cases
listlengths 1
37
| article_id
stringlengths 8
11
|
|---|---|
[
{
"age": 61,
"case_id": "PMC2790183_01",
"case_text": "This is the case of 61-year-old African-American woman with a history of depression and anxiety who presented to the emergency room in May 2008 with an acute episode of left-sided chest pain/pressure with associated shortness of breath, diaphoresis, and an impending sense of doom lasting 2-3 minutes. There was no identifiable precipitant to this event.\nShe was admitted and placed on a cardiac telemetry monitoring. In the hospital, she was free of chest pain. The electrocardiogram, telemetry, and serial cardiac enzymes did not reveal myocardial infarction or any acute cardiac event. There was no family history of coronary artery disease. Medical history included hypertension, obesity, sleep apnea, and a history of smoking (quit 10 years prior) and alcohol abuse (from age 40 to 51). During hospitalization, the patient voiced concern that her chest pain may have been related to a recent recurrence of depressive symptoms. She recalled having similar chest pain 10 years ago. At that time, she had had cardiac testing including angiography, which was normal, and the pain was diagnosed as panic attacks. At that time (10 years ago) some relief was provided by diazepam and sertraline. As a young adult, the patient described low-level depression with suicidal ideation. Her other past psychiatric medications included fluoxetine, buspirone, trazodone, and risperidone. Her family psychiatric history included a father with depression, a brother with alcohol abuse, and one son with depression, alcohol abuse, and completed suicide (7 years ago). At the time of hospitalization, the patient was divorced with one living son. At discharge, she was scheduled for an outpatient stress test.\nSix days after hospitalization, she was seen in the medical clinic. She was free of chest pain but reported depression with decreased energy, lethargy, and decreased interest in activities. Therapy was started with 25 mg of sertraline for 2 weeks, which was titrated up to 50 mg at week 3. A referral was made to the psychiatry department.\nOne month after being started on sertraline (early June), she was seen in psychiatry clinic. At that time, she was tolerating 50 mg of sertraline but without much benefit. She described depression with anergia and a lower level of anxiety than she had previously in psychiatric care years ago. She also reported 2 episodes of chest pain with tremor and sensation of heart racing in the past month. Laboratory analyses were ordered to rule out organic fatigue, and a referral was made to a sleep clinic as she had been diagnosed with sleep apnea 8 years before by a polysomnogram (PSG) test, but failed to follow up. Bupropion (Bupropion SR, 100 mg) was added to sertraline to address her depression with anergia, and alprazolam was given for anxiety as needed. Two and a half weeks after being started on bupropion the patient was still complaining of depression and fatigue, and bupropion was increased to 150 mg.\nThree weeks after the bupropion dose change, the PSG results came back revealing sleep apnea, and the patient was placed on continuous positive airway pressure (CPAP) therapy. A week after PSG results were received, during her sleep clinic appointment, the patient experienced substernal chest pain with pressure radiating down her left arm. The physician from the sleep clinic made a referral to cardiology, as she had failed a previous appointment for cardiology and a stress test. In a psychiatric follow-up (one week after her sleep clinic appointment), she was feeling much better, including improved mood and less fatigue and anxiety.\nOne week later, the patient was seen in the cardiology outpatient clinic describing a 3-month history of frequent (10 or 15) episodes of severe midsternal chest pain lasting 5 to 10 minutes that was associated with left arm weakness. The symptoms were neither exercise-induced nor predictable. The symptoms were extremely anxiety-provoking but she reported no associated diaphoresis or shortness of breath. The electrocardiogram revealed sinus rhythm and left ventricular hypertrophy. The cholesterol panel was unremarkable. Due to worrisome clinical presentation, coronary angiography was performed. The coronary arteries were angiographically normal. There were no wall motion abnormalities, and the ejection fraction was normal. The patient was discharged with a cardiac event monitor. Within 5 days the patient experienced two recurrences of her symptoms. The event monitor revealed ST elevations that were associated with anxiety-provoking chest pain (Figure 1). There were no significant changes in heart rate and no arrhythmias were recorded. The patient was diagnosed with vasospastic (Printzmetal's or variant) angina and started on amlodipine (2.5 mg daily) and isosorbide mononitrate (30 mg daily). \nIn a subsequent psychiatric follow-up, the patient was free of chest pain and panic attacks. Bupropion was tapered off, and sertraline was increased to 75 mg daily because it was feared that bupropion could contribute to or worsen her coronary vasospasm.",
"gender": "Female"
}
] |
PMC2790183
|
[
{
"age": 49,
"case_id": "PMC7490825_01",
"case_text": "A 49 year-old-man visited our hospital with abdominal bloating and lower abdominal mass for 2 years duration. He had no significant medical history and no family history. A fist-sized mass was palpated on his lower right abdomen. Abdominal computed tomography (CT) showed a huge, 17-cm pelvic tumor with a mixture of cystic and subcapsular parenchymal lesions, which had spooled up the terminal ileum (Fig. 1A-C). Simultaneously, a cord-like material leading to a tumor from the umbilical region was observed (Fig. 1D). On abdominal magnetic resonance imaging (MRI), the cystic tumor lumen exhibited a partition-wall structure, and both T1/T2-weighted images showed low- and high-intensity signals for the parenchymal lesion and the liquid component, respectively; furthermore, the tumor had a mosaic-like pattern (Fig. 1E and F). Total colonoscopy revealed no lesions in the colon; however, the ileal lumen on the ileocecal valve side was highly edematous, and the endoscope did not pass through. Therefore, we were unable to perform a biopsy of the tumor. Chest CT showed no specific findings such as lung metastases.\nAccordingly, we diagnosed the lesion as a huge pelvic tumor, possibly originated from the terminal ileum and connected to the umbilicus.\nBecause of the obstruction of the terminal ileum due to tumor progression, we performed a semi-urgently laparotomy. Intraoperative findings showed a cord covered with preperitoneal adipose tissue between the huge cystic tumor and the umbilicus (Fig. 2A). The localized tumor extensively adhered and spread over the right urinary bladder and on the surface of the right retroperitoneum. Tumor detachment from the urinary bladder and retroperitoneal tissue was possible. However, tumor detachment from the ileum, which was considered to be in a tumor-invaded region 60 cm from the ileocecal area, was impossible. Therefore, we resected this huge cystic tumor together with the invading ileum and the ileocecum (Fig. 2B).\nThe tumor was 22 x 13.6 x 12.5 cm in size (Fig. 3A) and invaded the ileum (Fig. 3B). The cystic lesion was surrounded by a fibrous cystic wall and filled with ocherous porridge-like contents (Fig. 3C). In invaded ileal regions, the tumor seemed to be sub-totally exposed to the mucosal surface over the lumen of the ileum, causing obstruction. However, the tumor growth itself appeared not from the ileal mucosa but from the lower part of the ileal mucosa or outside the ileal lumen to induce proliferation and invasion, which, ultimately, induced bowel obstruction (Fig. 3D).\nOn histopathological examination, obstructed ileal lesions, cystic wall lesions and porridge-like contents were all diagnosed as moderately differentiated tubular adenocarcinoma (Fig. 4A-C), and the immunohistochemical analysis with cytokeratin 7(-)/cytokeratin 20(++) confirmed that it was the adenocarcinoma originated from the digestive tract (Fig. 4D and E). The ileal mesenteric lymph node metastases were positive. As for the retrieval cord connecting the tumor from the umbilicus, stumps were missing during specimen fixation; hence, histopathological examination was impossible.\nConsidering that the cord extending from the umbilicus was connected to the tumor and that the tumor invaded the terminal ileum, we made a diagnosis of MD adenocarcinoma accompanied with the umbilical side of VDR and the huge cystic lesion bloated by tumor components filling up the duct due to cancer progression.\nThe postoperative course was uneventful and his abdominal symptoms also disappeared. He was discharged on the 12th day after surgery and postoperative adjuvant chemotherapy was performed for 6 months postoperation without complications. However, 4 months after the administration, the recurrence of multiple para-superior mesenteric artery lymph nodes and peritoneal dissemination appeared; therefore, the patient is currently receiving a second-line chemotherapy regimen.",
"gender": "Male"
}
] |
PMC7490825
|
[
{
"age": 14,
"case_id": "PMC9681893_01",
"case_text": "This study was reported under the principle of the CARE guideline. On April 18, 2022, a 14-year-old male was referred to West China Hospital for further investigations regarding the diagnosis of an intraabdominal mass. He had been experiencing recurrent dull abdominal pain for 8 months, which became aggravated one month ago. Persistent pain concentrated around the umbilicus for 1 to 2 hours, with gradual relief after resting. Any concomitant symptom, including fever, chill, vomiting, nausea, melena, and diarrhea, was denied. The patient reported unremarkable past medical history and family medical history. Physical examination revealed a palpable mass extending from the epigastric to the hypogastric region, particularly on the right side of the umbilicus. Neither routine laboratory investigations nor tumor marker testing revealed any abnormalities ( Table 1 ). Computed tomography (CT) showed a clumpy cystic low-density lesion on the right mesocolon (maximum cross-section,7.8x5.1cm). No enhancement was observed on contrast-enhanced CT, and the adjacent mesangial lymph nodes were slightly enlarged, suspecting a cyst lymphangioma ( Figure 1 ). To confirm the diagnosis and relieve symptoms, a laparoscopic operation was performed on April 25, 2022.\nUnder general anesthesia, a laparoscopic procedure was performed by transperitoneal approach. The patient assumed a supine position. A Veress needle was used to establish pneumoperitoneum, maintaining a constant pressure at 13 mmHg. Two 12-mm trocars were respectively inserted on the right and left side of the abdomen, 5cm below the umbilicus. The operation was carried out using an ultrasonic surgical aspirator (CUSA; Cavitron Laser-sonic Corp., Stamford, Connecticut, USA), harmonic scalpel (Ethicon Endo-Surgery, Inc., Blue Ash, Cincinnati, OH, USA), and a bipolar clamp coagulation system (ERBE, Tubingen, Germany). A large cystic mass covered the right mesocolon was found intraoperatively. The upper margin of the lesion reached the descending part of the duodenum, and the lower margin reached the beginning of the right common iliac artery. The lesion was carefully isolated from the surrounding tissue and then stripped from the capsule through blunt dissection. Colonic resection was not done. Tumor was completely excised and the resection specimen was collected in a plastic bag and removed via a 5-cm subxiphoid incision. After ensuring that there was no active bleeding in the abdominal cavity, a drainage tube was placed in the retroperitoneal space. At the end of the procedure, instruments were counted, trocars were removed, pneumoperitoneum was evacuated, and the incisions were sutured. The operation took 135 minutes and the blood loss was estimated at 20ml.\nGross specimens showed that the mass was measured at 8x7cm with line-like septal shadow, irregular shapes, and mainly cystic components. The cyst wall was irregularly thickened with clear and transparent cyst fluid. Histological analysis confirmed the final diagnosis of mesocolic cystic lymphangioma ( Figure 2 ).\nThe patient had no postoperative complications and abdominal pain symptoms disappeared dramatically after the procedure. He recovered uneventfully following the surgery and was discharged home on the fifth postoperative day. He and his family were satisfied with the outcome and receptive to the follow-up recommendations. No evidence of recurrence was found during the 3-month follow-up period.",
"gender": "Male"
}
] |
PMC9681893
|
[
{
"age": 57,
"case_id": "PMC4643349_01",
"case_text": "A 57-year old woman with a 6 h anamnesis of cramp-like diffuse abdominal pain and minor vomiting was admitted to the department for surgical emergency at midnight. The patient was known with Type 1 diabetes and diabetic neuropathy but otherwise healthy. The only prior surgery was a laparoscopic tubal sterilization. She had no recent travels.\nThe patient was afebrile, pulse; blood pressure and saturation were stable and all within normal range. On clinical examination the abdomen was found with diffuse tenderness but no defense. The pain subsided after IV morphine. Basic biochemistry was normal, White Cell count and CRP was 4.5 x 109 and <3 mg/L respectively (Normal values 3, 3-8, 8 x 109 and <5 mg/L respectively). There was no sign of liver dysfunction.\nThe next morning (8 h post admission) the abdominal pain was more intense and severe. An abdominal computed tomography (CT) scan was performed showing small bowel obstruction. At the subsequent laparotomy small bowel strangulation approximately 1 m from the ligament of Treitz was found. The strangulation was only a few millimeters wide and was due to adhesions from previous surgery. The bowel was found viable without signs of incarceration, perforation or peritoneal contamination. The liver was normal on palpation and inspection. The adhesions were resected and no further surgery was performed. No per- or post-operative antibiotics were initiated. The patient had an uncomplicated recovery, and was discharged 3 days later.\n24 h after discharge, the patient was readmitted complaining of headache, dyspnea, fever and abdominal discomfort. The pulse was 90, temperature was 39.1 C, and saturation was 95%. Except for a direct tenderness located at the right upper abdominal quadrant the clinical examination was without objective findings. Biochemistry showed an elevated d-dimer (4.3 mg/L, normal values <0.5 mg/L) but no signs of liver dysfunction or infection (white cell count = 7.5 x 109/L; CRP = 7 mg/L). A spiral CT of the chest was negative for pulmonary embolism.\nThe day after the readmission the patient's white cell count and CRP increased to 17.8 x 109/L and 147 mg/L, respectively. Thus, treatment with I.V. Metronidazol 500 mg and Piperacillin/Tazocin 4 g/0.5 g was initiated on suspicion of post-operative infection. The patient become afebrile and felt better. Two days after initiation of antibiotics the patient complained of severe abdominal pain and cramping. An abdominal CT showed dilated intrahepatic bile ducts in the right hepatic lobe and several hepatic abscesses up to 5 cm (Fig. 1), which were not present on the initial CT scan. At ultra-sound the abscesses were not found accessible for puncture or drainage. Thus, conservative treatment with antibiotics was decided. The patient was discharged after 9 days and a follow-up ultrasound after additional 14 days found the abscesses diminished in size to 1.2 cm. The patient was asymptomatic and was discharged without further follow-up.",
"gender": "Female"
}
] |
PMC4643349
|
[
{
"age": 61,
"case_id": "PMC3581863_01",
"case_text": "Lucille was 61 years old. She was of white race with graying blond, curly hair. She was 5 ft 2 in. tall and weighed 222 lbs. She moved slowly due to chronic back and leg pain and used a mobility cane and occasionally a walker. She said she had been diagnosed with arthritis, diabetes, and moderate kidney damage from long-term non-steroidal anti-inflammatory drug use. She also said she had a knee replacement and several back surgeries. She said she was unable to stand for 20 min, bend from a standing position, walk a quarter of a mile, or climb stairs. She said she had been incontinent since a hysterectomy was done in her mid 20s. She said she was unable to pull trash out of the can, mow her lawn, wash her dishes, hang up her clothes, or make her bed.",
"gender": "Female"
},
{
"age": 57,
"case_id": "PMC3581863_02",
"case_text": "Jocelyn said she was 57 years old. She was of white race with blond, straight, short hair. She was 5 ft 51/2 in. tall and weighed 250 pounds. She spoke of having a Bachelor's degree in English literature and a technical writing degree. She reported she had been divorced twice. She said she had been through menopause and never had children. Jocelyn said she was also visually impaired, and had lived with narrow angle glaucoma and optic nerve atrophy with associated visual loss since birth, which she characterized as legally blind. She said she was diagnosed at age 10. Jocelyn had reportedly lost abilities to perform many activities independently by age 35; up until that point she said she had been able to compensate for her vision loss and prevent further loss with the use of daily marijuana. She described herself as legally blind since childhood. Before moving to this rural region, she described frequenting known dealers in the urban area where she lived in order to obtain free marijuana. Once she decided to leave her husband, who she said abused and neglected her for being visually impaired, she believed she also left her marijuana contacts. Afterwards, she described losing all vision.\nIn order to portray the sisters' experience of living with multiple morbidity and functional limitations, we will briefly explain the major themes (Table 1) of their lives as they conveyed them from childhood to the present. Overall, the themes build to describe the sisters' perceptions of multiple morbidity and functional limitations, which was described as a series of losses, recoveries and re-engagement. Each loss of ability within a new functional category (e.g. sensory, mobility, cognitive, emotional) was unique and required a new skill set to manage. An exacerbation of a previous functional limitation was not the same experience as a new functional limitation. The tools for the management of an exacerbation were learned and in place. The tools for the management of a new functional loss were not yet established. In this case, acquiring a new functional limitation, while simultaneously managing or trying to cure prior limitations, was difficult to manage in the context of limited resources. The choice of how to adapt was critical along every step of the life course.\nJocelyn and Lucille were \"raised a very puritanical Christian by a mother who was a Nazarene and a daddy who was of the Church of God.\" They were taught \"no smoking, no drinking, no dancing, no nothing. No cards, no swearing, and you didn't cut your hair, you dressed very modestly.\" Lucille stated that they \"were raised like depression kids.\" They worked on the farm and ate what they raised. Lucille's memories were scattered, but Jocelyn's memories of childhood neglect were vivid.\nGrowing up, Jocelyn slept in a dresser drawer. Jocelyn said that her mother had \"gotten rid of the crib. I didn't have a high chair because she had gotten rid of it, because she thought she had gone through menopause and she couldn't get pregnant.\" Later, when Jocelyn was discovered to have limitations to her senses, her mother ignored it because she believed that such problems could be attributed only to sin, and, if present, could be overcome by faith. Jocelyn, however, could not smell, and she had limited sight. In response, her family did not recognize her unique needs and often left her unattended. At the young age of 3 years, she drank a large amount of kerosene. She said, \"I basically died. I can vaguely remember them making me vomit. I wasn't breathing and I basically died. And I remember coming back into my body:I didn't want to. It hurt!\" To sum up her childhood, Jocelyn paused and said, \"So you know, talk about your unwanted child.\"",
"gender": "Female"
},
{
"age": 4,
"case_id": "PMC3581863_03",
"case_text": "In response to Jocelyn's poisoning, Jocelyn said Lucille was \"put in charge of me [at] about three or four years old to make sure I didn't get in trouble, I didn't get lost, or I didn't fall off the neighbor's porch and hurt myself anymore or pull something off on my head. She was kind of made responsible for me.\" Lucille said they \"were a team\" and had become Jocelyn's \"sighted assistance to help me do my, my work. And uh, I was expected to work. It's just that, you know, sister [the nickname Jocelyn was given] needed more help.\" Jocelyn recalled going to Lucille for help more often than to her mother. She had developed an altered dependence on Lucille, who was only 4 years older than she.\nJocelyn said, \"My mother had this hard time accepting it. And so she'd say, \"I'm not raising you to be a blind person. Well, I was, but I wasn't. You know what I mean? Put a lot of pressure on me.\" After all, she said, \"it was a shame. It was a shameful thing. And she'd say, you're not blind, you just don't see very well.\" From this, Jocelyn learned to pass for sighted. Passing, however, left her feeling alone. It limited her abilities because she had to pretend that she was the same as everyone else. Passing encouraged self-neglect. Jocelyn had to claim a visual impairment to gain help with that impairment. Lucille was her only accommodation. She said, \"I grew up just limiting myself to what I could accomplish on my own. It definitely limited me, socially and physically.\"\nAnd see I fought this all my life this idea of my life being limited by my blindness. It is why I left home at 18 because I knew if I stayed at home I would never go anywhere, I would never do anything, I would never go to school. I would live out there on that farm and take care of mother and daddy and that would be it.\nJocelyn recalled that during her childhood she was kept away from mainstream culture. She referred to herself as a \"straight arrow,\" an adolescent who did not represent the counter-culture of the 1960s. Instead, she thought of herself as someone a viewer might expect to \"walk out of the 70s show Little House on the Prairie\". She stated, \"Between me struggling to do my schoolwork and being considered kind of a weirdo because of the way I dressed, and you know, in the sixties the psychedelics ... I did not fit in.\" Lucille, on the other hand, described herself as a \"farmhand\" who smelled like \"cow poop,\" someone she thought the opposite sex did not find attractive. In reaction to these feelings of estrangement from the world and a desire to fit in, Jocelyn said she left home at 18 and Lucille said she married the first man who came along. Jocelyn said, \nThe two sisters were separated from their family of origin, including each other, during their young adulthood. Although this time was described as full of promise and many dreams, they were just out of reach for Jocelyn. While Lucille was establishing a family, a joint business with her husband, and a \"wonderland of a home,\" Jocelyn was struggling to become educated and employed. She had been a nurse's aide in high school, but because of her vision she was not accepted into nursing school. When she went to college, she received a Bachelor's degree in English. After graduation, Jocelyn was eager for employment. She wanted a job working for a magazine. She said, \"the only job I could get is in classified advertising, answering the phone and taking ads. Well, I thought okay, it's a job.\" She wanted to further her education by gaining a graduate degree, thinking life would improve with advanced education, but her loans had defaulted because of nonpayment. Her job paid poorly. She couldn't afford tuition without more student loans. Social relations were also difficult. She said, \"I often offended a lot of people because they thought I was terribly rude because I didn't see them. Because they were fifteen feet away. 'Well, I waved at you but you didn't. You were looking right at me.' It's because I didn't see them.\" Jocelyn viewed life's benefits as just out of reach.\nAnd sometimes I'll think, you know, when I used these real bad medicines I used to have to wait for the, the effects would make me blind. They'd take away, make my vision so blurry I couldn't see, so I'd have to wait until I got to where I could see better. And sometimes I'll think, I better not wait, what are you waiting for?\nJocelyn tried to cure her blindness throughout most of her adult life. Her worst vision was in her left eye. Each time her left eye worsened, however, her right eye would worsen 6 to 8 months later. Researchers offered therapies; she said she enrolled in too many experimental studies to be remembered. Doctors offered surgeries, a total of four on one eye. Of the treatments she said, By the time of the last reparative surgery she said she was left with what she described as a \"peephole.\" Through it, she said, she \"could see like across the street but I couldn't see my hand.\" The peephole closed when she was 49 years of age.\nMany battles were fought by the sisters, the same fights many women have known. While Jocelyn was battling her vision and abusive relationships, Lucille was battling to overcome depression and to maintain a family and employment in the face of worsening mobility. After the birth of her son, Lucille experienced the onset of postpartum depression, which she said left her unable to care for her son. She also said she had difficulty maintaining relations with her spouse due to an infected episiotomy incision. And it was \"not too long after my son was born I had a prolapsed uterus. And it was sticking out my bottom.\" She said, \"We'd have sex but it, it really hurt. And, finally went ahead [crying] and had it taken care of, but by that time, it wasn't 6 months to a year after that. Everybody in the neighborhood knew it but me, the old story\": Her husband had an affair and asked her to leave. He kept their home, business, and son. She recovered and began anew as a secretary.\nOver the ensuing years, Lucille said her battle with depression never abated. Instead, it was made worse by osteoarthritis of the knees, a series of car accidents, and work place injuries, which left her functionally limited with chronic pain. She had multiple surgeries to maintain function. Eventually, she said she was forced out of her job by supervisors who viewed her injuries as trivial. On one memorable occasion, she said she was called into her boss's office to defend her physician's determination of workplace functional limitations. She said, \"They kept pushing me and pushing me and pushing me. They made me feel like I really wasn't needed. So, I left.\"\nMeanwhile, Jocelyn had married two men, one at 19 and the other at 35, both of whom were abusive. She said of her first husband, \"The blinder I got, the worse he got.\" She found no support from him. She said, \"And my husband came to pick me up from that appointment and I said, I told him what the doctor had said. I was, of course, very upset. She said he pulled over to the side of the road and he said, 'well, that just cuts it. I'm not going to put up.' And he left that night, and moved out. He left me. He left me.\" She said her second husband could not tolerate her vision loss either. She said he pushed her down stairs and refused to tell her when obstacles were in her path. And as her vision worsened, she thought, \"and I was going through this vision thing. And I was losing my sight, bad enough, but I'm having to deal with this man that can't handle it.\" She said her husband thought she faked her blindness for attention. She quipped, \"I'd say who would want to get attention falling over a newspaper rack. That doesn't make any sense to me.\" She said, \"You don't get mad at me because there's a stain on your shirt that I didn't see, because I can't see it.\" She described herself as desperate and nervous. She said she was losing the last of her pinhole of visual light and she said, \"I want to do it in peace.\"\nWhen Jocelyn decided to leave her spouse, she said she made the decision to give up all expectation of vision. With the separation from her spouse, she abandoned the lifestyle that enabled her self-treatment with marijuana. Despite the prescription she carried with her, she knew it a risk. Although in the city she had access to a medical marijuana society, she no longer had that in the rural community. She feared arrest and marijuana contamination with other drugs. Further, financially she couldn't afford it. She laughed, \"It's like, what if I get busted, the blind lady and her dog. Do I get to keep my dog?\" So, she stopped the only therapy she believed maintained her vision and relieved her ocular pain. She said, \"And when I moved out here, I also made a choice to get out of that life, that type of hang-out people that had access to that [marijuana] and a lot of good friends, and I just had to just, kind of ride off, because he was part of that life.\" In the end, she said, \"I just wanted completely out of those connections and that kind of sneakiness because I'm not a sneaky person.\" She said she chose to live with her visual loss through accommodations.\nNot long after moving to the rural community, both sisters' health and function worsened. Lucille described worsening problems due to acid reflux, a cholecystectomy, two knee replacements for osteoarthritis, neuropathy in her feet, worsening vision, and bilateral carpal tunnel syndrome from years of typing. She stated that her knees continued to ache after knee replacement surgery and that had it not been for Jocelyn's assistance when she was confined to her bed, she would have perished. Lucille stated, \"It takes me a long time to just go get a glass of water from the table or I have to ask my sister who is blind to get it for me.\" Jocelyn, however, was also ill. She was diagnosed with colon cancer, diabetes, and congestive heart failure. A year earlier, she was gravely ill and hospitalized with sepsis. She stated, \"Well, I used to say every time I'd go to the rehabilitation center for the blind, I'd come home and think, ' Oh, I'm so glad my life isn't like that! Cause they all had these multiple health problems and usually people just aren't blind, they're blind and two or three other things' which I am now.\"\nThe sister's lives were not as they had hoped. Although the cost of rural living was relatively low, they had little help with needed activities and little money for added expenses. The two sisters needed help. But the only available family support they had came from one another. While living in their new environment, and after the onset of Jocelyn's mobility impairment coupled with both sisters' multiple illnesses, they needed help with cleaning, bill paying, lawn care, bathing, and transportation. Jocelyn qualified for home health services after being on a wait list for 1 year. Once she was assigned a provider, however, nothing was done, or at least nothing was done well. Jocelyn said, \"And then I'd go in there and I'd touch the floor and I can find stuff on the floor. I got tired of that.\" Further, at one point, jewelry was stolen. Jocelyn said, \"When I was in the hospital last year, even though I called them and said, look you know they [bills] were made out but they didn't get mailed. I was like a day or two late and they raised my interest rate to like 27%.\" She said, \"I had a sister who could not walk, I was blind and I was not feeling well. And we couldn't get any help from anybody.\" She said she was told that they received too much in disability to qualify for other types of need-based services, and they were not old enough to qualify for elder services.\nJocelyn also said she felt that people misunderstood her visual impairment. Despite enactment of the Americans with Disabilities' Act in 1990, she said she was asked to leave a restaurant after its passage because her guide dog was not allowed. She said she was also followed around an antique store and told that she must buy whatever she broke. Jocelyn supported her sister's stories and she said she lamented the way her sister was treated.\nWith their sense that the world had turned its back, Jocelyn said she stopped integrating herself into society and lost her sense of being in the world. \"People are very reluctant to like ask me to do things, include me in things.\" She went to church and to the doctor. Otherwise, she stayed at home. She stated, \"it's just too much of a physical challenge to get there, and when I get there it's like I could have phoned this in, because I'm there but I'm not there, if you know what I am saying.\" She used to love to shop, but now she buys all her clothes through QVC while watching television. \"I can't just enjoy the colors and the textures. I can't physically stand there, and when you stand at a rack of clothes and you try to guess at what it is, it takes the fun out of it.\" She no longer writes poetry. She turns on the computer then turns it off. She also gave up gardening. Most tragically, her guide dog died. \"I had to have my guide dog put to sleep; it is going on three years ago now. And I miss her so much.\" And her lack of mobility prevented her from getting another dog. Jocelyn stated, \"When we moved out here, we wanted a place, I wanted a place, I had my guide dog and I wanted a place I could garden, which I can't do now.\" With loss of vision and loss of mobility, findings ways to remain active in society were a challenge.\nLucille stated that at one time she and her sister made up the function of one healthy person. The two of them made a team. But she no longer believed that. She felt they needed assistance. And she worried about Jocelyn's health. Jocelyn's thoughts were frequently devoted to the importance of \"being\" versus \"doing.\" She pondered whether her life had meaning without purpose, or whether her life was purely a matter of being in the world. Was being in the world a purpose in and of itself? She found few activities to keep her life fulfilled. She recalled having been given an activity to perform at church, where she introduced the hymns. After her illness, she was no longer invited to perform this activity. She said, \"It's just that when you've been doing something for over a year, and then suddenly nobody wants you do to do it anymore. It's like, okay, maybe you were making that up for me to do.\" Jocelyn admitted, \"Yeah, I got my feelings hurt.\" She struggled because, she said, \"I find myself being dismissed many times because they don't know what I can do.\"\nThe women were gradually returning to the belief that their bodies and their movement did not have to be ideal. They only had to be alive and to move. Set within the range of perceptions of women with chronic disabling conditions, these sisters did not display evidence of optimism, which might have indicated expectancy for positive outcomes despite the negative events; indications they might have extracted a benefit from their adversity. They did, however, adapt. For instance, when Jocelyn ate her dinner she lamented dropping food on her blouse and not knowing it, but she ate. She said she failed to color-sort the laundry into the appropriate piles, which resulted in things such as white sheets turning pink, but she did the laundry. Her sister, Lucille, complained when Jocelyn had to pull the trash out of the trashcan or make her bed for her. Lucille also said she had to stop doing dishes in the middle of the task only to later become \"bored from lying in bed watching the spiders on the ceiling\". At the same time, the sisters cared for two cats and multiple goats that lived in and around the house. Of these, the sisters stated, \"We just love it: cats and goats.\" Lucille had found and cared for a cat who was also disabled due to a dog fight. Although the cat was small and some of its fur was missing, she said she loved it. And although Jocelyn said she was unable to see and walk without difficulty; she used her mobility cane to find her way to feed her goats every day. We theorize that after multiple adverse events, the sisters stopped looking for perfection in their bodies and benefit in their adversity; instead, they started looking for pleasure in their relationships. They focused on their unique relationships with their God, each other and pets.",
"gender": "Female"
}
] |
PMC3581863
|
[
{
"age": 30,
"case_id": "PMC10133725_01",
"case_text": "Comprehensive diagnosis and treatment in psychiatry requires addressing pathology in all its dimensions: biological, psychological, social, cultural, and environmental. Integrating these into causal explanations of particular types of problems remains a challenge for psychiatric theory and practice. Approaching these multiple forms of explanations as independent or even incommensurable ignores the obvious ways in which processes at multiple levels not only affect but mediate each other. An ecosystemic approach to integration aims to identify multiple causal processes or mechanisms within and between levels of organization and articulate their connections in an overarching system.\nAdvancing integrative case formulation requires approaching the patient as embodied and embedded in an ecosocial niche that presents an array of inter-related social determinants of health with differential constraining and enabling opportunities. The same niche also provides models for self-understanding, values, aspirations, and afflictions that shape experience, adaptation, coping, and help-seeking behavior, as well as access to services, educational and vocational opportunities, and other resources. Individuals' responses to adversity, symptoms or disorders, and modes of recovery will be influenced by the norms, expectations, and constraints of the sociocultural contexts they inhabit.\nTo illustrate how this integrative perspective works in clinical practice, consider the following case vignette8:\nA 30-year-old woman presents to a mental health clinic with a self-diagnosis of depression. On inquiry, she reports feelings of emptiness, worthlessness, and guilt, as well as irritability, restlessness, rumination, difficulty concentrating, indecisiveness, early awakening, and fatigue over the past 6 months. Most recently, she has had increasing loss of interest and pleasure in ordinary activities and social isolation, as well as thoughts of death. She has done some online research and comes to the clinic asking for laboratory tests to confirm her diagnosis and determine the best treatment. She recently read a blog that mentioned novel research findings on the use of brain imaging and pharmacogenetics in personalized treatment for depression and presents the clinician with a list of private labs that offer this service. On further discussion, she reports that she lost her job three months ago and feels deep humiliation. She also mentions having difficulties in her relationship with her partner, saying that they are \"going through a rough patch.\" She explains that she feels anxious and out of control and at times fears that she is \"losing my mind.\" She is prescribed an SSRI antidepressant and experiences some lessening of her symptoms over the next few weeks, but does not feel any return of sexual interest, which adds to her worries about her relationship.\nAs is increasingly common in mental health care, the person in the vignette presents clinically with a self-diagnosis of depression and, in this case, expects treatment with medication for what she views as a brain-based disorder. She also has ongoing social stressors that may be both causes and consequences of her mental state. How she interprets her symptoms and her feelings of anxiety, hopelessness, humiliation, guilt or shame will affect both her behavioral and neurophysiological response to the predicaments of job loss and relationship strain. In addition to temperamental traits or constitutional predispositions and the neurobiology of mood regulation, a complex interaction of embodied processes:shaped by previous illness experience, life events, and the response of others:add reinforcing or attenuating loops that further complicate the system dynamics that underlie symptoms and distress. A clinically effective approach to explain and treat distress therefore must go beyond neural correlates and biomarkers to consider individual variations in phenomenology and lived experience, developmental processes, symptom trajectories, and socio-cultural dynamics, which depend on social structure, institutions and practices, as well as cultural systems of meaning.\nIn the case of the patient in the vignette, the causal mechanisms of anxiety, demoralization and depression can (and likely do) start at many different points in the network depicted in Figure 1. Additionally, each of these processes can interact with potentially reinforcing or compensatory feedback loops. These dynamics are important for adequately characterizing the nature of the problem, its likely course or prognosis, potential interventions, and treatment response.\nMany of the links shown in Figure 1 are mediated by personal, social and cultural processes of meaning making. These involve bodily and discursive practices as depicted in Figure 2. While physical stressors may have direct effects on physiology and elicit responses, based on past experience, that occur outside of awareness, the impact of stressors also depends on individuals' perception and interpretation of the event. This involves embodied and enactive processes of meaning-making that build on developmental experiences and draw from cultural resources. The process of meaning-making includes the person's appraisal of the level of threat, their coping skills and resources, and the potential consequences:that is, \"what's at stake\" for the individual and others in their social world. For example, while job loss is likely to be a stressor for most people, the degree of perceived stress and ability to cope will depend on contextual factors including the personal and cultural meanings of one's occupation and of unemployment, current economic resources, social supports and mobility.\nShame and humiliation follow from experiences of loss of social status and failure in performing according to social norms. The experience of humiliation in response to job loss depends on its timing (e.g., family just moved for the job or has had other resource depleting stressors), social position, roles, norms and expectations (e.g., father expects to be a breadwinner). Social validation of perceived stress can also contribute to self-regulation and reduction of perceived stress through process of feeling understood, supported and protected, as well as helping the individual to shift perspectives, mobilize problem solving strategies, and access stress-reducing resources.\nPerceived stress can prompt multiple maladaptive behaviors that feedback in loops that lead to resource depletion. For example, drug consumption for symptom control, relaxation and or escape can lead to emotional lability and irritability that challenge relationships. In favorable constellations however, response to perceived stress may lead one to develop new skills or positive schemas, overcome engrained biases, rescript self-understanding narratives, expand one's affordances, deepen social relationships and improve coping.\nIn the ecosocial systems view, interpersonal dynamics, work stress, gender discrimination, and cultural knowledge and practices for dealing with distress:all of which depend on or reside primarily in social interactions:may contribute to the patient's distress, coping strategies and process of recovery. Applying an integrative perspective in case formulation requires considering how these processes unfold over time in the individual's life trajectory. Moreover, the processes related to each of these levels and dimensions interact in ways that can give rise to feedback loops that exacerbate symptoms and result in a depressive disorder or other syndrome, which may then be maintained through similar looping mechanisms. These loops are not only internal to the brain and its circuits but extend beyond the body to social interactions with other people and social institutions:all of which affect the development and course of psychiatric disorders.\nThe cultural-ecosocial approach is fundamentally relational. The relationships it considers involve material, informational and symbolic-communicational interactions between the individual and the environment. These relationships can be mapped by causal loop diagrams (CLD) that aim to capture the links between observable processes. These maps can be used to develop formal quantitative models to reveal dynamics and test the potential impact of interventions, including changes in the configuration of systems:e.g., by altering individual biology or cognition, family interactions, health care systems or other social contingencies.\nIn the ecosocial view, humans are embedded in and dependent on culturally constructed environments that include physical arrangements as well as a web of relationships with other people and social institutions. The 4E perspective insists that interactions with the environment are part of the dynamics that constitute the individual. In human ecology, however, the distinctions between individual and environment are phenomenologically, psychologically, morally and politically important. Hence, drawing the boundary between 'inside' and 'outside' (organism and environment or system and subsystem) varies with the clinical question and the way we locate the relevant dynamics. There can be principled and practical reasons for drawing a boundary in a particular way both because it highlights crucial dynamics and constitutes a useful way to organize case formulation and guide intervention. These reasons may include the system's topology, the feasibility of specific interventions, and the ethical imperative to privilege the patient's perspective.",
"gender": "Female"
}
] |
PMC10133725
|
[
{
"age": 26,
"case_id": "PMC3690222_01",
