cases
listlengths 1
37
| article_id
stringlengths 8
11
|
|---|---|
[
{
"age": 10,
"case_id": "PMC4359789_01",
"case_text": "The male patient was referred for the first time at the age of 10 years for evaluation of autistic features, learning difficulties, speech and cognitive delays. No information are available on family history since he was adopted. Physical examination at 13 years of age revealed auxological parameters above the average (weight >97th centile; height between the 90th and 97th centile) and dysmorphic features including high forehead with frontal bossing, small palpebral fissures, epicanthal folds, hypertelorism (>2 SD), dental abnormalities, high arched palate, micrognathia, short neck (Figure 1). In addition, hyperopia and skeletal anomalies (scoliosis), gynecomastia and bilateral pes planus were reported.",
"gender": "Male"
},
{
"age": null,
"case_id": "PMC4359789_02",
"case_text": "Neuropsychiatric evaluation showed speech delay, mild cognitive impairment (QI 68), attention deficit hyperactivity disorder (ADHD). Also, the patient showed walking abnormalities (uncertain gait), clumsiness.\nAbdominal ultrasound examination and brain magnetic resonance imaging (MRI) were normal. Genetic evaluation revealed a normal 46,XY karyotype while DNA analysis for FMR-1 gene excluded the diagnosis of fragile X (FRAXA) syndrome.",
"gender": "Unknown"
}
] |
PMC4359789
|
[
{
"age": 14,
"case_id": "PMC4516357_01",
"case_text": "Two fourteen-year-old male siblings (twins) TG90.001 and TG90.002, were initially referred to the Montefiore Pediatric Genetics clinic for evaluation of multiple congenital anomalies. At age four, both boys were diagnosed with focal segmental glomerulosclerosis (FSGS) by renal biopsy and were also noted to have tics, which were felt by their neurologist to be due to a forme fruste of Tourette syndrome. Developmentally, motor and cognitive milestones were slightly delayed, and both had dolichostenomelia with arm spans significantly greater than height. In addition, each had a high arched palate, joint laxity, pectus excavatum, mild scoliosis, and pes planus (flat feet). All of these physical findings suggested a diagnosis of Marfan syndrome (MS) (OMIM#154700). However, since the urologic, renal and developmental problems affecting the siblings are not typically seen in MS, and cardiac evaluations were normal, it was unclear which testing should be performed. At the time of this evaluation, Fibrillin 1 (FBN1) testing was not clinically available. Testing through our panel revealed that both patients carried one previously-reported missense variant in the coding region of the FBN1 gene (c.G4001A; p.G1334D; rs191989961), which produces a guanine-aspartate change and it is predicted as probably-pathogenic by our in silico analysis. This variant was previously reported in one other subject by the Laboratory for Molecular Medicine (Cambridge, MA) and deemed likely pathogenic based on their systematic approach for variant classification, which considers disease association from existing data, mechanism of gene function, and the use of several bioinformatic tools to predict the possible impact of the variant on the gene. MS is inherited in an autosomal dominant manner and since variants in FBN1 are also commonly associated with MS, we believe our findings may help explaining the boys' MS-like features. There were no variants identified in the FSGS-associated genes present in our panel, suggesting that additional testing is needed in these patients to determine the underlying molecular cause for their renal and urologic phenotype. Of note, if testing for these patients were to be performed clinically by Sanger sequencing or using a disease-specific gene panel, the costs associated would have been greater given that two separate testing for each phenotype would have been required.",
"gender": "Male"
},
{
"age": 29,
"case_id": "PMC4516357_02",
"case_text": "A 29-year-old woman, RB1, was referred to the Montefiore Center for CardioGenetics for evaluation. She had experienced episodes of palpitations and syncope related to exercise since 11 years of age. Due to intermittent prolongation of her QT interval on electrocardiography (ECG), she was given a provisional diagnosis of either Long QT syndrome (LQTS) or CPVT. These disorders have some overlapping features and both, if left untreated, may result in sudden death. However, because the treatment for various forms of LQTS and CPVT differ, determining the exact genetic variants is extremely helpful in managing patients. In addition, identifying the genetic variant can be life-saving for first degree relatives. Commercial testing is available for this specific phenotype but requires two separate sequencing panels (one for LQTS and one for CPVT) to differentiate the diagnosis. Because of lack of insurance and high cost, commercial testing was never performed. Based on the custom multi-disease gene panel that we designed, this patient was identified to be a compound heterozygote for variants in the calsequestrin 2 (CASQ2) gene, identifying one novel stop variant (c.C199T, p.Gln67*) and one novel splice site variant (c.532+1G>A). Sanger sequencing confirmed the variants and in addition detected the presence of the p.Gln67* variant in the patient's child. The splice site variant was absent in the child, indicating that the mother's variants were in trans. Variants in CASQ2 account for 5-7% of all cases of CPVT, suggesting the most likely mode of inheritance to be autosomal recessive. Although the c.532+1G>A variant has not yet been demonstrated to alter mRNA splicing, we are conducting further functional work to determine how this variant affects splicing.\nThe DNA from two sisters, TG471.001, TG471.002, presented to the Center for CardioGenetics with overlapping phenotypes of Dilated Cardiomyopathy (DCM), were sequenced and all cardiac related genes were analyzed. Several variants associated with cardiac disorders were detected, but only the LDB3 gene is directly associated with DCM (LIM domain-binding 3 gene LDB3; Cardiomyopathy, Dilated, 1C; OMIM#601493) and both sisters harbored the same missense variant (c.G352A, p.V118M; rs35507268). However, this exact LDB3 variant was also observed in the unaffected mother and upon further investigation categorized as likely benign by dbSNP, ClinVar, and HGMD. The other variants identified in the sisters were also identified in the unaffected family members, suggesting a lack of a clear pathogenic effect (see Fig 4 for mutational pedigree). Based upon this analysis, the true disease causing variants remain to be identified. We recommend whole exome sequencing be performed on this family in order to identify additional variants potentially associated with DCM. CNV analysis performed on the sisters did not identify variations suggestive of a potentially pathogenic nature.\nPatient SS1, presenting with a dilated cardiomyopathy (DCM) with conduction defects (OMIM#115200) harbored a 3.74 kb deletion that resulted in the heterozygous loss of the alpha-T-catenin gene (CTNNA3). This gene maps to chromosome 10q21.3, a region linked to autosomal dominant familial DCM. The most common form of myocardial disease, DCM is associated with a high incidence of ventricular arrhythmias, severe congestive heart failure and an increased risk of sudden death. CTNNA3 is highly expressed at intercalated discs of cardiomyocytes and peritubular myoid cells of the testis, indicating a specific function for this gene in particular muscle tissues. Several reports link variants in the CTNNA3 gene with another form of cardiomyopathy, specifically, arrhythmogenic right ventricular dysplasia (ARVC; OMIM#107970). Li et al. examined the role of CTNNA3 in the hearts of mice and found that CTNNA3 acts as a molecular integrator of adherens junctional and desmosomal components at the area composita resulting in early onset of DCM. This CNV is not common and to our knowledge has never been reported based on a literature search or inquiry of CNV databases. We propose the deletion may be causative of the patient's phenotype.\nPatients TG90.001 and TG90.002 (CASES 1 and 2 above), both harbored two duplications mapping to regions 2q21.1 and 6q27, resulting in an allelic gain to eleven and four genes, respectively. Two genes, tubulin, alpha 3d (TUBA3D) located in the 2q21 region and kinesin family member 25 (KIF25) located in the 6q27 region are involved in microtubule formation. The copy number gain observed at 2q21 was maternally inherited, while the gain seen at 6q27 was paternally inherited. We suspect based on segregation analysis that these duplications, in addition to the potentially pathogenic variant identified in the FBN1 gene (previously discussed) could be responsible for the skeletal and muscular abnormalities observed in the twins, however in order to confirm this functional studies would need to be performed.",
"gender": "Female"
}
] |
PMC4516357
|
[
{
"age": 47,
"case_id": "PMC5106230_01",
"case_text": "Mr. X, a 47-year-old Caucasian male patient with no medical history visited the emergency unit on July 17, 2007 because of diplopia and dysphonia that had appeared during the night. On admission, the Glasgow coma scale score was 15/15, hemodynamics were preserved, and body temperature was 37.4 C. Medical history showed that the patient had diarrhea that lasted for one week, without improvement even after 5 days of symptomatic treatment. There was no report of recent vaccinations or travel. Clinical examination showed diplopia and dysphonia with nasal speech. He did not present any muscular weakness or sensory loss, and osteotendinous reflexes were present and symmetrical. Cranial nerve examination did not show swallowing disorder, oculomotor disorder, or facial paralysis. The patient had no difficulty in walking, no pain or amyotrophy, no sphincter disorder, and no cauda equina syndrome. The plantar reflex was in flexion.\nLaboratory tests were also normal. A brain CT with and without contrast was unremarkable. Lumbar puncture showed a clear cerebrospinal fluid with normal leukocyte count (less than 5/mm3 cells), proteins 44 mg/dL (normal range 20-40 mg/dL), glucose 61 mg/dL (n=45-80), and chloride 123 mEq/L (n=116-127). Cerebrospinal fluid culture remained negative after 2 days.\nYet, 3 hours after admission, became marked impairing speech, and paresthesia and numbness of the tongue was observed. Mr. X also reported paresthesia in his hands, without motor deficit. A Doppler ultrasound of carotid and vertebral arteries was unremarkable. While awaiting the results of bacteriological and viral testing, an empirical antibiotic treatment with amoxicillin, acyclovir, and sulfamethoxazole-trimethoprime was started in the eventuality of meningitis or meningoencephalitis.\nA Guillain-Barre syndrome was suspected, and so the patient was transferred to the medical intensive care unit. On admission to the intensive care unit, the patient was conscious and had a Glasgow coma scale score of 15/15. There was persistent dysphonia and impaired swallowing and vision; otherwise, the neurological examination was unchanged. Invasive ventilation was initiated soon after.\nAntibiotic therapy was switched to amoxicillin-clavulanic acid for one week in view of suspected aspiration pneumonia. Intravenous immunoglobulin (IVIG) therapy was started on admission at 0.4 g/kg a day for 5 days. Sedation (midazolam and remifentanil) was stopped on day 1; on day 3, the patient showed no sign of awakening. The Glasgow coma scale score was 3. The pupils were in nonreactive bilateral mydriasis.",
"gender": "Male"
}
] |
PMC5106230
|
[
{
"age": 60,
"case_id": "PMC4387336_01",
"case_text": "A 60-year-old man presented with a medical history significant for biopsy proven PAN (on prednisone and cyclophosphamide with prior failure on cyclophosphamide alone), paroxysmal atrial fibrillation, hypertension (not on calcium channels blocker), dyslipidemia, non-insulin dependent diabetes mellitus, with multiple prior admissions for PAN flares in the past, and with a history of an admission for septic shock 2 years prior to the current admission without any identifiable sources of infection.\nThe patient initially presented with a scrotal pain, a fever of 103 F, and fatigue. The patient was also found to be tachycardic to 130 beats per minute, hypotensive to 103/40 mm Hg.\nThe patient was initially started on broad-spectrum antibiotics consisting of vancomycin and Zosyn (piperacillin/tazobactam) in the emergency department followed by an admission under medicine service. During the hospital course the patient's kidney function worsened leading to a switch in antibiotics to meropenem. Despite switching antibiotics, the creatinine level continued to rise. The patient was on 40 mg of prednisone daily making a suspicion of acute interstitial nephritis less likely. Meanwhile, he continued to spike fevers without a specific source of an infection found in any of the blood, urine, and sputum cultures. Also, no focus was found on the CT chest, abdomen, and pelvis which led to stopping all antibiotics.\nAfter a time span of 1-2 weeks our patient started developing a previously present macular rash that progressed slowly to involve his axillary area, later including his chest, head, neck, and abdomen. Accompanied with these symptoms, the patient suffered an incendiary mental status than what was previously noted during the orientation exam. This was followed by a worsening of skin lesions with an element of bullae and vesicles. The dermatology team was involved, and a biopsy was obtained with a recommendation of initiating local steroid cream for the diagnosis of AGEP because of the given skin distribution and biopsy result, along with kidney injury, neutrophilia, and cyclic fevers. Nine days after the initial appearance of the rash, the rash became pustular, accompanied by high grade fever of 109 F leading to a transfer to the intensive care unit with a protocol of cooling. Given prior discussions with rheumatology, nephrology, and infectious disease, the patient was administered pulse steroids, given low suspicion of infection and his prior history of PAN flares and the general probability of autoimmune process.\nAfter completion of the third day of pulse steroids, the patient's fever subsided and subsequent improvement of the initial rash was observed, along with a decreased progression of sloughing and complete resolution of acute kidney injury. A taper in steroids followed pulse steroids.\nSkin biopsy\nUrine analysis\nCT chest/abdomen/pelvis\nCBC/BMP/coagulation",
"gender": "Male"
}
] |
PMC4387336
|
[
{
"age": null,
"case_id": "PMC6692872_01",
"case_text": "The cadaver of a wild female European rabbit, O. cuniculus, was one of a group shot for population management and donated for research and teaching to the veterinary anatomic pathology service of the Department of Veterinary Medicine, University of Cambridge (UK). The rabbit weighed 1.78 kg. Post mortem examination revealed a very firm, irregular mass with a smooth, gray/pink surface in the left abdomen. The mass had average dimensions 40 x 35 x 30 mm and had thin, tough, translucent adhesions to the left abdominal wall and the left uterine horn, the latter adhesion exhibiting evidence of vascularity, and the tension of the adhesion causing distortion of the left uterine horn (Figures 1A,B). On cut section, the mass was dry and multifocally gritty, but contained clearly discernable fetal remnants, including skin, hair, hard palate, and bone surrounded by lamellated fibrous tissue and fetal membranes (Figure 1C). The mass was interpreted to be a lithopedion, or mineralized abdominal ectopic pregnancy.\nAt the point of attachment to the left uterine horn, the uterine lumen contained an irregular, cream, 12 x 8 x 5 mm concretion and a circumferential 10 mm band of the uterine endometrium was dark red at this focus. The right uterine horn contained two fetuses, with crown-rump lengths 55 and 53 mm. Macroscopically, the mammary gland exhibited some evidence of development consistent with early pregnancy, such as prominent vasculature and mild parenchymal development, but this was considered markedly less than expected for this stage of pregnancy based on previous analyses. The gastrointestinal tract, in particular the stomach, was subjectively less full than the majority of wild rabbits from the same region examined as part of ongoing studies and scarce fecal pellets were present in the rectum. No other abnormalities were detected macroscopically.\nTissues were fixed in 10% neutral buffered formalin, and histological sections were prepared following standard procedures. The lithopedion was composed of amorphous eosinophilic material, indicative of degeneration and autolysis, which was multifocally heavily mineralized. Although nuclei were multifocally apparent, the degree of degeneration was such that cell populations were not identifiable and the presence of an inflammatory infiltrate could not be assessed. The uterus at the point of attachment of the lithopedion exhibited a locally extensive endometrial infiltrate of moderate numbers of lymphocytes, plasma cells, heterophils, and fewer macrophages, with locally extensive ulceration. Underlying this focus, there was a loss of distinction of the myometrial layers and locally extensive, mild to moderate, fibrosis. Together with the presence of the small concretion of mineralized material within the uterine lumen, this was considered strong evidence of abdominal pregnancy and formation of a lithopedion secondary to uterine rupture.",
"gender": "Female"
},
{
"age": null,
"case_id": "PMC6692872_02",
"case_text": "The macroscopic impression that the mammary gland was markedly under-developed for the stage of pregnancy was confirmed histologically, with only a thin layer of mammary tissue present and mammary lobules interspersed by prominent, wide, bands of connective tissue. The mammary alveoli frequently lacked intraluminal proteinaceous material and ducts were generally empty except for small numbers of macrophages and desquamated epithelial cells. The lack of mammary development was particularly pronounced when compared with mammary tissue from another female carrying a litter of similarly developed fetuses (crown-rump length median: 51 cm; mean: 50 cm; n = 8; Figure 2).\nHistologically the lungs exhibited multifocal, mild, granulomatous and heterophilic pneumonia with multinucleated giant cells and very rare adiaspores, with morphology consistent with Emmonsia spp. There were no other significant findings on histological examination.",
"gender": "Female"
}
] |
PMC6692872
|
[
{
"age": 83,
"case_id": "PMC6319684_01",
"case_text": "Patient A.N. is an 83-year-old woman who was living in Iran in January of 2015 when she presented to a local hospital with painless jaundice and dark urine. A CT scan showed a pancreatic head mass compressing the common bile duct. For palliation of hyperbilirubinemia, a palliative stent was placed in the common bile duct. A fine needle aspirate obtained through an endoscopic ultrasound (EUS) revealed a poorly differentiated adenocarcinoma. A follow-up CT scan performed on February 13, 2015 revealed a 3.6 x 2.7 cm pancreatic head mass that abutted the superior mesenteric artery and one of its proximal branches. There were suspicious peripancreatic and retroperitoneal nodes and no evidence of distant disease. At the beginning of March, she began taking 50,000 U vitamin D3 (cholecalciferol) daily, ordered directly from the Internet and not under the direction of a healthcare practitioner. Repeat EUS and biopsy on March 3, 2015 again confirmed adenocarcinoma with papillary features. She was referred to an oncologist and surgeon for evaluation. A triple phase CT was done on March 16, 2015 that showed a stable mass without any evidence of involvement of the celiac axis or superior mesenteric artery. Upfront chemotherapy was recommended, with consideration of surgery in the future.\nShe received gemcitabine/protein nanoparticle-bound paclitaxel in March. On day 10 of cycle 1, she developed neutropenic fever complicated by atrial fibrillation with rapid ventricular response. She was intubated for a brief time who then recovered to her baseline functional status. She was discharged on April 19. Based on her frailty, she was deemed to be a poor candidate for surgery and chemotherapy was not resumed.\nShe was referred to radiation oncology for consideration of stereotactic body radiotherapy, but she decided to first pursue alternative therapies. She visited an alternative care clinic in April and began taking chelodium, curcumin, community mushroom blend, viscosin, and naltrexone. She also continued to take her daily dose of 50,000 U vitamin D3. Although she was somewhat inconsistent in taking her regimen prescribed by the alternative therapy clinic, she consistently took the same vitamin D3 dose from April until the time of writing.\nShe was seen first at the Inova Schar Cancer Institute in September 2015. On September 4, 2015, CT scan revealed the pancreatic head mass to be 3.1 x 3.0 cm, slightly smaller than previously with a mild increase in pancreatic duct dilatation. On our first visit on September 5, 2015, we did not obtain a full supplement history, but checked a vitamin D, 25 OH level, which surprisingly was elevated above normal value of >150 ng/mL. Her calcium level was 9.7, which had been 7.7 in March 2015, before starting supplementation. In October, 8 months after her only dose of chemotherapy, she had a CT scan that showed continued disease stability (Fig. 1). As of December 4, 2015, she was stable with no evidence of disease progression by both CT and CA 19-9 level. She was admitted to Fairfax hospital in October of 2015 for diverticulitis with abscess formation that was treated with resection. Currently she describes as feeling quite well with no difficulty accomplishing her activities of daily living.",
"gender": "Female"
}
] |
PMC6319684
|
[
{
"age": 19,
"case_id": "PMC4773087_01",
"case_text": "A 19-years-old single woman presented to the Emergency Surgery Department of Ghaem Hospital in Mashhad, northeast Iran with abdominal pain, icterus, and anemia. She was admitted to the Surgery Department with acute abdominal pain. \n There was no significant disease in her medical history but in her social history she had addiction to hookah. She was a pilotage student and was working several hours of a day in the airport. There was no history of drug consumption in the recent months to justify related abnormal liver function tests. \n Location of pain was in epigastrium with radiation to the left lower quadrant area. The pain was persistent from 4 days ago, without relation to oral feeding. The patient had nausea and vomiting intermittently and also had anorexia but without significant weight loss. \n The patient's physical examination revealed stable hemodynamic, and mildly icteric sclera . In abdominal examination , tenderness of LLQ (left lower quadrant) in deep palpation without rigidity, or rebound tenderness was revealed. The other examinations such as chest and bowel sounds and also digital rectal examination were normal. \n Laboratory findings included a normocytic anemia and direct bilirubinemia (table 1). \n Plain abdominal radiography was normal. Ultrasound study of the abdomen and pelvis revealed several lymphadenopathies in the right lower quadrant and anterior to right psoas muscle. The biggest size of the lymph nodes was 14x7/5 mm. \n Abdominal pain subsided with conservative management in the Emergency Surgery Department, and the patient was referred to gastroenterologists for more evaluations because of abnormal liver function tests. Other potential causes of icter and abnormal aspartate transaminase and alanine transaminase including sepsis, viral hepatitis, autoimmune diseases, primary biliary cirrhosis, and primary sclerosing cholangitis were ruled out with proper laboratory and imaging modalities (table 1). \n A new abdominopelvic sonography revealed normal liver and biliary tract except large amounts of sludge in the gallbladder. Gall bladder wall thickness was normal. Spleen, pancreas, retroperitoneum, and other abdominal organs were normal. Both kidneys and urinary bladder, uterus, and endometrium were normal. Ovaries size was 40x26 mm with several follicles (all<10 mm). There were five 11-13 mm adenopathies in the right lower quadrant. \n Colonoscopy was normal until cecum. Terminal ileum was normal and biopsy of ileum revealed chronic inflammation, no villous atrophy, and no intraepithelial lymphocytosis. \n According to hookah consumption and an unreliable history for addiction to opioids, serum lead level was examined to rule out lead poisoning. The serum lead level was 415/6 microg/L (41/5 microg/dL) with normal range of <150 microg/L, thus hematology and toxicology consult was performed. \n Causes of anemia including iron deficiency and hemolytic anemia were excluded by checking serum iron, total iron binding capacity (TIBC), LDH(Lactate dehydrogenase), and reticulocyte count levels (table 1). \n Morphology of RBC in peripheral blood smear showed anisocytosis(+), microcytosis(+), hypochromia(+), ovalocytosis(+), and ostomatocytosis (+). Basophilic stippling was also seen in the peripheral smear, which can be seen in lead poisoning (figure1). \n Toxicology consult was done, and serum lead level was rechecked, which revealed 537 microg/L (53/7 mg/dL). Because of the serum lead level that was between 40 to 70 microg/dL and having considered the toxicology references only oral chelator (succimer) was recommended for the patient.The recommended dose was 10 mg/kg three times a day for five days, followed by 10 mg/kg twice a day for two weeks (maximum 500 mg/dose). \n Despite oral chelator consumption the pain continued, for which we decided to perform more evaluation for the patient. We found mild serum amylase and lipase elevation in the repeated lab tests (table 2). And according to the presence of sludge in the abdominal sonography of gallbladder, endosonography was done for more evaluation of common bile duct (CBD). The report read :\"there were multiple hyperechoic lesions and one small stone with posterior shadow inside the distal part of CBD. Diameter of CBD was 3/6 mm. pancreas was normal. Gall bladder had multiple small hyperechoic lesions\". \n Because of these findings and the presence of severe abdominal pain, endoscopic retrograde cholangiopancreaticography (ERCP) was done. ERCP revealed no dilation of CBD, so sphincterotomy was done and sludges were extracted. \n Despite these therapeutic managements, the abdominal pain deteriorated during the admission, and gradually did not respond to ordinary analgesics, and only opioid analgesics could relief the pain in the last nights of admission in the GI ward. Surgical consultation was done, by which laparoscopy was recommended to approach to the unknown origin of continuous pain and also to the lymphadenopathies, which were noted in the abdominal sonographies. The patient underwent laparascopy. Its report read: \"small intestine from proximal to distal was investigated which was normal but some lymphadenopathies was seen in the mesenter. Stomach, liver, uterus, ovaries, were normal.Cholecystectomy was done and biopsies obtained from the lymphnodes, liver and peritoneum.\" Pathological evaluation of the specimens revealed :1-cholecystectomy: acute on chronic cholecystitis, 2-mesenteric lymph node: reactive, 3- wedge liver biopsy: without significant pathologic changes, 4-labeled as peritoneal biopsy: fibromuscular tissue. \n Conservative management was done after surgery, but the pain continued. Because of the patient's job in the airport, consultation with occupational medicine specialist was done, who recommended re-evaluation for lead poisoning considering her work place that is a source of environmental lead poisoning and also history of substance abuse (hookah addiction) and unreliable history for probably opioid addiction. Therefore the patient was admitted to toxicology ward. \n At the toxicology ward, BLL was rechecked, which was 54 microg/dL. Because of no response to previous oral chelator therapy in the same BLL, and the severe suspicious to lead poisoning as the cause of the abdominal pain, intravenous (IV) and intramuscular (IM) chelator therapy were recommended. \n Dimercaprol or BAL (also referred to as British antilewisite) in conjunction with calcium EDTA was started for the patient. The recommended dose for BAL was 4 mg/kg to be injected deep IM every 4 hours for 3 days, in conjunction with edetate calcium disodium with the second dimercaprol dose; 25-50 mg/kg/day, IV for 5 days. A maximum dose of 3000 mg was considered for calcium EDTA. After 3 days of the treatment, clinical findings including nausea, vomiting, and abdominal pain subsided and finally the pain relieved dramatically. The patient was discharged after 5days of BAL prescription with maintenance therapy with oral succimer (10 mg/kg twice a day for two weeks). \n The patient was recommended to avoid substance abuse (hookah consumption), and also she was referred to occupational and environmental medicine specialists to evaluate the relationship between lead toxicity and her working environment. She was visited again 10 days later. There was no icterus, pain, or new signs or symptoms. New laboratory findings were all in normal range. She was recommended for monthly follow-up visits for six months (table 2).",
"gender": "Female"
}
] |
PMC4773087
|
[
{
"age": 51,
"case_id": "PMC4700856_01",
"case_text": "A 51-year-old male presented with the chief complaint of dysphagia for over 30 years. Eight years ago, the patient was diagnosed with esophageal achalasia, and balloon dilation was performed several times in a previous hospital, but it was not effective. Endoscopic findings before POEM showed a narrow esophagus in the lower esophageal sphincter (LES) region and severe circumferential esophagitis in the esophageal body due to stasis. In addition, there was a slightly depressed, reddish lesion suspected to be cancerous in the mid-thoracic esophagus. Histological diagnosis of the biopsy specimen prior to POEM was esophagitis (non-cancerous part) (Fig. 1A). However, early esophageal cancer was highly suspected. We expected secure diagnosis of the lesion by reducing the inflammation of esophageal mucosa by the POEM procedure. Thus, we performed myotomy from the distal side of the lesion, and the patient planned to undergo endoscopic submucosal dissection (ESD) procedure after POEM. We selected a posterior method for POEM, as there was severe scarring on anterior wall in the lower esophagus. During the POEM procedure, it was very difficult to create the submucosal tunnel because the mucosa adhered to the muscles (Fig. 1B). Therefore, we inserted an endoscope into the extraesophageal space through a tear in the musculature (Fig. 1C). Both the inner circular muscle and longitudinal muscles were pulled and divided carefully using a Triangle Tip knife to prevent mucosal damage outside of the esophagus (Fig. 1D). The total length of myotomy was 8 cm (the gastric side was 1 cm).\nAfter POEM, LES opened and patient's dysphagia improved. Endoscopic findings 3 months after POEM showed that the esophagitis had improved to mild. The reddish lesion in mid-thoracic esophagus was histologically diagnosed as cancer by repeat biopsy at that time. Intra-mucosal cancer was suspected based on the endoscopic appearance. It is difficult to take specimens by ESD for accurate pathological diagnosis when there is severe fibrosis in the submucosal space. As this was revealed in our patient during the POEM procedure, the patient instead underwent an esophagectomy (after informed consent). There were two main histological findings: first, intramucosal cancer; and second, the muscle tissue that had been divided by the POEM procedure was replaced with fibrotic tissue (Fig. 2 A,B,C,D).",
"gender": "Male"
}
] |
PMC4700856
|
[
{
"age": 32,
"case_id": "PMC6385762_01",
"case_text": "A 32-year-old male patient presented on March 14, 2015 with complaints of bilateral episodic pain of the bilateral lumbar region for 6 months. The history of his illness indicated that the patient used opium to reduce his pain. No significant medical or family history was mentioned and the laboratory findings were as follows: Hemoglobin: 14.6 g/dL, Blood urea nitrogen: 18 mg/dL, Creatinine: 1.3 mg/dL, Na: 142 m mol/L, K: 3.9 mmol/L, serum calcium: 9 mg/dL, and serum phosphorus: 3.5 mg/dL. Results of his physical examination on admission were unremarkable.\nAccording to the clinical symptoms, the kidney, ureter and bladder (KUB) X-ray test was ordered. Findings illustrated a huge left distal ureteral calculus with 14 cm length and 106 g weight, a large right ureteral calculus with 3 cm longitudinal diameter and also an opaque staghorn stone in the left kidney (Figure 1). The total weight of these stones was more than 300 g. Although excretion was reduced slightly in the right kidney, his overall renal function was normal and acceptable excretion was observed on the left side.\nWe employed the combination of open and endoscopic technique for treatment of this special case of ureteral stone. The patient underwent right side transurethral lithotripsy (TUL) and left open ureterolithotomy through the Gibson incision to remove the giant uretric calculus. Longitudinal incision was performed on the ureteral wall to remove the stone from the left ureter and the stone was extracted with difficulty due to its angle and impaction to the ureteral wall. Thereafter, the distal part of the left ureter was resected due to distal stenosis and then uretroscopy was performed through the resected ureter with advancement to the proximal part of the ureter; as we reached to the renal pelvis stone, it was fragmented. In fact, the retrograde intrarenal surgery (RIRS) was performed for three main goals: reducing the bulk of the stone, applying ureteral stents to ensure the patency of the ureter and facilitating percutaneous nephrolithotomy (PCNL) for the next surgery.\nTwo weeks after the first surgery, in the second session, PCNL was conducted to remove the remaining kidney stones and then the patient was transferred to the ward for subsequent observation and management. The patient was discharged a few days later.",
"gender": "Male"
}
] |
PMC6385762
|
[
{
"age": 7,
"case_id": "PMC7757964_01",
"case_text": "A seven-year-old male patient suffered dental avulsion of upper central incisors 11 and 21. In anamnesis, the patient described that he had suffered a trauma in an anterior-superior direction due to an accidental impact. The patient kept the teeth stored in dry media for 40 minutes, and an open apex was observed. The replantation procedure was made according to the International Association of Dental Traumatology (IADT) guidelines. The adopted protocol was the recommended for avulsed teeth with open apex and stored dry less than 60 minutes, and consisted of: roof surface and apical foramen cleaning with saline solution; local anaesthesia; alveolar socket evaluation for alveolar fracture (in the reported case it was not present); clot removal and gentle tooth replantation; no suture was necessary due to lacerations; removal of occlusal trauma; flexible splitting (for two weeks); systemic antibiotics; and antitetanic vaccination.\nThe immediate post-operative period was uneventful (Figure 1a). At six-month follow-up, there were no signs of necrosis or mobility; however, the patient disappeared and returned to our service after five years (Figure 1b).\nAt a five-year post-trauma evaluation, total apexification, complete PCC and yellow discoloration of the dental crown were observed in both central incisors, with an inconclusive response to pulp tests (Figure 1c). There were no signs of root resorption or pulp necrosis. After two years, tooth 11 showed a widening of the periodontal ligament space with occlusal trauma. At this moment, the probable cause was eliminated and the treatment chosen was the observation. However, at eight years post-trauma, a radiographically visible apical lesion was diagnosed, and the tooth did not respond to pulp tests and had light sensitivity to percussion (Figure 2a). Left central incisor 21 showed no lesion, symptomatology or signs of pulp necrosis.\nAlthough radiography showed complete PCC, this exam is not the gold standard. A cone beam computed tomography (CBCT) is the indicated exam to evaluate anatomy of the pulp canal and degree of calcification in detail. However, the CBCT exam was not available in our public service. At this moment, there were two treatment plans: to perform a conventional endodontic treatment or to perform a periapical surgery. Faced with the difficulty of executing conventional endodontic treatment due to the extreme calcification of the root canal and the risk of perforation and/or incomplete endodontic treatment, the clinical treatment plan established was periapical surgery and apical root sealing with MTA-based (MTA, Angelus, Londrina, PR, Brazil) endodontic cement. Also, any marginal bone loss due to perforation would have compromised the tooth because of the reduced root height. The patient was informed about the treatment plan and consented to undergo it.\nThe surgical procedure was performed under local anaesthesia using mepivacaine 3% with epinephrine 1:100,000. An intrasulcular trapezoidal incision was performed to provide an adequate surgical field and access to the apical area. The flap was reflected and spherical burs #5 (Microdent, Sao Paulo, Brazil) were used to cut and scrape the bone to access the root apical area of tooth 11 (Figure 2b). Periapical curettage was performed in order to remove granulation tissue (Figures 2bd). Due to the decreased length of the root, only a slight apical wear was performed. To prevent root perforation, preparation and regularisation of the apical cavity were performed until intracanal resistance was felt. Therefore, the preparation was limited to the apical third. Retrograde filling was done with MTA.\nThe mucoperiosteal flap was sutured in position, and a periapical radiograph was taken to confirm the accuracy of the retrograde filling of tooth 11. The post-operative period was uneventful, and the lesion was diagnosed as apical granuloma. In the six-month follow-up, a periapical radiograph showed a slight radiolucency consistent with scar tissue (Figure 3a). At 53 months, no apical lesions, root resorption or bone loss were observed (Figure 3b). In this case report, the periapical surgery was successful. The sensibility disappeared, the lesion decreased and the patient had no complaint. The intraoral evaluation presented periodontal health without mobility or any signs of infection.",
"gender": "Male"
}
] |
PMC7757964
|
[
{
"age": 37,
"case_id": "PMC9553713_01",
"case_text": "A 37-year-old female patient reported to the Department of Periodontics, Sree Mookambika Institute of Dental Sciences, Kulashekaram, Tamil Nadu, India, with a chief complaint of swelling of gums in the upper front tooth region. The medical history revealed that the patient reported to the hospital 9 months back as she felt a lump on her left breast. An incision biopsy was done and was pathologically diagnosed as invasive ductal carcinoma of histological grade II. Modified radical mastectomy (lumpectomy with axillary clearance) was done to remove the lump and involved axillary lymph nodes (levels I and II). Following the surgical removal, the patient was advised to start a course of radiotherapy and chemotherapy. The patient delayed the treatment by one month and later reported to the hospital with a complaint of memory loss, following which a positron emission tomography (PET) scan was done which showed the presence of brain metastasis. Palliative whole brain radiotherapy of 3000 cGy was administered, divided into 10 fractions. While on radiation treatment, the patient presented with multiple flaccid blisters, erythematous erosions spread throughout the body and was diagnosed as Steven Johnson syndrome (probably anti-epileptic drug induced) and this was managed conservatively. The patient was then started on chemotherapy 14 days later with paclitaxel. During chemotherapy, the patient developed a swelling of the gums which was symptomatic and hence was referred to the Periodontics department for further management. The swelling occurred 9 months after the initial breast swelling was noticed.\nOn intra-oral clinical examination, a dumbbell-shaped swelling of the gums was seen extending from the buccal aspect through the interdental space to the palatal aspect in the upper maxillary teeth (between 11 and 21). The swelling on the buccal aspect appeared smooth and shiny, while the palatal swelling had a more irregular surface. The swelling was reddish pink in color. The dimension of the buccal swelling was 16 mm x 11 mm and the palatal swelling was 13 x 12 mm approximately (Figures 1(a) and 1(b)). The patient reported that the swelling was initially small and grew at a rapid rate to the current size within a span of 2 weeks, causing an increase in space between the central incisors. The patient also had a history of occasional pain and bleeding from the palatal side of the swelling. Plaque and calculus deposits were present with generalized gingival inflammation. On general examination, the patient presented with cancer cell deposits, presenting as a painless nodular swelling with a central necrotic crust on the tip of the middle finger of the right hand involving the fingernail, chin, scalp, and the upper arm (Figure 2).\nRadiographic analysis was done to check for bony involvement and periapical radiographs showed bone loss extending beyond the middle third of the root in relation to 11 and 21. Cone beam computed tomography (CBCT) evaluation revealed that the height of maximum bone loss in the mid-alveolus region of 11 and 21 measured about 10.80 mm (Figures 1(c) and 1(d)). A panoramic radiograph was also taken to rule out the presence of other lytic bony lesions involving the jaw bones. Prior to surgery, routine hematological investigations were done and the reports showed that the blood parameters were just above the normal range.\nA wide excision of the lesion was planned to remove the entire swelling with a 2 mm margin of healthy tissue using a 15c blade. On the removal of the lesion, the exposed underlying bone showed a moth-eaten appearance, which is characteristic of lytic lesions of the bone (Figure 3). The large defect was sealed with a gelatin sponge, sutures were given, and a periodontal dressing was placed to shield the surgical site. The patient was prescribed antibiotics and analgesics. Post-operative review after 3 months revealed satisfactory healing of the wound.\nHistopathology of the hematoxylin and eosin-stained soft tissue section showed an atrophic ulcerated stratified squamous epithelium in association with a fibrovascular connective tissue. The connective tissue showed infiltrating solid islands of malignant epithelial tumour cells arranged in groups and clusters. The tumour cells were polygonal with eosinophilic cytoplasm and open-faced nuclei. Cells have pleomorphic hyperchromatic nuclei. The tumour cells showed numerous mitotic figures. Some of the dysplastic islands showed central necrosis resembling comedonecrosis. Focal areas of the tumour cells showed cytoplasmic clearing. The associated connective tissue was fibrovascular and scanty. The histopathological features were suggestive of infiltrating poorly differentiated adenocarcinoma (Figure 4). The tissue specimens were sent for immunohistochemistry (IHC) for confirmatory diagnosis. IHC evaluation showed that tumour cells were positive for cytokeratin (Pan CK) and specifically for CK7 while showing negative results for oestrogen receptor (ER), human epidermal growth factor receptor (HER)-2, GATA binding protein (GATA) 3, and thyroid transcription factor (TTF)1.\nAfter excision of the gingival enlargement, a PET scan was done which revealed extensive Fluorodeoxyglucose (FDG) avid metastases in the brain, lung, liver, pancreas, nodes, subcutaneous and intramuscular soft tissue nodules, and sacrum (Figure 5). FDG avid lesions in both breasts were also seen. Compared with the previous PET-CT, the reports suggested progression of the disease. The patient was started on chemotherapy:Eribulin in view of disease progression. Unfortunately, fourteen months after the detection of the primary breast cancer tumour the patient passed away.",
"gender": "Female"
}
] |
PMC9553713
|
[
{
"age": 84,
"case_id": "PMC5623757_01",
"case_text": "An 84-year-old patient with a history of Parkinson's disease was admitted to the cardiology ward because of chest pain. The day after admission, the patient complained of shaking limbs, for which the neurologist was consulted. Neurologic examination showed a pronounced negative myoclonus (Video 1). Laboratory examination including electrolytes, liver and renal function, thyroid function, glucose, and arterial blood gas was performed, showing no abnormalities. The patient had been using ciprofloxacin 500 mg twice a day for 5 days for a urinary tract infection. The ciprofloxacin was discontinued after which the negative myoclonus disappeared within 1 day.\nNegative myoclonus is characterized by a brief sudden loss of muscle activity in agonist muscles followed by a compensatory jerk of the antagonistic muscles, appearing as involuntary jerky movements. Negative myoclonus may be of cortical or subcortical origin. Cortical negative myoclonus may be caused by epilepsy syndromes and a variety of acquired factors, such as focal brain lesions. Subcortical myoclonus occurs mainly in toxic-metabolic encephalopathy, caused by electrolyte disturbances, liver and respiratory failure or several drugs. To our knowledge, negative myoclonus has not been previously described in association with the use of ciprofloxacin. However, several neurotoxic effects have been associated with the use of quinolones, including seizures, extrapyramidal manifestations, and positive myoclonus. The hypothesized mechanism of the neurotoxicity is inhibition of gamma-aminobutyric acid (GABA-A) receptors and activation of excitatory N-methyl-D-aspartate (NMDA) receptors, leading to a toxic encephalopathy. Patients with prior central nervous system disease, such as Parkinson's disease, impaired renal function, and advanced age may be particularly vulnerable.\nIn patients with negative myoclonus, laboratory examination and medication evaluation should be performed to identify the underlying cause. The differential diagnosis of negative myoclonus includes positive myoclonus and tremor. Electrophysiology can assist with determining this; however, this was not performed in our patient. The treatment includes correction of electrolyte disturbances or, like in our case, cessation of the provocative drug. If the negative myoclonus persists, neuro-imaging and/or emergent EEG may be useful to analyze other causes. If necessary, benzodiazepines such as clonazepam or anti-epileptic drugs can be administered to suppress the symptoms.",
"gender": "Unknown"
}
] |
PMC5623757
|
[
{
"age": 8,
"case_id": "PMC6095991_01",
"case_text": "A forty-eight year-old, right-handed female was admitted for gait disturbance and unusual movement of the left hand. She was treated for fever and cough before hospitalization. While her fever abated immediately, she had balance problems in walking and standing. Her past medical history was uneventful and there was no family history of optic neuritis, myelitis or NMOSD. She was alert and had no abnormal physical findings. On neurological examination, there was no weakness in muscles and no sensory disturbance, but she had uncoordinated movement in her both lower limbs in performing heel-knee test, and her gait was wide-based, and could not perform a tandem gait test. Neuropsychological examination revealed signs of the following corpus callosal disconnection syndromes: diagonistic apraxia, tactile anomia in the left hand, crossed tactile disorientation, crossed optic ataxia, alexia of the left visual field, auditory extinction of the left ear.\nWith diagonistic apraxia, she experienced bizarre movements in her left hand while changing her clothes and having meals. When taking a meal, her left hand involuntarily grabbed her rice bowl, while her right hand was selecting and picking food from a dish with chopsticks. The errant hand came under control when reprimanded verbally.\nIn laboratory testing, erythrocyte sedimentation rate was elevated 30 mm/1 h and 48 mm/2 h. Anti-aquaporin 4 (AQP4), Anti-Sjogren's syndrome-related antigen A (anti-SS-A), anti-SS-B, and anti-Mycoplasma pneumoniae-IgM antibodies were positive. Cerebrospinal fluid findings were lymphocytosis (9/muL), elevated protein content of 52 mg/dL, elevated myelin basic protein level of 1221.5 pg/mL (normal <102 pg/ml) and elevated IgG index of 0.9 (normal <0.8). The oligoclonal bands were negative. Her chest X-ray and CT examinations were normal.\nBrain MRI showed high-signal intensities of the entire corpus callosum from genu to splenium (Figures 1A,B). The lesions on the corpus callosum were a mixture of patchy low and high-intensity signals. She had prodromal infection, elevation of cells and myelin basic protein in cerebrospinal fluid, and lesions in the corpus callosum on brain MRI. Multiple sclerosis, NMOSD, acute disseminated encephalomyelitis, clinically mild encephalitis/encephalopathy with a reversible splenial lesion due to mycoplasma infection or vasculitis were considered as differential diagnoses. Because Anti-AQP4, anti-SS-A, and anti-SS-B antigens were positive and salivary gland biopsy revealed inflammatory cell infiltration with lymphocytes and plasma cells, the patient was diagnosed with anti-AQP4-seropositive NMOSD with SS.\nAfter intravenous steroid pulse therapy (1,000 mg of methylprednisolone for 3 days) was performed twice and the following symptoms improved; ataxia of the legs, unsteadiness in standing and walking, callosal disconnection syndromes such as left-hand diagonistic apraxia, left hand tactile anomia, crossed tactile disorientation, crossed optic ataxia, and left-visual field alexia. However, the patient's corpus callosum lesion was still edematous on MRI, and auditory extinction of left ear remained. Intravenous immunoglobulin (IVIg) was begun on day 21 for 5 days but changed little. She was discharged on day 40 with subsequent treatment of tapered prednisolone at 40 mg/day. Azathioprine 100 mg was also added. One year later the left-field alexia disappeared. A mottled signal inside the corpus callosum also remained (Figures 1C,D).",
"gender": "Female"
}
] |
PMC6095991
|
[
{
"age": null,
"case_id": "PMC6580008_01",
"case_text": "A 83-old lady, a known case of pulmonary emphysema, presented to our hospital with right upper quadrant pain evolving since 3 days. On clinical examination, the patient was febrile, hemodynamically stable, with tenderness in the right upper quadrant and a palpable tender gallbladder. Laboratory tests showed leukocytosis (WBC-16000 cell/ mm3) and liver function tests were normal.\nThe abdominal ultrasonography revealed a distended gallbladder with thickened edematous wall and surrounding loculated ascites. No gallstones were seen and the intrahepatic and extrahepatic bile duct were not dilated. Abdominal computed tomography (CT) revealed the presence of a distended, floating gallbladder measuring 12.2 x 8.2 x 7.6 cm located outside its normal fossa with thickened non-enhancing wall and a twisted pedicle (Fig. 1).\nThe diagnosis of acute cholecystitis complicating gallbladder volvulus was made. Intravenous\nfluid, broad spectrum antibiotics and analgesics were administrated followed by emergency laparotomy via right subcostal incision, the laparoscopic approach was refused by the anesthetist due to the history of pulmonary emphysema. At surgery, a distended gangrenous gallbladder was found. The gallbladder was completely rotated anticlockwise (360 ) around the cystic artery and the cystic duct (Fig. 2). After untwisting, it was found that the gallbladder had a complete long mesentery held closely to the liver (Fig. 3). Cholecystectomy was performed and suction drain was placed in the right subhepatic space. The postoperative course was uneventful. Histology revealed transmural gallbladder necrosis.",
"gender": "Female"
}
] |
PMC6580008
|
[
{
"age": 69,
"case_id": "PMC9098366_01",
