cases
listlengths 1
37
| article_id
stringlengths 8
11
|
|---|---|
[
{
"age": 21,
"case_id": "PMC5224419_01",
"case_text": "A 21-year-old gentleman presented to our emergency room complaining of headache and double vision for 3 weeks. Headache was constant and severe involving the entire head accompanied by nausea and vomiting. Eight months ago, he started to develop easy-fatigability and somnolence. He noted increase in his weight, mainly the abdomen, and upper back. This was associated with red/purple striae over his body, starting as small areas in his arm, then becoming wider; spreading over the trunk and thighs. He also complained of light bruising. He had a history of using copious amounts of topical steroids (clobetasol propionate) for more than a year; self-treating the post-shaving skin irritation. He did not have other neurological symptoms. There was no history of any oro-genital ulcers, redness of eyes, or prior systemic thrombosis. He denied any previous similar attacks. His general physical examination showed moon facies, abdominal obesity, posterior neck fat pads (buffalo hump), wide red striae over arms, abdomen, and thighs (Figure 1). Neurological examination showed he was fully conscious, alert, and oriented, with no cognitive dysfunction. Cranial nerve examination showed bilateral papilledema grade III, limited abduction of left eye, and areas of visual obscuration. Rest of cranial nerve examination was normal. The motor examination of upper limbs was normal including bulk, tone, power, and deep tendon reflexes. Lower limbs motor examination revealed mild bilateral proximal weakness grade 4/5 in the Medical Research Council Scale (MRC). There was no ataxia and no sensory deficits. Deep tendon reflexes were symmetrical, 2+ with down going plantars bilaterally.\nHis routine blood investigations including complete blood count, chemistries, liver function tests, renal function tests, and coagulation profile were normal. Glycosylated hemoglobin was 6.5%, autoimmune profile including vasculitis workup, serum vitamin B12 levels, folate, and thyroid function tests were all normal. Coagulopathy workup including protein C, antithrombin III, prothrombin, and factor V Leiden mutation, factor II prothrombin analysis, C3 and C4 complement levels, homocysteine, anticardiolipin antibodies were all normal. Protein S was slightly low 41.2% (normal range 65-140) while he was taking oral anticoagulation, and was likely artifactual. Cortisol level in serum repeated many times was within normal range as well as cortisol level in 24-hour urine. Non-contrasted CT scan of brain was normal. The CT venogram showed superior sagittal, left transverse, and sigmoid venous thrombosis extending to the left jugular vein. Brain MRI revealed a normal brain parenchymal findings. He was treated with subcutaneous low molecular heparin followed by oral anticoagulation therapy with the international normalized ration target of 2-3. The initial symptoms of headache and diplopia started to decrease 7 days after admission. At 3 month follow up, his symptoms and signs had completely resolved. The diagnosis of cerebral venous thrombosis requires a high index of suspicion as the presentations are highly variable. There is no definitive way of making the diagnosis clinically only. Neuroimaging is the mainstay of confirming the clinical impression. Hyperdensity in the region of cerebral venous sinuses raises the possibility of CVT; however, the anatomic variations of cerebral venous sinuses make this finding less sensitive. Computerized tomography venography has evolved as a rapid and reliable method of confirming cerebral venous thrombosis. Magnetic resonance venogram (MRV) is another non-invasive method of detecting CVT. The conventional angiography with direct visualization of cerebral venous sinuses are not used as often now, due to the availability of CTV and MRV.\nCerebral venous thrombosis is known to occur with high dose intravenous steroid use; however, there are no reports of cerebral venous thrombosis associated with the use of topical steroids. The extensive investigation for prothrombotic conditions was negative in our patient, we consider the use of topical steroids as the most plausible explanation of CVT in our case. Predisposing risk factors are found in 85%, these may include prothrombotic conditions, head injury, infectious diseases, dehydration and malignancy; the underlying cause in the rest 15% of cases cannot be determined. One of the underlying pathogenesis of cerebral venous thrombosis is occlusion of dural sinus resulting in decreased CSF absorption and elevated intracranial pressure. Our patient complained of double vision, which is not a commonly reported symptom of CVT. If the intracranial pressure is quite high, a sixth cranial nerve palsy may develop. Hypercortisolism seen with Cushing syndrome increases the risk of thromboembolic complications. Although the pathogenetic mechanism of this predisposition to hypercoagulation is not fully understood. Literature review shows that CVT may occur with an estimated incidence of 0.58% following steroid administration in MS patients with no other risk factors. High dose intravenous (IV) steroids are used to treat many neurological conditions; however, the reported incidence of cerebral venous thrombosis due to high dose IV steroids use is very low.\nIn our case, there was no history of CVT risk factors such as smoking, diabetes mellitus, systemic venous thrombosis, or other systemic or inflammatory diseases, as well as there was absence of clinical signs of dehydration or infection. An extensive laboratory investigations for thrombophilia in our patient demonstrated no underlying risk factors associated with CVT. This excluded essentially all other etiological factors for cerebral venous thrombosis, leading us to conclude that the use of large amounts of topical steroids was the culprit for CVT in our patient. We suggest that physicians should be aware that Cushing's syndrome can occur through topical steroids, and it is a possible cause of cerebral sinus thrombosis.",
"gender": "Male"
}
] |
PMC5224419
|
[
{
"age": 24,
"case_id": "PMC4881869_01",
"case_text": "A 24-year-old man presented with multiple episodes of syncope. He was found to have electrocardiographic evidence of AV Block I and AV Block II in the follow-up, and the echocardiographic evaluation has shown no other cardiac abnormalities. Due to recurrent symptomatic bradycardia with AV Block I and AV Block II , he was referred for an electrophysiological evaluation. The left femoral vein was accessed with a 7-French triport sheath through which three quadripolar pacing electrode catheters were introduced in an attempt to reach the right atrium, right ventricular apex, and atrioventricular junction. However, access to the right ventricle was not possible. The catheter was observed to advance parallel to the spine, past the contour of the heart, and to return back into what seemed to be the superior vena cava. Iodinated contrast material was injected in order to obtain a venogram (Fig. 1). It was observed that the contrast material did not pass to the right atrium, which suggested an anomaly of the IVC.\nMagnetic resonance (MR) angiography of the thorax and abdomen was performed for further evaluation of congenital cardiac and vascular defects (Fig. 2). Venous return from the inferior body regions drained into the dilated azygos vein, while a segment connecting the IVC to the hepatic vein and right atrium was missing. The azygos vein drained into the superior vena cava, and the hepatic veins drained directly into the right atrium. No other cardiovascular abnormalities were found.\nIn a second setting, with background knowledge of the anomalous venous return, an electrophysiological study was successfully performed via a right femoral access, passing the catheter through the azygos vein and superior vena cava (Fig. 3).\nProgrammed atrial stimulation showed a dual AV node physiology with typical AV reentrant tachycardia configuration. However, radiofrequency ablation was not successful. The patient was discharged home on metoprolol with no symptoms of palpitations.\nAplasia of the IVC is a rare anomaly that is present in approximately 0.6% of the population. It usually presents through thrombosis of the lower extremities. We report a case of an adult patient with IVC interruption and azygos continuation, in whom any symptoms or signs of complications of this anomaly were absent. The anomaly initially prevented invasive electrophysiological evaluation from a femoral access.",
"gender": "Male"
}
] |
PMC4881869
|
[
{
"age": 7,
"case_id": "PMC6449813_01",
"case_text": "A 7-year-old female entire Birman was referred for further investigation of acute-onset haemorrhagic vulvar discharge. A survey lateral abdominal radiograph was performed at the referring veterinary clinic, and a markedly enlarged uterus was noted. Cursory abdominal ultrasound identified at least three fetuses, with heart rates for each estimated to be in the region of 240 beats per min (bpm). The queen had a history of two prior litters, with no associated complications.\nOn initial presentation at our veterinary teaching hospital, the cat was bright and alert, with subjectively pale mucous membranes. Apart from the vulvar discharge described above, with associated matting of the coat over the perineum, no further significant findings were appreciated on the rest of the physical examination. Vital parameters were within normal limits. Abdominal palpation revealed at least two palpable fetuses. The body condition score was 3/9. No known toxin exposure (acetaminophen, onions) was reported.\nHaematology revealed a moderate, normocytic, normochromic, non-/pre-regenerative anaemia, along with a moderate mature neutrophilia (Table 1; day 1). Saline test for agglutination was positive. No haemotropic mycoplasmas were identified. Serum biochemistry demonstrated severe hyperbilirubinaemia (26 micromol/l; reference interval [RI] 0-5 micromol/l), moderately increased aspartate aminotransferase (334 IU/l; RI 0-66 IU/l), moderately increased alanine aminotransferase (311 IU/l; RI 0-100 IU/l), mild azotaemia (blood urea nitrogen 16.0 mmol/l; RI 5.7-12.9 mmol/l), mildly increased symmetric dimethylarginine (16 microg/dl; RI 0-14 microg/dl), mild hypokalaemia (3.2 mmol/l; RI 3.5-5.0 mmol/l) and moderate hypoproteinaemia (55 g/l; RI 63-83 g/l), composed of a moderate hypoalbuminaemia (19 g/l; RI 26-40 g/l) and normal globulin concentration (36 g/l; RI 27-49 g/l). The cat was negative on testing for both FeLV and feline immunodeficiency virus. Serology for toxoplasmosis revealed a titre of 1:512, and the cat was feline blood group B.\nFocal reproductive tract ultrasonography was performed to assess fetal viability, and better estimate stage of gestation, should any further intervention be required. A large uterus, containing at least three subjectively well-developed fetuses was identified. Two of the fetuses failed to exhibit independent motion or cardiac activity, and the third had a heart rate of 218 bpm, indicating fetal stress. Fetal development was advanced, with visibility of the cerebral choroid plexi, and individual heart chambers consistent with at least 50 days' gestation (Figure 1). Morphology of fetal organs was well defined and similar in all fetuses, indicating that the demise of two fetuses had occurred within the preceding 12 h. The zonary placenta were varied in appearance, and at least one was subjectively thickened, with an irregular inner margin. This zonary placenta had several small areas of heterogeneously increased echogenicity, where the normal hyperechoic inner, hypoechoic middle and hyperechoic outer layers were not visible. Another region of zonary placenta was diffusely hyperechoic (Figure 2). In addition, the uterus contained a moderate amount of strongly echogenic fluid contained in multiple pockets. A moderate amount of anechoic free peritoneal fluid was also present, along with subtly hyperechoic fat adjacent to the uterus.\nThe owner expressed no desire to continue breeding with the queen in the future, and with at least two of the fetuses no longer viable, and the third deemed unlikely to survive to term and/or delivery, OVH was advised. Exploratory laparotomy revealed a moderate amount of straw-coloured fluid in the caudal abdomen. Fluid analysis revealed mild increases in protein (31 g/l; RI 0-28 g/l) and nucleated cell count (2.6 x109/l; RI 0-1.5 x 109/l), with the latter composed of a small number of reactive mesothelial cells and occasional non-degenerate neutrophils and red blood cells. The gravid uterus appeared grossly congested and contained four fetuses. Recovery from anaesthesia was uneventful, and the cat was maintained on buprenorphine (0.025 mg/kg SC q8-12h) for pain management.\nRepeat haematology 3 days later revealed mild improvement in the degree of anaemia, along with evidence of regeneration (Table 1; day 4). The mature neutrophilia had since resolved; however, the cat was still positive on saline test for agglutination (Table 1; day 4). With gradual improvement in terms of both the degree of anaemia and regenerative response following surgery, no further treatment, more specifically immunosuppressive therapy, was instituted and the cat was discharged. Histology later revealed mild, multifocal suppurative placentitis, with Gram staining failing to demonstrate evidence of bacteria within the inflamed areas of placenta. Unfortunately, routine bacterial culture could not be performed to definitively rule out underlying bacterial infection. The IMHA described was deemed most likely to be associated with pregnancy, as is well documented in people.\nA revisit at the referring veterinary clinic 1 week later demonstrated further improvement, with a low normal haematocrit and moderate reticulocytosis; however, a weak positive was still noted on saline test for agglutination (Table 1; day 11). Further follow-up 1.5 months after OVH revealed complete resolution of the previously reported anaemia (Table 1; day 44). Repeat serology for toxoplasmosis revealed a titre of 1:1024.",
"gender": "Female"
}
] |
PMC6449813
|
[
{
"age": 28,
"case_id": "PMC3865702_01",
"case_text": "A 28-year-old man with quiescent Crohn's disease was started on infliximab (300 mg [5 mg/kg] intravenously monthly) for ankylosing spondylitis refractory to celecoxib. Four months before starting infliximab, serum enzymes were normal. Concomitant medications included fluoxetine, fluticasone, and omeprazole, and he reported no known drug allergies. After the fourth infusion, alanine aminotransferase (ALT) levels increased to 132 U/L, and total bilirubin was 0.8 mg/dL. In the week of his fifth infusion, ALT increased to 311 U/L, whereas alkaline phosphatase (Alk Phos) and bilirubin remained normal. Infliximab was stopped. He remained asymptomatic throughout, but ALT peaked at 1270 U/L. Serum ANA was initially negative, but 1 month later, it was positive in a titer of 1:160. Anti-smooth muscle antibody (ASMA) remained negative, and immunoglobulin (Ig) G levels were normal. Serum ALT fell to 198 U/L by 2 months after the last infusion but rose again to 1167 U/L, with a total bilirubin of 2.0 mg/dL (Figure 1 A1). Evaluation for hepatitis A, B, and C was negative, and hepatic computed tomography and ultrasound were normal. A liver biopsy obtained 3 months after the last infliximab infusion showed portal and lobular mixed inflammatory infiltrate with autoimmune features and no fibrosis (Figure 1 A2 and A3). Prednisone (50 mg/d) was started, and liver enzymes fell into the normal range within 2 months. Prednisone was tapered and stopped after 7 months. The serum ANA reverted to negative. He was placed on etanercept 11 months after his last dose of infliximab, and serum enzymes remained normal. The assigned DILIN causality score was 1 (definite), RUCAM 5 (possible), and severity score 1 (mild).\nThis subject developed progressively elevated serum aminotransferase levels after 5 doses of infliximab, but he remained asymptomatic and had only a mild increase in serum bilirubin. He was taking fluoxetine, fluticasone, and omeprazole at the time of onset, but these agents had been taken for more than a year and were continued. No other cause of liver disease was identified. Liver biopsy findings, ANA positivity, and response to prednisone suggested DILI with auto-immune features triggered by infliximab.\nTwenty-eight additional published cases were evaluated, and the results are summarized together with the 6 DILIN cases in Tables 2 and 3. The most common underlying disease was psoriasis and/or psoriatic arthritis (13 cases, 8 women), followed by inflammatory bowel disease (12 cases, 7 women), rheumatoid arthritis (6 cases, all women), and ankylosing spondylitis (3 cases, 1 woman). The drug most commonly incriminated was infliximab (26 cases), followed by etanercept and adalimumab (4 each). No published cases were found linked to natalizumab, golimumab, or certolizumab. On the basis of the reports and causality assessment by 2 of the authors (M.G. and M.B.), 1 case was considered definite, 21 were considered very likely (causality score 2), and 12 cases were deemed probable (causality score 3). An alcohol use history was available in 21 cases. Alcohol was considered a possible competing cause in 3 cases, but the final causality assessment for the anti-TNF compound was very likely in 1 case and probable in the other 2.\nSeverity scores could be ascertained in 30 cases, and the reaction was rated as mild in 20, moderate in 8, and severe (including 1 liver transplant) in 2. Peak serum ALT ranged from 140-2250 U/L, and bilirubin ranged from normal-27.7 mg/dL. The presence or absence of autoimmune serologies or histologic features was reported in 33 cases; 22 (66%) had autoimmune serologic markers and/or histologic features at some point during the clinical course. Overall, the prognosis was good, although 1 patient with underlying cirrhosis required liver transplantation. Twelve subjects improved after discontinuation of the implicated drug and with the addition or increased dosage of oral or parenteral corticosteroid therapy. The remainder improved after discontinuation of the implicated drug. Several patients tolerated treatment with etanercept without recurrence of liver injury after cessation of infliximab or adalimumab. Two did well with low-dose etanercept after DILI associated with full dose.\nWe compared 22 cases with autoimmune features (serology and/or histology) vs those without (Table 4). Those with auto-immune features had serum ANA titers ranging from 1:80 to 1:2560, and 17 subjects underwent liver biopsy that revealed autoimmune histopathologic features in 15. In contrast, among the 8 (of 12) patients without positive autoimmune serologies who underwent liver biopsy, none had clear-cut autoimmune features. Patients with autoimmune features tended to have longer latency and were more likely to have a hepatocellular pattern of serum enzyme elevations, with higher peak ALT and higher R values (Table 4).",
"gender": "Male"
}
] |
PMC3865702
|
[
{
"age": 53,
"case_id": "PMC9925037_01",
"case_text": "A 53-year-old male was riding a bike and was severely injured in a vehicle accident and sent to the emergency department. He suffered a head injury, pelvis and left leg injuries, and several abdominal abrasions. Due to a fracture of his left leg's tibia and fibula immediately after the injury, he could not bear his weight on that lower limb. Then the patient was treated for a head injury and managed with plating on the left leg in a private hospital. He was then taken immediately to the hospital, where X-rays was done. The right-sided pelvic fracture was diagnosed by an orthopaedic surgeon along with a neuro deficit in the right foot drop. Then he underwent an operative procedure in which surgical correction of the right side sacroiliac joint and external fixator application for pelvis fracture was performed. The patient had a history of Diabetes Mellitus and Systemic Hypertension for three years on medications. The pain was sudden in onset and excruciating, aggravated by movement and relieved at rest. Intensity of pain was 9/10 on the numerical pain rating scale for lower limb motion and 5/10 for rest.\nTimeline\nThe patient was admitted to the hospital on 03/09/2022. He was operated on for external fixator application for pelvis fracture and surgical correction of the right sacroiliac joint by CC screw on 16/09/2022. The physiotherapy intervention was started on 17/09/2022.\nFindings and impression of investigations\nX-ray results showed fractures in the right iliac wing and superior and inferior pubic rami. Left side sacrum involving ala and body with articular extension in the left side sacroiliac joint and left iliac bone. A communited minimally displaced fracture of the sacroiliac joint and the right iliac bone. Figure 1 shows the postoperative x-ray showing the external fixator application for pelvis fracture and surgical correction of the right sacroiliac joint by CC screw.\nDiagnosis\nThe patient had a right-sided iliac wing fracture that extended toward the sacroiliac joint, a fracture of the sacral ala joint on the left side, and fractures of the superior and inferior pubic rami on the right side (lateral compression type II of Young and Burgess classification system).\nClinical findings\nThe patient gave his written, informed consent. The patient was conscious, cooperative, and well-oriented to the time, place, and person during the general assessment. The patient's hemodynamics was normal. On observation, ankle toe movements were present on the left side, ankle dorsiflexion of the right side could not be evaluated, and plantar flexion at the toes and ankle was elicited. A sensory examination on the right side revealed a significant reduction of light touch and pinprick in the right L4-L5 and S1 distributions. A foot drop assessment was performed, and shin and foot numbness was examined. The Stanmore assessment for foot drop evaluated grades as very poor, less than 55 points. The table mentioned below shows the range of motion (Table 1).\nTherapeutic intervention\nPostoperative Management\nShort-term goals included minimizing pain and swelling, improving joint range of motion, improving cardiovascular fitness, encouraging early mobilization, and preventing pressure/bed sores. Long-term goals were to re-educate patients to walk again, educate them in gait and balance, and increase their capacity for independent performance of activities of daily living (ADLs). Table 2 below contains physiotherapy interventions from week 1 to week 12.\nFollow-up and outcomes\nAfter the physiotherapy rehabilitation, the patient was able to perform normal activities without experiencing any pain or decrease in range of motion. The patient noted an increased range of motion (ROM) and muscle strength (Table 3); the Stanmore assessment score was also increased from poor to very good grade, which is 100-85 points. Table 4 shows the range of motion evaluation after physiotherapy treatment.",
"gender": "Male"
}
] |
PMC9925037
|
[
{
"age": null,
"case_id": "PMC5123616_01",
"case_text": "A previously active female in her 50s with a history of chronic obstructive pulmonary disease secondary to smoking began to experience progressive worsening fatigue and two episodes of syncope over the course of 4 months. Her syncopal episodes occurred spontaneously without exertion or warning at work. Her primary care provider initiated workup including treadmill stress test and echocardiography; however, upon transthoracic echocardiography, a 4.9 x 3.5 cm2 left atrial mass occupying nearly 90% of her left atrium was seen (Supplementary File 1), and the patient was referred urgently to cardiology. Examination at that time revealed normal vital signs and an unremarkable physical examination with a blood pressure of 115/68 and a pulse of 72. Electrocardiogram showed normal sinus rhythm with nonspecific ST segment changes. Four days later, she underwent a diagnostic coronary angiogram, which revealed single-vessel disease with 70% diagonal branch stenosis off the left anterior descending coronary artery (LAD). Left ventricular ejection fraction was seen to be 60%. Soon thereafter, our patient underwent myxoma resection under cardiopulmonary bypass (CPB) via biatrial approach. Unfortunately, the mass was too large, and the thin septal crux between the wall of the aorta and mitral valve was damaged during resection, requiring stem cell tissue matrix (CorMatrix) for repair. Upon coming off of CPB, severe mitral regurgitation and a sluggish anterior wall suggesting infarct to the left coronary system during resection were seen. Subsequently, she was put back on CPB and received a mechanical mitral valve replacement and a saphenous vein graft to the LAD. Upon pathologic examination, the patient's myxoma measured 5.5 x 4.5 x 3.5 cm3 and weighed 52 g (Fig. 1). Postoperatively she developed atrial fibrillation with a left atrial appendage thrombus, New York Heart Association Class II-III heart failure with a LVEF of 30%-35%, and a transient ischemic attack (TIA).",
"gender": "Female"
}
] |
PMC5123616
|
[
{
"age": 57,
"case_id": "PMC2854399_01",
"case_text": "A 57-year-old female with established RA was stable until a recent clinical flare-up in the right wrist. Clinical examination revealed synovitis, swelling, and diminished range of motion. The patient also had a history of osteoarthritis (OA). An extremity 18F-FDG PET/CT scan immediately following MRI at baseline was performed on this patient. Tumor necrosis factor alpha (TNF-alpha) inhibitor (etanercept) therapy was then initiated as a part of the patient's standard of care. The patient was re-scanned 5 weeks after starting treatment.\nThe figure shows high-resolution 18F-FDG PET images (pseudocolor) overlaid on pre-contrast MRI images (gray scale) at baseline (left column) and 5 weeks (right column). Significant reduction in PET signal (suggesting reduced inflammation) in the synovium and at sites of erosions (white arrows) is visible. The green arrow shows inflammation due to OA. Physician examination at 3 months confirmed that this patient responded positively to etanercept. This case illustrates the potential of high-resolution PET with MRI for quantitative visualization of early response to therapy in RA.",
"gender": "Female"
}
] |
PMC2854399
|
[
{
"age": 34,
"case_id": "PMC10061108_01",
"case_text": "A 34-year-old male presented with abdominal pain and distension with no previous history of colon cancer. His father died of colon cancer at the age of 50 years and received conservative treatment in the internal medicine department of a local hospital on 2 January, 2019. Due to the symptoms of peritonitis, an exploratory laparotomy was performed on 11 January, 2019, which revealed necrosis of the small intestine (90 cm) and a large amount of bloody fluid and intestinal contents in the abdominal cavity. The final procedure was an ileostomy along with abdominal drainage, which was considered an intestinal fistula. The patient was referred to our hospital's intestinal fistula specialist on 27 May, 2019. During the colonoscopy, there was widespread polypoid hyperplasia (>100), no neoplastic spaces were found, and the patient underwent two exploratory laparotomies and abdominal irrigations for repeated intestinal leakage in the following year. However, there was no evidence of malignancy in postoperative pathology; however, purulent fluid continuously oozed from the incision. During this period, the patient repeatedly had a high fever of 39 C, and his weight gradually decreased by 25 kg, but he did not vomit blood, show blood in his stool, or suffer jaundice.\nOn 20 May, 2020, a colonoscopy was performed again, and new growths were found around 3/4 of the circumference of the transverse colon wall approximately 60 cm from the anus, which was brittle, hard, and prone to bleeding. Additionally, more than 100 flat polyps with a size of about 0.2-0.5 cm were found in each segment of the colon. Serologically, carcinoembryonic antigen and carbohydrate antigen 19-9 were significantly elevated. The abdominal CT scan depicted an unclear boundary between the middle abdomen and ascending colon, local invasion of the head of the pancreas, and an enhanced scan displayed significant enhancement ( Figure 1 ). On 5 June, 2020, the patient underwent a retroperitoneal tumor resection. During the operation, a 0.5x0.5 cm fistula was found at the colon anastomosis, and a 10x10 cm bossing could be touched in the ascending colon and invaded the head of the pancreas, making it difficult to move the fixation ( Figure 2A ). The postoperative pathology illustrated ulcerative moderately differentiated adenocarcinoma with a size of 6 *4.3*3 cm ( Figures 2B, C ). Cancer tissue infiltrated the intestinal wall and was located in the peripancreatic tissue, but no cancer tissue was found in lymph node 0/25.\nOn 16 June, 2020, PET/CT scans demonstrated a soft tissue mass (9.7*4.3 cm) in the middle abdomen, considered a malignant tumor. Microsatellite instability (MSI) testing through immunohistochemistry demonstrated that the tumor was microsatellite stable (MSS). Next-generation sequencing (NGS) applying the Illnuina NovaSeq6000 (ACCB Biotech) using the patient's archival tumor tissue and blood showed RAS wild-type, POLE mutation, tumor mutation load 119.9 mutation/MB ( Figure 3 ). A combination of oxaliplatin and fluorouracil chemotherapy was performed every two weeks for six cycles. According to the Response Evaluation Criteria In Solid Tumours (RECIST) criteria, the patient was deemed to have stable disease on CT at weeks 4/8, but the patient was assessed with progressive disease (PD) by CT at week 12. A genetic profile consistent with genetic instability (high tumor mutational burden, POLE mutation) and clear progression of FOLFOX led to the use of terriprizumab and bevacizumab on November 24, 2020. After one treatment cycle, the patient developed a soft abdominal mass protruding from the skin surface. A large amount of purulent fluid was extracted through the puncture and drainage, which healed with repeated irrigation and drainage. After two cycles of treatment, the patient's disease to was assessed partially responded (PR) by CT ( Figure 4A ), and the carcinoembryonic antigen, carbohydrate antigen 19-9, and carbohydrate antigen 50 levels returned to normal ( Figure 4B ). At the time of this report, the patient had a progression-free survival of 18 months, with ongoing clinical benefits and no immune-mediated toxicities. The case timeline is presented in Figure 5 . Consent for publication was obtained from the patient for her case report.",
"gender": "Male"
}
] |
PMC10061108
|
[
{
"age": 81,
"case_id": "PMC7164144_01",
"case_text": "The patient is an 81-year-old sterile, non-consanguineous Caucasian male who is a retired army engineer with a history of macrocytic anemia. The patient also had fatigue, paleness of the skin, shortness of breath, lightheadedness and occasional dizziness. The base line hemoglobin was 10.5 g/dl. After being placed on Vitamin B12 supplementation, hemoglobin increased and MCV decreased, but neither returned to normal range. To rule out MDS, a bone marrow biopsy was performed.\nBM morphometric and flow cytometric analysis revealed proportionally normal myeloid, monocytic and lymphoid elements with no increased blasts, plasma cells and no aberrant myeloid or lymphoid maturation (Fig. 1). Both conventional and FISH metaphase analysis proved the presence of 44 chromosomes containing (13;14) and (14;15) Robertsonian translocations (Figs. 2 and 4). Figure 2 shows the ISCN karyotype: 44,XY,rob(13;14)(q10;q10),rob(14;15)(q10;q10). No normal chromosome 14 was present in the karyotype. \nNo MDS/AML specific chromosome aberration was observed in the karyotype analysis or interphase and metaphase MDS FISH panel studies (Figs. 2 and 3). A double heterozygous RT consisting of rob(13q;14q) and rob (14q;15q) was further confirmed by metaphase FISH analysis using multiple FISH probes encompassing various regions of chromosome 13, 14 and 15 (Fig. 4). Both RTs were present in 100% of bone marrow, peripheral blood, and cultured fibroblast cells; therefore they were found to be constitutional and not mosaic in nature. \nBone marrow aspirate smears from the patient were stained with Wright- Giemsa Stain 1000X (Fig. 1). The patient's blood cells are larger than normal, with nuclei that appear to be immature relative to cellular cytoplasm. The five-color flow cytometric assay utilized the Cytomics FC500 with CXP software and fluorescent monoclonal antibodies (data not shown). Conventional G-banded metaphase chromosome analysis was performed on an unstimulated overnight bone marrow culture, a 72 h PHA-stimulated peripheral blood culture and bone marrow fibroblast cultures (Fig. 2). Bone marrow fibroblast cells were obtained by repeated culturing of bone marrow samples in a T25 flask for 3-4 weeks with weekly replacement of fresh media. Fibroblast cells were incubated overnight with Colcemid and metaphase chromosomes were prepared for analysis by standard methods. FISH analysis was performed on bone marrow metaphase chromosomes preparations. All fluorescently labeled DNA probes were purchased from Abbott Molecular and hybridizations done according to the manufacturer's protocol.\nIn humans, the NORs are located on the secondary constrictions of the five pairs of acrocentric chromosomes. Active NORs can be stained by silver nitrate and visualized with the use of the silver staining technique. This technique selectively stains active NORs but does not detect the presence of rRNA genes. To determine the number of active nucleolar organizing regions (NORs) on five pairs of acrocentric chromosomes, silver (NOR) staining was performed. Briefly, fresh bone marrow or peripheral blood metaphases were prepared on clean glass slides and incubated with 50% AgNO3 solution plus formic acid-gelatin developer sandwiched between glass cover slips. The slides are heated to 70 C for 3 to 4 min until the mixture turned yellow-brown and then they were rinsed with running water. Dark silver dots were deposited on the p arms of acrocentric chromosomes from the DRT patient and from normal controls. The silver deposits of 30 metaphases were scored and the mean number of Ag-NORs were calculated.",
"gender": "Male"
}
] |
PMC7164144
|
[
{
"age": 55,
"case_id": "PMC5259594_01",
"case_text": "A 55-year-old female with a known history of ischemic heart disease, hypertension, dyslipidemia, and insulin dependent diabetes mellitus presented to the Accident and Emergency Department of our hospital with new onset chest pain. The patient had a successful percutaneous coronary intervention in the proximal part of LAD for stable angina 9 years ago and two drug eluting stents (DES) (Taxus Liberte, Boston Scientific) were uneventfully implanted then. On admission, the electrocardiogram showed no significant changes and the cardiac troponin was slightly elevated. The patient was admitted to the Cardiac Intensive Care unit with the diagnosis of non-ST elevation myocardial infarction. The initial cardiac ultrasound showed normal ejection fraction with no regional wall motion abnormalities and no valvular abnormalities. The patient remained symptomatic with chest pain recurrences after maximum antianginal treatment with intravenous nitroglycerin and b-blockers, so we decided to proceed to emergency coronary angiography.\nThe coronary angiography was performed through the right radial approach after placement of a 6 Fr radial sheath (KDL, China) and it showed one vessel disease with significant restenosis within the previously implanted stents (Figure 1(a)). We decided to proceed to ad hoc percutaneous coronary intervention within the restenotic proximal LAD lesion. The patient was loaded with 60 mg prasugrel in addition to the already taken aspirin and intravenous bivalirudin was administered for anticoagulation at 0.75 mg/kg bolus followed by an infusion of 1.75 mg/kg/hr. A JL 3.5 6 F guide catheter was exchanged over a 0.035 guidewire and it was placed in the ostium of the left main. We crossed the lesion using a workhorse guidewire (Luge, Boston Scientific) and dilatation was performed with a 2.0 mm semicompliant balloon (Sprinter Legend RX, Medtronic), but the lesion remained undilatable (Figure 1(b)). At the third attempt to expand the lesion using high pressure (at 22 Atm), the balloon ruptured producing a massive dissection of the LAD beginning immediately after the distal part of the undilatable lesion (Figure 1(c)). The presence of radiolucent area during contrast injection suggesting the creation of double lumen without persistence after dye clearance classified the dissection as type B according to the NHLBI classification. The patient started complaining of chest pain and the ECG monitor showed ST segment elevation in lead V1.\nProceeding with an emergency CABG while on full antiplatelet treatment with prasugrel\nTreating the dissection with prolonged balloon inflation\nProceeding to rotational atherectomy and stenting\nThe placement of a stent distal to the undilatable lesion was attempted unsuccessfully, due to inability to pass the lesion. We did not insist further on in-stent placement with other options, like guide extension catheters, because even if we succeeded the patient would still be in need of coronary artery bypass grafting (CABG) operation, due to the undilatable proximal stenosis. The need for satisfactory lesion dilation was a prerequisite before any other action. Expansion of the stenosis with a cutting balloon failed completely as it did not even manage to go through the critical part of the lesion. In the meantime, the patient was still in pain and she became haemodynamically unstable making inotropic support necessary. Three options were available at this time point:The first option was rejected initially due to the very high bleeding risk of the patient and it was reserved as a last resort. Balloon inflation at the site of dissection after so many attempts for dilation was considered very venturous as it could easily augment the dissection even further, making surgical solution inevitable. Moreover, complete vessel occlusion could potentially deteriorate left ventricular function even further and induce a haemodynamic collapse. Taking into account the above-mentioned parameters, we decided to proceed to ad hoc rotational atherectomy, even though coronary dissection is considered as a contraindication for this technique. A 1.25 x 15 mm over-the-wire balloon (Sprinter OTW, Medtronic) was placed at the distal part of the LAD, the Luge guidewire was removed, and a Floppy Rotawire was placed at the distal part of LAD. Rotational atherectomy was successfully performed with a 1.25 mm burr (Figure 1(d)), but the lesion was still undilatable with a 2 mm semicompliant balloon. We upgraded the burr to a 1.5 mm and successfully rotablated the lesion once more. Dilation was performed using 2.0 mm and 2.5 mm semicompliant balloons (Figure 1(e)) (Sprinter Legend, Medtronic) and the dissected and the previously undilated segment were stented. Three DES were placed in a row starting distally and moving proximally (Resolute Integrity, Medtronic) with a favorable angiographic result (Figure 1(f)). The patient was pain-free at the end of the procedure and a modest troponin I elevation was observed the next day. There was no evidence of left ventricular dysfunction at the echocardiogram performed the next day. The patient was discharged after three days with dual antiplatelet treatment (aspirin 100 mg daily and prasugrel 10 mg daily) and she remains asymptomatic three months after the procedure.",
"gender": "Female"
}
] |
PMC5259594
|
[
{
"age": 57,
"case_id": "PMC6381881_01",
"case_text": "A 57-year-old man underwent pancreatoduodenectomy for duodenal bulb NET (G2) (T1 N1 M0 Stage IIIb) in December 2015 (Fig. 1). However, multiple liver metastasis was observed 6 months after the surgery. Therefore, TACE (lipiodol) was performed, which was ineffective, leading to disease progression. Next, everolimus was administered; however, CA 19-9 levels elevated after 6 months of administration, and multiple liver, lymph node, and bone metastasis was confirmed by an octreotide scan. The disease was judged to PD (Fig. 2a). In May 2017, STZ monotherapy (1,000 mg/m2; weekly administrations) was initiated. The CA 19-9 levels decreased after the third course and normalized after the fifth course. One year later, an octreotide scan showed a stable disease (Fig. 2b). However, 1 year later, because CA 19-9 levels increased, the STZ dose was increased to 1,500 mg/m2, after which the levels normalized again for the second time (Fig. 3). The STZ dose could be increased to 1,500 mg/m2 because the patient could tolerate the increased dose. The progression-free survival of the patient exceeds 1 year and 6 months, with STZ monotherapy ongoing for the patient (56 courses administered).\nPatient consent was obtained, and the study was approved by the ethics committee of our hospital.",
"gender": "Male"
}
] |
PMC6381881
|
[
{
"age": 36,
"case_id": "PMC5537934_01",
"case_text": "A 36 year old apparently healthy Hispanic female presented to the emergency department (ED) with a 4 days history of left upper extremity pain dull aching in nature and tenderness to palpation after a week of strenuous activity. Her background history was without any significant family history or risk factors. Physical examination revealed a moderately nourished, well-built female, not in acute distress except for marked pain in left extremity. No other abnormality was detected on physical examination.\nA complete blood count was done as part of a routine examination. Doppler studies of the four extremities was done in ED which showed left axillosubclavian acute DVT. Laboratory results are presented in Table 2 and Table 3 below. Secondary to the elevated D-Dimers patient underwent CT chest and pulmonary angiography to rule out pulmonary extension or pulmonary embolism (PE). The CT results confirmed the presence of left axillo-subclavian venous thrombosis; however, there was no evidence of PE. \nFuthermore, a CT chest was done and results showed there were no anatomical abnormalities obstructing thoracic outlet. It is possible that strenuous physical activity with temporary obstruction of the thoracic outlet while patient was training her upper body has triggered and likely temporary dehydration caused by extensive sweating during physical training further contributed to the thrombotic event.\nThe patient was started on strict precautions of left upper extremity immobilization, analgesics in the form of Tylenol 650 mg every 6 h for pain as well as cold compresses. Lovenox 90 mg subcutaneous twice daily (1 mg/kg BID) was started together with warfarin to keep INR 2-3. On the third day of hospitalization the therapeutic INR was reached and patient was discharged.\nAdditional workup to exclude hypercoagulable state in the form of antiphospholilpid antibody, factor V, Leyden, protein S and C and antithrombin III were within normal levels with no gross abnormality suggestive of thrombophilic state. Catheter-guided thrombolysis was considered with option to transfer patient to specialized center since this type of treatment was not available at the described facility. However patient was not willing to relocate and preferred to be treated at the same facility she was admitted to originally knowing that other type of treatment is available at the other center.\nTwo months after discharge, patient came for follow up. Doppler study showed that there were no blood clots in axillosubclavian vessels and all blood work was within normal limits including D-Dimers of 177 and the patient clinically asymptomatic.",
"gender": "Female"
}
] |
PMC5537934
|
[
{
"age": 6,
"case_id": "PMC5864519_01",
