "Prognose", "beizutragen", ".", "Es", "wird", "ueber", "monozygote", "13jaehrige", "maennliche", "Zwillinge", "berichtet", ",", "die", "neben", "den", "typischen", "Leitsymptomen", "erhoehte", "Verletzbarkeit", "der", "Haut", ",", "zahlreiche", "Narben", "an", "den", "Haenden", "und", "Atrophie", "der", "Mundschleimhaut", "sowie", "extrakutane", "Symptome", "wie", "Splenomegalie", ",", "Panzytopenie", "mit", "hochgradiger", "Markaplasie", "und", "aseptische", "Hueftkopfnekrose", "aufweisen", ".", "Beide", "Brueder", "zeigen", "einen", "nahezu", "identischen", "Krankheitsverlauf", ".", "Die", "vorliegende", "Arbeit", "gibt", "eine", "Uebersicht", "ueber", "Klinik", ",", "Pathogenese", ",", "Differentialdiagnosen", "und", "genetische", "Aspekte", "der", "DC", "." ]
[ "umlsterm" ]
maennlichen, Leukoplakie, Diagnosestellung, Patienten, Komplikationen, Prognose, maennliche, Zwillinge, Haut, Narben, Haenden, Atrophie, Mundschleimhaut, Splenomegalie, Panzytopenie, Markaplasie, Arbeit, Differentialdiagnosen
DerHautarzt.40450249.ger.abstr_task2
Sentence: Zusammenfassung . Die Dyskeratosis congenita ( DC ) ist eine sehr seltene Genodermatose mit variablem Erscheinungsbild und ueberwiegend maennlichen Betroffenen . Leitsymptome sind Poikilodermie Onychodystrophie und Leukoplakie . , Zusaetzlich finden sich zahlreiche weitere kutane und systemische Manifestationsformen . Eine fruehzeitige Diagnosestellung und regelmaessige engmaschige Ueberwachung der Patienten ist von grosser Bedeutung , um moegliche Komplikationen rechtzeitig zu erkennen und so zur Verbesserung der Prognose beizutragen . Es wird ueber monozygote 13jaehrige maennliche Zwillinge berichtet , die neben den typischen Leitsymptomen erhoehte Verletzbarkeit der Haut , zahlreiche Narben an den Haenden und Atrophie der Mundschleimhaut sowie extrakutane Symptome wie Splenomegalie , Panzytopenie mit hochgradiger Markaplasie und aseptische Hueftkopfnekrose aufweisen . Beide Brueder zeigen einen nahezu identischen Krankheitsverlauf . Die vorliegende Arbeit gibt eine Uebersicht ueber Klinik , Pathogenese , Differentialdiagnosen und genetische Aspekte der DC . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O" ]
Zusammenfassung . Die Dyskeratosis congenita ( DC ) ist eine sehr seltene Genodermatose mit variablem Erscheinungsbild und ueberwiegend maennlichen Betroffenen . Leitsymptome sind Poikilodermie Onychodystrophie und Leukoplakie . , Zusaetzlich finden sich zahlreiche weitere kutane und systemische Manifestationsformen . Eine fruehzeitige Diagnosestellung und regelmaessige engmaschige Ueberwachung der Patienten ist von grosser Bedeutung , um moegliche Komplikationen rechtzeitig zu erkennen und so zur Verbesserung der Prognose beizutragen . Es wird ueber monozygote 13jaehrige maennliche Zwillinge berichtet , die neben den typischen Leitsymptomen erhoehte Verletzbarkeit der Haut , zahlreiche Narben an den Haenden und Atrophie der Mundschleimhaut sowie extrakutane Symptome wie Splenomegalie , Panzytopenie mit hochgradiger Markaplasie und aseptische Hueftkopfnekrose aufweisen . Beide Brueder zeigen einen nahezu identischen Krankheitsverlauf . Die vorliegende Arbeit gibt eine Uebersicht ueber Klinik , Pathogenese , Differentialdiagnosen und genetische Aspekte der DC .
[ "Zusammenfassung", ".", "Die", "Dyskeratosis", "congenita", "(", "DC", ")", "ist", "eine", "sehr", "seltene", "Genodermatose", "mit", "variablem", "Erscheinungsbild", "und", "ueberwiegend", "maennlichen", "Betroffenen", ".", "Leitsymptome", "sind", "Poikilodermie", "Onychodystrophie", "und", "Leukoplakie", ".", ",", "Zusaetzlich", "finden", "sich", "zahlreiche", "weitere", "kutane", "und", "systemische", "Manifestationsformen", ".", "Eine", "fruehzeitige", "Diagnosestellung", "und", "regelmaessige", "engmaschige", "Ueberwachung", "der", "Patienten", "ist", "von", "grosser", "Bedeutung", ",", "um", "moegliche", "Komplikationen", "rechtzeitig", "zu", "erkennen", "und", "so", "zur", "Verbesserung", "der", "Prognose", "beizutragen", ".", "Es", "wird", "ueber", "monozygote", "13jaehrige", "maennliche", "Zwillinge", "berichtet", ",", "die", "neben", "den", "typischen", "Leitsymptomen", "erhoehte", "Verletzbarkeit", "der", "Haut", ",", "zahlreiche", "Narben", "an", "den", "Haenden", "und", "Atrophie", "der", "Mundschleimhaut", "sowie", "extrakutane", "Symptome", "wie", "Splenomegalie", ",", "Panzytopenie", "mit", "hochgradiger", "Markaplasie", "und", "aseptische", "Hueftkopfnekrose", "aufweisen", ".", "Beide", "Brueder", "zeigen", "einen", "nahezu", "identischen", "Krankheitsverlauf", ".", "Die", "vorliegende", "Arbeit", "gibt", "eine", "Uebersicht", "ueber", "Klinik", ",", "Pathogenese", ",", "Differentialdiagnosen", "und", "genetische", "Aspekte", "der", "DC", "." ]
[ "umlsterm" ]
yeast is a species, Saccharomyces cerevisiae is a species, yeast is a species, Saccharomyces cerevisiae is a species, yeast is a species, yeast is a species, human is a species, human is a species, yeast is a species, Yeast is a species, S.cerevisiae is a species, Schizosaccharomyces pombe is a species, human is a species, human is a species, yeast is a species, human is a species, human is a species, mouse is a species, donkey is a species, mouse is a species, mouse is a species, yeast is a species, Staphylococcus aureus is a species, human is a species, Drosophila is a species, Caenorhabditis elegans is a species, human is a species, yeast is a species, human is a species, human is a species, human is a species, human is a species, human is a species, human is a species, human is a species, S.pombe is a species, Arabidopsis thaliana is a species, C.elegans is a species, Drosophila melanogaster is a species, mouse is a species, human is a species, yeast is a species, human is a species, yeast is a species, human is a species, yeast is a species, yeast is a species, yeast is a species, human is a species, human is a species, human is a species, yeast is a species, human is a species
88_task0
Sentence: Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis Abstract ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide. Enp1 protein is localized in the nucleus and concentrated in the nucleolus. An enp1-1 temperature-sensitive mutant inhibited 35S pre-rRNA early processing at sites A0, A1 and A2 as shown by northern analysis of steady state levels of rRNA precursors. Pulse-chase analysis further revealed that the enp1-1 strain was defective in the synthesis of 20S pre-rRNA and hence 18S rRNA, which led to reduced formation of 40S ribosomal subunits. Co-precipitation analysis revealed that Enp1 was associated with Nop1 protein, as well as with U3 and U14 RNAs, two snoRNAs implicated in early pre-rRNA processing steps. These results suggest a direct role for Enp1 in the early steps of rRNA processing. INTRODUCTION Ribosome biogenesis is one of the major cellular activities in eukaryotic cells. It takes place primarily in a specialized subnuclear compartment, the nucleolus (1,2). In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1). This 35S precursor goes through a series of modifications and processing steps to generate the mature 18S, 5.8S and 25S rRNAs. The processing occurs first at sites A0, A1 and A2, resulting in the 20S pre-rRNA and 27SA2 pre-rRNA. The 20S pre-rRNA is then cleaved, leading to the mature 18S rRNA found in the 40S ribosomal subunit. The 27SA2 pre-rRNA is processed through two alternative pathways. The majority of 27SA2 pre-rRNA is cleaved at sites A3 and B2 to form the 27SA3 pre-rRNA, which is subsequently processed to produce 27SBS. Alternatively, 27SA2 pre-rRNA can be processed at sites B1L and B2 to generate 27SBL pre-rRNA. Both 27SBS and 27SBL pre-rRNAs are then cleaved at sites C1 and C2 to generate the mature 25S rRNA, and 7SS or 7SL intermediates, which are then processed to mature 5.8SS or 5.8SL rRNAs (Fig. 1). The 25S rRNA and 5.8S rRNA are the RNA components of the 60S ribosomal subunit (3). During the course of rRNA modification and processing, many of the ribosomal proteins are assembled onto the rRNA molecules to form the ribosome complex. Ribosome biogenesis needs a large number of trans-acting factors, including small nucleolar RNAs (snoRNAs), protein components of the snoRNP complexes, rRNA modifying enzymes, endo- and exonucleases, putative RNA helicases and other protein factors (3,4). In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing. On the basis of their structure, the snoRNAs can be divided into two groups: the box C/D family and box H/ACA family. Only one snoRNA, MRP RNA, belongs to neither family (5–7). While the majority of the snoRNAs participate in RNA pseudouridylation and 2′-O-ribose methylation, a few of them, including MRP snoRNA, box C/D snoRNAs U3 and U14, and box H/ACA snoRNAs snR10 and snR30, are required for processing of the pre-rRNA (8–12). Not only are U3, U14, snR10 and snR30 essential for early cleavages of 35S pre-rRNA to 18S rRNA, the proteins associated with them, including Nop1, Nop5, Gar1 and Nop10, have also been shown to be required for 18S rRNA synthesis (13–16). The ENP1 (Essential Nuclear Protein 1) gene was identified in a genetic screen for suppressors of an ost4 mutation (oligosaccharide transferase 4) (17). However, in subsequent studies it was found not to be involved in OST4 function (18). ENP1 is an essential gene encoding a 483 amino acid polypeptide. The Enp1 protein is highly conserved and homologs are found in all eukaryotes. The yeast protein was localized to the nucleus in a previous study (18). On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19). In this study, we report that the Enp1 protein not only is nuclear but is enriched in the nucleolus. We also found that Enp1 is required for the synthesis of 40S ribosomal subunits, and its presence is necessary for the pre-rRNA processing to form 20S pre-rRNA and 18S rRNA. An association between Enp1 and U3 and U14 snoRNAs, and with the nucleolar protein Nop1, was established. We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved. MATERIALS AND METHODS Yeast strains and media The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938. Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18). Strain JBY46 [MATa Δenp1::his5+/pJB23 (ENP1, URA3, CEN6)] is a haploid strain derived from JBY45 with wild-type ENP1 on a low copy number plasmid. Strain JBY48 [MATa Δenp1::his5+/pJB19 (enp1-1, TRP1, CEN6)] and strain JBY49 [MATa Δenp1::his5+/pJB39 (enp1-2, TRP1, CEN6)] have plasmids with enp1 temperature-sensitive (ts) mutations. Strain JBY51 (MATa Δenp1::his5+ TRP1::enp1-1) is an enp1 ts strain generated by integrating the enp1-1 gene at the chromosomal trp1-1 locus. Strain CWY13 [MATa Δenp1::his5+/pJB24 (pMET25-GFP-ENP1, URA3, CEN6)] has GFP-ENP1 under control of the MET25 promoter. Strain CWY14 (MATa ENP1-TAP) was created by fusing sequences encoding a Tandem Affinity Purification (TAP) tag (20,21) to the 3′ end of ENP1. Strain YRH39 (MATα HST2-TAP) was created by fusing sequences encoding a TAP tag to the 3′end of HST2. Strain RS1938 (Δnop1::URA3 pUN100-ProtA-NOP1) was created by transforming RS1935 (MATa/α leu2/leu2 ura3/ura3 lys2/lys2 ade2/ade2 Δnop1::URA3/NOP1) with pUN100-ProtA-NOP1 (strain and plasmid supplied by T. Schafer), followed by tetrad dissection. Strain CWY15 [MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a. The media used were prepared as described (22). Cloning of ENP1 pRS426-MEG1 (The original name of ENP1) was a gift from Dr William J. Lennarz. It contains the ENP1 gene within a 2.6 kb EcoRI genomic fragment cloned into pRS426 (18). The EcoRI fragment was subsequently cloned into pRS314 (TRP1, CEN6), pRS316 (URA3, CEN6) and pRS424 (TRP1, 2µ) to create pJB20, pJB23 and pJB21, respectively. pGFP-N-FUS is a centromeric plasmid for fusing green fluorescence protein (GFP) to a polypeptide’s N-terminus under control of the MET25 promoter (23). Cloning the ENP1 ORF into pGFP-N-FUS via XbaI and SalI sites generated plasmid pJB24. pJB19 (enp1-1, TRP1, CEN6) contains the enp1-1 mutant gene. The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively. The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118. Random mutagenesis of ENP1 to generate enp1 ts mutants The enp1 ts mutants were generated with a protocol introducing random mutations by PCR (25). The PCR was performed with oligonucleotides ENP1-MUT5′ (5′-GGTGGTGTCAGT AGGGGA-3′), ENP1-MUT3′ (5′-CAGTCTGCAATATA TGGAC-3′) and plasmid template pJB20 (see above). The nucleotide concentrations in the reaction were 1 mM each for dATP, dGTP, dCTP and dTTP. After strain JBY46 was transformed with the PCR product and with pJB20 gapped by NheI and NsiI, the transformants were replica-plated onto two plates containing 5-FOA synthetic medium without tryptophan; one replica was incubated at 23°C and the other at 37°C. Colonies growing at 23°C but not at 37°C were picked as candidates. Since approximately 10% of the colonies were inviable at both temperatures, we knew that 10% of the ENP1 PCR products lost their function after the PCR mutagenesis. This confirmed the effectiveness of the mutagenesis procedure. Two candidates showed good growth at 23°C but no growth at 37°C. They were named strains JBY48 and JBY49 and contained plasmids with the enp1-1 and enp1-2 mutations, respectively. The mutated enp1-1 gene on pJB19 was cloned into an integration vector, pRS304, as an EcoRI fragment. The plasmid was subsequently linearized with SnaBI within the TRP1 marker and was integrated at the chromosomal trp1-1 locus of strain JBY46. Selection on 5-FOA was used to remove plasmid pJB23, creating strain JBY51. Sucrose gradient analysis Polyribosome preparation and analysis were carried out essentially as described (26). Cells grown in YPD were collected at mid-log phase (OD600 0.8–1.0) and were broken with glass beads. The lysate was frozen immediately in liquid N2 and was stored at –80°C. Lysate (30 U of absorbance at OD260) was layered over a 7–47% (w/v) sucrose gradient, which was centrifuged at 28 000 r.p.m. for 5 h at 4°C in a SW28 rotor and was analyzed with an ISCO UA-5 gradient UV detection system on absorbency at 254 nm. Immunofluorescence Immunofluorescence analysis was carried out essentially as described (27). Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution. Images were taken on a Zeiss Axioplan2 microscope equipped with a Zeiss AxioCam camera. Pulse-chase labeling analysis of rRNA For [methyl-3H]methionine pulse-chase analysis, cells were grown in synthetic medium without methionine at room temperature or 37°C for 2 h. When the OD600 reached 1.0, 6 ml of the culture were pulse-labeled with 250 µCi [methyl-3H]methionine (Amersham Pharmacia) for 3 min and chased with cold methionine (500 µg/ml) for 2, 4 or 12 min. For each time point of the chase 1.25 ml of culture was mixed with ice and collected. The pellets were frozen immediately in liquid N2 and stored at –80°C before total RNA was purified using a hot phenol method (28). The RNAs were separated on a 1.2% agarose formaldehyde gel and transferred onto Hybond-N+ nylon membranes (Amersham Pharmacia). After being sprayed with EN3HANCE (Du Pont), the membranes were exposed to film at –80°C (29). Northern analysis Cells were grown inYPD at room temperature or 37°C for 2–4 h. When the OD600 reached 1.0, 10 ml of cells were collected and frozen immediately. Total RNA was extracted as described (28). Five micrograms of RNA were separated on 1.2% agarose formaldehyde gels (for high molecular weight RNA) or on 6% polyacrylamide 7 M urea denaturing gels (for low molecular weight RNA) for each sample. The RNA was then transferred to Zeta-Probe GT nylon membranes (Bio-Rad). Probes for hybridyzation were specific oligonucleotides end-labeled using [γ-32P]ATP. After hybridization and washes, membranes were exposed to phosphorimager screens or X-ray films (29). Oligonucleotides specific for various regions of 35S pre-rRNA are: 1, GGTCTCTCTGCTGCCG GAAATG; 3, AATGAGCCATTCGCAGTTTCACTG; 4, GCTCTCATGCTCTTGCCAAAAC; 5, TGTTTGTTACCT CTGGGCCCCG; 6, TCCAGTTACGAAAATTCTTG; 7, CGTATCGCATTTCGCTGCGTTC; 8, GTTCGCCTAGAC GCTCTCTCTTC; 9, GCGAGATTCCCCTACCCAC. The regions complementary to these oligonucleotides are shown in Figure 6A. The oligonucleotides probing box C/D snoRNAs are: U3, TTCGGTTTCTCACTCACTCTGGGGTAC; U14, GGAACCAGTCTTTCATCACCGTG. The oligonucleotides probing box H/ACA snoRNAs are: snoRNA10, CCTTG CAACGGTCCTCATCCGGG; snoRNA30, GTCCGAAGC GCCATCTAGATGA. RNA and protein precipitation analysis Cells were grown in YPD (1 l) to OD600 1.0, then collected, washed once in ice-cold PBS and broken using glass beads in 10 ml IPP150 buffer (10 mM Tris pH 8.0, 150 mM NaCl and 0.1% NP-40) with protease inhibitors. The lysates were mixed with 200 µl IgG agarose beads for 2 h at 4°C. After several washes with 50 ml IPP150 buffer, the IgG beads were collected and the RNA associated with the beads extracted by the hot phenol method (28). One-tenth of the precipitated RNA was then separated on 6% polyacrylamide 7 M urea denaturing gels and electro-transferred to Zeta-Probe GT nylon membranes. They were probed with [γ-32P]ATP labeled oligonucleotides. For the lanes showing total RNA, 2 µg RNA prepared from exponentially growing cultures were loaded. For co-precipitation analysis of proteins, the IgG beads were resuspended in 2× Laemmli sample buffer, boiled for 5 min and separated by SDS–polyacrylamide gel electrophoresis. Approximately 1% of the precipitate was loaded onto each lane. For the total protein, 0.1% of the extract prior to precipitation was loaded onto each lane. Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution. The antibody complexes were detected using ECL-Plus reagents (Amersham Pharmacia) as specified by the manufacturer. RESULTS Construction and analysis of ENP1 temperature-sensitive alleles ENP1 is an essential yeast gene conserved among eukaryotes (18). To study its functions, we first created a diploid strain, JBY45, heterozygous for the Δenp1 mutation. Then two enp1 ts mutant alleles (enp1-1 and enp1-2) were generated by random PCR mutagenesis, as described in Materials and Methods. Both mutant alleles were recessive to the wild-type ENP1 gene. The enp1-1 gene was integrated into the chromosomal trp1-1 locus to create strain JBY51 and all subsequent experiments were done with this enp1 allele. At 23°C the growth of JBY51 was comparable to that of W303-1a (ENP1), but at 37°C it did not grow (Fig. 2). Sequence analysis revealed that enp1-1 contains two point mutations, resulting in substitutions of two amino acids: W242→G and V415→A. No attempt was made to determine whether both mutations were required for the ts phenotype. Flow cytometry of strain JBY51 showed DNA content profiles similar to those of the wild-type strain at the non-permissive temperature (data not shown), suggesting that ENP1 is not involved in cell cycle regulation. Enp1 is enriched in the nucleolus Enp1 tagged at the C-terminus with the myc epitope was previously found to localize to the nucleus (18). To expand this analysis, we fused GFP to the N-terminus of Enp1, and expressed the tagged Enp1 protein under control of the MET25 promoter as the sole source of Enp1 protein in the cells. Cells of strain CWY13 (pMET25-GFP-ENP1) were grown in media with methionine (transcription partially repressed) or without methionine (transcription not repressed). Growth of CWY13 was comparable to that of wild-type cells in both media (data not shown), indicating that the GFP tagged Enp1 protein was functional. In cells cultured in medium without methionine, in which the ENP transcription was not repressed, the GFP-Enp1 protein was expressed at a high level and showed strong green fluorescence distributed throughout the nucleus (data not shown), consistent with the original observation (18). With methionine added to the medium, however, the fluorescent signal of GFP-Enp1 was weaker and surprisingly showed crescent or cap-like patterns typical of nucleolar proteins (Fig. 3A). This nucleolar enrichment was confirmed by its co-localization with the nucleolar protein Nop1 (Fig. 3B). ENP1 mutation leads to reduced levels of 40S ribosomal subunits The nucleolar enrichment suggested that Enp1 might play some role in ribosome synthesis. To test this possibility, cells of W303-1a (ENP1), JBY51 (enp1-1) and a top2 ts strain RS191 (30) were grown in YPD at 23 or 37°C and their ribosome profiles analyzed after separation on sucrose gradients. At 23°C, enp1-1 cells showed polysome profiles similar to those of the wild-type and top2-1 strains (Fig. 4A–C). In contrast, after incubation at the non-permissive temperature (37°C) for 40 min (data not shown) and 2 h, enp1-1 cells had reduced levels of 40S ribosomal subunits, 80S monosomes and polysomes, along with a dramatic increase in the free 60S subunit peak (Fig. 4F), while the wild-type and top2-1 cells showed little change in polysome profile at 37°C (Fig. 4D and E). These results demonstrate that the changes of the enp1-1 polysome profile were due to specific defects caused by the enp1-1 mutation, and not due simply to the shift to 37°C for a wild-type or ts strain. The processing of pre-rRNA for 18S rRNA is impaired in enp1 mutants In most cases reductions in ribosomal subunit levels are the results of defects in pre-rRNA processing or ribosome assembly or both (3). To study the mechanism by which Enp1 affects the 40S subunit, we analyzed the effects of enp1 mutations on processing of the pre-rRNA using pulse-chase labeling. [methyl-3H]methionine is preferred for labeling rRNAs in pulse-chase analysis because rRNAs are specifically methylated during the early steps of the processing. Cells of W303-1a (ENP1) and JBY51 (enp1-1) were grown at 23 or 37°C for 2 h before they were labeled with [methyl-3H]methionine for 3 min and chased with cold methionine for 2, 4 and 12 min. In wild-type cells, the labeled 35S rRNA precursor, 27S and 20S rRNA intermediates were rapidly chased into mature 25S and 18S rRNAs (Fig. 5), at 23 or 37°C. In contrast, enp1-1 cells showed dramatic changes after incubation at 37°C. Although at 23°C the synthesis and processing were comparable to those of wild-type cells, cells cultured at 37°C for 2 h had neither 20S pre-rRNA nor 18S rRNA, while 25S rRNA was generated at normal levels. The 37°C grown enp1-1 cells also had low levels of aberrant 23S and possibly 21S intermediates (Fig. 5). The defect in 18S rRNA synthesis was further supported by pulse-chase experiments carried out using [5,6-3H]uracil. The results obtained were essentially the same; no 20S pre-rRNA or 18S rRNA was produced, while processing to 25S rRNA was not affected (data not shown). Taken together, these results suggested that the enp1 mutation leads to specific defects in the processing pathway for 20S pre-rRNA and 18S rRNA, resulting in reduced 40S subunit synthesis and a lowered level of the 40S subunit. Enp1 is required for pre-rRNA processing at A0, A1 and A2 sites To define the processing steps affected by the enp1 mutation, the steady state levels of rRNA precursors and mature RNAs were analyzed by northern blotting. Total RNAs were isolated from cells of W303-1a (ENP1) and JBY51 (enp1-1) grown at 37°C for 2 or 4 h. After separation on formaldehyde agarose, RNAs were transferred onto nylon membranes and probed with radiolabeled oligonucleotides specific to various regions of the 35S pre-rRNA (Fig. 6A). After incubation at 37°C, enp1-1 cells had wild-type levels of 25S rRNA, but reduced levels of 18S rRNA (Fig. 6B). A probe specific to ITS1 (P5) further revealed that enp1-1 cells incubated at the non-permissive temperature accumulated two aberrant rRNAs, 23S and 21S (Fig. 6C). Aberrant rRNA processing products of similar sizes have been described in numerous studies (14,31–34) and result from defects in processing at A0, A1 and A2. Additional probes were used to verify the origins of the 23S and 21S RNAs in the enp1-1 strain. The 23S product was detected by oligos 1, 2, 4 and 5, but not by oligos 6, 7 or 8 (Fig. 6D, E, C, F, G and data not shown). Thus this RNA extends from the 5′ end of the 35S rRNA to the A3 site. The 21S product was detected by oligos 4 and 5, but not by oligos 1, 2, 6, 7 and 8 (Fig. 6E, C, D, F, G and data not shown), indicating that it extends from the A1 to the A3 site. At 37°C the enp1-1 cells also had less 32S and 20S rRNA intermediates (Fig. 6B and E). These results suggest that the enp1 mutation led to complete or nearly complete inhibition of processing at site A0 and A2, and partial inhibition of processing at site A1. As a consequence, the 35S pre-rRNA was cleaved at site A3 instead, producing 23S and 21S rRNA products. Consistent with this theory, the 27SA2 rRNA intermediate level was greatly reduced in enp1 cells at 37°C (Fig. 6C) due to the inhibition of processing at A2, while the 27SB pre-rRNA level was similar to wild-type cells (Fig. 6G). Moreover, no difference in the 5.8 rRNA level was observed between the wild-type cells and enp1 cells (Fig. 6H). Enp1 is associated with U3 and U14 snoRNAs and with Nop1 It has previously been shown that mutations in the U3, U14, snR10 and snR30 snoRNAs and in their associated proteins affect processing of 35S pre-rRNA at A0, A1 and A2. Because of the similarity with the processing defects of enp1-1 strains, we tested the association between Enp1 and snoRNAs. To do this, we created a strain in which a TAP tag was fused to the C-terminus of Enp1. The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity. Cells grew well with the TAP-tagged Enp1 as the only source of Enp1 protein, showing that it was functional. As a control, we used a TAP tag on an unrelated cytoplasmic protein, Hst2. Strain CWY14 (ENP1-TAP) and the Hst2-TAP tagged strain were grown in YPD to mid-exponential phase before being harvested. Extracts were prepared and mixed with IgG agarose beads to precipitate Enp1-TAP and associated RNAs. Total RNAs were extracted from washed IgG beads, separated on 6% polyacrylamide denaturing gels, transferred to nylon membranes and probed with radiolabeled oligonucleotides. Northern analysis revealed that Enp1-TAP precipitates were enriched with U3 and U14 snoRNAs relative to precipitates from the Hst2-tagged strain (Fig. 7A). The Enp1-TAP samples were not enriched with snR30 snoRNA (Fig. 7A), nor with U24 or U18 snoRNAs (data not shown). We found no change in the levels of U3, U14, snR10 and snR30 snoRNAs in the enp1 mutant, indicating that the mutation did not affect snoRNAs levels (Fig. 6I). The results indicate that Enp1 associates in vivo with U3 and U14 snoRNAs. Much less U3 RNA co-immunoprecipitated with Enp1-TAP than with Protein A-tagged Nop1, which is known to associate with U3 and U14 snoRNAs (Fig. 7A). However, Protein A-Nop1 was much more efficiently precipitated than was the Enp1-TAP protein (data not shown). Therefore, it is likely that similar amounts of RNAs are associated with the two proteins and that the proteins are part of the same complex. To address this further, we checked for the presence of Nop1 in the Enp1-TAP immunoprecipitates. Figure 7B shows that Nop1 indeed is in the Enp1 precipitate but not in the Hst2 control, whereas an abundant ribosomal protein, L3, is in neither precipitate. U3 and U14 snoRNAs have been shown to interact with rRNA precursors and these interactions are required for pre-rRNA processing (35–37). Using an in vitro system, U3 was also shown to be associated with its rRNA substrate and processing product (38). This raised the possibility that Enp1 might also be associated with rRNAs since its function in rRNA processing appeared linked to those of U3 and U14 snoRNAs. To test this possibility, we further analyzed the RNAs that co-precipiate with TAP-tagged Enp1. The RNAs were separated on 1.2% agarose formaldehyde gels or on polyacrylamide denaturing gels, transferred to nylon membranes and probed with radiolabeled oligonucleotides for pre-rRNAs. A probe (P4; see Fig. 6) specific to 20s and its precursors revealed that pre-rRNAs 35S, 33S, 32S and 20S specifically co-precipitated with Enp1-TAP (Fig. 7C). No such enrichment was found using a probe (P8; see Fig. 6) specific for 27S RNAs or a probe for 5.8S RNA (Fig. 7C). These results clearly demonstrated that Enp1 is associated with substrates and products of the early steps of 18S rRNA processing. Comparison of Enp1 with homologs in other organisms Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18). A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19). In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39). Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6. The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence. Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences. Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse. The alignment of the homologs showed that they shared homology from the N-terminus to the C-terminus, with the C-terminal half extremely well conserved, with close to 90% similarity (Fig. 8). One interesting observation is that the two amino acids changed in the enp1-1 mutant, W242 and V415, are conserved among all homologs. The human Enp1 homolog was cloned and expressed in yeast and tested for function. Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant. However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown). DISCUSSION ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18). ENP1 was shown to be essential for viability and the Enp1 protein localized to the nucleus (18). When we re-examined the localization of Enp1, we observed that the protein was enriched in the nucleolus. This finding led us to test for a role of Enp1 in ribosome synthesis. Using an enp1 ts mutant, we found that depletion of Enp1 caused a 40S ribosomal subunit deficiency. Further analysis revealed that this deficiency was not due to a change of the subunit’s stability, but to a defect in the synthesis of the subunit’s 18S rRNA component. Pulse-chase analysis of RNA synthesis in an enp1-1 strain revealed that no 20S pre-rRNA or 18S rRNA was made at the non-permissive temperature, while levels of 25S rRNA appeared normal. Low levels of precursors to 18S rRNA were detected in the mutants, and they were extremely unstable. Northern analysis of steady state RNA levels demonstrated that the enp1 mutation specifically inhibited the pre-rRNA early cleavages at sites A0, A1 and A2, which are required for the production of the 20S pre-rRNA and the 18S rRNA. These defects of the enp1 mutation on rRNA processing are very similar to those caused by mutation of KRR1, another essential nucleolar gene required for synthesis of the 40S, but not the 60S subunit (40). Co-precipitation analyses provided strong evidence that Enp1 is directly involved in pre-rRNA processing. In these experiments, TAP-tagged Enp1 bound to IgG beads specifically co-precipitated with two snoRNAs, U3 and U14, and with the 35S, 33S, 32S and 20S pre-rRNAs. Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing. It has been shown that mutations in U3, U14, snR10 and snR30 snoRNAs and protein components of the snoRNPs affect processing at sites A0, A1 or A2 (15,16,41,42). Enp1’s interaction with U3 and U14 snoRNAs suggests that Enp1’s function in rRNA processing involves these two snoRNAs. The fact that the nucleolar protein, Nop1, known to bind to U3 and U14 RNAs, also was found in the Enp1 precipitate, provides additional evidence that Enp1 is part of a complex involved in processing of rRNA. Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43). These proteins included Imp4, Kre31, Kre33, Mpp10, Nop1, Nop14 and Sof1, all of which have been implicated in 18S RNA processing or 40S biogenesis. Very recently (after the studies in this manuscript were concluded) Grandi et al. published an analysis of components of the 90s preribosomal particle, which include the 35S pre-rRNA, U3 snoRNP and rRNA processing factors for the 40S subunit (44). In agreement with our findings, they found that Enp1 is a component of this 90s complex and also of a smaller complex containing the 20S pre-rRNA. Surprisingly, none of the other proteins involved in processing of pre-rRNAs that were tested associated with the 20S rRNA, suggesting that those proteins, but not Enp1, are released prior to 20S pre-rRNA formation (44). The authors also showed co-precipitation of Enp1 with dimethylated 20S pre-rRNA, which is formed after export of 20S to the cytoplasm. These results of Grandi et al. suggest that Enp1 may also be involved in later steps of processing or nuclear export. A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19). Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids. Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown). This strongly suggests that the conserved function of Enp1 is in rRNA processing. The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog. It will be important to study the nature of the associations between Enp1 and U3 and U14 snoRNPs, and to learn more about the exact role of Enp1 in ribosomal RNA processing. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: species
[ "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "B-species", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "B-species", "I-species", "O", "B-species", "O", "B-species", "I-species", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis Abstract ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide. Enp1 protein is localized in the nucleus and concentrated in the nucleolus. An enp1-1 temperature-sensitive mutant inhibited 35S pre-rRNA early processing at sites A0, A1 and A2 as shown by northern analysis of steady state levels of rRNA precursors. Pulse-chase analysis further revealed that the enp1-1 strain was defective in the synthesis of 20S pre-rRNA and hence 18S rRNA, which led to reduced formation of 40S ribosomal subunits. Co-precipitation analysis revealed that Enp1 was associated with Nop1 protein, as well as with U3 and U14 RNAs, two snoRNAs implicated in early pre-rRNA processing steps. These results suggest a direct role for Enp1 in the early steps of rRNA processing. INTRODUCTION Ribosome biogenesis is one of the major cellular activities in eukaryotic cells. It takes place primarily in a specialized subnuclear compartment, the nucleolus (1,2). In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1). This 35S precursor goes through a series of modifications and processing steps to generate the mature 18S, 5.8S and 25S rRNAs. The processing occurs first at sites A0, A1 and A2, resulting in the 20S pre-rRNA and 27SA2 pre-rRNA. The 20S pre-rRNA is then cleaved, leading to the mature 18S rRNA found in the 40S ribosomal subunit. The 27SA2 pre-rRNA is processed through two alternative pathways. The majority of 27SA2 pre-rRNA is cleaved at sites A3 and B2 to form the 27SA3 pre-rRNA, which is subsequently processed to produce 27SBS. Alternatively, 27SA2 pre-rRNA can be processed at sites B1L and B2 to generate 27SBL pre-rRNA. Both 27SBS and 27SBL pre-rRNAs are then cleaved at sites C1 and C2 to generate the mature 25S rRNA, and 7SS or 7SL intermediates, which are then processed to mature 5.8SS or 5.8SL rRNAs (Fig. 1). The 25S rRNA and 5.8S rRNA are the RNA components of the 60S ribosomal subunit (3). During the course of rRNA modification and processing, many of the ribosomal proteins are assembled onto the rRNA molecules to form the ribosome complex. Ribosome biogenesis needs a large number of trans-acting factors, including small nucleolar RNAs (snoRNAs), protein components of the snoRNP complexes, rRNA modifying enzymes, endo- and exonucleases, putative RNA helicases and other protein factors (3,4). In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing. On the basis of their structure, the snoRNAs can be divided into two groups: the box C/D family and box H/ACA family. Only one snoRNA, MRP RNA, belongs to neither family (5–7). While the majority of the snoRNAs participate in RNA pseudouridylation and 2′-O-ribose methylation, a few of them, including MRP snoRNA, box C/D snoRNAs U3 and U14, and box H/ACA snoRNAs snR10 and snR30, are required for processing of the pre-rRNA (8–12). Not only are U3, U14, snR10 and snR30 essential for early cleavages of 35S pre-rRNA to 18S rRNA, the proteins associated with them, including Nop1, Nop5, Gar1 and Nop10, have also been shown to be required for 18S rRNA synthesis (13–16). The ENP1 (Essential Nuclear Protein 1) gene was identified in a genetic screen for suppressors of an ost4 mutation (oligosaccharide transferase 4) (17). However, in subsequent studies it was found not to be involved in OST4 function (18). ENP1 is an essential gene encoding a 483 amino acid polypeptide. The Enp1 protein is highly conserved and homologs are found in all eukaryotes. The yeast protein was localized to the nucleus in a previous study (18). On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19). In this study, we report that the Enp1 protein not only is nuclear but is enriched in the nucleolus. We also found that Enp1 is required for the synthesis of 40S ribosomal subunits, and its presence is necessary for the pre-rRNA processing to form 20S pre-rRNA and 18S rRNA. An association between Enp1 and U3 and U14 snoRNAs, and with the nucleolar protein Nop1, was established. We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved. MATERIALS AND METHODS Yeast strains and media The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938. Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18). Strain JBY46 [MATa Δenp1::his5+/pJB23 (ENP1, URA3, CEN6)] is a haploid strain derived from JBY45 with wild-type ENP1 on a low copy number plasmid. Strain JBY48 [MATa Δenp1::his5+/pJB19 (enp1-1, TRP1, CEN6)] and strain JBY49 [MATa Δenp1::his5+/pJB39 (enp1-2, TRP1, CEN6)] have plasmids with enp1 temperature-sensitive (ts) mutations. Strain JBY51 (MATa Δenp1::his5+ TRP1::enp1-1) is an enp1 ts strain generated by integrating the enp1-1 gene at the chromosomal trp1-1 locus. Strain CWY13 [MATa Δenp1::his5+/pJB24 (pMET25-GFP-ENP1, URA3, CEN6)] has GFP-ENP1 under control of the MET25 promoter. Strain CWY14 (MATa ENP1-TAP) was created by fusing sequences encoding a Tandem Affinity Purification (TAP) tag (20,21) to the 3′ end of ENP1. Strain YRH39 (MATα HST2-TAP) was created by fusing sequences encoding a TAP tag to the 3′end of HST2. Strain RS1938 (Δnop1::URA3 pUN100-ProtA-NOP1) was created by transforming RS1935 (MATa/α leu2/leu2 ura3/ura3 lys2/lys2 ade2/ade2 Δnop1::URA3/NOP1) with pUN100-ProtA-NOP1 (strain and plasmid supplied by T. Schafer), followed by tetrad dissection. Strain CWY15 [MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a. The media used were prepared as described (22). Cloning of ENP1 pRS426-MEG1 (The original name of ENP1) was a gift from Dr William J. Lennarz. It contains the ENP1 gene within a 2.6 kb EcoRI genomic fragment cloned into pRS426 (18). The EcoRI fragment was subsequently cloned into pRS314 (TRP1, CEN6), pRS316 (URA3, CEN6) and pRS424 (TRP1, 2µ) to create pJB20, pJB23 and pJB21, respectively. pGFP-N-FUS is a centromeric plasmid for fusing green fluorescence protein (GFP) to a polypeptide’s N-terminus under control of the MET25 promoter (23). Cloning the ENP1 ORF into pGFP-N-FUS via XbaI and SalI sites generated plasmid pJB24. pJB19 (enp1-1, TRP1, CEN6) contains the enp1-1 mutant gene. The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively. The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118. Random mutagenesis of ENP1 to generate enp1 ts mutants The enp1 ts mutants were generated with a protocol introducing random mutations by PCR (25). The PCR was performed with oligonucleotides ENP1-MUT5′ (5′-GGTGGTGTCAGT AGGGGA-3′), ENP1-MUT3′ (5′-CAGTCTGCAATATA TGGAC-3′) and plasmid template pJB20 (see above). The nucleotide concentrations in the reaction were 1 mM each for dATP, dGTP, dCTP and dTTP. After strain JBY46 was transformed with the PCR product and with pJB20 gapped by NheI and NsiI, the transformants were replica-plated onto two plates containing 5-FOA synthetic medium without tryptophan; one replica was incubated at 23°C and the other at 37°C. Colonies growing at 23°C but not at 37°C were picked as candidates. Since approximately 10% of the colonies were inviable at both temperatures, we knew that 10% of the ENP1 PCR products lost their function after the PCR mutagenesis. This confirmed the effectiveness of the mutagenesis procedure. Two candidates showed good growth at 23°C but no growth at 37°C. They were named strains JBY48 and JBY49 and contained plasmids with the enp1-1 and enp1-2 mutations, respectively. The mutated enp1-1 gene on pJB19 was cloned into an integration vector, pRS304, as an EcoRI fragment. The plasmid was subsequently linearized with SnaBI within the TRP1 marker and was integrated at the chromosomal trp1-1 locus of strain JBY46. Selection on 5-FOA was used to remove plasmid pJB23, creating strain JBY51. Sucrose gradient analysis Polyribosome preparation and analysis were carried out essentially as described (26). Cells grown in YPD were collected at mid-log phase (OD600 0.8–1.0) and were broken with glass beads. The lysate was frozen immediately in liquid N2 and was stored at –80°C. Lysate (30 U of absorbance at OD260) was layered over a 7–47% (w/v) sucrose gradient, which was centrifuged at 28 000 r.p.m. for 5 h at 4°C in a SW28 rotor and was analyzed with an ISCO UA-5 gradient UV detection system on absorbency at 254 nm. Immunofluorescence Immunofluorescence analysis was carried out essentially as described (27). Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution. Images were taken on a Zeiss Axioplan2 microscope equipped with a Zeiss AxioCam camera. Pulse-chase labeling analysis of rRNA For [methyl-3H]methionine pulse-chase analysis, cells were grown in synthetic medium without methionine at room temperature or 37°C for 2 h. When the OD600 reached 1.0, 6 ml of the culture were pulse-labeled with 250 µCi [methyl-3H]methionine (Amersham Pharmacia) for 3 min and chased with cold methionine (500 µg/ml) for 2, 4 or 12 min. For each time point of the chase 1.25 ml of culture was mixed with ice and collected. The pellets were frozen immediately in liquid N2 and stored at –80°C before total RNA was purified using a hot phenol method (28). The RNAs were separated on a 1.2% agarose formaldehyde gel and transferred onto Hybond-N+ nylon membranes (Amersham Pharmacia). After being sprayed with EN3HANCE (Du Pont), the membranes were exposed to film at –80°C (29). Northern analysis Cells were grown inYPD at room temperature or 37°C for 2–4 h. When the OD600 reached 1.0, 10 ml of cells were collected and frozen immediately. Total RNA was extracted as described (28). Five micrograms of RNA were separated on 1.2% agarose formaldehyde gels (for high molecular weight RNA) or on 6% polyacrylamide 7 M urea denaturing gels (for low molecular weight RNA) for each sample. The RNA was then transferred to Zeta-Probe GT nylon membranes (Bio-Rad). Probes for hybridyzation were specific oligonucleotides end-labeled using [γ-32P]ATP. After hybridization and washes, membranes were exposed to phosphorimager screens or X-ray films (29). Oligonucleotides specific for various regions of 35S pre-rRNA are: 1, GGTCTCTCTGCTGCCG GAAATG; 3, AATGAGCCATTCGCAGTTTCACTG; 4, GCTCTCATGCTCTTGCCAAAAC; 5, TGTTTGTTACCT CTGGGCCCCG; 6, TCCAGTTACGAAAATTCTTG; 7, CGTATCGCATTTCGCTGCGTTC; 8, GTTCGCCTAGAC GCTCTCTCTTC; 9, GCGAGATTCCCCTACCCAC. The regions complementary to these oligonucleotides are shown in Figure 6A. The oligonucleotides probing box C/D snoRNAs are: U3, TTCGGTTTCTCACTCACTCTGGGGTAC; U14, GGAACCAGTCTTTCATCACCGTG. The oligonucleotides probing box H/ACA snoRNAs are: snoRNA10, CCTTG CAACGGTCCTCATCCGGG; snoRNA30, GTCCGAAGC GCCATCTAGATGA. RNA and protein precipitation analysis Cells were grown in YPD (1 l) to OD600 1.0, then collected, washed once in ice-cold PBS and broken using glass beads in 10 ml IPP150 buffer (10 mM Tris pH 8.0, 150 mM NaCl and 0.1% NP-40) with protease inhibitors. The lysates were mixed with 200 µl IgG agarose beads for 2 h at 4°C. After several washes with 50 ml IPP150 buffer, the IgG beads were collected and the RNA associated with the beads extracted by the hot phenol method (28). One-tenth of the precipitated RNA was then separated on 6% polyacrylamide 7 M urea denaturing gels and electro-transferred to Zeta-Probe GT nylon membranes. They were probed with [γ-32P]ATP labeled oligonucleotides. For the lanes showing total RNA, 2 µg RNA prepared from exponentially growing cultures were loaded. For co-precipitation analysis of proteins, the IgG beads were resuspended in 2× Laemmli sample buffer, boiled for 5 min and separated by SDS–polyacrylamide gel electrophoresis. Approximately 1% of the precipitate was loaded onto each lane. For the total protein, 0.1% of the extract prior to precipitation was loaded onto each lane. Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution. The antibody complexes were detected using ECL-Plus reagents (Amersham Pharmacia) as specified by the manufacturer. RESULTS Construction and analysis of ENP1 temperature-sensitive alleles ENP1 is an essential yeast gene conserved among eukaryotes (18). To study its functions, we first created a diploid strain, JBY45, heterozygous for the Δenp1 mutation. Then two enp1 ts mutant alleles (enp1-1 and enp1-2) were generated by random PCR mutagenesis, as described in Materials and Methods. Both mutant alleles were recessive to the wild-type ENP1 gene. The enp1-1 gene was integrated into the chromosomal trp1-1 locus to create strain JBY51 and all subsequent experiments were done with this enp1 allele. At 23°C the growth of JBY51 was comparable to that of W303-1a (ENP1), but at 37°C it did not grow (Fig. 2). Sequence analysis revealed that enp1-1 contains two point mutations, resulting in substitutions of two amino acids: W242→G and V415→A. No attempt was made to determine whether both mutations were required for the ts phenotype. Flow cytometry of strain JBY51 showed DNA content profiles similar to those of the wild-type strain at the non-permissive temperature (data not shown), suggesting that ENP1 is not involved in cell cycle regulation. Enp1 is enriched in the nucleolus Enp1 tagged at the C-terminus with the myc epitope was previously found to localize to the nucleus (18). To expand this analysis, we fused GFP to the N-terminus of Enp1, and expressed the tagged Enp1 protein under control of the MET25 promoter as the sole source of Enp1 protein in the cells. Cells of strain CWY13 (pMET25-GFP-ENP1) were grown in media with methionine (transcription partially repressed) or without methionine (transcription not repressed). Growth of CWY13 was comparable to that of wild-type cells in both media (data not shown), indicating that the GFP tagged Enp1 protein was functional. In cells cultured in medium without methionine, in which the ENP transcription was not repressed, the GFP-Enp1 protein was expressed at a high level and showed strong green fluorescence distributed throughout the nucleus (data not shown), consistent with the original observation (18). With methionine added to the medium, however, the fluorescent signal of GFP-Enp1 was weaker and surprisingly showed crescent or cap-like patterns typical of nucleolar proteins (Fig. 3A). This nucleolar enrichment was confirmed by its co-localization with the nucleolar protein Nop1 (Fig. 3B). ENP1 mutation leads to reduced levels of 40S ribosomal subunits The nucleolar enrichment suggested that Enp1 might play some role in ribosome synthesis. To test this possibility, cells of W303-1a (ENP1), JBY51 (enp1-1) and a top2 ts strain RS191 (30) were grown in YPD at 23 or 37°C and their ribosome profiles analyzed after separation on sucrose gradients. At 23°C, enp1-1 cells showed polysome profiles similar to those of the wild-type and top2-1 strains (Fig. 4A–C). In contrast, after incubation at the non-permissive temperature (37°C) for 40 min (data not shown) and 2 h, enp1-1 cells had reduced levels of 40S ribosomal subunits, 80S monosomes and polysomes, along with a dramatic increase in the free 60S subunit peak (Fig. 4F), while the wild-type and top2-1 cells showed little change in polysome profile at 37°C (Fig. 4D and E). These results demonstrate that the changes of the enp1-1 polysome profile were due to specific defects caused by the enp1-1 mutation, and not due simply to the shift to 37°C for a wild-type or ts strain. The processing of pre-rRNA for 18S rRNA is impaired in enp1 mutants In most cases reductions in ribosomal subunit levels are the results of defects in pre-rRNA processing or ribosome assembly or both (3). To study the mechanism by which Enp1 affects the 40S subunit, we analyzed the effects of enp1 mutations on processing of the pre-rRNA using pulse-chase labeling. [methyl-3H]methionine is preferred for labeling rRNAs in pulse-chase analysis because rRNAs are specifically methylated during the early steps of the processing. Cells of W303-1a (ENP1) and JBY51 (enp1-1) were grown at 23 or 37°C for 2 h before they were labeled with [methyl-3H]methionine for 3 min and chased with cold methionine for 2, 4 and 12 min. In wild-type cells, the labeled 35S rRNA precursor, 27S and 20S rRNA intermediates were rapidly chased into mature 25S and 18S rRNAs (Fig. 5), at 23 or 37°C. In contrast, enp1-1 cells showed dramatic changes after incubation at 37°C. Although at 23°C the synthesis and processing were comparable to those of wild-type cells, cells cultured at 37°C for 2 h had neither 20S pre-rRNA nor 18S rRNA, while 25S rRNA was generated at normal levels. The 37°C grown enp1-1 cells also had low levels of aberrant 23S and possibly 21S intermediates (Fig. 5). The defect in 18S rRNA synthesis was further supported by pulse-chase experiments carried out using [5,6-3H]uracil. The results obtained were essentially the same; no 20S pre-rRNA or 18S rRNA was produced, while processing to 25S rRNA was not affected (data not shown). Taken together, these results suggested that the enp1 mutation leads to specific defects in the processing pathway for 20S pre-rRNA and 18S rRNA, resulting in reduced 40S subunit synthesis and a lowered level of the 40S subunit. Enp1 is required for pre-rRNA processing at A0, A1 and A2 sites To define the processing steps affected by the enp1 mutation, the steady state levels of rRNA precursors and mature RNAs were analyzed by northern blotting. Total RNAs were isolated from cells of W303-1a (ENP1) and JBY51 (enp1-1) grown at 37°C for 2 or 4 h. After separation on formaldehyde agarose, RNAs were transferred onto nylon membranes and probed with radiolabeled oligonucleotides specific to various regions of the 35S pre-rRNA (Fig. 6A). After incubation at 37°C, enp1-1 cells had wild-type levels of 25S rRNA, but reduced levels of 18S rRNA (Fig. 6B). A probe specific to ITS1 (P5) further revealed that enp1-1 cells incubated at the non-permissive temperature accumulated two aberrant rRNAs, 23S and 21S (Fig. 6C). Aberrant rRNA processing products of similar sizes have been described in numerous studies (14,31–34) and result from defects in processing at A0, A1 and A2. Additional probes were used to verify the origins of the 23S and 21S RNAs in the enp1-1 strain. The 23S product was detected by oligos 1, 2, 4 and 5, but not by oligos 6, 7 or 8 (Fig. 6D, E, C, F, G and data not shown). Thus this RNA extends from the 5′ end of the 35S rRNA to the A3 site. The 21S product was detected by oligos 4 and 5, but not by oligos 1, 2, 6, 7 and 8 (Fig. 6E, C, D, F, G and data not shown), indicating that it extends from the A1 to the A3 site. At 37°C the enp1-1 cells also had less 32S and 20S rRNA intermediates (Fig. 6B and E). These results suggest that the enp1 mutation led to complete or nearly complete inhibition of processing at site A0 and A2, and partial inhibition of processing at site A1. As a consequence, the 35S pre-rRNA was cleaved at site A3 instead, producing 23S and 21S rRNA products. Consistent with this theory, the 27SA2 rRNA intermediate level was greatly reduced in enp1 cells at 37°C (Fig. 6C) due to the inhibition of processing at A2, while the 27SB pre-rRNA level was similar to wild-type cells (Fig. 6G). Moreover, no difference in the 5.8 rRNA level was observed between the wild-type cells and enp1 cells (Fig. 6H). Enp1 is associated with U3 and U14 snoRNAs and with Nop1 It has previously been shown that mutations in the U3, U14, snR10 and snR30 snoRNAs and in their associated proteins affect processing of 35S pre-rRNA at A0, A1 and A2. Because of the similarity with the processing defects of enp1-1 strains, we tested the association between Enp1 and snoRNAs. To do this, we created a strain in which a TAP tag was fused to the C-terminus of Enp1. The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity. Cells grew well with the TAP-tagged Enp1 as the only source of Enp1 protein, showing that it was functional. As a control, we used a TAP tag on an unrelated cytoplasmic protein, Hst2. Strain CWY14 (ENP1-TAP) and the Hst2-TAP tagged strain were grown in YPD to mid-exponential phase before being harvested. Extracts were prepared and mixed with IgG agarose beads to precipitate Enp1-TAP and associated RNAs. Total RNAs were extracted from washed IgG beads, separated on 6% polyacrylamide denaturing gels, transferred to nylon membranes and probed with radiolabeled oligonucleotides. Northern analysis revealed that Enp1-TAP precipitates were enriched with U3 and U14 snoRNAs relative to precipitates from the Hst2-tagged strain (Fig. 7A). The Enp1-TAP samples were not enriched with snR30 snoRNA (Fig. 7A), nor with U24 or U18 snoRNAs (data not shown). We found no change in the levels of U3, U14, snR10 and snR30 snoRNAs in the enp1 mutant, indicating that the mutation did not affect snoRNAs levels (Fig. 6I). The results indicate that Enp1 associates in vivo with U3 and U14 snoRNAs. Much less U3 RNA co-immunoprecipitated with Enp1-TAP than with Protein A-tagged Nop1, which is known to associate with U3 and U14 snoRNAs (Fig. 7A). However, Protein A-Nop1 was much more efficiently precipitated than was the Enp1-TAP protein (data not shown). Therefore, it is likely that similar amounts of RNAs are associated with the two proteins and that the proteins are part of the same complex. To address this further, we checked for the presence of Nop1 in the Enp1-TAP immunoprecipitates. Figure 7B shows that Nop1 indeed is in the Enp1 precipitate but not in the Hst2 control, whereas an abundant ribosomal protein, L3, is in neither precipitate. U3 and U14 snoRNAs have been shown to interact with rRNA precursors and these interactions are required for pre-rRNA processing (35–37). Using an in vitro system, U3 was also shown to be associated with its rRNA substrate and processing product (38). This raised the possibility that Enp1 might also be associated with rRNAs since its function in rRNA processing appeared linked to those of U3 and U14 snoRNAs. To test this possibility, we further analyzed the RNAs that co-precipiate with TAP-tagged Enp1. The RNAs were separated on 1.2% agarose formaldehyde gels or on polyacrylamide denaturing gels, transferred to nylon membranes and probed with radiolabeled oligonucleotides for pre-rRNAs. A probe (P4; see Fig. 6) specific to 20s and its precursors revealed that pre-rRNAs 35S, 33S, 32S and 20S specifically co-precipitated with Enp1-TAP (Fig. 7C). No such enrichment was found using a probe (P8; see Fig. 6) specific for 27S RNAs or a probe for 5.8S RNA (Fig. 7C). These results clearly demonstrated that Enp1 is associated with substrates and products of the early steps of 18S rRNA processing. Comparison of Enp1 with homologs in other organisms Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18). A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19). In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39). Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6. The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence. Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences. Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse. The alignment of the homologs showed that they shared homology from the N-terminus to the C-terminus, with the C-terminal half extremely well conserved, with close to 90% similarity (Fig. 8). One interesting observation is that the two amino acids changed in the enp1-1 mutant, W242 and V415, are conserved among all homologs. The human Enp1 homolog was cloned and expressed in yeast and tested for function. Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant. However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown). DISCUSSION ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18). ENP1 was shown to be essential for viability and the Enp1 protein localized to the nucleus (18). When we re-examined the localization of Enp1, we observed that the protein was enriched in the nucleolus. This finding led us to test for a role of Enp1 in ribosome synthesis. Using an enp1 ts mutant, we found that depletion of Enp1 caused a 40S ribosomal subunit deficiency. Further analysis revealed that this deficiency was not due to a change of the subunit’s stability, but to a defect in the synthesis of the subunit’s 18S rRNA component. Pulse-chase analysis of RNA synthesis in an enp1-1 strain revealed that no 20S pre-rRNA or 18S rRNA was made at the non-permissive temperature, while levels of 25S rRNA appeared normal. Low levels of precursors to 18S rRNA were detected in the mutants, and they were extremely unstable. Northern analysis of steady state RNA levels demonstrated that the enp1 mutation specifically inhibited the pre-rRNA early cleavages at sites A0, A1 and A2, which are required for the production of the 20S pre-rRNA and the 18S rRNA. These defects of the enp1 mutation on rRNA processing are very similar to those caused by mutation of KRR1, another essential nucleolar gene required for synthesis of the 40S, but not the 60S subunit (40). Co-precipitation analyses provided strong evidence that Enp1 is directly involved in pre-rRNA processing. In these experiments, TAP-tagged Enp1 bound to IgG beads specifically co-precipitated with two snoRNAs, U3 and U14, and with the 35S, 33S, 32S and 20S pre-rRNAs. Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing. It has been shown that mutations in U3, U14, snR10 and snR30 snoRNAs and protein components of the snoRNPs affect processing at sites A0, A1 or A2 (15,16,41,42). Enp1’s interaction with U3 and U14 snoRNAs suggests that Enp1’s function in rRNA processing involves these two snoRNAs. The fact that the nucleolar protein, Nop1, known to bind to U3 and U14 RNAs, also was found in the Enp1 precipitate, provides additional evidence that Enp1 is part of a complex involved in processing of rRNA. Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43). These proteins included Imp4, Kre31, Kre33, Mpp10, Nop1, Nop14 and Sof1, all of which have been implicated in 18S RNA processing or 40S biogenesis. Very recently (after the studies in this manuscript were concluded) Grandi et al. published an analysis of components of the 90s preribosomal particle, which include the 35S pre-rRNA, U3 snoRNP and rRNA processing factors for the 40S subunit (44). In agreement with our findings, they found that Enp1 is a component of this 90s complex and also of a smaller complex containing the 20S pre-rRNA. Surprisingly, none of the other proteins involved in processing of pre-rRNAs that were tested associated with the 20S rRNA, suggesting that those proteins, but not Enp1, are released prior to 20S pre-rRNA formation (44). The authors also showed co-precipitation of Enp1 with dimethylated 20S pre-rRNA, which is formed after export of 20S to the cytoplasm. These results of Grandi et al. suggest that Enp1 may also be involved in later steps of processing or nuclear export. A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19). Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids. Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown). This strongly suggests that the conserved function of Enp1 is in rRNA processing. The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog. It will be important to study the nature of the associations between Enp1 and U3 and U14 snoRNPs, and to learn more about the exact role of Enp1 in ribosomal RNA processing.