"case_text": "A 69-year-old male patient presents with a chief complaint of neck pain of several weeks, radiating to the head and right shoulder. The pain is reported to be intermittent, burning in quality, associated with weakness and numbness especially in the right hand. The patient has a past medical history of hypertension, hyperlipidemia, benign prostatic hyperplasia, DVT/pulmonary embolus in the past year for which he is on anticoagulant therapy, and a surgical history of bilateral knee replacement within the past two years. The patient has no history of neurofibromatosis or stigmata of another genetic disorder. Upon physical examination, the patient has right hemiparesis (-4/5) that has mildly progressed compared to prior examination. MRI of the cervical spine (performed at an outside institution) reveals a T1 hypointense and T2 heterogeneously hyperintense extramedullary mass causing impingement upon the right side of the spinal cord which is flattened and displayed to the left at the C2-C3 level. The mass measures approximately 35 mm in transverse diameter by 13 mm in AP diameter by 18 mm in craniocaudal diameter and laterally extends through the right C2-C3 neural foramen. The radiologic impression is that of a nerve sheath tumor of either benign or malignant nature (no images available). Surgery is recommended, and the patient undergoes a C2-C3 laminectomy at an outside institution with resection of the tumor. Intraoperatively, the tumor is seen on the right side of the canal with the cord. Dorsolaterally, the tumor appears to blend in with the dura at its base. The junction is coagulated with bipolar cautery. Then, some of the tumor is debulked along the base, allowing it to shrink away from the cord laterally. Working around the superior pole of the tumor then reveals rootlets that appear to be joining the tumor to the right superior pole along its posterior aspect. Attempting to dissect to release it reveals that the rootlets were not just adherent to the capsule but rather growing into the tumor. The rootlets are hence cauterized and amputated at base. The tumor is removed in piecemeal fashion, and the tissue is sent to pathology. Grossly, the specimen consists of multiple pieces of light tan, firm tissue measuring in aggregate (2.0 x 1.6 x 0.3 cm).\nThe slides are sent to our institution for review. Microscopic examination reveals fragments of a benign nerve sheath tumor comprised of Schwannian cells arranged in loose fascicles set in an eosinophilic stroma with occasional hyalinized vessels and Verocay bodies, compatible with Schwannoma (Figures 1(a) and 1(b)). Also present was a small separate fibrous fragment with psammomatous calcifications and vaguely nested bland spindled to ovoid cells with focal crush artifact (Figure 2(a)). No necrosis or mitotic figures are identified. Immunohistochemical stains are performed and show that the tumor cells are diffusely positive for S100 and SOX-10 in the Schwannoma component (Figures 1(c) and 1(d)). The small fibrous fragment, on the other hand, is negative for SOX-10 (Figure 2(b)) and shows weak staining for S100 while PR and CD34 show patchy weak staining and EMA and SSTR2A are positive (Figures 2(c) and 2(d)) thus compatible with a meningothelial origin. HMB-45, Melan A, and STAT6 are negative.\nThe overall histopathological and immunohistochemical findings are compatible with Schwannoma with a small focus of benign meningothelial proliferation compatible with benign meningothelial hyperplasia. MRI with and without contrast performed three months after the surgery shows postoperative changes of subtotal resection of the enhancing mass centered about the right C2-C3 foramen, with a residual 21 x 10 x 16 mm (axial long axis x axial short axis x craniocaudal) right neural foraminal mass and significant improvement in the spinal cord compression. At six month postsurgery, MRI demonstrates improved postsurgical changes with redemonstration of the residual spinal enhancing mass at the right C2-C3 neural foramen extending into the spinal canal with minimal mass effect on the spinal cord on the right aspect of the cord at this level. No further available clinical data could be obtained due to the patient being lost to follow-up.",
"gender": "Male"
}
] |
PMC9098366
|
[
{
"age": 28,
"case_id": "PMC8636095_01",
"case_text": "A 28-year-old pregnant woman, 12 gestational weeks in July 2019, attracted our attention for recurrent abortions, as well as being strongly positive of anti-SSA /Ro and antinuclear antibodies, suspected fetal autoimmune associated AVB without cardiac structural abnormality.\nThe first pregnancy of this woman was in March 2017 but it resulted in a spontaneous abortion at 50+ days of pregnancy. Her second pregnancy in February 2018 was a biochemical pregnancy. Subsequently, a thyroid function test suggested hypothyroidism and was successfully treated by oral thyroxine. Whereas, strongly positive antinuclear antibody (granular type) with a titer of 1:1,000 (normal reference value is negative) and anti-SSA/Ro antibody with a quantitative >400 RU/ml (normal reference range 0 to <20 RU/ml) of the patient was revealed and was diagnosed of undifferentiated connective tissue disease by entomologist, and was given hydroxychloroquine (200 mg, twice a day), tacrolimus (500 mg, twice a day), and low-dose methylprednisolone (4 mg, once a day). Except for repeated abortions, the patient had not complained of photosensitive rash, thrombosis, joint pain, and arthritis, Raynaud's phenomenon, xerophthalmia, or xerostomia.\nThe patient was pregnant the third time in July 2019, and the re-examination of autoantibodies revealed antinuclear antibody-positive (particle type) with a titer of 1:320; anti-SSA/Ro antibody-positive with a quantitative >400 RU/ml. As the pregnancy progressed, monitoring the patient's serum antibody revealed that the anti-Sm antibody gradually became positive (>400 RU/ml, the normal reference range 0 to <20 RU/ml), but there was still no clinical sign of connective tissue disease. Hydroxychloroquine (200 mg, twice a day), tacrolimus (500 mg, twice a day), and low-dose methylprednisolone (4 mg, once a day) continued.\nThe patient was transferred to our hospital due to recurrent abortion and undifferentiated connective tissue disease by a local obstetrician and endocrinologist. Considering that the first two pregnancies of the patient were both early miscarriages, it is still uncertain whether there exited fetal immune heart injury in the first two pregnancies, and they might be probands of fetal immune heart damage to this pregnancy. Existing epidemiological studies suggest that the risk of fetal AVB will be significantly increased in a pregnancy with a previously affected fetus or neonate, and the role of fetal genetic susceptibility in the development of autoimmune:associated fetal AVB cannot be ignored. Therefore, we classified this pregnancy as a high-risk pregnancy of cardiac immune attack. During the whole pregnancy, the fetal AV interval and maternal serum autoantibody titers were regularly monitored. The mother was generally in good physical condition during pregnancy and no abnormal findings in the ECG and echocardiogram examinations.\nAt 12 weeks of gestation, we monitored the fetal echocardiogram and found that there exited strong light points about 2 mm in diameter in the left ventricular, as well as enhanced endocardial echo image, which indicated that the fetal heart might exit a certain degree of immune injury. At the same time, the fetal echocardiogram monitoring indicated that the AV interval was within the normal range (104-112 ms). Considering the relatively high incidence of fetal heart immune-mediated cardiac conduction injury in pregnancies that suffer from immune-mediated fetal congenital heart block, avoiding the occurrence of miscarriage or stillbirth, and potential fetal AVB, dexamethasone and intravenous immunoglobulin (IVIG) were treatment options according to the treatment regimens reported in previous literature.\nAfter fully understanding the advantages and disadvantages of dexamethasone and IVIG, the patient determined to adopt IVIG treatment (Chengdu Rongsheng Pharmaceutical Co., LTD., 2.5 g, 50 ml/bottle). According to the characteristics of IVIG, and the reported usage in the literature, the patient received IVIG 1 g/kg twice a week at 12 and 13-week of pregnancy, respectively. Encouragingly, in a reexamination of the fetal echocardiogram, the enhanced echoes and endocardial echo enhancement of the left ventricle gradually disappeared, and the AV interval was normal without a tendency of prolongation. Meanwhile, the maternal serum antibody titers showed a downward trend after receiving IVIG (Table 1).\nThen, the frequency of IVIG treatment was adjusted to once every 2 weeks, 1 month later, regarding fetal stable condition, and then adjusted once a month. However, at 25 + 6 weeks of gestation, a gradual prolongation of the AV interval was observed, increasing from 106 ms to 130-140 ms. Although the AV interval was still within the normal range, the rapidly extending within 1 week was urgent. In order to avoid progressive prolongation of the fetal AV interval, we upregulated the frequency of IVIG treatment to once every 3 weeks based on the half-life of immunoglobulin in human circulation (21 days). After adjusting the frequency of IVIG treatment, the AV interval of the fetal heart gradually returned to the previous condition. The last IVIG dosage was given at 33 + 6 GW. The fetal condition during pregnancy and maternal serum antibody level are shown in Table 1, and the use of IVIG is shown in Figure 1.\nFetal echocardiography was regularly performed until successful delivery, and there were no signs of fetal arrhythmia and/or cardiac malformations. Cesarean section was performed at 39 weeks of gestation and a male newborn was born with a birth weight of 2,940 g. The amniotic fluid was clear at birth, the Apgar score was 10 points, and there were no abnormalities in the placenta or expectation.\nThe newborn underwent a comprehensive physical examination after delivery and received blood routine tests, thyroid function tests, and echocardiography examination 3 days after being born, all showed within normal range. The electrocardiogram of the newborns was also performed on the first day after birth, and the results were normal with a PR interval of 104 ms, as well as the Holter monitoring. Meanwhile, the serum autoantibody examination of the baby showed positive results of anti-Sm antibodies (quantitative >400 RU/ml), anti-SSA/Ro antibodies (quantitative 148.7 RU/ml), and antinuclear antibodies (titer 1:100).\nAt 1-, 3-, 6-, 12-, 18-month follow-ups, the growth and development, ECG, and echocardiography of the baby were normal. Additionally, all the serum antibody titers also turned negative at 3- or 6-month of follow-up (Table 2).\nDuring the post-partum period, the mother remained asymptomatic and showed no signs of aggravation of the disease. The monitoring of maternal serum autoantibody level within 6-month follow-up indicated a gradual decline. While the recent laboratory tests showed that anti-Sm antibodies with quantitative >400 RU/ml, anti-SSA /Ro antibodies with quantitative 282.2 RU/ml, and antinuclear antibodies with titrum 1:320.",
"gender": "Female"
}
] |
PMC8636095
|
[
{
"age": 65,
"case_id": "PMC4247007_01",
"case_text": "In January 2013, a 65-year-old male presented to Korea University Anam Hospital (Seoul, Republic of Korea), with an intra-abdominal mass that was localized to the right side. The mass had presented one month previously. In addition, the patient had experienced weight loss (5 kg) during the previous four months. The medical history was unremarkable, with the exception of pulmonary tuberculosis 30 years previously, from which the patient had recovered. On physical examination, a round mass was palpated and there was tenderness of the right upper quadrant area. Hematological examination revealed a marginal decrease of hematocrit (35.8%; normal range, 37-51%) and hemoglobin (11.8 g/dl; normal range, 12.6-17.4 g/dl). Liver function tests revealed elevated alkaline phosphatase (423 IU/l; normal range, 30-120 IU/l) and gamma-glutamyl transferase (587 IU/l; normal range, 9-64 IU/l) levels. Aspartate aminotransferase, alanine aminotransferase and bilirubin levels were within the normal ranges of 3-45 IU/l, 3-45 IU/l and 0.0-0.4 mg/dl, respectively. An upper gastrointestinal endoscopy revealed a subepithelial mass with a fistulous hole on the second portion of the duodenum (Fig. 1). A total colonoscopy revealed no abnormalities. A computed tomography (CT) scan, which was acquired from the referring local clinic (Choi Kang Sik Internal Medicine, Seoul, Republic of Korea), demonstrated a large, heterogeneously enhanced lobulated mass (11.5x9.3 cm; longest diameter x greatest perpendicular diameter) with internal necrosis at the pancreaticoduodenal groove (Fig. 2A). The internal cavity of the mass was connected to the second portion of the duodenum, which was consistent with the endoscopic findings. Furthermore, an ill-defined low-attenuation lesion was identified at segment eight of the liver, abutting the bile duct and hepatic artery (Fig. 2B). Significantly enlarged lymph nodes were not observed in the abdominal cavity. In addition, a fludeoxyglucose positron emission tomography (FDG-PET) scan also revealed hypermetabolic masses in the duodenal groove and in segment eight of the liver, which was consistent with the CT scan. Abdominal MRI (magnetic resonance imaging) was also conducted for further characterization of the duodenal and hepatic masses observed on the CT scan, which confirmed the same findings. An ultrasound-guided needle biopsy of the duodenal mass was performed and pathological examination identified whirling sheets of spindle-shaped cells (Fig. 3A). Immunohistochemical staining was positive for c-Kit, but negative for cluster of differentiation 34, S-100 and desmin (Fig. 3B). Mitotic features could not be evaluated, as a surgically excised sample was not obtained. The diagnosis of high-risk GIST with hepatic metastasis was determined and the patient was treated with 400 mg imatinib, daily. The treatment was tolerated well, and the abdominal mass and distension improved significantly. After seven weeks of treatment, the follow-up abdominal CT scan revealed that the duodenal mass had significantly reduced in size (7.9x6.5 cm; longest diameter x greatest perpendicular diameter) and exhibited an increased area of internal necrosis. However, the hepatic mass had increased from 1.7x1.5 cm to 3.9x3.2 cm in diameter (longest diameter x greatest perpendicular diameter) and the right hepatic duct was markedly dilated by the mass (Fig. 4). Various enlarged lymph nodes were observed in the left gastric area, including the porta hepatis and portocaval space. The ultrasound-guided needle biopsy was repeated for the hepatic mass and histopathological examination of the biopsy specimen showed malignant cells with a glandular structure, which was consistent with adenocarcinoma. Immunohistochemical analysis exhibited c-Kit-negative and cytokeratin 19-positive staining (Fig. 5). The final diagnosis was synchronous ICC and GIST. Two weeks after the ultrasound-guided liver biopsy, the patient developed jaundice and a fever, and the total level of bilirubin increased rapidly to 9.4 mg/dl (normal range, 0.0-0.4 mg/dl). Percutaneous transhepatic biliary drainage was conducted along with antibiotic treatment and administration of imatinib was withheld to allow the patient to recover from the condition. An abdominal CT scan following three weeks of conservative treatment revealed an increase in size of the liver mass (5.3x3.9 cm; longest diameter x greatest perpendicular diameter) with portal vein thrombosis, and the size of the duodenal mass had also increased to 9.5x8.7 cm (longest diameter x greatest perpendicular diameter). The treatment regimen became focused towards the ICC, which was associated with a poorer prognosis. Due to the well-known toxicity of combined chemotherapy, administration of imatinib was terminated and the patient was treated with intravenous gemcitabine (100 mg/m2 for 30 min, days 1 and 8) and cisplatin (25 mg/m2 for 1 h, days 1 and 8) every three weeks for four cycles. During chemotherapy, the abdominal mass reappeared, as a follow-up CT scan, performed six weeks following treatment, revealed a prominent increase in the size of the duodenal mass (10.7x10 cm; longest diameter x greatest perpendicular diameter). However, the hepatic mass did not demonstrate a significant change in size during that interval. As the patient had tolerated the initial chemotherapy well, combined chemotherapy (consisting of imatinib, gemcitabine and cisplatin) was initiated for symptom control and treatment of the GIST. The addition of imatinib resulted in the duodenal mass decreasing significantly and the patient exhibited a good response to the treatment. However, certain toxicities are associated with combined chemotherapy, such as grade 1 bone marrow suppression, as observed in the present case. The follow-up CT scan revealed disease progression of the ICC, whereas the size of the GIST mass had decreased. The treatment modality was altered, due to refractory cholangiocarcinoma, from chemotherapy to radiation therapy (daily dose of 180 Gy), whilst maintaining the imatinib treatment. To date, the patient has been undergoing treatment for one year and is tolerating the treatment well.",
"gender": "Male"
}
] |
PMC4247007
|
[
{
"age": 55,
"case_id": "PMC9047901_01",
"case_text": "A 55-year-old male underwent thoracoscopic-assisted small-incision radical resection of lung cancer in October 11, 2017 after diagnosis of lung adenocarcinoma (stage pT1bN0M0, IA) ( Figure 1 ). His postoperative regular magnetic resonance imaging (MRI) and computerized tomography (CT) examinations showed no obvious abnormalities. Two years later (on October 12, 2019), the patient started to experience headache, blurred vision, and hearing loss. On October 31, 2019, his brain MRI exam showed multiple brain masses including multiple metastases in the lateral ventricle, right frontal lobe, and cerebellar hemisphere ( Figure 2A ). His genetic testing revealed the L858R mutation in exon 21 of EGFR. His positron emission tomography (PET) CT scan suggested bone metastasis ( Figure S1 ). The patient was then treated with osimertinib (80 mg oral administration daily), bevacizumab (7.5mg/kg q3w), and bisphosphonate (4mg q3w). After treatment for 1 month, his symptom of headache almost disappeared, but he developed blurred vision and unstable walking on both feet. On 2020-1-4, the patient complained increased blurred vision and occasional headache. On 2020-4-21, his brain MRI ( Figure 2B ) showed multiple dot-line enhancements (masses) in the cerebellar sulci, suggesting meningeal metastasis. On 2020-4-30, the patient underwent cerebrospinal fluid (CSF) cytology examination and cancer cells were found in the cerebrospinal fluid, which was in line with the characteristics of adenocarcinoma cells ( Figure 2C ). His CSF genetic testing results in May 2020 showed that mutations were EGFR p.L858R, TP53 p.R273C and ERBB2 p.S442L ( Figure 3A ). The patient was then treated with whole brain radiotherapy (40Gy/20 fractions). Between July 2020 and December 2020, the patient was treated with osimertinib (80 mg oral administration daily), anlotinib (12mg d1-14, q3w), pemetrexed (500mg/kg q4w), and temozolomide (300mg d1-5, q4w). Then, the patient experienced less headache. The re-test of the CSF samples showed that the mutations included EGFR p.L858R, TP53, ERBB2, and others (October 28, 2021). ( Figure 3A ). In January 2021, due to the continued elevated levels of tumor marker carcinoembryonic antigen (CEA) in his CSF ( Figure 3B ) and based on his CSF genetic test results, his treatment was switched to dacomitinib (30mg po qd), olaparib (100mg po bid), anlotinib (8mg po d1-14,q3w), pemetrexed (500mg/m2, q3w), and temozolomide (200mg/m2 d1-5, q4w). The patient's condition was stable after adjusting the treatment plan. His level of CEA was stable ( Figure 3B ), and his brain MRI showed no progression of the brain metastasis. The efficacy evaluation during the treatment period is shown in Figure 4 . In addition, after switching to targeted therapy, the patient no longer experienced obvious headache and dizziness, and his quality of life was significantly improved. Although he had the 2nd degree bone marrow suppression, there was no obvious functional damage of the liver and kidney during the process of treatment. The patient died of cachexia caused by the tumor in June 2021. Based upon, targeted drug therapy helped this patient obtain 6 months of progression-free survival (PFS). After the diagnosis of CNS metastases, although he was no longer sensitive to osimertinib, his overall survival reached 13 months which might be benefited from the treatment of olaparib in combination with dacomitinib.",
"gender": "Male"
}
] |
PMC9047901
|
[
{
"age": 59,
"case_id": "PMC7175777_01",
"case_text": "A 59-year-old man who presented with fever, headache, and awkward speech which specifically manifested as slow and unclear speech, was admitted to the hospital. He denied recent infections such as flu or gastroenteritis, travel, and other possible reasons, which could be responsible for the fever, which peaked at 39.5 C. Previous medical history revealed gout for 20 years, but no drugs were prescribed. His neurological examination and cranial computed tomography (CT) and magnetic resonance imaging (MRI) (Figure 1) scans were normal. EEG results showed minor irregularities in waves (5-20 muv 14-20 Hz beta) emitted from the bilateral hemispheres. Blood routine, C-reactive protein, serum vitamin B12, and folic acid, as well as other autoimmunity makers containing antinuclear antibody (ANA), anti-neutrophil cytoplasmic antibodies (ANCA), and rheumatoid factors were all unremarkable. The cerebrospinal fluid (CSF) showed an increased white blood cell (WBC) count (104 x 106/L, reference range 0-8 x 10^6/L) and elevated protein levels (1.68 g/L, reference range 0.15-0.45 g/L). Culture, smear, and bacterial, fungal, viral, and tubercle bacillus antibodies in the serum and CSF were negative. He was diagnosed with viral encephalitis and treated with antiviral agents. His symptoms eased within a week and he was discharged from the hospital. Five months later, he was referred to our hospital again due to a fever of 38.5 C and occasional sentence confusion. Another lumbar puncture was performed; the CSF had a WBC count of 39 x 10^6/L and the protein content was 1.32 g/L. The cranial MRI and laboratory test findings were almost normal except for decreased thyroid function and increased anti-thyroid autoantibody (ATA) levels in the serum and CSF. The initial findings were as follows: in the serum, the thyroid stimulating hormone (TSH) concentration was 43.39 uIU/ml (reference range (RR): 0.27-4.2 uIU/ml), free triiodothyronine (FT3) concentration was 2.89 pmol/ml (RR: 3.1-6.8 pmol/ml), free thyroxine (FT4) concentration was 7.18 pmol/ml (RR: 12.0-22.0 pmol/ml), total triiodothyronine (TT3) concentration was 1.17 pmol/ml (RR: 1.3-3.1 pmol/ml), and total thyroxine (TT4) concentration was 44.26 pmol/ml (RR: 66-181 pmol/ml); the titer of anti-thyroglobulin autoantibodies (TgAb) was 1274 IU/ml (RR: < 115 IU/ml) and the titer of anti-thyroperoxidase autoantibodies (TPOAb) was 600 IU/ml (RR: < 35 IU/ml). In the CSF, ATA was positive (TPOAb 17.06 IU/ml, TgAb 16.02 IU/ml). Ultrasound imaging indicated diffuse lesions of the thyroid. Antibody analysis of anti-NMDAR, AMPA1, AMPA2, LGI1, CASPR2, GABA, GAD, anti-Hu, Yo, Ri, MAI, MA2, CV2, Amphiphysin, SOX-1, Tr, Zic4, and GAD65, were all negative in both the serum and CSF. The patient was ultimately diagnosed with HE, Hashimoto's Thyroiditis, and hypothyroidism and prescribed methylprednisolone and Euthyrox. Methylprednisolone was started at a dose of 80 mg/day for 1 week and reduced to 40 mg/day in the 2 week; subsequently, oral prednisolone was prescribed, which was weaned at a rate of 5 mg per week, that is oral prednisolone was used for a total of 8 weeks. His symptoms were relieved in 3 days. The patient remained healthy during a follow up period of 1 year.",
"gender": "Male"
}
] |
PMC7175777
|
[
{
"age": 57,
"case_id": "PMC5494058_01",
"case_text": "A 57-year-old man presented to the hospital with a two-month history of vague \"on-and-off\" abdominal discomfort. No associated symptoms such radiating pain, weight loss, hematuria, or change in bowel habits were reported by the patient. The patient's medical, surgical, and family history were irrelevant. He also had no history of smoking. Physical examination revealed a soft lax abdomen with unremarkable systemic examination. The results of laboratory investigations, including a complete blood count, blood chemistry, serum urea, and urine analysis, were normal. An abdominal computed tomography (CT) scan showed a well-defined heterogeneous enhancing lesion measuring 2 x 1.5 cm located at the posterolateral upper pole of the left kidney. The lesion was in close proximity to the spleen. There was no evidence of hydronephrosis or kidney stones. The renal vein was patent. These findings suggested renal cell carcinoma (Figure 1). Two weeks later, the patient underwent left partial nephrectomy. The resected specimen was sent for histopathological analysis. Gross examination revealed a well-circumscribed but uncapsulated white-tan soft mass with homogenous cut surface measuring 2 x 1.5 x 1 cm located at the upper pole of the left kidney. The mass abutted but did not invade the renal capsule. No areas of necrosis were seen. No gross abnormality was observed in the rest of the renal parenchyma. Microscopic examination reveals a well-demarcated lesion composed of sheets of cells that were admixed with large, gaping, dilated cavernous-like spaces filled with blood (Figures 2(a) and 2(b)). These cells are monotonous, small, and round to oval, each containing a moderate amount of eosinophilic to amphophilic cytoplasm (Figures 2(e) and 2(f)). No pleomorphism was present. There was no evidence of necrosis (Figure 2(c)) or increased mitotic activity of more than 2/50 high-power field (HPF) (Figure 2(d)). No atypical mitosis was seen. High-power examination showed small nuclei with fine chromatin (Figure 2(f)) and smooth nuclear membrane embedded in a myxoid stroma (Figures 2(g) and 2(h)); other adjacent areas revealed hyalinized stromal reaction (Figure 2(d)). Capsular and lymphovascular invasion were not observed. Tumor cells showed diffuse and strong positivity for smooth muscle actin (alpha-SMA) (Figure 3(a)), vimentin, and pericellular net-like positivity for collagen type IV (Figure 3(b)). The tumor was negative for cytokeratins 7 and 20, RCC antigen, cluster of differentiation (CD10), epithelial membrane antigen (EMA), desmin, CD34, CD117, CD 99, synaptophysin, chromogranin, S100, renin, Melan A, and human melanoma black-45 (HMB-45). Periodic acid-Schiff (PAS) stain failed to reveal any cytoplasmic granules in any of the examined cells. CD31 and CD34 highlighted the vascular spaces and capillary network only. Ki67 index was less than 2%. Altogether, histopathology and immunohistochemical revealed findings consistent with primary glomangioma (glomus tumor) of the kidney. One year after surgery, a follow-up examination revealed that the patient was doing well and no tumor recurrence and/or metastasis was detected.",
"gender": "Male"
}
] |
PMC5494058
|
[
{
"age": 12,
"case_id": "PMC6282132_01",
"case_text": "A 12-year-old female with SW-CAH presented to the pediatric endocrinology clinic for routine follow-up. She was diagnosed with SW-CAH in the newborn period after presenting with ambiguous genitalia and was treated with supraphysiologic hydrocortisone divided three times daily throughout her life (prepubertal dosing range 10-15 mg/m2/day, pubertal dosing range 15-25 mg/m2/day), as well as fludrocortisone (0.1 mg daily). She was monitored every 3-4 months with clinical examinations, growth parameters, and serum measurements of 17-hydroxyprogesterone (17-OHP), androstenedione, and testosterone (Esoterix Laboratory, Calabasas Hills, CA), which together guided her medication dosing. She had no evidence of glucocorticoid excess and her growth velocity was normal, without evidence of acceleration or suppression. She and her parents reported continued excellent compliance with her medication regimen.\nAt age 12 3/12 years, she reported 3 recent emergency department visits for persistent vomiting without diarrhea, abdominal pain, inability to tolerate oral steroids, and tachycardia. One of the episodes was accompanied by fever >39 C. There was no hypotension during any of these episodes, but heart rates were elevated ranging from 124 to 154 beats per minute. Sodium and potassium were normal: Na 137-140 meq/L (reference range, 133-143 meq/L) and K 3.6-4.1 meq/L (reference range 3.4-4.7 meq/L). Each episode was treated with normal saline boluses and intravenous stress dose steroids, and treatment led to immediate improvement in symptoms. She was discharged from the emergency department with recommendations for stress dose steroids by mouth. Over the prior 9 months, she had also unintentionally lost 2.6 kg and had an accelerated annualized growth velocity of 10.6 centimeters per year. BMI was 15.4 kg/m2 (Z-score -1.38). She denied any heat intolerance, jitteriness, palpitations, sweating, diarrhea, or vision complaints. While in clinic, her resting pulse was elevated at 136 beats per minute and blood pressure was normal. She was noted to have new symmetric thyromegaly without nodules. She had no lid lag or stare. She was in mid-puberty, with tanner 3 breasts. There was no family history of autoimmune disease or thyroid disease. Labs (Table 1) showed a suppressed TSH, and an elevated free T4 and Total T3. Thyroid antibodies were consistent with Graves' disease, with a thyroid stimulating immunoglobulin (TSI) of 652% (reference range <140%). She had no prior thyroid studies for comparison. Adrenal androgens were markedly elevated with 17-OHP 11,600 ng/dl (reference range 11-155 ng/dl, target <1000 ng/dl in SW-CAH). At a clinic visit 15 weeks prior to this evaluation, her 17-OHP on the same dose of hydrocortisone (25 mg/m2/day) was improved at 639 ng/dl. She was initiated on methimazole 0.5 mg/kg/day. Her hydrocortisone dose was not changed and remained at 25 mg/m2/day. Four weeks later, repeat labs demonstrated normal free T4 with mildly suppressed TSH and normal total T3. 17-OHP was stable at 717 ng/dl (Figure 1). She had no further vomiting episodes after initiation of methimazole, and her tachycardia resolved.\nThree months after treatment began for Graves' disease, her TSH and free T4 were in the reference range, and methimazole was decreased to 0.3 mg/kg/day. Repeat 17-OHP was low at 33 ng/dl, indicating suppression on the unchanged hydrocortisone dose of 25 mg/m2/day. Her hydrocortisone dose was decreased to 21 mg/m2/day.",
"gender": "Female"
}
] |
PMC6282132
|
[
{
"age": 41,
"case_id": "PMC6609725_01",
"case_text": "A 41-year-old Caucasian woman presented to the emergency department with four day history of intermittent non-specific chest pain on a background of 30 pack years of smoking history. She also had a history of progressive exertional dyspnea for a few months and also loss of appetite during this presentation. She denied fever, cough, hemoptysis, pleurisy or coryzal symptoms. She had no significant past medical history, in particular, there was no history of diabetes and she was not on any regular medications. She had no significant occupational or travel history of significance. There was no history of exposure to tuberculosis. She was an avid gardener, residing in Darwin, Northern Territory of Australia. She usually walked barefoot in her garden and used large amounts of potting mix while gardening. She denied excessive alcohol consumption or recreational drug usage.\nOn clinical examination, vital signs were normal. Respiratory examination was unremarkable, with normal breath sounds bilaterally and there were no crackles or rhonchi or pleural rub in particular. Cardiovascular examination was also normal. Systemic examination showed no evidence of clubbing, oedema, cyanosis or lymphadenopathy. Her ECG showed normal sinus rhythm without ischemic changes. Blood tests showed white cell count of 11.5 x 109/L with neutrophilia 7.9 x 109/L and CRP was 15 Mg/L, Serial troponins were negative. Liver function, electrolytes, renal function were within normal limits. Quantiferon gold test was negative. Pulmonary function showed FVC of 3.88 L, (97% predicted), FEV1 3.05 L (92% predicted), FEV1/FVC ratio 0.787 (96% predicted), DLCO 77% and TLC 4.75L (89% predicted). Chest X-ray showed an opacity in the right mid-zone (Fig. 1a). She underwent a CT scan of the chest, that showed a mass in the right lower lobe measuring approximately 36 x 22mm suspicious of malignancy. There was no endoluminal bronchial lesion nor mediastinal or hilar lymph node enlargement. (Fig. 1b). Due to the high index of suspicion of lung malignancy, a PET-CT was performed, which demonstrated mild to moderate FDG avidity of the mass in the right lower lobe (Fig. 2a) but no other FDG avid nodal or distant metastatic disease. The patient underwent flexible bronchoscopy that showed no endobronchial lesion, then using the Endobrochial radial Ultrasound (EBUS) probe and utilizing the Guide sheath technique, the lesion was localized in the posterior segment of the right lower lobe. The EBUS images (Fig. 2b) demonstrated a heterogeneous lesion with non-compressed blood vessels and scattered air space shadows. Brushings, biopsies and washings were taken from the guide sheath, along with a transbronchial cryobiopsy from the same site identified by the ultrasound probe. The EBUS-guided biopsy of the lesion showed necrotic tissues and malignant cells were not identified. Culture of bronchial brushings on Ashdown's agar medium, however, grew bacterial colonies which were identified microscopically as gram negative bacilli. Bacterial culture from bronchial brushings was subsequently confirmed as Burkholderia pseudomallei, making the diagnosis of pulmonary melioidosis (Fig. 3). She was treated with intravenous ceftazidime 2 g 6 hourly for 4 weeks, followed by oral sulphamethoxazole/trimethoprim (800mg/160mg) 2 tablets twice a day for 3 months with daily folic acid 5mg. During the follow up visits, the patient demonstrated significant improvement both clinically and radiologically. Her CRP was noted to be < 0.1 Mg/L consistently, with normal white cell and neutrophil counts. Her exertional dyspnea was considered to be related to early airway disease secondary to smoking, possibly aggravated in the presence of pulmonary melioidosis and she was provided with support for smoking cessation.",
"gender": "Female"
}
] |
PMC6609725
|
[
{
"age": 7,
"case_id": "PMC4397003_01",
"case_text": "A 7-year-old girl reported to our hospital with a complaint of pain and swelling in the mandibular left posterior region for one month. The patient gave a history of bleeding from the swelling, which was aggravated upon brushing and chewing. The past medical and dental history were noncontributory. Clinical examination revealed a solitary, well defined, soft tissue growth on the posterior gingiva measuring about 2.5 x 1.5 cm, extending from the lingual and distal aspect of 36 to posteriorly 1 cm short of the anterior border of the ramus. The growth was sessile, dark red in colour, firm in consistency, tender on palpation, and nonfluctuant (Figure 1). Based on the history and clinical presentation a provisional diagnosis of pyogenic granuloma was made. The orthopantomograph showed no bony involvement (Figure 2). The initial clinical differential diagnosis included traumatic fibroma, peripheral giant cell lesion, neurofibroma, schwannoma, and hemangiopericytoma. Excisional biopsy was performed under local anaesthesia.\nHistopathological examination revealed anastomosing squamous surface epithelium with elongated rete ridges. The tumor was composed mainly of streaming and interlacing fascicles of spindle-shaped cells resembling fibroblasts or smooth muscle cells, suggesting myofibroblastic differentiations (Figure 3), and a few mitotic figures. In some areas, the lesional cells appeared to be round or polygonal and closely packed (Figure 4). The findings were suggestive of myofibroma but a definitive diagnosis was warranted. Additional serial sections were obtained for immunohistochemical studies.\nImmunohistochemistry showed a positive reaction in the tumor cells for alpha-smooth muscle actin (alpha-SMA) (Figure 5) but no immunoreactivity for antibodies directed against CD34 (Figure 6). We would have also done IHC for smooth muscle-specific myosin, in order to rule out leiomyoma, which would also be SMA-positive. It is still likely that the lesion is myofibroma, however. Based on the histopathologic and immunohistochemical features, a diagnosis of myofibroma involving the left gingiva was made.",
"gender": "Female"
}
] |
PMC4397003
|
[
{
"age": 33,
"case_id": "PMC9898587_01",
"case_text": "A 33-year-old female with a history of asthma presented after a witnessed out-of-hospital respiratory arrest leading to cardiac arrest. She had reportedly been experiencing shortness of breath and wheezing prior to her arrest. Resuscitative efforts were begun by bystanders and subsequently taken over by emergency medical services. The patient was intubated in the field and received intramuscular naloxone. She attained return of spontaneous circulation after about 15 min of cardiopulmonary resuscitation. Upon presentation to the hospital, the patient was still comatose, but her brainstem reflexes were intact. She was noted to have an esophageal intubation and was subsequently re-intubated. On secondary survey, she was found to have a bag of heroin in her sock. Toxicology screen was positive for fentanyl. Magnetic resonance imaging (MRI) of the brain was obtained at the time of admission and did not show any findings concerning for anoxic brain injury.\nWithin 12 hours of resuscitation, while she was still comatose, the patient developed generalized, stimulus-sensitive myoclonic jerks involving her arms, legs, and trunk with relative sparing of her face. Her diffuse, violent jerks led her to develop rhabdomyolysis necessitating propofol infusion for symptom control and precluding her from being weaned off sedation for an accurate neurological assessment. EEG obtained on day 3 of hospitalization, while the patient was still sedated, showed diffuse anteriorly prominent alpha and beta activity and occasional periods of diffuse delta slow-waves and diffuse voltage suppression and lack of any cerebral reactivity to external stimuli. A number of diffusely distributed bilaterally synchronous spike and wave epileptiform discharges were also noted. Given her overall picture with relative paucity of findings on MRI of the brain despite significant clinical myoclonus and findings on EEG, an MRI of the cervical spine was obtained but showed no notable findings consistent with anoxic injury.\nThe patient was started on ketamine infusion which, in addition to propofol, significantly improved her myoclonus. She was also started on valproate (1 g three times a day) and levetiracetam (2 g twice daily). By day 4-5 of her hospital course, the patient regained consciousness and was noted to have some improvement in her motor activity, though she continued to have significant stimulus-sensitive myoclonus. The patient was subsequently weaned off propofol and ketamine infusions. She was switched to clonazepam (2 mg three times daily) which, in addition to valproate and levetiracetam, significantly improved her symptoms, though she never achieved complete remission in her symptoms. Her neurological function gradually improved to the point where she was able to follow simple commands. Her sedation was weaned and the patient was subsequently extubated and transferred out of the ICU on day 11 of her hospitalization.\nThe patient remained on clonazepam and levetiracetam. Valproate was discontinued two weeks into her hospital course due to concern for drug-induced transaminitis. She was switched to zonisamide (100 mg three times a day) and remained on this combination regimen for the next two weeks. Approximately one month into the patient's hospital course, she started to exhibit significant resting and intention myoclonus as well as dysarthria, not responding to the current treatment. She underwent another video EEG and was noted to have recurrent episodes of jerking, of which some, but not all, were associated with underlying poly-spike discharges. The clinical impression of the neurology team was that the episodes not associated with poly-spike discharges could represent some component of brainstem or spinal myoclonus. The clinical team had a lower suspicion for functional myoclonus given the patient's overall clinical picture, though it could not be fully excluded based on scalp EEG. At this point, clonazepam did not seem to be significantly helpful in achieving symptom control and it was subsequently tapered off. Instead, the patient was treated with baclofen (20 mg every 6 hours) with significant improvement in her resting myoclonus, though she continued to have intention myoclonus. She was eventually discharged to a skilled nursing facility for further rehabilitation. She was seen again a month after her discharge for an unrelated complaint, and while she had preserved cognition and sensorimotor function, she continued to have significant, debilitating intention myoclonus.",
"gender": "Female"
}
] |
PMC9898587
|
[
{
"age": 13,
"case_id": "PMC10209118_01",
"case_text": "A 13 year-old healthy female presented approximately 1 h after an intentional overdose of 10 tablets of an unknown drug. She was asymptomatic at the time of presentation. Parents reported acetaminophen, aspirin, fluoxetine, trazadone, and prazosin were available in the home and reported that the patient had also visited her grandmother earlier that same evening. It was unknown at that time what medications the grandmother was prescribed.\nThe patient's vital signs were: blood pressure 128/87 mmHg, heart rate 82 beats per minute, respiratory rate 16 breaths per minute, peripheral oxygen saturation 99% on room air, and temperature 37.4 C. The initial physical examination revealed no abnormalities. No hyperreflexia, tremor, or clonus were noted. A complete blood count and comprehensive metabolic panel were within normal limits. The four hour acetaminophen concentration was 28 microg/ml. Serum aspirin and ethanol concentrations were undetectable. Urine drugs of abuse screening was negative for amphetamine, barbiturates, benzodiazepines, cannabinoids, cocaine, opiates, and PCP.\nAfter the patient's initial medical examination, she was observed overnight on telemetry pending psychiatric evaluation in the morning. Approximately 10 h after ingestion, irregular cardiac activity was noted on telemetry (Fig. 1). A 12-lead ECG (Fig. 2A) was obtained to further characterize this rhythm, which was determined to be a Mobitz I (Wenckebach) atrioventricular block. No prior ECGs could be obtained for comparison. Vital signs remained normal during this time and the patient continued to be asymptomatic. The toxicology service was consulted at that time given concern for potential cardiotoxicity from her unknown ingestion.\nToxicology recommendations included obtaining serum digoxin and lithium concentrations from index lab draw. Serum digoxin concentration was undetectable. Serum lithium concentration was 1.7 mEq/L (laboratory therapeutic range: 0.6-1.2 mEq/L). The patient was treated with intravenous fluids administered at twice the maintenance infusion rate for 14 h, after which a repeat lithium concentration was obtained and found to be less than the lower limit of detection. A repeat 12-lead EKG obtained approximately 20 h post-ingestion showed normal sinus rhythm with sinus arrhythmia (Fig. 2B).\nThe patient was medically cleared after 36 h of monitoring and, following psychiatry clearance, discharged with an ambulatory cardiac monitor and cardiology clinic follow up.",
"gender": "Female"
}
] |
PMC10209118
|
[
{
"age": 49,
"case_id": "PMC5944445_01",
"case_text": "A 49-year-old man was admitted with a suspected mass in the left lower pulmonary lobe found during health examination. The patient was a smoker with no family history of cancer. Chest computerized tomography (CT) (Figure 1) showed a quasi-circular mass (25.1 x 22.2 mm) in the left lower pulmonary lobe, together with an enlarged mediastinal lymph node (7.7 mm). The patient underwent CT-guided percutaneous biopsy in the left lung neoplasm. Pathological analysis revealed a poorly differentiated adenocarcinoma with neuroendocrine differentiation (Figure 2A). Immunohistochemistry showed positive staining of cytokeratin (CK), with CK7 and Ki-67 index of 60%, but negative staining of P63 and thyroid transcription factor-1 (Figure 2B-F). The discovered serum tumor markers included carcinoembryonic antigen (3.67 ng/mL), neuron-specific enolase (NSE; 19.36 ng/mL), and circulating cytokeration 19 fragments (CYFRA21-1; 2.15 ng/mL). Molecular analyses of exons 18, 19, 20, and 21 of EGFR revealed no mutation.\nThe patient was diagnosed with clinical stage IIIA (T1bN2M0) pulmonary adenocarcinoma with mediastinal lymph node metastasis. Optimal management requires both local and systemic disease controls; as a result, treatment for clinical stage IIIA (N2) NSCLC has been one of the most controversial topics in Thoracic Oncology. Neoadjuvant chemotherapy and/or radiotherapy prior to surgical resection has been demonstrated to provide better progression-free survival (PFS) than definitive chemoradiotherapy for patients with stage IIIA (N2) NSCLC, in several reports. The tumor was technically resectable, which involved single-zone mediastinal node. Therefore, neoadjuvant chemotherapy was selected, with an aim to induce tumor downstaging, thus facilitating and simplifying the subsequent surgical treatment. After a multidisciplinary team meeting, the patient proceeded to undergo two cycles of neoadjuvant chemotherapy with pemetrexed (500 mg/m2 on day 1, every 3 weeks) and cisplatin (25 mg/m2 from days 1 to 3, every 3 weeks) from March to April 2015. Side effects were limited to grade 1 fatigue and grade 1 nausea. Chest CT scan in May 2015 showed that the left lower lobe tumor had significantly reduced to 12.7 x 7.4 mm in size, and the enlarged mediastinal lymph node almost disappeared (Figure 3). The patient achieved partial remission (PR) after neoadjuvant chemotherapy.\nThe patient underwent left lower radical lobectomy completely (R0) resection and mediastinal lymph node dissection in video-assisted thoracoscopic surgery in May 2015. The postoperative sample was confirmed as pT1aN2M0 LCNEC upon pathological examination. Immunohistochemical analysis (Figure 4) demonstrated intense immunoreactivity of CK, CK7, as well as NSE, chromogranin-A (CgA), and cluster of differentiation 56 (CD56), which was a typical LCNEC component. Immunohistochemistry showed focally positive results of synaptophysin (SyN), and negative results of P63, P40, and NapsinA. No surgery-related complications occurred. Chest CT scan 1 month after surgical resection revealed no tumor recurrence (Figure 5A and B).\nThe patient convalesced well after surgery and received adjuvant chemotherapy of the same regimen for four cycles. Meanwhile, sequential postoperative radiotherapy (PORT) at a total radiation dose of 45 Gy was given, which was divided into a daily dose of 1.5 Gy for twice after surgery for a month. The patient is followed up by tumor marker every month, and CT scan every 2 months. No evidence of recurrence has been detected during the 24-month follow-up after surgery (Figure 5C and D).",
"gender": "Male"
}
] |
PMC5944445
|
[
{
"age": 51,
"case_id": "PMC5830816_01",
"case_text": "A 51-year-old man presented to the emergency department with mild, dull central abdominal pain and dyspepsia for 4 days. There was no history of fever, flank pain, hematuria, or dysuria. There was no history of renal impairment or bowel complaints. His history was significant for diabetes, hypertension, and hyperlipidemia. Abdominal examination revealed soft abdomen with mild generalized tenderness. Laboratory investigation revealed raised serum lipase, amylase levels, along with obstructive jaundice. Urine full examination microscopy elements test and renal function tests revealed no evidence of urinary tract infection. A contrast-enhanced computed tomography (CT) scan of the abdomen and pelvis showed gallbladder wall thickening, biliary dilatation, and swollen pancreas with a subtle lucent halo around the pancreas, associated with mild peripancreatic lymphadenopathy. In addition, there were multiple wedge-shaped areas in both kidneys without any hydronephrosis, nephrolithiasis, or perinephric fat stranding [Figure 1a and b]. Magnetic resonance imaging (MRI) of the upper abdomen confirmed mild edematous pancreatitis and biliary dilation, pancreatic duct dilatation without any ductal calculi. MRI also showed a peripheral halo around the pancreas while diffusion-weighted images demonstrated diffuse restricted diffusion in the pancreas consistent with pancreatitis. MRI evaluation of the kidneys showed multiple T2 dark areas in both kidneys showing restricted diffusion [Figure 2a and b]. These areas were isointense on T1-weighted images, showed progressive enhancement on serial postcontrast images, and again well delineated on 5 min delayed images [Figure 2c-g]. Tumor markers were within normal limits. Endoscopic retrograde cholangiopancreatography showed stricture of the distal common bile duct and pancreatic duct. A biliary stent was placed and biliary brushings were sent for cytology analysis. Endoscopic ultrasound-guided fine needle aspiration cytology (FNAC) was performed sampling the pancreatic head, uncinate process, ampulla, and peripancreatic lymph node. Serum IgG and IgG4 levels performed after CT and MRI were very high. FNAC results showed IgG4 immunostaining of inflammatory cells from the sample from pancreatic head. No malignant cells were seen. A diagnosis of IgG4-related autoimmune pancreatitis, biliary disease, and kidney disease was made. Post-stenting, the markers of obstructive jaundice and pancreatitis went down.",
"gender": "Male"
}
] |
PMC5830816
|
[
{
"age": 26,
"case_id": "PMC7580483_01",
"case_text": "A 26-year-old female, without any significant past history presented to department of critical care medicine with abnormal body movement, cough, fever, loss of consciousness, shortness of breath, vomiting for five days. At presentation her Glasgow Coma Scale (GCS) is 7/15, pulse rate-140 beats/per min, blood pressure-70/40 mmHg, respiratory rate-31 breaths/min, oxygen saturation-81% on 15 liter oxygen, and temperature-102 F. On examination, thyroid swelling, bilateral pitting edema, jaundice, neck rigidity and kerning's sign were present. On auscultation of chest, bilateral crepitation was present. Examination of other systems was normal. Immediately patient was resuscitated and intubated.\nHer investigation profile showed Total Leucocyte Count (TLC)-25000/mm3, platelets-100000/mm3, Hemoglobin (Hb)-9gm/dl, urea-90 mg/dl, creatinine-1.8 mg/dl, sodium and potassium were within normal range. Total bilirubin was found to be 6mg/dl in which direct bilirubin corresponds to3mg/dl, total protein was found to be 5.9mg/dl in which albumin corresponds to 3.1 mg/ dl, alanine aminotransferase (ALT) 301U/L, aspartate aminotransferase (AST) 281U/L. Lumbar puncture (LP) showed viral meningoencephalitis. IgM for scrub typhus was positive.Chest X-ray showed bilateral pneumonia (Figure 1). She was diagnosed as scrub meningoencephalitis with multiorgan dysfunction and septic shock.\nThe patient was started on meropenem, doxycycline, vasopressors, hydrocortisone, fluids and ventilator support. On second day, there was no improvement. Thyroid function test was done which showed free triiodothyronine (FT3) as 6 ng/dl, free tetraiodothyronine (FT4) as 5 ng/dl and thyroid stimulating hormone(TSH) as 0.02 mulU/ml.\nBurch-Wartofsky point scale(BWPS) was 55. Oral carbimazole was started due to unavailability of intravenous form. There was no improvement in consciousness and parameters of organ dysfunction over next 3 days. She expired on fifth day.",
"gender": "Female"
},
{
"age": 41,
"case_id": "PMC7580483_02",