"case_text": "A 6-year-old female with a history of HLHS diagnosed by echo at day 1 after birth that showed mitral atresia, rudimentary left ventricle, hypoplastic aortic arch, patent ductus arteriosus (PDA), and atrial septal defect (ASD). After initial diagnosis at birth, patient was started on prostaglandin and dobutamine and transferred to our center for further management.\n During the routine preoperative workup, she was found to have prolonged prothrombin time (PT) and activated partial thromboplastin time (aPTT) ( Figs. 1 and 2 ). Mixing study was performed by addition of normal pooled plasma to patient's plasma, and it showed normalization of both the prolonged PT and aPTT; which indicated clotting factor deficiency (factors II, V, or X) that was corrected by addition of normal plasma. The respective clotting factors assays were performed, factor II and factor V were found within normal range for age (0.78 and 0.9 IU/mL, respectively). On the other hand, FX, was found to have severe deficiency with plasma FX level < 0.01 IU/mL, and FX functional activity (FX:C) was > 1%. \n A structured plan was discussed with the hematologist for FX replacement therapy (one dose of FX concentrate [50 IU/kg] the day before the surgery and 1 hour prior to any future surgical intervention to reach an international normalized ratio [INR] level of < 1.5). If the target preoperative INR was not achieved, an extra dose of FX concentrate is given. This is followed by daily 30 IU/kg of FX concentrate after surgery together with 10 mg/kg tranexamic acid four times a day for a period of 5 to 7 days to eliminate the risk of perioperative bleeding. She successfully underwent Norwood I procedure (Damus-Kaye-Stansel (DKS), modified Blallock-Taussig shunt (mBTS), aortic arch augmentation, and atrial septectomy) at the age of 7 weeks and was discharged home in stable condition. \nAt the age of 14 months, she was admitted for right superior cavopulmonary anastomosis (Glenn procedure). She received two doses of 50 IU/kg FX (Factor X P Behring) (one dose of FX concentrate [50 IU/kg] the day before the surgery and another dose was given 1 hour prior to surgery). This was followed by daily 30 IU/kg for 5 days after the surgery. Our patient had an uneventful hospital course and was discharged in stable condition.\nAt the age of 3 years, she had an episode of seizure that was described as partial loss of consciousness with generalized stiffening of the body and trembling of the jaw. This episode happened intermittently over a period of 20 minutes. A computed tomography (CT) scan and magnetic resonance imaging (MRI) of the brain showed no intracranial hemorrhage or infarction, but electroencephalogram (EEG) showed mild and intermittent background generalized slowing. The patient was started on antiepileptic medication (levetiracetam).\nShe maintained her usual state of health with no signs of bleeding and continued to follow up with pediatric cardiology. However, she experienced a recent episode of hemoptysis following upper respiratory tract infection (URTI) at the age of 5 years. The patient was admitted in another facility and treated with plasma transfusions.\nFollow-up echocardiography showed patent right superior cavopulmonary anastomosis and DKS anastomosis, patent aortic arch, and large nonrestrictive ASD. Patient was planned for elective TCPC.\nDental clearance was done after undergoing multiple teeth extraction, restoration, and fillings. All were done in one session under general anesthesia after following the same FX preoperative replacement protocol. We did not give daily postoperative doses, as the patient underwent stage 3 palliation during the same admission.\nFinally, at the age of 6 years, the patient underwent extra cardiac nonfenestrated TCPC, again following the same FX replacement protocol. However, due to the limited supply of FX concentrate, we accepted a preoperative INR value of 1.8.\nThe patient tolerated the procedure well with minimal intraoperative bleeding and she was maintained on FX concentrates daily and 150 mg tranexamic acid four times a day for 1 week postoperatively.\nPostoperative echo showed patent TCPC circuit, confluent branch pulmonary arteries and patent DKS anastomosis, patent aortic arch with good overall ventricular systolic function, and no pericardial effusion. Patient had smooth uneventful postoperative course and was discharged in a stable condition.\nIn all of her surgical procedures, there was no noticeable perioperative bleeding or thromboembolic event related to coagulopathy or treatment administration.",
"gender": "Female"
}
] |
PMC5864519
|
[
{
"age": 19,
"case_id": "PMC3240924_01",
"case_text": "A 19-year-old sexually active high school student with a history of regular menses believed she was pregnant after missing her period for three months. Still in school and not ready to have a child, she wanted to terminate the pregnancy but was reluctant to visit a healthcare professional. She could not pay for such a visit and even though she had government-sponsored medical insurance, it did not cover abortion services. Her girlfriend, the only person in whom she confided, suggested misoprostol for termination; she had never been pregnant or previously used misoprostol. A Licensed Chemical Seller (LCS) sold her misoprostol without a prescription.\nThe fourth of 6 siblings, the patient had been sent to school from a rural farming community and lived near the school with her two younger sisters. Her first coitus was at 16 years, but she had never used birth control or condoms, claiming that she did not believe that she would get pregnant or contract sexually transmitted diseases (STDs). Her religious beliefs did not influence her behaviour.\nVaginal bleeding began a few hours after taking 200 mcg misoprostol orally and the same dose vaginally. She bled for four days, accompanied by severe constant lower abdominal pain. Nevertheless, she remained at home. Five days later, the bleeding subsided but right sided pelvic pain persisted. Two days later, she went to a hospital near her home, where she was given the clinical diagnosis of septic incomplete abortion with severe anaemia (Hgb 7.3 g/dl). They had no ultrasound or transfusion capability. Twenty-four hours after performing a manual vacuum aspiration (MVA) with no observable products of conception, they transferred the patient with a diagnosis of pelvic abscess. Despite her level of illness, she came to our district hospital, about 20 minutes away by taxi, the common transport for ambulatory patients.\nOn arrival, the thin and small-for-her-age woman looked pale and obviously ill. Her vital signs were temperature 37.8 C, BP 100/60 mm/Hg, pulse 100/min, regular and good volume. Her abdomen was diffusely tender with peritoneal signs. Since the one surgeon for the facility was operating, she was sent to the maternity ward, where the nurses, immediately recognizing her level of illness, started an IV, drew labs, and notified the surgeon.\nShe was found to have a Hgb 6.1 g/dl, WBC 15.9 x109/L, with 10.8% lymphocytes, 9.0% mononuclear cells, and 80.2% neutrophils. A physician-performed ultrasound transabdominal examination showed an empty but bulky uterus with fluid in the dependant parts of the abdominal cavity. The presumptive diagnosis was pelvic abscess, although other processes were considered that also required surgery. She received two units of whole blood, additional crystalloids, ciprofloxacin and metronidazole.\nUnder general anesthesia, exploration through a Pfannenstiel incision demonstrated that the uterus, fallopian tubes and both ovaries were normal, but that the peritoneal cavity contained a large quantity of serosanguinous fluid. The incision was extended in an inverted \"T\" to the epigastrium for a more extensive laparotomy. After draining the fluid, an inflamed appendix was found adhering to the cecum and no other pathology was identified. An appendectomy was performed (Figure 1), the peritoneal cavity was lavaged and the abdomen was closed primarily.\nPost-operative management included prolonged use of parenteral antibiotics. During the post-operative healthcare education, the patient stated that she did not intend to use either contraception or STD protection in the future, relying instead on sexual abstinence.",
"gender": "Female"
}
] |
PMC3240924
|
[
{
"age": 30,
"case_id": "PMC7508689_01",
"case_text": "A 30 years old lady with a history of amenorrhoea for 14 weeks came to emergency department (ED) of tertiary centre after assault by her neighbour who was mentally sick. The assault was done with an iron made belan, which was inserted into vagina. On presentation she was irritable and her airway was threatened, Breathing was spontaneous, respiratory rate was 18 per minutes, SPO2 was 96% on room air, pulse rate was 142 per minutes, Blood pressure was 80/50 mmHg, GCS was 8 and patient's body temperature was low. On secondary survey it was found that an iron rod like structure was inserted into the vagina (Fig. 1). Her body mass index was 23 kg/meter2. There was no significant drug history, past illness, family history, or psychosocial history. On considering all these clinical findings, ATLS Protocol was started to stabilize the patient in ED. All blood investigations were within normal limit except low haemoglobin (7.4 gm/dl) and Arterial blood gas analysis showed the features of acidosis. The Focused assessment Sonography for trauma (FAST) was done which showed free fluid in pelvis and also emphasized the presence of foetal heart sound. A differential diagnosis of haemoperitoneum with bladder, bowel or uterine perforation was suspected. As airway was threatened due to low GCS, she was intubated to secure the airway. In view of low blood pressure, two large bore cannula was inserted for the infusion of 2 L ringer's lactate and all minor lacerated wounds were sutured. The Ryle's tube and Foley's catheter were inserted (Fig. 2). In view to consider unstable haemodynamic status, free fluid present in pelvis, penetrating iron belan inside vagina with history of 14 weeks of pregnancy, the patient was immediately shifted to operation room (OR). Abdomen was opened by midline incision. There was haemoperitoneum more in pelvic cavity and source of bleeding was from mesenteric tear which was repaired and haemostasis achieved. The uterus was intact but on further exploration on its posterior side, the iron rod was felt to be implanted into the erector spine group of muscles. The rod was removed vaginally which was almost in the shape of belan (Fig. 3). There was 4 cm rent in posterior fornix (Fig. 4) which was repaired in double layers. All other solid organs was examined and no injury was found. After securing the haemostasis and examine all the rest gastrointestinal tract, the abdomen was closed in layers. All these operative interventions were done by an associate professor with 10 years of specialised training. Patient was shifted to intensive care unit without extubation and broad spectrum antibiotics coverage was also started. The other post-operative instructions were keep the patient nil per orally till bowel sound appears as well patient wean from ventilator, injectable proton pump inhibitors, non-steroid anti-inflammatory drugs, paracetamol infusion and intravenous fluid. Two units PRBC (O + VE) was given intraoperatively and 1 PRBC in the post-operative period. On third postoperative day tracheostomy was done. On 5th postoperative day, case was reviewed with bed side ultrasound and foetal demise was confirmed, so medical abortion was planned in view to consider intra uterine foetal death (14 weeks). Tab mifepristone (200 mg) orally through Ryle's tube and then 36 h later, tab misoprostol (200 mg) was started intravaginally every 6 hourly. A female abortus of weight 350 g expelled vaginally on 7th post-operative day. Placenta weighing around 50 g which was sent for histopathological study and foetus was sent for autopsy. Because of foetal demise and abortion, the post-operative recovery was delayed and patient was managed in ICU itself up to 9th post-operative day. On 10th post-operative day, the patient was shifted to general ward with tracheostomy tube in place. Tracheostomy tube was removed on 15th post-operative day. Patient was maintaining saturation (99% Spo2 in room air). On 18th post-operative day she was discharged. Patient was absolutely fine at 6 months of follow-up. She shared her experience as \"I am so grateful to the trauma team who have operated and save my life otherwise I would have not remain alive and boost-up my psychological level to start the normal life\".",
"gender": "Female"
}
] |
PMC7508689
|
[
{
"age": 39,
"case_id": "PMC8518698_01",
"case_text": "The patient was a newborn female infant with severe hypoxic-ischemic encephalopathy (HIE). She was born at a gestational age of 39 weeks 4 days by an emergency cesarean section because of non-reassuring fetal status. Her Apgar score was 3 and 5 at 1 min and 5 min, respectively. She was intubated soon after birth and underwent intensive treatment. Brain sonography showed diffuse brain edema and abnormally increased echogenicity, and EEG showed a burst suppression pattern on admission. However, brain hypothermia therapy could not be performed because of severe persistent pulmonary hypertension of the newborn. Brain magnetic resonance imaging (MRI) studies subsequently disclosed diffusely decreased apparent diffusion coefficient values at 2 days of age and multi-cystic encephalomalacia at 17 days of age. She depended on tube feeding that began in the neonatal period. Gastrostomy and tracheostomy were performed at 2 and 3 years of age, respectively. She has profound developmental delay without speech and is bed-ridden with severe tetraplegia until the present age of 8 years. Although she has shown involuntary movements (myoclonus) since infancy, she had no epileptic seizures after the neonatal period.\nFor her neonatal seizures that were observed from the first day of life to 13 days of age, we recorded a long-term eight-channel video-EEG with a sampling frequency at 500 Hz using a Nihon-Kohden Neurofax (EEG-1250, Nihon-Kohden, Tokyo, Japan). Electroencephalograms monitoring was done in an unshielded neonatal intensive care unit and no special shielding devices were used. We used passive Ag/AgCl electrodes and made an effort to maintain an electrode impedance of less than 10 kOmega during recording. She had focal motor seizures involving unilateral upper and lower limbs lasting for tens of seconds on days 0, 1, 4, 5, 8, and 9, and subclinical seizures on days 4-11. Phenobarbital (PB) was intravenously administered on days 0 (5 mg/kg), 2 (4 mg/kg), 4 (10 mg/kg), 5 (15 mg/kg), and 6 (10 mg/kg). Serum concentration of PB was 39.4 mug/ml at 6 days of age.\nAt 10 and 11 days of age, we found obvious fast activities superimposed on the ictal delta activities using visual inspection (Figure 1A). Therefore, we examined all artifact-free ictal EEGs through temporal expansion of traces and time-frequency spectral analysis. The conventional EEG traces were initially reviewed to identify the EEG seizures using a time constant of 0.3 s and a low-pass filter at 120 Hz. The traces of EEG seizures were then temporally expanded with a time constant of 0.03 s without any low-pass filter to study the details of the FOs. We built time-frequency spectra for EEG seizures by applying the Complex Demodulation Method (Nihon-Kohden Neuroworkbench ver. 07-03: frequency range, 10-150 Hz) to the artifact-free clear EEG data. Complex demodulation is a method to detect frequency components in the time course of EEG signals by computing the instantaneous frequency and momentary power. Table 1 shows daily information including the number of clinical seizures, clinical seizures with FOs (>40 Hz), subclinical seizures, subclinical seizures with FOs, and total duration of artifact-free EEG recording. We found FOs superimposed over delta waves in one clinical seizure and 42 subclinical focal seizures recorded at 8-11 days of age. Among them, we detected high-gamma (71.4-100 Hz) oscillations that had spectral peaks separate from those of low-gamma activities in the ictal EEG on 11 days of age (Figures 1B,C).",
"gender": "Female"
}
] |
PMC8518698
|
[
{
"age": 60,
"case_id": "PMC3083533_01",
"case_text": "A 60-year-old male smoker presented with cough, expectoration, and left-sided chest pain for the past one month. Chest radiograph revealed a mass lesion in the left upper lung [Figure 1]. Computed tomography (CT) of thorax revealed a heterogeneously enhancing lesion in the left hemithorax with the involvement of lung and a major portion of posterior mediastinum. Ultrasound-guided FNAC was performed and smears were stained with hematoxylin and eosin (H and E).\nSmears were highly cellular with a myxoid background. Cells were ovoid to spindle shaped with relatively uniform nuclei and thin cytoplasm. Focal areas showed a rich capillary network within the myxoid matrix and occasional large atypical cells, both univacuolated and multivacuolated having scalloped nuclei [Figures 2 and 3]. A differential diagnosis of fibrosarcoma was considered initially but ruled out on recognizing lipoblasts and the rich capillary network. The final diagnosis was given as a myxoid liposarcoma metastatic to lung and posterior mediastinum. Subsequently, the patient underwent a CT-guided biopsy. Histopathological examination showed a multinodular tumor of moderate cellularity with enhanced cellularity at the periphery. The individual tumor cells were seen in a myxoid matrix with a delicate plexiform capillary vascular network and many cells resembled mature adipocytes [Figure 4]. Univacuolar and multivacuolar lipoblasts were seen; some having large atypical nuclei with scalloped margins. The tumor showed immunoreactivity for S100 protein. The previous tumor in the thigh was reviewed and confirmed with immunohistochemical marker S100 as a myxoid liposarcoma. A diagnosis of classic myxoid liposarcoma in lung was given and in view of a previous history of excision of myxoid liposarcoma in the thigh the final diagnosis was signed out as a metastatic myxoid liposarcoma to lung and posterior mediastinum. Magnetic resonance imaging (MRI) revealed secondary deposits in liver also.\nThe patient was advised chemotherapy after surgery in the thigh but was lost to follow-up and came with the mediastinal mass. Chemotherapy was offered after the current resection. Six cycles of chemotherapy were advised and the patient is responding well.",
"gender": "Male"
}
] |
PMC3083533
|
[
{
"age": 64,
"case_id": "PMC9883726_01",
"case_text": "We present the case of a 64-year-old female with a history of chronic renal failure, on dialysis since she was 16 years old, who underwent 3 renal transplantations. The patient's history also included peripheral arteriopathy, stenting of the common right iliac artery and previous thoracic irradiation for breast cancer. The patient presented with Class III NYHA dyspnoea secondary to a double stenotic valvulopathy: a calcified aortic stenosis and a calcified MS. The society of thoracic surgeons (STS) score was 15.1% and the Euroscore 2 was 10.5%. Initial heart surgery consisted in aortic valve replacement with a 23 mm Edwards Carpentier Magna Ease and two coronary artery bypass graft surgery with left internal mammary artery at the left anterior descending artery and right internal mammary artery on the obtuse marginal. No surgical intervention could be performed as a treatment of the MS, as the mitral annulus and the subvalvular apparatus were highly calcified. After surgery, the patient presented with a massive acute pulmonary oedema requiring prolonged non-invasive ventilation sessions and intravenous diuretics dependence. Patient was sent to rehabilitation 2 weeks following cardiac surgery.\nA transoesophageal echocardiography (TEE) performed during hospital stay showed a much calcified stenotic mitral valve (mean gradient 15 mmHg and valve area at 1.01 cm2), a normally functioning aortic bioprosthesis and preserved left ventricular ejection fraction (LVEF) at 71% associated with a moderate circumferential LVH. The heart team decided to perform a ViMAC, as mitral surgery was not feasible and the patient's valvular anatomy was incompatible with balloon valvuloplasty (severely calcified valve, absence of commissural fusion). A preliminary feasibility assessment was carried out and included a cardiac computed tomography (CT) scan (Figure 1). The valvular area measurement was 642 mm2, leading to the choice of a 29 mm Sapien 3 bioprosthesis (Edwards Lifesciences, Irvine, CA, USA). The calcifications required for prosthesis anchoring, and in particular, the large and continuous calcifications of the posterior leaflet were clearly visible on the CT scan (Figure 1A) and were associated with a long and redundant anterior mitral leaflet (Figure 1B). The mitro-aortic angle measured 117.3 and the neo-LVOT area measurement (3mensio software) was 175.4 mm2 (Figure 1C). The left ventricular cavity was small, 73.9 mm by CT scan, and associated with a concentric LVH. Despite the high risk of LVOTO (neo-LVOT at 175 mm2), we decided to perform a TMVR because of the refractory symptomatology under optimal medical treatment.\nThe procedure was performed under general anaesthesia using TEE, via a right femoral venous route. After an echo-guided transseptal puncture, the mitral valve was crossed anterogradely with the help of an AGILIS L catheter. A Safari XS guidewire (Boston Scientific) was inserted in the left ventricle, the inter-atrial septum was predilated with a 14 mm balloon, and an Edwards 14 French sheath was inserted into the inferior vena cava. A 29 mm Edwards Sapien 3 balloon expandable prosthesis was then implanted under rapid pacing at 160 b.p.m. over the guidewire (see Supplementary material online, Video S1). Major low cardiac output occurred after the implantation, followed by a pulseless electrical activity which required cardiopulmonary resuscitation, chest compressions, and IV injection of 1 mg of adrenaline, repeated three times. TEE revealed a complete obstruction of the LVOT by the device and the anterior mitral leaflet, preventing the ventricular ejection, with still aortic leaflets (see Supplementary material online, Video S2).\nIn a situation of extreme emergency, we decided to insert a 10 French introducer (Terumo) in the left femoral artery and to place a second Safari XS guidewire in the left ventricle. A 23 mm balloon (Edwards Lifesciences) was introduced in the LVOT. We observed a deformation of the Edwards Sapien 3 prosthesis (Edwards Lifesciences) during balloon inflation (see Supplementary material online, Video S3), without any mobilization or embolization. The aortic balloon was sized according to the surgical aortic prosthesis dimension (23 mm).\nThe patient immediately recovered normal haemodynamic parameters and a correct systolic function. Echography images showed the aortic valve opening again and a non-obstructed LVOT.\nConsidering the initial LVH, and its intensification following the cardiac arrest, we decided to carry out an alcohol septal ablation via the second septal at the end of the procedure.\nPost-procedural course was uneventful both neurologically and haemodynamically, despite a 10 min low flow. The patient was discharged 13 days after the intervention. The echocardiographic assessment at discharge showed a normal biplane LVEF at 80%, normally functioning mitral bioprosthesis with a 3 mmHg mean gradient, only minimal paravalvular leak and an absence of significant LVOT obstruction with a 10 mmHg gradient.\nThe 2-year post-procedural follow-up is satisfactory with a significant symptomatic improvement: NYHA Class I dyspnoea. Two-year post-procedure trans-thoracic echocardiography showed a 68% LVEF with mild stenosis of prosthetic mitral valve (mean transprothestic gradient 4 mmHg) with no significant leak and no significant LVOTO (16 mmHg gradient; see Supplementary material online, Video S4), associated with septal thinning of the ablated zone.\nA CT scan without contrast medium showed an obvious, D-shaped deformation of the Sapien 3 valve (Edwards Lifesciences) caused by the inflated balloon used to treat the obstruction (Figure 2A). This deformation was also visible on the 3D reconstruction of the CT scan images (Figure 2B).",
"gender": "Female"
}
] |
PMC9883726
|
[
{
"age": 10,
"case_id": "PMC7429769_01",
"case_text": "A 10-year-old male castrated domestic shorthair cat presented to the author's hospital for progressive wheezing, increased respiratory effort, and dyspnea of 3 month's duration. On the day of presentation, the owners noted the cat occasionally had open mouth breathing and was breathing harder after walking up/down the stairs. The cat was taken to the primary care veterinarian 2 months prior, where radiographs revealed a soft tissue opacity in the trachea at the thoracic inlet. Tracheal collapse was suspected, and the cat was prescribed doxycycline (5 mg/kg PO q12h) and theophylline (100 mg PO q24h) which had no immediate effect on the clinical signs. The cat had an adverse reaction to the medications, causing hypersalivation, vocalization, and hyperactivity causing the owners to discontinue the medications. Following this, the primary care veterinarian recommended a surgical consultation.\nOn initial presentation, the cat was bright, alert, and responsive with pink and moist mucous membranes and a body condition score of 4/9. There was increased inspiratory and expiratory effort throughout the full respiratory cycle with wet sounding respiratory noises consistent with a partial tracheal obstruction. Cardio-thoracic auscultation revealed only moderate referred tracheal noises. The rest of the physical examination was unremarkable. The primary care veterinarian's radiographs were reviewed and were found to be most consistent with a soft tissue partial obstruction of the trachea at the thoracic inlet. Unfortunately, the thoracic limbs were positioned over the area of interest, making the radiographs difficult to fully assess.\nRecommendations included a computed tomography of the cervical and thoracic region for surgical planning as well as tracheoscopy to obtain a small cup biopsy for histopathologic diagnosis with the possibility for debulking under the same anesthesia. Based on the result of the histopathologic diagnosis, either chemotherapy (for lymphoma) or surgical tracheal R&A would be recommended. Alternatively, a tracheal R&A with histology of the mass could be performed without first obtaining a definitive diagnosis. Additionally, tracheal stenting was offered as a palliative maneuver. After discussing the risks versus benefits of different options, the owners decided to proceed with repeat radiographs and a tracheal R&A, forgoing any preliminary advanced diagnostics.\nThe cat was hospitalized and placed in an oxygen cage overnight in preparation for surgery the following day. A complete blood count and a chemistry profile showed a mild metabolic alkalosis with a total CO2 of 26 mmol/L (likely compensation to chronic hypoventilation and hypercapnia), a mildly elevated total protein (9.1), and a mild leukocytosis (27.1 k) due to a moderate eosinophilia (6 k), mild monocytosis (800), and mild neutrophilia (16.5 k). The remainder of the biochemistry panel was unremarkable. Vitals were normal (T: 100.5 F, P: 150 bpm, R: 24 bpm), and the cat's breathing pattern remained static overnight. The next morning, an IV catheter was placed, and the cat was premedicated with a bolus of fentanyl (4 mcg/kg IV once), induced with Valium (0.25 mg/kg IV) and propofol (4 mg/kg IV to effect). The patient was intubated routinely, using a 5.0 mm endotracheal tube, terminating rostral to the tracheal mass. Anesthesia was maintained with Isoflurane and a fentanyl continuous rate infusion (4-8 mcg/kg/h IV). When the trachea was not intubated during the procedure (see below), propofol was used IV for total intravenous anesthesia (TIVA) as needed to maintain an adequate plane of anesthesia until reintubation. The cat was placed on a mechanical ventilator with the pressure set to 5 cmH2O and a rate of 5 breaths per minute. The cat was given prophylactic antibiotics of cefazolin (22 mg/kg IV q90 minutes) twice during the surgery. Intravenous isotonic crystalloids were run at 5 ml/kg/h during the surgery. Monitoring and support included capnography, pulse oximetry, esophageal temperature, blood pressure (doppler and oscillometric), and telemetry as well as a forced warm air circulator and a fluid line warmer for thermal support. Preoperative radiographs were obtained (Figure 1) which showed an approximately 2 cm intraluminal tracheal mass at the level of the thoracic inlet obstructing >50% of the tracheal lumen.\nA ventral, cervical, midline incision with a partial cranial sternotomy was performed. The cranial half-sternotomy was made using a battery-operated oscillating saw. The trachea was freed from surrounding tissues using blunt dissection. Upon inspection of the trachea, there was a 2 cm lymph node on the left lateral aspect of the trachea just cranial to the thoracic inlet. At the thoracic inlet, there was a firm, multinodular mass associated with approximately 2.2 cm of the trachea that was obstructing greater than 50% of the lumen. The local cervical lymph node was removed and submitted for histopathology. After placing vessel loops, stay sutures, and preplaced appositional sutures, the trachea was transected caudal to the mass. A sterile 4.5 mm tube was then placed through the surgical site and into the caudal tracheal segment to allow for continued mechanical ventilation and maintenance with isoflurane and oxygen. Approximately, 3 cm (corresponding to 5 tracheal rings) was resected, creating approximately 4-5 mm visual margins cranial and caudal from the gross tumor. The mass and associated trachea were submitted for histopathology. The oral endotracheal tube was exchanged for a sterile 4.5 mm endotracheal tube. The sterile endotracheal tube entering the caudal segment of the trachea through the surgical site was then removed, and the oral endotracheal tube was advanced past the resection site into the caudal segment. The preplaced 4-0 prolene appositional sutures were tightened and were tied off in order to obtain tracheal segment apposition. 4-0 polypropylene sutures were used in a simple interrupted pattern to complete the anastomosis. The dorsal tracheal membrane was friable and did not hold sutures well creating a small tracheal tear. A 1 x 2.5 cm segment of the sternohyoid muscle was harvested and placed over the dorsal aspect of the trachea to reconstruct this defect. This was sutured in place using simple interrupted 4-0 polydioxanone. The endotracheal tube was deflated, repositioned cranial to the tracheal incision, and reinflated. This was used to pressure check the trachea which pressure checked appropriately up to 20 cmH2O. A 12Ga x 20 cm single lumen radiopaque polyurethane thoracostomy tube with multiple fenestrations was placed on the right hemithorax and sutured in place. The surgical site was then routinely closed using 3-0 polydioxanone, 3-0 poliglecaprone, and skin staples. Liposomal bupivacaine was injected along the incisional line during closure. The thoracostomy tube was aspirated until subatmospheric pressure was obtained. Postoperative radiographs were taken and revealed mild tracheal narrowing at the location of the anastomosis (Figure 2).\nThe cat was extubated and recovered routinely with pulse oximetry (SpO2) readings of 98%. Supplemental oxygen was provided for the first 2 hours after extubation as a precaution. In the oxygen cage, the patient was breathing easily with SpO2 monitoring remaining >98%. The patient was then weaned to room air with SpO2 monitoring remaining >98% overnight with a normal breathing pattern and effort. Postoperative analgesia consisted of a fentanyl CRI for 4hours, a fentanyl transdermal patch (12mcg/h) placed upon recovery, robenacoxib (2 mg/kg SQ), and gabapentin 10 mg/kg PO q8h. Isotonic crystalloids were continued at 1x maintenance (45 ml/kg/24 h) overnight. Cold compressing of the incision continued q4h during his hospital stay. To avoid anxiety-related respiratory complications, the cat was administered trazodone at 5 mg/kg PO q8h postoperatively. This caused excessive sedation, so trazodone was discontinued the following day, and gabapentin was decreased to 5 mg/kg PO q8h. Thoracostomy tube aspirations yielded minimal fluid (<0.25 ml/h) for over 24 h and was removed 24 hours after surgery. Robenacoxib was transitioned to the oral formulation (6 mg PO q24h) the day following surgery. Forty-eight hours after surgery, the cat was alert, eating, and comfortable and was breathing easily with minimal referred upper airway noise. The cat was discharged to the owner on the third day with 3 days of robenacoxib (6 mg PO q24h), 12 mcg fentanyl transdermal patch, 2 weeks of liquid gabapentin (5 mg/kg PO q8-12h), and 2 weeks of liquid amoxicillin/clavulanic acid (13.75 mg/kg PO q12h).\nHistopathological analysis of the submitted tissue revealed an incompletely excised squamous cell carcinoma originating from the tracheal mucosa with neoplastic cells noted at the cut edges cranially and caudally. The mass itself is composed of many irregular lobules of neoplastic squamous epithelial cells with central cystic areas within many lobules containing amorphous eosinophilic debris and neutrophils. The neoplastic tissue is noted to have 14 mitotic figures seen per 10 high power fields. This tissue is invading the lamina propria as well as into and through the tracheal cartilage. No lymphatic emboli were noted on the histopathology report. Histopathology of the local cervical lymph node showed no evidence of metastasis. These results were relayed to the owner, and further options including revisional surgery, radiation therapy, or chemotherapy were discussed.\nSeventeen days postoperatively the cat was presented for staple removal. The owners stated that the cat was acting normally at home, vocalizing normally and eating/drinking readily. Physical examination revealed a well-healed skin incision. The cat was eupneic with no tracheal sensitivity nor discomfort. No abnormal noise was noted on thoracic and tracheal auscultation. It was recommended to keep the cat's activity restricted for one more week and then reintroduce him back to his normal routine. A consultation with an oncologist was recommended with the option for a revisional surgery vs radiotherapy or chemotherapy being revisited. At the time of last phone recheck (120 days postoperatively), no further treatments have been initiated and a consultation appointment with the oncologist was canceled. The owners were contacted just prior to article submission, and the cat was acting normally at home with no clinical signs of recurrence.",
"gender": "Male"
}
] |
PMC7429769
|
[
{
"age": 0,
"case_id": "PMC8551767_01",
"case_text": "The cat described here was an adult, intact, female domestic short-haired cat. Although it was kept outdoors with other cats, it was the only clinically affected one. The cat was presented to the Veterinary Teaching Hospital, Faculty of Veterinary Medicine, Khon Kean University, because of feet problems. Physical examination revealed ulceration and swelling of all feet, mainly on the hindlimbs (Figure 1A). The lesions were 1 week old. The other vital signs, including appetite, heart rate, respiratory rate, mucous membrane color and hydration status, were within the normal ranges. Wound dressing accompanied with amoxicillin-clavulanic acid administration was performed, which partly improved the lesions. Subsequently, a punch biopsy was performed at the edge of the ulcerative wound 3 days after the first visit. Ulcerative, pyogranulomatous and eosinophilic pododermatitis with nematodes was diagnosed histopathologically. The cat was treated with wound dressing and additional treatment with emodepsine/praziquantel (Profender spot-on, Bayer); the skin lesions recovered within 3 days post-anthelmintic treatment and completely recovered after 2 weeks (Figure 1B).\nThe skin for the biopsy was fixed with 10% buffered formalin and embedded in paraffin wax. The paraffin-embedded specimen was cut into 4-mum thick slices and stained with haematoxylin and eosin (HE) for histopathological examination.\nMicroscopically, the ulceration and some hyperplasia of the epidermis could be observed. The cross-section of the nematode was noticed in the epidermis and dermis (Figure 2). Figure 3 shows inflammatory cell infiltration. The nematode was 135-150 mum in diameter and characterized by a striated cuticle, hypodermal musculature, pseudocoelom, and a uterus containing eggs; eggs were also accumulated next to the adult. The egg was oval, 30 x 55 mum in size, with a bi-operculate thick wall (Figure 3). Infiltration of mixed inflammatory cells including neutrophils, macrophages and eosinophils was noted at the dermis, accompanied by necrosis (Figure 3).\nFormalin-fixed paraffin-embedded samples were pooled and used for DNA extraction applying the QIAamp DNA FFPE Tissue Kit. The parasite species were identified via PCR targeting of the 18S rRNA gene, using a customized primer, ANT-F (5'ATGGCCGTTCTTAGTTGGTG'3) and ANT-R (5'CGCTGA CGCTTTCAGTG TAG'3). Primers were designed based on the Anatrichosoma spp. 18S rRNA sequence (KU215886) using Primer3 (version 0.4.0). The expected product was 213 base pairs. The PCR reaction mix contained 10 mul of 2 x ViRed Taq Master Mix (Vivantis, Malaysia), 0.5 muM of each primer and 4 mul of DNA. The conditions were initially 94 C for 5 min for pre-denaturation and followed by 35 cycles at 94 C for 30 s, 55 C for 30 s, 72 C for 30 s and final extension steps at 72 C for 10 min. The PCR products were run with gel electrophoresis and submitted to sanger sequencing. Anatrichosoma spp. DNA (positive control) was not used on PCR amplification while distilled water was used as the negative control. However, PCR was conducted twice separately and both expected products were submitted to sequencing. The results were identity. The sequence was aligned using BioEdit software (version 7.0.5.3) with several species of the order Trichinellida submitted in GenBank (https://www.ncbi.nlm.nih.gov/). A phylogenetic tree from the sequence of partial 18S rRNA was constructed employing Maximum likelihood methods using the Kimura 2-parameter for the substitution model. The phylograms were statistically tested using a Bootstrap method with 1,000 replications. Taenia taeniaeformis (EU051351) was set as an out group. The phylogenetic tree was produced using MEGA X software and constructed using fragment 18S rRNA sequences of several species of the order Trichinellida. The sequences were grouped into three clusters: Trichuris/Capillaria spp., Trichinella spp. and Anatrichosoma spp. (Figure 4).\nThe Anatrichosoma spp. obtained from this study (Accession number OK044796) has 99.00% identity with Anatrichosoma spp. from the olive glass mouse (Abrothrix olivacea) (KU215886). Anatrichosoma spp. found in this study (OK044796) was placed in the Anatrichosoma spp. cluster, which included Anatrichosoma spp. from the olive glass mouse (Abrothrix olivacea) (KU215886) and both Capillaria plica and Eucoleus aerophilus from the red fox (Vulpes vulpes).",
"gender": "Female"
}
] |
PMC8551767
|
[
{
"age": 91,
"case_id": "PMC8717000_01",
"case_text": "A 91-year-old woman, never smoker, nursing home resident, totally dependent for daily life activities and with history of arterial hypertension, hyperlipidemia (but no other known cardiovascular risk factors), chronic kidney disease, chronic bronchitis and a previous stroke on the left middle cerebral artery territory, chronically medicated with acetylsalicylic acid 150mg/day, simvastatin 20mg/day, folic acid 5mg/day, oral iron supplementation and fluticasone/formoterol by pressurized inhalers. She was carried to Emergency Department (ED) with history of weakness, altered mental status and pallor of the lower limbs, starting in the morning of that day.\nOne week before, she had already been brought to the ED because of high blood pressure with vomiting and pain during mobilization. At that occasion, thorax and abdominal x-rays were performed, both without major abnormalities. Arterial blood gas analysis, blood count, blood chemistry and urine analysis were also within normal limits. Brain scan was also performed and showed signs of ischemic leukoencephalopathy and sequelae of left parasagittal protuberance vascular lesion. After administration of hypotensive medication, she got mild BP control and was discharged.\nOn admission at current episode, the patient was conscious but unable to communicate or follow simple orders. On physical examination, she had cooling and marked pallor of the lower limbs, besides marbled skin proximal at both thighs. Femoral, popliteal and dorsalis pedis pulses were also absent, on both limbs. Upper limb BP (measured at right arm) was 162/88 mmHg. Lower limb BP was only measurable on the left leg, with a value of 28/11 mmHg, corresponding to an ankle-brachial index of 0.173. The diagnosis of bilateral lower limb ischemia was considered. Labs revealed normal hemoglobin and platelets, but leukocytosis and a normal coagulation profile. D-dimers, NT-proBNP, troponin and CK were not measured on admission. Since there was no available doppler device at the ED, it was not possible to evaluate arterial or venous signals, but based on clinical findings, since there was no reaction to pain or capacity to move both lower limbs, it was assumed the patient was on Stage III, regarding the Classification Scheme for Acute Limb Ischemia. Abdominal, pelvic and lower limbs CT were performed, revealing calcification and important atheromatosis of the thoracic-abdominal aorta and mural thrombus beginning above the origin of the celiac trunk, causing complete occlusion below the origin of the renal arteries (Figures 1 and 2). There was no evidence of thrombus at other sites and no evidence of distal embolization. Also, there were no relevant anatomic abnormalities of the thoracic-abdominal aorta. At the lower limbs there were no signs of hematomas, organized collections or evidence of compartment syndrome.\nThe reference vascular surgery department was contacted. After discussion, given the time elapsed, the advanced age and co-morbidities of this patient, she was considered not benefiting from surgery. Therefore, morphine perfusion at 4 mg/h was started in order to achieve pain control and provide the maximum comfort possible. The patient died 6 hours after admission.",
"gender": "Female"
}
] |
PMC8717000
|
[
{
"age": 55,
"case_id": "PMC5624160_01",
"case_text": "This is the case of a 55-year-old African American female, with past medical history of hypertension and illicit drug use, who presented with worsening productive cough. The patient stated that the cough had been ongoing for the past 5 months but had worsened in severity over the last 2 weeks prior to admission. She complained of associated fever and chills for two days, sore throat, and copious white sputum. She denied shortness of breath, wheezing, and pleuritic chest pain. She also denied having hemoptysis. Patient denied having had any recent exposure to sick individuals. She is a 40-pack-year smoker, drinks alcohol socially, and admits drug use.\nUpon admission temperature was 98.1 F, blood pressure 112/61, heart rate 92 beats per minute, respiratory rate 18 breaths per minute, and saturation 99% in room air. Physical examination was significant for left lower lobe rhonchi without wheezing or rales. Laboratory studies were significant for elevated leukocyte count of 13.0 x 103/muL with a negative procalcitonin level. All other laboratory values were within normal limits. Urine drug screen was positive for opiates.\nChest X-ray revealed left-sided infiltrative pattern (Figures 1(a) and 1(b)). A CT scan of the chest (Figures 2(a) and 2(b)) showed left-sided pneumonia involving the lingula and posterior basal segment and endobronchial occlusion of the posterior segment of the left lower lobe, possibly foreign body, not present on prior chest X-ray. Patient is subsequently scheduled for bronchoscopy.\nPrior to bronchoscopy, the patient disclosed additional information about her social history. She stated that 5 months prior to the admission, she was abusing cocaine and during an altercation with law enforcement she attempted to ingest a vial of cocaine. Bronchoscopy was performed, which revealed a significant circumferential inflammation of the left lower lobe segment and a foreign body noted in the postbasal left lower lobe bronchus. The foreign body was successfully removed with biopsy forceps, revealing a synthetic vial measuring 3.2 x 0.7 x 0.7 cm (Figure 3).\nFollowing bronchoscopy, the patient's cough improved significantly. She denied having shortness of breath, wheezing, and fever. Patient was sent home with oral antibiotics along with her home medications.",
"gender": "Female"
}
] |
PMC5624160
|
[
{
"age": null,
"case_id": "PMC8506038_01",
"case_text": "The patient was a third child of unrelated parents and was born in February 2003. He had two sisters, both of whom were in good health. However, his grandmother has a history of uremia. At 2 years of age, the patient was admitted to The Second Xiangya Hospital of Central South University due to polydipsia, polyuria, and weakness of lower extremities. The 24-h urine output was about 4,000 ml, and the blood pressure was normal (90/50 mmHg). Laboratory tests showed normal serum creatinine level (57.8 umol/l), while low levels of serum sodium (110.4 mmol/l), potassium (2.02 mmol/l), chlorine (83.5 mmol/l) and phosphorus (0.45 mmol/l) were reported (Table 1). Serum calcium (2.38 mmol/l) and magnesium (1 mmol/l) were within normal values. The patient had metabolic acidosis (pH 7.321,HCO3-14.2mmol/l), but his urine calcium level was normal (0.067 mmol/kg d). The physical examination of the eye and hearing was normal. He was diagnosed with Bartter syndrome, based on clinical manifestations and laboratory tests, and treatment began with potassium chloride sustained-release tablets, captopril, sodium bicarbonate, and calcitriol.",