"case_text": "A 26-year-old otherwise healthy female patient presented to King Faisal Specialist Hospital and Research Center with a 1-month history of epigastric pain. Systemic review was remarkable for night sweating and weight loss of 7 kg. On physical examination, a palpable, slightly mobile, and tender epigastric mass was detected. All laboratory tests including complete blood count, renal, bone, hepatic, and coagulation profiles, lactate dehydrogenase (LDH), carcinoembryonic antigen (CEA), alfa-feto protein (AFP), CA 19-9, and CA 12-5 were normal.\nBarium meal study showed an ill-defined mass involving gastric fundus and extending into gastric cardia and lower gastroesophageal junction. A chest, abdominal, and pelvic contrast-enhanced computed tomography (CT) scans showed a 3.8 x 7.2 x 8.7 cm ill-defined mass, involving gastric fundus and extending into gastric cardia and lower gastroesophageal junction (Figures 1(a) and 1(b)). It was associated with multiple enlarged gastrohepatic lymph nodes; the largest measured 1.2 cm. There was no evidence of ascites or retroperitoneal or mesenteric lymphatic metastases. A CT-guided tissue biopsy was obtained and revealed DSRCT. Positron emission tomography (PET) (Figure 2(a)) and transverse-section PET-CT (Figure 2(b)) scans showed hypermetabolic fluorodeoxyglucose- (FDG-) avid mass lesion in gastric fundus, extending into gastric cardia and lower gastroesophageal junction. In addition, it was associated with a few hypermetabolic FDG-avid lesions in the gastrohepatic junction, indicating lymph node metastases. No evidence of distant metastasis was identified. In view of a probable neoplastic lesion, the Surgical Oncology team advised for surgical resection.\nPatient underwent total gastrectomy with D2 lymphadenectomy, splenectomy, and antecolic Roux-en-Y esophagojejunal anastomosis. All resection margins were free from tumor cells. Metastatic tumor was found in five out of eighteen gastrohepatic lymph nodes. The common hepatic artery lymph nodes and the porta-hepatis lymph nodes were all reactive and negative for malignancy. The lymph nodes around the celiac access, splenic artery, and splenic hilum were involved and enlarged. Spleen showed no significant pathology. No evidence of ascites or peritoneal carcinomatosis was detected.\nMacroscopically, the outer surface of the resected gastric mass was white, irregular, firm, and marked with several prominences. Cut section of gastric mass revealed a 2.5 x 4.5 x 6.5 cm, irregular, ulcerated, necrotic, and hemorrhagic mass involving the gastric fundus, and extending into cardia and lower gastroesophageal junction (Figure 3(a)).\nMicroscopically, histopathological examination of the resected gastric mass revealed intact epithelial mucosa and presence of sheets of small round blue cells separated by minimal desmoplastic stroma (Figure 3(b)). Immunohistochemical stains showed diffuse perinuclear staining pattern with desmin, but characteristic dot positivity was not prominent (Figure 3(c)). There was focal mild positive staining with AE1/AE3 (cytokeratin) (Figure 3(d)) as well as patchy dot positivity with WT1 (Figure 3(e)). There was negative staining with smooth muscle actin, calretinin, Myo-D1, myogenin, CD 45, chromogranin A, EMA, TTF1, synaptophysin, and S100. Strong positivity with desmin, AE1/AE3, and WT1 suggested that this lesion is most likely to be a case of DSRCT of stomach.\nFurthermore, the resected specimen was analyzed by fluorescence in situ hybridization (FISH) technique and confirmed the diagnosis of DSRCT of stomach by identifying the characteristic EWS-WT1 gene fusion protein. Moreover, because of the unusual presentation, the resected specimen was sent to Mayo Clinic in Rochester, MN, USA, for diagnostic workup and results confirmed the abovementioned diagnosis (i.e., DSRCT of stomach).\nPatient was discharged on the 10th postoperative day in a good condition and received no adjuvant radiotherapy or chemotherapy. A postoperative 3-month followup failed to show any recurrence.",
"gender": "Female"
}
] |
PMC3690222
|
[
{
"age": 28,
"case_id": "PMC4742044_01",
"case_text": "A 28 year old female presented to the emergency department of our hospital, with complaints of early satiety, intermittent episodes of bilious vomiting, a slow growing, painless abdominal mass and an inability to pass motion and flatus since 2 weeks. On examination, a lobulated firm mass extending from the epigastrium to the pubic bones and bilateral lumbar region was found, becoming prominent on straight leg raising test. She also reported a history of appendicectomy and two pregnancies with spontaneous deliveries in 1994 and 1999. Analysed blood parameters were within normal limits. A standing abdominal film showed a soft tissue mass over the whole abdomen. A preoperative CT scan revealed a left lower abdominal wall tumor of unknown dignity (Figure 1).\nThe patient was taken up for an emergency laparotomy and intraoperatively, resection of the tumor with excision of the internal oblique abdominal muscle followed, and the defect was subsequently covered with a mesh and strengthened with omentum. Intraoperatively, the anterior rectus sheath was found tightly adherent to the mass. The tumor was also adherent to the parietal peritoneum and bladder on its posterior surface with strong adhesions to the pubic bones inferiorly as well as to the external iliac vein on the right side, which necessitated a vascular repair with prolene 6-0, round bodied, continuous sutures, after excision of the tumor. The tumor was found to cause compression of the intestines & the stomach leading to vomiting & early satiety. The excised tumor weighed 4.6 kg (Figure 2). Subsequent histopathology confirmed the features of a desmoid tumor.",
"gender": "Female"
}
] |
PMC4742044
|
[
{
"age": 71,
"case_id": "PMC5849808_01",
"case_text": "A 71 year old white female presented to the Emergency Department of a small community hospital in urban Chicago, brought by EMS. Her complaints upon presentation included severe, generalized abdominal pain, nausea and occasional vomiting. The patient stated that she was in her usual state of fair health until about 24 h before admission, when she began experiencing colicky type abdominal pain. During the next few hours the pain intensified, and changed from colicky to continuous, becoming generalized about 2 h before she summoned the emergency response systems (Chicago Fire Department). On presentation she had vomited twice what appeared to be bilious emesis. Her past medical history was significant for Hypertension, for which she was receiving metoprolol tartrate (Toprol XL, AstraZeneca LP, Wilmington DE) 25 mg PO every day and non-insulin dependent Diabetes, that she controlled with diet. She has never received an operation before. She denied any allergies. Her social history was negative for tobacco, alcohol abuse or recreational drugs. Family history was only significant for hypertension.\nOn physical examination the patient was awake, alert and oriented in person, time, place and situation. Her chest was clear and her heart had a regular rate and rhythm with no murmurs. Her abdomen was distended and firm on palpation in all four quadrants. The surgical consultant elicited guarding and rebound tenderness. Her bowel sounds were present but much diminished. Rectal exam showed no feces on the ampulla. Her external genitalia were normal for her age and sex. A formal vaginal exam was dispensed with given the condition of the patient. Her extremities showed no edema. A brief neurological evaluation was unremarkable.\nA Foley catheter was inserted and drain scant, dark urine. Her blood work was only remarkable for a White Blood Cell count of 19,500 with a left shit. Her hemoglobin, hematocrit and platelet count were all within normal limits. Her electrolytes were unremarkable, as was her amylase and lipase. A CT scan of the abdomen and pelvis was obtained prior to surgical consultation, which showed a central inflammatory mass, surrounded by small bowel with evidence of intramural air and possible perforation (Fig. 1). She was promptly taken to the Operating Room for surgical exploration.\nOnce general anesthesia was induced a generous midline incision was carried down to the peritoneal cavity, were a large mass was found, and determined to be arising from the ileum, without evidence of intestinal obstruction or torsion. There was evidence of suppuration at the surface of the mass, with stigmas of perforation. The loop of small bowel containing the mass was then resected (Fig. 2), and intestinal continuity restored by constructing a functional termino-terminal anastomosis with a surgical stapler (GIA, Covidien-Medtronics, Minneapolis MN). An incidental appendectomy was performed as well. The diverticulum was spherical, pedunculated, and measured as 29 cm in maximum diameter. Her pathology was reported as Giant Meckel's diverticulum, with both pancreatic and gastric tissue foci, and with evidence of perforation. There was no evidence of malignancy.\nHer postoperative course was as expected for intestinal resection and anastomosis. She was able to tolerate a diet on postop day 3, which was quickly advanced, and was discharged home uneventfully on postop day 6. The patient was seen in follow up at 2 weeks and 3 months postop. Her incision healed appropriately and her overall clinical condition was otherwise unremarkable.",
"gender": "Female"
}
] |
PMC5849808
|
[
{
"age": 12,
"case_id": "PMC8663739_01",
"case_text": "A 12-year-old boy was referred to the accident and emergency department. He had sustained an acute left knee injury with severe pain and was unable to weight-bear. No previous medical history was known.\nFrontal radiography of the left knee demonstrated two abnormalities: an osteochondral defect at the medial femur condyle (Figure 1, arrowhead) and widening of the proximal medial tibial growth plate (Figure 1, arrow), in keeping with a Salter-Harris type I fracture. Also note the soft tissue swelling along the medial side of the knee.\nMRI of the left knee was obtained because of persistent widening of the proximal tibia physis. Proton density and fat suppressed proton density sequences confirmed the Salter-Harris I fracture of the medial proximal tibial physis with mild widening and a well-defined band of low signal intensity on all sequences in the medial part of the growth plate (Figure 2A and 2B, long arrow) representing trapped periosteum that has displaced from the medial tibial metaphysis (dashed arrow). Also note the slight periosteal stripping and tear along the lateral tibial metaphysis without displacement (Figure 2B, arrowhead). Additionally, there was a moderate grade injury of the medial collateral ligament and pes anserine, which are partially shown (Figure 2B, dotted arrow and short arrow), and extensive soft tissue oedema.\nThe osteochondral lesion at the medial femoral condyle had normal overlying cartilage without signs of instability (not depicted).",
"gender": "Male"
}
] |
PMC8663739
|
[
{
"age": 42,
"case_id": "PMC3399419_01",
"case_text": "A 42-year-old patient was admitted to our service with a non-specified neoplastic cystic lesion in midportion of pancreas. In her past medical history, she underwent a total abdominal hysterectomy, bilateral salpingooophorectomy, omentectomy, appendectomy, and para-aortic lymph nodes dissection due to papillary serous ovarian adenocarcinoma about ten months prior to current diagnosis (Figure 1). She received chemotherapy following surgery.\nThe cystic lesion was revealed by an abdominal computerized tomography (CT) and then confirmed by magnetic resonance imaging (MRI) performed regularly in her followup (Figures 2 and 3). To confirm the malignant origin of this lesion, an endoscopic-ultrasound- (EUS-) guided fine needle aspiration (FNA) cytology was performed and the analysis of fluid showed malignant cells, but failed to identify the origin of tumor. The patient was referred to our hospital for further management. Upon admission, physical examination revealed no significant abnormalities except a vague abdominal discomfort. All laboratory tests were unremarkable. \nAt laparotomy, there was a cystic mass measured approximately 4 x 2 cm localized and confined within midportion of pancreas with no sign of local invasion or distant metastasis. A small amount of fluid from lesion was sent out for cytological evaluation and reported as malignant epithelial neoplastic cell, but failed to identify the origin of tumor. Then it was deemed as primary midportion of pancreatic cancer and a spleen-preserved distal pancreatectomy was performed. The final pathology showed high-grade papillary serous adenocarcinoma morphologically similar to the previously diagnosed ovarian cancer with cancer free of surgical margins (Figure 4). Her postoperative course was uneventful. She received chemotherapy.",
"gender": "Female"
}
] |
PMC3399419
|
[
{
"age": 59,
"case_id": "PMC9619336_01",
"case_text": "A 59-year-old man presented for a follow-up appointment approximately 6 months after a right total knee arthroplasty. During this visit he complained of a new mass along the inside aspect of his contralateral (left) knee, which had previously undergone a knee replacement one year prior. On physical examination, there was a soft, mobile mass located at the anteromedial aspect of the knee, measuring approximately 4 cm x 4 cm. The mass was nontender and it did not limit his range of motion at the knee.\nInitial radiographic evaluation showed soft tissue swelling corresponding to the location of the palpable mass (Fig. 1). Magnetic resonance imaging (MRI) demonstrated a multilobulated irregular mass located just deep to the medial patellofemoral retinaculum and inferior to the vastus medialis muscle. The mass demonstrated slight hyperintense T1 signal relative to muscle and heterogeneous, predominantly hyperintense T2 signal with enhancement on the post-contrast sequences (Fig. 2). Given its indeterminate appearance on imaging, a biopsy was indicated.\nHistopathologic analysis of the core needle specimens demonstrated a proliferation of monotonous spindle cells with overlapping nuclei and scattered wiry collagen bundles (Fig. 3). The tumor cells were positive for pan-cytokeratin (AE1/AE3) and S100, but were negative for SOX10, actin, CD34, and desmin. Molecular testing was positive for the SS18 rearrangement. The radiologic and pathologic findings were consistent with a diagnosis of synovial sarcoma (SS).\nInitial staging was performed with chest computed tomography (CT) and whole-body positron emission tomography (PET)-CT, which were interpreted as negative for metastatic disease (Fig. 4). The patient underwent neoadjuvant radiation (50Gy) followed by wide resection with negative surgical margins. Final pathology confirmed SS.\nApproximately 2 months after resection of the synovial sarcoma, the patient reported a new onset of rapid swelling in the medial thigh of the ipsilateral lower extremity. Axial and coronal CT imaging of the left thigh demonstrated a large, irregular soft tissue mass within the adductor compartment. The mass demonstrated mixed density with areas of internal low density consistent with necrosis, and heterogeneous, predominantly peripheral enhancement. The original staging PET-CT was reviewed retrospectively and a tiny focus of low-level hypermetabolism within the medial soft tissues of the proximal left thigh was identified, but the large mass was not present (Fig. 5).\nBiopsy of the thigh mass revealed bizarre cells with large, hyperchromatic nuclei and pleomorphic lipoblasts. There was no histologic resemblance to the previous SS at the knee (Fig. 6). The tumor tissue was negative for keratin, S-100, and actin. FISH study was negative for SS18 rearrangement. These findings were consistent with a pleomorphic liposarcoma (PLS). Repeat staging chest CT and PET-CT demonstrated no evidence of metastatic disease. Based on recommendations following multidisciplinary review, the patient received 50Gy neoadjuvant radiotherapy to the thigh and subsequent wide surgical resection.\nThe patient recovered from surgery uneventfully and was referred to our clinical genomics department for evaluation of germline mutations that might lead to sarcoma predisposition. No mutations were found. The patient is undergoing routine surveillance per our institutional protocol.",
"gender": "Male"
}
] |
PMC9619336
|
[
{
"age": 48,
"case_id": "PMC7269287_01",
"case_text": "A 48-year-old female with right mandible lesion referred to the Imam Khomeini Hospital (Tehran, Iran) in 2018 with the chief complaint of pain in the right mandibular area for 6 months. Her medical history showed that she had osteoporosis and was taking alendronate approximately for 10 years. According to the computed tomography scan, a large lytic destructive lesion with a soft-tissue component was seen as the right mandibular ramus suggestive of a malignant tumor lesion or metastasis [Figure 1]. A 12 mm x 7 mm lymph node in the IB zone on the right side of the neck was detected. Salivary glands have normal appearance complete opacity of the right sphenoid sinus was noted suggesting of sinusitis. An incisional biopsy was performed under local anesthesia and the microscopic examinations revealed proliferation of anaplastic spindle-shaped cells arranged in interlacing bundles and whorled patterns. Nuclear polymorphism, scattered cells with hyperchromatic nuclei and increased mitotic activity were notable. Sections of overlying oral epithelium revealed nuclear polymorphism, hyperchromatic, increased nuclear-cytoplasmic ratio, increased mitotic activity and atypical mitotic figures throughout the entire thickness of the epithelium. A fragment of necrotic bone was seen beneath the oral epithelium. To determine the origin of the spindle cells and their relationship to the overlying oral epithelium with carcinoma in situ, IHC studies for pan-cytokeratin and ki-67 was performed. The spindle cells revealed more than 20% nuclear immunoreactivity for ki-67 (that indicates their high proliferative activity) and occasional cytoplasmic reactivity for pan-cytokeratin which shows they are originally epithelial cells. Based on histopathologic features and IHC studies, the diagnosis of spindle squamous cell carcinoma and osteonecrosis was suggested [Figure 2].",
"gender": "Female"
}
] |
PMC7269287
|
[
{
"age": 54,
"case_id": "PMC3716036_01",
"case_text": "A 54-year-old female with a medical history of hypertension, hepatitis C, and cirrhosis presented with nausea, vomiting and dysphagia of 1-day duration following surveillance esophagogastroduodenoscopy (EGD) and banding from an outside hospital. She reported that her symptoms started immediately post-procedure and that she continued to have multiple episodes of mostly clear vomit with streaks of blood. She also reported throat, chest, and epigastric pain and was unable to eat anything since the procedure due to her symptoms.\nHer past medical history included hypertension, hepatitis C, cirrhosis, gastroesophageal reflux disease, variceal hemorrhage, gall stones and Graves disease. She was on propranolol, lactulose, alprazolam and amlodipine at home. Social history was significant for heavy alcohol use for over 30 years, which she quit following an episode of variceal bleeding. She had no episodes of recurrent gastrointestinal bleeding since her last EGD and banding. On physical examination, she was an ill-appearing female, had dry oral mucosa, tachycardic, had epigastric and RUQ tenderness with negative Murphy's sign, and no rebound or guarding. During the interview, she vomited small amounts of non-bloody white material several times.\nOn presentation, her laboratory tests were as follows: WBC 13.1, Hb/Hct 14/39.7, platelets 260; Na 152, K 3.6, Cl 112, CO2 22, BUN 30, Cr 0.87, glc 146; lipase 93, Alk Phos 113, AST/ALT 48/75, lactic acid 2.0 and drug screen was positive for propofol.\nThe patient was admitted for dehydration due to nausea and vomiting. She was started on IV fluids, anti-emetics, pain control and kept NPO (nothing by mouth). Her dyselectrolytemia improved following hydration and her diet was advanced on the following day. She could not tolerate oral intake and reported worsening dysphagia, nausea and vomiting. Over the course of next 2 days, the patient continued to have worsening dysphagia with no relief from anti-emetics. A barium swallow was administered which showed a complete obstruction of the distal esophagus (Fig. 1). The differential for obstruction was thought to be either from local edema from the banding procedure, impacted food or a hematoma from the procedure. An EGD was performed; the scope was advanced to 34 cm to the level of obstruction and it was noted to have a band with entrapped varix in the center of the lumen surrounded by fibrotic material closing off the rest of the lumen (Fig. 2). Several attempts were made with biopsy forceps to reopen the lumen that resulted in a small amount of bleeding and the scope was removed at this point. Conservative management of the patient continued, i.e., NPO with intravenous hydration and pain control. Her symptoms improved over the course of the next 3-4 days and she started tolerating diet advancement and was subsequently discharged.\nShe presented the next day with a recurrence of similar symptoms, i.e., dysphagia, abdominal pain and vomiting. A repeat barium swallow showed patency of the esophagus with a parallel channel that retained contrast much later than the initial swallow, suggestive of an esophageal tear with an intramural dissection of 6 cm to the level of gastro-esophageal junction (Fig. 3).\nThe patient was kept NPO with peripheral parenteral nutrition and close monitoring for possible esopheageal perforation. Over the course of the next several days, the diet was carefully advanced with inputs from gastroenterologist and surgical consultants. After 5 days, the patient reported much improvement in her symptoms and was able to tolerate a full diet for the first time.\nA repeat barium swallow was obtained prior to discharge that showed no obstruction or dissection. A small stricture was noted at the proximal margin at the origin of the prior dissection (Fig. 4). She was discharged with subsequent follow-up appointment at the GI clinic.",
"gender": "Female"
}
] |
PMC3716036
|
[
{
"age": 70,
"case_id": "PMC5684422_01",
"case_text": "A 70-years-old woman presented to urology outpatient with history of dysuria, poor stream, gross haematuria and blood spots on undergarments intermittently. On examination, a firm, rounded, pedunculated, black pigmented, friable and haemorrhagic lesion of about 0.5 x 0.5 cm was found at the posterior wall of the urethral meatus. The findings on the per speculum and vaginal examination of the cervix and general physical examination were unremarkable. No organomegaly or lump was found on an abdominal examination and no superficial lymph nodes were palpable. On cystourethroscopy, it was evident that the lesion partially occluded the distal third of the urethra (Fig. 1). The mass was removed by a wide local excision with the patient under spinal anaesthesia.\nGross examination of the resected specimen revealed a polypoidal solid mass (0.5. x 0.5 x 0.3 cm) with a dark-brown cut surface. The mass was covered with pinkish mucosa with surface ulceration. Histopathological analysis revealed polypoidal tumor with surface partially ulcerated and partially covered with squamous and transitional epithelium. The tumor was composed of loosely cohesive nests of atypical epitheloid and spindle shaped melanocytes showing diffuse and nested growth pattern. The neoplastic cells had abundant eosinophilic cytoplasm, large hyperchromatic nuclei with prominent nucleoli, and brisk mitotic activity (15/10 HPF). Most of the tumor cells contained coarsely granular melanocytic pigment (Fig. 2). No vascular/lymphatic invasion was seen histologically. Immunohistochemically tumor cells showed strong cytoplasmatic reactivity for HMB45 and S100 (Fig. 3A and B).\nThe clinical examination revealed no history of previous cutaneous biopsy or existence of recent suspicious pigmented lesion at any other location, and a diagnosis of primary melanoma was rendered. Initial metastatic evaluation, including computerized tomography scan of the chest, abdomen and pelvis revealed no evidence of disseminated disease. The patient showed no evidence of disease during a five year follow-up period.",
"gender": "Female"
}
] |
PMC5684422
|
[
{
"age": 53,
"case_id": "PMC4332983_01",
"case_text": "A 53-year-old woman was seen for transfer of care for metastatic lacrimal gland carcinoma. She had been diagnosed 2 and 1/2 years earlier in another state. She originally presented with progressive headaches, blurred vision, and right eye proptosis. CT imaging showed 2 separate masses involving the right orbit (a 2.5-3 cm mass under right orbital roof in the lacrimal area, also a 1 cm mass in the right orbital apex and superior orbital fissure) with possible intracranial extension. MRI imaging showed a right superior lateral orbital mass apparently originating from the lacrimal gland, invading into surrounding bone and possibly the brain parenchyma. The patient underwent subtotal resection of the locally advanced right orbital mass. The pathologic diagnosis was metastatic carcinoma of lacrimal gland origin. Immunohistochemistry was positive for keratin, CK7, and mammaglobin; negative for CK20, TTF-1, BRST-2 or estrogen or progesterone receptors.\nThe patient then received adjuvant radiation treatment to the right orbital area. She developed symptoms suggestive of metastatic disease less than a year later. MRI imaging of the thoracic spine showed 3 separate areas of intramedullary metastatic disease, at the T1 level, T6-7, and T12. There was no metastatic disease seen in the lumbar spine by MRI, and CT imaging of the chest and abdomen done at the same time also showed no evidence of metastases. The patient was again treated with radiotherapy. She later received radiation to new metastatic sites in the left cerebellum and an intramedullary lesion in the cervical spine.\nPET scan done following transfer of care showed evidence of disease progression in the cervical spine and proximal thoracic spine, as well as bilateral lung nodules and thoracic lymphadenopathy suggestive of systemic metastases. A biopsy was performed of one of the lung nodules, confirming metastatic adenocarcinoma. Due to the intramedullary location of spine mets, as well as prior radiotherapy to these sites, the patient was not considered a candidate for palliative surgery or radiation. Additional testing performed on the lung biopsy specimen showed no evidence of an epidermal growth factor receptor (EGFR) mutation; however, Her-2/neu expression was found to be amplified by FISH assay (Her-2/cen 17 ratio of 6.0). The patient was started on lapatinib, an oral tyrosine kinase inhibitor with systemic and central nervous system (CNS) activity against both Her-2/neu and EGFR, at a dose of 1500 mg daily. She tolerated lapatinib without significant side effects. CT imaging after 2 months of treatment showed stable disease.\nAfter approximately 5 months of treatment, the patient developed progressive weakness in both lower extremities. MRI imaging showed a moderate increase in size of the intramedullary lesion at T1, as well as increased cord edema and a syrinx extending to the C3 level. The findings were felt to be indeterminate for progression of malignancy versus radiation myelitis from prior radiotherapy. PET imaging was ordered to further evaluate this lesion. The PET study showed grossly stable size of multiple metastatic lesions but significant decrease in standardized uptake value (SUV) at all disease sites, consistent with a response to treatment. For example, the SUV of the largest lung lesion had decreased from 28.8 to 6.2, while the SUV of the T1 lesion had decreased from 18.6 to 6.6. Lapatinib was continued, based on the evidence of response and also as the patient was not considered a candidate for more aggressive treatment such as high-dose IV methotrexate. She was also treated with oral dexamethasone. Unfortunately, the patient's lower extremity weakness progressed to the point of paraplegia, and she had a steady clinical decline related to this. She ultimately died approximately 10 months after starting lapatinib and more than 4 years after original diagnosis.",
"gender": "Female"
}
] |
PMC4332983
|
[
{
"age": 24,
"case_id": "PMC5470063_01",
"case_text": "A 24-year-old and right-hand-dominant male presented with left intraarticular displaced radial styloid fracture accompanied with an ulnar styloid base fracture after a fall on his left wrist (Fig. 1). It was treated surgically with open reduction and internal fixation (ORIF) using 2 screws in another hospital, and the patient could be reemployed pain-free in his original occupation as a mechanic for agriculture machines. One year after the first injury, the patient sustained a second injury in his left wrist without fracture, diagnosed as a ligamentous distorsion. Two years after the first injury, the screw for reduction of the ulnar styloid has been broken due to a non-union, and all screws were removed in the same hospital. Four years after the first injury, the patient was unable to work in his original occupation, and presented himself for the first time in our hospital. The non-unioned ulnar styloid was excised accompanied with surgical denervation of the wrist. After that, the patient could be reemployed in his original occupation for another three years. Then, the 31-year-old patient was unable to work in his original occupation again. Radiographically, there was advanced stage of posttraumatic wrist joint OA due to a distinctive PUCT type I without signs of disruption of the scapholunate ligament (SLL) (Fig. 1b), accompanied with marked loss of wrist and forearm function (Figs. 2a-b). The patient declined a TWF, and a TWA using the relatively new MaestroTM Wrist Reconstructive System ((WRS), (Zimmer Biomet Holdings, Warsaw, Indiana / USA)) was detected by us. Intraoperatively, macroscopic findings confirmed pancarpal wrist joint OA in the absence of a SLL disruption, whereas a disruption of the lunotriquetral ligament (LTL) was present (Fig. 2c). At the 1-year follow-up, there was unchanged correct positioning of TWA without implant loosening or subsidence, and an excellent functional outcome without any signs of instability in terms of terminal ranges of motion radiographically (Fig. 3). Supination and pronation had improved to 90 (100% to right), extension had improved to 44 (73,3% to right), flexion had improved to 42 (84% to right), ulnar deviation had improved to 32 (64% to right), and radial deviation had improved to 24 (96% to right) (Figs. 3a-c) in comparison to (Figs. 2a-b). At the 16-months follow-up, the patient could be reemployed completely in his original occupation as a mechanic for agriculture machines, and he is able to carry out heavy works with loads more than 10 pounds again (Fig. 4). Pain in visual analogue score (scale 0-10 points) and function in patient-rated wrist evaluation score (scale 0-100 points) had improved to 2 (preop. 9) and 19 (preop. 68). The prolonged time of 16 months for recovery in our patient was not caused by the TWA, there were other difficulties in his life. The patient reported that he would undergo the same motion-preserving TWA a second time were it necessary.",
"gender": "Male"
}
] |
PMC5470063
|
[
{
"age": 35,
"case_id": "PMC2822253_01",
"case_text": "A 35-yr-old man who had been healthy underwent a routine medical check-up. On esophagogastroduodenoscopy (EGD), a submucosal mass with an irregular central umbilication was found in the gastric antrum (Fig. 1). The physical examination and all the laboratory findings were normal. The tumor markers including CEA (2.7 ng/mL), CA-19-9 (6.9 u/mL) and CA-72-4 (3.1 u/mL) were within normal ranges. Abdominal CT scan revealed a well-demarcated multiseptate cystic mass in the gastric antrum (Fig. 2). A wedge resection was performed under the clinical impression of gastrointestinal stromal tumor.\nGrossly, the submucosal mass (2x1.7x1.2 cm) was composed of a whitish tan oligolocular cystic portion and a yellowish tan solid granular portion with an intact overlying mucosa. Microscopically, the cystic portion was lined by a single layer of flat, cuboidal epithelium and surrounded by smooth muscle layers (Fig. 3, arrow and Fig. 4A). Periductal glandular structures were focally identified without islet cells (Fig. 4B). In the solid area, the adenocarcinoma components forming well-formed tubules (Fig. 5) infiltrated the underlying proper muscle layer and the overlying mucosa of the stomach. Lymphovascular tumor emboli were frequently seen in areas adjacent to the adenocarcinoma components. A dysplastic change was found in the epithelium of the cystic portion of the heterotopic pancreas, adjacent to the invasive adenocarcinoma (Fig. 5). The neoplastic cells and the heterotopic pancreas tissue showed diffusely strong positivity for cytokeratin 7 (CK7+, 1:200, DAKO, Denmark) and negativity for cytokeratin 20 (CK20-, 1:200, DAKO, Denmark) by immunohistochemical stainings (Fig. 6). The overlying gastric mucosa showed CK7+ only in mucous neck cells and CK20+ in foveolar epithelial cells. The subsequent distal gastrectomy specimen revealed no residual tumor. Lymph node metastasis was not identified. The follow-up course was uneventful 5 months postoperatively.",
"gender": "Male"
}
] |
PMC2822253
|
[
{
"age": 74,
"case_id": "PMC4246150_01",
"case_text": "A 74-year-old African American male with history of cardiomyopathy was hospitalized with progressive dyspnea on exertion and lower extremity edema. One week prior to admission he had worsening lower extremity edema, orthopnea, and paroxysmal nocturnal dyspnea unresponsive to an increase in his usual dose of oral furosemide, over which time he noted an 8-pound weight gain. NT-proBNP was 8,080 pg/ml, and troponin I was 0.151 ng/ml. Past medical history includes Type 2 diabetes mellitus, hypertension, chronic kidney disease, dyslipidemia, benign prostatic hyperplasia, sleep apnea, cataracts, glaucoma, right and left carpal tunnel syndrome status post release surgery 3 and 8 years ago, respectively, and several surgeries for stenosing tenosynovitis.\nThere was no family history of heart disease. There was a remote history of smoking, and he used alcohol rarely, and denied using illicit drugs. Medications included aspirin, valsartan, furosemide, metolazone, simvastatin, spironolactone, metoprolol, glipizide, and latanoprost ophthalmic.\nOn physical examination the patient was not in distress. Blood pressure was 97/61, respiratory rate was 22 per minute, heart rate was 69 bpm, and SatO2 was 100% on room air. Significant jugular venous distention was noted. Minimal bibasilar crackles were present. Point of maximal impulse (PMI) was displaced laterally, but no murmurs or gallops were noted. Abdomen was slightly distended, without organomegaly or ascites, and 3+ pitting edema extended to the thighs and scrotum. Electrocardiogram (EKG) showed low voltage in limb leads, Q waves compatible with prior inferior infarction, left anterior fascicular block, and prolonged QTc. Chest x-ray revealed no infiltrates or cardiomegaly.\nNon-ischemic cardiomyopathy was diagnosed 3 years prior to this admission. Cardiac catheterization revealed no coronary artery disease, mild global left ventricular (LV) hypokinesis, and ejection fraction of 45%. He had two prior admissions to the hospital for congestive heart failure exacerbation, each time responding to intravenous diuretics. A recent echocardiogram demonstrated a drop in ejection fraction to 30% with global hypokinesis, with marked echogenicity of the LV myocardium (Fig. 1). Pulmonary artery systolic pressure was estimated to be 55 mmHg.\nEvaluation for amyloidosis revealed serum protein electrophoresis (SPEP) to be negative for monoclonal gammopathy. His serum free kappa light chain was twice the normal level, and there was very mild serum lambda elevation. Immunofixation electrophoresis revealed no evidence of monoclonal gammopathy. An abdominal fat pad biopsy was positive for amyloid deposits by Congo red staining and the presence of apple green birefringence under polarized light. Cardiac MRI demonstrated diffuse LV hypertrophy and significant infiltrative process involving the entire myocardium (Figs. 2 and 3).\n Because of continued concern about AL amyloidosis (despite the absence of detectable monoclonal gammopathy), endomyocardial biopsy was performed and mass spectrometry analysis identified transthyretin amyloid with the Val122Ile mutation, confirming the diagnosis of familial amyloid cardiomyopathy. TTR genetic testing showed that he is heterozygous for this mutation.\nTreatment with aggressive intravenous diuretics was started. Weight decreased and edema resolved. At discharge, the patient was euvolemic but he still had NYHA class III symptoms. His beta blocker and angiotensin II receptor blocker were discontinued and he remained on a high dose of furosemide.",
"gender": "Male"
}
] |
PMC4246150
|
[
{
"age": 4,
"case_id": "PMC10277474_01",
"case_text": "A female aged 4 years and 10 months was admitted to our hospital due to paroxysmal abdominal pain for more than 2 months. The usual abdominal pain was mild, short, irregular, and spontaneously resolved. There were no symptoms of nausea, vomiting, abdominal distension, hematochezia, or other discomforts. The child was treated for gastroenteritis in a local hospital, however, her symptoms did not improve, and her parents came to our hospital for further treatment. Ultrasound examination showed a cystic mass of about 20 x 17 x 12 mm at the end of the ileum wall, which was anechoic and well transmitted. The intestinal contents passed smoothly, and a diagnosis of intestinal duplication of the terminal ileum was made. Meanwhile, abdominal CT examination showed two round cystic low-density shadows in the right lower abdomen, with sizes of 25.9 x 22.5 mm and 19.1 x 14.1 mm, respectively. The lesions were located close to the intestines and showed signs of compression (Figure 1). The patient was admitted to our hospital for surgery. The diagnosis of a small intestinal duplication was certain; however, further exploration was needed during surgery to confirm whether there was a single or multiple small intestinal duplications.",
"gender": "Female"
},
{
"age": null,
"case_id": "PMC10277474_02",
"case_text": "A 5 mm incision was made at the left and right edges of the umbilicus and a 5 mm trocar was inserted. After the cyst was found, incisions at the left and right edges of the umbilicus were curved along the lower edge of the umbilicus. And the intestinal tube was removed from the umbilical incision. All intestinal tubes were examined intraoperatively by laparoscopy. Two cystic masses, approximately 25 x 20 x 20 mm and 20 x 20 x 15 mm in size, were found at the ileocecal junction and 5.0 cm away from the ileocecal junction (Figure 2), located at the mesenteric border and co-walled with the ileum, with low tension and unobstructed passage of intestinal contents. Due to the proximity of the two cysts to the ileocecal region, mucosal resection was performed to preserve the ileocecal region. The intestinal mucosa was damaged from the cysts' location within the intestinal walls, and intestinal repair and reconstruction were performed. There were no postoperative complications, such as bleeding, intestinal fistula, or intestinal stenosis, and the abdominal pain was completely relieved. Postoperative pathology confirmed cystic intestinal duplications (One was lined with ectopic gastric mucosa. And the other was lined with small intestinal mucosa) (Figure 3). The patient was able to eat orally on the 4th day after surgery and was discharged successfully on the 9th day. The patient was followed up for 1 year and recovered well. We use a timeline to show the treatment process more intuitively (Figure 4).",
"gender": "Unknown"
}
] |
PMC10277474
|
[
{
"age": 45,
"case_id": "PMC5762939_01",
"case_text": "A 45-year-old man with stage 4 CKD (estimated glomerular filtration rate of 34 ml/min per 1.73 m2) was enrolled in the COMBINE study. The COMBINE study is an ongoing pilot trial testing whether NAM combined with lanthanum carbonate on a background of reduced dietary phosphate intake safely reduces serum phosphate and FGF23 levels over 12 months in 205 patients with stages 3 to 4 CKD (Figure 1). During the first month after randomization, the dose of NAM is 750 mg once daily and the dose of lanthanum carbonate is 500 mg 3 times daily with meals. After the first month, the dose of nicotinamide is increased to 750 mg twice daily and the dose of lanthanum carbonate is increased to 1000 mg 3 times daily with meals.\nThe patient's past medical history was significant for type 1 diabetes complicated by stage 4 CKD, diabetic retinopathy, and coronary artery disease (CAD). The patient was treated for diabetic retinopathy with vitrectomy 10 years before study participation, and for CAD with coronary artery bypass grafting 1 year before study participation. Other medical comorbidities included obstructive sleep apnea, for which he was treated with continuous positive airway pressure. His medication regimen was as follows: atorvastatin calcium, 80 mg daily; amlodipine besylate, 2.5 mg daily; carvedilol, 12.5 mg twice daily; clopidogrel bisulfate, 75 mg daily; duloxetine HCl, 60 mg daily; losartan potassium, 100 mg daily; ropinirole HCl, 1 mg daily; levothyroxine sodium, 50 mug daily; aspirin, 81 mg daily; furosemide, 20 mg daily as needed; and omega-3 fatty acids, 1000 mg daily. The patient also had an insulin pump, which delivered regular-human insulin (RELION R) 100 unit/ml, up to 130 units daily. Except for an uncle with alcoholic liver disease, no history of liver or kidney disease had been recorded for the patient's family. The patient did not smoke or use tobacco. He denied significant alcohol intake, tattoos, or blood transfusions. The patient reported that he had had a sexual encounter with a man a few months before study participation.\nThe patient's early course in the study was uneventful. The patient's liver function tests (LFTs) at the onset of the study were within the normal range (Table 1). The patient progressed through the baseline period and first 3-months' postrandomization visits without any problems.\nAt his 3-month follow up visit, which took place 13 weeks after randomization, the patient was noted to have a new anemia on the safety laboratory studies collected by the research team. He was referred to his primary care physician. Workup for anemia by the primary care physician revealed abnormal LFTs, with a cholestatic pattern. His alkaline phosphate (ALP) level was 11 times the upper limit of the local laboratory reference range. At the same time, the patient's aspartate aminotransferase (AST), alanine aminotransferase (ALT), and total bilirubin levels were also elevated; AST was > 7 times the upper limit of the reference range, ALT was > 9 times the upper limit of the reference range and total bilirubin was 1.5 times the upper limit of the reference range (Table 1, day 148). His study drugs were stopped, and the patient was admitted to the hospital for expedited workup of cholestatic liver injury. On the day of admission, examination demonstrated a blood pressure of 149/81 mm Hg and pulse of 85 beats/min. Skin examination revealed jaundice. Cardiovascular, respiratory, abdominal, and neurologic examinations were normal.\nA magnetic resonance imaging scan without gadolinium was performed, which showed mild splenomegaly and no evidence of biliary obstruction. A liver biopsy showed mild portal inflammation, mainly composed of lymphocytes, occasional plasma cells, and eosinophils (Figure 2, Figure 3, Figure 4). The biopsy also revealed ductular reaction and minimal hepatocyte reactive change (Figures 4 and 5). For diagnostic evaluation of liver tissue, trichrome, reticulin, periodic acid-Schiff, and iron stains were performed, and were considered unremarkable. The morphologic findings were nonspecific, due to either an adverse drug reaction or biliary tract disease. The patient's LFTs began to improve in the weeks after stopping NAM (Table 1). Bloodwork was repeated 3 weeks after stopping NAM, and showed that bilirubin was now within normal range; ALP, AST, and ALT were also decreased. One month after stopping NAM, the patient complained of persistent fatigue, recurrent Bell's palsy, and balance and vision impairment. The LFTs increased again. At the subsequent primary care visit, the patient's doctor noted a new palmar rash (Figure 6).\nA rapid plasma reagin test was performed 29 weeks postrandomization, and tested positive (titer 1:128). Lumbar puncture showed pleocytosis, consistent with neurosyphilis. The patient was diagnosed with secondary syphilis. I.v. penicillin was prescribed, and the patient completed a 14-day course. The patient's LFTs improved rapidly with i.v. penicillin (Table 1), establishing the diagnosis of syphilitic hepatitis as the most likely cause of cholestatic liver injury.",
"gender": "Male"
}
] |
PMC5762939
|
[
{
"age": 21,
"case_id": "PMC3789302_01",
"case_text": "A 21-year-old female presented with left spontaneous bloody nipple discharge. Her history was notable for keeping her cellular phone tucked into her bra on the left side for several hours each day. Her mammogram showed extensive pleomorphic calcifications and densities from the retroareolar region to the chest wall spanning a length of 12 cm. A magnetic resonance image (MRI) showed extensive abnormal nonmass enhancement in a segmental distribution corresponding to changes seen on her mammogram (Figures 1(a)-1(c)). She was treated with mastectomy and pathology revealed extensive ductal carcinoma in situ (DCIS) with multifocal microinvasion. Sentinel lymph nodes were negative for metastatic disease.",
"gender": "Female"
},
{
"age": 21,
"case_id": "PMC3789302_02",
"case_text": "A 21-year-old female presented with a palpable breast mass in the area where her cellular phone was kept in direct contact with her left breast. She had been placing her cellular device in her bra for eight hours a day or longer for the past six years. Breast MRI demonstrated four distinct separate lesions ranging from 15 to 18 mm in diameter involving an extensive area of the upper hemisphere of the left breast. Pathology of her mastectomy showed multifocal invasive cancer with extensive DCIS. Two of nine axillary lymph nodes were positive for metastatic disease. Later studies found metastasis to the bone.",
"gender": "Female"
},
{
"age": 33,
"case_id": "PMC3789302_03",
"case_text": "A 33-year-old female presented with two palpable masses in the upper outer quadrant of her right breast directly underneath where her cellular phone was placed against her breast in her bra. She had been placing her cellular phone in her bra intermittently for eight years. In the two years prior to diagnosis she would routinely place her phone in her bra while jogging 3-4 times per week. During this time period she would use a global positioning system (GPS) application on her cellular phone to determine her location while jogging. MRI demonstrated at least six suspicious lesions spanning a length of 8 cm in the upper outer quadrant of the right breast. Mastectomy specimen showed extensive DCIS with multifocal invasion. A 5 mm metastasis was found in one sentinel lymph node.",
"gender": "Female"
},
{
"age": 39,
"case_id": "PMC3789302_04",
"case_text": "A 39-year-old female presented with three palpable breast masses in the area of cellular phone contact with her right breast. She had been placing her cellular phone in her bra while commuting and using a Bluetooth device to talk for hours each day for the past ten years. MRI demonstrated multiple mass-like and tubular areas of enhancement essentially involving the entire upper right breast from the 11 to 1 o'clock position. Mastectomy showed four separate invasive ductal carcinomas ranging from 1 to 3 cm in size with 10 cm of DCIS. Two of nine lymph nodes were positive for metastatic disease. Pathology of the insitu and invasive ductal carcinomas observed in all four cases shows striking similarity, and the representative histological figures are illustrated in Figure 2.",
"gender": "Female"
}
] |
PMC3789302
|
[
{
"age": 0,
"case_id": "PMC3232594_01",