"case_text": "A 41-year-old female, without any significant past history presented to department of critical care medicinewith altered sensorium, fever, cough, shortness of breath, palpitation for 2 days. At presentation, her Glasgow Coma Scale (GCS) -12/15, pulse rate-190 beats/per min irregularly irregular, blood pressure-80/40 mm of Hg, respiratory rate-31breaths/ min, oxygen saturation-91% at five liter oxygen, and temperature -100 F. On examination thyroid swelling, bilateral pitting edema and jaundice were present.On auscultation of chest, bilateral crepitation was present. Cardiovascular examination showed tachycardia without murmur. Abdominal examination was normal. BWPS was 50.\nHer investigation profile were TLC-15000/ mm3,platelets-110000/mm3, Hb-9gm/dl, urea 90-mg/dl, creatinine-1.6 mg/dl, sodium and potassium were within normal range. Total bilirubin was 5mg/dl in which direct bilirubin corresponds to 2mg/dl, total protein-5.9mg/dl in which albumin-2.9 mg/dl, ALT-256U/L, AST-201U/L, FT3-8 ng/dl, FT4-5 ng/dl and TSH-0.01 mulU/ml.Chest X-ray showed bilateral pneumonia (Figure 2).\nImmediately the patient was resuscitated with fluid, hydrocortisone, broad spectrum antibiotics and cardio version. Heart rate got controlled with Digoxin followed by Propanolol (20 mg) three times a day orally. Carbimazole (20mg) was started thrice a day. The patient was transferred from Intensive Care Unit (ICU) on the fourth day. She was followed up at OPD after 2 weeks, thyroid function test was done and carbimazole was continued.",
"gender": "Female"
},
{
"age": 48,
"case_id": "PMC7580483_03",
"case_text": "A 48-year-old female, with past history of hyperthyroidism not under treatment presented todepartment of critical care medicine with altered sensorium, abdominal pain, cough, fever, shortness of breath, loose stool and vomiting for 3 days. At presentation, her Glasgow Coma Scale (GCS) was 13/15. Her pulse rate-136 beats/per min, blood pressure-80/50 mmHg, respiratory rate-26 breaths/min, oxygen saturation -90% on 10 liter oxygen, and temperature-102 F. On examination, thyroid swelling, bilateral pitting edema and jaundice were found. On auscultation of chest, bilateral crepitations were present. Examination of other systems were normal. BWPS was 75.Her investigation profile showed TLC-17000/mm3, platelets-110000/mm3, Hb- 10gm/dl, urea-90 mg/dl, creatinine-1.8 mg/dl, sodium and potassium were normal. Total bilirubin 6mg/dl in which direct 2.3mg/dl, total protein 5.9mg/dl in which albumin 2.9 mg/dl, ALT- 356U/L, AST- 301U/L. FT3 4.2 ng/dl, FT4 5 ng/dl and TSH <=0.01 mulU/ml. Chest x-ray showed bilateral pneumonia (Figure 3). Rest of the examination was normal.\nImmediately patient was resuscitated with fluids, vasopressors, broad spectrum antibiotics. Carbimazole (20mg) and propanolol (20mg) were started three times a day. Both blood pressure and heart rate got controlled on second and fourth days respectively. Sensorium was improved on the seventh day. The patient was transferred out of ICU on the ninth day. The patient was followed up at OPD after 2 weeks, thyroid function test was done and Carbimazole was continued.",
"gender": "Female"
}
] |
PMC7580483
|
[
{
"age": 30,
"case_id": "PMC10242558_01",
"case_text": "A 30-year-old male with a past medical history significant for asthma presented to the emergency department with a chief complaint of shortness of breath. According to the patient, he had been experiencing worsening shortness of breath for the past few weeks which was initially present only on exertion but had recently progressed to being persistent at rest as well. The patient also complained of a concomitant non-productive cough during this time which was accompanied by intermittent febrile episodes. He also noted a 15-pound unintentional weight loss over the past two months. Vital signs on initial evaluation were significant for a temperature of 98.2 F, BP 153/89, HR 114 and sp02 95% on room air. Physical examination revealed an alert, cooperative male in mild respiratory distress, appearing his stated age, PERRL, conjunctiva/corneas clear, EOM's intact, fundi benign, no appreciable cervical/axillary/supraclavicular lymphadenopathy. Air entry was notably reduced in the right mid and lower chest region, regular, rate, and rhythm, S1 and S2 normal, no murmur, rub or gallop, abdomen was soft and non-tender, bowel sounds active in all four quadrants with no masses, no organomegaly. Lower extremities were without edema.\nLabs were significant for WBC 15.62/nL, Hgb 13.4 g/dL, Platelets 428/nL, creatinine 0.94 mg/dL, AST 31, ALT 32, Na 137 mmol/L, LDH 817 U/L, Uric acid 5.4 mg/dL, ESR 28 mm/hr, CEA 0.9 ug/L, procalcitonin 0.06 ng/mL. CT angiogram of the chest was performed and showed a 20 x 7.8 cm predominantly low-density anterior mediastinal mass with no calcifications, seen in Fig. 1A. Some associated adenopathy in the precarinal space, 36 x 21 mm. Epicardial adenopathy was present measuring 31 x 22 mm. There was a also a small amount of pericardial fluid towards the cardiac apex. A large partially loculated right pleural effusion with areas of underlying consolidation and bilateral dependent changes was also seen and no filling defects in the central pulmonary arterial circulation that would suggest pulmonary embolism were appreciable. CT abdomen pelvis was also performed and showed no acute findings. Pulmonology was consulted for thoracentesis and Oncology was consulted for the mass seen on imaging. Echocardiogram was performed which was not suggestive of tamponade physiology and ejection fraction 60-65%. Thoracentesis revealed an exudative effusion with lymphocytic predominance, cytology was negative for malignant cells and flow cytometry revealed no immunophenotypic abnormalities. A mediastinal core needle biopsy was performed with findings of CD30 and CD15 positive lymphoid neoplasm, and negative for CD20 and EBV, consistent with Mediastinal Gray Zone Lymphoma. Additional serologic exams included an AFP <1.3 ng/mL, HCG <1.0 mIU/mL, Kappa Free light chain 1.18 mg/dL, Lambda free light chain 0.93 mg/dL, Kappa/Lambda ratio 1.27.\nA bone marrow biopsy revealed a normocellular marrow with maturing trilineage hematopoiesis, negative for involvement by lymphoma. Concurrent flow cytometry was negative for lymphoma. The patient's clinical presentation was consistent with Stage 2, bulky disease. The patient proceeded with starting allopurinol for prevention of tumor lysis and began dose adjusted EPOCH. After 2 cycles, there was significant delbulking of his disease noted on PET scan seen in Fig. 1B and improvement of his symptoms. He continued with cycle 3/6 of dose adjusted EPOCH and was noted to have complete metabolic response with a Deauville Score of 2 seen in Fig. 1C.",
"gender": "Male"
}
] |
PMC10242558
|
[
{
"age": null,
"case_id": "PMC2825652_01",
"case_text": "There is substantial third-party objective evidence that O experienced unrelenting illness that generally increased in the 10 years that preceded glycine treatment and that O's education and social life were profoundly disrupted. \nEvidence for disruption of education resides in a comprehensive set of third-party records on school attendance and nonattendance, academic performance during attendance, results from standardized academic tests, financial records from academic institutions, and written correspondence from academic administrators and city truancy officials. For 8 years before glycine treatment, there was no attendance of school or commercial tutoring. Resumption of education following the initiation of glycine treatment is likewise supported by comprehensive third-party objective evidence. Over a period of approximately 2 years, evidence for sustained and increasing improvement resides in the fact that O passed the high school equivalency exam, prepared for the SAT test in a commercial course, preformed well on SAT test and began college. Academic records indicate excellent attendance and performance. \n Disruption of education was accompanied by disruption of social life and a housebound state. Evidence for a resumption of social life following glycine treatment is likewise supported by substantial third-party objective evidence. For example, evidence for a resumption of social life resides in email correspondence with classmates that relates to social activities at specific events and locations in his city and another city. Credit card records indicate the purchase of clothes, attendance at restaurants and concerts in his city and another city. Thus, there is clear, third-party objective evidence for resumption of an active social life and normal mobility in his city that is not subject to concerns about subject, parental, or researcher bias relating to outcome assessment. This evidence for a major reduction in preglycine life disruptions suggests a major improvement in the OCD and BDD dimensions of O's illness. However, before this major improvement can be considered a genuine effect of glycine, it is necessary to rule out placebo effects and a spontaneous remission. \n Given that placebo effects derive from patient anticipations for treatment, there is the a priori expectation that placebo effects will not be durable in individuals experiencing powerful, life-disruptive psychiatric illness. This expectation has been confirmed by Quitkin and coworkers in systematic studies of placebo effects in depression. Specifically, there is a marked tendency for placebo responses to occur abruptly within the first two weeks and to disappear within the first 12 weeks of treatment. This placebo response pattern is in contrast to what the authors regard as the response pattern for a true pharmacologic response, where the initial effects appear after a period of two weeks and tend to last 12 weeks or longer. The placebo response pattern can, of course, be seen either with a true placebo or with an active drug. These authors \"conclude that a significant portion of relapses within the first 6 weeks of treatment with an active drug are not related to loss of a true drug effect. Rather some are related to loss of nonspecific placebo effects, and abrupt nonpersistent responses during drug treatment are most likely the result of placebo effects\". They note that the early occurrence of placebo effects is consistent with the notion that they derive from patient expectations. Others have made similar observations. In relation to studies of OCD patients, Ackerman and Greenland have noted that the observation of less improvement in longer trials of active drugs may be due to placebo effects from expectations generated by side effects: \"It is possible that in the early 10-week clomipramine and 8-week fluvoxamine trials, some of the subjects in the active treatment arms responded to nonspecific study effects (such as side effects). In longer studies, that improvement was not maintained.\" Here it can be noted that Quitkin et al. suggest that \"precise assessment of drug effects probably requires several months of observation.\" \n In view of the above considerations, we suggest that it is highly unlikely that the objective, major, and long-lasting changes in life activities that followed glycine treatment represent a placebo effect. Unlike placebo effects, the change that followed initiation of glycine treatment was not abrupt. The subject and his parents report that the first sign of improvement (leaving home without parental escort for the first time in 5 years) occurred 5 weeks after initiation of glycine consumption. Further improvement was also gradual, with third-party objective evidence documenting a gradual resumption of education and social life over treatment periods totaling 150 weeks (in an observation period of 5.3 years). This is much longer than the \"several months\" described by Quitkin et al. as sufficient to detect true drug effects. \n Although the above studies clearly suggest that effects generated by patient expectations tend to be transient, it is nonetheless possible to observe some cases in which improvement from a known placebo appears to be enduring. For example, Quitkin observed sustained improvement in placebo-treated individuals with depression. In these cases, the authors make the reasonable suggestion that the improvement was more likely to have been a spontaneous remission than a placebo effect. Therefore, it is necessary to consider the possibility that O's enduring improvement following initiation of glycine treatment was due to spontaneous evolution of illness. \n We first note that a spontaneous remission appears unlikely on the basis of prior longitudinal studies, which suggest that both OCD and BDD generally have a continuous course, with spontaneous remissions being rare, especially in SSRI-refractory cases. Moreover, the occurrence of both disorders together tends to be associated with a worse prognosis. Although suggestive, these considerations do not constitute definitive evidence against a spontaneous remission in a specific case. \n One approach to distinguish true efficacy from spontaneous remission in a specific case is to determine if deteriorations occur during periods of nontreatment. To pursue this approach, this study was continued until we obtained objective, third-party evidence for an unequivocal deterioration during nontreatment that avoided concerns about subject expectations and outcome assessment bias in the observations made by the subject, his parents and researchers. \n As noted for the long off-glycine periods, OP6 and OP10, modest relapses were seen for OCD and BDD. However, the clearest evidence of deterioration was for the cognitive dimension of O's illness. Most notably, third-party objective evidence derived from clinical neuropsychological testing in OP10 suggests substantial deficits in selective aspects of cognition by the end of this period. This testing with formal methods was done by a neuropsychologist who was blinded to psychiatric and treatment histories. A comparison of this off-glycine data with the excellent SAT scores obtained in the on-glycine period, OP5, suggests a substantial decline in selective aspects of cognition in OP10 relative to OP5 levels, as discussed in Section 3.5.11. All of this evidence is objective except for some neuropsychological tests that required subjective evaluation by the clinical neuropsychologist, such as the Rey-Osterrieth test. In these cases, any subjective judgments were made under blinded conditions that precluded expectations of the neuropsychologist that were based on treatment history or psychiatric diagnoses. \n The possibility that treatment cessation could have generated expectations in our subject that somehow affected his performance on the neuropsychological testing can also be considered. We first note that the subject reports that he initiated testing because of speech difficulties. The evaluation revealed normal verbal fluency but did reveal multiple other deficits. The point here is that the deficits found were different from the subject's initially expressed complaints. Further evidence against expectations for a decline in memory after glycine cessation reside in the fact that in serial interviews, the subject has expressed doubts about the validity of the tests for memory deficits and has noted that friends have commented on his excellent memory of the distant past. Moreover, he has not resumed high-dose glycine consumption in response to the test results. It can also be noted that the neuropsychologist reported that the subject was euthymic and appeared to make a full effort. \n On the basis of the above considerations, we suggest that the third-party evidence that we present for a cognitive deterioration is either fully objective evidence or is evidence that is not compromised by an absence of blinds or by subject expectations. An important point is that the selective cognitive deterioration was substantial, since some WMS-III scores were in the first percentile and since the Rey-Osterrieth copy score was more than 8 standard deviations below the mean. We suggest that it is unlikely that scores on these tests would have been much lower had they been measured before the initiation of glycine treatment. \n In summary, we suggest that the bias-free evidence that we present for a major improvement of OCD and BDD during treatment and for a major deterioration of selective aspects of cognition during nontreatment is consistent with the possible efficacy of glycine.\nIn response to the success achieved in the first year of this study, a collaborative initiative was begun to test glycine with other OCD patients. The first aspect of this initiative has been a placebo-controlled study in which glycine was used as an adjunct to pre-existing pharmacotherapy. The 5 individuals who were treated with glycine had a mean decrease in Y-BOCS score of 6.04 points where as the 9 subjects treated with placebo experienced a 1.00 point decrease (P = .053) (Greenberg, Benedict, Doerfer, Perrin, Panek, Cleveland, and Javitt, Adjunctive glycine in the treatment of obsessive-compulsive disorder in adults). Although much larger studies are needed to determine the frequency of responders, the results of Greenberg et al. are in agreement with this case study and raise the expectation that additional OCD patients will be glycine responders. To facilitate large trials, it would be desirable to identify glycine-responsive subtypes. The comprehensive case description in this paper has been motivated, in part, by this goal.\nTo our knowledge, this case study represents the first use of high-dose glycine with OCD or BDD and the first use of glycine alone with any psychiatric disorder. In addition, there was no psychotherapy or behavior therapy during the 5-year period of monitoring. Thus, this study is free of factors that confound the interpretations of many studies. Given the magnitude of the improvement seen in this study, we suggest that trials of glycine alone be considered for future studies.\nIn agreement with prior studies of glycine as an adjunct to conventional medication in schizophrenia, an initial response to glycine treatment was detected in this study only 23 days after reaching the target dose. However, the improvement reported for the first 12 weeks of treatment was only a small fraction of the improvement reported for the five on-glycine treatment periods that extended over a period of almost four years. This suggests that the short clinical trials used in the past, for example, 12 weeks, may have failed to reveal the full therapeutic potential of high-dose glycine treatment in the disorders studied.\nThe results of this high-dose glycine trial with refractory OCD, BDD, and cognition deficits are in unequivocal agreement with the main prediction of the Hypo-NMDAR-ST hypothesis that inspired its initiation. However, it is also necessary that this hypothesis be compatible with prior, well-established findings for NMDAR neurotransmission. \n Since our hypothesis was constructed to explain the apparent behavioral effects of clarithromycin, which has been reported to inhibit NMDAR-ST at a downstream point, it is reasonable to consider if other downstream NMDAR-ST inhibitors have similar effects. There are many studies of NMDAR inhibition on human behavior, but, to our knowledge, all employ global inhibitors, such as phencyclidine and ketamine, that act on the NMDAR itself. Thus, a direct comparison is not possible. With this caveat in mind, it is nonetheless of interest to consider known effects of ketamine and phencyclidine in relation to this study. \n To our knowledge, controlled studies with phencyclidine and ketamine have considered either healthy subjects or subjects with schizophrenia. In healthy subjects, the basic findings are deficits of cognition and other signs and symptoms that are schizophrenia-like. In subjects with schizophrenia, a worsening of existing or reactivation of previously controlled symptoms is the main presentation. In these very short-term experiments, signs and symptoms of OCD, to our knowledge, have not been reported. Although visual distortions of body parts are a prominent consequence of ketamine and phencyclidine and somatosensory abnormalities have been suggested to be an aspect of BDD deriving from parietal-occipital abnormalities, full-fledged DSM-IV BDD has not, to our knowledge, been reported in these experiments. At first sight, these findings might be considered incompatible with our hypothesis. However, general considerations suggest that local defects in NMDAR-ST could be specific for OCD/BDD. The absence of such defects in normal individuals and in individuals with schizophrenia would explain the absence of OCD/BDD in the reported ketamine and phencyclidine experiments. Here it can be noted that disorder-specific defects appear to have influenced the exacerbations induced by clarithromycin in other cases. For example, in one case, previously controlled bipolar disorder was reactivated. In another, previously controlled posttraumatic stress disorder was reactivated. \n It can also be noted that disorder-specific defects for OCD and BDD are plausible in relation to known neurobiology. Given that SSRIs are the first line drugs for both OCD and BDD, it is possible that abnormal serotonin neurotransmission plays a causal role in these disorders in some individuals. This raises the possibility of a local, OCD/BDD-specific defect that is restricted to serotonergic neurons of the raphe nuclei. Recent evidence indicates that NMDAR-ST regulates the firing rate of these neurons, suggesting that deficient NMDAR-ST could lead to an abnormal firing rate. The more downstream the defect the more likely it will involve the molecular systems that produce, release, and transport serotonin. Recent clarifications of mechanisms regulating serotonergic neurotransmission reveal a complex picture in which multiple processes couple NMDAR input with serotonin release/reuptake. Defects occurring in these processes could represent OCD/BDD-specific defects in NMDAR-ST. \n Another possibility is a deficiency of NMDAR-ST in GABA-ergic inhibitory interneurons (abundant in both the dorsal and median raphe nuclei) that regulate serotonergic neurons. This scenario can be seen as a variant of the elegant and influential theory of Olney et al. in which deficient NMDAR-ST leads to loss of feedback inhibition. The core principle of this theory, which goes beyond \"hyperglutamatergic\" or \"hypoglutamatergic\" models, is that glutamate \"functions not only as a straightforward excitatory agent in the brain, but as a major regulator of inhibitory tone\". Local NMDAR-ST deficits restricted to interneurons that regulate serotonergic neurons could reasonably be expected to lead to abnormal serotonergic tone and the emergence of OCD/BDD. \n In both of the above scenarios, there is an absence of the more widespread perturbations expected for global NMDAR-ST inhibition by ketamine and phencyclidine. The absence of these perturbations would be compatible with the emergence of OCD/BDD without the schizophrenia-like symptoms seen with ketamine and phencyclidine. Also, in both scenarios, it would be reasonable to expect worsening of signs and symptoms by an inhibitor and improvement from an enhancer of NMDAR-ST. However, it should be emphasized that the above analysis is intended only to suggest plausibility of disorder-specific defects, not to propose a specific mechanism for the case under study. \n Although OCD and BDD have not been seen in ketamine experiments with humans, some of the cognitive deficits seen in O show substantial overlap with the cognitive effects of ketamine. A consistent finding in multiple ketamine studies is a robust, dose-dependent decrease in verbal declarative memory that occurs at doses below those that induce schizophrenia-like symptoms. Deficits in verbal memory and learning in ketamine experiments have been assessed with story recall and list learning tests. For example, Newcomer et al. found a dose-dependent decrease in verbal memory under ketamine using a paragraph recall test from the Wechsler Memory Scale-Revised. Immediate and delayed recall scores from this study can be compared with O's corresponding scores on a revised version of this test, the WMS-III. O's Auditory Immediate and Auditory Delayed scores were in the ~1st percentile. In other ketamine studies, a robust decline in verbal memory has been found with list learning tests such as the Hopkins Verbal Learning Test (HVLT). These results can be compared with the significant deficits seen in O's scores on the CVLT-II, where the T score for Trials 1-5 was ~36 (Z = - 1.4) and Z-scores for delayed recalls (free and cued) ranged from ~-2 to ~-2.5, except for the short delay free recall, which was ~-1. The Z-score for total hits was ~-4. Thus, O's off-glycine deficits in verbal memory are strongly reminiscent of those induced by ketamine. This similarity is clearly supportive of our hypothesis. Also supportive are O's very high on-glycine scores on the GED and verbal SAT tests (99th and 90th percentiles, resp.), which suggest much improved verbal learning and memory in an on-glycine state, as discussed above. \n The finding that ketamine-induced cognition deficits appear at doses lower than those needed for other types of symptoms is also of relevance to our hypothesis. Assuming that an endogenous NMDAR-ST defect would mimic ketamine, this finding leads us to expect that the return to a deficient NMDAR-ST state after cessation of glycine would manifest itself with a cognitive relapse whose emergence is earlier and more pronounced than the relapses for other categories of signs and symptoms. Our data from OPs 6 and 10 appear to be consistent with this prediction. Also of relevance is the fact that in the initial emergence of illness in early childhood, difficulties in cognition appeared before obsessive-compulsive behaviors and BDD-related signs and symptoms. \n Finally, we note that additional support for our Hypo-NMDAR-ST hypothesis can be found in the course of O's illness. Specifically, it is known that NMDAR inhibition has mild behavioral effects in childhood and much larger effects after puberty. Assuming that an endogenous NMDAR-ST defect would imitate an inhibitor, it follows that O's very mild illness in childhood and the emergence of much more incapacitating illness after age 15 are consistent with an NMDAR-ST deficit.\nAlthough the findings of this study support the Hypo-NMDAR-ST hypothesis on which it is based, it is appropriate to consider our findings in the light of alternative hypotheses proposed by others. \nOne of the defining features of the PANDAS subtype is the occurrence of exacerbations with sudden, abrupt onset. The exacerbations are described as \"typically quite dramatic, with patients reporting that their symptoms \"...came on overnight\" or \"...appeared all of a sudden a few days after I had a sore throat.\"\" The fine details of O's exacerbations are not congruent with this picture. For O's age-19 exacerbation that followed a positive throat culture, detailed notes of O's father indicate an improved relationship with his son during the acute phase of the infection. The behavioral deterioration is described as beginning \"as soon as the infection cleared.\" Worsening of existing symptoms (e.g., line-crossing obsession) occurred 24 days after the positive throat culture. Episodes of violent imagery appeared for the first time approximately 40 days after the positive throat culture. In addition to the slower kinetics, O's nonresponse to IVIG therapy is unlike some PANDAS patients.\nAlthough, O's case cannot be classified as a clear case of PANDAS, it is still possible that it involves an antigen-specific autoimmune response induced by GABHS. There are, of course, multiple precedents, both experimental and theoretical, for the induction of antigen-specific anti-self-immune responses by foreign antigens that cross-react with self-epitopes or interact with self-receptors. Thus, the occurrence in O of two exacerbations following probable GABHS infections is immediately suggestive of an antigen-specific autoimmune mechanism. This follows from the major precedent residing in rheumatic fever (RF) as an antigen-specific autoimmune disease primed by GABHS. A comparison of O's illness with RF is therefore warranted. \n As expected for a pathogen-induced, antigen-specific autoimmune disease, recurrences of RF in adulthood are associated with probable reinfection with GABHS, often as a result of known, close contact with children having GABHS infections. The time interval between an initial occurrence of acute RF in childhood and a subsequent occurrence in adulthood can be multiple decades. During these long periods, there is an annual occurrence of upper respiratory viral infections, some of which are \"flu-like.\" As expected for infections which are unlikely to be antigenically related to GABHS, there is no retriggering of RF. Another point is that penicillin prophylaxis is effective in preventing a return of RF. This would not be expected if viral infections significantly trigger recurrence of RF. \n In contrast to RF, exacerbations in O's case and in some PANDAS cases appear to follow both GABHS and non-GABHS infections. It appears that Sydenham's chorea, a sequela of RF, can reoccur without GABH infection. One might propose that, in these cases, antigen-specific clones primed by an initial GABHS infection are somehow retriggered by other pathogens, such as viruses. However, the failure to see this phenomenon in RF represents a major challenge to this proposal. \n One possibility is that the putative brain injury responsible for O's case arises from nonantigen-specific consequences of GABHS and other infections. Such a mechanism would be compatible with recurrence from both GABHS and non-GABHS infections and would not be incompatible with the peripheral antibrain antibodies reported in the recent literature, since the latter could be a result (rather than a primary cause) of brain injury due to the release of antigens from an immunologically protected site. Here it is of interest that Husby et al. who in 1976 found antistriatal antibodies in patients with Sydenham's chorea, also found similar titers of antistriatal antibodies (using identical techniques) in patients with Huntington's chorea. This led in 1977 to the suggestion that Huntington's chorea could be an infection-triggered autoimmune disease. The latter is now known to be a polyglutamine disease that involves preferential death of striatal neurons. In brain-injury models of this type, it is formally possible that antibrain antibodies arising from brain injury could play a secondary role in pathogenesis. However, the demonstration that such antibodies play a causal role is a difficult task that is technically inaccessible in the absence of validated animal models, which are unavailable for psychiatric disorders that involve high-level human thinking.",
"gender": "Male"
}
] |
PMC2825652
|
[
{
"age": null,
"case_id": "PMC8734028_01",
"case_text": "There were two affected individuals in this family line, whose parents were not consanguineously married (Family Figure 1A ). The proband born on October 24, 1984, was found to have elevated blood glucose and edema throughout the body in November 2018 and was admitted to the hospital for treatment. Physical examination showed sparse scalp hair and eyebrows, absence of axillary and pubic hair, infantile external genitalia, generalized edema and intellectual disability ( Figures 2A, B ). Other data were normal, including bedside hearing and sensory testing (although formal assessment was not performed). Laboratory tests showed that the fasting glucose was 40.22 mmol/L (reference range: 3.9-6.1 mmol/L), and the glycosylated hemoglobin (HbA1c) was 13.8% (reference range: < 6.4%). Sex hormone tests revealed low levels of luteinizing hormone (LH), follicle stimulating hormone (FSH) and estradiol. Routine blood tests suggested that the patient had anemia and thrombocytopenia ( Table 1 ). Insulin and C-peptide release tests showed that the patient's insulin and C-peptide secretion had no peak ( Supplementary Table 1A ). The OGTT-based measures of insulin secretion index homeostasis model assessment- beta (HOMA-beta = 20 x Ins0/(Glu0-3.5) was low ( Table 1 ). Thyroid hormone tests revealed normal thyroid-stimulating hormone (TSH), low free thyroxine (FT4), and a low free triiodothyronine level (FT3). Pancreatic CT indicated a slightly atrophied pancreas ( Figure 3A ). While ultrasound showed that the uterus was absent. The patient was treated with insulin injection, and the blood glucose was poorly controlled.",
"gender": "Unknown"
},
{
"age": null,
"case_id": "PMC8734028_02",
"case_text": "The brother of the proband, who was born on October 29, 1986, was found to have elevated blood glucose in 2019 and admitted to our hospital for a closed fracture in January 2020. Physical examination also showed sparse scalp hair and eyebrows ( Figures 2C, D ), absence of axillary and pubic hair, hypotrophy testicles, small penis, and intellectual disability. Laboratory tests revealed that his fasting glucose was 14.91 mmol/L, HbA1c was 9.0%, he had negative insulin antibodies, low IGF-1 level of 43 ng/ml (reference range: 111-320 ng/ml), low testosterone and LH. Routine blood tests also suggested that the patient had anemia and thrombocytopenia. Insulin and C-peptide release tests showed low insulin, C-peptide secretion ( Supplementary Table 1B ) and low HOMA-beta. Thyroid hormone tests revealed normal thyroid function. The patient exhibited an uneven pancreatic density by abdominal CT scan ( Figure 3B ), empty sella by pituitary MRI ( Figures 3C, D ), and osteoporosis that was not consistent with actual age by hip CT scan ( Figure 3E ). Before admission to the hospital, the patient had oral hypoglycemic agents to control glucose, and insulin pump treatment was given after admission to the hospital, but the glucose control was poor.\n5ml venous blood was collected from the proband (II-1, Figure 1A ) and her family members (I-1, I-2, II-2 and II-3, Figure 1A ). Whole Exome sequencing (WES) was performed on proband using the xGen Exome Research Panel v1.0 (IDT, USA) on the Illumina NovaSeq6000. Genomic DNA was extracted from whole blood, then sheared by sonication and hybridized for enrichment. And the library was enriched for target regions, sequencing was performed to generate 150 bp paired-end reads. To identify mutations, sequencing data was analyzed and annotated according to an in-house pipeline which we describe before. Based on the variant annotations, a series of prioritization strategies were applied to identify candidate variants associated with the phenotypes. The detailed steps were as follows: (1) excluding variants outside exonic and splicing regions; (2) excluding variants with minor allele frequency >=0.01 according to public databases (GnomAD, 1000 Genomes and ExAC); (3) excluding synonymous variants; (4) excluding variants not presenting damaging results in the function prediction from clinPred. To prioritize the most likely candidate disease-causing gene, all candidate genes were then ranked by Phenolyzer. Human Phenotype Ontology (HPO) Identifiers of the proband's disease phenotype (anemia, HP:0001903; alopecia, HP:0001596; diabetes mellitus, HP:0000819; hypogonadism, HP:000013; intellectual disability, HP:0001249) were input as phenotype terms into Phenolyzer. To confirm the candidate disease-causing variant, we PCR-amplified the genomic DNA fragments in the proband (II-1) and her family members (I-1, I-2, II-4 and III-2), then sequenced them by Sanger sequencing. The PCR primer pairs were uses as followings: forward 5'-TCCTGGGTCCAGAGTTCTTT-3', reverse 5'-TGGGGTGTTTGGCTAAAAGT-3').\nBased on the aligned reads, 76,241 single nucleotide variants (SNVs) and 13,038 indels (deletions and insertions, <50bp) were identified by WES. After three filters of prioritization strategies, 271 variants from 244 genes were kept. Both these genes and HPO Identifiers of phenotypes of the proband were input Phenolyzer. Phenolyzer suggested that WSS was the most likely disease that can explain the syndrome phenotypes of the proband, and the DCAF17 gene was the candidate gene ( Supplementary Figure 1 ). A homozygous deletion DCAF17:c.1488_1489delAG was detected at genomic position 172,337,546-172,337,547 of chromosome 2 (GRCh37/Hg19), resulting in frameshift in reading frame in exon 14 leading to premature stop codon ( Figure 1B ). The full-length DDB1 and CUL4 associated factor 17 contains 520 amino acids. The premature termination was predicted to cause a truncated protein comprising 506 amino acids. The first 495 residues corresponding to the normal protein and the other extra 11 derived from the frameshift deletion. Sanger sequencing analysis showed the identified c.1488_1489delAG (deletion of nucleotide AG in coding region 1488-1489) was segregated with the disease in this family, which was in homozygous status in the proband's affected sibling (II-2) and heterozygous status in the proband's unaffected parents (I-1 and I-2) and sibling (II-3) ( Figure 1A ). Additionally, the identified variant allele has been recorded in the database of gnomAD with an extremely low allele frequency at 3/251,124 (dbSNP rs778488574). According to the ACMG/AMP criteria, the raw homozygous frameshift variant DCAF17:c.1488_1489delAG was classified as a pathogenic variant for WSS.",
"gender": "Female"
}
] |
PMC8734028
|
[
{
"age": 52,
"case_id": "PMC5730433_01",
"case_text": "A 52 year old man with a history of NF-1 was referred for back pain that continued for 2 days. The computed tomography (CT) scan showed a large haematoma in the right retroperitoneal space due to rupture of a right lumbar artery aneurysm (Fig. 1). Clinical examination showed multiple cafe-au-lait macules and right flank pain. His vital signs were stable, but the blood test results indicated anaemia (hemoglobin level 8.2 g/dL).\nThe emergency angiogram through the right femoral artery showed active extravasation of contrast medium from the ruptured aneurysm of the third right lumbar artery, which was successfully selected using a manually curved 4 Fr hook shaped catheter (RC-09; Medikit, Tokyo, Japan) (Fig. 2). At the distal side of the aneurysm, the lumbar artery branched into three. Through the 4 Fr catheter, a 2.9 Fr catheter (microcatheter with two coils for support; Hi-Lex, Takarazuka, Japan) was coaxially inserted using a 0.018 inch guidewire (AQUA VIII guidewire; Cardinal Health, Dublin, OH, USA). Three distal arterioles were successfully embolised using several microcoils (Tornado Embolisation Coil, MReye Embolisation Coil; Cook Medical, Bloomington, IN, USA), measuring 2-5 mm in diameter (Fig. 3). The aneurysm and residual tiny arteriole originating from the aneurysm were embolised using a mixture of N-butyl-2-cyanoacrylate and Lipiodol (Guerbet, Paris, France) in a 1:2 ratio. The inflow artery was embolised using the same microcoils measuring 2-4 mm in diameter. The final angiogram showed that the third right lumbar artery aneurysm was embolised successfully (Fig. 4). No blood transfusion was required and no complication was observed. The post-operative enhanced CT scan showed a thrombosed lumbar artery aneurysm with no extravasation and no additional aneurysm. The brain magnetic resonance imaging scan showed no aneurysm in the cervical or carotid arteries. The patient was discharged home in a good condition.",
"gender": "Male"
}
] |
PMC5730433
|
[
{
"age": 73,
"case_id": "PMC4015560_01",
"case_text": "A 73 year old right hand dominant active lady complained of bilateral shoulder pain for about two months and did not respond to two ultrasound guided subacromial subdeltoid corticosteroid injections. Her shoulder injury occurred whilst she had been caring for her husband and working on their farm. In the past she had recovered from non-Hodgkin's lymphoma and currently was on antihypertensive medication (candesartan cilexetil once a day). She had led a physically active country life style prior to the presentation of the problem and had never smoked in her life.\nAt presentation there was painful limitation of right sided shoulder abduction to less than 90 degrees. Ultrasound documented a 9mm x 14mm partial width full thickness footprint tear of the anterior to mid right supraspinatus with tendinosis of most of the tendon and enthesopathy at the greater tuberosity of the humeral head ( Figure 1). A plain radiograph of the right shoulder showed a down-sloping Type 2 acromion. There was mild wasting of the right supraspinatus muscle. A diagnosis of a recent footprint tear superimposed on degenerative supraspinatus tendon with mild muscle atrophy was made. Following written informed consent from the patient, 8ml of autologous unclotted blood was venesected and centrifuged for 5 minutes at about 3000 rotations per minute in a special tube for PRP preparation (BCT, REGEN Labs, Switzerland). 4 to 5ml of liquid PRP was injected through a 22g 5cm long needle into the tear and its margins with simultaneous percutaneous tenotomy directed into the footprint of the anterior facet of the greater tuberosity under direct ultrasound imaging control (GE Logic 9, 9MHz probe). 5ml 1% lignocaine was injected into the superficial soft tissues, subacromial bursa and the supraspinatus tear for local anaesthetic purposes. The shoulder was placed in a sling with 90 degree elbow flexion for 7 days. Physiotherapy was commenced at 4 to 5 weeks post PRP with a home exercise program. At 8 weeks follow up post PRP the patient verbally reported a marked reduction in pain with improvement in shoulder movement. At the 7 and 10 month follow up there was complete relief from pain with full range of movement of the right shoulder and she was able to lift bags of potting mix in her farm. At the 10 month follow up, ultrasound (GE Logic 9, 9MHz probe) performed by the author showed a near complete echogenic infilling obliterating the tear defect. The lateral margin of the tear merged with this neotendon tissue with mild medial retraction ( Figure 2). She was completely pain free at a follow up 1 year after PRP injection.",
"gender": "Female"
}
] |
PMC4015560
|
[
{
"age": 5,
"case_id": "PMC5866296_01",
"case_text": "A 5-year old female patient came from a rural area of Ethiopia referred to MCM (the Korean Hospital) for CT angiography of the lower extremities, and to access the vascular supply of the tail like soft tissue growth. Her mother died after giving birth to this child. History from close relative remarked no similar congenital abnormality among the members of her family. There was no known maternal history of diabetes or teratogenic drug usage in the pregnancy. CT scan findings are summarized as follows.\nProcedure done: Using multiplanar 8 slice General Electric CT machine, CT angiography of the lower extremities was performed., 17 cc of the Ultravist-370 was infused intravenously by using the power injector. The procedure was done under anesthesia using Ketamin IV infusion due to the patient's inability to stay still during the procedure\nRadiologic findings: Image 1, demonstrate the morphologic CT appearance. There is an extra parasitic lower limb duplication attached from sacral area with extension to the presacral space (looks like a tail). Image 2 showes Skeletal images viewed from The oblique projections showing. normal right and left lower extremities\nLength = 191 mm VS 238.8 mm\nCortical thickness =4.7 mm vs 4.8 mm\nFemoral shaft width= 8.9 mm vs 17.8 mm\nExtra lower limb was seen between the normal lower limbs. Comparision of the Parasite Femur Versus accompanied normal Femur: \nThe length of the parasitic (extra) femur was 80 % of the normal femur. Similarly, the width of the parasite femur was equvalent to 50%. However, the cortical thickness of both the parasitic and normal femur were almost equal.\nIntervention: after evaluation of the radiologic images, surgical intervention was done. Incision was done by leaving adequate flap for wound coverage. then dissecting in a correct cleavage between the parasite and the main body. after reading the neurovascular bundle, the vessels and nerves were ligated. Parasitic tissue was resected completely leaving intact of the main body structures. Reconstruction of the ascess rectum, urogenetal structure and sphincter and wound coverage with proper musculo cutaneous flap was done.. All in all, the surgery was successful and the child returned to her rural village to continue the usual life. Yet, follow-up appointment was given.",
"gender": "Female"
}
] |
PMC5866296
|
[
{
"age": null,
"case_id": "PMC10076629_01",
"case_text": "A female preterm infant, the first child of healthy nonconsanguineous parents, was born at 30 + 2 weeks of gestation by normal delivery, with a birth weight of 1,210 g and a negative family history. After birth, multiple skin defects were found in the whole body, mainly in the lower limbs. Physical examination at birth indicated skin defects of both lower limbs with basal flushing and exudation, but no obvious signs of infection were found in the wounds (Figure 1). The dorsum of the foot was a hyperflexion deformity with low muscle tone in the extremities. The upper abdomen was distended with a distinct gastric pattern. Routine blood test was measured and revealed that white blood cell count (WBC) 10.53 x 109/L (reference range 15.0-20.0 x 109/L), neutrophil numerals (Neut#) 8.13 x 109/L (ref. 1.8-6.3 x 109/L), haemoglobin (Hb) 137 g/L (ref. 170-200 g/L), platelets (PLT) 230 x 109/L (ref. 125-350 x 109/L). The results of coagulation function showed prothrombin time (PT) 16.0 s (ref. 9.8-12.1 s), active partial thromboplastin time (APTT) 110.2 s (ref. 25.0-31.3 s), international normalized ratio (INR) 1.38 (ref. 0.88-1.08). x-ray showed gas in the stomach but no inflation in the small intestine, which is considered pyloric obstruction (Figure 2A). Contrast medium accumulation in the stomach lumen was observed on upper gastrointestinal angiography, with no development in the duodenum or distal part (Figure 2B). There were no abnormalities in the respiratory, cardiac or urinary systems. A skin biopsy was recommended to further confirm the diagnosis of EB, but her parents refused to perform this test.\nThe patient's clinical manifestations and examinations indicated a genetic disease. After obtaining consent from the patient's family, we performed exome sequencing, which revealed heterozygous mutations in the affected ITGB4 gene, c.794dupC (p. S265fs*5) and c.2962G > A (p. A988T) (Table 1). These two variants were inherited from her parents respectively. The mutation c.794dupC is a frameshift mutation that results in the early termination of the amino acid code for protein synthesis. Another mutation c.2962G > A causes the substitution of a conserved amino acid. Computer analysis predicts that this mutation may affect protein structure and function.",
"gender": "Female"
},
{
"age": null,
"case_id": "PMC10076629_02",
"case_text": "In terms of treatment, sedation was given to reduce skin friction, and measures were taken to keep the skin clean and dry. Recombinant human epidermal growth factor gel was applied to the skin and covered with Vaseline gauze. Penicillin was also used to prevent infection. On the fourth day after admission, the baby began to develop a fever, and the result of routine blood tests showed WBC 1.89 x 109/L, Neut# 0.4 x 109/L, Hb 126 g/L, and PLT 127 x 109/L, while coagulation function revealed PT 18.7 s, APTT 70.6 s, INR 1.61. Meropenem, red blood cells and plasma were transfused, but the infection was difficult to control. The wound exudate increased and tended to bleed when touched. Abdominal distention also worsened. The patient was diagnosed with sepsis. The baby's parents refused further treatment because of the complexity of the disease, and the patient died shortly after being discharged from our hospital.",
"gender": "Unknown"
}
] |
PMC10076629
|
[
{
"age": 69,
"case_id": "PMC6561004_01",
"case_text": "A 69 year-old-man with a past medical history of hypertension and insulin dependent diabetes was admitted to the hospital after being found unconscious at his home. He was last seen normal about 9 hours prior to the emergency department arrival. Laboratory results revealed hypoglycemia, a blood sugar level of 29 mg/dL (1.6 mmol/L) on arrival. He received intravenous glucose (50% dextrose) immediately as per hypoglycemia protocol. Since his Glasgow Coma Scale (GCS) was low (<8) and with poor airway protection, he underwent endotracheal intubation with mechanical ventilation. There was no immediate clinical improvement even after the serum glucose was normalized. As per the family, he has had several episodes of hypoglycemia in the past and had responded well to immediate replenishment of glucose. Recent dosage modifications of his home insulin by his primary care physician had occurred due to the hypoglycemic events. On neurological examination, he was comatose, not following commands, there was no eye opening to noxious stimuli, pupils appeared to be equal and reactive to light and roving eye movements were noted. Doll's eye phenomenon was preserved. In response to painful stimuli, bilateral flexion of upper extremities was noted. Absent bilateral Babinski's reflex. Stroke was considered in the differential diagnosis. Computed tomography (CT) of head without contrast showed no hemorrhage and CT angiography (CTA) of head and neck was negative for large vessel occlusion. A magnetic resonance imaging (MRI) of brain revealed a hyperintense signal involving the head and tail of the left hippocampus on diffusion weighted image (DWI) sequence (Figure 1, Figure 2). A corresponding hypointense lesion was noted on apparent diffusion coefficient (ADC) sequence (Figure 3). He was transferred to the intensive care unit (ICU) for close neurological monitoring with frequent glycemic checks. His condition improved and was extubated a few days later, he was discharged home with no residual focal deficits.",
"gender": "Male"
}
] |
PMC6561004
|
[
{
"age": 65,
"case_id": "PMC6592670_01",
"case_text": "Taking into account the evaluation of all mortality causes, depending on risk factors, in patients treated for left main coronary artery disease, we observed a higher mortality in the smoking group compared to the nonsmoking group (HR log=1.58, 95% CI ratio 0.4920 to 4.827 for active smoking, and HR log=0.6327, 95% CI ratio 0.2071 to 2.032 for nonsmoking, p=0.4682) as it can be seen in Fig.3A. Also, higher morality was recorded in the group of patients with diabetes mellitus compared to those without diabetes (HR logrank=7.833, 95% CI ratio 2.114 to 17.51 for patients with diabetes mellitus, and HR logrank=0.1277, 95% CI ratio 0.05712 to 0.4730 for patients without diabetes, p=0.0011) (Fig.3B), in the male group compared to the female group (HR log=8.289, 95% CI ratio 2.246 to 16.06 for the male group, and HR log=0.1206, 95% CI ratio 0.06228 to 0.4453 for the female group, p =0.0005) (Fig.3C), but also in 65 years old patients or older compared to the patients aged less than 65 years (HR logrank=2.419, 95% CI ratio 0.8086 to 7.123 for age>=65 years group, and HR log=0.4134, 95% CI ratio 0.1404 to 1.237 for age <65 years group, p=0.1218) (Fig.3D). Thus, with regard to the mortality assessment, statistically significant differences were recorded only depending on the presence of diabetes mellitus and gender.",
"gender": "Female"
},
{
"age": 65,
"case_id": "PMC6592670_02",