"gender": "Male"
},
{
"age": null,
"case_id": "PMC8506038_02",
"case_text": "Symptoms such as polydipsia and polyuria were significantly improved after treatment. The urine protein levels fluctuated from + to 2+, and serum potassium level was maintained at a normal low level. In order to control urinary protein, the patients were treated with prednisone and mycophenolate mofetil in 2015. However, despite medical interventions, the patient developed chronic kidney disease stage 4 at 13 years of age. To determine the pathological condition of the kidney, a renal biopsy was performed in 2016. Light microscopy of renal tissue showing focal segmental glomerulosclerosis and renal interstitial fibrosis. Electron microscopy of renal tissue showing mild glomerular lesion, no parabulbar organs, renal tubular epithelial edema and interstitial fibrous hyperplasia. Ultrasonography of our patient's in 2020 showed diffuse parenchymal lesions of both kidneys and multiple cysts in both kidneys.",
"gender": "Unknown"
},
{
"age": null,
"case_id": "PMC8506038_03",
"case_text": "Although the patient was initially diagnosed with Bartter syndrome, the symptoms were not typical. First, there was no obvious metabolic alkalosis and the patient had long-standing proteinuria. Second, most patients with Bartter syndrome have normal renal function and good prognosis, while our patient developed chronic kidney disease stage 4 at 13 years of age, which is relatively rare in Bartter syndrome. Third, the main pathological feature of Bartter syndrome is the proliferation and hypertrophy of para-glomerular organs and the renal biopsy showed focal segmental glomerulosclerosis and interstitial fibrosis, which are rare in Bartter syndrome. Therefore, genetic testing was suggested and performed. The parents provide informed consent, and 2-3 ml of peripheral blood from both the child and parents were taken and used for genetic testing. The results showed a CLCN5 gene c. 941C > T mutation (p.S314L), with the mother being a heterozygous carrier at this site. No mutation was detected in the pathogenic gene of Bartter syndrome. The patient was finally diagnosed with Dent disease 1.",
"gender": "Unknown"
}
] |
PMC8506038
|
[
{
"age": 29,
"case_id": "PMC8832095_01",
"case_text": "A 29-year-old female visited our center for refractive surgery. Her manifest refraction was -20.5 -1.0 x 180 in the right eye and -21.0 -1.5 x 4 in the left eye with corrected distance visual acuity (CDVA) of 20/30 and 20/32, respectively. Axial length was 30.30 mm in the right and 30.04 mm in the left eye. The keratometry was 40.52@175/41.82@85 and 41.11@6/42.19@96, respectively. The white to white was 12.1 mm in both eyes. After excluding the traumatic history and systemic diseases, EPRL (Aijinglun Technology Co., Hangzhou, China) implantation was suggested considering the myopia of the patient was beyond -18D, which is the correction limit of ICL.\nEjinn phakic refractory lens (EPRL) model BK113 of -20.5D (11.3 mm diameter) and -21.0D (11.3 mm diameter) were implanted in both eyes, respectively, under topical anesthesia. Laser peripheral iridectomy was performed 3 months before surgery. No immediate complications occurred during the operation. At 1 month follow-up, the uncorrected distance visual acuity (UDVA) was 20/20 bilaterally. Slit-lamp examination and ultrasound biomicroscopy (UBM) showed the centered and proper location of EPRL. Intraocular pressure was 15 and 18 mmHg in both eyes.\nTwenty-six months post-operatively, the patient presented at our center complaining of suddenly blurry right eye vision. The UDVA was 0.15. Slit-lamp examination showed dislocation of the EPRL (Figure 1A). Removal of dislocated EPRL through clear cornea incision was arranged. However, the dislocated EPRL disappeared from the posterior chamber when she came to our center for surgery 2 days later. No phacodonesis or significant zonular weakness was observed in this eye (Figure 1C). Fundus examination showed a luxated EPRL located in front of the retina (Figure 1B). Pars plana vitrectomy, using diffuse illumination through 23-gauge cannulas, was performed to remove the EPRL. After careful vitreous dissection, fluorinated perfluorocarbon (Carl Zeiss Meditec AD, Germany) was injected to make the EPRL detach from the retina. Once floating on the top of the fluorinated perfluorocarbon bubble, the EPRL was grasped and cut into two equal pieces along the long axis (Figure 2A). Then, foreign forceps were used to gently grab each piece and remove them from the vitreous cavity (Figure 2B) through temporal sclerotomy, which was enlarged into 2.5 mm. Sclerotomies were sutured after the examination of the retina (Supplementary Video 1).\nAt 6-month follow-up, the manifest refraction was -20.0 -1.5 x 176 in the right eye with CDVA of 20/30. The refractive error of this eye was corrected by wearing a contact lens.",
"gender": "Female"
}
] |
PMC8832095
|
[
{
"age": 79,
"case_id": "PMC9198785_01",
"case_text": "A 79-year-old woman with five years of education accessed our Emergency Unit for a syncope. Her medical records included chronic atrial fibrillation, hypertension, chronic obstructive pulmonary disease, left coxarthrosis, and depression. The patient was under treatment with oral direct anticoagulant (apixaban), angiotensin receptor blocker, bisoprolol, furosemide, salmeterol/fluticasone, and bromazepam. The neurological examination was normal. Her cognitive and functional performances were unimpaired. The dosage of apixaban activity was in range. The computed tomography (CT) of the brain was negative, whereas angiography CT showed a lack of opacification of the P1 tract of the right posterior cerebral artery. Due to apixaban therapy, the patient was not eligible for systemic fibrinolysis. According to interventional radiology, eligible criteria for mechanical thrombolysis were also not met.\nThe patient was admitted to our Neurology Clinic, and a brain CT was repeated after 48 h, which was negative for recent ischemic lesions. After three days from the hospitalization, the patient experienced an episode of mixed delirium, assessed by 4AT test and represented by a combination of hyperactive (i.e., restlessness, psychomotor agitation, and aggressiveness) and hypoactive symptoms (i.e., reduced motor activity and drowsiness). The symptoms were treated with benzodiazepine and quetiapine. A spectral analysis electroencephalogram (QEEG) was performed (Fig. 1a), which showed a dominant frequency (DF) in the pre-alpha band (7.5 Hz) with a dominant frequency variability (DFV) of 2 Hz, typical of the early stages of DLB. At discharge, after seven days, her neurological examination was completely negative.\nAt six-month follow-up, the patient (confirmed by her relatives) reported attentive deficits with CF and the presence of RBD occurring over the past year. The neurological examination revealed moderate signs of parkinsonism (Unified Parkinson's Disease Rating Scale, UPDRS-III = 15). Cognitive performances were tested with a complete neuropsychological assessment (Table 1), including the Montreal Cognitive Assessment (MoCA), which showed a score of 15/30 (normal value > 26/30). QEEG recording confirmed the presence of a DLB-typical pattern (DF = 7.5 Hz, DFV = 2.5 Hz) (Fig. 1a). The patient underwent a 18F-fluorodeoxyglucose (18F-FDG) positron emission tomography (PET)/CT, which showed a moderate bilateral posterior hypometabolism (occipital and temporal cortex), with relative sparing of the posterior cingulate cortex compared to cuneus/precuneus (Cingulate Island sign), and mild bilateral hypometabolism in frontal regions. This pattern was suggestive of DLB diagnosis (Fig. 1b).\nAccording with a final diagnosis of probable DLB, treatment with rivastigmine patch (4.6 mg/24 h), levodopa/benserazide (100/25 mg three times a day), and clonazepam (1 mg before bedtime) was started.",
"gender": "Female"
}
] |
PMC9198785
|
[
{
"age": 20,
"case_id": "PMC3838809_01",
"case_text": "A 20-year-old Caucasian male, previously healthy, presented to our hospital with a 10-day history of abdominal pain, more intense in the right lower quadrant. He complained from fever and worsening of the pain in the last 3 days. He denied bloody stools, nausea, or vomiting. The only relevant finding on the physical examination was tenderness in the right lower quadrant. Initial laboratory tests showed increased white blood cell counts (18.97 x 109/L) and increased C-reactive protein (306.2 mg/L). Liver enzyme levels were elevated (aspartate aminotransferase:58 IU/L; alanine aminotransferase:59 IU/L; gamma-glutamyltransferase:169 IU/L; alkaline phosphatase:127 IU/L). \nAbdominal and pelvic contrast-enhanced CT study was performed. It revealed a dilated, hyperenhancing appendix, with surrounding mesenteric densification, indicative of acute appendicitis (Figure 1). There was an acute thrombus distending the lumen of the superior mesenteric vein and its tributaries, with inflammatory changes in the surrounding fat (Figure 2). There was also portal vein thrombosis (Figure 3). \nAt laparotomy, acute appendicitis was confirmed and appendectomy was performed. After a two-week course of antibiotics and anticoagulation, the patient had clinical improvement with almost complete normalization of the laboratory tests results. He was discharged without symptoms.\nTwo months later, the patient was in perfect clinical condition. Abdominal and pelvic evaluation with ultrasound demonstrated cavernomatous transformation of the portal vein (Figure 4). No other changes were seen.",
"gender": "Male"
}
] |
PMC3838809
|
[
{
"age": 52,
"case_id": "PMC8718908_01",
"case_text": "Such cause-effect relations between cytokines and lupus symptoms have already been shown for soluble tumor necrosis factor receptor 55kD (sTNF-R55) - a Th1 cytokine associated with clinical and subclinical SLE disease activity - in a previous study applying the integrative single-case design. The integrative single-case design is different from conventional methodology in that it uses time-series analysis and qualitative tools to investigate real-life cause-effect relationships between various biological, psychological and social variables under conditions of \"life as it is lived\". The study mentioned above was conducted with a 52-year-old woman with infrequently occurring, minor SLE symptoms not requiring steroidal or immunosuppressive drug therapy. In order to preserve the patient's normal routine as much as possible, proteinuria and cytokine levels were determined in 12 h urine samples to serially monitor these parameters non-invasively. Moreover, instead of having to see a physician every 12 hours, the patient used 100 mm visual analogue scales (VAS) to self-determine the presence of several specific (i.e. oral ulcers, facial rash and joint pain) and nonspecific SLE symptoms (i.e. fatigue, tiredness and body temperature). This procedure contributes to the high ecological validity of the study design.\nIn that study, we found that sTNF-R55 showed bidirectional cause-effect relations when cross-correlated with SLE symptoms. In particular, increased urinary sTNF-R55 concentrations preceded decreased urinary protein levels by 36-48 h, and, in the opposite direction of effect, increased urinary protein levels preceded increased urinary sTNF-R55 concentrations by 24-36 h. Furthermore, increases in urinary sTNF-R55 levels preceded increases in oral ulcers by 36-48 h, and increases in oral ulceration preceded decreases in urinary sTNF-R55 levels by 36-48 h. These cross-correlations in both directions of effect indicate feedback loops between sTNF-R55 and SLE symptoms. For example, elevated sTNF-R55 levels may have inhibited clearance of protein from circulation, while decreased protein clearance may have then resulted in decreased sTNF-R55 concentrations either per se or via an as yet unknown counterregulatory mechanism.\nSimilar bidirectional mechanisms might characterize the relationship between IL-6 and SLE symptoms. Both TNF-alpha and IL-6 are able to regulate the Th1/Th2/Th17/Treg balance, which plays a prominent role in autoimmune pathogenesis via feedback loops, and therefore contribute to the maintenance of immunological homeostasis.\nThe present article deals with a re-evaluation of the above-mentioned integrative single-case study and takes advantage of the opportunity to not only cross-correlate IL-6 and SLE symptoms (i.e. proteinuria, oral ulcers, facial rash, joint pain, fatigue, tiredness, body temperature) in the same patient but also to compare them with the findings on the relation between sTNF-R55 and SLE symptoms described above. Ultimately, this research strategy allows us to investigate the potentially diverse functional roles of sTNF-R55 and IL-6 in SLE.",
"gender": "Female"
}
] |
PMC8718908
|
[
{
"age": 53,
"case_id": "PMC6702817_01",
"case_text": "A 53-year-old African American male, ex-railroad worker, presented with back pain and acute worsening of right arm and bilateral lower extremity weakness and spasticity, disabling him from moving from the bed to his rolling walker.",
"gender": "Male"
},
{
"age": 48,
"case_id": "PMC6702817_02",
"case_text": "His past medical history consisted of a motor vehicle accident with open reduction internal fixation of the left ankle, heroin and cocaine use now on daily methadone, and chronic back pain, the MVA being a possible contributor. He had multiple admissions since March 2014, when he was 48 years old, for back and leg pain with lower extremity weakness. Imaging at the time showed extensive multilevel disc herniation, arthropathy, and foraminal stenosis in the cervical and lumbar regions. He reported self-medicating with oxycodone and sniffing heroin, as he stated it would alleviate muscle stiffness and pain and help him walk better. Over multiple ED visits, he was discharged on naproxen and advised to follow-up as an outpatient with a neurologist but was unable due to incarceration and lack of transportation after loss of driving capability. His weakness progressed from needing no assistance, to cane support, to rolling walker. On each presentation, the pain was described as sharp and stabbing, associated with intermittent numbness and tingling. Family history was only significant for hypertension. Social history significant for 30 pack-year tobacco use, substance abuse as mentioned, and occasional alcohol consumption. He had no allergies, and a review of systems was negative for current urinary/bowel changes, fevers, chills, weight loss, eye pain, or changes in appetite.\nOn physical exam, vital signs were T 36.8 C, HR 72 bpm, BP 140/89 mmHg, RR 18 breaths/min, SaO2 99% on room air, and BMI 23.4. He was a tall, lean man, with a child-like demeanor and had difficulty processing, repeating, and retaining new terms. Pertinent findings demonstrated hypertonicity of muscles through right arm and bilaterally in thighs, calves, and ankles. Patellar and Achilles' reflexes were 3+ bilaterally, and right brachioradialis and triceps were 3+. Left upper extremity reflexes were 2+. He had a \"swinging gait\" where he would hold his walker and swing one leg, lock, and then swing the other leg. The remainder of his physical exam was unremarkable.\nLab work was unremarkable except for anemia with hemoglobin of 10.4 g/dL and borderline low calcium of 8.7 mg/dL. Prior autoimmune labs of ANA, RPR, anti-Scl 70, antihistone, anti-dsDNA, anti-Smith, anti-SSA/SSB, anti-RNP, and RH factor were all negative. The 25-hydroxy vit D level was low at 24 nmol/L. A CT lumbar spine showed similar findings to prior CT scans of facet joint arthropathy, foraminal stenosis, and nerve root compressions from L1 down. However, there was a new T2 hyperintense lesion at the conus medullaris at the T12/L1 level, measuring 1 cm in diameter, read as suggestive of demyelinating disease. A brain MRI showed similar areas of patchy white matter changes to prior brain MRI from April 2016, with an increased number of periventricular white matter changes that had abnormal diffusion on FLAIR signal, highly suggestive of demyelinating disease (Figures 1 and 2); however, no acute demyelination was deemed visible in the brain. A MRI cervical spine also showed abnormal T2 FLAIR enhancement from C2 to C6, suggestive of chronic demyelination (Figure 3). No optic nerve involvement was seen. A lumbar puncture was performed, with colorless CSF, with minimal RBC, WBC, and no evidence of infection. CSF myelin basic protein came back first, which was negative.\nUsing the McDonald criteria, he was diagnosed with MS based on clinical presentation and imaging findings, likely progressive-relapsing subtype based on the history. He was treated with 5 days of high-dose methylprednisolone, his symptoms drastically improved, and he was discharged with close follow-up to an MS specialist. After the patient's discharge, CSF IgG oligoclonal bands came back significantly positive, which were not seen in the patient's serum.",
"gender": "Male"
}
] |
PMC6702817
|
[
{
"age": 60,
"case_id": "PMC5602351_01",
"case_text": "A 60-year-old gentleman with past medical history of cervical disk herniation presented with a 3-year history of progressive fatigue and bilateral upper extremity weakness. MRI was performed to evaluate the spine and was consistent with cervical spinal stenosis. T2 non-contrast images incidentally revealed an infiltrating mass in the left thyroid that was incompletely visualized. Ultrasound-guided fine needle aspiration showed atypia of undetermined significance. The patient was referred to surgery and was noted to have dysphonia but no stridor or dysphagia. The differential diagnosis was felt to include papillary thyroid carcinoma, follicular thyroid carcinoma, rare thyroid neoplasms including Hurthle cell carcinoma or anaplastic carcinoma, abscess, or autoimmune thyroid disease. He underwent total thyroidectomy with central neck dissection. On exploration, the thyroid mass was seen encasing the left recurrent laryngeal nerve and was shaved off the nerve and the trachea. The nerve was not stimulatable after resection and the patient developed left vocal cord paralysis. The tumor grossly measured 7 cm with extrathyroidal extension. There was lymphvascular space invasion and perineural invasion. Three lymph nodes were identified, and all were negative. Surgical margins had extensive involvement of tumor. Histopathologic analysis of the specimen showed high-grade carcinoma with thymus-like differentiation. Immunohistochemical staining was positive for pan-CK, p63 (cyokeratin and epithelial markers) and negative for chromogranin, thyroglobulin, and calcitonin (neuroendocrine, papillary and follicular thyroid, and medullary makers, respectively).\nThe tumor was arranged in broad, pushing, smooth-bordered islands abutted against a lymphocyte rich stroma. The lobules of tumor were surrounded by lymphocytes and plasma cells (Figures 1 and 2). The tumor cells were squamoid and syncytial to spindled, with eosinophilic cytoplasm, and the nuclei show mild pleomorphism with pale vesicular chromatin. The neoplastic cells were strongly immunoreactive for pancytokeratin and p63, as shown in Figures 3 and 4. These cells were also strongly positive for CD5, which marks background T lymphocytes (Figure 5). The neoplastic cells were non-reactive with TTF1 and thyroglobulin.\nPostoperative staging surveillance with PET scan was performed for systemic staging and due to positive margins. It showed no abnormal FDG uptake at distant sites and increased uptake at the operative bed, indeterminate between residual disease and postoperative changes. The patient underwent adjuvant treatment with radiation therapy to 64 Gy in 32 fractions with intensity modulated radiotherapy. Concurrent chemotherapy was given based on his extensive positive margins for radiosensitization. A dose of 60 Gy was delivered to the bilateral neck including paratracheal nodes into the upper mediastinum, with a 4 Gy sequential boost to the operative site. A coronal section of the radiotherapy plan is shown in Figure 6. Six cycles of intravenous concurrent cisplatin 35 mg/m2 were infused. During therapy, he developed grade 2 skin reaction characterized by dry desquamation and moderate erythema of the neck and upper chest. Skin moisturizer was used for therapy. He experienced grade 2 esophagitis and mucositis of the oropharynx and grade 2 nausea requiring topical analgesics, oral narcotics, antiemetics, and intravenous fluid administration. Weight decreased from 108 to 95.5 kg by the end of therapy. Nutritional counseling by dietician and oral nutritional supplementation were provided. With chemotherapy, the patient developed a tinnitus grade 1. Toxicities are reported per the Common Terminology Criteria for Adverse Events.\nAfter treatment, the patient initially experienced continued weight loss, and as a result underwent percutaneous endoscopic gastrostomy tube placement. Five months after end of treatment, the tube was removed after the patient was able to gain significant weight and completely obtain nutrition per oral route for 6 weeks. Dysphagia to solid foods is improving. He experienced persistent dysphonia secondary to left vocal cord paralysis since surgery and underwent left medialization thyroplasty 1 year later. He displayed improvement in voice quality. At 3-years follow-up after completion of radiotherapy, our patient is without evidence of locally recurrent or distant disease.",
"gender": "Male"
}
] |
PMC5602351
|
[
{
"age": 21,
"case_id": "PMC7787839_01",
"case_text": "A 21-year-old primigravida with cystic fibrosis presented for elective cesarean delivery at 34 weeks' gestation. Before becoming pregnant, she suffered recurrent chest infections requiring two to four courses of intravenous (IV) antibiotics per year and her sputum was chronically colonized with Pseudomonas aeruginosa, Stenotrophomonas, and MRSA. Her comorbidities included Class A1 diabetes mellitus, pancreatic insufficiency, and chronic hypoxemic respiratory failure on chronic prednisone 2.5 mg daily, requiring 4 L/min home oxygen at night with nasal cannula (NC). Throughout pregnancy, she required additional oxygen during the day at 2-3 L/min. Her baseline FEV1 was 27% of predicted. She denied any history of cardiac disease. She met lung transplantation criteria due to FEV1 <30% and recurrent exacerbations requiring IV antibiotics, which would be pursued following her delivery.\nShe was counselled at 11 weeks' gestation regarding the risk of serious worsening of her lung function but decided to continue with the pregnancy. At 24 weeks' gestation, she was admitted with deteriorating respiratory function (forced expiratory volume in one second (FEV1) 0.64 L, 21% of predicted) and shortness of breath. She was treated with IV antibiotics and intensive chest physiotherapy. On discharge, fifteen days later, her lung function had returned to baseline.\nA multidisciplinary meeting was organized with maternal-fetal medicine, obstetric anesthesiology, pulmonology, MICU, cardiac anesthesiology, cardiothoracic surgery, and NICU. Due to her poor lung function, pulmonology advised against normal vaginal delivery. The anesthetic plan was to prevent pulmonary decompensation and to avoid intubation because of the high likelihood of prolonged mechanical ventilation postoperatively. The patient would receive neuraxial anesthesia with general anesthesia as backup. A cardiac anesthesiologist would be available to assist with management and to perform intraoperative transthoracic or transesophageal echocardiogram if needed. Preemptive bilateral femoral sheath placement in preparation for possible cannulation for venovenous extracorporeal membrane oxygenation (ECMO) was also planned in case of intraoperative or postoperative decompensation. A low Pfannenstiel incision was planned and the MICU team arranged for postoperative ICU placement for close monitoring.\nA cesarean section was scheduled at 34 weeks of gestation, to avoid further deterioration in her lung function, because fetal growth began to slowdown and the mother started to lose weight. She was admitted six days before surgery weighing 53 kg. She received dexamethasone for fetal lung maturation, and a routine echocardiogram was performed at this stage which showed no evidence of pulmonary hypertension. Her diabetes was well controlled with insulin sliding scale. Chest physiotherapy continued 3 times a day. She was on amoxicillin/clavulanate for positive H. influenza sputum cultures, and she was switched to cefepime and aztreonam on admission and continued her home nebulization treatments with albuterol, dornase alfa, and acetylcysteine.\nOn the day of surgery, she received her bronchodilators and mucolytics and she was transferred to the OR after her hyperreactive airway symptoms subsided following chest physiotherapy. She was also premedicated with 30 mL of oral sodium citrate and 10 mg of IV metoclopramide. In the OR, a BiPAP machine, a high flow nasal cannula, and a bronchoscopy cart were readily available.\nMonitoring consisted of pulse oximetry, electrocardiogram, capnography, and direct intra-arterial blood pressure measurement after an arterial line was placed. Two 18-gauge peripheral cannulas were sited intravenously. A modified combined spinal-epidural was performed in the sitting position at L4-L5, with 9 mg of bupivacaine 0.75%, 15 mcg of fentanyl, and 100 mcg of preservative-free morphine given intrathecally. An epidural catheter was left in place. Only 9 mg of bupivacaine was administered aiming to slowly build a T5 sensory level with epidural medication and start placement of femoral sheaths simultaneously. Instead, the patient quickly developed a T2 sensory level but had nonlabored breathing on NC at 4 L/min and tolerated the anesthesia well. Phenylephrine (50 mcg/mL) infusion was started after injecting the intrathecal medications at a rate of 20 mcg/kg/min and titrated to keep MAP above 90. The patient was positioned laying on a wedge pillow, with her back up 30 degrees, because she could not tolerate lying supine. Oxygen was continued via a NC 4 L/min, and oxygen saturations were maintained above 95%. Arterial blood gas obtained after supine position showed pO2 of 104 mmHg, no acid-base imbalances, and hematocrit of 31%.\nBilateral femoral veins were cannulated with 16-gauge introducer sheaths, which would allow for rapid cannulation for ECMO if necessary. The patient received 2 g of cefazolin IV for surgical prophylaxis, and surgery was started. Shortly after incision, a female neonate was delivered with Apgar scores of 9 at 1, 5, and 10 minutes. Oxytocin infusion was started immediately after delivery and continued during the case. 15 minutes following delivery, the patient's oxygen saturation dropped to low 90 s and a Venturi mask at 10 L/min was temporarily required to improve her oxygen saturation, in addition to elevating the back of the bed. The patient received 1 g of acetaminophen and 30 mg of ketorolac IV as part of a multimodal pain regimen, and bilateral transversus abdominis plane (TAP) blocks with 266 mg of liposomal bupivacaine were performed in the OR following the end of surgery. Estimated blood loss was 600 mL. A final arterial blood gas again showed no acid-base disorders, pO2 was 114 mmHg, and hematocrit was 29%. The epidural catheter was removed at the end of the case, and the patient was transferred in stable condition on 4 L NC to a medical ICU for close monitoring.\nShe was placed on scheduled IV acetaminophen and ketorolac and reported excellent pain control with no supplemental opioids. Chest physiotherapy was resumed the same day. On postoperative day 1, the femoral sheaths were removed, subcutaneous heparin was started for deep venous thrombosis prophylaxis, the patient was ambulating, and she was transferred out of the ICU. While she remained inpatient, she continued to report significant improvement of the dyspnea. On the fifth postoperative day, she had no oxygen requirements on a six-minute walk test and her chest X-ray was stable, and on the following day, she was discharged home.",
"gender": "Female"
}
] |
PMC7787839
|
[
{
"age": 44,
"case_id": "PMC8034780_01",
"case_text": "A 44-year-old serviceman, diagnosed to have gall bladder NET (operated) with hepatic metastasis, was referred for the evaluation of peptide receptor radionuclide therapy (PRRT) presented with vague upper abdominal discomfort with dyspepsia of 1.5 months duration. The ultrasonography (USG) of the abdomen revealed ill-defined lesion adjacent to gall bladder fossa with soft-tissue area in the fundus. Further evaluation with diagnostic contrast-enhanced CT (CECT) (abdomen and pelvis) showed an irregular heterogeneously enhancing mass lesion at gall bladder fundus with the invasion of adjacent liver parenchyma (segment IVb). Histopathological analysis of the mass (USG-guided biopsy) revealed high grade well-differentiated NET with Ki-67/MiB-1 labeling index of 35%. The patient had received neoadjuvant chemotherapy regimen three cycles of cisplatin and etoposide, followed by radical cholecystectomy (the histopathology report correlated well with previous biopsy report). Postsurgery, he had received adjuvant chemotherapy of further three cycles of cisplatin and etoposide. On follow-up visit, he complained of only minor discomfort in the upper abdomen CECT at this time showed hypoenhancing mass of 5.1 cm x 3.7 cm involving segments IVa and IVb, with a tumor thrombus extending into the proximal part of the left main portal vein, suspicious for recurrence. The serum chromogranin A level was raised (3509 ng/mL).\nThe patient underwent dual tracer PET/CT scan (18F-fluorodeoxyglucose [18F-FDG] PET/CT and 68Ga-DOATATE PET/CT) at our center for the evaluation of the disease. The dose injected was 4.5 mCi (166Mbq) for 18F-FDG and study acquisition was undertaken at 60 min, while that for 68Ga-DOATATE PET/CT was 2.5 mCi (92.5 Mbq) and scan acquisition was undertaken between 50 and 60 min. The scans revealed both somatostatin receptor (SSTR) expressing and FDG-avid hypodense liver lesions, largest in segment IVa and IVb measuring 6.6 cm x 5.0 cm with SUVmax (FDG)-21.3 and SUVmax on 68Ga-DOTATATE PET/CT 33 with no other distant site of metastasis identified [Figure 1].",
"gender": "Male"
},
{
"age": 35,
"case_id": "PMC8034780_02",
"case_text": "The second patient was a 35-year-old male, a patient of esophageal NEN, who initially presented with 6 months history of progressive dyspepsia and gastroesophageal reflux disease. An upper gastrointestinal endoscopic examination (scopy) showed lower esophageal growth measuring around 0.8 cm. The histopathology report was NEC Grade III with the Ki-67 labeling index approximately 70%. The baseline/staging 18F FDG PET/CT at his local place had revealed metabolically active 7.4 cm thickening at the lower third of the esophagus, suspicious paraesophageal lymph nodes in its thoracic part and hypodense hepatic lesions. He received chemotherapy (Etoposide and Cisplatin) and restaging 18F-FDG PET/CT revealed only metabolically active esophageal disease, and he further proceeded to local EBRT; Post EBRT 18F-FDG-PET/CT showed complete response with no evidence of any metabolically active disease in the esophagus and abdomen. He remained asymptomatic but showed no significant weight gain for the next 6 months; this time the 18F-FDG PET/CT showed metabolically active recurrent/residual disease in the esophagus, perigastric lymph nodes, and multiple hypodense liver lesions; he was then considered for second-line paclitaxel based chemotherapy which was tolerated well, and 18F-FDG PET/CT for response evaluation showed stable disease with no significant decrease in size as well as SUV values.\nSubsequently, he defaulted for 6 months and again presented with complaints of significant weight loss (>8 kg in the previous 6 months) and dysphasia. He was evaluated in our department with dual tracer PET/CT studies 37 months after being diagnosed with surgically inoperable NEC, and after completion of 2nd line chemotherapy (18F-FDG PET/CT and 68Ga-DOATATE PET/CT) for disease evaluation. The dose injected was5.5 mCi (203.5 Mbq) for 18F-FDG and study acquisition was undertaken at 60 min, while that for 68Ga-DOATATE PET/CT was 2.2 mCi (81.4 Mbq) and scan acquisition was undertaken between 50 and 60 min. The scans revealed metabolically active lesion of the lower third part of the oesophagus (measuring approximately 4.5 cm vs previous 2.8cm) and multiple hypodense liver lesions (largest measuring 7.2 cm x 7 cm Vs previous 2.2cm x 2cm), multiple abdominal enlarged lymph nodes (largest perigastric lymph node now measuring 4.1 cm x 2.9 cm Vs previous 0.8cm) suggesting disease progression. All these lesions showed more avidity on the 18F-FDG scan compared to 68Ga-DOTATATE scan, which showed minimal uptake in the aforementioned lesions [Figure 2]. On comparison of the FDG-PET/CT, the primary esophageal lesion measured ~4.5 cm versus the previously recorded 2.8 cm, and SUVmax 7.0 versus 5.6 was observed. The liver segment IVb lesion measured 7.2 cm x 7.0 cm versus 2.2 cm x 2.0 cm, while the measured SUVmax was 27.6 versus 22.7 previously. With regard to the lymph nodes, the largest perigastric lymph node measured 4.1 cm x 2.9 cm with SUVmax 19.1, which was merely visible before (subcentimeter size). Many abdominal lymph nodes and liver lesions were newly seen; all these suggested disease progression.",
"gender": "Male"
}
] |
PMC8034780
|
[
{
"age": 62,
"case_id": "PMC3983676_01",
"case_text": "A 62-year-old female presented with a 30-year history of strange sensations in the right preauricular region, and involuntary contractions of the jaw, causing sporadic biting injuries to her buccal mucosa. Initially, laughing, talking, or eating were the precipitant factors for these contractions.\nThe symptoms progressed gradually so that at present she has severe daily contractions, with up to 30 episodes per day. The episodes consist of spontaneous appearance of twitches in the preauricular region, or spasms that hamper jaw opening for as long as 20 seconds. Temporo-mandibular pain is only present during prolonged spasms or contractions (Video 1).\nOn physical examination, hypertrophy of the masseter and temporalis muscles was noted. Dental treatments were required in order to repair several broken teeth.\nShe has no other medical conditions or family history; she does not take any medications and has no laboratory evidence for connective tissue disease or thyroid dysfunction.\nAt present, computerized tomography scan of the brain, brain magnetic resonance imaging, and electroencephalography are normal. Electromyography (EMG) of the right masseter and temporalis muscles revealed spontaneous activity consisting of repetitive, spontaneous bursts of motor unit discharges, ranging from 100 to 200 Hz (Figure 1).\nOver the last years, she has been treated with injections of botulinum toxin type A, every 3-4 months, with 60 U in the right masseter muscle and 40 U in the right temporalis muscle, with an excellent response. To date, this treatment remains beneficial.",
"gender": "Female"
}
] |
PMC3983676
|
[
{
"age": 48,
"case_id": "PMC8190587_01",
"case_text": "A 48-year-old female nurse had general malaise, low-grade fever, and sore throat without obvious cause. Three days later, she visited a local doctor and underwent a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) polymerase chain reaction (PCR) test. The PCR test was negative 6 days after the onset of symptoms, but the patient then developed a high fever. Ten days after the onset of symptoms, chest computed tomography (CT) revealed pneumonia with multiple frosted lesions that were widely scattered with peripheral predominance in each lobe of the lung; this finding was consistent with viral pneumonia syndrome. The patient was suspected of being COVID-19 positive and was admitted (the first day of admission). On day 2 of admission, the patient's respiratory condition deteriorated and she was transferred to our hospital and admitted to the ICU. On day 3, the PCR test results for COVID-19 were positive. On day 4, endotracheal intubation and MV were performed, and antibiotics (piperacillin-tazobactam), sedatives (midazolam and dexmedetomidine), analgesics (fentanyl), and steroids (prednisolone) were administered. Lung-protective ventilation and nutritional therapy by tube feeding were methodically conducted. On day 17, the patient was first referred to the rehabilitation department. Until that point, positioning by the nurses, mainly in the posterior lateral lying position, was performed to prevent decubitus, but no other rehabilitation intervention, including postural drainage, was performed.\nThe patient had a history of renal cancer and comorbidities of rheumatoid arthritis, diabetes mellitus, and impaired kidney function. She had been taking prednisolone (5 mg/day) for over a decade. Written consent was obtained from the patient for publication of this case report.\nThe patient's general findings were as follows: height, 168.0 cm; weight, 78.9 kg; body mass index, 28.0 kg/m2; Richmond Agitation Sedation Scale (RASS) score, -4 (deep sedation, no response to voice, but any movement to physical stimulation); body temperature, 37.6 C; pulse rate, 87/min; respiration rate, 20/min; and blood pressure, 118/56 mmHg.\nThe respirator settings were as follows: pressure control and assist control mode; fraction of inspired oxygen, 35%; and positive end expiratory pressure, 8 cmH2O.\nThe patient's physical findings were as follows: pupil diameter, 3/3 mm; normal bilateral light reflex; no rash; thick breath sounds from both sides of the lungs; chest abdominal (abdominal dominant) breathing; thorax elevation dominant on the left side; regular heart rhythm; inaudible pathological murmurs from the auscultatory valve areas; normal bowel sounds; no edema in the lower limbs; metacarpophalangeal joint deformity on both fingers and callus formation on both soles; and left valgus toe. Deep tendon reflexes: biceps +-/+-, triceps +-/+-, patellar tendon -/+-, Achilles tendon -/+-. Pathologic reflex: Babinski -/-, Chaddock -/-.\nChest X-ray and CT findings were as follows: frosted and infiltrated shadows with peripheral predominance in all lung fields (Fig. 1A). The blood gas analysis findings were as follows: pH, 7.375; PaO2, 75.0 mmHg; and PaCO2, 42.5 mmHg.\nThe blood test findings were as follows: white blood cell count, 8.09 x 109/L; neutrophilic cells, 73.5%; lymphocytes, 11.5%; platelet count, 1.80 x 1011/L; hemoglobin concentration, 97 g/L; hypersensitivity C-reactive protein, 7.81 mg/L; blood sugar, 99 mg/dL; hemoglobin A1c (NGSP), 6.9%; blood urea nitrogen, 59 mg/dL; creatinine, 1.25 mg/dL; and the estimated glomerular filtration rate, 37 ml/min/1.73 m2. The blood coagulation function findings were as follows: prothrombin time, 14.1 s; prothrombin activity, 69.7%; activated partial thromboplastin time, 40.1 s; fibrinogen, 646 mg/dL; and D-dimer, 2.1 mug/ml.\nThe grip power and Medical Research Council (MRC) score was used to assess muscle strength; the 6-minute walk test (6MWT) was used to assess exercise capacity; the functional independence measure (FIM) was used to assess ADL; the forced expiratory volume in 1 s (FEV1), forced vital capacity (FVC), and diffusing capacity for carbon monoxide (DLCO) were used to assess respiratory function; the Specific Activity Scale (SAS) as metabolic equivalents (METs) was used to assess physical activity intensity, and the Hospital Anxiety Depression Scale (HADS)) was used to assess mental state. HADS is a self-assessment scale and is a reliable instrument for detecting mental state using a questionnaire scored between 0 and 21 for either anxiety or depression (0-7: normal; 8-10: borderline abnormal; 11-21: abnormal).\nRehabilitation therapy was initiated with the minimum number of dedicated staff (a physiatrist, a physical therapist, and some nurses) to minimize the infection risk for staff members. All staff members wore personal protective equipment (PPE) to prevent SARS-CoV-2 infection via air droplets and aerosols. The patient's renal function was monitored daily to detect any worsening of renal dysfunction resulting from excessive exercise load.\nThe clinical course during hospitalization is shown in Fig. 2. On day 17, physical therapy of 20-40 min/day, 6 days/week, was first started with the aim of improving respiratory disorders by positioning, postural drainage, and early mobilization. Additionally, anti-gravity training with the patient in an anterior prone or tilt-up position was carried out, depending on the sedation state. On day 18, the RASS score had improved to -2 (light sedation, briefly awakens with eye contact to voice). Consequently, the respirator setting was changed to continuous positive airway pressure mode, and active-assisted exercise of the limbs was started. On day 20, the patient was weaned off MV, but oxygenation was started because she required effort to breathe. After the withdrawal of MV, voicelessness due to hoarseness, dysphagia, general muscle weakness, delirium, and hallucinations became apparent. In consultation with the attending physician and the infection control department, the patient's family was allowed to visit the patient through the glass window of the room with infection control and the use of PPE. After the first family visit, the delirium and hallucinations disappeared within a few days. Family visits were planned once or twice a week, and contact using remote devices was also conducted as needed.\nProgress of the exercise load applied during physical therapy and the peripheral vital signs after exercise are shown in Fig. 3 Immediately after the withdrawal of MV, muscle strengthening and ADL training were started as facilitated by nurses and physical therapists; however, on day 24, the patient's MRC score met the diagnostic criteria for ICU-acquired weakness (ICU-AW). On day 26, oxygenation was terminated because respiration had improved. On day 28, SAS assessment showed a physical activity intensity of 2.0 METs, and the HADS score was 4 for both anxiety and depression. On day 31, direct swallowing training with jelly was started under the guidance of a certified swallowing nurse and physiatrist. On day 38, additional occupational therapy was started that focused on the splinting of hand deformities, ADL training for joint protection, speech therapy focusing on swallowing assessment and training, and vocal exercises (each for 20 min/day, 6 days/week). On the same day, the patient underwent the 6MWT and achieved a distance of 85 m, despite shortness of breath; consequently, physical therapy was lengthened to 60 min/day with a focus on aerobic exercise.\nOn day 40, videoendoscopic evaluation of swallowing was performed. Poor mobility of the right vocal cord and decreased pharyngeal contraction were observed, which may have been the cause of hoarseness. However, no apparent aspiration or laryngeal invasion was observed with a small amount of water or food. On day 41, a dietary assessment was performed at lunch to confirm that there were no apparent problems in swallowing water or food; three meals a day were started on the next day. On day 54, evaluation using the SAS showed a value of 4.0-5.0 METs, and evaluation using the HADS indicated a score of 4 for anxiety and 2 for depression. On day 55, respiratory function tests were performed; the results were 86.3%, 90.7%, and 61.8% for FVC, FEV1, and DLCO, respectively (Table 1). By day 56, Chest X-ray and CT findings showed an improvement of shadows in the lungs (Fig. 1B). On day 60, the patient achieved independent ADL with no cognitive or mental problems and was discharged. At discharge, the 6MWT distance was 450 m (Fig. 2), but the patient still had shortness of breath during exertion and was voiceless because of hoarseness.\nAfter the patient was discharged from the hospital, physical and speech therapy were continued once or twice a month to monitor symptoms, give instructions for voluntary exercise, and provide feedback on the assessment of physical function. On day 118, Chest X-ray and CT findings showed only slight residual shadows in the lungs (Fig. 1C). On day 126, the 6MWT and DLCO further improved to 503 m (89.3% of the predicted value calculated using a regression method)) and 68.1%, respectively, but FVC and FEV1 decreased to 78.5% and 83.4%, respectively (Table 1), with no symptoms during exertion. On day 130, considering the assessment of respiratory function and exercise capacity, the patient was allowed finally to return to work as a nurse (which generally requires up to 4.5 METs)) but was limited to light clerical work.",