"case_text": "A 2 month old female child, product of non-consanguineous marriage, presented with history of rapid breathing. On physical examination, a pansystolic murmur [Grade 3/6] was heard in 3rd, 4th and 5th intercostal spaces in left parasternal area. On electrocardiography, no abnormality was detected. Chest x-ray showed normal cardiac silhouette and lung vasculature. Transthoracic echocardiography revealed dilated left atrium and left ventricle. Mitral valve was divided into 2 separate valve orifices by a fibrous bridge (Figure 1).\nDuring diastole in four chamber view, the anterior mitral leaflet appeared like a 'V' due to an abnormal bridge of fibrous tissue connecting the two leaflets. Color Doppler flow imaging of the mitral valve showed 2 separate envelopes of antegrade flow into the left ventricle through the double orifices during diastole. No mitral or aortic regurgitation was documented by color Doppler flow imaging. The left ventricular ejection fraction was within normal limits. There was a small perimembranous VSD with left to right shunt (Figure 2). A small PFO was present shunting from left to right. In view of patient age and the cardiac lesion i.e. DOMV associated with small size VSD without mitral valve obstruction, patient was advised conservative management.",
"gender": "Female"
}
] |
PMC3232594
|
[
{
"age": 80,
"case_id": "PMC6562361_01",
"case_text": "The patient was an 80-year-old man who had undergone distal gastrectomy for gastric cancer [T3N1M0 per tumor-node-metastasis (TNM) staging, 7th classification] and colectomy for transverse colon cancer (T2N0M0 per TNM staging, 7th classification) four years previously. Eight months after these surgeries, the patient underwent partial hepatectomy for a metastatic liver tumor arising from primary gastric cancer, which was pathologically confirmed. The patient refused to undergo adjuvant chemotherapy. Periodic assessment of tumor marker levels (carcinoembryonic antigen (CEA) and carbohydrate antigen 19-9 (CA 19-9)) and enhanced computed tomography (CT) were performed during follow-up. Enhanced CT performed 4 years after the gastric/colon surgeries revealed a new low-intensity mass, 16 mm in diameter, located in segment V of the liver; the location of this lesion was different from that of the lesion identified during the first liver surgery. There was no evidence of other local, peritoneal, or lung metastases. On PET-CT, the mass presented as a hot, linear-like lesion, that almost appeared as two separate lesions (Fig. 1a). Consistent with enhanced CT examination, PET-CT examination did not reveal evidence of other metastatic lesions. T2- and diffusion-weighted images from gadolinium-ethoxybenzyl-diethylenetriamine pentaacetic acid-enhanced (Gd-EOB-DTPA) MR imaging revealed a high-intensity mass with invasion of Glisson's pedicle in segment V of the liver (Fig. 1b/c). The CEA level was elevated, whereas the CA 19-9 level was within the normal range. Considering these clinical data, we suspected a metastatic liver tumor arising from either primary gastric or transverse colon cancer. As imaging studies indicated that liver resection and cholecystectomy could be achieved with no residual tumor, we proceeded with surgical treatment.\nAlthough the mass and Glisson's pedicle in segment V of the liver were visible on intraoperative echography, invasion of Glisson's pedicle, identified on MR imaging and PET examinations, was unclear. Accordingly, following cholecystectomy, we proceeded with partial hepatectomy and transection of the root of Glisson's pedicle in segment V, under intraoperative echography guidance.\nOn gross appearance, the surgical margin of the tumor was within the cut surface (Fig. 2). On the basis of the pathological reports of previously resected specimens of gastric and colon cancers, the resected tumor was pathologically similar to gastric cancer (Fig. 3). Tumor infiltration of Glisson's pedicle, including the interlobular bile duct, was also confirmed on pathological analysis (Fig. 4). Immunohistochemical staining was negative for caudal-type homeobox (CDX)-2 and cytokeratin (CK)-20 and positive for CK-7; these findings were compatible with those of previous gastric cancer rather than colon cancer (Fig. 5). Thus, a final diagnosis of metastatic liver tumor from primary gastric cancer was made. One year after surgery, tumor marker (CEA and CA 19-9) levels remained within the normal range, and the patient was alive, with no evidence of recurrence.",
"gender": "Male"
}
] |
PMC6562361
|
[
{
"age": 46,
"case_id": "PMC4485302_01",
"case_text": "During 2013, two patients with mediastinal bronchogenic cyst underwent the thoracoscopy in our hospital. Both patients were female, one 46-year-old while another 62-year-old, complaining of mild pain and discomfort in the upper chest or the root of neck, accompanied by paroxysmal cough but no mucus, and without positive signs. Contrast enhanced computer tomography (CT) was performed in both patients, displaying an unilocular cystic lesion about 2.0x2.0 cm in size far above the aortic arch and close to the cupula pleurae in one patient, and two lesions above the cupula pleurae in the other patient. Subsequent fiberoptic bronchoscopy revealed no abnormal condition.\nBoth patients were incubated with a double-lumen endotracheal tube, and placed in the lateral decubitus position. The cameral port was placed in the 7th intercostal space across the posterior axillary line, and the two operating ports were placed respectively in the 4th intercostal space across the anterior axillary line and the 8th intercostal space across the angulus inferior scapulae line. The masses were soft, smooth, and encapsulated, with complex anatomic relationship to adjacent tissues. Be careful to completely dissect away cysts with electrocautery or aspirator, and nourishing vessels were treated with electric coagulation or titanium clips. The operations went smoothly without conversion to thoracotomy. Chest tubes were removed respectively on postoperative day 3 or 5. Length of postoperative hospital stay was respectively 5 or 7 days. Both histological examinations proved congenital brochogenic cysts. Preoperative and postoperative CT images were shown as below (Fig.1).",
"gender": "Female"
}
] |
PMC4485302
|
[
{
"age": 40,
"case_id": "PMC6386336_01",
"case_text": "A 40-year-old male presented with the appearance of skin lesions on his face during the past two months. Past medical history of diabetes mellitus was noted for him without any genetic disorder. On clinical examination, two skin-colored dome shaped firm masses were noted with each size of 10x5mm and 5x5mm, respectively. The larger lesion showed surface ulcerations. With suspicion of basal cell carcinoma (BCC) for both lesions, excisional biopsy was performed and sent for pathological study including hematoxylin and eosin (H&E) and immunohistochemical (IHC) staining for S-100, neuron specific enolase (NSE), smooth muscle actin (SMA), and desmin markers. Histopathological results confirmed the BCC, nodular type, for the larger one (figure 1).\nH&E stained sections of smaller lesion showed epidermis with unremarkable changes. The dermis displayed a well circumscribed, non-encapsulated lesion composed of epithelial and mesenchymal components. The epithelial component consist of distorted and hyperplastic pilosebaceous units with prominent sebaceous glands (fig 2). \nThe mesenchymal component mainly showed myxoid and fibrillary appearance containing elongated and wavy spindle cells arranged in fascicles resembling neurofibroma (figure 3). \nFurther immunohistochemical study for confirmation of neural mesenchymal stroma was done. Fibrillary mesenchymal componenets express S-100 marker (figure 4), while neuron specific enolase, smooth muscle actin, and desmin were negative (figure 5). Based on the results of H&E staining and IHC, the diagnosis of neurofollicular hamartoma was confirmed. Neurofollicular hamartoma itself is a benign tumor and treatment was achieved by local excision. The BCC lesion was demarcated and small in size which was surgically removed without further topical treatment or radiotherapy.",
"gender": "Male"
}
] |
PMC6386336
|
[
{
"age": 20,
"case_id": "PMC7370326_01",
"case_text": "Written informed consent was obtained from the patient. A 20-year-old man who presented with 2 month history of fever was admitted in our hospital on 8 October 2016. Without obvious cause, the patient had repeated chills and fever 2 months ago and the highest temperature raised to 39 C. He passed bloody stools and got abdominal pain during hospitalization. Physical examination was non-remarkable. Blood examination revealed 10.42 x 109 white blood cells/L, with 69.40% neutrophils and 16.17% lymphocytes. HIV antibody, immunochemistry, dengue antigen, hepatitis B, hepatitis C, influenza A, and influenza B antigen were all unremarkable. Chest and abdominal computed tomography (CT) scan showed ileocecus of ascending colon, and transverse colon showed diffuse thickening of the wall. The most obvious was in the transverse colon, which was considered as inflammation. On 13 October 2016, colonoscopy showed multiple segmental colon ulcers, which was considered as Crohn's disease or tuberculosis (Figure 1(a) and (b)). Pathology showed that there were a lot of acute and chronic inflammatory cells infiltration in lamina propria, submucosa, and muscle layer, and there were multiple granulomatous lesions without obvious caseous necrosis. In addition, the possibility of intestinal bacterial infection, inflammatory bowel disease (IBD), intestinal tuberculosis, lymphoma, histoplasmosis, and other diseases were excluded. It tended to be Crohn's disease, but tuberculosis was not excluded (Figure 2). The CTE of the small intestine showed that ileocecus and distal ileum were thickened and strengthened obviously after injection, so that the patient was conformed to Crohn's disease (Figure 3(c) and (d)). From 8-25 October, we gave him antibiotic treatments. Taking small intestinal computed tomography enterography (CTE), colonoscopy, and pathology into consideration, he was diagnosed as Crohn's disease and given glucocorticoids and immunosuppressant therapy from 20 October. After 5 days of treatment, the patient still had repeated fever, and the anti-infection treatment was upgraded to imipenem. However, his symptoms still have not improved. Therefore, we rechecked the colonoscopy. On 30 October, IBD was considered by colonoscopy, but it was not confirmed (Figure 1(a) and (b)). Meanwhile, tuberculosis was not excluded. Sample of intestinal biopsy was sent to our hospital and the Southern Hospital of Southern Medical University for examination. In the oral report of intestinal pathology in our hospital, the microbes with positive Periodic acid-Schiff (PAS) staining were examined, which were also seen in the intestinal pathology on 13 October. Therefore, we thought that we made a wrong diagnosis. Pathology reported that distal ileum, ascending colon, transverse colon, and sigmoid colon mucosa were infiltrated by a large number of tissue cells that had a large number of blue purple granules. Special staining showed purple blue particles with positive PAS staining and Gomori's Methenamine-Silver (GMS) staining. It was considered to be histoplasmosis. On 7 November, Southern Hospital Pathology Consultation Report described that a large number of tissue cells and multinuclear giant cells were seen in the lamina propria of ileum mucosa, and fungal spores were found in tissue cells, so that he was diagnosed as talaromycosis (Figure 4). On 8 November, immunologic testing showed that CD3 cells accounted for 17.40%, CD4 cells accounted for 11.50%, CD8 cells accounted for 4.10% and a CD4/CD8 ratio of 2.8. According to the pathology consultation report, he was finally diagnosed as talaromycosis. A treatment of itraconazole 0.2 g twice daily for a long term was given to him. The temperature dropped to normal and bloody stools disappeared after anti-fungal treatment for 5 days. We knew that he used to have a history of taking methamphetamine many times between July and August after inquiring about his medical history again. He reviewed colonoscopy in the hospital again on 17 January 2017. The examination results suggested that the intestinal inflammation subsided.",
"gender": "Male"
}
] |
PMC7370326
|
[
{
"age": 59,
"case_id": "PMC4300357_01",
"case_text": "A 59-year old male was diagnosed with a Gleason 3 + 3 = 6 adenocarcinoma of the right peripheral zone of the prostate based on positive transrectal biopsies. The tumor was staged cT1cNxMx, and the initial prostate specific antygen (PSA) was 6.4 ng/ml. Final staging was determined based on clinical examination, including digital rectal exam, and magnetic resonance imaging (MRI). The patient elected to undergo treatment with brachytherapy, delivered as low-dose-rate (LDR) treatment of the whole prostate. A total of 53 125I seeds were transperineally inserted into the prostate through 22 needles under ultrasound guidance. Intra-operative dosimetry confirmed an excellent plan: the dose to the hottest 90% of the prostate (D90) was 193 Gy, and 99% of the prostate volume was covered by 100% of the prescribed dose of 145 Gy. There were no complications during the procedure or abnormalities at post-implant dosimetry.\nThe patient recovered well from the procedure without relevant long-term toxicity. A PSA nadir of 0.11 ng/ml was reached 5 years afterwards. However, subsequently a gradual raise in PSA was noticed. At 6-years post-treatment, the PSA level was 4.3 ng/ml, and the PSA-doubling time (PSA-DT) was 14 months. An 11C-choline positron emission tomography (PET)/computed tomography (CT) (11C-choline PET/CT) followed by an MRI of the small pelvis revealed a perineal mass with a diameter of 14 mm just dorsally to the penile bulb (Fig. 1). Subsequent needle aspiration biopsy confirmed the diagnosis of recurrent prostate cancer. The position of the recurrence in the area of the brachytherapy needle tracts is most consistent with perineal seeding by one of the brachytherapy needles.\nThe patient was discussed at multidisciplinary tumor rounds. In light of the patient's young age, low co-morbidity index, low PSA-DT, and absence of other metastases on 11C-choline PET/CT, local treatment was recommended. Local excision was considered risky due to the close relation of the nodule with the penile bulb, the anal sphincter and the previously irradiated prostate, and therefore stereotactic radiotherapy was suggested.",
"gender": "Male"
}
] |
PMC4300357
|
[
{
"age": 76,
"case_id": "PMC8483267_01",
"case_text": "A 76-years-old woman came to the 2nd oncology department of D.D. Pletnev City Clinical Hospital with a suspected malignant neoplasm of the kidney (ICD-10:C64) in October 2018. Written informed consent was obtained from the individual for the publication of any potentially identifiable images or data included in this article. According to the anamnesis, she complained of pain in the right side for a long time. An outpatient ultrasound examination revealed a solid tumor-like structure in the upper pole of the right kidney 7 x 6 x 5 cm in size. In computer tomography (CT) plain scan and magnetic resonance imaging (Figure 1), the formation had irregular contours. Based on the radiology, the lesion had RENAL Nephrometry Score 10 meaning high complexity of the surgical intervention. It was also known that the patient suffered from hypertension, a permanent atrial fibrillation, cerebral atherosclerosis (stenosis of the internal carotid arteries up to 50%), chronic heart failure, postmenopausal duration-26 years. The patient's creatinine and urea levels at the time of hospitalization were within normal limits. The hospital surgeons carried out a planned laparoscopic right-sided nephrectomy supported by the clinical picture and radiology (Table 1).\nGross evaluation of the surgical material revealed a multichamber keratin-filled lesion in the upper pole of the right kidney, 7 x 6 x 5 cm in size (Figures 2A,B). The canal (isthmus) with a diameter of 0.7 cm connected it with one of the minor calices. The kidney parenchyma was thinned to 0.1 cm above this formation, while in other areas it was around 2 cm. In histological analysis (Figures 2C-H), the lining of the lesion consisted of alternating sections of urothelium and epidermis with developed granular and stratum corneum. The wall consisted of fibrous tissue with focuses of adipose cells, multi-caliber blood vessels and clusters of smooth muscle cells, which were clearly visualized by immunohistochemistry (Figures 3A-C). Urothelium and cuboidal epithelium of the cyst expressed cytokeratin 7 (CK7) and uroplakin 3, while the stratified squamous epithelium did not express these markers (Figures 3D-I). Both urothelium and squamous epithelium expressed p63 (Figures 3J-L).\nIn some areas, the wall of the lesion had well-defined contours and was separated from the renal parenchyma by renal sinus adipose tissue (Figure 2D and Figures 3A,D). We observed the areas with atrophy of the smooth muscle layer (Figure 3B). Somewhere, it was completely absent, the epithelial lining closely adjoined to the renal parenchyma and a single-layer cuboidal epithelium lined the wall (Figures 2F,H, and Figures 3C,E,F,I,L). Also, we defined the signs of chronic pyelonephritis with dilatation and deformation of the pelvicalyceal system. It is important to highlight, that we did not observe the appendages of the skin (hair, sebaceous and sweat glands) or any other components of teratoma-group lesions.\nThe patient had no complains 2.5 years after the nephrectomy. Blood and urine test results have remained normal.",
"gender": "Female"
}
] |
PMC8483267
|
[
{
"age": 47,
"case_id": "PMC9870323_01",
"case_text": "We present the case of a 47-year-old woman with Down syndrome diagnosed with AD 4 years prior to writing this report. We will refer to her as Mary. Before the onset of dementia symptoms, Mary's Down syndrome limited her ability to live independently or maintain employment. In 2014, Mary's body mass index (BMI) classified her as obese at 46.7 kg/m2. She participated in many activities on the family hobby farm, including caring for the horses and dogs. One activity included going to the barn, removing the horses from their stalls, cleaning the stalls, and restoring the animals and tools to their proper places. She had substantial autonomy and could be unsupervised for up to 5 h without concern. She was able to perform basic activities of daily living, including choosing her clothes, showering without assistance, toileting without assistance, and completing household chores. Her communication skills never used words with three syllables but delivered her messages. Mary's weight prompted her family to support her commencing a \"paleo\" diet, which they described as only whole-food diet with <100 g total carbohydrates per day. Mary's mother, her primary caregiver, prepared her meals and measured carbohydrate intake using Cronometer, an app for tracking carbohydrates, protein, fat, and kilocalories.\nIn 2016, at age 41, Mary began exhibiting memory loss. She grew confused when she left the house and could not navigate back home. Her memory loss was associated with symptoms of fear and anxiety, and disruptive obsessive-compulsive behaviors. Her clothing pattern became restrictive, and her once widely varied wardrobe became reduced to one outfit worn over and over. She became paranoid about the water coming from the shower head and refused to shower. Because of her change in behavior, fear, and anxiety, she became largely housebound. Mary struggled with fatigue, took extended naps once or twice daily, and could no longer safely be left alone for extended periods (Figure 1).\nIn 2018, Mary's primary care physician referred her to a Memory Care Specialty center. Reversible causes of dementia were ruled out with normal thyroid studies, vitamin B12, and vitamin 25-OH D3. Her HbA1c measured 4.8% and ruled out untreated diabetes. Treatment began with daily paroxetine 20 mg, memantine 28 mg, and, as needed, alprazolam 0.5 mg.\nThrough adherence to a paleo diet with carb restriction to <100 g total per day between 2014 and 2020, Mary maintained a 90-pound weight loss, with BMI 27.2 kg/m2. Despite her weight loss and medications, Mary continued to decline cognitively. She developed staring spells with lapses in awareness. These led to jerking movements of the hands and arms and the sudden loss of bladder control. She was diagnosed with absence seizures. Treatment with lamotrigine 150 mg was initiated, and these symptoms decreased in frequency to 6-10 episodes per week.\nIn January 2021, Mary's carbohydrate intake was lowered to 75 grams daily to normalize weight into the non-overweight range to optimize her physical health. This resulted in another 10-pound weight loss with a BMI of 24.8 kg/m2. Mary's cognition progressively declined, and her paranoia and social isolation worsened. She required adult day care when her ability to navigate obstacles was compromised. For example, when attempting to hand her mother an item when positioned on the opposite side of a table, Mary failed to navigate around the table without specific instructions. She began to require around-the-clock care when her reasoning skills diminished further, as evidenced by eating raw meat and other spoiled foods out of the trash.\nIn December 2021, an assessment using the Activities of Daily Living Scale (ADCS-ADL) revealed a score of 34 out of a possible 78, with a lower score indicating greater severity of impairment and a 34/78 classifying her as \"severely impaired\" (Table 1).\nThe resources required to care for Mary at this time included the following: adult day care, complete bathing assistance, complete toileting assistance, adult incontinence undergarments, locked cupboards, locked refrigerator, locked garbage bins, door alarms preventing unnoticed entries or exits, nanny cams to monitor sleep, a memory-care team including geriatrician, social worker, and caregiver support group. Alprazolam was needed several times per week to help with anxiety. Mary's ADCS-ADL scores and the list of care resources before and after implementing a ketogenic diet are referenced in the Table 1.\nIn January 2022, Mary's mother began a ketogenic diet for her own health purposes, including self-education through a weekly physician-led ketogenic support group and confirmation of ketosis with daily measurements of serum ketones via fingerstick. With the support of Mary's physicians, Mary's mother began a ketogenic diet for Mary as well in the desperate hopes that nutritional ketosis could benefit her suffering daughter. She had already noted that the restriction of carbohydrates to 75 g was insufficient for Mary to enter ketosis, with serum measurements reading less than or equal to 0.2 mmol/L. Mary's carbohydrate intake was limited to <20 total grams daily, with a subsequent rise in serum ketones to consistently 0.8-3.0 mmol/L, measured morning fasting. Specifically, Mary's diet consisted of 70-80% fat by calories, with sample menus provided in Table 2.\nSeveral remarkable improvements occurred over the following 6 weeks.\nFirst, Mary's seizure activity improved. Within two weeks, she was fully continent and no longer experienced dissociative episodes or displayed any further evidence of seizure activity. Mary's sleep and energy also improved. She awoke unprompted, stopped napping, enjoyed more energy, and her mood improved.\nIn the third week, Mary surprised her mother when she replied with these words, \"Yes. I understand.\" This three-syllable word, \"understand,\" had never been part of Mary's vocabulary. Her advanced articulation accompanied Mary's participation in conversations requiring short-term memory.\nBy the end of the fourth week, Mary regained interest in leaving the house, attending social events, and no longer required adult day care. Mary's paranoia about the showerhead abated, and she resumed unsupervised showers. Her obsessive-compulsive symptoms also resolved, and she resumed a varied wardrobe again. Mary's memory, concentration, and executive functions improved enough to resume her caring for the animals. She was able to walk the dog unaccompanied and free of anxiety.\nAfter 6 months of starting a ketogenic diet, Mary's weight stabilized at 104 pounds, resulting in a BMI of 22.5 kg/m2. Her doctor discontinued all medications, and her ADCS-ADL returned to her baseline score of 58/74. Thus, the diagnosis of presumed AD was removed from her chart.",
"gender": "Female"
}
] |
PMC9870323
|
[
{
"age": 33,
"case_id": "PMC4891465_01",
"case_text": "We report a 33 year old male with persistent left wrist pain after a fall onto his outstretched hand. Physical exam demonstrated swelling and point tenderness at the anatomic snuffbox. Wrist radiographs confirmed a comminuted, mildly displaced fracture of the distal scaphoid (Figure 1).\nInternal fixation of the fracture was performed utilizing an Acutrak screw (Acumed, Beaverton, Oregon;) (Figure 2, Figure 3). During follow-up visits at 4 and 8 weeks, the patient reported progressively decreased pain and improved left wrist function. Follow-up radiographs demonstrated continued healing of the fracture, and the remainder of the patient's recovery was uneventful.",
"gender": "Male"
}
] |
PMC4891465
|
[
{
"age": 25,
"case_id": "PMC8589513_01",
"case_text": "A 25-year-old nulliparous Italian female patient was admitted to the Intensive Care Unit of Sandro Pertini Hospital, Rome, Italy, on April 4, 2020. The patient started to have body temperature of 38.1 C, headache, decreased consciousness, repetitive talking, and involuntary movements on mouth and feet reported from March 28, 2020. After 3 days, she developed amnesia, followed by delirium and discontinuous confusion. On April 4, 2020, the patient had started an epileptic seizure that lasted for few minutes. After this stage, the patient was admitted to the emergency department of Sandro Pertini Hospital of Rome for the appropriate investigations and therapy. Physical examination upon admission revealed a decreased Glasgow Coma Scale (eye response: 3; verbal response: 3; and movement response: 4), blood pressure was 139/68 mmHg, pulse was 90 times per minute, respiratory rate was 16 times per minute, and body temperature was 38.3 C. Neurological examination revealed severe nuchal rigidity, spastic tetraparesis, brisk reflexes, increased muscle tone of upper and lower limbs, Babinski reflex bilaterally positive, and numerous comitial seizures. Moreover, during hospital course, the patient developed numerous complex partial seizures. Pleocytosis was detected in the cerebrospinal fluid (CSF). Electroencephalography revealed frequency 7-9 c/s unstable, irregular, hyporeagent, and symmetric intermixed with delta activity at 1-2 c/s especially anterior regions and periventricular. Diagnostic suspicion included viral encephalitis, autoimmune encephalitis, and meningoencephalitis. Brain magnetic resonance imaging (MRI) scans showed periventricular, subarachnoid, and cortical hyperintensity on fluid-attenuated inversion recovery (FLAIR). Collaterally, a total body CT scan revealed a 22 x 8 x 19 mm dermoid cyst of the right ovary. Following radiological investigation, the diagnostic suspect of autoimmune encephalitis led to send patient's CSF and serum's sample for the NMDAR antibody test in the oncoimmunology center. Meanwhile, abdominal ultrasound (US) was performed to find link between dermoid cyst and neurological symptoms. Transvaginal ultrasound revealed a right adnexal diffusely echogenic unilocular mass sized 23 x 18 x 11 mm with posterior sound attenuation due to sebaceous material and hair within the cyst cavity, mural hyperechoic Rokitansky nodule, echogenic shadowing dental components, no internal vascularization at the color-Doppler examination. The lesion was considered to be teratoma. To relive worsening neurological symptoms, she was initially treated with anticonvulsants (oxcarbazepine, phenytoin, phenobarbital, and levetiracetam), neuroprotector, intravenous methylprednisolone, 6 courses of plasmapheresis, and 5 courses of IVIG.\nCSF NMDAR antibody returned positive confirming diagnosis of paraneoplastic NMDAR antibody-associated limbic encephalitis. With multidisciplinary team meeting (Neurologist, Gynecologist, Internist, Intensivist, and Anesthesiologist), confirming diagnostic suspicion, it was decided to undertake further surgical treatment and remove the ovarian lesion. Laparoscopic resection of the right ovary was performed on May 5, 2020. A postoperative pathologic examination revealed the following: right ovarian mass of primitive neuroglial elements mingled within surrounding lymphocytes and ectodermal elements, including squamous epithelium, sebaceous tissue, and hair elements. Therefore, pathological examination confirmed the diagnosis of mature teratoma. The patient's conditions gradually improved after the surgical treatment. The absence of remaining teratoma tissue was confirmed in a follow-up abdominopelvic CT. After the surgery, first-line medical therapy including steroid, intravenous immunoglobulin (IVIG) for 5 days, phenobarbital, valproate, levetiracetam, and olanzapine to control the epileptic and mental symptoms was performed. Following combined medical and surgical therapy, the patient showed significant improvement in language and cognitive function. The complete recovery was achieved after psychomotor rehabilitation sessions, including physiokinesitherapy and hydrotherapy, and behavioural rehabilitation. One month later, the patient mobilized without involuntary movements or seizures. After three months, all mental symptoms improved and the patient gained perfect cognitive and language function. Therefore, the patient was discharged on June 4, 2020, and she was sent for 3 months to a rehabilitation facility for motor and psychiatric outcomes.\nAfter this treatment, she discontinued all medications; she developed complete resolution of all cognitive and mood symptoms that persisted prior to surgery and did not experience any further symptoms.",
"gender": "Female"
}
] |
PMC8589513
|
[
{
"age": 53,
"case_id": "PMC9974013_01",
"case_text": "A 53-year-old right-handed AP pianist who had a moderate headache that had lasted three days as well as minor topographical agnosia, which made her feel lost while driving, walked into our emergency room. She began playing the piano when she was five years old and later earned a degree in piano performance from a music college. She was a moderate student in the college's music dictation class and had been conscious of her AP since elementary school. After graduating, she managed a music school and performed piano at some events. She was admitted with a blood pressure of 152/79 mmHg due to untreated hypertension. A right parietal subcortical hemorrhage of about 8 mL was detected by head computed tomography. Nicardipine was used as an antihypertensive medicine in conservative therapy.\nFluid-attenuated inversion recovery (FLAIR) images confirmed that the left Heschl's gyrus, planum temporale, inferior frontal gyrus, pre-supplementary motor area, dorsolateral prefrontal cortex, and intraparietal sulcus, which are important to AP, were not injured. The hematoma is shown (blue arrowheads in Figure 1A). The edematous lesion slightly improved on day 14 (orange arrowheads in Figure 1B). The right parietal lobe, where the hematoma was located, showed hypoperfusion on the arterial spin labeling (ASL) images (arrows in Figure 1C).\nOn the next day (day 15), her AP was evaluated using a pitch-naming test in the rehabilitation room, using a Yamaha C1X Grand Piano (Yamaha Music Japan Co., Ltd., Hamamatsu, Japan). She was instructed to identify pitch classes (e.g., C, C#, and D) of 60 random piano tones covering five octaves. One investigator applied equal force to each key on the piano once. A random number table determined the order of the tones. The piano-tone noises lasted for roughly two seconds. The patient was given as much time as needed to react throughout this untimed test. Another investigator recorded her replies as she read aloud the note's name. Her precision was 88%. Nearly 80% of the responses were given within three seconds. We determined that her AP was conserved as a result.\nOther measures of cognitive function did not show significant deficits, except for Kana pick-up test with 85% accuracy: The results of the Standard Language Test of Aphasia were 20/20, Communication Activities of Daily Living (ADL) test 136/136, Hasegawa Dementia Scale-Revised 30/30, Trail Making Test-A and -B 87 and 154 seconds, and Kohs block test intelligence quotient (IQ) 106. On day 27, she was discharged home with a modified Rankin Scale score of 0. She was back to working as a piano teacher soon, and there has been no particular interruption to her musical activities to date.",
"gender": "Female"
}
] |
PMC9974013
|
[
{
"age": 0,
"case_id": "PMC5878845_01",
"case_text": "A 5-day-old male weighing 1700g with a normal delivery was sent to our department for the suspicion of duodenal atresia. The newborn presented non-bilious vomiting since birth and never emitted meconium. Clinical examination found a poor general condition, a trisomic facies, a weight to 1600g and a plat abdomen. Biological check-up was normal. An abdominal X-ray showed a single bubble gastric air with no gas beyond (Figure 1). A second abdominal X-ray performed two days later showed a double bubble air without a distal aeration (Figure 2). Abdominal ultrasound was normal. The diagnosis evoked were PA and duodenal atresia. The laparotomy revelated a type C pyloric atresia with an important gap between the stomach and the duodenum (Figure 3). A duodenogastrostomy was performed and a transanastomotic naso-duodenal tube was placed. One day after surgery the newborn is fed by the nasoduodenal tube. On the 12th post-operative day, this tube was removed and oral feeding is started. The baby comes out of the hospital on day 16 post-operative with a weight of 2450g. He was asymptomatic after a follow up of one year.",
"gender": "Male"
}
] |
PMC5878845
|
[
{
"age": 57,
"case_id": "PMC10400715_01",
"case_text": "In April 2020, a 57-year-old female patient initially experienced a sudden onset of a right-sided limb movement disorder and a lack of fluency in speech. The cephalometric CT scan at a local hospital showed thalamic hemorrhages. After conservative treatment, her speech function recovered, but she still felt poor physical strength and had an abnormal gait. She was then admitted to Beijing United Rehabilitation Hospital for further rehabilitation in March 2021. Two months after hospitalization, the patient developed moderate-to-severe pain [visual analog scale (VAS) 6-9] on the right side of her body, including the face, arm, trunk, and limbs, with no apparent cause. The pain was persistent and tightness-like, accompanied by paroxysmal pinprick-like pain occurring 30-50 times per day. The patient felt a painful wandering mass on the right plantar aspect of her foot and was unable to put weight on the right foot due to the pain. She also experienced paroxysmal knife-like pain (VAS 9) in the right upper arm, and moderate-to-severe tearing-like pain (VAS 6-9) in the right axilla and lateral chest wall. The magnetic resonance imaging (MRI) showed a malacic lesion in the left thalamus, and chronic ischemic lesions in the brainstem, bilateral basal ganglia, and periventricular white matter. Multiple white matter lesions in bilateral periventricular and subcortical white matter were observed, and Fazekas 3 was considered (Figure 1).\nShe was prescribed oral medications, including Gabapentin(R) (1,200 mg, three times a day), Duloxetine(R) (60 mg, once a day), Neurotropine(R) (8 u, twice a day), Tylenol(R) (1 tablet, as needed), and received traditional acupuncture, herbal medicine, and physical therapy. However, the pain was not alleviated. The patient frequently woke up at night due to pain outbreaks, which severely influenced her mood, sleep, and her ability to cooperate with rehabilitation treatment. Thus, she sought a consultation from the Division of Pain for further treatment.\nDuring the consultation, the patient exhibited slower speech. Her right side of the body was hyperalgesic and could not tolerate cold when wiped with an alcohol swab. The muscle strength of the proximal right limb was grade 4, and the distal limb was grade 4-. The patient's right hand was unable to hold chopsticks or use a pen due to the contracture of the 3rd-5th fingers. Pressing pain was identified in the cervical spinous processes (C2-7), right transverse processes, and coracoid process of the right scapula. Similar symptoms were also detected in the right sternocleidomastoid, trapezius, and pectoralis major muscles. The abdomen was tense with pressing pain in the upper abdomen. The bilateral iliopsoas muscles, upper and lower back, and right hip experienced pressing pain. The patient also reported pressing pain in the posterior leg and on the right plantar.\nAfter the first treatment with cheek acupuncture (Figure 2), the patient experienced significant relaxation on the right side of her body and a 60% reduction in spontaneous pain. The painful mass in the right foot shifted to the heel, decreasing in size and pain level. The patient could tolerate the pain in the right foot triggered by touching the ground. The first four sessions were administered once a week, followed by treatments every two weeks. The symptoms continuously improved during the treatments. Eight sessions later, the spontaneous pain in the right limb and trunk was reduced by 70-80%, and paroxysmal pinprick-like pain episodes occurred less than five times a day, lasting 2-3 seconds each time. There were no more nocturnal eruptive pain episodes. The patient only took Gabapentin 900 mg three times a day. The patient could stand only on right leg. The contracture of the right hand significantly improved, and the patient could perform certain fine activities, such as eating with chopsticks and writing. The walking gait was much better than before. Importantly, the patient's mood and sleep improved significantly, which facilitated rehabilitation training.",
"gender": "Female"
},
{
"age": 46,
"case_id": "PMC10400715_02",
"case_text": "A 46-year-old female is a full-time mother and has been engaging in physical exercise for 2 h a day before sick, mainly to strengthen her abdominal, back, and gluteal muscles. She experienced on March 8, 2021 with severe pain in the right buttock, radiating to the area between the perineum and anus. The pain in the right gluteal region was moderate to severe, sharp pain (VAS 7-10). The radicular pain in the perineum was burning-like and electric shooting-like. Additionally, the patient experienced a slow onset of urination, anal swelling, and an increase in the frequency of stools (3-4 times a day). Turning over were difficult and lying down was in restricted positions due to the pain, which severely affected her sleep. She required regular walks or extra analgesic medicine at night to alleviate the pain and for sleep. An ultrasound of the superficial hip and a pelvic CT scan conducted in another hospital did not reveal any abnormalities. Blood sedimentation, C-reactive protein, and blood routine parameters were within the normal range. The patient had no significant medical history.\nOver the last two weeks, she consulted several hospitals and took various analgesic medicines, including Imrecoxib(R), Aescuven(R), Mecobalamin(R), Tizanidine(R), TaiLeNing(R), and Pregabalin(R), which provided slight relief, but she still experienced moderate to severe pain (VAS 7-9).\nThe patient came for consultation (March 23, 2021) in our service with a limp. Physical examination revealed a positive Patrick's test, increased tone of the right rectus abdominis muscle, pressing pain on the right pubic tuberosity with evoked right perineal pain. Pressing pain was also detected in the right iliopsoas muscle, with radicular pain extending to the perineal area, as well as in the right lesser trochanter and right gluteal region (between the right sacrum and the right greater trochanter). Increased tone of the right erector spinae muscle and pain sensitization in the right perineal area were also observed. The pudendal neuralgia was considered.\nFollowing cheek acupuncture, the burning-like pain in the right perineal area and the right hip pain disappeared, and the hip pressure pain was relieved by 90%. At the follow-up after treatment, the patient occasionally experienced mild electric shooting-like pain (VAS 2-3) in the right perineal area about 0-1 time per hour, along with mild deep hip pressure pain. On the fifth day after treatment, she discontinued the analgesic medications Imrecoxib(R), Aescuven(R), Mecobalamin(R), Tizanidine(R), and TaiLeNing(R), resulting in a slight increase in resting pain (VAS 2-3), hip pressure pain (VAS 6), and occasional mild electric shooting-like pain in the perineal area.\nOn the seventh day (March 30, 2021) after the initial acupuncture, an ultrasound was performed to measure the thickness of the piriformis muscle of the hip before the second session of acupuncture. The ultrasound probe was placed between the sacrum and the greater trochanter of the femur, where two layers of muscles, the gluteus maximus and piriformis muscles, were observed (Figure 3A). The piriformis muscle was identified by rotating the leg internally and externally. Color Doppler was used to determine the position of the inferior gluteal artery, next to which the thickness of the piriformis muscle was measured as 1.18 cm (left side, non-injured) and 2.05 cm (right side, injured) (Figures 3A, B), respectively. Then, cheek acupuncture treatment was performed for 30 mins (Figure 3C). After the treatment, the patient no longer experienced pain in the right perineal region and the right gluteus, and the gluteal pressure pain was relieved by 70%. Ultrasound showed the thickness of the piriformis muscle in right side decreased to 1.31 cm (Figure 3D). Follow-up on the third day after the second acupuncture session showed that the patient was pain-free and able to move without any positional limitations. Mild electric shooting-like pain occurred occasionally in the perineal area.\nThe acupuncturist has a couple of years of experience in cheek acupuncture. Prior to performing acupuncture manipulation, a thorough physical examination of the patients was required to accurately localize the pain in the body. This helped in identifying the specific muscle(s) and soft tissues that were injured, and/or the nerve was compressed or influenced. The corresponding acupoint(s) on the cheek and the appropriate size of acupuncture needles were then selected for the acupuncture procedure. Once the needles were inserted, the analgesic effect was reevaluated through physical examination. If the pain did not fully or only partially alleviate, the depth and direction of needling needed to be adjusted, or additional needles closer to the acupoint were required until complete or significant pain relief was achieved. For each treatment, specific acupoints were selected based on the results of the physical examination. Generally, the needles were left in place for 30 mins during each session, and treatments were performed once every 1-2 weeks depending on the progress of the symptoms. Table 1 presents the standard acupoints of cheek acupuncture, their orientations, applications for various diseases, and acupoints that have been used (all sessions) for two patients in the present study.",
"gender": "Female"
}
] |
PMC10400715
|
[
{
"age": 0,
"case_id": "PMC4263476_01",
"case_text": "Information on outbreak case patients and their contacts is shown in table 1. The index patient (Case 1) was a 9-month-old boy born on November 23, 2010. On August 17, the patient developed fever and cough; on August 20, he developed bilateral weakness of lower extremities. The patient was hospitalized one month later (September 19), and the case was reported as having AFP on September 20. Epidemiologic investigations were conducted, and two inadequate stool specimens were obtained from the patient on September 20 and September 22. Type Pi Sabin-related poliovirus strains were isolated from two specimens with 5 nt VP1 substitutions.",
"gender": "Male"
},
{
"age": 0,
"case_id": "PMC4263476_02",
"case_text": "The second case patient (Case 2) was a 10-month-old girl with onset of fever on 14 Oct and of bilateral leg paralysis on Oct 15. On Oct 17, she was taken to Ngawa Prefecture People's Hospital where she was reported as having AFP. Type Pi VDPV (6 nt VP1 substitutions) strains were isolated from stool specimens collected on Oct 18 and Oct 19. The third case patient (Case 3) was a 12-month-old girl. She developed fever and diarrhea on Dec 24, 2011 and right leg paralysis on Jan 7, 2012, and she was seen at township central clinic and Ngawa Prefecture People's Hospital. On Jan 16, because she had shown little improvement, she was taken to Huaxi second affiliated hospital of Sichuan university and was reported as having AFP. Type Pi VDPV (8 nt VP1 substitutions) strains were isolated from stool specimens collected on Jan 19 and Jan 21. The fourth case patient (Case 4) was a 9-month-old boy with bilateral leg paralysis on Feb 6, and he was seen at Ngawa Prefecture people's hospital on Feb 21. On Feb 22, because he had shown little improvement, he was taken to Chengdu Hospital of Infectious Disease and was reported as having AFP. Type Pi VDPV (11-12 nt VP1 substitutions) strains were isolated from stool specimens collected on Feb 23 and Feb 24.\nAll 4 case patients lived in Ngawa County and had not been immunized. The index case was diagnosed as clinical compatible polio case (poliovirus strain with 5 nt VP1 substitutions), and the other case patient were diagnosed as VDPV cases by provincial PEC.\nDuring Feb 7-10, stool specimens were collected from 150 close contacts of case patients. A type Pi VDPV strain was isolated from one other child (Case 3-c1) who lived in a neighboring village of the third case patient. A type SH poliovirus strain (8 nt VP1 substitutions) was also isolated from one close contact of the third case patient.\nTotally, 7 AFP cases were reported in Ngawa Tibetan and Qiang Autonomous Prefecture in 2011, including one clinical compatible polio case, one VDPV case and 5 non-polio AFP cases all of whom were paralyzed after the index case (Fig. 1). Of the 5 non-polio AFP cases, 2 (40%) were diagnosed as non-polio enteroviruses (NPEV) infection, 1 (20%) with Guillain Barre syndrome, 1 (20%) with hypokalemic periodic paralysis and 1 (20%) with transverse myelitis.\nA total of 9 AFP cases were reported in 2012, including 2 VDPV cases and 7 non-polio AFP cases all of whom were paralyzed after the last VDPV case (Fig. 1). All the 7 non-polio AFP cases were diagnosed as transverse myelitis.",
"gender": "Female"
}
] |
PMC4263476
|
[
{
"age": 4,
"case_id": "PMC5324876_01",