[ "Enp1", ",", "a", "yeast", "protein", "associated", "with", "U3", "and", "U14", "snoRNAs", ",", "is", "required", "for", "pre", "-", "rRNA", "processing", "and", "40S", "subunit", "synthesis", "\n", "Abstract", "\n", "ENP1", "is", "an", "essential", "Saccharomyces", "cerevisiae", "gene", "encoding", "a", "483", "amino", "acid", "polypeptide", ".", "Enp1", "protein", "is", "localized", "in", "the", "nucleus", "and", "concentrated", "in", "the", "nucleolus", ".", "An", "enp1", "-", "1", "temperature", "-", "sensitive", "mutant", "inhibited", "35S", "pre", "-", "rRNA", "early", "processing", "at", "sites", "A0", ",", "A1", "and", "A2", "as", "shown", "by", "northern", "analysis", "of", "steady", "state", "levels", "of", "rRNA", "precursors", ".", "Pulse", "-", "chase", "analysis", "further", "revealed", "that", "the", "enp1", "-", "1", "strain", "was", "defective", "in", "the", "synthesis", "of", "20S", "pre", "-", "rRNA", "and", "hence", "18S", "rRNA", ",", "which", "led", "to", "reduced", "formation", "of", "40S", "ribosomal", "subunits", ".", "Co", "-", "precipitation", "analysis", "revealed", "that", "Enp1", "was", "associated", "with", "Nop1", "protein", ",", "as", "well", "as", "with", "U3", "and", "U14", "RNAs", ",", "two", "snoRNAs", "implicated", "in", "early", "pre", "-", "rRNA", "processing", "steps", ".", "These", "results", "suggest", "a", "direct", "role", "for", "Enp1", "in", "the", "early", "steps", "of", "rRNA", "processing", ".", "\n\n", "INTRODUCTION", "\n", "Ribosome", "biogenesis", "is", "one", "of", "the", "major", "cellular", "activities", "in", "eukaryotic", "cells", ".", "It", "takes", "place", "primarily", "in", "a", "specialized", "subnuclear", "compartment", ",", "the", "nucleolus", "(", "1,2", ")", ".", "In", "the", "yeast", "Saccharomyces", "cerevisiae", ",", "each", "rRNA", "gene", "is", "transcribed", "by", "RNA", "polymerase", "I", "into", "a", "35S", "rRNA", "precursor", ",", "consisting", "of", "18S", ",", "5.8S", "and", "25S", "rRNA", "sequences", "flanked", "by", "two", "external", "transcribed", "spacers", "(", "ETS", ")", "and", "separated", "by", "two", "internal", "transcribed", "spacers", "(", "ITS", ")", "(", "Fig", ".", "1", ")", ".", "This", "35S", "precursor", "goes", "through", "a", "series", "of", "modifications", "and", "processing", "steps", "to", "generate", "the", "mature", "18S", ",", "5.8S", "and", "25S", "rRNAs", ".", "The", "processing", "occurs", "first", "at", "sites", "A0", ",", "A1", "and", "A2", ",", "resulting", "in", "the", "20S", "pre", "-", "rRNA", "and", "27SA2", "pre", "-", "rRNA", ".", "The", "20S", "pre", "-", "rRNA", "is", "then", "cleaved", ",", "leading", "to", "the", "mature", "18S", "rRNA", "found", "in", "the", "40S", "ribosomal", "subunit", ".", "The", "27SA2", "pre", "-", "rRNA", "is", "processed", "through", "two", "alternative", "pathways", ".", "The", "majority", "of", "27SA2", "pre", "-", "rRNA", "is", "cleaved", "at", "sites", "A3", "and", "B2", "to", "form", "the", "27SA3", "pre", "-", "rRNA", ",", "which", "is", "subsequently", "processed", "to", "produce", "27SBS", ".", "Alternatively", ",", "27SA2", "pre", "-", "rRNA", "can", "be", "processed", "at", "sites", "B1L", "and", "B2", "to", "generate", "27SBL", "pre", "-", "rRNA", ".", "Both", "27SBS", "and", "27SBL", "pre", "-", "rRNAs", "are", "then", "cleaved", "at", "sites", "C1", "and", "C2", "to", "generate", "the", "mature", "25S", "rRNA", ",", "and", "7SS", "or", "7SL", "intermediates", ",", "which", "are", "then", "processed", "to", "mature", "5.8SS", "or", "5.8SL", "rRNAs", "(", "Fig", ".", "1", ")", ".", "The", "25S", "rRNA", "and", "5.8S", "rRNA", "are", "the", "RNA", "components", "of", "the", "60S", "ribosomal", "subunit", "(", "3", ")", ".", "During", "the", "course", "of", "rRNA", "modification", "and", "processing", ",", "many", "of", "the", "ribosomal", "proteins", "are", "assembled", "onto", "the", "rRNA", "molecules", "to", "form", "the", "ribosome", "complex", ".", "\n", "Ribosome", "biogenesis", "needs", "a", "large", "number", "of", "trans", "-", "acting", "factors", ",", "including", "small", "nucleolar", "RNAs", "(", "snoRNAs", ")", ",", "protein", "components", "of", "the", "snoRNP", "complexes", ",", "rRNA", "modifying", "enzymes", ",", "endo-", "and", "exonucleases", ",", "putative", "RNA", "helicases", "and", "other", "protein", "factors", "(", "3,4", ")", ".", "In", "yeast", "cells", "there", "are", "more", "than", "100", "different", "snoRNAs", "playing", "important", "roles", "in", "rRNA", "modification", "and", "processing", ".", "On", "the", "basis", "of", "their", "structure", ",", "the", "snoRNAs", "can", "be", "divided", "into", "two", "groups", ":", "the", "box", "C", "/", "D", "family", "and", "box", "H", "/", "ACA", "family", ".", "Only", "one", "snoRNA", ",", "MRP", "RNA", ",", "belongs", "to", "neither", "family", "(", "5–7", ")", ".", "While", "the", "majority", "of", "the", "snoRNAs", "participate", "in", "RNA", "pseudouridylation", "and", "2′-O", "-", "ribose", "methylation", ",", "a", "few", "of", "them", ",", "including", "MRP", "snoRNA", ",", "box", "C", "/", "D", "snoRNAs", "U3", "and", "U14", ",", "and", "box", "H", "/", "ACA", "snoRNAs", "snR10", "and", "snR30", ",", "are", "required", "for", "processing", "of", "the", "pre", "-", "rRNA", "(", "8–12", ")", ".", "Not", "only", "are", "U3", ",", "U14", ",", "snR10", "and", "snR30", "essential", "for", "early", "cleavages", "of", "35S", "pre", "-", "rRNA", "to", "18S", "rRNA", ",", "the", "proteins", "associated", "with", "them", ",", "including", "Nop1", ",", "Nop5", ",", "Gar1", "and", "Nop10", ",", "have", "also", "been", "shown", "to", "be", "required", "for", "18S", "rRNA", "synthesis", "(", "13–16", ")", ".", "\n", "The", "ENP1", "(", "Essential", "Nuclear", "Protein", "1", ")", "gene", "was", "identified", "in", "a", "genetic", "screen", "for", "suppressors", "of", "an", "ost4", "mutation", "(", "oligosaccharide", "transferase", "4", ")", "(", "17", ")", ".", "However", ",", "in", "subsequent", "studies", "it", "was", "found", "not", "to", "be", "involved", "in", "OST4", "function", "(", "18", ")", ".", "ENP1", "is", "an", "essential", "gene", "encoding", "a", "483", "amino", "acid", "polypeptide", ".", "The", "Enp1", "protein", "is", "highly", "conserved", "and", "homologs", "are", "found", "in", "all", "eukaryotes", ".", "The", "yeast", "protein", "was", "localized", "to", "the", "nucleus", "in", "a", "previous", "study", "(", "18", ")", ".", "On", "the", "other", "hand", ",", "an", "Enp1", "human", "homolog", ",", "called", "bystin", ",", "was", "reported", "to", "localize", "to", "the", "cytoplasm", "and", "was", "proposed", "to", "be", "involved", "in", "cell", "adhesion", "(", "19", ")", ".", "\n", "In", "this", "study", ",", "we", "report", "that", "the", "Enp1", "protein", "not", "only", "is", "nuclear", "but", "is", "enriched", "in", "the", "nucleolus", ".", "We", "also", "found", "that", "Enp1", "is", "required", "for", "the", "synthesis", "of", "40S", "ribosomal", "subunits", ",", "and", "its", "presence", "is", "necessary", "for", "the", "pre", "-", "rRNA", "processing", "to", "form", "20S", "pre", "-", "rRNA", "and", "18S", "rRNA", ".", "An", "association", "between", "Enp1", "and", "U3", "and", "U14", "snoRNAs", ",", "and", "with", "the", "nucleolar", "protein", "Nop1", ",", "was", "established", ".", "We", "also", "found", "that", "human", "Enp1", ",", "expressed", "in", "yeast", ",", "was", "located", "in", "the", "nucleus", "and", "the", "nucleolus", ",", "suggesting", "that", "the", "function", "of", "this", "protein", "is", "conserved", ".", "\n\n", "MATERIALS", "AND", "METHODS", "\n", "Yeast", "strains", "and", "media", "\n", "The", "S.cerevisiae", "strains", "used", "in", "this", "study", "are", "all", "derivatives", "of", "a", "wild", "-", "type", "diploid", "strain", "W303", "(", "MATa", "/", "MATα", "ura3", "-", "1", "/", "ura3", "-", "1", "leu2", "-", "3,112", "/", "leu2", "-", "3,112", "trp1", "-", "1", "/", "trp1", "-", "1", "his3", "-", "11,15", "/", "his3", "-", "11,15", "ade2", "-", "1", "/", "ade2", "-", "1", "can1", "-", "100", "/", "can1", "-", "100", ")", "except", "for", "strain", "RS1938", ".", "Strain", "JBY45", "(", "MATa", "/", "MATα", "ENP1", "/", "Δenp1::his5", "+", ")", "was", "constructed", "by", "replacing", "one", "copy", "of", "the", "ENP1", "open", "reading", "frame", "(", "ORF", ")", "with", "the", "Schizosaccharomyces", "pombe", "his5", "+", "gene", "(", "18", ")", ".", "Strain", "JBY46", "[", "MATa", "Δenp1::his5+/pJB23", "(", "ENP1", ",", "URA3", ",", "CEN6", ")", "]", "is", "a", "haploid", "strain", "derived", "from", "JBY45", "with", "wild", "-", "type", "ENP1", "on", "a", "low", "copy", "number", "plasmid", ".", "Strain", "JBY48", "[", "MATa", "Δenp1::his5+/pJB19", "(", "enp1", "-", "1", ",", "TRP1", ",", "CEN6", ")", "]", "and", "strain", "JBY49", "[", "MATa", "Δenp1::his5+/pJB39", "(", "enp1", "-", "2", ",", "TRP1", ",", "CEN6", ")", "]", "have", "plasmids", "with", "enp1", "temperature", "-", "sensitive", "(", "ts", ")", "mutations", ".", "Strain", "JBY51", "(", "MATa", "Δenp1::his5", "+", "TRP1::enp1", "-", "1", ")", "is", "an", "enp1", "ts", "strain", "generated", "by", "integrating", "the", "enp1", "-", "1", "gene", "at", "the", "chromosomal", "trp1", "-", "1", "locus", ".", "Strain", "CWY13", "[", "MATa", "Δenp1::his5+/pJB24", "(", "pMET25-GFP", "-", "ENP1", ",", "URA3", ",", "CEN6", ")", "]", "has", "GFP", "-", "ENP1", "under", "control", "of", "the", "MET25", "promoter", ".", "Strain", "CWY14", "(", "MATa", "ENP1-TAP", ")", "was", "created", "by", "fusing", "sequences", "encoding", "a", "Tandem", "Affinity", "Purification", "(", "TAP", ")", "tag", "(", "20,21", ")", "to", "the", "3′", "end", "of", "ENP1", ".", "Strain", "YRH39", "(", "MATα", "HST2-TAP", ")", "was", "created", "by", "fusing", "sequences", "encoding", "a", "TAP", "tag", "to", "the", "3′end", "of", "HST2", ".", "Strain", "RS1938", "(", "Δnop1::URA3", "pUN100-ProtA", "-", "NOP1", ")", "was", "created", "by", "transforming", "RS1935", "(", "MATa", "/", "α", "leu2", "/", "leu2", "ura3", "/", "ura3", "lys2", "/", "lys2", "ade2", "/", "ade2", "Δnop1::URA3", "/", "NOP1", ")", "with", "pUN100-ProtA", "-", "NOP1", "(", "strain", "and", "plasmid", "supplied", "by", "T.", "Schafer", ")", ",", "followed", "by", "tetrad", "dissection", ".", "Strain", "CWY15", "[", "MATa", "/", "pCW109", "(", "pMET25-GFP", "-", "hENP1", ",", "URA3", ",", "CEN6", ")", "]", "has", "a", "human", "homolog", "of", "Enp1", "expressed", "in", "W303", "-", "1a", ".", "The", "media", "used", "were", "prepared", "as", "described", "(", "22", ")", ".", "\n\n", "Cloning", "of", "ENP1", "\n", "pRS426-MEG1", "(", "The", "original", "name", "of", "ENP1", ")", "was", "a", "gift", "from", "Dr", "William", "J.", "Lennarz", ".", "It", "contains", "the", "ENP1", "gene", "within", "a", "2.6", "kb", "EcoRI", "genomic", "fragment", "cloned", "into", "pRS426", "(", "18", ")", ".", "The", "EcoRI", "fragment", "was", "subsequently", "cloned", "into", "pRS314", "(", "TRP1", ",", "CEN6", ")", ",", "pRS316", "(", "URA3", ",", "CEN6", ")", "and", "pRS424", "(", "TRP1", ",", "2µ", ")", "to", "create", "pJB20", ",", "pJB23", "and", "pJB21", ",", "respectively", ".", "pGFP", "-", "N", "-", "FUS", "is", "a", "centromeric", "plasmid", "for", "fusing", "green", "fluorescence", "protein", "(", "GFP", ")", "to", "a", "polypeptide", "’s", "N", "-", "terminus", "under", "control", "of", "the", "MET25", "promoter", "(", "23", ")", ".", "Cloning", "the", "ENP1", "ORF", "into", "pGFP", "-", "N", "-", "FUS", "via", "XbaI", "and", "SalI", "sites", "generated", "plasmid", "pJB24", ".", "pJB19", "(", "enp1", "-", "1", ",", "TRP1", ",", "CEN6", ")", "contains", "the", "enp1", "-", "1", "mutant", "gene", ".", "The", "human", "homolog", "of", "yeast", "Enp1", "was", "PCR", "amplified", "from", "a", "human", "cDNA", "clone", "BC007340", "(", "Research", "Genetics", ")", ",", "then", "cloned", "into", "pGFP", "-", "N", "-", "FUS", ",", "p415-ADH", ",", "p415-GPD", "and", "p415-TEF", "(", "24", ")", "via", "XbaI", "and", "SalI", "sites", "to", "generate", "pCW109", ",", "pCW113", ",", "pCW115", "and", "pCW117", ",", "respectively", ".", "The", "fragment", "of", "the", "human", "Enp1", "homolog", "(", "amino", "acids", "152–437", ")", "was", "also", "cloned", "into", "these", "vectors", "to", "generate", "pCW110", ",", "pCW114", ",", "pCW116", "and", "pCW118", ".", "\n\n", "Random", "mutagenesis", "of", "ENP1", "to", "generate", "enp1", "ts", "mutants", "\n", "The", "enp1", "ts", "mutants", "were", "generated", "with", "a", "protocol", "introducing", "random", "mutations", "by", "PCR", "(", "25", ")", ".", "The", "PCR", "was", "performed", "with", "oligonucleotides", "ENP1-MUT5′", "(", "5′-GGTGGTGTCAGT", "AGGGGA-3′", ")", ",", "ENP1-MUT3′", "(", "5′-CAGTCTGCAATATA", "TGGAC-3′", ")", "and", "plasmid", "template", "pJB20", "(", "see", "above", ")", ".", "The", "nucleotide", "concentrations", "in", "the", "reaction", "were", "1", "mM", "each", "for", "dATP", ",", "dGTP", ",", "dCTP", "and", "dTTP", ".", "After", "strain", "JBY46", "was", "transformed", "with", "the", "PCR", "product", "and", "with", "pJB20", "gapped", "by", "NheI", "and", "NsiI", ",", "the", "transformants", "were", "replica", "-", "plated", "onto", "two", "plates", "containing", "5-FOA", "synthetic", "medium", "without", "tryptophan", ";", "one", "replica", "was", "incubated", "at", "23", "°", "C", "and", "the", "other", "at", "37", "°", "C", ".", "Colonies", "growing", "at", "23", "°", "C", "but", "not", "at", "37", "°", "C", "were", "picked", "as", "candidates", ".", "Since", "approximately", "10", "%", "of", "the", "colonies", "were", "inviable", "at", "both", "temperatures", ",", "we", "knew", "that", "10", "%", "of", "the", "ENP1", "PCR", "products", "lost", "their", "function", "after", "the", "PCR", "mutagenesis", ".", "This", "confirmed", "the", "effectiveness", "of", "the", "mutagenesis", "procedure", ".", "Two", "candidates", "showed", "good", "growth", "at", "23", "°", "C", "but", "no", "growth", "at", "37", "°", "C", ".", "They", "were", "named", "strains", "JBY48", "and", "JBY49", "and", "contained", "plasmids", "with", "the", "enp1", "-", "1", "and", "enp1", "-", "2", "mutations", ",", "respectively", ".", "The", "mutated", "enp1", "-", "1", "gene", "on", "pJB19", "was", "cloned", "into", "an", "integration", "vector", ",", "pRS304", ",", "as", "an", "EcoRI", "fragment", ".", "The", "plasmid", "was", "subsequently", "linearized", "with", "SnaBI", "within", "the", "TRP1", "marker", "and", "was", "integrated", "at", "the", "chromosomal", "trp1", "-", "1", "locus", "of", "strain", "JBY46", ".", "Selection", "on", "5-FOA", "was", "used", "to", "remove", "plasmid", "pJB23", ",", "creating", "strain", "JBY51", ".", "\n\n", "Sucrose", "gradient", "analysis", "\n", "Polyribosome", "preparation", "and", "analysis", "were", "carried", "out", "essentially", "as", "described", "(", "26", ")", ".", "Cells", "grown", "in", "YPD", "were", "collected", "at", "mid", "-", "log", "phase", "(", "OD600", "0.8–1.0", ")", "and", "were", "broken", "with", "glass", "beads", ".", "The", "lysate", "was", "frozen", "immediately", "in", "liquid", "N2", "and", "was", "stored", "at", "–", "80", "°", "C", ".", "Lysate", "(", "30", "U", "of", "absorbance", "at", "OD260", ")", "was", "layered", "over", "a", "7–47", "%", "(", "w", "/", "v", ")", "sucrose", "gradient", ",", "which", "was", "centrifuged", "at", "28", "000", "r.p.m", ".", "for", "5", "h", "at", "4", "°", "C", "in", "a", "SW28", "rotor", "and", "was", "analyzed", "with", "an", "ISCO", "UA-5", "gradient", "UV", "detection", "system", "on", "absorbency", "at", "254", "nm", ".", "\n\n", "Immunofluorescence", "\n", "Immunofluorescence", "analysis", "was", "carried", "out", "essentially", "as", "described", "(", "27", ")", ".", "Cells", "were", "fixed", "with", "3.7", "%", "formaldehyde", "at", "room", "temperature", "for", "1.5", "h.", "Antibodies", "included", "a", "mouse", "monoclonal", "anti", "-", "Nop1", "(", "a", "gift", "from", "John", "P.", "Aris", ",", "University", "of", "Florida", ",", "Gainesville", ",", "Florida", ")", "and", "a", "Texas", "-", "red", "-", "conjugated", "donkey", "-", "anti", "-", "mouse", "antibody", "(", "Jackson", "Lab", ")", ",", "both", "used", "at", "1:500", "dilution", ".", "Images", "were", "taken", "on", "a", "Zeiss", "Axioplan2", "microscope", "equipped", "with", "a", "Zeiss", "AxioCam", "camera", ".", "\n\n", "Pulse", "-", "chase", "labeling", "analysis", "of", "rRNA", "\n", "For", "[", "methyl-3H]methionine", "pulse", "-", "chase", "analysis", ",", "cells", "were", "grown", "in", "synthetic", "medium", "without", "methionine", "at", "room", "temperature", "or", "37", "°", "C", "for", "2", "h.", "When", "the", "OD600", "reached", "1.0", ",", "6", "ml", "of", "the", "culture", "were", "pulse", "-", "labeled", "with", "250", "µCi", "[", "methyl-3H]methionine", "(", "Amersham", "Pharmacia", ")", "for", "3", "min", "and", "chased", "with", "cold", "methionine", "(", "500", "µg", "/", "ml", ")", "for", "2", ",", "4", "or", "12", "min", ".", "For", "each", "time", "point", "of", "the", "chase", "1.25", "ml", "of", "culture", "was", "mixed", "with", "ice", "and", "collected", ".", "The", "pellets", "were", "frozen", "immediately", "in", "liquid", "N2", "and", "stored", "at", "–", "80", "°", "C", "before", "total", "RNA", "was", "purified", "using", "a", "hot", "phenol", "method", "(", "28", ")", ".", "The", "RNAs", "were", "separated", "on", "a", "1.2", "%", "agarose", "formaldehyde", "gel", "and", "transferred", "onto", "Hybond", "-", "N+", "nylon", "membranes", "(", "Amersham", "Pharmacia", ")", ".", "After", "being", "sprayed", "with", "EN3HANCE", "(", "Du", "Pont", ")", ",", "the", "membranes", "were", "exposed", "to", "film", "at", "–", "80", "°", "C", "(", "29", ")", ".", "\n\n", "Northern", "analysis", "\n", "Cells", "were", "grown", "inYPD", "at", "room", "temperature", "or", "37", "°", "C", "for", "2–4", "h.", "When", "the", "OD600", "reached", "1.0", ",", "10", "ml", "of", "cells", "were", "collected", "and", "frozen", "immediately", ".", "Total", "RNA", "was", "extracted", "as", "described", "(", "28", ")", ".", "Five", "micrograms", "of", "RNA", "were", "separated", "on", "1.2", "%", "agarose", "formaldehyde", "gels", "(", "for", "high", "molecular", "weight", "RNA", ")", "or", "on", "6", "%", "polyacrylamide", "7", "M", "urea", "denaturing", "gels", "(", "for", "low", "molecular", "weight", "RNA", ")", "for", "each", "sample", ".", "The", "RNA", "was", "then", "transferred", "to", "Zeta", "-", "Probe", "GT", "nylon", "membranes", "(", "Bio", "-", "Rad", ")", ".", "Probes", "for", "hybridyzation", "were", "specific", "oligonucleotides", "end", "-", "labeled", "using", "[", "γ-32P]ATP", ".", "After", "hybridization", "and", "washes", ",", "membranes", "were", "exposed", "to", "phosphorimager", "screens", "or", "X", "-", "ray", "films", "(", "29", ")", ".", "Oligonucleotides", "specific", "for", "various", "regions", "of", "35S", "pre", "-", "rRNA", "are", ":", "1", ",", "GGTCTCTCTGCTGCCG", "GAAATG", ";", "3", ",", "AATGAGCCATTCGCAGTTTCACTG", ";", "4", ",", "GCTCTCATGCTCTTGCCAAAAC", ";", "5", ",", "TGTTTGTTACCT", "CTGGGCCCCG", ";", "6", ",", "TCCAGTTACGAAAATTCTTG", ";", "7", ",", "CGTATCGCATTTCGCTGCGTTC", ";", "8", ",", "GTTCGCCTAGAC", "GCTCTCTCTTC", ";", "9", ",", "GCGAGATTCCCCTACCCAC", ".", "The", "regions", "complementary", "to", "these", "oligonucleotides", "are", "shown", "in", "Figure", "6A.", "The", "oligonucleotides", "probing", "box", "C", "/", "D", "snoRNAs", "are", ":", "U3", ",", "TTCGGTTTCTCACTCACTCTGGGGTAC", ";", "U14", ",", "GGAACCAGTCTTTCATCACCGTG", ".", "The", "oligonucleotides", "probing", "box", "H", "/", "ACA", "snoRNAs", "are", ":", "snoRNA10", ",", "CCTTG", "CAACGGTCCTCATCCGGG", ";", "snoRNA30", ",", "GTCCGAAGC", "GCCATCTAGATGA", ".", "\n\n", "RNA", "and", "protein", "precipitation", "analysis", "\n", "Cells", "were", "grown", "in", "YPD", "(", "1", "l", ")", "to", "OD600", "1.0", ",", "then", "collected", ",", "washed", "once", "in", "ice", "-", "cold", "PBS", "and", "broken", "using", "glass", "beads", "in", "10", "ml", "IPP150", "buffer", "(", "10", "mM", "Tris", "pH", "8.0", ",", "150", "mM", "NaCl", "and", "0.1", "%", "NP-40", ")", "with", "protease", "inhibitors", ".", "The", "lysates", "were", "mixed", "with", "200", "µl", "IgG", "agarose", "beads", "for", "2", "h", "at", "4", "°", "C", ".", "After", "several", "washes", "with", "50", "ml", "IPP150", "buffer", ",", "the", "IgG", "beads", "were", "collected", "and", "the", "RNA", "associated", "with", "the", "beads", "extracted", "by", "the", "hot", "phenol", "method", "(", "28", ")", ".", "One", "-", "tenth", "of", "the", "precipitated", "RNA", "was", "then", "separated", "on", "6", "%", "polyacrylamide", "7", "M", "urea", "denaturing", "gels", "and", "electro", "-", "transferred", "to", "Zeta", "-", "Probe", "GT", "nylon", "membranes", ".", "They", "were", "probed", "with", "[", "γ-32P]ATP", "labeled", "oligonucleotides", ".", "For", "the", "lanes", "showing", "total", "RNA", ",", "2", "µg", "RNA", "prepared", "from", "exponentially", "growing", "cultures", "were", "loaded", ".", "For", "co", "-", "precipitation", "analysis", "of", "proteins", ",", "the", "IgG", "beads", "were", "resuspended", "in", "2×", "Laemmli", "sample", "buffer", ",", "boiled", "for", "5", "min", "and", "separated", "by", "SDS", "–", "polyacrylamide", "gel", "electrophoresis", ".", "Approximately", "1", "%", "of", "the", "precipitate", "was", "loaded", "onto", "each", "lane", ".", "For", "the", "total", "protein", ",", "0.1", "%", "of", "the", "extract", "prior", "to", "precipitation", "was", "loaded", "onto", "each", "lane", ".", "Following", "electrophoresis", ",", "the", "proteins", "were", "transferred", "to", "nitrocellulose", "membranes", "and", "detected", "using", "anti", "-", "Nop1", "antibody", "at", "1:3000", "dilution", "(", "provided", "by", "J.", "Aris", ")", "and", "anti", "-", "L3", "antibody", "(", "provided", "by", "J.", "Warner", ")", "at", "1:3000", "dilution", "followed", "by", "peroxidase", "-", "conjugated", "anti", "-", "mouse", "secondary", "antibody", "at", "1:5000", "dilution", ".", "The", "antibody", "complexes", "were", "detected", "using", "ECL", "-", "Plus", "reagents", "(", "Amersham", "Pharmacia", ")", "as", "specified", "by", "the", "manufacturer", ".", "\n\n\n", "RESULTS", "\n", "Construction", "and", "analysis", "of", "ENP1", "temperature", "-", "sensitive", "alleles", "\n", "ENP1", "is", "an", "essential", "yeast", "gene", "conserved", "among", "eukaryotes", "(", "18", ")", ".", "To", "study", "its", "functions", ",", "we", "first", "created", "a", "diploid", "strain", ",", "JBY45", ",", "heterozygous", "for", "the", "Δenp1", "mutation", ".", "Then", "two", "enp1", "ts", "mutant", "alleles", "(", "enp1", "-", "1", "and", "enp1", "-", "2", ")", "were", "generated", "by", "random", "PCR", "mutagenesis", ",", "as", "described", "in", "Materials", "and", "Methods", ".", "Both", "mutant", "alleles", "were", "recessive", "to", "the", "wild", "-", "type", "ENP1", "gene", ".", "The", "enp1", "-", "1", "gene", "was", "integrated", "into", "the", "chromosomal", "trp1", "-", "1", "locus", "to", "create", "strain", "JBY51", "and", "all", "subsequent", "experiments", "were", "done", "with", "this", "enp1", "allele", ".", "At", "23", "°", "C", "the", "growth", "of", "JBY51", "was", "comparable", "to", "that", "of", "W303", "-", "1a", "(", "ENP1", ")", ",", "but", "at", "37", "°", "C", "it", "did", "not", "grow", "(", "Fig", ".", "2", ")", ".", "Sequence", "analysis", "revealed", "that", "enp1", "-", "1", "contains", "two", "point", "mutations", ",", "resulting", "in", "substitutions", "of", "two", "amino", "acids", ":", "W242→G", "and", "V415→A.", "No", "attempt", "was", "made", "to", "determine", "whether", "both", "mutations", "were", "required", "for", "the", "ts", "phenotype", ".", "Flow", "cytometry", "of", "strain", "JBY51", "showed", "DNA", "content", "profiles", "similar", "to", "those", "of", "the", "wild", "-", "type", "strain", "at", "the", "non", "-", "permissive", "temperature", "(", "data", "not", "shown", ")", ",", "suggesting", "that", "ENP1", "is", "not", "involved", "in", "cell", "cycle", "regulation", ".", "\n\n", "Enp1", "is", "enriched", "in", "the", "nucleolus", "\n", "Enp1", "tagged", "at", "the", "C", "-", "terminus", "with", "the", "myc", "epitope", "was", "previously", "found", "to", "localize", "to", "the", "nucleus", "(", "18", ")", ".", "To", "expand", "this", "analysis", ",", "we", "fused", "GFP", "to", "the", "N", "-", "terminus", "of", "Enp1", ",", "and", "expressed", "the", "tagged", "Enp1", "protein", "under", "control", "of", "the", "MET25", "promoter", "as", "the", "sole", "source", "of", "Enp1", "protein", "in", "the", "cells", ".", "Cells", "of", "strain", "CWY13", "(", "pMET25-GFP", "-", "ENP1", ")", "were", "grown", "in", "media", "with", "methionine", "(", "transcription", "partially", "repressed", ")", "or", "without", "methionine", "(", "transcription", "not", "repressed", ")", ".", "Growth", "of", "CWY13", "was", "comparable", "to", "that", "of", "wild", "-", "type", "cells", "in", "both", "media", "(", "data", "not", "shown", ")", ",", "indicating", "that", "the", "GFP", "tagged", "Enp1", "protein", "was", "functional", ".", "In", "cells", "cultured", "in", "medium", "without", "methionine", ",", "in", "which", "the", "ENP", "transcription", "was", "not", "repressed", ",", "the", "GFP", "-", "Enp1", "protein", "was", "expressed", "at", "a", "high", "level", "and", "showed", "strong", "green", "fluorescence", "distributed", "throughout", "the", "nucleus", "(", "data", "not", "shown", ")", ",", "consistent", "with", "the", "original", "observation", "(", "18", ")", ".", "With", "methionine", "added", "to", "the", "medium", ",", "however", ",", "the", "fluorescent", "signal", "of", "GFP", "-", "Enp1", "was", "weaker", "and", "surprisingly", "showed", "crescent", "or", "cap", "-", "like", "patterns", "typical", "of", "nucleolar", "proteins", "(", "Fig", ".", "3A", ")", ".", "This", "nucleolar", "enrichment", "was", "confirmed", "by", "its", "co", "-", "localization", "with", "the", "nucleolar", "protein", "Nop1", "(", "Fig", ".", "3B", ")", ".", "\n\n", "ENP1", "mutation", "leads", "to", "reduced", "levels", "of", "40S", "ribosomal", "subunits", "\n", "The", "nucleolar", "enrichment", "suggested", "that", "Enp1", "might", "play", "some", "role", "in", "ribosome", "synthesis", ".", "To", "test", "this", "possibility", ",", "cells", "of", "W303", "-", "1a", "(", "ENP1", ")", ",", "JBY51", "(", "enp1", "-", "1", ")", "and", "a", "top2", "ts", "strain", "RS191", "(", "30", ")", "were", "grown", "in", "YPD", "at", "23", "or", "37", "°", "C", "and", "their", "ribosome", "profiles", "analyzed", "after", "separation", "on", "sucrose", "gradients", ".", "At", "23", "°", "C", ",", "enp1", "-", "1", "cells", "showed", "polysome", "profiles", "similar", "to", "those", "of", "the", "wild", "-", "type", "and", "top2", "-", "1", "strains", "(", "Fig", ".", "4A", "–", "C", ")", ".", "In", "contrast", ",", "after", "incubation", "at", "the", "non", "-", "permissive", "temperature", "(", "37", "°", "C", ")", "for", "40", "min", "(", "data", "not", "shown", ")", "and", "2", "h", ",", "enp1", "-", "1", "cells", "had", "reduced", "levels", "of", "40S", "ribosomal", "subunits", ",", "80S", "monosomes", "and", "polysomes", ",", "along", "with", "a", "dramatic", "increase", "in", "the", "free", "60S", "subunit", "peak", "(", "Fig", ".", "4F", ")", ",", "while", "the", "wild", "-", "type", "and", "top2", "-", "1", "cells", "showed", "little", "change", "in", "polysome", "profile", "at", "37", "°", "C", "(", "Fig", ".", "4D", "and", "E", ")", ".", "These", "results", "demonstrate", "that", "the", "changes", "of", "the", "enp1", "-", "1", "polysome", "profile", "were", "due", "to", "specific", "defects", "caused", "by", "the", "enp1", "-", "1", "mutation", ",", "and", "not", "due", "simply", "to", "the", "shift", "to", "37", "°", "C", "for", "a", "wild", "-", "type", "or", "ts", "strain", ".", "\n\n", "The", "processing", "of", "pre", "-", "rRNA", "for", "18S", "rRNA", "is", "impaired", "in", "enp1", "mutants", "\n", "In", "most", "cases", "reductions", "in", "ribosomal", "subunit", "levels", "are", "the", "results", "of", "defects", "in", "pre", "-", "rRNA", "processing", "or", "ribosome", "assembly", "or", "both", "(", "3", ")", ".", "To", "study", "the", "mechanism", "by", "which", "Enp1", "affects", "the", "40S", "subunit", ",", "we", "analyzed", "the", "effects", "of", "enp1", "mutations", "on", "processing", "of", "the", "pre", "-", "rRNA", "using", "pulse", "-", "chase", "labeling", ".", "[", "methyl-3H]methionine", "is", "preferred", "for", "labeling", "rRNAs", "in", "pulse", "-", "chase", "analysis", "because", "rRNAs", "are", "specifically", "methylated", "during", "the", "early", "steps", "of", "the", "processing", ".", "Cells", "of", "W303", "-", "1a", "(", "ENP1", ")", "and", "JBY51", "(", "enp1", "-", "1", ")", "were", "grown", "at", "23", "or", "37", "°", "C", "for", "2", "h", "before", "they", "were", "labeled", "with", "[", "methyl-3H]methionine", "for", "3", "min", "and", "chased", "with", "cold", "methionine", "for", "2", ",", "4", "and", "12", "min", ".", "In", "wild", "-", "type", "cells", ",", "the", "labeled", "35S", "rRNA", "precursor", ",", "27S", "and", "20S", "rRNA", "intermediates", "were", "rapidly", "chased", "into", "mature", "25S", "and", "18S", "rRNAs", "(", "Fig", ".", "5", ")", ",", "at", "23", "or", "37", "°", "C", ".", "In", "contrast", ",", "enp1", "-", "1", "cells", "showed", "dramatic", "changes", "after", "incubation", "at", "37", "°", "C", ".", "Although", "at", "23", "°", "C", "the", "synthesis", "and", "processing", "were", "comparable", "to", "those", "of", "wild", "-", "type", "cells", ",", "cells", "cultured", "at", "37", "°", "C", "for", "2", "h", "had", "neither", "20S", "pre", "-", "rRNA", "nor", "18S", "rRNA", ",", "while", "25S", "rRNA", "was", "generated", "at", "normal", "levels", ".", "The", "37", "°", "C", "grown", "enp1", "-", "1", "cells", "also", "had", "low", "levels", "of", "aberrant", "23S", "and", "possibly", "21S", "intermediates", "(", "Fig", ".", "5", ")", ".", "The", "defect", "in", "18S", "rRNA", "synthesis", "was", "further", "supported", "by", "pulse", "-", "chase", "experiments", "carried", "out", "using", "[", "5,6", "-", "3H]uracil", ".", "The", "results", "obtained", "were", "essentially", "the", "same", ";", "no", "20S", "pre", "-", "rRNA", "or", "18S", "rRNA", "was", "produced", ",", "while", "processing", "to", "25S", "rRNA", "was", "not", "affected", "(", "data", "not", "shown", ")", ".", "\n", "Taken", "together", ",", "these", "results", "suggested", "that", "the", "enp1", "mutation", "leads", "to", "specific", "defects", "in", "the", "processing", "pathway", "for", "20S", "pre", "-", "rRNA", "and", "18S", "rRNA", ",", "resulting", "in", "reduced", "40S", "subunit", "synthesis", "and", "a", "lowered", "level", "of", "the", "40S", "subunit", ".", "\n\n", "Enp1", "is", "required", "for", "pre", "-", "rRNA", "processing", "at", "A0", ",", "A1", "and", "A2", "sites", "\n", "To", "define", "the", "processing", "steps", "affected", "by", "the", "enp1", "mutation", ",", "the", "steady", "state", "levels", "of", "rRNA", "precursors", "and", "mature", "RNAs", "were", "analyzed", "by", "northern", "blotting", ".", "Total", "RNAs", "were", "isolated", "from", "cells", "of", "W303", "-", "1a", "(", "ENP1", ")", "and", "JBY51", "(", "enp1", "-", "1", ")", "grown", "at", "37", "°", "C", "for", "2", "or", "4", "h.", "After", "separation", "on", "formaldehyde", "agarose", ",", "RNAs", "were", "transferred", "onto", "nylon", "membranes", "and", "probed", "with", "radiolabeled", "oligonucleotides", "specific", "to", "various", "regions", "of", "the", "35S", "pre", "-", "rRNA", "(", "Fig", ".", "6A", ")", ".", "After", "incubation", "at", "37", "°", "C", ",", "enp1", "-", "1", "cells", "had", "wild", "-", "type", "levels", "of", "25S", "rRNA", ",", "but", "reduced", "levels", "of", "18S", "rRNA", "(", "Fig", ".", "6B", ")", ".", "A", "probe", "specific", "to", "ITS1", "(", "P5", ")", "further", "revealed", "that", "enp1", "-", "1", "cells", "incubated", "at", "the", "non", "-", "permissive", "temperature", "accumulated", "two", "aberrant", "rRNAs", ",", "23S", "and", "21S", "(", "Fig", ".", "6C", ")", ".", "Aberrant", "rRNA", "processing", "products", "of", "similar", "sizes", "have", "been", "described", "in", "numerous", "studies", "(", "14,31–34", ")", "and", "result", "from", "defects", "in", "processing", "at", "A0", ",", "A1", "and", "A2", ".", "Additional", "probes", "were", "used", "to", "verify", "the", "origins", "of", "the", "23S", "and", "21S", "RNAs", "in", "the", "enp1", "-", "1", "strain", ".", "The", "23S", "product", "was", "detected", "by", "oligos", "1", ",", "2", ",", "4", "and", "5", ",", "but", "not", "by", "oligos", "6", ",", "7", "or", "8", "(", "Fig", ".", "6D", ",", "E", ",", "C", ",", "F", ",", "G", "and", "data", "not", "shown", ")", ".", "Thus", "this", "RNA", "extends", "from", "the", "5′", "end", "of", "the", "35S", "rRNA", "to", "the", "A3", "site", ".", "The", "21S", "product", "was", "detected", "by", "oligos", "4", "and", "5", ",", "but", "not", "by", "oligos", "1", ",", "2", ",", "6", ",", "7", "and", "8", "(", "Fig", ".", "6E", ",", "C", ",", "D", ",", "F", ",", "G", "and", "data", "not", "shown", ")", ",", "indicating", "that", "it", "extends", "from", "the", "A1", "to", "the", "A3", "site", ".", "At", "37", "°", "C", "the", "enp1", "-", "1", "cells", "also", "had", "less", "32S", "and", "20S", "rRNA", "intermediates", "(", "Fig", ".", "6B", "and", "E", ")", ".", "These", "results", "suggest", "that", "the", "enp1", "mutation", "led", "to", "complete", "or", "nearly", "complete", "inhibition", "of", "processing", "at", "site", "A0", "and", "A2", ",", "and", "partial", "inhibition", "of", "processing", "at", "site", "A1", ".", "As", "a", "consequence", ",", "the", "35S", "pre", "-", "rRNA", "was", "cleaved", "at", "site", "A3", "instead", ",", "producing", "23S", "and", "21S", "rRNA", "products", ".", "Consistent", "with", "this", "theory", ",", "the", "27SA2", "rRNA", "intermediate", "level", "was", "greatly", "reduced", "in", "enp1", "cells", "at", "37", "°", "C", "(", "Fig", ".", "6C", ")", "due", "to", "the", "inhibition", "of", "processing", "at", "A2", ",", "while", "the", "27SB", "pre", "-", "rRNA", "level", "was", "similar", "to", "wild", "-", "type", "cells", "(", "Fig", ".", "6", "G", ")", ".", "Moreover", ",", "no", "difference", "in", "the", "5.8", "rRNA", "level", "was", "observed", "between", "the", "wild", "-", "type", "cells", "and", "enp1", "cells", "(", "Fig", ".", "6H", ")", ".", "\n\n", "Enp1", "is", "associated", "with", "U3", "and", "U14", "snoRNAs", "and", "with", "Nop1", "\n", "It", "has", "previously", "been", "shown", "that", "mutations", "in", "the", "U3", ",", "U14", ",", "snR10", "and", "snR30", "snoRNAs", "and", "in", "their", "associated", "proteins", "affect", "processing", "of", "35S", "pre", "-", "rRNA", "at", "A0", ",", "A1", "and", "A2", ".", "Because", "of", "the", "similarity", "with", "the", "processing", "defects", "of", "enp1", "-", "1", "strains", ",", "we", "tested", "the", "association", "between", "Enp1", "and", "snoRNAs", ".", "To", "do", "this", ",", "we", "created", "a", "strain", "in", "which", "a", "TAP", "tag", "was", "fused", "to", "the", "C", "-", "terminus", "of", "Enp1", ".", "The", "TAP", "tag", "contains", "Staphylococcus", "aureus", "Protein", "A", "as", "well", "as", "calmodulin", "-", "binding", "peptide", "sequences", ",", "so", "the", "tagged", "Enp1", "binds", "IgG", "beads", "with", "high", "specificity", ".", "Cells", "grew", "well", "with", "the", "TAP", "-", "tagged", "Enp1", "as", "the", "only", "source", "of", "Enp1", "protein", ",", "showing", "that", "it", "was", "functional", ".", "As", "a", "control", ",", "we", "used", "a", "TAP", "tag", "on", "an", "unrelated", "cytoplasmic", "protein", ",", "Hst2", ".", "Strain", "CWY14", "(", "ENP1-TAP", ")", "and", "the", "Hst2-TAP", "tagged", "strain", "were", "grown", "in", "YPD", "to", "mid", "-", "exponential", "phase", "before", "being", "harvested", ".", "Extracts", "were", "prepared", "and", "mixed", "with", "IgG", "agarose", "beads", "to", "precipitate", "Enp1-TAP", "and", "associated", "RNAs", ".", "Total", "RNAs", "were", "extracted", "from", "washed", "IgG", "beads", ",", "separated", "on", "6", "%", "polyacrylamide", "denaturing", "gels", ",", "transferred", "to", "nylon", "membranes", "and", "probed", "with", "radiolabeled", "oligonucleotides", ".", "Northern", "analysis", "revealed", "that", "Enp1-TAP", "precipitates", "were", "enriched", "with", "U3", "and", "U14", "snoRNAs", "relative", "to", "precipitates", "from", "the", "Hst2-tagged", "strain", "(", "Fig", ".", "7A", ")", ".", "The", "Enp1-TAP", "samples", "were", "not", "enriched", "with", "snR30", "snoRNA", "(", "Fig", ".", "7A", ")", ",", "nor", "with", "U24", "or", "U18", "snoRNAs", "(", "data", "not", "shown", ")", ".", "We", "found", "no", "change", "in", "the", "levels", "of", "U3", ",", "U14", ",", "snR10", "and", "snR30", "snoRNAs", "in", "the", "enp1", "mutant", ",", "indicating", "that", "the", "mutation", "did", "not", "affect", "snoRNAs", "levels", "(", "Fig", ".", "6I", ")", ".", "The", "results", "indicate", "that", "Enp1", "associates", "in", "vivo", "with", "U3", "and", "U14", "snoRNAs", ".", "Much", "less", "U3", "RNA", "co", "-", "immunoprecipitated", "with", "Enp1-TAP", "than", "with", "Protein", "A", "-", "tagged", "Nop1", ",", "which", "is", "known", "to", "associate", "with", "U3", "and", "U14", "snoRNAs", "(", "Fig", ".", "7A", ")", ".", "However", ",", "Protein", "A", "-", "Nop1", "was", "much", "more", "efficiently", "precipitated", "than", "was", "the", "Enp1-TAP", "protein", "(", "data", "not", "shown", ")", ".", "Therefore", ",", "it", "is", "likely", "that", "similar", "amounts", "of", "RNAs", "are", "associated", "with", "the", "two", "proteins", "and", "that", "the", "proteins", "are", "part", "of", "the", "same", "complex", ".", "To", "address", "this", "further", ",", "we", "checked", "for", "the", "presence", "of", "Nop1", "in", "the", "Enp1-TAP", "immunoprecipitates", ".", "Figure", "7B", "shows", "that", "Nop1", "indeed", "is", "in", "the", "Enp1", "precipitate", "but", "not", "in", "the", "Hst2", "control", ",", "whereas", "an", "abundant", "ribosomal", "protein", ",", "L3", ",", "is", "in", "neither", "precipitate", ".", "\n", "U3", "and", "U14", "snoRNAs", "have", "been", "shown", "to", "interact", "with", "rRNA", "precursors", "and", "these", "interactions", "are", "required", "for", "pre", "-", "rRNA", "processing", "(", "35–37", ")", ".", "Using", "an", "in", "vitro", "system", ",", "U3", "was", "also", "shown", "to", "be", "associated", "with", "its", "rRNA", "substrate", "and", "processing", "product", "(", "38", ")", ".", "This", "raised", "the", "possibility", "that", "Enp1", "might", "also", "be", "associated", "with", "rRNAs", "since", "its", "function", "in", "rRNA", "processing", "appeared", "linked", "to", "those", "of", "U3", "and", "U14", "snoRNAs", ".", "To", "test", "this", "possibility", ",", "we", "further", "analyzed", "the", "RNAs", "that", "co", "-", "precipiate", "with", "TAP", "-", "tagged", "Enp1", ".", "The", "RNAs", "were", "separated", "on", "1.2", "%", "agarose", "formaldehyde", "gels", "or", "on", "polyacrylamide", "denaturing", "gels", ",", "transferred", "to", "nylon", "membranes", "and", "probed", "with", "radiolabeled", "oligonucleotides", "for", "pre", "-", "rRNAs", ".", "A", "probe", "(", "P4", ";", "see", "Fig", ".", "6", ")", "specific", "to", "20s", "and", "its", "precursors", "revealed", "that", "pre", "-", "rRNAs", "35S", ",", "33S", ",", "32S", "and", "20S", "specifically", "co", "-", "precipitated", "with", "Enp1-TAP", "(", "Fig", ".", "7C", ")", ".", "No", "such", "enrichment", "was", "found", "using", "a", "probe", "(", "P8", ";", "see", "Fig", ".", "6", ")", "specific", "for", "27S", "RNAs", "or", "a", "probe", "for", "5.8S", "RNA", "(", "Fig", ".", "7C", ")", ".", "These", "results", "clearly", "demonstrated", "that", "Enp1", "is", "associated", "with", "substrates", "and", "products", "of", "the", "early", "steps", "of", "18S", "rRNA", "processing", ".", "\n\n", "Comparison", "of", "Enp1", "with", "homologs", "in", "other", "organisms", "\n", "Homologs", "of", "Enp1", "protein", "in", "human", ",", "Drosophila", "and", "Caenorhabditis", "elegans", "have", "been", "reported", "(", "18", ")", ".", "A", "previously", "described", "human", "homolog", ",", "bystin", ",", "was", "only", "306", "amino", "acids", "in", "length", ",", "and", "lacked", "sequences", "corresponding", "to", "the", "N", "-", "terminal", "163", "amino", "acids", "of", "yeast", "Enp1", "(", "19", ")", ".", "In", "contrast", ",", "we", "identified", "a", "human", "expressed", "sequence", "tag", "(", "EST", ")", ",", "BC007340", "in", "a", "Blast", "search", "that", "revealed", "an", "ORF", "of", "1311", "nucleotides", "encoding", "a", "437", "amino", "acid", "polypeptide", "(", "39", ")", ".", "Comparison", "of", "this", "437", "amino", "acid", "polypeptide", "with", "human", "bystin", "(", "19", ")", "showed", "that", "they", "were", "encoded", "by", "the", "same", "gene", "on", "human", "chromosome", "6", ".", "The", "reported", "sequence", "for", "human", "bystin", "is", "a", "fragment", "of", "the", "437", "amino", "acid", "human", "Enp1", "protein", ",", "due", "to", "a", "truncated", "cDNA", "sequence", ".", "Also", ",", "a", "sequence", "discrepancy", "at", "the", "C", "-", "terminus", "is", "due", "to", "inaccurate", "DNA", "sequence", "of", "the", "human", "bystin", ",", "as", "confirmed", "by", "available", "human", "genome", "and", "EST", "sequences", ".", "Searches", "of", "the", "database", "of", "other", "organisms", "identified", "Enp1", "homologs", "in", "S.pombe", ",", "Arabidopsis", "thaliana", ",", "C.elegans", ",", "Drosophila", "melanogaster", "and", "mouse", ".", "The", "alignment", "of", "the", "homologs", "showed", "that", "they", "shared", "homology", "from", "the", "N", "-", "terminus", "to", "the", "C", "-", "terminus", ",", "with", "the", "C", "-", "terminal", "half", "extremely", "well", "conserved", ",", "with", "close", "to", "90", "%", "similarity", "(", "Fig", ".", "8)", ".", "One", "interesting", "observation", "is", "that", "the", "two", "amino", "acids", "changed", "in", "the", "enp1", "-", "1", "mutant", ",", "W242", "and", "V415", ",", "are", "conserved", "among", "all", "homologs", ".", "\n", "The", "human", "Enp1", "homolog", "was", "cloned", "and", "expressed", "in", "yeast", "and", "tested", "for", "function", ".", "Expressed", "under", "the", "control", "of", "ADH", ",", "TEF", "or", "GPD", "promoter", ",", "the", "human", "Enp1", "homolog", "did", "not", "complement", "a", "yeast", "enp1", "null", "mutant", ".", "However", ",", "a", "GFP", "fusion", "to", "the", "N", "-", "terminus", "of", "human", "Enp1", "homolog", "localized", "to", "the", "nucleus", "and", "was", "enriched", "in", "the", "nucleolus", "(", "data", "not", "shown", ")", ".", "\n\n\n", "DISCUSSION", "\n", "ENP1", "is", "a", "yeast", "gene", "first", "identified", "in", "a", "genetic", "screen", "for", "complementation", "of", "mutations", "in", "ost4", ",", "which", "encodes", "a", "subunit", "of", "oligosaccharide", "transferase", "(", "17", ")", ",", "although", "subsequent", "work", "showed", "that", "it", "is", "unlikely", "that", "Enp1", "has", "any", "connection", "to", "oligosaccharide", "transferase", "(", "18", ")", ".", "ENP1", "was", "shown", "to", "be", "essential", "for", "viability", "and", "the", "Enp1", "protein", "localized", "to", "the", "nucleus", "(", "18", ")", ".", "\n", "When", "we", "re", "-", "examined", "the", "localization", "of", "Enp1", ",", "we", "observed", "that", "the", "protein", "was", "enriched", "in", "the", "nucleolus", ".", "This", "finding", "led", "us", "to", "test", "for", "a", "role", "of", "Enp1", "in", "ribosome", "synthesis", ".", "Using", "an", "enp1", "ts", "mutant", ",", "we", "found", "that", "depletion", "of", "Enp1", "caused", "a", "40S", "ribosomal", "subunit", "deficiency", ".", "Further", "analysis", "revealed", "that", "this", "deficiency", "was", "not", "due", "to", "a", "change", "of", "the", "subunit", "’s", "stability", ",", "but", "to", "a", "defect", "in", "the", "synthesis", "of", "the", "subunit", "’s", "18S", "rRNA", "component", ".", "Pulse", "-", "chase", "analysis", "of", "RNA", "synthesis", "in", "an", "enp1", "-", "1", "strain", "revealed", "that", "no", "20S", "pre", "-", "rRNA", "or", "18S", "rRNA", "was", "made", "at", "the", "non", "-", "permissive", "temperature", ",", "while", "levels", "of", "25S", "rRNA", "appeared", "normal", ".", "Low", "levels", "of", "precursors", "to", "18S", "rRNA", "were", "detected", "in", "the", "mutants", ",", "and", "they", "were", "extremely", "unstable", ".", "Northern", "analysis", "of", "steady", "state", "RNA", "levels", "demonstrated", "that", "the", "enp1", "mutation", "specifically", "inhibited", "the", "pre", "-", "rRNA", "early", "cleavages", "at", "sites", "A0", ",", "A1", "and", "A2", ",", "which", "are", "required", "for", "the", "production", "of", "the", "20S", "pre", "-", "rRNA", "and", "the", "18S", "rRNA", ".", "These", "defects", "of", "the", "enp1", "mutation", "on", "rRNA", "processing", "are", "very", "similar", "to", "those", "caused", "by", "mutation", "of", "KRR1", ",", "another", "essential", "nucleolar", "gene", "required", "for", "synthesis", "of", "the", "40S", ",", "but", "not", "the", "60S", "subunit", "(", "40", ")", ".", "\n", "Co", "-", "precipitation", "analyses", "provided", "strong", "evidence", "that", "Enp1", "is", "directly", "involved", "in", "pre", "-", "rRNA", "processing", ".", "In", "these", "experiments", ",", "TAP", "-", "tagged", "Enp1", "bound", "to", "IgG", "beads", "specifically", "co", "-", "precipitated", "with", "two", "snoRNAs", ",", "U3", "and", "U14", ",", "and", "with", "the", "35S", ",", "33S", ",", "32S", "and", "20S", "pre", "-", "rRNAs", ".", "Among", "the", "more", "than", "100", "snoRNAs", "in", "yeast", "cells", ",", "U3", ",", "U14", ",", "snR10", ",", "snR30", "and", "MRP", "RNA", "are", "the", "only", "ones", "required", "for", "rRNA", "processing", ".", "It", "has", "been", "shown", "that", "mutations", "in", "U3", ",", "U14", ",", "snR10", "and", "snR30", "snoRNAs", "and", "protein", "components", "of", "the", "snoRNPs", "affect", "processing", "at", "sites", "A0", ",", "A1", "or", "A2", "(", "15,16,41,42", ")", ".", "Enp1", "’s", "interaction", "with", "U3", "and", "U14", "snoRNAs", "suggests", "that", "Enp1", "’s", "function", "in", "rRNA", "processing", "involves", "these", "two", "snoRNAs", ".", "The", "fact", "that", "the", "nucleolar", "protein", ",", "Nop1", ",", "known", "to", "bind", "to", "U3", "and", "U14", "RNAs", ",", "also", "was", "found", "in", "the", "Enp1", "precipitate", ",", "provides", "additional", "evidence", "that", "Enp1", "is", "part", "of", "a", "complex", "involved", "in", "processing", "of", "rRNA", ".", "Recently", ",", "a", "genome", "-", "wide", "study", "of", "yeast", "protein", "complexes", ",", "using", "a", "TAP", "tag", "method", "similar", "to", "ours", ",", "reported", "a", "number", "of", "proteins", "that", "co", "-", "immunoprecipitated", "with", "Enp1", "(", "43", ")", ".", "These", "proteins", "included", "Imp4", ",", "Kre31", ",", "Kre33", ",", "Mpp10", ",", "Nop1", ",", "Nop14", "and", "Sof1", ",", "all", "of", "which", "have", "been", "implicated", "in", "18S", "RNA", "processing", "or", "40S", "biogenesis", ".", "Very", "recently", "(", "after", "the", "studies", "in", "this", "manuscript", "were", "concluded", ")", "Grandi", "et", "al", ".", "published", "an", "analysis", "of", "components", "of", "the", "90s", "preribosomal", "particle", ",", "which", "include", "the", "35S", "pre", "-", "rRNA", ",", "U3", "snoRNP", "and", "rRNA", "processing", "factors", "for", "the", "40S", "subunit", "(", "44", ")", ".", "In", "agreement", "with", "our", "findings", ",", "they", "found", "that", "Enp1", "is", "a", "component", "of", "this", "90s", "complex", "and", "also", "of", "a", "smaller", "complex", "containing", "the", "20S", "pre", "-", "rRNA", ".", "Surprisingly", ",", "none", "of", "the", "other", "proteins", "involved", "in", "processing", "of", "pre", "-", "rRNAs", "that", "were", "tested", "associated", "with", "the", "20S", "rRNA", ",", "suggesting", "that", "those", "proteins", ",", "but", "not", "Enp1", ",", "are", "released", "prior", "to", "20S", "pre", "-", "rRNA", "formation", "(", "44", ")", ".", "The", "authors", "also", "showed", "co", "-", "precipitation", "of", "Enp1", "with", "dimethylated", "20S", "pre", "-", "rRNA", ",", "which", "is", "formed", "after", "export", "of", "20S", "to", "the", "cytoplasm", ".", "These", "results", "of", "Grandi", "et", "al", ".", "suggest", "that", "Enp1", "may", "also", "be", "involved", "in", "later", "steps", "of", "processing", "or", "nuclear", "export", ".", "\n", "A", "previous", "study", "on", "the", "Enp1", "human", "homolog", ",", "bystin", ",", "reported", "that", "the", "protein", "was", "localized", "in", "the", "cytoplasm", "of", "mammalian", "cells", "and", "might", "be", "involved", "in", "cell", "adhesion", "(", "19", ")", ".", "Our", "discovery", "of", "the", "437", "amino", "acid", "human", "Enp1", "homolog", "revealed", "that", "the", "bystin", "studied", "previously", "was", "from", "a", "truncated", "library", "cDNA", "encoding", "only", "the", "C", "-", "terminal", "306", "amino", "acids", ".", "Although", "the", "human", "homolog", "of", "Enp1", "did", "not", "complement", "a", "yeast", "Δenp1", "mutant", ",", "we", "did", "show", "that", "it", "was", "localized", "to", "the", "nucleus", "and", "enriched", "in", "the", "nucleolus", "(", "data", "not", "shown", ")", ".", "This", "strongly", "suggests", "that", "the", "conserved", "function", "of", "Enp1", "is", "in", "rRNA", "processing", ".", "The", "cytoplasmic", "localization", "of", "bystin", "and", "its", "proposed", "function", "in", "cell", "adhesion", "are", "unlikely", "to", "reflect", "the", "actual", "function", "of", "the", "human", "Enp1", "homolog", ".", "\n", "It", "will", "be", "important", "to", "study", "the", "nature", "of", "the", "associations", "between", "Enp1", "and", "U3", "and", "U14", "snoRNPs", ",", "and", "to", "learn", "more", "about", "the", "exact", "role", "of", "Enp1", "in", "ribosomal", "RNA", "processing", ".", "\n\n\n" ]
[ "species" ]
yeast is a species, Saccharomyces cerevisiae is a species, yeast is a species, Saccharomyces cerevisiae is a species, yeast is a species, yeast is a species, human is a species, human is a species, yeast is a species, Yeast is a species, S.cerevisiae is a species, Schizosaccharomyces pombe is a species, human is a species, human is a species, yeast is a species, human is a species, human is a species, mouse is a species, donkey is a species, mouse is a species, mouse is a species, yeast is a species, Staphylococcus aureus is a species, human is a species, Drosophila is a species, Caenorhabditis elegans is a species, human is a species, yeast is a species, human is a species, human is a species, human is a species, human is a species, human is a species, human is a species, human is a species, S.pombe is a species, Arabidopsis thaliana is a species, C.elegans is a species, Drosophila melanogaster is a species, mouse is a species, human is a species, yeast is a species, human is a species, yeast is a species, human is a species, yeast is a species, yeast is a species, yeast is a species, human is a species, human is a species, human is a species, yeast is a species, human is a species
88_task1
Sentence: Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis Abstract ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide. Enp1 protein is localized in the nucleus and concentrated in the nucleolus. An enp1-1 temperature-sensitive mutant inhibited 35S pre-rRNA early processing at sites A0, A1 and A2 as shown by northern analysis of steady state levels of rRNA precursors. Pulse-chase analysis further revealed that the enp1-1 strain was defective in the synthesis of 20S pre-rRNA and hence 18S rRNA, which led to reduced formation of 40S ribosomal subunits. Co-precipitation analysis revealed that Enp1 was associated with Nop1 protein, as well as with U3 and U14 RNAs, two snoRNAs implicated in early pre-rRNA processing steps. These results suggest a direct role for Enp1 in the early steps of rRNA processing. INTRODUCTION Ribosome biogenesis is one of the major cellular activities in eukaryotic cells. It takes place primarily in a specialized subnuclear compartment, the nucleolus (1,2). In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1). This 35S precursor goes through a series of modifications and processing steps to generate the mature 18S, 5.8S and 25S rRNAs. The processing occurs first at sites A0, A1 and A2, resulting in the 20S pre-rRNA and 27SA2 pre-rRNA. The 20S pre-rRNA is then cleaved, leading to the mature 18S rRNA found in the 40S ribosomal subunit. The 27SA2 pre-rRNA is processed through two alternative pathways. The majority of 27SA2 pre-rRNA is cleaved at sites A3 and B2 to form the 27SA3 pre-rRNA, which is subsequently processed to produce 27SBS. Alternatively, 27SA2 pre-rRNA can be processed at sites B1L and B2 to generate 27SBL pre-rRNA. Both 27SBS and 27SBL pre-rRNAs are then cleaved at sites C1 and C2 to generate the mature 25S rRNA, and 7SS or 7SL intermediates, which are then processed to mature 5.8SS or 5.8SL rRNAs (Fig. 1). The 25S rRNA and 5.8S rRNA are the RNA components of the 60S ribosomal subunit (3). During the course of rRNA modification and processing, many of the ribosomal proteins are assembled onto the rRNA molecules to form the ribosome complex. Ribosome biogenesis needs a large number of trans-acting factors, including small nucleolar RNAs (snoRNAs), protein components of the snoRNP complexes, rRNA modifying enzymes, endo- and exonucleases, putative RNA helicases and other protein factors (3,4). In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing. On the basis of their structure, the snoRNAs can be divided into two groups: the box C/D family and box H/ACA family. Only one snoRNA, MRP RNA, belongs to neither family (5–7). While the majority of the snoRNAs participate in RNA pseudouridylation and 2′-O-ribose methylation, a few of them, including MRP snoRNA, box C/D snoRNAs U3 and U14, and box H/ACA snoRNAs snR10 and snR30, are required for processing of the pre-rRNA (8–12). Not only are U3, U14, snR10 and snR30 essential for early cleavages of 35S pre-rRNA to 18S rRNA, the proteins associated with them, including Nop1, Nop5, Gar1 and Nop10, have also been shown to be required for 18S rRNA synthesis (13–16). The ENP1 (Essential Nuclear Protein 1) gene was identified in a genetic screen for suppressors of an ost4 mutation (oligosaccharide transferase 4) (17). However, in subsequent studies it was found not to be involved in OST4 function (18). ENP1 is an essential gene encoding a 483 amino acid polypeptide. The Enp1 protein is highly conserved and homologs are found in all eukaryotes. The yeast protein was localized to the nucleus in a previous study (18). On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19). In this study, we report that the Enp1 protein not only is nuclear but is enriched in the nucleolus. We also found that Enp1 is required for the synthesis of 40S ribosomal subunits, and its presence is necessary for the pre-rRNA processing to form 20S pre-rRNA and 18S rRNA. An association between Enp1 and U3 and U14 snoRNAs, and with the nucleolar protein Nop1, was established. We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved. MATERIALS AND METHODS Yeast strains and media The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938. Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18). Strain JBY46 [MATa Δenp1::his5+/pJB23 (ENP1, URA3, CEN6)] is a haploid strain derived from JBY45 with wild-type ENP1 on a low copy number plasmid. Strain JBY48 [MATa Δenp1::his5+/pJB19 (enp1-1, TRP1, CEN6)] and strain JBY49 [MATa Δenp1::his5+/pJB39 (enp1-2, TRP1, CEN6)] have plasmids with enp1 temperature-sensitive (ts) mutations. Strain JBY51 (MATa Δenp1::his5+ TRP1::enp1-1) is an enp1 ts strain generated by integrating the enp1-1 gene at the chromosomal trp1-1 locus. Strain CWY13 [MATa Δenp1::his5+/pJB24 (pMET25-GFP-ENP1, URA3, CEN6)] has GFP-ENP1 under control of the MET25 promoter. Strain CWY14 (MATa ENP1-TAP) was created by fusing sequences encoding a Tandem Affinity Purification (TAP) tag (20,21) to the 3′ end of ENP1. Strain YRH39 (MATα HST2-TAP) was created by fusing sequences encoding a TAP tag to the 3′end of HST2. Strain RS1938 (Δnop1::URA3 pUN100-ProtA-NOP1) was created by transforming RS1935 (MATa/α leu2/leu2 ura3/ura3 lys2/lys2 ade2/ade2 Δnop1::URA3/NOP1) with pUN100-ProtA-NOP1 (strain and plasmid supplied by T. Schafer), followed by tetrad dissection. Strain CWY15 [MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a. The media used were prepared as described (22). Cloning of ENP1 pRS426-MEG1 (The original name of ENP1) was a gift from Dr William J. Lennarz. It contains the ENP1 gene within a 2.6 kb EcoRI genomic fragment cloned into pRS426 (18). The EcoRI fragment was subsequently cloned into pRS314 (TRP1, CEN6), pRS316 (URA3, CEN6) and pRS424 (TRP1, 2µ) to create pJB20, pJB23 and pJB21, respectively. pGFP-N-FUS is a centromeric plasmid for fusing green fluorescence protein (GFP) to a polypeptide’s N-terminus under control of the MET25 promoter (23). Cloning the ENP1 ORF into pGFP-N-FUS via XbaI and SalI sites generated plasmid pJB24. pJB19 (enp1-1, TRP1, CEN6) contains the enp1-1 mutant gene. The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively. The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118. Random mutagenesis of ENP1 to generate enp1 ts mutants The enp1 ts mutants were generated with a protocol introducing random mutations by PCR (25). The PCR was performed with oligonucleotides ENP1-MUT5′ (5′-GGTGGTGTCAGT AGGGGA-3′), ENP1-MUT3′ (5′-CAGTCTGCAATATA TGGAC-3′) and plasmid template pJB20 (see above). The nucleotide concentrations in the reaction were 1 mM each for dATP, dGTP, dCTP and dTTP. After strain JBY46 was transformed with the PCR product and with pJB20 gapped by NheI and NsiI, the transformants were replica-plated onto two plates containing 5-FOA synthetic medium without tryptophan; one replica was incubated at 23°C and the other at 37°C. Colonies growing at 23°C but not at 37°C were picked as candidates. Since approximately 10% of the colonies were inviable at both temperatures, we knew that 10% of the ENP1 PCR products lost their function after the PCR mutagenesis. This confirmed the effectiveness of the mutagenesis procedure. Two candidates showed good growth at 23°C but no growth at 37°C. They were named strains JBY48 and JBY49 and contained plasmids with the enp1-1 and enp1-2 mutations, respectively. The mutated enp1-1 gene on pJB19 was cloned into an integration vector, pRS304, as an EcoRI fragment. The plasmid was subsequently linearized with SnaBI within the TRP1 marker and was integrated at the chromosomal trp1-1 locus of strain JBY46. Selection on 5-FOA was used to remove plasmid pJB23, creating strain JBY51. Sucrose gradient analysis Polyribosome preparation and analysis were carried out essentially as described (26). Cells grown in YPD were collected at mid-log phase (OD600 0.8–1.0) and were broken with glass beads. The lysate was frozen immediately in liquid N2 and was stored at –80°C. Lysate (30 U of absorbance at OD260) was layered over a 7–47% (w/v) sucrose gradient, which was centrifuged at 28 000 r.p.m. for 5 h at 4°C in a SW28 rotor and was analyzed with an ISCO UA-5 gradient UV detection system on absorbency at 254 nm. Immunofluorescence Immunofluorescence analysis was carried out essentially as described (27). Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution. Images were taken on a Zeiss Axioplan2 microscope equipped with a Zeiss AxioCam camera. Pulse-chase labeling analysis of rRNA For [methyl-3H]methionine pulse-chase analysis, cells were grown in synthetic medium without methionine at room temperature or 37°C for 2 h. When the OD600 reached 1.0, 6 ml of the culture were pulse-labeled with 250 µCi [methyl-3H]methionine (Amersham Pharmacia) for 3 min and chased with cold methionine (500 µg/ml) for 2, 4 or 12 min. For each time point of the chase 1.25 ml of culture was mixed with ice and collected. The pellets were frozen immediately in liquid N2 and stored at –80°C before total RNA was purified using a hot phenol method (28). The RNAs were separated on a 1.2% agarose formaldehyde gel and transferred onto Hybond-N+ nylon membranes (Amersham Pharmacia). After being sprayed with EN3HANCE (Du Pont), the membranes were exposed to film at –80°C (29). Northern analysis Cells were grown inYPD at room temperature or 37°C for 2–4 h. When the OD600 reached 1.0, 10 ml of cells were collected and frozen immediately. Total RNA was extracted as described (28). Five micrograms of RNA were separated on 1.2% agarose formaldehyde gels (for high molecular weight RNA) or on 6% polyacrylamide 7 M urea denaturing gels (for low molecular weight RNA) for each sample. The RNA was then transferred to Zeta-Probe GT nylon membranes (Bio-Rad). Probes for hybridyzation were specific oligonucleotides end-labeled using [γ-32P]ATP. After hybridization and washes, membranes were exposed to phosphorimager screens or X-ray films (29). Oligonucleotides specific for various regions of 35S pre-rRNA are: 1, GGTCTCTCTGCTGCCG GAAATG; 3, AATGAGCCATTCGCAGTTTCACTG; 4, GCTCTCATGCTCTTGCCAAAAC; 5, TGTTTGTTACCT CTGGGCCCCG; 6, TCCAGTTACGAAAATTCTTG; 7, CGTATCGCATTTCGCTGCGTTC; 8, GTTCGCCTAGAC GCTCTCTCTTC; 9, GCGAGATTCCCCTACCCAC. The regions complementary to these oligonucleotides are shown in Figure 6A. The oligonucleotides probing box C/D snoRNAs are: U3, TTCGGTTTCTCACTCACTCTGGGGTAC; U14, GGAACCAGTCTTTCATCACCGTG. The oligonucleotides probing box H/ACA snoRNAs are: snoRNA10, CCTTG CAACGGTCCTCATCCGGG; snoRNA30, GTCCGAAGC GCCATCTAGATGA. RNA and protein precipitation analysis Cells were grown in YPD (1 l) to OD600 1.0, then collected, washed once in ice-cold PBS and broken using glass beads in 10 ml IPP150 buffer (10 mM Tris pH 8.0, 150 mM NaCl and 0.1% NP-40) with protease inhibitors. The lysates were mixed with 200 µl IgG agarose beads for 2 h at 4°C. After several washes with 50 ml IPP150 buffer, the IgG beads were collected and the RNA associated with the beads extracted by the hot phenol method (28). One-tenth of the precipitated RNA was then separated on 6% polyacrylamide 7 M urea denaturing gels and electro-transferred to Zeta-Probe GT nylon membranes. They were probed with [γ-32P]ATP labeled oligonucleotides. For the lanes showing total RNA, 2 µg RNA prepared from exponentially growing cultures were loaded. For co-precipitation analysis of proteins, the IgG beads were resuspended in 2× Laemmli sample buffer, boiled for 5 min and separated by SDS–polyacrylamide gel electrophoresis. Approximately 1% of the precipitate was loaded onto each lane. For the total protein, 0.1% of the extract prior to precipitation was loaded onto each lane. Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution. The antibody complexes were detected using ECL-Plus reagents (Amersham Pharmacia) as specified by the manufacturer. RESULTS Construction and analysis of ENP1 temperature-sensitive alleles ENP1 is an essential yeast gene conserved among eukaryotes (18). To study its functions, we first created a diploid strain, JBY45, heterozygous for the Δenp1 mutation. Then two enp1 ts mutant alleles (enp1-1 and enp1-2) were generated by random PCR mutagenesis, as described in Materials and Methods. Both mutant alleles were recessive to the wild-type ENP1 gene. The enp1-1 gene was integrated into the chromosomal trp1-1 locus to create strain JBY51 and all subsequent experiments were done with this enp1 allele. At 23°C the growth of JBY51 was comparable to that of W303-1a (ENP1), but at 37°C it did not grow (Fig. 2). Sequence analysis revealed that enp1-1 contains two point mutations, resulting in substitutions of two amino acids: W242→G and V415→A. No attempt was made to determine whether both mutations were required for the ts phenotype. Flow cytometry of strain JBY51 showed DNA content profiles similar to those of the wild-type strain at the non-permissive temperature (data not shown), suggesting that ENP1 is not involved in cell cycle regulation. Enp1 is enriched in the nucleolus Enp1 tagged at the C-terminus with the myc epitope was previously found to localize to the nucleus (18). To expand this analysis, we fused GFP to the N-terminus of Enp1, and expressed the tagged Enp1 protein under control of the MET25 promoter as the sole source of Enp1 protein in the cells. Cells of strain CWY13 (pMET25-GFP-ENP1) were grown in media with methionine (transcription partially repressed) or without methionine (transcription not repressed). Growth of CWY13 was comparable to that of wild-type cells in both media (data not shown), indicating that the GFP tagged Enp1 protein was functional. In cells cultured in medium without methionine, in which the ENP transcription was not repressed, the GFP-Enp1 protein was expressed at a high level and showed strong green fluorescence distributed throughout the nucleus (data not shown), consistent with the original observation (18). With methionine added to the medium, however, the fluorescent signal of GFP-Enp1 was weaker and surprisingly showed crescent or cap-like patterns typical of nucleolar proteins (Fig. 3A). This nucleolar enrichment was confirmed by its co-localization with the nucleolar protein Nop1 (Fig. 3B). ENP1 mutation leads to reduced levels of 40S ribosomal subunits The nucleolar enrichment suggested that Enp1 might play some role in ribosome synthesis. To test this possibility, cells of W303-1a (ENP1), JBY51 (enp1-1) and a top2 ts strain RS191 (30) were grown in YPD at 23 or 37°C and their ribosome profiles analyzed after separation on sucrose gradients. At 23°C, enp1-1 cells showed polysome profiles similar to those of the wild-type and top2-1 strains (Fig. 4A–C). In contrast, after incubation at the non-permissive temperature (37°C) for 40 min (data not shown) and 2 h, enp1-1 cells had reduced levels of 40S ribosomal subunits, 80S monosomes and polysomes, along with a dramatic increase in the free 60S subunit peak (Fig. 4F), while the wild-type and top2-1 cells showed little change in polysome profile at 37°C (Fig. 4D and E). These results demonstrate that the changes of the enp1-1 polysome profile were due to specific defects caused by the enp1-1 mutation, and not due simply to the shift to 37°C for a wild-type or ts strain. The processing of pre-rRNA for 18S rRNA is impaired in enp1 mutants In most cases reductions in ribosomal subunit levels are the results of defects in pre-rRNA processing or ribosome assembly or both (3). To study the mechanism by which Enp1 affects the 40S subunit, we analyzed the effects of enp1 mutations on processing of the pre-rRNA using pulse-chase labeling. [methyl-3H]methionine is preferred for labeling rRNAs in pulse-chase analysis because rRNAs are specifically methylated during the early steps of the processing. Cells of W303-1a (ENP1) and JBY51 (enp1-1) were grown at 23 or 37°C for 2 h before they were labeled with [methyl-3H]methionine for 3 min and chased with cold methionine for 2, 4 and 12 min. In wild-type cells, the labeled 35S rRNA precursor, 27S and 20S rRNA intermediates were rapidly chased into mature 25S and 18S rRNAs (Fig. 5), at 23 or 37°C. In contrast, enp1-1 cells showed dramatic changes after incubation at 37°C. Although at 23°C the synthesis and processing were comparable to those of wild-type cells, cells cultured at 37°C for 2 h had neither 20S pre-rRNA nor 18S rRNA, while 25S rRNA was generated at normal levels. The 37°C grown enp1-1 cells also had low levels of aberrant 23S and possibly 21S intermediates (Fig. 5). The defect in 18S rRNA synthesis was further supported by pulse-chase experiments carried out using [5,6-3H]uracil. The results obtained were essentially the same; no 20S pre-rRNA or 18S rRNA was produced, while processing to 25S rRNA was not affected (data not shown). Taken together, these results suggested that the enp1 mutation leads to specific defects in the processing pathway for 20S pre-rRNA and 18S rRNA, resulting in reduced 40S subunit synthesis and a lowered level of the 40S subunit. Enp1 is required for pre-rRNA processing at A0, A1 and A2 sites To define the processing steps affected by the enp1 mutation, the steady state levels of rRNA precursors and mature RNAs were analyzed by northern blotting. Total RNAs were isolated from cells of W303-1a (ENP1) and JBY51 (enp1-1) grown at 37°C for 2 or 4 h. After separation on formaldehyde agarose, RNAs were transferred onto nylon membranes and probed with radiolabeled oligonucleotides specific to various regions of the 35S pre-rRNA (Fig. 6A). After incubation at 37°C, enp1-1 cells had wild-type levels of 25S rRNA, but reduced levels of 18S rRNA (Fig. 6B). A probe specific to ITS1 (P5) further revealed that enp1-1 cells incubated at the non-permissive temperature accumulated two aberrant rRNAs, 23S and 21S (Fig. 6C). Aberrant rRNA processing products of similar sizes have been described in numerous studies (14,31–34) and result from defects in processing at A0, A1 and A2. Additional probes were used to verify the origins of the 23S and 21S RNAs in the enp1-1 strain. The 23S product was detected by oligos 1, 2, 4 and 5, but not by oligos 6, 7 or 8 (Fig. 6D, E, C, F, G and data not shown). Thus this RNA extends from the 5′ end of the 35S rRNA to the A3 site. The 21S product was detected by oligos 4 and 5, but not by oligos 1, 2, 6, 7 and 8 (Fig. 6E, C, D, F, G and data not shown), indicating that it extends from the A1 to the A3 site. At 37°C the enp1-1 cells also had less 32S and 20S rRNA intermediates (Fig. 6B and E). These results suggest that the enp1 mutation led to complete or nearly complete inhibition of processing at site A0 and A2, and partial inhibition of processing at site A1. As a consequence, the 35S pre-rRNA was cleaved at site A3 instead, producing 23S and 21S rRNA products. Consistent with this theory, the 27SA2 rRNA intermediate level was greatly reduced in enp1 cells at 37°C (Fig. 6C) due to the inhibition of processing at A2, while the 27SB pre-rRNA level was similar to wild-type cells (Fig. 6G). Moreover, no difference in the 5.8 rRNA level was observed between the wild-type cells and enp1 cells (Fig. 6H). Enp1 is associated with U3 and U14 snoRNAs and with Nop1 It has previously been shown that mutations in the U3, U14, snR10 and snR30 snoRNAs and in their associated proteins affect processing of 35S pre-rRNA at A0, A1 and A2. Because of the similarity with the processing defects of enp1-1 strains, we tested the association between Enp1 and snoRNAs. To do this, we created a strain in which a TAP tag was fused to the C-terminus of Enp1. The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity. Cells grew well with the TAP-tagged Enp1 as the only source of Enp1 protein, showing that it was functional. As a control, we used a TAP tag on an unrelated cytoplasmic protein, Hst2. Strain CWY14 (ENP1-TAP) and the Hst2-TAP tagged strain were grown in YPD to mid-exponential phase before being harvested. Extracts were prepared and mixed with IgG agarose beads to precipitate Enp1-TAP and associated RNAs. Total RNAs were extracted from washed IgG beads, separated on 6% polyacrylamide denaturing gels, transferred to nylon membranes and probed with radiolabeled oligonucleotides. Northern analysis revealed that Enp1-TAP precipitates were enriched with U3 and U14 snoRNAs relative to precipitates from the Hst2-tagged strain (Fig. 7A). The Enp1-TAP samples were not enriched with snR30 snoRNA (Fig. 7A), nor with U24 or U18 snoRNAs (data not shown). We found no change in the levels of U3, U14, snR10 and snR30 snoRNAs in the enp1 mutant, indicating that the mutation did not affect snoRNAs levels (Fig. 6I). The results indicate that Enp1 associates in vivo with U3 and U14 snoRNAs. Much less U3 RNA co-immunoprecipitated with Enp1-TAP than with Protein A-tagged Nop1, which is known to associate with U3 and U14 snoRNAs (Fig. 7A). However, Protein A-Nop1 was much more efficiently precipitated than was the Enp1-TAP protein (data not shown). Therefore, it is likely that similar amounts of RNAs are associated with the two proteins and that the proteins are part of the same complex. To address this further, we checked for the presence of Nop1 in the Enp1-TAP immunoprecipitates. Figure 7B shows that Nop1 indeed is in the Enp1 precipitate but not in the Hst2 control, whereas an abundant ribosomal protein, L3, is in neither precipitate. U3 and U14 snoRNAs have been shown to interact with rRNA precursors and these interactions are required for pre-rRNA processing (35–37). Using an in vitro system, U3 was also shown to be associated with its rRNA substrate and processing product (38). This raised the possibility that Enp1 might also be associated with rRNAs since its function in rRNA processing appeared linked to those of U3 and U14 snoRNAs. To test this possibility, we further analyzed the RNAs that co-precipiate with TAP-tagged Enp1. The RNAs were separated on 1.2% agarose formaldehyde gels or on polyacrylamide denaturing gels, transferred to nylon membranes and probed with radiolabeled oligonucleotides for pre-rRNAs. A probe (P4; see Fig. 6) specific to 20s and its precursors revealed that pre-rRNAs 35S, 33S, 32S and 20S specifically co-precipitated with Enp1-TAP (Fig. 7C). No such enrichment was found using a probe (P8; see Fig. 6) specific for 27S RNAs or a probe for 5.8S RNA (Fig. 7C). These results clearly demonstrated that Enp1 is associated with substrates and products of the early steps of 18S rRNA processing. Comparison of Enp1 with homologs in other organisms Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18). A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19). In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39). Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6. The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence. Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences. Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse. The alignment of the homologs showed that they shared homology from the N-terminus to the C-terminus, with the C-terminal half extremely well conserved, with close to 90% similarity (Fig. 8). One interesting observation is that the two amino acids changed in the enp1-1 mutant, W242 and V415, are conserved among all homologs. The human Enp1 homolog was cloned and expressed in yeast and tested for function. Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant. However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown). DISCUSSION ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18). ENP1 was shown to be essential for viability and the Enp1 protein localized to the nucleus (18). When we re-examined the localization of Enp1, we observed that the protein was enriched in the nucleolus. This finding led us to test for a role of Enp1 in ribosome synthesis. Using an enp1 ts mutant, we found that depletion of Enp1 caused a 40S ribosomal subunit deficiency. Further analysis revealed that this deficiency was not due to a change of the subunit’s stability, but to a defect in the synthesis of the subunit’s 18S rRNA component. Pulse-chase analysis of RNA synthesis in an enp1-1 strain revealed that no 20S pre-rRNA or 18S rRNA was made at the non-permissive temperature, while levels of 25S rRNA appeared normal. Low levels of precursors to 18S rRNA were detected in the mutants, and they were extremely unstable. Northern analysis of steady state RNA levels demonstrated that the enp1 mutation specifically inhibited the pre-rRNA early cleavages at sites A0, A1 and A2, which are required for the production of the 20S pre-rRNA and the 18S rRNA. These defects of the enp1 mutation on rRNA processing are very similar to those caused by mutation of KRR1, another essential nucleolar gene required for synthesis of the 40S, but not the 60S subunit (40). Co-precipitation analyses provided strong evidence that Enp1 is directly involved in pre-rRNA processing. In these experiments, TAP-tagged Enp1 bound to IgG beads specifically co-precipitated with two snoRNAs, U3 and U14, and with the 35S, 33S, 32S and 20S pre-rRNAs. Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing. It has been shown that mutations in U3, U14, snR10 and snR30 snoRNAs and protein components of the snoRNPs affect processing at sites A0, A1 or A2 (15,16,41,42). Enp1’s interaction with U3 and U14 snoRNAs suggests that Enp1’s function in rRNA processing involves these two snoRNAs. The fact that the nucleolar protein, Nop1, known to bind to U3 and U14 RNAs, also was found in the Enp1 precipitate, provides additional evidence that Enp1 is part of a complex involved in processing of rRNA. Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43). These proteins included Imp4, Kre31, Kre33, Mpp10, Nop1, Nop14 and Sof1, all of which have been implicated in 18S RNA processing or 40S biogenesis. Very recently (after the studies in this manuscript were concluded) Grandi et al. published an analysis of components of the 90s preribosomal particle, which include the 35S pre-rRNA, U3 snoRNP and rRNA processing factors for the 40S subunit (44). In agreement with our findings, they found that Enp1 is a component of this 90s complex and also of a smaller complex containing the 20S pre-rRNA. Surprisingly, none of the other proteins involved in processing of pre-rRNAs that were tested associated with the 20S rRNA, suggesting that those proteins, but not Enp1, are released prior to 20S pre-rRNA formation (44). The authors also showed co-precipitation of Enp1 with dimethylated 20S pre-rRNA, which is formed after export of 20S to the cytoplasm. These results of Grandi et al. suggest that Enp1 may also be involved in later steps of processing or nuclear export. A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19). Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids. Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown). This strongly suggests that the conserved function of Enp1 is in rRNA processing. The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog. It will be important to study the nature of the associations between Enp1 and U3 and U14 snoRNPs, and to learn more about the exact role of Enp1 in ribosomal RNA processing. Instructions: please typing these entity words according to sentence: yeast, Saccharomyces cerevisiae, yeast, Saccharomyces cerevisiae, yeast, yeast, human, human, yeast, Yeast, S.cerevisiae, Schizosaccharomyces pombe, human, human, yeast, human, human, mouse, donkey, mouse, mouse, yeast, Staphylococcus aureus, human, Drosophila, Caenorhabditis elegans, human, yeast, human, human, human, human, human, human, human, S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster, mouse, human, yeast, human, yeast, human, yeast, yeast, yeast, human, human, human, yeast, human Options: species
[ "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "B-species", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "B-species", "I-species", "O", "B-species", "O", "B-species", "I-species", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis Abstract ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide. Enp1 protein is localized in the nucleus and concentrated in the nucleolus. An enp1-1 temperature-sensitive mutant inhibited 35S pre-rRNA early processing at sites A0, A1 and A2 as shown by northern analysis of steady state levels of rRNA precursors. Pulse-chase analysis further revealed that the enp1-1 strain was defective in the synthesis of 20S pre-rRNA and hence 18S rRNA, which led to reduced formation of 40S ribosomal subunits. Co-precipitation analysis revealed that Enp1 was associated with Nop1 protein, as well as with U3 and U14 RNAs, two snoRNAs implicated in early pre-rRNA processing steps. These results suggest a direct role for Enp1 in the early steps of rRNA processing. INTRODUCTION Ribosome biogenesis is one of the major cellular activities in eukaryotic cells. It takes place primarily in a specialized subnuclear compartment, the nucleolus (1,2). In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1). This 35S precursor goes through a series of modifications and processing steps to generate the mature 18S, 5.8S and 25S rRNAs. The processing occurs first at sites A0, A1 and A2, resulting in the 20S pre-rRNA and 27SA2 pre-rRNA. The 20S pre-rRNA is then cleaved, leading to the mature 18S rRNA found in the 40S ribosomal subunit. The 27SA2 pre-rRNA is processed through two alternative pathways. The majority of 27SA2 pre-rRNA is cleaved at sites A3 and B2 to form the 27SA3 pre-rRNA, which is subsequently processed to produce 27SBS. Alternatively, 27SA2 pre-rRNA can be processed at sites B1L and B2 to generate 27SBL pre-rRNA. Both 27SBS and 27SBL pre-rRNAs are then cleaved at sites C1 and C2 to generate the mature 25S rRNA, and 7SS or 7SL intermediates, which are then processed to mature 5.8SS or 5.8SL rRNAs (Fig. 1). The 25S rRNA and 5.8S rRNA are the RNA components of the 60S ribosomal subunit (3). During the course of rRNA modification and processing, many of the ribosomal proteins are assembled onto the rRNA molecules to form the ribosome complex. Ribosome biogenesis needs a large number of trans-acting factors, including small nucleolar RNAs (snoRNAs), protein components of the snoRNP complexes, rRNA modifying enzymes, endo- and exonucleases, putative RNA helicases and other protein factors (3,4). In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing. On the basis of their structure, the snoRNAs can be divided into two groups: the box C/D family and box H/ACA family. Only one snoRNA, MRP RNA, belongs to neither family (5–7). While the majority of the snoRNAs participate in RNA pseudouridylation and 2′-O-ribose methylation, a few of them, including MRP snoRNA, box C/D snoRNAs U3 and U14, and box H/ACA snoRNAs snR10 and snR30, are required for processing of the pre-rRNA (8–12). Not only are U3, U14, snR10 and snR30 essential for early cleavages of 35S pre-rRNA to 18S rRNA, the proteins associated with them, including Nop1, Nop5, Gar1 and Nop10, have also been shown to be required for 18S rRNA synthesis (13–16). The ENP1 (Essential Nuclear Protein 1) gene was identified in a genetic screen for suppressors of an ost4 mutation (oligosaccharide transferase 4) (17). However, in subsequent studies it was found not to be involved in OST4 function (18). ENP1 is an essential gene encoding a 483 amino acid polypeptide. The Enp1 protein is highly conserved and homologs are found in all eukaryotes. The yeast protein was localized to the nucleus in a previous study (18). On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19). In this study, we report that the Enp1 protein not only is nuclear but is enriched in the nucleolus. We also found that Enp1 is required for the synthesis of 40S ribosomal subunits, and its presence is necessary for the pre-rRNA processing to form 20S pre-rRNA and 18S rRNA. An association between Enp1 and U3 and U14 snoRNAs, and with the nucleolar protein Nop1, was established. We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved. MATERIALS AND METHODS Yeast strains and media The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938. Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18). Strain JBY46 [MATa Δenp1::his5+/pJB23 (ENP1, URA3, CEN6)] is a haploid strain derived from JBY45 with wild-type ENP1 on a low copy number plasmid. Strain JBY48 [MATa Δenp1::his5+/pJB19 (enp1-1, TRP1, CEN6)] and strain JBY49 [MATa Δenp1::his5+/pJB39 (enp1-2, TRP1, CEN6)] have plasmids with enp1 temperature-sensitive (ts) mutations. Strain JBY51 (MATa Δenp1::his5+ TRP1::enp1-1) is an enp1 ts strain generated by integrating the enp1-1 gene at the chromosomal trp1-1 locus. Strain CWY13 [MATa Δenp1::his5+/pJB24 (pMET25-GFP-ENP1, URA3, CEN6)] has GFP-ENP1 under control of the MET25 promoter. Strain CWY14 (MATa ENP1-TAP) was created by fusing sequences encoding a Tandem Affinity Purification (TAP) tag (20,21) to the 3′ end of ENP1. Strain YRH39 (MATα HST2-TAP) was created by fusing sequences encoding a TAP tag to the 3′end of HST2. Strain RS1938 (Δnop1::URA3 pUN100-ProtA-NOP1) was created by transforming RS1935 (MATa/α leu2/leu2 ura3/ura3 lys2/lys2 ade2/ade2 Δnop1::URA3/NOP1) with pUN100-ProtA-NOP1 (strain and plasmid supplied by T. Schafer), followed by tetrad dissection. Strain CWY15 [MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a. The media used were prepared as described (22). Cloning of ENP1 pRS426-MEG1 (The original name of ENP1) was a gift from Dr William J. Lennarz. It contains the ENP1 gene within a 2.6 kb EcoRI genomic fragment cloned into pRS426 (18). The EcoRI fragment was subsequently cloned into pRS314 (TRP1, CEN6), pRS316 (URA3, CEN6) and pRS424 (TRP1, 2µ) to create pJB20, pJB23 and pJB21, respectively. pGFP-N-FUS is a centromeric plasmid for fusing green fluorescence protein (GFP) to a polypeptide’s N-terminus under control of the MET25 promoter (23). Cloning the ENP1 ORF into pGFP-N-FUS via XbaI and SalI sites generated plasmid pJB24. pJB19 (enp1-1, TRP1, CEN6) contains the enp1-1 mutant gene. The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively. The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118. Random mutagenesis of ENP1 to generate enp1 ts mutants The enp1 ts mutants were generated with a protocol introducing random mutations by PCR (25). The PCR was performed with oligonucleotides ENP1-MUT5′ (5′-GGTGGTGTCAGT AGGGGA-3′), ENP1-MUT3′ (5′-CAGTCTGCAATATA TGGAC-3′) and plasmid template pJB20 (see above). The nucleotide concentrations in the reaction were 1 mM each for dATP, dGTP, dCTP and dTTP. After strain JBY46 was transformed with the PCR product and with pJB20 gapped by NheI and NsiI, the transformants were replica-plated onto two plates containing 5-FOA synthetic medium without tryptophan; one replica was incubated at 23°C and the other at 37°C. Colonies growing at 23°C but not at 37°C were picked as candidates. Since approximately 10% of the colonies were inviable at both temperatures, we knew that 10% of the ENP1 PCR products lost their function after the PCR mutagenesis. This confirmed the effectiveness of the mutagenesis procedure. Two candidates showed good growth at 23°C but no growth at 37°C. They were named strains JBY48 and JBY49 and contained plasmids with the enp1-1 and enp1-2 mutations, respectively. The mutated enp1-1 gene on pJB19 was cloned into an integration vector, pRS304, as an EcoRI fragment. The plasmid was subsequently linearized with SnaBI within the TRP1 marker and was integrated at the chromosomal trp1-1 locus of strain JBY46. Selection on 5-FOA was used to remove plasmid pJB23, creating strain JBY51. Sucrose gradient analysis Polyribosome preparation and analysis were carried out essentially as described (26). Cells grown in YPD were collected at mid-log phase (OD600 0.8–1.0) and were broken with glass beads. The lysate was frozen immediately in liquid N2 and was stored at –80°C. Lysate (30 U of absorbance at OD260) was layered over a 7–47% (w/v) sucrose gradient, which was centrifuged at 28 000 r.p.m. for 5 h at 4°C in a SW28 rotor and was analyzed with an ISCO UA-5 gradient UV detection system on absorbency at 254 nm. Immunofluorescence Immunofluorescence analysis was carried out essentially as described (27). Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution. Images were taken on a Zeiss Axioplan2 microscope equipped with a Zeiss AxioCam camera. Pulse-chase labeling analysis of rRNA For [methyl-3H]methionine pulse-chase analysis, cells were grown in synthetic medium without methionine at room temperature or 37°C for 2 h. When the OD600 reached 1.0, 6 ml of the culture were pulse-labeled with 250 µCi [methyl-3H]methionine (Amersham Pharmacia) for 3 min and chased with cold methionine (500 µg/ml) for 2, 4 or 12 min. For each time point of the chase 1.25 ml of culture was mixed with ice and collected. The pellets were frozen immediately in liquid N2 and stored at –80°C before total RNA was purified using a hot phenol method (28). The RNAs were separated on a 1.2% agarose formaldehyde gel and transferred onto Hybond-N+ nylon membranes (Amersham Pharmacia). After being sprayed with EN3HANCE (Du Pont), the membranes were exposed to film at –80°C (29). Northern analysis Cells were grown inYPD at room temperature or 37°C for 2–4 h. When the OD600 reached 1.0, 10 ml of cells were collected and frozen immediately. Total RNA was extracted as described (28). Five micrograms of RNA were separated on 1.2% agarose formaldehyde gels (for high molecular weight RNA) or on 6% polyacrylamide 7 M urea denaturing gels (for low molecular weight RNA) for each sample. The RNA was then transferred to Zeta-Probe GT nylon membranes (Bio-Rad). Probes for hybridyzation were specific oligonucleotides end-labeled using [γ-32P]ATP. After hybridization and washes, membranes were exposed to phosphorimager screens or X-ray films (29). Oligonucleotides specific for various regions of 35S pre-rRNA are: 1, GGTCTCTCTGCTGCCG GAAATG; 3, AATGAGCCATTCGCAGTTTCACTG; 4, GCTCTCATGCTCTTGCCAAAAC; 5, TGTTTGTTACCT CTGGGCCCCG; 6, TCCAGTTACGAAAATTCTTG; 7, CGTATCGCATTTCGCTGCGTTC; 8, GTTCGCCTAGAC GCTCTCTCTTC; 9, GCGAGATTCCCCTACCCAC. The regions complementary to these oligonucleotides are shown in Figure 6A. The oligonucleotides probing box C/D snoRNAs are: U3, TTCGGTTTCTCACTCACTCTGGGGTAC; U14, GGAACCAGTCTTTCATCACCGTG. The oligonucleotides probing box H/ACA snoRNAs are: snoRNA10, CCTTG CAACGGTCCTCATCCGGG; snoRNA30, GTCCGAAGC GCCATCTAGATGA. RNA and protein precipitation analysis Cells were grown in YPD (1 l) to OD600 1.0, then collected, washed once in ice-cold PBS and broken using glass beads in 10 ml IPP150 buffer (10 mM Tris pH 8.0, 150 mM NaCl and 0.1% NP-40) with protease inhibitors. The lysates were mixed with 200 µl IgG agarose beads for 2 h at 4°C. After several washes with 50 ml IPP150 buffer, the IgG beads were collected and the RNA associated with the beads extracted by the hot phenol method (28). One-tenth of the precipitated RNA was then separated on 6% polyacrylamide 7 M urea denaturing gels and electro-transferred to Zeta-Probe GT nylon membranes. They were probed with [γ-32P]ATP labeled oligonucleotides. For the lanes showing total RNA, 2 µg RNA prepared from exponentially growing cultures were loaded. For co-precipitation analysis of proteins, the IgG beads were resuspended in 2× Laemmli sample buffer, boiled for 5 min and separated by SDS–polyacrylamide gel electrophoresis. Approximately 1% of the precipitate was loaded onto each lane. For the total protein, 0.1% of the extract prior to precipitation was loaded onto each lane. Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution. The antibody complexes were detected using ECL-Plus reagents (Amersham Pharmacia) as specified by the manufacturer. RESULTS Construction and analysis of ENP1 temperature-sensitive alleles ENP1 is an essential yeast gene conserved among eukaryotes (18). To study its functions, we first created a diploid strain, JBY45, heterozygous for the Δenp1 mutation. Then two enp1 ts mutant alleles (enp1-1 and enp1-2) were generated by random PCR mutagenesis, as described in Materials and Methods. Both mutant alleles were recessive to the wild-type ENP1 gene. The enp1-1 gene was integrated into the chromosomal trp1-1 locus to create strain JBY51 and all subsequent experiments were done with this enp1 allele. At 23°C the growth of JBY51 was comparable to that of W303-1a (ENP1), but at 37°C it did not grow (Fig. 2). Sequence analysis revealed that enp1-1 contains two point mutations, resulting in substitutions of two amino acids: W242→G and V415→A. No attempt was made to determine whether both mutations were required for the ts phenotype. Flow cytometry of strain JBY51 showed DNA content profiles similar to those of the wild-type strain at the non-permissive temperature (data not shown), suggesting that ENP1 is not involved in cell cycle regulation. Enp1 is enriched in the nucleolus Enp1 tagged at the C-terminus with the myc epitope was previously found to localize to the nucleus (18). To expand this analysis, we fused GFP to the N-terminus of Enp1, and expressed the tagged Enp1 protein under control of the MET25 promoter as the sole source of Enp1 protein in the cells. Cells of strain CWY13 (pMET25-GFP-ENP1) were grown in media with methionine (transcription partially repressed) or without methionine (transcription not repressed). Growth of CWY13 was comparable to that of wild-type cells in both media (data not shown), indicating that the GFP tagged Enp1 protein was functional. In cells cultured in medium without methionine, in which the ENP transcription was not repressed, the GFP-Enp1 protein was expressed at a high level and showed strong green fluorescence distributed throughout the nucleus (data not shown), consistent with the original observation (18). With methionine added to the medium, however, the fluorescent signal of GFP-Enp1 was weaker and surprisingly showed crescent or cap-like patterns typical of nucleolar proteins (Fig. 3A). This nucleolar enrichment was confirmed by its co-localization with the nucleolar protein Nop1 (Fig. 3B). ENP1 mutation leads to reduced levels of 40S ribosomal subunits The nucleolar enrichment suggested that Enp1 might play some role in ribosome synthesis. To test this possibility, cells of W303-1a (ENP1), JBY51 (enp1-1) and a top2 ts strain RS191 (30) were grown in YPD at 23 or 37°C and their ribosome profiles analyzed after separation on sucrose gradients. At 23°C, enp1-1 cells showed polysome profiles similar to those of the wild-type and top2-1 strains (Fig. 4A–C). In contrast, after incubation at the non-permissive temperature (37°C) for 40 min (data not shown) and 2 h, enp1-1 cells had reduced levels of 40S ribosomal subunits, 80S monosomes and polysomes, along with a dramatic increase in the free 60S subunit peak (Fig. 4F), while the wild-type and top2-1 cells showed little change in polysome profile at 37°C (Fig. 4D and E). These results demonstrate that the changes of the enp1-1 polysome profile were due to specific defects caused by the enp1-1 mutation, and not due simply to the shift to 37°C for a wild-type or ts strain. The processing of pre-rRNA for 18S rRNA is impaired in enp1 mutants In most cases reductions in ribosomal subunit levels are the results of defects in pre-rRNA processing or ribosome assembly or both (3). To study the mechanism by which Enp1 affects the 40S subunit, we analyzed the effects of enp1 mutations on processing of the pre-rRNA using pulse-chase labeling. [methyl-3H]methionine is preferred for labeling rRNAs in pulse-chase analysis because rRNAs are specifically methylated during the early steps of the processing. Cells of W303-1a (ENP1) and JBY51 (enp1-1) were grown at 23 or 37°C for 2 h before they were labeled with [methyl-3H]methionine for 3 min and chased with cold methionine for 2, 4 and 12 min. In wild-type cells, the labeled 35S rRNA precursor, 27S and 20S rRNA intermediates were rapidly chased into mature 25S and 18S rRNAs (Fig. 5), at 23 or 37°C. In contrast, enp1-1 cells showed dramatic changes after incubation at 37°C. Although at 23°C the synthesis and processing were comparable to those of wild-type cells, cells cultured at 37°C for 2 h had neither 20S pre-rRNA nor 18S rRNA, while 25S rRNA was generated at normal levels. The 37°C grown enp1-1 cells also had low levels of aberrant 23S and possibly 21S intermediates (Fig. 5). The defect in 18S rRNA synthesis was further supported by pulse-chase experiments carried out using [5,6-3H]uracil. The results obtained were essentially the same; no 20S pre-rRNA or 18S rRNA was produced, while processing to 25S rRNA was not affected (data not shown). Taken together, these results suggested that the enp1 mutation leads to specific defects in the processing pathway for 20S pre-rRNA and 18S rRNA, resulting in reduced 40S subunit synthesis and a lowered level of the 40S subunit. Enp1 is required for pre-rRNA processing at A0, A1 and A2 sites To define the processing steps affected by the enp1 mutation, the steady state levels of rRNA precursors and mature RNAs were analyzed by northern blotting. Total RNAs were isolated from cells of W303-1a (ENP1) and JBY51 (enp1-1) grown at 37°C for 2 or 4 h. After separation on formaldehyde agarose, RNAs were transferred onto nylon membranes and probed with radiolabeled oligonucleotides specific to various regions of the 35S pre-rRNA (Fig. 6A). After incubation at 37°C, enp1-1 cells had wild-type levels of 25S rRNA, but reduced levels of 18S rRNA (Fig. 6B). A probe specific to ITS1 (P5) further revealed that enp1-1 cells incubated at the non-permissive temperature accumulated two aberrant rRNAs, 23S and 21S (Fig. 6C). Aberrant rRNA processing products of similar sizes have been described in numerous studies (14,31–34) and result from defects in processing at A0, A1 and A2. Additional probes were used to verify the origins of the 23S and 21S RNAs in the enp1-1 strain. The 23S product was detected by oligos 1, 2, 4 and 5, but not by oligos 6, 7 or 8 (Fig. 6D, E, C, F, G and data not shown). Thus this RNA extends from the 5′ end of the 35S rRNA to the A3 site. The 21S product was detected by oligos 4 and 5, but not by oligos 1, 2, 6, 7 and 8 (Fig. 6E, C, D, F, G and data not shown), indicating that it extends from the A1 to the A3 site. At 37°C the enp1-1 cells also had less 32S and 20S rRNA intermediates (Fig. 6B and E). These results suggest that the enp1 mutation led to complete or nearly complete inhibition of processing at site A0 and A2, and partial inhibition of processing at site A1. As a consequence, the 35S pre-rRNA was cleaved at site A3 instead, producing 23S and 21S rRNA products. Consistent with this theory, the 27SA2 rRNA intermediate level was greatly reduced in enp1 cells at 37°C (Fig. 6C) due to the inhibition of processing at A2, while the 27SB pre-rRNA level was similar to wild-type cells (Fig. 6G). Moreover, no difference in the 5.8 rRNA level was observed between the wild-type cells and enp1 cells (Fig. 6H). Enp1 is associated with U3 and U14 snoRNAs and with Nop1 It has previously been shown that mutations in the U3, U14, snR10 and snR30 snoRNAs and in their associated proteins affect processing of 35S pre-rRNA at A0, A1 and A2. Because of the similarity with the processing defects of enp1-1 strains, we tested the association between Enp1 and snoRNAs. To do this, we created a strain in which a TAP tag was fused to the C-terminus of Enp1. The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity. Cells grew well with the TAP-tagged Enp1 as the only source of Enp1 protein, showing that it was functional. As a control, we used a TAP tag on an unrelated cytoplasmic protein, Hst2. Strain CWY14 (ENP1-TAP) and the Hst2-TAP tagged strain were grown in YPD to mid-exponential phase before being harvested. Extracts were prepared and mixed with IgG agarose beads to precipitate Enp1-TAP and associated RNAs. Total RNAs were extracted from washed IgG beads, separated on 6% polyacrylamide denaturing gels, transferred to nylon membranes and probed with radiolabeled oligonucleotides. Northern analysis revealed that Enp1-TAP precipitates were enriched with U3 and U14 snoRNAs relative to precipitates from the Hst2-tagged strain (Fig. 7A). The Enp1-TAP samples were not enriched with snR30 snoRNA (Fig. 7A), nor with U24 or U18 snoRNAs (data not shown). We found no change in the levels of U3, U14, snR10 and snR30 snoRNAs in the enp1 mutant, indicating that the mutation did not affect snoRNAs levels (Fig. 6I). The results indicate that Enp1 associates in vivo with U3 and U14 snoRNAs. Much less U3 RNA co-immunoprecipitated with Enp1-TAP than with Protein A-tagged Nop1, which is known to associate with U3 and U14 snoRNAs (Fig. 7A). However, Protein A-Nop1 was much more efficiently precipitated than was the Enp1-TAP protein (data not shown). Therefore, it is likely that similar amounts of RNAs are associated with the two proteins and that the proteins are part of the same complex. To address this further, we checked for the presence of Nop1 in the Enp1-TAP immunoprecipitates. Figure 7B shows that Nop1 indeed is in the Enp1 precipitate but not in the Hst2 control, whereas an abundant ribosomal protein, L3, is in neither precipitate. U3 and U14 snoRNAs have been shown to interact with rRNA precursors and these interactions are required for pre-rRNA processing (35–37). Using an in vitro system, U3 was also shown to be associated with its rRNA substrate and processing product (38). This raised the possibility that Enp1 might also be associated with rRNAs since its function in rRNA processing appeared linked to those of U3 and U14 snoRNAs. To test this possibility, we further analyzed the RNAs that co-precipiate with TAP-tagged Enp1. The RNAs were separated on 1.2% agarose formaldehyde gels or on polyacrylamide denaturing gels, transferred to nylon membranes and probed with radiolabeled oligonucleotides for pre-rRNAs. A probe (P4; see Fig. 6) specific to 20s and its precursors revealed that pre-rRNAs 35S, 33S, 32S and 20S specifically co-precipitated with Enp1-TAP (Fig. 7C). No such enrichment was found using a probe (P8; see Fig. 6) specific for 27S RNAs or a probe for 5.8S RNA (Fig. 7C). These results clearly demonstrated that Enp1 is associated with substrates and products of the early steps of 18S rRNA processing. Comparison of Enp1 with homologs in other organisms Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18). A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19). In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39). Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6. The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence. Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences. Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse. The alignment of the homologs showed that they shared homology from the N-terminus to the C-terminus, with the C-terminal half extremely well conserved, with close to 90% similarity (Fig. 8). One interesting observation is that the two amino acids changed in the enp1-1 mutant, W242 and V415, are conserved among all homologs. The human Enp1 homolog was cloned and expressed in yeast and tested for function. Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant. However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown). DISCUSSION ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18). ENP1 was shown to be essential for viability and the Enp1 protein localized to the nucleus (18). When we re-examined the localization of Enp1, we observed that the protein was enriched in the nucleolus. This finding led us to test for a role of Enp1 in ribosome synthesis. Using an enp1 ts mutant, we found that depletion of Enp1 caused a 40S ribosomal subunit deficiency. Further analysis revealed that this deficiency was not due to a change of the subunit’s stability, but to a defect in the synthesis of the subunit’s 18S rRNA component. Pulse-chase analysis of RNA synthesis in an enp1-1 strain revealed that no 20S pre-rRNA or 18S rRNA was made at the non-permissive temperature, while levels of 25S rRNA appeared normal. Low levels of precursors to 18S rRNA were detected in the mutants, and they were extremely unstable. Northern analysis of steady state RNA levels demonstrated that the enp1 mutation specifically inhibited the pre-rRNA early cleavages at sites A0, A1 and A2, which are required for the production of the 20S pre-rRNA and the 18S rRNA. These defects of the enp1 mutation on rRNA processing are very similar to those caused by mutation of KRR1, another essential nucleolar gene required for synthesis of the 40S, but not the 60S subunit (40). Co-precipitation analyses provided strong evidence that Enp1 is directly involved in pre-rRNA processing. In these experiments, TAP-tagged Enp1 bound to IgG beads specifically co-precipitated with two snoRNAs, U3 and U14, and with the 35S, 33S, 32S and 20S pre-rRNAs. Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing. It has been shown that mutations in U3, U14, snR10 and snR30 snoRNAs and protein components of the snoRNPs affect processing at sites A0, A1 or A2 (15,16,41,42). Enp1’s interaction with U3 and U14 snoRNAs suggests that Enp1’s function in rRNA processing involves these two snoRNAs. The fact that the nucleolar protein, Nop1, known to bind to U3 and U14 RNAs, also was found in the Enp1 precipitate, provides additional evidence that Enp1 is part of a complex involved in processing of rRNA. Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43). These proteins included Imp4, Kre31, Kre33, Mpp10, Nop1, Nop14 and Sof1, all of which have been implicated in 18S RNA processing or 40S biogenesis. Very recently (after the studies in this manuscript were concluded) Grandi et al. published an analysis of components of the 90s preribosomal particle, which include the 35S pre-rRNA, U3 snoRNP and rRNA processing factors for the 40S subunit (44). In agreement with our findings, they found that Enp1 is a component of this 90s complex and also of a smaller complex containing the 20S pre-rRNA. Surprisingly, none of the other proteins involved in processing of pre-rRNAs that were tested associated with the 20S rRNA, suggesting that those proteins, but not Enp1, are released prior to 20S pre-rRNA formation (44). The authors also showed co-precipitation of Enp1 with dimethylated 20S pre-rRNA, which is formed after export of 20S to the cytoplasm. These results of Grandi et al. suggest that Enp1 may also be involved in later steps of processing or nuclear export. A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19). Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids. Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown). This strongly suggests that the conserved function of Enp1 is in rRNA processing. The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog. It will be important to study the nature of the associations between Enp1 and U3 and U14 snoRNPs, and to learn more about the exact role of Enp1 in ribosomal RNA processing.
[ "Enp1", ",", "a", "yeast", "protein", "associated", "with", "U3", "and", "U14", "snoRNAs", ",", "is", "required", "for", "pre", "-", "rRNA", "processing", "and", "40S", "subunit", "synthesis", "\n", "Abstract", "\n", "ENP1", "is", "an", "essential", "Saccharomyces", "cerevisiae", "gene", "encoding", "a", "483", "amino", "acid", "polypeptide", ".", "Enp1", "protein", "is", "localized", "in", "the", "nucleus", "and", "concentrated", "in", "the", "nucleolus", ".", "An", "enp1", "-", "1", "temperature", "-", "sensitive", "mutant", "inhibited", "35S", "pre", "-", "rRNA", "early", "processing", "at", "sites", "A0", ",", "A1", "and", "A2", "as", "shown", "by", "northern", "analysis", "of", "steady", "state", "levels", "of", "rRNA", "precursors", ".", "Pulse", "-", "chase", "analysis", "further", "revealed", "that", "the", "enp1", "-", "1", "strain", "was", "defective", "in", "the", "synthesis", "of", "20S", "pre", "-", "rRNA", "and", "hence", "18S", "rRNA", ",", "which", "led", "to", "reduced", "formation", "of", "40S", "ribosomal", "subunits", ".", "Co", "-", "precipitation", "analysis", "revealed", "that", "Enp1", "was", "associated", "with", "Nop1", "protein", ",", "as", "well", "as", "with", "U3", "and", "U14", "RNAs", ",", "two", "snoRNAs", "implicated", "in", "early", "pre", "-", "rRNA", "processing", "steps", ".", "These", "results", "suggest", "a", "direct", "role", "for", "Enp1", "in", "the", "early", "steps", "of", "rRNA", "processing", ".", "\n\n", "INTRODUCTION", "\n", "Ribosome", "biogenesis", "is", "one", "of", "the", "major", "cellular", "activities", "in", "eukaryotic", "cells", ".", "It", "takes", "place", "primarily", "in", "a", "specialized", "subnuclear", "compartment", ",", "the", "nucleolus", "(", "1,2", ")", ".", "In", "the", "yeast", "Saccharomyces", "cerevisiae", ",", "each", "rRNA", "gene", "is", "transcribed", "by", "RNA", "polymerase", "I", "into", "a", "35S", "rRNA", "precursor", ",", "consisting", "of", "18S", ",", "5.8S", "and", "25S", "rRNA", "sequences", "flanked", "by", "two", "external", "transcribed", "spacers", "(", "ETS", ")", "and", "separated", "by", "two", "internal", "transcribed", "spacers", "(", "ITS", ")", "(", "Fig", ".", "1", ")", ".", "This", "35S", "precursor", "goes", "through", "a", "series", "of", "modifications", "and", "processing", "steps", "to", "generate", "the", "mature", "18S", ",", "5.8S", "and", "25S", "rRNAs", ".", "The", "processing", "occurs", "first", "at", "sites", "A0", ",", "A1", "and", "A2", ",", "resulting", "in", "the", "20S", "pre", "-", "rRNA", "and", "27SA2", "pre", "-", "rRNA", ".", "The", "20S", "pre", "-", "rRNA", "is", "then", "cleaved", ",", "leading", "to", "the", "mature", "18S", "rRNA", "found", "in", "the", "40S", "ribosomal", "subunit", ".", "The", "27SA2", "pre", "-", "rRNA", "is", "processed", "through", "two", "alternative", "pathways", ".", "The", "majority", "of", "27SA2", "pre", "-", "rRNA", "is", "cleaved", "at", "sites", "A3", "and", "B2", "to", "form", "the", "27SA3", "pre", "-", "rRNA", ",", "which", "is", "subsequently", "processed", "to", "produce", "27SBS", ".", "Alternatively", ",", "27SA2", "pre", "-", "rRNA", "can", "be", "processed", "at", "sites", "B1L", "and", "B2", "to", "generate", "27SBL", "pre", "-", "rRNA", ".", "Both", "27SBS", "and", "27SBL", "pre", "-", "rRNAs", "are", "then", "cleaved", "at", "sites", "C1", "and", "C2", "to", "generate", "the", "mature", "25S", "rRNA", ",", "and", "7SS", "or", "7SL", "intermediates", ",", "which", "are", "then", "processed", "to", "mature", "5.8SS", "or", "5.8SL", "rRNAs", "(", "Fig", ".", "1", ")", ".", "The", "25S", "rRNA", "and", "5.8S", "rRNA", "are", "the", "RNA", "components", "of", "the", "60S", "ribosomal", "subunit", "(", "3", ")", ".", "During", "the", "course", "of", "rRNA", "modification", "and", "processing", ",", "many", "of", "the", "ribosomal", "proteins", "are", "assembled", "onto", "the", "rRNA", "molecules", "to", "form", "the", "ribosome", "complex", ".", "\n", "Ribosome", "biogenesis", "needs", "a", "large", "number", "of", "trans", "-", "acting", "factors", ",", "including", "small", "nucleolar", "RNAs", "(", "snoRNAs", ")", ",", "protein", "components", "of", "the", "snoRNP", "complexes", ",", "rRNA", "modifying", "enzymes", ",", "endo-", "and", "exonucleases", ",", "putative", "RNA", "helicases", "and", "other", "protein", "factors", "(", "3,4", ")", ".", "In", "yeast", "cells", "there", "are", "more", "than", "100", "different", "snoRNAs", "playing", "important", "roles", "in", "rRNA", "modification", "and", "processing", ".", "On", "the", "basis", "of", "their", "structure", ",", "the", "snoRNAs", "can", "be", "divided", "into", "two", "groups", ":", "the", "box", "C", "/", "D", "family", "and", "box", "H", "/", "ACA", "family", ".", "Only", "one", "snoRNA", ",", "MRP", "RNA", ",", "belongs", "to", "neither", "family", "(", "5–7", ")", ".", "While", "the", "majority", "of", "the", "snoRNAs", "participate", "in", "RNA", "pseudouridylation", "and", "2′-O", "-", "ribose", "methylation", ",", "a", "few", "of", "them", ",", "including", "MRP", "snoRNA", ",", "box", "C", "/", "D", "snoRNAs", "U3", "and", "U14", ",", "and", "box", "H", "/", "ACA", "snoRNAs", "snR10", "and", "snR30", ",", "are", "required", "for", "processing", "of", "the", "pre", "-", "rRNA", "(", "8–12", ")", ".", "Not", "only", "are", "U3", ",", "U14", ",", "snR10", "and", "snR30", "essential", "for", "early", "cleavages", "of", "35S", "pre", "-", "rRNA", "to", "18S", "rRNA", ",", "the", "proteins", "associated", "with", "them", ",", "including", "Nop1", ",", "Nop5", ",", "Gar1", "and", "Nop10", ",", "have", "also", "been", "shown", "to", "be", "required", "for", "18S", "rRNA", "synthesis", "(", "13–16", ")", ".", "\n", "The", "ENP1", "(", "Essential", "Nuclear", "Protein", "1", ")", "gene", "was", "identified", "in", "a", "genetic", "screen", "for", "suppressors", "of", "an", "ost4", "mutation", "(", "oligosaccharide", "transferase", "4", ")", "(", "17", ")", ".", "However", ",", "in", "subsequent", "studies", "it", "was", "found", "not", "to", "be", "involved", "in", "OST4", "function", "(", "18", ")", ".", "ENP1", "is", "an", "essential", "gene", "encoding", "a", "483", "amino", "acid", "polypeptide", ".", "The", "Enp1", "protein", "is", "highly", "conserved", "and", "homologs", "are", "found", "in", "all", "eukaryotes", ".", "The", "yeast", "protein", "was", "localized", "to", "the", "nucleus", "in", "a", "previous", "study", "(", "18", ")", ".", "On", "the", "other", "hand", ",", "an", "Enp1", "human", "homolog", ",", "called", "bystin", ",", "was", "reported", "to", "localize", "to", "the", "cytoplasm", "and", "was", "proposed", "to", "be", "involved", "in", "cell", "adhesion", "(", "19", ")", ".", "\n", "In", "this", "study", ",", "we", "report", "that", "the", "Enp1", "protein", "not", "only", "is", "nuclear", "but", "is", "enriched", "in", "the", "nucleolus", ".", "We", "also", "found", "that", "Enp1", "is", "required", "for", "the", "synthesis", "of", "40S", "ribosomal", "subunits", ",", "and", "its", "presence", "is", "necessary", "for", "the", "pre", "-", "rRNA", "processing", "to", "form", "20S", "pre", "-", "rRNA", "and", "18S", "rRNA", ".", "An", "association", "between", "Enp1", "and", "U3", "and", "U14", "snoRNAs", ",", "and", "with", "the", "nucleolar", "protein", "Nop1", ",", "was", "established", ".", "We", "also", "found", "that", "human", "Enp1", ",", "expressed", "in", "yeast", ",", "was", "located", "in", "the", "nucleus", "and", "the", "nucleolus", ",", "suggesting", "that", "the", "function", "of", "this", "protein", "is", "conserved", ".", "\n\n", "MATERIALS", "AND", "METHODS", "\n", "Yeast", "strains", "and", "media", "\n", "The", "S.cerevisiae", "strains", "used", "in", "this", "study", "are", "all", "derivatives", "of", "a", "wild", "-", "type", "diploid", "strain", "W303", "(", "MATa", "/", "MATα", "ura3", "-", "1", "/", "ura3", "-", "1", "leu2", "-", "3,112", "/", "leu2", "-", "3,112", "trp1", "-", "1", "/", "trp1", "-", "1", "his3", "-", "11,15", "/", "his3", "-", "11,15", "ade2", "-", "1", "/", "ade2", "-", "1", "can1", "-", "100", "/", "can1", "-", "100", ")", "except", "for", "strain", "RS1938", ".", "Strain", "JBY45", "(", "MATa", "/", "MATα", "ENP1", "/", "Δenp1::his5", "+", ")", "was", "constructed", "by", "replacing", "one", "copy", "of", "the", "ENP1", "open", "reading", "frame", "(", "ORF", ")", "with", "the", "Schizosaccharomyces", "pombe", "his5", "+", "gene", "(", "18", ")", ".", "Strain", "JBY46", "[", "MATa", "Δenp1::his5+/pJB23", "(", "ENP1", ",", "URA3", ",", "CEN6", ")", "]", "is", "a", "haploid", "strain", "derived", "from", "JBY45", "with", "wild", "-", "type", "ENP1", "on", "a", "low", "copy", "number", "plasmid", ".", "Strain", "JBY48", "[", "MATa", "Δenp1::his5+/pJB19", "(", "enp1", "-", "1", ",", "TRP1", ",", "CEN6", ")", "]", "and", "strain", "JBY49", "[", "MATa", "Δenp1::his5+/pJB39", "(", "enp1", "-", "2", ",", "TRP1", ",", "CEN6", ")", "]", "have", "plasmids", "with", "enp1", "temperature", "-", "sensitive", "(", "ts", ")", "mutations", ".", "Strain", "JBY51", "(", "MATa", "Δenp1::his5", "+", "TRP1::enp1", "-", "1", ")", "is", "an", "enp1", "ts", "strain", "generated", "by", "integrating", "the", "enp1", "-", "1", "gene", "at", "the", "chromosomal", "trp1", "-", "1", "locus", ".", "Strain", "CWY13", "[", "MATa", "Δenp1::his5+/pJB24", "(", "pMET25-GFP", "-", "ENP1", ",", "URA3", ",", "CEN6", ")", "]", "has", "GFP", "-", "ENP1", "under", "control", "of", "the", "MET25", "promoter", ".", "Strain", "CWY14", "(", "MATa", "ENP1-TAP", ")", "was", "created", "by", "fusing", "sequences", "encoding", "a", "Tandem", "Affinity", "Purification", "(", "TAP", ")", "tag", "(", "20,21", ")", "to", "the", "3′", "end", "of", "ENP1", ".", "Strain", "YRH39", "(", "MATα", "HST2-TAP", ")", "was", "created", "by", "fusing", "sequences", "encoding", "a", "TAP", "tag", "to", "the", "3′end", "of", "HST2", ".", "Strain", "RS1938", "(", "Δnop1::URA3", "pUN100-ProtA", "-", "NOP1", ")", "was", "created", "by", "transforming", "RS1935", "(", "MATa", "/", "α", "leu2", "/", "leu2", "ura3", "/", "ura3", "lys2", "/", "lys2", "ade2", "/", "ade2", "Δnop1::URA3", "/", "NOP1", ")", "with", "pUN100-ProtA", "-", "NOP1", "(", "strain", "and", "plasmid", "supplied", "by", "T.", "Schafer", ")", ",", "followed", "by", "tetrad", "dissection", ".", "Strain", "CWY15", "[", "MATa", "/", "pCW109", "(", "pMET25-GFP", "-", "hENP1", ",", "URA3", ",", "CEN6", ")", "]", "has", "a", "human", "homolog", "of", "Enp1", "expressed", "in", "W303", "-", "1a", ".", "The", "media", "used", "were", "prepared", "as", "described", "(", "22", ")", ".", "\n\n", "Cloning", "of", "ENP1", "\n", "pRS426-MEG1", "(", "The", "original", "name", "of", "ENP1", ")", "was", "a", "gift", "from", "Dr", "William", "J.", "Lennarz", ".", "It", "contains", "the", "ENP1", "gene", "within", "a", "2.6", "kb", "EcoRI", "genomic", "fragment", "cloned", "into", "pRS426", "(", "18", ")", ".", "The", "EcoRI", "fragment", "was", "subsequently", "cloned", "into", "pRS314", "(", "TRP1", ",", "CEN6", ")", ",", "pRS316", "(", "URA3", ",", "CEN6", ")", "and", "pRS424", "(", "TRP1", ",", "2µ", ")", "to", "create", "pJB20", ",", "pJB23", "and", "pJB21", ",", "respectively", ".", "pGFP", "-", "N", "-", "FUS", "is", "a", "centromeric", "plasmid", "for", "fusing", "green", "fluorescence", "protein", "(", "GFP", ")", "to", "a", "polypeptide", "’s", "N", "-", "terminus", "under", "control", "of", "the", "MET25", "promoter", "(", "23", ")", ".", "Cloning", "the", "ENP1", "ORF", "into", "pGFP", "-", "N", "-", "FUS", "via", "XbaI", "and", "SalI", "sites", "generated", "plasmid", "pJB24", ".", "pJB19", "(", "enp1", "-", "1", ",", "TRP1", ",", "CEN6", ")", "contains", "the", "enp1", "-", "1", "mutant", "gene", ".", "The", "human", "homolog", "of", "yeast", "Enp1", "was", "PCR", "amplified", "from", "a", "human", "cDNA", "clone", "BC007340", "(", "Research", "Genetics", ")", ",", "then", "cloned", "into", "pGFP", "-", "N", "-", "FUS", ",", "p415-ADH", ",", "p415-GPD", "and", "p415-TEF", "(", "24", ")", "via", "XbaI", "and", "SalI", "sites", "to", "generate", "pCW109", ",", "pCW113", ",", "pCW115", "and", "pCW117", ",", "respectively", ".", "The", "fragment", "of", "the", "human", "Enp1", "homolog", "(", "amino", "acids", "152–437", ")", "was", "also", "cloned", "into", "these", "vectors", "to", "generate", "pCW110", ",", "pCW114", ",", "pCW116", "and", "pCW118", ".", "\n\n", "Random", "mutagenesis", "of", "ENP1", "to", "generate", "enp1", "ts", "mutants", "\n", "The", "enp1", "ts", "mutants", "were", "generated", "with", "a", "protocol", "introducing", "random", "mutations", "by", "PCR", "(", "25", ")", ".", "The", "PCR", "was", "performed", "with", "oligonucleotides", "ENP1-MUT5′", "(", "5′-GGTGGTGTCAGT", "AGGGGA-3′", ")", ",", "ENP1-MUT3′", "(", "5′-CAGTCTGCAATATA", "TGGAC-3′", ")", "and", "plasmid", "template", "pJB20", "(", "see", "above", ")", ".", "The", "nucleotide", "concentrations", "in", "the", "reaction", "were", "1", "mM", "each", "for", "dATP", ",", "dGTP", ",", "dCTP", "and", "dTTP", ".", "After", "strain", "JBY46", "was", "transformed", "with", "the", "PCR", "product", "and", "with", "pJB20", "gapped", "by", "NheI", "and", "NsiI", ",", "the", "transformants", "were", "replica", "-", "plated", "onto", "two", "plates", "containing", "5-FOA", "synthetic", "medium", "without", "tryptophan", ";", "one", "replica", "was", "incubated", "at", "23", "°", "C", "and", "the", "other", "at", "37", "°", "C", ".", "Colonies", "growing", "at", "23", "°", "C", "but", "not", "at", "37", "°", "C", "were", "picked", "as", "candidates", ".", "Since", "approximately", "10", "%", "of", "the", "colonies", "were", "inviable", "at", "both", "temperatures", ",", "we", "knew", "that", "10", "%", "of", "the", "ENP1", "PCR", "products", "lost", "their", "function", "after", "the", "PCR", "mutagenesis", ".", "This", "confirmed", "the", "effectiveness", "of", "the", "mutagenesis", "procedure", ".", "Two", "candidates", "showed", "good", "growth", "at", "23", "°", "C", "but", "no", "growth", "at", "37", "°", "C", ".", "They", "were", "named", "strains", "JBY48", "and", "JBY49", "and", "contained", "plasmids", "with", "the", "enp1", "-", "1", "and", "enp1", "-", "2", "mutations", ",", "respectively", ".", "The", "mutated", "enp1", "-", "1", "gene", "on", "pJB19", "was", "cloned", "into", "an", "integration", "vector", ",", "pRS304", ",", "as", "an", "EcoRI", "fragment", ".", "The", "plasmid", "was", "subsequently", "linearized", "with", "SnaBI", "within", "the", "TRP1", "marker", "and", "was", "integrated", "at", "the", "chromosomal", "trp1", "-", "1", "locus", "of", "strain", "JBY46", ".", "Selection", "on", "5-FOA", "was", "used", "to", "remove", "plasmid", "pJB23", ",", "creating", "strain", "JBY51", ".", "\n\n", "Sucrose", "gradient", "analysis", "\n", "Polyribosome", "preparation", "and", "analysis", "were", "carried", "out", "essentially", "as", "described", "(", "26", ")", ".", "Cells", "grown", "in", "YPD", "were", "collected", "at", "mid", "-", "log", "phase", "(", "OD600", "0.8–1.0", ")", "and", "were", "broken", "with", "glass", "beads", ".", "The", "lysate", "was", "frozen", "immediately", "in", "liquid", "N2", "and", "was", "stored", "at", "–", "80", "°", "C", ".", "Lysate", "(", "30", "U", "of", "absorbance", "at", "OD260", ")", "was", "layered", "over", "a", "7–47", "%", "(", "w", "/", "v", ")", "sucrose", "gradient", ",", "which", "was", "centrifuged", "at", "28", "000", "r.p.m", ".", "for", "5", "h", "at", "4", "°", "C", "in", "a", "SW28", "rotor", "and", "was", "analyzed", "with", "an", "ISCO", "UA-5", "gradient", "UV", "detection", "system", "on", "absorbency", "at", "254", "nm", ".", "\n\n", "Immunofluorescence", "\n", "Immunofluorescence", "analysis", "was", "carried", "out", "essentially", "as", "described", "(", "27", ")", ".", "Cells", "were", "fixed", "with", "3.7", "%", "formaldehyde", "at", "room", "temperature", "for", "1.5", "h.", "Antibodies", "included", "a", "mouse", "monoclonal", "anti", "-", "Nop1", "(", "a", "gift", "from", "John", "P.", "Aris", ",", "University", "of", "Florida", ",", "Gainesville", ",", "Florida", ")", "and", "a", "Texas", "-", "red", "-", "conjugated", "donkey", "-", "anti", "-", "mouse", "antibody", "(", "Jackson", "Lab", ")", ",", "both", "used", "at", "1:500", "dilution", ".", "Images", "were", "taken", "on", "a", "Zeiss", "Axioplan2", "microscope", "equipped", "with", "a", "Zeiss", "AxioCam", "camera", ".", "\n\n", "Pulse", "-", "chase", "labeling", "analysis", "of", "rRNA", "\n", "For", "[", "methyl-3H]methionine", "pulse", "-", "chase", "analysis", ",", "cells", "were", "grown", "in", "synthetic", "medium", "without", "methionine", "at", "room", "temperature", "or", "37", "°", "C", "for", "2", "h.", "When", "the", "OD600", "reached", "1.0", ",", "6", "ml", "of", "the", "culture", "were", "pulse", "-", "labeled", "with", "250", "µCi", "[", "methyl-3H]methionine", "(", "Amersham", "Pharmacia", ")", "for", "3", "min", "and", "chased", "with", "cold", "methionine", "(", "500", "µg", "/", "ml", ")", "for", "2", ",", "4", "or", "12", "min", ".", "For", "each", "time", "point", "of", "the", "chase", "1.25", "ml", "of", "culture", "was", "mixed", "with", "ice", "and", "collected", ".", "The", "pellets", "were", "frozen", "immediately", "in", "liquid", "N2", "and", "stored", "at", "–", "80", "°", "C", "before", "total", "RNA", "was", "purified", "using", "a", "hot", "phenol", "method", "(", "28", ")", ".", "The", "RNAs", "were", "separated", "on", "a", "1.2", "%", "agarose", "formaldehyde", "gel", "and", "transferred", "onto", "Hybond", "-", "N+", "nylon", "membranes", "(", "Amersham", "Pharmacia", ")", ".", "After", "being", "sprayed", "with", "EN3HANCE", "(", "Du", "Pont", ")", ",", "the", "membranes", "were", "exposed", "to", "film", "at", "–", "80", "°", "C", "(", "29", ")", ".", "\n\n", "Northern", "analysis", "\n", "Cells", "were", "grown", "inYPD", "at", "room", "temperature", "or", "37", "°", "C", "for", "2–4", "h.", "When", "the", "OD600", "reached", "1.0", ",", "10", "ml", "of", "cells", "were", "collected", "and", "frozen", "immediately", ".", "Total", "RNA", "was", "extracted", "as", "described", "(", "28", ")", ".", "Five", "micrograms", "of", "RNA", "were", "separated", "on", "1.2", "%", "agarose", "formaldehyde", "gels", "(", "for", "high", "molecular", "weight", "RNA", ")", "or", "on", "6", "%", "polyacrylamide", "7", "M", "urea", "denaturing", "gels", "(", "for", "low", "molecular", "weight", "RNA", ")", "for", "each", "sample", ".", "The", "RNA", "was", "then", "transferred", "to", "Zeta", "-", "Probe", "GT", "nylon", "membranes", "(", "Bio", "-", "Rad", ")", ".", "Probes", "for", "hybridyzation", "were", "specific", "oligonucleotides", "end", "-", "labeled", "using", "[", "γ-32P]ATP", ".", "After", "hybridization", "and", "washes", ",", "membranes", "were", "exposed", "to", "phosphorimager", "screens", "or", "X", "-", "ray", "films", "(", "29", ")", ".", "Oligonucleotides", "specific", "for", "various", "regions", "of", "35S", "pre", "-", "rRNA", "are", ":", "1", ",", "GGTCTCTCTGCTGCCG", "GAAATG", ";", "3", ",", "AATGAGCCATTCGCAGTTTCACTG", ";", "4", ",", "GCTCTCATGCTCTTGCCAAAAC", ";", "5", ",", "TGTTTGTTACCT", "CTGGGCCCCG", ";", "6", ",", "TCCAGTTACGAAAATTCTTG", ";", "7", ",", "CGTATCGCATTTCGCTGCGTTC", ";", "8", ",", "GTTCGCCTAGAC", "GCTCTCTCTTC", ";", "9", ",", "GCGAGATTCCCCTACCCAC", ".", "The", "regions", "complementary", "to", "these", "oligonucleotides", "are", "shown", "in", "Figure", "6A.", "The", "oligonucleotides", "probing", "box", "C", "/", "D", "snoRNAs", "are", ":", "U3", ",", "TTCGGTTTCTCACTCACTCTGGGGTAC", ";", "U14", ",", "GGAACCAGTCTTTCATCACCGTG", ".", "The", "oligonucleotides", "probing", "box", "H", "/", "ACA", "snoRNAs", "are", ":", "snoRNA10", ",", "CCTTG", "CAACGGTCCTCATCCGGG", ";", "snoRNA30", ",", "GTCCGAAGC", "GCCATCTAGATGA", ".", "\n\n", "RNA", "and", "protein", "precipitation", "analysis", "\n", "Cells", "were", "grown", "in", "YPD", "(", "1", "l", ")", "to", "OD600", "1.0", ",", "then", "collected", ",", "washed", "once", "in", "ice", "-", "cold", "PBS", "and", "broken", "using", "glass", "beads", "in", "10", "ml", "IPP150", "buffer", "(", "10", "mM", "Tris", "pH", "8.0", ",", "150", "mM", "NaCl", "and", "0.1", "%", "NP-40", ")", "with", "protease", "inhibitors", ".", "The", "lysates", "were", "mixed", "with", "200", "µl", "IgG", "agarose", "beads", "for", "2", "h", "at", "4", "°", "C", ".", "After", "several", "washes", "with", "50", "ml", "IPP150", "buffer", ",", "the", "IgG", "beads", "were", "collected", "and", "the", "RNA", "associated", "with", "the", "beads", "extracted", "by", "the", "hot", "phenol", "method", "(", "28", ")", ".", "One", "-", "tenth", "of", "the", "precipitated", "RNA", "was", "then", "separated", "on", "6", "%", "polyacrylamide", "7", "M", "urea", "denaturing", "gels", "and", "electro", "-", "transferred", "to", "Zeta", "-", "Probe", "GT", "nylon", "membranes", ".", "They", "were", "probed", "with", "[", "γ-32P]ATP", "labeled", "oligonucleotides", ".", "For", "the", "lanes", "showing", "total", "RNA", ",", "2", "µg", "RNA", "prepared", "from", "exponentially", "growing", "cultures", "were", "loaded", ".", "For", "co", "-", "precipitation", "analysis", "of", "proteins", ",", "the", "IgG", "beads", "were", "resuspended", "in", "2×", "Laemmli", "sample", "buffer", ",", "boiled", "for", "5", "min", "and", "separated", "by", "SDS", "–", "polyacrylamide", "gel", "electrophoresis", ".", "Approximately", "1", "%", "of", "the", "precipitate", "was", "loaded", "onto", "each", "lane", ".", "For", "the", "total", "protein", ",", "0.1", "%", "of", "the", "extract", "prior", "to", "precipitation", "was", "loaded", "onto", "each", "lane", ".", "Following", "electrophoresis", ",", "the", "proteins", "were", "transferred", "to", "nitrocellulose", "membranes", "and", "detected", "using", "anti", "-", "Nop1", "antibody", "at", "1:3000", "dilution", "(", "provided", "by", "J.", "Aris", ")", "and", "anti", "-", "L3", "antibody", "(", "provided", "by", "J.", "Warner", ")", "at", "1:3000", "dilution", "followed", "by", "peroxidase", "-", "conjugated", "anti", "-", "mouse", "secondary", "antibody", "at", "1:5000", "dilution", ".", "The", "antibody", "complexes", "were", "detected", "using", "ECL", "-", "Plus", "reagents", "(", "Amersham", "Pharmacia", ")", "as", "specified", "by", "the", "manufacturer", ".", "\n\n\n", "RESULTS", "\n", "Construction", "and", "analysis", "of", "ENP1", "temperature", "-", "sensitive", "alleles", "\n", "ENP1", "is", "an", "essential", "yeast", "gene", "conserved", "among", "eukaryotes", "(", "18", ")", ".", "To", "study", "its", "functions", ",", "we", "first", "created", "a", "diploid", "strain", ",", "JBY45", ",", "heterozygous", "for", "the", "Δenp1", "mutation", ".", "Then", "two", "enp1", "ts", "mutant", "alleles", "(", "enp1", "-", "1", "and", "enp1", "-", "2", ")", "were", "generated", "by", "random", "PCR", "mutagenesis", ",", "as", "described", "in", "Materials", "and", "Methods", ".", "Both", "mutant", "alleles", "were", "recessive", "to", "the", "wild", "-", "type", "ENP1", "gene", ".", "The", "enp1", "-", "1", "gene", "was", "integrated", "into", "the", "chromosomal", "trp1", "-", "1", "locus", "to", "create", "strain", "JBY51", "and", "all", "subsequent", "experiments", "were", "done", "with", "this", "enp1", "allele", ".", "At", "23", "°", "C", "the", "growth", "of", "JBY51", "was", "comparable", "to", "that", "of", "W303", "-", "1a", "(", "ENP1", ")", ",", "but", "at", "37", "°", "C", "it", "did", "not", "grow", "(", "Fig", ".", "2", ")", ".", "Sequence", "analysis", "revealed", "that", "enp1", "-", "1", "contains", "two", "point", "mutations", ",", "resulting", "in", "substitutions", "of", "two", "amino", "acids", ":", "W242→G", "and", "V415→A.", "No", "attempt", "was", "made", "to", "determine", "whether", "both", "mutations", "were", "required", "for", "the", "ts", "phenotype", ".", "Flow", "cytometry", "of", "strain", "JBY51", "showed", "DNA", "content", "profiles", "similar", "to", "those", "of", "the", "wild", "-", "type", "strain", "at", "the", "non", "-", "permissive", "temperature", "(", "data", "not", "shown", ")", ",", "suggesting", "that", "ENP1", "is", "not", "involved", "in", "cell", "cycle", "regulation", ".", "\n\n", "Enp1", "is", "enriched", "in", "the", "nucleolus", "\n", "Enp1", "tagged", "at", "the", "C", "-", "terminus", "with", "the", "myc", "epitope", "was", "previously", "found", "to", "localize", "to", "the", "nucleus", "(", "18", ")", ".", "To", "expand", "this", "analysis", ",", "we", "fused", "GFP", "to", "the", "N", "-", "terminus", "of", "Enp1", ",", "and", "expressed", "the", "tagged", "Enp1", "protein", "under", "control", "of", "the", "MET25", "promoter", "as", "the", "sole", "source", "of", "Enp1", "protein", "in", "the", "cells", ".", "Cells", "of", "strain", "CWY13", "(", "pMET25-GFP", "-", "ENP1", ")", "were", "grown", "in", "media", "with", "methionine", "(", "transcription", "partially", "repressed", ")", "or", "without", "methionine", "(", "transcription", "not", "repressed", ")", ".", "Growth", "of", "CWY13", "was", "comparable", "to", "that", "of", "wild", "-", "type", "cells", "in", "both", "media", "(", "data", "not", "shown", ")", ",", "indicating", "that", "the", "GFP", "tagged", "Enp1", "protein", "was", "functional", ".", "In", "cells", "cultured", "in", "medium", "without", "methionine", ",", "in", "which", "the", "ENP", "transcription", "was", "not", "repressed", ",", "the", "GFP", "-", "Enp1", "protein", "was", "expressed", "at", "a", "high", "level", "and", "showed", "strong", "green", "fluorescence", "distributed", "throughout", "the", "nucleus", "(", "data", "not", "shown", ")", ",", "consistent", "with", "the", "original", "observation", "(", "18", ")", ".", "With", "methionine", "added", "to", "the", "medium", ",", "however", ",", "the", "fluorescent", "signal", "of", "GFP", "-", "Enp1", "was", "weaker", "and", "surprisingly", "showed", "crescent", "or", "cap", "-", "like", "patterns", "typical", "of", "nucleolar", "proteins", "(", "Fig", ".", "3A", ")", ".", "This", "nucleolar", "enrichment", "was", "confirmed", "by", "its", "co", "-", "localization", "with", "the", "nucleolar", "protein", "Nop1", "(", "Fig", ".", "3B", ")", ".", "\n\n", "ENP1", "mutation", "leads", "to", "reduced", "levels", "of", "40S", "ribosomal", "subunits", "\n", "The", "nucleolar", "enrichment", "suggested", "that", "Enp1", "might", "play", "some", "role", "in", "ribosome", "synthesis", ".", "To", "test", "this", "possibility", ",", "cells", "of", "W303", "-", "1a", "(", "ENP1", ")", ",", "JBY51", "(", "enp1", "-", "1", ")", "and", "a", "top2", "ts", "strain", "RS191", "(", "30", ")", "were", "grown", "in", "YPD", "at", "23", "or", "37", "°", "C", "and", "their", "ribosome", "profiles", "analyzed", "after", "separation", "on", "sucrose", "gradients", ".", "At", "23", "°", "C", ",", "enp1", "-", "1", "cells", "showed", "polysome", "profiles", "similar", "to", "those", "of", "the", "wild", "-", "type", "and", "top2", "-", "1", "strains", "(", "Fig", ".", "4A", "–", "C", ")", ".", "In", "contrast", ",", "after", "incubation", "at", "the", "non", "-", "permissive", "temperature", "(", "37", "°", "C", ")", "for", "40", "min", "(", "data", "not", "shown", ")", "and", "2", "h", ",", "enp1", "-", "1", "cells", "had", "reduced", "levels", "of", "40S", "ribosomal", "subunits", ",", "80S", "monosomes", "and", "polysomes", ",", "along", "with", "a", "dramatic", "increase", "in", "the", "free", "60S", "subunit", "peak", "(", "Fig", ".", "4F", ")", ",", "while", "the", "wild", "-", "type", "and", "top2", "-", "1", "cells", "showed", "little", "change", "in", "polysome", "profile", "at", "37", "°", "C", "(", "Fig", ".", "4D", "and", "E", ")", ".", "These", "results", "demonstrate", "that", "the", "changes", "of", "the", "enp1", "-", "1", "polysome", "profile", "were", "due", "to", "specific", "defects", "caused", "by", "the", "enp1", "-", "1", "mutation", ",", "and", "not", "due", "simply", "to", "the", "shift", "to", "37", "°", "C", "for", "a", "wild", "-", "type", "or", "ts", "strain", ".", "\n\n", "The", "processing", "of", "pre", "-", "rRNA", "for", "18S", "rRNA", "is", "impaired", "in", "enp1", "mutants", "\n", "In", "most", "cases", "reductions", "in", "ribosomal", "subunit", "levels", "are", "the", "results", "of", "defects", "in", "pre", "-", "rRNA", "processing", "or", "ribosome", "assembly", "or", "both", "(", "3", ")", ".", "To", "study", "the", "mechanism", "by", "which", "Enp1", "affects", "the", "40S", "subunit", ",", "we", "analyzed", "the", "effects", "of", "enp1", "mutations", "on", "processing", "of", "the", "pre", "-", "rRNA", "using", "pulse", "-", "chase", "labeling", ".", "[", "methyl-3H]methionine", "is", "preferred", "for", "labeling", "rRNAs", "in", "pulse", "-", "chase", "analysis", "because", "rRNAs", "are", "specifically", "methylated", "during", "the", "early", "steps", "of", "the", "processing", ".", "Cells", "of", "W303", "-", "1a", "(", "ENP1", ")", "and", "JBY51", "(", "enp1", "-", "1", ")", "were", "grown", "at", "23", "or", "37", "°", "C", "for", "2", "h", "before", "they", "were", "labeled", "with", "[", "methyl-3H]methionine", "for", "3", "min", "and", "chased", "with", "cold", "methionine", "for", "2", ",", "4", "and", "12", "min", ".", "In", "wild", "-", "type", "cells", ",", "the", "labeled", "35S", "rRNA", "precursor", ",", "27S", "and", "20S", "rRNA", "intermediates", "were", "rapidly", "chased", "into", "mature", "25S", "and", "18S", "rRNAs", "(", "Fig", ".", "5", ")", ",", "at", "23", "or", "37", "°", "C", ".", "In", "contrast", ",", "enp1", "-", "1", "cells", "showed", "dramatic", "changes", "after", "incubation", "at", "37", "°", "C", ".", "Although", "at", "23", "°", "C", "the", "synthesis", "and", "processing", "were", "comparable", "to", "those", "of", "wild", "-", "type", "cells", ",", "cells", "cultured", "at", "37", "°", "C", "for", "2", "h", "had", "neither", "20S", "pre", "-", "rRNA", "nor", "18S", "rRNA", ",", "while", "25S", "rRNA", "was", "generated", "at", "normal", "levels", ".", "The", "37", "°", "C", "grown", "enp1", "-", "1", "cells", "also", "had", "low", "levels", "of", "aberrant", "23S", "and", "possibly", "21S", "intermediates", "(", "Fig", ".", "5", ")", ".", "The", "defect", "in", "18S", "rRNA", "synthesis", "was", "further", "supported", "by", "pulse", "-", "chase", "experiments", "carried", "out", "using", "[", "5,6", "-", "3H]uracil", ".", "The", "results", "obtained", "were", "essentially", "the", "same", ";", "no", "20S", "pre", "-", "rRNA", "or", "18S", "rRNA", "was", "produced", ",", "while", "processing", "to", "25S", "rRNA", "was", "not", "affected", "(", "data", "not", "shown", ")", ".", "\n", "Taken", "together", ",", "these", "results", "suggested", "that", "the", "enp1", "mutation", "leads", "to", "specific", "defects", "in", "the", "processing", "pathway", "for", "20S", "pre", "-", "rRNA", "and", "18S", "rRNA", ",", "resulting", "in", "reduced", "40S", "subunit", "synthesis", "and", "a", "lowered", "level", "of", "the", "40S", "subunit", ".", "\n\n", "Enp1", "is", "required", "for", "pre", "-", "rRNA", "processing", "at", "A0", ",", "A1", "and", "A2", "sites", "\n", "To", "define", "the", "processing", "steps", "affected", "by", "the", "enp1", "mutation", ",", "the", "steady", "state", "levels", "of", "rRNA", "precursors", "and", "mature", "RNAs", "were", "analyzed", "by", "northern", "blotting", ".", "Total", "RNAs", "were", "isolated", "from", "cells", "of", "W303", "-", "1a", "(", "ENP1", ")", "and", "JBY51", "(", "enp1", "-", "1", ")", "grown", "at", "37", "°", "C", "for", "2", "or", "4", "h.", "After", "separation", "on", "formaldehyde", "agarose", ",", "RNAs", "were", "transferred", "onto", "nylon", "membranes", "and", "probed", "with", "radiolabeled", "oligonucleotides", "specific", "to", "various", "regions", "of", "the", "35S", "pre", "-", "rRNA", "(", "Fig", ".", "6A", ")", ".", "After", "incubation", "at", "37", "°", "C", ",", "enp1", "-", "1", "cells", "had", "wild", "-", "type", "levels", "of", "25S", "rRNA", ",", "but", "reduced", "levels", "of", "18S", "rRNA", "(", "Fig", ".", "6B", ")", ".", "A", "probe", "specific", "to", "ITS1", "(", "P5", ")", "further", "revealed", "that", "enp1", "-", "1", "cells", "incubated", "at", "the", "non", "-", "permissive", "temperature", "accumulated", "two", "aberrant", "rRNAs", ",", "23S", "and", "21S", "(", "Fig", ".", "6C", ")", ".", "Aberrant", "rRNA", "processing", "products", "of", "similar", "sizes", "have", "been", "described", "in", "numerous", "studies", "(", "14,31–34", ")", "and", "result", "from", "defects", "in", "processing", "at", "A0", ",", "A1", "and", "A2", ".", "Additional", "probes", "were", "used", "to", "verify", "the", "origins", "of", "the", "23S", "and", "21S", "RNAs", "in", "the", "enp1", "-", "1", "strain", ".", "The", "23S", "product", "was", "detected", "by", "oligos", "1", ",", "2", ",", "4", "and", "5", ",", "but", "not", "by", "oligos", "6", ",", "7", "or", "8", "(", "Fig", ".", "6D", ",", "E", ",", "C", ",", "F", ",", "G", "and", "data", "not", "shown", ")", ".", "Thus", "this", "RNA", "extends", "from", "the", "5′", "end", "of", "the", "35S", "rRNA", "to", "the", "A3", "site", ".", "The", "21S", "product", "was", "detected", "by", "oligos", "4", "and", "5", ",", "but", "not", "by", "oligos", "1", ",", "2", ",", "6", ",", "7", "and", "8", "(", "Fig", ".", "6E", ",", "C", ",", "D", ",", "F", ",", "G", "and", "data", "not", "shown", ")", ",", "indicating", "that", "it", "extends", "from", "the", "A1", "to", "the", "A3", "site", ".", "At", "37", "°", "C", "the", "enp1", "-", "1", "cells", "also", "had", "less", "32S", "and", "20S", "rRNA", "intermediates", "(", "Fig", ".", "6B", "and", "E", ")", ".", "These", "results", "suggest", "that", "the", "enp1", "mutation", "led", "to", "complete", "or", "nearly", "complete", "inhibition", "of", "processing", "at", "site", "A0", "and", "A2", ",", "and", "partial", "inhibition", "of", "processing", "at", "site", "A1", ".", "As", "a", "consequence", ",", "the", "35S", "pre", "-", "rRNA", "was", "cleaved", "at", "site", "A3", "instead", ",", "producing", "23S", "and", "21S", "rRNA", "products", ".", "Consistent", "with", "this", "theory", ",", "the", "27SA2", "rRNA", "intermediate", "level", "was", "greatly", "reduced", "in", "enp1", "cells", "at", "37", "°", "C", "(", "Fig", ".", "6C", ")", "due", "to", "the", "inhibition", "of", "processing", "at", "A2", ",", "while", "the", "27SB", "pre", "-", "rRNA", "level", "was", "similar", "to", "wild", "-", "type", "cells", "(", "Fig", ".", "6", "G", ")", ".", "Moreover", ",", "no", "difference", "in", "the", "5.8", "rRNA", "level", "was", "observed", "between", "the", "wild", "-", "type", "cells", "and", "enp1", "cells", "(", "Fig", ".", "6H", ")", ".", "\n\n", "Enp1", "is", "associated", "with", "U3", "and", "U14", "snoRNAs", "and", "with", "Nop1", "\n", "It", "has", "previously", "been", "shown", "that", "mutations", "in", "the", "U3", ",", "U14", ",", "snR10", "and", "snR30", "snoRNAs", "and", "in", "their", "associated", "proteins", "affect", "processing", "of", "35S", "pre", "-", "rRNA", "at", "A0", ",", "A1", "and", "A2", ".", "Because", "of", "the", "similarity", "with", "the", "processing", "defects", "of", "enp1", "-", "1", "strains", ",", "we", "tested", "the", "association", "between", "Enp1", "and", "snoRNAs", ".", "To", "do", "this", ",", "we", "created", "a", "strain", "in", "which", "a", "TAP", "tag", "was", "fused", "to", "the", "C", "-", "terminus", "of", "Enp1", ".", "The", "TAP", "tag", "contains", "Staphylococcus", "aureus", "Protein", "A", "as", "well", "as", "calmodulin", "-", "binding", "peptide", "sequences", ",", "so", "the", "tagged", "Enp1", "binds", "IgG", "beads", "with", "high", "specificity", ".", "Cells", "grew", "well", "with", "the", "TAP", "-", "tagged", "Enp1", "as", "the", "only", "source", "of", "Enp1", "protein", ",", "showing", "that", "it", "was", "functional", ".", "As", "a", "control", ",", "we", "used", "a", "TAP", "tag", "on", "an", "unrelated", "cytoplasmic", "protein", ",", "Hst2", ".", "Strain", "CWY14", "(", "ENP1-TAP", ")", "and", "the", "Hst2-TAP", "tagged", "strain", "were", "grown", "in", "YPD", "to", "mid", "-", "exponential", "phase", "before", "being", "harvested", ".", "Extracts", "were", "prepared", "and", "mixed", "with", "IgG", "agarose", "beads", "to", "precipitate", "Enp1-TAP", "and", "associated", "RNAs", ".", "Total", "RNAs", "were", "extracted", "from", "washed", "IgG", "beads", ",", "separated", "on", "6", "%", "polyacrylamide", "denaturing", "gels", ",", "transferred", "to", "nylon", "membranes", "and", "probed", "with", "radiolabeled", "oligonucleotides", ".", "Northern", "analysis", "revealed", "that", "Enp1-TAP", "precipitates", "were", "enriched", "with", "U3", "and", "U14", "snoRNAs", "relative", "to", "precipitates", "from", "the", "Hst2-tagged", "strain", "(", "Fig", ".", "7A", ")", ".", "The", "Enp1-TAP", "samples", "were", "not", "enriched", "with", "snR30", "snoRNA", "(", "Fig", ".", "7A", ")", ",", "nor", "with", "U24", "or", "U18", "snoRNAs", "(", "data", "not", "shown", ")", ".", "We", "found", "no", "change", "in", "the", "levels", "of", "U3", ",", "U14", ",", "snR10", "and", "snR30", "snoRNAs", "in", "the", "enp1", "mutant", ",", "indicating", "that", "the", "mutation", "did", "not", "affect", "snoRNAs", "levels", "(", "Fig", ".", "6I", ")", ".", "The", "results", "indicate", "that", "Enp1", "associates", "in", "vivo", "with", "U3", "and", "U14", "snoRNAs", ".", "Much", "less", "U3", "RNA", "co", "-", "immunoprecipitated", "with", "Enp1-TAP", "than", "with", "Protein", "A", "-", "tagged", "Nop1", ",", "which", "is", "known", "to", "associate", "with", "U3", "and", "U14", "snoRNAs", "(", "Fig", ".", "7A", ")", ".", "However", ",", "Protein", "A", "-", "Nop1", "was", "much", "more", "efficiently", "precipitated", "than", "was", "the", "Enp1-TAP", "protein", "(", "data", "not", "shown", ")", ".", "Therefore", ",", "it", "is", "likely", "that", "similar", "amounts", "of", "RNAs", "are", "associated", "with", "the", "two", "proteins", "and", "that", "the", "proteins", "are", "part", "of", "the", "same", "complex", ".", "To", "address", "this", "further", ",", "we", "checked", "for", "the", "presence", "of", "Nop1", "in", "the", "Enp1-TAP", "immunoprecipitates", ".", "Figure", "7B", "shows", "that", "Nop1", "indeed", "is", "in", "the", "Enp1", "precipitate", "but", "not", "in", "the", "Hst2", "control", ",", "whereas", "an", "abundant", "ribosomal", "protein", ",", "L3", ",", "is", "in", "neither", "precipitate", ".", "\n", "U3", "and", "U14", "snoRNAs", "have", "been", "shown", "to", "interact", "with", "rRNA", "precursors", "and", "these", "interactions", "are", "required", "for", "pre", "-", "rRNA", "processing", "(", "35–37", ")", ".", "Using", "an", "in", "vitro", "system", ",", "U3", "was", "also", "shown", "to", "be", "associated", "with", "its", "rRNA", "substrate", "and", "processing", "product", "(", "38", ")", ".", "This", "raised", "the", "possibility", "that", "Enp1", "might", "also", "be", "associated", "with", "rRNAs", "since", "its", "function", "in", "rRNA", "processing", "appeared", "linked", "to", "those", "of", "U3", "and", "U14", "snoRNAs", ".", "To", "test", "this", "possibility", ",", "we", "further", "analyzed", "the", "RNAs", "that", "co", "-", "precipiate", "with", "TAP", "-", "tagged", "Enp1", ".", "The", "RNAs", "were", "separated", "on", "1.2", "%", "agarose", "formaldehyde", "gels", "or", "on", "polyacrylamide", "denaturing", "gels", ",", "transferred", "to", "nylon", "membranes", "and", "probed", "with", "radiolabeled", "oligonucleotides", "for", "pre", "-", "rRNAs", ".", "A", "probe", "(", "P4", ";", "see", "Fig", ".", "6", ")", "specific", "to", "20s", "and", "its", "precursors", "revealed", "that", "pre", "-", "rRNAs", "35S", ",", "33S", ",", "32S", "and", "20S", "specifically", "co", "-", "precipitated", "with", "Enp1-TAP", "(", "Fig", ".", "7C", ")", ".", "No", "such", "enrichment", "was", "found", "using", "a", "probe", "(", "P8", ";", "see", "Fig", ".", "6", ")", "specific", "for", "27S", "RNAs", "or", "a", "probe", "for", "5.8S", "RNA", "(", "Fig", ".", "7C", ")", ".", "These", "results", "clearly", "demonstrated", "that", "Enp1", "is", "associated", "with", "substrates", "and", "products", "of", "the", "early", "steps", "of", "18S", "rRNA", "processing", ".", "\n\n", "Comparison", "of", "Enp1", "with", "homologs", "in", "other", "organisms", "\n", "Homologs", "of", "Enp1", "protein", "in", "human", ",", "Drosophila", "and", "Caenorhabditis", "elegans", "have", "been", "reported", "(", "18", ")", ".", "A", "previously", "described", "human", "homolog", ",", "bystin", ",", "was", "only", "306", "amino", "acids", "in", "length", ",", "and", "lacked", "sequences", "corresponding", "to", "the", "N", "-", "terminal", "163", "amino", "acids", "of", "yeast", "Enp1", "(", "19", ")", ".", "In", "contrast", ",", "we", "identified", "a", "human", "expressed", "sequence", "tag", "(", "EST", ")", ",", "BC007340", "in", "a", "Blast", "search", "that", "revealed", "an", "ORF", "of", "1311", "nucleotides", "encoding", "a", "437", "amino", "acid", "polypeptide", "(", "39", ")", ".", "Comparison", "of", "this", "437", "amino", "acid", "polypeptide", "with", "human", "bystin", "(", "19", ")", "showed", "that", "they", "were", "encoded", "by", "the", "same", "gene", "on", "human", "chromosome", "6", ".", "The", "reported", "sequence", "for", "human", "bystin", "is", "a", "fragment", "of", "the", "437", "amino", "acid", "human", "Enp1", "protein", ",", "due", "to", "a", "truncated", "cDNA", "sequence", ".", "Also", ",", "a", "sequence", "discrepancy", "at", "the", "C", "-", "terminus", "is", "due", "to", "inaccurate", "DNA", "sequence", "of", "the", "human", "bystin", ",", "as", "confirmed", "by", "available", "human", "genome", "and", "EST", "sequences", ".", "Searches", "of", "the", "database", "of", "other", "organisms", "identified", "Enp1", "homologs", "in", "S.pombe", ",", "Arabidopsis", "thaliana", ",", "C.elegans", ",", "Drosophila", "melanogaster", "and", "mouse", ".", "The", "alignment", "of", "the", "homologs", "showed", "that", "they", "shared", "homology", "from", "the", "N", "-", "terminus", "to", "the", "C", "-", "terminus", ",", "with", "the", "C", "-", "terminal", "half", "extremely", "well", "conserved", ",", "with", "close", "to", "90", "%", "similarity", "(", "Fig", ".", "8)", ".", "One", "interesting", "observation", "is", "that", "the", "two", "amino", "acids", "changed", "in", "the", "enp1", "-", "1", "mutant", ",", "W242", "and", "V415", ",", "are", "conserved", "among", "all", "homologs", ".", "\n", "The", "human", "Enp1", "homolog", "was", "cloned", "and", "expressed", "in", "yeast", "and", "tested", "for", "function", ".", "Expressed", "under", "the", "control", "of", "ADH", ",", "TEF", "or", "GPD", "promoter", ",", "the", "human", "Enp1", "homolog", "did", "not", "complement", "a", "yeast", "enp1", "null", "mutant", ".", "However", ",", "a", "GFP", "fusion", "to", "the", "N", "-", "terminus", "of", "human", "Enp1", "homolog", "localized", "to", "the", "nucleus", "and", "was", "enriched", "in", "the", "nucleolus", "(", "data", "not", "shown", ")", ".", "\n\n\n", "DISCUSSION", "\n", "ENP1", "is", "a", "yeast", "gene", "first", "identified", "in", "a", "genetic", "screen", "for", "complementation", "of", "mutations", "in", "ost4", ",", "which", "encodes", "a", "subunit", "of", "oligosaccharide", "transferase", "(", "17", ")", ",", "although", "subsequent", "work", "showed", "that", "it", "is", "unlikely", "that", "Enp1", "has", "any", "connection", "to", "oligosaccharide", "transferase", "(", "18", ")", ".", "ENP1", "was", "shown", "to", "be", "essential", "for", "viability", "and", "the", "Enp1", "protein", "localized", "to", "the", "nucleus", "(", "18", ")", ".", "\n", "When", "we", "re", "-", "examined", "the", "localization", "of", "Enp1", ",", "we", "observed", "that", "the", "protein", "was", "enriched", "in", "the", "nucleolus", ".", "This", "finding", "led", "us", "to", "test", "for", "a", "role", "of", "Enp1", "in", "ribosome", "synthesis", ".", "Using", "an", "enp1", "ts", "mutant", ",", "we", "found", "that", "depletion", "of", "Enp1", "caused", "a", "40S", "ribosomal", "subunit", "deficiency", ".", "Further", "analysis", "revealed", "that", "this", "deficiency", "was", "not", "due", "to", "a", "change", "of", "the", "subunit", "’s", "stability", ",", "but", "to", "a", "defect", "in", "the", "synthesis", "of", "the", "subunit", "’s", "18S", "rRNA", "component", ".", "Pulse", "-", "chase", "analysis", "of", "RNA", "synthesis", "in", "an", "enp1", "-", "1", "strain", "revealed", "that", "no", "20S", "pre", "-", "rRNA", "or", "18S", "rRNA", "was", "made", "at", "the", "non", "-", "permissive", "temperature", ",", "while", "levels", "of", "25S", "rRNA", "appeared", "normal", ".", "Low", "levels", "of", "precursors", "to", "18S", "rRNA", "were", "detected", "in", "the", "mutants", ",", "and", "they", "were", "extremely", "unstable", ".", "Northern", "analysis", "of", "steady", "state", "RNA", "levels", "demonstrated", "that", "the", "enp1", "mutation", "specifically", "inhibited", "the", "pre", "-", "rRNA", "early", "cleavages", "at", "sites", "A0", ",", "A1", "and", "A2", ",", "which", "are", "required", "for", "the", "production", "of", "the", "20S", "pre", "-", "rRNA", "and", "the", "18S", "rRNA", ".", "These", "defects", "of", "the", "enp1", "mutation", "on", "rRNA", "processing", "are", "very", "similar", "to", "those", "caused", "by", "mutation", "of", "KRR1", ",", "another", "essential", "nucleolar", "gene", "required", "for", "synthesis", "of", "the", "40S", ",", "but", "not", "the", "60S", "subunit", "(", "40", ")", ".", "\n", "Co", "-", "precipitation", "analyses", "provided", "strong", "evidence", "that", "Enp1", "is", "directly", "involved", "in", "pre", "-", "rRNA", "processing", ".", "In", "these", "experiments", ",", "TAP", "-", "tagged", "Enp1", "bound", "to", "IgG", "beads", "specifically", "co", "-", "precipitated", "with", "two", "snoRNAs", ",", "U3", "and", "U14", ",", "and", "with", "the", "35S", ",", "33S", ",", "32S", "and", "20S", "pre", "-", "rRNAs", ".", "Among", "the", "more", "than", "100", "snoRNAs", "in", "yeast", "cells", ",", "U3", ",", "U14", ",", "snR10", ",", "snR30", "and", "MRP", "RNA", "are", "the", "only", "ones", "required", "for", "rRNA", "processing", ".", "It", "has", "been", "shown", "that", "mutations", "in", "U3", ",", "U14", ",", "snR10", "and", "snR30", "snoRNAs", "and", "protein", "components", "of", "the", "snoRNPs", "affect", "processing", "at", "sites", "A0", ",", "A1", "or", "A2", "(", "15,16,41,42", ")", ".", "Enp1", "’s", "interaction", "with", "U3", "and", "U14", "snoRNAs", "suggests", "that", "Enp1", "’s", "function", "in", "rRNA", "processing", "involves", "these", "two", "snoRNAs", ".", "The", "fact", "that", "the", "nucleolar", "protein", ",", "Nop1", ",", "known", "to", "bind", "to", "U3", "and", "U14", "RNAs", ",", "also", "was", "found", "in", "the", "Enp1", "precipitate", ",", "provides", "additional", "evidence", "that", "Enp1", "is", "part", "of", "a", "complex", "involved", "in", "processing", "of", "rRNA", ".", "Recently", ",", "a", "genome", "-", "wide", "study", "of", "yeast", "protein", "complexes", ",", "using", "a", "TAP", "tag", "method", "similar", "to", "ours", ",", "reported", "a", "number", "of", "proteins", "that", "co", "-", "immunoprecipitated", "with", "Enp1", "(", "43", ")", ".", "These", "proteins", "included", "Imp4", ",", "Kre31", ",", "Kre33", ",", "Mpp10", ",", "Nop1", ",", "Nop14", "and", "Sof1", ",", "all", "of", "which", "have", "been", "implicated", "in", "18S", "RNA", "processing", "or", "40S", "biogenesis", ".", "Very", "recently", "(", "after", "the", "studies", "in", "this", "manuscript", "were", "concluded", ")", "Grandi", "et", "al", ".", "published", "an", "analysis", "of", "components", "of", "the", "90s", "preribosomal", "particle", ",", "which", "include", "the", "35S", "pre", "-", "rRNA", ",", "U3", "snoRNP", "and", "rRNA", "processing", "factors", "for", "the", "40S", "subunit", "(", "44", ")", ".", "In", "agreement", "with", "our", "findings", ",", "they", "found", "that", "Enp1", "is", "a", "component", "of", "this", "90s", "complex", "and", "also", "of", "a", "smaller", "complex", "containing", "the", "20S", "pre", "-", "rRNA", ".", "Surprisingly", ",", "none", "of", "the", "other", "proteins", "involved", "in", "processing", "of", "pre", "-", "rRNAs", "that", "were", "tested", "associated", "with", "the", "20S", "rRNA", ",", "suggesting", "that", "those", "proteins", ",", "but", "not", "Enp1", ",", "are", "released", "prior", "to", "20S", "pre", "-", "rRNA", "formation", "(", "44", ")", ".", "The", "authors", "also", "showed", "co", "-", "precipitation", "of", "Enp1", "with", "dimethylated", "20S", "pre", "-", "rRNA", ",", "which", "is", "formed", "after", "export", "of", "20S", "to", "the", "cytoplasm", ".", "These", "results", "of", "Grandi", "et", "al", ".", "suggest", "that", "Enp1", "may", "also", "be", "involved", "in", "later", "steps", "of", "processing", "or", "nuclear", "export", ".", "\n", "A", "previous", "study", "on", "the", "Enp1", "human", "homolog", ",", "bystin", ",", "reported", "that", "the", "protein", "was", "localized", "in", "the", "cytoplasm", "of", "mammalian", "cells", "and", "might", "be", "involved", "in", "cell", "adhesion", "(", "19", ")", ".", "Our", "discovery", "of", "the", "437", "amino", "acid", "human", "Enp1", "homolog", "revealed", "that", "the", "bystin", "studied", "previously", "was", "from", "a", "truncated", "library", "cDNA", "encoding", "only", "the", "C", "-", "terminal", "306", "amino", "acids", ".", "Although", "the", "human", "homolog", "of", "Enp1", "did", "not", "complement", "a", "yeast", "Δenp1", "mutant", ",", "we", "did", "show", "that", "it", "was", "localized", "to", "the", "nucleus", "and", "enriched", "in", "the", "nucleolus", "(", "data", "not", "shown", ")", ".", "This", "strongly", "suggests", "that", "the", "conserved", "function", "of", "Enp1", "is", "in", "rRNA", "processing", ".", "The", "cytoplasmic", "localization", "of", "bystin", "and", "its", "proposed", "function", "in", "cell", "adhesion", "are", "unlikely", "to", "reflect", "the", "actual", "function", "of", "the", "human", "Enp1", "homolog", ".", "\n", "It", "will", "be", "important", "to", "study", "the", "nature", "of", "the", "associations", "between", "Enp1", "and", "U3", "and", "U14", "snoRNPs", ",", "and", "to", "learn", "more", "about", "the", "exact", "role", "of", "Enp1", "in", "ribosomal", "RNA", "processing", ".", "\n\n\n" ]
[ "species" ]
yeast, Saccharomyces cerevisiae, yeast, Saccharomyces cerevisiae, yeast, yeast, human, human, yeast, Yeast, S.cerevisiae, Schizosaccharomyces pombe, human, human, yeast, human, human, mouse, donkey, mouse, mouse, yeast, Staphylococcus aureus, human, Drosophila, Caenorhabditis elegans, human, yeast, human, human, human, human, human, human, human, S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster, mouse, human, yeast, human, yeast, human, yeast, yeast, yeast, human, human, human, yeast, human
88_task2
Sentence: Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis Abstract ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide. Enp1 protein is localized in the nucleus and concentrated in the nucleolus. An enp1-1 temperature-sensitive mutant inhibited 35S pre-rRNA early processing at sites A0, A1 and A2 as shown by northern analysis of steady state levels of rRNA precursors. Pulse-chase analysis further revealed that the enp1-1 strain was defective in the synthesis of 20S pre-rRNA and hence 18S rRNA, which led to reduced formation of 40S ribosomal subunits. Co-precipitation analysis revealed that Enp1 was associated with Nop1 protein, as well as with U3 and U14 RNAs, two snoRNAs implicated in early pre-rRNA processing steps. These results suggest a direct role for Enp1 in the early steps of rRNA processing. INTRODUCTION Ribosome biogenesis is one of the major cellular activities in eukaryotic cells. It takes place primarily in a specialized subnuclear compartment, the nucleolus (1,2). In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1). This 35S precursor goes through a series of modifications and processing steps to generate the mature 18S, 5.8S and 25S rRNAs. The processing occurs first at sites A0, A1 and A2, resulting in the 20S pre-rRNA and 27SA2 pre-rRNA. The 20S pre-rRNA is then cleaved, leading to the mature 18S rRNA found in the 40S ribosomal subunit. The 27SA2 pre-rRNA is processed through two alternative pathways. The majority of 27SA2 pre-rRNA is cleaved at sites A3 and B2 to form the 27SA3 pre-rRNA, which is subsequently processed to produce 27SBS. Alternatively, 27SA2 pre-rRNA can be processed at sites B1L and B2 to generate 27SBL pre-rRNA. Both 27SBS and 27SBL pre-rRNAs are then cleaved at sites C1 and C2 to generate the mature 25S rRNA, and 7SS or 7SL intermediates, which are then processed to mature 5.8SS or 5.8SL rRNAs (Fig. 1). The 25S rRNA and 5.8S rRNA are the RNA components of the 60S ribosomal subunit (3). During the course of rRNA modification and processing, many of the ribosomal proteins are assembled onto the rRNA molecules to form the ribosome complex. Ribosome biogenesis needs a large number of trans-acting factors, including small nucleolar RNAs (snoRNAs), protein components of the snoRNP complexes, rRNA modifying enzymes, endo- and exonucleases, putative RNA helicases and other protein factors (3,4). In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing. On the basis of their structure, the snoRNAs can be divided into two groups: the box C/D family and box H/ACA family. Only one snoRNA, MRP RNA, belongs to neither family (5–7). While the majority of the snoRNAs participate in RNA pseudouridylation and 2′-O-ribose methylation, a few of them, including MRP snoRNA, box C/D snoRNAs U3 and U14, and box H/ACA snoRNAs snR10 and snR30, are required for processing of the pre-rRNA (8–12). Not only are U3, U14, snR10 and snR30 essential for early cleavages of 35S pre-rRNA to 18S rRNA, the proteins associated with them, including Nop1, Nop5, Gar1 and Nop10, have also been shown to be required for 18S rRNA synthesis (13–16). The ENP1 (Essential Nuclear Protein 1) gene was identified in a genetic screen for suppressors of an ost4 mutation (oligosaccharide transferase 4) (17). However, in subsequent studies it was found not to be involved in OST4 function (18). ENP1 is an essential gene encoding a 483 amino acid polypeptide. The Enp1 protein is highly conserved and homologs are found in all eukaryotes. The yeast protein was localized to the nucleus in a previous study (18). On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19). In this study, we report that the Enp1 protein not only is nuclear but is enriched in the nucleolus. We also found that Enp1 is required for the synthesis of 40S ribosomal subunits, and its presence is necessary for the pre-rRNA processing to form 20S pre-rRNA and 18S rRNA. An association between Enp1 and U3 and U14 snoRNAs, and with the nucleolar protein Nop1, was established. We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved. MATERIALS AND METHODS Yeast strains and media The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938. Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18). Strain JBY46 [MATa Δenp1::his5+/pJB23 (ENP1, URA3, CEN6)] is a haploid strain derived from JBY45 with wild-type ENP1 on a low copy number plasmid. Strain JBY48 [MATa Δenp1::his5+/pJB19 (enp1-1, TRP1, CEN6)] and strain JBY49 [MATa Δenp1::his5+/pJB39 (enp1-2, TRP1, CEN6)] have plasmids with enp1 temperature-sensitive (ts) mutations. Strain JBY51 (MATa Δenp1::his5+ TRP1::enp1-1) is an enp1 ts strain generated by integrating the enp1-1 gene at the chromosomal trp1-1 locus. Strain CWY13 [MATa Δenp1::his5+/pJB24 (pMET25-GFP-ENP1, URA3, CEN6)] has GFP-ENP1 under control of the MET25 promoter. Strain CWY14 (MATa ENP1-TAP) was created by fusing sequences encoding a Tandem Affinity Purification (TAP) tag (20,21) to the 3′ end of ENP1. Strain YRH39 (MATα HST2-TAP) was created by fusing sequences encoding a TAP tag to the 3′end of HST2. Strain RS1938 (Δnop1::URA3 pUN100-ProtA-NOP1) was created by transforming RS1935 (MATa/α leu2/leu2 ura3/ura3 lys2/lys2 ade2/ade2 Δnop1::URA3/NOP1) with pUN100-ProtA-NOP1 (strain and plasmid supplied by T. Schafer), followed by tetrad dissection. Strain CWY15 [MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a. The media used were prepared as described (22). Cloning of ENP1 pRS426-MEG1 (The original name of ENP1) was a gift from Dr William J. Lennarz. It contains the ENP1 gene within a 2.6 kb EcoRI genomic fragment cloned into pRS426 (18). The EcoRI fragment was subsequently cloned into pRS314 (TRP1, CEN6), pRS316 (URA3, CEN6) and pRS424 (TRP1, 2µ) to create pJB20, pJB23 and pJB21, respectively. pGFP-N-FUS is a centromeric plasmid for fusing green fluorescence protein (GFP) to a polypeptide’s N-terminus under control of the MET25 promoter (23). Cloning the ENP1 ORF into pGFP-N-FUS via XbaI and SalI sites generated plasmid pJB24. pJB19 (enp1-1, TRP1, CEN6) contains the enp1-1 mutant gene. The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively. The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118. Random mutagenesis of ENP1 to generate enp1 ts mutants The enp1 ts mutants were generated with a protocol introducing random mutations by PCR (25). The PCR was performed with oligonucleotides ENP1-MUT5′ (5′-GGTGGTGTCAGT AGGGGA-3′), ENP1-MUT3′ (5′-CAGTCTGCAATATA TGGAC-3′) and plasmid template pJB20 (see above). The nucleotide concentrations in the reaction were 1 mM each for dATP, dGTP, dCTP and dTTP. After strain JBY46 was transformed with the PCR product and with pJB20 gapped by NheI and NsiI, the transformants were replica-plated onto two plates containing 5-FOA synthetic medium without tryptophan; one replica was incubated at 23°C and the other at 37°C. Colonies growing at 23°C but not at 37°C were picked as candidates. Since approximately 10% of the colonies were inviable at both temperatures, we knew that 10% of the ENP1 PCR products lost their function after the PCR mutagenesis. This confirmed the effectiveness of the mutagenesis procedure. Two candidates showed good growth at 23°C but no growth at 37°C. They were named strains JBY48 and JBY49 and contained plasmids with the enp1-1 and enp1-2 mutations, respectively. The mutated enp1-1 gene on pJB19 was cloned into an integration vector, pRS304, as an EcoRI fragment. The plasmid was subsequently linearized with SnaBI within the TRP1 marker and was integrated at the chromosomal trp1-1 locus of strain JBY46. Selection on 5-FOA was used to remove plasmid pJB23, creating strain JBY51. Sucrose gradient analysis Polyribosome preparation and analysis were carried out essentially as described (26). Cells grown in YPD were collected at mid-log phase (OD600 0.8–1.0) and were broken with glass beads. The lysate was frozen immediately in liquid N2 and was stored at –80°C. Lysate (30 U of absorbance at OD260) was layered over a 7–47% (w/v) sucrose gradient, which was centrifuged at 28 000 r.p.m. for 5 h at 4°C in a SW28 rotor and was analyzed with an ISCO UA-5 gradient UV detection system on absorbency at 254 nm. Immunofluorescence Immunofluorescence analysis was carried out essentially as described (27). Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution. Images were taken on a Zeiss Axioplan2 microscope equipped with a Zeiss AxioCam camera. Pulse-chase labeling analysis of rRNA For [methyl-3H]methionine pulse-chase analysis, cells were grown in synthetic medium without methionine at room temperature or 37°C for 2 h. When the OD600 reached 1.0, 6 ml of the culture were pulse-labeled with 250 µCi [methyl-3H]methionine (Amersham Pharmacia) for 3 min and chased with cold methionine (500 µg/ml) for 2, 4 or 12 min. For each time point of the chase 1.25 ml of culture was mixed with ice and collected. The pellets were frozen immediately in liquid N2 and stored at –80°C before total RNA was purified using a hot phenol method (28). The RNAs were separated on a 1.2% agarose formaldehyde gel and transferred onto Hybond-N+ nylon membranes (Amersham Pharmacia). After being sprayed with EN3HANCE (Du Pont), the membranes were exposed to film at –80°C (29). Northern analysis Cells were grown inYPD at room temperature or 37°C for 2–4 h. When the OD600 reached 1.0, 10 ml of cells were collected and frozen immediately. Total RNA was extracted as described (28). Five micrograms of RNA were separated on 1.2% agarose formaldehyde gels (for high molecular weight RNA) or on 6% polyacrylamide 7 M urea denaturing gels (for low molecular weight RNA) for each sample. The RNA was then transferred to Zeta-Probe GT nylon membranes (Bio-Rad). Probes for hybridyzation were specific oligonucleotides end-labeled using [γ-32P]ATP. After hybridization and washes, membranes were exposed to phosphorimager screens or X-ray films (29). Oligonucleotides specific for various regions of 35S pre-rRNA are: 1, GGTCTCTCTGCTGCCG GAAATG; 3, AATGAGCCATTCGCAGTTTCACTG; 4, GCTCTCATGCTCTTGCCAAAAC; 5, TGTTTGTTACCT CTGGGCCCCG; 6, TCCAGTTACGAAAATTCTTG; 7, CGTATCGCATTTCGCTGCGTTC; 8, GTTCGCCTAGAC GCTCTCTCTTC; 9, GCGAGATTCCCCTACCCAC. The regions complementary to these oligonucleotides are shown in Figure 6A. The oligonucleotides probing box C/D snoRNAs are: U3, TTCGGTTTCTCACTCACTCTGGGGTAC; U14, GGAACCAGTCTTTCATCACCGTG. The oligonucleotides probing box H/ACA snoRNAs are: snoRNA10, CCTTG CAACGGTCCTCATCCGGG; snoRNA30, GTCCGAAGC GCCATCTAGATGA. RNA and protein precipitation analysis Cells were grown in YPD (1 l) to OD600 1.0, then collected, washed once in ice-cold PBS and broken using glass beads in 10 ml IPP150 buffer (10 mM Tris pH 8.0, 150 mM NaCl and 0.1% NP-40) with protease inhibitors. The lysates were mixed with 200 µl IgG agarose beads for 2 h at 4°C. After several washes with 50 ml IPP150 buffer, the IgG beads were collected and the RNA associated with the beads extracted by the hot phenol method (28). One-tenth of the precipitated RNA was then separated on 6% polyacrylamide 7 M urea denaturing gels and electro-transferred to Zeta-Probe GT nylon membranes. They were probed with [γ-32P]ATP labeled oligonucleotides. For the lanes showing total RNA, 2 µg RNA prepared from exponentially growing cultures were loaded. For co-precipitation analysis of proteins, the IgG beads were resuspended in 2× Laemmli sample buffer, boiled for 5 min and separated by SDS–polyacrylamide gel electrophoresis. Approximately 1% of the precipitate was loaded onto each lane. For the total protein, 0.1% of the extract prior to precipitation was loaded onto each lane. Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution. The antibody complexes were detected using ECL-Plus reagents (Amersham Pharmacia) as specified by the manufacturer. RESULTS Construction and analysis of ENP1 temperature-sensitive alleles ENP1 is an essential yeast gene conserved among eukaryotes (18). To study its functions, we first created a diploid strain, JBY45, heterozygous for the Δenp1 mutation. Then two enp1 ts mutant alleles (enp1-1 and enp1-2) were generated by random PCR mutagenesis, as described in Materials and Methods. Both mutant alleles were recessive to the wild-type ENP1 gene. The enp1-1 gene was integrated into the chromosomal trp1-1 locus to create strain JBY51 and all subsequent experiments were done with this enp1 allele. At 23°C the growth of JBY51 was comparable to that of W303-1a (ENP1), but at 37°C it did not grow (Fig. 2). Sequence analysis revealed that enp1-1 contains two point mutations, resulting in substitutions of two amino acids: W242→G and V415→A. No attempt was made to determine whether both mutations were required for the ts phenotype. Flow cytometry of strain JBY51 showed DNA content profiles similar to those of the wild-type strain at the non-permissive temperature (data not shown), suggesting that ENP1 is not involved in cell cycle regulation. Enp1 is enriched in the nucleolus Enp1 tagged at the C-terminus with the myc epitope was previously found to localize to the nucleus (18). To expand this analysis, we fused GFP to the N-terminus of Enp1, and expressed the tagged Enp1 protein under control of the MET25 promoter as the sole source of Enp1 protein in the cells. Cells of strain CWY13 (pMET25-GFP-ENP1) were grown in media with methionine (transcription partially repressed) or without methionine (transcription not repressed). Growth of CWY13 was comparable to that of wild-type cells in both media (data not shown), indicating that the GFP tagged Enp1 protein was functional. In cells cultured in medium without methionine, in which the ENP transcription was not repressed, the GFP-Enp1 protein was expressed at a high level and showed strong green fluorescence distributed throughout the nucleus (data not shown), consistent with the original observation (18). With methionine added to the medium, however, the fluorescent signal of GFP-Enp1 was weaker and surprisingly showed crescent or cap-like patterns typical of nucleolar proteins (Fig. 3A). This nucleolar enrichment was confirmed by its co-localization with the nucleolar protein Nop1 (Fig. 3B). ENP1 mutation leads to reduced levels of 40S ribosomal subunits The nucleolar enrichment suggested that Enp1 might play some role in ribosome synthesis. To test this possibility, cells of W303-1a (ENP1), JBY51 (enp1-1) and a top2 ts strain RS191 (30) were grown in YPD at 23 or 37°C and their ribosome profiles analyzed after separation on sucrose gradients. At 23°C, enp1-1 cells showed polysome profiles similar to those of the wild-type and top2-1 strains (Fig. 4A–C). In contrast, after incubation at the non-permissive temperature (37°C) for 40 min (data not shown) and 2 h, enp1-1 cells had reduced levels of 40S ribosomal subunits, 80S monosomes and polysomes, along with a dramatic increase in the free 60S subunit peak (Fig. 4F), while the wild-type and top2-1 cells showed little change in polysome profile at 37°C (Fig. 4D and E). These results demonstrate that the changes of the enp1-1 polysome profile were due to specific defects caused by the enp1-1 mutation, and not due simply to the shift to 37°C for a wild-type or ts strain. The processing of pre-rRNA for 18S rRNA is impaired in enp1 mutants In most cases reductions in ribosomal subunit levels are the results of defects in pre-rRNA processing or ribosome assembly or both (3). To study the mechanism by which Enp1 affects the 40S subunit, we analyzed the effects of enp1 mutations on processing of the pre-rRNA using pulse-chase labeling. [methyl-3H]methionine is preferred for labeling rRNAs in pulse-chase analysis because rRNAs are specifically methylated during the early steps of the processing. Cells of W303-1a (ENP1) and JBY51 (enp1-1) were grown at 23 or 37°C for 2 h before they were labeled with [methyl-3H]methionine for 3 min and chased with cold methionine for 2, 4 and 12 min. In wild-type cells, the labeled 35S rRNA precursor, 27S and 20S rRNA intermediates were rapidly chased into mature 25S and 18S rRNAs (Fig. 5), at 23 or 37°C. In contrast, enp1-1 cells showed dramatic changes after incubation at 37°C. Although at 23°C the synthesis and processing were comparable to those of wild-type cells, cells cultured at 37°C for 2 h had neither 20S pre-rRNA nor 18S rRNA, while 25S rRNA was generated at normal levels. The 37°C grown enp1-1 cells also had low levels of aberrant 23S and possibly 21S intermediates (Fig. 5). The defect in 18S rRNA synthesis was further supported by pulse-chase experiments carried out using [5,6-3H]uracil. The results obtained were essentially the same; no 20S pre-rRNA or 18S rRNA was produced, while processing to 25S rRNA was not affected (data not shown). Taken together, these results suggested that the enp1 mutation leads to specific defects in the processing pathway for 20S pre-rRNA and 18S rRNA, resulting in reduced 40S subunit synthesis and a lowered level of the 40S subunit. Enp1 is required for pre-rRNA processing at A0, A1 and A2 sites To define the processing steps affected by the enp1 mutation, the steady state levels of rRNA precursors and mature RNAs were analyzed by northern blotting. Total RNAs were isolated from cells of W303-1a (ENP1) and JBY51 (enp1-1) grown at 37°C for 2 or 4 h. After separation on formaldehyde agarose, RNAs were transferred onto nylon membranes and probed with radiolabeled oligonucleotides specific to various regions of the 35S pre-rRNA (Fig. 6A). After incubation at 37°C, enp1-1 cells had wild-type levels of 25S rRNA, but reduced levels of 18S rRNA (Fig. 6B). A probe specific to ITS1 (P5) further revealed that enp1-1 cells incubated at the non-permissive temperature accumulated two aberrant rRNAs, 23S and 21S (Fig. 6C). Aberrant rRNA processing products of similar sizes have been described in numerous studies (14,31–34) and result from defects in processing at A0, A1 and A2. Additional probes were used to verify the origins of the 23S and 21S RNAs in the enp1-1 strain. The 23S product was detected by oligos 1, 2, 4 and 5, but not by oligos 6, 7 or 8 (Fig. 6D, E, C, F, G and data not shown). Thus this RNA extends from the 5′ end of the 35S rRNA to the A3 site. The 21S product was detected by oligos 4 and 5, but not by oligos 1, 2, 6, 7 and 8 (Fig. 6E, C, D, F, G and data not shown), indicating that it extends from the A1 to the A3 site. At 37°C the enp1-1 cells also had less 32S and 20S rRNA intermediates (Fig. 6B and E). These results suggest that the enp1 mutation led to complete or nearly complete inhibition of processing at site A0 and A2, and partial inhibition of processing at site A1. As a consequence, the 35S pre-rRNA was cleaved at site A3 instead, producing 23S and 21S rRNA products. Consistent with this theory, the 27SA2 rRNA intermediate level was greatly reduced in enp1 cells at 37°C (Fig. 6C) due to the inhibition of processing at A2, while the 27SB pre-rRNA level was similar to wild-type cells (Fig. 6G). Moreover, no difference in the 5.8 rRNA level was observed between the wild-type cells and enp1 cells (Fig. 6H). Enp1 is associated with U3 and U14 snoRNAs and with Nop1 It has previously been shown that mutations in the U3, U14, snR10 and snR30 snoRNAs and in their associated proteins affect processing of 35S pre-rRNA at A0, A1 and A2. Because of the similarity with the processing defects of enp1-1 strains, we tested the association between Enp1 and snoRNAs. To do this, we created a strain in which a TAP tag was fused to the C-terminus of Enp1. The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity. Cells grew well with the TAP-tagged Enp1 as the only source of Enp1 protein, showing that it was functional. As a control, we used a TAP tag on an unrelated cytoplasmic protein, Hst2. Strain CWY14 (ENP1-TAP) and the Hst2-TAP tagged strain were grown in YPD to mid-exponential phase before being harvested. Extracts were prepared and mixed with IgG agarose beads to precipitate Enp1-TAP and associated RNAs. Total RNAs were extracted from washed IgG beads, separated on 6% polyacrylamide denaturing gels, transferred to nylon membranes and probed with radiolabeled oligonucleotides. Northern analysis revealed that Enp1-TAP precipitates were enriched with U3 and U14 snoRNAs relative to precipitates from the Hst2-tagged strain (Fig. 7A). The Enp1-TAP samples were not enriched with snR30 snoRNA (Fig. 7A), nor with U24 or U18 snoRNAs (data not shown). We found no change in the levels of U3, U14, snR10 and snR30 snoRNAs in the enp1 mutant, indicating that the mutation did not affect snoRNAs levels (Fig. 6I). The results indicate that Enp1 associates in vivo with U3 and U14 snoRNAs. Much less U3 RNA co-immunoprecipitated with Enp1-TAP than with Protein A-tagged Nop1, which is known to associate with U3 and U14 snoRNAs (Fig. 7A). However, Protein A-Nop1 was much more efficiently precipitated than was the Enp1-TAP protein (data not shown). Therefore, it is likely that similar amounts of RNAs are associated with the two proteins and that the proteins are part of the same complex. To address this further, we checked for the presence of Nop1 in the Enp1-TAP immunoprecipitates. Figure 7B shows that Nop1 indeed is in the Enp1 precipitate but not in the Hst2 control, whereas an abundant ribosomal protein, L3, is in neither precipitate. U3 and U14 snoRNAs have been shown to interact with rRNA precursors and these interactions are required for pre-rRNA processing (35–37). Using an in vitro system, U3 was also shown to be associated with its rRNA substrate and processing product (38). This raised the possibility that Enp1 might also be associated with rRNAs since its function in rRNA processing appeared linked to those of U3 and U14 snoRNAs. To test this possibility, we further analyzed the RNAs that co-precipiate with TAP-tagged Enp1. The RNAs were separated on 1.2% agarose formaldehyde gels or on polyacrylamide denaturing gels, transferred to nylon membranes and probed with radiolabeled oligonucleotides for pre-rRNAs. A probe (P4; see Fig. 6) specific to 20s and its precursors revealed that pre-rRNAs 35S, 33S, 32S and 20S specifically co-precipitated with Enp1-TAP (Fig. 7C). No such enrichment was found using a probe (P8; see Fig. 6) specific for 27S RNAs or a probe for 5.8S RNA (Fig. 7C). These results clearly demonstrated that Enp1 is associated with substrates and products of the early steps of 18S rRNA processing. Comparison of Enp1 with homologs in other organisms Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18). A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19). In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39). Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6. The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence. Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences. Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse. The alignment of the homologs showed that they shared homology from the N-terminus to the C-terminus, with the C-terminal half extremely well conserved, with close to 90% similarity (Fig. 8). One interesting observation is that the two amino acids changed in the enp1-1 mutant, W242 and V415, are conserved among all homologs. The human Enp1 homolog was cloned and expressed in yeast and tested for function. Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant. However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown). DISCUSSION ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18). ENP1 was shown to be essential for viability and the Enp1 protein localized to the nucleus (18). When we re-examined the localization of Enp1, we observed that the protein was enriched in the nucleolus. This finding led us to test for a role of Enp1 in ribosome synthesis. Using an enp1 ts mutant, we found that depletion of Enp1 caused a 40S ribosomal subunit deficiency. Further analysis revealed that this deficiency was not due to a change of the subunit’s stability, but to a defect in the synthesis of the subunit’s 18S rRNA component. Pulse-chase analysis of RNA synthesis in an enp1-1 strain revealed that no 20S pre-rRNA or 18S rRNA was made at the non-permissive temperature, while levels of 25S rRNA appeared normal. Low levels of precursors to 18S rRNA were detected in the mutants, and they were extremely unstable. Northern analysis of steady state RNA levels demonstrated that the enp1 mutation specifically inhibited the pre-rRNA early cleavages at sites A0, A1 and A2, which are required for the production of the 20S pre-rRNA and the 18S rRNA. These defects of the enp1 mutation on rRNA processing are very similar to those caused by mutation of KRR1, another essential nucleolar gene required for synthesis of the 40S, but not the 60S subunit (40). Co-precipitation analyses provided strong evidence that Enp1 is directly involved in pre-rRNA processing. In these experiments, TAP-tagged Enp1 bound to IgG beads specifically co-precipitated with two snoRNAs, U3 and U14, and with the 35S, 33S, 32S and 20S pre-rRNAs. Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing. It has been shown that mutations in U3, U14, snR10 and snR30 snoRNAs and protein components of the snoRNPs affect processing at sites A0, A1 or A2 (15,16,41,42). Enp1’s interaction with U3 and U14 snoRNAs suggests that Enp1’s function in rRNA processing involves these two snoRNAs. The fact that the nucleolar protein, Nop1, known to bind to U3 and U14 RNAs, also was found in the Enp1 precipitate, provides additional evidence that Enp1 is part of a complex involved in processing of rRNA. Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43). These proteins included Imp4, Kre31, Kre33, Mpp10, Nop1, Nop14 and Sof1, all of which have been implicated in 18S RNA processing or 40S biogenesis. Very recently (after the studies in this manuscript were concluded) Grandi et al. published an analysis of components of the 90s preribosomal particle, which include the 35S pre-rRNA, U3 snoRNP and rRNA processing factors for the 40S subunit (44). In agreement with our findings, they found that Enp1 is a component of this 90s complex and also of a smaller complex containing the 20S pre-rRNA. Surprisingly, none of the other proteins involved in processing of pre-rRNAs that were tested associated with the 20S rRNA, suggesting that those proteins, but not Enp1, are released prior to 20S pre-rRNA formation (44). The authors also showed co-precipitation of Enp1 with dimethylated 20S pre-rRNA, which is formed after export of 20S to the cytoplasm. These results of Grandi et al. suggest that Enp1 may also be involved in later steps of processing or nuclear export. A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19). Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids. Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown). This strongly suggests that the conserved function of Enp1 is in rRNA processing. The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog. It will be important to study the nature of the associations between Enp1 and U3 and U14 snoRNPs, and to learn more about the exact role of Enp1 in ribosomal RNA processing. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "B-species", "O", "B-species", "I-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "B-species", "I-species", "O", "B-species", "O", "B-species", "I-species", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-species", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Enp1, a yeast protein associated with U3 and U14 snoRNAs, is required for pre-rRNA processing and 40S subunit synthesis Abstract ENP1 is an essential Saccharomyces cerevisiae gene encoding a 483 amino acid polypeptide. Enp1 protein is localized in the nucleus and concentrated in the nucleolus. An enp1-1 temperature-sensitive mutant inhibited 35S pre-rRNA early processing at sites A0, A1 and A2 as shown by northern analysis of steady state levels of rRNA precursors. Pulse-chase analysis further revealed that the enp1-1 strain was defective in the synthesis of 20S pre-rRNA and hence 18S rRNA, which led to reduced formation of 40S ribosomal subunits. Co-precipitation analysis revealed that Enp1 was associated with Nop1 protein, as well as with U3 and U14 RNAs, two snoRNAs implicated in early pre-rRNA processing steps. These results suggest a direct role for Enp1 in the early steps of rRNA processing. INTRODUCTION Ribosome biogenesis is one of the major cellular activities in eukaryotic cells. It takes place primarily in a specialized subnuclear compartment, the nucleolus (1,2). In the yeast Saccharomyces cerevisiae, each rRNA gene is transcribed by RNA polymerase I into a 35S rRNA precursor, consisting of 18S, 5.8S and 25S rRNA sequences flanked by two external transcribed spacers (ETS) and separated by two internal transcribed spacers (ITS) (Fig. 1). This 35S precursor goes through a series of modifications and processing steps to generate the mature 18S, 5.8S and 25S rRNAs. The processing occurs first at sites A0, A1 and A2, resulting in the 20S pre-rRNA and 27SA2 pre-rRNA. The 20S pre-rRNA is then cleaved, leading to the mature 18S rRNA found in the 40S ribosomal subunit. The 27SA2 pre-rRNA is processed through two alternative pathways. The majority of 27SA2 pre-rRNA is cleaved at sites A3 and B2 to form the 27SA3 pre-rRNA, which is subsequently processed to produce 27SBS. Alternatively, 27SA2 pre-rRNA can be processed at sites B1L and B2 to generate 27SBL pre-rRNA. Both 27SBS and 27SBL pre-rRNAs are then cleaved at sites C1 and C2 to generate the mature 25S rRNA, and 7SS or 7SL intermediates, which are then processed to mature 5.8SS or 5.8SL rRNAs (Fig. 1). The 25S rRNA and 5.8S rRNA are the RNA components of the 60S ribosomal subunit (3). During the course of rRNA modification and processing, many of the ribosomal proteins are assembled onto the rRNA molecules to form the ribosome complex. Ribosome biogenesis needs a large number of trans-acting factors, including small nucleolar RNAs (snoRNAs), protein components of the snoRNP complexes, rRNA modifying enzymes, endo- and exonucleases, putative RNA helicases and other protein factors (3,4). In yeast cells there are more than 100 different snoRNAs playing important roles in rRNA modification and processing. On the basis of their structure, the snoRNAs can be divided into two groups: the box C/D family and box H/ACA family. Only one snoRNA, MRP RNA, belongs to neither family (5–7). While the majority of the snoRNAs participate in RNA pseudouridylation and 2′-O-ribose methylation, a few of them, including MRP snoRNA, box C/D snoRNAs U3 and U14, and box H/ACA snoRNAs snR10 and snR30, are required for processing of the pre-rRNA (8–12). Not only are U3, U14, snR10 and snR30 essential for early cleavages of 35S pre-rRNA to 18S rRNA, the proteins associated with them, including Nop1, Nop5, Gar1 and Nop10, have also been shown to be required for 18S rRNA synthesis (13–16). The ENP1 (Essential Nuclear Protein 1) gene was identified in a genetic screen for suppressors of an ost4 mutation (oligosaccharide transferase 4) (17). However, in subsequent studies it was found not to be involved in OST4 function (18). ENP1 is an essential gene encoding a 483 amino acid polypeptide. The Enp1 protein is highly conserved and homologs are found in all eukaryotes. The yeast protein was localized to the nucleus in a previous study (18). On the other hand, an Enp1 human homolog, called bystin, was reported to localize to the cytoplasm and was proposed to be involved in cell adhesion (19). In this study, we report that the Enp1 protein not only is nuclear but is enriched in the nucleolus. We also found that Enp1 is required for the synthesis of 40S ribosomal subunits, and its presence is necessary for the pre-rRNA processing to form 20S pre-rRNA and 18S rRNA. An association between Enp1 and U3 and U14 snoRNAs, and with the nucleolar protein Nop1, was established. We also found that human Enp1, expressed in yeast, was located in the nucleus and the nucleolus, suggesting that the function of this protein is conserved. MATERIALS AND METHODS Yeast strains and media The S.cerevisiae strains used in this study are all derivatives of a wild-type diploid strain W303 (MATa/MATα ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100) except for strain RS1938. Strain JBY45 (MATa/MATα ENP1/Δenp1::his5+) was constructed by replacing one copy of the ENP1 open reading frame (ORF) with the Schizosaccharomyces pombe his5+ gene (18). Strain JBY46 [MATa Δenp1::his5+/pJB23 (ENP1, URA3, CEN6)] is a haploid strain derived from JBY45 with wild-type ENP1 on a low copy number plasmid. Strain JBY48 [MATa Δenp1::his5+/pJB19 (enp1-1, TRP1, CEN6)] and strain JBY49 [MATa Δenp1::his5+/pJB39 (enp1-2, TRP1, CEN6)] have plasmids with enp1 temperature-sensitive (ts) mutations. Strain JBY51 (MATa Δenp1::his5+ TRP1::enp1-1) is an enp1 ts strain generated by integrating the enp1-1 gene at the chromosomal trp1-1 locus. Strain CWY13 [MATa Δenp1::his5+/pJB24 (pMET25-GFP-ENP1, URA3, CEN6)] has GFP-ENP1 under control of the MET25 promoter. Strain CWY14 (MATa ENP1-TAP) was created by fusing sequences encoding a Tandem Affinity Purification (TAP) tag (20,21) to the 3′ end of ENP1. Strain YRH39 (MATα HST2-TAP) was created by fusing sequences encoding a TAP tag to the 3′end of HST2. Strain RS1938 (Δnop1::URA3 pUN100-ProtA-NOP1) was created by transforming RS1935 (MATa/α leu2/leu2 ura3/ura3 lys2/lys2 ade2/ade2 Δnop1::URA3/NOP1) with pUN100-ProtA-NOP1 (strain and plasmid supplied by T. Schafer), followed by tetrad dissection. Strain CWY15 [MATa/pCW109 (pMET25-GFP-hENP1, URA3, CEN6)] has a human homolog of Enp1 expressed in W303-1a. The media used were prepared as described (22). Cloning of ENP1 pRS426-MEG1 (The original name of ENP1) was a gift from Dr William J. Lennarz. It contains the ENP1 gene within a 2.6 kb EcoRI genomic fragment cloned into pRS426 (18). The EcoRI fragment was subsequently cloned into pRS314 (TRP1, CEN6), pRS316 (URA3, CEN6) and pRS424 (TRP1, 2µ) to create pJB20, pJB23 and pJB21, respectively. pGFP-N-FUS is a centromeric plasmid for fusing green fluorescence protein (GFP) to a polypeptide’s N-terminus under control of the MET25 promoter (23). Cloning the ENP1 ORF into pGFP-N-FUS via XbaI and SalI sites generated plasmid pJB24. pJB19 (enp1-1, TRP1, CEN6) contains the enp1-1 mutant gene. The human homolog of yeast Enp1 was PCR amplified from a human cDNA clone BC007340 (Research Genetics), then cloned into pGFP-N-FUS, p415-ADH, p415-GPD and p415-TEF (24) via XbaI and SalI sites to generate pCW109, pCW113, pCW115 and pCW117, respectively. The fragment of the human Enp1 homolog (amino acids 152–437) was also cloned into these vectors to generate pCW110, pCW114, pCW116 and pCW118. Random mutagenesis of ENP1 to generate enp1 ts mutants The enp1 ts mutants were generated with a protocol introducing random mutations by PCR (25). The PCR was performed with oligonucleotides ENP1-MUT5′ (5′-GGTGGTGTCAGT AGGGGA-3′), ENP1-MUT3′ (5′-CAGTCTGCAATATA TGGAC-3′) and plasmid template pJB20 (see above). The nucleotide concentrations in the reaction were 1 mM each for dATP, dGTP, dCTP and dTTP. After strain JBY46 was transformed with the PCR product and with pJB20 gapped by NheI and NsiI, the transformants were replica-plated onto two plates containing 5-FOA synthetic medium without tryptophan; one replica was incubated at 23°C and the other at 37°C. Colonies growing at 23°C but not at 37°C were picked as candidates. Since approximately 10% of the colonies were inviable at both temperatures, we knew that 10% of the ENP1 PCR products lost their function after the PCR mutagenesis. This confirmed the effectiveness of the mutagenesis procedure. Two candidates showed good growth at 23°C but no growth at 37°C. They were named strains JBY48 and JBY49 and contained plasmids with the enp1-1 and enp1-2 mutations, respectively. The mutated enp1-1 gene on pJB19 was cloned into an integration vector, pRS304, as an EcoRI fragment. The plasmid was subsequently linearized with SnaBI within the TRP1 marker and was integrated at the chromosomal trp1-1 locus of strain JBY46. Selection on 5-FOA was used to remove plasmid pJB23, creating strain JBY51. Sucrose gradient analysis Polyribosome preparation and analysis were carried out essentially as described (26). Cells grown in YPD were collected at mid-log phase (OD600 0.8–1.0) and were broken with glass beads. The lysate was frozen immediately in liquid N2 and was stored at –80°C. Lysate (30 U of absorbance at OD260) was layered over a 7–47% (w/v) sucrose gradient, which was centrifuged at 28 000 r.p.m. for 5 h at 4°C in a SW28 rotor and was analyzed with an ISCO UA-5 gradient UV detection system on absorbency at 254 nm. Immunofluorescence Immunofluorescence analysis was carried out essentially as described (27). Cells were fixed with 3.7% formaldehyde at room temperature for 1.5 h. Antibodies included a mouse monoclonal anti-Nop1 (a gift from John P. Aris, University of Florida, Gainesville, Florida) and a Texas-red-conjugated donkey-anti-mouse antibody (Jackson Lab), both used at 1:500 dilution. Images were taken on a Zeiss Axioplan2 microscope equipped with a Zeiss AxioCam camera. Pulse-chase labeling analysis of rRNA For [methyl-3H]methionine pulse-chase analysis, cells were grown in synthetic medium without methionine at room temperature or 37°C for 2 h. When the OD600 reached 1.0, 6 ml of the culture were pulse-labeled with 250 µCi [methyl-3H]methionine (Amersham Pharmacia) for 3 min and chased with cold methionine (500 µg/ml) for 2, 4 or 12 min. For each time point of the chase 1.25 ml of culture was mixed with ice and collected. The pellets were frozen immediately in liquid N2 and stored at –80°C before total RNA was purified using a hot phenol method (28). The RNAs were separated on a 1.2% agarose formaldehyde gel and transferred onto Hybond-N+ nylon membranes (Amersham Pharmacia). After being sprayed with EN3HANCE (Du Pont), the membranes were exposed to film at –80°C (29). Northern analysis Cells were grown inYPD at room temperature or 37°C for 2–4 h. When the OD600 reached 1.0, 10 ml of cells were collected and frozen immediately. Total RNA was extracted as described (28). Five micrograms of RNA were separated on 1.2% agarose formaldehyde gels (for high molecular weight RNA) or on 6% polyacrylamide 7 M urea denaturing gels (for low molecular weight RNA) for each sample. The RNA was then transferred to Zeta-Probe GT nylon membranes (Bio-Rad). Probes for hybridyzation were specific oligonucleotides end-labeled using [γ-32P]ATP. After hybridization and washes, membranes were exposed to phosphorimager screens or X-ray films (29). Oligonucleotides specific for various regions of 35S pre-rRNA are: 1, GGTCTCTCTGCTGCCG GAAATG; 3, AATGAGCCATTCGCAGTTTCACTG; 4, GCTCTCATGCTCTTGCCAAAAC; 5, TGTTTGTTACCT CTGGGCCCCG; 6, TCCAGTTACGAAAATTCTTG; 7, CGTATCGCATTTCGCTGCGTTC; 8, GTTCGCCTAGAC GCTCTCTCTTC; 9, GCGAGATTCCCCTACCCAC. The regions complementary to these oligonucleotides are shown in Figure 6A. The oligonucleotides probing box C/D snoRNAs are: U3, TTCGGTTTCTCACTCACTCTGGGGTAC; U14, GGAACCAGTCTTTCATCACCGTG. The oligonucleotides probing box H/ACA snoRNAs are: snoRNA10, CCTTG CAACGGTCCTCATCCGGG; snoRNA30, GTCCGAAGC GCCATCTAGATGA. RNA and protein precipitation analysis Cells were grown in YPD (1 l) to OD600 1.0, then collected, washed once in ice-cold PBS and broken using glass beads in 10 ml IPP150 buffer (10 mM Tris pH 8.0, 150 mM NaCl and 0.1% NP-40) with protease inhibitors. The lysates were mixed with 200 µl IgG agarose beads for 2 h at 4°C. After several washes with 50 ml IPP150 buffer, the IgG beads were collected and the RNA associated with the beads extracted by the hot phenol method (28). One-tenth of the precipitated RNA was then separated on 6% polyacrylamide 7 M urea denaturing gels and electro-transferred to Zeta-Probe GT nylon membranes. They were probed with [γ-32P]ATP labeled oligonucleotides. For the lanes showing total RNA, 2 µg RNA prepared from exponentially growing cultures were loaded. For co-precipitation analysis of proteins, the IgG beads were resuspended in 2× Laemmli sample buffer, boiled for 5 min and separated by SDS–polyacrylamide gel electrophoresis. Approximately 1% of the precipitate was loaded onto each lane. For the total protein, 0.1% of the extract prior to precipitation was loaded onto each lane. Following electrophoresis, the proteins were transferred to nitrocellulose membranes and detected using anti-Nop1 antibody at 1:3000 dilution (provided by J. Aris) and anti-L3 antibody (provided by J. Warner) at 1:3000 dilution followed by peroxidase-conjugated anti-mouse secondary antibody at 1:5000 dilution. The antibody complexes were detected using ECL-Plus reagents (Amersham Pharmacia) as specified by the manufacturer. RESULTS Construction and analysis of ENP1 temperature-sensitive alleles ENP1 is an essential yeast gene conserved among eukaryotes (18). To study its functions, we first created a diploid strain, JBY45, heterozygous for the Δenp1 mutation. Then two enp1 ts mutant alleles (enp1-1 and enp1-2) were generated by random PCR mutagenesis, as described in Materials and Methods. Both mutant alleles were recessive to the wild-type ENP1 gene. The enp1-1 gene was integrated into the chromosomal trp1-1 locus to create strain JBY51 and all subsequent experiments were done with this enp1 allele. At 23°C the growth of JBY51 was comparable to that of W303-1a (ENP1), but at 37°C it did not grow (Fig. 2). Sequence analysis revealed that enp1-1 contains two point mutations, resulting in substitutions of two amino acids: W242→G and V415→A. No attempt was made to determine whether both mutations were required for the ts phenotype. Flow cytometry of strain JBY51 showed DNA content profiles similar to those of the wild-type strain at the non-permissive temperature (data not shown), suggesting that ENP1 is not involved in cell cycle regulation. Enp1 is enriched in the nucleolus Enp1 tagged at the C-terminus with the myc epitope was previously found to localize to the nucleus (18). To expand this analysis, we fused GFP to the N-terminus of Enp1, and expressed the tagged Enp1 protein under control of the MET25 promoter as the sole source of Enp1 protein in the cells. Cells of strain CWY13 (pMET25-GFP-ENP1) were grown in media with methionine (transcription partially repressed) or without methionine (transcription not repressed). Growth of CWY13 was comparable to that of wild-type cells in both media (data not shown), indicating that the GFP tagged Enp1 protein was functional. In cells cultured in medium without methionine, in which the ENP transcription was not repressed, the GFP-Enp1 protein was expressed at a high level and showed strong green fluorescence distributed throughout the nucleus (data not shown), consistent with the original observation (18). With methionine added to the medium, however, the fluorescent signal of GFP-Enp1 was weaker and surprisingly showed crescent or cap-like patterns typical of nucleolar proteins (Fig. 3A). This nucleolar enrichment was confirmed by its co-localization with the nucleolar protein Nop1 (Fig. 3B). ENP1 mutation leads to reduced levels of 40S ribosomal subunits The nucleolar enrichment suggested that Enp1 might play some role in ribosome synthesis. To test this possibility, cells of W303-1a (ENP1), JBY51 (enp1-1) and a top2 ts strain RS191 (30) were grown in YPD at 23 or 37°C and their ribosome profiles analyzed after separation on sucrose gradients. At 23°C, enp1-1 cells showed polysome profiles similar to those of the wild-type and top2-1 strains (Fig. 4A–C). In contrast, after incubation at the non-permissive temperature (37°C) for 40 min (data not shown) and 2 h, enp1-1 cells had reduced levels of 40S ribosomal subunits, 80S monosomes and polysomes, along with a dramatic increase in the free 60S subunit peak (Fig. 4F), while the wild-type and top2-1 cells showed little change in polysome profile at 37°C (Fig. 4D and E). These results demonstrate that the changes of the enp1-1 polysome profile were due to specific defects caused by the enp1-1 mutation, and not due simply to the shift to 37°C for a wild-type or ts strain. The processing of pre-rRNA for 18S rRNA is impaired in enp1 mutants In most cases reductions in ribosomal subunit levels are the results of defects in pre-rRNA processing or ribosome assembly or both (3). To study the mechanism by which Enp1 affects the 40S subunit, we analyzed the effects of enp1 mutations on processing of the pre-rRNA using pulse-chase labeling. [methyl-3H]methionine is preferred for labeling rRNAs in pulse-chase analysis because rRNAs are specifically methylated during the early steps of the processing. Cells of W303-1a (ENP1) and JBY51 (enp1-1) were grown at 23 or 37°C for 2 h before they were labeled with [methyl-3H]methionine for 3 min and chased with cold methionine for 2, 4 and 12 min. In wild-type cells, the labeled 35S rRNA precursor, 27S and 20S rRNA intermediates were rapidly chased into mature 25S and 18S rRNAs (Fig. 5), at 23 or 37°C. In contrast, enp1-1 cells showed dramatic changes after incubation at 37°C. Although at 23°C the synthesis and processing were comparable to those of wild-type cells, cells cultured at 37°C for 2 h had neither 20S pre-rRNA nor 18S rRNA, while 25S rRNA was generated at normal levels. The 37°C grown enp1-1 cells also had low levels of aberrant 23S and possibly 21S intermediates (Fig. 5). The defect in 18S rRNA synthesis was further supported by pulse-chase experiments carried out using [5,6-3H]uracil. The results obtained were essentially the same; no 20S pre-rRNA or 18S rRNA was produced, while processing to 25S rRNA was not affected (data not shown). Taken together, these results suggested that the enp1 mutation leads to specific defects in the processing pathway for 20S pre-rRNA and 18S rRNA, resulting in reduced 40S subunit synthesis and a lowered level of the 40S subunit. Enp1 is required for pre-rRNA processing at A0, A1 and A2 sites To define the processing steps affected by the enp1 mutation, the steady state levels of rRNA precursors and mature RNAs were analyzed by northern blotting. Total RNAs were isolated from cells of W303-1a (ENP1) and JBY51 (enp1-1) grown at 37°C for 2 or 4 h. After separation on formaldehyde agarose, RNAs were transferred onto nylon membranes and probed with radiolabeled oligonucleotides specific to various regions of the 35S pre-rRNA (Fig. 6A). After incubation at 37°C, enp1-1 cells had wild-type levels of 25S rRNA, but reduced levels of 18S rRNA (Fig. 6B). A probe specific to ITS1 (P5) further revealed that enp1-1 cells incubated at the non-permissive temperature accumulated two aberrant rRNAs, 23S and 21S (Fig. 6C). Aberrant rRNA processing products of similar sizes have been described in numerous studies (14,31–34) and result from defects in processing at A0, A1 and A2. Additional probes were used to verify the origins of the 23S and 21S RNAs in the enp1-1 strain. The 23S product was detected by oligos 1, 2, 4 and 5, but not by oligos 6, 7 or 8 (Fig. 6D, E, C, F, G and data not shown). Thus this RNA extends from the 5′ end of the 35S rRNA to the A3 site. The 21S product was detected by oligos 4 and 5, but not by oligos 1, 2, 6, 7 and 8 (Fig. 6E, C, D, F, G and data not shown), indicating that it extends from the A1 to the A3 site. At 37°C the enp1-1 cells also had less 32S and 20S rRNA intermediates (Fig. 6B and E). These results suggest that the enp1 mutation led to complete or nearly complete inhibition of processing at site A0 and A2, and partial inhibition of processing at site A1. As a consequence, the 35S pre-rRNA was cleaved at site A3 instead, producing 23S and 21S rRNA products. Consistent with this theory, the 27SA2 rRNA intermediate level was greatly reduced in enp1 cells at 37°C (Fig. 6C) due to the inhibition of processing at A2, while the 27SB pre-rRNA level was similar to wild-type cells (Fig. 6G). Moreover, no difference in the 5.8 rRNA level was observed between the wild-type cells and enp1 cells (Fig. 6H). Enp1 is associated with U3 and U14 snoRNAs and with Nop1 It has previously been shown that mutations in the U3, U14, snR10 and snR30 snoRNAs and in their associated proteins affect processing of 35S pre-rRNA at A0, A1 and A2. Because of the similarity with the processing defects of enp1-1 strains, we tested the association between Enp1 and snoRNAs. To do this, we created a strain in which a TAP tag was fused to the C-terminus of Enp1. The TAP tag contains Staphylococcus aureus Protein A as well as calmodulin-binding peptide sequences, so the tagged Enp1 binds IgG beads with high specificity. Cells grew well with the TAP-tagged Enp1 as the only source of Enp1 protein, showing that it was functional. As a control, we used a TAP tag on an unrelated cytoplasmic protein, Hst2. Strain CWY14 (ENP1-TAP) and the Hst2-TAP tagged strain were grown in YPD to mid-exponential phase before being harvested. Extracts were prepared and mixed with IgG agarose beads to precipitate Enp1-TAP and associated RNAs. Total RNAs were extracted from washed IgG beads, separated on 6% polyacrylamide denaturing gels, transferred to nylon membranes and probed with radiolabeled oligonucleotides. Northern analysis revealed that Enp1-TAP precipitates were enriched with U3 and U14 snoRNAs relative to precipitates from the Hst2-tagged strain (Fig. 7A). The Enp1-TAP samples were not enriched with snR30 snoRNA (Fig. 7A), nor with U24 or U18 snoRNAs (data not shown). We found no change in the levels of U3, U14, snR10 and snR30 snoRNAs in the enp1 mutant, indicating that the mutation did not affect snoRNAs levels (Fig. 6I). The results indicate that Enp1 associates in vivo with U3 and U14 snoRNAs. Much less U3 RNA co-immunoprecipitated with Enp1-TAP than with Protein A-tagged Nop1, which is known to associate with U3 and U14 snoRNAs (Fig. 7A). However, Protein A-Nop1 was much more efficiently precipitated than was the Enp1-TAP protein (data not shown). Therefore, it is likely that similar amounts of RNAs are associated with the two proteins and that the proteins are part of the same complex. To address this further, we checked for the presence of Nop1 in the Enp1-TAP immunoprecipitates. Figure 7B shows that Nop1 indeed is in the Enp1 precipitate but not in the Hst2 control, whereas an abundant ribosomal protein, L3, is in neither precipitate. U3 and U14 snoRNAs have been shown to interact with rRNA precursors and these interactions are required for pre-rRNA processing (35–37). Using an in vitro system, U3 was also shown to be associated with its rRNA substrate and processing product (38). This raised the possibility that Enp1 might also be associated with rRNAs since its function in rRNA processing appeared linked to those of U3 and U14 snoRNAs. To test this possibility, we further analyzed the RNAs that co-precipiate with TAP-tagged Enp1. The RNAs were separated on 1.2% agarose formaldehyde gels or on polyacrylamide denaturing gels, transferred to nylon membranes and probed with radiolabeled oligonucleotides for pre-rRNAs. A probe (P4; see Fig. 6) specific to 20s and its precursors revealed that pre-rRNAs 35S, 33S, 32S and 20S specifically co-precipitated with Enp1-TAP (Fig. 7C). No such enrichment was found using a probe (P8; see Fig. 6) specific for 27S RNAs or a probe for 5.8S RNA (Fig. 7C). These results clearly demonstrated that Enp1 is associated with substrates and products of the early steps of 18S rRNA processing. Comparison of Enp1 with homologs in other organisms Homologs of Enp1 protein in human, Drosophila and Caenorhabditis elegans have been reported (18). A previously described human homolog, bystin, was only 306 amino acids in length, and lacked sequences corresponding to the N-terminal 163 amino acids of yeast Enp1 (19). In contrast, we identified a human expressed sequence tag (EST), BC007340 in a Blast search that revealed an ORF of 1311 nucleotides encoding a 437 amino acid polypeptide (39). Comparison of this 437 amino acid polypeptide with human bystin (19) showed that they were encoded by the same gene on human chromosome 6. The reported sequence for human bystin is a fragment of the 437 amino acid human Enp1 protein, due to a truncated cDNA sequence. Also, a sequence discrepancy at the C-terminus is due to inaccurate DNA sequence of the human bystin, as confirmed by available human genome and EST sequences. Searches of the database of other organisms identified Enp1 homologs in S.pombe, Arabidopsis thaliana, C.elegans, Drosophila melanogaster and mouse. The alignment of the homologs showed that they shared homology from the N-terminus to the C-terminus, with the C-terminal half extremely well conserved, with close to 90% similarity (Fig. 8). One interesting observation is that the two amino acids changed in the enp1-1 mutant, W242 and V415, are conserved among all homologs. The human Enp1 homolog was cloned and expressed in yeast and tested for function. Expressed under the control of ADH, TEF or GPD promoter, the human Enp1 homolog did not complement a yeast enp1 null mutant. However, a GFP fusion to the N-terminus of human Enp1 homolog localized to the nucleus and was enriched in the nucleolus (data not shown). DISCUSSION ENP1 is a yeast gene first identified in a genetic screen for complementation of mutations in ost4, which encodes a subunit of oligosaccharide transferase (17), although subsequent work showed that it is unlikely that Enp1 has any connection to oligosaccharide transferase (18). ENP1 was shown to be essential for viability and the Enp1 protein localized to the nucleus (18). When we re-examined the localization of Enp1, we observed that the protein was enriched in the nucleolus. This finding led us to test for a role of Enp1 in ribosome synthesis. Using an enp1 ts mutant, we found that depletion of Enp1 caused a 40S ribosomal subunit deficiency. Further analysis revealed that this deficiency was not due to a change of the subunit’s stability, but to a defect in the synthesis of the subunit’s 18S rRNA component. Pulse-chase analysis of RNA synthesis in an enp1-1 strain revealed that no 20S pre-rRNA or 18S rRNA was made at the non-permissive temperature, while levels of 25S rRNA appeared normal. Low levels of precursors to 18S rRNA were detected in the mutants, and they were extremely unstable. Northern analysis of steady state RNA levels demonstrated that the enp1 mutation specifically inhibited the pre-rRNA early cleavages at sites A0, A1 and A2, which are required for the production of the 20S pre-rRNA and the 18S rRNA. These defects of the enp1 mutation on rRNA processing are very similar to those caused by mutation of KRR1, another essential nucleolar gene required for synthesis of the 40S, but not the 60S subunit (40). Co-precipitation analyses provided strong evidence that Enp1 is directly involved in pre-rRNA processing. In these experiments, TAP-tagged Enp1 bound to IgG beads specifically co-precipitated with two snoRNAs, U3 and U14, and with the 35S, 33S, 32S and 20S pre-rRNAs. Among the more than 100 snoRNAs in yeast cells, U3, U14, snR10, snR30 and MRP RNA are the only ones required for rRNA processing. It has been shown that mutations in U3, U14, snR10 and snR30 snoRNAs and protein components of the snoRNPs affect processing at sites A0, A1 or A2 (15,16,41,42). Enp1’s interaction with U3 and U14 snoRNAs suggests that Enp1’s function in rRNA processing involves these two snoRNAs. The fact that the nucleolar protein, Nop1, known to bind to U3 and U14 RNAs, also was found in the Enp1 precipitate, provides additional evidence that Enp1 is part of a complex involved in processing of rRNA. Recently, a genome-wide study of yeast protein complexes, using a TAP tag method similar to ours, reported a number of proteins that co-immunoprecipitated with Enp1 (43). These proteins included Imp4, Kre31, Kre33, Mpp10, Nop1, Nop14 and Sof1, all of which have been implicated in 18S RNA processing or 40S biogenesis. Very recently (after the studies in this manuscript were concluded) Grandi et al. published an analysis of components of the 90s preribosomal particle, which include the 35S pre-rRNA, U3 snoRNP and rRNA processing factors for the 40S subunit (44). In agreement with our findings, they found that Enp1 is a component of this 90s complex and also of a smaller complex containing the 20S pre-rRNA. Surprisingly, none of the other proteins involved in processing of pre-rRNAs that were tested associated with the 20S rRNA, suggesting that those proteins, but not Enp1, are released prior to 20S pre-rRNA formation (44). The authors also showed co-precipitation of Enp1 with dimethylated 20S pre-rRNA, which is formed after export of 20S to the cytoplasm. These results of Grandi et al. suggest that Enp1 may also be involved in later steps of processing or nuclear export. A previous study on the Enp1 human homolog, bystin, reported that the protein was localized in the cytoplasm of mammalian cells and might be involved in cell adhesion (19). Our discovery of the 437 amino acid human Enp1 homolog revealed that the bystin studied previously was from a truncated library cDNA encoding only the C-terminal 306 amino acids. Although the human homolog of Enp1 did not complement a yeast Δenp1 mutant, we did show that it was localized to the nucleus and enriched in the nucleolus (data not shown). This strongly suggests that the conserved function of Enp1 is in rRNA processing. The cytoplasmic localization of bystin and its proposed function in cell adhesion are unlikely to reflect the actual function of the human Enp1 homolog. It will be important to study the nature of the associations between Enp1 and U3 and U14 snoRNPs, and to learn more about the exact role of Enp1 in ribosomal RNA processing.
[ "Enp1", ",", "a", "yeast", "protein", "associated", "with", "U3", "and", "U14", "snoRNAs", ",", "is", "required", "for", "pre", "-", "rRNA", "processing", "and", "40S", "subunit", "synthesis", "\n", "Abstract", "\n", "ENP1", "is", "an", "essential", "Saccharomyces", "cerevisiae", "gene", "encoding", "a", "483", "amino", "acid", "polypeptide", ".", "Enp1", "protein", "is", "localized", "in", "the", "nucleus", "and", "concentrated", "in", "the", "nucleolus", ".", "An", "enp1", "-", "1", "temperature", "-", "sensitive", "mutant", "inhibited", "35S", "pre", "-", "rRNA", "early", "processing", "at", "sites", "A0", ",", "A1", "and", "A2", "as", "shown", "by", "northern", "analysis", "of", "steady", "state", "levels", "of", "rRNA", "precursors", ".", "Pulse", "-", "chase", "analysis", "further", "revealed", "that", "the", "enp1", "-", "1", "strain", "was", "defective", "in", "the", "synthesis", "of", "20S", "pre", "-", "rRNA", "and", "hence", "18S", "rRNA", ",", "which", "led", "to", "reduced", "formation", "of", "40S", "ribosomal", "subunits", ".", "Co", "-", "precipitation", "analysis", "revealed", "that", "Enp1", "was", "associated", "with", "Nop1", "protein", ",", "as", "well", "as", "with", "U3", "and", "U14", "RNAs", ",", "two", "snoRNAs", "implicated", "in", "early", "pre", "-", "rRNA", "processing", "steps", ".", "These", "results", "suggest", "a", "direct", "role", "for", "Enp1", "in", "the", "early", "steps", "of", "rRNA", "processing", ".", "\n\n", "INTRODUCTION", "\n", "Ribosome", "biogenesis", "is", "one", "of", "the", "major", "cellular", "activities", "in", "eukaryotic", "cells", ".", "It", "takes", "place", "primarily", "in", "a", "specialized", "subnuclear", "compartment", ",", "the", "nucleolus", "(", "1,2", ")", ".", "In", "the", "yeast", "Saccharomyces", "cerevisiae", ",", "each", "rRNA", "gene", "is", "transcribed", "by", "RNA", "polymerase", "I", "into", "a", "35S", "rRNA", "precursor", ",", "consisting", "of", "18S", ",", "5.8S", "and", "25S", "rRNA", "sequences", "flanked", "by", "two", "external", "transcribed", "spacers", "(", "ETS", ")", "and", "separated", "by", "two", "internal", "transcribed", "spacers", "(", "ITS", ")", "(", "Fig", ".", "1", ")", ".", "This", "35S", "precursor", "goes", "through", "a", "series", "of", "modifications", "and", "processing", "steps", "to", "generate", "the", "mature", "18S", ",", "5.8S", "and", "25S", "rRNAs", ".", "The", "processing", "occurs", "first", "at", "sites", "A0", ",", "A1", "and", "A2", ",", "resulting", "in", "the", "20S", "pre", "-", "rRNA", "and", "27SA2", "pre", "-", "rRNA", ".", "The", "20S", "pre", "-", "rRNA", "is", "then", "cleaved", ",", "leading", "to", "the", "mature", "18S", "rRNA", "found", "in", "the", "40S", "ribosomal", "subunit", ".", "The", "27SA2", "pre", "-", "rRNA", "is", "processed", "through", "two", "alternative", "pathways", ".", "The", "majority", "of", "27SA2", "pre", "-", "rRNA", "is", "cleaved", "at", "sites", "A3", "and", "B2", "to", "form", "the", "27SA3", "pre", "-", "rRNA", ",", "which", "is", "subsequently", "processed", "to", "produce", "27SBS", ".", "Alternatively", ",", "27SA2", "pre", "-", "rRNA", "can", "be", "processed", "at", "sites", "B1L", "and", "B2", "to", "generate", "27SBL", "pre", "-", "rRNA", ".", "Both", "27SBS", "and", "27SBL", "pre", "-", "rRNAs", "are", "then", "cleaved", "at", "sites", "C1", "and", "C2", "to", "generate", "the", "mature", "25S", "rRNA", ",", "and", "7SS", "or", "7SL", "intermediates", ",", "which", "are", "then", "processed", "to", "mature", "5.8SS", "or", "5.8SL", "rRNAs", "(", "Fig", ".", "1", ")", ".", "The", "25S", "rRNA", "and", "5.8S", "rRNA", "are", "the", "RNA", "components", "of", "the", "60S", "ribosomal", "subunit", "(", "3", ")", ".", "During", "the", "course", "of", "rRNA", "modification", "and", "processing", ",", "many", "of", "the", "ribosomal", "proteins", "are", "assembled", "onto", "the", "rRNA", "molecules", "to", "form", "the", "ribosome", "complex", ".", "\n", "Ribosome", "biogenesis", "needs", "a", "large", "number", "of", "trans", "-", "acting", "factors", ",", "including", "small", "nucleolar", "RNAs", "(", "snoRNAs", ")", ",", "protein", "components", "of", "the", "snoRNP", "complexes", ",", "rRNA", "modifying", "enzymes", ",", "endo-", "and", "exonucleases", ",", "putative", "RNA", "helicases", "and", "other", "protein", "factors", "(", "3,4", ")", ".", "In", "yeast", "cells", "there", "are", "more", "than", "100", "different", "snoRNAs", "playing", "important", "roles", "in", "rRNA", "modification", "and", "processing", ".", "On", "the", "basis", "of", "their", "structure", ",", "the", "snoRNAs", "can", "be", "divided", "into", "two", "groups", ":", "the", "box", "C", "/", "D", "family", "and", "box", "H", "/", "ACA", "family", ".", "Only", "one", "snoRNA", ",", "MRP", "RNA", ",", "belongs", "to", "neither", "family", "(", "5–7", ")", ".", "While", "the", "majority", "of", "the", "snoRNAs", "participate", "in", "RNA", "pseudouridylation", "and", "2′-O", "-", "ribose", "methylation", ",", "a", "few", "of", "them", ",", "including", "MRP", "snoRNA", ",", "box", "C", "/", "D", "snoRNAs", "U3", "and", "U14", ",", "and", "box", "H", "/", "ACA", "snoRNAs", "snR10", "and", "snR30", ",", "are", "required", "for", "processing", "of", "the", "pre", "-", "rRNA", "(", "8–12", ")", ".", "Not", "only", "are", "U3", ",", "U14", ",", "snR10", "and", "snR30", "essential", "for", "early", "cleavages", "of", "35S", "pre", "-", "rRNA", "to", "18S", "rRNA", ",", "the", "proteins", "associated", "with", "them", ",", "including", "Nop1", ",", "Nop5", ",", "Gar1", "and", "Nop10", ",", "have", "also", "been", "shown", "to", "be", "required", "for", "18S", "rRNA", "synthesis", "(", "13–16", ")", ".", "\n", "The", "ENP1", "(", "Essential", "Nuclear", "Protein", "1", ")", "gene", "was", "identified", "in", "a", "genetic", "screen", "for", "suppressors", "of", "an", "ost4", "mutation", "(", "oligosaccharide", "transferase", "4", ")", "(", "17", ")", ".", "However", ",", "in", "subsequent", "studies", "it", "was", "found", "not", "to", "be", "involved", "in", "OST4", "function", "(", "18", ")", ".", "ENP1", "is", "an", "essential", "gene", "encoding", "a", "483", "amino", "acid", "polypeptide", ".", "The", "Enp1", "protein", "is", "highly", "conserved", "and", "homologs", "are", "found", "in", "all", "eukaryotes", ".", "The", "yeast", "protein", "was", "localized", "to", "the", "nucleus", "in", "a", "previous", "study", "(", "18", ")", ".", "On", "the", "other", "hand", ",", "an", "Enp1", "human", "homolog", ",", "called", "bystin", ",", "was", "reported", "to", "localize", "to", "the", "cytoplasm", "and", "was", "proposed", "to", "be", "involved", "in", "cell", "adhesion", "(", "19", ")", ".", "\n", "In", "this", "study", ",", "we", "report", "that", "the", "Enp1", "protein", "not", "only", "is", "nuclear", "but", "is", "enriched", "in", "the", "nucleolus", ".", "We", "also", "found", "that", "Enp1", "is", "required", "for", "the", "synthesis", "of", "40S", "ribosomal", "subunits", ",", "and", "its", "presence", "is", "necessary", "for", "the", "pre", "-", "rRNA", "processing", "to", "form", "20S", "pre", "-", "rRNA", "and", "18S", "rRNA", ".", "An", "association", "between", "Enp1", "and", "U3", "and", "U14", "snoRNAs", ",", "and", "with", "the", "nucleolar", "protein", "Nop1", ",", "was", "established", ".", "We", "also", "found", "that", "human", "Enp1", ",", "expressed", "in", "yeast", ",", "was", "located", "in", "the", "nucleus", "and", "the", "nucleolus", ",", "suggesting", "that", "the", "function", "of", "this", "protein", "is", "conserved", ".", "\n\n", "MATERIALS", "AND", "METHODS", "\n", "Yeast", "strains", "and", "media", "\n", "The", "S.cerevisiae", "strains", "used", "in", "this", "study", "are", "all", "derivatives", "of", "a", "wild", "-", "type", "diploid", "strain", "W303", "(", "MATa", "/", "MATα", "ura3", "-", "1", "/", "ura3", "-", "1", "leu2", "-", "3,112", "/", "leu2", "-", "3,112", "trp1", "-", "1", "/", "trp1", "-", "1", "his3", "-", "11,15", "/", "his3", "-", "11,15", "ade2", "-", "1", "/", "ade2", "-", "1", "can1", "-", "100", "/", "can1", "-", "100", ")", "except", "for", "strain", "RS1938", ".", "Strain", "JBY45", "(", "MATa", "/", "MATα", "ENP1", "/", "Δenp1::his5", "+", ")", "was", "constructed", "by", "replacing", "one", "copy", "of", "the", "ENP1", "open", "reading", "frame", "(", "ORF", ")", "with", "the", "Schizosaccharomyces", "pombe", "his5", "+", "gene", "(", "18", ")", ".", "Strain", "JBY46", "[", "MATa", "Δenp1::his5+/pJB23", "(", "ENP1", ",", "URA3", ",", "CEN6", ")", "]", "is", "a", "haploid", "strain", "derived", "from", "JBY45", "with", "wild", "-", "type", "ENP1", "on", "a", "low", "copy", "number", "plasmid", ".", "Strain", "JBY48", "[", "MATa", "Δenp1::his5+/pJB19", "(", "enp1", "-", "1", ",", "TRP1", ",", "CEN6", ")", "]", "and", "strain", "JBY49", "[", "MATa", "Δenp1::his5+/pJB39", "(", "enp1", "-", "2", ",", "TRP1", ",", "CEN6", ")", "]", "have", "plasmids", "with", "enp1", "temperature", "-", "sensitive", "(", "ts", ")", "mutations", ".", "Strain", "JBY51", "(", "MATa", "Δenp1::his5", "+", "TRP1::enp1", "-", "1", ")", "is", "an", "enp1", "ts", "strain", "generated", "by", "integrating", "the", "enp1", "-", "1", "gene", "at", "the", "chromosomal", "trp1", "-", "1", "locus", ".", "Strain", "CWY13", "[", "MATa", "Δenp1::his5+/pJB24", "(", "pMET25-GFP", "-", "ENP1", ",", "URA3", ",", "CEN6", ")", "]", "has", "GFP", "-", "ENP1", "under", "control", "of", "the", "MET25", "promoter", ".", "Strain", "CWY14", "(", "MATa", "ENP1-TAP", ")", "was", "created", "by", "fusing", "sequences", "encoding", "a", "Tandem", "Affinity", "Purification", "(", "TAP", ")", "tag", "(", "20,21", ")", "to", "the", "3′", "end", "of", "ENP1", ".", "Strain", "YRH39", "(", "MATα", "HST2-TAP", ")", "was", "created", "by", "fusing", "sequences", "encoding", "a", "TAP", "tag", "to", "the", "3′end", "of", "HST2", ".", "Strain", "RS1938", "(", "Δnop1::URA3", "pUN100-ProtA", "-", "NOP1", ")", "was", "created", "by", "transforming", "RS1935", "(", "MATa", "/", "α", "leu2", "/", "leu2", "ura3", "/", "ura3", "lys2", "/", "lys2", "ade2", "/", "ade2", "Δnop1::URA3", "/", "NOP1", ")", "with", "pUN100-ProtA", "-", "NOP1", "(", "strain", "and", "plasmid", "supplied", "by", "T.", "Schafer", ")", ",", "followed", "by", "tetrad", "dissection", ".", "Strain", "CWY15", "[", "MATa", "/", "pCW109", "(", "pMET25-GFP", "-", "hENP1", ",", "URA3", ",", "CEN6", ")", "]", "has", "a", "human", "homolog", "of", "Enp1", "expressed", "in", "W303", "-", "1a", ".", "The", "media", "used", "were", "prepared", "as", "described", "(", "22", ")", ".", "\n\n", "Cloning", "of", "ENP1", "\n", "pRS426-MEG1", "(", "The", "original", "name", "of", "ENP1", ")", "was", "a", "gift", "from", "Dr", "William", "J.", "Lennarz", ".", "It", "contains", "the", "ENP1", "gene", "within", "a", "2.6", "kb", "EcoRI", "genomic", "fragment", "cloned", "into", "pRS426", "(", "18", ")", ".", "The", "EcoRI", "fragment", "was", "subsequently", "cloned", "into", "pRS314", "(", "TRP1", ",", "CEN6", ")", ",", "pRS316", "(", "URA3", ",", "CEN6", ")", "and", "pRS424", "(", "TRP1", ",", "2µ", ")", "to", "create", "pJB20", ",", "pJB23", "and", "pJB21", ",", "respectively", ".", "pGFP", "-", "N", "-", "FUS", "is", "a", "centromeric", "plasmid", "for", "fusing", "green", "fluorescence", "protein", "(", "GFP", ")", "to", "a", "polypeptide", "’s", "N", "-", "terminus", "under", "control", "of", "the", "MET25", "promoter", "(", "23", ")", ".", "Cloning", "the", "ENP1", "ORF", "into", "pGFP", "-", "N", "-", "FUS", "via", "XbaI", "and", "SalI", "sites", "generated", "plasmid", "pJB24", ".", "pJB19", "(", "enp1", "-", "1", ",", "TRP1", ",", "CEN6", ")", "contains", "the", "enp1", "-", "1", "mutant", "gene", ".", "The", "human", "homolog", "of", "yeast", "Enp1", "was", "PCR", "amplified", "from", "a", "human", "cDNA", "clone", "BC007340", "(", "Research", "Genetics", ")", ",", "then", "cloned", "into", "pGFP", "-", "N", "-", "FUS", ",", "p415-ADH", ",", "p415-GPD", "and", "p415-TEF", "(", "24", ")", "via", "XbaI", "and", "SalI", "sites", "to", "generate", "pCW109", ",", "pCW113", ",", "pCW115", "and", "pCW117", ",", "respectively", ".", "The", "fragment", "of", "the", "human", "Enp1", "homolog", "(", "amino", "acids", "152–437", ")", "was", "also", "cloned", "into", "these", "vectors", "to", "generate", "pCW110", ",", "pCW114", ",", "pCW116", "and", "pCW118", ".", "\n\n", "Random", "mutagenesis", "of", "ENP1", "to", "generate", "enp1", "ts", "mutants", "\n", "The", "enp1", "ts", "mutants", "were", "generated", "with", "a", "protocol", "introducing", "random", "mutations", "by", "PCR", "(", "25", ")", ".", "The", "PCR", "was", "performed", "with", "oligonucleotides", "ENP1-MUT5′", "(", "5′-GGTGGTGTCAGT", "AGGGGA-3′", ")", ",", "ENP1-MUT3′", "(", "5′-CAGTCTGCAATATA", "TGGAC-3′", ")", "and", "plasmid", "template", "pJB20", "(", "see", "above", ")", ".", "The", "nucleotide", "concentrations", "in", "the", "reaction", "were", "1", "mM", "each", "for", "dATP", ",", "dGTP", ",", "dCTP", "and", "dTTP", ".", "After", "strain", "JBY46", "was", "transformed", "with", "the", "PCR", "product", "and", "with", "pJB20", "gapped", "by", "NheI", "and", "NsiI", ",", "the", "transformants", "were", "replica", "-", "plated", "onto", "two", "plates", "containing", "5-FOA", "synthetic", "medium", "without", "tryptophan", ";", "one", "replica", "was", "incubated", "at", "23", "°", "C", "and", "the", "other", "at", "37", "°", "C", ".", "Colonies", "growing", "at", "23", "°", "C", "but", "not", "at", "37", "°", "C", "were", "picked", "as", "candidates", ".", "Since", "approximately", "10", "%", "of", "the", "colonies", "were", "inviable", "at", "both", "temperatures", ",", "we", "knew", "that", "10", "%", "of", "the", "ENP1", "PCR", "products", "lost", "their", "function", "after", "the", "PCR", "mutagenesis", ".", "This", "confirmed", "the", "effectiveness", "of", "the", "mutagenesis", "procedure", ".", "Two", "candidates", "showed", "good", "growth", "at", "23", "°", "C", "but", "no", "growth", "at", "37", "°", "C", ".", "They", "were", "named", "strains", "JBY48", "and", "JBY49", "and", "contained", "plasmids", "with", "the", "enp1", "-", "1", "and", "enp1", "-", "2", "mutations", ",", "respectively", ".", "The", "mutated", "enp1", "-", "1", "gene", "on", "pJB19", "was", "cloned", "into", "an", "integration", "vector", ",", "pRS304", ",", "as", "an", "EcoRI", "fragment", ".", "The", "plasmid", "was", "subsequently", "linearized", "with", "SnaBI", "within", "the", "TRP1", "marker", "and", "was", "integrated", "at", "the", "chromosomal", "trp1", "-", "1", "locus", "of", "strain", "JBY46", ".", "Selection", "on", "5-FOA", "was", "used", "to", "remove", "plasmid", "pJB23", ",", "creating", "strain", "JBY51", ".", "\n\n", "Sucrose", "gradient", "analysis", "\n", "Polyribosome", "preparation", "and", "analysis", "were", "carried", "out", "essentially", "as", "described", "(", "26", ")", ".", "Cells", "grown", "in", "YPD", "were", "collected", "at", "mid", "-", "log", "phase", "(", "OD600", "0.8–1.0", ")", "and", "were", "broken", "with", "glass", "beads", ".", "The", "lysate", "was", "frozen", "immediately", "in", "liquid", "N2", "and", "was", "stored", "at", "–", "80", "°", "C", ".", "Lysate", "(", "30", "U", "of", "absorbance", "at", "OD260", ")", "was", "layered", "over", "a", "7–47", "%", "(", "w", "/", "v", ")", "sucrose", "gradient", ",", "which", "was", "centrifuged", "at", "28", "000", "r.p.m", ".", "for", "5", "h", "at", "4", "°", "C", "in", "a", "SW28", "rotor", "and", "was", "analyzed", "with", "an", "ISCO", "UA-5", "gradient", "UV", "detection", "system", "on", "absorbency", "at", "254", "nm", ".", "\n\n", "Immunofluorescence", "\n", "Immunofluorescence", "analysis", "was", "carried", "out", "essentially", "as", "described", "(", "27", ")", ".", "Cells", "were", "fixed", "with", "3.7", "%", "formaldehyde", "at", "room", "temperature", "for", "1.5", "h.", "Antibodies", "included", "a", "mouse", "monoclonal", "anti", "-", "Nop1", "(", "a", "gift", "from", "John", "P.", "Aris", ",", "University", "of", "Florida", ",", "Gainesville", ",", "Florida", ")", "and", "a", "Texas", "-", "red", "-", "conjugated", "donkey", "-", "anti", "-", "mouse", "antibody", "(", "Jackson", "Lab", ")", ",", "both", "used", "at", "1:500", "dilution", ".", "Images", "were", "taken", "on", "a", "Zeiss", "Axioplan2", "microscope", "equipped", "with", "a", "Zeiss", "AxioCam", "camera", ".", "\n\n", "Pulse", "-", "chase", "labeling", "analysis", "of", "rRNA", "\n", "For", "[", "methyl-3H]methionine", "pulse", "-", "chase", "analysis", ",", "cells", "were", "grown", "in", "synthetic", "medium", "without", "methionine", "at", "room", "temperature", "or", "37", "°", "C", "for", "2", "h.", "When", "the", "OD600", "reached", "1.0", ",", "6", "ml", "of", "the", "culture", "were", "pulse", "-", "labeled", "with", "250", "µCi", "[", "methyl-3H]methionine", "(", "Amersham", "Pharmacia", ")", "for", "3", "min", "and", "chased", "with", "cold", "methionine", "(", "500", "µg", "/", "ml", ")", "for", "2", ",", "4", "or", "12", "min", ".", "For", "each", "time", "point", "of", "the", "chase", "1.25", "ml", "of", "culture", "was", "mixed", "with", "ice", "and", "collected", ".", "The", "pellets", "were", "frozen", "immediately", "in", "liquid", "N2", "and", "stored", "at", "–", "80", "°", "C", "before", "total", "RNA", "was", "purified", "using", "a", "hot", "phenol", "method", "(", "28", ")", ".", "The", "RNAs", "were", "separated", "on", "a", "1.2", "%", "agarose", "formaldehyde", "gel", "and", "transferred", "onto", "Hybond", "-", "N+", "nylon", "membranes", "(", "Amersham", "Pharmacia", ")", ".", "After", "being", "sprayed", "with", "EN3HANCE", "(", "Du", "Pont", ")", ",", "the", "membranes", "were", "exposed", "to", "film", "at", "–", "80", "°", "C", "(", "29", ")", ".", "\n\n", "Northern", "analysis", "\n", "Cells", "were", "grown", "inYPD", "at", "room", "temperature", "or", "37", "°", "C", "for", "2–4", "h.", "When", "the", "OD600", "reached", "1.0", ",", "10", "ml", "of", "cells", "were", "collected", "and", "frozen", "immediately", ".", "Total", "RNA", "was", "extracted", "as", "described", "(", "28", ")", ".", "Five", "micrograms", "of", "RNA", "were", "separated", "on", "1.2", "%", "agarose", "formaldehyde", "gels", "(", "for", "high", "molecular", "weight", "RNA", ")", "or", "on", "6", "%", "polyacrylamide", "7", "M", "urea", "denaturing", "gels", "(", "for", "low", "molecular", "weight", "RNA", ")", "for", "each", "sample", ".", "The", "RNA", "was", "then", "transferred", "to", "Zeta", "-", "Probe", "GT", "nylon", "membranes", "(", "Bio", "-", "Rad", ")", ".", "Probes", "for", "hybridyzation", "were", "specific", "oligonucleotides", "end", "-", "labeled", "using", "[", "γ-32P]ATP", ".", "After", "hybridization", "and", "washes", ",", "membranes", "were", "exposed", "to", "phosphorimager", "screens", "or", "X", "-", "ray", "films", "(", "29", ")", ".", "Oligonucleotides", "specific", "for", "various", "regions", "of", "35S", "pre", "-", "rRNA", "are", ":", "1", ",", "GGTCTCTCTGCTGCCG", "GAAATG", ";", "3", ",", "AATGAGCCATTCGCAGTTTCACTG", ";", "4", ",", "GCTCTCATGCTCTTGCCAAAAC", ";", "5", ",", "TGTTTGTTACCT", "CTGGGCCCCG", ";", "6", ",", "TCCAGTTACGAAAATTCTTG", ";", "7", ",", "CGTATCGCATTTCGCTGCGTTC", ";", "8", ",", "GTTCGCCTAGAC", "GCTCTCTCTTC", ";", "9", ",", "GCGAGATTCCCCTACCCAC", ".", "The", "regions", "complementary", "to", "these", "oligonucleotides", "are", "shown", "in", "Figure", "6A.", "The", "oligonucleotides", "probing", "box", "C", "/", "D", "snoRNAs", "are", ":", "U3", ",", "TTCGGTTTCTCACTCACTCTGGGGTAC", ";", "U14", ",", "GGAACCAGTCTTTCATCACCGTG", ".", "The", "oligonucleotides", "probing", "box", "H", "/", "ACA", "snoRNAs", "are", ":", "snoRNA10", ",", "CCTTG", "CAACGGTCCTCATCCGGG", ";", "snoRNA30", ",", "GTCCGAAGC", "GCCATCTAGATGA", ".", "\n\n", "RNA", "and", "protein", "precipitation", "analysis", "\n", "Cells", "were", "grown", "in", "YPD", "(", "1", "l", ")", "to", "OD600", "1.0", ",", "then", "collected", ",", "washed", "once", "in", "ice", "-", "cold", "PBS", "and", "broken", "using", "glass", "beads", "in", "10", "ml", "IPP150", "buffer", "(", "10", "mM", "Tris", "pH", "8.0", ",", "150", "mM", "NaCl", "and", "0.1", "%", "NP-40", ")", "with", "protease", "inhibitors", ".", "The", "lysates", "were", "mixed", "with", "200", "µl", "IgG", "agarose", "beads", "for", "2", "h", "at", "4", "°", "C", ".", "After", "several", "washes", "with", "50", "ml", "IPP150", "buffer", ",", "the", "IgG", "beads", "were", "collected", "and", "the", "RNA", "associated", "with", "the", "beads", "extracted", "by", "the", "hot", "phenol", "method", "(", "28", ")", ".", "One", "-", "tenth", "of", "the", "precipitated", "RNA", "was", "then", "separated", "on", "6", "%", "polyacrylamide", "7", "M", "urea", "denaturing", "gels", "and", "electro", "-", "transferred", "to", "Zeta", "-", "Probe", "GT", "nylon", "membranes", ".", "They", "were", "probed", "with", "[", "γ-32P]ATP", "labeled", "oligonucleotides", ".", "For", "the", "lanes", "showing", "total", "RNA", ",", "2", "µg", "RNA", "prepared", "from", "exponentially", "growing", "cultures", "were", "loaded", ".", "For", "co", "-", "precipitation", "analysis", "of", "proteins", ",", "the", "IgG", "beads", "were", "resuspended", "in", "2×", "Laemmli", "sample", "buffer", ",", "boiled", "for", "5", "min", "and", "separated", "by", "SDS", "–", "polyacrylamide", "gel", "electrophoresis", ".", "Approximately", "1", "%", "of", "the", "precipitate", "was", "loaded", "onto", "each", "lane", ".", "For", "the", "total", "protein", ",", "0.1", "%", "of", "the", "extract", "prior", "to", "precipitation", "was", "loaded", "onto", "each", "lane", ".", "Following", "electrophoresis", ",", "the", "proteins", "were", "transferred", "to", "nitrocellulose", "membranes", "and", "detected", "using", "anti", "-", "Nop1", "antibody", "at", "1:3000", "dilution", "(", "provided", "by", "J.", "Aris", ")", "and", "anti", "-", "L3", "antibody", "(", "provided", "by", "J.", "Warner", ")", "at", "1:3000", "dilution", "followed", "by", "peroxidase", "-", "conjugated", "anti", "-", "mouse", "secondary", "antibody", "at", "1:5000", "dilution", ".", "The", "antibody", "complexes", "were", "detected", "using", "ECL", "-", "Plus", "reagents", "(", "Amersham", "Pharmacia", ")", "as", "specified", "by", "the", "manufacturer", ".", "\n\n\n", "RESULTS", "\n", "Construction", "and", "analysis", "of", "ENP1", "temperature", "-", "sensitive", "alleles", "\n", "ENP1", "is", "an", "essential", "yeast", "gene", "conserved", "among", "eukaryotes", "(", "18", ")", ".", "To", "study", "its", "functions", ",", "we", "first", "created", "a", "diploid", "strain", ",", "JBY45", ",", "heterozygous", "for", "the", "Δenp1", "mutation", ".", "Then", "two", "enp1", "ts", "mutant", "alleles", "(", "enp1", "-", "1", "and", "enp1", "-", "2", ")", "were", "generated", "by", "random", "PCR", "mutagenesis", ",", "as", "described", "in", "Materials", "and", "Methods", ".", "Both", "mutant", "alleles", "were", "recessive", "to", "the", "wild", "-", "type", "ENP1", "gene", ".", "The", "enp1", "-", "1", "gene", "was", "integrated", "into", "the", "chromosomal", "trp1", "-", "1", "locus", "to", "create", "strain", "JBY51", "and", "all", "subsequent", "experiments", "were", "done", "with", "this", "enp1", "allele", ".", "At", "23", "°", "C", "the", "growth", "of", "JBY51", "was", "comparable", "to", "that", "of", "W303", "-", "1a", "(", "ENP1", ")", ",", "but", "at", "37", "°", "C", "it", "did", "not", "grow", "(", "Fig", ".", "2", ")", ".", "Sequence", "analysis", "revealed", "that", "enp1", "-", "1", "contains", "two", "point", "mutations", ",", "resulting", "in", "substitutions", "of", "two", "amino", "acids", ":", "W242→G", "and", "V415→A.", "No", "attempt", "was", "made", "to", "determine", "whether", "both", "mutations", "were", "required", "for", "the", "ts", "phenotype", ".", "Flow", "cytometry", "of", "strain", "JBY51", "showed", "DNA", "content", "profiles", "similar", "to", "those", "of", "the", "wild", "-", "type", "strain", "at", "the", "non", "-", "permissive", "temperature", "(", "data", "not", "shown", ")", ",", "suggesting", "that", "ENP1", "is", "not", "involved", "in", "cell", "cycle", "regulation", ".", "\n\n", "Enp1", "is", "enriched", "in", "the", "nucleolus", "\n", "Enp1", "tagged", "at", "the", "C", "-", "terminus", "with", "the", "myc", "epitope", "was", "previously", "found", "to", "localize", "to", "the", "nucleus", "(", "18", ")", ".", "To", "expand", "this", "analysis", ",", "we", "fused", "GFP", "to", "the", "N", "-", "terminus", "of", "Enp1", ",", "and", "expressed", "the", "tagged", "Enp1", "protein", "under", "control", "of", "the", "MET25", "promoter", "as", "the", "sole", "source", "of", "Enp1", "protein", "in", "the", "cells", ".", "Cells", "of", "strain", "CWY13", "(", "pMET25-GFP", "-", "ENP1", ")", "were", "grown", "in", "media", "with", "methionine", "(", "transcription", "partially", "repressed", ")", "or", "without", "methionine", "(", "transcription", "not", "repressed", ")", ".", "Growth", "of", "CWY13", "was", "comparable", "to", "that", "of", "wild", "-", "type", "cells", "in", "both", "media", "(", "data", "not", "shown", ")", ",", "indicating", "that", "the", "GFP", "tagged", "Enp1", "protein", "was", "functional", ".", "In", "cells", "cultured", "in", "medium", "without", "methionine", ",", "in", "which", "the", "ENP", "transcription", "was", "not", "repressed", ",", "the", "GFP", "-", "Enp1", "protein", "was", "expressed", "at", "a", "high", "level", "and", "showed", "strong", "green", "fluorescence", "distributed", "throughout", "the", "nucleus", "(", "data", "not", "shown", ")", ",", "consistent", "with", "the", "original", "observation", "(", "18", ")", ".", "With", "methionine", "added", "to", "the", "medium", ",", "however", ",", "the", "fluorescent", "signal", "of", "GFP", "-", "Enp1", "was", "weaker", "and", "surprisingly", "showed", "crescent", "or", "cap", "-", "like", "patterns", "typical", "of", "nucleolar", "proteins", "(", "Fig", ".", "3A", ")", ".", "This", "nucleolar", "enrichment", "was", "confirmed", "by", "its", "co", "-", "localization", "with", "the", "nucleolar", "protein", "Nop1", "(", "Fig", ".", "3B", ")", ".", "\n\n", "ENP1", "mutation", "leads", "to", "reduced", "levels", "of", "40S", "ribosomal", "subunits", "\n", "The", "nucleolar", "enrichment", "suggested", "that", "Enp1", "might", "play", "some", "role", "in", "ribosome", "synthesis", ".", "To", "test", "this", "possibility", ",", "cells", "of", "W303", "-", "1a", "(", "ENP1", ")", ",", "JBY51", "(", "enp1", "-", "1", ")", "and", "a", "top2", "ts", "strain", "RS191", "(", "30", ")", "were", "grown", "in", "YPD", "at", "23", "or", "37", "°", "C", "and", "their", "ribosome", "profiles", "analyzed", "after", "separation", "on", "sucrose", "gradients", ".", "At", "23", "°", "C", ",", "enp1", "-", "1", "cells", "showed", "polysome", "profiles", "similar", "to", "those", "of", "the", "wild", "-", "type", "and", "top2", "-", "1", "strains", "(", "Fig", ".", "4A", "–", "C", ")", ".", "In", "contrast", ",", "after", "incubation", "at", "the", "non", "-", "permissive", "temperature", "(", "37", "°", "C", ")", "for", "40", "min", "(", "data", "not", "shown", ")", "and", "2", "h", ",", "enp1", "-", "1", "cells", "had", "reduced", "levels", "of", "40S", "ribosomal", "subunits", ",", "80S", "monosomes", "and", "polysomes", ",", "along", "with", "a", "dramatic", "increase", "in", "the", "free", "60S", "subunit", "peak", "(", "Fig", ".", "4F", ")", ",", "while", "the", "wild", "-", "type", "and", "top2", "-", "1", "cells", "showed", "little", "change", "in", "polysome", "profile", "at", "37", "°", "C", "(", "Fig", ".", "4D", "and", "E", ")", ".", "These", "results", "demonstrate", "that", "the", "changes", "of", "the", "enp1", "-", "1", "polysome", "profile", "were", "due", "to", "specific", "defects", "caused", "by", "the", "enp1", "-", "1", "mutation", ",", "and", "not", "due", "simply", "to", "the", "shift", "to", "37", "°", "C", "for", "a", "wild", "-", "type", "or", "ts", "strain", ".", "\n\n", "The", "processing", "of", "pre", "-", "rRNA", "for", "18S", "rRNA", "is", "impaired", "in", "enp1", "mutants", "\n", "In", "most", "cases", "reductions", "in", "ribosomal", "subunit", "levels", "are", "the", "results", "of", "defects", "in", "pre", "-", "rRNA", "processing", "or", "ribosome", "assembly", "or", "both", "(", "3", ")", ".", "To", "study", "the", "mechanism", "by", "which", "Enp1", "affects", "the", "40S", "subunit", ",", "we", "analyzed", "the", "effects", "of", "enp1", "mutations", "on", "processing", "of", "the", "pre", "-", "rRNA", "using", "pulse", "-", "chase", "labeling", ".", "[", "methyl-3H]methionine", "is", "preferred", "for", "labeling", "rRNAs", "in", "pulse", "-", "chase", "analysis", "because", "rRNAs", "are", "specifically", "methylated", "during", "the", "early", "steps", "of", "the", "processing", ".", "Cells", "of", "W303", "-", "1a", "(", "ENP1", ")", "and", "JBY51", "(", "enp1", "-", "1", ")", "were", "grown", "at", "23", "or", "37", "°", "C", "for", "2", "h", "before", "they", "were", "labeled", "with", "[", "methyl-3H]methionine", "for", "3", "min", "and", "chased", "with", "cold", "methionine", "for", "2", ",", "4", "and", "12", "min", ".", "In", "wild", "-", "type", "cells", ",", "the", "labeled", "35S", "rRNA", "precursor", ",", "27S", "and", "20S", "rRNA", "intermediates", "were", "rapidly", "chased", "into", "mature", "25S", "and", "18S", "rRNAs", "(", "Fig", ".", "5", ")", ",", "at", "23", "or", "37", "°", "C", ".", "In", "contrast", ",", "enp1", "-", "1", "cells", "showed", "dramatic", "changes", "after", "incubation", "at", "37", "°", "C", ".", "Although", "at", "23", "°", "C", "the", "synthesis", "and", "processing", "were", "comparable", "to", "those", "of", "wild", "-", "type", "cells", ",", "cells", "cultured", "at", "37", "°", "C", "for", "2", "h", "had", "neither", "20S", "pre", "-", "rRNA", "nor", "18S", "rRNA", ",", "while", "25S", "rRNA", "was", "generated", "at", "normal", "levels", ".", "The", "37", "°", "C", "grown", "enp1", "-", "1", "cells", "also", "had", "low", "levels", "of", "aberrant", "23S", "and", "possibly", "21S", "intermediates", "(", "Fig", ".", "5", ")", ".", "The", "defect", "in", "18S", "rRNA", "synthesis", "was", "further", "supported", "by", "pulse", "-", "chase", "experiments", "carried", "out", "using", "[", "5,6", "-", "3H]uracil", ".", "The", "results", "obtained", "were", "essentially", "the", "same", ";", "no", "20S", "pre", "-", "rRNA", "or", "18S", "rRNA", "was", "produced", ",", "while", "processing", "to", "25S", "rRNA", "was", "not", "affected", "(", "data", "not", "shown", ")", ".", "\n", "Taken", "together", ",", "these", "results", "suggested", "that", "the", "enp1", "mutation", "leads", "to", "specific", "defects", "in", "the", "processing", "pathway", "for", "20S", "pre", "-", "rRNA", "and", "18S", "rRNA", ",", "resulting", "in", "reduced", "40S", "subunit", "synthesis", "and", "a", "lowered", "level", "of", "the", "40S", "subunit", ".", "\n\n", "Enp1", "is", "required", "for", "pre", "-", "rRNA", "processing", "at", "A0", ",", "A1", "and", "A2", "sites", "\n", "To", "define", "the", "processing", "steps", "affected", "by", "the", "enp1", "mutation", ",", "the", "steady", "state", "levels", "of", "rRNA", "precursors", "and", "mature", "RNAs", "were", "analyzed", "by", "northern", "blotting", ".", "Total", "RNAs", "were", "isolated", "from", "cells", "of", "W303", "-", "1a", "(", "ENP1", ")", "and", "JBY51", "(", "enp1", "-", "1", ")", "grown", "at", "37", "°", "C", "for", "2", "or", "4", "h.", "After", "separation", "on", "formaldehyde", "agarose", ",", "RNAs", "were", "transferred", "onto", "nylon", "membranes", "and", "probed", "with", "radiolabeled", "oligonucleotides", "specific", "to", "various", "regions", "of", "the", "35S", "pre", "-", "rRNA", "(", "Fig", ".", "6A", ")", ".", "After", "incubation", "at", "37", "°", "C", ",", "enp1", "-", "1", "cells", "had", "wild", "-", "type", "levels", "of", "25S", "rRNA", ",", "but", "reduced", "levels", "of", "18S", "rRNA", "(", "Fig", ".", "6B", ")", ".", "A", "probe", "specific", "to", "ITS1", "(", "P5", ")", "further", "revealed", "that", "enp1", "-", "1", "cells", "incubated", "at", "the", "non", "-", "permissive", "temperature", "accumulated", "two", "aberrant", "rRNAs", ",", "23S", "and", "21S", "(", "Fig", ".", "6C", ")", ".", "Aberrant", "rRNA", "processing", "products", "of", "similar", "sizes", "have", "been", "described", "in", "numerous", "studies", "(", "14,31–34", ")", "and", "result", "from", "defects", "in", "processing", "at", "A0", ",", "A1", "and", "A2", ".", "Additional", "probes", "were", "used", "to", "verify", "the", "origins", "of", "the", "23S", "and", "21S", "RNAs", "in", "the", "enp1", "-", "1", "strain", ".", "The", "23S", "product", "was", "detected", "by", "oligos", "1", ",", "2", ",", "4", "and", "5", ",", "but", "not", "by", "oligos", "6", ",", "7", "or", "8", "(", "Fig", ".", "6D", ",", "E", ",", "C", ",", "F", ",", "G", "and", "data", "not", "shown", ")", ".", "Thus", "this", "RNA", "extends", "from", "the", "5′", "end", "of", "the", "35S", "rRNA", "to", "the", "A3", "site", ".", "The", "21S", "product", "was", "detected", "by", "oligos", "4", "and", "5", ",", "but", "not", "by", "oligos", "1", ",", "2", ",", "6", ",", "7", "and", "8", "(", "Fig", ".", "6E", ",", "C", ",", "D", ",", "F", ",", "G", "and", "data", "not", "shown", ")", ",", "indicating", "that", "it", "extends", "from", "the", "A1", "to", "the", "A3", "site", ".", "At", "37", "°", "C", "the", "enp1", "-", "1", "cells", "also", "had", "less", "32S", "and", "20S", "rRNA", "intermediates", "(", "Fig", ".", "6B", "and", "E", ")", ".", "These", "results", "suggest", "that", "the", "enp1", "mutation", "led", "to", "complete", "or", "nearly", "complete", "inhibition", "of", "processing", "at", "site", "A0", "and", "A2", ",", "and", "partial", "inhibition", "of", "processing", "at", "site", "A1", ".", "As", "a", "consequence", ",", "the", "35S", "pre", "-", "rRNA", "was", "cleaved", "at", "site", "A3", "instead", ",", "producing", "23S", "and", "21S", "rRNA", "products", ".", "Consistent", "with", "this", "theory", ",", "the", "27SA2", "rRNA", "intermediate", "level", "was", "greatly", "reduced", "in", "enp1", "cells", "at", "37", "°", "C", "(", "Fig", ".", "6C", ")", "due", "to", "the", "inhibition", "of", "processing", "at", "A2", ",", "while", "the", "27SB", "pre", "-", "rRNA", "level", "was", "similar", "to", "wild", "-", "type", "cells", "(", "Fig", ".", "6", "G", ")", ".", "Moreover", ",", "no", "difference", "in", "the", "5.8", "rRNA", "level", "was", "observed", "between", "the", "wild", "-", "type", "cells", "and", "enp1", "cells", "(", "Fig", ".", "6H", ")", ".", "\n\n", "Enp1", "is", "associated", "with", "U3", "and", "U14", "snoRNAs", "and", "with", "Nop1", "\n", "It", "has", "previously", "been", "shown", "that", "mutations", "in", "the", "U3", ",", "U14", ",", "snR10", "and", "snR30", "snoRNAs", "and", "in", "their", "associated", "proteins", "affect", "processing", "of", "35S", "pre", "-", "rRNA", "at", "A0", ",", "A1", "and", "A2", ".", "Because", "of", "the", "similarity", "with", "the", "processing", "defects", "of", "enp1", "-", "1", "strains", ",", "we", "tested", "the", "association", "between", "Enp1", "and", "snoRNAs", ".", "To", "do", "this", ",", "we", "created", "a", "strain", "in", "which", "a", "TAP", "tag", "was", "fused", "to", "the", "C", "-", "terminus", "of", "Enp1", ".", "The", "TAP", "tag", "contains", "Staphylococcus", "aureus", "Protein", "A", "as", "well", "as", "calmodulin", "-", "binding", "peptide", "sequences", ",", "so", "the", "tagged", "Enp1", "binds", "IgG", "beads", "with", "high", "specificity", ".", "Cells", "grew", "well", "with", "the", "TAP", "-", "tagged", "Enp1", "as", "the", "only", "source", "of", "Enp1", "protein", ",", "showing", "that", "it", "was", "functional", ".", "As", "a", "control", ",", "we", "used", "a", "TAP", "tag", "on", "an", "unrelated", "cytoplasmic", "protein", ",", "Hst2", ".", "Strain", "CWY14", "(", "ENP1-TAP", ")", "and", "the", "Hst2-TAP", "tagged", "strain", "were", "grown", "in", "YPD", "to", "mid", "-", "exponential", "phase", "before", "being", "harvested", ".", "Extracts", "were", "prepared", "and", "mixed", "with", "IgG", "agarose", "beads", "to", "precipitate", "Enp1-TAP", "and", "associated", "RNAs", ".", "Total", "RNAs", "were", "extracted", "from", "washed", "IgG", "beads", ",", "separated", "on", "6", "%", "polyacrylamide", "denaturing", "gels", ",", "transferred", "to", "nylon", "membranes", "and", "probed", "with", "radiolabeled", "oligonucleotides", ".", "Northern", "analysis", "revealed", "that", "Enp1-TAP", "precipitates", "were", "enriched", "with", "U3", "and", "U14", "snoRNAs", "relative", "to", "precipitates", "from", "the", "Hst2-tagged", "strain", "(", "Fig", ".", "7A", ")", ".", "The", "Enp1-TAP", "samples", "were", "not", "enriched", "with", "snR30", "snoRNA", "(", "Fig", ".", "7A", ")", ",", "nor", "with", "U24", "or", "U18", "snoRNAs", "(", "data", "not", "shown", ")", ".", "We", "found", "no", "change", "in", "the", "levels", "of", "U3", ",", "U14", ",", "snR10", "and", "snR30", "snoRNAs", "in", "the", "enp1", "mutant", ",", "indicating", "that", "the", "mutation", "did", "not", "affect", "snoRNAs", "levels", "(", "Fig", ".", "6I", ")", ".", "The", "results", "indicate", "that", "Enp1", "associates", "in", "vivo", "with", "U3", "and", "U14", "snoRNAs", ".", "Much", "less", "U3", "RNA", "co", "-", "immunoprecipitated", "with", "Enp1-TAP", "than", "with", "Protein", "A", "-", "tagged", "Nop1", ",", "which", "is", "known", "to", "associate", "with", "U3", "and", "U14", "snoRNAs", "(", "Fig", ".", "7A", ")", ".", "However", ",", "Protein", "A", "-", "Nop1", "was", "much", "more", "efficiently", "precipitated", "than", "was", "the", "Enp1-TAP", "protein", "(", "data", "not", "shown", ")", ".", "Therefore", ",", "it", "is", "likely", "that", "similar", "amounts", "of", "RNAs", "are", "associated", "with", "the", "two", "proteins", "and", "that", "the", "proteins", "are", "part", "of", "the", "same", "complex", ".", "To", "address", "this", "further", ",", "we", "checked", "for", "the", "presence", "of", "Nop1", "in", "the", "Enp1-TAP", "immunoprecipitates", ".", "Figure", "7B", "shows", "that", "Nop1", "indeed", "is", "in", "the", "Enp1", "precipitate", "but", "not", "in", "the", "Hst2", "control", ",", "whereas", "an", "abundant", "ribosomal", "protein", ",", "L3", ",", "is", "in", "neither", "precipitate", ".", "\n", "U3", "and", "U14", "snoRNAs", "have", "been", "shown", "to", "interact", "with", "rRNA", "precursors", "and", "these", "interactions", "are", "required", "for", "pre", "-", "rRNA", "processing", "(", "35–37", ")", ".", "Using", "an", "in", "vitro", "system", ",", "U3", "was", "also", "shown", "to", "be", "associated", "with", "its", "rRNA", "substrate", "and", "processing", "product", "(", "38", ")", ".", "This", "raised", "the", "possibility", "that", "Enp1", "might", "also", "be", "associated", "with", "rRNAs", "since", "its", "function", "in", "rRNA", "processing", "appeared", "linked", "to", "those", "of", "U3", "and", "U14", "snoRNAs", ".", "To", "test", "this", "possibility", ",", "we", "further", "analyzed", "the", "RNAs", "that", "co", "-", "precipiate", "with", "TAP", "-", "tagged", "Enp1", ".", "The", "RNAs", "were", "separated", "on", "1.2", "%", "agarose", "formaldehyde", "gels", "or", "on", "polyacrylamide", "denaturing", "gels", ",", "transferred", "to", "nylon", "membranes", "and", "probed", "with", "radiolabeled", "oligonucleotides", "for", "pre", "-", "rRNAs", ".", "A", "probe", "(", "P4", ";", "see", "Fig", ".", "6", ")", "specific", "to", "20s", "and", "its", "precursors", "revealed", "that", "pre", "-", "rRNAs", "35S", ",", "33S", ",", "32S", "and", "20S", "specifically", "co", "-", "precipitated", "with", "Enp1-TAP", "(", "Fig", ".", "7C", ")", ".", "No", "such", "enrichment", "was", "found", "using", "a", "probe", "(", "P8", ";", "see", "Fig", ".", "6", ")", "specific", "for", "27S", "RNAs", "or", "a", "probe", "for", "5.8S", "RNA", "(", "Fig", ".", "7C", ")", ".", "These", "results", "clearly", "demonstrated", "that", "Enp1", "is", "associated", "with", "substrates", "and", "products", "of", "the", "early", "steps", "of", "18S", "rRNA", "processing", ".", "\n\n", "Comparison", "of", "Enp1", "with", "homologs", "in", "other", "organisms", "\n", "Homologs", "of", "Enp1", "protein", "in", "human", ",", "Drosophila", "and", "Caenorhabditis", "elegans", "have", "been", "reported", "(", "18", ")", ".", "A", "previously", "described", "human", "homolog", ",", "bystin", ",", "was", "only", "306", "amino", "acids", "in", "length", ",", "and", "lacked", "sequences", "corresponding", "to", "the", "N", "-", "terminal", "163", "amino", "acids", "of", "yeast", "Enp1", "(", "19", ")", ".", "In", "contrast", ",", "we", "identified", "a", "human", "expressed", "sequence", "tag", "(", "EST", ")", ",", "BC007340", "in", "a", "Blast", "search", "that", "revealed", "an", "ORF", "of", "1311", "nucleotides", "encoding", "a", "437", "amino", "acid", "polypeptide", "(", "39", ")", ".", "Comparison", "of", "this", "437", "amino", "acid", "polypeptide", "with", "human", "bystin", "(", "19", ")", "showed", "that", "they", "were", "encoded", "by", "the", "same", "gene", "on", "human", "chromosome", "6", ".", "The", "reported", "sequence", "for", "human", "bystin", "is", "a", "fragment", "of", "the", "437", "amino", "acid", "human", "Enp1", "protein", ",", "due", "to", "a", "truncated", "cDNA", "sequence", ".", "Also", ",", "a", "sequence", "discrepancy", "at", "the", "C", "-", "terminus", "is", "due", "to", "inaccurate", "DNA", "sequence", "of", "the", "human", "bystin", ",", "as", "confirmed", "by", "available", "human", "genome", "and", "EST", "sequences", ".", "Searches", "of", "the", "database", "of", "other", "organisms", "identified", "Enp1", "homologs", "in", "S.pombe", ",", "Arabidopsis", "thaliana", ",", "C.elegans", ",", "Drosophila", "melanogaster", "and", "mouse", ".", "The", "alignment", "of", "the", "homologs", "showed", "that", "they", "shared", "homology", "from", "the", "N", "-", "terminus", "to", "the", "C", "-", "terminus", ",", "with", "the", "C", "-", "terminal", "half", "extremely", "well", "conserved", ",", "with", "close", "to", "90", "%", "similarity", "(", "Fig", ".", "8)", ".", "One", "interesting", "observation", "is", "that", "the", "two", "amino", "acids", "changed", "in", "the", "enp1", "-", "1", "mutant", ",", "W242", "and", "V415", ",", "are", "conserved", "among", "all", "homologs", ".", "\n", "The", "human", "Enp1", "homolog", "was", "cloned", "and", "expressed", "in", "yeast", "and", "tested", "for", "function", ".", "Expressed", "under", "the", "control", "of", "ADH", ",", "TEF", "or", "GPD", "promoter", ",", "the", "human", "Enp1", "homolog", "did", "not", "complement", "a", "yeast", "enp1", "null", "mutant", ".", "However", ",", "a", "GFP", "fusion", "to", "the", "N", "-", "terminus", "of", "human", "Enp1", "homolog", "localized", "to", "the", "nucleus", "and", "was", "enriched", "in", "the", "nucleolus", "(", "data", "not", "shown", ")", ".", "\n\n\n", "DISCUSSION", "\n", "ENP1", "is", "a", "yeast", "gene", "first", "identified", "in", "a", "genetic", "screen", "for", "complementation", "of", "mutations", "in", "ost4", ",", "which", "encodes", "a", "subunit", "of", "oligosaccharide", "transferase", "(", "17", ")", ",", "although", "subsequent", "work", "showed", "that", "it", "is", "unlikely", "that", "Enp1", "has", "any", "connection", "to", "oligosaccharide", "transferase", "(", "18", ")", ".", "ENP1", "was", "shown", "to", "be", "essential", "for", "viability", "and", "the", "Enp1", "protein", "localized", "to", "the", "nucleus", "(", "18", ")", ".", "\n", "When", "we", "re", "-", "examined", "the", "localization", "of", "Enp1", ",", "we", "observed", "that", "the", "protein", "was", "enriched", "in", "the", "nucleolus", ".", "This", "finding", "led", "us", "to", "test", "for", "a", "role", "of", "Enp1", "in", "ribosome", "synthesis", ".", "Using", "an", "enp1", "ts", "mutant", ",", "we", "found", "that", "depletion", "of", "Enp1", "caused", "a", "40S", "ribosomal", "subunit", "deficiency", ".", "Further", "analysis", "revealed", "that", "this", "deficiency", "was", "not", "due", "to", "a", "change", "of", "the", "subunit", "’s", "stability", ",", "but", "to", "a", "defect", "in", "the", "synthesis", "of", "the", "subunit", "’s", "18S", "rRNA", "component", ".", "Pulse", "-", "chase", "analysis", "of", "RNA", "synthesis", "in", "an", "enp1", "-", "1", "strain", "revealed", "that", "no", "20S", "pre", "-", "rRNA", "or", "18S", "rRNA", "was", "made", "at", "the", "non", "-", "permissive", "temperature", ",", "while", "levels", "of", "25S", "rRNA", "appeared", "normal", ".", "Low", "levels", "of", "precursors", "to", "18S", "rRNA", "were", "detected", "in", "the", "mutants", ",", "and", "they", "were", "extremely", "unstable", ".", "Northern", "analysis", "of", "steady", "state", "RNA", "levels", "demonstrated", "that", "the", "enp1", "mutation", "specifically", "inhibited", "the", "pre", "-", "rRNA", "early", "cleavages", "at", "sites", "A0", ",", "A1", "and", "A2", ",", "which", "are", "required", "for", "the", "production", "of", "the", "20S", "pre", "-", "rRNA", "and", "the", "18S", "rRNA", ".", "These", "defects", "of", "the", "enp1", "mutation", "on", "rRNA", "processing", "are", "very", "similar", "to", "those", "caused", "by", "mutation", "of", "KRR1", ",", "another", "essential", "nucleolar", "gene", "required", "for", "synthesis", "of", "the", "40S", ",", "but", "not", "the", "60S", "subunit", "(", "40", ")", ".", "\n", "Co", "-", "precipitation", "analyses", "provided", "strong", "evidence", "that", "Enp1", "is", "directly", "involved", "in", "pre", "-", "rRNA", "processing", ".", "In", "these", "experiments", ",", "TAP", "-", "tagged", "Enp1", "bound", "to", "IgG", "beads", "specifically", "co", "-", "precipitated", "with", "two", "snoRNAs", ",", "U3", "and", "U14", ",", "and", "with", "the", "35S", ",", "33S", ",", "32S", "and", "20S", "pre", "-", "rRNAs", ".", "Among", "the", "more", "than", "100", "snoRNAs", "in", "yeast", "cells", ",", "U3", ",", "U14", ",", "snR10", ",", "snR30", "and", "MRP", "RNA", "are", "the", "only", "ones", "required", "for", "rRNA", "processing", ".", "It", "has", "been", "shown", "that", "mutations", "in", "U3", ",", "U14", ",", "snR10", "and", "snR30", "snoRNAs", "and", "protein", "components", "of", "the", "snoRNPs", "affect", "processing", "at", "sites", "A0", ",", "A1", "or", "A2", "(", "15,16,41,42", ")", ".", "Enp1", "’s", "interaction", "with", "U3", "and", "U14", "snoRNAs", "suggests", "that", "Enp1", "’s", "function", "in", "rRNA", "processing", "involves", "these", "two", "snoRNAs", ".", "The", "fact", "that", "the", "nucleolar", "protein", ",", "Nop1", ",", "known", "to", "bind", "to", "U3", "and", "U14", "RNAs", ",", "also", "was", "found", "in", "the", "Enp1", "precipitate", ",", "provides", "additional", "evidence", "that", "Enp1", "is", "part", "of", "a", "complex", "involved", "in", "processing", "of", "rRNA", ".", "Recently", ",", "a", "genome", "-", "wide", "study", "of", "yeast", "protein", "complexes", ",", "using", "a", "TAP", "tag", "method", "similar", "to", "ours", ",", "reported", "a", "number", "of", "proteins", "that", "co", "-", "immunoprecipitated", "with", "Enp1", "(", "43", ")", ".", "These", "proteins", "included", "Imp4", ",", "Kre31", ",", "Kre33", ",", "Mpp10", ",", "Nop1", ",", "Nop14", "and", "Sof1", ",", "all", "of", "which", "have", "been", "implicated", "in", "18S", "RNA", "processing", "or", "40S", "biogenesis", ".", "Very", "recently", "(", "after", "the", "studies", "in", "this", "manuscript", "were", "concluded", ")", "Grandi", "et", "al", ".", "published", "an", "analysis", "of", "components", "of", "the", "90s", "preribosomal", "particle", ",", "which", "include", "the", "35S", "pre", "-", "rRNA", ",", "U3", "snoRNP", "and", "rRNA", "processing", "factors", "for", "the", "40S", "subunit", "(", "44", ")", ".", "In", "agreement", "with", "our", "findings", ",", "they", "found", "that", "Enp1", "is", "a", "component", "of", "this", "90s", "complex", "and", "also", "of", "a", "smaller", "complex", "containing", "the", "20S", "pre", "-", "rRNA", ".", "Surprisingly", ",", "none", "of", "the", "other", "proteins", "involved", "in", "processing", "of", "pre", "-", "rRNAs", "that", "were", "tested", "associated", "with", "the", "20S", "rRNA", ",", "suggesting", "that", "those", "proteins", ",", "but", "not", "Enp1", ",", "are", "released", "prior", "to", "20S", "pre", "-", "rRNA", "formation", "(", "44", ")", ".", "The", "authors", "also", "showed", "co", "-", "precipitation", "of", "Enp1", "with", "dimethylated", "20S", "pre", "-", "rRNA", ",", "which", "is", "formed", "after", "export", "of", "20S", "to", "the", "cytoplasm", ".", "These", "results", "of", "Grandi", "et", "al", ".", "suggest", "that", "Enp1", "may", "also", "be", "involved", "in", "later", "steps", "of", "processing", "or", "nuclear", "export", ".", "\n", "A", "previous", "study", "on", "the", "Enp1", "human", "homolog", ",", "bystin", ",", "reported", "that", "the", "protein", "was", "localized", "in", "the", "cytoplasm", "of", "mammalian", "cells", "and", "might", "be", "involved", "in", "cell", "adhesion", "(", "19", ")", ".", "Our", "discovery", "of", "the", "437", "amino", "acid", "human", "Enp1", "homolog", "revealed", "that", "the", "bystin", "studied", "previously", "was", "from", "a", "truncated", "library", "cDNA", "encoding", "only", "the", "C", "-", "terminal", "306", "amino", "acids", ".", "Although", "the", "human", "homolog", "of", "Enp1", "did", "not", "complement", "a", "yeast", "Δenp1", "mutant", ",", "we", "did", "show", "that", "it", "was", "localized", "to", "the", "nucleus", "and", "enriched", "in", "the", "nucleolus", "(", "data", "not", "shown", ")", ".", "This", "strongly", "suggests", "that", "the", "conserved", "function", "of", "Enp1", "is", "in", "rRNA", "processing", ".", "The", "cytoplasmic", "localization", "of", "bystin", "and", "its", "proposed", "function", "in", "cell", "adhesion", "are", "unlikely", "to", "reflect", "the", "actual", "function", "of", "the", "human", "Enp1", "homolog", ".", "\n", "It", "will", "be", "important", "to", "study", "the", "nature", "of", "the", "associations", "between", "Enp1", "and", "U3", "and", "U14", "snoRNPs", ",", "and", "to", "learn", "more", "about", "the", "exact", "role", "of", "Enp1", "in", "ribosomal", "RNA", "processing", ".", "\n\n\n" ]
[ "species" ]
Nuclear factor of activated T cells is a protein_family_or_group, AP-1 is a protein_molecule, IL-2 promoter activation is an other_name, CD28 up - regulation is an other_name, RE / AP is a protein_molecule
68197_task0
Sentence: Nuclear factor of activated T cells and AP-1 are insufficient for IL-2 promoter activation: requirement for CD28 up-regulation of RE/AP. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: other_name, protein_family_or_group, protein_molecule
[ "B-protein_family_or_group", "I-protein_family_or_group", "I-protein_family_or_group", "I-protein_family_or_group", "I-protein_family_or_group", "I-protein_family_or_group", "O", "B-protein_molecule", "O", "O", "O", "B-other_name", "I-other_name", "I-other_name", "O", "O", "O", "B-other_name", "I-other_name", "I-other_name", "I-other_name", "O", "B-protein_molecule", "I-protein_molecule", "I-protein_molecule", "O" ]
Nuclear factor of activated T cells and AP-1 are insufficient for IL-2 promoter activation: requirement for CD28 up-regulation of RE/AP.
[ "Nuclear", "factor", "of", "activated", "T", "cells", "and", "AP-1", "are", "insufficient", "for", "IL-2", "promoter", "activation", ":", "requirement", "for", "CD28", "up", "-", "regulation", "of", "RE", "/", "AP", "." ]
[ "protein_family_or_group", "other_name", "(OR DNA_domain_or_region DNA_domain_or_region)", "cell_line", "DNA_family_or_group", "DNA_domain_or_region", "other_organic_compound", "cell_type", "protein_molecule", "" ]
Nuclear factor of activated T cells is a protein_family_or_group, AP-1 is a protein_molecule, IL-2 promoter activation is an other_name, CD28 up - regulation is an other_name, RE / AP is a protein_molecule
68197_task1
Sentence: Nuclear factor of activated T cells and AP-1 are insufficient for IL-2 promoter activation: requirement for CD28 up-regulation of RE/AP. Instructions: please typing these entity words according to sentence: Nuclear factor of activated T cells, AP-1, IL-2 promoter activation, CD28 up - regulation, RE / AP Options: other_name, protein_family_or_group, protein_molecule
[ "B-protein_family_or_group", "I-protein_family_or_group", "I-protein_family_or_group", "I-protein_family_or_group", "I-protein_family_or_group", "I-protein_family_or_group", "O", "B-protein_molecule", "O", "O", "O", "B-other_name", "I-other_name", "I-other_name", "O", "O", "O", "B-other_name", "I-other_name", "I-other_name", "I-other_name", "O", "B-protein_molecule", "I-protein_molecule", "I-protein_molecule", "O" ]
Nuclear factor of activated T cells and AP-1 are insufficient for IL-2 promoter activation: requirement for CD28 up-regulation of RE/AP.
[ "Nuclear", "factor", "of", "activated", "T", "cells", "and", "AP-1", "are", "insufficient", "for", "IL-2", "promoter", "activation", ":", "requirement", "for", "CD28", "up", "-", "regulation", "of", "RE", "/", "AP", "." ]
[ "protein_family_or_group", "other_name", "(OR DNA_domain_or_region DNA_domain_or_region)", "cell_line", "DNA_family_or_group", "DNA_domain_or_region", "other_organic_compound", "cell_type", "protein_molecule", "" ]
Nuclear factor of activated T cells, AP-1, IL-2 promoter activation, CD28 up - regulation, RE / AP
68197_task2
Sentence: Nuclear factor of activated T cells and AP-1 are insufficient for IL-2 promoter activation: requirement for CD28 up-regulation of RE/AP. Instructions: please extract entity words from the input sentence
[ "B-protein_family_or_group", "I-protein_family_or_group", "I-protein_family_or_group", "I-protein_family_or_group", "I-protein_family_or_group", "I-protein_family_or_group", "O", "B-protein_molecule", "O", "O", "O", "B-other_name", "I-other_name", "I-other_name", "O", "O", "O", "B-other_name", "I-other_name", "I-other_name", "I-other_name", "O", "B-protein_molecule", "I-protein_molecule", "I-protein_molecule", "O" ]
Nuclear factor of activated T cells and AP-1 are insufficient for IL-2 promoter activation: requirement for CD28 up-regulation of RE/AP.
[ "Nuclear", "factor", "of", "activated", "T", "cells", "and", "AP-1", "are", "insufficient", "for", "IL-2", "promoter", "activation", ":", "requirement", "for", "CD28", "up", "-", "regulation", "of", "RE", "/", "AP", "." ]
[ "protein_family_or_group", "other_name", "(OR DNA_domain_or_region DNA_domain_or_region)", "cell_line", "DNA_family_or_group", "DNA_domain_or_region", "other_organic_compound", "cell_type", "protein_molecule", "" ]
T - cell expression is an other_name, human GATA-3 gene is a DNA_domain_or_region, non - lineage - specific silencer is a DNA_domain_or_region
49340_task0
Sentence: T-cell expression of the human GATA-3 gene is regulated by a non-lineage-specific silencer. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: DNA_domain_or_region, other_name
[ "B-other_name", "I-other_name", "I-other_name", "I-other_name", "O", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "O", "O", "O", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "O" ]
T-cell expression of the human GATA-3 gene is regulated by a non-lineage-specific silencer.
[ "T", "-", "cell", "expression", "of", "the", "human", "GATA-3", "gene", "is", "regulated", "by", "a", "non", "-", "lineage", "-", "specific", "silencer", "." ]
[ "(AND cell_type cell_type)", "DNA_domain_or_region", "protein_family_or_group", "other_name", "protein_molecule", "", "(AND DNA_domain_or_region DNA_domain_or_region)", "cell_line", "DNA_substructure", "cell_type" ]
T - cell expression is an other_name, human GATA-3 gene is a DNA_domain_or_region, non - lineage - specific silencer is a DNA_domain_or_region
49340_task1
Sentence: T-cell expression of the human GATA-3 gene is regulated by a non-lineage-specific silencer. Instructions: please typing these entity words according to sentence: T - cell expression, human GATA-3 gene, non - lineage - specific silencer Options: DNA_domain_or_region, other_name
[ "B-other_name", "I-other_name", "I-other_name", "I-other_name", "O", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "O", "O", "O", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "O" ]
T-cell expression of the human GATA-3 gene is regulated by a non-lineage-specific silencer.
[ "T", "-", "cell", "expression", "of", "the", "human", "GATA-3", "gene", "is", "regulated", "by", "a", "non", "-", "lineage", "-", "specific", "silencer", "." ]
[ "(AND cell_type cell_type)", "DNA_domain_or_region", "protein_family_or_group", "other_name", "protein_molecule", "", "(AND DNA_domain_or_region DNA_domain_or_region)", "cell_line", "DNA_substructure", "cell_type" ]
T - cell expression, human GATA-3 gene, non - lineage - specific silencer
49340_task2
Sentence: T-cell expression of the human GATA-3 gene is regulated by a non-lineage-specific silencer. Instructions: please extract entity words from the input sentence
[ "B-other_name", "I-other_name", "I-other_name", "I-other_name", "O", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "O", "O", "O", "O", "B-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "I-DNA_domain_or_region", "O" ]
T-cell expression of the human GATA-3 gene is regulated by a non-lineage-specific silencer.
[ "T", "-", "cell", "expression", "of", "the", "human", "GATA-3", "gene", "is", "regulated", "by", "a", "non", "-", "lineage", "-", "specific", "silencer", "." ]
[ "(AND cell_type cell_type)", "DNA_domain_or_region", "protein_family_or_group", "other_name", "protein_molecule", "", "(AND DNA_domain_or_region DNA_domain_or_region)", "cell_line", "DNA_substructure", "cell_type" ]
chronic toxicity is a ADVERSE
example-98_task0
Sentence: Hg2+ and Cd2+ interact differently with biomimetic erythrocyte membranes. In order to characterize the potentially deleterious effects of toxic Hg(2+) and Cd(2+) on lipid membranes, we have studied their binding to liposomes whose composition mimicked erythrocyte membranes. Fluorescence spectroscopy utilizing the concentration dependent quenching of Phen Green SK by Hg(2+) and Cd(2+) was found to be a sensitive tool to probe these interactions at metal concentrations < or =1 microM. We have systematically developed a metal binding affinity assay to screen for the interactions of Hg(2+) or Cd(2+) with certain lipid classes. A biomimetic liposome system was developed that contained four major lipid classes of erythrocyte membranes (zwitterionic lipids: phosphatidylcholine and phosphatidylethanolamine; negatively charged: phosphatidylserine and neutral: cholesterol). In contrast to Hg(2+), which preferentially bound to the negatively charged phosphatidylserine compared to the zwitterionic components, Cd(2+) bound stronger to the two zwitterionic lipids. Thus, the observed distinct differences in the binding affinity of Hg(2+) and Cd(2+) for certain lipid classes together with their known effects on membrane properties represent an important first step toward a better understanding the role of these interactions in the chronic toxicity of these metals. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: ADVERSE
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ADVERSE", "I-ADVERSE", "O", "O", "O", "O" ]
Hg2+ and Cd2+ interact differently with biomimetic erythrocyte membranes. In order to characterize the potentially deleterious effects of toxic Hg(2+) and Cd(2+) on lipid membranes, we have studied their binding to liposomes whose composition mimicked erythrocyte membranes. Fluorescence spectroscopy utilizing the concentration dependent quenching of Phen Green SK by Hg(2+) and Cd(2+) was found to be a sensitive tool to probe these interactions at metal concentrations < or =1 microM. We have systematically developed a metal binding affinity assay to screen for the interactions of Hg(2+) or Cd(2+) with certain lipid classes. A biomimetic liposome system was developed that contained four major lipid classes of erythrocyte membranes (zwitterionic lipids: phosphatidylcholine and phosphatidylethanolamine; negatively charged: phosphatidylserine and neutral: cholesterol). In contrast to Hg(2+), which preferentially bound to the negatively charged phosphatidylserine compared to the zwitterionic components, Cd(2+) bound stronger to the two zwitterionic lipids. Thus, the observed distinct differences in the binding affinity of Hg(2+) and Cd(2+) for certain lipid classes together with their known effects on membrane properties represent an important first step toward a better understanding the role of these interactions in the chronic toxicity of these metals.
[ "Hg2", "+", "and", "Cd2", "+", "interact", "differently", "with", "biomimetic", "erythrocyte", "membranes", ".", " ", "In", "order", "to", "characterize", "the", "potentially", "deleterious", "effects", "of", "toxic", "Hg(2", "+", ")", "and", "Cd(2", "+", ")", "on", "lipid", "membranes", ",", "we", "have", "studied", "their", "binding", "to", "liposomes", "whose", "composition", "mimicked", "erythrocyte", "membranes", ".", "Fluorescence", "spectroscopy", "utilizing", "the", "concentration", "dependent", "quenching", "of", "Phen", "Green", "SK", "by", "Hg(2", "+", ")", "and", "Cd(2", "+", ")", "was", "found", "to", "be", "a", "sensitive", "tool", "to", "probe", "these", "interactions", "at", "metal", "concentrations", "<", "or", "=", "1", "microM.", "We", "have", "systematically", "developed", "a", "metal", "binding", "affinity", "assay", "to", "screen", "for", "the", "interactions", "of", "Hg(2", "+", ")", "or", "Cd(2", "+", ")", "with", "certain", "lipid", "classes", ".", "A", "biomimetic", "liposome", "system", "was", "developed", "that", "contained", "four", "major", "lipid", "classes", "of", "erythrocyte", "membranes", "(", "zwitterionic", "lipids", ":", "phosphatidylcholine", "and", "phosphatidylethanolamine", ";", "negatively", "charged", ":", "phosphatidylserine", "and", "neutral", ":", "cholesterol", ")", ".", "In", "contrast", "to", "Hg(2", "+", ")", ",", "which", "preferentially", "bound", "to", "the", "negatively", "charged", "phosphatidylserine", "compared", "to", "the", "zwitterionic", "components", ",", "Cd(2", "+", ")", "bound", "stronger", "to", "the", "two", "zwitterionic", "lipids", ".", "Thus", ",", "the", "observed", "distinct", "differences", "in", "the", "binding", "affinity", "of", "Hg(2", "+", ")", "and", "Cd(2", "+", ")", "for", "certain", "lipid", "classes", "together", "with", "their", "known", "effects", "on", "membrane", "properties", "represent", "an", "important", "first", "step", "toward", "a", "better", "understanding", "the", "role", "of", "these", "interactions", "in", "the", "chronic", "toxicity", "of", "these", "metals", "." ]
[ "ADVERSE" ]
chronic toxicity is a ADVERSE
example-98_task1
Sentence: Hg2+ and Cd2+ interact differently with biomimetic erythrocyte membranes. In order to characterize the potentially deleterious effects of toxic Hg(2+) and Cd(2+) on lipid membranes, we have studied their binding to liposomes whose composition mimicked erythrocyte membranes. Fluorescence spectroscopy utilizing the concentration dependent quenching of Phen Green SK by Hg(2+) and Cd(2+) was found to be a sensitive tool to probe these interactions at metal concentrations < or =1 microM. We have systematically developed a metal binding affinity assay to screen for the interactions of Hg(2+) or Cd(2+) with certain lipid classes. A biomimetic liposome system was developed that contained four major lipid classes of erythrocyte membranes (zwitterionic lipids: phosphatidylcholine and phosphatidylethanolamine; negatively charged: phosphatidylserine and neutral: cholesterol). In contrast to Hg(2+), which preferentially bound to the negatively charged phosphatidylserine compared to the zwitterionic components, Cd(2+) bound stronger to the two zwitterionic lipids. Thus, the observed distinct differences in the binding affinity of Hg(2+) and Cd(2+) for certain lipid classes together with their known effects on membrane properties represent an important first step toward a better understanding the role of these interactions in the chronic toxicity of these metals. Instructions: please typing these entity words according to sentence: chronic toxicity Options: ADVERSE
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ADVERSE", "I-ADVERSE", "O", "O", "O", "O" ]
Hg2+ and Cd2+ interact differently with biomimetic erythrocyte membranes. In order to characterize the potentially deleterious effects of toxic Hg(2+) and Cd(2+) on lipid membranes, we have studied their binding to liposomes whose composition mimicked erythrocyte membranes. Fluorescence spectroscopy utilizing the concentration dependent quenching of Phen Green SK by Hg(2+) and Cd(2+) was found to be a sensitive tool to probe these interactions at metal concentrations < or =1 microM. We have systematically developed a metal binding affinity assay to screen for the interactions of Hg(2+) or Cd(2+) with certain lipid classes. A biomimetic liposome system was developed that contained four major lipid classes of erythrocyte membranes (zwitterionic lipids: phosphatidylcholine and phosphatidylethanolamine; negatively charged: phosphatidylserine and neutral: cholesterol). In contrast to Hg(2+), which preferentially bound to the negatively charged phosphatidylserine compared to the zwitterionic components, Cd(2+) bound stronger to the two zwitterionic lipids. Thus, the observed distinct differences in the binding affinity of Hg(2+) and Cd(2+) for certain lipid classes together with their known effects on membrane properties represent an important first step toward a better understanding the role of these interactions in the chronic toxicity of these metals.
[ "Hg2", "+", "and", "Cd2", "+", "interact", "differently", "with", "biomimetic", "erythrocyte", "membranes", ".", " ", "In", "order", "to", "characterize", "the", "potentially", "deleterious", "effects", "of", "toxic", "Hg(2", "+", ")", "and", "Cd(2", "+", ")", "on", "lipid", "membranes", ",", "we", "have", "studied", "their", "binding", "to", "liposomes", "whose", "composition", "mimicked", "erythrocyte", "membranes", ".", "Fluorescence", "spectroscopy", "utilizing", "the", "concentration", "dependent", "quenching", "of", "Phen", "Green", "SK", "by", "Hg(2", "+", ")", "and", "Cd(2", "+", ")", "was", "found", "to", "be", "a", "sensitive", "tool", "to", "probe", "these", "interactions", "at", "metal", "concentrations", "<", "or", "=", "1", "microM.", "We", "have", "systematically", "developed", "a", "metal", "binding", "affinity", "assay", "to", "screen", "for", "the", "interactions", "of", "Hg(2", "+", ")", "or", "Cd(2", "+", ")", "with", "certain", "lipid", "classes", ".", "A", "biomimetic", "liposome", "system", "was", "developed", "that", "contained", "four", "major", "lipid", "classes", "of", "erythrocyte", "membranes", "(", "zwitterionic", "lipids", ":", "phosphatidylcholine", "and", "phosphatidylethanolamine", ";", "negatively", "charged", ":", "phosphatidylserine", "and", "neutral", ":", "cholesterol", ")", ".", "In", "contrast", "to", "Hg(2", "+", ")", ",", "which", "preferentially", "bound", "to", "the", "negatively", "charged", "phosphatidylserine", "compared", "to", "the", "zwitterionic", "components", ",", "Cd(2", "+", ")", "bound", "stronger", "to", "the", "two", "zwitterionic", "lipids", ".", "Thus", ",", "the", "observed", "distinct", "differences", "in", "the", "binding", "affinity", "of", "Hg(2", "+", ")", "and", "Cd(2", "+", ")", "for", "certain", "lipid", "classes", "together", "with", "their", "known", "effects", "on", "membrane", "properties", "represent", "an", "important", "first", "step", "toward", "a", "better", "understanding", "the", "role", "of", "these", "interactions", "in", "the", "chronic", "toxicity", "of", "these", "metals", "." ]
[ "ADVERSE" ]
chronic toxicity
example-98_task2
Sentence: Hg2+ and Cd2+ interact differently with biomimetic erythrocyte membranes. In order to characterize the potentially deleterious effects of toxic Hg(2+) and Cd(2+) on lipid membranes, we have studied their binding to liposomes whose composition mimicked erythrocyte membranes. Fluorescence spectroscopy utilizing the concentration dependent quenching of Phen Green SK by Hg(2+) and Cd(2+) was found to be a sensitive tool to probe these interactions at metal concentrations < or =1 microM. We have systematically developed a metal binding affinity assay to screen for the interactions of Hg(2+) or Cd(2+) with certain lipid classes. A biomimetic liposome system was developed that contained four major lipid classes of erythrocyte membranes (zwitterionic lipids: phosphatidylcholine and phosphatidylethanolamine; negatively charged: phosphatidylserine and neutral: cholesterol). In contrast to Hg(2+), which preferentially bound to the negatively charged phosphatidylserine compared to the zwitterionic components, Cd(2+) bound stronger to the two zwitterionic lipids. Thus, the observed distinct differences in the binding affinity of Hg(2+) and Cd(2+) for certain lipid classes together with their known effects on membrane properties represent an important first step toward a better understanding the role of these interactions in the chronic toxicity of these metals. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-ADVERSE", "I-ADVERSE", "O", "O", "O", "O" ]
Hg2+ and Cd2+ interact differently with biomimetic erythrocyte membranes. In order to characterize the potentially deleterious effects of toxic Hg(2+) and Cd(2+) on lipid membranes, we have studied their binding to liposomes whose composition mimicked erythrocyte membranes. Fluorescence spectroscopy utilizing the concentration dependent quenching of Phen Green SK by Hg(2+) and Cd(2+) was found to be a sensitive tool to probe these interactions at metal concentrations < or =1 microM. We have systematically developed a metal binding affinity assay to screen for the interactions of Hg(2+) or Cd(2+) with certain lipid classes. A biomimetic liposome system was developed that contained four major lipid classes of erythrocyte membranes (zwitterionic lipids: phosphatidylcholine and phosphatidylethanolamine; negatively charged: phosphatidylserine and neutral: cholesterol). In contrast to Hg(2+), which preferentially bound to the negatively charged phosphatidylserine compared to the zwitterionic components, Cd(2+) bound stronger to the two zwitterionic lipids. Thus, the observed distinct differences in the binding affinity of Hg(2+) and Cd(2+) for certain lipid classes together with their known effects on membrane properties represent an important first step toward a better understanding the role of these interactions in the chronic toxicity of these metals.
[ "Hg2", "+", "and", "Cd2", "+", "interact", "differently", "with", "biomimetic", "erythrocyte", "membranes", ".", " ", "In", "order", "to", "characterize", "the", "potentially", "deleterious", "effects", "of", "toxic", "Hg(2", "+", ")", "and", "Cd(2", "+", ")", "on", "lipid", "membranes", ",", "we", "have", "studied", "their", "binding", "to", "liposomes", "whose", "composition", "mimicked", "erythrocyte", "membranes", ".", "Fluorescence", "spectroscopy", "utilizing", "the", "concentration", "dependent", "quenching", "of", "Phen", "Green", "SK", "by", "Hg(2", "+", ")", "and", "Cd(2", "+", ")", "was", "found", "to", "be", "a", "sensitive", "tool", "to", "probe", "these", "interactions", "at", "metal", "concentrations", "<", "or", "=", "1", "microM.", "We", "have", "systematically", "developed", "a", "metal", "binding", "affinity", "assay", "to", "screen", "for", "the", "interactions", "of", "Hg(2", "+", ")", "or", "Cd(2", "+", ")", "with", "certain", "lipid", "classes", ".", "A", "biomimetic", "liposome", "system", "was", "developed", "that", "contained", "four", "major", "lipid", "classes", "of", "erythrocyte", "membranes", "(", "zwitterionic", "lipids", ":", "phosphatidylcholine", "and", "phosphatidylethanolamine", ";", "negatively", "charged", ":", "phosphatidylserine", "and", "neutral", ":", "cholesterol", ")", ".", "In", "contrast", "to", "Hg(2", "+", ")", ",", "which", "preferentially", "bound", "to", "the", "negatively", "charged", "phosphatidylserine", "compared", "to", "the", "zwitterionic", "components", ",", "Cd(2", "+", ")", "bound", "stronger", "to", "the", "two", "zwitterionic", "lipids", ".", "Thus", ",", "the", "observed", "distinct", "differences", "in", "the", "binding", "affinity", "of", "Hg(2", "+", ")", "and", "Cd(2", "+", ")", "for", "certain", "lipid", "classes", "together", "with", "their", "known", "effects", "on", "membrane", "properties", "represent", "an", "important", "first", "step", "toward", "a", "better", "understanding", "the", "role", "of", "these", "interactions", "in", "the", "chronic", "toxicity", "of", "these", "metals", "." ]
[ "ADVERSE" ]
Magnetic resonance imaging is an umlsterm, method is an umlsterm, bone marrow is an umlsterm, pathological processes is an umlsterm, MRI is an umlsterm, patients is an umlsterm, disorders is an umlsterm, bone marrow is an umlsterm, aim is an umlsterm, proton is an umlsterm, bone marrow is an umlsterm, sex - dependent is an umlsterm, data basis is an umlsterm, measurements is an umlsterm, patients is an umlsterm
DerRadiologe.00400694.eng.abstr_task0
Sentence: Background . Magnetic resonance imaging has shown to be a sensitive method for diagnostics of the red bone marrow , the composition of which changes physiologically and during pathological processes . However , the interpretation of MRI in patients with disorders of the red bone marrow is very difficult . The aim of this study was the characterization of the proton spectrum of healthy bone marrow and its age- and sex-dependent changes to obtain a data basis for measurements in patients . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O" ]
Background . Magnetic resonance imaging has shown to be a sensitive method for diagnostics of the red bone marrow , the composition of which changes physiologically and during pathological processes . However , the interpretation of MRI in patients with disorders of the red bone marrow is very difficult . The aim of this study was the characterization of the proton spectrum of healthy bone marrow and its age- and sex-dependent changes to obtain a data basis for measurements in patients .
[ "Background", ".", "Magnetic", "resonance", "imaging", "has", "shown", "to", "be", "a", "sensitive", "method", "for", "diagnostics", "of", "the", "red", "bone", "marrow", ",", "the", "composition", "of", "which", "changes", "physiologically", "and", "during", "pathological", "processes", ".", "However", ",", "the", "interpretation", "of", "MRI", "in", "patients", "with", "disorders", "of", "the", "red", "bone", "marrow", "is", "very", "difficult", ".", "The", "aim", "of", "this", "study", "was", "the", "characterization", "of", "the", "proton", "spectrum", "of", "healthy", "bone", "marrow", "and", "its", "age-", "and", "sex", "-", "dependent", "changes", "to", "obtain", "a", "data", "basis", "for", "measurements", "in", "patients", "." ]
[ "umlsterm" ]
Magnetic resonance imaging is an umlsterm, method is an umlsterm, bone marrow is an umlsterm, pathological processes is an umlsterm, MRI is an umlsterm, patients is an umlsterm, disorders is an umlsterm, bone marrow is an umlsterm, aim is an umlsterm, proton is an umlsterm, bone marrow is an umlsterm, sex - dependent is an umlsterm, data basis is an umlsterm, measurements is an umlsterm, patients is an umlsterm
DerRadiologe.00400694.eng.abstr_task1
Sentence: Background . Magnetic resonance imaging has shown to be a sensitive method for diagnostics of the red bone marrow , the composition of which changes physiologically and during pathological processes . However , the interpretation of MRI in patients with disorders of the red bone marrow is very difficult . The aim of this study was the characterization of the proton spectrum of healthy bone marrow and its age- and sex-dependent changes to obtain a data basis for measurements in patients . Instructions: please typing these entity words according to sentence: Magnetic resonance imaging, method, bone marrow, pathological processes, MRI, patients, disorders, bone marrow, aim, proton, bone marrow, sex - dependent, data basis, measurements, patients Options: umlsterm
[ "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O" ]
Background . Magnetic resonance imaging has shown to be a sensitive method for diagnostics of the red bone marrow , the composition of which changes physiologically and during pathological processes . However , the interpretation of MRI in patients with disorders of the red bone marrow is very difficult . The aim of this study was the characterization of the proton spectrum of healthy bone marrow and its age- and sex-dependent changes to obtain a data basis for measurements in patients .
[ "Background", ".", "Magnetic", "resonance", "imaging", "has", "shown", "to", "be", "a", "sensitive", "method", "for", "diagnostics", "of", "the", "red", "bone", "marrow", ",", "the", "composition", "of", "which", "changes", "physiologically", "and", "during", "pathological", "processes", ".", "However", ",", "the", "interpretation", "of", "MRI", "in", "patients", "with", "disorders", "of", "the", "red", "bone", "marrow", "is", "very", "difficult", ".", "The", "aim", "of", "this", "study", "was", "the", "characterization", "of", "the", "proton", "spectrum", "of", "healthy", "bone", "marrow", "and", "its", "age-", "and", "sex", "-", "dependent", "changes", "to", "obtain", "a", "data", "basis", "for", "measurements", "in", "patients", "." ]
[ "umlsterm" ]
Magnetic resonance imaging, method, bone marrow, pathological processes, MRI, patients, disorders, bone marrow, aim, proton, bone marrow, sex - dependent, data basis, measurements, patients
DerRadiologe.00400694.eng.abstr_task2
Sentence: Background . Magnetic resonance imaging has shown to be a sensitive method for diagnostics of the red bone marrow , the composition of which changes physiologically and during pathological processes . However , the interpretation of MRI in patients with disorders of the red bone marrow is very difficult . The aim of this study was the characterization of the proton spectrum of healthy bone marrow and its age- and sex-dependent changes to obtain a data basis for measurements in patients . Instructions: please extract entity words from the input sentence
[ "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O" ]
Background . Magnetic resonance imaging has shown to be a sensitive method for diagnostics of the red bone marrow , the composition of which changes physiologically and during pathological processes . However , the interpretation of MRI in patients with disorders of the red bone marrow is very difficult . The aim of this study was the characterization of the proton spectrum of healthy bone marrow and its age- and sex-dependent changes to obtain a data basis for measurements in patients .
[ "Background", ".", "Magnetic", "resonance", "imaging", "has", "shown", "to", "be", "a", "sensitive", "method", "for", "diagnostics", "of", "the", "red", "bone", "marrow", ",", "the", "composition", "of", "which", "changes", "physiologically", "and", "during", "pathological", "processes", ".", "However", ",", "the", "interpretation", "of", "MRI", "in", "patients", "with", "disorders", "of", "the", "red", "bone", "marrow", "is", "very", "difficult", ".", "The", "aim", "of", "this", "study", "was", "the", "characterization", "of", "the", "proton", "spectrum", "of", "healthy", "bone", "marrow", "and", "its", "age-", "and", "sex", "-", "dependent", "changes", "to", "obtain", "a", "data", "basis", "for", "measurements", "in", "patients", "." ]
[ "umlsterm" ]
topoisomerase ii is a GENE-Y, Topoisomerase II is a GENE-Y, TOP2 is a GENE-Y, TOP2 is a GENE-Y, ATP is a CHEMICAL, TOP2 is a GENE-Y, ATP is a CHEMICAL, TOP2 is a GENE-Y, ATP is a CHEMICAL, adenosine 5'-(beta , gamma - imino)triphosphate is a CHEMICAL, ATP is a CHEMICAL, TOP2 is a GENE-Y, doxorubicin is a CHEMICAL, etoposide is a CHEMICAL, mitoxantrone is a CHEMICAL, 4'-(9-acridinylamino)methanesulfon - m - anisidide is a CHEMICAL, ATP is a CHEMICAL, TOP2 is a GENE-Y, amonafide is a CHEMICAL, batracylin is a CHEMICAL, menadione is a CHEMICAL, ADP is a CHEMICAL, ATP is a CHEMICAL, ATP is a CHEMICAL, TOP2 is a GENE-Y, C427A is a GENE-N, human TOP2alpha is a GENE-Y, ATPase is a GENE-N, ATP is a CHEMICAL, ATP is a CHEMICAL, TOP2 is a GENE-Y, ciprofloxacin is a CHEMICAL, ATP is a CHEMICAL, ATP is a CHEMICAL, ciprofloxacin is a CHEMICAL, ATP is a CHEMICAL, TOP2 is a GENE-Y, ATP is a CHEMICAL, TOP2 is a GENE-Y, Lac repressor - operator complexes is a GENE-N, ATP is a CHEMICAL, TOP2 is a GENE-Y
5932_task0
Sentence: Atp-bound topoisomerase ii as a target for antitumor drugs. Topoisomerase II (TOP2) poisons interfere with the breakage/reunion reaction of TOP2 resulting in DNA cleavage. In the current studies, we show that two different classes (ATP-sensitive and -insensitive) of TOP2 poisons can be identified based on their differential sensitivity to the ATP-bound conformation of TOP2. First, in the presence of 1 mm ATP or the nonhydrolyzable analog adenosine 5'-(beta,gamma-imino)triphosphate, TOP2-mediated DNA cleavage induced by ATP-sensitive TOP2 poisons (e.g. doxorubicin, etoposide, mitoxantrone, and 4'-(9-acridinylamino)methanesulfon-m-anisidide) was 30-100-fold stimulated, whereas DNA cleavage induced by ATP-insensitive TOP2 poisons (e.g. amonafide, batracylin, and menadione) was only slightly (less than 3-fold) affected. In addition, ADP was shown to strongly antagonize TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-insensitive TOP2 poisons. Second, C427A mutant human TOP2alpha, which exhibits reduced ATPase activity, was shown to exhibit cross-resistance to all ATP-sensitive but not ATP-insensitive TOP2 poisons. Third, using ciprofloxacin competition assay, TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-insensitive poisons was shown to be antagonized by ciprofloxacin. These results suggest that ATP-bound TOP2 may be the specific target of ATP-sensitive TOP2 poisons. Using Lac repressor-operator complexes as roadblocks, we show that ATP-bound TOP2 acts as a circular clamp capable of entering DNA ends and sliding on unobstructed duplex DNA. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: GENE-N, GENE-Y, CHEMICAL
[ "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "B-GENE-N", "O", "B-GENE-Y", "I-GENE-Y", "O", "O", "O", "O", "B-GENE-N", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "B-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Atp-bound topoisomerase ii as a target for antitumor drugs. Topoisomerase II (TOP2) poisons interfere with the breakage/reunion reaction of TOP2 resulting in DNA cleavage. In the current studies, we show that two different classes (ATP-sensitive and -insensitive) of TOP2 poisons can be identified based on their differential sensitivity to the ATP-bound conformation of TOP2. First, in the presence of 1 mm ATP or the nonhydrolyzable analog adenosine 5'-(beta,gamma-imino)triphosphate, TOP2-mediated DNA cleavage induced by ATP-sensitive TOP2 poisons (e.g. doxorubicin, etoposide, mitoxantrone, and 4'-(9-acridinylamino)methanesulfon-m-anisidide) was 30-100-fold stimulated, whereas DNA cleavage induced by ATP-insensitive TOP2 poisons (e.g. amonafide, batracylin, and menadione) was only slightly (less than 3-fold) affected. In addition, ADP was shown to strongly antagonize TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-insensitive TOP2 poisons. Second, C427A mutant human TOP2alpha, which exhibits reduced ATPase activity, was shown to exhibit cross-resistance to all ATP-sensitive but not ATP-insensitive TOP2 poisons. Third, using ciprofloxacin competition assay, TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-insensitive poisons was shown to be antagonized by ciprofloxacin. These results suggest that ATP-bound TOP2 may be the specific target of ATP-sensitive TOP2 poisons. Using Lac repressor-operator complexes as roadblocks, we show that ATP-bound TOP2 acts as a circular clamp capable of entering DNA ends and sliding on unobstructed duplex DNA.
[ "Atp", "-", "bound", "topoisomerase", "ii", "as", "a", "target", "for", "antitumor", "drugs", ".", "\n", "Topoisomerase", "II", "(", "TOP2", ")", "poisons", "interfere", "with", "the", "breakage", "/", "reunion", "reaction", "of", "TOP2", "resulting", "in", "DNA", "cleavage", ".", "In", "the", "current", "studies", ",", "we", "show", "that", "two", "different", "classes", "(", "ATP", "-", "sensitive", "and", "-insensitive", ")", "of", "TOP2", "poisons", "can", "be", "identified", "based", "on", "their", "differential", "sensitivity", "to", "the", "ATP", "-", "bound", "conformation", "of", "TOP2", ".", "First", ",", "in", "the", "presence", "of", "1", "mm", "ATP", "or", "the", "nonhydrolyzable", "analog", "adenosine", "5'-(beta", ",", "gamma", "-", "imino)triphosphate", ",", "TOP2-mediated", "DNA", "cleavage", "induced", "by", "ATP", "-", "sensitive", "TOP2", "poisons", "(", "e.g", ".", "doxorubicin", ",", "etoposide", ",", "mitoxantrone", ",", "and", "4'-(9-acridinylamino)methanesulfon", "-", "m", "-", "anisidide", ")", "was", "30", "-", "100-fold", "stimulated", ",", "whereas", "DNA", "cleavage", "induced", "by", "ATP", "-", "insensitive", "TOP2", "poisons", "(", "e.g", ".", "amonafide", ",", "batracylin", ",", "and", "menadione", ")", "was", "only", "slightly", "(", "less", "than", "3-fold", ")", "affected", ".", "In", "addition", ",", "ADP", "was", "shown", "to", "strongly", "antagonize", "TOP2-mediated", "DNA", "cleavage", "induced", "by", "ATP", "-", "sensitive", "but", "not", "ATP", "-", "insensitive", "TOP2", "poisons", ".", "Second", ",", "C427A", "mutant", "human", "TOP2alpha", ",", "which", "exhibits", "reduced", "ATPase", "activity", ",", "was", "shown", "to", "exhibit", "cross", "-", "resistance", "to", "all", "ATP", "-", "sensitive", "but", "not", "ATP", "-", "insensitive", "TOP2", "poisons", ".", "Third", ",", "using", "ciprofloxacin", "competition", "assay", ",", "TOP2-mediated", "DNA", "cleavage", "induced", "by", "ATP", "-", "sensitive", "but", "not", "ATP", "-", "insensitive", "poisons", "was", "shown", "to", "be", "antagonized", "by", "ciprofloxacin", ".", "These", "results", "suggest", "that", "ATP", "-", "bound", "TOP2", "may", "be", "the", "specific", "target", "of", "ATP", "-", "sensitive", "TOP2", "poisons", ".", "Using", "Lac", "repressor", "-", "operator", "complexes", "as", "roadblocks", ",", "we", "show", "that", "ATP", "-", "bound", "TOP2", "acts", "as", "a", "circular", "clamp", "capable", "of", "entering", "DNA", "ends", "and", "sliding", "on", "unobstructed", "duplex", "DNA", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
topoisomerase ii is a GENE-Y, Topoisomerase II is a GENE-Y, TOP2 is a GENE-Y, TOP2 is a GENE-Y, ATP is a CHEMICAL, TOP2 is a GENE-Y, ATP is a CHEMICAL, TOP2 is a GENE-Y, ATP is a CHEMICAL, adenosine 5'-(beta , gamma - imino)triphosphate is a CHEMICAL, ATP is a CHEMICAL, TOP2 is a GENE-Y, doxorubicin is a CHEMICAL, etoposide is a CHEMICAL, mitoxantrone is a CHEMICAL, 4'-(9-acridinylamino)methanesulfon - m - anisidide is a CHEMICAL, ATP is a CHEMICAL, TOP2 is a GENE-Y, amonafide is a CHEMICAL, batracylin is a CHEMICAL, menadione is a CHEMICAL, ADP is a CHEMICAL, ATP is a CHEMICAL, ATP is a CHEMICAL, TOP2 is a GENE-Y, C427A is a GENE-N, human TOP2alpha is a GENE-Y, ATPase is a GENE-N, ATP is a CHEMICAL, ATP is a CHEMICAL, TOP2 is a GENE-Y, ciprofloxacin is a CHEMICAL, ATP is a CHEMICAL, ATP is a CHEMICAL, ciprofloxacin is a CHEMICAL, ATP is a CHEMICAL, TOP2 is a GENE-Y, ATP is a CHEMICAL, TOP2 is a GENE-Y, Lac repressor - operator complexes is a GENE-N, ATP is a CHEMICAL, TOP2 is a GENE-Y
5932_task1
Sentence: Atp-bound topoisomerase ii as a target for antitumor drugs. Topoisomerase II (TOP2) poisons interfere with the breakage/reunion reaction of TOP2 resulting in DNA cleavage. In the current studies, we show that two different classes (ATP-sensitive and -insensitive) of TOP2 poisons can be identified based on their differential sensitivity to the ATP-bound conformation of TOP2. First, in the presence of 1 mm ATP or the nonhydrolyzable analog adenosine 5'-(beta,gamma-imino)triphosphate, TOP2-mediated DNA cleavage induced by ATP-sensitive TOP2 poisons (e.g. doxorubicin, etoposide, mitoxantrone, and 4'-(9-acridinylamino)methanesulfon-m-anisidide) was 30-100-fold stimulated, whereas DNA cleavage induced by ATP-insensitive TOP2 poisons (e.g. amonafide, batracylin, and menadione) was only slightly (less than 3-fold) affected. In addition, ADP was shown to strongly antagonize TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-insensitive TOP2 poisons. Second, C427A mutant human TOP2alpha, which exhibits reduced ATPase activity, was shown to exhibit cross-resistance to all ATP-sensitive but not ATP-insensitive TOP2 poisons. Third, using ciprofloxacin competition assay, TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-insensitive poisons was shown to be antagonized by ciprofloxacin. These results suggest that ATP-bound TOP2 may be the specific target of ATP-sensitive TOP2 poisons. Using Lac repressor-operator complexes as roadblocks, we show that ATP-bound TOP2 acts as a circular clamp capable of entering DNA ends and sliding on unobstructed duplex DNA. Instructions: please typing these entity words according to sentence: topoisomerase ii, Topoisomerase II, TOP2, TOP2, ATP, TOP2, ATP, TOP2, ATP, adenosine 5'-(beta , gamma - imino)triphosphate, ATP, TOP2, doxorubicin, etoposide, mitoxantrone, 4'-(9-acridinylamino)methanesulfon - m - anisidide, ATP, TOP2, amonafide, batracylin, menadione, ADP, ATP, ATP, TOP2, C427A, human TOP2alpha, ATPase, ATP, ATP, TOP2, ciprofloxacin, ATP, ATP, ciprofloxacin, ATP, TOP2, ATP, TOP2, Lac repressor - operator complexes, ATP, TOP2 Options: GENE-N, GENE-Y, CHEMICAL
[ "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "B-GENE-N", "O", "B-GENE-Y", "I-GENE-Y", "O", "O", "O", "O", "B-GENE-N", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "B-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Atp-bound topoisomerase ii as a target for antitumor drugs. Topoisomerase II (TOP2) poisons interfere with the breakage/reunion reaction of TOP2 resulting in DNA cleavage. In the current studies, we show that two different classes (ATP-sensitive and -insensitive) of TOP2 poisons can be identified based on their differential sensitivity to the ATP-bound conformation of TOP2. First, in the presence of 1 mm ATP or the nonhydrolyzable analog adenosine 5'-(beta,gamma-imino)triphosphate, TOP2-mediated DNA cleavage induced by ATP-sensitive TOP2 poisons (e.g. doxorubicin, etoposide, mitoxantrone, and 4'-(9-acridinylamino)methanesulfon-m-anisidide) was 30-100-fold stimulated, whereas DNA cleavage induced by ATP-insensitive TOP2 poisons (e.g. amonafide, batracylin, and menadione) was only slightly (less than 3-fold) affected. In addition, ADP was shown to strongly antagonize TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-insensitive TOP2 poisons. Second, C427A mutant human TOP2alpha, which exhibits reduced ATPase activity, was shown to exhibit cross-resistance to all ATP-sensitive but not ATP-insensitive TOP2 poisons. Third, using ciprofloxacin competition assay, TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-insensitive poisons was shown to be antagonized by ciprofloxacin. These results suggest that ATP-bound TOP2 may be the specific target of ATP-sensitive TOP2 poisons. Using Lac repressor-operator complexes as roadblocks, we show that ATP-bound TOP2 acts as a circular clamp capable of entering DNA ends and sliding on unobstructed duplex DNA.
[ "Atp", "-", "bound", "topoisomerase", "ii", "as", "a", "target", "for", "antitumor", "drugs", ".", "\n", "Topoisomerase", "II", "(", "TOP2", ")", "poisons", "interfere", "with", "the", "breakage", "/", "reunion", "reaction", "of", "TOP2", "resulting", "in", "DNA", "cleavage", ".", "In", "the", "current", "studies", ",", "we", "show", "that", "two", "different", "classes", "(", "ATP", "-", "sensitive", "and", "-insensitive", ")", "of", "TOP2", "poisons", "can", "be", "identified", "based", "on", "their", "differential", "sensitivity", "to", "the", "ATP", "-", "bound", "conformation", "of", "TOP2", ".", "First", ",", "in", "the", "presence", "of", "1", "mm", "ATP", "or", "the", "nonhydrolyzable", "analog", "adenosine", "5'-(beta", ",", "gamma", "-", "imino)triphosphate", ",", "TOP2-mediated", "DNA", "cleavage", "induced", "by", "ATP", "-", "sensitive", "TOP2", "poisons", "(", "e.g", ".", "doxorubicin", ",", "etoposide", ",", "mitoxantrone", ",", "and", "4'-(9-acridinylamino)methanesulfon", "-", "m", "-", "anisidide", ")", "was", "30", "-", "100-fold", "stimulated", ",", "whereas", "DNA", "cleavage", "induced", "by", "ATP", "-", "insensitive", "TOP2", "poisons", "(", "e.g", ".", "amonafide", ",", "batracylin", ",", "and", "menadione", ")", "was", "only", "slightly", "(", "less", "than", "3-fold", ")", "affected", ".", "In", "addition", ",", "ADP", "was", "shown", "to", "strongly", "antagonize", "TOP2-mediated", "DNA", "cleavage", "induced", "by", "ATP", "-", "sensitive", "but", "not", "ATP", "-", "insensitive", "TOP2", "poisons", ".", "Second", ",", "C427A", "mutant", "human", "TOP2alpha", ",", "which", "exhibits", "reduced", "ATPase", "activity", ",", "was", "shown", "to", "exhibit", "cross", "-", "resistance", "to", "all", "ATP", "-", "sensitive", "but", "not", "ATP", "-", "insensitive", "TOP2", "poisons", ".", "Third", ",", "using", "ciprofloxacin", "competition", "assay", ",", "TOP2-mediated", "DNA", "cleavage", "induced", "by", "ATP", "-", "sensitive", "but", "not", "ATP", "-", "insensitive", "poisons", "was", "shown", "to", "be", "antagonized", "by", "ciprofloxacin", ".", "These", "results", "suggest", "that", "ATP", "-", "bound", "TOP2", "may", "be", "the", "specific", "target", "of", "ATP", "-", "sensitive", "TOP2", "poisons", ".", "Using", "Lac", "repressor", "-", "operator", "complexes", "as", "roadblocks", ",", "we", "show", "that", "ATP", "-", "bound", "TOP2", "acts", "as", "a", "circular", "clamp", "capable", "of", "entering", "DNA", "ends", "and", "sliding", "on", "unobstructed", "duplex", "DNA", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
topoisomerase ii, Topoisomerase II, TOP2, TOP2, ATP, TOP2, ATP, TOP2, ATP, adenosine 5'-(beta , gamma - imino)triphosphate, ATP, TOP2, doxorubicin, etoposide, mitoxantrone, 4'-(9-acridinylamino)methanesulfon - m - anisidide, ATP, TOP2, amonafide, batracylin, menadione, ADP, ATP, ATP, TOP2, C427A, human TOP2alpha, ATPase, ATP, ATP, TOP2, ciprofloxacin, ATP, ATP, ciprofloxacin, ATP, TOP2, ATP, TOP2, Lac repressor - operator complexes, ATP, TOP2
5932_task2
Sentence: Atp-bound topoisomerase ii as a target for antitumor drugs. Topoisomerase II (TOP2) poisons interfere with the breakage/reunion reaction of TOP2 resulting in DNA cleavage. In the current studies, we show that two different classes (ATP-sensitive and -insensitive) of TOP2 poisons can be identified based on their differential sensitivity to the ATP-bound conformation of TOP2. First, in the presence of 1 mm ATP or the nonhydrolyzable analog adenosine 5'-(beta,gamma-imino)triphosphate, TOP2-mediated DNA cleavage induced by ATP-sensitive TOP2 poisons (e.g. doxorubicin, etoposide, mitoxantrone, and 4'-(9-acridinylamino)methanesulfon-m-anisidide) was 30-100-fold stimulated, whereas DNA cleavage induced by ATP-insensitive TOP2 poisons (e.g. amonafide, batracylin, and menadione) was only slightly (less than 3-fold) affected. In addition, ADP was shown to strongly antagonize TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-insensitive TOP2 poisons. Second, C427A mutant human TOP2alpha, which exhibits reduced ATPase activity, was shown to exhibit cross-resistance to all ATP-sensitive but not ATP-insensitive TOP2 poisons. Third, using ciprofloxacin competition assay, TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-insensitive poisons was shown to be antagonized by ciprofloxacin. These results suggest that ATP-bound TOP2 may be the specific target of ATP-sensitive TOP2 poisons. Using Lac repressor-operator complexes as roadblocks, we show that ATP-bound TOP2 acts as a circular clamp capable of entering DNA ends and sliding on unobstructed duplex DNA. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "I-GENE-Y", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "O", "O", "B-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "I-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "B-CHEMICAL", "O", "B-CHEMICAL", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "B-GENE-N", "O", "B-GENE-Y", "I-GENE-Y", "O", "O", "O", "O", "B-GENE-N", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "B-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "I-GENE-N", "O", "O", "O", "O", "O", "O", "B-CHEMICAL", "O", "O", "B-GENE-Y", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Atp-bound topoisomerase ii as a target for antitumor drugs. Topoisomerase II (TOP2) poisons interfere with the breakage/reunion reaction of TOP2 resulting in DNA cleavage. In the current studies, we show that two different classes (ATP-sensitive and -insensitive) of TOP2 poisons can be identified based on their differential sensitivity to the ATP-bound conformation of TOP2. First, in the presence of 1 mm ATP or the nonhydrolyzable analog adenosine 5'-(beta,gamma-imino)triphosphate, TOP2-mediated DNA cleavage induced by ATP-sensitive TOP2 poisons (e.g. doxorubicin, etoposide, mitoxantrone, and 4'-(9-acridinylamino)methanesulfon-m-anisidide) was 30-100-fold stimulated, whereas DNA cleavage induced by ATP-insensitive TOP2 poisons (e.g. amonafide, batracylin, and menadione) was only slightly (less than 3-fold) affected. In addition, ADP was shown to strongly antagonize TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-insensitive TOP2 poisons. Second, C427A mutant human TOP2alpha, which exhibits reduced ATPase activity, was shown to exhibit cross-resistance to all ATP-sensitive but not ATP-insensitive TOP2 poisons. Third, using ciprofloxacin competition assay, TOP2-mediated DNA cleavage induced by ATP-sensitive but not ATP-insensitive poisons was shown to be antagonized by ciprofloxacin. These results suggest that ATP-bound TOP2 may be the specific target of ATP-sensitive TOP2 poisons. Using Lac repressor-operator complexes as roadblocks, we show that ATP-bound TOP2 acts as a circular clamp capable of entering DNA ends and sliding on unobstructed duplex DNA.