"gender": "Female"
}
] |
PMC8190587
|
[
{
"age": 7,
"case_id": "PMC8245756_01",
"case_text": "A 7-year-old girl with a 1-month history of neck pain and a 3-week history of progressive weakness in the right hand was presented to us. Physical examination showed a decreased muscle strength (Grade 1/5 according to the Medical Research Council scale) in the right upper extremity, and the left and anterior movement of the neck was limited. The muscular tone was normal, and the Hoffmann's sign was negative bilaterally. Spinal magnetic resonance imaging (MRI) revealed an intramedullary lesion at the C2-7 levels. The lesion showed isointensity on T1-weighted imaging and slightly hyperintensity on T2-weighted imaging; after administration of contrast medium, the lesion was heterogeneously enhanced (Figures 1A-C). A diagnosis of spinal cord glioma was suspected. The preoperative ADL (Activity of Daily Living scale) score was 65.\nMicrosurgical resection of the intramedullary lesion was performed with the assistance of intraoperative neuroelectrophysiological monitoring. Intraoperatively, the lesion was soft in nature and pink in color with abundant blood supply. The spinal cord was severely compressed and deformed. Eventually, a subtotal resection (~80% of the mass) was achieved. Postoperatively, the neck pain was relieved, while the muscle strength of the right upper extremity remained unchanged (Grade 1/5); the muscle strength of the right lower extremity was Grade 2/5. The postoperative ADL score was 25 (Table 1).\nPostoperative spinal MRI confirmed a subtotal resection of the tumor (Figures 1D-F). Pathological examination revealed that the density of tumor cells was moderate, the nucleus was irregular and slightly to moderately heteromorphic, and no karyokinesis was observed (Figure 2A). Immunohistochemistry showed the tumor harbored an H3 K27M mutation (Figure 2B). The Ki-67 proliferation index was about 30%. These characteristics conformed to a diagnosis of spinal cord H3 K27M-mutant DMG (WHO Grade IV).\nPostoperatively, the girl was treated with concurrent chemoradiotherapy. Oral temozolomide was administered for 7-months (67 mg/day for 42 days; thereafter, 150 mg/day for 5 days during each 28-day cycle). In addition, 22 courses of radiotherapy (local radiotherapy: three-dimensional conformal radiotherapy) with a total dose of 45 Gy were delivered within 5 weeks. After chemoradiotherapy, the muscle strength of right upper limb was improved, and the residual tumor was smaller than before. After an 18-month follow-up, the child's tumor did not progress, and the child's condition was stable and recovered well.",
"gender": "Female"
}
] |
PMC8245756
|
[
{
"age": 46,
"case_id": "PMC4363670_01",
"case_text": "A 46-year-old Guinea-Bissau born male, living in Portugal for 16 years, was admitted to our institution because of vomiting, hiccups, weight loss (about 16 kg), occasional nocturnal sweating, and dry cough, lasting for 1 month. He had a past medical history of recurrent episodes of intestinal worm infection and excessive alcohol consumption (100-120 g/day). He was screened for tuberculosis due to prior contact with pulmonar tuberculosis. Laboratory blood tests were normal except for a high sedimentation rate (79 mmh). A bilateral bronchial reinforcement was observed on chest X-ray. Mediastinal enlarged lymph nodes and a nodular lesion at inferior left pulmonary lobe were noted on chest CT (computerized tomography) scan. A brain CT showed a small corticosubcortical ring-enhancing lesion in the right frontal lobe. He was diagnosed with HIV-1 infection (323/8,3% T-CD4 + lymphocytes/muL) and HBV chronic infection (AgHBs positive, Ac anti-HBc positive, and AgHBe negative).\nInspection revealed good general condition, with papular lesions scattered throughout the body. On brain MRI a single round lesion with 7 mm was seen, with perilesional oedema, suggesting tuberculoma (Figures 1(a)-1(b)).\nCerebrospinal fluid (CSF) cytochemical evaluation was normal. Bronchoscopy showed nonspecific inflammatory findings. Bacteriological and mycobacteriological (direct and cultural examination) analysis of respiratory products tested negative. Bronchial histology showed inflammatory infiltrate, with no granuloma or neoplastic tissue. Patient was discharged from hospital clinically stable, with no signs of infection.\nOne month later he manifested persistent deterioration of general condition, with vomiting, abdominal pain in the right upper quadrant, myalgias, and fever. Laboratory tests revealed leukocytosis, C-reactive protein 12,2 mg/dL, and sedimentation rate >120 mmh. On chest CT scan a bulky right adrenal gland mass was disclosed. Abdominal sepsis was considered and treatment with intravenous (IV) ceftriaxone (1 g bid) was empirically started. Blood, urine, and stool cultural exams were negative, as well as Schistosoma spp. and Taenia solium serology. He completed a 14-day cycle of antibiotic treatment with clinical and analytical improvement. He was also treated with oral fluconazole (200 mg id) during 14 days for esophageal candidiasis. One week after ceftriaxone suspension a worsening of headache and inaugural seizures were observed. MRI brain-scan presented multiple well-defined annular lesions. Nocardia versusfungal abscesses was hypothesized (Figures 1(c)-1(d)). Empirical treatment with IV ceftriaxone (2 g bid), liposomal B amphotericin (4 mg/Kg id), and valproic acid was started. Adrenal mass was punctured; culture of purulent material revealed Nocardia spp. Characterization of bacterial species and antimicrobial susceptibility testing were not possible, neither by microbiologic methods nor by protein chain reaction (the sample was deteriorated when it arrived at reference laboratory; in Portugal, characterization of Nocardia spp. and antimicrobial susceptibility testing are made at reference laboratory, National Health Institute, Dr. Ricardo Jorge). ACTH and cortisol were within normal limits. As skin nodules persisted, a skin biopsy was performed; histology revealed superficial acute folliculitis and no microorganisms were seen with special stains; microbiological study was missed. The diagnosis of disseminated nocardiosis with brain, adrenal, and possibly lung and skin involvement was assumed. Based on literature, IV treatment was started with cotrimoxazole 1440 mg 8/8 h, amikacin (dosage adjusted to the serum levels), and ceftriaxone (2 g bid); liposomal B amphotericin was stopped.\nTwo months later the patient showed clinical and laboratory improvement. His CD4 + cell count was then 207 (7,1%)/muL and viral load was 491640 cp/mL (genotypic resistance test was negative); HBV viral load was 777873717 UI/mL. An antiretroviral scheme with HBV activity was initiated with lopinavir/ritonavir (LPV/RTV) and tenofovir/emtricitabine (TDF/FTC). Four weeks later there was deterioration of renal function (GFR 69,2 mL/min). Amikacin was stopped. As renal failure went on worsening (GFR 37,7 mL/min), TDF/FTC was replaced by abacavir/lamivudine (ABC/3TC) and then cotrimoxazole was also stopped. Attempting to maintain a sulfonamide on the antibiotic regimen, dapsone was introduced. A significant transaminases elevation (AST 513 U/L; ALT 622 U/L with normal bilirubin) was interpreted as hepatotoxicity and dapsone was discontinued. The possibility of reactivation of HBV infection regarding the replacement of TDF/FTC for ABC/3TC was also considered. HBV viral load was still detectable (782 UI/mL), but at a lower level, so entecavir was added. Treatment with IV ceftriaxone (2 g bid) was kept for 1 year. Reassessment with Brain-MRI showed remaining lesions (Figures 1(e)-1(f)) and abdominal-CT scan showed resolution of adrenal abscess; HIV viral load was on the threshold of detectability (54 cp/mL) as well as HVB viral load (16 UI/mL).\nCurrently, six months after stopping ceftriaxone, the patient is asymptomatic and presents a good recovery of renal function (GFR 80 mL/min). He is under valproic acid (800 mg bid) and antiretrovirals, with virologic suppression of HIV and HBV and improvement of immune status (306/12% T-CD4 + lymphocytes/muL).",
"gender": "Male"
}
] |
PMC4363670
|
[
{
"age": 37,
"case_id": "PMC8799065_01",
"case_text": "A 37-year-old woman presented with recurrent lower abdominal discomfort for more than half a year. No nausea, cough, dyspnea, hemoptysis, or abdominal distension was found. Additionally, the menstruation of the patient was regular. There were no abnormalities in routine laboratory examinations, tumor markers, and pulmonary function tests. She had no medical, family, and psycho-social history of relative diseases. This was her first visit to this issue, and she had no relevant past interventions. All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional research committee and the Helsinki Declaration (as revised in 2013). Written informed consent was obtained from the patient.\nA contrast-enhanced thoracic CT scan revealed a 9 mm x 7 mm solid nodule in the right upper lobe with shallow lobules at the margin, clear boundary, and obvious enhancement; no enlarged lymph nodes in the mediastinum and hila. And two radiologists considered it to be benign or low-grade malignant (Figure 1). A gynecological ultrasound indicated multiple fibroids in the uterus and left adnexal nodules.\nLaparoscopic hysteromyomectomy and left adnexectomy were performed on September 17, 2019. The gross examination showed the surface cut of the tumor was pale and tough, and its tissue had a whirlpool shape. The postoperative pathology indicated uterine leiomyoma (Figure 2A,B). The results of immunohistochemistry were as follows: Ki-67 (1%, +), ER (+), PR (+), SMA (+), Des (+), CD117 (-), CD34 (-), DOG1 (-), and B-Catenin (-). After postoperative rehabilitation and follow-up examinations, the patient received apical and posterior segmentectomy (the location of the nodule was too deep to perform wedge resection) by video-assisted thoracic surgery on October 21, 2019. The intraoperative frozen section demonstrated a spindle cell tumor. The gross examination showed a pale 0.8-cm-diameter nodule with a clear boundary with normal lung tissue. Postoperative pathological findings suggested a leiomyoma (Figure 2C,D). And immunohistochemical analysis revealed a result of SMA (+), Des (+), ER (+), PR (+), Ki-67 (5%, +), CK7 (-), CD34 (-), STST6 (-), ALK (-), CD68 (-). Therefore, this case was diagnosed as benign metastasizing leiomyoma. Afterward, the patient received a treatment of tamoxifen. No radiological evidence of progressive disease and further distant metastasis were found in a twelve-week follow-up. The patient had no relevant symptoms and the prognosis was good.",
"gender": "Female"
}
] |
PMC8799065
|
[
{
"age": 46,
"case_id": "PMC5676382_01",
"case_text": "Our patient is a 46-year-old male with a history of Hodgkin's Lymphoma diagnosed approximately 8 years before admission in remission status after rituximab therapy. He presented with subsequent left upper extremity focal SLS diagnosed two years before this admission by anti-GAD antibody elevation and electromyography (EMG) findings. He was recently on a maintenance regimen of rituximab therapy every 8 weeks but this had been discontinued approximately three months prior to this admission. He presented with left upper extremity pain, stiffness, and firm muscles. He was being managed by neurology with diazepam, hydrocodone, and tizanidine and reported two prior admissions in the last year for exacerbations of his SPS, once complicated by left upper extremity deep venous thrombosis. On both admissions, he was treated with plasmapheresis with little to no appreciable improvement of his symptoms but with significant reductions in anti-GAD-65 antibody titers.\nOn admission, the patient was found to have a limited range of motion in his left upper extremity with rigidity and apparent contracture with swelling secondary to a deep venous thrombosis. He was able to flex and extend his second and third digit, but was unable to move the fourth and fifth. Sensation was intact in all extremities, and his physical exam was otherwise unremarkable.\nLab workup was notable for an anti-GAD-65 antibody level of 64 IU/mL (reference range <5 IU/mL) by ELISA, a TSH of 0.240 mIU/L (reference range 0.35-4.94 mIU/L), and a C-PEPTIDE of 5.19 ng/mL (reference range 0.80-3.85 ng/mL). Previous EMG studies had demonstrated continuous motor unit activation of the left upper extremity consistent with a diagnosis of SLS, but the patient refused EMG and nerve conduction studies on this admission. He also refused further lab work to include anti-amphiphysin testing and lumbar puncture for CSF analysis.\nA \"mediport\" catheter was placed and plasmapheresis was initiated on hospital day two with repeat plasmapheresis every other day for five total rounds. On hospital day one, he was started at 20 mg of diazepam four times per day, 12 mg of tizanidine every eight hours, and acetaminophen/hydrocodone three times per day as needed. By hospital day five he had had his second round of plasmapheresis, and his medicine regimen had been increased to 30 mg of diazepam every six hours, 10 mg of baclofen twice per day, 500 mg of divalproex twice per day, 9 mg of tizanidine every six hours, topical diclofenac gel twice per day, and 500 mg of methocarbamol every eight hours, still with poor control of his symptoms.\nNeurology recommended the addition of botulinum toxin therapy, and on hospital day seven he was treated with 300 units of botulinum toxin type A (Xeomin), with 130 units injected in the left biceps, 70 units in the left brachioradialis, and 50 units injected into both flexor digitorum superficialis and profundus. On the following day, the patient reported some mild relief of his pain, but no relief of his rigidity, and on hospital day nine the patient stated both the pain and rigidity had both returned completely. Medical cannabis was considered, but was not an option per hospital policy.\nThis patient was discharged on hospital day ten with no further relief of his symptoms on maximal medical therapy and after his fifth round of plasmapheresis. He was discharged on 9 mg of tizanidine four times per day and 30 mg of diazepam four times per day. He was given instructions to follow up with neurology outpatient for assessment of his symptoms after botulinum injection and for repeat injections in three months. Approximately 14 days and again at 30 days after discharge contact was made with this patient by phone, and he advised on both occasions that he had no improvement in his symptoms. He declined further botulinum injection therapy, but opted to reestablish rituximab therapy with his oncologist. He refused follow-up EMG, NCS, and anti-GAD laboratory studies.",
"gender": "Male"
}
] |
PMC5676382
|
[
{
"age": 41,
"case_id": "PMC7550963_01",
"case_text": "A 41-year-old mother was pregnant by in-vitro fertilization (IVF) treatment. She had no medical problems during the antenatal period. There is no consanguinity between the parents. All triplets were boys and were born at 25 + 3 weeks of GA by cesarean section.\nTriplet A weighed 800 g and had patent ductus arteriosus (PDA), sepsis and RDS that progressed to chronic lung disease (CLD) and as a result was on mechanical ventilation for 61 days. He was treated with penicillin and gentamicin for presumed sepsis. At day 18, he had developed sepsis (blood culture showed Staphylococcus capitis) which was treated with teicoplanin and amikacin for 10 days. ROP screening at 32 + 6 weeks (weight 1.57 kg) revealed no ROP. At 34 + 6 weeks, his weight was 1.88 kg and he presented with stage 2, zone 2. At 41 weeks, there was no ROP detected on examination and his weight had increased to 3.70 kg. In the follow-up period after 10 months, his weight had increased to 7.99 kg and fundus examination showed zone 3 vascularization. Cycloplegic refraction was done revealing a mild hyperopia in both eyes (oculus dexter (OD): +1.5/-0.5 x 180, oculus sinister (OS): +1.5/-0.5 x 180).\nTriplet B weighed 630 g at birth and he had PDA and RDS which progressed to CLD. He was intubated twice and was on mechanical ventilation for 85 days. He also had presumed sepsis and was treated with penicillin and gentamicin for 7 days. At 32 + 6 weeks, he weighed 1.470 kg but ROP screening showed bilateral stage 3, posterior zone 2 with plus disease (Figure 1). He was treated with intravitreal ranibizumab injection (0.03 mL) in both eyes. At 36 weeks, his weight increased to 1.91 kg and at 41 weeks his weight was 3.20 kg. At 10 months of age, the retina was vascularized to zone 3 with no plus disease. His weight was 8.30 kg and cycloplegic refraction for both eyes was done (OD: plano/-0.50 x 180, OS: plano/-0.50 x 180).\nTriplet C's birth weight was 520 g with PDA, jaundice and RDS which progressed to CLD. He was intubated once and then was placed on mechanical ventilation for 63 days. At 36 weeks, he developed ROP stage 3, posterior zone 2 with plus disease while his weight was 1.65 kg. Intravitreal ranibizumab (0.03 mL) was injected in both eyes. After initial regression of ROP, it recurred again after 5 weeks with stage 3, zone 2 with plus disease in right eye (threshold disease); and stage 2, zone 2 with mild plus in left eye (Type I ROP). He was treated with diode laser photocoagulation in both eyes with 4435 shots in the right eye and 3969 shots in the left eye (Figure 1). His ROP regressed completely after laser treatment. After 10 months, his weight was 6.70 kg and he developed myopia. His cycloplegic refraction was (OD: -2.75/-0.50 x 180, OS: -2.50/-0.50 x 180). Table 1 summarizes the demographics of the triplets.",
"gender": "Female"
}
] |
PMC7550963
|
[
{
"age": 62,
"case_id": "PMC5909947_01",
"case_text": "The patient is a 62-year-old male, smoker (a 25 pack-year smoking history), an occasional alcohol drinker, without any family history of pancreatic or other types of malignancy. He is overweight (BMI=27.8), has high blood pressure and was diagnosed with type two diabetes mellitus (DM) in June 2014, receiving insulin therapy since then. He was first admitted to the Gastroenterology Department of Fundeni Clinical Institute on the 28th of January 2015. His complaints were: several episodes of acute diarrhea (3 stools/day) accompanied by a weight loss of 8 kg in the previous 3 months, diffuse, dull abdominal pain, aggravated by meals, occurring during day-time only, nausea and anorexia. Clinical examination revealed flushing and an enlarged, firm left liver lobe, with an irregular surface. Laboratory tests showed: hyperglycemia (15.71mmol/L), HbA1c=61mmol/mol, ALT=76U/L, total bilirubin=32.5micromol/L, gammaGT=634U/L, inflammatory syndrome with plasma fibrinogen=13.38micromol/L, negative HBs antigen and anti HCV (hepatitis C virus) antibodies, high CA19-9 (132.9UI/mL) and alpha-fetoprotein (30.7ng/mL), normal CEA (carcinoembryonic antigen). \n A computed tomography (CT) had already been performed in another clinical unit and revealed a locally invasive tumoral mass at the level of the pancreatic body, 75/37 mm in size, without a clear demarcation line between the tumor, the posterior wall of the antrum and gastric body and the celiac trunk and its bifurcation. An enlarged liver with an irregular border and multiple nodules (maximum diameter of 63/44 mm) disseminated throughout the parenchyma, spontaneously hypodense, without intrahepatic bile duct dilation and retroperitoneal adenopathies (maximum size of 25 mm) were also described. The abdominal ultrasound we performed confirmed these findings (Figures 1, 2). \n Due to the high clinical suspicion of pancreatic NET, the level of chromogranin A (CgA) in the blood level was tested: 317mug/L (N: 19-98microg/L). The serotonin blood and urine level and the urinary 5-HIAA (5-Hydroxyindoleacetic acid) were normal. We also checked the blood levels of hormones like gastrin, glucagon and VIP, thinking they could be responsible for inducing diarrhea in this patient, in the case of a functioning pancreatic NET; they were all in the normal range. \n Percutaneous liver biopsy from one of the nodules was obtained. The histopathological examination described atypical small and monomorphic cell proliferation, with round nuclei, without obvious nucleolus, with eosinophilic cytoplasm; compact cellular placement, frequently around neoformed capillaries resulting in microacinar structures (Figures 3, 4). \n Immunohistochemistry (IHC) was positive for CgA, strongly positive for synaptophysin, negative for CDX2 and TTF1, positive for AE1-AE3, with a Ki-67 proliferation marker of 10-15% in the hotspot areas (Figures 5, 6, 7, 8). In conclusion, according to the \"European Neuroendocrine Tumor Society/WHO nomenclature and classification for digestive system neuroendocrine tumors\", the diagnosis was intermediate grade (G2) well-differentiated pancreatic NET, with liver metastases. \n The patient began palliative chemotherapy with capecitabine and oxaliplatin in March 2015. In June 2015, Sandostatin LAR 30 mg/week was added, and oxaliplatin was discontinued until March 2016 when the CT scan showed progressive disease. At that time oxaliplatin was reintroduced, and the dose of Sandostatin LAR was raised to 40mg/week, in an attempt to control tumor growth. In July 2016, he had stable disease following imaging assessment. \n Because the patient complained of lower back pain, a bone scan was conducted in September 2016 and described hypermetabolic lesions of the T10 vertebra, probably malignant. At that time, zolendronic acid treatment was associated. An abdominopelvic MRI (magnetic resonance imaging) performed in November 2016 found multiple bone metastases at the level of the thoracolumbar vertebrae, with bilateral pre/paravertebral and also epidural extension. In December 2016,. The CT scan showed progressive disease again, with liver, splenic and bone metastases. Palliative radiotherapy was recommended and carried out in February 2017: a total dose of 20Gy in 4 fractions over 4 days at the T10-T11 level. In June 2017, he was admitted with abdominal pain, extreme fatigue, performance status ECOG=3 and cachexia. He received major pain control therapy and nutritional support. On June 29th, he received Nordic FOLFIRI chemotherapy. His condition progressively worsened, and he died on July 18, 2017.",
"gender": "Male"
}
] |
PMC5909947
|
[
{
"age": 39,
"case_id": "PMC6416218_01",
"case_text": "A 39-year-old male with a past medical history significant for hypogammaglobulinemia, and asthma, and colectomy status-post bowel perforation, presented with several days of increasing watery ostomy output, non-bloody vomiting, and subjective fevers. The cause of spontaneous bowel perforation is unclear. The diagnosis of hypogammaglobulinemia had been made 1 year prior to presentation when patient had no prior history of any gastrointestinal symptoms. Therefore, excluding any possibility of hypogammaglobulinemia secondary to protein-losing enteropathy. He had been doing well on intravenous immunoglobulin (IVIG) up until this point. A computed tomography scan of the abdomen and pelvis with contrast revealed diffuse small bowel mucosal hyperenhancement consistent with enteritis, with no evidence of free air or recurrent bowel perforation. He underwent EGD and colonoscopy with no complications. Both procedures revealed grossly normal mucosa with the exception of two diminutive sessile polyps at the cecum, which were biopsied. Immunohistochemistry revealed cells positive for cytomegalovirus and evidence of chronic active crypt-destructive colitis related to cytomegalovirus infection. Serum CMV was quantitated by PCR and found to be 9561 IU/ml. He was subsequently started on valgancyclovir with marked improvement in his clinical condition. Results of routine immunological analysis prior to starting immunoglobuline therapy revealed IgG (498 mg/dl; control range 694-1,618 mg/dl), IgA (118 mg/dl; control range 68-378 mg/dl), IgM (92 mg/dl; control range 65-263 mg/dl). At the time of diagnosis of CMV colitis, his lymphocyte subsets were as follow: CD3+ T cells 1,828/mul (control range 502-1,902/mul), CD4+ T-cells 949/mul (control range 338-1,194/mul), CD8+ T-cells 970/mul, (control range 85-729/mul), CD19+ B-cells 86/mul (control range 51-473/mul), and NK cells 86/mul (range 12-349/mul). Proliferative responses to recall antigens (Candida albicans and tetanus toxoid) and mitogens (phytohemagglutinin, concanavalin A, and pokeweed) were also normal. HIV was negative.",
"gender": "Male"
}
] |
PMC6416218
|
[
{
"age": 49,
"case_id": "PMC5733991_01",
"case_text": "A 49-year-old male was presented at our department with lower back pain and walking instability for the last few days. The patient suffered from end-stage renal disease on dialysis for the last 15 years and had a history of successful renal transplantation about 25 years ago. The initial renal insufficiency resulted from a chronic glomerulonephritis and the allograft was rejected 9 years after transplantation due to the same underlying condition. Furthermore, about 2 years ago, he underwent bilateral nephrectomy for solid tumorous masses in both nonfunctioning kidneys. The histologic examination revealed, bilaterally at that time, type 1 papillary renal cell carcinoma (pT1aN0M0, Fuhrman grade II, in sano resection). Additionally, the nonfunctioning transplant kidney was removed about 6 months ago due to recurrent episodes of macrohaematuria, without evidence for a malign tumour. At that time, there were no signs for a metastatic disease.\nAt current presentation, the performed magnetic resonance imaging (MRI) of the spine showed a pathologic facture at the right side of the first and second lumbar vertebral body (Figure 1) from a metastatic solid mass, as well as multiple osteolytic metastases from 7th cervical to 2nd lumbar vertebra. A staging computed tomography (CT) of the thorax and abdomen showed further osseous osteolytic metastatic lesions at the sternum, both scapulae, the bone pelvis, and the left proximal femoral bone. The performed biopsy of the osteolytic metastatic lesion at the second lumbar vertebra revealed a metastatic, mucin-poor variant, of a mucinous tubular and spindle cell carcinoma of the kidney (Figure 2). A thorough reexamination of the old nephrectomy specimens showed that the tumour of the right kidney was also a mucin-poor variant of a MTSCC of the kidney, while the tumour of the left kidney was confirmed as a papillary RCC.\nHistologically, both the biopsy sample and the nephrectomy-specimen of the right kidney showed a renal cell tumour with a spindle cell component, as well as tubular and papillary parts without any clear cells. Both spindle and tubular-papillary parts were delimited by a basal membrane, forming a ball-shaped, epithelial tumour-growth pattern with spindled nuclear morphology, which did not match a sarcomatoid differentiation. Immunohistochemically, the tumour was negative for desmin and actin and S100 protein, as well as for HMB45, MITF1, MART1, and SOX-10. A positive reaction to Racemase (AMARC), PAX-8, and RCC was found, with focal positivity for CD10. Pan-Cytokeratin (AE1/AE3) and CK7 were negative except from the papillary parts. The Ki67 stain showed focal proliferation rates up to 30%. Furthermore, no mucoid interstitial matrix was found with H&E stain. Only with Alcian blue staining, <1% mucin in cellular areas was observed.\nAccording to our interdisciplinary tumour conference board's recommendation, the patient followed a systemic treatment with pazopanib and focal radiotherapy to lumbar and cervical vertebrae metastases. In further follow-up, irrespective of the started treatment, the tumour spread rapidly and after three months the patient presented with additional hepatic and pulmonary metastases. The patient finally succumbed to the disease a few months later.",
"gender": "Male"
}
] |
PMC5733991
|
[
{
"age": 38,
"case_id": "PMC3985368_01",
"case_text": "A 38-year-old female patient presented with progressive dysarthria, dysphagia, nasal regurgitation and hyper nasal speech for 5 months duration. She had 4 episodes of partial seizures involving the right upper and the lower limb for the past 5 months and was not on any medications. There was weakness of the left upper limb for the past 15 days duration but there was no headache, vomiting or blurring of vision. She had emotional instability in the form of inappropriate crying. Neurological examination showed exaggerated jaw jerks and gag reflex with spastic dysarthria. She had both proximal and distal weakness in the left upper limb with power of 3/5. All the deep tendon reflexes were brisk with plantar response mute bilaterally and cortical sensory loss in the left upper limb. There was no atrophy or fasciculation of the affected muscles. The fundus and other system examination were normal.\nLaboratory examination revealed positive neurocysticercosis serology. The peripheral smear was normal. The renal and liver function tests were normal. The MRI brain showed multiple small cysts with scolex in both the cerebral hemispheres and a giant intraparenchymal cyst measuring 5 x 4.3 cms in the right cerebral hemisphere [Figure 1a and b].\nOur patient presented with pseudobulbar palsy, partial seizures and weakness of the left upper limb. Her NCC serology was positive and diagnosis confirmed by MRI, which showed multiple cysts with scolex (in vesicular stage). She received the treatment with albendazole at 15 mg/kg/day along with steroids (for two weeks). She also received phenytoin for seizures. The patient remained seizure free and there were no significant events during her hospital stay. On follow-up six weeks after the completion of albendazole therapy she reported no recurrence of seizures and her right upper limb weakness recovered partially with power of 4/5. There was also improvement in her speech, emotional instability and was able to take food without nasal regurgitation.",
"gender": "Female"
}
] |
PMC3985368
|
[
{
"age": 59,
"case_id": "PMC2852117_01",
"case_text": "Subjects included a patient with neglect (JM) who had participated in Experiment 1 as well as seven age-matched normal controls (mean age = 53.6 years; range = 42-72 years). JM was a 59-year old right-handed male who had suffered a right parietal and posterior temporal infarction. He exhibited neglect of the left body and left extrapersonal space on a variety of tasks including line cancellation, line bisection, and visual search (See Figure 3). He had minimal left-sided clumsiness but no weakness, and visual fields were full to confrontation. Testing was performed over a 4-month interval approximately 8-12 months following infarction.\nExperimental details were the same as Experiment 1, except that a central fixation point replaced the midline box and became an arrow indicating either the correct location of the subsequent target (VALID trial), an incorrect location (INVALID trial), or no location information by becoming a double-headed arrow (NEUTRAL trial).\nA comparison of the results for normal subjects and for patient JM on both the centrally cued task and to his prior performance on the peripheral cued-response task is shown (See Figure 4). The data from the 7 normal controls was subjected to an analysis of variance (ANOVA) in which eccentricity (2 and 8 ), SOA (50, 150, 500 and 1000 msec.), cue validity (valid, invalid and neutral) and side of target (right, left) were treated as within subject factors. Significant main effects were noted for eccentricity (F[1,6] = 10.442; p =.018) validity (F[1,6] = 8.536; p =.027), and a marginally significant effect of SOA was noted (F[1,6] = 5.772; p =.053). No significant interactions were observed between factors.\nFor JM a separate univariate ANOVA was performed on individual trial data in which eccentricity, SOA, validity, and side, were treated as fixed factors. All main effects were significant (p <.001 in all cases), and a number of significant interactions emerged. Pertinent to our hypotheses, significant interactions were noted for eccentricity x side (F [1, 11] = 14.801; p <0.001), reflecting a greater effect of target eccentricity for left-sided targets than for targets on the right. A significant side x validity interaction (F [2,11] = 11.176; p <.001), was consistent with the observation that responses to left-sided invalidly cued targets (mean RT = 643.48 msec) were slower than responses to right-sided invalidly cued targets (mean RT = 531.38). Finally, there was a significant three-way interaction between eccentricity x side x validity (F [2, 745] = 3.152; p =.043), consistent with the finding that JM demonstrated prolonged RTs for invalid left-sided targets as a function of target eccentricity. There were insufficient errors (<3% trials) in either control subjects or for JM to pursue error analysis.\nThe principal finding from Experiment 2 is that, compared to control subjects, JM demonstrates an exaggerated interaction of validity and eccentricity for contralesional stimuli for both centrally and peripherally cued targets. This result weighs against the notion that eccentricity x validity interactions are mediated by differential deficits in disengagement from cues in the ipsilesional hemispace. Were this the case, one would have predicted that a centrally cued task would not be affected by variations in target eccentricity. Our results instead suggest that covert shifts of attention, regardless of whether they are oriented by exogenous or endogenous mechanisms, require the movement of a locus of attention through space, and that this process would be slowed in the affected hemifield of patients with neglect regardless of the nature of the cue.\nThese findings are consistent with prior data indicating that the validity effect seen in response to endogenously cued stimuli is larger in patients with neglect than normal subjects for contralesional space. While a number of prior studies have demonstrated differences in normal subjects for exogenous as compared to endogenous cues, other data demonstrate that validity effects can be seen in either condition. The results of Experiment 2 are consistent with prior data that indicate that the validity effect seen in response to endogenously cued stimuli is larger in patients with neglect for contralesional space than in normal subjects.\nOur results indicate that the slowing of attentional shifts that occurs in patients with neglect occurs on the basis of damage to mechanisms that impact both peripherally (Experiment 1) and centrally (Experiment 2) cued targets. While this implies that both exogenous and endogenous mechanisms of attention are affected, one important caveat is that Experiments 1 and 2 may not perfectly delineate these two mechanisms. In Experiment 1 peripheral cues were somewhat (72%) predictive of target location. It is possible that shifts of attention may contain an endogenous component, since subjects could develop expectations regarding the location of targets based on the appearance of cues. Prior investigations that have employed informative peripheral cues demonstrate validity effects that are presumed to be attributable to endogenously generated expectations about target location. Thus, it may be the case that endogenous mechanisms may be contributing to the exaggerated validity and eccentricity effects observed for neglect patients in Experiment 1. This possibility is itself interesting, because it contrasts with prior studies demonstrating relative preservation of endogenous mechanisms for orienting attention into contralesional space in patients with neglect.",
"gender": "Male"
}
] |
PMC2852117
|
[
{
"age": 76,
"case_id": "PMC8492411_01",
"case_text": "A 76-year-old male presented to the emergency room with slowly progressive gait difficulty, motor retardation, and generalized \"weakness.\" The patient otherwise had no relevant past medical history. Computed tomography (CT) and magnetic resonance imaging were performed which demonstrated prominent lateral ventricles out of proportion to the degree of cortical sulcal markings [Figure 1]. The patient was seen by the neurology service due to a broad differential diagnosis including Parkinson's disease; however, following clinical evaluation, NPH was thought to be the most likely diagnosis. A high-volume LP was then performed and resulted in significant improvement in the patient's gait. Based on his clinical presentation, his excellent response to CSF drainage, and after ruling out other coexisting neurological disorders, the patient was diagnosed with INPH and was scheduled for surgical intervention with a ventriculoperitoneal (VP) shunt placement. The patient underwent a right VP shunt placement with neuronavigation with a Strata valve set to 2.0 and tolerated the surgery well without complications. Postoperative imaging demonstrated a reduction in the amount of ventricular dilatation [Figure 2].\nDuring his 2-week follow-up visit, the patient reported improvement in his gait, cognition, and incontinence. In his 3-month follow-up visit the patient reported episodic low back pain, but his clinical symptoms from the INPH remained stable and his valve setting was therefore left at 2.0. A timeline of the distance and steps walked by the patient over the span of 1 year preoperatively to 1 year postoperatively demonstrated a progressive decline in activity which continued following surgical intervention [Figure 3].",
"gender": "Male"
},
{
"age": 70,
"case_id": "PMC8492411_02",
"case_text": "A 70-year-old male presented with a 2-month history of cognitive slowing, bladder dysfunction, and gait imbalance. The patient additionally reported a history of chronic lower back pain, benign prostatic hyperplasia, and a right total knee replacement 8 months prior. After clinical evaluation and CT imaging, he was found to have INPH and was referred for right VP shunt placement [Figure 4]. The patient underwent an uncomplicated right VP shunt placement with a Strata valve set to 2.0 and tolerated the procedure well [Figure 5].\nAt his 2-week follow-up visit, the patient self-reported that his walking has improved since surgery. He did report some fatigue but attributed this to his right total knee replacement. He additionally reported an improvement in both urinary continence and cognition. At this time, the Strata valve was dilated to 1.5 in attempt to further symptomatic improvement. During his 1-month postoperative visit, he reported further improvement in walking and urinary incontinence and his valve was therefore left at 1.5. A timeline of the distance and steps walked by the patient over the span of 1 year preoperatively to 1 year postoperatively demonstrated a transient, but significant improvement in activity following surgery which was sustained until approximately week 47, after which patient experienced progressive activity decline [Figure 6].",
"gender": "Male"
}
] |
PMC8492411
|
[
{
"age": 43,
"case_id": "PMC5078781_01",
"case_text": "Case 1. The first case is of a 43-year-old previously female who initially presented with severe headaches and diplopia due to right abducens nerve palsy. On initial computerized tomography imaging (CT), she was found to have a large sphenoid mass, multiple pulmonary nodules, and multiple lytic bone lesions (Figure 1). During her subsequent assessment for tissue biopsy, she became severely hypoxic and was directly admitted to the intensive care unit (ICU) for hypoxic respiratory distress and required mechanical ventilation. Her ICU course was complicated by severe hyponatremia and sepsis secondary to Pseudomonas bacteremia successfully treated with cefepime and levofloxacin. A biopsy of the sphenoid sinus lesion was consistent with anaplastic large cell lymphoma (ALCL), with malignant cells positive for CD30+ and ALK-1+ immunohistochemical stains. She received her first cycle of cyclophosphamide, hydroxydaunorubicin, vincristine, etoposide, and prednisone (CHOEP) while being intubated in the ICU. After 1 cycle of CHOEP, her condition stabilized and she was later discharged to follow up at our institution for second opinion and evaluation for autologous stem cell transplantation. Despite the well-described chemosensitivity of ALK-positive ALCL and the relatively favorable prognosis of this entity compared to ALK negative ALCL, our patient presented with fulminant, multisystem disease. Due to the aggressiveness of her disease coupled with the possibility of central nervous system (CNS) involvement, our team decided to escalate her regimen to include CNS-penetrating agents using standard hyperCVAD with high dose methotrexate (MTX) and cytarabine with intrathecal (IT) MTX and cytarabine. The cycle of CHOEP she received in the ICU was counted as cycle 1 of hyperCVAD. On her follow-up after cycle 2, she presented with a clinically palpable lymph node in her scalp; she had a gradual increase of plasma lactate dehydrogenase (LDH) from normal levels peaking to 347 (U/L, range 135-225) several days after completion of hyperCVAD. CT showed confirmed progression of her pulmonary disease (Figure 1). Since her disease was strongly CD30-positive and her anticipated prognosis was extremely poor given demonstrated refractoriness of disease to very intensive chemotherapy regimen, we decided to add BV to the hyperCVAD regimen. Due to the overlapping neurotoxicity between BV and vincristine, vincristine was removed from her hyperCVAD regimen (herein referred to as \"hyperCBAD\").\nThe hyperCBAD regimen is modified hyperCVAD with two regimens alternating on a 21-day cycle. The first regimen (A) consists of cyclophosphamide 300 mg/m2 intravenous given every 12 hours on days 1 to 3, MESNA 600 mg/m2/day continuous infusion given on days 1 to 3 six hours after cyclophosphamide, doxorubicin 50 mg/m2 intravenous given on day 4, dexamethasone 40 mg given on days 1 to 4 and days 11 to 14, IT-MTX 12 mg given on day 2, and IT-cytarabine 100 mg given on day 8. BV 1.8 mg/kg was given on day 1 one hour after cyclophosphamide. G-CSF support with pegfilgrastim 6 mg was given subcutaneously on day 5. The second regimen (B) consists of high dose MTX (200 mg/m2 given over 2 hours on day 1 followed by 800 mg/m2 over 22 hours), cytarabine 3000 mg/m2 given intravenously every 12 hours on days 2 and 3, methylprednisolone 50 mg given intravenously twice daily on days 1 to 3, and IT-MTX 12 mg given on day 2. Leucovorin 50 mg intravenously was given 12 hours from the start of MTX infusion followed by 50 mg every 6 hours until serum MTX is less than 0.1. BV 1.8 mg/kg was given intravenously on day 1. G-CSF support with pegfilgrastim 6 mg was given on day 4. For both regimens, the patient was given prophylactic antimicrobials with levofloxacin 500 mg daily, posaconazole 300 mg tab daily, acyclovir 400 mg twice daily, and atovaquone 750 mg daily.\nThe PET/CT after 3 cycles of alternating regimens A and B of hyperCBAD showed no metabolic evidence of lymphoma. The widespread osseous lytic lesions persisted but did not show FDG-PET avidity. The sphenoid sinus mass also persisted but no FDG avidity was demonstrated. The right abducens nerve palsy resolved. She then received consolidation radiation therapy to right sphenoid sinus. Endoscopic evaluation of the sphenoid sinus was unremarkable. Given concern that high dose chemotherapy and autologous stem cell transplant would result in excessive toxicity having just completed the hyperCBAD regimen and considering that the patient achieved a complete remission, our team decided to hold autologous stem cell transplantation. Instead, she was started on single agent BV maintenance (1.8 mg/kg every 21 days). After 5 cycles of maintenance BV, she opted to stop treatment due to worsening peripheral neuropathy. After two months of observation, she relapsed in the right temporal parietal lobe presenting with severe headaches and neurologic deficits. She was treated with 2 cycles of high dose MTX (8,000 mg/m2 every 2 weeks) which stabilized the CNS disease. She was then treated with salvage chemotherapy with cytarabine (3 gm/m2 given on days 1 and 2), thiotepa (40 mg/m2 given on day 2), IT liposomal cytarabine 50 mg on day 3, and dexamethasone 4 mg orally given twice daily on days 3 to 7. Unfortunately, the patient's performance status continued to decline and she opted for best supportive care with home hospice and died at home.",
"gender": "Female"
},
{
"age": 60,
"case_id": "PMC5078781_02",