"case_text": "A 4-year-old boy without any medical history presented to local emergency department with fever for 10 days and aggravated abdominal pain for 3 days. Gastroenteritis was suspected and intravenous antibiotic was prescribed. Three days later, he suffered cardiac arrest and after successful cardiopulmonary resuscitation, he was immediately transferred to our hospital. Electrocardiogram showed sinus tachycardia, Q wave was observed in V2-4 (Fig. 1a). Transthoracic echocardiogram (TTE) and 3-dimensional TTE revealed giant dilatation of left anterior descending coronary artery (LAD; 16 mm) with massive intraluminal thrombus (Fig. 1b, Fig. 1 Video 1, 2), dilated right coronary artery (RCA; 6 mm), enlarged left ventricle with abnormal wall motion (left ventricular ejection fraction: 48%) (Fig. 1c, Fig. 1 Video 3). Patient was diagnosed with incomplete Kawasaki disease and myocardial infarction. Intravenous immunoglobulin, clopidogrel, warfarin, and diuretic were administered.\nSix months later he continued to have limited, aggravated physical activity. Coronary computed tomography angiography confirmed giant dilatated and distal-blocked LAD (17 mm) (Fig. 1d, Fig. 1e). Positron emission tomography also revealed large myocardial perfusion defect in left ventricular apical segment and survival of some mid anterior myocardial cells (Fig 2. arrows).\nConsidering deterioration of left ventricular function and evidence of myocardial ischemia, coronary artery bypass graft surgery was scheduled. The patient was transferred to cardiovascular surgery department.\nLeft anterior descending coronary artery aneurysm with massive intraluminal thrombus.\nThree-dimensional view of left anterior descending coronary artery aneurysm and thrombus.\nAn enlarged left heart.",
"gender": "Male"
}
] |
PMC5324876
|
[
{
"age": 49,
"case_id": "PMC3543949_01",
"case_text": "A 49-year-old man who had developed type 2 diabetes mellitus at 42 years of age, presented with diarrhea 6 months ago. His glycemia was poorly controlled, based on a haemoglobin A1c of 17.7%. He had hypercholesterolemia, orthostatic hypotension, diabetic retinopathy, nephropathy, peripheral neuropathy, autonomic neuropathy, and gastroparesis. Current medications included insulin, losartan, atorvastatin, midodrine, metoclopramide, and domperidone. Diarrhea occurred at a frequency of > 10 bowel movements per day, with fecal urgency following meals. Steatorrhea was absent and the stool examination was unremarkable. He was prescribed conventional antidiarrheals, including a pancreatic enzyme supplement, rifaximin, probiotics, cimetropium bromide, and loperamide, but these were ineffective. He also had iron-deficiency anemia, as evidenced by a hemoglobin of 9.1 g/dL, mean corpuscular volume of 84.7 fL, 1.95% reticulocytes, and ferritin of 8.45 ng/mL. Capsule endoscopy (PillCam SB2, Given Imaging, Yokneam, Israel) was performed after upper endoscopy, colonoscopy, and abdominal computed tomography failed to explain the iron-deficiency anemia. He fasted for 12 hours before capsule ingestion. For 4 hours following ingestion of the capsule, only water was permitted, after which a liquid diet was offered. All medications except the losartan were discontinued. Capsule endoscopy identified multiple angiodysplastic lesions in the distal ileum. Interestingly, a markedly prolonged gastric emptying time (13 hours 33 minutes) with a rapid small bowel transit time (14 minutes) was noted (Fig. 1), suggesting gastroparesis and autonomic neuropathy, respectively. The diarrhea persisted, so ramosetron therapy (Irribow, Astellas Pharma Korea, Seoul, Korea) was started at 5 microg once daily before breakfast. The diarrhea and fecal urgency disappeared completely after 1 week of ramosetron treatment, with the bowel movement frequency reduced to two soft stools per day. On ceasing ramosetron, the diarrhea recurred, but was relieved once more when the medication was restarted. 5-Hydroxytrytamine (5-HT) acts on 5-HT3 parasympathetic receptors to produce smooth muscle contraction and the release of acetylcholine from nerve terminals, causing intestinal secretion to increase. The 5-HT3 receptor antagonist alosetron is useful in the treatment of diarrhea in patients with irritable bowel syndrome, but must be avoided in more severe cases because of the risk of constipation. The efficacy of other 5-HT3 receptor antagonists such as ondansetron and ramosetron in the treatment of diabetic diarrhea has been documented.\nIn conclusion, given the inhibitory effects of a 5-HT3 receptor antagonist on smooth muscle contraction and secretion, ramosetron should be considered in cases of diabetic diarrhea with rapid small bowel transit. A larger study is needed to verify the efficacy of ramosetron in treating this condition.",
"gender": "Male"
}
] |
PMC3543949
|
[
{
"age": null,
"case_id": "PMC5129125_01",
"case_text": "A baby girl with prenatally diagnosed duodenal atresia was born at 40 weeks of gestation and a birth weight of 3070 g. The karyotype excluded Down syndrome. Postnatal radiography confirmed a double-bubble in the upper abdomen (Fig. 2). No other associated anomalies were detected, and the nasogastric output was clear and nonbilious.\nThe child was scheduled for laparoscopic duodenoduodenostomy on the second day of life. During surgery, 3 mm trocars were placed in the navel, as well as the left upper and right lower quadrants. The distended proximal duodenum was immediately visible. Upon further inspection, the underlying cause of the atresia was found to be annular pancreas. The distal, atretic portion of the duodenum was relatively fixed to the retroperitoneum due to the annular pancreas. Therefore, distal duodenum and a portion of jejunum was mobilized and brought close to the proximal portion using transabdominal percutaneous stitches. With both portions of the bowel apposed, enterotomies were performed using cold endoscopic scissors at the anterior aspect (Fig. 3). A 5.8 mm diameter articulating endostapler (MicroCutter 5/80, Dextera Surgical Inc., Redwood City, CA) was introduced through an additional skin incision in the right upper quadrant in trajectory of the aligned portions of duodenum (Fig. 4). Care was taken not to include the papilla in the anastomosis by gently pushing the stapler inferiorly, away from the liver. The stapling device was activated, creating a side-to-side anastomosis of both duodenal limbs. The combined enterotomy was closed using a running 4-0 Glycolactate suture. Total operative time was 75 min. The staple line was well visible on a postoperative radiograph (Fig. 5). Breastmilk was given on postop day one and the patient was discharged home on postop day 5. At a recent 5 months follow up visit, she was developing and thriving normally.",
"gender": "Female"
}
] |
PMC5129125
|
[
{
"age": 53,
"case_id": "PMC6442326_01",
"case_text": "We report a 53-year-old man presented with dropping of the right eyelid associated with a diminished vision for 4 months. He also complained of vertical diplopia especially when looking down. The past medical history revealed chronic sinusitis. There was no previous history of diabetes or hypertension. Ophthalmological examination revealed right blepharospasm associated with right hypertropia. There is palpable mass at the inferiomedial aspect of the right eye. Conjunctiva, cornea, anterior chamber, pupil, iris, and lens were normal. Magnetic resonance imaging revealed orbital mass in the form of abnormal signal intensity in the right orbit inferior aspect occupying the orbital floor, measured 2.7 cm x 2.5 cm x 1.2 cm and showed enhancement on postcontrast study. It was slightly of low-signal intensity on T2, intermediate on T1 and showed enhancement on postcontrast study. Laboratory investigation revealed normal complete blood count.\nThe patient underwent complete excision of the tumor. The tumor measured 4.5 cm x 3 cm x 0.6 cm. Serial sectioning of the specimen revealed a homogeneous, white tan cut surface. No areas of hemorrhage or necrosis were seen. Microscopic examination revealed aggregates of histiocytes with abundant cytoplasm admixed with numerous plasma cells and some lymphocytes [Figure 1a and b]. Some of the histiocytes appeared to engulf small lymphocytes and plasma cells (emperipolesis). There were fibroblastic proliferation and fibrous tissue formation. The proliferation surrounded and involved nerve bundles, skeletal muscle, and adipose tissue. Immunohistochemistry study revealed that the histiocytes were positive for CD68 and S100 [Figure 1c] and negative for CD1a and langerin. The plasma cells expressed CD79a, CD138 [Figure 1d] and appeared polyclonal with Kappa and Lambda light chain stains. The immunoglobulin G (IgG) 4/IgG ratio was <5% [Figure 1e and f], which against the diagnosis of IgG4-related disease. The lymphoid component was a mixed population of B-cells (CD20 positive) and T-cells (CD3 positive). The fibroblastic proliferation was positive for vimentin and focally for Muscle Specific Actin (MSA). They were negative for desmin, Smooth Muscle Actin (SMA), ALK-1, S100, and pankeratin. Special stains for acid-fast bacilli (Z-N) and fungi (periodic acid-Schiff and Gomori methenamine silver) were negative. These histological and immunohistochemical features are consistent with extranodal RDD. There was no complication after the complete excision. Clinical follow-up until 2 years after surgery did not show any evidence of recurrence.",
"gender": "Male"
}
] |
PMC6442326
|
[
{
"age": 18,
"case_id": "PMC5629886_01",
"case_text": "Mr. X, a 18-year-old right-handed single male educated up to 12th standard presented to our psychiatric outpatient clinic in September 2015 with complaints of excessive sleep episodes of abrupt onset lasting for 7-14 days occurring 1-2 times every year from the last 5 years (onset at 13 years of age) associated with feeling of depersonalization and derealization with abnormal behavior. He would experience sudden-onset extreme fatigability with an irresistible need to rest, sleeping for 22-23 h/day with spontaneous waking for 2-3 times to pass urine or stools. He would have to be coaxed to eat once or twice in the day and would report loss of appetite when awaken by family members. He also reported feeling of depersonalization and derealization when awake during this period as if in a dream-like state and felt as if he was dead or in a movie with things around him being unreal. He would be apathetic and stopped doing his routine activities. During the episodes, there was no history of hyperphagia, hypersexuality, and prominent mood or anxiety symptoms. There was no positive past or family history of any psychiatric or neurological disorder.\nIn the first episode, the patient also had, in addition to above-described symptoms, sudden-onset persecutory delusion and disorganized behavior lasting for 2-3 days. He was diagnosed as a case of unspecified nonorganic psychosis (according to the International Classification of Diseases [ICD-10]) and had received multiple antipsychotics (olanzapine, aripiprazole, trifluoperazine) with episodes occurring despite of patient being compliant to antipsychotic treatment.\nThe patient was admitted in psychiatry ward for detailed evaluation to rule out any neurological or sleep disorder causing the present condition. Routine (liver functions, renal functions, hemogram, fasting blood sugar, urine routine and microscopy, chest-X-ray, electrocardiogram) and other laboratory investigations (serum Vitamin B-12 and folic acid, serum adenosine deaminase, serum ferritin, blood ammonia) did not detect any abnormality. Endocrine evaluation (serum thyroid-stimulating hormone, T3, T4, thyroid peroxidase antibody, serum testosterone, serum adrenocorticotropic hormone, serum prolactin) was within normal limit. Electroencephalography was normal with no epileptiform discharges and magnetic resonance imaging of the brain did not reveal any structural abnormality. Polysomnography was also done to rule out any sleep-related disorder and did not detect any abnormality. Technetium-99m ethyl cysteinate dimer brain perfusion study (single-photon emission computed tomography) revealed hypoperfusion in left frontal (precentral gyrus), left temporoparietal, left basal ganglia, and left thalamus consistent with findings reported in KLS patients.\nOur case fulfills the criteria for KLS given in the ICD-3 (2013) guideline. Antipsychotics were stopped and the patient continues to maintain symptom-free on conservative management and is in active follow-up.",
"gender": "Male"
}
] |
PMC5629886
|
[
{
"age": 21,
"case_id": "PMC10243658_01",
"case_text": "A 21-year-old primigravida mother presented at 34 weeks with a third-trimester antenatal scan showing a pericardial mass and cardiomegaly. An anomaly scan at 18 weeks was normal. Pregnancy was otherwise uneventful. A girl baby was delivered at 38 weeks by elective cesarean section with a birth weight of 2670g. The baby did not require any resuscitation and was kept in the neonatal care unit for further evaluation of pericardial mass. The baby did not have any sign of respiratory distress, hemodynamic impairment, or murmur at birth. Arterial oxygen saturation (SaO2) was >95% in both upper and lower limbs. Chest X-ray (CXR) on day 1 showed cardiomegaly (cardiothoracic ratio of 0.8) with no features of pulmonary edema [Figure 1]. A postnatal echocardiogram on day 2 showed a 30 mm x 20 mm echogenic pericardial mass surrounding the left ventricle with no intracardiac extension and mild pericardial effusion [Figure 2]. A provisional diagnosis of cardiac teratoma was made because of the pericardial location, the absence of myocardial involvement, and pericardial effusion. Serum alpha-fetoprotein, a marker of germ cell tumor, was also raised (5520 ng/ml), which further strengthen our diagnosis. As the baby was asymptomatic with no outflow obstruction, a cardiac computerized tomography (CT) was planned and was kept under observation. However, from day 7, the baby started having respiratory difficulties with features of cardiac failure. The baby was put on noninvasive respiratory support and was barely maintaining SaO2 above 90%. Relevant blood works were sent to rule out sepsis. A repeat echocardiogram on day 7 showed poor cardiac contractility with an increase in pericardial mass (36 mm x 23 mm) and compression of the left ventricle [Figure 3]. CXR showed massive cardiomegaly and severe pulmonary edema [Figure 4]. Day 1 versus day 7 CXR [Figures 1 and 4] revealed progressive cardiomegaly and the appearance of pulmonary congestion. The baby was intubated and mechanically ventilated with a high ventilatory setting. Inotropic support was started, and supportive management was continued. Another echocardiogram performed after 72 h (day 10) in addition to earlier findings demonstrated progressive infiltration of the myocardium which was of the same intensity as that of cardiac mass [Figure 5]. Serial echocardiography assessment [Figures 2, 3, and 5] revealed a progressive enlargement of the pericardial mass, an increase in pericardial effusion, and also the involvement of myocardium, which was not obvious in the earlier images. This made us doubtful about the initial diagnosis of cardiac teratoma, which is usually of pericardial origin. Cardiac CT was planned to further characterize the cardiac mass. Cardiac CT showed a 4.7 cm x 3.4 cm x 4.7 cm heterogeneously enhancing well-defined soft-tissue density mass lesion on the left side of pericardium abutting the left atrium and ventricle causing mild mediastinal shift with mild pericardial effusion. An indistinct margin between mass and myocardium indicated the possibility of infiltration with no obvious intra-atrial/ventricular component [Figure 6]. These CT findings further increased the possibility of germ cell tumors. However, CT angiogram was not performed which could demonstrate the vascularity of the cardiac mass. In view of extensive myocardial involvement, tumor excision was not an option. However, to confirm the histopathologic diagnosis of cardiac teratoma, a cardiac biopsy was planned in consultation with the cardiothoracic unit. HPE of the excised sample showed dilated and vacuolated myocytes with radiating pink thin cytoplasmic process resembling spider cells which are strongly PAS positive [Figure 7]. The above HPE was diagnostic of cardiac rhabdomyoma.\nRhabdomyoma is most commonly associated with tuberous sclerosis complex (TSC). Although cardiac tumor is usually the earliest finding, often appearing between 20 and 30 weeks of gestation, it often resolves spontaneously after birth. In minority of cases, rhabdomyoma can lead to ventricular outflow obstruction, arrhythmia, intractable heart failure, and death. After histopathological confirmation of rhabdomyoma, we thoroughly looked for other pertinent clinical features suggestive of TSC in the infant. However, no other findings were present. MRI brain was normal. The infant was started on mTOR inhibitors (sirolimus at 1 mg/m2/day) in an attempt to reduce the size of the tumor. In the absence of clinical diagnosis of TSC, a genetic panel for TSC1/TSC2 mutation analysis was sent. In the meantime, despite starting mTOR inhibitors and continued supportive management, the baby could not recover from refractory heart failure and passed away on day 32 of life. Mutation analysis revealed a heterozygous splice site variant (c. 848 + 2T>A) in the exon 9-intron 10 splice donor site in TSC2 gene on chromosome 16p13. This variant has been reported as likely pathogenic in the VarSome database and can cause altered splicing leading to absent or abnormal protein. Based on mutation analysis, tuberous sclerosis-2 (OMIM#613254) was confirmed in the infant.",
"gender": "Female"
}
] |
PMC10243658
|
[
{
"age": 18,
"case_id": "PMC5464578_01",
"case_text": "Adults (>= 18 years old) with a strong clinical suspicion (solid and/or liquid dysphagia and weight loss) at selected anatomical cancer sites or with confirmed incident primary EC or gastro-esophageal junction cancer according to the International Classification of Diseases for Oncology, 3rd edition, identified at the participating clinics and hospital, were eligible. Patients with a second or relapse EC and those who were mentally, emotionally, or physically unable to give consent were excluded. Eligible topography sites were: cervical esophagus (C15.0), upper third of the esophagus (C15.3), middle third of the esophagus (C15.4), lower third of the esophagus (C15.5), overlapping lesion of esophagus (C15.8), esophagus unspecified (C15.9), and cardia, NOS (cardio-esophageal junction, esogastric junction, gastro-esophageal junction) (C16.0).\nFor patients enrolled at the endoscopy clinics, the initial diagnosis was based on clinical suspicion, but a final diagnosis relied on histological or cytological confirmation. In patients consenting to donate biopsy specimens at endoscopy, three samples were taken and used to generate two formalin-fixed, paraffin-embedded (FFPE) blocks, and diagnosis slides, and the third sample for fresh tissue preservation. A majority of patients recruited at TAH were referred from other hospitals for treatment and did not have tumor tissue archived at TAH. For these patients, the diagnosis was based on histology slides or FFPE blocks, if these materials were available from the referral hospitals and patients consented to release of these specimens, or on a copy of the pathology report from the referral hospitals.\nA slightly larger proportion of cases (36%) than controls (26%) were ever qat users (S1 Table), whereas duration of use among consumers did not differ much between cases (mean, 30 years) and controls (mean, 31 years). Overall, very few qat users had used qat for less than 10 years. The median retention time of the qat wad in the mouth during a chewing session was 4 hours in both cases and in controls. A higher proportion of cases (11%) than of controls (2.3%) retained the qat wad in the mouth overnight. Smoking during qat chewing sessions was reported in 16.4% of cases and in 11.3% of controls. Reporting of ever alcohol use was slightly higher in controls (41%) than in cases (30%), possibly related to the religious affiliation (S2 Table). Although the overall distribution of reported consumed staple food items did not differ between cases and controls, a slightly higher proportion of cases (21.9%) than controls (12%) specified kocho as the staple food. Kocho (qocho) is a local flatbread made using the starch obtained from the trunk of the false banana plant (Ensete ventricosum), fermented for several months and subsequently cooked in a griddle. Consumption of very salty food was more commonly reported by cases (26%) than by controls (1.5%).\nA non-significant 2-fold elevation in risk of EC was seen in ever qat chewers compared with never users in unadjusted conditional analysis (odds ratio [OR] = 2.12; 95% confidence interval [CI]: 0.94, 4.74)) (Table 2), although this association disappeared after accounting for differences in tobacco use, consumption of alcohol and green vegetables, education level, and religion (OR = 0.95; 95% CI: 0.22, 4.22). No clear trend was observed between duration of qat use and risk of EC (Table 2). Tobacco use was associated with a more than 2-fold increase in risk of EC (OR = 2.62; 95% CI: 1.16, 5.92), the association in the adjusted model showed a larger magnitude but a lower precision, becoming non-significant (OR = 3.31; 95% CI: 0.53, 20.62) (Table 2). We did not observe a clear trend in EC risk with duration of tobacco use (Table 2). In sensitivity analysis according to control type, we observed a statistically significant elevation in risk of EC associated with ever tobacco use when including healthy visitor-type controls (OR = 3.02; 95% CI: 1.04, 8.77; p = 0.04) but not when limiting to hospital controls (OR = 1.75; 95% CI: 0.56, 5.51; p = 0.34) in fully adjusted unconditional logistic regression models. The association of qat chewing and risk of EC was also evaluated after stratifying by tobacco use. The risk of EC in ever qat users was elevated and statistically significant among never tobacco users (OR = 5.81; 95% CI: 1.21, 27.9) but not among ever tobacco users (OR = 0.76; 95% CI: 0.12, 4.61) (Table 2) in univariate analysis. After adjusting for differences in consumption of alcohol and green vegetables, education level, and religion, the risk of EC in ever qat users remained elevated but with a very wide confidence interval including 1 (OR = 6.75; 95% CI: 0.48, 96). The p-value for the interaction term between ever qat use and ever tobacco use was 0.06.\nEver alcohol use was associated with a reduction in risk of EC (OR = 0.45; 95% CI: 0.21, 0.96) according to the unadjusted risk estimate, but the odds ratio increased to 2.3 (95% CI: 0.32, 16.53) after adjusting for tobacco use, consumption of green vegetables, education level, and religion (Table 3). Staple foods reported to have been consumed one year before the interview, or one year before the endoscopy or diagnosis, were suggestive of an elevation in risk of EC. Subjects who specified kocho as the staple food had a statistically significantly elevated EC risk in univariate analysis only (Table 3). Low consumption of green vegetables was associated with an increased risk of EC, with subjects consuming green vegetables less than once a week (OR = 3.57; 95% CI: 1.31, 9.71) or not at all (OR = 12.47; 95% CI: 2.91, 53) having a substantially higher risk of EC compared with those with daily consumption. These results were corroborated after adjusting for confounders (Table 3). Saltiness of food and smokiness inside the home were associated with an increased risk of EC in unadjusted analysis, whereas in adjusted analysis an elevation in risk remained only for saltiness of food (Table 3).\nEducation level and religion were strongly associated with risk of EC (Table 3). More educated people had a lower risk of EC compared with illiterate people, even when the level of education did not reach complete schooling. Christians had a lower risk of EC compared with Muslims. Accounting for differences in tobacco use, alcohol use, and consumption of green vegetables did not affect the statistically significant association of education level and religion with risk of EC (Table 3). Thus, education level and religion were associated with EC independently of these specific lifestyle/dietary factors.",
"gender": "Unknown"
}
] |
PMC5464578
|
[
{
"age": 60,
"case_id": "PMC1326210_01",
"case_text": "A 60-year-old woman was diagnosed to have a left breast cancer stage T2 N1 M0 hormone receptor-positive in 1997. She was treated with modified radical mastectomy, adjuvant chemotherapy with cyclophosphamide, adriamycin and 5-fluorouracil, followed by adjuvant hormonal therapy. She completed five years of adjuvant tamoxifen in 2003 and and was started on letrozole adjuvant therapy in January 2004.\nThe patient had an ocular history significant for bilateral dacryocystitis, cataracts and open angle glaucoma, left dacryocystectomy (DCR) in 1997, right DCR in 2000 and 2003, as well as a right eye phacoemulsification with implantation of a hydrophilic acrylic intraocular lens in 2003 with a postoperative uncorrected visual acuity of 20/25. The patient was maintained on antiglaucoma treatment in the form of topical beta blocker eyedrops for both eyes, combined with prostaglandin eyedrops for her left eye.\nThe patient was scheduled to have zoledronic acid 4 mg once every six months for osteoporosis. In August 2004, the patient was given intravenous hydration with normal saline, premedicated with paracetamol, and had an intravenous infusion of zoledronic acid 4 mg in 100 cc normal saline given over 30 minutes. The patient did well throughout the infusion; however, she felt chilly and feverish overnight. The next day, she presented to the Emergency Department complaining of severe right eye pain and decreased vision. Examination revealed uncorrected visual acuity of 20/100 in the right eye and 20/60 in the left eye. The intraocular pressure was 14 mmHg in both eyes. Slit lamp examination revealed marked ciliary injection of the right eye, and a 2+ flare and inflammatory cells in the anterior chamber. An inflammatory fibrinous pupillary membrane was also present (Fig 1). Fundus examination was normal. A diagnosis of right anterior uveitis was made. The patient was placed on topical prednisone every 6 hours, and atropine eyedrops every 12 hours. She responded well to the treatment which was gradually tapered off over a period of 6 weeks without recurrence of uveitis. Following treatment, visual acuity in the right eye improved to 20/30, and slit lamp examination revealed slight opacification of the posterior capsule (Fig 2), and residual pigmented deposits on the surface of the intraocular lens (Fig 3). These inflammatory changes and deposits on the posterior lens surface disappeared on their own over a period of 3 months, but residual posterior capsular opacification (PCO) is still present. This PCO has no effect on the patient's visual acuity at present and doesn't require any intervention.\nUnlike in metastatic bone diseases where bisphosphonate therapy is administered on a monthly basis, our plan was to give the patient zoledronic acid every six months. The patient refused to have any further bisphosphonate therapy",
"gender": "Female"
}
] |
PMC1326210
|
[
{
"age": 0,
"case_id": "PMC5949951_01",
"case_text": "Case 1: A 9-month-old infant presented with malaise and mild fever. On day 4, she manifested an episode of staring. CSF showed 332 cells per mm3 and HSV-1 DNA positivity by PCR. She was started on 60 mg/kg/d acyclovir. The magnetic resonance imaging (MRI) on day 15 showed a haemorrhagic lesion in the left temporal lobe (Figure 1a, 1d). She was discharged after a 21-day course of acyclovir in excellent neurological condition; at discharge, her CSF had become negative for the virus by PCR. However, 2 days later, she was readmitted with fever, agitation, choreoathetotic and dystonic movements and seizures. At this time, she tested positive for anti-NMDAR antibodies in both serum and CSF; retrospective testing of her previous serum and CSF samples drawn 3 weeks earlier were NMDAR-negative. MRI did not show significant changes (Figure 1b, 1e); repeated PCR for HSV remained negative. Interestingly, both of her CSF samples (the first, NMDAR negative, and the second, NMDAR positive) were positive for intrathecal synthesis of immunoglobulin G (IgG) anti-HSV 1 antibodies, prompting another course of antiviral therapy with acyclovir. She was, however, concurrently started on immunotherapy with IVIg 2 g/kg and steroids (5-day pulse IV methylprednisolone/30 mg/kg/d followed by prednisolone 2 mg/kg/d with slow tapering over 1 year).\nIn spite of the immediate immunotherapy initiation, she clinically worsened with continuous violent jerking abnormal movements, suppressed level of consciousness, apnoeas and bradycardia. She was admitted to the intensive care unit and received additional symptomatic treatment with clonidine, lorazepam, phenobarbital, phenytoin, midazolam, ketamine, fentanyl and chloral hydrate 4% pro re nata. On day 30, rituximab (375 mg/m2 every week for 4 weeks) was also added for her anti-NMDAR encephalitis. Gradual clinical improvement in the level of consciousness, autonomic dysfunction and abnormal movements was noted 2 weeks after the onset of rituximab. She was discharged after 98 days of hospitalization with clonidine, levetiracetam, phenobarbital, prednisolone, acyclovir, cotrimoxazole, fluconazole and ranitidine. Brain MRI at discharge showed significant dilatation of subarachnoid spaces with enlargement of the third and lateral ventricles (Figure 1f); the prior haemorrhagic lesion in the left temporal lobe related to HSV-1 infection remains now as a gliotic area (Figure 1c). On discharge, she was not able to sit, had feeding difficulties, very poor visual contact and impaired social interactions.\nAt 1 year later, anti-NMDAR antibodies, tested again in both serum and CSF, were negative. No increased IgG intrathecal synthesis for HSV-1 antibodies was detected. The infant has been left with a significant neurodevelopmental delay, mainly in speech, cognitive and social skills. Her motor development is better, without abnormal muscle tone, and a steady but slow improvement in her gross motor skills. All drugs except antiepileptics were discontinued.\nCase 2: A 10-month-old infant was admitted because of intense agitation lasting 20 days. A 3-day febrile infection that spontaneously resolved preceded the irritability. Although the infant was afebrile, a lumbar puncture was performed because of persisting irritability, which revealed 40-45 leukocytes/mm3 and 83 mg/dl of protein. Intravenous ceftriaxone and acyclovir were initiated. CSF culture and PCR for HSV-1 and -2 were negative. However, antibodies for HSV-1 at high titres were found in the serum [both immunoglobulin M (IgM) and IgG] and increased intrathecal synthesis of anti-HSV-1 IgG was detected in the CSF. Brain MRI revealed the presence of increased T2-MRI signal diffusely at the left temporal and occipital lobes (Figure 2a, 2b), consistent with the diagnosis of HSV encephalitis. Although agitation was slightly improved in the ensuing days, the child started to show signs of psychomotor regression. A second lumbar puncture performed at day 23 of admission revealed CSF pleocytosis with 185 leukocytes/mm3 and increased protein of 75 mg/dl; glucose was 50 mg/dl and cultures were negative. A second PCR for HSV-1 and -2 was also negative but the increased intrathecal synthesis of anti-HSV-1 IgG persisted. The CSF now tested positive for anti-NMDAR antibodies.\nIn the following days, the child developed choreoathetotic movements, generalized hypotonia, automatisms and impaired feeding. Immunotherapy with IVIg 2 g/kg/day divided in 5 days was initiated followed by methylprednisolone (30 mg/kg/day for 5 days) and gradual oral tapering for 6 weeks. Levetiracetam was added. A new CSF analysis 2 weeks later revealed a higher titre of anti-NMDAR antibodies. Follow-up brain MRI, performed 1 month after immunotherapy, revealed areas of necrotic lesions mainly at the temporal and occipital lobes (Figure 2c, 2d). The child was treated for almost 1 month with intravenous acyclovir 45 mg/kg/day, followed by oral acyclovir prophylaxis for 2 months. The patient, despite the abnormal MRI findings, shows gradual clinical and psychomotor improvement in a 3-month follow up.\nCase 3: A 14-year-old girl with no previous medical history presented with a febrile viral infection lasting for 3 days, followed by intense headache, somnolence, confusion and generalized epileptic seizures 8 days later. She was diagnosed with herpetic encephalitis based on positive PCR for HSV-1 in the CSF. CSF analysis revealed 165 cells per mm3, glucose 57 mg/dl and protein 39 mg/dl. Oligoclonal bands and IgG intrathecal synthesis were negative. Brain MRI revealed symmetrical focal lesions in bilateral temporal lobes and basal ganglia without contrast enhancement. She tested negative for antineuronal antibodies in both serum and CSF. The patient was treated with a 3-week course of IV acyclovir plus antiepileptics (sodium valproate) and she was recovering steadily and uneventfully. At 2 months after the initial viral encephalitis, however, she presented with complex partial seizures (manifested with a sense of weakness, staring, dysarthria and difficulty speaking, followed by drowsiness); levetiracetam was added. She continued, however, to experience sporadic epileptic episodes despite adjustments to the antiepileptic therapy.\nAt 1 year later, the patient was readmitted to the hospital after a more severe epileptic episode and altered level of consciousness. She manifested staring, reduced responsiveness to verbal stimuli, flaccid muscle tone and irregular jerks of arms and legs lasting approximately 1 minute, followed by a short period of weakness and dizziness. For the 3 weeks prior to readmission, she experienced daily long-lasting episodes of headaches, accompanied by photophobia and phonophobia and the last 3 days became somnolent. Repeated diagnostic work up at the time of admission revealed negative CSF PCR for HSV-1 and -2, negative intrathecal synthesis for anti-HSV IgG and negative CSF anti-NMDAR antibodies. Her serum, however, tested positive for anti-NMDAR antibodies that persisted when retested 3 months later. There were no abnormal findings in the electroencephalogram (EEG). Immunotherapy for autoimmune anti-NMDAR encephalitis was not initiated because she had clinically improved and the CSF was negative.\nCase 4: A 58-year-old woman was transferred to our hospital with hyperpyrexia (39.0 C) and headache. She was drowsy but easily awoken. CSF analysis showed 140 cells per mm3 and tested positive for HSV-1 in the CSF by PCR. MRI revealed increased T2 signal intensity in the right temporal lobe. She was started on intravenous acyclovir for 21 days and then continued on oral valacyclovir. She gradually improved and normalized. After treatment and before discharge, the HSV-1 PCR in the CSF was negative but the intrathecal synthesis of anti-HSV-1 antibodies persisted; her serum tested positive for anti-NMDAR antibodies, even though she had no residual abnormal neurological findings. During the next 2 months she started to develop dysosmias, sleep disturbance and anxiety. Serum testing for anti-NMDAR autoantibodies continued to be positive. At 6 months later, she developed prosopagnosia and personality changes, followed by an episode of loss of consciousness and generalized epileptic seizures for which she was readmitted to the hospital. Brain MRI revealed gliosis and atrophy of the right temporal lobe, as previously observed. Anti-NMDAR autoantibodies remained positive in the serum, but this time were also detected in the CSF; the intrathecal synthesis of anti-IgG HSV-1 antibodies persisted. She was treated only symptomatically with levetiracetam and improved. She denied treatment with rituximab. Follow-up antibody testing showed persistence of anti-NMDAR antibodies in the serum 3, 12 and 24 months later, even though her clinical condition remains stable.\nCase 5: A 33-year-old woman presented with seizures, but with normal orientation, MRI and EEG, afebrile at initial presentation. She was started on oral levetiracetam. At 5 days afterward, she had two more epileptic episodes. She was stable until 10 days later, when she had four new episodes of generalized tonicoclonic spasms occurring within a 24-hour period that led to hospitalization. Neurological examination revealed horizontal nystagmus, confusion and disorientation. She was treated with a single dose of 1000 mg of IV levetiracetam. EEG showed a slow wave pattern, while MRI showed a lesion, probably inflammatory, in the left hippocampus. The CSF revealed 15 cells per mm3 and was negative for HSV-1 and -2 by PCR. Her serum tested positive for IgM HSV-1 and HSV-2 antibodies and she was diagnosed as having HSV encephalitis for which she was treated with IV acyclovir. Orientation improved after 21 days of therapy but then she worsened, becoming confused. A new CSF study 1 month later was negative for HSV-1 IgG antibodies and for HSV-1 and -2 by PCR. However, the patient tested positive for NMDAR and GABAbR antibodies in the serum and for anti-GABAbR antibodies in the CSF. The patient was started on IV corticosteroids followed by IVIg (5 days, 120 g total). After 1 month, she was discharged without any residual symptoms or the need for long-term immunotherapy. Testing after 1, 4 and 22 months revealed persistent seropositivity for both anti-NMDAR and anti-GABAbR antibodies, even though she was clinically normal. Repeated testing after 34 months showed persistence of anti-GABAbR but not anti-NMDAR antibodies.\nThe case series are explained below in Table 1.",
"gender": "Female"
}
] |
PMC5949951
|
[
{
"age": 17,
"case_id": "PMC6388527_01",
"case_text": "Case 1: A 17-year-old boy presented with a complaint of acute and painless diminution of vision in his left eye (LE) for one week. Best corrected visual acuity (BCVA) was 6/6 in right eye (RE) and 6/60 in the LE. There were no signs of anterior uveitis in either eye, and the retrolental space and vitreous were devoid of cells. While RE fundus was normal, evaluation of the LE revealed granulomatous optic nerve head (ONH) swelling with engorged veins in the superior quadrant, flame-shaped hemorrhages, and peri-papillary serous retinal detachment extending temporally to involve the fovea [Figure 1a]. The clinical suspicion of ONH granuloma was confirmed with ultrasonography, which showed a significantly raised lesion over the optic disc [Figure 1b]. Fundus fluorescein angiography (FFA) showed early diffuse leak in the peripapillary region along with microaneurysms [Figure 1c], and optical coherence tomography (OCT) revealed the presence of serous retinal detachment. The patient was found to be clinically normal on general physical examination and on examination of the chest, heart, abdomen, and neurological systems.",
"gender": "Male"
},
{
"age": 18,
"case_id": "PMC6388527_02",
"case_text": "Case 2: An 18-year-old boy presented with sudden, painless vision loss in RE that started 15 days prior. BCVA was 6/60 in the RE and 6/6 in the LE. The anterior chamber, retrolental space, and anterior vitreous were unremarkable in both eyes and did not contain cells. RE fundus examination revealed optic disc edema (more marked in its upper half), hyperemia, and small haemorrhages over the optic disc, along with engorged veins and extensive perivascular exudation (phlebitis; superior retina >> inferior retina). The posterior vitreous had localized inflammation around the regions of vasculitis and near the optic disc. Loss of foveal reflex, macular edema, and serous macular detachment were also found in the RE [Figure 2a]. LE fundus was unremarkable. FFA confirmed the clinical findings and did not reveal any new vessels. OCT revealed increased macular thickness of nearly 992 microns in addition to serous retinal detachment. The patient was clinically normal on systemic examination, as in Case 1.\nComplete blood count, peripheral blood smear, liver function tests, and serum globulin level measurement of both patients yielded normal results. Mantoux test reading was 10 mm in case 1 and 8 mm in case 2. Ultrasonography of the abdomen, chest radiography, high resolution contrast enhanced computerized tomography of the chest, and magnetic resonance imaging of the brain (for ruling out CNS granulomas/optic nerve lesions) revealed no anomaly. Serum angiotensin-converting enzyme (ACE) level was elevated in both patients (Case 1: 55 mug/L, Normal range: 9-39 mug/L; case 2: 68.3 mug/L; normal range 8.0-52 mug/L). Serum of both patients was non-reactive to treponemal antibodies and viral markers, including HIV -1 and 2, and Hepatitis B and Hepatitis C viruses. Toxoplasmosis and cat scratch disease were ruled out on the basis of serology results.\nBoth patients were prescribed oral prednisolone (1 mg/kg) with slow tapering over 3 months. Case 1 showed a drastic response in ONH swelling and his vision recovered to 6/24 at 3 weeks, 6/12 at 9 weeks, and 6/6 at 12 weeks after start of treatment [Figure 1d]. In the second case, visual acuity recovered to 6/9 in right eye at day 4 after the start of the treatment and disc edema and vasculitis resolved gradually [Figure 2b]. OCT imaging was performed during follow-up in both cases to document macular changes [Figure 3]. While sub retinal fluid resolved within 15 days of therapy in case 1, macular thickness decreased to 580 microns at day 4 and to 330 microns at week 3 of follow up in case 2. Case 1 has been followed up for 2 years and Case 2 has been followed up for over a year. Both patients are stable, with no recurrence of uveitis or any sign of systemic sarcoidosis/granulomatous disease or steroid toxicity. In both cases, consulting pulmonary specialists advised against a lung biopsy.",
"gender": "Male"
}
] |
PMC6388527
|
[
{
"age": 45,
"case_id": "PMC6369568_01",
"case_text": "A 45 year old Indian male, height: 168 cm, weight: 78 kilos; Race: Asian, occupation fabric businessman, residing in Kolar, a suburb of Bangalore City, had a history of fever, cough and breathlessness.\nPrior to admission to the tertiary care unit (TCU) he had received treatment in a privately owned small hospital. A diagnosis of community acquired pneumonia had been made and he was admitted to their intensive care unit (ICU). He received piperacillin and tazobactam combination (Baxter, Illinois, USA), 4.5 g intravenously every 6 hours and continued for 14 days, plus azithromycin (CiplaInc, Mumbai, India) 500 mgv once a day and continued for 5 days, and oseltamivir (Roche Holding AG Inc, Basel, Switzerland) 75 mg, oral every 12 hours, continued for 10 days. Additionally, oxygen therapy and intermittent non-invasive respiratory support (NIV) was administered using a Drager Savina 300 NIV machine (Drager International, Geneva Swiss) with a setting of 12/6 cm of water continuously for fifteen days. His condition did not improve and he was referred to the Fortis Hospitals, a tertiary care hospital (TCH) in Bangalore City because of their excellent ICU and pulmonology team. According to local protocol, since it was in intra-ICU referral, he was directly admitted to ICU in the TCU of TCH.\nOn admittance to the TCU, an initial examination indicated that he had extensive subcutaneous emphysema with bilateral crepitus. This diagnosis was not included in the referral letter from the private hospital and it may be assumed that such a diagnosis had not been previously made. The referral letter did state that he had had a contrast enhanced computed tomography (CECT) following a non-resolving pneumonia, the films of which had been enclosed with the letter. This indicated severe right to left pneumomediastinum with extensive subcutaneous emphysema accompanied by interstitial pneumonitis features (Fig. 1A). Initially, treatment for pneumonia was continued and throat and nasal swabs sent for laboratory examination. Both throat and nasal swab tested positive for the H1N1 pandemic 2009 strain.\nNon-invasive respiratory support was continued. A plain computed tomography was undertaken which showed a residual and resolving pneumomediastinum and extensive interstitial pneumonitis. Clinically, the subcutaneous emphysema had reduced dramatically.\nThe day after admission, the patient had a bout of coughing following which he complained of sudden onset of severe retrosternal chest pain and breathlessness. There was extensive subcutaneous emphysema spanning his whole upper body, extending into his arms. His blood oxygen saturation dropped to 70% and he went into respiratory distress.\nThe patient was intubated and the following drugs were prescribed. Fentanyl (Diprivan, ICI Healthcare Ltd) 50 microgram/hour by injection plus propofol (Diprivan, ICI Healthcare Ltd) 50 microgram/kg/min by injection and atracurium (Neon Lab Ltd, India) 7mg/hour by intravenous injection.\nSedation and paralysis were monitored for twenty-four hours during which his condition improved, and after which it was assumed that he was ready to undergo the gradual process of decreased ventilator support (weaning) since he was stable with a blood oxygen saturations >94%. To assess if he was able to breathe spontaneously, sedation was ceased and his ventilator settings changed to a pressure support mode, with pressure support of 15cm of H2O and PEEP of 5 cm keeping the FIO2 at 40%. This \"spontaneous breathing trial\" was planned to continue for forty-five minutes. However, within just a few minutes of such a trial, the patient immediately become tachypneic and tachycardic.\nIn keep with the hospital protocol, a patient meets the criteria of being ready to wean when he is hemodynamically stable and the primary disease process is resolving and good oxygen saturation is maintained. At this point, the ventilator settings are reduced and the patient is allowed to breathe on a spontaneous breathing mode on the ventilator. This patient appeared to meet all these criteria but could not pass a spontaneous breathing trial to meet the required extubating criteria.\nTherefore subsequent to the failure of the \"spontaneous breathing trial\" reported above, his airway was secured immediately and ventilation was continued with a pressure control volume guarantee mode with volume of 400 ml and a 100% fraction of inspired oxygen. Peak pressures reached to about 45 cm of water but oxygen saturations greater than 94% were maintained.\nClinically, there was a suspicion of pneumomediastinum, so rather than having a chest X-ray normally undertaken after intubation to confirm the cause of respiratory distress and rule out pneumothorax, an emergency high-dose contrast-enhanced computed tomography (CECT) was carried out. This showed an extensive mediastinal emphysema and pneumomediastinum. (Fig. 1B, C)\nInvestigations of the retroperitoneum, esophagus and bronchi, to determine the possible sources of mediastinal air, were found to be normal.\nWhenever, sedation was stopped, and a spontaneous breathing trial started, the patient would immediately commence coughing, become tachypneic and tachycardic. Concomitant with these coughing bouts, his subcutaneous emphysema would worsen.\nThis patient met the criteria of prolonged wean which according to the published consensus is seen in <15% of intubated patients. One approach to manage a prolonged wean is tracheostomy, usually a bedside procedure done by the intensivist. He failed to respond to the gradual process of decreased ventilator support (weaning) over a one week period and consequently a decision was made to undertake a period of prolonged weaning and a surgical tracheostomy was performed. However in this case because of his extensive subcutaneous emphysema he was operated on by ENT surgeons, who performed a surgical tracheostomy.\nWeaning problems persisted after tracheostomy. The patient was psychologically motivated and ready for weaning but when a spontaneous breathing trial was performed, even with a high pressure support of 16/8 and continuous positive airway pressure mode, he would fail within thirty minutes. Bilateral intercostal drains (ICD's) were inserted and a planned mediastinal drain was take into consideration, in the possible event there would be no improvement.",