[ "Atp", "-", "bound", "topoisomerase", "ii", "as", "a", "target", "for", "antitumor", "drugs", ".", "\n", "Topoisomerase", "II", "(", "TOP2", ")", "poisons", "interfere", "with", "the", "breakage", "/", "reunion", "reaction", "of", "TOP2", "resulting", "in", "DNA", "cleavage", ".", "In", "the", "current", "studies", ",", "we", "show", "that", "two", "different", "classes", "(", "ATP", "-", "sensitive", "and", "-insensitive", ")", "of", "TOP2", "poisons", "can", "be", "identified", "based", "on", "their", "differential", "sensitivity", "to", "the", "ATP", "-", "bound", "conformation", "of", "TOP2", ".", "First", ",", "in", "the", "presence", "of", "1", "mm", "ATP", "or", "the", "nonhydrolyzable", "analog", "adenosine", "5'-(beta", ",", "gamma", "-", "imino)triphosphate", ",", "TOP2-mediated", "DNA", "cleavage", "induced", "by", "ATP", "-", "sensitive", "TOP2", "poisons", "(", "e.g", ".", "doxorubicin", ",", "etoposide", ",", "mitoxantrone", ",", "and", "4'-(9-acridinylamino)methanesulfon", "-", "m", "-", "anisidide", ")", "was", "30", "-", "100-fold", "stimulated", ",", "whereas", "DNA", "cleavage", "induced", "by", "ATP", "-", "insensitive", "TOP2", "poisons", "(", "e.g", ".", "amonafide", ",", "batracylin", ",", "and", "menadione", ")", "was", "only", "slightly", "(", "less", "than", "3-fold", ")", "affected", ".", "In", "addition", ",", "ADP", "was", "shown", "to", "strongly", "antagonize", "TOP2-mediated", "DNA", "cleavage", "induced", "by", "ATP", "-", "sensitive", "but", "not", "ATP", "-", "insensitive", "TOP2", "poisons", ".", "Second", ",", "C427A", "mutant", "human", "TOP2alpha", ",", "which", "exhibits", "reduced", "ATPase", "activity", ",", "was", "shown", "to", "exhibit", "cross", "-", "resistance", "to", "all", "ATP", "-", "sensitive", "but", "not", "ATP", "-", "insensitive", "TOP2", "poisons", ".", "Third", ",", "using", "ciprofloxacin", "competition", "assay", ",", "TOP2-mediated", "DNA", "cleavage", "induced", "by", "ATP", "-", "sensitive", "but", "not", "ATP", "-", "insensitive", "poisons", "was", "shown", "to", "be", "antagonized", "by", "ciprofloxacin", ".", "These", "results", "suggest", "that", "ATP", "-", "bound", "TOP2", "may", "be", "the", "specific", "target", "of", "ATP", "-", "sensitive", "TOP2", "poisons", ".", "Using", "Lac", "repressor", "-", "operator", "complexes", "as", "roadblocks", ",", "we", "show", "that", "ATP", "-", "bound", "TOP2", "acts", "as", "a", "circular", "clamp", "capable", "of", "entering", "DNA", "ends", "and", "sliding", "on", "unobstructed", "duplex", "DNA", "." ]
[ "CHEMICAL", "GENE-N", "GENE-Y" ]
multicenter study is an umlsterm, association is an umlsterm, stress is an umlsterm, use is an umlsterm, patients is an umlsterm, diabetes is an umlsterm
MedizinischeKlinik.00950369.eng.abstr_task0
Sentence: Background : In a multicenter study the association of psychosocial stress and the use of psychosocial support in patients with diabetes mellitus was evaluated . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O" ]
Background : In a multicenter study the association of psychosocial stress and the use of psychosocial support in patients with diabetes mellitus was evaluated .
[ "Background", ":", "In", "a", "multicenter", "study", "the", "association", "of", "psychosocial", "stress", "and", "the", "use", "of", "psychosocial", "support", "in", "patients", "with", "diabetes", "mellitus", "was", "evaluated", "." ]
[ "umlsterm" ]
multicenter study is an umlsterm, association is an umlsterm, stress is an umlsterm, use is an umlsterm, patients is an umlsterm, diabetes is an umlsterm
MedizinischeKlinik.00950369.eng.abstr_task1
Sentence: Background : In a multicenter study the association of psychosocial stress and the use of psychosocial support in patients with diabetes mellitus was evaluated . Instructions: please typing these entity words according to sentence: multicenter study, association, stress, use, patients, diabetes Options: umlsterm
[ "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O" ]
Background : In a multicenter study the association of psychosocial stress and the use of psychosocial support in patients with diabetes mellitus was evaluated .
[ "Background", ":", "In", "a", "multicenter", "study", "the", "association", "of", "psychosocial", "stress", "and", "the", "use", "of", "psychosocial", "support", "in", "patients", "with", "diabetes", "mellitus", "was", "evaluated", "." ]
[ "umlsterm" ]
multicenter study, association, stress, use, patients, diabetes
MedizinischeKlinik.00950369.eng.abstr_task2
Sentence: Background : In a multicenter study the association of psychosocial stress and the use of psychosocial support in patients with diabetes mellitus was evaluated . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O" ]
Background : In a multicenter study the association of psychosocial stress and the use of psychosocial support in patients with diabetes mellitus was evaluated .
[ "Background", ":", "In", "a", "multicenter", "study", "the", "association", "of", "psychosocial", "stress", "and", "the", "use", "of", "psychosocial", "support", "in", "patients", "with", "diabetes", "mellitus", "was", "evaluated", "." ]
[ "umlsterm" ]
Minderperfusion is an umlsterm, Leriche - Syndrom is an umlsterm, Ischaemie is an umlsterm, Beckenarterien is an umlsterm, Komplikationen is an umlsterm, letalem Ausgang is an umlsterm, Perfusion is an umlsterm, Aorta is an umlsterm, Beckenarterien is an umlsterm, Blutungen is an umlsterm, Beckenbereich is an umlsterm, Komplikationen is an umlsterm, Blasennekrosen is an umlsterm, Kolonischaemien is an umlsterm, Spinalarterienischaemien is an umlsterm, Nekrosen is an umlsterm, Therapie is an umlsterm, Patienten is an umlsterm, Komplikation is an umlsterm
Gefaesschirurgie.70020065.ger.abstr_task0
Sentence: Die chronische Minderperfusion im aortoiliakalen Stromgebiet fuehrt zu einem Symptomenkomplex , der als Leriche-Syndrom bekannt ist . Im Gegensatz dazu drohen bei akuter Ischaemie nach Verschluss der Beckenarterien schwere Komplikationen mit teilweise letalem Ausgang [ 2 , 4 , 5 , 9 , 10 , 12 13 ] . , Die akute Unterbrechung der aortoiliakalen Perfusion wird ueberwiegend nach Eingiffen an der Aorta und den Beckenarterien , oder auch nach selektiver kathetergesteuerter Embolisation der Iliakalarterien zur Beherrschung von Blutungen im Beckenbereich beobachtet [ 1 , 8 ] . Die verschiedenen Komplikationen verteilen sich auf Blasennekrosen [ 6 ] , linksseitige Kolonischaemien und Spinalarterienischaemien [ 10 ] , Nervenausfaelle sowie Nekrosen des Rektums und der Glutealmuskulatur [ 2 11-13 ] . , Trotz adaequater Therapie betraegt die Letalitaet ueber 70% [ 2 ] . Wir berichten ueber einen 66jaehrigen Patienten , bei dem nach Ausschaltung eines rechtsseitig gedeckt rupturierten Iliakalaneurysmas durch eine Y-Prothese aufgrund eines beidseitigen Verschlusses der Aa . iliacae internae eine bilaterale Glutealnekrose auftrat , der aber dennoch diese meist letale Komplikation ueberlebte . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O" ]
Die chronische Minderperfusion im aortoiliakalen Stromgebiet fuehrt zu einem Symptomenkomplex , der als Leriche-Syndrom bekannt ist . Im Gegensatz dazu drohen bei akuter Ischaemie nach Verschluss der Beckenarterien schwere Komplikationen mit teilweise letalem Ausgang [ 2 , 4 , 5 , 9 , 10 , 12 13 ] . , Die akute Unterbrechung der aortoiliakalen Perfusion wird ueberwiegend nach Eingiffen an der Aorta und den Beckenarterien , oder auch nach selektiver kathetergesteuerter Embolisation der Iliakalarterien zur Beherrschung von Blutungen im Beckenbereich beobachtet [ 1 , 8 ] . Die verschiedenen Komplikationen verteilen sich auf Blasennekrosen [ 6 ] , linksseitige Kolonischaemien und Spinalarterienischaemien [ 10 ] , Nervenausfaelle sowie Nekrosen des Rektums und der Glutealmuskulatur [ 2 11-13 ] . , Trotz adaequater Therapie betraegt die Letalitaet ueber 70% [ 2 ] . Wir berichten ueber einen 66jaehrigen Patienten , bei dem nach Ausschaltung eines rechtsseitig gedeckt rupturierten Iliakalaneurysmas durch eine Y-Prothese aufgrund eines beidseitigen Verschlusses der Aa . iliacae internae eine bilaterale Glutealnekrose auftrat , der aber dennoch diese meist letale Komplikation ueberlebte .
[ "Die", "chronische", "Minderperfusion", "im", "aortoiliakalen", "Stromgebiet", "fuehrt", "zu", "einem", "Symptomenkomplex", ",", "der", "als", "Leriche", "-", "Syndrom", "bekannt", "ist", ".", "Im", "Gegensatz", "dazu", "drohen", "bei", "akuter", "Ischaemie", "nach", "Verschluss", "der", "Beckenarterien", "schwere", "Komplikationen", "mit", "teilweise", "letalem", "Ausgang", "[", "2", ",", "4", ",", "5", ",", "9", ",", "10", ",", "12", "13", "]", ".", ",", "Die", "akute", "Unterbrechung", "der", "aortoiliakalen", "Perfusion", "wird", "ueberwiegend", "nach", "Eingiffen", "an", "der", "Aorta", "und", "den", "Beckenarterien", ",", "oder", "auch", "nach", "selektiver", "kathetergesteuerter", "Embolisation", "der", "Iliakalarterien", "zur", "Beherrschung", "von", "Blutungen", "im", "Beckenbereich", "beobachtet", "[", "1", ",", "8", "]", ".", "Die", "verschiedenen", "Komplikationen", "verteilen", "sich", "auf", "Blasennekrosen", "[", "6", "]", ",", "linksseitige", "Kolonischaemien", "und", "Spinalarterienischaemien", "[", "10", "]", ",", "Nervenausfaelle", "sowie", "Nekrosen", "des", "Rektums", "und", "der", "Glutealmuskulatur", "[", "2", "11", "-", "13", "]", ".", ",", "Trotz", "adaequater", "Therapie", "betraegt", "die", "Letalitaet", "ueber", "70", "%", "[", "2", "]", ".", "Wir", "berichten", "ueber", "einen", "66jaehrigen", "Patienten", ",", "bei", "dem", "nach", "Ausschaltung", "eines", "rechtsseitig", "gedeckt", "rupturierten", "Iliakalaneurysmas", "durch", "eine", "Y", "-", "Prothese", "aufgrund", "eines", "beidseitigen", "Verschlusses", "der", "Aa", ".", "iliacae", "internae", "eine", "bilaterale", "Glutealnekrose", "auftrat", ",", "der", "aber", "dennoch", "diese", "meist", "letale", "Komplikation", "ueberlebte", "." ]
[ "umlsterm" ]
Minderperfusion is an umlsterm, Leriche - Syndrom is an umlsterm, Ischaemie is an umlsterm, Beckenarterien is an umlsterm, Komplikationen is an umlsterm, letalem Ausgang is an umlsterm, Perfusion is an umlsterm, Aorta is an umlsterm, Beckenarterien is an umlsterm, Blutungen is an umlsterm, Beckenbereich is an umlsterm, Komplikationen is an umlsterm, Blasennekrosen is an umlsterm, Kolonischaemien is an umlsterm, Spinalarterienischaemien is an umlsterm, Nekrosen is an umlsterm, Therapie is an umlsterm, Patienten is an umlsterm, Komplikation is an umlsterm
Gefaesschirurgie.70020065.ger.abstr_task1
Sentence: Die chronische Minderperfusion im aortoiliakalen Stromgebiet fuehrt zu einem Symptomenkomplex , der als Leriche-Syndrom bekannt ist . Im Gegensatz dazu drohen bei akuter Ischaemie nach Verschluss der Beckenarterien schwere Komplikationen mit teilweise letalem Ausgang [ 2 , 4 , 5 , 9 , 10 , 12 13 ] . , Die akute Unterbrechung der aortoiliakalen Perfusion wird ueberwiegend nach Eingiffen an der Aorta und den Beckenarterien , oder auch nach selektiver kathetergesteuerter Embolisation der Iliakalarterien zur Beherrschung von Blutungen im Beckenbereich beobachtet [ 1 , 8 ] . Die verschiedenen Komplikationen verteilen sich auf Blasennekrosen [ 6 ] , linksseitige Kolonischaemien und Spinalarterienischaemien [ 10 ] , Nervenausfaelle sowie Nekrosen des Rektums und der Glutealmuskulatur [ 2 11-13 ] . , Trotz adaequater Therapie betraegt die Letalitaet ueber 70% [ 2 ] . Wir berichten ueber einen 66jaehrigen Patienten , bei dem nach Ausschaltung eines rechtsseitig gedeckt rupturierten Iliakalaneurysmas durch eine Y-Prothese aufgrund eines beidseitigen Verschlusses der Aa . iliacae internae eine bilaterale Glutealnekrose auftrat , der aber dennoch diese meist letale Komplikation ueberlebte . Instructions: please typing these entity words according to sentence: Minderperfusion, Leriche - Syndrom, Ischaemie, Beckenarterien, Komplikationen, letalem Ausgang, Perfusion, Aorta, Beckenarterien, Blutungen, Beckenbereich, Komplikationen, Blasennekrosen, Kolonischaemien, Spinalarterienischaemien, Nekrosen, Therapie, Patienten, Komplikation Options: umlsterm
[ "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O" ]
Die chronische Minderperfusion im aortoiliakalen Stromgebiet fuehrt zu einem Symptomenkomplex , der als Leriche-Syndrom bekannt ist . Im Gegensatz dazu drohen bei akuter Ischaemie nach Verschluss der Beckenarterien schwere Komplikationen mit teilweise letalem Ausgang [ 2 , 4 , 5 , 9 , 10 , 12 13 ] . , Die akute Unterbrechung der aortoiliakalen Perfusion wird ueberwiegend nach Eingiffen an der Aorta und den Beckenarterien , oder auch nach selektiver kathetergesteuerter Embolisation der Iliakalarterien zur Beherrschung von Blutungen im Beckenbereich beobachtet [ 1 , 8 ] . Die verschiedenen Komplikationen verteilen sich auf Blasennekrosen [ 6 ] , linksseitige Kolonischaemien und Spinalarterienischaemien [ 10 ] , Nervenausfaelle sowie Nekrosen des Rektums und der Glutealmuskulatur [ 2 11-13 ] . , Trotz adaequater Therapie betraegt die Letalitaet ueber 70% [ 2 ] . Wir berichten ueber einen 66jaehrigen Patienten , bei dem nach Ausschaltung eines rechtsseitig gedeckt rupturierten Iliakalaneurysmas durch eine Y-Prothese aufgrund eines beidseitigen Verschlusses der Aa . iliacae internae eine bilaterale Glutealnekrose auftrat , der aber dennoch diese meist letale Komplikation ueberlebte .
[ "Die", "chronische", "Minderperfusion", "im", "aortoiliakalen", "Stromgebiet", "fuehrt", "zu", "einem", "Symptomenkomplex", ",", "der", "als", "Leriche", "-", "Syndrom", "bekannt", "ist", ".", "Im", "Gegensatz", "dazu", "drohen", "bei", "akuter", "Ischaemie", "nach", "Verschluss", "der", "Beckenarterien", "schwere", "Komplikationen", "mit", "teilweise", "letalem", "Ausgang", "[", "2", ",", "4", ",", "5", ",", "9", ",", "10", ",", "12", "13", "]", ".", ",", "Die", "akute", "Unterbrechung", "der", "aortoiliakalen", "Perfusion", "wird", "ueberwiegend", "nach", "Eingiffen", "an", "der", "Aorta", "und", "den", "Beckenarterien", ",", "oder", "auch", "nach", "selektiver", "kathetergesteuerter", "Embolisation", "der", "Iliakalarterien", "zur", "Beherrschung", "von", "Blutungen", "im", "Beckenbereich", "beobachtet", "[", "1", ",", "8", "]", ".", "Die", "verschiedenen", "Komplikationen", "verteilen", "sich", "auf", "Blasennekrosen", "[", "6", "]", ",", "linksseitige", "Kolonischaemien", "und", "Spinalarterienischaemien", "[", "10", "]", ",", "Nervenausfaelle", "sowie", "Nekrosen", "des", "Rektums", "und", "der", "Glutealmuskulatur", "[", "2", "11", "-", "13", "]", ".", ",", "Trotz", "adaequater", "Therapie", "betraegt", "die", "Letalitaet", "ueber", "70", "%", "[", "2", "]", ".", "Wir", "berichten", "ueber", "einen", "66jaehrigen", "Patienten", ",", "bei", "dem", "nach", "Ausschaltung", "eines", "rechtsseitig", "gedeckt", "rupturierten", "Iliakalaneurysmas", "durch", "eine", "Y", "-", "Prothese", "aufgrund", "eines", "beidseitigen", "Verschlusses", "der", "Aa", ".", "iliacae", "internae", "eine", "bilaterale", "Glutealnekrose", "auftrat", ",", "der", "aber", "dennoch", "diese", "meist", "letale", "Komplikation", "ueberlebte", "." ]
[ "umlsterm" ]
Minderperfusion, Leriche - Syndrom, Ischaemie, Beckenarterien, Komplikationen, letalem Ausgang, Perfusion, Aorta, Beckenarterien, Blutungen, Beckenbereich, Komplikationen, Blasennekrosen, Kolonischaemien, Spinalarterienischaemien, Nekrosen, Therapie, Patienten, Komplikation
Gefaesschirurgie.70020065.ger.abstr_task2
Sentence: Die chronische Minderperfusion im aortoiliakalen Stromgebiet fuehrt zu einem Symptomenkomplex , der als Leriche-Syndrom bekannt ist . Im Gegensatz dazu drohen bei akuter Ischaemie nach Verschluss der Beckenarterien schwere Komplikationen mit teilweise letalem Ausgang [ 2 , 4 , 5 , 9 , 10 , 12 13 ] . , Die akute Unterbrechung der aortoiliakalen Perfusion wird ueberwiegend nach Eingiffen an der Aorta und den Beckenarterien , oder auch nach selektiver kathetergesteuerter Embolisation der Iliakalarterien zur Beherrschung von Blutungen im Beckenbereich beobachtet [ 1 , 8 ] . Die verschiedenen Komplikationen verteilen sich auf Blasennekrosen [ 6 ] , linksseitige Kolonischaemien und Spinalarterienischaemien [ 10 ] , Nervenausfaelle sowie Nekrosen des Rektums und der Glutealmuskulatur [ 2 11-13 ] . , Trotz adaequater Therapie betraegt die Letalitaet ueber 70% [ 2 ] . Wir berichten ueber einen 66jaehrigen Patienten , bei dem nach Ausschaltung eines rechtsseitig gedeckt rupturierten Iliakalaneurysmas durch eine Y-Prothese aufgrund eines beidseitigen Verschlusses der Aa . iliacae internae eine bilaterale Glutealnekrose auftrat , der aber dennoch diese meist letale Komplikation ueberlebte . Instructions: please extract entity words from the input sentence
[ "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O" ]
Die chronische Minderperfusion im aortoiliakalen Stromgebiet fuehrt zu einem Symptomenkomplex , der als Leriche-Syndrom bekannt ist . Im Gegensatz dazu drohen bei akuter Ischaemie nach Verschluss der Beckenarterien schwere Komplikationen mit teilweise letalem Ausgang [ 2 , 4 , 5 , 9 , 10 , 12 13 ] . , Die akute Unterbrechung der aortoiliakalen Perfusion wird ueberwiegend nach Eingiffen an der Aorta und den Beckenarterien , oder auch nach selektiver kathetergesteuerter Embolisation der Iliakalarterien zur Beherrschung von Blutungen im Beckenbereich beobachtet [ 1 , 8 ] . Die verschiedenen Komplikationen verteilen sich auf Blasennekrosen [ 6 ] , linksseitige Kolonischaemien und Spinalarterienischaemien [ 10 ] , Nervenausfaelle sowie Nekrosen des Rektums und der Glutealmuskulatur [ 2 11-13 ] . , Trotz adaequater Therapie betraegt die Letalitaet ueber 70% [ 2 ] . Wir berichten ueber einen 66jaehrigen Patienten , bei dem nach Ausschaltung eines rechtsseitig gedeckt rupturierten Iliakalaneurysmas durch eine Y-Prothese aufgrund eines beidseitigen Verschlusses der Aa . iliacae internae eine bilaterale Glutealnekrose auftrat , der aber dennoch diese meist letale Komplikation ueberlebte .
[ "Die", "chronische", "Minderperfusion", "im", "aortoiliakalen", "Stromgebiet", "fuehrt", "zu", "einem", "Symptomenkomplex", ",", "der", "als", "Leriche", "-", "Syndrom", "bekannt", "ist", ".", "Im", "Gegensatz", "dazu", "drohen", "bei", "akuter", "Ischaemie", "nach", "Verschluss", "der", "Beckenarterien", "schwere", "Komplikationen", "mit", "teilweise", "letalem", "Ausgang", "[", "2", ",", "4", ",", "5", ",", "9", ",", "10", ",", "12", "13", "]", ".", ",", "Die", "akute", "Unterbrechung", "der", "aortoiliakalen", "Perfusion", "wird", "ueberwiegend", "nach", "Eingiffen", "an", "der", "Aorta", "und", "den", "Beckenarterien", ",", "oder", "auch", "nach", "selektiver", "kathetergesteuerter", "Embolisation", "der", "Iliakalarterien", "zur", "Beherrschung", "von", "Blutungen", "im", "Beckenbereich", "beobachtet", "[", "1", ",", "8", "]", ".", "Die", "verschiedenen", "Komplikationen", "verteilen", "sich", "auf", "Blasennekrosen", "[", "6", "]", ",", "linksseitige", "Kolonischaemien", "und", "Spinalarterienischaemien", "[", "10", "]", ",", "Nervenausfaelle", "sowie", "Nekrosen", "des", "Rektums", "und", "der", "Glutealmuskulatur", "[", "2", "11", "-", "13", "]", ".", ",", "Trotz", "adaequater", "Therapie", "betraegt", "die", "Letalitaet", "ueber", "70", "%", "[", "2", "]", ".", "Wir", "berichten", "ueber", "einen", "66jaehrigen", "Patienten", ",", "bei", "dem", "nach", "Ausschaltung", "eines", "rechtsseitig", "gedeckt", "rupturierten", "Iliakalaneurysmas", "durch", "eine", "Y", "-", "Prothese", "aufgrund", "eines", "beidseitigen", "Verschlusses", "der", "Aa", ".", "iliacae", "internae", "eine", "bilaterale", "Glutealnekrose", "auftrat", ",", "der", "aber", "dennoch", "diese", "meist", "letale", "Komplikation", "ueberlebte", "." ]
[ "umlsterm" ]
Haut is an umlsterm, Schleimhaut is an umlsterm, Haut- is an umlsterm, Geschlechtskrankheiten is an umlsterm, Haut is an umlsterm
DerHautarzt.40450207.ger.abstr_task0
Sentence: Zusammenfassung . Ausgehend von einer infektiologisch begruendeten neuartigen Begriffsbestimmung der Antiseptik , die die lokale Anwendung von Antiinfektiva aus prophylaktischer , praeventiver oder therapeutischer Indikation auf Haut , Schleimhaut , Wunden , in Koerperhoehlen oder auf chirurgisch freigelegten bzw. eroeffneten endosomatischen Arealen umfasst , werden die antiseptischen Indikationen im Fachgebiet der Haut- und Geschlechtskrankheiten dargestellt . In Auswertung des aktuellen Wissensstandes werden In-vitro- und In-vivo-Anforderungen an lokale Antiinfektiva mit Empfehlungen zur klinischen Anwendung definiert . Die derzeit vorwiegend prophylaktisch angewendeten Wirkstoffe werden einer vergleichenden Nutzen-Risiko-Analyse mit Hinweisen zur Wirkstoffauswahl unterzogen . Dabei werden sowohl Wirkstoffe zur Anwendung auf der Haut als auch im Genitalbereich , in der Mundhoehle und auf Wunden beruecksichtigt . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Zusammenfassung . Ausgehend von einer infektiologisch begruendeten neuartigen Begriffsbestimmung der Antiseptik , die die lokale Anwendung von Antiinfektiva aus prophylaktischer , praeventiver oder therapeutischer Indikation auf Haut , Schleimhaut , Wunden , in Koerperhoehlen oder auf chirurgisch freigelegten bzw. eroeffneten endosomatischen Arealen umfasst , werden die antiseptischen Indikationen im Fachgebiet der Haut- und Geschlechtskrankheiten dargestellt . In Auswertung des aktuellen Wissensstandes werden In-vitro- und In-vivo-Anforderungen an lokale Antiinfektiva mit Empfehlungen zur klinischen Anwendung definiert . Die derzeit vorwiegend prophylaktisch angewendeten Wirkstoffe werden einer vergleichenden Nutzen-Risiko-Analyse mit Hinweisen zur Wirkstoffauswahl unterzogen . Dabei werden sowohl Wirkstoffe zur Anwendung auf der Haut als auch im Genitalbereich , in der Mundhoehle und auf Wunden beruecksichtigt .
[ "Zusammenfassung", ".", "Ausgehend", "von", "einer", "infektiologisch", "begruendeten", "neuartigen", "Begriffsbestimmung", "der", "Antiseptik", ",", "die", "die", "lokale", "Anwendung", "von", "Antiinfektiva", "aus", "prophylaktischer", ",", "praeventiver", "oder", "therapeutischer", "Indikation", "auf", "Haut", ",", "Schleimhaut", ",", "Wunden", ",", "in", "Koerperhoehlen", "oder", "auf", "chirurgisch", "freigelegten", "bzw", ".", "eroeffneten", "endosomatischen", "Arealen", "umfasst", ",", "werden", "die", "antiseptischen", "Indikationen", "im", "Fachgebiet", "der", "Haut-", "und", "Geschlechtskrankheiten", "dargestellt", ".", "In", "Auswertung", "des", "aktuellen", "Wissensstandes", "werden", "In", "-", "vitro-", "und", "In", "-", "vivo", "-", "Anforderungen", "an", "lokale", "Antiinfektiva", "mit", "Empfehlungen", "zur", "klinischen", "Anwendung", "definiert", ".", "Die", "derzeit", "vorwiegend", "prophylaktisch", "angewendeten", "Wirkstoffe", "werden", "einer", "vergleichenden", "Nutzen", "-", "Risiko", "-", "Analyse", "mit", "Hinweisen", "zur", "Wirkstoffauswahl", "unterzogen", ".", "Dabei", "werden", "sowohl", "Wirkstoffe", "zur", "Anwendung", "auf", "der", "Haut", "als", "auch", "im", "Genitalbereich", ",", "in", "der", "Mundhoehle", "und", "auf", "Wunden", "beruecksichtigt", "." ]
[ "umlsterm" ]
Haut is an umlsterm, Schleimhaut is an umlsterm, Haut- is an umlsterm, Geschlechtskrankheiten is an umlsterm, Haut is an umlsterm
DerHautarzt.40450207.ger.abstr_task1
Sentence: Zusammenfassung . Ausgehend von einer infektiologisch begruendeten neuartigen Begriffsbestimmung der Antiseptik , die die lokale Anwendung von Antiinfektiva aus prophylaktischer , praeventiver oder therapeutischer Indikation auf Haut , Schleimhaut , Wunden , in Koerperhoehlen oder auf chirurgisch freigelegten bzw. eroeffneten endosomatischen Arealen umfasst , werden die antiseptischen Indikationen im Fachgebiet der Haut- und Geschlechtskrankheiten dargestellt . In Auswertung des aktuellen Wissensstandes werden In-vitro- und In-vivo-Anforderungen an lokale Antiinfektiva mit Empfehlungen zur klinischen Anwendung definiert . Die derzeit vorwiegend prophylaktisch angewendeten Wirkstoffe werden einer vergleichenden Nutzen-Risiko-Analyse mit Hinweisen zur Wirkstoffauswahl unterzogen . Dabei werden sowohl Wirkstoffe zur Anwendung auf der Haut als auch im Genitalbereich , in der Mundhoehle und auf Wunden beruecksichtigt . Instructions: please typing these entity words according to sentence: Haut, Schleimhaut, Haut-, Geschlechtskrankheiten, Haut Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Zusammenfassung . Ausgehend von einer infektiologisch begruendeten neuartigen Begriffsbestimmung der Antiseptik , die die lokale Anwendung von Antiinfektiva aus prophylaktischer , praeventiver oder therapeutischer Indikation auf Haut , Schleimhaut , Wunden , in Koerperhoehlen oder auf chirurgisch freigelegten bzw. eroeffneten endosomatischen Arealen umfasst , werden die antiseptischen Indikationen im Fachgebiet der Haut- und Geschlechtskrankheiten dargestellt . In Auswertung des aktuellen Wissensstandes werden In-vitro- und In-vivo-Anforderungen an lokale Antiinfektiva mit Empfehlungen zur klinischen Anwendung definiert . Die derzeit vorwiegend prophylaktisch angewendeten Wirkstoffe werden einer vergleichenden Nutzen-Risiko-Analyse mit Hinweisen zur Wirkstoffauswahl unterzogen . Dabei werden sowohl Wirkstoffe zur Anwendung auf der Haut als auch im Genitalbereich , in der Mundhoehle und auf Wunden beruecksichtigt .
[ "Zusammenfassung", ".", "Ausgehend", "von", "einer", "infektiologisch", "begruendeten", "neuartigen", "Begriffsbestimmung", "der", "Antiseptik", ",", "die", "die", "lokale", "Anwendung", "von", "Antiinfektiva", "aus", "prophylaktischer", ",", "praeventiver", "oder", "therapeutischer", "Indikation", "auf", "Haut", ",", "Schleimhaut", ",", "Wunden", ",", "in", "Koerperhoehlen", "oder", "auf", "chirurgisch", "freigelegten", "bzw", ".", "eroeffneten", "endosomatischen", "Arealen", "umfasst", ",", "werden", "die", "antiseptischen", "Indikationen", "im", "Fachgebiet", "der", "Haut-", "und", "Geschlechtskrankheiten", "dargestellt", ".", "In", "Auswertung", "des", "aktuellen", "Wissensstandes", "werden", "In", "-", "vitro-", "und", "In", "-", "vivo", "-", "Anforderungen", "an", "lokale", "Antiinfektiva", "mit", "Empfehlungen", "zur", "klinischen", "Anwendung", "definiert", ".", "Die", "derzeit", "vorwiegend", "prophylaktisch", "angewendeten", "Wirkstoffe", "werden", "einer", "vergleichenden", "Nutzen", "-", "Risiko", "-", "Analyse", "mit", "Hinweisen", "zur", "Wirkstoffauswahl", "unterzogen", ".", "Dabei", "werden", "sowohl", "Wirkstoffe", "zur", "Anwendung", "auf", "der", "Haut", "als", "auch", "im", "Genitalbereich", ",", "in", "der", "Mundhoehle", "und", "auf", "Wunden", "beruecksichtigt", "." ]
[ "umlsterm" ]
Haut, Schleimhaut, Haut-, Geschlechtskrankheiten, Haut
DerHautarzt.40450207.ger.abstr_task2
Sentence: Zusammenfassung . Ausgehend von einer infektiologisch begruendeten neuartigen Begriffsbestimmung der Antiseptik , die die lokale Anwendung von Antiinfektiva aus prophylaktischer , praeventiver oder therapeutischer Indikation auf Haut , Schleimhaut , Wunden , in Koerperhoehlen oder auf chirurgisch freigelegten bzw. eroeffneten endosomatischen Arealen umfasst , werden die antiseptischen Indikationen im Fachgebiet der Haut- und Geschlechtskrankheiten dargestellt . In Auswertung des aktuellen Wissensstandes werden In-vitro- und In-vivo-Anforderungen an lokale Antiinfektiva mit Empfehlungen zur klinischen Anwendung definiert . Die derzeit vorwiegend prophylaktisch angewendeten Wirkstoffe werden einer vergleichenden Nutzen-Risiko-Analyse mit Hinweisen zur Wirkstoffauswahl unterzogen . Dabei werden sowohl Wirkstoffe zur Anwendung auf der Haut als auch im Genitalbereich , in der Mundhoehle und auf Wunden beruecksichtigt . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Zusammenfassung . Ausgehend von einer infektiologisch begruendeten neuartigen Begriffsbestimmung der Antiseptik , die die lokale Anwendung von Antiinfektiva aus prophylaktischer , praeventiver oder therapeutischer Indikation auf Haut , Schleimhaut , Wunden , in Koerperhoehlen oder auf chirurgisch freigelegten bzw. eroeffneten endosomatischen Arealen umfasst , werden die antiseptischen Indikationen im Fachgebiet der Haut- und Geschlechtskrankheiten dargestellt . In Auswertung des aktuellen Wissensstandes werden In-vitro- und In-vivo-Anforderungen an lokale Antiinfektiva mit Empfehlungen zur klinischen Anwendung definiert . Die derzeit vorwiegend prophylaktisch angewendeten Wirkstoffe werden einer vergleichenden Nutzen-Risiko-Analyse mit Hinweisen zur Wirkstoffauswahl unterzogen . Dabei werden sowohl Wirkstoffe zur Anwendung auf der Haut als auch im Genitalbereich , in der Mundhoehle und auf Wunden beruecksichtigt .
[ "Zusammenfassung", ".", "Ausgehend", "von", "einer", "infektiologisch", "begruendeten", "neuartigen", "Begriffsbestimmung", "der", "Antiseptik", ",", "die", "die", "lokale", "Anwendung", "von", "Antiinfektiva", "aus", "prophylaktischer", ",", "praeventiver", "oder", "therapeutischer", "Indikation", "auf", "Haut", ",", "Schleimhaut", ",", "Wunden", ",", "in", "Koerperhoehlen", "oder", "auf", "chirurgisch", "freigelegten", "bzw", ".", "eroeffneten", "endosomatischen", "Arealen", "umfasst", ",", "werden", "die", "antiseptischen", "Indikationen", "im", "Fachgebiet", "der", "Haut-", "und", "Geschlechtskrankheiten", "dargestellt", ".", "In", "Auswertung", "des", "aktuellen", "Wissensstandes", "werden", "In", "-", "vitro-", "und", "In", "-", "vivo", "-", "Anforderungen", "an", "lokale", "Antiinfektiva", "mit", "Empfehlungen", "zur", "klinischen", "Anwendung", "definiert", ".", "Die", "derzeit", "vorwiegend", "prophylaktisch", "angewendeten", "Wirkstoffe", "werden", "einer", "vergleichenden", "Nutzen", "-", "Risiko", "-", "Analyse", "mit", "Hinweisen", "zur", "Wirkstoffauswahl", "unterzogen", ".", "Dabei", "werden", "sowohl", "Wirkstoffe", "zur", "Anwendung", "auf", "der", "Haut", "als", "auch", "im", "Genitalbereich", ",", "in", "der", "Mundhoehle", "und", "auf", "Wunden", "beruecksichtigt", "." ]
[ "umlsterm" ]
Tumoren is an umlsterm, Klassifikation is an umlsterm, Prognose is an umlsterm, Therapie is an umlsterm, Faerbungen is an umlsterm, Therapieprotokollen is an umlsterm, gefaerbten is an umlsterm, Prognose is an umlsterm
DerPathologe.90200087.ger.abstr_task0
Sentence: Rhabdomyosarkome stellen eine heterogene Gruppe von ganz verschiedenartigen , histogenetisch wohl nicht zusammengehoerenden Tumoren dar . Nach der heute verwendeten " Internationalen Klassifikation " der Rhabdomyosarkome werden neben der Unterteilung in embryonalen und alveolaere Rhabdomyossarkome auch Subtypen des embryonalen RMS identifiziert botryoider und leiomyomatoeser Subtyp ) , ( die durch eine guenstigere Prognose und durch die Notwendigkeit einer weniger aggressive Therapie gekennzeichnet sind . Durch Einsatz von verschiedenen histologischen und immunhistochemischen Faerbungen ist die Identifizierung der verschiedenen Typen der RMS heute moeglich und auch zwingend notwendig , da die einzelnen Entitaeten nach ganz unterschiedlichen Therapieprotokollen behandelt werden . Der Nachweis typischer molekulargenetischer Veraenderungen kann in der Unterscheidung insbesondere von embryonalen und alveolaeren RMS hilfreich sein . In der Regel ist die Abgrenzung zwischen diesen beiden Entitaeten auch an konventionell gefaerbten Schnittpraeparaten moeglich . Die Identifizierung von alveolaeren RMS mit einer t ( 1 ; 13 -Translokation ) koennte in Zukunft eine grosse Bedeutung haben , da diese genetische Veraenderung moeglicherweise mit einer guenstigeren Prognose assoziert sein koennte als die t ( 2 ; 13 -Translokation . ) Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Rhabdomyosarkome stellen eine heterogene Gruppe von ganz verschiedenartigen , histogenetisch wohl nicht zusammengehoerenden Tumoren dar . Nach der heute verwendeten " Internationalen Klassifikation " der Rhabdomyosarkome werden neben der Unterteilung in embryonalen und alveolaere Rhabdomyossarkome auch Subtypen des embryonalen RMS identifiziert botryoider und leiomyomatoeser Subtyp ) , ( die durch eine guenstigere Prognose und durch die Notwendigkeit einer weniger aggressive Therapie gekennzeichnet sind . Durch Einsatz von verschiedenen histologischen und immunhistochemischen Faerbungen ist die Identifizierung der verschiedenen Typen der RMS heute moeglich und auch zwingend notwendig , da die einzelnen Entitaeten nach ganz unterschiedlichen Therapieprotokollen behandelt werden . Der Nachweis typischer molekulargenetischer Veraenderungen kann in der Unterscheidung insbesondere von embryonalen und alveolaeren RMS hilfreich sein . In der Regel ist die Abgrenzung zwischen diesen beiden Entitaeten auch an konventionell gefaerbten Schnittpraeparaten moeglich . Die Identifizierung von alveolaeren RMS mit einer t ( 1 ; 13 -Translokation ) koennte in Zukunft eine grosse Bedeutung haben , da diese genetische Veraenderung moeglicherweise mit einer guenstigeren Prognose assoziert sein koennte als die t ( 2 ; 13 -Translokation . )
[ "Rhabdomyosarkome", "stellen", "eine", "heterogene", "Gruppe", "von", "ganz", "verschiedenartigen", ",", "histogenetisch", "wohl", "nicht", "zusammengehoerenden", "Tumoren", "dar", ".", "Nach", "der", "heute", "verwendeten", "\"", "Internationalen", "Klassifikation", "\"", "der", "Rhabdomyosarkome", "werden", "neben", "der", "Unterteilung", "in", "embryonalen", "und", "alveolaere", "Rhabdomyossarkome", "auch", "Subtypen", "des", "embryonalen", "RMS", "identifiziert", "botryoider", "und", "leiomyomatoeser", "Subtyp", ")", ",", "(", "die", "durch", "eine", "guenstigere", "Prognose", "und", "durch", "die", "Notwendigkeit", "einer", "weniger", "aggressive", "Therapie", "gekennzeichnet", "sind", ".", "Durch", "Einsatz", "von", "verschiedenen", "histologischen", "und", "immunhistochemischen", "Faerbungen", "ist", "die", "Identifizierung", "der", "verschiedenen", "Typen", "der", "RMS", "heute", "moeglich", "und", "auch", "zwingend", "notwendig", ",", "da", "die", "einzelnen", "Entitaeten", "nach", "ganz", "unterschiedlichen", "Therapieprotokollen", "behandelt", "werden", ".", "Der", "Nachweis", "typischer", "molekulargenetischer", "Veraenderungen", "kann", "in", "der", "Unterscheidung", "insbesondere", "von", "embryonalen", "und", "alveolaeren", "RMS", "hilfreich", "sein", ".", "In", "der", "Regel", "ist", "die", "Abgrenzung", "zwischen", "diesen", "beiden", "Entitaeten", "auch", "an", "konventionell", "gefaerbten", "Schnittpraeparaten", "moeglich", ".", "Die", "Identifizierung", "von", "alveolaeren", "RMS", "mit", "einer", "t", "(", "1", ";", "13", "-Translokation", ")", "koennte", "in", "Zukunft", "eine", "grosse", "Bedeutung", "haben", ",", "da", "diese", "genetische", "Veraenderung", "moeglicherweise", "mit", "einer", "guenstigeren", "Prognose", "assoziert", "sein", "koennte", "als", "die", "t", "(", "2", ";", "13", "-Translokation", ".", ")" ]
[ "umlsterm" ]
Tumoren is an umlsterm, Klassifikation is an umlsterm, Prognose is an umlsterm, Therapie is an umlsterm, Faerbungen is an umlsterm, Therapieprotokollen is an umlsterm, gefaerbten is an umlsterm, Prognose is an umlsterm
DerPathologe.90200087.ger.abstr_task1
Sentence: Rhabdomyosarkome stellen eine heterogene Gruppe von ganz verschiedenartigen , histogenetisch wohl nicht zusammengehoerenden Tumoren dar . Nach der heute verwendeten " Internationalen Klassifikation " der Rhabdomyosarkome werden neben der Unterteilung in embryonalen und alveolaere Rhabdomyossarkome auch Subtypen des embryonalen RMS identifiziert botryoider und leiomyomatoeser Subtyp ) , ( die durch eine guenstigere Prognose und durch die Notwendigkeit einer weniger aggressive Therapie gekennzeichnet sind . Durch Einsatz von verschiedenen histologischen und immunhistochemischen Faerbungen ist die Identifizierung der verschiedenen Typen der RMS heute moeglich und auch zwingend notwendig , da die einzelnen Entitaeten nach ganz unterschiedlichen Therapieprotokollen behandelt werden . Der Nachweis typischer molekulargenetischer Veraenderungen kann in der Unterscheidung insbesondere von embryonalen und alveolaeren RMS hilfreich sein . In der Regel ist die Abgrenzung zwischen diesen beiden Entitaeten auch an konventionell gefaerbten Schnittpraeparaten moeglich . Die Identifizierung von alveolaeren RMS mit einer t ( 1 ; 13 -Translokation ) koennte in Zukunft eine grosse Bedeutung haben , da diese genetische Veraenderung moeglicherweise mit einer guenstigeren Prognose assoziert sein koennte als die t ( 2 ; 13 -Translokation . ) Instructions: please typing these entity words according to sentence: Tumoren, Klassifikation, Prognose, Therapie, Faerbungen, Therapieprotokollen, gefaerbten, Prognose Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Rhabdomyosarkome stellen eine heterogene Gruppe von ganz verschiedenartigen , histogenetisch wohl nicht zusammengehoerenden Tumoren dar . Nach der heute verwendeten " Internationalen Klassifikation " der Rhabdomyosarkome werden neben der Unterteilung in embryonalen und alveolaere Rhabdomyossarkome auch Subtypen des embryonalen RMS identifiziert botryoider und leiomyomatoeser Subtyp ) , ( die durch eine guenstigere Prognose und durch die Notwendigkeit einer weniger aggressive Therapie gekennzeichnet sind . Durch Einsatz von verschiedenen histologischen und immunhistochemischen Faerbungen ist die Identifizierung der verschiedenen Typen der RMS heute moeglich und auch zwingend notwendig , da die einzelnen Entitaeten nach ganz unterschiedlichen Therapieprotokollen behandelt werden . Der Nachweis typischer molekulargenetischer Veraenderungen kann in der Unterscheidung insbesondere von embryonalen und alveolaeren RMS hilfreich sein . In der Regel ist die Abgrenzung zwischen diesen beiden Entitaeten auch an konventionell gefaerbten Schnittpraeparaten moeglich . Die Identifizierung von alveolaeren RMS mit einer t ( 1 ; 13 -Translokation ) koennte in Zukunft eine grosse Bedeutung haben , da diese genetische Veraenderung moeglicherweise mit einer guenstigeren Prognose assoziert sein koennte als die t ( 2 ; 13 -Translokation . )
[ "Rhabdomyosarkome", "stellen", "eine", "heterogene", "Gruppe", "von", "ganz", "verschiedenartigen", ",", "histogenetisch", "wohl", "nicht", "zusammengehoerenden", "Tumoren", "dar", ".", "Nach", "der", "heute", "verwendeten", "\"", "Internationalen", "Klassifikation", "\"", "der", "Rhabdomyosarkome", "werden", "neben", "der", "Unterteilung", "in", "embryonalen", "und", "alveolaere", "Rhabdomyossarkome", "auch", "Subtypen", "des", "embryonalen", "RMS", "identifiziert", "botryoider", "und", "leiomyomatoeser", "Subtyp", ")", ",", "(", "die", "durch", "eine", "guenstigere", "Prognose", "und", "durch", "die", "Notwendigkeit", "einer", "weniger", "aggressive", "Therapie", "gekennzeichnet", "sind", ".", "Durch", "Einsatz", "von", "verschiedenen", "histologischen", "und", "immunhistochemischen", "Faerbungen", "ist", "die", "Identifizierung", "der", "verschiedenen", "Typen", "der", "RMS", "heute", "moeglich", "und", "auch", "zwingend", "notwendig", ",", "da", "die", "einzelnen", "Entitaeten", "nach", "ganz", "unterschiedlichen", "Therapieprotokollen", "behandelt", "werden", ".", "Der", "Nachweis", "typischer", "molekulargenetischer", "Veraenderungen", "kann", "in", "der", "Unterscheidung", "insbesondere", "von", "embryonalen", "und", "alveolaeren", "RMS", "hilfreich", "sein", ".", "In", "der", "Regel", "ist", "die", "Abgrenzung", "zwischen", "diesen", "beiden", "Entitaeten", "auch", "an", "konventionell", "gefaerbten", "Schnittpraeparaten", "moeglich", ".", "Die", "Identifizierung", "von", "alveolaeren", "RMS", "mit", "einer", "t", "(", "1", ";", "13", "-Translokation", ")", "koennte", "in", "Zukunft", "eine", "grosse", "Bedeutung", "haben", ",", "da", "diese", "genetische", "Veraenderung", "moeglicherweise", "mit", "einer", "guenstigeren", "Prognose", "assoziert", "sein", "koennte", "als", "die", "t", "(", "2", ";", "13", "-Translokation", ".", ")" ]
[ "umlsterm" ]
Tumoren, Klassifikation, Prognose, Therapie, Faerbungen, Therapieprotokollen, gefaerbten, Prognose
DerPathologe.90200087.ger.abstr_task2
Sentence: Rhabdomyosarkome stellen eine heterogene Gruppe von ganz verschiedenartigen , histogenetisch wohl nicht zusammengehoerenden Tumoren dar . Nach der heute verwendeten " Internationalen Klassifikation " der Rhabdomyosarkome werden neben der Unterteilung in embryonalen und alveolaere Rhabdomyossarkome auch Subtypen des embryonalen RMS identifiziert botryoider und leiomyomatoeser Subtyp ) , ( die durch eine guenstigere Prognose und durch die Notwendigkeit einer weniger aggressive Therapie gekennzeichnet sind . Durch Einsatz von verschiedenen histologischen und immunhistochemischen Faerbungen ist die Identifizierung der verschiedenen Typen der RMS heute moeglich und auch zwingend notwendig , da die einzelnen Entitaeten nach ganz unterschiedlichen Therapieprotokollen behandelt werden . Der Nachweis typischer molekulargenetischer Veraenderungen kann in der Unterscheidung insbesondere von embryonalen und alveolaeren RMS hilfreich sein . In der Regel ist die Abgrenzung zwischen diesen beiden Entitaeten auch an konventionell gefaerbten Schnittpraeparaten moeglich . Die Identifizierung von alveolaeren RMS mit einer t ( 1 ; 13 -Translokation ) koennte in Zukunft eine grosse Bedeutung haben , da diese genetische Veraenderung moeglicherweise mit einer guenstigeren Prognose assoziert sein koennte als die t ( 2 ; 13 -Translokation . ) Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Rhabdomyosarkome stellen eine heterogene Gruppe von ganz verschiedenartigen , histogenetisch wohl nicht zusammengehoerenden Tumoren dar . Nach der heute verwendeten " Internationalen Klassifikation " der Rhabdomyosarkome werden neben der Unterteilung in embryonalen und alveolaere Rhabdomyossarkome auch Subtypen des embryonalen RMS identifiziert botryoider und leiomyomatoeser Subtyp ) , ( die durch eine guenstigere Prognose und durch die Notwendigkeit einer weniger aggressive Therapie gekennzeichnet sind . Durch Einsatz von verschiedenen histologischen und immunhistochemischen Faerbungen ist die Identifizierung der verschiedenen Typen der RMS heute moeglich und auch zwingend notwendig , da die einzelnen Entitaeten nach ganz unterschiedlichen Therapieprotokollen behandelt werden . Der Nachweis typischer molekulargenetischer Veraenderungen kann in der Unterscheidung insbesondere von embryonalen und alveolaeren RMS hilfreich sein . In der Regel ist die Abgrenzung zwischen diesen beiden Entitaeten auch an konventionell gefaerbten Schnittpraeparaten moeglich . Die Identifizierung von alveolaeren RMS mit einer t ( 1 ; 13 -Translokation ) koennte in Zukunft eine grosse Bedeutung haben , da diese genetische Veraenderung moeglicherweise mit einer guenstigeren Prognose assoziert sein koennte als die t ( 2 ; 13 -Translokation . )
[ "Rhabdomyosarkome", "stellen", "eine", "heterogene", "Gruppe", "von", "ganz", "verschiedenartigen", ",", "histogenetisch", "wohl", "nicht", "zusammengehoerenden", "Tumoren", "dar", ".", "Nach", "der", "heute", "verwendeten", "\"", "Internationalen", "Klassifikation", "\"", "der", "Rhabdomyosarkome", "werden", "neben", "der", "Unterteilung", "in", "embryonalen", "und", "alveolaere", "Rhabdomyossarkome", "auch", "Subtypen", "des", "embryonalen", "RMS", "identifiziert", "botryoider", "und", "leiomyomatoeser", "Subtyp", ")", ",", "(", "die", "durch", "eine", "guenstigere", "Prognose", "und", "durch", "die", "Notwendigkeit", "einer", "weniger", "aggressive", "Therapie", "gekennzeichnet", "sind", ".", "Durch", "Einsatz", "von", "verschiedenen", "histologischen", "und", "immunhistochemischen", "Faerbungen", "ist", "die", "Identifizierung", "der", "verschiedenen", "Typen", "der", "RMS", "heute", "moeglich", "und", "auch", "zwingend", "notwendig", ",", "da", "die", "einzelnen", "Entitaeten", "nach", "ganz", "unterschiedlichen", "Therapieprotokollen", "behandelt", "werden", ".", "Der", "Nachweis", "typischer", "molekulargenetischer", "Veraenderungen", "kann", "in", "der", "Unterscheidung", "insbesondere", "von", "embryonalen", "und", "alveolaeren", "RMS", "hilfreich", "sein", ".", "In", "der", "Regel", "ist", "die", "Abgrenzung", "zwischen", "diesen", "beiden", "Entitaeten", "auch", "an", "konventionell", "gefaerbten", "Schnittpraeparaten", "moeglich", ".", "Die", "Identifizierung", "von", "alveolaeren", "RMS", "mit", "einer", "t", "(", "1", ";", "13", "-Translokation", ")", "koennte", "in", "Zukunft", "eine", "grosse", "Bedeutung", "haben", ",", "da", "diese", "genetische", "Veraenderung", "moeglicherweise", "mit", "einer", "guenstigeren", "Prognose", "assoziert", "sein", "koennte", "als", "die", "t", "(", "2", ";", "13", "-Translokation", ".", ")" ]
[ "umlsterm" ]
Kidney , parathyroid , congenital bone metabolic is a Scope, disease is a Condition
NCT02156999_exc_task0
Sentence: Kidney, parathyroid, congenital bone metabolic disease Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Scope, Condition
[ "B-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "B-Condition", "O" ]
Kidney, parathyroid, congenital bone metabolic disease
[ "Kidney", ",", "parathyroid", ",", "congenital", "bone", "metabolic", "disease", "\n" ]
[ "Scope", "Qualifier", "Condition" ]
Kidney , parathyroid , congenital bone metabolic is a Scope, disease is a Condition
NCT02156999_exc_task1
Sentence: Kidney, parathyroid, congenital bone metabolic disease Instructions: please typing these entity words according to sentence: Kidney , parathyroid , congenital bone metabolic, disease Options: Scope, Condition
[ "B-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "B-Condition", "O" ]
Kidney, parathyroid, congenital bone metabolic disease
[ "Kidney", ",", "parathyroid", ",", "congenital", "bone", "metabolic", "disease", "\n" ]
[ "Scope", "Qualifier", "Condition" ]
Kidney , parathyroid , congenital bone metabolic, disease
NCT02156999_exc_task2
Sentence: Kidney, parathyroid, congenital bone metabolic disease Instructions: please extract entity words from the input sentence
[ "B-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "I-Scope", "B-Condition", "O" ]
Kidney, parathyroid, congenital bone metabolic disease
[ "Kidney", ",", "parathyroid", ",", "congenital", "bone", "metabolic", "disease", "\n" ]
[ "Scope", "Qualifier", "Condition" ]
Prostataresektion is an umlsterm, Methoden is an umlsterm, Alkohol is an umlsterm, Alkoholtestgeraets is an umlsterm, Patienten is an umlsterm, Nasensonde is an umlsterm, Alkohol is an umlsterm, Methode is an umlsterm, Alkohols is an umlsterm, Alkoholmessung is an umlsterm, Blutalkoholspiegel is an umlsterm, Alkohol is an umlsterm, Haematokrit is an umlsterm, Serumnatrium is an umlsterm, Blutgasanalyse is an umlsterm, Patienten is an umlsterm, Serum - Natrium is an umlsterm, Haematokrit is an umlsterm, Alkoholbestimmung is an umlsterm, Blutalkoholspiegel is an umlsterm, Alkoholkonzentration is an umlsterm
DerAnaesthesist.50440436.ger.abstr_task0
Sentence: Die Einschwemmung grosser Volumina von Spuelfluessigkeit stellt bei der transurethralen Prostataresektion das Hauptproblem dar . Bisher verwendete Methoden weisen die Einschwemmung unzureichend nach . Erstmals setzten Hulten et al. der Spuelfluessigkeit 2%igen Alkohol zu und wiesen diesen exspiratorisch diskontinuierlich mittels eines Alkoholtestgeraets nach . In dieser Studie entnahmen wir 17 Patienten unter Spinalanaesthesie ueber eine Nasensonde kontinuierlich Exspirationsluft aus dem oberen Nasen-Rachen-Raum , die wir mittels eines NormacTM-Anaesthesiegasmonitors ( Fa. Datex , Helsinki ) auf Alkohol untersuchten . Es sollte festgestellt werden , ob diese Methode mit klinisch ausreichender Genauigkeit eine Einschwemmung des Alkohols , der der Spuelfluessigkeit zugemischt wird , aufzeigen kann . Dazu wurden neben der kontinuierlichen exspiratorischen Alkoholmessung folgende Messwerte erhoben : Blutalkoholspiegel , endexspiratorischer Alkohol mittels Alcotest 7110 Haematokrit , Serumnatrium und Blutgasanalyse . , Bei 17 Patienten wurden 68 Messungen durchgefuehrt ( je ein Leerwert , in 10minuetigem Abstand ) . Erwartungsgemaess korrelierten das Serum-Natrium ( r2 = 0,68 ) und der Haematokrit ( r2 = 0,39 ) schlecht mit der durch Blutalkoholbestimmung ermittelten Einschwemmung . Die Ergebnisse der exspiratorischen Alkoholbestimmung mit dem Alcotest-Geraet ( r2 - 0,93 ) und die kontinuierliche Messung mit dem Normac ( r2 = 0,85 ) ergaben gute Uebereinstimmungen mit den Blutalkoholkontrollen . Im klinisch interessanten Bereich ab 0,3permil Blutalkoholspiegel ( entsprechend 500 bis 1000 ml Einschwemmvolumen ) erreicht das kontinuierliche Monitoring der exspiratorischen Alkoholkonzentration mit einem NormacTM eine ausreichende Genauigkeit und liefert fruezeitig einen zuverlaessigen Hinweis fuer eine Einschwemmung . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Die Einschwemmung grosser Volumina von Spuelfluessigkeit stellt bei der transurethralen Prostataresektion das Hauptproblem dar . Bisher verwendete Methoden weisen die Einschwemmung unzureichend nach . Erstmals setzten Hulten et al. der Spuelfluessigkeit 2%igen Alkohol zu und wiesen diesen exspiratorisch diskontinuierlich mittels eines Alkoholtestgeraets nach . In dieser Studie entnahmen wir 17 Patienten unter Spinalanaesthesie ueber eine Nasensonde kontinuierlich Exspirationsluft aus dem oberen Nasen-Rachen-Raum , die wir mittels eines NormacTM-Anaesthesiegasmonitors ( Fa. Datex , Helsinki ) auf Alkohol untersuchten . Es sollte festgestellt werden , ob diese Methode mit klinisch ausreichender Genauigkeit eine Einschwemmung des Alkohols , der der Spuelfluessigkeit zugemischt wird , aufzeigen kann . Dazu wurden neben der kontinuierlichen exspiratorischen Alkoholmessung folgende Messwerte erhoben : Blutalkoholspiegel , endexspiratorischer Alkohol mittels Alcotest 7110 Haematokrit , Serumnatrium und Blutgasanalyse . , Bei 17 Patienten wurden 68 Messungen durchgefuehrt ( je ein Leerwert , in 10minuetigem Abstand ) . Erwartungsgemaess korrelierten das Serum-Natrium ( r2 = 0,68 ) und der Haematokrit ( r2 = 0,39 ) schlecht mit der durch Blutalkoholbestimmung ermittelten Einschwemmung . Die Ergebnisse der exspiratorischen Alkoholbestimmung mit dem Alcotest-Geraet ( r2 - 0,93 ) und die kontinuierliche Messung mit dem Normac ( r2 = 0,85 ) ergaben gute Uebereinstimmungen mit den Blutalkoholkontrollen . Im klinisch interessanten Bereich ab 0,3permil Blutalkoholspiegel ( entsprechend 500 bis 1000 ml Einschwemmvolumen ) erreicht das kontinuierliche Monitoring der exspiratorischen Alkoholkonzentration mit einem NormacTM eine ausreichende Genauigkeit und liefert fruezeitig einen zuverlaessigen Hinweis fuer eine Einschwemmung .
[ "Die", "Einschwemmung", "grosser", "Volumina", "von", "Spuelfluessigkeit", "stellt", "bei", "der", "transurethralen", "Prostataresektion", "das", "Hauptproblem", "dar", ".", "Bisher", "verwendete", "Methoden", "weisen", "die", "Einschwemmung", "unzureichend", "nach", ".", "Erstmals", "setzten", "Hulten", "et", "al", ".", "der", "Spuelfluessigkeit", "2%igen", "Alkohol", "zu", "und", "wiesen", "diesen", "exspiratorisch", "diskontinuierlich", "mittels", "eines", "Alkoholtestgeraets", "nach", ".", "In", "dieser", "Studie", "entnahmen", "wir", "17", "Patienten", "unter", "Spinalanaesthesie", "ueber", "eine", "Nasensonde", "kontinuierlich", "Exspirationsluft", "aus", "dem", "oberen", "Nasen", "-", "Rachen", "-", "Raum", ",", "die", "wir", "mittels", "eines", "NormacTM", "-", "Anaesthesiegasmonitors", "(", "Fa", ".", "Datex", ",", "Helsinki", ")", "auf", "Alkohol", "untersuchten", ".", "Es", "sollte", "festgestellt", "werden", ",", "ob", "diese", "Methode", "mit", "klinisch", "ausreichender", "Genauigkeit", "eine", "Einschwemmung", "des", "Alkohols", ",", "der", "der", "Spuelfluessigkeit", "zugemischt", "wird", ",", "aufzeigen", "kann", ".", "Dazu", "wurden", "neben", "der", "kontinuierlichen", "exspiratorischen", "Alkoholmessung", "folgende", "Messwerte", "erhoben", ":", "Blutalkoholspiegel", ",", "endexspiratorischer", "Alkohol", "mittels", "Alcotest", "7110", "Haematokrit", ",", "Serumnatrium", "und", "Blutgasanalyse", ".", ",", "Bei", "17", "Patienten", "wurden", "68", "Messungen", "durchgefuehrt", "(", "je", "ein", "Leerwert", ",", "in", "10minuetigem", "Abstand", ")", ".", "Erwartungsgemaess", "korrelierten", "das", "Serum", "-", "Natrium", "(", "r2", "=", "0,68", ")", "und", "der", "Haematokrit", "(", "r2", "=", "0,39", ")", "schlecht", "mit", "der", "durch", "Blutalkoholbestimmung", "ermittelten", "Einschwemmung", ".", "Die", "Ergebnisse", "der", "exspiratorischen", "Alkoholbestimmung", "mit", "dem", "Alcotest", "-", "Geraet", "(", "r2", "-", "0,93", ")", "und", "die", "kontinuierliche", "Messung", "mit", "dem", "Normac", "(", "r2", "=", "0,85", ")", "ergaben", "gute", "Uebereinstimmungen", "mit", "den", "Blutalkoholkontrollen", ".", "Im", "klinisch", "interessanten", "Bereich", "ab", "0,3permil", "Blutalkoholspiegel", "(", "entsprechend", "500", "bis", "1000", "ml", "Einschwemmvolumen", ")", "erreicht", "das", "kontinuierliche", "Monitoring", "der", "exspiratorischen", "Alkoholkonzentration", "mit", "einem", "NormacTM", "eine", "ausreichende", "Genauigkeit", "und", "liefert", "fruezeitig", "einen", "zuverlaessigen", "Hinweis", "fuer", "eine", "Einschwemmung", "." ]
[ "umlsterm" ]
Prostataresektion is an umlsterm, Methoden is an umlsterm, Alkohol is an umlsterm, Alkoholtestgeraets is an umlsterm, Patienten is an umlsterm, Nasensonde is an umlsterm, Alkohol is an umlsterm, Methode is an umlsterm, Alkohols is an umlsterm, Alkoholmessung is an umlsterm, Blutalkoholspiegel is an umlsterm, Alkohol is an umlsterm, Haematokrit is an umlsterm, Serumnatrium is an umlsterm, Blutgasanalyse is an umlsterm, Patienten is an umlsterm, Serum - Natrium is an umlsterm, Haematokrit is an umlsterm, Alkoholbestimmung is an umlsterm, Blutalkoholspiegel is an umlsterm, Alkoholkonzentration is an umlsterm
DerAnaesthesist.50440436.ger.abstr_task1
Sentence: Die Einschwemmung grosser Volumina von Spuelfluessigkeit stellt bei der transurethralen Prostataresektion das Hauptproblem dar . Bisher verwendete Methoden weisen die Einschwemmung unzureichend nach . Erstmals setzten Hulten et al. der Spuelfluessigkeit 2%igen Alkohol zu und wiesen diesen exspiratorisch diskontinuierlich mittels eines Alkoholtestgeraets nach . In dieser Studie entnahmen wir 17 Patienten unter Spinalanaesthesie ueber eine Nasensonde kontinuierlich Exspirationsluft aus dem oberen Nasen-Rachen-Raum , die wir mittels eines NormacTM-Anaesthesiegasmonitors ( Fa. Datex , Helsinki ) auf Alkohol untersuchten . Es sollte festgestellt werden , ob diese Methode mit klinisch ausreichender Genauigkeit eine Einschwemmung des Alkohols , der der Spuelfluessigkeit zugemischt wird , aufzeigen kann . Dazu wurden neben der kontinuierlichen exspiratorischen Alkoholmessung folgende Messwerte erhoben : Blutalkoholspiegel , endexspiratorischer Alkohol mittels Alcotest 7110 Haematokrit , Serumnatrium und Blutgasanalyse . , Bei 17 Patienten wurden 68 Messungen durchgefuehrt ( je ein Leerwert , in 10minuetigem Abstand ) . Erwartungsgemaess korrelierten das Serum-Natrium ( r2 = 0,68 ) und der Haematokrit ( r2 = 0,39 ) schlecht mit der durch Blutalkoholbestimmung ermittelten Einschwemmung . Die Ergebnisse der exspiratorischen Alkoholbestimmung mit dem Alcotest-Geraet ( r2 - 0,93 ) und die kontinuierliche Messung mit dem Normac ( r2 = 0,85 ) ergaben gute Uebereinstimmungen mit den Blutalkoholkontrollen . Im klinisch interessanten Bereich ab 0,3permil Blutalkoholspiegel ( entsprechend 500 bis 1000 ml Einschwemmvolumen ) erreicht das kontinuierliche Monitoring der exspiratorischen Alkoholkonzentration mit einem NormacTM eine ausreichende Genauigkeit und liefert fruezeitig einen zuverlaessigen Hinweis fuer eine Einschwemmung . Instructions: please typing these entity words according to sentence: Prostataresektion, Methoden, Alkohol, Alkoholtestgeraets, Patienten, Nasensonde, Alkohol, Methode, Alkohols, Alkoholmessung, Blutalkoholspiegel, Alkohol, Haematokrit, Serumnatrium, Blutgasanalyse, Patienten, Serum - Natrium, Haematokrit, Alkoholbestimmung, Blutalkoholspiegel, Alkoholkonzentration Options: umlsterm
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Die Einschwemmung grosser Volumina von Spuelfluessigkeit stellt bei der transurethralen Prostataresektion das Hauptproblem dar . Bisher verwendete Methoden weisen die Einschwemmung unzureichend nach . Erstmals setzten Hulten et al. der Spuelfluessigkeit 2%igen Alkohol zu und wiesen diesen exspiratorisch diskontinuierlich mittels eines Alkoholtestgeraets nach . In dieser Studie entnahmen wir 17 Patienten unter Spinalanaesthesie ueber eine Nasensonde kontinuierlich Exspirationsluft aus dem oberen Nasen-Rachen-Raum , die wir mittels eines NormacTM-Anaesthesiegasmonitors ( Fa. Datex , Helsinki ) auf Alkohol untersuchten . Es sollte festgestellt werden , ob diese Methode mit klinisch ausreichender Genauigkeit eine Einschwemmung des Alkohols , der der Spuelfluessigkeit zugemischt wird , aufzeigen kann . Dazu wurden neben der kontinuierlichen exspiratorischen Alkoholmessung folgende Messwerte erhoben : Blutalkoholspiegel , endexspiratorischer Alkohol mittels Alcotest 7110 Haematokrit , Serumnatrium und Blutgasanalyse . , Bei 17 Patienten wurden 68 Messungen durchgefuehrt ( je ein Leerwert , in 10minuetigem Abstand ) . Erwartungsgemaess korrelierten das Serum-Natrium ( r2 = 0,68 ) und der Haematokrit ( r2 = 0,39 ) schlecht mit der durch Blutalkoholbestimmung ermittelten Einschwemmung . Die Ergebnisse der exspiratorischen Alkoholbestimmung mit dem Alcotest-Geraet ( r2 - 0,93 ) und die kontinuierliche Messung mit dem Normac ( r2 = 0,85 ) ergaben gute Uebereinstimmungen mit den Blutalkoholkontrollen . Im klinisch interessanten Bereich ab 0,3permil Blutalkoholspiegel ( entsprechend 500 bis 1000 ml Einschwemmvolumen ) erreicht das kontinuierliche Monitoring der exspiratorischen Alkoholkonzentration mit einem NormacTM eine ausreichende Genauigkeit und liefert fruezeitig einen zuverlaessigen Hinweis fuer eine Einschwemmung .