"case_text": "Case 2. The second patient is a 60-year-old male with history of coronary artery disease, hypertension, and hyperlipidemia, who was referred to our clinic by his cardiologist for evaluation of diffuse lymphadenopathy. One week prior to presenting to his cardiologist, he reported having acute viral illness, consisting of acute diarrhea and nausea. His symptoms improved after four to five days, but then he developed new cervical and axillary lymphadenopathy, difficulty swallowing, decreased appetite, and an eight-pound weight loss over two weeks. Initial workup was negative for Epstein Bar Virus (EBV), cytomegalovirus (CMV), and Human Immunodeficiency Virus (HIV) infection. Lactate dehydrogenase and uric acid levels were elevated. Review of his peripheral blood smear was notable for large, atypical lymphocytes. Subsequent flow cytometry analysis of the peripheral blood was significant for a CD5+ monoclonal B-cell population with lambda light chain restriction. CT of his chest, abdomen, and pelvis showed diffuse lymphadenopathy (Figure 2(a)). The bone marrow core biopsy showed a hypercellular marrow (95%) (Figure 2): 50% of the cells were large lymphoid cells positive for CD5, CD20, and dimly BCL 6 positive. These same cells were also found in the cerebrospinal fluid (CSF) analysis.\nHe was diagnosed with stage IV nongerminal center DLBCL with leptomeningeal involvement and was started on standard rituximab, cyclophosphamide, Adriamycin, vincristine, and prednisone (R-CHOP) with IT-MTX. His first cycle of R-CHOP was complicated by pancytopenia and neutropenic fever which was successfully treated with broad spectrum antibiotics. Upon completion of his second IT-MTX treatment, no monoclonal B-cells were seen in his CSF by flow cytometry and cytology. After 3 cycles of R-CHOP and five doses of IT-MTX, the patient subsequently developed a right cranial nerve (CN) III palsy and right eyelid lag despite significant response in the lymphadenopathy. Given clinical evidence of leptomeningeal disease, we decided to continue R-CHOP but added high dose intravenous MTX every three weeks, given one week after R-CHOP. High dose MTX was added because of known central nervous system (CNS) penetration and activity. We also added IT-cytarabine along with IT-MTX alternating between cycles.\nDespite receiving two more doses of R-CHOP, two doses of IT-MTX and Ara-C, and three doses of high dose intravenous MTX, he developed progressive lymphadenopathy and additional neurologic deficits (right CN VI palsy and right arm weakness in addition to his right CN III palsy and right eye lid lag). Restaging PET/CT confirmed progression of his diffuse lymphadenopathy with no malignant foci in the brain or spine. Despite progression of disease, his performance status remained intact with an Eastern Cooperative Oncology Group (ECOG) performance status of 1. The patient was then treated with salvage chemotherapy using R-DHAP (rituximab, dexamethasone, high dose Ara-C, and cisplatin) and IT-depot liposomal cytarabine. He developed acute kidney injury, likely from cisplatin, and new hoarseness due to involvement of the recurrent laryngeal nerve. Further treatment with R-DHAP salvage chemotherapy was stopped due to continued, progressive disease (Figure 3(b)). Despite disease progression on cisplatin-based salvage chemotherapy, the patient's performance status was still excellent and the patient expressed willingness to pursue alternative therapy. Reanalysis of the bone marrow specimen revealed that approximately 10-15% of the lymphoma cells expressed CD30 by immunohistochemistry (Figure 2). We then decided to combine BV (1.8 mg/kg given on day 1) with topotecan (1 mg/m2 given on days 1-6) on a 21-day schedule. Topotecan was chosen for its ability to penetrate the CNS and the dose and schedule were adopted from the TTR (taxol, topotecan, and rituximab) regimen. Upon completion of cycle 1 of this regimen, he developed Grade 2 vertigo. A magnetic resonance imaging scan (MRI) of his brain did not show a CNS lesion. The patient otherwise continued to have good functional status and treatment was continued. A staging PET/CT performed after completion of the 2nd cycle of TTR showed significant improvement in adenopathy (Figure 3(c)), but he developed Grade 2 diarrhea, Grade 3 neutropenia, Grade 3 anemia, Grade 2 thrombocytopenia, and Grade 2 vertigo, with a subsequent decrease in his ECOG performance status from 1 to 2. He otherwise had no new neurological deficits. Repeated CSF analysis showed no malignant lymphocytes. He received the third dose of BV and topotecan and was evaluated for stem cell harvest for possible ASCT. Unfortunately, the patient developed episodic syncope, lightheadedness, and diaphoresis, thought to be due to autonomic dysfunction, and his performance status declined drastically. Although brain and spinal MRI did not reveal any focal abnormalities and CSF analysis was negative, clinical progression of the leptomeningeal disease could not be ruled out. He was empirically treated for adrenal insufficiency with a trial of fludrocortisone which was ineffective. At this point, he declined further treatment and was transitioned to best supportive care with home hospice. Two months after discontinuing therapy, he died at home.",
"gender": "Male"
}
] |
PMC5078781
|
[
{
"age": 39,
"case_id": "PMC7193124_01",
"case_text": "A 39-year-old Taiwanese male painter had a history of alcohol consumption (approximately 90 units of alcohol per week for more than 6 years) and smoking (30 pack-years), but no illicit drugs use. Initially, he was brought to our hospital on 31 August 2018 with hemoptysis, yellowish thick sputum, a retrosternal burning sensation, and a 2-month history of progressive cough. No fever, chest pain, dyspnea, or tarry stool was found. He denied any previous medical history and he also denied previous travel history. At the emergency department, physical examination revealed a heart rate of 102 beats per minute, blood pressure of 133/82 mm Hg, respiratory rate of 20 breaths per minute, oxygen saturation of 89% on room air, and temperature of 37.0 Celsius. There was no lymphadenopathy or splenomegaly. There were left lower lung crackles on chest auscultation, and the neurological examination was normal. A chest radiograph showed a cavitary lesion in the left lower lung area (Fig. 1A). Chest high-resolution computed tomography revealed a cavitary mass with air-fluid level over the left upper and lower lobes (Fig. 1E); therefore, lung abscess was diagnosed. For community acquired pneumonia, these are many types of pathogens which could induce pneumonia with parenchymal cavitary lesion, including Gram negative bacteria such as Klebsiella pneumoniae and Haemophilus influenzae, Gram positive bacteria such as Staphylococcus aureus including methicillin-resistant Staphylococcus aureus (MRSA) and Streptococcus pneumoniae, atypical bacteria such Mycoplasma pneumoniae and Legionella pneumophila, pulmonary tuberculosis, fungal infection, and parasite infection. The patient was admitted to our ward on 31 August 2018. The initial white blood cell (WBC) count was 10.33 x 1000/muL, C-reactive protein was 97.8 mg/L, and eosinophilic percentage was about 0.8%. Based on the laboratory data, bacterial infection was suspected. In addition, due to previous alcoholism history, Gram negative bacterial infection was highly suspected, especially Klebsiella pneumoniae. According to 2019 American Thoracic Society (ATS) and Infectious Diseases Society of America (IDSA) for pneumonia treatment guide suggestion, beta-lactam with fluoroquinolone combination therapy is considered as a standard regimen for severe inpatient pneumonia. In our patient, the chest CT revealed lung abscess lesion over the left upper and lower lobes. Lung abscess is a relatively more severe pattern of pneumonia. In addition, the patient had used to drink alcohol for a long time, and immunocompromised status should be considered. According to ATS & IDSA guideline, combined treatment with Curam (amoxycillin + clavulanate potassium) and levofloxacin should be suitable in this situation.\nTherefore, we prescribed intravenous amoxicillin 1000 mg/clavulanic acid 200 mg every 8 hours and levofloxacin 750 mg per day for initial treatment. The serum mycoplasma IgM titer was 0.443 OD ratio which excluded mycoplasma infection. In addition, three sets of tuberculosis acid fast stains showed negative results on 04 September 2018 afternoon, and therefore pulmonary tuberculosis infection was excluded. The sputum culture report became available on 03 September 2018, and confirmed Klebsiella pneumoniae infection, which was sensitive to all of the antibiotics except ampicillin. Besides, chest radiograph on 6 September 2018 showed persistent cavitary lesion with newly developed peripheral infiltration at left lower lung field (Fig. 1B). Therefore, we changed the antibiotics from amoxicillin/clavulanate to inhaled colimycin (colistin base 2MU (66.8 mg) = 2.0 MIU colistimethate sodium (CMS) (160 mg/vial)) every 8 hours, but we retained levofloxacin as a synergistic agent for severe pneumonia treatment. The patient's chest radiograph on 13 September 2018 showed both the cavitary lesion and peripheral infiltration at left lower lung field had improved one week after change of antibiotics (Fig. 1C), and the lung lesions were almost completely resolved after four weeks of treatment (Fig. 1D and F).",
"gender": "Male"
}
] |
PMC7193124
|
[
{
"age": 17,
"case_id": "PMC7392863_01",
"case_text": "A previously healthy 17-year-old male with noncontributory past medical history, presented with a one month of dry cough and intermittent hemoptysis. For several weeks prior to hospitalization, he experienced severe exertion dyspnea that limited his mobility. The patient also complained of high fever and shivers in 15 days. The patient acknowledged oral and genital aphtous ulcers occasionally in the past two years. On clinical examination, the patient was alert, oriented, and appeared weak and thin. He weighed 45 kilograms of unintentional weight loss over the preceding two months. The patient vital signs were as follows: temperature 39; blood pressure 128/70 mmHg; heart rate 117 bpm; respiratory rate 20 bpm and an oxygen saturation 97% on room air. He had folliculitis in his face otherwise; the rest of the examination was unremarkable (no oral lesions or penile ulcers objected).\nThe patient's white blood count was 10.14 103 cells/ml with normal differential; red cell count was 9.18 GM/dL; hematocrit, 38.5% and platelets were 212 103 cells/ml. C-reactive protein was 105 mg.L-1.The liver function tests, urea and electrolytes were normal. His chest radiography showed right basal consolidation. The three acid-fast bacillus smears were negative, culture was underway. An initial chest CT found condensation in the apical segment of the inferior right lobe (Figure 1). The patient was placed under antibiotic treatment with amoxicillin + clavulanic acid, but the evolution was marked by the non-clinical improvement and persistence of hemoptysis.\nTaking into consideration, the young age of the patient, the history of oral and genital aphthous stomatitis, and the recurrent hemoptysis, a chest CT angiography was requested. It showed a pulmonary embolism of the right pulmonary artery and the right lower lobe bronchus, the presence of a bilateral partial thrombosis ectasia of the right middle lobe bronchus and the left lower lobe brochus and a right intraventricular thrombus (Figure 2). The transthoracic echocardiography showed severe right ventricle enlargement and a 40 mm 26 mm friable mass with a broad attachment to the right ventricular outflow tract and distal right ventricle. The pathergy test was negative. He was finally diagnosed as Behcet's disease (BD) associated with extensive venous thromboembolism including intracardiac thrombus in the right ventricle and pulmonary embolism. The patient was initially treated by anticoagulant then immunosuppressant: methylprednisolone bolus, cyclophosphamide and colchicine. The clinical evolution was favorable.",
"gender": "Male"
}
] |
PMC7392863
|
[
{
"age": 71,
"case_id": "PMC10158724_01",
"case_text": "A 71-year-old Japanese man was presented to our institution with severe thrombocytopenia. His past medical history included postoperative lung and bladder cancer, coronary stenting for myocardial infarction, pacemaker implantation for sick sinus syndrome, and Helicobacter pylori eradication. In addition, a year prior to his presentation to our institute, a right retroperitoneal mass without cervical, axillary, and para-aortic lymphadenopathy was incidentally detected on a whole-body computed tomography (CT) on a follow-up visit after surgery for lung cancer (Fig. 1A-C). CT-guided biopsy of the right retroperitoneal mass was performed, and he was diagnosed with reactive lymphoid hyperplasia.\nAt the time of presentation to our institution, there were no other obvious clinical findings except for petechial hemorrhage in the lower leg. Complete blood counts showed anemia (10.7 g/dL; normal range, 14.0-17.5 g/dL) and severe thrombocytopenia (10 x 103/muL; normal range, 158-348 x 103/muL). Biochemical tests revealed mild hypoalbuminemia (2.7 g/dL; normal range, 4.1-5.1 g/dL) and elevated lactate dehydrogenase (275 IU/L; normal range, 124-222 IU/L). Serological tests demonstrated elevated C-reactive protein (2.90 mg/dL; normal range, 0.00-0.30 mg/dL), ferritin (376.7 ng/mL; normal range, 21.8-274.6 ng/mL), and soluble interleukin-2 receptor (sIL2-R) (2900 IU/mL; normal range, 122-496 IU/mL). The patient had polyclonal hypergammaglobulinemia and strongly positive antinuclear antibody, but there were no physical findings suggestive of collagen disease. In addition, platelet-associated immunoglobulin G was elevated (1570 ng/107 cells; normal range, <= 46 ng/107 cells), and platelet binding-IgG was detected, suggesting the presence of autoantibodies to platelets (Table 1). A whole-body CT revealed small cervical, axillary, and para-aortic lymphadenopathy, but the known right retroperitoneal mass had spontaneously resolved. (Fig. 1D-F). Secondary immune thrombocytopenia due to low-grade lymphoma was suspected, but it was difficult to perform lymph node biopsy because of severe thrombocytopenia. He did not wish to undergo bone marrow examination; thus, he was treated with PSL (0.5 mg/kg daily), and his platelet count gradually recovered. Due to a reduction in the PSL dose to 7.5 mg daily, a recurrence of thrombocytopenia occurred and 10 mg daily was recontinued.\nApproximately two and a half years after starting PSL treatment, cervical lymphadenopathy had slightly progressed without other clinical symptoms. Positron emission tomography-CT showed increased fluorodeoxyglucose uptake in systemic enlarged lymph nodes (Fig. 1G-I). The results of blood tests were similar to those at the initial presentation, except for an improvement in thrombocytopenia, hypoalbuminemia, and liver dysfunction, an exacerbation of creatinine and sIL2-R, and the detection of Epstein-Barr virus (EBV)-DNA (Table 2). A biopsy of the left cervical lymph node was performed. Histological examination of the biopsy specimen using hematoxylin and eosin (H & E) staining revealed the dense proliferation of medium-sized lymphoid cells between enlarged follicles (Fig. 2A). These medium-sized lymphoid cells were CD3+, CD4+, CD5+, CD7+, CD8-, CD10-, CD20-, programmed cell death (PD)-1+, and inducible T-cell co-stimulator+ (partially) on immunohistochemistry (Fig. 2B-D). These tumor cells proliferated around the residual non-neoplastic germinal centers where follicular dendritic cell meshwork (CD21+ area) was maintained (Fig. 2E), showing a \"T-zone pattern\". Neither high endothelial venule, nor clear cells, were observed. Ki-67 labeling index was high (data not shown) and in situ hybridization for EBV-encoded small RNA revealed scattered positive cells (Fig. 2F). We analyzed T-cell receptor (TCR) gene rearrangements by polymerase chain reaction (PCR) using a formalin-fixed paraffin-embedded section; however, a monoclonal peak was not found due to the quality of the PCR product (data not shown). Bone marrow biopsy (BMB) using H & E staining showed no obvious lymphoma cell infiltration or morphological dysplasia (data not shown). In addition, a pathological review of the right retroperitoneal mass demonstrated a dense infiltrate of small-to-medium-sized CD4+ and PD-1+ T-cells outside the follicles (Fig. 2G-I). Thus, we considered the possibility of capturing the initial lesion of the T-cell lymphoma in a biopsy sample. The patient was finally diagnosed with nodal PTCL with TFH phenotype which presented as immune thrombocytopenia (Lugano classification: Stage III).\nThe patient did not receive chemotherapy because of the absence of clinical symptoms other than lymphadenopathy and concomitant cardiac and renal failure. However, his lymphadenopathy did not progress (Fig. 1J-L), and he had no recurrence of thrombocytopenia and no appearance of lymphoma-related symptoms for one and a half years after diagnosis with PSL dose: 10 mg daily continuation.",
"gender": "Male"
}
] |
PMC10158724
|
[
{
"age": 37,
"case_id": "PMC4083103_01",
"case_text": "The patient, a 37 year old Malaysian Chinese parturient (Gravida 4 Para 2 + 1) was admitted at 25 weeks gestation following a routine scan which suggested intrauterine death. A repeat scan done when she had per vaginal bleeding confirmed the death and showed a grade 3-4 placenta praevia with suggestions of a placenta accreta.Her two previous deliveries were via caesarean section for breech delivery 8 and 6 years prior to the current event in another hospital. She was confirmed to have a congenital complete heart block after her first delivery and was followed up in the National Heart Insitute where she was treated conservatively. Throughout the period of current and previous pregnancies, she has never been symptomatic of CHB; chest pain, palpitations or syncopal attacks. Her ECG showed a complete heart block with narrow QRS complex, indicating a high nodal impulse with a rate of 50/min (Figure 1). Her blood pressure was 140/80 mmHg. Bedside echocardiogram was relatively normal except for mild mitral regurgitation. Her serum thyroid stimulating hormone and antinuclear antibody levels were normal. Coagulation profile showed a slightly elevated prothrombin time of 1.24 s and an international normalized ratio of 1.3. Her fibrinogen levels were normal.\nThe obstetrician opted for hysterostomy to deliver the baby with an alternative plan of performing a caesarean hysterectomy in the event of uncontrolled bleeding. Prior to the surgery, bilateral uterine artery embolization was performed by a radiologist. A temporary intravenous pacemaker was also inserted by a cardiologist.\nGeneral anesthesia was induced with fentanyl 100 mug, etomidate 18 mg and suxamethonium 100 mg. Anaesthesia was maintained with 2% sevoflurane in oxygen/air 50%. Pain relief was with morphine boluses and continued muscle relaxation with rocuronium. Tranexamic 1 g was also infused intra-operatively.Patient's heart rate was monitored and averaged between 50-60 beats/minute which did not require pacemaker activation. Intra-arterial blood pressure monitoring did not show any instability. The patient's haemodynamics remained stable intra-operatively (Figure 2).\nThe total blood loss was 1.2 L and patient was transfused 3 units of packed cells intra-operatively. The pre-operative haemoglobin was 11.3 g/dL and the immediate post-operative value was 7.9 g/dL. A total abdominal hysterectomy was done to control the bleeding.\nPost-operatively, the patient was extubated as she remained stable hemodynamically. She was monitored in the intensive care unit and the pacemaker was removed 48 hours later as she remained stable hemodynamically. Patient was discharged home on the 4th post-operative day.",
"gender": "Female"
}
] |
PMC4083103
|
[
{
"age": 25,
"case_id": "PMC6252179_01",
"case_text": "A 25-year-old man, known case of dilated cardiomyopathy, aneurysm of the ascending aorta, and severe aortic regurgitation, referred to our center for heart transplantation. He had no risk factor for cardiovascular diseases. He was under treatment with furosemide, spironolactone, lisinopril, atorvastatin, and carvedilol. Echocardiography showed severe left ventricular enlargement with severe systolic dysfunction (LVEF of 20%), global hypokinesia, significantly increased left ventricular filling pressure, severe right ventricular enlargement with severe systolic dysfunction, tethered mitral leaflets with moderate functional mitral regurgitation, tricuspid malcoapted aortic leaflets with severe aortic insufficiency, aneurysmal dilatation of the sinus of Valsalva (6.9 cm) and ascending aorta (8.1 cm), severe pulmonary hypertension (mean PAP of 45 mm Hg), and large bilateral pleural effusion. He underwent total cardiac and aortic root transplantation. The surgically excised aortic aneurysm is shown in Figure 1. \nOperative Technique\nAfter proper prep and drape, midline sternotomy was done with 3 cm extension of superior aspect of the incision to the neck. Using two thoracic retractors, at the same time, we had a good exposure to the thorax and neck vessels. Before opening the pericardium, we explored the innominate artery in the neck and after injection of the proper amount of heparin, we cannulated it directly with simple aortic cannula. At first, tip of the cannula was guided toward the aortic arch. Then, the pericardium was opened vertically and a two-stage cannula was inserted into the right atrium. Cardiopulmonary bypass was started and the patient cooled down to 28 C.\nThe groove between the ascending aorta and pulmonary artery was dissected properly and an aortic clamp was inserted at the mid-portion of the most dilated part of the ascending aorta. Resection of the recipient's heart was done as routine with the resection of aorta just below the clamp. The donor's heart was transplanted first with the left atrium anastomosis. Then, the posterior part of the pulmonary artery was anastomosed properly. Then, the tip of the aortic cannula was turned toward the cervical vessels at low flow state and aortic clamp was opened. Another clamp was inserted between the arch and the cannula at innominate artery. Circulatory arrest was started with a perfusion rate of 600 mL/min of head and neck vessels. Hemi-arch resection was done and the donor's aorta, which was resected totally with its arch, was anastomosed to the hemi-arch of the patient.\nWarming of the patient was started. The cannula's tip was rotated again toward the aortic arch. Normal cardiopulmonary flow was started after inserting the aortic vent and the superior and inferior vena cava and anterior part of the pulmonary artery was anastomosed as routine at normal temperature. The cardiopulmonary bypass was stopped. Immediately post-operative trans-esophageal echocardiography showed normal left ventricular size with mild to moderate systolic dysfunction (LVEF of 40%-45%) with hypokinesia of the lateral wall, moderate right ventricular enlargement with moderate to severe systolic dysfunction, mild to moderate mitral regurgitation, no aortic insufficiency, and normal ascending aorta. The patient had an uneventful hospital course. He was followed for three years annually until now. His last admission was for annual cardiac biopsy, when echocardiography showed normal left ventricular size and systolic function (LVEF of 55%), mild to moderate right ventricular enlargement and dysfunction, no aortic insufficiency, mild mitral regurgitation, and no pulmonary artery hypertension.",
"gender": "Male"
}
] |
PMC6252179
|
[
{
"age": 58,
"case_id": "PMC10291978_01",
"case_text": "A 58-year-old male with a past medical history of paroxysmal atrial fibrillation/flutter, diastolic heart failure, severe tricuspid (TR) and mitral (MR) regurgitation, coronary artery disease status post coronary artery bypass graft, and substance abuse presented to the emergency department with shortness of breath, chest tightness, nausea, and lower extremity swelling for one to two weeks. The patient had not been compliant with his medications. His heart rate (HR) was irregular with a documented rate of 95 bpm, blood pressure was 132/81 mmHg, and oxygen saturation was 97% on room air. His weight was 209 pounds, up from a baseline of approximately 185 pounds.\nChest x-ray showed cardiomegaly and pulmonary vascular congestion. B-type Natriuretic Peptide (BNP) and troponin were elevated. Prothrombin time, international normalized ratio, liver enzymes, electrolytes, blood urine nitrogen, and creatine (Cr) were within normal limits.\nThe urine drug screen was negative. Electrocardiogram (ECG) showed atrial flutter with a 3:1 AV conduction and a rate of 85 bpm. He was admitted for heart failure exacerbation and home medications were resumed including metoprolol, aspirin, apixaban, and atorvastatin. Diuresis was initiated with intravenous furosemide and oral metolazone.\nTroponin peaked at 0.185 ng/ mL during the event before trending down back to 0.033 ng/ mL. The trend in troponin was attributed to demand ischemia. The patient tolerated diuresis well and his weight returned to baseline after four days. Heart rate was variable during this time, ranging from 67 to 126 bpm, with most readings being over 100. Blood pressure was stable with systolic at 120-135 mmHg and diastolic at 70-90 mmHg. HR remained elevated despite medical treatment; thus, it was decided to attempt cardioversion. In preparation, a transesophageal echocardiogram (TEE) showed no atrial thrombus, but rather severe mitral and tricuspid insufficiency. The morning of the TEE, vital signs remained stable and labs were unremarkable.\nThe following morning Cr increased to 1.88 mg/dL and Blood Urea Nitrogen (BUN) 40 mg/dL. The patient underwent successful cardioversion and oral Amiodarone was initiated. Following the procedure blood pressure was 87/61 mmHg. Pressures remained suboptimal throughout the morning: systolic 90-93 mmHg and diastolic 60-73 mmHg. HR was 58-80 bpm. Blood pressure medications were held. Labs later that day showed an increase in serum Cr increased to 2.52 mg/dL, potassium (K+) to 6.4 mEq/L, and bicarbonate decreased from 29 to 19 mEq/L. Aspartate aminotransferase (AST) was 101 U/L and alanine aminotransferase (ALT) was 79 U/L, an increase from AST 31 and ALT 24 one week prior. Total bilirubin (T Bil) also increased from 0.8 to 1.7 mg/dL.\nThe patient began complaining of right upper quadrant (RUQ) abdominal pain. Abdominal x-ray showed constipation but was otherwise unremarkable. Computed tomography of the abdomen and pelvis without contrast was unremarkable. Repeat labs revealed rising serum Cr up to 3.37 mg/dL, AST of 263 U/L, ALT of 203 U/L, and T bil of 1.9 mg/dL. Lactic acid was 5.0 mmol/L. Electrocardiogram (ECG) showed sinus rhythm with a rate of 60 bpm. Urinalysis was unremarkable. Creatine phosphokinase was within normal limits. The patient's hypotension progressed, and a norepinephrine drip was started. The patient continued to be in sinus rhythm with heart rate ranging between 60-80 bpm. Blood and urine cultures were obtained, and broad-spectrum antibiotics were initiated.\nThe morning after cardioversion, labs showed AST of 6694 U/L, ALT of 3354 U/L, T bil of 2.1 mg/Dl, and direct bilirubin 1.3 mg/dL. Cr and K also continued to rise, and a plan to start hemodialysis was initiated. Repeat echocardiogram showed similar findings as before, with ejection fraction of 50-55%, severe MR, moderate to severe TR with no evidence of cardiogenic shock. Blood pressures stabilized and the patient was weaned off pressor support, requiring less than 24 hours. Due to evidence of acute renal failure, urgent hemodialysis was started. Amiodarone was held due to elevated liver enzymes; he received a total of 200 mg of oral amiodarone. The next morning, labs were AST 2928 U/L and ALT 2524 U/L, T bil 1.6 mg/dL, and INR 2.3. The viral hepatitis panel was negative. The patient tolerated dialysis well and kidney function and liver function improved. Cultures showed no growth at the 48-hour mark and hence antibiotics were stopped. Metoprolol and furosemide were slowly re-started, and patient tolerated them well.",
"gender": "Male"
}
] |
PMC10291978
|
[
{
"age": 28,
"case_id": "PMC6442154_01",
"case_text": "A 28-year-old man presented to our medical center with pain and asymmetric penile swelling, following a penile injury sustained 1 hour previously. He described having sexual intercourse in the female superior position when, on attempting penetration, his penis bent sharply against his partner's thigh. He noticed a 'snap' in the left side of his penis, associated with severe pain, discoloration and deformation. The penis then began to swell and marked bruising developed along the shaft, eventually tracking down into the scrotum. He was able to void normally and had not noticed blood in his urine. On physical examination, the patient had a grossly deformed penis with swelling and deviation to the right (Figure-1). There was no microscopic hematuria on dipstick urinalysis and urethral imaging was, therefore, not performed. Axial CT image demonstrated unilateral 0.8cm x 1.4cm area of tear of the left lateral tunica albuginea with adjacent hematoma. The penile shaft deviates to the right side. The imaging findings were confirmed at surgery (Figure-2).\nThe patient was transferred to the operating room where, under general anesthesia, a defect in the middle of the left corpus cavernosum could be palpated by rolling a finger over the hematoma. He was treated by surgical exploration, evacuation of the haematoma and repair of the ruptured tunica albuginea using absorbable sutures (Figure-3). The patient had good erection with no angular deformity or plaque formation after a 3-month follow-up.",
"gender": "Male"
}
] |
PMC6442154
|
[
{
"age": 61,
"case_id": "PMC6302118_01",
"case_text": "A 61-year-old man was transferred to the emergency department at Kameda Medical Center complaining of dyspnea. Eighteen years previously, he had been diagnosed with asthma at another hospital. Fourteen years earlier he had developed fever, rash, pinprick sensation in both legs, and eosinophilia. Although a serum test for MPO-ANCA at that time was negative, EGPA was suspected on clinical grounds and he was treated with oral prednisone 60 mg/day. He showed an immediate response to treatment, so the oral prednisone was gradually tapered to 5 mg/day. Six years earlier, he had developed chronic wheezing and cough, and was referred to our clinic at Kameda Medical Center. At that time, his eosinophil count and MPO-ANCA titer were high. We diagnosed EGPA on the basis of his symptoms and increased the dose of oral prednisone. His eosinophil count and MPO-ANCA titer trended downward but his symptoms continued to worsen. He developed wheezing, cough, purpura on the extensor surfaces of the right arm and left elbow, pinprick sensation in both arms and both legs, hearing impairment, and sinusitis. Magnetic resonance imaging of the brain revealed multiple cerebral infarcts. Intravenous glucocorticoid pulse therapy and intravenous cyclophosphamide were started. Despite frequent administration of both treatments, one year prior to the current admission he was diagnosed with DAH based on findings in bronchoalveolar lavage fluid (BALF). The DAH relapsed despite addition of plasma exchange to his treatment regimen. Before the present admission, the total dose of intravenous cyclophosphamide was 12.8 g and the total number of plasma exchanges was 7. The patient then developed dyspnea and was transferred to our hospital on the same day. He denied bloody sputum, palpitations, or chest pain. His medical history included diabetes mellitus, thalamic and left putamen hemorrhage, and right caudate infarction. He was taking oral prednisone at a dose of 55 mg/day, aspirin, and trimethoprim-sulfamethoxazole, and was administering subcutaneous insulin. He had smoked 1-2 packs of cigarettes daily for 30 years and had quit smoking 15 years earlier. He was employed as an office worker.\nOn physical examination, the patient was alert and oriented. He had a blood pressure of 123/78 mmHg, a pulse rate of 108 beats/minute, a respiratory rate of 25 per minute, an oxygen saturation of 99% on 10 L/minute of oxygen via a nasal cannula, and a temperature of 37.8 C. On chest auscultation, fine crackles were detected in the lung fields bilaterally. Fissured hyperkeratotic lesions were observed on the palmar surfaces of all fingers on both hands. The pinprick sensation persisted in both legs, but no other neurologic abnormality was found. Laboratory findings revealed only mild inflammation. The peripheral white blood cell count was 40,000 cells/muL with 95% neutrophils. The blood eosinophil count was almost zero. A peripheral blood smear did not reveal any circulating blast cells. Serum MPO-ANCA levels had been negative in the previous two years. Tests for anti-nuclear antibody, proteinase 3-antineutrophil cytoplasmic antibody, and anti-glomerular basement membrane antibody were negative. The lactate dehydrogenase level was 330 U/L, the C-reactive protein level was 3.2 mg/dL, and tests for beta-D glucan and galactomannan were negative. Urinalysis revealed no proteinuria or hematuria. High-resolution computed tomography showed alveolar consolidation spreading to both lower lobes. Bronchoalveolar lavage was performed using a high-flow nasal cannula; the fluid returned became progressively more bloody in appearance. Analysis of BALF revealed the following: total cells, 2,100,000; neutrophils, 90%; lymphocytes, 0%; eosinophils, 0%; and alveolar macrophages, 10%. The results of the BALF analysis were the same as those noted on previous DAH tests. BALF cytology with Prussian blue demonstrated siderophages (hemosiderin-containing macrophages). A BALF culture showed group alpha and gamma streptococci phagocytosed by neutrophils. Cytology of the BALF did not reveal any malignant cells. There was no indication of involvement of the myocardium on an echocardiogram. Nerve conduction studies were performed twice, but did not show any abnormalities. A skin biopsy at the left elbow showed leukocytoclastic vasculitis. A biopsy performed at the left inferior nasal concha revealed eosinophilic infiltration.\nAfter hospitalization, based on the BALF analysis and Gram stain results, we suspected DAH caused by EGPA and complicated by gram-positive bacterial pneumonia. Rituximab 600 mg once weekly for four weeks was used as induction therapy for the refractory DAH. Following the steroid taper, we administered pulse treatments of methylprednisolone 1 g intravenously for three successive days. We also administered linezolid to cover gram-positive bacteria and tazobactam/piperacillin and azithromycin to cover a broad range of other bacteria. On hospital day 6, his oxygen saturation recovered to 95% without oxygen inhalation therapy. His radiologic findings improved gradually and he was discharged on hospital day 11. He achieved a remission, and mepolizumab 100 mg once a month was started for maintenance therapy. He has remained in remission ever since. We arrived at a final diagnosis of EGPA with DAH complicated by bacterial pneumonia caused by alpha and gamma streptococci.",
"gender": "Male"
}
] |
PMC6302118
|
[
{
"age": 4,
"case_id": "PMC6858974_01",
"case_text": "A 4-year-old intact female Hungarian viszla was presented to UCDVH in June 2014 with a black, necrotic, cutaneous lesion, of approximately 2 cm in diameter, involving the umbilical region of the ventral abdomen (Fig. 1). The dog was dull, moderately dehydrated and icteric on presentation. There were extensive ecchymoses on the ventral abdomen and ventrolateral aspect of the thorax bilaterally. \nHaematology, biochemistry, urinalysis and coagulation testing identified thrombocytopenia (19 (reference interval 150-500) x 109/L), azotaemia (creatinine 283 (20-120) umol/L urea 40.6 (3.6-8.6) mmol/L, panhypoproteinaemia (total protein 41.8 (54-71) g/L, hyperbilirubinaemia (258 (0.9-10) umol/L, increased creatine kinase (CK) (1590 (0-122) U/L and hepatic enzyme activities (alkaline phosphatase (ALP) 4200 (0-82) U/L, alanine transaminase (ALT) 1087 U/L; RI 0-36, glutamate dehydrogenase (GLDH) 370 (0-16) U/L, aspartate aminotransferase (AST) 749 (0-37) U/L), prolonged prothrombin time (17.2 (7-14) s), glucosuria (3+) and proteinuria (3+). tick-borne disease (Babesia spp., Anaplasma spp., Ehrlichia spp. and Hepatozoon canis) polymerase chain reaction (PCR) (IDEXX Laboratories, Wetherby, United Kingdom) and Leptospira microscopic agglutination test (MAT) (Agri-Food and Biosciences Institute Veterinary Laboratory, Belfast, Northern Ireland) were negative. Thoracic and abdominal imaging identified microcardia and echogenic material in the urinary bladder consistent with haemorrhage.\nStandard management for AKI was undertaken (fluid therapy, antiemetics, gastroprotectants and diuretic), in addition to antimicrobial therapy (amoxicillin-clavulanate and doxycycline) given the possibility of leptospirosis, whilst awaiting test results. However the dog continued to deteriorate, with worsening anaemia (haematocrit 0.16 (0.37-0.55) L/L), azotaemia (creatinine 691 umol/L, urea 57 mmol/L, and hyperbilirubinaemia (425 umol/L), and euthanasia was performed at the owner's request.\nPertinent gross post mortem findings included ecchymoses within the renal capsule and bladder wall in addition to congested and oedematous pulmonary parenchyma. Histopathological examination revealed microthrombosis and necrosis of renal glomerular tufts and, multifocally, of tubular epithelia. Transmural haemorrhage was confirmed in the bladder and occasional microthrombi were observed in the lung. Randomly distributed focal hepatocyte necrosis and loss was also noted. At the time, CRGV was not well recognised and retrospective evaluation of post-mortem data was required to confirm a diagnosis.",
"gender": "Female"
},
{
"age": 4,
"case_id": "PMC6858974_02",
"case_text": "A 4-year-old neutered female golden retriever was presented to UCDVH in February 2017 with a large, necrotic, cutaneous lesion involving the ventral abdomen and left hindlimb, extending from the caudal ventral abdomen to the mid-aspect of the ventrum (Fig. 2). Pitting oedema was present on the left hindlimb. The dog was dull, poorly ambulatory and icteric. Multiple, widespread petechiae were identified. \nHaematology, biochemistry, urinalysis and coagulation testing identified non-regenerative anaemia (haematocrit 0.34 L/L), thrombocytopenia (19 x 109/L), leucocytosis (white blood cell count 25.01 (6-17) x 109/L), increased urea concentration (15.3 mmol/L), panhypoproteinaemia (total protein 41.2 g/L), hyperbilirubinaemia (237.2 umol/L), increased CK (3041 U/L) and hepatic enzyme activities (ALP 915 U/L, ALT 141 U/L, AST 598 U/L), glucosuria (2+), proteinuria (2+) and granular casts in the urine. Assessment for canine pancreatic lipase concentration (cPLI) (SNAP ) (IDEXX Laboratories) was abnormal (quantitative value (IDEXX Laboratories, Wetherby, United Kingdom) 234 (< 200) ug/L in the equivocal range).\nThe anaemia, renal parameters and hyperbilirubinaemia (haematocrit 0.29 L/L, creatinine 181 umol/L, urea 22.7 mmol/L, bilirubin 336.9 umol/L) worsened over the first 24 h. Standard therapy for AKI was administered (fluid therapy, antiemetics, gastroprotectants and diuretics), however the urine output declined (to 0.8 mL/kg/hour) and creatinine increased (305 umol/L) despite this therapy. The owners opted to euthanase the dog on the third day of therapy.\nPost mortem examination revealed fibrinoid necrosis and microthrombosis within renal glomeruli, hepatic sinusoids and the stomach and small intestinal walls with attendant haemorrhage, necrosis and inflammation. There was marked dermal oedema and inflammation with necrosis of the overlying epidermis. Multifocal necrosis, haemorrhage and inflammation were noted in the subcutis where fibrinoid necrosis of arterioles was a feature.",
"gender": "Female"
},
{
"age": 0,
"case_id": "PMC6858974_03",
"case_text": "A 6-month-old entire male Hungarian viszla was presented to UCDVH in October 2018 with a well-demarcated, ulcerative and exudative skin lesion on the dorsolateral aspect of the left carpus (Fig. 3). A smaller lesion of similar appearance was also noted at the palmar aspect of the left thoracic paw, and there were multiple small ulcers on the tongue. \nHaematology, biochemistry, urinalysis and coagulation testing identified azotaemia (creatinine 179 umol/L, urea 31.1 mmol/L), hyperphosphataemia (3.87 (0.8-1.8) mmol/L), proteinuria (3+) and granular casts in the urine. SNAP cPLi was abnormal (quantitative value > 2000 mug/L; consistent with pancreatitis). Leptospira SNAP test, 4DX SNAP test (IDEXX Laboratories), Angiodetect (IDEXX Laboratories) and modified Baermann were negative. Abdominal ultrasonography identified moderately thickened and diffusely hyperechoic renal cortices with a hyperechoic rim at the cortico-medullary junction, bilaterally.\nThe dog was managed with antimicrobial (amoxicillin-clavulanate) and intravenous fluid therapy. Seizure episodes developed on the second day of hospitalisation, with three occurring in the space of a 24 h period. There was no change in mentation after the development of seizure episodes, however the dog was very dull throughout the hospitalisation time. Unfortunately, a neurological examination was not performed. Over 3 days of therapy, the azotaemia markedly worsened (creatinine 412 umol/L, urea 60.6 mmol/lL) and thrombocytopenia developed (manual platelet count 75 x 109/L). Due to the progression of clinical and clinicopathological abnormalities, the owners elected for euthanasia.\nPertinent gross post mortem findings included petechiae and ecchymoses of the gastric and intestinal mucosa, renal cortices and leptomeninges (Fig. 4). Histopathological examination revealed arteriolar fibrinoid necrosis and microthrombosis within renal glomeruli, in the myocardium, lung and pancreas, transmurally within the small intestine, within the dermis and subcutis, and focally within the cerebrum. There were varying degrees of attendant haemorrhage, necrosis and inflammation.",
"gender": "Male"
}
] |
PMC6858974
|
[
{
"age": 58,
"case_id": "PMC3568418_01",