"gender": "Male"
}
] |
PMC6369568
|
[
{
"age": 41,
"case_id": "PMC9021507_01",
"case_text": "Of the 121 patients in British Columbia who received rituximab for the treatment of glomerulonephritis (GN) from January 2014 to April 2018, 4 were adults with primary FSGS in the native kidney. Clinical and laboratory data are summarized in Table 1.\nPatient 1 is a 41-year-old female who had previously failed combination therapy with prednisone, MMF, tacrolimus, and galactose. Her creatinine was 71 micromol/L, albumin 23 g/L, and proteinuria 4.95 g/d while on therapeutic tacrolimus level and MMF. She was treated with rituximab 375 mg/m2 weekly for 4 doses followed by single 375 mg/m2 doses with CD20 reconstitution (approximately every 7 months). She achieved CR 3 months after her first rituximab dose. One year after the initiation of rituximab she was tapered off all other immunosuppressive agents and remained in CR. Two years after her first rituximab dose, we started tapering her rituximab dosage yearly. Fifty-seven months after her first rituximab dose, her serum creatinine was 81 micromol/L, albumin 42 g/L, and an ACR of 2.1 mg/mmol consistent with a CR.\nPatient 2 is a 21-year-old male, who had previously failed tacrolimus, cyclosporine, and was on prednisone and MMF. His serum creatinine was 168 micromol/L, albumin 30 g/L, and proteinuria 8.69 g/d. He was treated with rituximab 375 mg/m2 weekly for 4 doses followed by single 375 mg/m2 doses with CD20 reconstitution (approximately every 6 months). He achieved PR 3 months after his first rituximab dose. Seventeen months after the initiation of rituximab, he was tapered off all other immunosuppressive and remained in partial remission. Thirty-three months after his first rituximab dose, we began tapering his rituximab dosage yearly. Fifty-five months after is first rituximab dose, his serum creatinine was 270 micromol/L, albumin 36 g/L, and an ACR of 55 mg/mmol consistent with a PR. Unfortunately, his chronic kidney disease continued to progress likely on the basis of sclerosis.\nPatient 3 is a 26-year-old female who was steroid-sensitive, but unable to taper off prednisone without a disease flare despite concurrent use of cyclophosphamide, cyclosporine, or tacrolimus. At the time of being treated with rituximab 1 g every 2 weeks for 2 doses, she was on tacrolimus 3 mg BID and prednisone 20 mg/d, with serum creatinine 63 micromol/L, albumin 35 g/L, and proteinuria 0.38 g/d. She achieved PR 2 months after her first rituximab dose. Following the two rituximab doses, she received rituximab 1 g with CD 20 reconstitution (approximately every 8 months). Thirty months after rituximab treatment, she was off all immunosuppression. At that time, her serum creatinine was 70 micromol/L, albumin 39 g/L, and proteinuria 0.79 g/d consistent with a PR.\nPatients 4 is a 19-year-old male. He was diagnosed at 2 years of age with biopsy proven minimal change disease. He was steroid-sensitive, but unable to taper off prednisone despite being treated with chlorambucil, levamisole, cyclophosphamide, tacrolimus, and MMF. At 17 years of age, he received 1 course of rituximab 375 mg/m2 weekly for 4 doses and remained relapse-free on no other immunosuppressive agent for 24 months. Two years later, he had a relapse with significant nephrotic syndrome and creatinine 233 micromol/L, albumin 12 g/L, and proteinuria 8.3 g/d. A repeat biopsy showed FSGS. He was on no immunosuppressive therapy at this point. He was treated with rituximab 375 mg/m2 weekly for 4 doses followed by single 375 mg/m2 doses with CD20 reconstitution (approximately every 11 months). He achieved PR 1 month after first rituximab dose. Twenty-three months after his first rituximab dose, we began tapering his rituximab dosage yearly. Forty months after his first rituximab dose, his serum creatinine was 91 micromol/L, albumin 43 g/L, and proteinuria of 0.66 g/day consistent with a PR.",
"gender": "Female"
}
] |
PMC9021507
|
[
{
"age": null,
"case_id": "PMC4219705_01",
"case_text": "Inferred diagnoses were identified based on a combination of 262 codes: 63 relating to prescriptions (36 for warfarin, 27 for digoxin) and 199 excluding conditions (97 for prior HF, 60 for prior DVT, 22 for prior PE) and procedures (20 for heart valve replacement). A total of 39,527 patients met the criteria for an inferred diagnosis of AF during the study period. Warfarin prescriptions accounted for 18,714 (47%) patient diagnoses, digoxin prescriptions for 10,592 (28%), and the remaining 10,221 (26%) had both prescription patterns. A small percentage of patients with an inferred diagnosis (3,754; 9.5%) received coded or historical diagnoses of AF prior to cohort entry. Of the remaining 35,773 individuals, 28,305 (71.6%) had an AF diagnosis code recorded during follow-up and 7,468 (18.9%) had no codes relating to AF diagnosis in their record.\nOf the 28,305 individuals who met the inferred AF diagnosis criteria and had an AF diagnosis code within the study window, the majority (75.7%; 21,420 individuals) received the diagnosis code before meeting the criteria for an inferred diagnosis, and for a further 11.2% (3,167 individuals) this occurred on the same day. Thus only 13% of patients (3,718 individuals) met the inferred diagnosis criteria before an AF diagnosis was recorded. For these 3,718 individuals, the average time between an inferred diagnosis and receiving a diagnosis code was 19.8 months (median 6.54 months). Within 30 days of meeting inferred diagnosis criteria, 21.1% of these patients received a diagnosis code; 59.7% received a diagnosis code within one year. However, the temporal relationship between these diagnoses varied depending on the year of the initial inferred diagnosis; the proportion receiving a diagnosis code within 12 months increased gradually over time from 37.1% in 1998 to 92.3% in 2009. The proportion of AF cases based on inferred criteria also decreased over the study period, from just over 15% of cases in 1998 to less than 10% of cases from 2006 onwards.",
"gender": "Unknown"
},
{
"age": 60,
"case_id": "PMC4219705_02",
"case_text": "The proportion of cases contributed by each source differed by age at diagnosis; individuals identified by inferred diagnosis criteria made up a greater proportion of cases diagnosed at younger ages (<=60 years), while cases diagnosed at older ages (>=80 years) were mostly identified from secondary care data (see Figure 4 ). The proportion of cases identified in primary care was highest for ages 60-80 years, but for all age groups primary care contributed fewer cases than secondary care. For patients diagnosed in secondary care, AF was more likely to be the main diagnosis for the hospital episode when individuals were younger (<=50 years), whereas amongst those diagnosed at older ages AF was much more likely to be a secondary diagnosis made during admission for another condition. Patients with diagnoses recorded only in secondary care were slightly more likely to be female compared to those with diagnoses in both data sources, primary care only, or inferred diagnoses (51.3%, 48.2%, 48.8% and 47.6% female respectively).\nThe percentage of patients with comorbid conditions at the time that their AF diagnosis was recorded differed by source of diagnosis (see Table 1 ). Patients for which an AF diagnosis was drawn only from secondary care were more likely to have already received a diagnosis for all the conditions examined, with the exception of hypertension, than those with a diagnosis drawn from primary care or meeting the inferred diagnosis criteria. The difference between data sources was largest for renal failure; the percentage of patients with renal failure amongst those diagnosed with AF in secondary care only was twice that of patients with AF diagnoses recorded in the other data sources (22.4% versus 10.9%, 11.0%, and 10.0%). A similar, although less extreme, pattern was also observed for HF, MI, stroke, and diabetes (Type 2). This does not appear to be completely due to differences in the age of patients from each source as even within age groups the percentages of patients with pre-existing conditions were still higher for those diagnosed in secondary care, particularly for HF and diabetes. In contrast, the percentage of AF patients with hypertension was highest amongst those with a primary care diagnosis (86.0% for primary and secondary, 86.2% for primary only, compared to 83% for secondary only and 78% for inferred).",
"gender": "Female"
}
] |
PMC4219705
|
[
{
"age": 42,
"case_id": "PMC5054637_01",
"case_text": "A 42-year-old male presented with sudden onset of severe back pain after heavy lifting. He exhibited a partial left foot drop (Medical Research Council Grade 4/5). The original MR study documented a left-sided left L4-5 intervertebral disc compressing the left L5 nerve root [Figure 1]. He was managed conservatively.\nSix months later, the patient's symptoms worsened; symptoms included dysesthesia in the left L5 distribution and extensor hallucis longus (EHL) weakness (MRC Grade 4/5). The second lumbar MR showed a well-defined round mass at the left L4-5 disc level, which was hypointense on T1 and hyperintense on T2-weighted images, which was consistent with a cyst [Figure 2]. The patient underwent a left-sided L4-5 microsurgical laminotomy for cyst decompression/excision. During surgery, a small well-encapsulated, grayish blue colored extradural cyst compressing the left L5 root was completely removed [Figure 3a]. The cyst communicated with the subligamentous disc fragment [Figure 3b] and was connected to the intervertebral disc [Figure 3c]. The histopathological examination of the cyst revealed a wall comprising fibrous connective/ligamentous tissue, without any evidence of disc material or synovial tissue and without any epithelial lining. Hemosiderin deposits were noted in the cyst wall [Figure 4]. Postoperatively, all of the patient's symptoms and signs were resolved.",
"gender": "Male"
}
] |
PMC5054637
|
[
{
"age": 44,
"case_id": "PMC5767566_01",
"case_text": "A 44-year-old woman was found to have pleural effusion on a chest radiograph during an annual health checkup in July 2016. Her computed tomography (CT) scan showed pleural effusion, ascites fluid, and a nodular lesion of the pelvis; therefore, we suspected peritoneal cancer. There was no familial history of tuberous sclerosis complex. She had a history of tonsillectomy at 28 years of age and lumbar disc herniation at 36 years of age.\nThe physical examination at the initial visit revealed that her height was 156 cm, body weight was 48.6 kg, body temperature was 36.1 C, blood pressure was 104/62 mmHg, radial pulse rate was 80/min, and respiratory rate was 18/min. No superficial lymphadenopathy was identified on palpation. She had neither anemia nor jaundice. Auscultations of her heart and lung sound were normal. The abdomen was slightly distended, which indicated the presence of ascites.\nResults of the biochemical examination of blood at the initial visit were normal, except for the hemoglobin level of 10.5 g/dL (reference range 11.6-14.8 g/dL). Regarding tumor markers, the carbohydrate antigen 125 level was 628 U/mL (reference range 0.0-35.0 U/mL). As for results of the pulmonary function test, percentage vital capacity (%VC) and 1% forced expiratory volume (FEV1.0%) were within normal range (%VC: 83.8%; FEV1.0%: 98.4%), but the percentage diffusing capacity of the lung carbon monoxide (%DLco) and percentage diffusing capacity of the lung carbon monoxide/alveolar ventilation (%DLco/VA) were slightly decreased (%DLco: 76.0%; %DLco/VA: 72.0%). The chest radiograph revealed right pleural effusion with mild to moderate retention (Fig. 1), and the chest CT scan showed moderate accumulation of the right pleural effusion with multiple thin-walled cysts in both lung fields (Fig. 2A). The enhanced abdominal CT scan demonstrated ascites and slightly heterogeneous tumorous lesions of the right pelvis (Fig. 2B). However, there was no evidence of any renal angiomyolipomas. Even the magnetic resonance imaging scan of the pelvic area showed similar findings.\nThe patient's clinical course is presented in Fig. 3. She did not have an appetite because of the presence of ascites fluid with severe retention at the initial visit. The ascites fluid was chylous ascites (Fig. 4A). Despite the use of diuretics (furosemide and spironolactone), albumin therapy, abdominocentesis, and cell-free and concentrated ascites reinfusion therapy, we could not control the ascites fluid, and the patient developed significant hypoproteinemia and hypoalbuminemia. In November, enucleation of the right retroperitoneal tumor was performed. According to the histopathological examination, the cell that had a kind of circular nucleus from a uniform circle in acidophilic cytoplasm stained by hematoxylin-eosin formed a strand from a vacuole nest and multiplied (Fig. 5A). Additionally, a part of the same type of cell became spindle-shaped and was complex (Fig. 5B). The immunohistochemical stain was positive for smooth muscle actin (Fig. 5C), HMB45 (Fig. 5D), and MelanA (Fig. 5E), leading to the diagnosis of LAM. Postoperatively, we noticed that chyluria (Fig. 4B) had worsened, and a diagnosis of nephrotic syndrome was made (daily urinary protein level: 11,258 mg/day; daily urinary albumin level: 4675.45 mg/day). There was no oval fat body or fatty cast with urinary sediment, so the cause of nephrotic syndrome was regarded as chyluria due to lymphatic vessel obstruction with LAM, not a glomerular abnormality. Although lymphangiography was performed to confirm the position of the fistula in the thoracic duct, we could not detect it. We hypothesized that stenosis or occlusion of the lymphatic vessel by tumor invasion within the pelvis would exist.\nNext, the oral administration of 1 mg/day each of sirolimus and ezetimibe, which is a small intestine cholesterol transporter inhibitor, was started. After 10 days of treatment with sirolimus, her urine became transparent (Fig. 4C), and hypoalbuminemia improved dramatically. Twenty days later, ascites fluid retention decreased, and pitting edema of the extremities improved; thus, she was discharged.\nTwo months later, the serum albumin level became within normal range, and the enhanced abdominal CT scan revealed that the quantity of ascites fluid and size of the tumor lesion were smaller (Fig. 2D). Additionally, the multiple small cysts in both lungs were stable on the chest CT scan (Fig. 2C). Ten months later, %VC and FEV1.0% were unchanged (%VC: 92.4%; FEV1.0%: 108.6%), but %DLco and %DLco/VA were improved (%DLco: 92.0%; %DLco/VA: 74.8%). Currently, she has experienced no adverse events with sirolimus.",
"gender": "Female"
}
] |
PMC5767566
|
[
{
"age": null,
"case_id": "PMC7222550_01",
"case_text": "A case was defined as a patient who was admitted with a probable diagnosis of dengue, confirmed by a positive test for the dengue-specific NS-1 antigen during the course of illness or becoming positive for dengue IgM, and died during the hospital stay following complications related to dengue illness including DHF/DSS. The controls were serologically confirmed dengue patients who developed dengue hemorrhagic fever (DHF) but making a full recovery from the illness.",
"gender": "Unknown"
}
] |
PMC7222550
|
[
{
"age": 8,
"case_id": "PMC8191564_01",
"case_text": "An 8-year-old female patient reported to the department of pediatric and preventive dentistry with a chief complaint of severe pain, with upper and lower right back quadrants of the jaws. The pain was relieved on medication for about 1 month, after which she complained of night pain for a week. The patients' earlier medical records indicated that she was diagnosed with DS since birth. Before starting her physical examination, parental consent was obtained.\nHer general features included elfin facies, upturned nose, low-set ears, hypertelorism of the orbits, acanthosis nigricans, skin tags, hirsutism, and enlargement of the secondary sex organs [Figures 1 and 2]. Upper and lower extremities showed extreme skin roughness [Figures 3 and 4]. Her intraoral features included crowded and dysplastic dentition, narrow maxillary arch, anterior open bite, palatally placed 12 and 22, and hyperplastic gingival among visible features [Figure 5]. Macroglossia was seen with enlarged filiform papillae and vertical furrows [Figure 1]. She had carious 16, 26, 36, and 46. There was a previous history of root canal treatment with 36. She was extremely apprehensive on oral examination and showed delayed understanding (mild mental retardation).\nShe was then referred to the department of pediatrics for a general examination as well as medical fitness. It became evident that she had organomegaly as well as a distended abdomen pointing downward along with the other features of severe insulin resistance syndrome (IRS). Blood investigations revealed had very low hemoglobin (Hb) (7.9 mg/dl) and hyperglycemia (fasting: 200-300 mg/dl, postprandial: 300-400 mg/dl). She was already on a combination of metformin and pioglitazone (one tablet twice a day). She was considered medically unfit to be treated on the chair as she was of the American Society of Anesthesiologists (ASA) Category 4. It was also very likely that she would either undergo hyperglycemic shock (high sugar) or syncopal shock (low Hb). This, along with the delayed mental faculties, would not be manageable on the dental chair, and therefore, it was decided that she would be taken under general anesthesia for dental treatment.\nIt is important to note that her genetic tests were never carried out due to poor socioeconomic background. Her diagnosis of DS was made in very early infancy due to her symptoms.\nThe patient was admitted to the pediatric wards 2 days prior to the decided date of the procedure to make sure that appropriate care was provided both before and after the procedure. It was decided to start her on insulin injections (injection glargine 8 units postnight meal) to keep her sugar under check (>=200 mg/dl).\nOn examination, she was found to have uncontrolled sugar (<=200 mg/dl), very low Hb (7.9 mg/dl), hyponatremia (126 mEq/l) as well as cervical lymphadenopathy. She soon developed upper respiratory tract infection, and thus, the procedure had to be postponed till the patient was optimized to meet the criteria to undergo treatment under general anesthesia.\nAchievement of optimization of the patient was done by starting her on injection Actrapid (1.2 ml diluted in 39cc saline) and glargine (8 units post dinner). Alongside, she was also kept on her regular dose of oral hypoglycemics. She was also given a blood transfusion to bring up her Hb levels. Once the optimization was complete, the patient was taken under general anesthesia at the earliest.\nOur patient, due to her condition, would be considered under ASA Category IV which is defined as a patient having a severe systemic condition that is a constant threat to life. Once the patient was taken under general anesthesia, it became clearly evident intraoral features, especially such as macroglossia, narrow high arched palate, comparatively long maxillary insicors, poor visibility of the uvula (according to Mallampati Classification, Class IV), and poor compliance of mandibular space, etc., would make this a difficult airway to negotiate.\nSince the procedure would be performed intraorally, nasal intubation was tried. It was not successful; there was profuse bleeding and dropping of saturation levels. One of the reasons for difficulty with nasal intubation could be midfacial instability as well as active upper respiratory infection. It was thus decided to proceed with orotracheal intubation. Once the patient was confirmed stable, the intraoral dental procedures were finally carried out.\nThe dental procedures that were carried out were oral prophylaxis, restorations, and extractions of severely carious teeth. Owing to the patient's condition, it was imperative to reduce the bacterial load as much as possible. The patient was given local anesthesia in spite of being under general anesthesia to reduce postoperative pain. She was given very controlled amounts to maintain stability. Not only were the carious teeth extracted but also the palatally placed teeth 12 and 22 were subsequently removed in an attempt to relieve the crowding [Figure 6]. The carious teeth on extraction showed the presence of granulomatous tissue. Post extraction, the sockets were thoroughly curetted and cleaned and irrigated with betadine. They were closed using resorbable Vicryl sutures.\nThe patient was kept in postoperative care on the surgery floor for about 3-4 h. Her vital signs and sugar levels were kept closely monitored. The patient had suffered a mucosal injury during intubation, the result of which was bronchospasm of the left lung. She was thus moved to the pediatric intensive care unit where she was kept under vigilant monitoring. The patient was kept on electrolytes and the insulin drip along with injection glargine to maintain her electrolyte and sugar levels. The patient was kept under sedation for the remainder of the day.\nThe next day, the patient had gained complete consciousness, though she did experience postoperative lethargy. She was brought back to her regular routine by that very afternoon. Her insulin drip was stopped entirely. She was kept on nebulization with asthalin and budecort for 2 days. She was also started on postoperative antibiotics (injection augmentin 400 mg intravenous [IV] TDS and injection metronidazole 120 mg IV TDS). She was not started on anti-inflammatories as there was a risk of gastrointestinal (GI) bleed.\nDuring her stay at the hospital, postoperatively, her wound healing sites as well as suture sites were carefully monitored for pain and swelling. Instead of anti-inflammatories, she was given topical local anesthetics to reduce the pain. When the patient was finally deemed stable, she was started on Syrup Ibuclin Junior twice a day. Due to her immune-compromised state and uncontrolled sugar rate, it was decided by the pediatricians as well as the pedodontists on the team to discharge the patient to avoid any more risk of hospital-acquired infections.",
"gender": "Female"
}
] |
PMC8191564
|
[
{
"age": 61,
"case_id": "PMC5010440_01",
"case_text": "The patient was a previously healthy 61-year-old woman who was immunocompetent and who presented to clinic with several clear fluid-filled vesicles localized to the upper extremity 6 days after receiving the live-attenuated varicella zoster virus (VZV) vaccine.\nThe initial history had been obtained by the inpatient team. The patient had been otherwise well since receiving the vaccine. She did not have any associated symptoms and had no known sick contacts or recent travel. A single lesion was unroofed at that time and a sample was obtained for polymerase chain reaction (PCR) testing for VZV and herpes simplex virus (HSV). The provider recommended that she keep the area covered and cleared her for vacation travel to the southwestern United States. Over the next several days, she developed increasing pruritus, while the area of skin involvement progressed to include all four extremities as well as her trunk. She had no systemic symptoms. She then presented to the emergency department for further evaluation due to progression of the rash. The patient reported a personal history of depression, hyperlipidemia, and allergic rhinitis that were well controlled. She was not taking any new medications, herbals, or supplements in the past month. She had taken fluoxetine, simvastatin, aspirin, and loratadine for many years without any adverse reaction. She specifically indicated that she was not taking any systemic corticosteroids or other immune suppressive agents, and she had no history of opportunistic or recurrent infections.\nOn examination, vital signs were within normal limits. The patient appeared uncomfortable but nontoxic. She was noted to have multiple clear, fluid-filled vesicles on an erythematous base in a linearly streaked distribution on her dorsal forearms bilaterally and on the anterior surface of her right lower leg. Raised erythematous plaques were also observed on her right upper back. There were multiple areas of skin erosion and excoriations associated with each of these areas without overt signs of secondary bacterial skin infection (Figs. 1 and 2). The results of the remainder of her examination were unremarkable.",
"gender": "Female"
}
] |
PMC5010440
|
[
{
"age": 30,
"case_id": "PMC2841377_01",
"case_text": "A 30-year-old male presented to us with a history of watering and irritation in both eyes of three days duration. He was diagnosed to have EM minor following an attack of viral fever with skin eruptions on the face, arms and legs along with shallow, aphthous ulcers, one week back. There was no history of any drug intake leading to the fever and occurrence of skin eruptions. The erythrocyte sedimentation rate (ESR) was 42 mm/h and the total white blood count was 12,000 cells/mm3 with predominant neutrophils (72%). Routine urine examination was normal. Blood and urine cultures were negative for bacteria and fungi. Chest X-ray was normal. Antinuclear antibody and rheumatoid factor were negative. He was on oral acyclovir 800 mg five times/day, started by his treating dermatologist, given for a total of seven days.\nOn examination, he had papular skin eruptions on the face, arms and legs with two shallow painful ulcers in the buccal mucosa [Fig. 1]. His best-corrected visual acuity was 20/20 in both eyes. Slit-lamp examination in both eyes revealed multiple coin-shaped epithelial lesions, some showing central clearing [Fig. 2A, B]. There was no involvement of the stroma. Corneal sensation (tested with wisp of cotton) was normal. Rest of the anterior segment, intraocular pressures and fundus examination were normal. Confocal microscopy (HRT II, Rostock corneal module, Heidelberg, Germany) showed conglomerates of hyper-reflective epithelial cells corresponding to the coin-shaped epithelial lesions [Fig. 3]. The subepithelial nerve plexus, the stroma and endothelium were normal. He was started on oral prednisone, 60 mg/day slowly tapered by 10 mg/day over six weeks along with ocular lubricants (1% carboxymethyl cellulose eye drops, four times a day). The skin and corneal lesions [Fig. 4] resolved over six weeks. Repeat confocal microscopy showed normal epithelial cells, subepithelial nerve plexus, stroma with keratocytes and endothelium.",
"gender": "Male"
}
] |
PMC2841377
|
[
{
"age": 68,
"case_id": "PMC8095308_01",
"case_text": "A 68-year-old African-American primary open-angle glaucoma female patient was referred to Wills Eye Glaucoma Service for uncontrolled IOP of the right eye. She had received selective laser trabeculoplasty 9 years prior in both eyes and phacoemulsification with ab-interno canaloplasty of the right eye 6 months before trabeculectomy.\nPreoperatively, she had corrected VA of 20/20 in both eyes. The IOP was 30 mmHg OD and 15 mmHg OS on brimonidine, latanoprost, fixed-combination dorzolamide/timolol OU, and netarsudil OD. The pachymetry was 554 mu OD and 544 OS. Anterior segment examination was unremarkable except for posterior chamber intraocular lens OD and minimal nuclear sclerosis OS. Posterior segment examination revealed a cup-to-disc ratio of 0.75 OD and 0.7 OS, without any abnormality in the macula or the retina OU. The angle was open on gonioscopy (D35r in all quadrants OU; Spaeth grading system). Visual field showed superior arcuate scotoma and nasal step OD and superior nasal step OS with a mean deviation of -10.43 OD and -1.03 OS, respectively.\nShe underwent trabeculectomy augmented by MMC; subconjunctival injection (0.4 mg/ml). In the first 2 postoperative weeks, the patient had a quiet eye, VA of 20/20, a nice bleb, and IOP of 10-12 mmHg. She presented with pain and photophobia on the 3rd postoperative week. Examination revealed VA of 20/40, IOP of 12 mmHg, +1 diffuse conjunctival injection, +1 cells, and flare in the anterior chamber. The provisional diagnosis was rebound inflammation, and topical steroid frequency was increased. In the follow-up, the patient developed a thin layer of hyphema and NVA in the inferior 180 of the angle [Figure 1]. No rubeosis iridis was detected. Retinal evaluation by a retina specialist including fundus fluorescein angiography and optical coherence tomography revealed no signs of posterior segment ischemia [Figure 2]. Carotid Doppler ultrasonography did not show any abnormal findings. Given the lack of any sign of posterior segment ischemia, subconjunctival bevacizumab (1.25 mg/0.1 ml) was administered weekly for 3 weeks. Six months after the surgery, the VA was 20/20 OU, and IOP was 12 mmHg OD without any glaucoma medications and 14 mmHg OS on brimonidine and fixed-combination dorzolamide/timolol. No NVA was detected on gonioscopy, but scattered peripheral anterior synechiae developed in the inferior angle.",
"gender": "Female"
}
] |
PMC8095308
|
[
{
"age": 62,
"case_id": "PMC7093742_01",
"case_text": "We present a case of a 62 year old female with a past medical history significant for multiple myeloma status post stem cell transplant 16 months prior and subsequently treated with pomalidomide and biweekly dexamethasone, and well controlled diabetes who initially was brought to the hospital by her family for headaches beginning that morning. Subsequently she became more lethargic, confused, and febrile to a temperature of 102 degrees Fahrenheit. On arrival to the emergency department she was found to be septic, with a fever of 103.2 degrees Fahrenheit and tachycardia with a HR of 127 bpm. Initial work up showed a possible infiltrate on chest x-ray concerning for pneumonia, a urinalysis concerning for urinary tract infection, and a respiratory viral panel by PCR which was positive for coronavirus. The patient was initiated on vancomycin and piperacillin-tazobactam empirically. Initial CT scan of the head was largely unremarkable, showing only mild prominence of the ventricles and global cerebral volume loss (Fig. 1). The patient was admitted to the medical wards, where she had rapid deterioration of her clinical status resulting in obtundation, acute hypoxic respiratory failure and septic shock requiring intubation and vasopressors.\nThe infectious work up revealed Escherichia coli bacteremia thought to be secondary to a urinary source. On the second day of admission she was escalated to meropenem, but she continued to spike fevers with no improvement in mental status despite weaning off sedation. On the 6th day of admission, a repeat CT scan of her head revealed a new hydrocephalus with transependymal flow and questionable midbrain lucency (Fig. 2). Subsequent Magnetic Resonance Imaging of the brain showed intraventricular hemorrhage. An external ventricular drain (EVD) was placed emergently by neurosurgery, and the resulting cerebrospinal fluid analysis showed 22 nucleated cells with 35 % neutrophils and 35 % lymphocytes, an elevated protein of 84 and low normal glucose of 49, though cerebrospinal fluid glucose was less than 60 percent of serum glucose. Cerebrospinal fluid PCR returned positive for Listeria monocytogenes and antimicrobials were changed to ampicillin, in addition to ceftriaxone to cover for E coli bacteremia. The patient was later started on gentamicin to add double coverage for Listeria and was given a dose of intrathecal amikacin. After 5 days the EVD was clamped, and when subsequent CT showed no further enlargement of the ventricles, the EVD was removed 8 days after originally having been placed. The patient showed improvement in mental status, first localizing to voice and then partially following commands. She was successfully extubated on hospital day 16. Upon further questioning, her spouse mentioned that the patient had been to an international barbecue a week prior to admission, and might have eaten uncooked food there, illuminating the possible source of infection.",
"gender": "Female"
}
] |
PMC7093742
|
[
{
"age": 50,
"case_id": "PMC5266149_01",
"case_text": "We report the case of a 50 years old woman followed in the Department of Endocrinology at Brest University Hospital (France) for malignant adrenocortical carcinoma.\nIn October 2013, the patient came to the emergency department for a superficial phlebitis of the left calf associated with dyspnea. Additional tests revealed a large mass of 6.6 cm long axis at the expense of the left adrenal gland. Faced with this suspicion of adrenocortical carcinoma, the patient underwent resective surgery, planned quickly. Pathological analysis confirmed the diagnosis of malignant adrenocortical carcinoma.\nAs part of the treatment, the patient received mitotane (Lysodren) as adjuvant treatment. Six months after starting the treatment, she reported severe discomfort at vaginal and oral levels (causing difficulty feeding). An alteration of the mucous membranes was observed. Mitotane treatment also resulted in a central hypothyroidism after 1 year of treatment. This side effect was treated by levothyroxine sodium (Levothyrox). The mensual plasma dosage of mitotane confirmed the stable level of the drug between 14 and 20 nanograms per milliliter, as recommended.\nThe initial diagnosis, established in the Endocrinology Department from the clinical data, was an oral candida fungus treated by flucytosine (antifungal for systemic use indicated in severe fungal infections) and fluconazole (antifungal indicated especially in the treatment of candidiasis). Due to lack of efficiency, patient was addressed in the Dermatology Department where a possible lupus was discussed. Immunological tests and vaginal and oral biopsy were performed. A presumptive diagnosis of lichen planus led to corticosteroids mouthwash prescription. Presentation of this case was made in the multidisciplinary lupus consult. This staff concluded that clinical and immunological examinations were not in favor of an induced lupus. The treatment then undertook was mouthwashes of lidocaine (local anesthetic) and prescription of Colchimax (consisting of methyl tiemonium, opium, and colchicine: antigout and antiinflammatory especially indicated to treat Behcet disease). One month later, treatments were suspended because of healing courses of lesions. Investigations have also been undertaken to rule out a deficiency origin. Vitamin supplements were prescribed.\nFinally, biopsy performed at vaginal level revealed an active erosive lichen (Fig. 6). Oral biopsy is not specific but by analogy the diagnosis was bipolar erosive lichen planus. The lichen was first treated with corticosteroids (prednisone) that have proven ineffective and badly tolerated by the patient. Then treatment with ciclosporine (Neoral: immunosuppressive therapy) was conducted to the same result. So, prescription of Acitretin (Soriatane: keratolytic agent indicated for the treatment of severe forms of lichen planus on failure of the usual therapeutic) without improvement.\nThe patient was sent to the Pathology and Oral Surgery Department of where were objectified:\nErosive lichenoid lesions on right and left cheeks (Figs. 1 and 2).\nErosive lichenoid lesion of the right side edge of the tongue (Fig. 3).\nComplicated with pyogenic granuloma on left cheek (Fig. 4).\nErosive lichenoid eruptions associated with endovaginal synechia (Fig. 5).\nNow, the patient is treated - for its erosive lichen planus - by hydroxychloroquine sulfate (Plaquenil: indicated for the treatment of lupus erythematosus and steroid-resistant or refractory lichen planus) associated with corticosteroids mouthwash for OLP and clobetasol propionate (Dermoval) with cortisone for vulvo-vaginal eruptions. At its last consultation, the patient reported significant improvement in both oral and vaginal symptoms.\nCurrently, discussion is ongoing to evaluate the benefit/risk balance for the maintenance or not treatment of mitotane, medication being not substitutable at the time.",
"gender": "Female"
}
] |
PMC5266149
|
[
{
"age": 72,
"case_id": "PMC3299630_01",
"case_text": "A 72-year-old Asian Taiwanese woman with intermittent, painless, total gross hematuria visited the Department of Urology of our hospital in 2010. She had been diagnosed with chronic hepatitis C and stage III chronic kidney disease for 10 years and has regular follow-up. In 2001 (nine years ago), a routine ultrasound examination showed a left renal tumor. Computed tomography (CT) confirmed the diagnosis (Figure 1). She then was transferred to our Department of Urology and underwent a hand-assisted laparoscopic radical nephrectomy. The pathological reports revealed an RCC of stage T1N1M0, which covered the cortex and medulla with central areas of necrosis and hemorrhage, measuring 11.0 cm x 7.0 cm x 4.0 cm. The calyx segment of the collecting system was also included. Her ureter was not dilated and its mucosa was not remarkable. Fortunately, her ureter was free from cancer tissues. After the operation, she received regular follow-up.\nAt the beginning of 2010, nine years later, our patient had one episode of gross hematuria. The results of examinations such as urine cytology and cystoscopy were normal. A CT scan showed two renal stones in her right kidney without other abnormalities. The hematuria subsided spontaneously. Two months later, another episode of gross hematuria occurred. This time, clot formation was noted in her urine. Once again, the symptoms subsided spontaneously. Cystoscopy revealed whitish debris coating the left ureter orifice; no gross bladder tumor was seen. A ureter catheter could not be inserted into her left ureter due to a ureterovesical junction stricture. Thus, retrograde pyelography with a cone tip ureteral catheter was tried, but also failed. However, CT scans showed a prominent soft tissue mass at the ureterovesical junction. The middle and lower third parts of her residual left ureter were dilated (Figure 2). According to the imaging, a urothelial carcinoma of the ureter stump was highly suspected. Therefore, a ureteroscopic examination and biopsy was performed using a fiberoptic rigid ureteroscope. We tried to use a guidewire to pass the ureteral orifice cystoscopically but the guidewire could only be progressed for less than 1 cm. The ureteroscope was therefore inserted without intramural dilatation of the ureterovesical junction and it was only possible to examine the ureter up to less than 1 cm from the ureterovesical junction. The biopsy was thus taken from the lower ureter where it is close to the ureterovesical junction. The pathological report showed a high-grade infiltrating urothelial carcinoma. The tumor invaded the subepithelial connective tissue (lamina propria) and the pathologic staging of the primary tumor was T1. A radical operation (ureterectomy with ipsilateral bladder cuff excision or a cystectomy) or systemic chemotherapy were suggested. Without family support, our patient had been in a depressed state for a long time. With consideration of the multiple coexisting systemic diseases, such as liver cirrhosis, chronic kidney disease, gallbladder stones, facial palsy, hypertension and recurrent urinary tract infection, our patient refused both treatment options. She asked for supportive treatment only.\nTo further identify the possible risk factors contributing to the urothelial carcinoma of the ureteral stump, we checked the medication history of our patient. As shown in Table 1, our patient had taken several different kinds of drugs for more than 10 years. These were cephalosporin, nitroxoline, sulfonamide, levofloxacin for urinary tract infection, atenolol, amlodipine, solantin for hypertension, atorvastatin for hyperlipidemia, ursodeoxycholic acid for liver cirrhosis and Chinese herbal drugs for multiple somatic complaints. Importantly, although our patient had taken Chinese herbal drugs for more than 10 years, the compositions of these drugs remain unclear. Long-term multiple use of Chinese herbal drugs may influence inflammatory reactions. We therefore compared gene expression level of Cox-2 between this patient and patients with calcium nephrolithiasis. Real-time polymerase chain reaction experiments indicated that a high level of expression of the Cox-2 gene was seen in our patient with the urothelial carcinoma of the ureteral stump (Figure 3).",
"gender": "Female"
}
] |
PMC3299630
|
[
{
"age": 78,
"case_id": "PMC5274690_01",
"case_text": "A 78-year-old woman with a history of a remote right-sided cerebrovascular accident complained of painless, progressive onset of binocular horizontal diplopia, elicited by switching from near to distance vision. Prism glasses improved her symptoms. In addition, she had noticed progressive onset of axial weakness, dysphagia, and imbalance three years earlier, which had significantly worsened in the past few months as the ocular symptoms presented. Her symptoms progressed until she was unable to support herself when sitting and walking and required the use of two canes to ambulate.\nOn examination, her distance visual acuity was 20/20 OU. There was no dyschromatopsia or defects on Amsler grid testing. Pupils were equal and briskly reactive to light without a relative afferent pupillary defect. Trigeminal and facial nerve functions were intact. Her marginal reflex distance (MRD1) measured 3 mm in the right eye and 2 mm in the left. Levator function was 14 mm in both eyes. Ocular motility exam revealed comitant esotropia of 12-15 PD at distance vision and smaller esophoria of 6 PD at near vision. Extraocular movements were full and saccades, smooth pursuit, and OKN were intact. There was no pathological nystagmus. Slit lamp examination revealed bilateral map dot fingerprint dystrophy. Funduscopic examination was normal. Our clinical impression was divergence insufficiency and bilateral levator dehiscence due to Sagging Eye Syndrome.\nThe patient was evaluated by Neurology for her axial weakness. In addition to her severe axial weakness, she had MRC grade 4 strength in the neck flexors, extensors, deltoids, and hip flexors. EMG revealed evidence of left lumbosacral radiculopathy at L2-L5 levels without electrophysiological evidence of length-dependent large fiber neuropathy, neuromuscular junction disorder, or myopathy. Studies for CK, HbA1c, TSH, IgG, IgA, IgM, SPEP, UPEP, vitamin B panel, paraneoplastic autoantibodies, ANA, ANCA, cryoglobulin, and autoantibodies for Celiac disease (Gliadin Pep Ab IgA and TTG IgA) and Sjogren's syndrome (SS-A 52, SS-A60, and SS-B Ab IgG) revealed no abnormalities. In view of a lack of obvious cause for the patient's muscle weakness, a muscle biopsy of the left quadriceps was performed. The biopsy showed chronic myopathic changes with many lobulated fibers and several fibers containing rods, suggesting an adult-onset nemaline myopathy (Figures 1(a) and 1(b)). A single fiber with rods was also detected in the deltoid muscle.\nAn MRI of the orbit with and without contrast was performed to evaluate for SES versus a myopathic involvement of extraocular muscles. Imaging demonstrated inferior displacement of the lateral rectus muscle bilaterally (Figure 2). The muscles were normal in signal intensity without abnormal enhancement.\nThe patient was subsequently treated with IVIG and noted improvement in her limb weakness but thus far has not noted any improvement in core muscle weakness. Her diplopic symptoms were alleviated by prism lenses.",
"gender": "Female"
}
] |
PMC5274690
|
[
{
"age": 24,
"case_id": "PMC5585683_01",
"case_text": "A 24-year-old male presented to our emergency department with worsening cough, fever, and chills of one-day duration. The patient reported cough for one week that progressively worsened, with mucoid phlegm associated with low-grade fever, chills, and shortness of breath of 1-day duration. He denied hemoptysis, gastrointestinal symptoms, and chest pain and reported no bird exposure, skin rash, arthralgia, recent travel, or sick contacts. His medical history was significant for mild persistent asthma and schizophrenia. He had no prior surgeries and had resided in a psychiatric facility for 2 years with no occupational exposure to chemicals or toxins. He was a former polysubstance abuser and was in abstinence for 2 years. He denied smoking cigarettes, using illicit drugs, or abusing alcohol and had no reported allergies. His medications included divalproex sodium, clozapine, zolpidem, albuterol, and fluticasone aerosol inhaler. He had a negative tuberculin skin test 6 months prior to admission for the current complaint.\nA physical examination revealed a young man of average built, with a temperature of 100.4 F, pulse rate of 78/min, respiratory rate of 20/min, and blood pressure of 110/66 mmHg; he also showed 96% saturation on ambient air. He appeared lethargic, with no conjunctival pallor, cyanosis, nuchal rigidity, skin eruptions, or palpable lymphadenopathy. Bilateral air entry was evident on auscultation of lungs, with fine rales on the right side. A precordial examination revealed normal heart sounds, with no murmur, rub, or gallop. An abdominal exam revealed no organomegaly, and a neurological examination showed no motor or sensory neurological deficits. An initial laboratory examination showed neutrophilic leukocytosis (white blood cell count, 18,000/mm3 with 74% neutrophils) and elevated blood urea nitrogen (25 mg/dL) with lactic acidosis (2.5 mmol/L). He had no anemia (hemoglobin, 13.5 g/dL), thrombocytopenia (157,000/muL), or renal failure (creatinine, 0.6 mg/dL). A urine toxicology screen was negative for any drugs. His initial chest radiograph showed right upper lobe consolidation (Figure 1(a)). He was admitted to the hospital for pneumonia, which was managed with vancomycin, piperacillin-tazobactam, and azithromycin. Further evaluation by chest computed tomography (CT) showed a thick-walled, right upper lobe cavitary lesion (Figure 2(a)). Fiberoptic bronchoscopy (FOB) with bronchoalveolar lavage (BAL) was performed to test for associated infections or noninfectious processes. A transbronchial biopsy of the lung showed diffuse lymphocytic infiltrates. Cultures for common bacteria, Mycobacterium tuberculosis, and fungi were negative, as were cultures for respiratory syncytial virus, influenza viruses, parainfluenza viruses, adenoviruses, and vasculitis workup as shown in Table 1. Serology performed to detect other infections indicated a cold agglutinin titer of 1 : 320 and an M. pneumoniae IgM antibody titer of 1 : 1,280. At this point, antibiotic treatment with oral azithromycin was continued and the remaining antibiotics were discontinued. The patient's condition did not improve clinically, so levofloxacin was started and the patient was discharged to the psychiatric facility on oral medication for 2 weeks. Follow-up chest radiograph two months later showed right upper lobe scarring and improvement in consolidation (Figure 1(b)). Follow-up CT scan two months later showed foci with ground glass opacity in the anterior right upper lobe of the lung surrounding a 9.9 mm nodular density and three months later showed complete resolution of the cavitary lesion without sequelae (Figures 2(b) and 2(c)); the antibody titer for M. pneumoniae IgM was also reduced (1 : 160) 3 months later.",