"case_text": "Analyzing the left ventricular ejection fraction (LVEF) for three years, in patients treated for left main coronary artery disease, we observed a decrease in LVEF in active smoking group compared to nonsmoking group (HR log=1.539, 95% CI ratio 0.7263 to 3.289 for active smoking, and HR log=0.6496, 95% CI ratio 0.3040 to 1.377 for nonsmoking, p=0.2838) as it can be seen in Fig.4A. Also, a significant decrease in LVEF was recorded in the group of patients with diabetes mellitus compared to the group without diabetes (HR logrank=9.139, 95% CI ratio 3.662 to 14.82 for patients with diabetes mellitus, and HR logrank=0.1094, 95% CI ratio 0.06745 to 0.2731 for patients without diabetes, p<0.0001) (Fig. 4B), in the male group compared to the female group (HR log=2.045, 95% CI ratio 1.058 to 4.448 for male group, and HR log=0.4889, 95% CI (Fig. 4C), but also in the 65-year-old patient group compared to patients aged less than 65 years (HR logrank=1.737, 95% CI ratio 0.9394 to 3.607 for age>=65 years group, and HR log=0.5759, 95% CI ratio 0.2772 to 1.064 for age <65 years group, p=0.0933) (Fig. 4D). Thus, in terms of left ventricular ejection fraction (LVEF), statistically significant differences were recorded only in relation to the presence of diabetes and gender.\nIn what the occurrence of ischemic heart disease symptomatology manifested by angina pectoris depending on risk factors in patients treated for left main coronary artery disease is concerned, we observed an increase in symptomatology in the smoking group compared to the nonsmoking group (HR logrank=1.94, 95% CI ratio 1.240 to 3.925 for active smoking, and HR log=0.5156, 95% CI ratio 0.2548 to 0.8063 for nonsmoking, p=0.0226) as it can be seen in Fig. 5A. Also, an increased rate of symptomatic patients was recorded in the group of patients with diabetes mellitus compared to those without diabetes (HR logrank=2.684, 95% CI ratio 2.280 to 6.625 for patients with diabetes mellitus, and HR logrank=0.3726, 95% CI ratio 0.1509 to 0.4385 for patients without diabetes, p<0.0001) (Fig. 5B), in the male group compared to the female group (HR log=1.861, 95% CI ratio 1.390 to 4.055 for the male group, HR log=0.5374, 95 % CI ratio 0.2466 to 0.7195 for the female group,=0.0075) (Fig. 5C), but also in patients older than or equal to 65 years of age compared to patients aged less than 65 years (HR logran=1.355, 95% CI ratio 0.8773 to 2.604 for age >=65 years group, and HR log=0.7378, 95% CI ratio 0.3840 to 1.140 for age <65 years group, p=0.2021) (Fig. 5D). Thus, with regard to the occurrence of ischemic heart disease symptomatology manifested by angina pectoris, statistically significant differences were recorded onlyforsmoking, diabetes mellitus and gender.\n Looking at the incidence of the acute nonfatal myocardial infarction in patients with left ventricular coronary artery disease, we observed an increase in the rate of acute nonfatal myocardial infarction in the active smoking group compared to the nonsmoking group (HR log=1.832, 95% CI ratio 0.6961 to 4.492 for active smoking, and HR log=0.5459, 95% CI ratio 0.2226 to 1.437 for nonsmoking, p=0.2496) as it can be seen in Fig. 6A. Also, an increase in the rate of acute nonfatal myocardial infarction was recorded in the group of patients with diabetes mellitus compared to those without diabetes (HR logrank=7.833, 95% CI ratio 2.732 to 15.35 for patients with diabetes mellitus, and HR logrank=0.1277 , 95% CI ratio 0.06515 to 0.3660 for patients without diabetes, p<0.0001) (Fig. 6B), in the male group compared to the female group (HR log=1.924, 95% CI ratio 0.8567 to 4.770 for male group and HR log=0.5197, 95% CI ratio 0.2097 to 1.167 for female group, p=0.1227) (Fig. 6C), but also in the group of patients aged 65 years or older compared with patients aged less than 65 (HR logrank=2.15, 95% CI ratio 0.9473 to 5.248 for age >=65 years group, and HR log=0.4651, 95% CI ratio 0.1906 to 1.056 for age <65 years group, p=0.0778) (Fig. 6D). Thus, with regard to the occurrence of acute nonfatal myocardial infarction, statistically significant differences were recorded only depending on the presence of diabetes mellitus.\nRegarding the need for revascularization after treatment (PCI vs. CABG) in patients with LMCAD depending on the risk factors, we noticed a higher need for revascularization in the smoking group compared to the nonsmoking group (HR logrank=2.155, 95% CI ratio 1.232 to 4.229 for active smoking, and HR logrank=0.464, 95% CI ratio 0.2365 to 0.8117 for nonsmoking, p=0.021) as it can be seen in Fig.7A. Also, a higher need for revascularization was recorded in the group of patients with diabetes mellitus compared to those without diabetes (HR logrank=3.808, 95% CI ratio 2.822 to 8.946 for patients with diabetes mellitus, and HR logrank=0.2626, 95% CI ratio of 0.1118 to 0.3544 for patients without diabetes, p<0.0001) (Fig. 7B), in the male group compared to the female group (HR log=1.842, 95% CI ratio 1.217 to 3.884 for male group, and HR log=0.5429, 95% CI ratio 0.2575 to 0.8214 for female groups, p=0.0202) (Fig. 7C), but also in patients aged 65 years or older compared with patients aged less than 65 years (HR logrank=1.528, 95% CI ratio 0.9601 to 3.053 for age >=65 years group, and HR log=0.6546, 95% CI ratio 0.3276 to 1.042 for age <65 years group, p=0.107) (Fig. 7D). Thus, in what the need for revascularization is concerned statistically significant differences were recorded only depending on smoking, diabetes mellitus and gender.",
"gender": "Female"
}
] |
PMC6592670
|
[
{
"age": 9,
"case_id": "PMC8635928_01",
"case_text": "A 9-year-old young girl was referred to the rheumatology clinic from the ophthalmology unit as a case of systemic vasculitis with episcleritis. She presented with recurrent bilateral red painful eyes, a painful swollen left ear, and left knee pain in the preceding 10 months. A month prior to the presentation, she had developed an intermittent fever and reduced hearing. Three months prior to this, she had been admitted with painful swelling of the left knee and a fever, for which she was treated for septic arthritis of the left knee. Two years preceding the visit to the rheumatology clinic, she had also presented to the otorhinolaryngology unit on several occasions with complaints of hearing difficulty and was diagnosed with otitis externa. She has sickle cell disease-genotype SF and is a regular attendant at the pediatric sickle cell clinic. She did not suffer from an autoimmune condition, but had a first-degree cousin with systemic lupus erythematosus. She is the first of 2 children (her younger sibling is well) and has been unable to attend school due to arthralgia and difficulty hearing.\nOn examination, there was mild pallor, axillary lymphadenopathy, and bilateral conjunctival injection with proptosis. The pinnae were swollen, erythematous, and tender, resembling \"cauliflower ears\" (Figure 1). The cardiorespiratory system examination was normal. There was acute synovitis of both knees with an old arthrotomy scar on the left (Figure 2).\nResults from a previous synovial biopsy showed moderate, chronic inflammatory infiltrates composed of lymphocytes and plasma cells with stromal edema and congested vessels, but no malignant cells were seen, in keeping with chronic synovitis. The audiology assessment confirmed bilateral sensorineural hearing loss, worse in the left ear.\nLaboratory investigations showed the following: Hb 10.7 g/dl (11-18 g/dl): microcytic, hypochromic pattern; WBC 15.7 x 10^9/L (2.5-8.5 x 10^9); and platelets 688 x 10^9/L (150-450 x 10^9). Erythrocyte sedimentation rate (ESR) and C reactive protein (CRP) were elevated at 96 mm/hr (0-15 mm/hr) and 143.7 mg/l (<5 mg/l), respectively. Hepatitis B, hepatitis C, and retroviral screens were negative. Hb electrophoresis-Hb A2-3%, Hb F-38.8%, Hb S-57.7%. The rheumatoid factor, ANA, and ENA panel were negative.\nThe initial diagnoses considered were juvenile idiopathic arthritis, septic arthritis of the left knee, systemic vasculitis, relapsing polychondritis (RP), and Cogan's syndrome, but the condition was subsequently confirmed to be RP with inflammatory arthritis based on the diagnostic criteria by McAdam et al. She initially fulfilled 4 out of the 6 features which are as follows: recurrent chondritis of both auricles, nonerosive inflammatory arthritis, inflammation of ocular structures, and bilateral sensorineural hearing loss, and later went on to develop an additional feature of chondritis of laryngeal and or tracheal cartilages as outlined below.\nShe was admitted and started on intravenous (IV) clindamycin 180 mg 6 hourly and IV ciprofloxacin 200 mg 12 hourly for septic arthritis; oral ibuprofen 200 mg 12 hourly, oral paracetamol 250 mg 8 hourly, and prednisolone 15 mg daily to which she showed initial signs of response. The steroids and analgesia were started to help control the inflammation and pain associated with the disease. However, her disease flared up again with significant knee pain and swelling, a left conjunctival injection associated with pain, and high inflammatory markers. Prednisolone was increased from 15 mg to 20 mg daily, and oral methotrexate 7.5 mg weekly and folic acid 5 mg weekly were introduced. The inflammation in the eye persisted, though there was a reduction in inflammatory markers (ESR 70 mm/hr., CRP 111.7 mg/l) at subsequent reviews. The methotrexate dose was titrated up to 10 mg weekly, and the prednisolone dose was further increased to 30 mg daily. Two months after initiation of therapy, she had resolution of the auricular inflammation and a reduction in intermittent eye inflammation. Her knee swelling and tenderness had improved (Figure 2(c)), with a significant decline in her inflammatory markers (ESR-34 mm/hr, CRP 42.7 mg/l). The dose of methotrexate was increased further from 10 mg to 15 mg weekly. This was to provide steroid-sparing treatment, as she still had significant symptoms despite the higher doses of steroids used for control of inflammation. Despite the increase in the methotrexate dose, there was still significant disease activity after 2 months which signified some degree of corticosteroid dependence. The dose of prednisolone was tapered gradually at a dose of 5 mg weekly anytime there was a decrease in inflammatory markers, suggesting a reduction in inflammation.\nDue to failure to respond adequately to methotrexate, as evidenced by the frequency of disease flares and worsening of her eye symptoms, she also developed cataracts due to the high doses of steroids used. This led to the introduction of infliximab 10 months into treatment. She received the loading course of 100 mg of intravenous infliximab at 0, 2, and 6 weeks, but was unable to continue with the maintenance therapy of 8-weekly infusions due to financial constraints. Despite the short course of infliximab, clinical benefits such as reduction in arthritis and eye inflammation were noted. Six weeks after her last infliximab infusion, she developed difficulty breathing.\nThis progressed, leading to her presenting in the emergency room with signs of respiratory distress. On examination, she had audible inspiratory stridor, tachypnea, inspiratory rhonchi, and a slight reduction in breath sounds bilaterally, though vesicular in nature.\nLateral cervical X-ray showed partial narrowing in the region of the cricoid cartilage (Figure 3). A diagnosis of upper airway obstruction (subglottic) secondary to perichondritis of the cricoid cartilage with respiratory fatigue was made upon review by the otorhinolaryngologist and pulmonologist. Treatment ensued with intravenous dexamethasone 2 mg 8 hourly, nebulized Pulmicort 500 mcg 12 hourly, and salbutamol 2.5 mg 4 hourly, and she was transferred to the intensive care unit. An emergency tracheostomy to relieve the subglottic stenosis was performed. She recovered well and was discharged on day 4 of admission.\nHer medications were reviewed, taking into account the financial challenges to include oral colchicine 500 mcg twice daily, oral methotrexate 15 mg weekly and oral prednisolone 40 mg daily which was to be tapered gradually. Knee synovitis persisted, requiring intra-articular injections of 80 mg of methylprednisolone acetate into each joint. Tracheostomy care was carried out regularly at the otorhinolaryngology department, and close vigilance for infection was maintained.\nA year and a half from the start of her treatment, she developed mid- to low-back pain. An X-ray of the lumbosacral spine showed a vertebral collapse at the L1 vertebra. A compression fracture was confirmed on MRI, with similar but less pronounced changes seen in T11, L3, and L4 vertebrae, suggestive of a bone softening process in keeping with glucocorticoid-induced osteoporosis and underlying hemoglobinopathy (Figure 4).\nSteroid dose reduction continued and bisphosphonate therapy with alendronate 35 mg weekly was introduced. Oral dapsone 25 mg daily was added to her treatment for disease control due to its immunosuppressive and anti-inflammatory properties, but she continues to have remitting and relapsing disease.",
"gender": "Female"
}
] |
PMC8635928
|
[
{
"age": 69,
"case_id": "PMC5966628_01",
"case_text": "A 69-year-old man with severe COPD requiring chronic oxygen supplementation (1 L/min) and suspected underlying X-linked granulomatous disease was admitted to the ICU with acute-on-chronic respiratory failure. He had a progressively worsening cough, shortness of breath, increased sputum production and had experienced a 10 kg weight loss with muscle depletion in the preceding three months. The patient had been treated for pulmonary tuberculosis at the age of 23 years, with no subsequent recurrence of infection. Chronic treatment with clomipramine (75 mg/day) was ongoing for a major depressive syndrome which had been diagnosed five years earlier. He was being monitored with monthly seriated electrocardiograms for QT prolongation attributable to clomipramine therapy.\nAt ICU admission, the patient presented with severe dyspnea. Arterial blood-gas analysis showed mixed respiratory failure (pH 7.22, PaO2 58 mmHg, PaCO2 80 mmHg, HCO3- 35 mMol/L) requiring non-invasive ventilation. Chest examination revealed bilateral crackles, with no signs of chronic heart failure. Blood tests showed the white blood cell count to be in the normal range (8000/mm3), with no neutropenia (neutrophil count 1846/mm3), but mild lymphopenia was present (lymphocytes 810/mm3). The patient was anemic (Hb 10.9 g/dL). Platelet count was high (438,000/muL) and C-reactive protein (CRP) was markedly increased (35 mg/L; normal level <5 mg/L). Renal function was normal (serum creatinine 0.9 mg/dL), as were liver function tests (aspartate transaminase [AST] 11 IU/L, alanine transaminase [ALT] 14 IU/L, gamma-glutamyl transpeptidase [GGT] 30 IU/L, total bilirubin 0.15 mg/dL). Baseline electrocardiogram showed a sinus rhythm with a right bundle branch block and prolonged QT interval (453 ms).\nChest x-ray showed multiple bilateral lung opacities. CT and [18F] fluorodeoxyglucose (FDG)-PET/CT scans revealed bilateral nodular infiltrates.\nDue to the patient's critical condition and the multiple potential etiologies for the pulmonary infection, a bronchoscopy was performed, which demonstrated purulent secretions. Broncho-alveolar lavage (BAL) fluid was negative for bacteria, fungi, mycobacteria, Actinomyces spp. and Nocardia, but tested positive for galactomannan (GM; ODI 2.6).\nAccording to the European Organisation for Research and Treatment of Cancer (EORTC) criteria for non-neutropenic patients, the diagnosis of probable IPA was made based on the presence of baseline predisposing comorbidities (severe COPD and suspected X-linked granulomatous disease), the presence of bilateral nodular infiltrates, and GM positivity on BAL.\nVoriconazole was considered unsuitable due to the patient's baseline QT prolongation and the risk of a drug-drug interaction with clomipramine, potentially leading to further QT prolongation and severe cardiac arrhythmias. Isavuconazole therapy was selected, and started with a loading dose of 200 mg every 8 h for six doses, following by 200 mg daily.\nAfter starting antifungal treatment with isavuconazole, the patient showed a progressive improvement in his clinical condition. At week 2, the arterial blood-gas analysis showed resolution of the decompensated respiratory acidosis, with normalization of pH (pH 7.40, PaO2 62 mmHg, PaCO2 50 mmHg, HCO3- 30 mMol/L). There was no further need of non-invasive ventilation. On day 17, the patient was moved from the ICU to the infectious diseases ward, and required only low flow oxygen supplementation (1 L/min). He was discharged on day 42. CT scanning and FDG-PET/TC after eight weeks of antifungal treatment confirmed the improvement of pulmonary infiltrates. In total, a three-month course of isavuconazole treatment was completed, and there were no clinical or radiologic signs of infection after six months' follow-up. Isavuconazole was well-tolerated, with no adverse events and no change in liver enzymes. Serial ECG monitoring showed no prolongation of the QT interval.",
"gender": "Male"
}
] |
PMC5966628
|
[
{
"age": 39,
"case_id": "PMC8688253_01",
"case_text": "A 39 years old man was admitted to our hospital on January 2, 2019 with the chief complaint of recurrent diarrhea and black stool for 3 weeks. A gastroscopy showed erosion, hyperplasia and protuberance of cardia mucosa. Pathological biopsy of the protuberant lesions showed cardia adenocarcinoma. Further immunohistochemistry showed MSH2 (+), MSH6 (+), PMS2 (+), MLH1 (+), HER-2 (2+). And negative for HER-2 fluorescence in situ hybridization (FISH) test and Epstein-Barr encoding region (EBER) polymerase chain reaction (PCR) test. A positron emission tomography - computed tomography (PET-CT) was conducted and showed thickened gastric cardia wall, multiple enlarged lymph nodes with high standard uptake value (SUV), including left supraclavicular lymph nodes, multiple lymph nodes adjacent to the cardia and retroperitoneal lymph nodes, multiple destructive bones (left scapula, right 5th rib, Th8-10 vertebrae, L3 left adnexa, sacrum and left iliac bone). He denied any family history of hereditary diseases and special medical history. The laboratory examination showed elevated carbohydrate antigen 199 (CA19-9) of 52.1U/ml and normal carcinoembryonic antigen (CEA), carbohydrate antigen 125 (CA125) and alpha fetoprotein (AFP) level.\nAfter admission, the patient received 4 cycles of FOLFOX4 chemotherapy from January 9, to February 27, 2019. After the initial 4 cycles of chemotherapy, the patient complaint of aggravated chest and back pain. Besides, CA125 and CA19-9 were increased from 32.1 U/ml to 62.9 U/ml and from 52.1 U/ml to 78.4 U/ml respectively. A computed tomography (CT) scan suggested an increase in the size of metastatic lymph nodes and the extent of bone metastases compared to that before treatment (Figure 1). Thus, the curative effect was evaluated as progressive disease (PD) with a progression-free survival (PFS) of 3.5 months.\nIn order to look for more effective treatment, a next generation sequencing (NGS) (unpublished report) was performed and showed CCND1 gene amplification, RICTOR gene amplification, TMB-L (TMB 5 Muts/Mb) and MSS. The immunohistochemistry of PD-L1 with 22C3 antibody showed a Combined Positive Score (CPS) with 0 (Supplementary Figure 1). Then, the patient accepted second-line chemotherapy of albumin paclitaxel combined with tegafur (S-1) for 6 cycles from March 15th to July 10th, 2019. In the meantime, thoracic spine and lumbar spine radiotherapy of DT 36Gy/12F was performed to relieve the pain. CT scans after every 2 cycles of chemotherapy suggested sustained stable disease (SD). CA125 and CA19-9 decreased to the normal level during the second-line chemotherapy gradually. The patient reported improving quality of life by relieving pain. Thus, single agent maintenance chemotherapy with S-1 was initiated from Aug. 2nd,2019. The regular visit 2 months later showed increased CA19-9 from 30.8 U/ml to 354 U/ml. And the pain was aggravated gradually. The CT scan suggested PD with newly formed bone metastases after maintenance chemotherapy with S-1 for only 2 months (Figure 2). Therefore, a third-line treatment was considered. And in the choice of third-line treatment regimen, either Apatinib or anti-PD-1 was considered according to the Chinese guideline at that time. While considering that the previous paclitaxel was effective as the second line therapy and the high cost of Apatinib or PD-1 antibody at that time, single-agent docetaxel was accepted as the final choice. Docetaxel was used for 3 cycles. And at the same time, right iliac and left acromioclavicular head radiotherapy was conducted at a dose of 30Gy/10F to relieve the pain. The evaluation after three cycles of third line docetaxel showed enlarged lymph nodes in the neck and axilla with aggravated cough, which suggested PD (Figure 3).\nLuckily, a clinical trial of PD-1 antibody SCT-I10A (unlisted) for metastatic gastric cancer was recruiting in our center and the patient was a qualified participant. After informed consent, the patient took part in the clinical trial and received the first dose of PD-1 antibody (SCT-I10A) on January 10, 2020. Surprisingly, the patient reported that the cough disappeared around 3 weeks after the first dose of the drug. Then, due to the pandemic of Corona Virus Disease 2019 (COVID-19), the treatment was discontinued for nearly 3 months without any treatment. After the pandemic, the patient returned to the hospital for further evaluation. The result showed reduced pleural fluid, shrunken mediastinal, neck, axillary and retroperitoneal lymph nodes and normal tumor markers, which were suggestive of partial response (PR) (Figure 4). Considering the inspiring response, another 23 cycles of PD-1 antibody therapy were conducted with the last treatment on 2021.7.16 and the efficacy was assessed as sustained PR.\nTo further clarify whether this patient has specific gene mutations that make him sensitive to immunotherapy, a NGS test of peripheral blood was conducted on Jan. 28th, 2021. The results showed no gene mutations with MSS and TMB-L.\nUp to now, the patient has an overall survival (OS) of over 30 months and has no discomfort. The timeline of patient treatment and change of tumor markers was shown in Supplementary Figure 2.",
"gender": "Male"
}
] |
PMC8688253
|
[
{
"age": 77,
"case_id": "PMC7326191_01",
"case_text": "The case review was conducted according to all guidelines outlined in the Declaration of Helsinki. Written informed consent for publication of any case details and any accompanying images was obtained from the patient's family. A 77-year-old male was taken to our emergency department after being found at the foot of a flight of stairs in a semicomatose state. Although nobody witnessed the fall, the trauma was apparent from multiple abrasions and bruising on the face and chest. Upon arrival at the emergency room, the Glasgow coma scale (GCS) score was 6 (E1M3V2), and the pupil size and light reflex were intact. The neurologic examination demonstrated no focal neurologic deficits, including motor weakness or sensory change in all four extremities. The patient had no underlying disease such as hypertension, diabetes, or heart disease, and did not take any medication that induces coagulopathy.\nInitial CT of the brain disclosed diffuse SAH of the basal cistern, accompanying intraventricular hemorrhage (IVH), and hydrocephalus, which are common in nontraumatic aneurysmal SAH (Figure 1). Despite the external wounds and skull fracture, the appearance of the SAH was different from that of usual traumatic SAH, which typically shows small amounts of blood in the sulci of the cerebral convexities. We suspected that an aneurysm might have ruptured spontaneously just before the patient fell down the stairs, causing trauma secondarily. However, the subsequent head and neck CT angiography failed to reveal a cerebral aneurysm or other vascular malformation that could give rise to basal SAH.\nWe performed extraventricular drainage (EVD) emergently at the right Kocher's point to relieve the hydrocephalus. The opening pressure was as high as 15 cm H2O and the intracranial pressure (ICP) decreased after draining the bloody cerebrospinal fluid (CSF). However, the patient showed minimal neurologic improvement postoperatively.\nAfter stabilizing the ICP, we performed digital subtraction angiography (DSA) to identify a cerebral aneurysm or other vascular malformation that might have been missed on CT angiography. The DSA disclosed a 1.8 mm sized traumatic pseudoaneurysm at the mid-portion of the right PCoA that was inapparent on CT angiography (Figure 2). We observed extravasation of contrast media from it, resulting in basal SAH (Figure 2B). In this manner, because no other aneurysm or pre-existing vascular abnormality was found on DSA, the patient's basal SAH was confirmed as traumatic in origin.\nAfter confirming adequate blood flow of the right posterior cerebral artery through the posterior circulation, we performed endovascular trapping from the mid- to distal portion of the right PCoA using coils (Figure 3A and B). There was no intraoperative unexpected event or thromboembolic complication. Postoperatively, we confirmed the absence of extravasated contrast media and intactness and patency of the collateral vessels (Figure 3C and D). Despite successful trapping of the PCoA, the patient had an unfavorable clinical course. Although the patient's mental status improved minimally, to stuporous mentality, the hydrocephalus persisted, requiring repeated EVD. The patient did not recover alert mentality and was transferred to another local hospital.",
"gender": "Male"
}
] |
PMC7326191
|
[
{
"age": 39,
"case_id": "PMC4427135_01",
"case_text": "A 39-year-old male with no significant past medical history presented with a 1-week history of increasing pain in the calf of the right leg associated with bluish-black discoloration on the back of right leg from the upper thigh to the ankle area. He denied any history of trauma to the leg and reported that he was driving when he noticed a 'pop' noise from his right leg. Since then he had noticed gradually increasing swelling, pain and discoloration of the leg. His social history was significant for consumption of twelve 16-ounce bottles of beer every day for 20 years (232 g of alcohol daily). He denied any history of blood in stool or urine, epistaxis, easy bruising or bleeding in joints or any surgeries in the past. His family history was noncontributory in terms of bleeding disorders.\nAt first presentation, his pulse was 96/min, blood pressure 137/79 mm Hg, respiratory rate 20/min, temperature 98.7 F. General examination showed a well-developed man in no distress, with pallor and icterus. Local examination was significant for severe tenderness over the right calf region with tense rigidity. Extensive tense ecchymosis was noted over the back of the right leg extending from the lower gluteal fold to the ankle (fig. 1). Distal pulses were intact. Neurologic examination showed intact power and sensation to pain, pressure and vibration. Systemic examination was significant for smooth liver margin palpable at least 2 cm below the costal margin with a liver span of approximately 9 cm and splenomegaly. Labs at admission were significant for hemoglobin (9.2 mg/dl), hematocrit (26.8%), reticulocyte index (1.4), mean corpuscular volume (105.2 fl) and platelet count (64,000/mul). Liver function tests showed total bilirubin 7.2 mg/dl and direct bilirubin 2.1 mg/dl, total protein 6.5 g/dl, albumin 2.3 g/dl, alkaline phosphatase 164 U/l, gamma-glutamyltransferase 133 U/l, aspartate aminotransferase 59 U/l and alanine aminotransferase 30 U/l. Coagulation profile showed prothrombin time 25.1, activated partial thromboplastin time 44.2 and international normalized ratio 2.43. Direct Coombs test was negative. Creatinine kinase at admission was 63 U/l. Individual coagulation factor assays are shown in table 1. A computed tomography scan of the lower extremity without contrast showed multiple loculated fluid collections in the medial head of the gastrocnemius muscle which measured 4.5 x 2.6 cm (fig. 2). Compartment syndrome was ruled out in the absence of signs of gangrene or neurovascular compromise. After admission, the patient received 2 units of fresh frozen plasma to correct the coagulopathy; however, overnight his hemoglobin dropped to 7.2 g/dl, which raised suspicion of rebleed. Doppler ultrasound of the legs showed a stable hematoma of 14.2 x 3.0 x 4.2 cm and a fecal occult blood sample was negative for blood. Abdominal ultrasound showed nodular appearance of the liver consistent with cirrhosis and splenomegaly and a large ascites. Ascitic fluid analysis showed a high serum-ascites albumin gradient which was consistent with cirrhosis as the cause of ascites. Other causes of cirrhosis were ruled out with a negative autoimmunity workup and negative hepatitis profile. Serum and urine immunofixation were negative for monoclonal bands. Though the patient did not exhibit any neurologic signs, we ruled out Wilson's disease with a normal ceruloplasmin level. Coagulopathy workup showed prolonged thrombin time and correction of prothrombin time/activated partial thromboplastin time on both immediate and incubated mixing studies, indicating factor deficiency.\nSpecific factor assays showed depletion of all factors except for factor VIII, which further confirmed the suspicion that the factor depletion was secondary to liver cirrhosis. Liver biopsy was deferred in view of the deranged coagulation profile. He was discharged after 8 days in stable condition, having been told that he had a life-threatening condition and that complete abstinence from alcohol for 6 months would be necessary before transplantation could be considered. Screening esophagoscopy showed large esophageal varices without any stigmata of bleeding. On follow-up visits to the outpatient clinic the hematoma continued to resolve, however liver function tests and coagulation profile continued to worsen. Four months later he was readmitted with worsening ascites and increasing bilateral swelling. He was found to have renal insufficiency and a high serum-ascites albumin gradient. He was also diagnosed with heart failure with preserved ejection fraction; the presentation was suggestive of hepatorenal syndrome. The patient requested a return to his home country (Mexico) for further care. This was arranged with the help of palliative services.",
"gender": "Male"
}
] |
PMC4427135
|
[
{
"age": 71,
"case_id": "PMC9726840_01",
"case_text": "A 71-year-old woman who had previously been diagnosed with rheumatoid arthritis presented with generalized edema, worsening hypertension, and non-blanchable erythematous papules with reticulation on both legs, which had been presented for 4 months, as shown in Figure 1. Rheumatoid arthritis had been diagnosed 5 years prior when she presented with polyarthralgia and positivity for rheumatoid factor. Prednisolone, methotrexate, and subcutaneous etanercept were prescribed, and complete clinical remission had been achieved after 2 years of treatment. The medications were then discontinued, and the patient sustained her clinical remission afterward.\nThe patient had developed both ankle edema 4 months prior to this admission, which slowly progressed to the pretibial areas. Her urine appeared foamier for 2 months, which was accompanied by rising of blood pressure according to a home monitoring device. Urine color and volume were unchanged from the patient's perspective. Physical examination indicated high blood pressure (190/94 mm Hg), bilateral pitting edema, and livedo reticularis of both legs. No other skin lesion was found. There was no active arthritis, fever, or lymphadenopathy. The results of the initial investigation are displayed in Table 1, which shows a serum creatinine of 1.86 mg/dL, dysmorphic red blood cells in urine, and proteinuria.\nFurther investigations showed a positive result for antinuclear antibody (ANA) with a homogeneous, fine-speckled, and nucleolar pattern (titer > 1:1280). The level of rheumatoid factor was 54.40 IU/mL (normal < 20 IU/mL). Serum cryoglobulin was positive. Serological tests for HCV and human immunodeficiency virus (HIV) were negative. The serology results for hepatitis B virus (HBV) were negative for HBsAg, positive for anti-HBc, and positive for anti-HBs antibodies. Complement C3 was normal, and C4 was 3.09 mg/dL (10-40 mg/dL).\nA percutaneous kidney biopsy was performed and kidney pathology is shown in Figures 2 and 3. The kidney pathology revealed diffuse endocapillary hypercellularity and mesangial expansion with lobular accentuation of glomeruli in hematoxylin and eosin (H&E) staining. Periodic acid-Schiff (PAS) staining demonstrated global and diffuse double-contour thickening of the glomerular basement membrane, which was compatible with a pattern of MPGN. No crescentic lesion was observed.\nThe immunofluorescence (IF) study revealed predominant IgM (2+) staining. IgG (1+) and C3 (1+) granular staining in mesangium and capillary loops were also observed. Equivalent kappa and lambda staining was found in the capillary loops (1+). C1q and IgA results were negative. Figure 3 displays the results of an electron microscopic (EM) study, which revealed the deposition of organized electron-dense materials at the mesangium and subendothelium. The substructures were composed of short microtubules (~20 nm thickness) with hollow centers. Neomembrane formation and diffuse foot process effacement were also noted.\nThe positive result for serum cryoglobulin, bilateral skin rash compatible with leukocytoclastic vasculitis, polytypic IgM-dominant deposits in the IF study, and organizing deposits in the EM study help to narrow the diagnosis to cryoglobulinemic glomerulonephritis. The kidney pathology did not show any light-chain restriction since there was equal intensity of kappa and lambda staining, suggesting mixed cryoglobulinemic glomerulonephritis. The underlying cause of cryoglobulinemia was then investigated in this elderly patient.\nCommon causes of mixed cryoglobulinemia such as HCV and HBV were ruled out by negative serology results. The results of age-appropriate cancer screenings including colonoscopy, mammography, and pelvic examination were all negative. However, serum protein electrophoresis revealed a monoclonal spike of 0.35 g/dL. Serum immunofixation showed IgM kappa monoclonal gammopathy. The immunofixation of cryoprecipitate was not done at that time due to the logistic issue in the out-patient setting. Serum kappa was 248.31 mg/dL (3.3-19.4 mg/dL) and serum lambda was 40.84 mg/dL (5.71-26.30 mg/dL) with a kappa-to-lambda free light-chain ratio of 6.08. These findings raised the possibility of lymphoproliferative disorder. However, bone marrow aspiration and biopsy showed normocellular trilineage marrow without evidence of abnormal clonality, lymphoma, or plasma cell disorders.\nBased on all evidence, particularly the detectable monoclonal IgM kappa gammopathy in the patient's serum despite not revealing lymphoproliferative disease, a diagnosis of MGRS with non-hepatitis-associated mixed cryoglobulinemic glomerulonephritis was suspected. After a multidisciplinary team discussion and informing the patient of all the possibilities, clone-directed therapy was initiated, including a 3-week cycle of oral cyclophosphamide at 200 mg/day and dexamethasone. After six cycles, the bilateral leg edema and rash were completely resolved. Serum creatinine was decreased to 0.83 mg/dL, and proteinuria was 0.49 g/g creatinine. The monoclonal protein level was decreased to 0.13 g/dL, and the serum kappa-to-lambda ratio was 1.3. The patient is still in remission as of 3 years after the completion of treatment.",
"gender": "Female"
}
] |
PMC9726840
|
[
{
"age": null,
"case_id": "PMC2892669_01",
"case_text": "A British Caucasian male patient, born in 1946, fell down from a ladder in 2002 and sustained concussional brain injury, soft tissue injury to left shoulder, burst fracture of thoracic vertebrae 4, 5, and 6, paraplegia T-5 (American Spinal Injury Association grade B), multiple rib fractures and mediastinal haematoma. Following rehabilitation, this patient had been managing his bladder by long-term indwelling catheter drainage.",
"gender": "Male"
},
{
"age": null,
"case_id": "PMC2892669_02",
"case_text": "In June 2009, he developed temperature of 38.8 degrees Celsius. White cell count was high (18.1 x 109/L). Neutrophils were increased (15.85 x 109/L). C-reactive protein was elevated (121.1 mg/L). Total protein: 65 g/L. Albumin: 39 g/L. Globulin: 26 g/L. Urine microbiology showed growth of Klebsiella pneumoniae, which produced an extended spectrum beta-lactamase and multiresistant. This patient was prescribed gentamicin 320 mg once daily. In October 2009, this patient again developed urine infection. C-reactive protein was high at 165.8 mg/L. Total protein: 69 g/L. Albumin: 38 g/L. Globulin: 31 g/L. Haemoglobin was 12.7 g/dL. Urine showed growth of Escherichia coli; antibiotic sensitivity report was not available. This patient was prescribed meropenem, one gram intravenously every eight hours. While the patient received meropenem, another sample of urine was sent for microbiology; this sample of urine showed no growth. Intravenous urography was performed in November 2009 to exclude stones in the upper urinary tract as a reason for the recurrent urinary tract infection. No renal or ureteric calculi were found.",
"gender": "Male"
},
{
"age": null,
"case_id": "PMC2892669_03",
"case_text": "In January 2010, this patient decided to undergo suprapubic cystostomy so that he could discard permanent catheter in the penis. At the time of undergoing suprapubic cystostomy, this patient was feeling well; he did not have symptomatic urine infection. He did not suffer from any comorbid condition such as diabetes mellitus, pressure sore, ischaemic heart disease, hypertension, or mental health problem. This patient had Medtronic programmable pump implanted for intrathecal administration of baclofen for control of spasticity. His medications were senna syrup, sugar-free, 30 mg on alternate evenings; Micralax Micro-enema 5 mL on alternate mornings; oxybutynin modified release 10 mg, once daily. Neither blood tests nor urodynamics were performed prior to suprapubic cystostomy. He was given gentamicin 240 mg intravenously, as antibiotic sensitivity report of urine sample was not available to physicians treating this patient. Suprapubic cystostomy was performed in the outpatient department using Add a Cath. The urinary bladder was located by ultrasound scan. The procedure was carried out uneventfully. Following suprapubic cystostomy, there was mild haematuria. Two hours later, this patient was feeling unwell; he had tachycardia, spasms, and cold fingers. Temperature was 38 degrees Celsius; oxygen saturation was 97%; urine was stained with blood; there was some oozing of blood from suprapubic cystostomy site. Suprapubic catheter was patent. Diagnosis was septicaemia. He had received one dose of gentamicin 240 mg intravenously. Subsequently, a review of laboratory reports revealed that in October 2009, urine showed growth of coliforms, sensitive to meropenem. Therefore, this patient was prescribed meropenem 1 gram intravenously every eight hours. He was given fluids intravenously. A Foley catheter was inserted per urethra. Blood culture was taken. This blood culture yielded growth of Escherichia coli; however, antibiotic sensitivity was not available. Full blood count revealed low white cell count of 2.7 x 109/L, which indicated severe sepsis. Blood test showed Total Protein: 72 g/L; Albumin: 40 g/L; Globulin: 32 g/L.",
"gender": "Male"
},
{
"age": null,
"case_id": "PMC2892669_04",
"case_text": "Sixteen hours after undergoing suprapubic cystostomy, this patient was afebrile. He was breathing spontaneously with 40% oxygen by nasal mask. Heart rate was 93 per minute; Blood pressure was 80/33 mm Hg; respiratory rate was 16 per minute. There was peripheral cyanosis; capillary circulation return time was greater than two seconds. Examination of chest revealed bilateral equal air entry and vesicular breath sounds. Abdomen was soft and bowel sounds were present. Clinical impression was septicaemia and hypovolaemia. Rate of administration of intravenous fluids was increased to 160 mL per hour. Arterial blood gas showed pH: 7.393; pCO2: 5.87 kPa; pO2: 8.25 kPa; actual bicarbonate: 26.2 mmol/L; standard bicarbonate: 25.2 mmol/L; base excess: 1.0 mmol/L. Full blood count showed leucocytosis (15.6 x 109/L); neutrophils count was high (15.3 x 109/L). APTT ratio was high at 1.40 (reference range: 0.84-1.16). C-reactive protein was high at 123.1 mg/L. Blood urea: 9.1 mmol/L; creatinine: 148 micromol/L; sodium: 133 mmol/L; potassium: 4.3 mmol/L.",
"gender": "Male"
},
{
"age": null,
"case_id": "PMC2892669_05",
"case_text": "Thirty-four hours after performing suprapubic cystostomy, this patient was found to be confused. Heart rate was 113 per minute; blood pressure was 119/63 mm Hg. Physical examination revealed clear chest; abdomen was silent; penis was oedematous. Blood tests showed sodium: 133 mmol/L; potassium: 4.3 mmol/L; urea: 9.1 mmol/L; creatinine 148 micromol/L. This patient was given intravenous infusion of succinylated gelatine (Gelofusine) 500 mL. Even after this fluid challenge, urine output was only 15 mL. Both urinary catheters were patent. On clinical examination, abdomen was soft and nontender. Urinary bladder was not palpable; suprapubic wound was healthy; penis was very oedematous.",
"gender": "Unknown"
},
{
"age": null,
"case_id": "PMC2892669_06",
"case_text": "Thirty-six hours after undergoing suprapubic cystostomy, this patient was in renal failure; urine output was 5 mL in two hours. Full blood count showed very high white cell count (23.6 x 109/L). Haemoglobin was slightly low at 10.5 g/dL. Platelet count was also low at 12 x 109/L 1. Neutrophils were greatly increased (22.4 x 109/L). Blood urea had risen to 16.4 mmol/L. Creatinine concentration also had increased to 253 micromol/L. Sodium was low at 127 mmol/L. Potassium level had increased from 4.3 mmol/L to 5.4 mmol/L. This patient developed cardiac arrest 38 hours after suprapubic cystostomy. After 28 minutes of unsuccessful resuscitation, he was declared dead. Patient's wife did not give permission for autopsy.",
"gender": "Male"
}
] |
PMC2892669
|
[
{
"age": 0,
"case_id": "PMC3245498_01",
"case_text": "A 45-day-old male baby born at term with a birth weight of 2600 g presented with vomiting and poor sucking. Body weight was 2600 g, indicating that the patient had not gained weight since birth. Physical examination revealed severe dehydration and mild scrotal hyperpigmentation. Laboratory results were as follows: Serum Na: 114 mEq/L (N: 135-143 mEq/L), K: 7.7 mEq/L (N: 3.5-5.5mEq/L), blood pH: 7.3, HCO3: 12 mmol/L, BUN: 24 mg/dL (0-10 mg/dL), creatinine: 0.5 mg/dL (0.3-1.2 mg/dL). Urinalysis revealed leukocytes and urine culture grew 100 000 colonies/mL E. coli. Intravenous saline treatment was started together with antibiotics for the UTI. Hormonal evaluation results were adrenocorticotropic hormone (ACTH): 186 pg/mL (N: 3-46 pg/mL), basal cortisol: 8 mug/dL, renin: 836 pg/mL (N: 2.4-37 pg/mL) and aldosterone: 450 pg/mL (N: 20-700 pg/mL) - findings which led to a preliminary diagnosis of PHA. A high ACTH value was noted. The ACTH stimulation test performed to rule out CAH gave the following results for 17-hydroxyprogesterone (17-OHP) response: 27.7 ng/mL at 0 time, 37.2 ng/mL at 30 minutes and 35.3 ng/mL at 60 minutes. The patient was therefore diagnosed as CAH. Treatment was started with hydrocortisone and fludrocortisone and 1 g/day salt was added to the diet. A high level of aldosterone despite salt loss is not expected in CAH. We therefore performed renal ultrasonography to detect any renal anomaly that could cause a lack of response to aldosterone and found grade 2 hydronephrosis of the left kidney and bilateral grade 4-5 VUR on voiding cystogram. Amoxicillin prophylaxis was started. Genetic analysis revealed a heterozygous Q318X and homozygous IVS2 mutation of the 21-OH gene. Bilateral Teflon injection was performed for the VUR. The patient is currently 4 years old, is on hydrocortisone and fludrocortisone and is being followed-up without any problems.\nPatient 2",
"gender": "Male"
},
{
"age": 0,
"case_id": "PMC3245498_02",
"case_text": "A 35-day-old male baby born with a birth weight of 3500 g at term presented to the emergency service of our hospital with vomiting and failure to thrive. His weight was 3200 g,",
"gender": "Male"
},
{
"age": 1,
"case_id": "PMC3245498_03",
"case_text": "indicating a weight loss of 8% since birth. The patient's general condition was poor. Marked dehydration and mild scrotal hyperpigmentation were present. Laboratory results were as follows: Serum Na: 95 mEq/L (N: 135-143 mEq/L), K: 6.9 mEq/L (N: 3.5-5.5 mEq/L ), blood pH: 7.3, HCO3: 11.7 mmol/L, BUN: 26 mg/dL (0-10 mg/dL), creatinine: 0.47 mg/dL (0.3-1.2 mg/dL). Urinalysis was positive for nitrite and leukocytes and there was a growth of 100 000 colonies of Klebsiella on urine culture. Fludrocortisone and antibiotics were started together with intravenous fluid treatment. Renal ultrasonographic investigation for UTI showed prominent collective structures in the left kidney and grade 2 VUR on the voiding cystogram. Antibiotic prophylaxis was started. Hormonal evaluation revealed basal cortisol of 18 mug/dL, ACTH 89.5 pg/mL (N: 3-46 pg/mL), renin: 186 pg/mL (N: 2.4-37 pg/mL), and aldosterone level of 2 000 pg/mL (N:20-700 pg/mL). The preliminary diagnosis was PHA. The patient benefited from fludrocortisone treatment. Taking into account the high serum ACTH level, an ACTH stimulation test was performed to rule out CAH and the 17-OHP response was as follows: 27.6 ng/mL at 0 time, 44.1 ng/mL at 30 minutes and 41.2 ng/mL at 60 minutes. Hydrocortisone was added to the fludrocortisone and salt treatment. Genetic analysis revealed a large deletion of the 21-OH gene. The patient is currently 1 year old and is being followed-up without any problems on hydrocortisone, fludrocortisone and oral 1 g/day salt treatment. Age at presentation and laboratory findings of the patients are given in Table 1.",
"gender": "Unknown"
}
] |
PMC3245498
|
[
{
"age": 62,
"case_id": "PMC5369366_01",
"case_text": "A 62-year-old man was admitted to our hospital with three weeks of non-productive cough, dyspnea, fatigue, and anorexia. He had started ibrutinib six weeks prior to admission for relapsed CLL. He was retired and lived in western Oregon. He reported no exposure to tobacco, dust, birds, or other animals. His tuberculin skin test was negative prior to initiation of ibrutinib. On examination, the patient was afebrile (36.7 C); pulse was 66/min; BP was 82/52 mm Hg; respiratory rate 16/min; and oxygen saturation 96% on room air. Cardiopulmonary examination was normal. Laboratory investigations revealed anemia (Hgb 5.0 g/dL), leukocytosis (21.2 x 103/mul), decreased platelets (140 x 103/mul), and a normal neutrophil count (1.91 x 103/mul). Serum chemistries were notable for a sodium of 129 mmol/L, chloride of 97 mmol/L, bicarbonate of 17 mmol/L, urea nitrogen of 26 mg/dL, and creatinine of 1.2 mg/dL.\nComputed tomography scan of the lung showed multifocal upper lobe centrilobular nodules, patchy consolidations with air bronchograms, and small areas of cavitation (Fig. 1A), findings that were not present prior to ibrutinib initiation. Bronchoscopy revealed endobronchial masses in the lingula and right upper lobe (Fig. 1B). Biopsy of the masses showed necrotic mucosa containing septate fungal hyphae with acute angle branching, consistent with Aspergillus (Fig. 1C). Bronchoalveolar lavage (BAL) was performed in the right middle lobe. BAL fluid grew Aspergillus fumigatus and showed no evidence of acid-fast bacilli or nocardia. BAL galactomannan was positive.\nThe patient was treated with voriconazole and ibrutinib was briefly discontinued. The patient developed hypercalcemia suspicious for relapsed CLL and ibrutinib was resumed at a lower dose. Serial chest radiographs showed resolution of the multifocal consolidative opacities and nodules over the subsequent two months. The patient's CLL continued to progress despite additional chemotherapy and he died five months after starting ibrutinib.",
"gender": "Male"
}
] |
PMC5369366
|
[
{
"age": 29,
"case_id": "PMC4996573_01",
"case_text": "A 29-year-old female presented to the emergency department with severe abdominal pain. A CT scan showed a possible urachal diverticulum with signs of surrounding infection and inflammation. Her urine culture grew out Escherichia coli and Enterococcus faecalis. She defervesced with antibiotics and conservative measures.\nEight months later, she was referred to urology with a history of chronic suprapubic pain, dyspareunia, and dysorgasmia. The pain was described as intermittent lasting minutes to hours. She also noted soreness in the suprapubic area and bloating. Follow-up MRI revealed a benign-appearing multilocular urachal cyst with thin nonenhancing septations as depicted in Figures 1 and 2. On cystoscopy, the bladder appeared normal. However, palpation of the tender abdominal area correlated cystoscopically with the dome of the bladder in the region of the urachal remnant. She opted for cyst removal in an attempt to alleviate her symptoms and reduce the risk of reinfection or malignant transformation.\nThe patient was positioned in the steep Trendelenburg position and an 18F three-way Foley catheter was inserted. We insufflated the abdomen supraumbilically using a Veress needle. The procedure was done transperitoneally with port placement similar to a standard robotic prostatectomy. The urachus was divided and the bladder was mobilized from the anterior abdominal wall by incising the peritoneum lateral to the medial umbilical ligaments. The space of Retzius was developed. A flexible cystoscope was placed into the bladder to illuminate the bladder dome and urachal remnant:this video feed was transmitted into the Tile Pro software of the robot to allow simultaneous cystoscopic visualization through the robotic console illustrated in Figure 3. The urachal cyst was mobilized and skeletonized down to a small neck at its insertion. The detrusor muscle layer was incised with thermal energy just below the neck of the cyst but superficial to the bladder mucosa. The cyst was extracted and sent for frozen section, which was negative for malignancy, obviating the need for partial cystectomy. The overlying detrusor was repaired with a 3-0 V-Loc followed by a second 3-0 V-Loc on the muscle and peritoneum. The bladder was filled and the repair was noted to be watertight.\nThe patient was discharged home the same day. Her catheter was removed on day 3. She has remained symptom free over the past 12 months since surgery.",
"gender": "Female"
}
] |
PMC4996573
|
[
{
"age": 37,
"case_id": "PMC6217883_01",
"case_text": "A 37-year-old African American man with a history of type 1 diabetes and sickle cell trait was referred to the Gastroenterology service for ERCP/EUS to evaluate jaundice. He presented with right upper quadrant (RUQ) abdominal pain with associated nausea and vomiting ongoing in the past ten days. He denied the use of tobacco, alcohol, or other illicit drugs. The patient reported several female sexual partners in the past six months. Physical exam revealed scleral icterus and RUQ abdominal tenderness. Laboratory studies were notable for alanine aminotransferase (ALT) of 59 U/L, aspartate aminotransferase (AST) of 39 U/L, total bilirubin of 11.4 mg/dL, and alkaline phosphatase (ALP) of 657 U/L. His hepatitis A antibody, hepatitis B surface antigen, hepatitis B surface antibody, and hepatitis C antibody were negative. HIV-1 and HIV-2 antibodies were negative. Serum autoimmune markers, alpha-1 antitrypsin, iron profile, and ceruloplasmin were also negative. Antimitochondrial antibody was positive and smooth muscle antibody was weakly positive. Lactate dehydrogenase and haptoglobin levels were within normal limits.\nLiver ultrasound showed mild hepatic fatty infiltration without biliary obstruction or stones. Magnetic resonance cholangiopancreatography (MRCP) was negative for biliary or pancreatic ductal dilation. RPR returned positive with a reflex titer of 1:64. Treponema pallidum IgG was sent for confirmation and it was reactive. Liver biopsy demonstrated chronic hepatitis with normal hepatic architecture, Kupffer cell hyperplasia, hepatic cholestasis and ductal proliferation (Figure 1). Iron stain was positive. Periodic acid-Schiff and Periodic acid-Schiff-diastase stains were negative for alpha 1 anti-trypsin granules. Warthin starry stain was negative. Immunochemical stain for Treponema pallidum revealed no organisms. These findings were suggestive of syphilitic hepatitis. Patient had a reported allergy of pruritus to penicillins in the past. The allergist was consulted and patient underwent a challenge with oral penicillin and tolerated it well, no reaction was noted. The patient was given a single dose treatment: penicillin G 2.4 million units intramuscular route (IM) once. He showed symptomatic improvement subsequently, including resolution of nausea/RUQ abdominal pain. He was discharged to be followed up outpatient. Follow-up visit in two weeks revealed improvement in serum biochemical tests with ALT of 45 U/L, AST of 39 U/L, ALP of 298 U/L, total bilirubin 1.7 mg/dL, and absence of abdominal pain.",
"gender": "Male"
}
] |
PMC6217883
|
[
{
"age": 57,
"case_id": "PMC9207123_01",