"case_text": "A 58-year-old black woman sought the Stomatology Outpatient Clinic of the Sao Jose dos Campos Dental School in March 2008 because of a \"blood stain on the roof of her mouth\" (sic). The patient used a removable upper denture and had noted the presence of black-brownish spots on the hard palate 3 months ago. The spots had increased in size during this period and presented discrete itching when touched by the tongue.\nClinically, the lesions appeared as spots with imprecise borders, had a brown to dark brown color, and presented a tendency towards nodule formation (Figure 1). Radiography was non-contributory. Based on the differential diagnosis of melanoma, a punch biopsy (4 mm in diameter) was performed. The material was fixed in 10% formalin, embedded in paraffin, and stained with hematoxylin-eosin or submitted to immunohistochemical analysis. Histopathological analysis revealed a mucosal fragment lined with hyperorthokeratinized stratified pavement epithelium. The epithelium exhibited mild acanthosis and melanin pigmentation in the basal layer. Several dendritic melanocytes were observed in the spinous layer and melanin pigment was present in the cytoplasmic processes interposed with keratinocytes. In the lamina propria consisting of fibrous connective tissue, melanophages were present in the juxtaepithelial region and a scarce and diffuse mononuclear inflammatory infiltrate was noted. In view of the histopathological findings, a diagnosis of MA was made (Figure 2).\nImmunohistochemistry using antibodies against protein S-100, melan-A, HMB-45, MCM-2, MCM-5, Ki-67 and geminin was performed for a better understanding of oral MA. Reactivity for protein S-100 was observed in Langerhans cells, melanocytes and some cells of the underlying submucosa. Immunostaining of HMB-45 and melan-A was only detected in melanocytes, with the observation of a larger number of HMB-45-positive cells. Anti-Ki-67, anti-MCM-2 and anti-geminin antibodies only reacted with cells of the basal and suprabasal layers of the epithelium, whereas MCM-5 staining was negative (Figures 3 and 4).\nThe biopsy region healed normally and no new intervention was necessary. The patient has been followed up for 30 months and shows no clinical alterations.\nMany terms have been proposed for MA, including melanocytic reactive hyperplasia and mucosal melanotic macule, reactive type. In a literature review, Fornatora et al. (2003) analyzed 28 cases of MA and observed a mean patient age of 27.9 years (range: 9 to 54 years). Twenty-five (89.3%) of the 28 patients were black and there was a female preference (female:male ratio of 2.1:1). Although the cheek mucosa was the site most commonly affected (18 of 28 cases), MA occurred at other sites such as lip mucosa, lower lip, palate, gingiva, alveolar mucosa, and oropharynx. The size of the lesions, if reported, ranged from 0.3 to 5 cm in maximum diameter. MA presented as a smooth or slightly raised, hyperpigmented (brown to black) lesion that rapidly reached various centimeters. Traditionally, MA is asymptomatic but pain, a burning sensation and itching have been reported. The present patient reported discrete itching upon touch.\nMA is believed to be a reactive lesion that typically affects mucosal surfaces susceptible to trauma and rapidly develops after an episode of acute trauma or at a site of chronic mucosal irritation. The rapid growth, resolution after incomplete removal, and the presence of an inflammatory infiltrate in the underlying connective tissue support the reactive nature of MA. This fact explains the higher incidence of MA in mobile mucosa vulnerable to trauma (e.g., cheek mucosa, lip mucosa, and palate). In the present case, the patient used a removable mucosa-supported upper denture. The diagnostic hypothesis was melanoma considering the clinical characteristics of the case, including rapid progression of the lesion, color, irregular contours, and tendency towards nodule formation. Although Kaposi's Sarcoma is common in hard palate it was not considered in our diagnostic hypothesis. The algorithm proposed by Kauzman et al. (2004) to guide the assessment of pigmented lesions of the oral cavity on the basis of history, clinical examination and laboratory investigations includes Kaposi's Sarcoma in the group of diffuse and bilateral pigmentation with predominantly adult onset. Early lesions of Kaposi's Sarcoma appear as flat or slightly elevated brown to purple lesions and the advanced ones may appear as dark red to purple plaques or nodules that may exhibit ulceration, bleeding and necrosis.\nHistologically, MA is characterized by the proliferation of melanocytes in the basal layer and by the presence of strongly pigmented dendritic melanocytes throughout the acanthotic epithelium. The presence of large dendritic melanocytes in the superficial portions of the epithelium is the cause of the histological resemblance with melanoma, particularly acral lentiginous melanoma. In the latter case, atypical pigmented dendritic melanocytes are irregularly distributed in the acanthotic epithelium and atypical non-dendritic melanocytes may proliferate along the basal layer (lentiginous proliferation). This type of melanoma can also exhibit a dense subepithelial lymphocytic infiltrate.\nAccording to Goode et al. (1983), the inflammatory infiltrate in MA exhibits eosinophilia associated with increased vascularization and mild chronic inflammation. Cases of MA usually present a slight increase of vascularization and a chronic heterogeneous inflammatory infiltrate in connective tissue. In MA, melanin is generally restricted to melanocytes, whereas adjacent keratinocytes contain no pigment. In the case of other hyperpigmented lesions such as oral melanotic macule and physiological pigmentation, melanin is transferred from dendritic epidermal melanocytes to epidermal keratinocytes that form the epidermal melanin. Once the histological diagnosis of MA is established, no further investigation is required since there are no reports of malignant transformation of MA.\nThe present histopathological findings showing no sign of malignancy agree with reports in the literature. Although some investigators emphasize the frequent occurrence of a heterogeneous inflammatory infiltrate in cases of MA, the present patient presented a scarce and diffuse mononuclear inflammatory infiltrate.\nImmunohistochemical analysis was performed in order to better understand the etiology and behavior of MA. For this purpose, specific markers of cellular elements that might be compromised during the genesis of the disease and cell proliferation markers were used. Epithelial cells stained positive for protein S-100, demonstrating the involvement of cells of neuroectoderm origin in the etiology of MA. Protein S-100 shows a sensitivity of 97 to 100% for the detection of melanoma. However, the specificity of this protein for melanocytic lesions is limited, with this marker also being expressed on neural cells, myoepithelial cells, adipocytes, chondrocytes, Langerhans cells, and in tumors arising from these cells. Melan-A, a marker that recognizes normal melanocytes as well as antigens present on melanomas, was detected in the present study in some epithelial cells. Likewise, HMB-45, a melanoma marker, also stained epithelial cells but to a lesser extent than melan-A. Staining for Ki-67, MCM-2 and geminin was only detected in cells of the basal and suprabasal layers of the epithelium. Since these proteins are markers of cell proliferation, they might be responsible for the acanthotic phenomenon seen in the epithelium of MA. In contrast, immunostaining for MCM-5, a marker that seems to exert a function similar to that of MCM-2, was negative.\nNo neoplastic progression of melanocytic lesions has been observed in the cases reported in the literature. Regression of the lesions within a period of 2 to 6 months after diagnosis has been reported after removal of the local irritating agent or after excisional and/or incisional biopsy. In contrast, in the present case the lesion had not regressed and continued to be stable after 20 months of follow-up. Spontaneous resolution after elimination of the source of trauma has been reported in the literature. Therefore, investigation of local mechanical sources of irritation and their consequent elimination are recommended as the first-line treatment after diagnosis.\nAccording to Carlos-Bregni et al. (2007), since MA grows rapidly a biopsy is indicated to rule out the hypothesis of melanoma, among others. A biopsy is necessary for the diagnosis of any recent pigmented lesion in the oral mucosa.",
"gender": "Female"
}
] |
PMC3568418
|
[
{
"age": 73,
"case_id": "PMC10185437_01",
"case_text": "A 73-year-old male presented with right upper abdominal pain with bilious vomiting and weight loss for 6 months. The patient had no significant personal, past, or family history. Both general and systemic examination was within normal limits except for hepatomegaly. The complete blood cell count and liver function test were within normal limits. Serology for hepatitis B and C virus were negative.\nUltrasonography abdomen pelvis revealed moderate hepatomegaly with a large complex cyst, likely to be a hydatid or haemorrhagic cyst. On computed tomography (CT) of the abdomen and pelvis, the cyst measured approximately 25 cm x 16 cm x 18 cm involving the right lobe and segment IV. A homogenous nodular enhancement was noted along the anterior wall of the cyst measuring 3.9 cm x 1.5 cm in size (Figure 1A and B). The above findings prompted the differential diagnosis of biliary cystadenoma and hydatid cyst. Positron emission tomography and CT showed a large hypodense ametabolic liver mass with a peripheral zone of hypermetabolism. No fluorodeoxyglucose (FDG) avid distant organ involvement uptake was seen. The workup for serum tumour markers like carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), and carbohydrate antigen 19-9 (CA19-9) was not done as hepatic malignancy was not suspected clinically as well as radiologically.\nHPE revealed a part of the right lobe with an attached cyst measuring 18.5 cm in diameter. The surgical margin was 1.5 cm away from the cyst. Externally, the cyst was smooth, congested, and intact. On cutting open thick brownish fluid oozed out, the cyst was solid-cystic and uninoculated. The cyst wall was irregular and haemorrhagic with attached yellowish, friable material. A solid grey area was noted within the cyst which measured 3.0 cm in greatest dimension (Figure 1C and D). The adjacent liver showed tiny whitish nodules ranging from 0.2 cm to 0.4 cm in diameter. The gall bladder was 6 cm in length, externally congested, and showed greenish velvety mucosa.\nThe microscopy revealed a cyst with thick fibro collagenous wall beneath which tumour cells were seen arranged in an acinar, glandular, and focal papillary pattern. The individual tumour cells had round to oval nuclei with finely granular chromatin and mild nuclear pleomorphism. The cytoplasm was scant to moderate and eosinophilic. Occasional mitotic activity was noted. Foci of haemorrhage, pigment-laden macrophages, infarction, and cholesterol clefts were noted. Lymphovascular emboli were seen. Sections from the adjacent liver showed multiple satellite nodules tumours with similar histomorphology (Figure 2).\nThe surgical margin was free of tumour. Gall bladder showed features of chronic cholecystitis and was free of tumour. Immunohistochemistry (IHC) workup revealed diffuse and strong positivity for synaptophysin and chromogranin (Cg), and the Ki-67 proliferation index (Ki-67 index) was 10-12% (Figure 3).\nAll the above findings lead to the confirmatory diagnosis of NET of the liver, grade II with lymphovascular emboli and satellite nodules in the adjacent liver. As a margin-negative resection was achieved, the patient is kept on regular follow-up. To rule out primary vs. metastatic NET further workup was advised. Three weeks postoperatively gas chromatograph-1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (GC-DOTA) scan was done which revealed resolution of the previously seen liver mass and no lesion with somatostatin receptors (SSTRs) expression to suggest locoregional residual disease/recurrence or distant organ involvement. Hence, the diagnosis of PHNET was confirmed and metastatic NET was ruled out. The patient is kept on regular follow-up. Serum CgA level done immediately postoperatively was 484 ng/mL (normal < 108 ng/mL) followed by a repeat test done two months later revealing a value of 26.2 ng/mL.",
"gender": "Male"
}
] |
PMC10185437
|
[
{
"age": 64,
"case_id": "PMC6554495_01",
"case_text": "A 64-year-old woman was diagnosed with stage IVB (T4N3M1c) LAD expressing mutant EGFR (exon 19 deletion) (Fig. 1-A). We administered afatinib (40 mg/day) as the first-line regimen. Three months after starting afatinib, the patient developed repeatedly grade 3 diarrhea (Common Terminology Criteria for Adverse Events version 4.0). Therefore, the afatinib dose was reduced to 20 mg/day until twenty-three months from starting afatinib, maintaining a partial response of the LAD (Fig. 1-B).\nAt the time of diagnosis of LAD, we detected abdominal lymphadenopathies by abdominal computed tomography (CT) imaging; however, we assessed them as metastases from the LAD (Fig. 1-C). During treatment with afatinib, abdominal lymphadenopathies and splenomegaly continued to increase on the CT image (Fig. 1-D). At the time of starting afatinib therapy, complete blood count showed normality of differential white blood count and only thrombocytopenia (white blood cells: 4500 [institutional normal range is 4000-8500]/muL; neutrophils 3290/muL, lymphocytes 790/muL, hemoglobin: 11.1 [11.0-15.0] g/dL and platelet: 7.5 x 104 [1.5-3.5 x 105]/muL).\nThirty-two months after starting afatinib treatment, the patient was admitted to the hospital due to acute abdominal distension. We detected hepatosplenomegaly, ascites, and intra-abdominal lymphadenopathies by abdominal CT (Fig. 1-E, F). The complete blood count revealed elevated white blood cell (24900/muL) and lymphocyte counts (21370/muL), including 87% of atypical lymphocytes that appeared small and cleaved typically (Fig. 2-A); Hemoglobin decreased to 9.3 g/dL, and thrombocyte count to 63000/muL. Immunohistochemistry of atypical lymphocytes in peripheral blood revealed that they were positive for CD10, CD19, CD20, CD79a, and BCL-2 (Fig. 2-B, C, D, E), and negative for CD3, CD4, CD5, and CD8 (not shown). On the basis of these findings, we suspected that lymphoid malignancy coexisted with LAD. Subsequent flow cytometry showed that the lymphoma cells were CD3-, CD4-, CD5-, CD8-, CD10+, CD19+, CD20+, CD79a+, BCL-2+, and Ig-kappa+. Similar findings were found in ascites and bone marrow. Fluorescence in situ hybridization of ascites revealed the translocation of IGH and BCL2 (Fig. 2-F). These pathological features were consistent with follicular lymphoma (FL). These findings, obtained by whole body contrast-enhanced CT, immunohistochemistry and flow cytometry of peripheral blood, ascites and bone marrow, and fluorescence in situ hybridization of ascites suggested that the follicular lymphoma infiltrated her bone marrow. Therefore, we assessed her clinical stage was stage IV of Ann Arbor classification and high risk in FL international prognostic index-2. Retrospectively, we diagnosed this case as FL that was probably present before the diagnosis of LAD and developed slowly while on treatment with afatinib for LAD. At first, we could not ascertain whether intra-abdominal lymphadenopathies had resulted from LAD or lymphoma. We considered it reasonable to continue treatment with afatinib because the discontinuation of afatinib would have led to a rapid exacerbation of LAD. Furthermore, she developed FL with high tumor burden defined by GELF criteria. Therefore, we decided to concurrently administer immunochemotherapy for FL.\nAt first, we planned to perform R-CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone with rituximab) as the first regimen for FL. However, we started CHOP alone to avoid infusion reaction in the first cycle, and subsequently added rituximab to CHOP from the second cycle.\nAfter completing six-cycles of immunochemotherapy for FL, we evaluated the therapeutic effects on LAD and FL, respectively. The primary lesion of the LAD maintained reduced size but multiple small LAD metastases occurred in both lung fields (Fig. 3-A). A T790M mutation of the EGFR was detected by liquid biopsy, and therefore we administered osimertinib as a second line treatment. Treatment of the FL resulted in the disappearance of lymphoma cells in peripheral blood, reduction of hepatosplenomegaly, and shrinking of swollen intra-abdominal lymph nodes (Fig. 3-B), therefore we assessed that she achieved a partial response. Accordingly, the patient's performance status improved.",
"gender": "Female"
}
] |
PMC6554495
|
[
{
"age": 77,
"case_id": "PMC5317028_01",
"case_text": "The authors present a case of a pedicled, functional LD flap for reconstruction of a soft-tissue defect after upper-extremity sarcoma extirpation. The patient was a 77-year-old, right-hand-dominant man who initially presented to the orthopedic oncology team with a slow-growing soft-tissue mass (13.9 x 12.0 x 9.0 cm) at the anterior aspect of the right proximal arm (Fig 1). Pathologic analysis from an excisional biopsy indicated myxofibrosarcoma involving muscle and distal humerus. The sarcoma occupied most of the anterior compartment of the arm (Fig 2). Neurovascular structures were intact. After undergoing radical resection of the mass (Fig 3), prosthetic total elbow replacement was performed.\nThe plastic surgery team was requested for coverage of the resulting defect (Fig 4). Functional reconstruction using LD muscle transfer for prosthetic coverage was performed (Fig 5, see Video 1). The flap was sutured to the proximal ulna, periosteum, and joint capsule. At last follow-up, 3 months postoperatively, the patient was able to perform elbow flexion, extension, pronation, and supination. Elbow flexion against gravity was possible (grade M3).",
"gender": "Male"
}
] |
PMC5317028
|
[
{
"age": 45,
"case_id": "PMC5308427_01",
"case_text": "A 45-year-old male, with no significant past medical history, noted skin changes involving both ears about 3 years prior to initial presentation (Figure 1). He described it as non-tender, reddish discoloration of both auricles. He did not note significant changes in appearance or progression since that time. There were no associated B symptoms initially. The patient finally decided to seek medical attention for cosmetic reason. On examination, he was found to have plum-colored swellings involving the helices of both ears. He was also found to have cervical and axillary lymphadenopathy. Computed tomography (CT) scans confirm the presence of lymphadenopathy. There was no evidence of hepatosplenomegaly. Complete blood count (CBC) showed leukocytosis 19.1/L with lymphocyte predominance 11.1/L, hemoglobin (Hb) was 15.5 g/dL and platelet count (PLT) was 122,000/microL. Biopsies (Figure 2) of these skin lesions were performed and results were suggestive of a low-grade B-cell lymphoma (initial immunohistochemical (IHC) stain positive for CD20, few positive for CD3 and negative for CD30). A lymph node biopsy was consistent with CD5-positive B-cell lymphoproliferative neoplasm, with co-expression of dim CD20 and CD23, favoring small lymphocytic lymphoma (SLL)/CLL. Rai stage was 1. Peripheral blood smear and flow cytometry confirmed circulating CLL and fluorescence in situ hybridization (FISH) demonstrated a 13q deletion, which is a favorable prognostic factor. ZAP-70 result was indeterminate; however, CD38 expression was positive.\nAfter initial discussion regarding local radiation therapy, the patient opted for watch-and-wait approach. After 6 months, the patient developed significant fatigue and drenching night sweats for 1 month. At this time, CBC showed leukocytosis 17.1/L with lymphocyte predominance 9.7/L, Hb was 16 g/dL and PLT was 126,000/microL.\nBecause of systemic involvement, it was decided to commence treatment. We discussed the standard therapy with fludarabine, cyclophosphamide and rituximab (FCR). However, the patient was still working full-time and was planning his wedding in the near future. He, therefore, adamantly refused aggressive cytotoxic chemotherapy for fear of change in current quality of life. We, therefore, discussed less intense therapy with chlorambucil and obinutuzumab. This is a very active regimen and currently recommended first-line therapy for elderly or \"less fit\" patient. He understood that risk of earlier relapse with this regimen may be higher, but he insisted that his quality of life was paramount. He, therefore, chose to be treated with chlorambucil and obinutuzumab. He received six cycles, which he tolerated very well. His B symptoms resolved and he was fully able to perform his daily routine including work-related activities. The patient had an excellent response to therapy. The skin lesions regressed (Figure 1) and the lymphadenopathy resolved. Counts were within normal limits. Repeat peripheral blood flow cytometry did not show any immunophenotypic evidence of an abnormal population of B-lymphocytes. Upon his last follow-up, 2 years since starting chemotherapy, he still remained in complete remission.",
"gender": "Male"
}
] |
PMC5308427
|
[
{
"age": null,
"case_id": "PMC4334879_01",
"case_text": "Female patient, age 29, admitted to the hospital in 2 days after the manifestation, complaining about neck pain irradiating into nose, mouth, mostly on the right side, difficulty in swallowing, swollen neck, mostly on the right side. There was no determined prior history of trauma, invasive manipulations or pathology of parathyroid glands. During child years, the patient was observed by endocrinologist due to endemic goiter. During the examination, it was discovered that the thyroid gland was enlarged, the consistency was soft and elastic, moderate pain was felt during palpation. The patient had a low-grade fever.",
"gender": "Unknown"
},
{
"age": null,
"case_id": "PMC4334879_02",
"case_text": "Echography of the thyroid gland indicated that the right lobe was enlarged due to an isoechoic area in the lower posterior part, with dimensions of 28 mm x 26 mm x 30 mm. The patient was hospitalized with suspected acute thyroiditis. A nonhomogenous structure with contained liquid and abnormally high blood circulation, which was spreading over the posterior surface of the thyroid gland into mediastinal septum was determined one day later, during echography of the thyroid gland (Fig. 1). Indirect laryngoscopy: right-side larynx paresis. Blood test: parathyroid hormone 843 pg/ml (norm 15-65), chlorine - 110.7 mmol/l (norm 97-110), calcium - 2.96 mmol/l (norm 2.10-2.60), ionized calcium 1.8 mmol/l (norm 0.9-1.1), TSh 0.9 mkME/ml (norm 0.4-4.0), fT4 11.9 pmol/l (norm 9.0-22.2) hemoglobin 129 g/l (norm 120-150), hematocrit 37.4% (norm 36-42). Within three days of hospitalization the patient was diagnosed with spontaneous hematoma of the neck on the right side. We did not know the reason for the hematoma, but figured out an increase of blood calcium levels. This was the basis for determining of the level of parathyroid hormone. The result of this analysis was obtained the 3rd day after. Positive dynamics was observed throughout 8 days of fluid treatment (0.9% aqueous solution of sodium chloride) and anti-inflammatory therapy (prednisolone, amoxicillin + clavulanic acid) - reduction of pain syndrome, dysphagy, reduction of swelling and pain in the neck area. Ecchymosis appeared in the skin of neck area and chest. The patient continued to run a low-grade fever. The patient's condition improved within 8 days, and there was a hope for recovery without any operation. We have not seen any activity of the parathyroid glands by 99mTc-Pertechnetate Scintigraphy. However, a simple combination of hematoma and hyperparathyroidism seemed unlikely.",
"gender": "Unknown"
},
{
"age": null,
"case_id": "PMC4334879_03",
"case_text": "Symptoms of neck organs compression increased at the 9th day. There were signs of breathing difficulties and the operation got inevitable. An ultrasonography of the neck vessels was performed to identify the source of bleeding before surgery - the source was not found. A tense hematoma (Fig. 2) and hemorrhage into the hematoma cavity from the branch of inferior thyroid artery were visualized on a multi-slice CT scan with angiography. Discussion dealt with several possible operations: a simple hematoma emptying from a small incision; a full audit of the neck and removal of the modified parathyroid gland simultaneously with the removal of the hematoma. The difficulty consisted in that we did not know what parathyroid gland caused the hyperparathyroidism. We did not know how many parathyroid glands have increased its function. There was the risk of hypercalcemic crisis while leaving the source of hyperparathyroidism. There was a risk of rebleeding by simply hematoma draining. In addition, we bewared of the presence of inflammation in the hematoma area that bores the risk of wound infection in case of a full neck audit. Therefore it was decided to search for the parathyroid glands only on the right side after hematoma emptying and ligation of the bleeding source. The patient was operated - hematoma lancing with resection of walls. The standard cross cervical access used for thyroidectomy was applied. The operation detected the deformation of the right lobe of thyroid gland. The capsule was involved in an inflammatory process. A significant scarring process was observed in the area of hematoma capsule. The hematoma cavity was opened by a small incision. 100 ml of old blood was removed. The hematoma cavity contained fragments of tissues, which were not related to the capsule. These tissues were removed for histological examination. There was a defect along the lower lateral wall of hematoma cavity. The blood clots were removed from a mediastinum through this defect. There was no hemorrhage during the surgery.\nThe right recurrent laryngeal nerve was exposed through the rear wall of the hematoma and separated from scars along the distance up mediastinum to larynx. Hematoma wall joined to thyroid gland were removed for histological examination. Hematoma wall joined to shroud of common carotid artery and internal jugular vein were removed for histological examination. A branch of the inferior thyroid artery was exposed during mobilization of the lateral hematoma wall. The branch ended in the hematoma wall. The proximal part of that branch was ligated, while the distal part was excised together with hematoma wall.",
"gender": "Unknown"
},
{
"age": null,
"case_id": "PMC4334879_04",
"case_text": "Histological examination discovered the fragments of parathyroid adenoma in the hematoma wall (Fig. 3). Level of ionized blood calcium got normal (1.06) approximately 24 h after the surgery. There were no complications during the post-operative period. Level of parathyroid hormone in blood at the 10th day after the surgery amounted to 26 pmol/l (norm 1.45-10.41). The patient was examined 6 months after the surgery. The patient had no complaints. She observed that her voice quality restored 2 months after the surgery, though the laryngoscopy indicated a still conserved right-side paresis of the larynx. The patient did not feel disphagy, voice quality was intact, breathing was not restricted. Level of parathyroid hormone in blood amounted to 8 pmol/l (norm 1.45-10.41), serum ionized calcium concentration 1.14 pmol/l (norm 1.03-1.23), inorganic phosphorus 1.37 mmol/l (norm 0.87-1.45).",
"gender": "Female"
}
] |
PMC4334879
|
[
{
"age": 43,
"case_id": "PMC6329364_01",
"case_text": "A 43-year-old man presented with seven months of intermittent lower abdominal pain and altered bowel habit. The patient denied having similar symptoms in the past or any history of abdominal surgery. He had no past medical history or familial history of colorectal malignancy. On presentation, he appears well with no tenderness or palpable masses on abdominal examination. A computed tomography of the abdomen and pelvis demonstrated a 13 x 10 x 10 mm3 ovoid lesion in the distal descending colon and no evidence obstruction and associated regional lymphadenopathy (Fig. 1). A colonoscopy performed confirmed the ovoid mass, for which an inverted diverticulum was initially suspected (Fig. 2). Mucosal biopsies did not demonstrate any pathological changes. The patient underwent laparoscopic high anterior resection with an uncomplicated post-operative course and a rapid recovery.\nThe intussuscepting mass was completely excised with clear margins (Fig. 3). Histopathology showed a unilocular cyst in the submucosa with a thin fibrous wall lined by a monolayer of lymphatic endothelium confirmed with immunohistochemistry for D2 40 (podoplanin) consistent with a lymphangioma. Some smaller lymphatic channels were noted in the cyst wall. No evidence of diverticulosis was identified (Fig. 4).",
"gender": "Male"
}
] |
PMC6329364
|
[
{
"age": 42,
"case_id": "PMC4236639_01",
"case_text": "A 42-year-old Indian male presented with a dorsal foot ulcer Wagner Grade 3 and exposed tendons. Risk factors associated with healing consisted of an 8-year history of type 2 DM and hyperlipidemia. The patient had previously undergone three surgical wound debridements and ray amputation of the big toe in January 2013 in a different facility where he was offered a below-the-knee amputation. Patient had refused and presented to our facility for further care.\nPatient's dorsalis pedis and posterior tibial pulses were palpable, with ankle brachial index and toe brachial index readings of 1.23 and 0.87, respectively and a capillary refill timing of <2 seconds. The patient's Semmes-Weinstein monofilament test was 5/10 with a 24 V reading on the neurothesiometer. Markers of infection were as follows: white blood cell (WBC) count of 12x109/L, erythrocyte sedimentation rate (ESR) of 141 mm/hr and C-reactive protein (CRP) of 138 mg/L. The markers of wound healing included 14.5% for hemoglobin (Hb) A1C, 11.6 g/dL for Hb and 20 g/L for albumin. Renal function indicated a level of 54 micromol/L for creatinine and 3.7 mmol/L for blood urea nitrogen. A microbiology test for culture and sensitivity indicated that the following microorganisms were present: Proteus mirabilis, Enterococcus faecalis and Coagulase-negative Staphylococcus aureus.\nThe patient was administered intravenous piperacillin/tazobactam (Tazocin) and surgical wound debridements were performed. This was followed by the application of Renasys-GO NPWT dressing with bedside debridements post-operation between dressing changes. By the 17th post-operative day, a microbiology culture test was performed without any growth of microorganisms found. A STSG was carried out and intravenous antibiotic therapy was discontinued after 2 weeks. The STSG wound became slightly infected in the fourth week. This was treated with regular dressings and completely healed in the eighth week and gained his ambulatory status (Fig. 2).",
"gender": "Male"
},
{
"age": 65,
"case_id": "PMC4236639_02",
"case_text": "A 65-year-old Malay female presented with an ulcer on the left shin. Risk factors associated with healing consisted of a history of more than 10 years of type 2 DM, hyperlipidemia and hypertension.\nPatient's dorsalis pedis and posterior tibial pulses were found to be palpable. Markers of infection were as such: WBC 11.5x109/L, ESR 53 mm/hr and CRP 42 mg/L. The markers of healing were >16.0% for HbA1C, 12.0 g/dL for Hb and 35 g/L for albumin. Renal function indicated a level of 105 micromol/L for creatinine and 6.6 mmol/L for blood urea nitrogen. Klebsiella pneumonia was identified to be present in the patient's wound.\nHydrosurgical debridement of the infected ulcer was carried out before application of the Renasys-GO NPWT dressing. A final debridement along with a STSG was then performed, followed by the NPWT application. The wound was inspected 5 days after the STSG and healed completely after 2 months. The wound area was decreased by 31.00% (Fig. 3).",
"gender": "Female"
}
] |
PMC4236639
|
[
{
"age": 60,
"case_id": "PMC3082491_01",
"case_text": "A 60-year-old woman was referred to our department for fundus examination on June 25, 2008, and was scheduled to begin PEG-IFN and ribavirin therapy for chronic HCV infection. She had been diagnosed with VKH disease in 1991 and had been treated for 15 months with both injection and oral steroid therapies (fig. 1a, b). After the initial treatment, no further symptoms or evidence of the disease were observed over the next 17 years. At the time of the examination, she had no symptoms, and her visual acuity was 1.2 in her right eye and 1.0 in her left eye. The fundus of both eyes showed a sunset appearance, but slit lamp and fundus examinations showed no active inflammation. Based on our findings, treatment with PEG-IFN and ribavirin was started.\nAt 3 weeks after the start of the therapeutic intervention, the patient complained of visual blurring, eye pain, and an increased hearing loss. Her visual acuity was reduced to 0.2 in her right eye and remained at 1.0 in her left. A slit lamp examination disclosed bilateral granulomatous uveitis. A fundus examination revealed bilateral serous retinal detachment without retinal vasculitis (fig. 2a, b). Fluorescein angiography showed multiple leakage of fluorescein dye from the choroid into the subretinal space (fig. 2c, d). Auditory acuity was mildly diminished in both ears. As we diagnosed a relapse of the patient's VKH disease, PEG-IFN and ribavirin therapy was discontinued. We began administration of intravenous pulses of methylprednisolone (1,000 mg/day for 3 days), followed by daily oral corticosteroids, which were then tapered off over time. Two months after the symptoms first appeared, her visual acuity returned to 1.0 in both eyes without ocular inflammation and remained stable thereafter for more than 15 months.",
"gender": "Female"
}
] |
PMC3082491
|
[
{
"age": 18,
"case_id": "PMC8297826_01",
"case_text": "Patients with AVB recruited in this study were over 18 years old and had LVEF >50% at baseline. The pacing strategies were determined by operators as per the clinical practice at each hospital. The LBBAP group included all patients who attempted the LBBAP procedure, while the RVP group included patients undergoing RV apex or septum pacing. Patients were excluded if they (1) were younger than 18 years; (2) underwent pacemaker replacement or upgrading with existing leads; (3) had severe valvular diseases, congenital heart disease, or hypertrophic cardiomyopathy; (4) were diagnosed with acquired AVB after surgery for hypertrophic cardiomyopathy or other congenital heart diseases; (5) were diagnosed with persistent atrial fibrillation; and (6) were unavailable to be regularly followed up at the clinic visit for various reasons or to provide written informed consent (Figure 1).\nThe LBBAP procedure has been previously described in detail. During the later period of the study, we simplified the implant procedure of the LBBAP ventricular pacing lead. Briefly, the Select Secure pacing lead of model 3830 (Medtronic, Inc., Minneapolis, MN, USA) was delivered through the C315 sheath (Medtronic, Inc.) after left axillary vein access. In the right anterior oblique 30 position, the sheath with a 3830 pacing lead was directly inserted into the right ventricle through the tricuspid annulus. The tip of the 3830 pacing lead was advanced slightly outside the sheath to touch the septum myocardium at an area 1.5~2.0 cm away from the tricuspid annulus. Unipolar pacing was performed at an output of 2.0 V/0.4 ms to identify a potential screwing site according to the following criteria: (1) a paced morphology of the QS complex with a notch in the bottom in lead V1 and (2) R wave amplitudes >5 mV. After screwing the lead deep into the septum, unipolar pacing was performed to assess the paced QRS morphology, the R wave amplitude, and pacing impedance. The stimulus-to-peak LV activation time (S-pLVAT) was measured at both low (2.0 V/0.4 ms) and high (5.0 V/0.4 ms) outputs in lead V4-6. Ring pacing was tested to evaluate the lead depth in the interventricular septum. Measures of impedance and R wave amplitudes are helpful to prevent lead penetration into the LV. If LBBAP could not be successful after five attempts, the lead was screwed into the interventricular septum to achieve deep LV septal pacing. The RV lead was implanted at the RV apex or septum by a shaping stylet to achieve stable pacing parameters.\nSuccessful LBBAP was confirmed per the previously published criteria: (a) paced QRS morphology presented with an RBBB pattern and (b) S-pLVAT shortened abruptly and remained shortest and constant at different testing outputs. Selective LBBP was identified if a discrete component was presented between the spike and the QRS onset on intracardiac electrogram at a low output (usually at 0.5 V/0.4 ms), or left bundle branch potential could be recorded, or a transition in QRS morphology of V1 from \"Qr\" or \"QR\" type to \"rsR\" type with decreasing unipolar output could be observed. Sixty beats per minute with bipolar pacing mode was set in all of the patients. The pacing output was set as 3.0 V/0.4 ms at the first 3 months of follow-up. If the threshold remained stable at the 3-month follow-up, the automatic ventricular capture management algorithms might be turned on, or the pacing output would be set at 2.0-2.5 V/0.4 ms based on pacing thresholds. For patients with complete heart block, the atrioventricular delay was set as 150/120 ms after the procedure of both LBBAP and RVP. For patients with intermittent AVB, atrioventricular delay programming strategies were different between LBBAP and RVP. In patients with RVP, automatic atrioventricular delay optimization algorithms were routinely turned on to minimize the use of RVP. In patients with LBBAP, the atrioventricular delay was set 30 ms longer than the intrinsic atrioventricular interval if the patient had a normal intrinsic QRS duration. If patients had baseline bundle branch block, the atrioventricular delay was set 30 ms shorter than the intrinsic atrioventricular interval to achieve possible correction of electrical dyssynchronization.\nThe clinic visit follow-up was performed every 6 months after pacemaker implantation in each hospital. Echocardiographic evaluations were conducted at baseline, 6 months, and 1 year after the procedure by using Vivid E9 systems (GE Vingmed Ultrasound AS, Horten, Norway). Left ventricular end-diastolic diameter (LVEDD) and LVEF were evaluated by the core lab that was blinded to the pacing parameter settings, and in cases of disagreement, a senior echocardiographer was invited to read the original data to reach an agreement. Biplane Simpson's method in two-dimensional transthoracic echocardiography was used for the evaluation of LVEF.\nThe primary outcome was defined as a combined endpoint including the first episode of HF hospitalization or the need for upgrading to BiVP. The independent event committee adjudicated all events. HF hospitalization was identified if the patient presented to outpatients or emergency department visits or inpatient hospitalization with symptoms and signs consistent with HF and required diuretics and other therapy (vasodilation, etc.). The indications for requiring an upgrade to BiVP were according to current guidelines, including HF and AVB with reduced LVEF (<40%) after guideline-directed medical treatment for at least 3 months. The pacing parameters and ventricular pacing burden and 12-lead ECG were all recorded at baseline and at each follow-up visit. Lead-related complications were routinely tracked.\nThe statistical analyses were performed by SPSS version 24.0 (SPSS, Inc., Chicago, IL, USA) and GraphPad Prism 5 (GraphPad Software, Inc., San Diego, CA). Continuous variables were summarized using the means and standard deviation or median and interquartile range and compared with two-tailed Student's t-tests or Wilcoxon rank sum test. Nominal data are presented as frequencies and percentages and were compared by using the chi-square test or Fisher's exact test. Kaplan-Meier curves and univariate and multivariate Cox proportional hazard models were used to analyze the primary outcomes, and time censoring was determined by time to primary outcomes or time to last follow-up. All statistical tests were two-tailed. A P value of < 0.05 was considered significant.",
"gender": "Unknown"
}
] |
PMC8297826
|
[
{
"age": 22,
"case_id": "PMC9902872_01",
"case_text": "A 22-year-old Han Chinese woman presented with paroxysmal dizziness, fatigue, nausea and vomiting for 6 years, and the symptoms had worsened over the prior few months. The patient had no previous medical history and no family genetic history of related diseases, and there were no obvious abnormalities on physical examination and laboratory tests, such as blood cell analysis, blood coagulation function, blood biochemistry test, plasmic electrolyte test, cranial nerves examination, motor function and sensory function. Magnetic resonance imaging (MRI) revealed a heterogeneously contrast-enhancing, irregular, lobulated lesion (3.0 cm x 2.5 cm x 2.5 cm in size) at the posterior horn of the right lateral ventricle, and the lesion was intimately related to the choroid plexus. The mass was hypointense on T1-weighted images and iso-hyperintense on T2-weighted images ( Figures 1A-D ). A diagnosis of lateral ventricle meningioma was made before surgery.\nThe patient underwent surgery with the right temporal-occipital craniotomy approach. The intraoperative findings showed that the lesion was irregular and hard and measured 3.0x3.0x2.7 cm in size, and the lesion was closely attached to the choroid plexus. The diagnosis of meningioma was confirmed according to the intraoperative findings.\nThe lesion was proven to be a schwannoma by pathological analysis ( Figure 2A ). In terms of immunohistochemical staining, the tumor cells were positive for S-100 ( Figure 2B ), vimentin and Ki-67 (1%) and negative for glial fibrillary acidic protein (GFAP) and epithelial membrane antigen (EMA). The postoperative axial and coronal MRI scan revealed that the lesion had been completely resected ( Figures 3A, B ). The patient developed mild depression during the follow-up. The prognosis was goodat the 14-month follow-up.",
"gender": "Female"
}
] |
PMC9902872
|
[
{
"age": null,
"case_id": "PMC9019577_01",
"case_text": "This case describes a male patient born vaginally at 36 weeks + 2 days after preterm prolonged rupture of membranes (32 h) with a birthweight of 2.8 kg and Apgar score of 9-10-10. Umbilical cord blood-gas analysis, performed after birth, showed normal potential of hydrogen (pH), base excess (BE), and lactate, see Timeline (Figure 1). The pregnancy had been normal, apart from several urinary tract infections (UTIs) during the second trimester. The UTIs had been treated by the primary health-care center, where growth of ESBL-E. coli in the urine had been detected and the mothers medical record had been marked to signal colonization with MDR bacteria. Further molecular characterization was not performed, as it is not routine on ESBL-E. coli isolates from urine. After treatment with pivmecillinam twice and nitrofurantoin twice, a control culture of the mother's urine was negative, which led to the removal of the warning in the medical record by the treating physician. At time of delivery, the mother was given benzylpenicillin intrapartum, as per routine in case of prolonged rupture of membrane.",
"gender": "Male"
},
{
"age": null,
"case_id": "PMC9019577_02",
"case_text": "The newborn patient presented with respiratory distress at 1 h of age and fluctuating tachypnoea during the first 20 h of age. The patient was grunting, hard to comfort and had frequent stools. Nonetheless, the patient had a normal respiratory rate (RR) and oxygen saturation (SaO2), normal blood-sugar levels (lowest value 2.8 mmol/L) and a normal body temperature. Thus, the pediatrician on call assessed that the patient was not tachypneic and clinically stable. No blood test was taken, and no further examinations were made at that point. The patient's condition was unchanged during the first day. However, at 36 h of age, he was found pale and distressed, whereupon he was admitted to the neonatal unit with a suspected infection.",
"gender": "Male"
},
{
"age": null,
"case_id": "PMC9019577_03",
"case_text": "Upon admittance the patient had a temperature of 36.8 C, Median Arterial Pressure (MAP) 43 mmHg, RR 65/minute, SaO2 100% and capillary refill of 3-5 s (chest-foot). Blood tests showed an elevated C-reactive protein (CRP) 85 mg/L (n.v 0-3), a low white blood count (WBC) of 0.8 x 109/L (n.v 5-25) and normal levels of blood platelets (TPK) 144 x 109 (n.v 85-475). Initial venous blood-gas analysis showed pH 7.25 (7.32-7.43); pCO2 5.8 kPa (5.3-6.6); glucose 2.9 mmol/L (n.v 4.0-6.0); lactate 7.5 mmol/L (n.v 0.5-2.3) and BE -8 mmol/L (n.v -3-3). Benzylpenicillin (100 mg/kg/day) and amikacin (18 mg/kg/day), was given as recommended first-line therapy for early neonatal sepsis. Sepsis work-up was done and the mother's chart was checked for risk factors for infection. A maternal urinary culture taken, on the day of delivery, showed the growth of E. coli with ongoing susceptibility testing. There were no signs of earlier ESBL- E. coli colonization or infection in the maternal medical record, since the MDR-marking previously had been removed. Seven hours after admission, the patient developed seizures with electrographic correlates and phenobarbital and later midazolam was given. A lumbar puncture was performed, and cerebrospinal fluid (CSF) analysis showed pleocytosis with WBC of 1639 x 106/L (n.v 0-5), RBC of 125 x 106/L (n.v 0-1), polymorphonuclear leukocytes 781 x 106/L (n.v 0-1), monomorphonuclear leukocytes 858 x 106/L (n.v 0-5), lactate 8.2 mmol/L (n.v 1.1-2.4) and glucose of <0.7 mmol/L. The patient deteriorated into severe metabolic acidosis with pH 7.06 (n.v 7.32-7.43); lactate 15 mmol/L (n.v. 0.5-2.3) and BE -16 mmol/L (n.v -3-3). The patient received mechanical ventilation and antimicrobial therapy was changed to cefotaxime (150 mg/kg/day), ampicillin (300 mg/kg/day) and acyclovir (60 mg/kg/day), according to guidelines with suspicion of meningitis.",
"gender": "Unknown"
},
{
"age": null,
"case_id": "PMC9019577_04",
"case_text": "A Gram-negative rod grew rapidly in blood (3.7 h) and a few hours later it was found to be an E. coli. At that time, cefotaxime was changed to meropenem (40 mg/kg/day). An hour later, it was reported to be an ESBL- E. coli strain, susceptible to carbapenems (i.e., imipenem, meropenem and ertapenem, but resistant to cefotaxime, ceftazidime, gentamicin, and ciprofloxacin) according to European Committee on Antimicrobial Susceptibility Testing (EUCAST)'s breakpoints. Thus, the strain was resistant to earlier applied treatment in this case. The next day, the same bacterial strain grew in the child's cerebrospinal fluid and in the mother's urine. New blood tests showed an increasing CRP 119 mg/L (n.v 0-3), continuously low WBC 1.6 x 109/L (n.v 5-25) and decreasing TPK 22 x 109 (n.v 85-475). The patient proceeded into to severe respiratory failure despite increased supportive mechanical ventilation. Hypotension was treated with fresh frozen plasma and inotropes, with no effect on urine production. Echocardiography confirmed pulmonary hypertension. Seizures, non-responsive to treatment, increased as the clinical picture of fulminant septic shock developed. Due to poor prognosis, the intensive care was withdrawn from the patient at 3 days of age. This followed an ethical discussion and was in consent with the parents.",
"gender": "Unknown"
},
{
"age": null,
"case_id": "PMC9019577_05",