"gender": "Male"
}
] |
PMC5585683
|
[
{
"age": 29,
"case_id": "PMC7684555_01",
"case_text": "A 29-year-old woman, previously healthy, presented to the accident and emergency department with complaints of fronto-occipital headache and decreased consciousness level for the last 24 hours. The symptoms suddenly started and included photophobia, neck pain, and nonprojectile vomiting (four times). She had urine incontinence and drowsiness. No further symptoms or signs were present on admission. Her vital signs were stable, and she was afebrile. Her Glasgow coma score (GCS) was 12/15 (E3 M5 V4), and pupils were 3 mm bilaterally and reactive to light. Her laboratory values showed leukocytosis (white blood cell: 22.5 x 103/muL, neutrophils 42%, hemoglobin 13.3 gm/dL, platelet 318 x 103/muL), high lactate 4.8 mmol/L, and normal glucose, electrolytes, and liver and kidney function tests. A CT head scan showed isodense rounded lesion seen at the level of the foramen of Monro measuring 13 x 15 mm, which was likely a cyst with secondary significant dilatation of the lateral ventricles with brain edema.\nFew hours later, the patient became unresponsive with drop of GCS to 3/15, tachycardic (heart rate 160 beat/min), and hypertensive (blood pressure 150/110 mm Hg). Pupils were unequal in size; right 8 mm nonreactive and left 6 mm reactive to light. The patient was immediately intubated and escorted to the operating room (OR) for emergency external ventricular drain (EVD) insertion. Upon connecting her to the anesthesia ventilator in the OR, she had pink frothy secretions from the endotracheal tube, high peak airway pressures of 40 cm H2O, and oxygen saturation (SO2) 92%, and she needed fraction of inspired oxygen (FiO2) of 100%. The clinical diagnosis of pulmonary edema was made, and she was given furosemide and morphine and was escorted to the surgical intensive care unit where she was sedated with remifentanil and dexmedetomidine infusions. Her pupils were 2 mm bilaterally equal and reactive to light after the EVD insertion. Noradrenaline infusion was required to maintain adequate hemodynamics. Her chest had bilateral crepitations, and chest X-ray showed bilateral infiltrates (Figure 1). Her arterial blood gas showed metabolic acidosis (pH 7.26, PCO2 43 mm Hg, PO2 74 mm Hg, lactate 2.5 mmol/L, SO2 94%, BE: - 7 mmol/L, HCO3 18 mmol/L, and PO2/Fio2 148 mm Hg). Cardiac biomarkers were elevated (pro B-type natriuretic peptide 3825 pg/mL and highly sensitive troponin T: first set 1917, second set 1085, and third set 756 ng/L). Electrocardiogram (ECG) showed T-wave inversion in leads I, aVL, V2, and V3 (Figure 2).\nA right femoral arterial pulse-induced continuous cardiac output (PiCCO ) catheter was inserted for advanced hemodynamic monitoring. Its findings were in line with the diagnosis of heart failure: cardiac index 1.85 L/min/m2, cardiac functional index 3.2, systemic vascular resistance index 2710 DS/cm5m2, extravascular lung water index 16.2 mL/kg, intrathoracic blood volume index 854 mL/m2, global end-diastolic volume index 623 mL/m2, and stroke volume variation 10 L/min/m2. She was started on dobutamine infusion and boluses of furosemide in addition to noradrenaline infusion. Transthoracic echocardiogram (ECHO) showed global hypokinesia of the left ventricle with low-moderate systolic function impairment (ejection fraction of 30%-35%) and no diastolic dysfunction or valvular abnormalities or any changes in wall thickness. The right ventricle systolic pressure was 25 mm Hg. Lisinopril and carvedilol were added to the therapy as anti-failure medications. Brain MRI on day 3 showed a midline anterior third ventricle and foramen of Monro well-defined globular cyst measuring about 1.5 cm that causes CSF obstruction with mild-moderate hydrocephalus of the lateral ventricles (Figure 3). Noradrenaline infusion was stopped on day 3, and the patient was kept on dobutamine infusion and furosemide. Daily PiCCO results are shown in Table 1.\nThe patient showed improvement in clinical, hemodynamic, and neurological status by day 5 and was extubated and put on noninvasive ventilation. Dobutamine infusion was discontinued on day 6. After a multidisciplinary team meeting, patient was brought to the OR on day 17 for endoscopic excision of the cystic lesion. The patient came back from the OR extubated with GCS 15/15. Final histopathology results of the cystic lesion on day 21 were consistent with colloid cyst (no hemorrhage in the cyst). She was transferred to a neurosurgical ward on day 25. From there, she was discharged home on day 32. Her follow-up in outpatient clinics for the next 6 months of discharge showed improvement in her cardiac status. Her ECG and ECHO findings were improved and within the normal range. Follow-up brain MRI showed complete excision of the cyst.",
"gender": "Female"
}
] |
PMC7684555
|
[
{
"age": 32,
"case_id": "PMC9537450_01",
"case_text": "The patient was a Caucasian female, born and resident in the city of Rio de Janeiro, 32 years old, and married. No allergies or comorbidities were reported, denied alcohol and tobacco consumption or continuous use of any medication, and had no history of recent exposure to azoles or methotrexate, which is an antifolate that can induce cross-resistance to azoles. In May 2018, at 39 gestational weeks (plus 1 day), according to the patient's choice, an elective cesarean section was performed, and no complications during childbirth or prenatal care were reported. The newborn was kept in exclusive breastfeeding after birth.\nThe patient sought medical attention 10 days after delivery complaining of pain in both breasts and presenting bilateral breast fissure. After being instructed on best practices for breastfeeding, a return appointment was scheduled within 7 days, when a significant improvement in the pain and breast fissures was seen. Thirty days after delivery, the infant presented inadequate weight gain, according to the World Health Organization guidelines and growth chart, requiring milk complementation using the trans-lactation technique. As the infant evolved effective weight gain, supplementation was gradually decreased. Two months and 15 days after delivery, the patient presented intense burning in both breasts in a symmetrical way, with worsening of symptoms after breastfeeding. No fever or other complaint was reported. The patient reported that there were no changes in hygiene, food, or health-related habits in the postpartum period. Upon clinical examination of the breasts, a mild bilateral areolar hyperemia was observed. The nipples did not present any changes (before or after breastfeeding). Mammary/nipple palpation was painless and did not indicate the presence of any nodule. No signs of candidiasis were seen in the newborn, who was well positioned and attached during breastfeeding.\nA milk sample was collected and submitted to culture for bacterial and fungal screening. The patient was prescribed fluconazole 150 mg P.O. once a week for 4 weeks, in addition to the topical application of nystatin in both breasts after breastfeeding for 7 days. The use of oral nystatin in the infant was also recommended, following internal protocols of the institution. It is worth mentioning that fluconazole can pass into breast milk in amounts lower than the dosages used in the treatment of systemic infections and the use of fluconazole during breastfeeding does not pose a risk to infants, according to the American Society of Pediatrics and the Brazilian Ministry of Health. Although ketoconazole is the drug of choice for mastitis treatment in puerperal women according to the guidelines of the Brazilian Ministry of Health, this medication was not available at the health institution where the patient was assisted; and thus, fluconazole was used following the internal institution's protocol. The patient was assisted at Instituto Fernandes Figueira (IFF) of Fundacao Oswaldo Cruz, which is a reference institution in mother and child health, and is considered by the WHO and the Brazilian Ministry of Health as a \"child-friendly hospital.\" The study was approved by the institution's Research Ethics Committee (CAAE 43389321.9.0000.5257). During treatment, the patient continued to breastfeed symmetrically. In addition, the patient was advised to adhere to recommendations related to best hygiene practices (exposing the breasts to air, washing hands before and after breastfeeding, sterilizing objects in contact with the newborn's mouth). Two weeks after starting the treatment, the patient returned to a new appointment, and showed no improvement in the pain besides presenting a mild desquamation and moderate bilateral areolar hypochromia. The infant had no symptoms or complications. Milk samples, as well as samples of skin areas of both breasts, were collected and submitted to culture. In addition, a second round of fluconazole 150 mg for 7 days was prescribed, according to the internal health unit's protocol. One week later, the patient returned to the health unit and was fully recovered, with no pain and no areolar lesions Table 1.\nFor sample collection, the medical staff used clean medical gloves, and 2 ml of breast milk was collected after discarding the first 1 ml. Samples were transported to the Laboratory of Taxonomy, Biochemistry, and Bioprospection of Fungi at Fundacao Oswaldo Cruz, Rio de Janeiro, Brazil within 30 min after sampling and kept at -20 C until analysis. Samples were streaked onto Sabouraud Dextrose Agar (SDA) and incubated at 30 C for 48 h, when the morphological characteristics were then evaluated. No bacterial growth was detected, and fungal colonies with the same morphology and characteristics were observed from all clinical samples (Figure 1A). Growth on SDA was subcultured onto CHROMagar Candida (BD Difco) and CHROMagar Candida Plus (CHROMagar ) and colonies were interpreted according to the manufacturer's instructions. Small pink colonies, suggesting C. guilliermondii, were observed in both media (Figures 1B-E) from all clinical samples. Biochemical characteristics, examined by conventional methods, also indicated C. guilliermondii. In addition to morphologic and phenotypic tests, the isolate was also identified using molecular tools, including MALDI-TOF MS and sequencing of ITS region.\nIdentification at species level by MALDI-TOF MS was carried out as previously described by and with few modifications. Briefly, 106 yeast cells were transferred from the culture plate (c.a. 1g) to a 500 mul tube containing 20 mul of 70% formic acid in water (v/v). The supernatant of each sample (1 mul) was transferred to a paraffin film surface and 10 mul of acetonitrile was added. The sample (1 mul) was spotted onto the MALDI-TOF MS stainless plate (Bruker Daltonics, Germany) and covered with 1 mul matrix solution alpha-cyano-4-hydroxycinnamic acid (CHCA, Fluka, Buchs, Switzerland). Each sample was analyzed in triplicate. The sample was air-dried at room temperature previous to the spectra acquisition. Using the Bruker database, it was possible to identify the isolate at species level (score of 1.72) as C. guilliermondii. The spectra generated were exported to BioNumerics software v8.1 (Applied Maths) with which a Neighbor-Joining tree was created using MALDI-TOF spectra generated from reference strains representing major Candida species. The clinical isolate was clustered together with C. guilliermondii reference strain (Figure 2) confirming the automated identification by MALDI-TOF MS.\nFrom colonies grown in SDA culture, genomic DNA was extracted using the Gentra Puregene Yeast and G+ Bacteria kit (Qiagen , Maryland, United States) according to the manufacturer's recommendations. The amplification of the ITS1-5.8S-ITS2 region of ribosomal DNA was performed in a final volume of 50 mul containing 100 ng of DNA and 25 ng/muL of each primer (InvitrogenTM Brazil), ITS1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS4 (5'TCCTCCGCTTATTGATATGC 3'). PCR was performed in an Applied Biosystems thermocycler (model Veriti) with annealing temperature of 50 C. The amplified product was purified with the QIAquick PCR Purification Kit (QIAGEN ) and sequenced using the ABI-3730 sequencer (Applied Biosystems). The sequences were edited using CodonCode Aligner (Genes Code Corporation, Ann Arbor, United States), and phylogenetic analysis was performed using Blast software for comparison with the sequences deposited in the NCBI/GenBank database. An identity of 100% of the clinical isolate when compared to the reference sequence of C. guilliermondii (ATCC6260) KU729068.1 deposited at NCBI/GenBank was observed (Figure 3).",
"gender": "Female"
}
] |
PMC9537450
|
[
{
"age": 31,
"case_id": "PMC3277043_01",
"case_text": "A 31-year-old male, non-smoker, presented to us with a history of attacks of chronic intermittent cough since childhood. These attacks usually last for two to three days. Sometimes initiated and aggravated after heavy meals. It was also associated with recurrent chest infections. No significant history of hemoptysis, shortness of breath, difficulty of swallowing, or chocking was reported. Systemic examination was unremarkable. He used inhalers and cough suppressants as required.\nChest X-ray showed bilateral apical pleural thickening with fibroatelectatic changes at the right upper lobe. Barium studies showed significant dilatation of the whole esophagus, more at the proximal 3rd, with free passage of the contrast into the stomach without any stricture or narrowing at the distal end or at gastroesophageal junction; these findings were suggestive of some neurological causes or esophageal motility disorder. For further evaluation, the patient underwent esophageal manometry study and upper gastro-intestinal (GI) endoscopy. Esophageal manometry showed aperistaltic esophagus, but the lower esophageal sphincter could not be assessed. Upper GI endoscopy revealed the presence of smooth tracheoesophageal opening (fistula) in the upper 3rd of the anterior wall of the esophagus at 25 cm from the incisor teeth [Figure 1]; however, biopsy and wash aspiration from this fistula was negative for tuberculosis (TB) culture.\nComputed tomography (CT) scan of chest confirmed the presence of the TEF at the level of sternoclavicular joint along with dilated esophagus. Also, there was evidence of cystic, cylindrical, and varicose bronchiectatic changes in both the right upper, middle lobes, and in the lingula. There were also subpleural fibroatelectatic changes in the posterior segment of the right upper lobe, most likely due to recurrent aspirations [Figure 2a-b].\nPatient explored in the operating room through cervical approach along the anterior border of the left sternocleidomastoid muscle. Fistula was identified between the posterolateral wall of the trachea and the anterior wall of the esophagus. Adhesions separated and the fistula isolated completely and then closed by endo-GI stapler. Esophageal side reinforced with muscular patch to buttress this repair and to minimize the postoperative esophageal leak and to prevent long-term recurrence. Postoperative recovery was uneventful. Patient started oral fluids on the second postoperative day, the drain removed on the third day, and he was discharged home on fourth postoperative day. Patient remained asymptomatic and well at 12-month regular follow-up, as he underwent during this follow-up a barium swallow study which showed normal swallowing process and no hold up of the contrast with no evidence of gastroesophageal reflux and there was no evidence of recurrence of the TEF; however, he remained under regular follow-up with the gastroenterologist team for the esophageal motility disorder which has improved significantly clinically and radiologically.",
"gender": "Male"
}
] |
PMC3277043
|
[
{
"age": 65,
"case_id": "PMC5009580_01",
"case_text": "This patient is a 65-year-old left-handed man, who suffered serious head trauma causing a large left frontal contusion at age 54 after a fall at the workplace. At that time, he was placed in a medically induced coma for 3 days. Serial imaging after the injury demonstrated encephalomalacia and gliosis at the site of the contusion [Figure 1]. He developed seizures 7 months after the injury. His seizures were well-controlled on lamotrigine until 11 years later when their frequency and severity increased. Imaging at that time remained unchanged. Three months later, he developed status epilepticus. Magnetic resonance imaging (MRI) of the brain revealed a large 4 cm heterogeneously enhancing tumor with a necrotic center in the left frontal lobe [Figure 1]. The tumor was in the same location as the original injury. Of note, it had been a mere 3 months since his last serial MRI, which showed no evidence of tumor.\nIn preparation for resection of the tumor, a Wada Test revealed bilateral hemispheric language dominance. To avoid damaging language-processing centers, awake language mapping was attempted during planned operative resection. The patient became agitated during language mapping and the surgeon opted to place subdural grid electrodes for extraoperative speech mapping, which revealed no regions associated with language function in the vicinity of the tumor. In a second operative procedure under general anesthesia, he underwent uneventful resection of >90% of the tumor with residual in the left insula. Histopathologic analysis confirmed the diagnosis of GBM. The Ki-67 immunolabeling index using MIB1 antibody was up to 25%. Immunohistochemistry for the R132H mutation in IDH1 was negative.\nAfter surgery, he was treated with concurrent chemoradiotherapy (Stupp protocol). However, the tumor recurred rapidly and he expired within 4 months after surgery.",
"gender": "Male"
},
{
"age": 54,
"case_id": "PMC5009580_02",
"case_text": "This patient is a 54-year-old right-handed man who suffered a large contusion and severe injury to the inferior right frontal lobe in an automobile accident at age 47 [Figure 2]. Shortly after the injury, he developed post-traumatic hydrocephalus that was treated with a right frontal ventriculoperitoneal shunt. Subsequently, he required placement of a cardiac pacemaker that precluded imaging with MRI. He was followed with serial computed tomography (CT), which showed resolution of the contusion and development of encephalomalacia at the site of the inferior right frontal injury.\nSeven years after the injury, he came again to medical attention due to headaches and confusion. CT imaging indicated a 4 cm heterogeneously enhancing inferior right frontal mass at the site of the brain injury. There was extensive vasogenic edema surrounding the lesion. He underwent right frontal craniotomy for gross total resection of the mass, which was diagnosed as GBM. Immunohistochemistry for the R132H mutation in IDH1 was negative. He was subsequently treated with chemoradiotherapy as per Stupp protocol. As per the most recent follow-up 8 months post-resection, he remains neurologically intact with no evidence for recurrence on CT.",
"gender": "Male"
}
] |
PMC5009580
|
[
{
"age": 34,
"case_id": "PMC9195123_01",
"case_text": "A 34 year old man with a history of type 2 diabetes mellitus (T2DM), obesity, depression and anxiety presented to his primary care physician with difficulty concentrating and increased time spent playing video games. He estimated that he had been playing video games for about 14 h per day and noted this had begun to affect his work. He worked from home as an information technology consultant, and his last job performance evaluation was poor, whereas previous evaluations were good or satisfactory. With the onset of the COVID-19 pandemic, work tasks initially slowed down and he spent his extra time playing games online. Additionally, given social distancing he had not needed to, nor had he been leaving his house often. He currently lives with his parents who handle the family's grocery shopping. When business improved, he found himself struggling to complete assignments, and would be gaming during work hours. Before the COVID-19 pandemic he estimated he spent 2 h a day playing games. Prior to the pandemic he socialized with friends weekly, however at the time of presentation, his social interactions occurred through online gaming only.\nThe patient had no history of addiction and denied present alcohol or recreational drug use. Of note, the patient was in a car accident at the age of 12 and suffered a basilar skull fracture and concussion, resulting in a coma. He continued to have concussion symptoms for approximately 1 year and believes that is when he began to have difficulty concentrating. His current medications include metformin for his T2DM (most recent hemoglobin A1C was 7.3%). In the past he has taken bupropion and paroxetine but had not taken either for 2 years at the time of presentation. Physical exam reveals an obese male with a BMI of 46.2 kg/m2, and who appears depressed. His PHQ9 score was 13 and GAD7 score was 7.\nOn the advice of his primary care physician, paroxetine and bupropion were resumed. The patient declined a recommended psychotherapy referral. A neuropsychological evaluation was ordered to investigate his difficulty with concentration. At follow up, the patient had reduced depression and anxiety and improved self esteem, with PHQ9 score of 1 and GAD 7 score of 1. However, he did not feel he had decreased his screen time and still estimated it to be 14 h per day. The patient canceled his neuropsychological evaluation and indicated that he would not reschedule.",
"gender": "Male"
}
] |
PMC9195123
|
[
{
"age": 82,
"case_id": "PMC6701271_01",
"case_text": "The patient was an 82-year-old female who is a nursing home resident presented to an outside hospital with a two-week history of jaundice that had progressively worsened. She was brought to the emergency department and found to have hyperbilirubinemia with a total bilirubin of 10.7 and a direct bilirubin of 8.7. She was afebrile, and white blood cell count was 8.9. A CT scan of her abdomen and a MRCP were diagnostic for Mirizzi syndrome, revealing large stones compressing the common bile duct (CBD) with proximal dilation. She was transferred to our hospital for a higher level of care with hepato-pancreatico-biliary surgeons. Of note, her past medical history was significant for morbid obesity with a BMI of 42, dementia, diabetes mellitus, hypothyroidism, deep vein thrombosis (DVT), depression, anemia, tobacco use, and congestive heart failure (CHF). Her surgical history consisted of an appendectomy.\nUpon arrival at our hospital, the patient underwent an endoscopic retrograde cholangiopancreatography (ERCP) with the removal of small stones in the common bile duct, sphincterotomy, and two stent placements with ends terminating in the distal right and left hepatic ducts. However, despite this, there was still tapering in the common hepatic and common bile ducts noted from extrinsic compression from the large stones in the gallbladder and a significant filling defect through the cystic duct (Figure 1). Additionally, the patient developed a fever and leukocytosis and persistently elevated bilirubin, with the most likely cause being an obstruction of the biliary stents causing persistent cholangitis and cholecystitis. The ERCP was repeated, and a third stent was placed. The patient's fever was controlled, and the bilirubin began to trend down.\nOnce the patient was stabilized, she was taken to the operating room for a cholecystectomy. The procedure began laparoscopically, but dense adhesions in the right upper quadrant involving the liver, gall bladder, omentum, and transverse colon prevented the development of adequate and safe dissection planes, and thus, the procedure was converted to open. The lysis of adhesions continued to be difficult, but once the gallbladder was dissected out, two large, firm masses were palpated within the fundus and the neck of the gallbladder. Given the difficulty with the anatomy to safely do a cholecystectomy with the gallstones en bloc, the decision was made at this time to do a partial cholecystectomy with the removal of the stones. The anterior gallbladder wall was first opened near the fundus, and the gallbladder wall was first dissected off the stone and then the stone from the posterior wall. When removed, the stone measured approximately 3.5 centimeters (Figure 2), and pus and necrotic tissue were found within the gallbladder.\nAttention was then turned to the neck of the gallbladder where the anterior wall of the gallbladder was again incised, revealing another a large 4-centimeter stone (Figure 2) that was dissected off the posterior wall and removed. It was noted at this time that there was significant arterial bleeding with a loss of approximately 300 cc of blood and the development of mild hypotension and tachycardia. Given the new symptoms and the patient's baseline hemoglobin of 8.4, the patient received two units of red blood cells intraoperatively. The arterial bleeding was controlled with sutures, and attention was turned to the biliary tree upon which a defect in the common hepatic duct and the common bile duct was noted, presumably where the cystic duct previously entered and from the cholecystocholedochal fistula formation. The defect measured approximately three centimeters in length and eight millimeters in width after debridement of necrotic tissue.\nGiven the fragility of the tissue and the size of CBD defect, it was not closed primarily. However, the patient's hemodynamic instability and overall health status made a biliary-enteric anastomosis a very high-risk operation with significant morbidity and mortality for the patient. Thus, the decision was made to use a dissected, viable gallbladder wall piece to form a free flap to repair the defect in the biliary tree (Figure 3). The mucosal surface of the gall bladder wall was juxtaposed to the lumen of the common ducts and secured in place with a running 5-0 PDS suture. The remnant gallbladder stump was closed and oversewn in a continuous fashion. The area was extensively irrigated given the pus and necrosis that was discovered during the cholecystectomy. One drain was placed within the closed gallbladder remnant and the second one outside the closed gallbladder remnant. The abdomen was then closed in the usual manner.\nImmediately, postoperatively, the patient was managed in the intensive care unit given her instability during the operation but was transferred to a step down unit shortly after on postoperative day two. She was observed off of antibiotics with normalization of leukocytosis, remained afebrile and hemodynamically stable, and had continuously down trending bilirubin levels throughout the remainder of her hospital stay. Clinically, she recovered well and was stable for discharge on postoperative day seven with drains remaining in place and to be removed on a follow-up as an outpatient. On a subsequent follow-up, the patient was noted to remain clinically stable and follow-up CT scans revealed no intrahepatic biliary duct dilation, a normal caliber common bile duct, no intraluminal filling defect, a patent stent, and no biliary leak (Figure 4). Laboratory evaluation revealed no leukocytosis and normalization of liver enzymes and total bilirubin levels. Given these results, her surgical drains were removed, but her biliary stents remained in place, and despite multiple contact points and counseling to have a follow-up with the gastroenterologists for ERCP and removal, she was noncompliant and the stents remain in place to date. She however remains stable and healthy during her one follow-up appointment as of this writing and continues to be monitored closely with phone check-ins with no evidence of further hepatobiliary symptoms or complaints of incisional hernias.",
"gender": "Female"
}
] |
PMC6701271
|
[
{
"age": 61,
"case_id": "PMC9889852_01",
"case_text": "A 61-year-old male was referred to our hospital due to a mass found in his left neck three years ago. The patient complained no salient clinical symptoms, including tachycardia, sweating, weight loss, dyspnea, or hoarseness. He had no history of neck radiation or familial thyroid disease. A moderately hard and painless nodule measured 5 cm in the left thyroid lobe that could move with swallowing was detected by physical examination. Meanwhile, routine blood tests, thyroid hormone, and thyroid-stimulating hormone were within the normal ranges. A hypoechoic solid nodule (measured 50 mmx 23 mm x 23 mm) with a clear boundary was found in the enlarged left lobe of the thyroid, and punctate echogenic foci was not detected on ultrasonography ( Figure 1A ). According to ACR TI-RADS (American College of Radiology, Thyroid Imaging Reporting and Data System), this nodule was assigned to TR-4 category. Blood flow signals within and around the nodule were shown by Color Doppler flow imaging ( Figure 1B ). The patient underwent follow-up instead of surgical treatment. However, the gradual growth during the follow-up was presented by semiannual thyroid ultrasonography. Therefore, further evaluation was recommended. A fine-needle aspiration (FNA) biopsy under the guidance of ultrasound was performed, and the lesion was suspected to be an oncocytic neoplasm by pathology. Furthermore, the contrast-enhanced ultrasound (CEUS) was performed with a bolus injection of 2 mL of SonoVue (Bracco, Milan, Italy) followed by 5 mL of saline. The lesion showed heterogeneous hypoenhancement during the whole procedure of CEUS ( Figure 1C ). Moreover, the lesion was soft according to the stiffness measurement by shear wave elastography (SWE) (Emax=5.3 kPa, Emean=4.2 kPa, Emin=3.2 kPa, Ratio=0.4) ( Figure 1D ). The lesion showed slightly low density with unclear boundary in the enlarged left thyroid lobe on plain computed tomography (CT) ( Figure 2 ).\nUltimately, the patient underwent resection of the left thyroid lobe and isthmus due to the suspicious malignant nodule. The patient exhibited normal preoperative thyroid hormone, thyroglobulin, and thyroid-stimulating hormone level. During surgery, the trachea was found to be pushed to the unaffected side of the neck due to the enlarged left lobe and isthmus of the thyroid. The tumor of the left thyroid lobe was a red, soft, and solid mass with a clear boundary. The central neck lymph node dissection was performed, and no enlarged lymph nodes were found visually during surgery. Postoperative pathology showed lymph node metastasis was not found. Histologic examination of the tumor showed that it consisted of bland spindle cells, immature elongated cells with bipolar cytoplasmic extensions, strap-type rhabdomyoblasts with abundant eosinophilic cytoplasm and round vesicular nuclei displaying a fascicular growth pattern ( Figure 3A ). No pleomorphism, necrosis, or atypical mitoses were observed. On immunohistochemistry, the tumor had strong desmin ( Figure 3B ) and weak sparse myoD1 expression ( Figure 3C ), while myogenin ( Figure 3D ), smooth muscle actin ( Figure 3E ), S-100 protein ( Figure 3F ), thyroglobulin, thyroid transcription factor 1, cytokeratin, and paired box protein 8 were negative. The expression of Ki-67 was less than 1%. Finally, the lesion was confirmed to be an AR of the thyroid by histopathology. After an uneventful postoperative course, the patient was discharged. No postoperative complications, such as hoarseness and hypoparathyroidism, were reported after the surgery. The patient is currently well one year after surgery and is undergoing semiannual conventional ultrasound examinations to follow up.",
"gender": "Male"
}
] |
PMC9889852
|
[
{
"age": 33,
"case_id": "PMC5971236_01",
"case_text": "The patient was a 33-year-old woman, gravida 2 para 1, with an intrauterine pregnancy dated by a 9-week ultrasound. She had an obstetrical history of one prior vaginal term delivery and a family history of breast cancer. Beginning at 11 weeks gestation, she reported headaches that were not relieved by acetaminophen, as well as a pulsing sensation in her left ear. Treatment was initiated with acetaminophen/butalbital/caffeine (Fioricet) for presumed migraine headaches. At 14 weeks, she complained of new onset jaw-tightness and a vibrating sensation in her ears, which prompted a referral to a primary care physician. At 20 weeks, the fetal anatomy scan showed appropriate growth with no fetal anomalies, but the patient's headaches had worsened and required frequent narcotic use. Four weeks later, the patient was referred to a neurologist who attributed her worsening symptoms to occipital neuralgia. Beginning at 26 weeks, her headaches were accompanied by anorexia, nausea, and vomiting. She also experienced two vasovagal episodes with questionable seizure activity. Psychiatric changes, which included severe depression and neglected hygiene, prompted two visits to the emergency department where she was diagnosed with migraine headaches and received opiates and antiemetics.\nAt 28 6/7 weeks, the patient underwent a workup for preeclampsia for which laboratory investigations were negative. However, magnetic resonance imaging (MRI) of the brain revealed a 7.5 cm heterogenous mass in the right frontal lobe (Figure 1) that showed patchy contrast enhancement, focal calcifications with blood products, and surrounding vasogenic edema with mild midline shift. At this time, the patient was transferred to our institution for the remainder of her care.\nOn admission, she was noted to have sluggishly reactive pupils and mild weakness in the left upper extremity. An ultrasound confirmed appropriate estimated fetal weight and amniotic fluid level. Levetiracetam was administered as well as dexamethasone, which was switched to methylprednisolone after 48 hours.\nThree days following transfer of care, the patient showed evidence of clinical deterioration, including recurrent aphasia and a generalized atonic seizure. The decision was made to proceed with neurosurgical resection of the brain mass to relieve intracranial pressure. Given the extent of the mass, involvement of eloquent cortex, and safety concerns for the fetus and the mother, the operation was planned in a staged fashion, with the second stage scheduled after delivery. At 29 4/7 weeks, the patient underwent a bifrontal craniotomy and subtotal right frontal lobectomy with excision of a highly vascular tumor; the posterior aspect of the neoplasm encroached on the motor cortex and was not resected at that time. Estimated blood loss was 100 mL. Continuous fetal heart monitoring performed throughout the operation showed a baseline of 135 beats per minute with minimal variability and no acceleration or deceleration. Once in recovery, the fetal heart tracing improved to moderate variability with 10 x 10 acceleration. Postoperatively, the patient recovered well. Her neurological status improved with resolution of her aphasia and cessation of seizure activity. She was discharged home on postoperative day two.\nHematoxylin and eosin (H&E) staining and immunohistochemistry were performed on sections prepared from formalin-fixed paraffin-embedded tissue. Microscopic examination showed hypercellular neuroglial tissue featuring GFAP-positive neoplastic astrocytes and clusters of dysplastic-appearing ganglion cells highlighted by NeuN and synaptophysin immunostains. The ganglioglioma was qualified as anaplastic due to increased cellularity, nuclear atypia, and mitotic activity in the glial component (Figure 2).\nDue to the highly aggressive nature of AGG, a compromise was reached between prolonging gestation and delaying further treatment. At 34 6/7 weeks, a viable 2800 gram male infant was born via cesarean delivery with Apgar scores of 7 and 8 at one and five minutes, respectively. Eleven weeks after the initial resection and five weeks after delivery, the patient underwent the second operative phase consisting of an awake-craniotomy with neuronavigation. There was complete gross resection of residual tumor, except for a small portion attached to the anterior cerebral artery.\nIntensity modulated radiotherapy to the brain was initiated two weeks after the operation. The patient underwent 2 Gy external beam radiotherapy in thirty sessions for a total of 60 Gy. She then completed twelve cycles of adjuvant temozolomide with excellent tolerability. The patient is now two years status post-initial tumor resection. She has no neurologic sequelae; however, her latest MRI showed continued slow growth of an enhancing 1.7 cm left frontal calvarium lesion. The clinical significance is yet undetermined. Her infant required hospitalization in the neonatal intensive care unit for 19 days due to feeding difficulties prior to discharge but is currently doing well.",
"gender": "Female"
}
] |
PMC5971236
|
[
{
"age": 75,
"case_id": "PMC6157206_01",
"case_text": "A 75-year-old woman was admitted in ICU after a cardiac arrest with return of spontaneous circulation, caused by tension pneumothorax. Now-flow and low-flow were 1 minute and 17 minutes, respectively. She was admitted 1 hour after the event, without sedation. Lungs were mechanically ventilated, the pleural drain was in place, pulse oximetry was 100% /FiO2 0.5, arterial pressure and heart rate were 160/70 mmHg and 110bpm, respectively, with norepinephrine at an infusion rate of 1mg/h, and temperature and glycaemia were 36.5 C and 8 mmol/L, respectively. There was no any sign of pneumothorax. Fever was actively treated without inducing hypothermia.\nShe was unconscious (Glasgow Coma Scale: 3/15), with a conserved bilateral photomotor reflexes. She had intermittent bilateral ocular revulsion and bilateral shoulders tremor. Propofol was initiated by a bolus followed by a continuous infusion and the movements of the eyes and shoulders ceased immediately. One hour later a 13 channels EEG (Figure S1 in supplementary figures) diagnosed a NCSE as a pattern of generalized periodic spike-waves evolving in generalized rhythmic spike-waves at 1 Hz with high amplitude (> 200 microV), without response to stimulation. Midazolam was initiated by a bolus followed by a continuous infusion which permitted to achieve a burst suppression pattern (Figure S2 in supplementary figures). A 4-channel sensor connected to BIS VISTA monitor was placed, in order to monitor the two processed parameters and showed an isoelectric signal (Figure S3 in supplementary figures).\nOn day 2 Clobazam and levetiracetam were added to ensure a bridging between IV and oral antiepileptic drugs. Conventional EEG recording showed a pattern of burst suppression and raw EEG from BIS monitor showed an isoelectric signal.\nOn day 3, the 4-channel sensor was replaced by a 2-channel sensor which was connected to patient's bedside monitoring. Propofol and midazolam were both decreased progressively. Few hours later (Figure 1, video 1, and figure S4), while there were no any abnormal movements, raw EEG of BIS monitor connected to a Philips BIS module [panel A] and secondarily to a BIS VISTA module [panel B] showed a pattern of high voltage with irregular morphology, alternating with isoelectric signal, evoking spikes (white arrows), spike-waves (red arrows), and polyspikes (white star). BIS and SR values did not show significant variations.\nAlthough it was not planned at that moment to request a conventional EEG recording, given the high suspicion of NCSE recurrence, the neurophysiology team was urgently contacted and the NCSE recurrence was confirmed and treated. The conventional EEG showed continuous generalized rhythmic spikes and spike-waves, sharply countered, of medium amplitude at 1-1.5 Hz (Figure S5 in supplementary figures). Unfortunately the patient died on the fifth day.",
"gender": "Female"
}
] |
PMC6157206
|
[
{
"age": 36,
"case_id": "PMC3364100_01",
"case_text": "A 36-year-old HIV-positive male was admitted to our institution due to a 2-week history of worsening headache and ataxia. He was originally diagnosed with HIV 8 months prior and had begun antiretroviral therapy at that time, including a non-nucleoside reverse transcriptase inhibitor, efavirenz. Then, 4 months prior to this admission, the patient had experienced progressive ataxia and lower extremity paresthesias eventually leading to a brain MRI which showed an avidly enhancing extra-axial left cerebellar mass (fig. 1a) most consistent with benign meningioma. CD4+ count at that time was 44. No mass effect was noted and watchful waiting was elected at that time. The patient's symptoms were stable until the clinical decline preceding this most recent admission. Repeat MRI at this time showed that the cerebellar mass had expanded over a period of 4 months from 1.6 x 1.6 x 1.5 cm to 4.8 x 4.4 x 4.0 cm with effacement of the 4th ventricle, obstructive hydrocephalus, and additional small foci of similar enhancement located extra-axially at distant but still intracranial sites (fig. 1b, c). It was presumed that these additional foci represented spread of the primary process. At this point, the lesions were suspicious for atypical meningioma or hemangiopericytoma, primary CNS lymphoma, or infectious etiologies. Serum was negative for toxoplasma IgG. Cerebrospinal fluid was negative for Epstein-Barr virus and cytomegalovirus by polymerase chain reaction. Aerobic, anaerobic, fungal, viral, and acid-fast bacilli cultures of the cerebrospinal fluid were all negative.\nThe patient was brought to surgery to excise the tumor due to rapid enlargement and mass effect. Following posterior fossa craniotomy and microscope-aided cerebellar dissection, the tumor was identified as a rubbery yellow mass. Intra-operative frozen section specimens were labelled meningioma or hemangiopericytoma. Subtotal resection was then performed as the tumor was found to be extending through the tentorium. It was felt that adequate debulking had been performed despite leaving a small amount of residual tumor above the tentorium.\nExamination of the permanent sections showed a densely cellular neoplasm comprised of spindle cells arranged in a solid and storiform pattern. The background blood vessels had a distinct staghorn-like pattern. Based on these features, the final diagnosis was hemangiopericytoma. The additional foci observed radiographically were not biopsied but were presumed to be metastases from the primary lesion. Following the surgery, the patient's neurologic symptoms were stable and the extra-ventricular drain was able to be removed on postoperative day 6. On postoperative day 10, the patient was discharged to a neurologic rehabilitation facility and after a short stay was discharged home. The patient underwent postoperative radiation therapy but, unfortunately, experienced a large recurrence of the cerebellar mass that required further surgery as well as interval increase in size in the accessory foci. The patient was undergoing additional rehabilitation at the time of submission of this work.",
"gender": "Male"
}
] |
PMC3364100
|
[
{
"age": 33,
"case_id": "PMC7342458_01",
"case_text": "A 33-year-old woman without pain or fever detected a firm mass measuring 30 mm on the central part of the left breast, which quickly grew to a size of 100x70 mm in 3 months. During this period she did not receive any treatment. The patient had a 6-year-old son and no family history or history of medication or psychosocial issues. Physical examination revealed a 150x120 mm mass in the central quadrant of the left breast that caused the nipple to retract (Figure 1A). Superficial lymph nodes in both axillae were not significantly enlarged, and no masses were detected in the right breast. An ultrasound (US) examination revealed a low-echoic lesion in the left breast whose size was too large to estimate (Figure 2A), while no hypoechoic mass was observed in the right breast. There were 6 enlarged lymph nodes in the left axilla with an indistinct medullary boundary (Figure 2B). Mammography revealed dense glands in both breasts that were asymmetrically distributed. Diffuse, microscopic calcifications and spiculated masses were present throughout the left breast (Breast Imaging-Reporting and Data System 4), and spiculated masses were also observed in the right breast. Breast magnetic resonance imaging (MRI) imaging revealed heterogeneous enhancement of the left breast with nipple inversion. Strikingly, there was an ovoid, poorly defined mass in the upper quadrant of the right breast; although visible enhancement was observed by MRI (Figure 3A-C), the color Doppler US examination result was negative. Staging workups including chest and brain computed tomography, liver US, and whole-body bone scintigraphy were negative for metastatic disease.\nCore needle biopsy of bilateral breast masses suggested IMPC, while cytologic detection of metastatic breast carcinoma in the left axillary lymph node yielded positive findings (Figure 4A-C). Immunohistochemistry (IHC) of the left breast showed that cancer cells were positive for estrogen receptor (ER), progesterone receptor (PR), and HER2 (2+) (Figure 5A); fluorescence in situ hybridization (FISH) revealed m17 (Figure 5C); and the Ki-67 proliferation index was 20%, with similar IHC and FISH results obtained for the right breast mass (Figure 5B, D). The pathologic diagnosis was locally advanced, stage IIIA cancer (cT3N1M0) in the left breast and stage IA cancer (cT1N0M0) in the right breast. The patient received neoadjuvant chemotherapy consisting of docetaxel (120 mg), epirubicin (140 mg), and cyclophosphamide (800 mg) every 21 days for 6 cycles.\nDuring the treatment course, the size of the tumor decreased significantly as a result of neoadjuvant chemotherapy as determined by physical examination, US, and breast MRI (Figures 1-3, 4D-F), and there were no severe adverse effects. We recommended mastectomy on the left side with immediate breast reconstruction but this was rejected by the patient, who instead elected to undergo left-side modified radical mastectomy, right breast-conserving surgery, and right sentinel lymph node biopsy. The results of pathologic analysis of the left breast mass were consistent with chemotherapy-associated changes in IMPC, which occupied a large area and could not be evaluated in terms of size. Dissected left axillary lymph nodes showed 12 of 16 signs of metastasis. The left breast mass was positive for ER, PR, HER2 (2+), Ki-67 (20%), and epithelial membrane antigen (EMA) by IHC. The right-side lesion was determined as multifocal IMPC (0.5-2 mm in diameter). There was no metastasis in the sentinel lymph nodes. The right breast mass was positive for ER, PR, HER2 (2+), and EMA by IHC, and the Ki-67 proliferation index was 10%. FISH confirmed m17 on both sides. Postoperatively, the patient received radiation therapy and ovarian function suppression plus aromatase inhibitor therapy but refused trastuzumab treatment. At the 30-month follow-up, the patient was still alive and there was no evidence of metastasis (Figure 6).",
"gender": "Female"
}
] |
PMC7342458
|
[
{
"age": 30,
"case_id": "PMC9057225_01",