"case_text": "A 57-year-old male was consulted by the internal medicine department with a chief complaint of painful tumors on the chest, right shoulder and neck. Eleven months prior to the consultation, the patient complained of multiple lymphadenopathies on the right side of the neck, covered by multiple marble-sized tumors overlying the lymphadenopathy after one month. The tumors spread to the chest and neck in two months. The patient also complained of coughing and voice hoarseness. Within two months prior to the consult, the skin lesion increased in number and became painful. The complaint was followed by shortness of breath, voice hoarseness, coughing, and weakness; hence, the patient was treated by a hematology-oncology specialist. The history of malignancy in the family was unknown. The patient admitted to having a history of smoking as a risk factor.\nPhysical examination revealed rapid breathing, pale conjunctiva, increased jugular venous pressure, asymmetrical chest movement, diminished vesicular breathing sound on the left hemithorax, and multiple immobile and non-tender lymphadenopathies in the anterior and posterior sides of the neck and around the cervical region. Dermatological status revealed multiple tumors on the chest, right shoulder and neck with well-defined border and serous crust found on several tumor surfaces (Figure 1). In the internal medicine department, the patient had undergone several examinations; chest radiography showed right pleural effusion with lymphocytic effusion on cytologic examination, while enhanced chest CT-scan showed a solid mass in the anterior mediastinum, superior vena cava syndrome, and pleural effusion (Figure 2). Histopathological examination of the lymph node revealed metastatic carcinoma in the right supraclavicular region, and immunohistochemistry (IHC) examination of the lymph node was positive for CK7.\nThe histopathological result from affected skin revealed round, hyperplastic, and hyperchromatic cells in the dermis consistent with metastases to the skin (Figure 3). We continued the immunohistochemical (IHC) staining to find the primary tumor, resulting in positive CK7. Meanwhile, IHC results for CD5, CD117, p63, CK20, P40, and TTF-1 were negative (Figure 4). It was determined that the primary tumor originated from thymic carcinoma because CK7 was positive on IHC examination of the skin tissue and lymph nodes, and enhanced chest CT-scan revealed a mass in the mediastinum that favors thymic carcinoma.\nThe patient was treated with a chemotherapy regimen of cyclophosphamide, doxorubicin, and carboplatin planned for six cycles. Unfortunately, the patient passed away after receiving only three cycles of chemotherapy.",
"gender": "Male"
}
] |
PMC9207123
|
[
{
"age": 9,
"case_id": "PMC3700476_01",
"case_text": "A 9-year-old boy was presented to our emergency department complaining of left hip pain, fever, malaise, and inability to bear weight. The pain was described as \"dull\" and was aggravated by movement and only partially relieved by rest and analgesics. The condition started 14 days prior to presenting at our department with left knee pain and limping. The fever was intermittent. There was a history of sore throat 5 days before the knee pain, for which the patient received an incomplete course of antibiotics. Ten days later, the knee pain progressed to an increasing pain that started in the left groin, with inability to bear weight. At this stage of the disease the patient presented to our hospital. The patient denied any history of trauma.\nOn examination the patient was unwell, with a temperature of 39.5 C. No other focus of infection was identified on examination. His left hip was held in flexion, abduction, and external rotation. His hip and thigh were tender, but there was no erythema or swelling. Active movements were more painful than passive movements. The painful limitation of all ranges of motion suggested an acute hip problem.\nLaboratory investigations at the time of presentation showed evidence of acute infectious process. Leukocytic count was 22 300/mm3, erythrocyte sedimentation rate (ESR) was 135 mm/h, and C-reactive protein was 4.6 mg/dl. The patient's blood culture grew Staphylococcus aureus sensitive to oxacillin, cefoxitin, and gentamicin.\nThe plain radiograph of the hip and pelvis revealed normal contour, joint space, and alignment, with no soft-tissue abnormalities, but the left hip was in abduction, flexion, and external rotation (Figure 1). Ultrasound of both hips revealed mild left hip effusion.\nThe clinical picture and laboratory investigations were strongly suggestive of septic arthritis of the hip, and the patient had signs of sepsis that needed urgent intervention. An informed consent for urgent arthrotomy and drainage was obtained after discussion with the family.\nUnder general anesthesia and with the help of an image intensifier, aspiration of the hip was performed, which showed blood-stained fluid that was sent for gram staining, culture, and sensitivity testing. The decision was made to proceed with open drainage of the hip through an anterior approach. Exploration of the left hip revealed no pus and the synovial membrane was normal. Samples of synovial fluid and synovium were taken for gram staining, culture, sensitivity testing, and for histopathological examination; the results were normal.\nAntibiotics were started in the operating room - intravenous cefoxitin 100 mg/kg /day in 4 divided doses and cloxacillin 100 mg/kg/day in 4 divided doses - after taking the necessary samples. Skin traction was applied to the left hip.\nMRI (Figures 2 and 3) was requested to rule out osteomyelitis of the proximal femur, pelvic collection, or sacroiliitis. It revealed lobulated collection, of low attenuation, with enhancing rim at the left side of the pelvis involving the left OI and extending to the left OE muscles, as well as small abscesses seen in the left vastus intermedius and vastus lateralis muscles. MRI findings confirmed the diagnosis of pyomyositis of the left OI extending to the OE.\nTreatment was continued in the form of antibiotics and skin traction. The patient showed steady improvement and his temperature returned to normal within 48 hours, with gradual improvement of the hip pain. After 3 days the patient regained painless movement of the left hip and he was walking with a slight limp. The patient was discharged from the hospital in good general condition, with full weight-bearing and without limping after completing a 1-week course of intravenous antibiotics. When C-reactive protein returned to normal, oral cloxacillin, 500 mg every 6 hours was started and continued for 2 weeks. The patient was followed in our outpatient clinic for 2 years without any complaints. At the final follow-up the patient was fully active and had full range of motion.",
"gender": "Male"
}
] |
PMC3700476
|
[
{
"age": 12,
"case_id": "PMC9873306_01",
"case_text": "Our case refers to a 12-year-old boy with painless exophthalmos in the left eye. He had no relevant clinical symptoms, a previous medical history of binocular vision, and a family history of neurofibromatosis. Physical examination showed that binocular vision was normal, the eyeballs could move freely in all directions, and the eyes were sensitive to light reflection. In addition, there were no facial paresthesias or abnormal facial expression.\nA computed tomography (CT) scan revealed a homogeneous and non-calcified mass in the extraconal compartment of the left posterior eyeball that was similar in density to the brain parenchyma. The inner bone wall of the left orbit was thinner than before, with compressive displacement of the adjacent bone and widening of the supraorbital fissure (Figure 1). Magnetic resonance imaging (MRI) demonstrated an elliptical, well-defined, and homogeneous retrobulbar mass, including the left orbit, the orbital apex, and even the left cavernous sinus. The superior orbital rectus muscle was compressed and transformed; the optic foramen was enlarged, but the optic nerve was not obviously pressed. The mass presented as a slightly uneven hypointense signal, a hyperintense signal, and an isointense signal on T1-weighted images (T1WI), T2-weighted images (T2WI), and fluid-attenuated inversion recovery (FLAIR), respectively. Meanwhile, the mass showed a hypointense signal on diffusion-weighted imaging (DWI) and a low value of apparent diffusion coefficient (ADC), with apparent and inhomogeneous enhancement after gadolinium (Gd) injection (Figure 2). An MRI performed 3 months after surgery showed no tumor persistence (Figure 3).\nA gross total excision was performed via a left frontotemporal craniotomy. The solid tumor was found to be located above the eyeball and the optic nerve, which occupied the middle and posterior parts of the orbital region and extended to the anterior part of the cavernous sinus through the enlarged supraorbital fissure. The result of the intraoperative pathological diagnosis was a spindle cell tumor. Postoperatively, the patient's painless exophthalmos had completely disappeared, with no evidence of postoperative sequelae or visual impairment during a follow-up.\nThe mass had a biphasic pattern of Antoni A (palisading spindle tumor cells are arranged vertically and tightly) and Antoni B (haphazardly spindle and multipolar cells are arranged loosely as a reticular structure) under a microscope. Immunohistochemical analysis showed that the neural marker (S100 protein) was firmly and positively stained, which was specific for the diagnosis. The nuclei of those cells showed positive immunoreactivity for SOX10 and less than 1% of the nuclei showed positive immunoreactivity for KI67 (Figure 4).",
"gender": "Male"
}
] |
PMC9873306
|
[
{
"age": 65,
"case_id": "PMC8739263_01",
"case_text": "A 65-year-old woman with a longstanding history of hypertension noticed a sudden decrease in vision in her left eye. She had no other ocular problems apart from a mild cataract in both eyes before. Her best-corrected visual acuity was 20/33 in her right eye, and 6/100 in her left eye. Fluorescein angiography showed a retinal arterial macroaneurysm with telangiectatic retinal vascular changes in the inferior temporal macular region (Figure 1). Optical coherence tomography (OCT) examination demonstrated the presence of subretinal hemorrhage which extends into the foveal area, and incomplete posterior vitreous detachment (Figure 2). Because of the presence of submacular hemorrhage, some medicine was administrated and the patient was followed up. Then, 5 months later, the hemorrhage was absorbed. OCT examination exhibited a full-thickness MH with a macular epiretinal membrane (Figure 3). The size of the MH was 722 mum in diameter. She was then given a standard three-port pars plana vitrectomy, along with peeling of the internal limiting membrane and filling the vitreous cavity with air. Anatomic closure of the MH was achieved after 4 weeks of the surgery by the examination of OCT (Figure 4). The BCVA was improved to 15/100.\nPars plana vitrectomy (PPV) method:\nStandard three-port vitrectomy was performed, followed by surgical separation of the posterior cortical vitreous from the optic nerve and posterior retina. About 1% indocyanine green (ICG) was injected over the macula region after temporarily stopping the infusion. The ILM with 2 disk diameters of the fovea was removed. The vitreous cavity was filled with air. The patient was asked to remain face down for a week following the surgery.",
"gender": "Female"
}
] |
PMC8739263
|
[
{
"age": 35,
"case_id": "PMC5067447_01",
"case_text": "A 35-year-old man was admitted to our hospital 3 months back with history of fever with chills for five days. The patient had undergone PBMV for severe rheumatic mitral stenosis 2 weeks prior to this episode. No other predisposition was found. There was no history of dental procedures or injections of intravenous drugs. On physical examination, blood pressure was 110/70 mmHg, pulse rate 85/min, and body temperature of 38 C. Cardiac examination revealed loud S1 and P2 with grade III mid-diastolic murmur at the apex. The remaining physical examination was unremarkable. There were no peripheral signs of infective endocarditis. Laboratory tests showed that his Hemoglobin was 12.8 gm/dl, white blood cell (WBC) was 18,900/L, erythrocyte sedimentation rate (ESR) was 52 mm in first hour, and urinalysis was normal. Renal parameters were normal. Cardiomegaly was apparent in chest radiography. Electrocardiogram revealed a normal sinus rhythm. The transthoracic echo demonstrated moderate mitral stenosis, severe eccentric mitral regurgitation, which was not there previously, and suspicious vegetation was present on mitral valve. The transesophagial echocardiogram revealed freely mobile sessile vegetation of size 5 mm x 5 mm over both anterior and posterior mitral leaflets (Fig. 1). The patient was started with a regimen of ceftriaxone and gentamycin. S. maltophilia was identified on blood culture and the antibiotics were changed to co-trimoxazole and levofloxacin as per culture sensitivity report. After 1 week of antibiotics, patient became afebrile, and repeat transesophagial echo after 2 weeks revealed disappearance of vegetation (Fig. 2). Antibiotics were continued for 6 weeks. He was discharged successfully.",
"gender": "Male"
},
{
"age": 40,
"case_id": "PMC5067447_02",
"case_text": "A 40-year-old man was admitted for fever and chill for a period of 2 months following mechanical valve replacement (27 mm Carbo-Medics) of mitral valve for severe rheumatic mitral stenosis. No other comorbidities were found. There was no history of dental procedures or injections of intravenous drugs. At presentation, he was drowsy, pale, and edematous with raised jugular venous pulsation. Blood pressure was 90/60 mmHg, pulse rate 120/min, and body temperature was 38 C. Cardiac examination revealed soft S1, normal S2 with metallic heart sound. There was no audible murmur. Chest examination revealed bilateral basal crepitations. Glasgow Coma Scale (GCS) at presentation was E3 M5 V4 with no focal neurological deficits. The rest of the physical examination was unremarkable. Laboratory tests showed that Hb was 7.6 gm/dl, WBC 17,500/L, and ESR was 80 mm/hr. The renal parameters were elevated with urea of 65 mg/dl and serum creatinine of 3.0 mg/dl. Arterial Blood Gas (ABG) revealed metabolic acidosis. Increased cardiothoracic ratio and features suggestive of pulmonary edema were observed on chest radiography. Electrocardiogram revealed sinus tachycardia. The transthoracic echo demonstrated large mobile vegetation of 2 cm x 1.6 cm in size on prosthetic mitral valve (Fig. 3). There was mild paravalvular leak with partial dehiscence, moderate mitral regurgitation, moderate tricuspid valve regurgitation, moderate pulmonary arterial hypertension, and moderate left ventricular dysfunction. The patient was empirically started on vancomycin and ceftriaxone. Initially, blood cultures grew MRSA sensitive to only teicoplanin, gentamycin, and linezolid. Fever continued with spikes. Supportive treatment was given in the form of inotropic support, vasodilators, and peritoneal dialysis for rapidly worsening renal dysfunction. By the time, the repeat blood culture could identify the culprit bacteria to be S. maltophilia, the patient died of septicemia and renal dysfunction.",
"gender": "Male"
}
] |
PMC5067447
|
[
{
"age": 9,
"case_id": "PMC10288866_01",
"case_text": "The girl with mosaic DS had a mild intellectual handicap and had been attending a special educational class since the age of 9, but she had no medical complications as a result of trisomy 21. Her premorbid demeanor was upbeat, and she enjoyed dancing and singing. She was somewhat obstinately diligent in academic works, and would cry with stress when she was called on in class but could not answer well to the questions. No autistic traits had been reported. Her intellectual quotient was assessed as 58 on the Wechsler Intelligence Scale for Children, 4th edition, at the age of 11 years.",
"gender": "Female"
},
{
"age": 12,
"case_id": "PMC10288866_02",
"case_text": "Shortly after starting junior high school at the age of 12 years, the patient complained of fatiguability and paroxysmal weakening of fingers and acquired an unsteady gait over 3 months period. Slowness in the speech was also observed (Figure 1). Blood tests and brain MRI results were normal (Figure 2A), and the symptoms resolved spontaneously. But, following a summer holiday, the patient had weakness, insomnia, and severe gait disturbance, for which she was taken to the hospital for medical assessments. Brain and spinal cord MRI revealed no specific abnormalities, and routine blood, urine, and CSF samples, analyses, as well as nerve conduction velocity testing, were all unremarkable. She was tentatively diagnosed with adjustment disorder and was discharged. Thereafter nonspecific complaints waxed and waned.",
"gender": "Female"
},
{
"age": null,
"case_id": "PMC10288866_03",
"case_text": "Nine months later, a few weeks after the COVID-19 pandemic was settled down and the school activity restarted, the girl's linguistic communication and eye contact continued to deteriorate, as did her sleep maintenance insomnia, and night terrors. Within a week, she complained of chest pain, nausea, the delusion of observation, and the perception of how each piece of furniture was feeling. The next morning, she was discovered incontinent and unresponsive to her surroundings, her facial appearance being completely lost. When she arrived at our hospital, her body temperature was 38.1 C, which subsided soon after admission. Her awareness level fluctuated substantially, between E4V1M6 and E1V1M4 on the Glasgow Coma Scale. She demonstrated her intent by shaking or nodding her head. No focal neurological signs were noted on examination. However, she was akinetic and completely mute, stared into space, and held a fixed posture or showed waxy flexibility in her extremities. Drooling and retching, were common, as was oral dyskinesia. Blood and CSF tests, including herpes simplex virus DNA, came back within normal ranges. Brain MRI indicated several high-intensity spots in the frontal white matter, but no abnormalities in the hippocampus sections; sleep EEG revealed a widespread high voltage slow-wave activity, that progressed to irregular activity with a frequency range of 3-10 Hz upon awakening (Figures 2B, C, F). Lorazepam was prescribed to treat catatonic syndrome. The patient could talk in sentences the next morning, though as slow as uttering her name in 30 s or more. It was also established that she had experienced visual hallucinations of an unknown person. She could socially smile and laugh a few days later, but she had a prolonged appetite loss, that required tube feeding. The treatment regimen was supplemented with escitalopram, aripiprazole, and ramelteon. On day 14 of admission, she began playing card games, and the stomach tube was withdrawn. She was discharged, with some persistent behavioral and motor issues (Figure 1).",
"gender": "Female"
},
{
"age": null,
"case_id": "PMC10288866_04",
"case_text": "Soon thereafter, the patient came to manifest with a silly smile, paradoxical laughter, and monology. The patient claimed that there are many, invisible people or goods in her house, that dwarf and fairly are sitting on the air cleaner or her head/arms/clothing, that she was talking with someone in her ear and/or neck, that there are tubes in her ear/mouth/body, and that bad ideas come into her head prompting an urge to stab someone with a pair of scissors. A SPECT examination found hypoperfusion in the bilateral parietal and left occipital lobes (Figure 2E), contradicting the pathophysiology of primary psychiatric illness to explain the catatonia and subsequent psychosis. CSF specimens from both admissions tested positive for anti-NMDA receptor antibodies by enzyme-linked immunosorbent assay (ELISA) (Figure 3). Anti-TPO antibody was found to be positive; but, the patient was euthyroid. Clinical and paraclinical findings in this patient were compatible with DSDD, and at the same time fulfilled the criteria for probable NMDARE. However, following points were rather atypical for NMDARE (Figure 1, Supplementary Tables S1, S2); (1) the presence of psychosocial stressors triggering each phase of illness, (2) the first phase of nonspecific complaints as long as 12 months, (3) the order of predominant movement disorder (catatonia) phase and late-evolving psychiatric phase, (4) negative CSF results, and (5) hypoperfusion on SPECT imaging not involving the limbic areas. With a diagnosis of DSDD, intravenous methylprednisolone was provided 3 months after the last admission, at age 13 years and 9 months. However, the effect of this treatment was minimal. Follow-up MRI revealed nonspecific high signal regions (arrows) in the bilateral deep parietal white matter (Figure 2D).",
"gender": "Female"
},
{
"age": 12,
"case_id": "PMC10288866_05",
"case_text": "She then claimed to have delusions that her voices were recorded, that another person arose while she was fake, and that the present day was the dinosaur age. These psychotic symptoms were relieved by increasing the dosage of aripiprazole. During the period of preparation for high school admission, however, complaints of somatic symptoms or cenesthopathy predominated including throat discomfort, feeling like her face was slipping off, stubbed or dirty abdomen, dysesthesia in the distal extremities, and difficulty in chewing. Coupled with an auditory hallucination that someone was requesting and/or ordering her to die, the patient was influenced by thoughts over suicide and/or life expectancy, as well as the belief that she was already dead. She is currently a high school student, with persistent psychiatric issues. Such an extended course of hallucinations and delusions prompted us to examine the CSF specimen with cell based assay (CBA), which qualified a positive result of anti-NMDA receptor antibodies for the specimen taken just before the intravenous methylprednisolone (Figure 3). The patient was diagnosed with definite NMDARE, for whom second-line immunotherapies are being planned. Ovarian tumor was not seen on an abdominal MRI.\nCSF levels of IL-5, IL-15, CCL-5, granulocyte colony-stimulating factor, platelet-derived growth factor (PDGF)-bb, and vascular endothelial growth factor (VEGF) were raised throughout the course, highest at the first examination at the age of 12 years (Figure 3).",
"gender": "Female"
}
] |
PMC10288866
|
[
{
"age": 91,
"case_id": "PMC9845545_01",
"case_text": "A 91-year-old male patient with a nonischemic cardiomyopathy status post dual-chamber ICD implantation in 2010 and upgrade to left prepectoral biventricular ICD in 2013, permanent atrial fibrillation, and essential thrombocythemia on hydroxyurea presented to an outside hospital for 2 weeks of progressive ICD pocket swelling and erythema. The patient denied pain at the ICD pocket site. Examination revealed an erythematous, swollen pocket with overlying telangiectasias. The patient was afebrile with mild leukocytosis. Ultrasound of the pocket revealed an irregular fluid collection inferior to the ICD generator measuring 4 x 2.6 x 3.3 cm. The patient was treated empirically with broad-spectrum antibiotics for presumed ICD pocket infection and transferred to our center for pocket exploration and possible extraction.\nPocket exploration revealed a solid mass with cystic components extending onto the ICD generator, leads, and surrounding tissues. A biopsy specimen was obtained. The device was left in position and the pocket was closed. Bacterial and acid-fast bacilli wound cultures showed no growth, and blood cultures remained negative. Antibiotics were discontinued given low clinical suspicion for infection and absence of supportive microbiologic data. Microscopy of the biopsy specimen revealed fragments of fibrous tissue with focal chronic inflammation and fibrosis. No malignant cells were observed.\nThe patient was seen in follow-up approximately 1 month later for consideration of surgical excision of the ICD pocket mass. Computed tomography scan of the chest revealed a large complex fluid collection measuring up to 11.5 cm involving the ICD pocket, few top-normal mediastinal lymph nodes, and a rounded density within the left pectoralis muscle measuring up to 1.8 cm. The patient was admitted following this evaluation for worsening ICD pocket swelling and erythema. The patient underwent repeat pocket exploration and resection of the 418 g, 14 x 8 x 6 cm mass including a segment of the left pectoralis major muscle. Microscopy revealed a partially necrotic tumor with diffuse proliferation of atypical cells with frequent mitotic figures and apoptosis extending into skeletal muscle. Flow cytometry revealed evidence of abnormal B cells, confirming the diagnosis of diffuse large B-cell lymphoma, activated immunophenotype (Figure 1). An interdisciplinary team including the patient, oncology, and electrophysiology favored holding further staging and treatment owing to poor functional status. The patient was transitioned to hospice care and died.",
"gender": "Male"
}
] |
PMC9845545
|
[
{
"age": 45,
"case_id": "PMC3716248_01",
"case_text": "This 45-year-old patient was referred by gastroenterologist as surgical emergency with signs of perforative peritonitis following attempted colonoscopic retrieval of intra luminal ileal mass. The plain X-ray chest with both domes of diaphragm showed gas under right dome of diaphragm. Patient was resuscitated and taken up for emergency laparotomy. Preoperative abdominal examination showed two healed scar marks on in right sub costal region (open cholecystectomy scar) and lower abdomen pfannelstiel incision (Abdominal hysterectomy scar). On exploration about 500 ml of bile stained fluid was found and small bowel perforation was noticed about 20 cm from ileocecal junction. A large thick wall ileal loop with some unusual intra luminal mass was felt. Ileal mass was resected along with perforated site with end-to-end ileal-ileal anastomosis. Patient had postoperative wound infection which responded to the antibiotic and other supportive measures. On incision of resectedileal loop [Figures 1 and 2] abdominal sponge was retrieved [Figure 3].",
"gender": "Unknown"
}
] |
PMC3716248
|
[
{
"age": 45,
"case_id": "PMC7298528_01",
"case_text": "A 45-year-old man presented to the emergency room 30 min after developing left hemiparesis and SICH was diagnosed. He refused the treatment on admission. Seven hours later, the patient was brought back to the hospital with diminished level of consciousness and left hemiparesis. The Glasgow Coma Scale (GCS) was E3V3M5.\nHead MRI showed acute ICH in the right basal ganglia with volume 55 cc. The perifocal edema displaced the right lateral and third ventricles, causing midline shifting as much as 5 mm to the other side. The patient consented to undergo stereotactic aspiration surgery without anticoagulant for evacuating the clot.\nStereotactic aspiration of ICH was performed under general anesthesia 10 h after admission. Ten cc of residual hematoma was detected on repeat CT scan and decision was made to manage it conservatively. The patient was treated for 23 days with a satisfactory result. GCS improved to E4V5M6 with residual left hemiparesis. Fig. 1 shows MRI scan two months after surgery.",
"gender": "Male"
},
{
"age": 52,
"case_id": "PMC7298528_02",
"case_text": "A 52-year-old woman was admitted to the hospital 15 min after developing a decline in level of consciousness. The GCS was E4V2M5 and no hemiparesis. Head MRI showed hyperacute ICH in left temporal lobe (left external capsule and left corona radiate) with volume of 25.6 cc. The perifocal edema pushed the left lateral ventricle, causing midline structure deviation to the right side as much as 6 mm.\nWe performed stereotactic surgery without anticoagulant for ICH evacuation 6 h after the onset of symptoms. Fig. 2 presents the postoperative head CT scan showing 80 percent reduction in the amount of hemorrhage. The patient was treated for 11 days. She had GCS E4V5M6 and was able to do routine activities independently before discharge.",
"gender": "Female"
},
{
"age": 27,
"case_id": "PMC7298528_03",
"case_text": "A 27-year-old girl arrived in the emergency room with diminished consciousness 30 min after the onset of symptoms. The GCS was E3V2M5 with no hemiparesis. A head CT scan revealed ICH on the frontal and parietal regions with a volume of 35 cc causing midline shift to the right side as far as 4 mm. There was non-communicating hydrocephalus, intraventricular hemorrhage, and brain edema.\nStereotactic aspiration surgery for evacuating the hemorrhage and external ventricular drainage was done without any anticoagulant. The post procedure CT scan showed 90 percent reduction in the amount of hemorrhage. A week later another CT scan was repeated. We found that the ICH in left subcortical frontal lobe (left basal ganglia) had significantly reduced (Fig. 3). The patient was treated for 16 days. Her level of consciousness was E4V5M6 with no neurological deficits, and she was able to take on routine activities independently.",
"gender": "Female"
}
] |
PMC7298528
|
[
{
"age": 47,
"case_id": "PMC10174326_01",
"case_text": "A 47-year-old woman, accompanied by her husband, voluntarily visited the psychiatric clinic after 2 months of anxiety, weight loss and sleep problems linked to work stress. The patient complained of constant nervousness, muscular tension, restlessness, sweating, heart palpitations, dizziness, and epigastric discomfort. She has been exhibiting obsessive behavior since adolescence. The patient has no family history of mental disorders or severe physical diseases. Laboratory tests, including complete hemogram, electrolytes (sodium, potassium, calcium, magnesium, chlorine), and thyroid function, were all within normal range. For a preliminary diagnosis of anxiety disorder, unspecified, paroxetine 20 mg/d and lorazepam 1.5 mg/d were prescribed. Lorazepam was changed to clonazepam 4 mg/d after one week due to unresolved anxiety, restlessness, and insomnia. Following a panic attack, the patient visited the emergency department, which revealed hypokalemia (potassium 3.0 mmol/l). She gradually developed depression and delusions as more symptoms appeared, convinced that all physical symptoms were signs of severe organ dysfunction, which led her to have suicidal thoughts. Following a suicide attempt, she was involuntarily admitted to another psychiatric facility. During hospitalization, blood tests revealed persistent hypokalemia and progressive hypothyroidism, which could not be fully explained by inadequate dietary intake. Immunologic markers, including autoantibodies, immunoglobins, and complements, were not remarkable. A CT scan of the head yielded no significant findings. Electroconvulsive therapy and a variety of medications were utilized to treat major depressive episode with nihilistic delusion, as shown in Figure 1. Upon discharge, the patient achieved clinical remission of depression. Nevertheless, anxiety was still present, and an undiscovered physical condition was suspected.\nAfter presenting to the Department of Endocrinology, the patient underwent an enhanced MRI of the head and found a microadenoma 0.3 cm in diameter to the right side of the lower pituitary gland, as shown in Figure 2. In a further review of symptoms, the patient recalled a rounder face and increased waist circumference prior to anxiety symptoms, and amenorrhea following anxiety symptoms and reduced food intake. Purple striae and buffalo hump were absent, as were signs of secondary diabetes, hypertension, or osteoporosis. Laboratory tests revealed elevated serum free cortisol, ACTH, and 24-h urinary free cortisol (24-h UFC), and the phenomenon that 24-h UFC and serum cortisol was not suppressed after low-dose dexamethasone suppression test, all indicated the diagnosis of CS. Elevated ACTH suggested the possibility of ACTH-dependent CS. Furthermore, bilateral petrosal sinus sampling (BIPSS) with desmopressin stimulation test showed inferior petrosal sinus/peripheral (IPS/P) ACTH gradient at baseline as 3.1, and IPS/P ACTH gradient after desmopressin stimulation as 10.6. Taking all of the above into account, the patient was diagnosed with CD and subsequently transferred to the Department of Neurosurgery for pituitary microadenoma resection. Psychiatric medication was not discontinued or reduced until the day of surgery. The day after surgery, the patient developed tachycardia, tachypnea, elevated temperatures, tremors, and strong anxiety. Over the next few days, her condition progressed to hypovolemic shock. She refused to take oral medication and refused to cooperate with verbal responses. Considering that the above-mentioned manifestations are due to postoperative adrenal insufficiency, hydrocortisone supplementation was introduced. All psychiatric medications were resumed to alleviate anxiety. After resumption of medication, extrapyramidal symptoms were observed during psychiatric consultations, which prompted recommendations for tapering psychotropic agents. Before discharge, the patient maintained the preoperative dose of all antidepressants, anxiolytics, and antipsychotics because her anxiety had not improved.\nOne week after discharge, the patient was again admitted to the emergency department with a high fever, tachycardia, hypertension, and impaired consciousness. The initial diagnosis was secondary adrenal insufficiency after excluding infection. Physical examination indicated tremor, dysarthria, increased muscle tone in the extremities and neck, and myoclonic manifestations of the lower extremities, all of which could not be fully explained by adrenal insufficiency. A psychiatric follow-up consultation revealed that the patient was still taking multiple antidepressants due to persistent anxiety, raising the possibility of serotonin syndrome. Serotoninergic medications were recommended to be discontinued despite the discovery of normal creatine kinase level, with only clonazepam remaining to treat anxiety. Blood pressure, heart rate, and temperature all decreased to normal the next day, as did muscle spasticity. The patient's subjective anxiety slowly subsided by the time she was discharged 4 weeks later. Clonazepam was gradually replaced by estazolam due to daytime sleepiness. The trajectories of serum cortisol, ACTH, and creatine kinase are shown in Figure 3. During the one-month follow-up after discharge, the patient expressed concern for her health and made plans to eventually resume family and work responsibilities once her condition stabilized.",
"gender": "Female"
}
] |
PMC10174326
|
[
{
"age": 13,
"case_id": "PMC6699327_01",
"case_text": "The first case was of a Japanese man in his mid-30s. His major psychiatric issues included bipolar I disorder, intellectual developmental disorder, and transvestism. Although formal genetic testing was not performed, he showed typical clinical presentation of EDS: skin hyperextensibility, generalized joint hypermobility (which satisfied the two major criteria, as set in 2017), soft and doughy skin including the nose septum and auricular, flexible flatfoot, epicanthal folds on the tongue (which satisfied three minor criteria), and phlebitis in his legs (as an additional symptom). His medical history included fetal asphyxia, pediatric asthma, congenital hip arthritis, for which he had undergone two surgeries at 5 and 20 years of age, and hepatitis C caused by blood transfusion that was performed at the second surgery. Since there was no history of interferon therapy during the 10 years before the first visit to a psychiatrist (at year X), the possibility is remote that he had interferon-associated psychiatric disturbances. His premorbid personality traits included nervousness, obstinance, and incoordination. He had no relatives with EDS. The patient was the second son among three siblings. His father had bipolar disorder and committed suicide when the patient was 13 years old.\nHe was evaluated for intellectual developmental disorder in his adulthood twice at years X+1 and X+6. His verbal intelligence quotient (IQ) was found to be 67 and 77, performance IQ 69 and 49, and full IQ 66 and 62, respectively. In addition, magnetic resonance imaging scans revealed cavum septi pellucidi (CSP) and small infarct lesions in the cerebral white matter. The psychological examinations, including the Rorschach test and the Minnesota Multiphasic Personality Inventory suggested a low degree of autonomy or insight but no abnormality in recognizing himself as male gender.\nThe patient had experienced sexual trauma, as he had been molested by his father in his elementary-school years. He also experienced bullying by classmates because of his poor academic performance at that time. During this difficult time, the father committed suicide. After his father's death, the patient started exhibiting cross-dressing behavior. There was no particular evidence indicating a correlation between his transvestic behavior and his father's death.\nDespite his poor academic performance, he was able to graduate from senior high school. After spending 1 year at a training school for persons with disabilities, he secured a clerk position at a general corporation as an employee with disabilities. He first visited a psychiatrist (at year X) because he had started experiencing paranoia in the workplace. The symptom subsided with a low dose of haloperidol but at year X+3, paranoia reappeared along with irritation, insomnia, loss of motivation, hypochondriac symptoms, and depressive mood as his job became more demanding. One month after the relapse, his mood changed to mania with insomnia, anger, irritation, and increased appetite and libido. The patient recovered with mood stabilizers, antipsychotics, and a 6-month sick leave from his job. However, he again relapsed 3 months after remission was achieved. Since then, his affect has remained cyclic while receiving medical treatment either as an outpatient or inpatient.\nThe intellectual developmental disorder in this case could have possibly been caused by several factors: (1) EDS, (2) past history of fetal asphyxia, (3) presence of CSP, and (4) others. CSP reportedly occasionally causes intellectual developmental disorder, emotional mood disorders, and schizotypal symptoms in adulthood. Although remarkably enlarged CSP (anteroposterior diameter >= 6 mm) is associated with serious mental illnesses such as schizophrenia, many patients with less prominent CSP remain asymptomatic. The association between CSP and bipolar disorder is generally weaker than that with schizophrenia; the CSP in this case was not enlarged to the extent that could account for all symptoms.\nWhile his cross-dressing habit began in childhood, first in private in his room, and persisted in public through adulthood, his behaviors and symptoms did not meet the DSM-5 criteria of gender dysphoria. Although he used complete female attire, including upper and lower undergarments, he did not apply female make up on his face and did not look himself in the mirror when wearing female clothes; moreover, his desire to wear female clothes expired when he received psychological support from a nurse at the Company Health Office. His desire was primarily to wear female clothes and his consideration for a sex-change was secondary to feelings of slight guilt and shame that accompanied the desire for cross-dressing. He did not have intense sexual arousal, distress, or impairment in social life, and thus did not meet the DSM-5 criteria for transvestic disorder.\nRegarding the relationship between transvestism and mood disorders, cross-dressing is reportedly more remarkable during the manic phase and becomes inconspicuous during the remission phase. In this case, his desire to cross-dress remained consistent in the remission phase of the bipolar disorder, and the cycle of mood symptoms did not affect the degree of cross-dressing to a considerable degree. We considered that his symptoms could be attributable to (a) his mother's overprotectiveness and excessive interference due to his intellectual developmental disorder and EDS, (b) conflict with his older brother when he was in the manic phase, and (c) maladaptation in the job environment and failures in the establishment of human relationships. While patients with intellectual developmental disorder may exhibit the so-called pseudo-transvestism used as a means to fantasize women during masturbation, cross-dressing was the objective per se for this patient. Additionally, because he was more interested in looking at pictures of himself wearing female underwear than in changing his gender, his behavior could have been obsessive/compulsive to some degree in the sense that he was overwhelmingly driven to wear female clothes; by doing so, he considered that he could escape into a fantasy world where he could cope with his desire. Anupama et al. reported three cases of patients who cross-dressed; two had intellectual developmental disorder and one had obsessive-compulsive disorder. Meanwhile, Bowler et al. proposed that patients with intellectual developmental disorder tended to engage in cross-dressing, as it was difficult for them to communicate with the opposite sex, both personally and socially. Although cross-dressing is more frequently observed in patients with intellectual developmental disorder than in the general population, their symptoms subside when they are involved in a relationship, while their preference for brilliant clothing continues.\nThe family environments during childhood have been carefully studied in relation to transvestism; coldness, high pressure, or weak presence with only few emotional exchanges all have been associated with distorted father images in these patients.\nThe second case was of a Japanese woman in her late 20s. Her major diagnoses were dissociative identify disorder, gender dysphoria, dysthymia, and anorexia nervosa (restriction type). She had classical EDS with skin hyperextensibility and atrophic scarring, generalized joint hypermobility (which satisfied the second major criterion based on the 2017 criteria), easy bruising, soft and doughy skin, skin fragility and traumatic splitting, complications of joint hypermobility such as pain, and family history (which satisfied the fifth minor criterion). The final diagnosis was straightforward even without genetic testing. She did not have notable past medical history and had nervousness as her premorbid personality trait. Her monozygotic twin sister also had EDS, and except for her twin sister, she also had an older brother; none of her other relatives had EDS or diagnosed psychiatric disorders including gender dysphoria and dissociative identity disorder.\nThe patient was brought up as older sister in contrast with that another twin sister was treated as younger sister in their family, although they are monozygotic twins. She was prone to injuries and dislocations and had led an infirm life since childhood. In elementary school, she was frequently bullied for her facial scars and suffering from dysthymic status. In addition, as far as the patient could recollect, she started to feel uncomfortable wearing women's clothes in her early elementary-school years. Her mother reacted to the situation by overprotection, imposing rules to prohibit the patient from playing outdoors or behaving as a boy and restricting her behavior inside the house. Compared with her mother's parental control, her father was judgmental against her \"laziness\" because she was unable to overcome her dysthymic personality/character and secure regular employment after graduating from high school.\nShe was aware of having dissociative identity disorder since childhood based on her recollections of first experiencing a personality change at the age of 5 years. The original personality (A) corresponded to a patient with anorexia nervosa and was mainly dormant. She was aware of two male personalities present most of the time; personality (B) who oversaw meals and personal activities and personality (C) who oversaw contact with others (including during consultation with the psychiatrist). The replacement personalities appeared depending on the circumstances; several male personalities, including (B) and (C), dominated during housekeeping, eating, and social encounters, while the female personalities were likely to surface when the patient was required to dress and behave in a female manner during her school years and, currently, those personalities appear to be integrated as personality (D), emerging only when the patient is concerned with feminine hygiene during bathing and menstruation. In the past, she presented with a larger number of personalities, but they were consolidated to the relatively few personalities mentioned above, presumably as a coping mechanism in an effort to maintain wellness.\nWhen limb movement paralysis and inability to open her eyes appeared at the age of mid-20s, a physical examination was performed at a hospital as her first major psychiatric consultation (at year Y). Meanwhile, no physical abnormalities were detected and she was diagnosed with dissociative movement disorder. Since then, she has been occasionally treated as an outpatient at the psychiatric department of the university hospital. Despite her main complaint of excessive dietary restriction and self-induced vomiting based on her desire to lose weight, psychiatric treatment was intermittent. She had strong desire for social support, self-acceptance, and integration of a male identity. To fulfil what she considered were the requirements of a male identity, she habitually used male public restrooms. Finally, she received a first psychiatric diagnosis of gender dysphoria based on the DSM-5 criteria, with the disorder involving years of marked incongruence between the self-referenced and assigned genders. At year Y+2, she relocated without her parents' permission to the house of a friend with dissociative identity disorder who she knew through the Social Network Service. She was then transferred to another hospital located near her home at year Y+3, where the psychiatric diagnosis of gender dysphoria was confirmed based on the DSM-5 criteria.\nThe difference in intellectual level between the two patients may have led to different phenotypes, hypochondriac behavior in Case 1 and dissociative identity disorder in Case 2. Patients with dissociative identity disorder often experience considerable stress during early and late childhood, which may include (a) bullying from schoolmates and siblings, (b) restrictions in self-expression by overly controlling parents, (c) child abuse including neglect, and (d) mental trauma caused by accidents or other incidents. Factors (a) to (c), as well as (d), render individuals susceptible to trauma and were present and constituted high risk of dissociative identity disorder in Case 2. The specific personalities of dissociative identity disorder were deemed to stem from the clinical features of EDS. Primary personality (A) had anorexia nervosa, possibly influenced by insufficiency of maternal separation from early childhood because of her mothers' overprotectiveness and excessive interference driven by her concern for the high risk of trauma associated with EDS. Eating disorder is a symbolic disease mainly observed in women, and the patient attempted to deny her femininity through her gender dysphoria. Although she reported experiencing a strong sense of discomfort and disgust for being treated as a woman, she also understood the risks of surgery because of her EDS and did not consider a sex-change operation. As a compensatory mechanism against these feelings, the male personalities (B) and (C) became dominant, overseeing meals to counter anorexia nervosa, which is a symbol of femininity, controlling physical health, and acting as a form of psychological coping mechanism to protect the patient against the discomfort of gender dysphoria. It is difficult to discern whether anorexia nervosa or gender dysphoria was the primary disorder. To summarize, the prolongation of her dissociative identity disorder maintained her original personality at a dormant state. In fact, the memory rupture and amnesia are well recognized in dissociative identity disorder and did not occur with personalities (B) and (C), which retained almost all the memories of the other personalities.",
"gender": "Male"
}
] |
PMC6699327
|
[
{
"age": 54,
"case_id": "PMC4620392_01",
"case_text": "A 54-year-old male patient was referred by the physiotherapist with 1 year history of anterior left knee pain. He had sustained a patellar tendon tear, requiring surgical repair 30 years ago. Clinical examination was mainly suggestive of patellofemoral arthritis. This was confirmed on plain radiographs and MRI. A knee arthroscopy was performed that showed grade 2 changes in the trochlea with grade 3 changes on the patella. At six-month review the patient reported no significant improvement in symptoms; he was therefore listed for patellofemoral joint replacement (PFJR). Following his surgery using the Zimmer Gender Solutions Patello-Femoral Joint his symptoms progressively worsened (Figure 1).\nThe patient was systemically well; however, his mobility and left knee range of motion worsened to the extent that he required 2 crutches. His infection screen, including full blood count, CRP, and plasma viscosity, was not raised. All possible nonoperative measures were exhausted therefore we decided to perform a single stage revision to a total knee replacement. Intraoperatively, a large cyst was discovered under the femoral component. This necessitated a change of plan to a 2-stage revision. Multiple samples were taken and sent for microbiological and histological study. The cyst was curetted and packed with bone graft and a cement spacer was placed (Figure 2).\nThe microbiological studies were negative and histopathological studies showed nonspecific inflammatory response. In the absence of any other cause of implant failure metal allergy was considered. The patient was referred to the allergy clinic for further investigation. A patch test was strongly positive for nickel allergy. This patient went on to have a 2nd stage revision using a nickel-free revision knee system (Figure 3), and at 6-month follow-up showed dramatic improvement in his symptoms.",
"gender": "Male"
}
] |
PMC4620392
|
[
{
"age": 66,
"case_id": "PMC9086612_01",
"case_text": "The participant is a (currently) 66-year-old Chinese Han man born and raised in Guizhou, China. He is married, well-educated, and retired (used to work as a teacher and civil servant). He does not smoke, does not take drugs, and drinks alcohol in moderation (<140 ml of ethanol/week). We investigated his daily habits, eating preferences, physical activities, etc., and there was nothing special except the handstand concerned in this study. The participant was healthy 40 years ago, and he did handstand exercise because he wanted to stay fit.\nThe participant designed the passive handstand device. The device includes a V-shaped support frame, a high bracket for handstand, and a foot retainer (Figure 1). When he was young, he used the device to exercise for approximately 30 min at a time, but because of his busy schedule and many business trips, he was sometimes unable to exercise on time. When he retired at age 60, he persisted in doing handstand exercises once daily for only 10 min. When using the device, he did not experience discomfort.\nWe quantified health through physical and auxiliary examinations, including imaging studies to evaluate the participant's cerebrovascular, spinal health, facial aging, mental health, and visual acuity. Assessments were performed every 10 years. In the first 20 years of follow-up, due to the underdeveloped medical technology and the lack of auxiliary examination at that time, physical examination was mainly used.\nIn 2021, spinal health evaluation comprised physical examination at each follow-up and magnetic resonance imaging. At the 20-year follow-up, we examined the participant's cervical spine using radiography. Cerebrovascular assessment consisted of computed tomography angiography and magnetic resonance angiography. We compared his current cerebrovascular condition (assessed by magnetic resonance angiography) with that 10 years prior (assessed by computed tomography angiography) to confirm the effect of long-term handstand suspension on cerebrovascular elasticity. We also evaluated his cerebrovascular health by measuring his blood pressure before, during, and after using the device.\nWe took pictures of the participant and compared them with those taken more than a decade prior to assess the rate of facial aging. Facial aging was assessed according to the severity of eyelid pouches and facial wrinkles. The severity of eyelid pouches was categorized as no pouches, mild pouches (slight herniation of the lower orbital septum fat accompanied by slight relaxation of the lower eyelid skin), moderate pouches (moderate herniation of the lower orbital septum fat accompanied by moderate relaxation of the lower eyelid skin), and severe pouches (severe herniation of the lower orbital septum fat or severe relaxation of the lower eyelid skin). The severity of facial wrinkles was evaluated using the Wrinkle Severity Rating Scale.\nSince 1991, the visual acuity of this man was measured according to the Early Treatment of Diabetic Retinopathy Study protocol using a LogMAR chart. The test results of the better eye were expressed in logarithmic units ranging from 1 (20/200) to -0 3 (20/10), with lower values indicating better vision.\nMoreover, since 1991, we have assessed his mental health and cognitive function using the Mini Mental State Examination scale.\nThe sponsor (Science and Technology Innovation Talent Team Project of Guizhou Province, China) provided financial support in the collection and interpretation of data.\nThe patient and the public were involved in the design, reporting, or dissemination plans of our research. The participant made some suggestions for the design of our research.",