"case_text": "Samples of the blood- and cerebrospinal fluid from the child as well as a urine sample from the mother were analyzed. The bacteria grew on blood agar plates at 37 C after 3.7 h and were thereafter typed as E. coli with Matrix-Assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry (MALDI-TOF MS). Susceptibility testing of the E. coli was performed with disk diffusion, which 2.5 days after the samples had been taken, showed that the strain was ESBL-producing with resistance to cefotaxime, ceftazidime, gentamicin and ciprofloxacin. The bacteria showed susceptibility to carbapenems and amikacin. Epidemiological typing was thereafter performed with Multi-Locus Sequence Typing (MLST), showing that the E. coli in all three samples belonged to ST 1193.",
"gender": "Unknown"
}
] |
PMC9019577
|
[
{
"age": 79,
"case_id": "PMC2206399_01",
"case_text": "Amisulpride therapy was initiated in a 79-year-old patient with a schizoaffective disorder. After 10 days the patient became somnolent with a high body temperature (40.3 C), diaphoresis, tachycardia, rigid skeletal muscles of a 'lead pipe' character, cogwheel phenomena and resting tremor (video footage is available in Additional data file 1). Laboratory results revealed creatine kinase to be 15.1 mukat/l and myoglobin to be 8,654 mug/l, indicating rhabdomyolysis. Blood urea nitrogen was 11.6 mmol/l and creatine was 139 mumol/l, indicating renal failure that probably was caused by dehydration. Procalcitonin was within normal limits, excluding infection. A brain computed tomography scan and lumbar puncture findings were normal. NMS caused by treatment with amisulpride was suspected and it was discontinued.\nExternal cooling with sponging and fanning was started. Bromocriptine, a dopamine agonist, was introduced at a dose of 5 mg every 8 hours through a nasogastric tube, but after 1 day there was no clinical improvement and so bromocriptine was withdrawn. Then, 60 mg (1 mg/kg) dantrolene was administered intravenously over 5 min. Muscle rigidity, cogwheel phenomena and tremor disappeared within 10 min (video footage is available in Additional file 2), but they gradually reappeared within an hour. The dantrolene infusion was repeated three times within 12 hours and body temperature gradually decreased to 37.5 C. Bromocriptine therapy was continued two more days. The patient's level of consciousness improved and signs of NMS disappeared during subsequent days.\nThe diagnosis of NMS in this patient is based on identifying the characteristic clinical manifestations in association with a typical history of therapy with amisulpride, which antagonizes dopaminergic D2/D3 receptor subtypes. The patient also developed renal failure, which may participate in amisulpride accumulation because amisulpride is eliminated unchanged in urine.\nDantrolene might be useful in managing skeletal muscle rigidity because it relaxes skeletal muscles by inhibiting release of calcium from the sarcoplasmic reticulum, thereby reducing actinmyosin contractile activity. In the videos presented (Additional data files 1 and 2) the effect of dantrolene on muscular rigidity of a 'lead pipe' nature, cogwheel phenomena and tremor are clearly visible. However, the usefulness of dantrolene in NMS remains questionable, and this is but one of a number of anecdotal reports. Nevertheless, it offers an additional visual impression of the effectiveness of dantrolene on rigidity and tremor caused by NMS.\nTo conclude, we speculate that prompt reduction in NMS-associated muscular rigidity by dantrolene contributed to a decrease in body temperature. Our reporting of this case was approved by the Hospital Committee for Medical Ethics (University Medical Centre Ljubljana).",
"gender": "Unknown"
}
] |
PMC2206399
|
[
{
"age": 23,
"case_id": "PMC4206058_01",
"case_text": "A 23-year-old man presented to the emergency department following a witnessed assault. On presentation, he complained of lower facial pain, malocclusion, and numbness of the lower lip.\nWhat are the clinical signs and symptoms of mandibular fractures?\nWhat are the general principles for operative management of mandibular fractures?\nHow should teeth in the line of mandibular angle fractures be managed?\nHow should combined fractures of the mandibular angle and parasymphysis be managed?",
"gender": "Male"
}
] |
PMC4206058
|
[
{
"age": 26,
"case_id": "PMC5039285_01",
"case_text": "A 26-year-old woman admitted herself for urological consultation to our hospital. She described a recent history of gross haematuria as well as having recognized a prolapsing vaginal mass. After our first examination we presumed the vaginal mass to be a thrombosed urethral caruncle. The initial sonographic evaluation of both kidneys revealed no pelvic dilatation. While the first try of carefully repositioning our clinical findings (Figure 1) was unsuccessful, we decided to admit the patient to the operating theatre in order to do further examinations and explorations under anesthesia. If the presumed diagnosis of a thrombosed urethral caruncle was correct, deroofing the caruncle would have been possible in the same instance.\nDuring the examination in general anesthesia we found that some clear fluid was secreted from the circular prolapsed vaginal mass when putting pressure on it. Upon further pressure the mass retreated itself spontaneously into the outer urethral meatus. As will be seen in Figure 2, in the following cystoscopy we found a big ureterocele on the left patient's side, matching the formerly prolapsed mass. The left ureteral ostium was not to be identified.\nThe right-sided ureteral ostium showed some small protrusion as well, presumably coinciding with another small ureterocele on this side. The further cystoscopy was largely inconspicuous so that we decided to end the procedure due to the now resolved acute situation which, nonetheless, required further investigation.\nIn order to confirm our intraoperatively newly obtained diagnosis of a prolapsed ureterocele, we did a CT scan of the patient's abdomen the day after the surgical intervention. In the CT scan (Figure 3) the presumed huge ureterocele on the left patient's side was indeed confirmed, accompanied by consecutively dilated left ureter and renal pelvis. There was no incidence for a duplex pelvic system. The right ureter was found to be normal with an inconspicuous ureteral ostium into the bladder.\nWhile being clinically asymptomatic and with the renal retention parameters being always within normal range, the patient was then discharged from hospital and followed up one month later. In the follow-up examination there was no sonographic incidence for a dilated renal pelvis on both sides and in cystoscopy the left-sided ureterocele seemed to have regressed in size. Even the ureteral ostium was now easily identified.\nWe established two further follow-up appointments 5 and 12 months after the initial consultation. In both cases the patient was found to be absolutely asymptomatic. No further episodes of gross haematuria or urinary tract infections were reported. Sonography always showed normal conditions concerning the renal drainage and sonography as well as cystoscopy during the 5- and 12-month follow-ups revealed a further regression of the ureterocele in size. The sonographic findings of the 12-month follow-up are to be seen in Figures 4 and 5.",
"gender": "Female"
}
] |
PMC5039285
|
[
{
"age": 35,
"case_id": "PMC9622463_01",
"case_text": "A 35-year-old man sought care at the emergency department of Jackson Memorial Hospital on July 28th, 2022, with a complaint of worsening facial rash and blurry vision for two days. A couple of days prior, he arrived at the emergency department with one week of lymphadenopathy, fever, and facial lesions. He was told he likely had monkeypox and was discharged home with instructions to quarantine. However, his rash continued to worsen. He had since developed intraoral lesions, penile lesions, a diffuse maculopapular rash, and blurry vision in the right eye. He endorsed fever, chills, night sweats, and diarrhea. He stated the rash was both itchy and painful. On presentation at the emergency department, the patient was afebrile, saturating well, and hemodynamically stable.\nPast medical history was significant for an abscess in his right posterior thigh that he has been self-treating with sulfamethoxazole-trimethoprim DS BID for 6 weeks. He was taking this antibiotic intermittently upon admission to the hospital. Within the past year, he has had other skin infections in face and leg associated with trauma. Furthermore, he had history of multiple rashes that were triggered by contact with irritants. Based on his description, it was likely he was experiencing contact dermatitis. He endorsed marijuana and methamphetamine use. Lastly, he was sexually active with partners of the same sex. He typically engaged in penetrative anal sex. He stated that one week prior to the onset of his symptoms, he engaged in a sexual encounter with a partner who fell ill requiring emergency room care within the subsequent 24 h. He reported not having sex with the man, only kissing with clothing off, also known as outercourse.\nOn physical exam, the patient presented with several lesions. First, there was a diffuse erythematous maculopapular rash present across his abdomen and back (Fig. 1). On his face, there were multiple large pustular lesions with surrounding erythema. These were distributed across the mandible, bilateral cheeks, and forehead (Fig. 2). His facial lesions were swollen, with erythematous border. One pustular lesion located on the chin had yellow and black crusting with purulent discharge. Furthermore, there was a large raised umbilicated pustule present on the right eyelid with swelling and tearing. However, the cornea and sclera were clear. There were numerous small vesicles present on his neck, right arm, right palm, and back (Fig. 3). There was a singular small, raised vesicle on the base of the penis (Fig. 3). Lastly, there were several small vesicular lesions on the tongue, base of the mouth, and intranasal surface.\nHe tested positive for the preliminary Orthopoxvirus PCR test done by Florida Department of Health. Later, he tested positive for the Monkeypox PCR test done by the Centers of Disease Control and Prevention (CDC). His RPR, HIV, gonorrhea, and chlamydia tests came back negative. Given the presence of lesions on his penis and mouth, and the proximity of a vesicle to his right eyeball, the patient was initiated on Tecovirimat 600 mg every 12 h. Vancomycin 1 g every 12 h was also started to treat presumptive bacterial superinfection on his chin due to the significant inflammation and purulent discharge noted in this lesion. Ophthalmology evaluated the patient due to complaints of blurry vision; however, no lesions were noted on the ocular surface. Lastly, trimethoprim - sulfamethoxazole was discontinued as the maculopapular rash on his torso was possibly attributed to a drug eruption. He was then discharged on Tecovirimat with instructions to complete a 14-day course. Vancomycin was switched to oral Doxycycline 100 mg for outpatient therapy. At 10-day follow-up, the patient reported that he has remained compliant on his outpatient regimen. He stated that most of his lesions have resolved. His large pustular lesions on his face were improving and had formed a crust. His smaller vesicular lesions on his penis, hands, back and torso resolved within a few days. He stated he did not notice an improvement in his symptoms until four doses of Tecovirimat were completed. He experienced dysuria, diarrhea, and burning sensation while defecating, which the patient attributed to Tecovirimat. However, he increased his fiber intake and all these symptoms resolved.",
"gender": "Male"
}
] |
PMC9622463
|
[
{
"age": 0,
"case_id": "PMC10155007_01",
"case_text": "Two 6-month-old littermate Russian Blue cross kittens (male and female) from Colorado presented for megaesophagus, intermittent vomiting and regurgitation. One week prior to referral, the male kitten was lethargic, had decreased appetite, was diagnosed with aspiration pneumonia and was started on antibiotics (cefovecin 8 mg/kg SC once [Convenia; Zoetis]). Both kittens were started on sildenafil (0.5 mg/kg PO q12h; compounded) to decrease the tone of lower esophageal sphincter, without clinical improvement. Both kittens were fed a liquid diet and held in an upright position for 20 mins post-feeding. The kittens were originally adopted at 3 months of age and were not fully vaccinated. According to the owner, there was a third kitten in the litter that died prior to adoption.\nUpon referral, on physical examination, the male kitten was quieter, smaller and had a lower body condition score (3/9) than the female kitten (4/9). It was also tachypneic and had increased respiratory effort. The female kitten had a dry and crusted nose. Both kittens were normothermic and had a normal heart rate (200-240 beats/min [bpm]). Bilaterally, both kittens had severe mydriasis, moderate-to-severe blepharospasm with photophobia, and absent direct and indirect pupillary light reflexes (PLRs). The male kitten had a plantigrade stance and normal proprioception. The female kitten had normal mentation, gait and proprioception. Both kittens tested negative for feline immunodeficiency virus (FIV)/feline leukemia virus (FeLV), as well as parvovirus infections, by SNAP Combo FeLV antigen/FIVantibodies and Snap Parvo test (IDEXX Laboratories). Previous in-house hematology by the primary care veterinarian was unremarkable and in the male kitten, serum chemistry showed increased symmetric dimethylarginine (15 microg/dl; reference interval [RI] 0-14) and potassium (7.1 mmol/l; RI 3.7-5.9); serum potassium had decreased (6.2 mEq/l) at another recheck.\nNon-sedated thoracic radiographs of the female kitten showed megaesophagus with gastric distension. The male kitten's thoracic radiographs showed marked diffuse esophageal dilation and a convex soft tissue opacity in the caudal dorsal thorax, suspicious for hiatal hernia. Schirmer tear test was low in both kittens (0 mm/min in both eyes [OU]). A pilocarpine (0.05%) response test showed pupil constriction at 60 mins (Figure 1) and histamine intradermal testing performed by intradermal 0.05 ml injections of histamine (1:10,000) and 0.9% saline and showed no response to histamine. An atropine response test was not performed as neither of the kittens were bradycardic. A presumptive diagnosis of dysautonomia was made and both kittens were started on cisapride (1 mg/cat PO q8h; compounded) and artificial tears; all other medications were discontinued, but elevated feeding was continued at home.",
"gender": "Female"
},
{
"age": 1,
"case_id": "PMC10155007_02",
"case_text": "One month later, the male kitten presented for acute respiratory distress and was euthanized. Post-mortem examination revealed a markedly dilated and thinned esophagus with approximately 90% of the stomach and greater omentum inverted into the distal esophagus; however, no evidence of hiatal hernia was present on necropsy (Figure 2). The gastric submucosa was diffusely expanded by edema. The lungs were atelectatic, and the left cranial lung lobe sank in 10% neutral-buffered formalin, which correlated to regional aspiration pneumonia microscopically. Histologic examination of the celiac ganglion, and the myenteric and submucosal plexuses throughout the gastrointestinal tract, revealed marked neuronal dropout and degeneration with necrosis and satellitosis. Special stains including glial fibrillary acidic protein, and neurofilament protein highlighted neuronal dropout and were compared with a 1-year-old healthy cat as a non-age-matched control (Figures 3 and 4).\nThree months later, the female kitten presented for re-evaluation. According to the owner, the kitten had been doing much better since starting cisapride and only regurgitated once or twice per month. On physical examination, the mydriasis OU, and dry and crusty nose were mildly improved but still lacked direct or indirect PLR; body condition score remained at 4/9. No further diagnostics were performed. The owner reported that the patient was doing well at the time of writing (5 months since diagnosis) and continued to receive cisapride and artificial tear medications.",
"gender": "Male"
}
] |
PMC10155007
|
[
{
"age": 71,
"case_id": "PMC9794504_01",
"case_text": "A 71-year-old-man living in the countryside presented to several clinics with the complaint of swelling and redness on the right forehead 5 months ago and received various topical antibiotic treatments. However, lesions did not respond to treatments and spread to the periorbital region, and he was referred to our clinic with a preliminary diagnosis of preseptal cellulitis. On inspection, there were edema and hyperemia on both eyelids on the right side, predominantly on the upper eyelid, and crusted lesions that were mainly located on the lateral aspect of the right eyebrow and spread to the forehead (Fig. 1). There was no heat or tenderness on the eyelids. Bilateral visual acuity was 20/20. The anterior segment and fundus examinations were normal. Eye movements were normal bilaterally. Medical history revealed no trauma, chronic systemic disease, or known immunodeficiency disorder. Orbital computed tomography was reported to be consistent with preseptal cellulitis. The patient was consulted by the dermatology department to rule out herpetic infection and impetigo. Intravenous ampicillin-sulbactam 4 x 2 g was started after consultation with the infectious diseases department. On the 5th day of the treatment, there was no response to the treatment. Thus, the infectious diseases and dermatology departments were consulted again. Infectious diseases started intravenous (iv) amphotericin-B 3 mg/kg for possible fungal infection and it was decided to continue with intravenous (iv) piperacillin-tazobactam 3 x 0.5 g. There was no additional recommendation from the dermatology department. No regression was observed in clinical findings on the 12th day of treatment. Therefore, it was decided to perform a biopsy of the skin lesions.\nHistopathological evaluation of the biopsy was reported as cutaneous leishmaniasis. The patient was consulted by the dermatology department again and it was decided to perform an intralesional glucantime injection. Glucantime injection was administered as an intralesional injection once a week for 5 weeks (1 cycle). At the end of this period, regression of the lesions was observed and the treatment was continued for one more cycle. After the second cycle, significant improvement was detected in the lesions (Fig. 2). Following 4 years of treatment, there was no sign of infection and the lesions healed without any scarring (Fig. 3).",
"gender": "Male"
}
] |
PMC9794504
|
[
{
"age": 72,
"case_id": "PMC4085836_01",
"case_text": "A 72-year-old woman was admitted to our hospital with right-sided pleuritic chest pain, cough with purulent sputum, fatigue and shortness of breath. Her pulse was 90 beats per minute, blood pressure was 120/80 mmHg, respiration was 22/min, and temperature was 37 C. On physical examination, the patient appeared thin but healthy. There was no history of smoking tobacco. Her past medical history was remarkable only for coronary disease and hypertension, which were subsequently treated with appropriate drugs. An HIV test was negative and no other underlying disease was detected. A computed tomography (CT) scan revealed multiple pulmonary nodules in the lower lobes. The CT scan also demonstrated some cavitary lung lesions with a feeding vessel sign in the lower lobes (Fig 1).\nMicroscopic examinations of sputum were negative for acid-fast bacilli and fungi; cytologic examination showed no malignant tumor cells. Blood cultures were negative. Needle biopsy of the lung was performed under CT guidance and revealed lung parenchyma with elastofibrosis and anthracosis.\nExamination of the lung fragment by direct microscopy showed multiple non-acid-fast (Ziehl-Neelsen), gram-positive rods (Fig 2). The searches for malignant (H&E) and fungus (Grocott) cells were negative. Culture on blood agar yielded pure growth of an organism identified as Corynebacterium striatum (99.7% probability) by the API-CORYNE system (BioMerieux Marcy l'Etoile, France). Laboratory investigations revealed hemoglobin concentrations of 9.3 g/d, a total white blood cell count of 12 x 109/L with 80% neutrophils, 7% bands, 9% lymphocytes, and 3% monocytes; platelets of 452 x 109/L, and a erythrocyte sedimentations rate of 55 mm/hour. Routine blood chemistry was normal. Creatinine was 1.6 mg/dL, alkaline phosphatase was 82 U/L, aspartate aminotransferase was 42 U/L, and alanine aminotransferase 30 U/L. Antibiotic susceptibility was tested by the disk diffusion method (Oxoid SA, Spain) in Mueller-Hinton agar supplemented with 5% blood for all antibiotics tested including penicillin (10U), gentamicin (10 microg), vancomycin (30 microg), erythromycin (15 microg), and tetracycline (30 microg). The susceptibility criteria of the CLSI for Staphylococcus spp. were used for all antibiotics, which result in sensitivity for erythromycin and vancomycin, and resistance for all the others. The patient was treated with erythromycin (500 mg/qds) and rifampin (600 mg/daily), both administered orally. Despite therapy, relentless deterioration continued, resulting in death 12 days after respiratory failure.",
"gender": "Female"
}
] |
PMC4085836
|
[
{
"age": 19,
"case_id": "PMC5968865_01",
"case_text": "A 19-year old woman diagnosed with anorexia nervosa, restrictive subtype (AN; subsequently referred to as index patient, IP) was admitted to the inpatient psychosomatic clinic at the University Hospital Bochum, Germany in April 2015. At that time, her body weight was 44.5 kg (97.9 lbs) corresponding to a body mass index (BMI) of 13.9 kg/m2. Amenorrhea was present, a body image disorder was only slightly pronounced. Her estimated premorbid BMI assessed by a patient interview was 23 kg/m2 at the age of 15. A previous attempt in a community hospital in order to restore weight had been unsuccessful.\nThe IP showed oriented awareness, was clear to all dimensions, and appeared in slightly reduced force. Apart from specific eating disorder thoughts revolving around food and weight, formal or substantive thought disorders could be excluded. Alcohol and any drug abuse were denied. At admission, she was on 15 mg mirtazapine per day. Basic serum chemistry including blood sedimentation was within normal limits. Complete blood count indicated a reduced leucocyte number (3.7 x 103/muL). Activities of aspartate (39 U/L) and alanine aminostransferase (29 U/L), and of gamma glutamyl transferase (66 U/L) were within normal ranges. Creatine kinase was elevated (320 U/L). All other laboratory parameters (electrolytes, lipase, amylase, albumin, phosphate, direct and total bilirubin levels, creatinine, glomerular filtration rate, urine analysis) were within normal limits. Thyroid hormones, transglutaminase IgA and endomysium IgA (to exclude celiac disease) were normal. Extensive somatic diagnostics did not indicate any signs for malignancies, gastrointestinal malabsorption, inflammatory bowel disease and endocrine or exocrine pancreatic dysfunction. Clinical chemistry did not show any evidence for a refeeding syndrome at any time.\nThe IP reported high caloric requirements (4,000 kcal) in order to gain weight. This statement usually raises concerns regarding patients' therapy adherence, because AN patients often avoid weight gain by not eating enough, vomiting, taking laxatives or exercising excessively. The IP denied all counterproductive behaviors. Thus, after initial low energy intake, her meal plan in the later refeeding phase was adjusted to 4,000 kcal/d resulting in a steady increase in body weight (Figure 3). Usually at this stage, our patients achieve weight gain with considerably lower caloric intakes (around 2,500-3,000 kcal/d).",
"gender": "Female"
}
] |
PMC5968865
|
[
{
"age": 54,
"case_id": "PMC4323914_01",
"case_text": "A 54-year-old man was detected to have hyperlipidemia and was prescribed atorvastatin 20 mg and a multivitamin capsule 1 month prior to initial consultation and and received no other drug. He was detected to have diabetes mellitus 6 months ago, but received no medication. He felt unwell after taking atorvastatin and on evaluation had normal renal function (blood urea: 38 mg/dl, serum creatinine [SCr]: 1.1 mg/dl). Since he continued to feel tired, he had a review 3 weeks later and was detected to have azotemia (blood urea: 54 mg/dl, SCr: 1.9 mg/dl) and was referred to our unit. He complained of tiredness, but did not have fever, skin rash, muscle weakness or tenderness. Blood pressure was 105/80 mm Hg and pulse rate was 75/min. Clinical examination was unremarkable. Urine examination showed no albuminuria and no sediment on microscopy. Serum creatine kinase (CK) was normal (70 U/L). He denied taking any other drug, including indigenous or over the counter medications, other than atorvastatin and multivitamin capsule. He was thought to have AKI due to atorvastatin and it was discontinued. After 1 week SCr rose to 2.4 mg/dl and he underwent renal biopsy, which showed nine glomeruli, of which one showed periglomerular fibrosis. Moderate interstitial round cell infiltrates [Figure 1] were seen along with few eosinophils. Mild hyaline arteriosclerosis was seen. Immunoflurescence study showed minimal mesangial deposits of immunoglobulin M and was negative for other immunoglobulins and C3. The renal biopsy was consistent with acute interstitial nephritis.\nHe was started on oral prednisolone 1 mg/kg/day for 2 weeks and then slowly tapered the dose over 2 months and stopped. The response to corticosteroid was good and SCr improved to 1.3 mg/dl at the end of 2 months [Figure 2]. He was advised not to take statins in the future.\nHe was admitted 6 months after the initial presentation with acute myocardial infarction (AMI) and underwent primary percutaneous transluminal coronary angioplasty (PTCA) and stenting. He was given atorvastatin 40 mg post PTCA, but was replaced with rosuvastatin 10 mg after 2 days in view of previous allergic interstitial nephritis attributed to atorvastatin. He was explained about the possible cross reactivity with atorvastatin and SCr was monitored on weekly basis. SCr was 1.4 mg/dl at the initiation of rosuvastatin therapy and gradually increased to a peak of 1.8 mg/dl at 4 weeks [Figure 2]. Serum CK was normal (55 U/L) and there was no evidence of any other etiologic factor to account for AKI during this period. After much deliberation, rosuvastatin was stopped and he was followed closely. The renal biopsy was not repeated since antiplatelet drugs could not be stopped so early after PTCA and steroid were not given in view of possible worsening of dyslipidemia and hyperglycemia. SCr returned to baseline value spontaneously over next 2 months and remained stable over next 12 months.",
"gender": "Male"
}
] |
PMC4323914
|
[
{
"age": 68,
"case_id": "PMC10011424_01",
"case_text": "A 68-year-old male presented to the emergency department with a seven-day history of shortness of breath, upper respiratory symptoms and fever. The symptoms exacerbated in two days prior to admission and progressed rapidly. His past medical history included former smoking, hypertension and obesity (BMI 37.6 kg/m2). He had also undergone a total penile and scrotum amputation with a perineal urostomy due to penis cancer six years ago. No relapse was observed.\nOn admission, he was found to be dyspnoeic and drowsy. His body temperature was 37.6 Celsius. His blood pressure was 180/100 mmHg, with a regular heart rate of 114 beats per minute, a respiratory rate of 40 breaths per minute and oxygen saturation of 92% on 10 litres per minute of supplemental oxygen. No heart murmurs were detected. Bilateral wheezing was heard on lung auscultation and bedside lung ultrasound revealed bilateral B-lines. The electrocardiogram showed sinus tachycardia and widespread ST segment depression. Laboratory studies demonstrated leucocytosis of 30 x 106/mL (3.5-8.8 x106/mL), haemoglobin of 135 g/L (134-170 g/L), and platelet count of 570 x 106/mL (145-348 x106/mL). Other laboratory abnormalities included serum sodium of 130 mmol/L (137-145 mmol/L), and serum potassium of 4.7 mmol/L (3.5-4.4 mmol/L). Serum creatinine was 81 mumol/L (60-105 mumol/L), lactic acid was 2.9 mmol/L (0.5-2.2 mmol/L), high sensitivity troponin I was 627 ng/L (<54 ng/L) and the C-reactive protein (CRP) was elevated at 205 mg/L (<5 mg/L). PCR tests for SARS-CoV-2 and influenza were negative. Blood cultures were secured. No urine sample could be collected prior to the administration of antibiotics. Initially, the patient could urinate, but three hours after admission he experienced difficulties and received a urinary catheter, which drained clear urine.\nA transthoracic echocardiogram (TTE) was performed in the emergency department. The quality was not optimal due to poor echo window. The left and right ventricular ejection fractions were assessed as normal. Hypokinesia of the lateral myocardial wall was described. No pericardial effusion was present. Computed tomography (CT) scan revealed no pulmonary embolism. There were signs of pulmonary congestion and bilateral peribronchial parenchymal infiltrates compatible with infection (Fig. 1).\nThe initial management of the patient was focused on clinical left ventricular failure associated with bilateral pneumonia. The aim was to decrease pulmonary congestion, to reverse the hypoxia and thus avoiding endotracheal intubation. Bilevel positive airway pressure was applied and loop diuretics were given. This led to improvement of the respiratory function. He was transferred to the cardiac intensive care unit and his state improved. Cefotaxime 1 g every 8 h and levofloxacin 500 mg every 12 h were administered intravenously on the suspicion of severe community acquired pneumonia.\nA comprehensive bedside TTE and a transoesophageal echocardiography (TEE) were performed 12 h after admission. The left ventricle was normal in size with discrete apical and lateral hypokinesia. The left ventricular ejection fraction was normal. The size and the systolic function of the right ventricle were in normal ranges. The aortic valve was tricuspid. There was a 12 mm highly mobile mass on the non-coronary cusp of the aortic valve (Fig. 2) with severe aortic regurgitation (Fig. 3). A perivalvular echolucent area suggesting an aortic root abscess was observed (Fig. 4). No signs of endocarditis on the other valves were detected.\nThe hemodynamics of the patient remained stable for the next few hours. Peripheral oxygen saturation was 95% with 3 litres per minutes of oxygen without need for non-invasive respiratory support. The heart rate was 100/min. Blood pressure was 130/70 mmHg. The dose of cefotaxime was increased to 3 g every 8 h. As the patient had been temporary stabilized, a multidisciplinary decision was made by cardiologists and a cardiac surgeon to perform coronary angiography prior to an emergency aortic homograft implantation within the next 24 h.\nThe high sensitivity troponin I continued to rise to a level of 6912 ng/L (<54 ng/L). Since it was deemed preferable to know the coronary anatomy prior to aortic root replacement it was decided to perform a preoperative coronary angiography as soon as possible. Coronary angiography was performed and revealed a significant stenosis in the left anterior descending artery. During the coronary angiography the state of the patient worsened rapidly. The patient was transferred to the cardiac intensive care unit. He developed a fulminant pulmonary oedema and cardiogenic shock with cardiac arrest within a few minutes. Cardiopulmonary resuscitation was attempted but no return of spontaneous circulation occurred. No autopsy was performed.\nThe next day, blood cultures demonstrated growth of A. sanguinicola in all four bottles. Species determination was performed using (MALDI-TOF MS) (Microflex, Bruker Daltonics, Bremen, Germany) with a score value of 2.4. The isolate displayed a minimal inhibitory concentration of 0.125 mg/L for cefotaxime, determined with Etest (bioMerieux). Species specific breakpoints are no available for cefotaxime and A. sanguinicola, but according to EUCAST non-species specific breakpoints the isolate was deemed sensitive to cefotaxime.",
"gender": "Male"
}
] |
PMC10011424
|
[
{
"age": 35,
"case_id": "PMC6323585_01",
"case_text": "A 35-year-old woman presented to the emergency service with a headache that developed over a week and progressively grew in intensity until it became unbearable. The patient reported suffering from periodic attacks of transient headache, sometimes associated with nausea and/or dizziness, beginning within 30 minutes of standing without remarkable triggering events. No other comorbidity was reported; neither use of medicines or contraceptives nor alcohol or illicit drug intake was discovered in her medical history. Neurological examination, blood analysis, and computed tomography (CT) scan performed at the emergency service were normal. Due to the ineffectiveness of conventional therapies, a standard MRI brain and cervical spine examination before and after intravenous gadolinium administration was performed. MRI showed diffuse pachymeningeal enhancement with positive venous distention sign, and reduced mamillopontine distance (about 5 mm) and cerebellar tonsils ectopia (about 4 mm). No associated subdural effusion was highlighted; callosal and pontomesencephalic angles were normal. As an occasional finding, a single CNS capillary telangiectasia was observed in the right putamen (Figure 1). The patient was treated with bed rest and steroid therapy (oral treatment with prednisone, 50 mg/day, with a gradual withdrawal in 30 days), with complete symptomatic relief in a few days. After two months, follow-up brain MRI showed almost complete resolution of the imaging pathological findings (Figure 2).",
"gender": "Female"
},
{
"age": 66,
"case_id": "PMC6323585_02",
"case_text": "A 66-year-old woman with personal history of orthostatic headache associated with dizziness and vertigo came to our attention to perform a contrast-enhanced brain and cervical spine MRI scan, because of the activity-impairing nature of her condition. She was under therapy for essential hypertension and dyslipidaemia. No other comorbidity was noticed at outpatient clinical anamnesis, and neurological examination was normal. A previous cerebellopontine and temporal bone CT scan (performed because of invalidating vertigo attacks) did not bring to light any anomaly. MRI examination showed diffuse and intense pachymeningeal enhancement, involving also spinal dura; neither cerebellar tonsils ectopia nor herniation was noticed (Figure 3). A moderate venous distension and epidural vein engorgement were present; callosal angle, mamillopontine distance and pontomesencephalic angle were normal, and subdural effusions were absent. The patient was treated with bed rest and steroid therapy (oral treatment with prednisone, 50 mg/day, with a gradual withdrawal in 30 days) [16], with a progressive and long-term clinical improvement. After three months, follow-up brain and spine MRI showed a persistent dural contrast-enhancement (Figure 4), but it was less pronounced compared to the previous MRI examination. After the above-mentioned conservative therapy, the patient reported long-lasting complete disappearance of the symptoms.",
"gender": "Female"
}
] |
PMC6323585
|
[
{
"age": 20,
"case_id": "PMC5881520_01",
"case_text": "More than 20 years later, in February 2017, a 68-year-old woman with a history of recurrent otitis presented to a hospital in RI with one day of fever, otalgia, and encephalopathy. Imaging revealed a small intraventricular bleed with mild sphenoid sinusitis, chronic mastoiditis, and ventriculitis. She was given ceftriaxone 2 g IV every 12 h, vancomycin 1 g IV twice daily (aiming for a trough of 15-20 mcg/mL), rifampin 600 mg IV daily, and dexamethasone IV. Levetiracetam was given for seizure prophylaxis. Cerebrospinal fluid and blood cultures yielded S. pneumoniae resistant to ceftriaxone with a minimum inhibitory concentration (MIC) of 2 mcg/mL; the isolate was sensitive to vancomycin and rifampin. The patient's mental status returned to baseline within five days. Ceftriaxone, vancomycin, and rifampin were continued for 2 weeks following the first negative blood culture. She had no residual symptoms at clinic follow-up on her last day of therapy.\nThis case of ceftriaxone-resistant S. pneumoniae meningitis comes at a time when both IPD and resistant pneumococci are rarely a concern in immunocompetent individuals. Treatment for possible resistant pneumococci was based on knowledge of a similar prior case and a review of recently available Infectious Disease Society of America guidelines for the diagnosis and treatment of meningitis and ventriculitis. These guidelines suggest considering rifampin as an adjunct to vancomycin and continuing both when the MIC of ceftriaxone is >2 ug/mL. This case suggests continued vigilance is warranted for the rare but real possibility of ceftriaxone-resistant pneumococci causing meningitis in an adult. While ceftriaxone and vancomycin are standard choices for the empiric treatment of meningitis, rifampin should be considered as an adjunctive therapy in severe cases until susceptibilities allow for de-escalation.",
"gender": "Female"
}
] |
PMC5881520
|
[
{
"age": 25,
"case_id": "PMC6191556_01",
"case_text": "A 25-year-old female patient presented to the emergency room with dyspnea and markedly reduced effort capacity. Medical history was notable for an uneventful pregnancy and normal delivery of a healthy baby 1 week prior to presentation. Dyspnea on exertion started on the 2nd postpartum day, progressed, and the patient reported paroxysmal nocturnal dyspnea for 3 nights. Her admission vitals were normal except tachypnea and a relatively low oxygen saturation (93%). Physical examination revealed general pallor, bibasilar rales, and S3. Electrocardiography showed sinus tachycardia. Ventricular dilatation, increased ventricular filling pressure, moderate systolic dysfunction, and moderate mitral regurgitation were found on TTE, together with an sPAB of 40 mmHg. A hypoechoic mass with irregular borders concurrent with a thrombus was apparent in the left ventricle (Fig. 1). Liver and kidney function tests were within normal limits; brain natriuretic peptide and D-dimer levels were high. Autoimmune panel and thyroid function tests were normal.\nPatient was admitted to the coronary care unit with presumed diagnoses of peripartum cardiomyopathy and an apical thrombus. Diuresis and heparinization were initiated. Cardiac tomography scan (CTC) was planned to investigate the accompanied cardiac anomaly causing ventricular thrombus development, and apical cardiac thrombus was confirmed (Fig. 2a, Fig. 2b). On the 3rd day of admission, a control TTE showed that the embolus had diminished in size. To exclude coronary heart disease, invasive coronary angiography (ICA) was scheduled, and ICA performed on the 5th day revealed a normal coronary artery (Fig. 3) concurrent with peripartum cardiomyopathy. Patient was maintained on diuretics and coumadin and was discharged on the 10th day of admission. Control TTE in the 1st month showed improvement of ventricular diameters, absence of embolus, and an EF of 50%. Patient was maintained on anticoagulation and 1st year TTE was within normal limits. Patient was counseled for further pregnancies and increased risk of cardiac and thromboembolic events.",
"gender": "Female"
}
] |
PMC6191556
|
[
{
"age": 55,
"case_id": "PMC5299195_01",
"case_text": "In May of 2016, a 55-year-old male with history of hypertension, hyperlipidemia, and coronary artery disease (CAD) status after angioplasty of left anterior descending (LAD) artery 2 years ago presented to the emergency room (ER) with substernal chest pain. His cardiac enzymes were not elevated and electrocardiogram (EKG) showed normal sinus rhythm at a rate of 62 bpm with borderline AV conduction delay and right bundle branch block (RBBB) pattern (Figure 1). The patient was only taking aspirin and had discontinued his statin due to muscle ache and metoprolol because of fatigue. His chest pain was relieved with sublingual nitroglycerin in the ER. In view of his significant history of CAD and typical anginal symptoms, patient underwent cardiac catheterization. It revealed 90 percent stenosis of the left mid circumflex coronary artery which was successfully stented with a drug-eluting stent. Right coronary artery (RCA) showed 50-60% stenosis while LAD showed patent stent. The patient recovered very well. After calculating the GRACE score, the patient was discharged on aspirin and ticagrelor as per the ACC guidelines. He was also prescribed rosuvastatin and metoprolol. Two months after PCI, the patient presented to his primary cardiologist due to worsening fatigue and intermittent dizziness. His metoprolol was stopped. In November, 2016, he was brought by emergency squad to the hospital due to worsening dizziness and diaphoresis at rest. He denied any h/o chest pain, palpitations, nausea, or loss of consciousness. The patient had stopped ticagrelor 1 day prior to this admission since he ran out of it. The patient requested a second opinion on this admission. On physical examination, his blood pressure was 126/66 mmHg and heart rate was regular at 42 beats per minute. The neck was supple with no carotid bruits and cardiac auscultation revealed 2/6 ejection systolic murmur in the left sternal border. Patient's EKG revealed second-degree type II atrioventricular (AV) block which was new (Figure 2). His cardiac enzymes, thyroid stimulating hormone, serum potassium, and magnesium were within normal range. The patient did not receive ticagrelor further during the admission. Cardiac catheterization revealed RCA stenosis of 60-70% but no intervention was required as this was not the cause of the new onset heart block. We considered starting patient on oral theophylline on admission had the heart block not resolved within 24 hours. His second-degree heart block resolved 2 days after discontinuation of ticagrelor and his EKG showed sinus bradycardia (heart rate = 54 bpm) with borderline AV conduction delay with RBBB pattern (Figure 3) which was similar to his baseline EKG. Clopidogrel was started as an alternative P2Y12 platelet receptor inhibitor and aspirin was continued. He was discharged after an event monitor was placed.",
"gender": "Male"
}
] |
PMC5299195
|
[
{
"age": 50,
"case_id": "PMC5556594_01",
"case_text": "A 50-year-old male presented with headache since the past two months. He also complained of weakness in both upper and lower limbs and altered sensorium for the past fifteen days. On physical examination, the patient was conscious with a GCS of E4M6V4. The power was reduced on the left side (3/5), but maintained on the right side (5/5). Computed tomography (CT) revealed well defined hetero-dense masses measuring 5x4 cm and 2x2 cm in the right and the left parietal region respectively with surrounding edema and mass effect (Figure 1 (Fig. 1)). A diagnosis of glioblastoma multiforme was suggested. Total excision of both the masses was done and they were sent for examination. Histopathology of both lesions showed a tumor with cells arranged diffusely in sheets as well as scattered singly. The cells had abundant amounts of eosinophilic cytoplasm, eccentrically placed nuclei, and prominent nucleoli. Areas of high mitotic activity and necrosis were also noted (Figure 2 (Fig. 2)). The possibilities considered were glioblastoma multiforme, metastases, melanoma, plasmacytoma, and rhabdoid meningioma. On IHC (immunohistochemistry), the tumor cells were negative for GFAP, CK, HMB-45 and showed diffuse positivity for D2-40 and vimentin. Focal positivity for EMA was also observed. The high mitotic activity was highlighted by Ki67 positivity demonstrating a mean labeling index of 15% (Figure 3 (Fig. 3)). Absence of pigment and HMB-45 reactivity ruled out a melanocytic lesion. Absence of mott cells and CD 138 reactivity ruled out plasmacytoma. Absence of any other primary lesion on imaging and CK negativity eliminated metastatic carcinoma. GFAP negativity excluded the possibility of glioma. Finally, EMA, D2-40, and vimentin positivity confirmed the meningeal nature of the tumor cells. Thus, a final diagnosis of bilateral rhabdoid meningioma was rendered. Often, the presence of classical areas of meningothelial appearance in the tumor help in reaching the diagnosis. However, these were absent in the present case. Postoperatively, there was improvement in the neurological deficit and subsequently, the patient was put on radiotherapy. He received 30 cycles of radiotherapy with a radiation dose of 60 Gy. Till one year follow-up, the patient is asymptomatic and doing well.",
"gender": "Male"
}
] |
PMC5556594
|
[
{