"case_text": "A 30-year-old multigravida (g3p2, repeated cesarean section) 32-weeks pregnant patient reported to the emergency service at 10 PM with complaints of chills, cough and shortness of breath that started 6 days ago. She had no medical history and her previous pregnancies had normal processes. There has never been a COVID-19 vaccine. Her respiratory rate was 26/min, blood pressure was 110/75 mm Hg, oxygen-free saturation was 84%, and body temperature was 38.8 C. There was no uterine activity.\nInitial laboratory examinations of the patient in the emergency room revealed lymphopenia, elevated liver enzymes, low platelets, increased Prothrombin Time (PT/INR) and activated Partial Thromboplastin Time (aPTT), high D-dimer, high total bilirubin, and high LDH; hemoglobin and kidney function tests were normal. The patient's laboratory findings were evaluated as compatible with HELLP syndrome (Table 1). Gynecological examination by obstetrician (no uterine tenderness, no foul-smelling discharge, no amniotic discharge in speculum examination and ponding test), Ultrasound findings (head presentation, fetal heart rate: 145/min, amniotic fluid volume normal, biparietal diameter normal, placenta anterior) and NST findings (no reactive contraction) were normal. With these findings, the patient was admitted to the 3rd level intensive care unit reserved for COVID-19 patients, with preliminary diagnoses of COVID-19, sepsis and HELLP syndrome. \nIn the intensive care follow-up, the patient accepted the tomography recommendation, and bilateral diffuse ground glass areas, diffuse peripheral interstitial thickening and bilateral mild pleural effusion were found in the thorax CT examination, and these findings were reported to be compatible with viral pneumonia (COVID-19) (Figure 1). Immediately after this, the oropharyngeal swab sample obtained for the COVID-19 polymerase chain reaction (PCR) test was positive. Also, hepatitis markers studied and HIV test were negative. There was no growth in the blood and urine cultures taken on the first day. Serum electrolytes (Na, K, Cl, Ca, P, Mg) and cardiac markers (Troponin I, CKMB) were normal. Anti-Covid treatment (Lopinavir/Ritonavir, Hydroxychloroquine) was started upon the recommendation of the infection specialist, after obtaining the patient's written consent.\nThe patient became hypertensive (blood pressure value >=185/120 in consecutive measurements) at the end of the second day of hospitalization. Pregnant patient's oxygen-free saturation dropped below 80% and a change in consciousness level developed. The patient was intubated in this condition. Obstetrician was consulted again to evaluate the possibility of termination of pregnancy, but they decided to operate the patient if hemodynamic stabilization was achieved. Our pregnant patient did not have risk factors for preeclampsia such as twin pregnancy and first pregnancy. However, hypertension developed. Therefore, the patient was started on antihypertensive treatment (sodium nitroprusside) and magnesium sulfate for seizure prophylaxis upon the recommendation of the obstetricians.\nHaptoglobin studied on the 2nd day of hospitalization was 21 mg/dl, Reticulocyte Count was 98,109/L, Corrected Reticulocyte Percentage (Ret% xHCT /45) was 2.93 and direct COOMBS test was negative. Abdominal USG was evaluated as normal (liver size, parenchyma echo was normal) and there was no acute fatty liver of pregnancy. In addition, Anti Ds DNA studied for differential diagnosis of HELLP Syndrome, IFT (5.88 IU/mL), Lupus anticoagulant/confirmation test (31.6 sec), Anti-nuclear Antibody (FANA) (IFA), Anti Cardiolipin IgG (5.6 GPL-U/ mL) was found to be negative on the 3rd day of hospitalization. In addition to these, thyroid function tests, vit-B, folic acid levels, Brucella Agglutination (Rose Bengal), lipase, urine microscopy and culture were also normal.\nHowever, in the echocardiography performed on the 3rd day of the intensive care follow-up, segmental wall motion defects were detected and myocarditis was considered in the forefront by the cardiologist in the patient who developed concurrent troponin and CRP elevations. For the patient who was consulted again with the obstetrics and gynecology department on the same day (day three) (due to a progressive deterioration in maternal oxygen saturation, progressive deterioration in the blood picture despite platelet, FFP, fibrinogen replacement, a deterioration parallel to the pregnant's baseline low in the NST follow-up of the fetus and in order to protect the fetus from hypoxic damage as much as possible), cesarean delivery was recommended. Thereupon, the patient was given preoperative two units of erythrocyte suspension, five units of platelet, two units of fresh frozen plasma transfusion with the recommendation of internal medicine physicians, and a singleton live baby boy via CS with Apgar scores of two and six was delivered on the third day of her hospitalization. Following delivery, the general condition and vital signs of the newborn deteriorated rapidly and he was intubated. Chest X-ray was normal, but the fetus was confirmed to be positive for COVID-19. Pancytopenia and renal failure developed on the 2nd day of intensive care hospitalization. The newborn died on the 5th postnatal day.\nDuring the intensive care treatment, fluid, electrolyte, blood and blood products resuscitation, antihypertensive treatment, magnesium sulfate, antibiotherapy, hemodialysis due to anuria continued to be applied, however, the general condition of the patient gradually deteriorated. Brain MRI examination performed on the 9th day of her hospitalization revealed normal brain MRI findings. However, many attempts to extubate the patient were unsuccessful, and unfortunately the mother patient died on the 10th day of her hospitalization. This case belongs to a research proposal with ethical approval code of Mogadishu Somalia Recep Tayyip Erdogan Training and Research Hospital institutional Medical Ethics Committee (MSTH/8135).",
"gender": "Female"
}
] |
PMC9057225
|
[
{
"age": 60,
"case_id": "PMC7262434_01",
"case_text": "A 60-year-old male with a history of arterial hypertension visited the emergency department of the University Hospital Bratislava complaining of fever, chills, malaise, fatigue, anorexia and left flank pain. His illness started 16 days ago with abrupt onset of chills, nausea, vomiting and diarrhea. The vomiting and diarrhoea subsided after 5 days but the chills and malaise remained. Therefore, his general practitioner treated him with amoxicillin-clavulanic acid (825/125 mg bid) for 7 days. Despite antimicrobial treatment, the malaise and fatigue worsened and a fever up to 40 C developed. He also developed left flank pain and hematuria, and the diarrhea reappeared. At the emergency department, the patient presented with signs and symptoms of sepsis. He was febrile (38.5 Celsius), hypotensive (arterial pressure of 90/50 mmHg), tachypneic (26 breaths per minute) and tachycardic (135 beats per minute). Abdominal ultrasound revealed an enlarged left kidney. In laboratory screening, there was significant leukocytosis (17 280 cells/mL) with neutrophilia (15 260 cells/ml), elevated C-reactive protein (CRP: 388.38 mg/L), procalcitonin (10.61 ng/mL), creatinine (2.68 mg/dL) and urea (45.93 mg/dL).\nThe patient was diagnosed with pyelonephritis and sepsis and admitted to the intensive care unit of the Department of Infectology and Geographical Medicine of the University Hospital Bratislava. He was treated with parenteral fluids and antimicrobial therapy (cefotaxime, 2 g tid). Blood and urine culture revealed Salmonella enterica, serovar Enteritidis resistant to cefuroxime, ciprofloxacin, gentamicin and amikacin and susceptible to ampicillin (MIC 1 mug/mL), cefotaxime (MIC 0.25 mug/mL), meropenem (MIC 0.12 mug/mL) and trimethoprim/sulfamethoxazol (MIC 0.12). Screening for Clostridioides difficile also revealed positive antigen and toxin in stool. Trimethoprim/sulfamethoxazole 960 mg every 24 hours and oral vancomycin 125 mg every 6 hours was added to therapy. In order to screen for other possible extraintestinal sites of infection, transthoracic echocardiography and native computed tomography (CT) of the abdomen were performed. Echocardiography was unremarkable and CT revealed just discrete inflammatory changes of fat around the left kidney. However, intravenous contrast was not used because of the high risk of contrast-induced nephropathy. The patient was treated with a combination of parenteral cefotaxime and trimethoprim/sulfamethoxazole for 10 days and discharged on his own request. He continued on oral trimethoprim/sulfamethoxazole and was recommended to continue therapy until the next outpatient visit. Five days after discharge he arbitrarily stopped the antimicrobial therapy.\nThree days after discontinuing antimicrobial treatment, the patient visited the emergency department again. He was suffering from progressive weakness, night sweating and dull pain in the lumbar and sacral region. Laboratory screening revealed only elevated CRP (66.33 mg/L). Physical examination and abdominal ultrasound were unremarkable. The patient was admitted and therapy was started with 2 g of parenteral ceftriaxone every 24 hours and 125 mg of oral vancomycin once daily as a prophylaxis for Clostridioides difficile infection recurrence. Follow up blood culture revealed Salmonella enterica, serovar Enteritidis with the same antibiotic susceptibility profile. Because of suspicion of vertebral osteomyelitis magnetic resonance imaging of the lumbar spine was performed, which showed no vertebral affection but revealed dilatation of the infrarenal part of the abdominal aorta. Therefore, a contrast CT of the abdomen was performed, which revealed a fusiform aneurysm of the abdominal aorta ranging from offset of renal arteries to bifurcation. The aneurysm was 36 mm at its largest diameter and was partially obliterated with dense thrombus. CT also revealed aneurysm of the left internal iliac artery, saccular in shape and 25 mm at its largest diameter, compressing the left ureter, which was dilated, and the left kidney showed signs of grade 2 hydronephrosis. Vascular surgeons were consulted but they recommended conservative therapy due to the relatively small diameter of the aneurysm. The patient was treated with ceftriaxone for 30 days. CT follow-up showed progression of the aneurysm diameter to 36 mm. The infrarenal aorta was recanalized without any signs of progression in the aneurysm diameter. Therefore, the patient underwent surgery with ligation of the left internal iliac artery and partial extirpation of the aneurysm. Total extirpation was not possible because of tight adhesions between the aneurysm and the left ureter. Aneurysm of the abdominal aorta was left intact. A histologic examination of an extirpated material revealed nonspecific inflammation of arterial wall and all cultures were sterile. Then the patient was treated for another 14 days with parenteral antimicrobial therapy. CT follow-up showed complete obliteration of the residual aneurysm of the left internal iliac artery. The patient was discharged and continued oral therapy with trimethoprim/sulfamethoxazole (960 mg bid) for the next 7 days until normalization of the CRP level. At a 3-month follow-up, the patient was completely asymptomatic and the CRP level remained in the reference range.",
"gender": "Male"
}
] |
PMC7262434
|
[
{
"age": 20,
"case_id": "PMC8243003_01",
"case_text": "The patient is a 20-year-old man with no significant past medical history who presented to the emergency department with an 8-day history of systemic complaints. He had initially presented to an outside hospital 4 days prior with similar complaints and was treated for a presumed viral infection. He reported sore throat, chest pain, episodes of non-bilious, non-bloody emesis, and diarrhea. He lived at home and denied sick contacts or recent dental work.\nIn the emergency department (ED) the patient was febrile and hypotensive with systolic pressures in the 70 s-80 s mm Hg that did not respond to fluid resuscitation. Physical exam was pertinent for hepatosplenomegaly and tenderness over the right upper quadrant; no rash was present. Labs can be found in Table 1. He was pan-cultured (blood cultures at this time included only an aerobic bottle; anaerobic bottle was collected on day 3 of hospitalization) and was started on vancomycin, cefepime, and vasopressors. Computed tomography (CT) scan of the chest showed diffuse ground-glass attenuation and consolidation in both lungs consistent with multifocal pneumonia (Fig. 1) and a transthoracic echocardiogram (TTE) showed ejection fraction of 51 % and no vegetations. Septic emboli were considered less likely due to lack of cavitation.\nInfectious disease was consulted to assist in ascertaining the etiology of this pneumonia. Preliminary blood cultures grew gram-positive cocci in chains. Antimicrobials were adjusted to ceftriaxone, vancomycin, and clindamycin added to inhibit toxin production due to suspicion for streptococcal toxic shock syndrome.\nIn the following days the patient's blood pressure and leukocytosis improved. (Table 1). Throat and aerobic blood cultures grew beta-hemolytic group C streptococcus and vancomycin was discontinued. Repeat blood cultures were negative, and the patient defervesced. Due to the patient's initial presentation of group C streptococcus throat infection and septic shock due to toxic shock syndrome, the patient was directed to complete a 14-day course of intravenous (IV) ceftriaxone after discharge.\nOne day after discharge, final blood cultures from the hospitalization grew Fusobacterium necrophorum in the anaerobic bottle. Clinic follow-up was planned, but the patient returned to the ED four days after discharge due to new-onset fever, neck pain, and shortness of breath for one day. In the ED, he was febrile with otherwise stable vitals. Examination was significant for anterior neck tenderness. Labs can be found in Table 1. Repeat CT chest showed decreased opacities in the bilateral lungs and new cavitary lesions suspicious for septic emboli Figure 2 . CT neck revealed a filling defect in the right internal jugular vein (IJV) Figure 3 Metronidazole was added to the patient's IV ceftriaxone for coverage of the Fusobacterium.\nAnticoagulation was held as septic emboli were stable, and the patient defervesced with antimicrobial therapy. During admission, the patient remained afebrile and had improvement of his symptoms; his lab values also improved (Table 1). Blood cultures remained negative. The patient was discharged with a peripherally inserted central catheter (PICC) line to continue IV ceftriaxone and oral metronidazole for 4-6 weeks.",
"gender": "Male"
}
] |
PMC8243003
|
[
{
"age": 13,
"case_id": "PMC7508690_01",
"case_text": "A 13-year-old boy arrived via a 'hot' helicopter retrieval to a regional adult hospital in Far North Queensland, Australia, following a high-speed motor vehicle accident. The patient was a back-seat passenger in a car versus truck head-on collision at 80 km/hour. There was significant cabin intrusion requiring extrication by retrieval services. The hospital received early notification and he was resuscitated en route. On arrival to the emergency department, the patient was peripherally shut down and hemodynamically unstable with a systolic blood pressure of 85 mmHg and a heart rate of 120 bpm despite fluid resuscitation. His abdomen was soft with generalised tenderness, maximally epigastrium, with minor bruising. His examination did not otherwise reveal any penetrating injuries or external trauma. A FAST scan was positive for fluid in the right upper quadrant and a poor-quality pelvic x-ray showed potential open book pelvic fracture. His haemodynamics deteriorated and he remained unresponsive to fluids so, a decision was made for red blanket trauma laparotomy.\nOnce anaesthetized, screening was done which showed no fractures. On entering the abdominal cavity, there was moderate haemoperitoneum with active bleeding from the hilum of the spleen. A large upper abdominal central haematoma was found extending to the right over the right kidney.\nUpon full mobilisation of the right colon and kocherisation of the duodenum, 90% circumferential disruption of the 3rd part of the duodenum was evident, with 3 cm of ischaemic duodenum distal to the laceration. Brisk venous bleeding obscured the anatomy and was controlled with digital pressure. In the setting of progressive haemodynamic shock, with a drop systolic blood pressure 22 mmHg, the supracoeliac aorta was cross-clamped to increase proximal perfusion. The bleeding vein was then identified as the superior mesenteric vein with two injuries just inferior to the confluence of the splenic vein. Distal and proximal control of the vein were achieved and a primary repair with 6-0 prolene sutures was performed.\nSlow removal of the supracoeliac aorta clamps began 21 min after cross-clamping. Small bleeding vessels in the hilum of the spleen were clipped with Liga clips. Once vascular control was achieved, the remaining duodenum was mobilized and explored. Throughout the operation the patient was acidotic at pH 7.1, hypothermic with a temperature of 36 C, and persistently hypotensive systolic blood pressure of 70 mmHg. He remained too unstable for repair and removal of his ischaemic duodenum. As such, devitalized tissue was used to close the abdomen to prevent contamination. A surgical drain was placed in-situ with a VAC dressing.\nA post-operative computed tomography (CT) pan scan revealed the extent of his injuries. CT head and CT angiogram of the neck were normal. CT chest showed a large left pleural effusion, with multiple bilateral pulmonary contusions and an associated small right pneumothorax. There was an extensive laceration to the liver involving segments 6 and segment 7, however, there was no arterial blush to indicate a significant active bleed. There was a contusion of the spleen at the lower pole, in association with a subcapsular hematoma. Both kidneys showed extensive irregular contusions. Post-operatively the patient went to the intensive care unit for stabilization and monitoring. He was then transferred to a tertiary pediatric centre for ongoing management by a specialist team. He underwent planned re-look laparotomy two days later, and a betadine test of the duodenal repair showed a small defect that was closed with 4-0 PDS sutures and an omental patch. The inferior pole of the spleen was ischaemic and required partial splenectomy. There was a left sided diaphragmatic defect with a 10 cm intercostal defect that was also repaired and closed. No other bleeding or injuries were identified. Ultimately, the patient was able to be discharged home where he could begin rehabilitation and make a full recovery (Fig. 1, Fig. 2, Fig. 3).",
"gender": "Male"
}
] |
PMC7508690
|
[
{
"age": 46,
"case_id": "PMC3121312_01",
"case_text": "A 46-year-old man visited the emergency department with pain and blurry vision in the right eye after blunt ocular trauma. Uncorrected visual acuities were 20/30 OD and 20/25 OS. External examination showed periorbital ecchymosis and laceration. Pupil examination results were normal with relative afferent pupillary defect. Intraocular pressures were 14 mm Hg OD and 13 mm Hg OS. Slitlamp examination revealed a subconjunctival hemorrhage in the right eye. Orbital computed tomography demonstrated fracture of the right inferior and medial orbital walls. Dilated examination of the right eye showed a central, annular area of opacification of the retina surrounding the fovea consistent with commotio retinae (Figure 1). Retinal imaging was performed using spectral-domain OCT (Cirrus HD-OCT, software version 3.0; Carl Zeiss Meditec, Dublin, California) and prototype hs-UHR-OCT.",
"gender": "Male"
}
] |
PMC3121312
|
[
{
"age": 69,
"case_id": "PMC6487139_01",
"case_text": "A 69-year-old lady was admitted to the acute medical unit with a several-month history of progressive, exertional breathlessness and atypical chest pain. Cardiac risk factors were hypertension, hyperlipidaemia, and a positive family history of ischaemic heart disease. Drug therapy on admission was simvastatin and amlodipine.\nClinical examination revealed a grade 3 pansystolic murmur radiating to the apex, with no signs of cardiac failure, organomegaly, or lymphadenopathy. The pulse was regular at 81 bpm, BP was 119/90 mmHg, and oxygen saturations were 100% on room air. EKG demonstrated sinus rhythm with fixed, lateral T-wave inversion and ST depression. Serial troponin-Is were 44, 44, and 31 ng/L (normal range: 0-14). Haematology and blood biochemistry were normal including d-dimer, liver function tests, and serum amylase. Chest X-ray demonstrated normal lung fields; however, subtle intracardiac calcification within the cardiac silhouette was visible and comparable to a radiograph in 2015.\nA transthoracic echocardiogram (echo) demonstrated mobile valve leaflets with an echo-bright structure in the region of the posterior mitral annulus suggestive of calcification. However, views were limited due to poor echogenicity with incomplete visualisation of the myocardium. A transoesophageal echocardiogram (TOE) revealed a heavily calcified mitral annulus but no mitral stenosis. A bidirectional jet of moderate mitral regurgitation (MR) was noted secondary to extensive mitral annular calcification (MAC) with tethering of the leaflet tips, particularly the anterior mitral valve leaflet. No other valvular heart disease was present, and the left ventricle (LV) retained good contractility throughout with overall normal function.\nA CT coronary angiogram (CTCA) (Siemens' SOMATOM Definition Flash CT) showed extensive MAC which infiltrated the left ventricular myocardium resulting in widespread intramyocardial calcification, predominantly in the septum and anterior wall and also in the apex and apical lateral wall (Figure 1). Maximal septal LV wall thickness measured 28 mm and similarly around the infiltrative lesions. The calcified lesions were heterogenous in appearance and extended from the mitral annulus. The external layer of the lesions was calcific, whilst the internal portion was of a heterogenous lower density signal, suggesting caseation. The myocardium contracted normally around the lesions with the estimated ejection fraction of 57%. Calcification of the coronary arteries was apparent with moderate mid-left anterior descending artery (LAD) disease and moderate stenosis of the proximal first diagonal vessel. Thoracic CT screening for extracardiac calcification and carcinoma was unremarkable.\nDue to the extent of the intramyocardial calcification, we sought to determine the aetiology and screen for metabolic disease. Serum calcium, phosphate, and eGFR were normal. PTH levels were slightly raised at 8.6 pmol/L (normal range: 1.3-7.3); the vitamin D level was low at 21 nmol/L (normal range: 100-200) indicating vitamin D deficiency. Hb was 119 g/L (normal: 120-160) with negative haemolytic and haematinic screenings. Lipid profile revealed a triglyceride level of 5.0 mmol/L (normal: 0.12-2.10) and HDL of 0.99 mmol/L (normal: 1.2-1.8) with the total cholesterol measuring 5.7 mmol/L. There was an isolated raised bilirubin of 38 microm/L (range: 0-17), but the direct Coombs test and haptoglobin levels did not suggest haemolytic anaemia. Autoantibody screens (immunoglobulins, ANA, ANCA, dsDNA) were negative. Serum iron levels were slightly low; however, the total iron binding capacity was normal. Serum ACE levels were 24 U/L (normal: 8-52). Abdominal ultrasound confirmed fatty liver infiltration. Tuberculosis exposure was excluded through careful history taking and supported with a negative acid-fast bacilli sputum sample.\nAlthough still experiencing exertional breathlessness, the patient's symptoms improved with low-dose furosemide, and given the presence of coronary artery disease on CTCA, she was discharged with dual antiplatelet therapy added to her current medication regimen.\nCardiac MRI was performed (Figure 2), and similar to the CT, this showed extensive calcification extending into the myocardium from the mitral valve annulus, evidenced by the absent signal on T1- and T2-weighted imaging. The lesions enhanced on late gadolinium imaging suggesting the presence of an extracellular matrix within the calcium, but they were not encased entirely by calcium and were in communication with the surrounding myocardium. The findings were consistent with an aggressive caseating, calcific process extending into the left ventricular myocardium from the mitral valve annulus. The infiltrated myocardium was thickened with reduced contractility, whilst the noninfiltrated myocardium contracted well and compensated to maintain an overall normal left ventricular ejection fraction.\nCoronary angiography showed moderate mid and distal LAD disease, in addition to severe distal posterior descending artery (PDA) disease (Figure 3); this was not felt sufficient to explain the aetiology of her breathlessness.\nPET CT was requested to further examine the calcified lesions within the myocardium and evaluate for metastatic calcific phenomenon. This scan demonstrated no abnormal uptake nor metabolic activity outside of the heart, therefore providing reassurance for our patient with exclusion of metastatic infiltrative disease. Interestingly, there was some evidence of metabolic activity around the calcified lesions within the heart; however, it is uncertain whether this represents an active disease process or the chronic inflammatory process described in the caseating tissue.\nGiven her symptomatic improvement and normal left ventricular function, ongoing surveillance was arranged with interval scanning.",
"gender": "Female"
}
] |
PMC6487139
|
[
{
"age": 56,
"case_id": "PMC7192281_01",
"case_text": "A 56 year old male incidentally is diagnosed on thorax CT (Fig. 1) who consulted to thorax disease clinic with coughing complaint for a month. When he was scanned with thorax CT, a giant liver hemangioma was seen at the lower images, which were about 30 cm. He was directed for consultation to our clinic. In our examination, we palpated a mass which lies from under the right subcostal to the paraumbilical area. We screened the mass with the US and MRI (Fig. 1).\nWe diagnosed the 30 cm giant hemangioma originating from the sol hepatic lobe and very close to the gallbladder. He showed no symptoms about this situation. We decided to operate after we tried embolization, which was unsuccessful because of technical difficulty. All of the complications about the surgical procedure, including death were explained, and patients' consent for surgical procedure, was obtained. On admission, patients' all laboratory parameters were normal except platelet level, which was 132x103. We prepared blood suspensions for transfusion (such as erythrocyte, thrombocyte susp). During the operation, we made chevron incision. When we entered the abdomen, we saw a cavernous mass which covered 2/3 of the abdominal cavity. We elevated a mass to reach to hepatoduodenal ligament. There was no invasion. Then, we performed left hepatectomy within 25 minutes (Fig. 2). After resection, we made hemorrhage control, and the raw surface of the liver was checked for bile leaks and the omentum was placed over the free surface; a silicone drain was placed to allow postoperative bile leakage and hemorrhaging to be monitored. After four days, the patient was discharged, and no complication was observed. The pathological result came as cavernous hemangioma (Fig. 2).",
"gender": "Male"
}
] |
PMC7192281
|
[
{
"age": 18,
"case_id": "PMC4193390_01",
"case_text": "In October, 2013, an 18-year-old African American young woman diagnosed in August of that year with SLE presented to a community hospital complaining of headache, neck and back pain for five days, and vomiting with non-bloody diarrhea for one day. Additionally, she reported right-sided weakness. Six weeks prior to this presentation, she met the criteria for a diagnosis of SLE with arthritis, a photosensitive malar rash, and serum serology positivity for anti-nuclear antibodies (1:5120) as well as anti-double stranded DNA and anti-ribonuclear protein antibodies. A regimen of oral prednisone (10 mg twice daily) and hydroxychloroquine (200 mg twice daily) was begun. In the weeks subsequent to the diagnosis and treatment of SLE, and prior to her hospitalization, the patient had a positive home pregnancy test, which was followed by an unusually heavy menstrual cycle and presumed spontaneous abortion. The patient did not seek medical attention, and therefore no uterine manipulation or evacuation was performed. The patient's family history is significant for a maternal aunt and paternal cousin with SLE, and a maternal great-uncle who died from Libman-Sacks endocarditis.\nAt the time of the acute presentation, she was febrile to 38.9 C, oriented to self only, and had positive Kernig and Brudzinski signs. A computed tomography scan of the head revealed an extra-axial fluid collection in the right frontotemporal region, with a mild local mass effect, but no midline shift and normal ventricles. Intravenous vancomycin and ceftriaxone were initiated and the patient was transferred to our institution.\nOn arrival to our pediatric intensive care unit, the patient's temperature was 38.8 C, blood pressure was 145/76 mmHg, heart rate was 70 beats per minute, respiratory rate was 22 breaths per minute, and oxygen saturation was 100% on room air. She was drowsy and irritable when aroused, complaining of continued severe headache and neck pain. Neurological exam was significant for photophobia and meningismus. The remainder of the neurological exam and the ocular exam were normal. Analysis of the cerebrospinal fluid (CSF) revealed 1525 white blood cells/microL (91% neutrophils), 65 red blood cells/microL, 252 mg/dL protein, and 56 mg/dL glucose. An MRI of the brain with and without contrast revealed a moderately sized extra-axial effusion with secondary inflammatory response ( Figure 1 and Figure 2) and punctate diffusion abnormalities within the dependent portion of the lateral ventricles, consistent with pus or debris. The CSF culture was negative for bacteria, likely secondary to receipt of antibiotics prior to sampling, but the blood culture prior to antibiotic receipt grew GBS. Antibiotic susceptibility testing was not performed. CSF studies for other pathogens, including cryptococcal antigen, detection of herpes simplex and varicella viruses by PCR, and specific cultures for acid-fast bacilli and fungi, were negative. Upon identification of GBS, vancomycin and ceftriaxone were discontinued, and treatment was continued with intravenous penicillin G (4,000,000 units every 4 hours) for two weeks. The patient showed rapid improvement on antibiotic therapy and had resolution of all neurologic symptoms within one week of admission. She was discharged to receive intravenous ceftriaxone for one additional week at home.\nNotably, the patient's SLE was severely active during the course of this acute illness. Initial laboratory results at our institution demonstrated anti-Smith, anti-Ro and anti-La antibodies. She also had severe hypocomplementemia, doubling of serum creatinine, and nephrotic range proteinuria as assessed by 24-hour urine collection. Subsequent kidney biopsy demonstrated class V lupus nephritis. Induction therapy with intravenous methylprednisolone was started, which was then changed to oral prednisone (30 mg twice daily), mycophenolate mofetil (1000 mg twice daily), and hydroxychloroquine (400 mg once daily). Her serologically active SLE began to improve after her course of methylprednisolone, but was still active at the time of discharge.",
"gender": "Female"
}
] |
PMC4193390
|
[
{
"age": 58,
"case_id": "PMC4558288_01",
"case_text": "A 58-year-old-woman presented to clinic with a 4-month history of a lump in her right breast close to the axilla. There was no history of nipple discharge or any skin changes. Her most recent screening mammogram was unremarkable and had been performed approximately 2 years and 6 months prior to presentation. There was no family history of breast or ovarian cancer. On examination, a firm non-tender mass measuring 2x2 cm was noted in the right upper quadrant of the breast and the axillary tail, which was not attached to the underlying structures. Mammography revealed a dense irregular mass in the axillary tail and a circumscribed nodule in the 6 O'clock periareolar region. An asymmetric density was also seen in the central right breast. There was no evidence of axillary lymphadenopathy. Ultrasound demonstrated a lobulated solid mass in the axillary tail measuring 2.2x1.8x1.5 cm, and a simple cyst measuring 1.1x0.8x0.7 cm in the peri-areolar region at 6 O'clock. Normal appearing lymph nodes were seen in the right axilla.\nFine needle aspiration cytology of the right breast axillary tail revealed a poorly differentiated invasive carcinoma consistent with mammary duct origin. Biopsy of the areolar region of the right breast revealed a typical duct hyperplasia in a background of dense stromal fibrosis. The patient underwent right-sided total mastectomy with sentinel lymph node biopsy.\nOn histopathological examination, the specimen revealed a tumor measuring 2.6 cm in greatest dimension, with resection margins negative for tumor. Skin and nipple were negative for tumor. It was an infiltrating ductal carcinoma with metaplastic features of chondroid differentiation (Figs. 1 and 2). The tumor was estrogen receptor (ER), progesterone receptor (PR), and HER-2 negative with 0% nuclear staining. Immunohistochemical stains for pan cytokeratin on the sentinel lymph nodes were negative. Tumor cells showed some degree of anisocytosis with a nuclear pleomorphism score of 3, and mitotic figures in tumor cells were frequent with an average of eight mitoses or more per square mm. The overall ELSTON grade of invasive carcinoma was grade 3. Ki-67 index was 52% with strong nuclear staining. Adjuvant chemotherapy with AC-T (Adriamycin, Cytoxan, and Taxol) was initiated. The patient tolerated chemotherapy well initially but developed taxol-induced sensory neuropathy leading to early discontinuation of taxol. She is currently undergoing surveillance with no evidence of recurrent disease.",
"gender": "Female"
}
] |
PMC4558288
|
[
{
"age": 79,
"case_id": "PMC5828340_01",
"case_text": "A 79-year-old right-handed female with lumbar spondylosis and chronic low back pain presented with a two-year, slowly progressive history of mild left hand resting tremor, stooped posture, generalized slowness, and fatigue. She reported a decline in her balance, though denied falls, and she was able to walk independently. She denied urinary symptoms, constipation, dysphagia, hypophonia, hyposmia, and symptoms of REM behavioral disorder. She denied cognitive or behavioral problems and denied previous exposure to neuroleptics, antiemetics, or head trauma. Her family history was noncontributory. Baseline examination revealed a pleasant woman with normal mental status who scored a 28/30 on the Montreal Cognitive Assessment (MoCA), with points missed for delayed recall. She displayed mild hypomimia with decreased blink rate. Myerson's sign was present, with no palmomental and no grasp reflex. Vertical saccades were slightly hypometric in both directions. There was a near-constant, low-frequency chin tremor. Her slow pill-rolling tremor of the left hand was unmasked by distraction and contralateral activation, and associated cogwheeling was appreciated in the ipsilateral wrist. There was slight rigidity affecting the left extremities and mild bilateral bradykinesia. Chair mobility was normal, and her gait notable for bilaterally diminished arm swing, affecting the left more than the right. Cadence, stride length, and ground clearance were slightly reduced. She had no FoG. She recovered from the pull test in 4 steps, yielding a UPDRS motor score of 21. The remainder of her physical examination was notable for bilateral, symmetrically reduced deep tendon reflexes in the lower limbs and a positive Romberg test. Electromyography and nerve conduction studies demonstrated a primarily sensory, large fiber peripheral neuropathy affecting both legs, with no evidence of radiculopathy, plexopathy, or myopathy. The patient was diagnosed with PD according to the United Kingdom Parkinson's Disease Society Brain Bank (UKPDSBB) criteria. She was started on rasagiline 1 mg once a day.\nSix months later, she reported occasional detailed visual hallucinations with retained insight and progressive decline in her hand dexterity. Her physical examination was unchanged. A brain MRI revealed mild prominence of the ventricular system and cortical sulci along with multiple foci of periventricular, subcortical, and brainstem T2/FLAIR hyperintensities, consistent with chronic nonspecific microvascular changes (Figure 1). Rasagiline was discontinued due to a lack of efficacy and the potential contribution to hallucinations. Carbidopa-levodopa 25-100 mg was initiated and gradually titrated up to one full tablet TID. After 6 months, the patient reported improvements in stiffness, general slowness, and tremor. Her UPDRS motor score on levodopa improved by 19% and hallucinations completely resolved.\nOver the following months, the patient experienced progressive gait deterioration with marked unsteadiness, particularly during transfers, with frequent falls and severe FoG. Near-falls began occurring daily, she was unable to walk unassisted when outdoors, and FoG episodes became disabling. She also reported increased urinary frequency, occasional urinary incontinence, mild forgetfulness affecting her short-term memory, and difficulties with word retrieval. Her mood significantly deteriorated, with increased apathy and pervasive sadness. On examination, her MoCA decreased to 22/30, with abnormal verbal recall, visuospatial function, executive function, and mental calculation. Her examination was notable for severe gait failure, with markedly decreased stride length and cadence, en bloc turns, freezing, and absent postural reflexes. Her gait failure was notably out of proportion to her otherwise stable appendicular signs. Carbidopa-levodopa was increased up to 1.5 tablets TID without benefit.\nIn considering the possibility of iNPH, we ordered a repeat brain MRI (Figure 1). The ventricular size was further increased and ventriculomegaly was out of proportion to sulcal enlargement. Confluent areas of T2 hyperintensity were detected in the periventricular white matter. On sagittal sections, a strong flow void was noted at the cerebral aqueduct (Figure 2). The patient underwent a large volume lumbar puncture (LP) with pre- and post-LP testing. Approximately 40 cc of clear CSF was withdrawn. Standard CSF analysis was unremarkable. Observation of gait after LP revealed improved velocity and uniformity of cadence relative to pre-LP baseline. There was a distinct improvement in the patient's ability to make 180 turns with no evidence of FoG. Video gait analysis was performed on a distance of 18 m with postprocessing of gait speed and stride length. Both parameters significantly improved compared to her pre-LP condition (Figure 3). Additionally, her post-LP neuropsychological assessment revealed significant improvement in Trail Making B (Table 1).\nGiven her response to LP, a ventricular-peritoneal (VP) shunt was placed without complications. Over the following weeks, she experienced a dramatic improvement in balance and walking. She was able to walk unassisted for long distances. Her functional independence, per the Schwab and England Activities of Daily Living scale, improved from 80% (doing most of daily chores takes twice as long) to 100% (completely independent, able to do all chores without slowness, difficulty, or impairment). Falls, near-falls, and her bladder symptoms ceased. UPDRS part II FoG item improved from 2 to 0. On examination, walking speed, stride length, and heel strike significantly increased, with resolution of FoG. Her pull test normalized. Gait profile and neuropsychological assessment were repeated according to the same baseline procedures approximately two and six months after shunt placement (Figure 3 and Table 1). On both postshunt assessments, video analysis showed a significant and sustained improvement in stride length and mean gait velocity. Neuropsychological assessment revealed a significant improvement in all measured outcomes, and her MoCA improved by 3 points. Improvements in gait and balance were sustained over one year of follow-up. Appendicular symptoms including bradykinesia, stiffness, and resting tremor persisted but were well controlled without adjustments in the patient's dopaminergic regimen.",
"gender": "Female"
}
] |
PMC5828340
|
[
{
"age": null,
"case_id": "PMC7498275_01",
"case_text": "A 64-year female, with a carcinoma of the left breast, underwent breast conservation surgery in 2002. Her histopathological examination (HPE) revealed intraductal carcinoma, grade 1 (pT1N0M0). The hormone receptor status was positive (ER+/PR+), while HER2 was negative. She further received loco-regional radiotherapy to the left breast. She was also given 5 years of hormone therapy with tamoxifen and was kept under regular follow up. In April 2019, she presented with rapidly progressing dyspnoea with poor Eastern Cooperative Oncology Group (ECOG) performance status (PS) 3.\nStaging positron emission tomography-computed tomography (PET-CT) was done which showed metabolically active lung disease (upper left lobe) and metabolically active nodular thickenings in the left mediastinal, diaphragmatic and coastal pleura along with metabolically active moderate left side pleural effusion (Figure 1). AN intercostal drainage tube was inserted and pleural fluid was sent for the analysis which showed presence of malignant cells. Pleural fluid cell block was tested with immunohistochemistry (IHC) to characterise the recurrence. They were positive for EMA, CK7 and negative for TTF1, GATA-3, CK20, PAX8, WT1 and Calretinin. However, occasional cells showed weak CDX2 positivity. CT guided pleural mass biopsy was performed which confirmed presence of adenocarcinoma. The tumour cells were diffusely positive for CK7, focally CDX2and GATA-3 while were negative for TTF-1, ER, PR, HER2 and CK20 (Figure 2a-d).\nThe pathological examination of both the pleural mass and the pleural fluid, favoured metastasis, with possible primary in the breast, gastrointestinal tract or lung. Normal clinical and radiological work up negated primary GI malignancy. Although negative IHC for TTF-1, calretinin and WT1 made primary lung and pleural involvement unlikely, a second primary in the lung could not be completely ruled out and was a remote possibility owing to the immunohistochemical pattern (ER negative, CK7+, CK20-) (Table 1) and long interval between the two malignancies. However, going by the patient's previous history, positive IHC for CK7, EMA, GATA-3, negative IHC for TTF-1 and after extensive discussions and review, a final diagnosis of MBC was considered.",
"gender": "Female"
},
{
"age": null,
"case_id": "PMC7498275_02",
"case_text": "She received one cycle of weekly paclitaxel 60 mg /m2 and carboplatin (AUC 1.5), however, the patient deteriorated with this standard chemotherapy. In view of poor PS and to have fair evidence to rule out primary lung carcinoma, reverse transcription polymerase chain reaction for EGFR was ordered which confirmed exon21 L861Q mutation positivity (Figure 3). The case was discussed in molecular tumour board and was started on erlotinib 150 mg daily dose on May 23, 2019 under close observation. She showed a quick response with symptomatic improvement in 2 weeks. The dyspnoea improved significantly and ECOG PS improved to 1. She was continued on the same drug and an assessment contrast enhanced computed tomography (CECT) scan was carried out on August, 14th, 2019 (after 3 months of starting the drug) which showed a partial response (Figure 4). She continued to be stable, with good general condition on erlotinib for 6 months when she progressed symptomatically as abdominal pain and dyspnoea on exertion. She developed rapidly progressive disease and succumbed to her illness on 20th December 2019.",
"gender": "Female"
}
] |
PMC7498275
|
[
{
"age": 73,
"case_id": "PMC4178053_01",
"case_text": "A 73-year-old patient, a professor of medicine, admitted himself to the Endoscopy Unit of the Specialist Hospital, Szczecin-Zdunowo to perform panendoscopy because of a suspected foreign body in ZD. Having woken up, the patient realised his denture was missing (of one tooth). He did not find it in his surroundings, which led to suspicion of swallowing. Neck and chest radiograph, performed on the patient's request, revealed on the first thoracic vertebra level, a triangle-shaped shadow with measurements 1.1 cm x 1.3 cm, intensely absorbing X-rays, which could correspond to the tooth (Figure 1). After oral contrast administration, oesophageal ZD was revealed, filled with contrast medium, with measurements 2.7 cm x 2.0 cm (Figure 2). The patient suffered from arterial hypertension, arrhythmia, and chronic coronary heart disease in the form of a previous myocardial infarction, chronically treated with inter alia angiotensin-converting-enzyme inhibitors and beta-blockers. Hoarseness and solid-food dysphagia had occurred periodically since June 2009. The symptoms did not cause a significant weight reduction nor had a relevant impact on daily functioning, and the patient linked them with heart disease and pharmacotherapy and was unaware of the occurrence of the diverticulum. In an endoscopic study (performed on the patient's request with no premedication) a small ZD and a foreign body present in its lumen were revealed: a single-tooth denture (Figure 3). A successful attempt to remove it using a Dormia basket was carried out (Figure 4). The course of the procedure was without complication. During the following 6-month follow-up the patient has not suffered from aggravation of symptoms and has not decided on definite treatment yet.",
"gender": "Male"
}
] |
PMC4178053
|
[
{
"age": 48,
"case_id": "PMC7700045_01",
"case_text": "A 48-year-old Moroccan woman presented with progressive, painless decreased vision in the left eye for 2 months. Her visual acuity was light perception in the left eye and 20/20 in the right one. Biomicroscopy of the left eye showed no conjunctival hyperemia, a clear cornea, and no inflammation in the anterior chamber. Intraocular pressure was normal. Fundus examination and fluorescein angiography of the left eye showed a retinal detachment (RD) with a large superior brownish mass (Figure 1). The right eye examination was unremarkable.\nB-scan ultrasonography of the left eye revealed a large choroidal dome-shaped mass, surrounded by subretinal fluid, with neither acoustic hollowing nor calcification (Figure 2). MRI of the orbits showed an intraocular tumor measuring 12 x 11 x 11mm, which displayed a high signal intensity on T1-weighted images, low signal intensity on T2, with a collar-button extension, and an enhancement on T1-weighted images after Gadolinium administration. This appearance was consistent with a choroidal melanoma. There was a scleral thickening and no evidence of extraocular tumor extension (Figure 3). Thoracoabdominal CT scan did not reveal any sign of metastasis. According to the results, this intraocular tumor was highly suggestive of a choroidal melanoma; an enucleation of the left eye was therefore indicated, with the patient's consent.\nThe histopathological study of the enucleated eye showed a brownish-black pigmented tumor arising from the choroid, composed of fusiform cells with brownish cytoplasm, elongated nuclei, and small nucleoli. No signs of necrosis or malignancy were found (Figure 4). Immunohistochemical analysis demonstrated a positive cytoplasmic reaction for S-100 protein and HMB-45 monoclonal antibody. These findings were consistent with a choroidal melanocytoma, not a melanoma.",