"gender": "Male"
}
] |
PMC9086612
|
[
{
"age": 74,
"case_id": "PMC9468777_01",
"case_text": "A 74-year-old Japanese man with end-stage renal failure, precipitated by an unknown primary disease, had been maintained on hemodialysis since 2018. In April 2019, he was diagnosed with advanced sigmoid colon cancer and underwent a colectomy for the same. The pathological stage of the tumor was confirmed as IIIC (T4aN2M0). Although the patient was informed that there was a high chance of cancer recurrence, he did not wish to receive adjuvant therapy. Follow-up computed tomography scan performed in December 2019 revealed multiple lung and liver metastases, considered to be recurrent colon cancers. The molecular biology of the tumor was as follows; microsatellite instability, MSS; KRAS mutation, exon 2 (G12D); BRAF mutation, wild type; UGT1A1 mutation, absent ( Table 1 ). Thereafter, the patient was treated with modified FOLFOX6 as first-line chemotherapy in April 2020. Unfortunately, the liver metastases increased after 21 cycles of treatment, and in April 2021, the patient was referred to our hospital for further treatment. Physical and blood examinations revealed no notable changes, and his performance status was 0 at admission. Laboratory data obtained on admission to our hospital and the genetic information of the cancer are shown in Table 1 .\nThe body surface area of the patient was 1.46 m2, and he was treated with FOLFIRI [irinotecan 120 mg/m2 intravenously infused over 120 min (80% of the standard dose in Japan), with levofolinate 200 mg/m2 over 120 min, followed by 5-FU 2400 mg/m2 intravenously infuse over 46 h (without 5-FU bolus)] plus bevacizumab (5 mg/kg intravenously infused over 30 min) every 2 weeks. Hemodialysis was performed on the second day for convenience and scheduling following FOLFIRI therapy and repeated 3 times per week. To measure serum bevacizumab concentrations, blood samples were collected at five time points: pretreatment (defined as day 0), before hemodialysis on day 2, day 4, day 6, and day 8. For days 4, 6, and 8, blood samples were obtained just before the start of dialysis. All blood samples were centrifuged immediately after collection at 3000 rpm for 10 min, and the obtained serum was further centrifuged at 3000 rpm for 20 min. The centrifuged samples were stored in a freezer until measurement using a bevacizumab ELISA Kit (#ab237642; Abcam, Cambridge, UK).\nIt was observed that the serum concentration of bevacizumab increased to 56.3 microg/mL on day 2 but then decreased over time regardless of hemodialysis; the serum concentration on day 8 decreased to 37.1 microg/mL ( Figure 1A ). At the fifth cycle after treatment initiation, neutropenia (grade 4) was observed, and thus we reduced the dosage of 5-FU to 2000 mg/m2 and that of irinotecan to 100 mg/m2. However, no bevacizumab-related AEs were observed. Regarding therapeutic effects, stable disease was maintained for 7.5 months under treatment with FOLFIRI plus bevacizumab. Thereafter, the disease showed progression with elevated tumor markers and increased size and number of lung and liver metastases ( Figure 1B ), following which the treatment regimen was changed to trifluridine/tipiracil. Unfortunately, the therapeutic effect was poor, and the treatment was transitioned from chemotherapy to best supportive care.",
"gender": "Male"
}
] |
PMC9468777
|
[
{
"age": 57,
"case_id": "PMC10319284_01",
"case_text": "A 57-year-old man with history of double LTx in October 2019 (lung donated voluntarily with written informed consent, and that this was conducted in accordance with the Declaration of Istanbul) for bronchiectasis secondary to CVID. He was supplemented by subcutaneous immunoglobulin G and had a prior history of pan-sensitive Pseudomonas aeruginosa colonization. The immunosuppressive regimen included induction with basiliximab and maintenance with steroids, tacrolimus, and mycophenolate mofetil. After transplant, the patient rapidly developed severe recurrent bronchopulmonary infections due to Pseudomonas aeruginosa despite several repeated associative antibiotic therapies and continuous inhaled colistin (Figure 1, description of the clinical course and therapies). The patient's respiratory function progressively deteriorated (obstructive pattern) leading to severe chronic respiratory failure requiring oxygen supplementation associated with recurrence of bronchiectasis on chest CT scan (Figure 1). \nAs a result of antibiotic pressure, an XDR strain emerged, which was only susceptible to colistin, cefiderocol, amikacin, and gentamicin. The use of aminoglycosides was challenging to manage due to side effects with multiple episodes of acute kidney injury that evolved to severe chronic kidney failure and hearing loss.\nWithin the first-year post-transplant, steroids were rapidly tapered, azithromycin introduced (250 mg given once daily) as a treatment of chronic lung allograft dysfunction (CLAD), the mycophenolate mofetil stopped and never reintroduced to minimize the infection risk (antimetabolite agent), and cyclosporin A finally tapered to 10 mg per day resulting in an undetectable residual rate of blood cyclosporin A because the infection was not controlled despite the mycophenolate mofetil stopped. No acute rejection was found on the repeated lung biopsies. We enhanced the immunoglobulin supplementation with IgM/IgA-enriched immunoglobulins (Pentaglobin , Biotest, Dreieich, Germany), Figure 2. \nFrom that adaptation of the immunosuppressive regimen, we managed to obtain clinical stability (oxygen requirement decreased to 1 L/min, no sepsis, decreased sputum) but every attempt to stop the antibiotic treatment failed.\nIn this context of therapeutic impasse, a decolonization strategy with bacteriophage therapy (BT) has been considered. Pherecydes Pharma (Pherecydes Pharma, Romainville, France, https://www.pherecydes-pharma.com/en/) owns a collection of anti-Pseudomonas aeruginosa phages. In the scope of compassionate use and in agreement with the French health authorities, the strains isolated from the patient were sent to the company, which performed a phagogram (equivalent to an antibiogram but with phages). Among the phages produced in compliance with the Good Manufacturing Practices (GMP) and that were available as ready-to-use by the company, PP1450, PP1792, and PP1797 have shown activity on the patient's strains (Figure 3). Multisite samples revealed the presence of the XDR Pseudomonas aeruginosa in the stool and the nose. For that reason, we associated inhaled phage therapy (2 inhalations a day using vibrating mesh, Aeroneb , Aerogen, Galway, Ireland) and oral ingestion of phages 2 times a day for 7 days (Figure 4). \nThe phages were supplied by Pherecydes Pharma as well as the stability data which allowed us to prepare the treatment for 2 days (4 administrations). Four mL of each phage at 10Log were collected and completed with 48 mL of a saline solution. From that mixture, nebulizations were performed with 8 mL and oral ingestion with 6 mL of the solution. A sterility test was performed with 1 mL of each prepared solution.\nBecause phages survival is favor by basic condition, we treated the patient with double dose of proton pump inhibitor to maximize the efficacy. We had thought of a fecal transplantation to decolonize the digestive tract. The request was refused due to a shortage of stool available in the context of the COVID19 pandemic. In June 2021, the strain was susceptible to cefiderocol and colistin. Thus, we associated these antibiotics with the BT, Figure 4. Oral and nasal decolonization were performed with chlorhexidine 4%, 4 times a day for 14 days. Daily skin decolonization was performed with chlorhexidine 2% for 14 days. The patient was isolated in a single bedroom with contact and droplet precaution. Personal belongings have been taken out of the room and isolated (including clothes, computer, and mobile phone). Daily bio-cleaning with disinfectant were performed. Finally, the patient was moved to another room at the end of the BT.\nDuring the BT, the patient's respiratory conditions improved (less sputum production) allowing a weaning from oxygen supplementation. At the end of the first cycle of BT, XDR Pseudomonas aeruginosa was still identified in sputum and stool. We sent new samples to Pherecydes Pharma laboratory who confirmed that the strain was still susceptible to bacteriophages initially tested. As we were waiting for the second cycle of BT, the patient presented a new acute respiratory failure related to the worsening of the bronchopulmonary infection, despite no discontinuation of the antibiotic therapy, that required mechanical ventilation. The second cycle of BT was administrated through bronchoscopy and by nasogastric tube with the same protocol as described for the first cycle. The patient presented a severe obstructive pattern on the ventilator, and despite aggressive intensive care and protective ventilation, the patient progressed to multi-organ failure and died at 24 months post-LTx. For the first time, all samples collected (rectal smear, bronchial aspiration, and bronchoalveolar lavage) were interpreted as sterile from day 5 of the second cycle of BT (and confirmed the days after till the death).\nIn summary, we could observe first clinical stability (low oxygen supplementation and no more sepsis) after adapting the immunosuppressive regimen and mainly after initiating the IgM/IgA-enriched immunoglobulins, but without the possibility to stop the antibiotic treatment. And second, we could obtain sterilization of the different sites that were previously infected or colonized by Pseudomonas aeruginosa after the second cycle of BT, despite the fatal outcome.",
"gender": "Male"
}
] |
PMC10319284
|
[
{
"age": 71,
"case_id": "PMC8100614_01",
"case_text": "A 71-year-old woman with remitting multi-resistant tender papules with a metameric disposition was initially treated as herpes zoster. She later developed a chronic ulcer on the scalp that, after investigation, was indicative of pyoderma gangrenosum (PG) or pyoderma-like. She had a previous history of pulmonary tuberculosis and PG on both legs in 2003. She was treated with cyclosporine, infliximab, clofazimine, doxycycline, and intralesional triamcinolone injections with varying results for over four years. PG was finally controlled in mid-2007. She remained asymptomatic until March 2020, when intense and sudden pain on the vertex and left parietal region developed. Multiple tender papules with peripheral erythema were present. Although no vesicles were found, a tentative diagnosis of cephalic herpes zoster was suspected. Despite treatment with valacyclovir and pregabalin, symptoms increased, and papules evolved into multiple, deep, ulcerated lesions with a central necrotic scab and undermining border. Expression yielded a significant amount of purulent secretion. Skin biopsy findings were of an ulcer with exuberant granulation tissue. Histology study was performed on the material obtained while curetting one of the large abscesses rather than by a wedge excision of the border. Although the vertex aspect on the scalp suggested an erosive pustular dermatosis of the scalp, histology was more consistent with PG. Attempts to obtain microbiological cultures were twice negative.\nPrevious comorbidities include IgA multiple myeloma in remission for the past seven years and remission of pulmonary tuberculosis treated with triple therapy 18 years ago. In the process of choosing a proper therapy, the Quantiferon test was performed, which was negative. After a short period of use of oral Dapsone, the disease progressed. Due to the previous history of tuberculosis and possible contra-indications for anti-TNF alpha therapy, she was started on baricitinib, a novel Janus kinase (JAK) inhibitor, 4 mg orally daily, taking into consideration the past attempts with more conservative approaches mentioned above. The idea of using JAK inhibitors was considered in the case of failed treatments, which proved helpful. Lesions started to improve, and by seven days, no new lesions were identified. Complete regression was achieved after five weeks, leaving a depressed scar (Fig. 1, Fig. 2).\nCase 2 A 59-year-old female with rheumatoid arthritis since 2011, controlled with methotrexate 15 mg/week, developed in 2018 a leg skin ulcer for which PG was diagnosed. Healing was obtained with dressings and MTX maintenance.\nIn 2019, another PG occurred on the left leg and ankle; treatment consisted of prednisone 0.7 mg/kg/d associated with MTX 20 mg/week. PG resolved in 4 months; corticotherapy was gradually tapered, and MTX was maintained. Severe Cushing's syndrome signs were noted, impairing quality of life.\nIn 2020, another outbreak of PG compromised the right leg; methotrexate was suspended, and baricitinib 4 mg/day was introduced, with the lesion's healing in 3 months presented in the photos (Fig. 3, Fig. 4).",
"gender": "Female"
}
] |
PMC8100614
|
[
{
"age": 10,
"case_id": "PMC10190599_01",
"case_text": "P1 was a 10-year-old girl with autism. Her mother had canceled all her therapy sessions, since the beginning of the pandemic, so she did not get any other therapy for emotion recognition. Her mother reported that her main problem was in recognizing the fear emotion. She also had problems in her social interactions and did not know how to interact with others. For instance, she showed friendly behaviors with unfamiliar individuals and could not keep the right social distance, when speaking to others. In addition, she had stubborn behaviors and persisted in her requests without considering the situation.",
"gender": "Female"
},
{
"age": 6,
"case_id": "PMC10190599_02",
"case_text": "P2 was a 6-year-old boy with autism who showed difficulty in recognizing sadness and fear emotions. His mother said that he did not enter other children's group play and did not share his interests with others. He did not know the rules and norms of group play, so he was not successful in making good relationships with his peers. Moreover, he mostly expected confirmation of his actions from his parents, otherwise, he would become very nervous.",
"gender": "Male"
},
{
"age": 7,
"case_id": "PMC10190599_03",
"case_text": "P3 was a 7-year-old boy with developmental delay and with major problems in recognizing anger and \"fear\" emotions. His mother complained that he was shy and could not speak and communicate comfortably with other people while he was good at doing his school homework. In addition, he had problems with the theory of mind ability and did not comprehend the concept of winning or losing in games or how to behave when he was a winner or a loser. It was also reported that he could not play properly with others.",
"gender": "Male"
},
{
"age": 8,
"case_id": "PMC10190599_04",
"case_text": "P4 was also an 8-year-old boy who showed major difficulty in recognizing sad emotions. Also, his mother reported that he did not vocally express his emotions or express them on his face when he experienced emotional situations. In addition, he had major problems in his relationship with his classmates, because his social skills were lower than his peers. For example, he could not tolerate when he would lose in a game. Also, he rarely could pass theory of mind tests which was his major problem for which he was referred for further evaluations and interventions.",
"gender": "Male"
},
{
"age": 11,
"case_id": "PMC10190599_05",
"case_text": "P5 was an 11-year-old boy with autism, whose major problem was recognizing anger and fear emotions. It was reported that he was addicted to playing computer games and did not attend social activities. In addition, he mostly wanted to leave in the middle of his therapy sessions. His therapist expressed that his language abilities were lower than his age group, so he rarely made a good connection with his peers. In addition, it was reported that he could have had better cognitive and social abilities if he had not left his therapy sessions periodically due to his good learning abilities.",
"gender": "Male"
},
{
"age": 10,
"case_id": "PMC10190599_06",
"case_text": "P6, was a 10-year-old boy with autism diagnosis of severity level 2, with a major problem in recognizing anger and fear emotions. Also, he had difficulty recognizing happy facial expressions. Regarding expressing emotions, he could not show any emotions on his face. He had some movement difficulties and when he was left alone, he would start to tip-toe walking. His mother reported that he had low patience to wait when he demanded something. In addition, he rarely interacted with other people spontaneously and never initiated entering his peers' games. Also, most of the time, he did not initiate communication unless to satisfy his needs. The others asked questions to communicate with him. Furthermore, he was behind his age in his language competencies compared to his age group.\nIt should be mentioned that none of the participants received other emotion recognition interventions during our study period.\nThe RSE setup, i.e., a 50 cm high table with two robots and a tablet, was set in a 3 x 3 meters room. The tablet was placed on a stand between the robots to display the images or run the designed games. The game was developed using the Unity game engine to show the desired emotions. A camera was positioned at one corner of the room to record the overall view of the setting so that we can analyze the sessions later. In each session, there was a psychologist who was overseeing the whole process to make sure everything run smoothly and according to general therapy rules. Furthermore, his feedback was collected for future improvements. Besides the therapist, the main researcher was present during all the sessions making sure that the sessions run according to the plan. The overall structure of the designed RSE can be seen in Figure 3.\nTo investigate the effect of the proposed RSE in teaching facial expressions (happiness, sadness, anger, and fear) to children with autism, a single case A-B-A design experiment with a generalization probe across novel stimuli and setting was conducted. The A-B-A technique is a reversal design that has three phases: 1) Phase A or the first baseline in which no treatment is introduced, and the behavior is evaluated, 2) Phase B in which the treatment is introduced, 3) Phase A (that we called it A') or second baseline which is a return to the baseline by stopping the treatment. In this technique, the effectiveness of a proposed protocol is evaluated using multiple measures to see the changes by comparing Phase A to Phase B and then to Phase A'.\nWithin 1 week after baseline phase (A), a familiarization session was conducted to introduce the robots to the participants and reduce their novelty effect. In this session, the session conductor invited the participants to become familiar with the two robots. Then the robots started greeting the participants, introduced themselves, and asked the participants' names, ages, and favorite activities to make a sense of friendship. Then the robots started playing with a robotic ball, called Sphero, to attract the participants. In this familiarization session, the participants were free to play with the robots. Within 1 week after this session, the training phase (B) was started.\nBefore starting the training sessions, we evaluated the participants' abilities in recognizing emotions in three sessions for 2 weeks. The images were selected from the Child Affective Facial Expression (CAFE) set and Radboud Faces Database to have both adults' and children's images. Twenty images, 10 males and 10 females, were randomly selected from these datasets, including 5 images for every facial expression. The order of the images was also random to avoid memorizing the images based on the order. Each participant sat on a chair in front of a laptop computer and the session conductor presented the images one by one and asked the participant \"what is her/his feeling?\", then she waited for 3s. If the participant did not look at the images, she delivered the question up to two additional times. No feedback was provided on the responses of the participants. At the end of the task, the participants were praised for their attentiveness. The participants scored one for each right answer and zero for each wrong answer or lack of an answer.\nThe first therapy session was started 1 week after the familiarization session. A fixed protocol was given to the robots' operator to run all the sessions. Thirty-two images of 4 emotions, i.e. 8 images per expression, were chosen to be displayed on the tablet. These images were different from the images that were used in the baseline phases to prevent children from memorizing them. The schematic of the familiarization and Phase B can be seen in Figure 4.\n1. Robots greet the participant.\n2. If the participant shows a tendency to speak to the robots, the robots answer him/her and give them feedback with laughing, movement, and funny voices.\n3. The robots invite the participant to sit on a chair and watch them play.\n4. The game is run for the robots to correctly name the emotions.\n5. The robots start the conversation about the current image and name the emotion.\n6. Another image is displayed, and this process repeats until the termination of the game (going back to step 5).\n7. If the session ends, the robots say goodbye to the participant and invite him/her to the next session.\nBefore starting the therapy, the operator practiced the scenario several times. For all steps of the scenario, potential interaction sentences were determined. The scenario and the overall setup were tested by 5 members of our laboratory. They gave us feedback about the speed and ability of the operator to run the system. We used their comments to run the scenario smoother and more naturally. The steps of the scenario are as follows. \nIf there is any problem with the interaction that would cause any disruptive behavior the session conductor reacted accordingly.\nIn step 5, RoboParrot asked Red \"what is this boy/girl/man/woman feeling?\", then Red answered the question and explained why that face convey that feeling, such as \"he is laughing so he is happy\". Also, the robot may explain the same thing from the effect point of view of the emotion, i.e., \"When we are happy, we may laugh\". As a verbal reward, Roboparrot praised Red saying \"bravo\" to reinforce his correct answer. Furthermore, a star or a flower was displayed on the screen as a visual reinforcement for Red. To ensure that the participants do not miss the named emotion, one of the robots would repeat the named emotion again. Every training session took a maximum of 30 min. A view of the experimental set-up is shown in Figure 5.\nIt should be mentioned that we had designed several questions and sentences based on our previous studies such as \"how are you? How old are you? sit on the chair, listen to me, what is your name? and I am fine\", to interact with children if they showed interest to interact. For instance, at the start of a conversation, P2 asked one of the robots \"are you talking to your friend, is it possible to talk to me too?\" or asked them \"are you playing together\". Also, P4 hugged and touched them and asked their names. In such cases, the robots answered the participants. These behaviors mostly occurred at the beginning or end of the sessions.\nAt the end of each session, the participants were taken to another room and the researcher evaluated their emotion recognition capabilities, with a similar process to the baseline phase. Every participant had one or two training sessions weekly with at least 3 days gap, so the whole training phase took 8 weeks.\nThree sessions were conducted for the second baseline, which was similar to the first baseline. The second baseline was done 2 weeks after the training phase.\nA generalization probe was conducted 2 weeks after the second baseline. In this session, a similar evaluation to the baselines was conducted with 20 new images that were randomly selected from Radboud and CAFE datasets. In other words, we wanted to show that the subjects did not only learn the emotions in the images used in the therapy sessions, but they learned to recognize the four emotions in a set of new images. This evaluation was designed and performed in a room different from the therapy room to see if children could generalize the newly-learned skills to unseen stimulus items and setting.\nTo evaluate the effects of the proposed RES on children's emotion recognition skills, we used descriptive analysis, i.e., visualization of the gathered data from the sessions, and a non-parametric rank order correlation effect size measure, called TAU-U. This method helps interpret single-case experiments. Using graphs to show each participant's data point in all sessions, enables us to track the level, trend, and changes within and between phases. Using these two methods together can make the evaluation more reliable.\nThe TAU-U non-parametric analysis is a useful and desirable method for single-case experiments to calculate and illustrate the effects of therapy on both within-phase trends and across-phase differences separately. It considers all pairwise comparisons of non-overlap points in a time-forward direction similar to the NAP method (non-overlap of all pairs). However, NAP is insensitive to the trend of the data and cannot consider the pre-existing trend of the baseline which would be an indicator of the participants' improvement even without intervention. The pairwise comparisons in TAU-U result in three decisions of Pos (positive), Neg (negative), or Tie. Pos shows a score improvement and Neg shows a score decrement from Phase A to B. TAU-U is calculated based on the number of Pos and Neg pairwise points. It also considers controlling undesirable baseline monotonic trend with baseline correction by calculating Tau-UA vs. B-trend A In this study three TAU-U calculations were considered: 1) Tau-Utrend A to control the trend of baseline, 2) Tau-UA vs. B to evaluate the effect of the training, and 3) Tau-UA vs. A' to compare the second baseline with the first baseline to examine the sustained effect of the training. When Tau-Utrend A >= 0.4, which means that there is a trend in the baseline, a baseline trend control is needed to remove its effect in the analysis process. The conditions for interpreting TAU-U are as follows: 1) above 0.8 is a very large change, 2) between 0.6 and 0.8 is a large change, 3) between 0.2 and 0.6 is a moderate change, and 4) 0.2 and below is considered a small change.\nIn addition to the above evaluation approaches, the mothers of participants were interviewed at the end of RSE therapy to see if they had observed any changes in their children's abilities in recognizing and expressing emotions.",
"gender": "Male"
}
] |
PMC10190599
|
[
{
"age": 9,
"case_id": "PMC4093733_01",
"case_text": "A 9-year-old boy presented with a progressive spastic quadriparesis following trivial trauma. X-ray studies showed an occipitalized CO-C1 and congential C2-3 fusion; both contributed to an irreducible AAD resulting in cervico-medullary junction compression. Of interest, the C1 sagittal inferior facet angles measured 138 . The computed tomography (CT) angiogram clearly defined the anomalous course of the V3 segments of both VA; the VA exited from the C2 transverse foramen, took a lateral course toward the C1 transverse foramen, but instead of traversing the C1 foramen, turned inferiorly and coursed medially beneath the C1 posterior arch before piercing the dura [Figure 1]. Therefore, both VA lay posterior to the inferior facet of C1 (3D CT; Figure 1).\nAs the patient was incompletely reduced with traction, surgical intervention was warranted. The C1-2 joints were approached posteriorly, and both C2 nerve root ganglia were cut to expose the anomalous VAs just anterior to it. In order to avoid inadvertent injury to the VAs, the loops crossing the C1 facets were carefully exposed; the posterior wedge of the C2 and anterior wedge of the C1 facets were drilled making the inferior facet angle flat in order to reduce the AAD. Spacers and bone grafts were placed in the C1-2 joint spaces. Next, the VAs were gently retracted inferiorly to insert the C1 lateral mass screws, which were sufficiently tightened to leave enough space between the screw head and the facet surface for the VA; the postoperative CT also showed adequate reduction [Figure 2 and 3]. Postoperatively, the child did well, becoming ambulatory, and 4 months later, the CT exhibited good bony fusion.",
"gender": "Male"
}
] |
PMC4093733
|
[
{
"age": 73,
"case_id": "PMC5434259_01",
"case_text": "73-year-old female with history of hypertension, and a recent diagnosis of right lower lobe (RLL) lung mass, presented to the emergency department (ED) complaining of progressively worsening dysphagia for few weeks. The patient had difficulty in swallowing both liquids and solids. She reported decreased appetite, weight loss, and multiple episodes of nonbloody vomit. She was scheduled to have an endoscopy as an outpatient on the same day of admission; however, she decided to come to the ED instead, as her symptoms became more severe.\nThe patient had a remote history of 20 pack-year of cigarettes smoking. Her medications included Aspirin, Iron Pills, Atorvastatin, and Lisinopril. On physical exam, she was hypothermic with a temperature of 35.6 degrees Celsius and tachycardic with a heart rate of 103. The patient looked cachectic and chronically ill. She also had dry oral mucous membranes. The initial laboratory results showed significant leukocytosis with a white blood cell count of 29.3 thousand/ul and hyponatremia with a sodium of 127 mmol/L. The urine was cloudy in appearance, and it contained leukocytes esterase and more than 50 white blood cells. The chest X-ray revealed RLL mass, with no evidence of pulmonary consolidation. The patient was admitted to a telemetry bed and was started on aggressive IV hydration and IV ceftriaxone as a treatment for severe sepsis syndrome. The source of the sepsis was thought to be a urinary tract infection as the urine culture grew Kluyvera ascorbata and Streptococcus agalactiae (group B), and both organisms were sensitive to ceftriaxone. The hospital course was prolonged and complicated. During the first 24 hours, the patient went into atrial fibrillation with rapid ventricular rate and was started on IV amiodarone and heparin drip. She also had an abrupt onset of cold and discolored left leg that required an emergent vascular surgery evaluation. The patient was found to have left femoral artery occlusion and underwent left iliac artery stenting and left femoral endarterectomy.\nFurthermore, she had a CT-guided biopsy of the RLL mass and the pathology was consistent with primary adenocarcinoma. The patient was intubated for the surgical procedure and the biopsy. Few days later, she was briefly extubated; however, she continued to have significant hypoxia and hypotension. There was also a concern for aspiration pneumonia. Palliative care team was involved and after an extensive discussion with family, the decision was taken to change the code status to DNR. Patient expired after 2 weeks of hospitalization. The endoscopy was never done as the patient was never in a stable condition throughout her hospital stay.",
"gender": "Female"
}
] |
PMC5434259
|
[
{
"age": 81,
"case_id": "PMC4133753_01",
"case_text": "An 81-year-old Turkish woman with a mechanical bowel obstruction was referred to our emergency department. The patient had complained of acute abdominal pain, vomiting, and mechanical obstruction for five days before her admission to our emergency service. Her records confirmed that she had cholecystolithiasis for 15 years; a cholecystectomy was offered to her many times by different surgeons, but she refused to undergo the surgery. At physical examination, her abdomen was moderately distended, and tympanic bowel sounds were auscultated. The rectal examination revealed empty ampulla recti. The laboratory test an elevated total leukocyte count (15.6 x 109 cells/L) and slightly increased renal function test values, which could be considered as an indication of pre-renal azotemia. The liver function test results and serum bilirubin levels were normal. Plain radiographs of the abdomen revealed multiple air-fluid levels in the small intestine. The patient was treated with intravenous fluids and antibiotics in the tertiary hospital. On the fifth day of hospitalization, she was referred to our hospital because of the deterioration of her clinical condition. After the initial examination, computed tomography (CT) was performed, which demonstrated small-bowel obstruction by a 40 mm high-density image in a jejunal loop (Fig. 1). Additionally, the scan showed pneumobilia in the left hepatic biliary branch and thickening between the gallbladder and the duodenal walls (Fig. 2). The contrast liquid was observed in the gallbladder, and the air-fluid levels were detected on the CT scan. A cholecystoduodenal fistula resulting from chronic cholelithiasis was suspected.\nAn exploratory laparoscopy was performed. Moderately dilated jejunal loops proximal to the distal jejunum were observed during the laparoscopy. An obstruction was observed approximately 50-60 cm from the ligament of Treitz, where an enterotomy was performed to extirpate a 5 x 4 x 3 cm gallstone (Fig. 3). After the removal of the gallstone, the defect in the intestinal wall was closed, primarily with vicryl sutures. The patient had an uneventful postoperative course and was discharged on postoperative day 5.",
"gender": "Female"
}
] |
PMC4133753
|
[
{
"age": 14,
"case_id": "PMC8311769_01",
"case_text": "A 14-year-old female patient reported to the Department of Periodontology, Jaipur with a complaint of swollen gums on both the arches for 3 years, which was slow at the outset, and then the swelling started to dilate for 4 months. Due to swollen gums, she was facing a hurdle in speech, while chewing food, and during the cleaning of teeth with the brush and also complaint of bleeding gums and bad breath since last 4 months. The patient had also gone for surgical intervention for similar swollen gums 3 years ago.\nThe patient had no signs of mental retardation, hypertrichosis, or epilepsy and had no history of any medication that can be the reason for the occurrence of the overgrowth of the gingiva. The history of the family was noncontributory.\nExtraoral examination of the patient revealed a convex profile and prominent lips. Intraoral examination exhibiting generalized overgrowth of the gingiva in both the arches. More than half of the crown was covered with gingival tissue (Fig. 1). The gingiva color was normal with dense consistency. Maxillary anterior teeth were proclined. There was spacing between the teeth and a deep bite was also present. Orthopantomogram (OPG) showed localized vertical bone loss with respect to 46 and horizontal bone loss 16 and 47 and except for the third molars, all the permanent teeth were present. The treatment plan was followed by phase 1 therapy (scaling and root planing) and after completion of phase 1 therapy, the labial tissue from the mandibular anterior region was excised and sent for histopathological examination. Histopathological appearance revealed idiopathic gingival fibromatosis which showed parakeratinized stratified squamous cell epithelium with elongated rete pegs. The connective tissue showed densely packed collagen bundles (Fig. 2). After the result of the biopsy, the external bevel gingivectomy in association with gingivoplasty was planned and performed under local anesthesia quadrant-wise (Fig. 3). And after the required crown lengthening was attained (Fig. 4) then the excised site was thoroughly irrigated and the periodontal dressing was applied for 7 days and the chlorhexidine mouthwash (0.2%) was instructed to the patient, to rinse it twice a day and to maintain proper oral hygiene.\nAfter 1-week dressing was removed and postoperative healing was uneventful. And after 1 week next quadrant was excised similarly. After 1 month of the recall, it was observed that there was no recurrence of the enlargement (Figs 5 and 6).",
"gender": "Female"
}
] |
PMC8311769
|
[
{
"age": null,
"case_id": "PMC10231445_01",
"case_text": "A woman in her mid 50s presented to the emergency department of a large metropolitan teaching hospital in a critical condition. Initial investigations demonstrated hyperleukocytosis, severe anaemia and hypo-osmolar hyponatraemia (white cell count 290 x109/L, haemoglobin 39 g/L, sodium 108 mEq/L). She was transferred to the high-dependency unit for ongoing assessment and multidisciplinary management with haematology, renal and intensive care specialists.\nShe underwent computed tomography (CT) chest/abdomen/pelvis with contrast and positron emission tomography whole body fluorodeoxyglucose studies, which demonstrated extensive nodal disease above and below the diaphragm, with splenic and skeletal involvement. Blood film and diagnostic bone marrow aspirate and trephine was performed which confirmed a diagnosis of DLBCL (Figure 1). The tumour cells were large and show marked nuclear pleomorphism. On immunohistochemistry, they were positive for CD20, PAX5, CD5, BCL2, cMYC and MUM1, and negative for cyclin D1 and TdT. Weak-to-moderate Bcl-6 immunostaining was seen in around 30% of tumour cells. The Ki-67 proliferation index is approximately 25% by visual estimation. The immunophenotype based on flow cytometric assessment was CD45+/HLA-DR+/CD19+/CD20+/CD22+/CD23-/CD200+/CD5+/CD10-/CD38-/CD11c+/FMC7+/cyto-Kappa+ with absent surface light chain expression. MYC, BCL2 and BCL6 gene rearrangements were not detected by FISH. Cytogenetics analysis reveal an abnormal clone with [42-44, XX, add(1)(p32), add (4)(p14), add(12)(p11.2)]. TP53 variant was present at 92%VRF on NGS. CNS involvement was present with 19% lymphoma cells noted in the CSF at diagnosis. Non-contrast CT brain demonstrated no abnormality.",
"gender": "Female"
},
{
"age": null,
"case_id": "PMC10231445_02",
"case_text": "One week into her hospital admission, the patient reported bilateral, painless blurred vision and difficulty focusing on near objects. The onset of these symptoms was reported to have coincided with her presentation to the emergency department seven days prior. Aside from presbyopia, the patient had no previous ophthalmological history. Best corrected visual acuity (BCVA) was 6/9 in the right eye and 6/6 in the left, with no relative afferent pupillary defect. The intraocular pressures were normal in both eyes (15 OD and 12 OS). Ophthalmoscopy demonstrated bilateral venous dilation and tortuosity in the retinal vasculature, superficial retinal hemorrhages scattered throughout the posterior pole of the eye and cotton wool spots indicative of localized ischemia (Figure 2). Dynamic fundoscopy demonstrated raised retinal venous pressure, with ocular compression causing closure of the retinal arterioles prior to the retinal venules. However, there was no evidence of anterior or posterior uveitis, no keratic precipitates and no other features suggestive of intraocular lymphoma. Similarly, optical coherence tomography (OCT) imaging found no associated macular edema in either eye (Figure 3).",
"gender": "Female"
},
{
"age": null,
"case_id": "PMC10231445_03",
"case_text": "The patient was diagnosed with bilateral CRVO, secondary to leukostasis. Given her concurrent systemic illness, the management centred around treating her underlying lymphoma, with ongoing ophthalmology follow-up. In the absence of cystoid macular oedema or retinal neovascularisation, no active ophthalmic intervention was indicated.\nShe was subsequently commenced on the first of eight planned cycles of non-Hodgkin lymphoma R-CHOEP14 (rituximab, cyclophosphamide, doxorubicin, vincristine, etoposide, prednisolone) immunochemotherapy. One week later she was reviewed again in ophthalmology clinic. Her BCVA had improved to 6/6 OD and was stable at 6/6 OS, whilst funduscopic and OCT examination showed no change in the patient's ocular signs. After two weeks, she was discharged from hospital with a plan for ongoing ophthalmology follow-up.",
"gender": "Female"
},
{
"age": null,
"case_id": "PMC10231445_04",
"case_text": "Three weeks later she was re-admitted to hospital with chest pain in the context of DLBCL. She had a complicated admission with ongoing pain and cytopenias, which required multiple specialist medical team input. Whilst her ocular disease remained subjectively stable, the patient's condition continued to deteriorate, as she developed febrile neutropenia, a gram negative (pseudomonas) bacteraemia, as well as COVID-19 infection. Despite ongoing active treatment of her infections, the patient sadly passed away less than two months after commencing chemotherapy.",
"gender": "Female"
}
] |
PMC10231445
|
[
{
"age": 11,
"case_id": "PMC4943128_01",
"case_text": "An 11-year-old male child was presented in outpatient department with complaints of pain in the abdomen. Stool examination was advised. Stool examination showed the presence of eggs. The eggs were bile stained, thick walled, approximately around 70-75 mum in size in wet mount preparation. An embryo could be identified with six hooklets without polar filaments [Figure 1]. The eggs were identified as of H. diminuta. The peripheral smear showed eosinophilia.",
"gender": "Male"
}
] |
PMC4943128
|
[
{
"age": 17,
"case_id": "PMC10062505_01",
"case_text": "The patient was a 17-year-old female and was admitted from the emergency department to our urology ward with a complaint of dysuria. Her symptoms were distressing with pelvic pain, hematuria, and suprapubic pain, followed by the insertion of the pen in the urinary bladder. The patient's physical examination revealed suprapubic tenderness bladder. In addition, the pelvic examination showed an intact hymen and no major damage to the reproductive organs. Similarly, the laboratory findings were unremarkable, except the presence of red blood cells in the urine sample.\nFurthermore, the computed tomography of the bladder confirmed the presence of a foreign body in the urinary bladder [Figure 1]. After obtaining confirmed consent, the patient was shifted to the operative room; general anesthesia was given to the patient, preceded by the initiation of the operating procedure. A nephroscope size 26 French was intruded into the bladder transurethrally, and the pen was extracted by a grasper in its whole length [Figures 2 and 3]. About half an hour (30 min) was allocated to the operating procedure, and the surgery was successful with no severe complications. The patient showed a good operative recovery at the end of the period of care.",
"gender": "Female"
}
] |
PMC10062505
|
[
{
"age": 79,
"case_id": "PMC9022146_01",
"case_text": "79-year-old female, with no ophthalmic history, was referred by general ophthalmologist for the management of a MH and cataract in the right eye (OD). She was evaluated by a retina specialist in our center confirming the diagnosis. \nBest corrected visual acuity (BCVA): OD 20/100 and left eye (OS) 20/70. At slit lamp, anterior segment was unremarkable and NO4 cataract in both eyes (OU) was found. Fundus examination showed OD with MH larger than 600 microns and adjacent mild RPE atrophy; OS healthy macula with applied retina. It was decided to perform combined surgery of PPV + ILM peeling + gas tamponade + phacoemulsification with intraocular lens (IOL) implant in OD. No dyes were used and the procedure was performed without complications. Subsequently, routine controls were made during the first month. BCVA OD at 1-month was counting fingers at 2-feet, which did not improve with pinhole. Fundus examination showed a closed MH with severe hyperplasia of the central macular RPE. At 2-months follow-up, OD fundus color photography evidenced large RPE atrophic changes in the peeling zone (Fig. 1A), marked hypoautofluorescence at the same level (Fig. 1B), and macular optical coherence tomography (OCT) showed loss of retinal layers parallelism, irregular RPE enlargement with disruption at inner/outer segment junction and posterior optical reinforcement (Fig. 2). After 2-years, BCVA was hand motion in the OD with persisting rounded hyperplasia of the RPE corresponding to the size of the peeling zone.\n Case 2",
"gender": "Female"
},
{
"age": 69,
"case_id": "PMC9022146_02",
"case_text": "69-year-old female, with no ophthalmic history, came to our center because of metamorphopsia in her OS and a diagnosis of ERM and bilateral cataract given by a general ophthalmologist. She was evaluated by a retina specialist in our center confirming the diagnosis. \nBCVA was 20/30 OU. At slit lamp, anterior segment was unremarkable and P2 cataract in OU was present. Fundus exam showed ERM with applied retina OU. It was decided to perform a combined surgery of PPV + ERM peeling + gas tamponade + phacoemulsification with IOL implantation in OS. During the procedure, ERM was removed without any dye and ILM removal was stained with brilliant blue (BB). Peeling of ILM was difficult because of a great adherence of the membrane to the retina, therefore the procedure was performed without any further complications. Routine controls were scheduled during the first month. At 2-months follow-up, macular edema with OS central macular thickness of 327 mu was observed in OCT, so an Ozurdex was implanted decreasing this value to 262 mu. After 5-months of follow-up, marked atrophy of the macular RPE with adjacent pigmentary changes was observed.\nA new macular OCT of the OS was requested, showing loss of parallelism of the retinal layers, irregular RPE and disruption of the inner and outer retina compatible with atrophy at that level (Fig. 3); fundus autofluorescence showed an extensive RPE mottling characterized by an hypoautofluorescent area in the posterior pole extending outside the temporal vascular arcades associated with hyperreflective dots (Fig. 4).\nIn the last control 2-years after surgery, BCVA was 20/40 in the OS that did not improve with pinhole.",
"gender": "Female"
}
] |
PMC9022146
|
[
{
"age": 74,
"case_id": "PMC2495020_01",
"case_text": "Malignant lesions resected were colorectal metastases. Benign lesions treated included haemangiomas, liver cell adenoma, focal nodular hyperplasia, and deroofing of liver cysts and a bile duct cyst. Microwave ablation was utilised for hepatocellular carcinoma, haemangioma, metastatic parathyroid carcinoma, and focal nodular hyperplasia. Three operations incorporated multiple procedures these included a 74-year-old frail male patient who had a right inguinal hernia repair immediately before proceeding to a planned segment 5 resection of a colorectal metastasis. This negated the requirement for a second anaesthetic. A 73-year-old male who had a wedge excision of a haemangioma in segment 5 and microwave ablation of a second highly vascular haemangioma in segment 6, minimising the amount of tissue resected for benign disease. A 34-year-old female undergoing laparoscopic left lateral lobectomy for a suspicious lesion thought to be FNH, with a similar suspicious lesion found in segment 4a, intraoperative frozen section confirmed this lesion also to be FNH and a successful microwave ablation was performed preventing a formal hemihepatectomy in a young patient with benign disease.\nThe operations included right hemihepatectomy n = 1, (a second right hemihepatectomy was aborted due to widespread peritoneal disease following an exploratory laparoscopy n = 1), left lateral lobectomy n = 4, bisegmentectomy n = 2, segmetectomy n = 8, wedge resection n = 11, microwave ablation n = 8, and deroofing of liver and bile duct cysts n = 7, right inguinal hernia repair n = 1. Table 1 describes the demographic, intraoperative and postoperative details of all the patients.\nMedian operating time for the entire group of patients as judged by length of time under general anaesthetic in theatre was 120 minutes (range 40-240 minutes). Mean blood loss was 78 mL and only one patient required transfusion. Conversion to open operation was carried out in 1 out of 40 patients; this was a segment 5 resection for a colorectal metastasis and was due to CUSA failure. There was no perioperative mortality and no 30-day mortality. Median total length of stay in hospital was 3 days. No bile leaks were experienced and there were no other complications.\nMedian operating time excluding patients having only cyst deroofing or microwave ablation, and excluding the patient who was converted to open hepatectomy and the patient having a failed right hemihepatectomy due to the presence of peritoneal metastasis, was unchanged at 120 minutes (range 60-240 minutes), mean blood loss was 104 mL, and median length of stay remained 3 days for this group. This data is described in Table 2.\nMedian resection margins given by the pathologist were 10 mm (range 1-45 mm), where actual resection margins were not given malignant lesions were described as completely excised (CE). Of the 17 malignant tumours, one patient has died of coronary artery disease and one patient who had a segment 5 resection of colorectal liver metastasis has developed lung metastases. No patient has had locally recurrent disease.",
"gender": "Female"
}
] |
PMC2495020
|
[
{
"age": 54,
"case_id": "PMC4755470_01",
"case_text": "In April 2012, the ENT (ear, nose, and throat) Department at the University Hospital of Clermont-Ferrand examined a 54-year-old patient suffering from a blood discharge of the right nostril progressing over a couple of months. In the patient's personal history, there was a retinoblastoma of the right eye at the age of 7 months, which received enucleating treatment followed by radiotherapy (two doses of 40 Gy in 18 fractions and 14 fractions, by small fields of 4-6 cm2), due to the radiation-induced sequelae of the right hemifacial requiring multiple reconstructive surgeries and a prosthetic device.\nHe is under levothyroxine treatment after a thyroidectomy for a benign tumor, carries a defibrillator, and is being treated for hypotension. The patient has also smoked since the age of 16 years (approximately 35 packs per year) and has presented three episodes of \"angioneurotic\" edema following an allergic reaction to penicillin. In the family history, his mother has breast cancer. A bilateral retinoblastoma detected in his daughter at the age of 3 months was treated by enucleation of the left-eye and right-eye radiotherapy (45 Gy in 24 sessions over 32 days) associated with chemotherapy, which led to a sarcoma pleomorphic undifferentiated in the irradiation zone, and was treated with surgery and chemotherapy.\nThe ENT examination revealed at the right nostril a blackish tumor on the anterior part of the nasal septum. The left nasal cavity was normal, the orbital floors were free, and the examination of the cervical area was normal. The computed tomography scan found thickening tissue of the right nasal cavity remaining confined without any suspicious abnormality (Figure 1). No magnetic resonance imaging was done, because of the presence of the defibrillator. The biopsy performed under local anesthesia with a histopathological analysis of the sample reported a malignant melanoma globocellular type of nasal septum (Figure 2). An endonasal resection performed with immunohistochemical examination confirmed the diagnosis of malignant melanoma. The lesion was strongly expressing vimentin and human melanoma black 45 (HBM45) (Figure 3). It was an epithelial membrane antigen (EMA) and negative pankeratin. Surgery on the tumor was performed under general anesthesia by the endonasal route, with excision of the tumor in one piece and all the nasal septum. Extemporaneous examinations were performed on all incision samples, which yielded negative results. A consultation was performed in addictology in order to help the patient stop smoking. The anatomopathological analysis of surgical specimens confirmed the malignant melanoma (1.5 cm-long axis, infiltration and ulceration of the right nasal cavity, globular cells of an epitheloid appearance rich in cytonuclear irregularity, large nucleus with nucleolus strongly thickened with nuclear membrane and a coarse chromatin with mitosis), which came into contact with the overlap of the lower septum (Figure 4). Adjuvant radiotherapy of 54 Gy was delivered in 18 fractions of 3 Gy. Clinical (ENT, ophthalmology, medical) and radiological (computed tomography, chest X-ray, ultrasound) examinations performed every 3 months were unremarkable (Figure 5). This case report followed the tenets of the Declaration of Helsinki and was approved by the Center Hospital University of Clermont-Ferrand ethics committee. Written consent was obtained from the patient.",