[ "Die", "Einschwemmung", "grosser", "Volumina", "von", "Spuelfluessigkeit", "stellt", "bei", "der", "transurethralen", "Prostataresektion", "das", "Hauptproblem", "dar", ".", "Bisher", "verwendete", "Methoden", "weisen", "die", "Einschwemmung", "unzureichend", "nach", ".", "Erstmals", "setzten", "Hulten", "et", "al", ".", "der", "Spuelfluessigkeit", "2%igen", "Alkohol", "zu", "und", "wiesen", "diesen", "exspiratorisch", "diskontinuierlich", "mittels", "eines", "Alkoholtestgeraets", "nach", ".", "In", "dieser", "Studie", "entnahmen", "wir", "17", "Patienten", "unter", "Spinalanaesthesie", "ueber", "eine", "Nasensonde", "kontinuierlich", "Exspirationsluft", "aus", "dem", "oberen", "Nasen", "-", "Rachen", "-", "Raum", ",", "die", "wir", "mittels", "eines", "NormacTM", "-", "Anaesthesiegasmonitors", "(", "Fa", ".", "Datex", ",", "Helsinki", ")", "auf", "Alkohol", "untersuchten", ".", "Es", "sollte", "festgestellt", "werden", ",", "ob", "diese", "Methode", "mit", "klinisch", "ausreichender", "Genauigkeit", "eine", "Einschwemmung", "des", "Alkohols", ",", "der", "der", "Spuelfluessigkeit", "zugemischt", "wird", ",", "aufzeigen", "kann", ".", "Dazu", "wurden", "neben", "der", "kontinuierlichen", "exspiratorischen", "Alkoholmessung", "folgende", "Messwerte", "erhoben", ":", "Blutalkoholspiegel", ",", "endexspiratorischer", "Alkohol", "mittels", "Alcotest", "7110", "Haematokrit", ",", "Serumnatrium", "und", "Blutgasanalyse", ".", ",", "Bei", "17", "Patienten", "wurden", "68", "Messungen", "durchgefuehrt", "(", "je", "ein", "Leerwert", ",", "in", "10minuetigem", "Abstand", ")", ".", "Erwartungsgemaess", "korrelierten", "das", "Serum", "-", "Natrium", "(", "r2", "=", "0,68", ")", "und", "der", "Haematokrit", "(", "r2", "=", "0,39", ")", "schlecht", "mit", "der", "durch", "Blutalkoholbestimmung", "ermittelten", "Einschwemmung", ".", "Die", "Ergebnisse", "der", "exspiratorischen", "Alkoholbestimmung", "mit", "dem", "Alcotest", "-", "Geraet", "(", "r2", "-", "0,93", ")", "und", "die", "kontinuierliche", "Messung", "mit", "dem", "Normac", "(", "r2", "=", "0,85", ")", "ergaben", "gute", "Uebereinstimmungen", "mit", "den", "Blutalkoholkontrollen", ".", "Im", "klinisch", "interessanten", "Bereich", "ab", "0,3permil", "Blutalkoholspiegel", "(", "entsprechend", "500", "bis", "1000", "ml", "Einschwemmvolumen", ")", "erreicht", "das", "kontinuierliche", "Monitoring", "der", "exspiratorischen", "Alkoholkonzentration", "mit", "einem", "NormacTM", "eine", "ausreichende", "Genauigkeit", "und", "liefert", "fruezeitig", "einen", "zuverlaessigen", "Hinweis", "fuer", "eine", "Einschwemmung", "." ]
[ "umlsterm" ]
Prostataresektion, Methoden, Alkohol, Alkoholtestgeraets, Patienten, Nasensonde, Alkohol, Methode, Alkohols, Alkoholmessung, Blutalkoholspiegel, Alkohol, Haematokrit, Serumnatrium, Blutgasanalyse, Patienten, Serum - Natrium, Haematokrit, Alkoholbestimmung, Blutalkoholspiegel, Alkoholkonzentration
DerAnaesthesist.50440436.ger.abstr_task2
Sentence: Die Einschwemmung grosser Volumina von Spuelfluessigkeit stellt bei der transurethralen Prostataresektion das Hauptproblem dar . Bisher verwendete Methoden weisen die Einschwemmung unzureichend nach . Erstmals setzten Hulten et al. der Spuelfluessigkeit 2%igen Alkohol zu und wiesen diesen exspiratorisch diskontinuierlich mittels eines Alkoholtestgeraets nach . In dieser Studie entnahmen wir 17 Patienten unter Spinalanaesthesie ueber eine Nasensonde kontinuierlich Exspirationsluft aus dem oberen Nasen-Rachen-Raum , die wir mittels eines NormacTM-Anaesthesiegasmonitors ( Fa. Datex , Helsinki ) auf Alkohol untersuchten . Es sollte festgestellt werden , ob diese Methode mit klinisch ausreichender Genauigkeit eine Einschwemmung des Alkohols , der der Spuelfluessigkeit zugemischt wird , aufzeigen kann . Dazu wurden neben der kontinuierlichen exspiratorischen Alkoholmessung folgende Messwerte erhoben : Blutalkoholspiegel , endexspiratorischer Alkohol mittels Alcotest 7110 Haematokrit , Serumnatrium und Blutgasanalyse . , Bei 17 Patienten wurden 68 Messungen durchgefuehrt ( je ein Leerwert , in 10minuetigem Abstand ) . Erwartungsgemaess korrelierten das Serum-Natrium ( r2 = 0,68 ) und der Haematokrit ( r2 = 0,39 ) schlecht mit der durch Blutalkoholbestimmung ermittelten Einschwemmung . Die Ergebnisse der exspiratorischen Alkoholbestimmung mit dem Alcotest-Geraet ( r2 - 0,93 ) und die kontinuierliche Messung mit dem Normac ( r2 = 0,85 ) ergaben gute Uebereinstimmungen mit den Blutalkoholkontrollen . Im klinisch interessanten Bereich ab 0,3permil Blutalkoholspiegel ( entsprechend 500 bis 1000 ml Einschwemmvolumen ) erreicht das kontinuierliche Monitoring der exspiratorischen Alkoholkonzentration mit einem NormacTM eine ausreichende Genauigkeit und liefert fruezeitig einen zuverlaessigen Hinweis fuer eine Einschwemmung . Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "I-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O" ]
Die Einschwemmung grosser Volumina von Spuelfluessigkeit stellt bei der transurethralen Prostataresektion das Hauptproblem dar . Bisher verwendete Methoden weisen die Einschwemmung unzureichend nach . Erstmals setzten Hulten et al. der Spuelfluessigkeit 2%igen Alkohol zu und wiesen diesen exspiratorisch diskontinuierlich mittels eines Alkoholtestgeraets nach . In dieser Studie entnahmen wir 17 Patienten unter Spinalanaesthesie ueber eine Nasensonde kontinuierlich Exspirationsluft aus dem oberen Nasen-Rachen-Raum , die wir mittels eines NormacTM-Anaesthesiegasmonitors ( Fa. Datex , Helsinki ) auf Alkohol untersuchten . Es sollte festgestellt werden , ob diese Methode mit klinisch ausreichender Genauigkeit eine Einschwemmung des Alkohols , der der Spuelfluessigkeit zugemischt wird , aufzeigen kann . Dazu wurden neben der kontinuierlichen exspiratorischen Alkoholmessung folgende Messwerte erhoben : Blutalkoholspiegel , endexspiratorischer Alkohol mittels Alcotest 7110 Haematokrit , Serumnatrium und Blutgasanalyse . , Bei 17 Patienten wurden 68 Messungen durchgefuehrt ( je ein Leerwert , in 10minuetigem Abstand ) . Erwartungsgemaess korrelierten das Serum-Natrium ( r2 = 0,68 ) und der Haematokrit ( r2 = 0,39 ) schlecht mit der durch Blutalkoholbestimmung ermittelten Einschwemmung . Die Ergebnisse der exspiratorischen Alkoholbestimmung mit dem Alcotest-Geraet ( r2 - 0,93 ) und die kontinuierliche Messung mit dem Normac ( r2 = 0,85 ) ergaben gute Uebereinstimmungen mit den Blutalkoholkontrollen . Im klinisch interessanten Bereich ab 0,3permil Blutalkoholspiegel ( entsprechend 500 bis 1000 ml Einschwemmvolumen ) erreicht das kontinuierliche Monitoring der exspiratorischen Alkoholkonzentration mit einem NormacTM eine ausreichende Genauigkeit und liefert fruezeitig einen zuverlaessigen Hinweis fuer eine Einschwemmung .
[ "Die", "Einschwemmung", "grosser", "Volumina", "von", "Spuelfluessigkeit", "stellt", "bei", "der", "transurethralen", "Prostataresektion", "das", "Hauptproblem", "dar", ".", "Bisher", "verwendete", "Methoden", "weisen", "die", "Einschwemmung", "unzureichend", "nach", ".", "Erstmals", "setzten", "Hulten", "et", "al", ".", "der", "Spuelfluessigkeit", "2%igen", "Alkohol", "zu", "und", "wiesen", "diesen", "exspiratorisch", "diskontinuierlich", "mittels", "eines", "Alkoholtestgeraets", "nach", ".", "In", "dieser", "Studie", "entnahmen", "wir", "17", "Patienten", "unter", "Spinalanaesthesie", "ueber", "eine", "Nasensonde", "kontinuierlich", "Exspirationsluft", "aus", "dem", "oberen", "Nasen", "-", "Rachen", "-", "Raum", ",", "die", "wir", "mittels", "eines", "NormacTM", "-", "Anaesthesiegasmonitors", "(", "Fa", ".", "Datex", ",", "Helsinki", ")", "auf", "Alkohol", "untersuchten", ".", "Es", "sollte", "festgestellt", "werden", ",", "ob", "diese", "Methode", "mit", "klinisch", "ausreichender", "Genauigkeit", "eine", "Einschwemmung", "des", "Alkohols", ",", "der", "der", "Spuelfluessigkeit", "zugemischt", "wird", ",", "aufzeigen", "kann", ".", "Dazu", "wurden", "neben", "der", "kontinuierlichen", "exspiratorischen", "Alkoholmessung", "folgende", "Messwerte", "erhoben", ":", "Blutalkoholspiegel", ",", "endexspiratorischer", "Alkohol", "mittels", "Alcotest", "7110", "Haematokrit", ",", "Serumnatrium", "und", "Blutgasanalyse", ".", ",", "Bei", "17", "Patienten", "wurden", "68", "Messungen", "durchgefuehrt", "(", "je", "ein", "Leerwert", ",", "in", "10minuetigem", "Abstand", ")", ".", "Erwartungsgemaess", "korrelierten", "das", "Serum", "-", "Natrium", "(", "r2", "=", "0,68", ")", "und", "der", "Haematokrit", "(", "r2", "=", "0,39", ")", "schlecht", "mit", "der", "durch", "Blutalkoholbestimmung", "ermittelten", "Einschwemmung", ".", "Die", "Ergebnisse", "der", "exspiratorischen", "Alkoholbestimmung", "mit", "dem", "Alcotest", "-", "Geraet", "(", "r2", "-", "0,93", ")", "und", "die", "kontinuierliche", "Messung", "mit", "dem", "Normac", "(", "r2", "=", "0,85", ")", "ergaben", "gute", "Uebereinstimmungen", "mit", "den", "Blutalkoholkontrollen", ".", "Im", "klinisch", "interessanten", "Bereich", "ab", "0,3permil", "Blutalkoholspiegel", "(", "entsprechend", "500", "bis", "1000", "ml", "Einschwemmvolumen", ")", "erreicht", "das", "kontinuierliche", "Monitoring", "der", "exspiratorischen", "Alkoholkonzentration", "mit", "einem", "NormacTM", "eine", "ausreichende", "Genauigkeit", "und", "liefert", "fruezeitig", "einen", "zuverlaessigen", "Hinweis", "fuer", "eine", "Einschwemmung", "." ]
[ "umlsterm" ]
Abstract is an umlsterm, men is an umlsterm, age is an umlsterm, sequelae is an umlsterm, hair is an umlsterm, compensation is an umlsterm, Polyether is an umlsterm, amide is an umlsterm, hair is an umlsterm, patient is an umlsterm, implantation is an umlsterm, technique is an umlsterm, needle is an umlsterm, patients is an umlsterm, bacterial is an umlsterm, folliculitis is an umlsterm, patients is an umlsterm, patients is an umlsterm, motorcycle is an umlsterm, helmet is an umlsterm, tropical climate is an umlsterm, patient is an umlsterm, hair is an umlsterm, sauna is an umlsterm, hair is an umlsterm, patients is an umlsterm, patients is an umlsterm, All is an umlsterm, patients is an umlsterm, scars is an umlsterm, complication is an umlsterm, technique is an umlsterm, hair is an umlsterm, implantation is an umlsterm, procedure is an umlsterm, sequelae is an umlsterm
DerHautarzt.50460010.eng.abstr_task0
Sentence: Abstract . Five men ( average age 35 years ) suffering from the sequelae of hair implants were examined in the course of claims for legal compensation . Polyether amide hair fibres had been implanted , 1000 per patient and session . In all cases the improved implantation technique with a needle and subcutaneous knotting had been used in a total of three institutions . Three patients developed bacterial folliculitis after 4 - 8 weeks ; in the other two patients this developed later , after 3 - 6 months . In two patients the possible triggering event was the wearing of a motorcycle helmet and a vacation in a tropical climate respectively . In another patient the artificial hair curled considerably after he visited a sauna . The implanted hair had fallen out almost completely in all cases ( 100% in two patients after 9 - 12 months , 50 - 75% in three patients after 7 months to 2 years ) . All patients showed cosmetically disturbing small scars and pigmentary changes . Despite an apparently improved complication rate , the new technique of hair fibre implantation remains a doubtful procedure and cannot be recommended in view of possible permanent sequelae . Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: umlsterm
[ "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O" ]
Abstract . Five men ( average age 35 years ) suffering from the sequelae of hair implants were examined in the course of claims for legal compensation . Polyether amide hair fibres had been implanted , 1000 per patient and session . In all cases the improved implantation technique with a needle and subcutaneous knotting had been used in a total of three institutions . Three patients developed bacterial folliculitis after 4 - 8 weeks ; in the other two patients this developed later , after 3 - 6 months . In two patients the possible triggering event was the wearing of a motorcycle helmet and a vacation in a tropical climate respectively . In another patient the artificial hair curled considerably after he visited a sauna . The implanted hair had fallen out almost completely in all cases ( 100% in two patients after 9 - 12 months , 50 - 75% in three patients after 7 months to 2 years ) . All patients showed cosmetically disturbing small scars and pigmentary changes . Despite an apparently improved complication rate , the new technique of hair fibre implantation remains a doubtful procedure and cannot be recommended in view of possible permanent sequelae .
[ "Abstract", ".", "Five", "men", "(", "average", "age", "35", "years", ")", "suffering", "from", "the", "sequelae", "of", "hair", "implants", "were", "examined", "in", "the", "course", "of", "claims", "for", "legal", "compensation", ".", "Polyether", "amide", "hair", "fibres", "had", "been", "implanted", ",", "1000", "per", "patient", "and", "session", ".", "In", "all", "cases", "the", "improved", "implantation", "technique", "with", "a", "needle", "and", "subcutaneous", "knotting", "had", "been", "used", "in", "a", "total", "of", "three", "institutions", ".", "Three", "patients", "developed", "bacterial", "folliculitis", "after", "4", "-", "8", "weeks", ";", "in", "the", "other", "two", "patients", "this", "developed", "later", ",", "after", "3", "-", "6", "months", ".", "In", "two", "patients", "the", "possible", "triggering", "event", "was", "the", "wearing", "of", "a", "motorcycle", "helmet", "and", "a", "vacation", "in", "a", "tropical", "climate", "respectively", ".", "In", "another", "patient", "the", "artificial", "hair", "curled", "considerably", "after", "he", "visited", "a", "sauna", ".", "The", "implanted", "hair", "had", "fallen", "out", "almost", "completely", "in", "all", "cases", "(", "100", "%", "in", "two", "patients", "after", "9", "-", "12", "months", ",", "50", "-", "75", "%", "in", "three", "patients", "after", "7", "months", "to", "2", "years", ")", ".", "All", "patients", "showed", "cosmetically", "disturbing", "small", "scars", "and", "pigmentary", "changes", ".", "Despite", "an", "apparently", "improved", "complication", "rate", ",", "the", "new", "technique", "of", "hair", "fibre", "implantation", "remains", "a", "doubtful", "procedure", "and", "cannot", "be", "recommended", "in", "view", "of", "possible", "permanent", "sequelae", "." ]
[ "umlsterm" ]
Abstract is an umlsterm, men is an umlsterm, age is an umlsterm, sequelae is an umlsterm, hair is an umlsterm, compensation is an umlsterm, Polyether is an umlsterm, amide is an umlsterm, hair is an umlsterm, patient is an umlsterm, implantation is an umlsterm, technique is an umlsterm, needle is an umlsterm, patients is an umlsterm, bacterial is an umlsterm, folliculitis is an umlsterm, patients is an umlsterm, patients is an umlsterm, motorcycle is an umlsterm, helmet is an umlsterm, tropical climate is an umlsterm, patient is an umlsterm, hair is an umlsterm, sauna is an umlsterm, hair is an umlsterm, patients is an umlsterm, patients is an umlsterm, All is an umlsterm, patients is an umlsterm, scars is an umlsterm, complication is an umlsterm, technique is an umlsterm, hair is an umlsterm, implantation is an umlsterm, procedure is an umlsterm, sequelae is an umlsterm
DerHautarzt.50460010.eng.abstr_task1
Sentence: Abstract . Five men ( average age 35 years ) suffering from the sequelae of hair implants were examined in the course of claims for legal compensation . Polyether amide hair fibres had been implanted , 1000 per patient and session . In all cases the improved implantation technique with a needle and subcutaneous knotting had been used in a total of three institutions . Three patients developed bacterial folliculitis after 4 - 8 weeks ; in the other two patients this developed later , after 3 - 6 months . In two patients the possible triggering event was the wearing of a motorcycle helmet and a vacation in a tropical climate respectively . In another patient the artificial hair curled considerably after he visited a sauna . The implanted hair had fallen out almost completely in all cases ( 100% in two patients after 9 - 12 months , 50 - 75% in three patients after 7 months to 2 years ) . All patients showed cosmetically disturbing small scars and pigmentary changes . Despite an apparently improved complication rate , the new technique of hair fibre implantation remains a doubtful procedure and cannot be recommended in view of possible permanent sequelae . Instructions: please typing these entity words according to sentence: Abstract, men, age, sequelae, hair, compensation, Polyether, amide, hair, patient, implantation, technique, needle, patients, bacterial, folliculitis, patients, patients, motorcycle, helmet, tropical climate, patient, hair, sauna, hair, patients, patients, All, patients, scars, complication, technique, hair, implantation, procedure, sequelae Options: umlsterm
[ "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O" ]
Abstract . Five men ( average age 35 years ) suffering from the sequelae of hair implants were examined in the course of claims for legal compensation . Polyether amide hair fibres had been implanted , 1000 per patient and session . In all cases the improved implantation technique with a needle and subcutaneous knotting had been used in a total of three institutions . Three patients developed bacterial folliculitis after 4 - 8 weeks ; in the other two patients this developed later , after 3 - 6 months . In two patients the possible triggering event was the wearing of a motorcycle helmet and a vacation in a tropical climate respectively . In another patient the artificial hair curled considerably after he visited a sauna . The implanted hair had fallen out almost completely in all cases ( 100% in two patients after 9 - 12 months , 50 - 75% in three patients after 7 months to 2 years ) . All patients showed cosmetically disturbing small scars and pigmentary changes . Despite an apparently improved complication rate , the new technique of hair fibre implantation remains a doubtful procedure and cannot be recommended in view of possible permanent sequelae .
[ "Abstract", ".", "Five", "men", "(", "average", "age", "35", "years", ")", "suffering", "from", "the", "sequelae", "of", "hair", "implants", "were", "examined", "in", "the", "course", "of", "claims", "for", "legal", "compensation", ".", "Polyether", "amide", "hair", "fibres", "had", "been", "implanted", ",", "1000", "per", "patient", "and", "session", ".", "In", "all", "cases", "the", "improved", "implantation", "technique", "with", "a", "needle", "and", "subcutaneous", "knotting", "had", "been", "used", "in", "a", "total", "of", "three", "institutions", ".", "Three", "patients", "developed", "bacterial", "folliculitis", "after", "4", "-", "8", "weeks", ";", "in", "the", "other", "two", "patients", "this", "developed", "later", ",", "after", "3", "-", "6", "months", ".", "In", "two", "patients", "the", "possible", "triggering", "event", "was", "the", "wearing", "of", "a", "motorcycle", "helmet", "and", "a", "vacation", "in", "a", "tropical", "climate", "respectively", ".", "In", "another", "patient", "the", "artificial", "hair", "curled", "considerably", "after", "he", "visited", "a", "sauna", ".", "The", "implanted", "hair", "had", "fallen", "out", "almost", "completely", "in", "all", "cases", "(", "100", "%", "in", "two", "patients", "after", "9", "-", "12", "months", ",", "50", "-", "75", "%", "in", "three", "patients", "after", "7", "months", "to", "2", "years", ")", ".", "All", "patients", "showed", "cosmetically", "disturbing", "small", "scars", "and", "pigmentary", "changes", ".", "Despite", "an", "apparently", "improved", "complication", "rate", ",", "the", "new", "technique", "of", "hair", "fibre", "implantation", "remains", "a", "doubtful", "procedure", "and", "cannot", "be", "recommended", "in", "view", "of", "possible", "permanent", "sequelae", "." ]
[ "umlsterm" ]
Abstract, men, age, sequelae, hair, compensation, Polyether, amide, hair, patient, implantation, technique, needle, patients, bacterial, folliculitis, patients, patients, motorcycle, helmet, tropical climate, patient, hair, sauna, hair, patients, patients, All, patients, scars, complication, technique, hair, implantation, procedure, sequelae
DerHautarzt.50460010.eng.abstr_task2
Sentence: Abstract . Five men ( average age 35 years ) suffering from the sequelae of hair implants were examined in the course of claims for legal compensation . Polyether amide hair fibres had been implanted , 1000 per patient and session . In all cases the improved implantation technique with a needle and subcutaneous knotting had been used in a total of three institutions . Three patients developed bacterial folliculitis after 4 - 8 weeks ; in the other two patients this developed later , after 3 - 6 months . In two patients the possible triggering event was the wearing of a motorcycle helmet and a vacation in a tropical climate respectively . In another patient the artificial hair curled considerably after he visited a sauna . The implanted hair had fallen out almost completely in all cases ( 100% in two patients after 9 - 12 months , 50 - 75% in three patients after 7 months to 2 years ) . All patients showed cosmetically disturbing small scars and pigmentary changes . Despite an apparently improved complication rate , the new technique of hair fibre implantation remains a doubtful procedure and cannot be recommended in view of possible permanent sequelae . Instructions: please extract entity words from the input sentence
[ "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "O", "B-umlsterm", "I-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "B-umlsterm", "O", "B-umlsterm", "O", "B-umlsterm", "O", "O", "O", "B-umlsterm", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-umlsterm", "O" ]
Abstract . Five men ( average age 35 years ) suffering from the sequelae of hair implants were examined in the course of claims for legal compensation . Polyether amide hair fibres had been implanted , 1000 per patient and session . In all cases the improved implantation technique with a needle and subcutaneous knotting had been used in a total of three institutions . Three patients developed bacterial folliculitis after 4 - 8 weeks ; in the other two patients this developed later , after 3 - 6 months . In two patients the possible triggering event was the wearing of a motorcycle helmet and a vacation in a tropical climate respectively . In another patient the artificial hair curled considerably after he visited a sauna . The implanted hair had fallen out almost completely in all cases ( 100% in two patients after 9 - 12 months , 50 - 75% in three patients after 7 months to 2 years ) . All patients showed cosmetically disturbing small scars and pigmentary changes . Despite an apparently improved complication rate , the new technique of hair fibre implantation remains a doubtful procedure and cannot be recommended in view of possible permanent sequelae .
[ "Abstract", ".", "Five", "men", "(", "average", "age", "35", "years", ")", "suffering", "from", "the", "sequelae", "of", "hair", "implants", "were", "examined", "in", "the", "course", "of", "claims", "for", "legal", "compensation", ".", "Polyether", "amide", "hair", "fibres", "had", "been", "implanted", ",", "1000", "per", "patient", "and", "session", ".", "In", "all", "cases", "the", "improved", "implantation", "technique", "with", "a", "needle", "and", "subcutaneous", "knotting", "had", "been", "used", "in", "a", "total", "of", "three", "institutions", ".", "Three", "patients", "developed", "bacterial", "folliculitis", "after", "4", "-", "8", "weeks", ";", "in", "the", "other", "two", "patients", "this", "developed", "later", ",", "after", "3", "-", "6", "months", ".", "In", "two", "patients", "the", "possible", "triggering", "event", "was", "the", "wearing", "of", "a", "motorcycle", "helmet", "and", "a", "vacation", "in", "a", "tropical", "climate", "respectively", ".", "In", "another", "patient", "the", "artificial", "hair", "curled", "considerably", "after", "he", "visited", "a", "sauna", ".", "The", "implanted", "hair", "had", "fallen", "out", "almost", "completely", "in", "all", "cases", "(", "100", "%", "in", "two", "patients", "after", "9", "-", "12", "months", ",", "50", "-", "75", "%", "in", "three", "patients", "after", "7", "months", "to", "2", "years", ")", ".", "All", "patients", "showed", "cosmetically", "disturbing", "small", "scars", "and", "pigmentary", "changes", ".", "Despite", "an", "apparently", "improved", "complication", "rate", ",", "the", "new", "technique", "of", "hair", "fibre", "implantation", "remains", "a", "doubtful", "procedure", "and", "cannot", "be", "recommended", "in", "view", "of", "possible", "permanent", "sequelae", "." ]
[ "umlsterm" ]
nucleocapsid protein is a Gene/protein/RNA, phosphoprotein is a Individual_protein, P is a Individual_protein, P is a Gene/protein/RNA
629_task0
Sentence: Sequence analysis of the genes encoding the nucleocapsid protein and phosphoprotein (P) of phocid distemper virus, and editing of the P gene transcript. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Gene/protein/RNA, Individual_protein
[ "O", "O", "O", "O", "O", "O", "O", "B-Gene/protein/RNA", "I-Gene/protein/RNA", "O", "B-Individual_protein", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Gene/protein/RNA", "O", "O", "O" ]
Sequence analysis of the genes encoding the nucleocapsid protein and phosphoprotein (P) of phocid distemper virus, and editing of the P gene transcript.
[ "Sequence", "analysis", "of", "the", "genes", "encoding", "the", "nucleocapsid", "protein", "and", "phosphoprotein", "(", "P", ")", "of", "phocid", "distemper", "virus", ",", "and", "editing", "of", "the", "P", "gene", "transcript", "." ]
[ "Gene/protein/RNA", "Individual_protein" ]
nucleocapsid protein is a Gene/protein/RNA, phosphoprotein is a Individual_protein, P is a Individual_protein, P is a Gene/protein/RNA
629_task1
Sentence: Sequence analysis of the genes encoding the nucleocapsid protein and phosphoprotein (P) of phocid distemper virus, and editing of the P gene transcript. Instructions: please typing these entity words according to sentence: nucleocapsid protein, phosphoprotein, P, P Options: Gene/protein/RNA, Individual_protein
[ "O", "O", "O", "O", "O", "O", "O", "B-Gene/protein/RNA", "I-Gene/protein/RNA", "O", "B-Individual_protein", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Gene/protein/RNA", "O", "O", "O" ]
Sequence analysis of the genes encoding the nucleocapsid protein and phosphoprotein (P) of phocid distemper virus, and editing of the P gene transcript.
[ "Sequence", "analysis", "of", "the", "genes", "encoding", "the", "nucleocapsid", "protein", "and", "phosphoprotein", "(", "P", ")", "of", "phocid", "distemper", "virus", ",", "and", "editing", "of", "the", "P", "gene", "transcript", "." ]
[ "Gene/protein/RNA", "Individual_protein" ]
nucleocapsid protein, phosphoprotein, P, P
629_task2
Sentence: Sequence analysis of the genes encoding the nucleocapsid protein and phosphoprotein (P) of phocid distemper virus, and editing of the P gene transcript. Instructions: please extract entity words from the input sentence
[ "O", "O", "O", "O", "O", "O", "O", "B-Gene/protein/RNA", "I-Gene/protein/RNA", "O", "B-Individual_protein", "O", "B-Individual_protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Gene/protein/RNA", "O", "O", "O" ]
Sequence analysis of the genes encoding the nucleocapsid protein and phosphoprotein (P) of phocid distemper virus, and editing of the P gene transcript.
[ "Sequence", "analysis", "of", "the", "genes", "encoding", "the", "nucleocapsid", "protein", "and", "phosphoprotein", "(", "P", ")", "of", "phocid", "distemper", "virus", ",", "and", "editing", "of", "the", "P", "gene", "transcript", "." ]
[ "Gene/protein/RNA", "Individual_protein" ]
IgG Endopeptidase is a Protein, SeMac is a Protein, Streptococcus equi Subspecies equi is a Organism, Horse is a Organism, Mac is a Protein, group A Streptococcus is a Organism, GAS is a Organism, GAS is a Protein, human is a Organism, human is a Organism, immunoglobulin G is a Protein, IgG is a Protein, horse is a Organism, Streptococcus equi subspecies equi is a Organism, Mac is a Protein, SeMac is a Protein, SeMac is a Protein, SeMac is a Protein, IgG endopeptidase is a Protein, S. equi is a Organism, horse is a Organism, SeMac is a Protein, Escherichia coli is a Organism, Mice is a Organism, S. equi is a Organism, horses is a Organism, S. equi is a Organism, SeMac is a Protein, SeMac is a Protein, SeMac is a Protein, human is a Organism, IgG1 is a Protein, horse is a Organism, SeMac is a Protein, SeMac is a Protein, S. equi is a Organism, horse is a Organism, GAS is a Organism, human is a Organism, SeMac is a Protein, cysteine endopeptidase is a Protein, horse is a Organism, IgG is a Protein
82_task0
Sentence: IgG Endopeptidase SeMac does not Inhibit Opsonophagocytosis of Streptococcus equi Subspecies equi by Horse Polymorphonuclear Leukocytes The secreted Mac protein made by group A Streptococcus (GAS) inhibits opsonophagocytosis of GAS by human polymorphonuclear leukocytes (PMNs). This protein also has the endopeptidase activity against human immunoglobulin G (IgG), and the Cys94, His262 and Asp284 are critical for the enzymatic activity. The horse pathogen Streptococcus equi subspecies equi produces a homologue of Mac (SeMac). SeMac was characterized to determine whether SeMac has IgG endopeptidase activity and inhibits opsonophagocytosis of S. equi by horse PMNs. The gene was cloned and recombinant SeMac was overexpressed in Escherichia coli and purified to homogeneity. Mice with experimental S. equi infection and horses with strangles caused by S. equi seroconverted to SeMac, indicating that SeMac is produced in vivo during infection. SeMac has endopeptidase activity against human IgG. However, the protein just cleaves a small fraction, which may be IgG1 only, of horse IgG. Replacement of Cys102 with Ser or His272 with Ala abolishes the enzymatic activity of SeMac, and the Asp294Ala mutation greatly decreases the enzymatic activity. SeMac does not inhibit opsonophagocytosis of S. equi by horse PMNs but opsonophagocytosis of GAS by human PMNs. Thus, SeMac is a cysteine endopeptidase with a limited activity against horse IgG and must have other function. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Organism, Protein
[ "B-Protein", "I-Protein", "B-Protein", "O", "O", "O", "O", "O", "B-Organism", "I-Organism", "I-Organism", "I-Organism", "O", "B-Organism", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "B-Organism", "I-Organism", "I-Organism", "O", "B-Organism", "O", "O", "O", "O", "B-Protein", "O", "B-Organism", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Organism", "B-Protein", "I-Protein", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Organism", "O", "B-Organism", "I-Organism", "I-Organism", "I-Organism", "O", "O", "O", "O", "B-Protein", "O", "B-Protein", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "B-Protein", "O", "B-Protein", "I-Protein", "O", "O", "O", "O", "O", "B-Organism", "I-Organism", "O", "B-Organism", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "B-Organism", "I-Organism", "O", "O", "O", "O", "O", "B-Organism", "O", "O", "B-Organism", "I-Organism", "O", "O", "B-Organism", "O", "O", "O", "O", "B-Organism", "I-Organism", "O", "O", "B-Protein", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "B-Organism", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "B-Organism", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "B-Organism", "I-Organism", "O", "B-Organism", "O", "O", "O", "O", "B-Organism", "O", "B-Organism", "O", "O", "O", "O", "B-Protein", "O", "O", "B-Protein", "I-Protein", "O", "O", "O", "O", "O", "B-Organism", "B-Protein", "O", "O", "O", "O", "O", "O", "O" ]
IgG Endopeptidase SeMac does not Inhibit Opsonophagocytosis of Streptococcus equi Subspecies equi by Horse Polymorphonuclear Leukocytes The secreted Mac protein made by group A Streptococcus (GAS) inhibits opsonophagocytosis of GAS by human polymorphonuclear leukocytes (PMNs). This protein also has the endopeptidase activity against human immunoglobulin G (IgG), and the Cys94, His262 and Asp284 are critical for the enzymatic activity. The horse pathogen Streptococcus equi subspecies equi produces a homologue of Mac (SeMac). SeMac was characterized to determine whether SeMac has IgG endopeptidase activity and inhibits opsonophagocytosis of S. equi by horse PMNs. The gene was cloned and recombinant SeMac was overexpressed in Escherichia coli and purified to homogeneity. Mice with experimental S. equi infection and horses with strangles caused by S. equi seroconverted to SeMac, indicating that SeMac is produced in vivo during infection. SeMac has endopeptidase activity against human IgG. However, the protein just cleaves a small fraction, which may be IgG1 only, of horse IgG. Replacement of Cys102 with Ser or His272 with Ala abolishes the enzymatic activity of SeMac, and the Asp294Ala mutation greatly decreases the enzymatic activity. SeMac does not inhibit opsonophagocytosis of S. equi by horse PMNs but opsonophagocytosis of GAS by human PMNs. Thus, SeMac is a cysteine endopeptidase with a limited activity against horse IgG and must have other function.
[ "IgG", "Endopeptidase", "SeMac", "does", "not", "Inhibit", "Opsonophagocytosis", "of", "Streptococcus", "equi", "Subspecies", "equi", "by", "Horse", "Polymorphonuclear", "Leukocytes", "\n", "The", "secreted", "Mac", "protein", "made", "by", "group", "A", "Streptococcus", "(", "GAS", ")", "inhibits", "opsonophagocytosis", "of", "GAS", "by", "human", "polymorphonuclear", "leukocytes", "(", "PMNs", ")", ".", "This", "protein", "also", "has", "the", "endopeptidase", "activity", "against", "human", "immunoglobulin", "G", "(", "IgG", ")", ",", "and", "the", "Cys94", ",", "His262", "and", "Asp284", "are", "critical", "for", "the", "enzymatic", "activity", ".", "The", "horse", "pathogen", "Streptococcus", "equi", "subspecies", "equi", "produces", "a", "homologue", "of", "Mac", "(", "SeMac", ")", ".", "SeMac", "was", "characterized", "to", "determine", "whether", "SeMac", "has", "IgG", "endopeptidase", "activity", "and", "inhibits", "opsonophagocytosis", "of", "S.", "equi", "by", "horse", "PMNs", ".", "The", "gene", "was", "cloned", "and", "recombinant", "SeMac", "was", "overexpressed", "in", "Escherichia", "coli", "and", "purified", "to", "homogeneity", ".", "Mice", "with", "experimental", "S.", "equi", "infection", "and", "horses", "with", "strangles", "caused", "by", "S.", "equi", "seroconverted", "to", "SeMac", ",", "indicating", "that", "SeMac", "is", "produced", "in", "vivo", "during", "infection", ".", "SeMac", "has", "endopeptidase", "activity", "against", "human", "IgG.", "However", ",", "the", "protein", "just", "cleaves", "a", "small", "fraction", ",", "which", "may", "be", "IgG1", "only", ",", "of", "horse", "IgG.", "Replacement", "of", "Cys102", "with", "Ser", "or", "His272", "with", "Ala", "abolishes", "the", "enzymatic", "activity", "of", "SeMac", ",", "and", "the", "Asp294Ala", "mutation", "greatly", "decreases", "the", "enzymatic", "activity", ".", "SeMac", "does", "not", "inhibit", "opsonophagocytosis", "of", "S.", "equi", "by", "horse", "PMNs", "but", "opsonophagocytosis", "of", "GAS", "by", "human", "PMNs", ".", "Thus", ",", "SeMac", "is", "a", "cysteine", "endopeptidase", "with", "a", "limited", "activity", "against", "horse", "IgG", "and", "must", "have", "other", "function", ".", "\n" ]
[ "Organism", "Protein" ]
IgG Endopeptidase is a Protein, SeMac is a Protein, Streptococcus equi Subspecies equi is a Organism, Horse is a Organism, Mac is a Protein, group A Streptococcus is a Organism, GAS is a Organism, GAS is a Protein, human is a Organism, human is a Organism, immunoglobulin G is a Protein, IgG is a Protein, horse is a Organism, Streptococcus equi subspecies equi is a Organism, Mac is a Protein, SeMac is a Protein, SeMac is a Protein, SeMac is a Protein, IgG endopeptidase is a Protein, S. equi is a Organism, horse is a Organism, SeMac is a Protein, Escherichia coli is a Organism, Mice is a Organism, S. equi is a Organism, horses is a Organism, S. equi is a Organism, SeMac is a Protein, SeMac is a Protein, SeMac is a Protein, human is a Organism, IgG1 is a Protein, horse is a Organism, SeMac is a Protein, SeMac is a Protein, S. equi is a Organism, horse is a Organism, GAS is a Organism, human is a Organism, SeMac is a Protein, cysteine endopeptidase is a Protein, horse is a Organism, IgG is a Protein
82_task1
Sentence: IgG Endopeptidase SeMac does not Inhibit Opsonophagocytosis of Streptococcus equi Subspecies equi by Horse Polymorphonuclear Leukocytes The secreted Mac protein made by group A Streptococcus (GAS) inhibits opsonophagocytosis of GAS by human polymorphonuclear leukocytes (PMNs). This protein also has the endopeptidase activity against human immunoglobulin G (IgG), and the Cys94, His262 and Asp284 are critical for the enzymatic activity. The horse pathogen Streptococcus equi subspecies equi produces a homologue of Mac (SeMac). SeMac was characterized to determine whether SeMac has IgG endopeptidase activity and inhibits opsonophagocytosis of S. equi by horse PMNs. The gene was cloned and recombinant SeMac was overexpressed in Escherichia coli and purified to homogeneity. Mice with experimental S. equi infection and horses with strangles caused by S. equi seroconverted to SeMac, indicating that SeMac is produced in vivo during infection. SeMac has endopeptidase activity against human IgG. However, the protein just cleaves a small fraction, which may be IgG1 only, of horse IgG. Replacement of Cys102 with Ser or His272 with Ala abolishes the enzymatic activity of SeMac, and the Asp294Ala mutation greatly decreases the enzymatic activity. SeMac does not inhibit opsonophagocytosis of S. equi by horse PMNs but opsonophagocytosis of GAS by human PMNs. Thus, SeMac is a cysteine endopeptidase with a limited activity against horse IgG and must have other function. Instructions: please typing these entity words according to sentence: IgG Endopeptidase, SeMac, Streptococcus equi Subspecies equi, Horse, Mac, group A Streptococcus, GAS, GAS, human, human, immunoglobulin G, IgG, horse, Streptococcus equi subspecies equi, Mac, SeMac, SeMac, SeMac, IgG endopeptidase, S. equi, horse, SeMac, Escherichia coli, Mice, S. equi, horses, S. equi, SeMac, SeMac, SeMac, human, IgG1, horse, SeMac, SeMac, S. equi, horse, GAS, human, SeMac, cysteine endopeptidase, horse, IgG Options: Organism, Protein
[ "B-Protein", "I-Protein", "B-Protein", "O", "O", "O", "O", "O", "B-Organism", "I-Organism", "I-Organism", "I-Organism", "O", "B-Organism", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "B-Organism", "I-Organism", "I-Organism", "O", "B-Organism", "O", "O", "O", "O", "B-Protein", "O", "B-Organism", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Organism", "B-Protein", "I-Protein", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Organism", "O", "B-Organism", "I-Organism", "I-Organism", "I-Organism", "O", "O", "O", "O", "B-Protein", "O", "B-Protein", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "B-Protein", "O", "B-Protein", "I-Protein", "O", "O", "O", "O", "O", "B-Organism", "I-Organism", "O", "B-Organism", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "B-Organism", "I-Organism", "O", "O", "O", "O", "O", "B-Organism", "O", "O", "B-Organism", "I-Organism", "O", "O", "B-Organism", "O", "O", "O", "O", "B-Organism", "I-Organism", "O", "O", "B-Protein", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "B-Organism", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "B-Organism", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "B-Organism", "I-Organism", "O", "B-Organism", "O", "O", "O", "O", "B-Organism", "O", "B-Organism", "O", "O", "O", "O", "B-Protein", "O", "O", "B-Protein", "I-Protein", "O", "O", "O", "O", "O", "B-Organism", "B-Protein", "O", "O", "O", "O", "O", "O", "O" ]
IgG Endopeptidase SeMac does not Inhibit Opsonophagocytosis of Streptococcus equi Subspecies equi by Horse Polymorphonuclear Leukocytes The secreted Mac protein made by group A Streptococcus (GAS) inhibits opsonophagocytosis of GAS by human polymorphonuclear leukocytes (PMNs). This protein also has the endopeptidase activity against human immunoglobulin G (IgG), and the Cys94, His262 and Asp284 are critical for the enzymatic activity. The horse pathogen Streptococcus equi subspecies equi produces a homologue of Mac (SeMac). SeMac was characterized to determine whether SeMac has IgG endopeptidase activity and inhibits opsonophagocytosis of S. equi by horse PMNs. The gene was cloned and recombinant SeMac was overexpressed in Escherichia coli and purified to homogeneity. Mice with experimental S. equi infection and horses with strangles caused by S. equi seroconverted to SeMac, indicating that SeMac is produced in vivo during infection. SeMac has endopeptidase activity against human IgG. However, the protein just cleaves a small fraction, which may be IgG1 only, of horse IgG. Replacement of Cys102 with Ser or His272 with Ala abolishes the enzymatic activity of SeMac, and the Asp294Ala mutation greatly decreases the enzymatic activity. SeMac does not inhibit opsonophagocytosis of S. equi by horse PMNs but opsonophagocytosis of GAS by human PMNs. Thus, SeMac is a cysteine endopeptidase with a limited activity against horse IgG and must have other function.
[ "IgG", "Endopeptidase", "SeMac", "does", "not", "Inhibit", "Opsonophagocytosis", "of", "Streptococcus", "equi", "Subspecies", "equi", "by", "Horse", "Polymorphonuclear", "Leukocytes", "\n", "The", "secreted", "Mac", "protein", "made", "by", "group", "A", "Streptococcus", "(", "GAS", ")", "inhibits", "opsonophagocytosis", "of", "GAS", "by", "human", "polymorphonuclear", "leukocytes", "(", "PMNs", ")", ".", "This", "protein", "also", "has", "the", "endopeptidase", "activity", "against", "human", "immunoglobulin", "G", "(", "IgG", ")", ",", "and", "the", "Cys94", ",", "His262", "and", "Asp284", "are", "critical", "for", "the", "enzymatic", "activity", ".", "The", "horse", "pathogen", "Streptococcus", "equi", "subspecies", "equi", "produces", "a", "homologue", "of", "Mac", "(", "SeMac", ")", ".", "SeMac", "was", "characterized", "to", "determine", "whether", "SeMac", "has", "IgG", "endopeptidase", "activity", "and", "inhibits", "opsonophagocytosis", "of", "S.", "equi", "by", "horse", "PMNs", ".", "The", "gene", "was", "cloned", "and", "recombinant", "SeMac", "was", "overexpressed", "in", "Escherichia", "coli", "and", "purified", "to", "homogeneity", ".", "Mice", "with", "experimental", "S.", "equi", "infection", "and", "horses", "with", "strangles", "caused", "by", "S.", "equi", "seroconverted", "to", "SeMac", ",", "indicating", "that", "SeMac", "is", "produced", "in", "vivo", "during", "infection", ".", "SeMac", "has", "endopeptidase", "activity", "against", "human", "IgG.", "However", ",", "the", "protein", "just", "cleaves", "a", "small", "fraction", ",", "which", "may", "be", "IgG1", "only", ",", "of", "horse", "IgG.", "Replacement", "of", "Cys102", "with", "Ser", "or", "His272", "with", "Ala", "abolishes", "the", "enzymatic", "activity", "of", "SeMac", ",", "and", "the", "Asp294Ala", "mutation", "greatly", "decreases", "the", "enzymatic", "activity", ".", "SeMac", "does", "not", "inhibit", "opsonophagocytosis", "of", "S.", "equi", "by", "horse", "PMNs", "but", "opsonophagocytosis", "of", "GAS", "by", "human", "PMNs", ".", "Thus", ",", "SeMac", "is", "a", "cysteine", "endopeptidase", "with", "a", "limited", "activity", "against", "horse", "IgG", "and", "must", "have", "other", "function", ".", "\n" ]
[ "Organism", "Protein" ]
IgG Endopeptidase, SeMac, Streptococcus equi Subspecies equi, Horse, Mac, group A Streptococcus, GAS, GAS, human, human, immunoglobulin G, IgG, horse, Streptococcus equi subspecies equi, Mac, SeMac, SeMac, SeMac, IgG endopeptidase, S. equi, horse, SeMac, Escherichia coli, Mice, S. equi, horses, S. equi, SeMac, SeMac, SeMac, human, IgG1, horse, SeMac, SeMac, S. equi, horse, GAS, human, SeMac, cysteine endopeptidase, horse, IgG
82_task2
Sentence: IgG Endopeptidase SeMac does not Inhibit Opsonophagocytosis of Streptococcus equi Subspecies equi by Horse Polymorphonuclear Leukocytes The secreted Mac protein made by group A Streptococcus (GAS) inhibits opsonophagocytosis of GAS by human polymorphonuclear leukocytes (PMNs). This protein also has the endopeptidase activity against human immunoglobulin G (IgG), and the Cys94, His262 and Asp284 are critical for the enzymatic activity. The horse pathogen Streptococcus equi subspecies equi produces a homologue of Mac (SeMac). SeMac was characterized to determine whether SeMac has IgG endopeptidase activity and inhibits opsonophagocytosis of S. equi by horse PMNs. The gene was cloned and recombinant SeMac was overexpressed in Escherichia coli and purified to homogeneity. Mice with experimental S. equi infection and horses with strangles caused by S. equi seroconverted to SeMac, indicating that SeMac is produced in vivo during infection. SeMac has endopeptidase activity against human IgG. However, the protein just cleaves a small fraction, which may be IgG1 only, of horse IgG. Replacement of Cys102 with Ser or His272 with Ala abolishes the enzymatic activity of SeMac, and the Asp294Ala mutation greatly decreases the enzymatic activity. SeMac does not inhibit opsonophagocytosis of S. equi by horse PMNs but opsonophagocytosis of GAS by human PMNs. Thus, SeMac is a cysteine endopeptidase with a limited activity against horse IgG and must have other function. Instructions: please extract entity words from the input sentence
[ "B-Protein", "I-Protein", "B-Protein", "O", "O", "O", "O", "O", "B-Organism", "I-Organism", "I-Organism", "I-Organism", "O", "B-Organism", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "B-Organism", "I-Organism", "I-Organism", "O", "B-Organism", "O", "O", "O", "O", "B-Protein", "O", "B-Organism", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Organism", "B-Protein", "I-Protein", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Organism", "O", "B-Organism", "I-Organism", "I-Organism", "I-Organism", "O", "O", "O", "O", "B-Protein", "O", "B-Protein", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "B-Protein", "O", "B-Protein", "I-Protein", "O", "O", "O", "O", "O", "B-Organism", "I-Organism", "O", "B-Organism", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "B-Organism", "I-Organism", "O", "O", "O", "O", "O", "B-Organism", "O", "O", "B-Organism", "I-Organism", "O", "O", "B-Organism", "O", "O", "O", "O", "B-Organism", "I-Organism", "O", "O", "B-Protein", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "B-Organism", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "B-Organism", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "O", "O", "O", "O", "O", "B-Organism", "I-Organism", "O", "B-Organism", "O", "O", "O", "O", "B-Organism", "O", "B-Organism", "O", "O", "O", "O", "B-Protein", "O", "O", "B-Protein", "I-Protein", "O", "O", "O", "O", "O", "B-Organism", "B-Protein", "O", "O", "O", "O", "O", "O", "O" ]
IgG Endopeptidase SeMac does not Inhibit Opsonophagocytosis of Streptococcus equi Subspecies equi by Horse Polymorphonuclear Leukocytes The secreted Mac protein made by group A Streptococcus (GAS) inhibits opsonophagocytosis of GAS by human polymorphonuclear leukocytes (PMNs). This protein also has the endopeptidase activity against human immunoglobulin G (IgG), and the Cys94, His262 and Asp284 are critical for the enzymatic activity. The horse pathogen Streptococcus equi subspecies equi produces a homologue of Mac (SeMac). SeMac was characterized to determine whether SeMac has IgG endopeptidase activity and inhibits opsonophagocytosis of S. equi by horse PMNs. The gene was cloned and recombinant SeMac was overexpressed in Escherichia coli and purified to homogeneity. Mice with experimental S. equi infection and horses with strangles caused by S. equi seroconverted to SeMac, indicating that SeMac is produced in vivo during infection. SeMac has endopeptidase activity against human IgG. However, the protein just cleaves a small fraction, which may be IgG1 only, of horse IgG. Replacement of Cys102 with Ser or His272 with Ala abolishes the enzymatic activity of SeMac, and the Asp294Ala mutation greatly decreases the enzymatic activity. SeMac does not inhibit opsonophagocytosis of S. equi by horse PMNs but opsonophagocytosis of GAS by human PMNs. Thus, SeMac is a cysteine endopeptidase with a limited activity against horse IgG and must have other function.
[ "IgG", "Endopeptidase", "SeMac", "does", "not", "Inhibit", "Opsonophagocytosis", "of", "Streptococcus", "equi", "Subspecies", "equi", "by", "Horse", "Polymorphonuclear", "Leukocytes", "\n", "The", "secreted", "Mac", "protein", "made", "by", "group", "A", "Streptococcus", "(", "GAS", ")", "inhibits", "opsonophagocytosis", "of", "GAS", "by", "human", "polymorphonuclear", "leukocytes", "(", "PMNs", ")", ".", "This", "protein", "also", "has", "the", "endopeptidase", "activity", "against", "human", "immunoglobulin", "G", "(", "IgG", ")", ",", "and", "the", "Cys94", ",", "His262", "and", "Asp284", "are", "critical", "for", "the", "enzymatic", "activity", ".", "The", "horse", "pathogen", "Streptococcus", "equi", "subspecies", "equi", "produces", "a", "homologue", "of", "Mac", "(", "SeMac", ")", ".", "SeMac", "was", "characterized", "to", "determine", "whether", "SeMac", "has", "IgG", "endopeptidase", "activity", "and", "inhibits", "opsonophagocytosis", "of", "S.", "equi", "by", "horse", "PMNs", ".", "The", "gene", "was", "cloned", "and", "recombinant", "SeMac", "was", "overexpressed", "in", "Escherichia", "coli", "and", "purified", "to", "homogeneity", ".", "Mice", "with", "experimental", "S.", "equi", "infection", "and", "horses", "with", "strangles", "caused", "by", "S.", "equi", "seroconverted", "to", "SeMac", ",", "indicating", "that", "SeMac", "is", "produced", "in", "vivo", "during", "infection", ".", "SeMac", "has", "endopeptidase", "activity", "against", "human", "IgG.", "However", ",", "the", "protein", "just", "cleaves", "a", "small", "fraction", ",", "which", "may", "be", "IgG1", "only", ",", "of", "horse", "IgG.", "Replacement", "of", "Cys102", "with", "Ser", "or", "His272", "with", "Ala", "abolishes", "the", "enzymatic", "activity", "of", "SeMac", ",", "and", "the", "Asp294Ala", "mutation", "greatly", "decreases", "the", "enzymatic", "activity", ".", "SeMac", "does", "not", "inhibit", "opsonophagocytosis", "of", "S.", "equi", "by", "horse", "PMNs", "but", "opsonophagocytosis", "of", "GAS", "by", "human", "PMNs", ".", "Thus", ",", "SeMac", "is", "a", "cysteine", "endopeptidase", "with", "a", "limited", "activity", "against", "horse", "IgG", "and", "must", "have", "other", "function", ".", "\n" ]
[ "Organism", "Protein" ]
NF - kappa B is a Entity, I kappa B alpha is a Protein, phosphatase 2A - sensitive sites is a Entity, NF - kappa B is a Entity, I kappa B alpha is a Protein, I kappa B alpha is a Protein, I kappa B alpha is a Protein, NF - kappa B heterodimer is a Entity, I kappa B alpha is a Protein, tumor necrosis factor alpha is a Protein, TNF - alpha is a Protein, I kappa B alpha is a Protein, TNF - alpha is a Protein, I kappa B alpha is a Protein, NF - kappa B is a Entity, I kappa B alpha is a Protein, TNF - alpha is a Protein, I kappa B alpha is a Protein, I kappa B alpha is a Protein, I kappa B alpha is a Protein, TNF - alpha is a Protein, I kappa B alpha is a Protein, proteasome is a Entity
780_task0
Sentence: Activation of NF-kappa B by phosphatase inhibitors involves the phosphorylation of I kappa B alpha at phosphatase 2A-sensitive sites. Activation of NF-kappa B by various cellular stimuli involves the phosphorylation and subsequent degradation of its inhibitor, I kappa B alpha, although the underlying mechanism remains unclear. In the present study, the role of serine/threonine phosphatases in the regulation of I kappa B alpha phosphorylation was investigated. Our studies demonstrate that incubation of human T cells with low concentrations (approximately 1-5 nM) of calyculin A or okadaic acid, potent inhibitors of protein phosphatase type 1 (PP-1) and type 2A (PP-2A), induces the phosphorylation of I kappa B alpha even in the absence of any cellular stimulus. This action of the phosphatase inhibitors, which is associated with the activation of the RelA.p50 NF-kappa B heterodimer, is not affected by agents that block the induction of I kappa B alpha phosphorylation by tumor necrosis factor alpha (TNF-alpha). Furthermore, the phosphorylated I kappa B alpha from calyculin A-treated cells, but not that from TNF-alpha-stimulated cells, is sensitive to PP-2A in vitro, suggesting the existence of fundamental differences in the phosphorylation of I kappa B alpha induced by the two different NF-kappa B inducers. However, induction of I kappa B alpha phosphorylation by both TNF-alpha and the phosphatase inhibitors is associated with the subsequent degradation of I kappa B alpha. We further demonstrate that TNF-alpha- and calyculin A-induced I kappa B alpha degradation exhibits similar but not identical sensitivities to a proteasome inhibitor. Together, these results suggest that phosphorylation of I kappa B alpha, mediated through both the TNF-alpha-inducible and the PP-2A-opposing kinases, may serve to target I kappa B alpha for proteasome-mediated degradation. Instructions: please extract entities and their types from the input sentence, all entity types are in options Options: Entity, Protein
[ "O", "O", "B-Entity", "I-Entity", "I-Entity", "I-Entity", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "B-Entity", "I-Entity", "I-Entity", "I-Entity", "I-Entity", "O", "O", "O", "O", "B-Entity", "I-Entity", "I-Entity", "I-Entity", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Entity", "I-Entity", "I-Entity", "I-Entity", "I-Entity", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "B-Protein", "I-Protein", "I-Protein", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "O", "O", "O", "O", "B-Entity", "I-Entity", "I-Entity", "I-Entity", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "O", "B-Protein", "I-Protein", "I-Protein", "I-Protein", "O", "B-Entity", "O", "O", "O", "O", "O" ]
Activation of NF-kappa B by phosphatase inhibitors involves the phosphorylation of I kappa B alpha at phosphatase 2A-sensitive sites. Activation of NF-kappa B by various cellular stimuli involves the phosphorylation and subsequent degradation of its inhibitor, I kappa B alpha, although the underlying mechanism remains unclear. In the present study, the role of serine/threonine phosphatases in the regulation of I kappa B alpha phosphorylation was investigated. Our studies demonstrate that incubation of human T cells with low concentrations (approximately 1-5 nM) of calyculin A or okadaic acid, potent inhibitors of protein phosphatase type 1 (PP-1) and type 2A (PP-2A), induces the phosphorylation of I kappa B alpha even in the absence of any cellular stimulus. This action of the phosphatase inhibitors, which is associated with the activation of the RelA.p50 NF-kappa B heterodimer, is not affected by agents that block the induction of I kappa B alpha phosphorylation by tumor necrosis factor alpha (TNF-alpha). Furthermore, the phosphorylated I kappa B alpha from calyculin A-treated cells, but not that from TNF-alpha-stimulated cells, is sensitive to PP-2A in vitro, suggesting the existence of fundamental differences in the phosphorylation of I kappa B alpha induced by the two different NF-kappa B inducers. However, induction of I kappa B alpha phosphorylation by both TNF-alpha and the phosphatase inhibitors is associated with the subsequent degradation of I kappa B alpha. We further demonstrate that TNF-alpha- and calyculin A-induced I kappa B alpha degradation exhibits similar but not identical sensitivities to a proteasome inhibitor. Together, these results suggest that phosphorylation of I kappa B alpha, mediated through both the TNF-alpha-inducible and the PP-2A-opposing kinases, may serve to target I kappa B alpha for proteasome-mediated degradation.
[ "Activation", "of", "NF", "-", "kappa", "B", "by", "phosphatase", "inhibitors", "involves", "the", "phosphorylation", "of", "I", "kappa", "B", "alpha", "at", "phosphatase", "2A", "-", "sensitive", "sites", ".", "\n", "Activation", "of", "NF", "-", "kappa", "B", "by", "various", "cellular", "stimuli", "involves", "the", "phosphorylation", "and", "subsequent", "degradation", "of", "its", "inhibitor", ",", "I", "kappa", "B", "alpha", ",", "although", "the", "underlying", "mechanism", "remains", "unclear", ".", "In", "the", "present", "study", ",", "the", "role", "of", "serine", "/", "threonine", "phosphatases", "in", "the", "regulation", "of", "I", "kappa", "B", "alpha", "phosphorylation", "was", "investigated", ".", "Our", "studies", "demonstrate", "that", "incubation", "of", "human", "T", "cells", "with", "low", "concentrations", "(", "approximately", "1", "-", "5", "nM", ")", "of", "calyculin", "A", "or", "okadaic", "acid", ",", "potent", "inhibitors", "of", "protein", "phosphatase", "type", "1", "(", "PP-1", ")", "and", "type", "2A", "(", "PP-2A", ")", ",", "induces", "the", "phosphorylation", "of", "I", "kappa", "B", "alpha", "even", "in", "the", "absence", "of", "any", "cellular", "stimulus", ".", "This", "action", "of", "the", "phosphatase", "inhibitors", ",", "which", "is", "associated", "with", "the", "activation", "of", "the", "RelA.p50", "NF", "-", "kappa", "B", "heterodimer", ",", "is", "not", "affected", "by", "agents", "that", "block", "the", "induction", "of", "I", "kappa", "B", "alpha", "phosphorylation", "by", "tumor", "necrosis", "factor", "alpha", "(", "TNF", "-", "alpha", ")", ".", "Furthermore", ",", "the", "phosphorylated", "I", "kappa", "B", "alpha", "from", "calyculin", "A", "-", "treated", "cells", ",", "but", "not", "that", "from", "TNF", "-", "alpha", "-", "stimulated", "cells", ",", "is", "sensitive", "to", "PP-2A", "in", "vitro", ",", "suggesting", "the", "existence", "of", "fundamental", "differences", "in", "the", "phosphorylation", "of", "I", "kappa", "B", "alpha", "induced", "by", "the", "two", "different", "NF", "-", "kappa", "B", "inducers", ".", "However", ",", "induction", "of", "I", "kappa", "B", "alpha", "phosphorylation", "by", "both", "TNF", "-", "alpha", "and", "the", "phosphatase", "inhibitors", "is", "associated", "with", "the", "subsequent", "degradation", "of", "I", "kappa", "B", "alpha", ".", "We", "further", "demonstrate", "that", "TNF", "-", "alpha-", "and", "calyculin", "A", "-", "induced", "I", "kappa", "B", "alpha", "degradation", "exhibits", "similar", "but", "not", "identical", "sensitivities", "to", "a", "proteasome", "inhibitor", ".", "Together", ",", "these", "results", "suggest", "that", "phosphorylation", "of", "I", "kappa", "B", "alpha", ",", "mediated", "through", "both", "the", "TNF", "-", "alpha", "-", "inducible", "and", "the", "PP-2A", "-", "opposing", "kinases", ",", "may", "serve", "to", "target", "I", "kappa", "B", "alpha", "for", "proteasome", "-", "mediated", "degradation", ".", "\n" ]
[ "Entity", "Protein" ]