"gender": "Female"
}
] |
PMC7700045
|
[
{
"age": 24,
"case_id": "PMC3952285_01",
"case_text": "A 24-year-old male presented with a 15 days history of persistent swelling of upper lip that ulcerated 2 days ago. He denied any history of trauma, fever, cough, weight loss, and drug or tobacco usage and his past medical and dental history was non-contributory. The patient was thin built with normal vital signs. There was no lymphadenopathy. A diffuse, non-tender swelling of lower lip with mild eversion of the lip was present [Figure 1]. A reddish pink granular lesion involving the vermillion border, labial mucosa, floor of the mouth, and the mandibular anterior gingiva was seen. The lesion had patchy areas of brown crustation, bleeding and purulent discharge [Figure 2]. A provisional diagnosis of Chelitis granulomatosis was made with a differential diagnosis of Baelz disease, tuberculous granulomatosis, sarcoidosis, a deep mycosis, primary syphilis, leishmaniasis, Squamous cell carcinoma, and non-Hodgkin's lymphoma. Plain chest radiograph and complete hemogram were within normal range. Serologies for syphilis and Leishmania, Mantoux test, and Enzyme-linked immunosorbent assay (ELISA) for HIV gave a negative result. An incisional biopsy from the lesion was undertaken that revealed numerous necrotizing epitheloid granulomas with Langhans type giant cells. Ziehl-Neelsen staining showed multiple rods like acid fast bacilli, confirming the diagnosis of primary labial tuberculosis [Figures 3 and 4]. The patient was started on anti-Koch's therapy in consultation with the physician with culture report awaited. Culture report obtained after 6 weeks confirmed mycobacterium tuberculous infection. Anti-Koch's therapy administered in this case consisted of four drug regimen, that is, rifampicin, isoniazide, ethambutol, and pyrazinamide for 6 months. The patient was regularly followed-up for next 6 months. The lesions regressed significantly within 15 days of beginning of the therapy and healed completely within 2 months [Figure 5].",
"gender": "Male"
}
] |
PMC3952285
|
[
{
"age": 71,
"case_id": "PMC7725134_01",
"case_text": "The patient was a 71-year-old man with a history of diabetes, hypertension, and benign prostatic hyperplasia. Despite malaise for a few days, he was able to talk normally with his family just before taking a hot-water bath. However, 10 min later, he was found unconscious in the bath and was then brought to the emergency room (ER) in our hospital. At the ER, his vital signs were as follows: respiratory rate, 30 breaths/min; oxygen saturation, 96% on O2 2 L/min; blood pressure, 70/40 mmHg; heart rate, 150 b.p.m.; body temperature (BT), 40.1 C; and level of consciousness (as measured using the Glasgow Coma Scale), E1V1M1. There was no rash or other signs of skin burns. Initial laboratory testing was generally normal except for the slightly elevated C-reactive protein and creatinine (Table 1). Antigen testing of nasal swab was positive for influenza A. An HCT was normal (Fig. 1A). Taken together, we thought that he had heatstroke due to hot-water bathing associated with influenza A, and then administered fluid bolus and peramivir (300 mg), and also performed surface cooling. Two hours later, his consciousness slightly recovered to E2V2M3 without limb palsy. Other vital signs also improved, as follows: blood pressure, 110/70 mmHg; heart rate, 120 b.p.m.; and BT, 38.0 C. However, 24 h later, his consciousness remained the same despite his BT returning to normal (36.5 C). The laboratory data were now consistent with multiple organ dysfunction (Table 1). The second HCT showed abnormal hypodensity at both thalamus, cerebellum, and brain stem (Fig. 1B). Furthermore, the subsequently performed head MRI revealed the symmetrical high-density lesions in the same area, which indicated progressed ANE with severe edema, infarction, and necrosis (Fig. 2A,B). The patient died 30 h later after admission.",
"gender": "Male"
}
] |
PMC7725134
|
[
{
"age": 57,
"case_id": "PMC7337589_01",
"case_text": "The case describes a 57-year-old woman (weight: 68 kg; height: 1.6 m) who experienced menarche at age 11 years, menopause at 50 years, and was nulliparous. Relevant personal history included a total hysterectomy 2 years previously (55 years) with removal of the uterus and cervix due to atypical endometrial hyperplasia, and hypertension treated with enalapril 10 mg/day. Relevant family history included a sister with breast cancer and a father with myocardial infarction at age 74 years.\nAt age 51 years, the patient presented with dyspareunia. Her Vaginal Health Index score was 9/25. A diagnosis of VVA was confirmed by physical examination (Figure 1) and Pap smear. Consistent with the usual consequences of VVA, the patient complained of low sexual desire and arousal problems (Figure 2).\nIn the years since her diagnosis, the patient had been managing her symptoms using lubricants/moisturizers with or without phytotherapeutic agents (isoflavones), but further-line therapy was currently indicated. Local menopausal hormone therapy was suggested but she refused due to breast cancer concerns. In January 2018, treatment was initiated with ospemifene 60 mg/day. Six months later, her Vaginal Health Index score had improved from 9/25 to 16/25 and a Pap smear confirmed normal vaginal trophism.\nThe patient's lipid profiles immediately before starting treatment with ospemifene (baseline) and 6 months later are shown in Table 1. A total cholesterol concentration of 241 mg/dL at baseline (January 2018) indicated increased cardiovascular risk. Two months later (data not shown), total cholesterol and LDL-C were reduced, and HDL-C was similar, relative to baseline. By July 2018, further improvements in lipid parameters were observed. Compared with baseline, there were decreases of 11% in total cholesterol, 16% in LDL-C, and 15% in triglycerides. HDL-C was unchanged. As total cholesterol (214 mg/dL) was above the threshold (200 mg/dL), the patient's primary care physician initiated treatment with simvastatin 10 mg. At follow-up in February 2019, after approximately 13 months' treatment with ospemifene and 7 months' treatment with simvastatin, there were further improvements in her lipid profile.\nCoagulation indices were all within reference ranges at baseline and were not remeasured at 6 months. Homocysteine decreased by 23% from 20.4 mumol/L at baseline (reference range: 3.7-13.9 mumol/L) to 15.7 mumol/L after 6 months' treatment with ospemifene, although remained above the reference range.\nThe case describes a postmenopausal woman with persistent symptoms of VVA despite treatment with lubricants/moisturizers +- phytotherapeutic agents. Treatment with a local estrogen was refused. Ospemifene was selected based on the results of meta-analyses confirming its efficacy and safety in severe symptomatic VVA. Ospemifene's estrogen agonist activity in the vaginal epithelium led to its approval as the first non-hormonal, non-estrogenic drug for treatment of moderate-to-severe VVA in women unsuited to receive vaginal estrogen therapy. By regenerating vaginal cells and improving lubrication, ospemifene treats the underlying cause of vaginal dryness and dyspareunia. Most women notice symptom improvement within the first 4 weeks of treatment.\nIn our patient with dyslipidemia, ospemifene 60 mg/day for 13 months had no negative impact on lipid parameters or coagulation factors. Improvements in lipid parameters in the 6-month period before the start of simvastatin were likely attributable to ospemifene, and possibly also to dietary changes. A post hoc analysis of pooled data from 2166 postmenopausal women found no detrimental effects on serum lipid and coagulation parameters during treatment with ospemifene 60 mg/day for up to 12 months. In this analysis, mean increases from baseline in HDL-C were significantly greater with ospemifene than placebo at 3 months (4.4 versus 0.2%; p<0.0001), 6 months (5.1 versus 1.5%; p=0.0359), and 12 months (2.3 versus -1.9%; p=0.0086). Likewise, changes from baseline in LDL-C significantly favored ospemifene over placebo at 3 months (-5.2 versus 2.4%; p<0.0001), 6 months (-6.7 versus 2.4%; p=0.0002), and 12 months (-7.0 versus -2.1%; p=0.0293). A significant reduction from baseline in total cholesterol was observed with ospemifene at 6 months compared with placebo (-1.8 versus 1.6%; p=0.0345). Increases in triglycerides at 3, 6, and 12 months did not differ between ospemifene and placebo. In our patient, the improvements observed in total cholesterol (-11%), LDL-C (-16%), and triglycerides (-15%) during ospemifene treatment could potentially contribute to a reduction in long-term CVD risk.",
"gender": "Female"
}
] |
PMC7337589
|
[
{
"age": 17,
"case_id": "PMC7428957_01",
"case_text": "A 17-year-old girl was referred to our department for the investigation of a newly diagnosed diabetes mellitus and a severe arterial hypertension. She was the first child of consanguineous parents. Her past medical history was unremarkable. Her family history was notable for type 2 diabetes and dyslipidemia but no history of pheochromocytoma, paraganglioma, unexplained sudden death, or condition that may lead to thinking about VHL disease was reported.\nAs symptoms, the patient complained of headaches, palpitations, diaphoresis, and hot flashes since one month. She reported also asthenia and body weight loss of five kilograms in two weeks.\nOn examination, she had a body weight of 50 kg, a body height of 154 cm, a body mass index of 21.1 kg/m2, a blood pressure of 200/100 mmHg without orthostatic hypotension, a regular pulse of 120 bpm, and a large abdominal cafe-au-lait spot (Figure 1). Thyroid, abdominal, and neurological examinations were normal.\nTwenty-four-hour blood pressure monitoring confirmed the diagnosis of hypertension and the presence of peaks of 230/110 mmHg. Electrocardiogram showed a sinus tachycardia. Capillary glucose level was 2.68 g/l without ketosis.\nFundoscopy showed grade 3 hypertensive retinopathy without any other abnormalities.\nThe results of biological investigations are shown in Table 1.\nThe diagnosis of clinically suspected pheochromocytoma was confirmed by the dosage of urinary methoxylated derivatives at 5 times the upper limit of normal. In addition, the diagnosis of diabetes mellitus, dyslipidemia, and primary hyperparathyroidism were made.\nThe abdominal computed tomography (CT) showed two adrenal masses: the first on the right measuring 35 x 55 x 70 mm with a spontaneous density of 30 HU heterogeneously enhanced in the arterial time showing areas of necrosis with an absolute washout of 40%, the second on the left measuring 24 x 27 mm with the same characteristics as the first one (Figure 2). There were neither other localizations nor lymph nodes. Metaiodobenzylguanidine (MIBG) scintigraphy exhibited a high accumulation of the tracer in both adrenal tumors with no other localization. Cervical ultrasound and 99mTc-sestamibi scintigraphy were normal. Cardiac ultrasound was normal.\nThe diagnosis of multiple endocrine neoplasia type 2a was highly suspected, and the patient underwent a molecular investigation. DNA analysis did not find a RET proto-oncogene mutation. However, it showed a missense mutation c.191G > C (p.Arg64Pro) in exon 1 of the VHL gene on chromosome 3. The diagnosis of bilateral pheochromocytoma in the setting of VHL disease was established. Abdominal CT scan and craniospinal magnetic resonance imaging with contrast did not show any cysts or other tumors.\nThe patient was treated with an alpha blocker, prasozine, a calcium channel blocker, a beta blocker, and insulin at a daily dose of 1.4 units/kg. She underwent a bilateral adrenalectomy in two steps. The pathological examination confirmed bilateral adrenal pheochromocytomas. Replacement therapy with hydrocortisone was initiated after surgery.\nThe postoperative outcome was determined by the spontaneous normalization of blood pressure, blood glucose, calcium, and PTH levels. The patient remained asymptomatic with no evidence of local recurrence or distant metastasis during the 12 months of follow-up. The family screening for VHL has not been performed yet.",
"gender": "Female"
}
] |
PMC7428957
|
[
{
"age": 27,
"case_id": "PMC10225700_01",
"case_text": "Three female goalkeepers from the Canadian senior women's national water polo team took part in this study. They encompass 100% of the goalkeepers in the team. Participants' ages ranged between 23 and 27 years old and height ranged between 172 cm and 179 cm. All three had greater than five years of experience competing at the senior international level. Participants were first provided with information about the study and consented to participate. The experimental protocol was reviewed and approved by the McGill university IRB (study 01-M01-20A) in alignment with the Declaration of Helsinki.\nInternal loads were defined as session rating of perceived exertion (sRPE) by multiplying rating of perceived exertion (RPE, 0-10 scale) by the session duration in minutes. Data were collected daily after each training session (including water polo sessions, dryland sessions and combined water polo and dryland sessions) between May and August 2021, as part of the ongoing training load monitoring process of the Canadian senior women's national water polo team. The athletes logged their sRPE via an online platform available through their smartphones (Hexfit , Canada). Afterwards, entries were validated retrospectively by a staff member to identify aberrant durations or incorrect labelling of the training type. Only the sRPE data for water polo and combined sessions were used in the following analysis because IMU data were not collected during dryland sessions.\nTri-axial accelerations and angular velocities were measured with an IMU (Xsens Dot, Xsens Technologies, Enschede, Netherlands) placed on the lower back by a staff member prior to water polo sessions. The IMU signals were filtered and analyzed with a custom Matlab script (MathWorks, Natick, USA) to create training volume metrics according to previous methods from Clement et al.. These included overall player-load (summation of change of accelerations), high-intensity activity counts such as number of jumps and kicks, as well as an index score based on the weighted time spent in different intensity zones. The score is weighed so that a value of 100% would imply that 100% of the session was spent at high intensity.\nDuring the same period, the participants also recorded their pre-training resting HR using a Polar H10 chest strap connected to the Polar Beat application for smartphones via Bluetooth (Polar Electro, Finland). The participants further used a PUSH Pro Band 2.0 accelerometer connected to the PUSH application for smartphones via Bluetooth (Whoop Unite, Boston, USA) to record the peak velocities and estimate jump height during a dryland bout of three counter-movement jumps. These heart rate and jump measurements were collected and included in the same database as sRPE and IMU-metrics but were not included in the analysis due to the excessive missing data (see Discussion).\nDescriptive statistics characterize the range of values obtained for each of the variables under study. Statistical tests were performed to convey the direction of inference of the data, and 95% confidence intervals express the limitations in generalizability of this case study. Because of the non-normality of the data, relationships between sRPE and IMU-derived metrics were explored using Spearman's rank correlations, with values of 0-0.39 interpreted as weak, 0.4-0.69 as moderate, 0.7-0.89 as strong, and 0.9-1.0 as very strong associations. To assess the effect of athlete and session type on the measurements, we conducted a two-way ANOVA (athlete x session type) on the rank-transformed data of each self-reported and IMU metrics and performed Wilcoxon signed-rank tests in post-hoc analysis. Multivariate imputation by chained equations approach (MICE) was applied to account for missing sRPE data as it is both flexible and practical to this data scenario because the dataset for IMU variables is nearly complete. MICE parameters were set to five multiple imputations, 50 iterations and predictive mean matching (pmm) as the imputation method; the average of the five imputations was retained as the imputed dataset. The imputed dataset was used to explore the temporal changes in player-load and sRPE. Specifically, weekly sums for sRPE and player-load were compared using the original data and the imputed dataset. The complete statistical analysis was conducted in R with stats, DescTools and mice packages, whereas figures were generated with the package ggpubr. Statistical tests were computed using a significance level of alpha = 0.05.",
"gender": "Female"
}
] |
PMC10225700
|
[
{
"age": 45,
"case_id": "PMC4729428_01",
"case_text": "A 45-year-old man presented with headache for two days. He described the quality of headache as throbbing, and it was unilateral. There was no history of fever, vomiting, blurred vision, ear discharge or trauma, no relevant past medical or drug history and no family history of note. On examination, he was afebrile with pulse 76/min, regular, blood pressure of 130/80mmHg. His pupils and speech appeared normal. There were no papilledema, sensory deficit, focal neurological deficit or signs of meningeal irritation. Hyperdensity of right transverse sinus (Figure 1) and superior sagittal sinus was identified on unenhanced computed tomography (CT). Magnetic resonance venography (MRV) demonstrated lack of flow in right transverse sinus (Figure 2) and superior sagittal sinus.",
"gender": "Male"
}
] |
PMC4729428
|
[
{
"age": 23,
"case_id": "PMC10125812_01",
"case_text": "A 23-year-old Japanese woman was referred to our hospital with an elevation of transaminases in the absence of any significant abdominal symptoms. She had polycystic ovaries but no history of abdominal injuries, surgery, or severe pain. Her laboratory data are shown in Table. Abdominal ultrasonography revealed a fatty liver and detected a mass lesion in the spleen incidentally (Fig. 1). Within the splenic parenchyma, there was a well-defined spherical mass measuring 111x95 mm with iso-level internal echoes containing various sizes of anechoic area. There was no blood flow signal in the mass. Plain and contrast-enhanced abdominal CT showed a cystic, unilocular, homogeneous, and hypodense mass with wall calcifications. The internal structure did not seem to exist. On T1-WI of MRI, the mass had an inhomogeneous low signal intensity. T2-WI showed a heterogeneous high signal. Diffusion WI also showed a high signal that was still lower than that of the spleen parenchyma. Although CT showed pure cystic, US and MRI indicated the possibility of another kind of mass, such as lymphangioma, sclerosing angiomatoid nodular transformation, and lymphoma. Thus, after the administration of the pneumococcal vaccine, splenectomy was performed with laparoscopic approaches (Fig. 2) followed by autologous transplantation of normal spleen tissue into the abdominal cavity.\nPathological findings showed a splenic false cyst (Fig. 3) with a fibrotic wall (5-6 mm) lacking any epithelial elements, which was filled with liquefactive necrosis in the lumen.\nThe patient has provided her permission to publish these features of her case. The research ethics committee of the international university of health and welfare hospital approved this report for publication (NO. 21-B-56).",
"gender": "Female"
}
] |
PMC10125812
|
[
{
"age": 50,
"case_id": "PMC4954936_01",
"case_text": "A 50 year-old man presented to the emergency department with acute retrosternal pain and dyspnea after choking during ingestion of a meal of greens, followed by a forceful vomiting. He developed subcutaneous emphysema of the neck and chest with severe airway compromise and was intubated emergently. A CT scan revealed pneumomediastinum and a paraesophageal fluid collection above the esophagogastric junction (Fig. 1). He was transferred to the operating room where through a left posterolateral thoracotomy the esophagus was inspected but a rupture was not detected. Exploration of the subdiaphragmatic esophagus through a midline laparoscopy was also unremarkable. A small amount of purulent pleural effusion was drained and revealed high amylase levels (Table 1). Pleural fluid culture did not grow any microorganisms.\nAfter surgery, the patient was transferred to the ICU with signs of septic shock (fever, leukocytosis, tachycardia and hemodynamic instability). Although he was started on iv imipenem, vancomycin and metronidazole he remained febrile and hemodynamically unstable. On postoperative day 14 Clostridium subterminale was isolated from a blood culture and identified by Vitek 2 automated system (Biomerieux). A new CT scan of the chest showed an nonhomogeneous paraesophageal effusion (Fig. 2). Under CT guidance a diagnostic puncture of this effusion was performed and yielded purulent material but without any growth of microorganisms.\nThe patient underwent a right thoracotomy and a collection of pus and food residuals was drained from the lower mediastinum. During the next two days he significantly improved and was awakened with good muscle strength and Glasgow Coma Scale of 15. After a successful spontaneous breathing trial he was extubated but shortly after he developed a dramatic clinical picture with signs of bulbar dysfunction i.e. weak cough, disordered swallowing and dysphonia. Although he did not develop hypoxemia or hypercapnia he had to be reintubated for airway protection. A tracheostomy was subsequently performed. A barium swallow test revealed microaspiration during swallowing. Brain CT scan was normal. Anti-acetylcholine receptor (AChR) antibody test was negative. The patient remained awake, afebrile and hemodynamically stable on spontaneous breathing through the tracheostomy tube and was transferred to the ward. His bulbar function was gradually restored and the tracheostomy tube was removed ten days later.",
"gender": "Male"
}
] |
PMC4954936
|
[
{
"age": 43,
"case_id": "PMC4847605_01",
"case_text": "A 43-year-old married Syrian woman presented at the age of 40 with distortion of central vision in the right eye. Choroidal dystrophy was suspected in Damascus (Syria) (Figures 1 and 2). Rheumatology and infectious workup was negative (syphilis, tuberculosis, anti-double-stranded DNA, anti-single-stranded DNA, rheumatoid factor). CNV was also detected in the macular area in Dubai (United Arab Emirates) and intravitreal injections were advised. She subsequently received three monthly intravitreal ranibizumab injections in Barcelona (Spain) (Figure 3A and B). Past ocular history revealed myopia of 2.5 D as per patient recollection. She had undergone bilateral refractive surgery (excimer laser 5 years ago followed by laser in situ keratomileusis [LASIK] 3 years ago). Medical history was negative. There was a strong family history of myopia and no parental consanguinity. Fifteen months after initial right eye involvement, the patient expressed the same symptoms in the left eye, such as seeing broken lines and asymmetric faces. She was advised to undergo treatment for CNV in the macular region. She received one injection in Beirut (Lebanon), and subsequently, three monthly injections in Dubai to the left eye. She reported further worsening of vision after each injection. Consultation in London (UK) revealed a best-corrected visual acuity of 20/80 in the right eye and 20/30 in the left eye. Dilated fundoscopy revealed bilateral areas of vertically linear atrophy, more extensive in the right eye, without subretinal fluid or hemorrhage by optical coherence tomography. Fundus autofluorescence imaging revealed areas of reduced autofluorescence corresponding to these areas of atrophy. The reported clinical impression then was myopic chorioretinal degeneration versus lacquer crack-associated myopic degeneration. She was advised to have regular checkup without intravitreal injections as long as the macula stays dry. The patient was frustrated because of both inability to pinpoint a definite diagnosis and gradual decline in vision bilaterally. Nine months later, she initially presented to our clinic with 20/200 visual acuity. Fundoscopy revealed definite widening of the vertical macular choroidal rupture bilaterally (Figure 4A and B). Stippled changes in the retinal pigment epithelium were observed. Peau d'orange appearance was not present. The patient was emmetropic without keratoconus on corneal topography. Axial length measurement with the IOL Master (Carl Zeiss Meditec AG, Jena, Germany) was 27.35 mm in the right eye and 27.31 mm in the left eye. Keratometry readings were 38.6 D in the right eye and 38.2 D in the left eye. The skin of the neck had tiny pinkish papules suspicious for early goose flesh (Figure 5). Two separate dermatology consultations and skin biopsies did not favor the diagnosis of pseudoxanthoma elasticum. Even further widening of the choroidal rupture occurred 9 months after presentation. Our working diagnosis was lacquer crack from high myopia (without pseudoxanthoma elasticum) (Figure 6) possibly initiated by LASIK and exacerbated by ocular rubbing and intravitreal injections (Figure 7). The patient was instructed to avoid ocular rubbing, head-down position, and intravitreal injection (unless an exudative component was present) and to have prior paracentesis before any future intravitreal injections.",
"gender": "Female"
}
] |
PMC4847605
|
[
{
"age": 67,
"case_id": "PMC5301121_01",
"case_text": "A 67-year-old man was referred to our hospital for treatment of a gastric tumor detected by esophagogastroduodenoscopy (EGD). He reported abdominal discomfort, occasional vomiting, and weight loss of 10 kg during the 4 months preceding his presentation. Following admission to our hospital, we performed an EGD that showed copious gastric food debris and a tumor involving the entire stomach (Fig 1). Because definite stenosis caused by the tumor was absent, the accumulation of gastric debris appeared to result from reduced peristalsis due to tumor extension throughout the stomach. The histological diagnosis was human epidermal growth factor receptor 2 (HER2)-negative well-differentiated gastric adenocarcinoma. Abdominal computed tomography (CT) showed cancer invasion of the pancreas and metastatic lymph nodes near the aorta. We diagnosed the lesion as an unresectable advanced gastric cancer. The patient's performance status was sufficiently good, and chemotherapy was indicated. In Japan, for patients with HER2-negative gastric cancer, S-1 plus cisplatin combination chemotherapy is the standard of care. However, our patient sometimes vomited due to delayed gastric emptying (DGE), and oral treatment was difficult. We started intravenous nutrition and chemotherapy with ramucirumab plus paclitaxel. After the chemotherapy was started, the patient's oral intake gradually increased, and he ceased vomiting. He was discharged in satisfactory condition after finishing the first cycle of chemotherapy.\nThe patient continued chemotherapy as an outpatient but developed sudden severe upper abdominal pain on the seventh day of the second cycle of the chemotherapy. A CT examination showed perforation at the lesser curvature of the gastric body (Fig 2a), and he was readmitted to our hospital. Because he had been taking a proton pump inhibitor, we did not think that the perforation was caused by acid-induced ulceration, and we attributed the perforation to ramucirumab. We began treatment with analgesic medication and decompression using a nasogastric tube. The patient's condition improved with conservative treatment. On the 15th hospital day, his CT scan showed improvement of the gastric perforation, and we removed the nasogastric tube. He started to take a liquid diet but developed a fever (39.0 C) on the 24th hospital day. His laboratory data showed an increased white blood cell count and elevated C-reactive protein level. A CT examination on the 27th hospital day showed enlargement of the fluid collection outside the stomach (Fig 2b). We considered an intra-abdominal abscess following the gastric perforation and performed EUS-guided fine-needle aspiration of the fluid collection using a 19-gauge needle (SonoTip Pro Control; Medi-Globe GmbH, Achenmuhle, Germany). Because malodorous yellowish-white pus was aspirated, we diagnosed the lesion as an intra-abdominal abscess and conducted EUS-guided drainage (Fig 3a). The procedure was performed using a convex-type echoendoscope (GF-UCT260; Olympus Medical Systems, Tokyo, Japan). A 0.025-inch guidewire (VisiGlide, Olympus Medical Systems) was introduced through the needle and coiled into the abscess under fluoroscopic guidance. The fistula was dilated using a dilation catheter (ES dilator; Zeon Medical, Tokyo, Japan), and a 6-Fr pigtail nasal biliary catheter (nasal biliary drainage set; Cook Medical, Bloomington, IN, USA) was subsequently placed (Fig 3b). Gram staining and culturing of an aspirate sample confirmed anaerobic bacteria (Prevotella melaninogenica and Peptostreptococcus micros). Meropenem (3 g/day) was administered because the antibiotic sensitivity test showed that all the causative bacteria were sensitive to meropenem and it had the lowest minimum inhibitory concentration. The external drainage catheter placed via the nose was irrigated once daily with 10-20 mL of sterile saline.\nThe clinical course after drainage was uneventful and the external drainage catheter was removed on the 34th hospital day. The patient had not vomited since he started oral intake on the 36th hospital day, and we observed that his DGE was improved by the first cycle of the chemotherapy with ramucirumab plus paclitaxel. Therefore, we started chemotherapy with S-1 plus cisplatin on the 41st hospital day, and the patient was discharged after the first cycle of this chemotherapy was finished. The patient gave informed consent for each treatment he received.",
"gender": "Male"
}
] |
PMC5301121
|
[
{
"age": 71,
"case_id": "PMC5438854_01",
"case_text": "A 71-year-old female patient is presented to the emergency department with the chief complaint of abdominal pain. She described a 1-week history of worsening right upper quadrant pain with nausea and vomiting. Her physical examination body temperature 37.5 C, pulse 90/min, blood pressure 120/80 mmHg, and respiratory rate 15/min. A slight distension and a tenderness in the right hypochondrium area were detected in the abdominal examination; abdominal defense and rebound phenomenon were absent. Her medical history revealed geophagia during childhood and a previous long-term dental treatment. She did not have diabetes or any prior surgeries.\nWhite Blood Cell (WBC) count was 22.9 x 109/L [normal: 3.7 x 109/L-10 x 109/L], and C-reactive protein (CRP) was 150 (NV < 5). Ultrasound (USG) scan revealed a distended gall bladder with a thickened wall and multiple stones. The patient was diagnosed as acute cholecystitis and admitted to the surgical ward.\nShe received 3 days of intravenous (IV) cefazolin 2 x 1 gr/day. At the end of the 3rd day, her symptoms improved, but WBC and CRP levels remained high. On the 7th day of her treatment, her symptoms resolved and WBC levels normalized, but paradoxically CRP levels still remained high and control ultrasound revealed an increase in the thickness of the gall bladder wall and pericholecystic fluid collection. According to these findings, surgery was planned. During exploration, the gall bladder was found to be buried in the omentum with multiple foci of closed perforation. Cholecystectomy was performed and no complications occurred during the postoperative period. Cultures of microbiological sample were taken during the operation. The sample was cultivated on EMB and sheep blood agar with standard loop as the inoculant. Gram-negative bacilli grew on both culture media to a density of >100,000 CFU/mL. The isolate was analyzed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry using the VITEK MS (bioMerieux, Marcy l'Etoile, France) system and identified as R. planticola. Antimicrobial susceptibility testing was performed using the VITEK-2 compact system which was sensitive to cefazolin, ampicillin/sulbactam, ceftriaxone, ciprofloxacin, gentamicin, ceftazidime, tobramycin, and levofloxacin and resistant to ampicillin, cefuroxime, imipenem, trimethoprim/sulfamethoxazole, amoxicillin/clavulanic acid, cefuroxime axetil, and nitrofurantoin. According to the culture results, the ampicillin/sulbactam regimen was continued for 10 days and the patient was discharged with normal CRP levels and no complications. The final pathological result was gangrenous cholecystitis. In the 3rd postoperative month of follow-up, all the blood stats, USG, and magnetic resonance cholangiopancreatography (MRCP) images were normal.",
"gender": "Female"
}
] |
PMC5438854
|
[
{
"age": 81,
"case_id": "PMC4672872_01",
"case_text": "A 81-year-old Iranian man with a history of hypertension (HTN) and hemodialysis presented to the emergency department with complains of shortness of breath with cough since 5 days ago. He was intubated on the same day upon admission due to respiratory distress and respiratory arrest occurred, cardiopulmonary resuscitation (CPR) was performed and the patient was sent to the ICU. Five days after hospitalization, eight fly larvae were discovered in the aspiration material of the oral cavity. The larvae were removed using sterile forceps and sent to the microbiology unit in 70% alcohol solution.",
"gender": "Male"
},
{
"age": 47,
"case_id": "PMC4672872_02",
"case_text": "A 47-year-old Iranian man was admitted to an ICU in Iran. The patient was diagnosed with hepatitis B and liver cirrhosis. Due to respiratory apnea, loss of consciousness and right upper quadrant (RUQ) pain, he was intubated and underwent mechanical ventilation (MV). He has been in ICU for 15 days and on the sixth day of hospitalization, about 20 maggots which showed spiral form and varied in size from 4 to 6 mm were discovered in the oral cavity. The maggots were removed and sent to the microbiology unit laboratory.",
"gender": "Male"
},
{
"age": 74,
"case_id": "PMC4672872_03",
"case_text": "A 74-year-old Iranian woman with clinical history of asthma for 5 years, was admitted with dyspnea and chest pain symptoms to the emergency room (ER) of the general hospital. Emergency treatment was performed, including intubation. She was intubated 5 days prior to admission to ICU. Several hours after transfer to the ICU, the nurse reported approximately 8 larvae in the patient's oral cavity and removed the larvae by combining manual extraction with tweezers and aspiration after having washed the infected area with water and povidone iodine. But three hours later, the nurse reported 4 maggots which were removed and then sent to the microbiology unit laboratory.\nThese patients were classified as having nosocomial infestation. The cases occurred simultaneously in general ICU among three patients in late spring (June). The window meshes had been changed before the patients were hospitalized. Considering that it was the season for flies to bear their nits, some flies could have entered the ICU and bore their nits in the mouths of these three patients. Based on the morphological characteristics including size of the larva, spinous bands and the color in all the 3 cases, the larvae were identified as part of the Calliphoridae family (Figure 1 (Fig. 1)). In addition, through our inspection in the hospital, some dead adult flies were found beside the window (Figure 1 (Fig. 1)).",
"gender": "Female"
}
] |
PMC4672872
|
[
{
"age": 67,
"case_id": "PMC5960570_01",
"case_text": "A 67-year-old woman was admitted in March 2016, to the Erasme University Hospital for irregular and abnormal vaginal bleeding occurring one year before. Her past medical history was characterized by severe obesity with a body mass index evaluated to 35, hypertension, and type 2 diabetes mellitus. Gynaecological examination was unremarkable but vaginal ultrasound and pelvic MRI control showed a corporal endocavitary mass of 25 x 17 mm relevant to endometrial neoplasia stage FIGO IA. Endometrial curettage was performed and revealed a poorly differentiated invasive carcinoma and therefore the patient underwent radical hysterectomy with bilateral salpingo-oophorectomy associated with a pelvic and lumbar-aortic lymphatic dissection.\nMacroscopically, a partially polypoid mass of 20 x 15 mm, mainly located in the uterine fundus, was observed. The tumor was soft, with areas of haemorrhage and necrosis, and invaded less than half of the myometrium (Figure 1). The adnexa, parameters, and lymph nodes were macroscopically unremarkable.\nMicroscopically, the tumor consisted of syncytial tumor nests of pleomorphic epithelial cells often with large nuclei and prominent nucleoli. No or only minimal glandular differentiation was observed. The surrounding stroma was heavily infiltrated by lymphocytes and plasma cells with numerous lymphoepithelial complexes. An infiltration of the inner layers of the myometrium was observed (Figure 2).\nUsing immunohistochemistry, as we have previously described, the carcinomatous component was positive for broad spectrum cytokeratins AE1/AE3 (clone AE1/AE3, 1 : 150, Dako Glostrup, Denmark), cytokeratin 7 (CK7) (clone OV/TL12/30, 1 : 400, Leica Newcastle, United Kingdom), estrogen (ER) (clone EP1, 1 : 50, Dako Glostrup, Denmark) and progesterone (PR) (clone 16 + SAN27, 1 : 500, Leica Newcastle, United Kingdom), Vimentin (vim) (clone V9, 1 : 1000, Dako Glostrup, Denmark), p53 protein (strong nuclear staining) (clone DO-7, 1 : 200, Dako Glostrup, Denmark), MLH1 (MutL homolog 1) (clone ES05, 1 : 50, Leica Newcastle, United Kingdom), MSH2 (MutS homolog 2) (clone FE11, 1 : 50, Dako Glostrup, Denmark), MSH6 (MutS homolog 6) (clone EP49, 1 : 100, Dako Glostrup, Denmark), and PMS2 (postmeiotic segregation 2) (clone EP51, 1 : 100, Dako Glostrup, Denmark) (Figure 3). Stromal lymphoid cell showed a CLA (clone 2B11 + PD7/26, ready to use, Dako Glostrup, Denmark) positivity in mirror of epithelial component. Immunophenotyping demonstrated an increase of CD8+ cytotoxic T-lymphocytes (clone C8/144B, 1 : 200, Dako Glostrup, Denmark) in predominantly CD3+ T-lymphocytes (clone LN10, ready to use, Leica Newcastle, United Kingdom) contingent. PDL 1 (programmed death-ligand 1) (clone 22C3, ready to use, Dako Glostrup, Denmark) expression was negative in the epithelial component but scattered lymphocytes in peritumoral infiltrate were positive (Figure 3).\nGene mutation testing has been performed by next generation sequencing (NGS), as we have previously validated, with a panel of 16 genes described in Table 1.\nTwo mutations were found: K132M mutation of the p53 gene and R88Q mutation of the PIK3CA gene.\nIn situ hybridization (ISH) with EBER probe for qualitative identification of Epstein-Barr Virus (EBV) using the automated Leica BOND-III system (Leica Biosystems, Nussloch, Germany) was negative. In addition, the detection of High Risk-HPV DNA (HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 59, 66, and 68) from the paraffin-embedded sample using the BD onclarity HPV assay (BD diagnostics, Sparks, USA) was also negative.\nAccording to all these pathological and molecular data, the diagnosis of lymphoepithelioma-like carcinoma was performed. The tumor was limited to the uterus, no lymph node involvement was observed, and therefore it was staged pT1aNo according to the WHO 2014. No complementary treatment was applied and to date with a follow-up of 16 months the patient was disease free.",
"gender": "Female"
}
] |
PMC5960570
|
[
{
"age": 87,
"case_id": "PMC10109244_01",
"case_text": "87-year-old female resident (\"Resident 1\") - additional fall mitigation strategies included use of a pressure alarm on bed and wheelchair, and use of a rolling walker. Early in the morning hours, the resident walked out of her room into the hallway with no assistive device wearing the smartbelt. She grabbed onto a medication cart which then rolled, causing the resident to lose her balance and fall towards her right side. The irrecoverable fall motion caused the smartbelt airbags to deploy prior to her hip striking the floor. A nurse sitting at the end of the hall witnessed this fall. The smartbelt triggered alarms that the fall and airbag deployed. The resident was immediately approached and given attention for injury assessment by the staff nurse. The resident had no complaint of pain and was assisted to her feet and walked back to her bed. The resident's son expressed his gratitude and sense of assurance for having the device on his mother.",
"gender": "Female"
},
{
"age": 88,
"case_id": "PMC10109244_02",
"case_text": "88-year-old female resident (\"Resident 2\") - additional fall mitigation strategies included use of a pressure alarm on bed and wheelchair, and use of a wheelchair. In the early evening, the resident experienced a fall onto the floor while attempting to rise unassisted to standing from being seated in her wheelchair while wearing the smartbelt. The smartbelt detected an irrecoverable serious hip-impacting fall motion, deployed the airbags and triggered alarms to bring attention. Nurses found the resident on the floor with the wheelchair behind her. The nursing staff completed a physical assessment including checking for range of motion. No injuries were reported, and the resident had no complaints of pain or discomfort. The resident was helped to her feet and returned to her wheelchair.",
"gender": "Female"
},
{
"age": 94,
"case_id": "PMC10109244_03",
"case_text": "94-year-old female resident of memory care unit (\"Resident 3\") - additional fall mitigation strategies included use of a wheelchair. In the early evening, the resident fell during an attempt to self-transfer from her wheelchair to her bed while wearing the smartbelt. The smartbelt detected an irrecoverable serious hip-impacting fall motion, deployed airbags and sent alerts of the fall. The nursing staff discovered the resident on the floor of her room, provided a physical assessment with no injuries reported and helped the resident to her bed.",
"gender": "Female"
},
{
"age": 83,
"case_id": "PMC10109244_04",
"case_text": "83-year-old female resident (\"Resident 4\") - no additional fall mitigation strategies. In the early morning hours, an unwitnessed fall occurred while wearing the smartbelt in her room. The smartbelt detected an irrecoverable serious hip-impacting fall motion, deployed airbags and sent alerts of the fall. Nursing staff reported no injury following physical inspection. Post-hoc analysis of motion data captured by the smartbelt indicated a distinct pattern of gait with increasing postural sway prior to the fall, suggesting that the resident attempted to walk from her bed across the room prior to losing her balance and falling onto her side.",
"gender": "Female"
},
{
"age": 91,
"case_id": "PMC10109244_05",
"case_text": "91-year-old female resident of memory care unit (\"Resident 5\") - additional fall mitigation strategies included use of a pressure alarm on bed and wheelchair. One morning, the resident stood up from the memory unit dining room chair and fell. The smartbelt deployed airbags prior to the individual striking the floor and sent alerts that the fall had occurred. The resident was immediately given attention by nursing staff for physical assessment and found to have no injuries. Family members expressed to the facility team that they were very pleased that she sustained no injuries from the fall.",
"gender": "Female"
},
{
"age": 78,
"case_id": "PMC10109244_06",
"case_text": "78-year-old female resident (\"Resident 6\") - participant had a past medical history of Parkinson's Disease, low BMI and frequent falls who was on hospice care in addition to the fall risk factors noted above. Additional fall mitigation strategies included use of a pressure alarm on bed and wheelchair. In the very early morning hours, an unwitnessed fall occurred while wearing the smartbelt in her room. It was believed that the resident was attempting to make her way to the restroom from her bed, lost her balance and fell sideways very quickly onto the floor. The smartbelt deployed the airbags and sent alerts to the care team. Upon assessment, a minor injury of an elbow scratch was discovered. She was helped to her feet and returned to bed. The Memory Support Director in the unit reported her belief that the smartbelt \"saved the resident's hip.\"\nDuring the 23-month time period after implementation, there were 2 incidents of airbag deployment not related to a serious hip-impacting fall. The first incident occurred when a participant with dementia became agitated, wriggled out of the smartbelt, and tossed the device across the room. The second incident involved a participant, described by staff as being a \"fidgeter,\" slipped the device past their hips, leading to airbag deployment as the device fell to the floor. Neither of these incidents resulted in participant injury. Lastly, staff at the center did not report any instances of participants sustaining a fall which resulted in a major hip injury.",
"gender": "Female"
}
] |
PMC10109244
|
[
{
"age": 67,
"case_id": "PMC6345092_01",
"case_text": "A 67-year-old woman presented with shortness of breath on exertion of 4 months duration. No other symptoms were revealed by direct questioning. There had been no recent travelling, immobility or other intercurrent illness. She gave a past history of rheumatic fever in childhood and of Dercum's disease (DD). The latter was diagnosed more than a decade earlier after she had presented over years with recurrent painful lipomas, based on her personal and family history and after surgical excision and histological examination of one. Clinical examination revealed multiple lipomas consistent with her underlying chronic condition. The cardiovascular, respiratory, gastrointestinal and neurological examination was otherwise normal. CXR was unremarkable. D-Dimer was elevated at 3100 ng/mL and VQ SPECT scanning revealed multiple pulmonary emboli (Fig. 1). Outpatient investigations looking to identify an underlying cause were unyielding (see Table 1 for a summary of results).\nThree weeks later, the patient's identical twin was admitted with a 6-month history of gradually worsening shortness of breath on exertion. The recent admission of her sister with symptoms which mirrored her own had prompted the patient to seek medical advice. The patient was otherwise well but also had a diagnosis of Dercum's disease which was made after her twin had been diagnosed. Again, there was no recent travelling, immobility or intercurrent acute illness. Aside from multiple lipomas in line with her past medical history, the physical examination was unremarkable. Again, her CXR was normal and D-Dimer was elevated. VQ SPECT scanning demonstrated multiple pulmonary emboli (Fig. 2). Further investigations were performed as an outpatient which also were unyielding (see Table 1). The patient herself had identified a lipoma in the right groin and had raised the suspicion of a pressure effect on the underlying vasculature in this area. In an ultrasound scan, the abdominal and pelvic organs appeared normal with no evidence of lesions at any site. No lipoma was identified in the right groin at the site indicated by the patient. The right femoral vein appeared normal.",
"gender": "Female"
}
] |
PMC6345092
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.