"gender": "Male"
}
] |
PMC4755470
|
[
{
"age": 80,
"case_id": "PMC7605928_01",
"case_text": "An 80-year-old man with flu symptoms collapsed at his house because of lightheadedness. He received a diagnosis of lumbar compression fracture at a local clinic. He obtained nerve block injection to control his backache at another medical facility. However, he lost his appetite and could not stand, and his backache condition deteriorated, so his family called for an ambulance.",
"gender": "Male"
},
{
"age": 31,
"case_id": "PMC7605928_02",
"case_text": "He had a history of gastrectomy at 31 years old, cerebral infarction at 71 years old, lumbar spinal canal stenosis at 73 years old, and acute coronary syndrome requiring percutaneous coronary intervention at 79 years old. He had no specific family history. On arrival, his blood pressure was 142/110 mmHg, his heart rate was 92 beats per minute, his body temperature was 37.2 C, and his percutaneous oxygen saturation was 97% under room air. He complained of backache on motion. He had no sensory or motor disturbance. The main results of a blood test are shown in Table 1. Chest X-ray showed reduced permeability of the right lung field (Figure 1), and truncal computed tomography (CT) suggested right multilobular empyema and right iliopsoas abscess (Figure 2). Exploratory puncture under ultrasonic guidance resulted in confirmation of the abscess, and we performed right small thoracotomy for empyema; about 300 ml of bloody pus was removed. We then inserted a continuous double lumen catheter into the right chest. Next, we performed drainage under ultrasonic guidance for the right iliopsoas abscess, and about 100 ml of bloody pus was also removed. We inserted a catheter for drainage of the remaining iliopsoas abscess. We diagnosed him with empyema with an iliopsoas abscess and started intravenous administration of doripenem hydrate after obtaining culture samples.\nAfter these treatments, his general condition improved, and he was able to feed himself. On day 7, S. intermedius was cultured from all sites, and doripenem hydrate was deescalated to ampicillin based on the results of a drug sensitivity test and the possibility of switching to medicines for internal use. On day 9, all drainage tubes were removed because of an improvement in his inflammatory response. On day 16, lumbar fusion was performed for lumbar compression fracture. Following the operation, he continued rehabilitation and intravenous administration of ampicillin for three months. With these treatments, the abscess shrank. Finally, he was transferred to another hospital for rehabilitation.",
"gender": "Male"
}
] |
PMC7605928
|
[
{
"age": 43,
"case_id": "PMC8650644_01",
"case_text": "A 43-year-old male patient with underlying diabetes mellitus and a history of admission for meningitis lesser than one year before this current condition presented with lower abdominal pain with radiation to the left thigh. He also complained of having fever and lethargy for the past three days and eventually unable to ambulate due to worsening pain. On physical examination, he appeared lethargic, while his vital signs were still stable. Both iliac fossae were tender, and crepitus was felt along the anteromedial aspect of the left thigh. The neurovascular status of the bilateral lower limbs was intact. Blood investigations showed lymphocytosis. A CT scan was done urgently and revealed retroperitoneal collection from the L1/L2 vertebral body and the collection was extending to bilateral iliacus muscle. However, it extended beyond the iliopsoas insertion on the left side. The CT scan images revealed also the destruction of the first and second lumbar vertebrae (Figure 1). \nThe patient was resuscitated adequately and, then, taken for surgical intervention on the same day as the presentation. Extensive incision and drainage were done bilaterally. Intraoperatively, more than 1,000 mL pus was drained, and the extensive slough tissue was debrided. The collection was found to unusually breach the deep fascia and extent into the left adductor canal (Figure 2). \nDuring this setting, a diagnostic laparoscopy was also performed, and intra-abdominal involvement was ruled out. Specimens were sent for culture and sensitivity intraoperatively, which later revealed the growth of Klebsiella pneumoniae (K. pneumoniae). The patient was treated with intravenous amoxicillin/clavulanic acid. A repeat CT scan was done one week later and showed a residual collection. The patient was taken in for another surgical drainage, while intravenous antibiotics were continued. Subsequent repeat scan revealed only minimal residual collection, while there was no worsening of vertebral bony destruction. Although the collection was visualized to involve the L1 and L2 vertebral bodies with bony destruction, no surgical interventions were performed for the spine, as the patient did not have neurological deficits and there was no worsening of the spinal column during treatment with intravenous antibiotics. \nEventually, the patient improved clinically and was deemed fit for discharge. He was followed in the outpatient setting. However, eight months later, the patient was re-admitted for a left hip intramuscular abscess for which left hip drainage of the intramuscular abscess and arthrotomy washout was done, revealing about 40 mL of pus. During the same admission, the patient was also treated for lung empyema and bilateral pleural effusion by the surgical and medical team, respectively. Culture and sensitivity of specimens sent intraoperatively yielded growth of K. pneumoniae and he was treated with intravenous meropenem. Unfortunately, the patient eventually succumbed to sepsis due to the deep-seated intramuscular abscess and lung empyema. A written informed consent was obtained from the patient.",
"gender": "Male"
}
] |
PMC8650644
|
[
{
"age": 18,
"case_id": "PMC2948899_01",
"case_text": "A 18-year-old patient with a history of Matched-Unrelated-Donor Peripheral Blood Stem Cell Transplantation (MUD-PBSCT) was admitted to the hospital because of renal failure. In November 2007 the patient was first diagnosed with acute lymphoblastic leukemia of T cells (T-ALL) at another institution, where he was treated with induction therapy according to Hyper-CVAD Protocol (Cyclophosphamide 300 mg/m2 intravenously (IV) over 3 hours every 12 hours for six doses on days 1 through 3, with mesna given by continuous infusion, vincristine 2 mg IV days 4 and 11, doxorubicin 50 mg/m2 IV day 4, and dexamethasone 40 mg daily on days 1 through 4 and 11 through 14) and was refractory when he presented in our department of hematology/oncology. The diagnosis of T-ALL has been confirmed, immunophenotype precursor T-ALL (CD7, CD3, CD2, CD4, and CD8 pos), cytogenetic 46, XY, Fluorescein in sito hybridisation (FISH) analysis 87% deletion of p16 on the chromosome 9 region p21. He was then treated with induction therapy according to the German multicenter ALL protocol (GMALL) achieving only reduction of blasts after Induction II. Briefly, the induction in GMALL protocol was composed of eight cytotoxic drugs administered sequentially in two phases over an 8-week period. During the first 4 weeks (phase I), the patient received 60 mg/m2 prednisolone PO daily (days 1 through 28) plus 45 mg/m2 daunorubicin and 2 mg vincristine IV weekly (days 1, 8, 15, and 22). L-asparaginase (5 000 U/m2) was administered IV daily (days 15 through 28). In the second 4 weeks (phase II), the patient received two doses of 650 mg/m2 cyclophosphamide IV (days 29, 43, and 57) together with 60 mg/m2 6-mercaptopurine PO daily (days 29 through 57) and four courses of 75 mg/m2 cytarabine IV (days 31 through 34, 38 through 41, 45 through 48, and 52 through 55). He was then treated with nelarabine and achieved complete remission (CR1) following MUD-PBSCT. The conditioning consisted of total body irradiation (TBI), 12 Gy, given fractionated 2 times daily for three days, from day -6 to day -4, and cyclophosphamide 60 mg/kg once daily i.v. on days -3 and -2 (total dose 120 mg/kg b.w.). A Human Leukocyte Antigen (HLA) identical unrelated donor peripheral blood stem cells were infused on day 0. Graft-versus-Host Disease (GvHD) prophylaxis consisted of thymoglobulin (2 mg/kg b.w. daily, from day -3 to -1, total dose of 6 mg/kg b.w.), cyclosporine 5 mg/kg starting on day -1, and methotrexate at days +1, +3, +6, and +11 intravenously 15 mg absolute. The bone marrow puncture on day +28 showed a complete hematological remission with 100% donor chimerism. Along with the regeneration of white blood cells the patient developed a methylprednisolone-dependent GvHD of the skin and gastrointestinal, grade II. After 10 days the therapy with corticosteroids could be discontinued by rapid improvement of the GvHD-related symptoms. Under the therapy with corticosteroids the patient developed a herpes simplex related oesophagitis on day 21 post transplant which was treated with 30 g daily over 5 days i.v. immunoglobulin and foscarnet 90 mg/kg b.w. divided in 2 doses. On day +28 after PBSCT the patient developed a hemorrhagic cystitis with high urine titers of BK polyoma virus and CMV infection. A therapy with ganciclovir was initiated for ten days. Under treatment with ganciclovir, CMV infection improved, and the treatment with cidofovir was started (1 mg/kg b.w. for two weeks). The BK Virus viruria and viremia improved, and the patient received ganciclovir treatment for additional two weeks (Figure 1). The cyclosporine level was from 200 to 150 from day 0 to day 30, followed with level of 100 from day 30 to day 40 post transplant, and level of 50 from day 40 to day 50. The cyclosporine has been discontinued on day +70 after MUD-PBSCT in absence of acute GvHD and as recommended in GMALL protocol. On day +48 after PBSCT a cystoscopy with a continuous intravesical saline irrigation was started and discontinued 2 weeks later. The patient symptoms improved, and creatinine levels returned to normal. He was discharged from hospital; his medications at the time of discharge included ciprofloxacin (250 mg twice daily), valacyclovir (500 mg twice daily), fluconazole (200 mg daily), folate, and cotrimoxazole twice weekly for prophylaxis of pneumocystis carinii infection.\nOver the next year the levels of urea nitrogen and creatinine gradually rose (Table 1), which was attributed to drug toxicity. cotrimoxazole prophylaxis was stopped. Cyclosporine was discontinued since no signs of GvHD were present 6 months after PBSCT. The serum creatinine level was 153 mumol/l (Table 1). Routine urinary diagnostic measures were carried out and showed inconsistent microhematuria. BK viruria was negative in this period. \nOn admission, blood pressure was 130/80 mmHg with 90 heart beats per minute, a temperature of 36.4 C, and an oxygen saturation of 99% when the patient was breathing ambient air. The lungs were clear, the results of the remainder of the examination were normal. The complete blood count and levels of serum electrolytes, liver function tests, and levels of total protein and albumin were normal. The urine sediment was not nephritic but contained a small amount of leukocytes indicating an inflammatory process such as cystitis. Results of other laboratory tests are shown in Table 1. \nUltrasonographic examination of the kidneys showed bilateral hydronephrosis stage III-IV (Figure 2(a)). In addition, decreased echotexture bladder tumours were seen (Figure 2(b)). The patient was presented to the urologist. Cystoscopy with urethrography has shown exophytic bladder tumours in both ostii. The extirpation of the tumours was performed and sent off for pathological examination. In addition a double-J catheter was placed. The hydronephrosis of the left kidney improved immediately and improved to grade II in the right kidney. For histological examination tissues were formalin-fixed overnight and embedded in paraffin. Hematoxylin & Eosin staining of 5 micrometer sections was performed following standard procedures. \nThe pathohistology of the specimen showed a chronic cystical urocystitis with bleedings (Figure 3(a)). Tissue probes of both ureters were stained for SV40 large T antigen (clone pAb416, Oncogene Science, Boston, Mass, USA; dilution 1 : 100, antigen retrieval and amplification with catalyzed system amplification, Dako, Carpinteria, CA). The reactions were detected by means of the streptavidin-biotin method and were revealed using diaminobenzidine as a chromogen. In all tissue probes immunohistochemistry for large T antigen was negative (Figure 3(b)). \nThe patient has undergone double-J catheter controls and changes every two months and is doing well 2 years after PBSCT and 1 year after operative extirpation of tumours. The last control was in April 2010 (Table 1).\nTwo different regions of the BKV genome were amplified by PCR, VP2 in serum and urine, and large T antigen from tissue biopsies.\nNucleic acids were extracted from 200 microliter blood or urine using magnetic beads (MagNA Pure LC total NA isolation kit, Roche, Mannheim, Germany) according to the manufacturer's instructions while from formalin-fixed, paraffin-embedded material nucleic acids were extracted using the QIAamp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany). VP2 primers lead to amplification of a 131 bp fragment. PCR reaction was carried out in 20 microliter capillaries containing master mix (6 mM MgCl2, 0.1 mg/ml BSA (Sigma, St. Louis, USA)) and 10 picoM of each primer (Metabion, Martinsried, Germany), 3 picoM of each hybridization probe (5'-GGCTGCTGCTGCCACAGGATTTTC-FL (probe 1) and 5'LC Red640-GTAGCTGAAATTGCTGCTGGAGAG-ph (probe 2), 0.25 mM dNTP's (Roche)), and 1U Platinum Taq Polymerase (Invitrogen, Karlsruhe, Germany). Target DNA was added in a volume of 5 microliters. Two negative and 4 positive controls in different concentrations were included into each run performed on a LightCycler 1.0 instrument (Roche, Mannheim, Germany) under the following conditions: initial denaturation and activation of hot-start enzyme at 95 C for 30 s, followed by 45 cycles of denaturation at 95 C for 0 s, annealing of primers at 58 C for 10 s, and primer extension at 72 C for 20 s. Fluorescence was monitored by single acquisition during the annealing phase of each PCR cycle and channel setting F2/F1 (640 nm/530 nm). Differentiation of BK virus amplicons from JC virus depends on the binding of the probe 2, which perfectly matches JC virus but differs at the two underlined positions from BK virus. Thus binding to BK virus results in a shifted melting curve (61.5 C for BK versus 63.8 C for JC).\nFor detection of the viral large T-antigen, a 128 bp long fragment was amplified using modified primers from that match BKV genotypes 1 to 4, forward primer 5'-CAGGCAAGGGTTCTATTACTAAAT-3', reverse primer 5'-GCAACAGCAGATTCYCAACA-3', probe 5'-6FAM-AAACTGGTGTAGATCAGARGGAAAGTCTTTAGGGTCTT-BBQ. \nPCR conditions were identical to the one described above except TaqMan probe that was used at 4 pico molar, primer annealing was 56 C for 10 s, and fluorescence acquisition was at the end of each primer extension phase at 530 nm.",
"gender": "Male"
}
] |
PMC2948899
|
[
{
"age": 70,
"case_id": "PMC9316585_01",
"case_text": "A 70-year-old male was referred to our hospital in June 2020 because of a right renal mass accidentally detected on computed tomography (CT). There were no complaints of haematuria, abdominal masses, pain, or weight loss. The patient's past medical history included hypertension, coronary artery disease, and chronic hepatitis B. His medications included olmesartan, aspirin and entecavir. There was no family history of cancer, and the physical examination was unremarkable.\nAbdominal contrast-enhanced CT revealed a round-like mass with obvious early enhancement in the middle part of the right kidney. The mass did not protrude beyond the renal contour and was accompanied by slight shrinkage of the renal cortex ( Figures 1A-E ). For the purpose of partial nephrectomy, 8 and 4 points were evaluated according to PADUA and SPARE nephrometry scoring systems, respectively.\nIn preoperative discussion, urologists did not believe that the small renal mass could be accurately identified or palpated during nephron-sparing surgery. Considering that the mass was located in the lateral region of the right kidney and intraoperative ultrasound (US) was highly dependent on the operator, we decided to perform microcoil implantation prior to laparoscopy to provide a direction for partial nephrectomy.\nAfter preoperative evaluations were performed and informed consent was obtained, the patient underwent CT-guided localization of the small renal mass without any complications or obvious inconvenience. A tornado-like radio-opaque microcoil (MWCE-18S-6/2-TORNADO, Cook Medical, Bloomington, IN, USA) was implanted into the renal parenchyma targeting the small renal mass ( Figure 1F ).\nThe right kidney was scanned by CT five times, and the cumulative effective radiation dosage was 5.1 mSv. The span between CT-guided microcoil localization and the start of the operation was 15 hours. Under general anaesthesia, the patient underwent laparoscopic partial nephrectomy in the left lateral position. Laparoscopic exploration of the retroperitoneal cavity revealed the implanted microcoil protruding from the dorsal surface of the right kidney ( Figure 2A ). The resection range was 2 cm in radius with the implanted microcoil as the centre. The mass was completely removed without excessive damage to the renal vasculature or collecting system ( Figure 2B ). The operation time was 105 minutes, and the warm ischaemia time was 25 minutes.\nThe postoperative recovery was smooth, and no perioperative complications occurred. The postoperative serum creatinine concentration was 88.4 mumol/L, within the normal range, and no hydronephrosis was observed on US at the postoperative follow-up. The final pathological result revealed T1a renal cell carcinoma (RCC, American Joint Committee on Cancer TNM stage), WHO/ISUP grade 2 ( Figure 2C ), 16 mm in greatest dimension. The tumour did not involve the perirenal capsule and was at least 2 mm away from the surgical margin. Eleven months later, follow-up magnetic resonance imaging showed no RCC recurrence, and the patient remained asymptomatic.",
"gender": "Male"
}
] |
PMC9316585
|
[
{
"age": 11,
"case_id": "PMC9329137_01",
"case_text": "The first case presented at birth with imperforate anus and intestinal obstruction for which a sigmoid colostomy was performed in the neonatal period. This case represented an extreme form of anorectal anomaly with severe sacral dysplasia, pelvic asymmetry, and deformed genitalia. Chromosomal analysis confirmed normal male karyotype (46 XY). Perineal examination revealed a caudally positioned hypospadiac phallus with severe penoscrotal transposition ( Fig. 1A and B ). A single wide perineal orifice proved to be the bladder neck directly communicating with the perineum without recognizable urethra in-between (vesico-perineal fistula). The urinary bladder was very small (underdeveloped) due to continuous leakage of urine through the wide and incompetent bladder neck. Distal colostogram demonstrated no communication with the urinary tract (imperforate anus without fistula) ( Fig. 1C ). A perineal swelling was located just beside the central perineal orifice which proved to be a lipoma on magnetic resonance imaging (MRI) ( Fig. 1D and E ). This case had other associated major anomalies: renal and testicular agenesis on the right side as well as poor lower limb development on the same side ( Fig. 1D ), asymmetrical lower vertebral dysplasia, and lipomyelomeningocele. Because of the severe distortion and asymmetry of pelvic anatomy, in addition to the presence of significant sacral dysplasia and spinal anomalies, a very poor prognosis for continence (both urinary and fecal) was expected in this case. After counseling with the parents, we decided to leave the patient with colostomy, while continent urinary diversion was performed later at the age of 4 years. The ureter of the single left kidney was disconnected from the hypoplastic bladder, and then was reimplanted in a pouch formed from intestine (ileocecal pouch), while the appendix was used as a conduit for self-catheterization (Mitrofanoff principle). The parents were instructed to keep on long-term follow-up at nephrology clinic for his special renal condition (single kidney draining into pouch of intestine). This patient is now 11 years old; and he is doing well at school. He is continent to urine through regular self-catheterization, and his single left kidney shows normal sonographic appearance at follow-up. He still has a colostomy, while the lipomyelomeningocele was managed conservatively. He underwent above knee amputation for the poorly developed right lower limb, and he is walking using artificial limb (right side) and crutches. He is now counseling for possibility of some sort of corrective surgery for the external genitalia. \n The second case was referred to our hospital at the age of 9 months with a sigmoid colostomy performed elsewhere at birth. Perineal examination revealed similar anatomical derangement ( Fig. 2 ): single perineal orifice, caudally positioned hypospadiac phallus, severe penoscrotal transposition, in addition to a perineal swelling covered with mucous membrane. Chromosomal analysis confirmed normal male karyotype (46 XY). Imaging studies demonstrated the rectum joining with the urethra 1.5 cm below the bladder neck to form a common excretory orifice just distal to their confluence. Compared with the first case, this case represented a milder form of the anomaly, not only for the absence of major associated anomalies but also for the presence of a recognizable segment of proximal urethra below the bladder neck. However, the urethral segment was too short (like the female urethra); and the bladder neck was still wide and was located at a lower level in the pelvis opposite the distal end of the pubic symphysis ( Fig. 2D ). At the age of 18 months, posterior sagittal anorectoplasty was performed to mobilize the rectum and reposition it backward within the sphincter muscle complex, in addition to excision of the perineal swelling ( Fig. 2E , F ). Histopathological examination of excised perineal swelling was compatible with hamartomatous polyp ( Fig. 3 ). Correction of the penile deformity will require staged reconstruction.",
"gender": "Female"
}
] |
PMC9329137
|
[
{
"age": 16,
"case_id": "PMC4236770_01",
"case_text": "A 16-year-old man presented with a one month history of fever, pubic pain which irradiates to the genitals and increases when hip is mobilized, and this fact produces gait claudicating. The symptoms started a few days after playing a football match, though the patient denied any history of trauma. He had a temperature of 38.5 C and a normal testicular and abdominal examination. The C reactive protein had risen to 12 mg/l with an erythrocyte sedimentation rate of 25 mm/h and a white blood cell of 16410 per mm3. Echocardiogram was normal and autoimmune screen was negative. The blood culture was negative. The magnetic resonance imagery (MRI) of the pelvis showed a bone oedema of symphysis pubis and abdominal muscles (Figure 1, Figure 2). The puncture guided by computed tomography (CT) of the articulation of pubis returned of Staphylococcus aureus methicillin-susceptible (SAMS). The patient was prescribed intravenous flucloxacillin 1 g six times a day for six weeks and discharged with further four months of oral flucloxacillin at 1g three times a day on microbiologist's advice. A repeat MRI after four months showed a complete resolution.",
"gender": "Male"
}
] |
PMC4236770
|
[
{
"age": 13,
"case_id": "PMC6515074_01",
"case_text": "A 13-year-old boy underwent pericardial fenestration and thoracic duct ligation for pericardial and pleural effusion at 3 years of age and was diagnosed with GLA after a pleural biopsy. The patient experienced no pleural effusion before his 11th birthday. The patient had a history of cerebrospinal fluid leakage due to a skull fracture at 7 years of age. The patient was referred to our department immediately following pleural effusion when he was 11 years old. A hematological examination showed high values for D-dimer (22.2 mug/mL) and P-FDP (50.9 mug/mL). A radiograph showed pleural effusion in the right lung (Figure 1). Thoracentesis revealed chylothorax mixed with blood components. Magnetic resonance imaging showed additional lesions on the lymph ducts on both sides of the inner auditory channels; computed tomography (CT) showed diffuse osteolytic changes on both sides of the femoral neck and thoracic vertebra. Figure 2 shows the patient's clinical course. Although the patient abstained from eating and parenteral nutrition was provided in addition to octreotide testing and pulse steroid therapy, pleural effusion worsened and became bilateral. Two or more liters were drained on days when there was a large amount of pleural effusion. We were unable to locate the site of the leakage even though we conducted a lymphogram to treat the pleural effusion and identify the leakage site. Sirolimus administration was initiated at 0.88 mg/m2/day, which proved to be an insufficient dosage. However, when the dosage was increased to 1.3 mg/m2/day after 1 month, the patient experienced an onset of disseminated intravascular coagulation (DIC) after 1 week. At that time, a blood examination showed platelet (1.4 x 104/muL), P-FDP (590 mug/mL), fibrinogen (114 mg/dL), prothrombin time rate (1.35), antithrombin (129%), and no liver dysfunction. The urine and blood cultures were negative. Viral serology was negative for cytomegalovirus, and aspergillus antigen was negative. Rheumatoid factor and antinuclear antibody were normal levels. The CT scan showed no sign of pneumonia or pyothorax. We diagnosed him with DIC using DIC score. Although we temporarily paused the administration of sirolimus, the patient experienced an additional onset of DIC 10 days after we resumed administration. Thus, he underwent thoracoscopic removal of the hematoma (Figure 3). The trough level of sirolimus during administration was 3.4-8.9 ng/mL, which does not represent abnormal elevation. Although an additional pause in the administration of sirolimus did not reduce the amount of pleural fluid, there were no additional onsets of DIC. Subsequently, there was a significant decrease in pleural fluid once Eppikajyutsuto was administered at 0.2 g/kg/day. We were able to proceed with tube thoracostomy removal 40 days after the initiation of oral administration. There was no re-accumulation of pleural fluids in the 18 months following the initiation of oral administration.",
"gender": "Male"
}
] |
PMC6515074
|
[
{
"age": 66,
"case_id": "PMC4348141_01",
"case_text": "A 66-year-old man was referred to our hospital, the National Defense Medical College, Tokorozawa City, Japan from an ophthalmology clinic with a 1-week history of visual disturbance in his right eye. There was no ocular history of trauma, inflammation, or medication. His family history and medical history for systemic diseases were unremarkable. At presentation, the best corrected visual acuity was 20/30 in the right eye and 20/15 in the left eye. Intraocular pressure (IOP) was 30 mmHg in the right eye and 14 mmHg in the left eye. Biomicroscopy revealed ciliary injection, corneal epithelial edema, mutton-fat keratic precipitates, flare, and infiltrating cells in the anterior chamber of the right eye (Figure 1A and B). In addition, pigmentation of trabecular pigment band in the angle was increased in the right eye compared with the left eye (Figure 1C and D). Although mild opacity and cell infiltration in the anterior vitreous of the right eye were present, retinitis or retinal vasculitis was not observed. No abnormalities were found in the left eye.\nIn addition to the laboratory blood tests, the multiplex polymerase chain reaction (PCR) for human herpes viruses (HHVs) 1 through 8, of the aqueous humor from the right eye was performed, and treatment with topical 0.1% betamethasone, mydriatic (0.1% phenylephrine and 0.1% tropicamide), and 0.005% latanoprost for ocular hypertension was initiated. The serological tests were negative for syphilis and anti-herpes simplex virus, as well as anti-VZV antibodies. However, VZV-DNA was detected by multiplex PCR in the aqueous humor obtained from the right eye, and quantitative real-time PCR revealed VZV-DNA copies of 1.28x107 copies/mL. Although the patient had not been vaccinated for VZV, there was no history of chickenpox in childhood or later, and serum anti-VZV antibodies were not detected. However, ZSH was diagnosed since the clinical findings were compatible with VZV-associated anterior uveitis and skin lesions were absent, thus excluding HZO.\nWe initiated medical treatment for VZV with oral valaciclovir 1,500 mg three times a day for 1 month, in addition to the topical treatment. Ocular inflammation resolved gradually, and IOP decreased to lower than 21 mmHg. VZV-DNA in the aqueous humor was reduced to 4.08x104 copies/mL at 3 months after the first visit, and serum anti-VZV antibodies were first detected after 4 months. Distorted pupil and fan-shaped iris atrophy, which are characteristics of VZV iridocyclitis, appeared at the upper nasal iris (Figure 2). Ocular inflammation was not observed at 6 months, and VZV-DNA was not detected from the aqueous humor. Written informed consent was obtained from the patient for publication of this case report and accompanying images.",
"gender": "Male"
}
] |
PMC4348141
|
[
{
"age": 35,
"case_id": "PMC6525288_01",
"case_text": "A 35-year-old healthy pregnant lady with a history of 3 previous cesarean sections was scheduled for her 4th cesarean delivery. The operation was performed under spinal anesthesia. Severe adhesion of the urinary bladder to the lower uterine segment was encountered but there was no apparent lower urinary tract injury. Her postoperative period was uneventful and she was discharged home the next day. On the 11th postoperative day she was readmitted to the emergency unit at 11 pm with considerable abdominal distension, shortness of breath and difficulty of micturition with straining to void. Further questioning revealed sudden inability to void 5 days earlier followed by mild hematuria and passing a small amount of urine. On examination she was dyspneic, the abdomen was distended, pulse rate was 100 BPM, blood pressure was 100/60 mm/Hg and afebrile. Immediate resuscitation was started and Foley catheter was inserted which drained 100 ml concentrated urine. Serum creatinine (6.8 mg/dl), blood urea (123 mg/dl) and serum potassium (5.6 meq/l) were high. Abdominal and pelvic ultrasound showed marked ascites (Fig. 1), normal both kidneys with no hydronephrosis. A trial of diagnostic and therapeutic ascitic fluid drainage was performed by putting a percutaneous 12 French pigtail catheter in the right lower abdomen under ultrasonic guidance (Fig. 2). Six and a half liters of clear fluid was drained. Biochemical investigation of the drained fluid showed high urea (145 mg/dl) and creatinine (20 mg/dl). Diagnosis of urinary ascites was confirmed. Later on, there was a dramatic improvement in the general condition of the patient. Next day blood chemistry was repeated and showed normal blood urea and serum creatinine. Through cystoscopy, we detected a perforation at the posterior wall of the bladder (Fig. 3), while both ureters were normal. Then a Foley catheter was fixed to completely drain the urine in addition to the peritoneal drain to allow the perforation to heal. The patient was put on intravenous fluid and antibiotics with monitoring of vital signs. Three days later the intraperitoneal drain nearly had no drainage and no more free fluid could be seen on ultrasound scan, therefore the tube was removed. The patient was discharged with Foley catheter in place. Two weeks later voiding cystography was performed which showed no more leak (Fig. 4) and the Foley catheter was removed. The patient was discharged home with a good health and returned to her daily life.",
"gender": "Female"
}
] |
PMC6525288
|
[
{
"age": 66,
"case_id": "PMC10338080_01",
"case_text": "This patient was a 66-year-old male farmer, who suffered from left eye swelling and pain. Six months ago, the patient developed mild blurred vision with a small amount of eye discharge. Twenty days before presenting to the hospital, the patient developed the sudden onset of swelling, pain, and blurred vision in the left eye. He was treated with intravenous amoxicillin/clavulanic acide at a local hospital but had progression of the blurred vision and distension. The patient had a history of hypertension for four years and was taking amlodipine benzoate.\nPhysical examination: There was no light perception in the left eye. Conjunctival hyperemia and corneal edema were evident. A large amount of flocculent milky white pus was seen in the anterior chamber. The texture of the iris could not been clearly seen via slit lamp examination. The examinations of corneal topography showed an abnormal corneal curvature of left eye ( Figure 1A ). The corneal endothelial cell quality detection showed that almost no intact corneal cells could be seen in the left eye ( Figure 1B ). These results meant that the cornea and eyeball of left eye were almost completely destroyed ( Figure 1 ).\nThe diagnosis was left eye endophthalmitis and left eye blindness, accompanied with progressive worsening of symptoms and lack of ocular preservation value. Left eye evisceration was performed. A large amount of milky white purulent flocs was seen during the operation, and the pus in the anterior chamber was taken for microbial smear and culture. Clear mycelium with septa and branches were observed in smear test, and grayish-white fluffy colonies were cultured in different types of medium. After surgery, erythromycin eye ointment and levofloxacin eye drops were given to control infection. The patient recovered well after surgery and was discharged from hospital on 10 January 2022. No antifungal drugs were given. No abnormalities were found during follow-up.\nPus samples were taken from intraoperative milky white purulent flocculent.\nDry leaves were cut into pieces and soaked in distilled water for 6 h and then boiled and centrifuged at 2,500 rpm for 10 min. The supernatant was filtered through a 0.22-mum sterilization filter. Natural substrate potato dextrose agar (PDA) agar medium was prepared using 20 g of dry powder of PDA medium (Beijing Tiantan Bio) dissolved in 1,000 ml of supernatant of distilled water soaked in dry leaves. Meanwhile, ordinary PDA agar medium was prepared using distilled water.\nFungal DNA extraction kit (EE101, TransGen Biotech, Beijing, China) was used to extract DNA of the isolates. Internal transcribed spacer (ITS), beta-tubulin (BT2), translation elongation factor 1-alpha (tef-1), and RNA polymerase II (RPB2) gene were amplified using PCR as follows. PCR reaction system: Taq of 0.5 mul, 2x Taq Master Mix of 25 mul, deoxynucleotide triphosphates (dNTPs) of 5 mul, upstream and downstream primers of 0.5 mul each, template DNA of 2 mul, and ddH2O of up to 50 mul. Reaction conditions: pre-denaturation at 94 C for 2 min; denaturation at 94 C for 30 s, annealing at 58 C for 30 s, extension at 72 C for 90s, cycle number 35; extension at 72 C for 7 min. The primer sequences (5'-3') were ITS1: TCCGTAGGTGAACCTGCGG and ITS4: TCCTCCGCTTATTGATATGC for ITS; T1: AACATGCGTGAGATTGTAAGT and Bt2b: ACCCTCA-GTGTAGTGACCCTTGGC for BT2; EF1-1018F: GAYTTCATCAAGAACATGAT and EF1-1620R: GACGTTGAADCCRACRTTGTC for tef-1; DRPB2-5F: GAYACNGAYGAYCGWGAYCAYTTYGG and DRPB2-7R: AANCCCATDGCYTGYTTDCCCAT for RPB2. The PCR products were identified by 1% agarose gel electrophoresis and sequenced by Tsingke Biotechnology Co (Chengdu, China).\nThe sequences were submitted to GenBank, and accession numbers were obtained (OQ658167 for ITS, OQ700917 for BT2, OQ700916 for tef-1, and OQ700915 for RPB2). Phylogenetic trees of ITS, tef-1, and RPB2 were constructed by neighbor-joining and maximum likelihood methods with 1,000 bootstrap replicates using MEGA 6.06 software.\nAntifungal susceptibility tests were performed by using the Sensititre YeastOne YO10 (CN15009V2, Thermo Scientific, Cleveland, OH, USA) according to the manufacturer's instructions. Briefly, the conidia were collected with a cotton swab, suspended in a sterile saline solution containing Tween-20, and inoculated on the drug-sensitive plate. The broth microdilution panel was incubated in a non-CO2 incubator at 35 C for 72 h. Candida albicans ATCC14053 was used as the quality control strain in this test. The minimum inhibitory concentration (MIC) values were read according to the MIC interpretation standard of Aspergillus following the kit instructions (recommended by CLSI M38 and EUCAST).",
"gender": "Male"
}
] |
PMC10338080
|
[
{
"age": 3,
"case_id": "PMC4503302_01",
"case_text": "This is a 3 year-old girl with Caucasian ethnicity with severe lipoatrophy, pulmonary hypertension, and a progeroid appearance (Fig A in S1 File). Amniocentesis was performed during this pregnancy and showed a normal fetal karyotype. Fetal ultrasound revealed bilateral pleural cavity fluid collections, thought to represent chylothorax. These resolved by the 7th or 8th month of gestation. Fetal growth rate was slow.\nDelivery was uncomplicated, by repeat C-section at term, and no fetal resuscitation was required. A chest X-ray was done for tachypnea, which revealed bilateral small pneumothoraces. This resolved spontaneously. As a neonate, she had a poor suck, and cried inconsolably while she nursed.\nAs an infant, skin findings noted on her exam included a fine reticular pattern of her skin (livedoreticularis or cutis marmorata), large anterior fontanelle, absence of subcutaneous fat, with a history of feeding problems, vomiting and failure to thrive. She was given N-G tube feedings of breast milk. Weight gain remained poor, and she did not tolerate greater than 1-oz bolus feedings. She continued to have daily episodes of projectile vomiting, in spite of thickened feedings. At 8 months of age, a feeding gastrostomy was placed and she was fed continuously. She presented with hypertriglyceridemia at age 3 months, and has had fluctuating episodes of elevated triglyceride levels and normal levels since her first test.\nHer development has been normal. She did not have seizures and was always active. Initial Neurological Examination at 7 months found that she was thin, her weight well below 5%, and her height and head circumference were between 60-75%. She had very little subcutaneous fat, livedoreticularis of the skin, prominent skin veins, a triangular appearance to her face, and a large anterior fontanelle, extending into the metopic suture.\nSubsequent examinations continued to show lack of subcutaneous fat, livedoreticularis, large and open anterior fontanelle, but no focal neurological findings. She was active, playful, interactive, and was speaking in sentences. She developed echocardiographic features of pulmonary hypertension, confirmed by catheterization. Ophthalmological examination was normal.",
"gender": "Female"
},
{
"age": 4,
"case_id": "PMC4503302_02",
"case_text": "Brain MRI done at 3 months and 8 months showed prominent subarachnoid spaces, ventricles, and Sylvian fissure, raising the possibility of cerebral atrophy. Upper GI studies were normal. Thyroid function tests, complete metabolic profile, plasma amino acids, urine organic acids, and array CGH were normal. Bone age was normal; skull X-ray showed only the large anterior fontanelle, but absence of Wormian bones. Genetic testing for Russell-Silver syndrome, mandibulo acral dysplasia were negative. Sweat chloride test was normal, and a chest CT scan was normal. Lung biopsy showed focal smooth muscle thickening of pre-acinar arterioles. At 4-years old, the patient's fasting serum leptin was 0.7 ng/mL, which is much lower than healthy 4-year old females: 1.9 (1.5-2.7).\nAverage genome sequencing depth was 39x, with 96.93% over 10x depth. Variant calling revealed a de novo frame-shift mutation in the CAV1 gene (chr7:116199282-3>delTT; NM_001172897.1:c.385_386delTT;NP_001166368.1:p.Phe129X; NM_001753.4:c.478_479delTT;NP_001744.2:p.Phe160X), previously associated with Congenital generalized lipodystrophy type 3. The mutation introduces an immediate stop into the protein. Whole genome sequencing could not reveal a second mutation in CAV1, although coverage across all exons was sufficient to detect variations. In addition, we also found a second variant of interest in a gene associated with congenital generalized lipodystrophy type 1: AGPAT2 (chr9:139581758insCAG; NM_006412.3:c.51_52insGTC; NP_006403.2:p.X18Leu; rs201504151). The variant in AGPAT2 is inherited from the father, though quite frequently present in the normal population (7.18%, exome variant server). It is unclear whether this variant contributes to any symptoms present the patient. A last interesting variant was found in lipin 1 (LPIN1), in which mutations cause a lipoatrophic phenotype in the mouse (chr2: 11927238G>A;NP_001248356.1:p.Val500Met; rs33997857). This variant has a 2.2% frequency in the population, was inherited from the mother, and is predicted damaging. The CADD scores and details of all 3 variants are listed in Table 1. All variants were confirmed with Sanger sequencing in the patient and parents. Studying mRNA extracted from the patient's whole blood revealed that both mutant and wild type CAV1 were transcribed (Fig B in S1 File), and that the RNA from the mutant allele was neither degraded by nonsense mediated RNA decay; nor was the second allele silenced by a regulatory mutation.\nOverrepresentation analysis was done to identify pathways that are dysregulated in our patient compared to 4 healthy controls, unaffected relatives from patients of our rare childhood disorder center. 1346 genes reached significance after multiple testing (FDR correction) (2.5% of total genes), 519 were recognized in a REACTOME pathway for analysis (Table A in S1 File). Most genes were found to be downregulated. Most significantly dysregulated pathways are: Translational regulation, RNA metabolism and protein metabolism and most interesting pathways are shown in Fig 1.\nIn addition, we looked at genes involved in other progeroid and lipodystrophy syndromes (Fig 2). We found that several progeroid syndrome genes are dysregulated: LMNA, ATM, RECQL4 and WRN. The gene causing Berardinelli-Seip Congenital Lipodystrophy (AGPAT2) is very significantly underexpressed (padj = 0.002; Fig 2). BSCL2, PTRF and LPIN1 lipodystrophy genes are not differentially expressed.\n129 proteins are found to interact directly with Cav1 based previous studies (NCBI gene interactions; http://www.ncbi.nlm.nih.gov/gene), and 102 of these were expressed highly enough in RNA extracted from whole blood to perform differential analysis. Of these 102, 30 were significantly different between our case and the controls (29.4%) (Table B in S1 File), and 72 (73.3%) are down regulated (Fig 2).\nCaveolins interact with a variety of downstream signaling molecules, including Src-family tyrosine kinases, p42/44 mitogen activated protein (MAP) kinase, and endothelial nitric oxide synthase (eNOS). In the Caveolin downstream pathway, we found a significant under expression of NOSIP, a modulator of eNOS. MAPK3 (p44) is underexpressed, and HCK and FGR are also significantly underexpressed (SRC-family tyrosine kinases) (Fig 2). Caveolin-1 associates with TRAF2 to form a complex that is recruited to tumor necrosis factor receptors. In this pathway, TRADD, TRAF2, TNFRSF1A and TNFRSF1B are also significantly underexpressed (Fig 2).\nProtein lysates from case and control fibroblasts were subjected to western blotting to measure protein expression of CAV1 (in triplicate). Two different antibodies were used: one that targets the C-terminus of CAV1 (and would only recognize the wild type (WT) CAV1), and one that recognized an internal epitope of CAV1 (which would recognize both WT and mutant (MT) CAV1 if expressed). All blots showed a significant decrease in expression of CAV1 compared to the control that was similar between an antibody that detected WT CAV1 only and an antibody detecting both WT + MT CAV1, suggesting MT CAV1 is not expressed or expressed at a very low level (Fig 3). In addition, fibroblasts were grown on glass coverslips, fixed and stained for localization of CAV1 and PTRF (Caveolae marker) (Fig 3). In the control, co-localization of CAV1 and the caveolae marker was perfect, however, the co-localization was not entirely fully concordant in the case (Fig 3).",
"gender": "Female"
}
] |
PMC4503302
|
[
{
"age": 77,
"case_id": "PMC9699840_01",
"case_text": "A 77-year-old woman with a history of cerebral infarction and chronic low back pain was taking antiplatelet drugs and selective serotonin reuptake inhibitors (SSRI). She had undergone magnetic resonance imaging (MRI) at another hospital 3 years before bleeding because of a headache, and an incidental tumor (volume 4.31 cm3) along the right falx cerebri had been identified. MRI showed the tumor as a well-circumscribed, slightly high-intensity area on T2-weighted images and a dural tail sign. The tumor was suspected to be a falx meningioma. The follow-up MRI 1 year before bleeding showed that the tumor had rapidly grown to 12.76 cm3. The follow-up MRI 2 weeks before bleeding showed 22.27 cm3 of volume and grown not only to the right but also to the left falx cerebri. Furthermore, MRI revealed a left flow void showing blood vessels that had moved from the median side to the lateral side due to tumor growth [Figure 1]. She was scheduled for tumor removal as MRI showed a rapidly growing tumor. However, she experienced a sudden onset of disturbance of consciousness and was transferred to our hospital before scheduled treatment. On arrival, her Glasgow Coma Scale (GCS) was 6 (E1V1M4) and the right hemiplegia was observed. She had no history of traumatic events or physical scarring. After admission, the patient presented with generalized convulsions and was administered anti-seizure medication. Computed tomography (CT) revealed left hemispheric ASDH, interhemispheric ASDH, and intracerebral hematoma extending from the left intra-/ extra-tumoral lesion. Contrast CT showed extravasation in the hematoma of the left frontal lobe. Digital subtraction angiography (DSA) performed 1 day after admission showed neither tumor staining nor abnormal vessels. In the venous phase of the bilateral common carotid angiogram, the anterior part of the superior sagittal sinus (SSS) revealed no obliteration [Figure 2].\nTumor removal and hematoma evacuation were performed 3 days after admission. First, we removed the left frontal hematoma due to an increase in dural pressure and subsequently confirmed a decrease in dural pressure. Second, we performed internal decompression of the tumor and incised the SSS and falx to block feeding arteries. Third, we dissected the tumor from the surrounding normal brain parenchyma, removed the gross total of the tumor together with the falx of the attachment (Simpson Grade I), and drained the hematoma. No clear active bleeding points or intratumoral subacute clot was found intraoperatively. Fragile and irregular vessels were attached to the tumor wall.\nThe pathological diagnosis was confirmed as meningothelial meningioma (the World Health Organization [WHO] Grade I according to the 2016 Classification of Tumors of the Central Nervous System). Postoperative CT confirmed the removal of the tumor and hematoma. Postoperative enhanced MRI revealed gross total tumor removal [Figure 3]. Her GCS score was 10 (E4V1M5) and she was transferred to a rehabilitation hospital.",
"gender": "Female"
}
] |
PMC9699840
|
[
{
"age": 38,
"case_id": "PMC9797860_01",
"case_text": "A 38-year-old woman without cardiovascular risk factors was suffering since the age of 14 from endometriosis refractory to non-steroidal anti-inflammatory drugs. At the age of 25, progesterone replacement therapy (PRT) was prescribed with a significant decrease in pain and cramps around menstruations, but worsening episodes of migraine with aura concomitantly occurred. She reported no neurologic symptoms. On neurological examination, strength, skin sensation, visual field, reflexes, and coordination were normal.\nShe was suffering since childhood from prodromal symptoms (sensitivity to light) preceding recurrent attacks of unilateral reversible visual aura and sensory symptoms (numbness) that were usually followed by intensive headache lasting up to 24 h occurring two times a week with nausea often followed by emesis with aggravation of the headaches, meeting International Classification of Headache Disorders-3rd edition for migraine aura. Tryptans did not ameliorate her headaches. T1-, T2-, T2-FLAIR, and diffusion-weighted brain magnetic resonance imaging (MRI) showed scanty focal bilateral supratentorial white matter hyperintensities (WMHs).\nPregnancy was planned and HRT was suspended. After an uneventful delivery, HRT was re-started and a severe migraine aura occurred thereafter.\nOn control MRI 1 year later, WMHs of the same size and number were identified (Figure 1) as it has been reported in shunt-associated migraine (SAM) patients.\nElectrocardiogram showed persistent sinus rhythm and incomplete right bundle branch block. Chest X-ray, computed tomography angiography (CTA), and 2D TTE/TEE color Doppler were performed resulting within normal limits. Contrast TTE/TEE using agitated saline solution showed no RLS across the interatrial septum (Figure 2, Supplementary Videos 1, 2) but conversely demonstrated bubbles arriving from left pulmonary veins to the left atrium and left ventricle via a pulmonary arteriovenous fistula (Supplementary Figure 1) in basal conditions. Contrast-enhanced Transcranial Doppler (cTCD) raised the suspicion of an extracardiac RLS by showing in basal conditions high-intensity transient signals passing through the middle cerebral artery with a delayed (17 s) \"shower\" pattern (Figure 3, Supplementary Video 2). Of note, aura migraine symptoms occurred 4 min after agitated saline injection (\"bubble migraine positive\" patient). According to the protocol of the Venice 1999 Consensus conference, the bubble count was performed twice, during normal breathing and after Valsalva strain. It is worth to mention that no evidence or family history of HHT was documented in her past medical history.\nThe decision was made by our multidisciplinary heart and brain team to offer a clinical re-evaluation in order to stratify the risk of paradoxical embolism and consequently to perform possibly a catheter-based embolization using detachable coils or vascular plugs of the isolated intrapulmonary RLS. Written informed consent, after explanation, was obtained from the patient. During the hospital stay, she was monitored for vital parameters without any abnormalities except for a slight reduction in arterial oxygen saturation (SaO2) of 94%. Continuous ECG ruled out atrial fibrillation. Right heart catheterization to evaluate hemodynamic parameters and selective pulmonary angiograms were performed in order to definitively check for an isolated PAVM and to search for accompanying malformations. Right atrial pressure, pulmonary artery pressure, pulmonary vascular resistance, and pulmonary to systemic flow ratio (QP/QS) were within normal limits. It has been impossible to cross the interatrial septum with a multipurpose catheter despite multiple attempts. Oddly, selective right and left pulmonary arteriograms did not show abnormalities of the pulmonary vasculature or arteriovenous shunts (Figure 4, Supplementary Video 3). Brachiocephalic vein angiogram ruled out the presence of persistent left superior vena cava draining into the left atrium, another possible rare cause of RLS and paradoxical embolism (Supplementary Video 4).\nThe Heart and Brain team then decided to discharge the patient on off-label thienopyridine agents (clopidogrel 75 mg die) in terms of primary prophylaxis for paradoxical embolization of thrombotic material that could bypass the pulmonary capillary filter. Surprisingly, a substantial reduction in aura migraine symptoms in our patient was achieved using P2Y12 platelet inhibition, suggesting a platelet-based trigger. HRT was advantageously resumed without migraine attacks. During 2 years of follow-up on thienopyridine therapy, the resolution of migraine aura episodes was accomplished.",
"gender": "Female"
}
] |
PMC9797860
|
[
{
"age": 85,
"case_id": "PMC5709343_01",
"case_text": "An 85-year-old man with a history of rheumatic heart disease status-post mechanical mitral and aortic valve replacements, persistent atrial fibrillation on anticoagulation, and longstanding recurrent admissions for congestive heart failure presented with progressive fatigue and shortness of breath for 3 days. He denied any fevers, or sputum production. His heart rate was 78 bpm with a blood pressure of 141/68, and an oxygen saturation of 90% on room air. Physical exam was significant for respiratory distress, jugular venous distension, bibasilar rales, decreased breath sounds at the right lung base, and warm lower extremities without edema. INR was therapeutic at 3.2 and routine chemistries and CBC were unremarkable. Chest X-ray revealed a large right-sided pleural effusion, pulmonary vascular congestion, and cardiomegaly. The patient was admitted and treated with intravenous diuretics for acute decompensated heart failure.\nOn hospital day 8, the patient remained dyspneic despite negative fluid balance. The procedure team was consulted and bedside ultrasound revealed a persistent, large right-sided pleural effusion with an apparent large loculation of fluid 6 cm from the posterior chest wall (Fig. 1, A). A diagnostic and therapeutic thoracentesis was planned. Prior to the procedure, a CT scan of the chest from two years prior was reviewed (Fig. 1, B and C). The apparent loculation of fluid seen on bedside ultrasound was determined to be a \"giant left atrium\" (15 cm x 7.2 cm), which is likely the sequela of rheumatic heart disease.\nGiven the patient's high risk of stroke from mechanical aortic and mitral valves with atrial fibrillation, his therapeutic anticoagulation was not reversed prior to thoracentesis, but coumadin had been held. A therapeutic thoracentesis was successfully performed via a posterior-lateral approach and 800 ml of clear yellow fluid was removed with improvement in patient's dyspnea. His hemodynamics and post-procedure hematocrit remained stable. His INR was 3 the morning before therapeutic thoracentesis and 1.8 the next day, which required bridging with low molecular weight heparin. Post-procedure chest X-ray showed a reduction in the right-sided pleural effusion and no pneumothorax. Fluid characteristics were consistent with a transudative pleural effusion and cytology was negative for malignant cells.\nThe availability of ultrasound at the bedside has enabled clinicians to make rapid assessments and treatment decisions at the point-of-care. Ultrasound assistance in thoracentesis has even been shown to reduce pneumothorax rates. However, this case illustrates the importance of reviewing relevant prior diagnostic imaging before a bedside procedure, even when point-of-care ultrasound is used; attempting to drain the apparent fluid loculation (the giant left atrium) could have had devastating consequences. Furthermore, this case supports the growing evidence that performing a bedside thoracentesis is safe at an INR >1.5.",
"gender": "Male"
}
] |
PMC5709343
|
[
{
"age": 5,
"case_id": "PMC9595572_01",
"case_text": "A 5 year and 4 month old boy was referred to us for polydipsia and polyuria. His blood glucose was 29.5 mmol/L, hemoglobin A1c (HbA1c) was 8.9%, and fasting C-peptide was 0.07 ng/ml. Serum anti-glutamate decarboxylase antibody and anti-islet cell antibody were both positive. He was diagnosed with T1DM at the onset. He had a history of recurrent oral mucocutaneous Candida fungi and respiratory infections after birth. At the age of 1 year, he suffered from herpetic pharyngitis with alanine transferase (ALT) 1,000-2,000 U/L, which was relieved by anti-infective and liver-protecting treatment. Increased ALT levels occurred several times after infection. A left under axillary abscess incision and drainage was performed when he was 3 years and 8 months old. He was the first child of non-consanguineous parents without any family history of hereditary diseases.\nPhysical examination showed the weight was 18 kg (25th percentile), and the height was 110 cm (25th percentile). The blood pressure was normal. He was conscious, his thyroid and cardiopulmonary systems were normal, and there was no evidence of an enlarged lymph node. The liver is 4 cm under the right rib, and the spleen is 5 cm below the left rib, with blunt edges, and there is no swelling in the lower limbs.\nLaboratory investigation revealed normal blood routine analysis, thyroid function, immunoglobulin A (IgA), immunoglobulin M, immunoglobulin G, ammonia, lactic acid, blood amino acids, acylcarnitine, and urine organic acid analysis. The level of aspartate aminotransferase was 100 U/L, ALT was 16.2 U/L. Hepatophilic virus antibodies [anti-cytomegalovirus-immunoglobulin M (CMV-IgM), anti-Epstein-Barr virus (EBV)-IgM, hepatitis A/B/C/E virus antibodies] and autoimmune liver disease antibodies were negative. The thyroglobulin antibody, thyroid peroxidase antibody, and thyroid-stimulating hormone receptor antibody were negative. The percentage of CD4 lymphocytes was 21%, CD8 lymphocytes was 45%, and CD4/CD8 was 0.46, which indicated immunodeficiency, the detailed laboratory information was shown in Table 1.\nWES identified a heterozygous de novo STAT1 mutation in the child, c.866A > G, p.Y289C, which was further confirmed by Sanger sequencing (Figure 1). It was previously shown to be a GOF mutation and was defined as pathogenic according to criteria published by the American College of Medical Genetics and Genomics (ACMG). The child was corrected diagnosed with monogenic autoimmune diabetes.\nBased on the presence of CMC, immunodeficiency, autoimmune diabetes, and autoimmune hepatitis, as well as genetic results, the boy was diagnosed with syndromic CMC that was caused by a heterozygous GOF mutation of STAT1.\nUpon admission, he was given rapid-acting insulin with meals and long-acting insulin at bedtime, with a total amount of 1.27 IU/kg/d, with blood glucose levels of 6-7 mmol/L before meals and 6-12 mmol/L after meals. During the follow-up, he was given oral antifungal therapy of fluconazole (75 mg/d) and intravenous injection of human immunoglobulin once a month for candidiasis and recurrent infections.",
"gender": "Male"
},
{
"age": 8,
"case_id": "PMC9595572_02",
"case_text": "As of now, he was 8 years old and his insulin dosage was 1.1 IU/kg/d. Even under fluconazole therapy, he developed oral mucocutaneous Candida fungi twice every month, but he did not develop recurrent viral or bacterial infections. He was given antituberculosis drugs (isoniazide, rifampicin) for tuberculosis infection. The liver function was normal at the last follow-up, and the HbA1c was 6.5%. Ruxolitinib was recommended to the patient's parents, but they refused because of concerns about side effects.",
"gender": "Male"
}
] |
PMC9595572
|
[
{
"age": 45,
"case_id": "PMC5958580_01",
"case_text": "A 45-year-old female patient with no known previous medical and psychiatric history was referred to a psychiatric clinic for abnormal behavior. She initially had symptoms of depression, including social withdrawal, fatigue and hypersomnia, with loss of interest in her work and her family. She was brought to multiple traditional healers. No medical treatment was sought. After 6 months, her symptoms worsened, whereby she was noted to have developed childish behavior and was unable to take care of herself. She also had become forgetful with poor insight. There was no history of head trauma or any focal neurological deficit. There was no history of psychiatric illness in her family. She never smoked or consumed alcohol and was not on any illicit drugs.\nOn examination, she was found to be oriented to time, place, and person but had poor attention and concentration with poor judgments. Her Mini-Mental state examination score was 21/30. She weighed 70 kg. Her blood pressure was 125/70 mmHg, with a pulse rate of 80 beats/min. A fundoscopy examination showed bilateral papilloedema. Neurological examinations, including cranial nerve and other systemic examinations, were all unremarkable. Her blood test results, including hematological and biochemical parameters, were normal.\nA contrast-enhanced computed tomography (CECT) of the patient's brain was performed, and the findings showed a well-defined markedly enhancing lesion in the frontal region that measured 5.5 cm x 5.2 cm x 4.4 cm compressing on the adjacent brain parenchyma with an associated marked surrounding edema. These features are in keeping with a bifrontal tumor - olfactory groove meningioma [Figures 1 and 2]. A bifrontal craniotomy and tumor excision were performed after the patient was referred to the Department of Neurosurgery. Two months postsurgery, the patient was referred to neuropsychology for a neuropsychological assessment. Her symptoms resolved after the surgical treatment, and her quality of life also significantly improved.",
"gender": "Female"
}
] |
PMC5958580
|
[
{
"age": 35,
"case_id": "PMC5096402_01",
"case_text": "The patient is a 35-year-old Caucasian female who first presented in 1988 at the age of 11 with cramping abdominal pain associated with watery, non-bloody diarrhea during a trip to the southern United States. Her mother experienced similar symptoms at that time, and so a self-limited infectious etiology was presumed. The patient at that time had a personal history of bacterial upper respiratory infections and scarlet fever. Her family history is significant for hypertension and dyslipidemia (father) and myocardial infarction at age 52 (paternal grandfather). The patient's abdominal pain led to an extensive GI work-up in 1989 revealing normal upper and lower endoscopic biopsies, a normal hepatobiliary iminodiacetic acid (HIDA) scan, normal fecal cultures for bacteria, ova, and parasites, a negative study for lactase deficiency, and unrevealing serology for auto-immune disease. An HIV test and screen for cystic fibrosis were negative. Laboratory screening for thyroid function, copper, ceruloplasmin, gastrin, and porphyrin levels was also unrevealing. The patient did have significant dyslipidemia in 1989 as follows: total cholesterol 406, LDL 356, HDL 16, VLDL 41, and triglyceride 206. Additional lab work indicated ApoA1 was 63 mg/dL (normal > 140) and ApoB was 162 mg/dL (normal < 130). Liver function tests in 1989 were also abnormal as follows: AST 74, ALT 134, ALP 196. The patient continued to suffer from frequent GI upset and increased bowel motions with pediatric growth charts indicating a failure to thrive. A decision was made to start the patient on cholestyramine with a low-fat diet which showed some improvement in her lipid profile as indicated in Figure 1A. When hepatomegaly was appreciated in 1990, a liver biopsy led to a suspected diagnosis of a glycogen storage disease, and she was started on cornstarch. Cholestyramine was discontinued, but then re-started shortly after it was discovered she still had marked dyslipidemia. A second liver wedge biopsy performed in 1990 showed a non-specific storage disease of a lipid nature and, ultimately, deficiency of lysosomal acid lipase (LAL) confirmed the disorder to be CESD.\nThe patient was managed initially by a pediatric gastroenterologist until it was believed that her GI symptoms were unrelated to her dyslipidemia, and then a pediatric cardiologist assumed care for the patient. A modified Bruce exercise stress test was completed in 1992 (age 15), which was negative for inducible ischemia, and carotid duplex imaging showed only mild, non-obstructive disease. The patient was, then, started on atorvastatin 20 mg daily and aspirin 325 mg daily, which remained her treatment regimen for years, until it was changed to rosuvastatin 40 mg in 2009. The patient's lipid profile (Figure 1A) and liver function tests (Figure 1B) are indicated graphically at the time of diagnosis and throughout the evolution of her treatment regimen.",
"gender": "Female"
}
] |
PMC5096402
|
[
{
"age": 0,
"case_id": "PMC5360091_01",
"case_text": "A 9-day-old normal spontaneous vaginal delivery full-term male infant was referred to our institute from a regional hospital as a case of chronic heart disease. After birth, he was diagnosed ultrasonically with persistent truncus arteriosus, atrial septal defect, and a perimembranous ventricular septal defect. The patient was stabilized and then discharged on anti-heart failure medications. Two days later, he was readmitted as a result of cyanosis.\nOn examination, the patient was found to have dysmorphic features and hypocalcemia, in addition to the congenital cardiac anomalies described earlier. Further tests were performed, and he was found to have DiGeorge syndrome, as well as cholestasis and jaundice. The patient was started on ursodiol (ursodeoxycholic acid), oral feeding with Similac 20 (Abbott, Ill), and synchronized intermittent mandatory ventilation with pressure control and support.\nAt the age of 27 days, the patient was found to have developed a small localized swelling on the dorsum of the right hand. It was initially thought to be an injury caused by intravenous cannulation. The mass persisted for 2 weeks and then the infant became febrile and the right hand dorsal swelling became erythematous and hot to touch. Cellulitis was suspected; thus, empiric treatment with morphine, meropenem, vancomycin, and colistin was commenced by the primary team while the septic workup was being undertaken.\nThree days later, the plastic surgery service was consulted on the slowly growing swelling on the back of the hand. The plastic surgeon's examination revealed a small area of fluctuation over the mass. An ultrasound scan was ordered, and aspiration of the swelling was done and the fluid was sent for gram staining, culture, and sensitivity testing. Silver sulfadiazine cream and dressings were ordered to be applied to the wound twice daily until such time as the results of investigations were apparent. Ultrasound assessment of the hand revealed soft-tissue swelling and calcification.\nOn the next day, an x-ray film was obtain and the image exhibited a central area of calcification within the swelling as well. Moreover, results of blood and fluid cultures were inconclusive and found no organisms; antibiotic treatment was discontinued. However, silver sulfadiazine cream application was continued but reduced to once daily, and the hand was kept elevated. The swelling on the dorsum of the hand reduced gradually over the following few days, and dressing protocol was continued. A week later, however, at the age of 51 days, the swelling increased in size once more. Aspiration was conducted a second time, and the fluid sent for staining and culture, which proved to be negative again. Blood investigations did not yield any insight into the cause of the patient's condition either. It was at this juncture when the diagnosis of HO was considered. No further treatment was ordered except for frequent monitoring to rule out superimposed infection and cellulitis.",
"gender": "Male"
}
] |
PMC5360091
|
[
{
"age": 0,
"case_id": "PMC4941117_01",
"case_text": "A 6 month old infant brought to the emergency room in the King Fahad Specialist Hospital-Dammam, Saudi Arabia with cough, fever, difficulty breathing, sneezing, irritation, excessive crying, decreased oral intake, and cyanosis. He had been diagnosed with infantile nephrotic syndrome 5 months earlier. In his past medical history, he had several episodes of septicemia caused mainly by Pseudomonas aeruginosa. In addition, he was previously on multiple courses of antibiotics including meropenem, ceftriaxone, and vancomycin. He was intubated and ventilated. Blood specimens revealed mild neutrophilia and elevated CRP. Blood culture and urine culture were negative. Chest X rays revealed left sided pleural effusion with left lower lobe opacities. Several respiratory specimens from endotracheal tube (ETT) were submitted to the microbiology laboratory for culture. Round yellow pigmented non hemolytic colonies grew on blood agar plates. Gram stain revealed Gram negative bacilli. The organism was catalase and oxidase positive. Organism identification and antimicrobial susceptibility testing were carried out using the Vitek 2 automatic system (bioMerieux, Paris, France) according the manufacturer's instructions. E. coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 strains were used as controls for the antimicrobial susceptibility testing. There are no Clinical and Laboratory Standards Institute (CLSI) guidelines specific for Chryseobacterium species. However, minimum inhibitory concentrations (MIC) and breakpoints were determined according to the CLSI recommendation for other Non-Enterobacteriaceae. The organism was identified as Chryseobacterium gleum and it was confirmed using API20NE kit and 16 S rRNA sequencing. The organism was resistant to ceftazidime (MIC >= 64 mug/mL), cefepime (MIC >= 64 mug/mL), meropenem (MIC >= 16 mug/mL), piperacillin-tazobactam (MIC >= 128 mug/mL), colistin (MIC >= 8 mug/mL), gentamicin (MIC >= 16 mug/mL), and amikacin (MIC >= 64 mug/mL). It was intermediate to imipenem (MIC = 8 mug/mL), ciprofloxacin (MIC = 2 mug/mL), and tigecycline (MIC = 4 mug/mL). The organism was susceptible to trimethoprim-sulfamethoxazole (MIC <= 20 mug/mL), minocycline (MIC <= 1 mug/mL), and levofloxacin (MIC = 0.5 mug/mL). In addition, the isolate was resistant to vancomycin. Environmental samples from the mechanical ventilator and the patient room did not grow any Chryseobacterium isolate. Chryseobacterium was tested for the presence of carbapenem resistant genes (OXA48, NDM1, IMP, VIM, CTX-14, CTX-M15, and KPC) by multiplex PCR methodology using ARM-D for beta-Lactamase ID kit (Streck, Omaha, NE, USA) as instructed by the manufacturer. Positive controls and an internal control are included in the kit. In addition, molecular grade water (Promega, WI, USA) was used as a negative control to detect contamination. None of the tested genes was detected by PCR. The patient improved on levofloxacin for a period of 16 days and subsequent respiratory specimens did not grow C. gleum. Neither trimethoprim-sulfamethoxazole nor minocycline was used since they were not available in hospital at time of treatment.",
"gender": "Male"
}
] |
PMC4941117
|
[
{
"age": 41,
"case_id": "PMC4353120_01",
"case_text": "The proband, a 41-year-old man, was referred to the Neurology Department of Xuanwu Hospital with hemiparesis, dysarthria, and mild cognitive deficits. At 31 years of age, the patient experienced a slight weakness in the left leg that included numbness, which resulted in gait problems that did not interfere with a normal lifestyle. Over the next four years, symptoms progressively worsened and led to weakness in the left leg. Simultaneously, the right leg became weak and numb, and urinary retention and urgent micturition ensued, which persisted to time of the study. Over the last two years, the left hand became uncoordinated and mild dysarthria developed. Since then, the patient experienced mood disorders, as well as involuntary and frequent crying spells. The patient exhibited slight cognitive impairment over a ten-year period, which interfered with employment status, social interactions, and daily life. The patient did not suffer from migraine headaches during this period.\nPast medical history revealed right central retinal artery occlusion and retinal hemorrhage at age 33, which was surgically treated. However, right-eye vision was also lost at time of study. There was no family history of diabetes, hypertension, or hypercholesterolaemia. Seven members in his family experienced similar syndromes (Table 1, Figure 1).\nNeurological examination revealed normal vital signs, slight dysarthria, loss of vision, and direct and indirect light reflexes in the abducted right eye, with a 5-mm dilated pupil. Fundoscopic examination revealed optical nerve atrophy. Left-eye visual acuity and fields remained intact. Muscle mass was within normal limits. Strength was 4+/5 in the left leg, 5-/5 in the left arm and right leg, and intact in the right arm. Deep tendon reflex was significantly increased, in particular on the left side. Extensor plantar responses were elicited on both sides. Gait was hemiparetic, with poor bilateral coordination. Patellar and ankle clonus was bilaterally present. Brown hemochromatosis and hypesthesia were noted on calf areas of both legs (supplementary Figure 2 online). Remaining physical examinations were unremarkable.\nComplete blood count, tests of hepatic and renal function, and measurements of lipoprotein A, electrolytes, glucose, thyroxine, vitamin B12, antinuclear antibodies and rheumatoid factor were all within normal limits. Serological examination for syphilis, human immunodeficiency virus, and tumor markers were negative. No abnormalities were found on cerebrospinal fluid analysis.\nPrevious brain computed tomography (CT) and MRI results revealed multiple infarctions, as well as multiple abnormal signals and bilateral pontine atrophy in the head MRI. Hyperintense signals were noted in the corpus pons, genu of the callosum, left basal ganglia, corona radiate, and semiovale centrum on T2-weighted images, as well as symmetrical high signals in the bilateral temporal lobes (Figures 2A, B, D). A fluid-attenuated inversion recovery sequence revealed diffuse hyperintense signals in the subcortical and deep white matter (Figure 2C). Diffusion sequences produced negative results.\nA sural nerve biopsy was performed and the glutaraldehyde-fixed tissue was examined by transmission electron microscopy, revealing granular osmophilic material (GOM) deposits in the extracellular matrix adjacent to and within smooth muscle cells of dermal arterioles. The deposits were variable in size; the largest measured approximately 0.4-0.6 mm (Figure 3). Screening exons 2-4 for mutations of NOTCH 3 by direct sequencing produced negative results.",
"gender": "Male"
}
] |
PMC4353120
|
[
{
"age": 65,
"case_id": "PMC6362694_01",
"case_text": "Hallux valgus is the most common forefoot deformity presenting to foot and ankle surgeons, often accompanied by foot pain and severe functional constraint. The global prevalence, as described in the international literature, is 23 % in 18 to 65 year old patients and up to 35 % in elderly over 65 years of age. It has been widely reported, that women are more often affected than men - there are female / male ratios reported up to a level of 15:1. The valgus deformity can be caused by multiple exogenous and endogenous factors such as wearing of tight and high-heeled shoes or genetic predisposition. Diagnosis of hallux valgus is achieved by clinical examination. A plain radiograph of the weight bearing foot is required additionally. There still is no consensus about which clinical and radiographic findings lead to the indication of which method of operative correction of hallux valgus. \nWe report our experience with special regard to the correlation of radiographic findings and resulting method of operative correction of the valgus deformity by developing a schema that helps to determine the correct indication.",
"gender": "Female"
}
] |
PMC6362694
|
[
{
"age": 16,
"case_id": "PMC9970259_01",
"case_text": "Case 1 is a 16-year-old male who presented with well-controlled type 2 diabetes, obstructive sleep apnea (OSA), severe obesity, and acute onset severe back pain with limited mobility. Initial biochemical evaluation was concerning for acute lymphocytic leukemia (ALL), requiring magnetic resonance imaging (MRI) to determine staging and appropriate treatment. However, due to limitations of the MRI machine at the pediatric center, the patient was unable to obtain imaging secondary to body habitus presenting a significant diagnostic challenge. The obesity medicine team was consulted for assistance with acute weight loss to promote ability for accurate diagnosis, prognosis, and initiation of an appropriate treatment regimen for his oncologic process. The patient was admitted to inpatient rehabilitation for two weeks. On admission, his type 2 diabetes was controlled with insulin and metformin and he had a hgA1c of 6.4. However, due to worsening hepatotoxicity, his Metformin was discontinued. Given his new onset AL.L and concern for chemotherapy induced pancreatitis, the oncology team did not feel comfortable starting a glucagon-like peptide 1 (GLP-1) medication. Interventions included placing the patient on the institutional inpatient obesity protocol including: (1) intake with a registered dietitian; (2) dietary composition: 1,500 calorie per day, less than 150 grams of carbohydrates, no sugar-sweetened beverages, 35 grams of fiber, 32 ounces of water; (3) structured mealtimes (3 meals and 2 snacks); (4) daily physical therapy as tolerated; (5) initiation of weight loss medications (phentermine 15 mg daily). One week after initiation of this protocol, his weight was down trending and he was tolerating phentermine without side effect. Given lack of side effects but increasing hunger with goal of continued weight loss in efforts to obtain an MRI, his phentermine was increased to 37.5 mg daily and dietary program intensified to 1,200 calories and less than 100 grams of carbohydrates daily. At admission, his weight was at 190% BMIp95 (Figure 3). Upon discharge and after two weeks after initiation of his individualized weight-management plan, it decreased to 175%BMIp95 and his hgba1c improved to 6.0. He also reported decreased appetite and no side effects throughout his treatment. He continued his outpatient weight-management program with monthly virtual visits with obesity medicine specialists and dietitian. One month after discharge, his %BMI95 had decreased to 165% BMIp95, and by month six, to 160% BMIp95 (associated with a total BMI reduction of 4.85 kg/m2 and BMI z-score reduction of 0.12 standard deviations).",
"gender": "Male"
},
{
"age": 15,
"case_id": "PMC9970259_02",
"case_text": "Case 2 is a 15-year-old male with Prader-Willi Syndrome, class III obesity, impaired fasting glucose, hypertriglyceridemia, and obstructive sleep apnea (OSA) controlled on continuous positive air pressure (CPAP) admitted for acute respiratory failure and placed on a ventilator. Patient had a history of excessive weight gain due to hyperphagia associated with significant anxiety exacerbated by the Covid-19 pandemic. Outpatient, he was taking Metformin 1,000 mg twice daily and Topiramate 100 mg nightly for off-label weight control. Family had completed three, intensive outpatient lifestyle modifications programs and set up a food safe zone (locked cabinets and food storage units) with limited success. Upon admission, he had a 40-pound gain since his last outpatient encounter four months prior and his respiratory function had worsened significantly in response to this weight gain with blood gases demonstrating carbon dioxide retention levels in the upper 70s. He underwent extensive evaluation for hypertension, cardiac dysfunction, and worsening obstructive sleep apnea and his acutely worsened respiratory status was thought to be largely secondarily to his weight gain. This evaluation included a normal electrocardiogram, echocardiogram and renal ultrasound. He underwent a polysomnography which was abnormal due to breath stacking, hyperventilation, and hypoxemia for which his CPAP machine was adjusted. He also had a number of screening labs during his hospitalization with normal thyroid function (TSH 2.62 uIU/ml, T4 7.5 mcg/dl), free cortisol (0.18), ACTH (21) hgbA1c (5.3%), lipid panel (triglycerides 94, total cholesterol 150). Notably he had low testosterone (Free 2.09 ng/dl, total 83 ng/dl), LH (0.31 mIU/mL), FSH (<0.66 mIU/ml), IGF-1(26 ng/ml) and IGF-BP3 and (0.8 mg/L) ultimately started on 100 mg Testosterone supplementation.\nThe obesity medicine team was consulted by pulmonology to address diagnostic and treatment challenges by supporting acute weight loss interventions while inpatient. This was in an effort to optimize respiratory control for ability to discharge home. The personalized intervention for this patient included placing him on the institutional inpatient obesity protocol including: (1) intake with a registered dietitian; (2) dietary composition: 800 calories daily, less than 90 grams of carbohydrates, no sugar-sweetened beverages, 35 grams of fiber, 32 ounces of water; (3) structured mealtimes (2 meals and 2 snacks); (4) daily physical therapy as tolerated; (5) optimization of weight loss medication regimen (topiramate increased to 200 mg nightly and initiation of semaglutide 0.25 mg weekly). He remained admitted to the rehabilitation unit for one month, during which, his %BMIp95 decreased from 313% to 300% BMIp95 (Figure 3). At the same time, his ventilatory needs decreased with successful transition to continuous positive airway pressure (CPAP) overnight and oxygen by nasal cannula during the day, allowing for safe discharge home. He reported no side effects from the medications during this time period. Given lack of side effects and meeting goal of decreasing respiratory support, no further medication changes were made inpatient. Upon discharge, he was enrolled in the outpatient weight-management program and attended monthly visits with obesity medicine specialists and dietitian. Two and a half months after discharge, his weight had decreased to 297% BMIp95 (associated with a total BMI reduction of 1.2 kg/m2 and BMI z-score reduction of 0.01 standard deviations). His triglycerides and hgba1c were stable at 94 and 5.3% respectively at this time and Testosterone increased with injections.",
"gender": "Male"
},
{
"age": 6,
"case_id": "PMC9970259_03",
"case_text": "Case 3 is a 6-year-old male with history of a parapharyngeal desmoid tumor resected in June 2019, who had subsequent weight gain of 20 kg over the next two years in association with the Covid-19 pandemic. He was getting serial MRIs with sedation for tumor monitoring, which required admission for respiratory support in the context of his obesity. The obesity medicine team was consulted by oncology and anesthesiology to support acute weight loss interventions while inpatient in an effort to minimize airway risk with his recurrent sedation needs. He was placed on the institutional inpatient obesity protocol including: (1) intake with a registered dietitian; (2) dietary composition: 1,200 calories daily, less than 100 grams of carbohydrates, no sugar-sweetened beverages, 35 grams of fiber, 32 ounces of water; (3) structured mealtimes (3 meals and 2 snacks); and (4) thirty minutes of moderate intensity physical activity daily. One challenge the obesity medicine team faced during the goal of acute weight loss was parental preference not to start anti-obesity medications. He did continue to have normal Hgb A1c (5.1-5.2%) as well as normal lipid panel (triglycerides 74, total cholesterol 161) but elevated alanine aminotransferase and aspartate aminotransferase of 62 and 48 respectively. He remained admitted to the rehabilitation unit for one week with associated weight stabilization. Upon discharge, he was enrolled in the outpatient weight-management program and met with obesity medicine specialists and a dietitian monthly. Five months after discharge, his weight had decreased from 195% BMIp95 to 175% BMIp95 (Figure 3).",
"gender": "Male"
}
] |
PMC9970259
|
[
{
"age": 35,
"case_id": "PMC8826099_01",
"case_text": "In the morning of 8 May, a 35-year-old man was admitted to the emergency department complaining of episodes of pressure pain behind the sternum, lasting from 2-5 min to 1 h; the pain radiated to the left upper limb, arose after gardening works and persisted both at rest and during moderate physical exertion.\nIt is known from the anamnesis that, since April 2019, the patient had complaints of blurred vision; the patient was observed by an ophthalmologist with a diagnosis Serpiginous Choroiditis of both eyes. He was initially received pulse therapy with glucocorticoids (methylprednisolone in a cumulative dose of 1000 mg); then, he administrated methylprednisolone at a dose of 4 mg/day per os. On 20 April, the patient noted weakness, fever up to 38 C, nasal congestion, anosmia, dry cough, and chest congestion. The repeated polymerase chain reaction (PCR) test for 2019-nCoV was positive. The patient was hospitalized at the clinic for patients with COVID-19, where he was staying from 21 April to 3 May 2020, with a diagnosis of Coronavirus disease 2019 (mild case), nasopharyngitis. During hospitalization, computed tomography (CT) scanning of the chest was performed, according to which no pathological changes were detected. In the course of hospitalization, there was a moderate increase of C-reactive protein (up to 12.5 mg/L, reference values:up to 8.0 mg/L). During hospitalization for COVID-2019, the patient received hydroxychloroquine and clarithromycin.\nIt is also known from the anamnesis that the patient has no established cardiovascular diseases. Among cardiovascular risk factors were active smoking for 26 years (20 cigarettes/day), overweight (height = 171 cm, weight = 85 kg, body mass index (BMI) = 29.1 kg/m2). The patient denied the use of psychoactive substances (cocaine, etc.).\nOn admission to the emergency department on 8 May, according to objective examination, the parameters were as follows: blood pressure = 126/78 mm Hg, heart rate = 84 beats per minute, respiratory rate = 18 per minute, additional respiratory sounds in the lungs were not auscultated, saturation (on room air) = 99%. On admission, a high-sensitive cardiac troponin was within the reference values. The patient was given loading doses of acetylsalicylic acid, clopidogrel, and heparin. The electrocardiogram (ECG) on admission is shown in Figure 1.\nTaking into account the clinical picture of ACS with ST segment elevation, the patient underwent coronary angiography. A linear dissection of ramus intermedius (RI) was established over 20 mm with stenosis of the lumen up to 80% in diameter against the background of thrombolysis in myocardial infarction (TIMI) 3 blood flow in all coronary arteries (Figure 2).\nIt was decided to stent RI dissection area with a drug-coated sirolimus stent. TIMI 3 blood flow on control angiograms is shown in Figure 3. The results of laboratory tests are presented in Table 1.\nSubsequently, the patient received therapy consistent with the clinical recommendations, including triple antithrombotic therapy using acetylsalicylic acid, clopidogrel, and infusion of unfractionated heparin intravenously.\nAt 7:20 p.m. of the same day, in the intensive care unit, the patient again had anginal pain syndrome without significant effect from nitroglycerin; the pain was relieved with morphine. ECG was performed (see Figure 4).\nGiven the appearance of ST segment elevation in the leads from the inferior wall of the left ventricle, the patient underwent repeated angiography (see Figure 5).\nIt was established that the stented segment and other sections of the left coronary artery (LCA) had no stenosis. Blood flow along the right coronary artery (RCA) TIMI 0-1 with occlusion in the distal section. Also, stenosis of the initial and middle sections of the RCA was detected (up to 60%-75%) over the entire length according to the type of possible spasm in comparison with the initial coronary angiograms. After two injections of contrast into the RCA and 2.0 mL of a 0.01% solution of nitroglycerin, recanalization was observed with the restoration of the initial caliber of the artery with visualization of linear dissections throughout the initial and middle sections. According to the control angiography, after 15 min (see Figure 6), a decrease in the length of the dissected segment in the initial and middle sections of the RCA and posterior lateral branch of the RCA was established. Taking into account the TIMI 3 blood flow, extended lesions of the RCA, and the posterolateral branch of the RCA, spontaneous positive dynamics in relation to this dissected segment, conservative management were applied.\nOver the next 72 h, the patient's condition remained stable, and chest pain did not recur. In the morning of 14 May, the patient again felt a pain behind the sternum, lasting up to 10-15 min and stopping on its own. ECG was performed, and found that there were no significant dynamic changes from previous ECGs (see Figure 7).\nIt was decided to conduct control angiography. It was detected that there was no change either in the RCA or the posterolateral branch of the RCA in comparison with the previous examination. The stented segment of the RI LCA was passable; however, in one of the RI branches, immediately after its bifurcation, stenosis of up to 85% in diameter with a length of 20-25 mm was detected, which was absent in the previous two angiograms (see Figure 8). With intracoronary administration of 2 mL of 0.01% nitroglycerin, there were no changes in the degree of stenosis in the affected artery.\nSubsequently, anginal pain did not recur. The patient was discharged from the clinic on 20 May 2020. Written informed consent has been obtained from the patient for publication of the case report and accompanying images.\nIt should be noted that, during the hospitalization, the patient was consulted by a rheumatologist. Additional examinations were performed (antinuclear antibodies, HLA-B27 test, rheumatoid factor, antibodies to beta2-macroglobulin:all tests were negative), which allowed the rheumatologist to exclude the presence of chronic systemic inflammatory disease. CT of the chest in dynamics from April 2020 was also performed, which also showed no pathological changes (see Figure 9).",
"gender": "Male"
}
] |
PMC8826099
|
[
{
"age": null,
"case_id": "PMC7931941_01",
"case_text": "Typical data mining models train on data collected in the past, and then are used to make decisions about the future. If there are historical inequalities inherent in the training data, they will be perpetuated, and possibly even exacerbated by our predictive model. Skewed training data can lead to better accuracy for some groups vs. others. We discussed the example of gender stereotypes encoded in word embeddings used in natural language processing (Bolukbasi et al.,), and the example of facial recognition tools trained on majority white, male faces (Buolamwini and Gebru,). These examples demonstrate cases where fairness research had a real world impact, as these papers have prompted companies to improve facial recognition software, and the development of bias mitigation techniques for text analysis. We discussed questions to consider when developing/applying new method, e.g., \"Who will use this technology, and will it work equally well for everyone?\" and \"Is my dataset representative of all groups?\"\nThe learning objectives of the tutorial are to examine some examples of structural inequality in society that is buttressed by data mining practices including developing ways to recognize ways in which unfair bias might be introduced into a data mining pipeline. Because vulnerable populations are often placed in the position of being whistleblowers for structural inequalities, we discussed how to perform analyses to verify whether a predictive model is fair or unfair and what outcomes should be considered when developing data mining techniques beyond accuracy. To address these concerns we have to develop tools to democratize the development of data mining techniques and technologies using open and transparent methods with clearly reproducible findings. This tutorial demonstrates one approach to doing this [i.e., with interactive Jupyter notebooks (Kluyver et al.,)] and give students hands-on experience with open software tools.\nThe Algorithmic Fairness for Vulnerable Populations tutorial steps through a typical data analysis pipeline. First the data is cleaned and preprocessed according to the steps taken in the ProPublica analysis. Then a number of statistical and visualization methods are applied to allow participants to assess the attributes in the training dataset and understand whether there is any unfair bias present. Finally, three notions of group fairness are introduced, covering state-of the-art bias detection metrics from the recent literature:\nDisparate Impact. This legal concept is used to describe situations when an entity such as an employer inadvertently discriminates against a certain protected group. This is distinct from disparate treatment where discrimination is intentional. To demonstrate cases of disparate impact, the Equal Opportunity Commission (EEOC) proposed \"rule of thumb\" is known as the 80% rule.\nCalibration. This statistical test was used to verify the fairness of the COMPAS model by the company Northpoint that created the tool. The basic idea behind calibrating a classifier is to have the confidence of the predictor reflect the true outcomes. In a well-calibrated classifier, if 100 people are assigned 90% confidence of being in the positive class, then in reality, 90 of them should actually have had a positive label. To use calibration as a fairness metric we compare the calibration of the classifier for each group.\nEqualized Odds. The last fairness metric we consider is based on the difference in error rates between groups. The equalized odds criterion (Hardt et al.,) proposes to look at the difference in the true positive and false positive rates for each group. This aligns with the analysis performed by ProPublica.\nThe goal of this tutorial's implementation was to allow for hands-on analysis right away, without requiring any heavy overhead from installing many tools or having to clean and pre-process the data. At the same time, all analysis was fully transparent and available for experimentation. Participants could step through the notebook and simply follow along, or dig deeper and edit the code directly to experiment with the data. Suggestions for possible further experimentation are provided throughout. Links to datasets, research papers, Wikipedia entries, and Python data mining tools provide context and avenues for deeper investigation into the topics and methods described. A clear outcomes was that trainees who undertook the data manipulation and assessment felt empowered to identify the limitations of data resulting from structural inequalities and to identify mechanisms to address those biases in data.\nIndigenous communities represent a classic example of a vulnerable population for whom territorial rights, educational attainment and health status are all under stress. Nevertheless, they remain a subject of keen genomic interest to western scientists. Unfortunately, these largely one-sided cross cultural scientific interactions between Indigenous populations and European ancestried scientists have long been steeped in misunderstanding and mistrust. Cases like the Havasupai Nation's inclusion in stigmatizing mental health research against their will have helped to drive many Indigenous peoples to reassess their willingness to work with non-Indigenous scientists (Garrison,). The development of novel large scale data generation tools have emphasized the voluntary exclusion of Indigenous populations and the paucity of data upon which to gain meaningful insights on Indigenous communities' health and well-being.\nThe utility of data analysis has been readily adopted by human geneticists, who have willingly accepted the tools of big data to better understand the features of the genome including variable sites across the genome, chromosomal arrangements, and population level variation.\nThis pursuit of ever increasing data has lead to breakthroughs in ancestry assessments, multi-omic precision medicine models and has spurred molecular breakthroughs like the Crispr-Cas9 system of gene editing. Crispr-Cas9, most recently made infamous by the ethically condemned modification of Chinese twins (Schmitz,).\nWhile genome sequencing is a great tool for identifying genetic variation that might be involved in disease mechanisms, correlation does not equal causality. Gene editing tools offer the population geneticists the opportunity to identify population-specific variation derived from large scale sequencing experiments and to conduct further assessment of the functional significance of genome sequence variation, thus potentially identifying the changeable sites underlying traits or disorders. For example, gene editing technologies can be used to investigate population-specific, positively selected point mutations implicated in a range of diseases (Komor et al.,). In addition to using these tools that are already in existence to functionally investigate individual variants in clonal cell lines, multiple laboratories have begun to develop new editing tools to simultaneously introduce multiple mutations in the human genome via multiplex nucleotide editing of population specific haplotypes under selection, or multiple point mutations on different chromosomes in human genome.\nEngineering new tools to functionally investigate single nucleotide changes is an exciting prospect for two primary reasons: (A) Creating accountability. Culturally competent empirical evidence and detailed theoretical considerations should be used for evolutionary explanations of phenotypic variation observed in humans (especially Indigenous populations). Population genetics investigators frequently overlook the importance of these ethnographic criteria when associating observed trait variation with evolutionary analysis. Functional investigation of population specific variation has the potential to empower the population genetics community by holding evolutionary explanations accountable (Gould and Lewontin,). This need for mechanistic insight is framed by problematic narratives and exacerbated by correlation based studies that fail to properly functionally investigate single nucleotide changes. Because Indigenous populations are vulnerable (i.e., at risk populations), it is the genomic technology development community's responsibility to take these potentially problematic narratives to task (Neel,). Not to just reclaim Indigenous history through the population genetics projects we champion, but potentially empower Indigenous history with genome editing tools. (B) Democratizing tools. Indigenous peoples are under-represented in both population-based genomic studies, and as primary investigators in academia. For Indigenous researchers, this leads to questions as to how Indigenous peoples will meaningfully participate in human population genetics, and how to address the disparities currently existing in Indigenous communities? One way that Indigenous scientists are addressing this is the formation of an educational consortium that is focused on educating Indigenous genetics, such as the Summer Internship for Indigenous Peoples in Genomics (SING Consortium). This research consortium works with Indigenous communities to generate large scale data to address the genomic and health disparity questions that those communities have Claw et al..\nIn addition to standard metrics of academic success such as grant awards and paper publications, Indigenous researchers must transition our research focus to understanding how independent research programs will become actionable. If participating Indigenous communities are not presented with tangible benefits to collaborating with non-Indigenous scientists, such as access to medicine, developments to infrastructure, or capacity building, then research focusing on Indigenous communities could potentially continue a legacy of colonial exploitation. Technological independence, self-governance, and democratization of the tools should always be the long-term goal of ethical partnerships in genomic sample collection, large scale data analysis and inference generation. Some easy solutions to address these concerns include engaging Indigenous communities in educational seminars within Indigenous spaces including Native American Reservations, Hawaiian Heiau, and Maori Marae. Another priority must be to transition genomic research toward focusing on the development of biomedical tools to make gene editing of deleterious genomic changes more affordable, empowering Indigenous populations across the globe to gain agency over their own future.",
"gender": "Male"
}
] |
PMC7931941
|
[
{
"age": 62,
"case_id": "PMC8495127_01",
"case_text": "A 62-year-old non-smoking woman with cough and chest tightness was initially found to have space-occupying lesions in her lungs in a physical examination at another hospital. Then she came to our hospital for further treatment. At this time, she had an Eastern Cooperative Oncology Group (ECOG) performance status of 1. And she had no relevant medical or surgical history. Enhanced CT showed a 3.0 x 3.0 cm mass in the left lower lung with diffuse miliary metastases in both lungs and no distant lymph node metastasis. The clinical stage was T1cN0M1a, and the pathological puncture diagnosis was lung adenocarcinoma in December 2016. She refused the gene test and received first-line treatment: pemetrexed 0.5 mg/m2 d1 + cisplatin 75 mg/m2 d1, q3w, for six cycles from January 2017 to June 2017. From July 2017 to April 2018, pemetrexed was given 0.8 d1, q3w, for nine cycles, and the best response was stable disease (SD) ( Figure 1 ). In May 2018, CT reexamination revealed multiple vertebral metastases in the spine, and the efficacy was evaluated as progressive disease (PD). Therefore, second-line treatment regimen was used: docetaxel 120 mg d1, q21d, five cycles, from May 2018 to September 2018. Then CT reexamination after the end of treatment showed that the response was PD.\nThis time, the patient expressed a strong desire for treatment, and we had full discussions with the patient and her family to determine the next step of treatment. On October 22, 2018, we performed genetic testing on the patient using PCR, and the results showed that EGFR, ALK, and ROS1 were all wild types ( Figure 2A ). Atezolizumab treatment was initiated on November 2, 2018, based on the results of the OAK clinical trial and the guidelines. After two cycles, CT showed partial response (PR) ( Figure 3 ).\nAt cycle 18 of atezolizumab, free triiodothyronine (FT3) decreased to 3.62 pmol/L, and the patient was treated with the addition of levothyroxine sodium tablet 50 mug qd po. Liver metastasis occurred, and lung disease progressed on October 13, 2020 ( Figure 2C ). PFS was as long as 23 months. The clinical stage at this time was T2aN0M1c. After discussion of the multidisciplinary team (MDT), pathological puncture and genetic testing were conducted again for the patient, and the results showed EGFR L858R and T790M mutations ( Figure 2B ). Research by Hsu et al. suggested that mutations in EGFR are associated with a higher rate of miliary lung metastases; for the sake of precision, we redid genetic testing on the patient's 2018 pathological specimen using a more accurate next-generation sequencing (NGS), and we found that the patient had the EGFR L858R mutation prior to the use of atezolizumab. Then the patient was treated with osimertinib in view of EGFRT790M, but the follow-up CT until March 2021 showed that the lesion continued to progress ( Figure 2D ).\nIn order to explore why the patient responded well to atezolizumab but not to osimertinib, we performed the whole gene test (825 gene) by NGS and immunohistochemistry (IHC). At this time, the patient carried EGFR L858R, T790M, and TP53 R282W mutations; and her plasma sample had a low tumor mutational burden (TMB) of 6.45 muts/Mb. IHC showed PD-L1 tumor proportion score (TPS) <1% (antibody was 22C3), but the expression of PD-L1 in immune cells was 5%. In addition, CD4+ and CD8+ T cells were highly infiltrated ( Figure 4 ).",
"gender": "Female"
}
] |
PMC8495127
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.