"age": 79,
"case_id": "PMC6949671_01",
"case_text": "A 79-year-old gentleman who lived alone and mobilised with a walking frame was seen in his GP surgery complaining of sudden onset bilateral hip pain. He gave a past medical history of rheumatoid arthritis for many years treated with leflunomide and prednisolone. He also suffered from atrial fibrillation and was on warfarin. He described a severe aching type pain within the hips and was unable to weight bear at the time. His Abbreviated Mental Test (AMT) score was 10. The general practitioner ordered a pelvic X-ray and appropriately referred the patient to orthopaedics for further specialist assessment. The X-ray was reviewed by the orthopaedic registrar on call at the time, and an initial diagnosis of an acute exacerbation of rheumatoid arthritis was made. Advice was given to manage the patient with analgesia and anti-inflammatories.\nThe patient then attended after ten days when he had a trivial fall due to his \"legs giving way.\" On clinical examination, he had tenderness in both hips. Both lower limbs were externally rotated and shortened during assessment. Range of motion was extremely limited due to pain. Plain radiographic examination of the pelvis revealed bilateral displaced intracapsular fractures (Figure 1). On reviewing the initial radiographs ordered by the general practitioner, it was apparent that the patient had bilateral undisplaced fractures of the neck of femurs (Figure 2).\nThe patient was admitted to the acute trauma ward and optimised by the orthogeriatrician. He then underwent a single-stage bilateral cemented Exeter hemiarthroplasties in lateral position using anterolateral approaches (Figure 3). The patient was transferred to ITU postoperatively and monitored. He was shifted to a rehabilitation ward for intensive physiotherapy. He had an uneventful recovery with mobilisation using a walking frame and was discharged home after 20 days.",
"gender": "Male"
}
] |
PMC6949671
|
[
{
"age": 45,
"case_id": "PMC8571294_01",
"case_text": "A 45-year-old female presented with a Chiari I malformation (CM) and RA presented with 7-months of progressive suboccipital headaches [Table 1]. The brain MRI showed brainstem/ upper cervical cord compression attributed to a Chiari I malformation (i.e., with 4-mm of tonsillar descent), with BI/platybasia (i.e., defined based >3-mm extension cranial to Chamberlain's line, extension cranial to McRae's line, and with a nasion/clival angle >143 degrees) [Figures 1-3]. Cervical X-rays also confirmed odontoid instability with anterolisthesis of C2 over C3 and C3 over C4 on flexion which reduces on extension [Figure 4].\nAs 48 h of halo ring traction (i.e. secured to a halo vest) resulted in minimal odontoid reduction (i.e. movement of ~2-mm), the patient required posterior followed by anterior cervical surgery [Figure 5].\nThe C0-C5 decompression and fusion revealed underdeveloped lateral masses (i.e., analogous to pediatric lateral masses) and confirmed a congenital C2/3 lateral mass fusion. Despite this finding, 14-mm screws were effectively placed for lateral mass fixation. The second procedure, an endoscopic/endonasal odontoidectomy utilized neuronavigation. A small incision was made in the soft palate, and the posterior portion of the hard palate was removed using the zero-degree endoscope allowing access to remove the inferior odontoid [Figures 6a and b]. In addition, soft tissue from the anterior arch of C1 and the small intervening portion of the clivus between C1 and C2 were removed [Figures 6c and 7]. As stereotactic navigation appeared to be inaccurate, 3D fluoroscopy was additionally employed to complete the endoscopic/endonasal odontoidectomy [Figures 8a and b]. A second O-arm spin demonstrated a small residual portion of the left lateral base of odontoid, which was then removed [Figure 9]. The patient tolerated the procedure well. Further, the final post-operative CT of confirmed good decompression [Figure 10]. Her headaches resolved postoperative at 4-weeks and the neck stiffness was improving.",
"gender": "Female"
}
] |
PMC8571294
|
[
{
"age": 75,
"case_id": "PMC6346800_01",
"case_text": "The Emergency Medical Services (EMS) were called to attend a 75-year-old man who felt unwell and was confused after injuring his left foot on a tree branch 3 days previously. The EMS staff, realizing the patient was unstable and in a septic state, requested a physician staffed Mobile Emergency Care Unit (MECU). The MECU determined the patient's vital signs were normal apart from a body temperature of 39.5 C and a respiratory rate of 50 breaths per minute. On-site venous blood gas analysis revealed a blood lactate concentration of 5.7 mmol/l and a pH level of 7.3. Blood cultures were drawn and 2 g of meropenem were administered along with intravenous fluids.\nUpon arrival at the ED, the patient's heart rate had increased to 114 bpm while his blood pressure remained normal. He was found to be slightly confused but scored 15 on the Glasgow Coma Scale. Arterial blood gas analysis showed a blood lactate concentration of 3.9 mmol/l and a pH level of 7.37. The patient desaturated and required supplemental nasal oxygen. Plasma creatinine was 182 mmol/l, bilirubin 22 mmol/l, C-reactive protein 127 mg/l, white blood cell count 2.51x109/l, and creatine kinase 773 U/l.\nThe patient's left foot showed marked evidence of a skin infection. The patient was found to have severe sepsis and incipient multiple organ failure, so antibiotics and intravenous fluids were intensified. Upon arrival at the ED, both conventional and thermographic images were taken with the patient's consent (Fig. 1a). Imaging repeated after 1 hour showed progression of the infection (Fig. 1b). Conventional imaging showed the development of bullae, while the thermal image showed increased dermal temperature and extent with decreased dermal temperature near the bullae.\nThe patient was taken to the operating theatre and the diagnosis of necrotizing fasciitis was confirmed. Blood cultures and tissue samples both showed growth of haemolytic group A streptococci.",
"gender": "Male"
}
] |
PMC6346800
|
[
{
"age": null,
"case_id": "PMC3447224_01",
"case_text": "The proposita is the second of three siblings (Figure 1; individual 2 : 4), conceived when the mother was 21 years of age. Individual 2 : 4 was first consulted at 33 years of age upon referral for suspected infertility. Initial investigations revealed hypergonadotropic hypogonadism (elevated gonadotrophins with low estradiol and progesterone), indicating poor ovarian function with ovarian resistance. Results were confirmed on several occasions, and premature menopause was diagnosed. Following a short course of ovulatory induction, this patient experienced an early pregnancy at age 36; however, that pregnancy resulted in spontaneous abortion at 36-week gestation (individual 3 : 3). Sporadic chromosomal abnormalities as well as both maternal and paternal meiotic errors may contribute to unsuccessful pregnancies of this type. Recently, individual 2 : 4 successfully conceived a male child (Individual 3 : 4) following assisted fertility therapy using donor ovum (from Individual 2 : 5) and partner sperm (from individual 2 : 3). That pregnancy lasted 37 weeks, and the progeny (individual 3 : 4) was born without complication. The patient had been previously investigated for suitability to in vitro fertilization, which had on that occasion confirmed ovarian resistance. Both the proband and her partner underwent chromosome analysis. Individual 2 : 3 was determined karyotypically normal (46XY). For individual 2 : 4, cytogenetic studies revealed a 46XX genotype with balanced translocation of the long arms of an X-chromosome and the distal region of chromosome 18 (46, X, t(X;18)(q22.3;q23). The couple was informed of potentially viable pregnancy outcomes, and it was explained that the translocation was the most likely cause of the apparent ovarian failure, owing to a relative X-monosomy with partial inactivation of the second X-chromosome. The likelihood of the production of a chromosome 18 trisomy, leading to Edwards syndrome was discussed. Consultation regarding assisted reproductive technologies and preimplantation genetic diagnosis were undertaken. Analysis of chromosomal segregation patterns showed that of the 16 possible segregations (meiotic), only 2 could yield normal or balanced gametes. The risk of producing potential carrier siblings was discussed (Table 1).",
"gender": "Male"
},
{
"age": 36,
"case_id": "PMC3447224_02",
"case_text": "The proband's brother, the first of three siblings (individual 2 : 1), was conceived at 19 years maternal age. He was aged 36 years at the time of initial presentation and was referred for fertility testing. On examination, the patient was phenotypically normal. Genomic analysis revealed a balanced X;18 translocation (46, Y, t(X;18)(q22.3;q23)). Concerns regarding the likelihood of infertility were discussed. X-autosome translocations are known to interfere with meiosis leading to disrupted spermatogenesis. It is known that most males and approximately half of all females with X-autosome translocations experience sterility. Balanced reciprocal translocations are amongst the most common chromosomal abnormalities. Rearrangements usually result in sterility and/or a higher risk of chromosomal imbalance among offspring. Seminal fluid analysis was conducted and individual 2 : 1 was found to have decreased motile sperm count (<25%), increased sluggish/nonprogressive sperm (90%), as well as elevated abnormal spermatozoa (99%). Overall, analysis showed quantitatively normal seminal fluid with reduced motility, with the increased presence of abnormal forms. The limited prospects of successful conception were discussed with the couple (individuals 2 : 1 and 2 : 2).\nThe sister of the proband is the youngest of the three siblings (individual 2 : 6) and was conceived at 25 years maternal age. She was referred with oligomenorrhea and irregular menstrual cycles (ranging from nil for 6 months to 5-week-long cycles). Cytogenetic analysis revealed a 46, X, der(X), t(X;18)(q22.3;q23) unbalanced translocation, that is, trisomic 18q karyotype. Other than the genotype, the subject was and continues to be phenotypically normal. She was further counselled regarding the decreased likelihood of successful pregnancy, and the translocation implications were explained.",
"gender": "Female"
},
{
"age": null,
"case_id": "PMC3447224_03",
"case_text": "The mother of the proband was consulted (individual 1 : 2). She had previously experienced three uncomplicated pregnancies at the ages of 19, 21, and 25 years. Chromosomal analysis revealed 46, X, t(X;18)(q22.3;q23) with a balanced reciprocal translocation between the long arms of one X-chromosome and chromosome 18 (18q). Cytogenetic analysis showed breakpoints at Xq22.3 and 18q23. This patient is phenotypically normal. Although Xq22 breakpoints may be associated with ovarian dysfunction, the patient reported no fertility issues and had previously produced three offspring, which resulted from uncomplicated full-term pregnancies. Pregnancies in such situations run the risk of unknowingly producing unbalanced gametes owing to their clinically silent presentation, which indeed was the case in this instance.",
"gender": "Female"
}
] |
PMC3447224
|
[
{
"age": 46,
"case_id": "PMC6056777_01",
"case_text": "A 46-year-old lady had undergone multiple surgeries for vascular manifestations of a genetically confirmed MFS. In 2005, she had undergone a Crawford II repair for descending aortic dissection. In 2008, she received a valve-sparing aortic root replacement for ascending aortic dissection and had undergone bilateral mastectomy for breast cancer (BRCA2 mutation) in 2007.\nIn 2016, a routine computed tomography (CT) scan in an outside hospital revealed a newly developed circumscript aneurysm (4.1 x 3.3 cm) of the left subclavian artery (LSA) in the retro-clavicular intrathoracic space (Figure 1). Clinically, a recent onset of pulsatile sensation in the left supra-clavicular fossa and increasing hoarseness were noted by the patient. Physical examination confirmed a palpable swelling in the retro-clavicular space. The patient was initially offered surgical resection, however, with limited mobility; after previous thoracotomies and restricted lung function from multiple thoracotomies, she declined open surgery and opted for an endovascular solution. The endovascular strategy eventually was to place a highly flexible self-expanding stent-graft (W.L Gore Viabahn Endoprosthesis 9 x 100 mm) across the aneurysm with about 3 cm of landing zone on either end, leaving left vertebral and mammary artery unobstructed. For this percutaneous strategy, a standard 9F sheath was advanced into the left brachial artery. Heparin was given as soon as the access was established. Then, a '0.035' J-tip guide-wire was navigated across the aneurysm to reach the ascending aorta, followed by a Viabahn stent-graft (9 x 100 mm) advanced safely over this wire and precisely deployed to exclude the aneurysm (Figure 2(a)-(c)). A completion angiogram confirmed correct positioning and absence of endoleak (Figure 2(d)); the brachial artery access was closed by manual compression for 30 min and then a large radial TR-band for 3 h. Post-procedure, the patient was stable and recovered well. Before hospital discharge, a CT angiogram demonstrated that the LSA stent had been precisely deployed, not compromising vital side branches and completely excluding the aneurysmal sac (Figure 3(b) and (e)). The patient went home on a combination medication of Aspirin 75 mg, Bisoprolol 5 mg and Losartan 50 mg, and was followed for 1 year; at 1-year follow-up, a CT scan confirmed no endoleak, a completely thrombosed LSA aneurysm and eventually complete resolution of the aneurysmal sac (Figure 3(a)-(f)). Informed consent was obtained by the patient in writing to allow publishing the case and the associated images. As the durability of results after stent-graft peripheral arteries in MFS patients is still a matter of debate and possibly controversial, such patients are currently followed by CT Angiogram or Magnetic Resonance Angiography (MRA) according to surveillance protocol (in annual intervals).",
"gender": "Female"
}
] |
PMC6056777
|
[
{
"age": 0,
"case_id": "PMC3620447_01",
"case_text": "A 17-month-old boy was admitted to the Department of Neurosurgery, Children's University Hospital in Cracow due to aggravating problems with balance. Starting a week earlier, the parents noticed that the boy had a tendency to tilt the head to the right and would choke when drinking. Neurologic examination found the following deficits: cerebellar disturbances of balance illustrated by the boy's staggering and inability to walk, compulsory tilting of the head to the right, slight right pyramidal hemiparesis, left VI and VII cranial nerve palsies, bulbar signs demonstrated by choking, weak pharyngeal and palatal reflexes, and a suspected lesion in the visual field which could not be confirmed due to the child's lack of cooperation. Computer tomography (CT) and magnetic resonance imaging (MRI) revealed an enormous tumor (44 x 35 x 45 mm in CT and 35 x 36 x 32 mm in MRI) in the brainstem, mostly in the left pons and medulla oblongata (Fig. 1a, b). The tumor was hyperintense in T2 and showed heterogenous contrast enhancement in T1 with narrowing of the fourth ventricle (Fig. 1b). There were no features of supratentorial hydrocephalus in spite of evidence of elevated pressure in the posterior fossa. The state of the child was unstable and the risk of its marked worsening due to operation was high. Even the biopsy bore a significant risk. As a result, the parents, after meticulous consideration of the pros and cons, did not give consent to neither an operation nor biopsy on assumption that the child would receive chemotherapy, which was immediately introduced. Consecutively, the child was transferred to the Department of Pediatric Hematology and Oncology, Children's University Hospital in Cracow. Further diagnostics did not reveal any other foci of disease. Based on the clinical picture and neuroimaging, a malignant glioma of the brainstem was tentatively diagnosed and chemotherapy was introduced accordingly with two cycles of cisplatin, etoposide, and vincristine, and one cycle of cyclophosphamide, etoposide, and vincristine. Two months after first admission, the child showed signs of ataxia and decreased muscle tone. Soon, the child's condition abruptly worsened with severe vomiting and a forced retroflexed position. Repeated MRI revealed enlargement of the tumor (52 x 50 x 54 mm) and supratentorial hydrocephalus due to compression of the cerebral aqueduct with transudation (Fig. 1c). The hydrocephalus was treated with implantation of a ventriculo-peritoneal shunt, and chemotherapy with irinotecan and carboplatin was introduced. The hydrocephalus remitted but the child relentlessly deteriorated as the tumor continued to enlarge and died 3 months after hospitalization. \nAn autopsy of the brain performed at Department of Pathology, Children's University Hospital, revealed an enormous tumor inside left cerebellar hemisphere partially occupying the pons and also expanding to the midbrain. The tumor distorted the whole brainstem and cerebellum, pushing aside and compressing the fourth ventricle, but definitely not originating from it (Fig. 1d). This confirmed the previous MRI findings of a primary brainstem tumor (Fig. 1a). On cross section, the tumor showed uniform consistency, slightly lower than the normal brain tissue. The tumor had well marked borders with a smooth transition into adjacent apparently normal tissue.\nMicroscopic pictures represented a very conspicuous pattern with relatively paucicellular neuropil-like background with numerous and rather evenly distributed cellular densities populated with small undifferentiated cells (Fig. 1e). Rosettes formed another characteristic element of the tumor (Fig. 1f). Neuropil zones, in contrast to the cellular zones, showed immunopositivity to synaptophysin (Fig. 2a). Both in cellular zones and neuropil zones, there were scattered characteristic rosettes, totally negative to synaptophysin (Fig. 2b) but strongly positive to vimentin (Fig. 2c). The rosettes had an \"empty,\" homogenous core, but frequently with a delicate eosinophilic contouring reminiscent of ependymoblastic rosettes, though somewhat more delicate than those occurring in typical ependymoblastoma (Fig. 1e, f). The rosettes were also weakly positive for glial fibrillary acidic protein (GFAP) and for S100 protein (Fig. 2d). However, in neuropil zones, there were cells present with the immuno- and morphophenotype of astrocytes (GFAP+ and some S100+). Moreover, outside of the rosettes, synaptophysin-positive mature neuron-like cells were noted (Fig. 2b), and some were even strongly positive for synaptophysin, in spite of resembling astrocytes (Fig. 2e). Ki-67 expression was high but limited to rosettes (Fig. 2f) and cellular zones especially around the vessels. No areas of frank necrosis or any \"pathological\" forms of endothelial proliferation were noted. However delicate vessels were numerous, frequently surrounded by undifferentiated cells that do not conform to the description of \"perivascular formations\" or pseudorosettes.",
"gender": "Male"
}
] |
PMC3620447
|
[
{
"age": 6,
"case_id": "PMC2838361_01",
"case_text": "The proband, an adopted six-year-old girl, and her four-year-old sister were brought to a pediatric cardiologist for evaluation, largely at the insistence of the natural maternal grandmother (MGM), who had maintained contact with the adoptive parents. At the time of the initial evaluation, the proband's family history, obtained through the natural MGM, was notable for hypertrophic cardiomyopathy (HCM) in her maternal uncle (diagnosed on autopsy following SCD at age 15), maternal grandfather (s/p ICD for HCM), and two maternal great aunts (SCD at age 16 and 36) (Figure 1). At the time of the maternal uncle's death, the cardiac status of the proband's mother was deemed \"normal.\" On initial evaluation, the proband was asymptomatic with a normal physical exam, a normal electrocardiogram (ECG) and a normal echocardiogram. Given their significant family history for HCM, the proband and her sister were followed at 1-2 year intervals.\nAt 8, 11, and 13 years, the proband was largely asymptomatic. The electrocardiograms showed no evidence of ST changes, left ventricular hypertrophy (LVH), or T-wave changes. The echocardiograms were completely within normal limits. She remained a very active child playing soccer and basketball without any exercise intolerance. At 13 years, the proband experienced a syncopal episode lasting a few minutes that was attributed to a vasovagal event. Her ECG and Holter monitoring at the time did not show any abnormalities. \nAt 14 years, the proband continued to be athletic and denied any symptoms. Her physical exam and echocardiogram were normal. However, the proband's ECG did show nonspecific ST-T wave changes (Figure 2(a)). At this time, genetic testing was discussed with her and her adopted parents, but the family opted to defer testing.\nAt 15 years, the proband's ECG showed right bundle branch block, right posterior fascicular block, and Q waves in the lateral and inferior leads (Figure 2(b)). Subsequent cardiac evaluations, including an exercise stress test, echo, and MRI, however, were normal, without any signs of myocardial ischemia or hypertrophy. The proband denied any symptoms or exercise intolerance. \nAt 17 years, the proband's echocardiogram showed very mild concentric LVH (thickness 1.1 cm, Z-Score of 2), with evidence of diastolic dysfunction (maximal E : E' ratio=12). An exercise stress test did not reveal any evidence of ischemia or ectopy, and Holter monitoring was unremarkable. At this time, the proband was restricted from participating in competitive athletics, and genetic testing was performed (see below). An MRI performed two weeks later showed normal overall left ventricular mass at 67 g/m sq and normal interventricular septal and posterior wall thickness, but also revealed a prominent 2.7 cm thickening of the anterior wall at the base of the left ventricle (Figure 3).",
"gender": "Female"
},
{
"age": 15,
"case_id": "PMC2838361_02",
"case_text": "The genetic testing, performed by the Harvard-Partners Laboratory for Molecule Medicine (http://www.hpcgg.org/LMM/), involved sequencing the coding regions and splice sites of the genes encoding the sarcomeric proteins cardiac alpha-actin (ACTC), cardiac myosin-binding protein C (MYBPC3), cardiac beta-myosin heavy chain (MYH7), myosin regulatory light chain (MYL2), cardiac myosin essential light chain (MYL3), cardiac troponin I (TNNI3), cardiac troponin T2 (TNNT2), and tropomyosin 1 (TPM1). In addition, the genetic testing included sequencing the genes for alpha-galactosidase A (GLA), lysosomal associated membrane protein 2 (LAMP2), and AMP-activated protein kinase, gamma-2 subunit (PRKAG2), which are involved in storage diseases that can lead to cardiac hypertrophy. The sequencing effort revealed two variants in the MYH7 gene: the proband was doubly heterozygous for a R719Q variant (2156G>A in Exon19) as well as a T1513S variant (4537A>T in Exon 33). The R179Q variant alone was likely to be causative for HCM as it met the criteria for pathogenity based on segregation studies and frequency. However, the significance of the T1513S variant was unclear even though it was detected in one additional HCM patient tested by the reference lab (http://www.hpcgg.org/LMM/) and in one patient reported in the literature. In both of these prior cases, the T1513S variant was found in combination with the R719Q variant. Given the rare but recurrent presyncopal/syncopal complaints and significant family history of SCD, the proband received an internal cardiac defibrillator (ICD). The proband's 15-year-old sister was not found to have any genetic variants.",
"gender": "Unknown"
},
{
"age": 36,
"case_id": "PMC2838361_03",
"case_text": "To determine the significance of the MYH7 T1513S variant, and to determine whether the two variants are present in cis (on the same allele) or in trans (on different copies of the gene), we contacted the proband's natural birth mother. The natural mother (36 years old) was found to have developed significant hypertrophic cardiomyopathy (IVS dimension of 2.7 cm, with a resting LV outflow gradient of 40 mmHg) with debilitating heart failure symptoms. She had received an ICD and was awaiting septal myomectomy. The genetic test on the mother revealed that she too was a heterozygote for both the R719Q and T1513S variants.",
"gender": "Female"
}
] |
PMC2838361
|
[
{
"age": 69,
"case_id": "PMC6381883_01",
"case_text": "This case was a 69-year-old female. Right eyelid tumor appeared and grew rapidly. A biopsy strongly indicated a pathological diagnosis of SC, leading to surgical resection (orbital exenteration). Given postoperative pathological findings of nests of polygonal tumor cells with highly heteromorphic nuclei and foamy lipid droplets, a final diagnosis of SC was made (Fig. 1).\nFour months after surgery, multiple lung metastases (Fig. 2a) and abdominal subcutaneous metastases occurred. Chemotherapy with carboplatin (AUC5) and paclitaxel (200 mg/m2) was started as combination therapy with platinum and taxane, which have been shown to be effective for adenocarcinomas of various origins. At the start of chemotherapy, performance status (PS) was 2. After the second cycle of chemotherapy, computed tomography (CT) for response assessment revealed a partial response (PR) with an at least 50% reduction in total maximum diameter of lung (Fig. 2b) and subcutaneous metastatic nodules. A total of 7 cycles of chemotherapy was given, at 3-weeks per cycle. Hematotoxicity was Grade 3 neutropenia, but febrile neutropenia did not occur, and non-hematological toxicity was Grade 1 peripheral nerve disorder. Nonetheless, treatment was well tolerated. Combination therapy with carboplatin and paclitaxel resulted in 11-month progression-free survival (PFS).\nLater, however, multiple lung metastatic nodules increased in number and grew, and multiple brain metastases occurred. Whole-brain irradiation was performed for the treatment of multiple brain metastases, resulting in disappearance of brain metastatic nodules. After whole-brain irradiation, second-line treatment with docetaxel (60 mg/m2) alone was administered. At the start of monotherapy, PS was 2. A total of 6 cycles was given, at 3-weeks per cycle. A PR was achieved with a 45% regression of multiple lung metastatic nodules. Hematotoxicity was Grade 4 neutropenia and Grade 3 febrile neutropenia; nonetheless, treatment was well tolerated.\nChemotherapy is currently suspended at the request of the patient. However, she has survived for 18 months with 7-month PFS after the start of docetaxel.",
"gender": "Female"
}
] |
PMC6381883
|
[
{
"age": 7,
"case_id": "PMC6076945_01",
"case_text": "A previously healthy 7-year-old male presented to a community hospital with severe lower extremity trauma due to accident with a truck. The patient was instantly brought to the OR and the surgeon performed a lower right leg and an upper left leg guillotine amputation. During surgery the patient received one litre of crystalloids, two units of packed cells, and one unit plasma and remained hemodynamically stable with low noradrenaline dosage. For postoperative analgesia a n. ischiadicus and a n. popliteal catheter were placed during surgery in the left and right lower extremity, respectively. Since much postoperative pain was expected ropivacaine infusion of 0.2 mg kg-1 h-1 was started over each catheters (0.4 mg kg-1 h-1 in total), postoperatively. Intravenous infusion of esketamin 0,2 mg kg-1 h -1 and morphine 20 mcg kg-1 h-1 was started additionally. Initially peripheral catheters were preferred since less hemodynamic consequences were expected. Postoperative analgesia was generally sufficient scoring NRS 0 at rest and NRS 2 during movement. However, after one week his pain management was not sufficient anymore, most probably due to peripheral catheter manipulation after several debridements and stump closure on OR. Therefore, the peripheral catheters were removed and since the patient was hemodynamically stable and had no fever anymore a tunneled epidural catheter (L4-L5) was placed and ropivacaine 0.4 mg kg-1 h -1 infusion was started epidurally. This resulted in adequate pain management during rest and additional morphine was stopped since it caused itching. However, during wound treatment the next day the patient experienced again nonacceptable pain. A bolus of esketamin did not reduce pain to acceptable levels. Moreover, infusion of esketamin is controversial since it may induce liver enzyme disorder and it was stopped. One day after epidural placement a bolus of 10 ml ropivacaine 0.375% with 5 mcg of sufentanil resulted in adequate pain relief, and we increased continuous epidural infusion to 0,48 mg kg-1 h -1 of ropivacaine. Initially a bilateral sensory block was present at T12/L1 without a motor block. We observed the patient in a medium care unit with continuously pulse oximetry, 3-lead ECG (no qualitative 12-lead ECG analysis) and blood pressure monitoring. Furthermore, our nurses are trained to recognize symptoms of LAST and the patient was monitored on a daily basis by the acute pain service. Since we did not observe symptoms of LAST whatsoever, no side effects of epidural bupivacaine 0.5 mg kg-1 h -1 were described in literature, the department of pediatric anesthesiology approved these high concentrations, and adequate pain relief was obtained and these high dosages were accepted. After taking into account the weight loss due to amputation we were actually infusing at 0.56 mg kg-1 h -1.\nSince few studies are performed to assess intravenous ropivacaine concentration after subsequent epidural infusion for days in pediatrics, we obtained venous and arterial samples after 8 days of epidural ropivacaine infusion and continued epidural infusion. Venous sampling resulted in 1.1 mg/l and 0.06 mg/l bound and unbound ropivacaine concentration, respectively. Arterial sampling resulted in 1.2 mg/l and 0.05 mg/l bound and unbound ropivacaine concentration, respectively. To our knowledge there were no other laboratory tests which we could perform to monitor for ropivacaine toxicity, other than more frequent testing which we did not find ethical to do in a child.\nAfter 11 days, our patient was transferred, with the epidural in situ, to another hospital closer to his hometown. In follow-up, we learned that the epidural catheter was luxated during transport and thus removed. At this moment, the pain was tolerated well. No long-term side effects such as paresthesia were observed.",
"gender": "Male"
}
] |
PMC6076945
|
[
{
"age": 46,
"case_id": "PMC3090653_01",
"case_text": "A 46-year-old man presented to the emergency department with pleuritic chest pain, a swollen and painful right knee, and weight-bearing difficulty. Accompanying this was hip and back pain after a fall. This occurred on a background of unexplained progressive weight loss of 40 kilograms over the past 2 years, poor appetite, fever and drenching night sweats, increased susceptibility to infection, and intravenous drug use. He had a 16-year history of hepatitis C (HCV; genotype 3), which remained untreated due to noncompliance and poor clinic attendance. He had been a well-built professional boxer of 96 to 100 kilograms for most of his adult life; however, his admission weight was 60.61 kilograms. This was a loss of approximately 63% of his total body weight. His relevant medical history includes postoperative pulmonary embolism, disc prolapse, mild depression, and a family history of adult polycystic kidney disease. The relevant surgical history includes osteomyelitis and amputation of the third digit of the right hand, and multiple fracture repairs. Systems review was unremarkable. He has a complicated social history including a troubled upbringing, intravenous heroin use up to 1 gram per day, experimentation with most illicit drugs, a significant criminal history, and participation in an opiate substitution programme. He does not smoke tobacco or drink alcohol. \nOn examination, the patient appeared acutely unwell, although vital signs were normal. He appeared cachectic, had sunken eyes, reduced skin turgor, poor dentition, extensive tattoos, and had track marks in the cubital fossae and groin. There was rib and mediastinal tenderness with no masses. Right upper quadrant abdominal tenderness was noted on palpation, with hepatomegaly 6 centimetres below the costal margin. Nontender lymphadenopathy was present in the upper left jugular nodes and bilaterally in the groin. A warm, right knee effusion was also apparent. There were no signs suggestive of infective endocarditis or chronic liver disease. Respiratory, cardiovascular, thyroid, and neurological examinations were unremarkable. \nInitial blood biochemistry revealed a noncritical normocytic normochromic anaemia (haemoglobin 102 g/L), raised CRP, elevated calcium (2.57 mmol/L), and low albumin (23 grams/L). A thyroid function test detected 18 picomols/L of free T4 (normal range 7-17 pmols/L). This was assumed to be a transient reactive elevation rather than the cause of such significant weight loss. Liver function tests, blood cultures, electrolytes, renal function, coagulation profile, alpha-fetoprotein, vasculitic screen, iron studies, vitamin B12, urate, and globulins were all within normal ranges. Hepatitis C serology was reactive with an IgG response. forth generation antigen/antibody assay was performed twice, four weeks apart, to determine HIV positivity; however, both tests returned negative. The patient's history revealed that previous HIV tests were also negative, and as such a Western blot analysis was not performed. Hepatitis B serology was consistent with immunisation. Polymerase chain reaction found the patient to be reactive to cytomegalovirus (CMV), and Epstein Barr virus (EBV), but human herpes virus 8 was not detected. Although blood IL-6 levels could have been used as a marker of systemic inflammation, C-reactive protein was chosen instead as per hospital policies. A computerized tomography of the chest and abdomen found enlarged para-aortic lymph nodes and lytic lesions in T8 and T9. There was no splenomegaly, and the liver architecture was unchanged. \nA computerized tomography pulmonary angiogram, chest X-ray, and cardiac troponin I were requested to exclude pulmonary embolism, rib fracture and pneumothorax, and myocardial infarction. All were normal. The right knee joint was aspirated, and fluid analysis showed methicillin sensitive Staphylococcus aureus which was treated as septic arthritis with intravenous flucloxacillin and vancomycin. Following spiking fevers over the next few weeks in hospital, a transoesophageal echocardiogram was performed to exclude infective endocarditis from a septic arthritis-induced bacteraemia. \nAt this point, the patient was clinically suspected to have lymphoma or multiple myeloma, and further investigations undertaken were to exclude either. beta-2 microglobulin and LDH levels were normal, no monoclonal band was detected on serum and urine protein electropheresis, and flow cytometry showed normal subpopulations of B cell and T cell lineages. A bone scan showed further destructive thoracic lesions but did not confirm its extent. Magnetic resonance imaging confirmed T8 to T11 osteomyelitis with epidural involvement indenting on, but not compressing, the spinal cord. Lymphoma and multiple myeloma were excluded by bone marrow biopsy. \nThe diagnosis of multicentric plasmacytic Castleman's disease was histologically confirmed by an excision biopsy from an inguinal lymph node. Macroscopically, the specimen was a circumscribed ovoid nodule measuring 30 x 22 x 10 mm with a central blackish area. Microscopically, no malignant cells, Reed Sternberg cells, or their variants were seen. This was confirmed by two separate laboratories. Also noted were distinct hyaline deposits, prominent paracortical expansion by sheets of plasma cells, and subcapsular and interfollicular neutrophilic bodies. HHV-8 was not detected in this sample. \nA four-week rituximab regime was chosen as the primary treatment for this patient. Steroid treatment was also being considered as adjunct therapy.",
"gender": "Male"
}
] |
PMC3090653
|
[
{
"age": 32,
"case_id": "PMC9051404_01",
"case_text": "A 32-year-old female presented to her primary care physician with tender erythematous nodules on her bilateral lower extremities four weeks following her second Moderna COVID vaccination (Figure 1). She had a past medical history of Ehlers-Danlos syndrome, psoriasis, 3 possible first-trimester pregnancy losses, and chronic diarrhea. There were no other family members with similar conditions. Serologic testing for SS-A, SS-B, JO-1, RF, CCP, ANA, DNAse B, TG2, PR3/MPO with reflex to ANCA, protein electrophoresis with immunofixation, complement C3c and C4c, tuberculosis, and hepatitis B and C was negative. A punch biopsy was reported by a community pathologist to be consistent with leukocytoclastic vasculitis. Additional testing for HIV antigen/antibody and Lyme disease was negative. Vascular studies revealed no abnormalities. As her clinical presentation did not match a small vessel vasculitis, a provisional diagnosis of cutaneous polyarteritis nodosa (PAN) was made by a community rheumatologist in the setting of ulcerating retiform purpura consistent with a medium vessel process.\nTreatment with 50 mg oral prednisone daily, 0.6 mg colchicine twice daily, and daily wound care with Medihoney for suspected cutaneous PAN was ineffective. Her dose of prednisone was decreased to 40 mg. One week later, the patient reported \"a feeling of gravel\" on her legs. At this time, her legs contained many necrotic ulcers and nodules, requiring debridement under anesthesia at an outside institution. Cultures showed extended spectrum beta-lactamase (ESBL)-producing E. coli and she was started on intravenous (IV) vancomycin and fluconazole, with collagenase and xeroform wound care.\nIn early September, the patient was admitted to our institution for pain control and wound management, with her prior antibiotic regimen stopping 3 days prior. Estrogen based hormones were stopped at this time, and she was started on ertapenem 1 g IV and fluconazole 400 mg daily with wounds dressed in sulfamylon cream. Alternative diagnoses were discussed at this time due to lack of response to treatment of medium vessel vasculitis, including pyoderma gangrenosum. Repeat autoimmune and infectious testing was negative. A colonoscopy showed no evidence of inflammatory bowel disease. Magnetic resonance imaging (MRI) of her chest, abdomen, and pelvis was negative for vasculitis. The initial outside punch biopsy was reviewed, and the pathology findings were reclassified as thrombotic vasculopathy instead of vasculitis. Repeat punch biopsy revealed subcuticular necrosis with fibrin thrombi within blood vessels. No significant immunoglobulin (Ig) G, IgA, IgM, or C3 deposits were identified via direct immunofluorescence. Testing for coagulopathies was positive for prothrombin variant G20210A. The remainder of her thrombophilia evaluation, including testing for cold agglutinins, JAK2 with reflex, paroxysmal nocturnal hemoglobinuria, antithrombin III deficiency, factor V Leiden, platelet factor 4 antibodies, antiphospholipid labs, platelet count, and protein C and S levels were normal. The patient started taking warfarin due to concern of vasculopathy and was transitioned to apixaban once negative antiphospholipid antibodies were confirmed. Her antibiotic regimen was altered to 3 g IV ampicillin-sulbactam and 100 mg micafungin daily after a wound swab grew Klebsiella.\nIn October, a diagnosis of cutaneous PAN was no longer favored due to evidence of ulcers eroding further into adipose tissue despite patient's steroid treatment (Figure 2). The patient's steroid treatment was tapered. After being on prolonged antibiotic treatments, the patient developed diarrhea secondary to clostridium difficile infection. Oral vancomycin was added, and she underwent two surgical debridements to lessen the load of necrotic tissue. Her anticoagulant regimen was switched to a heparin drip prior to the first procedure. By the end of October, it was discovered the patient was resistant to heparin. At the end of this month, the patient was transferred to the intensive care unit for sedation due to uncontrollable pain.\nBy the beginning of November, the patient received her third debridement. The most likely cause of the patient's progressive necrotic ulcers at this time was thought to be a thrombotic vasculopathy. A review of the literature found a case series on subcutaneous thrombotic vasculopathy similar to the patient's presentation. The possibility of an autoimmune reaction following COVID vaccination was discussed by the hematology and immunology teams at this time. A larger incisional biopsy at the edge of a developing lesion on her flank was performed. She was started on therapeutic enoxaparin, 81 mg aspirin daily, dipyridamole 75 mg four times daily, and pentoxifylline 400 three times a day in addition to treatments with IV immunoglobulins. Despite appropriate 1 mg/kg twice daily dosing of enoxaparin, the patient's anti-factor X activity level was subtherapeutic requiring escalation to 1.5 mg/kg twice a day. In addition, the patient was given 1 g IV solumedrol and transitioned to prednisone. The biopsy results came back as diffuse small vessel thrombosis with rare small vessel calcification, suggesting a thrombotic vasculopathy (Figure 3). Despite the less conspicuous tissue calcification present in the patient's biopsy, calciphylaxis was considered as a diagnosis. The low risk of IV sodium thiosulfate was weighed with the potential benefits, and it was started twice weekly. Over the next 2 weeks, the patient experienced improvement in pain - however during this time she started oral ketamine and received a hydromorphone PCA.\nIn mid-November, the patient had a spontaneous retroperitoneal bleed resulting in discontinuation of therapeutic anticoagulation. By the end of November, pentoxifylline was restarted with prophylactic enoxaparin. Wounds continued to progress (Figure 4), most notably on patient's bilateral flanks. The decision was made to stop intravenous immunoglobulin and initiate plasmapheresis in attempt to reverse any unknown immune-mediated processes. Her bilateral legs were debrided again early December 2021 to decrease necrotic tissue burden. She is now on argatroban due to difficulty with enoxaparin dosing, has received 7 treatments of plasmapheresis, and is receiving IV sodium thiosulfate 25 g five times weekly. A recent tissue culture was positive for Stenotrophomonas maltophilia, Mucor, and Candida parapsilosis, and her antibiotic regimen consists of 100 mg minocycline twice daily, 1 g imipenem/cilastin intravenous every 8 h, 5 mg/kg IV amphotericin B every 24 h as tolerated, and oral 125 mg vancomycin four times daily.\nHer prognosis remained guarded, with differential diagnoses including idiopathic subcutaneous thrombotic vasculopathy, non-uremic calciphylaxis sin calcifications, or an autoimmune response to her COVID vaccination. She reported depression, and high levels of pain despite a rigorous pain control regimen. She chose not to see the lesions on her bilateral lowerextremities since November as she believed it would worsen her mental health. Although it was difficult at times to havehope, she and her family continued to search for answers and have aggressive treatment goals. She wanted to share her story with the medical field in hope other providers would be able to provide insight to help her, and future patients with similar afflictions. In early February, the patient was transitioned to comfort care and passed away surrounded by her family.",
"gender": "Female"
}
] |
PMC9051404
|
[
{
"age": 52,
"case_id": "PMC8634327_01",
"case_text": "A 52-year-old woman presented at the emergency room (ER) in a regional hospital with progressive dyspnea, a dry cough and fatigue during several weeks despite taking oral antibiotics because of a suspected pneumonia. Three days prior to presentation she had experienced a severe dull thoracic and epigastric pain accompanied by nausea and vomiting that had resolved spontaneously. Besides taking ferrofumarate and cholecalciferol for iron-deficiency anemia and vitamin D deficiency, she had no previous medical history.\nOn presentation, physical examination revealed a regular tachycardia of 116 beats per minute (bpm), a blood pressure of 120/75 mmHg, an oxygen saturation of 100% while breathing ambient air, and a core temperature of 38.0 C (100.4 F). Cardiac, pulmonary, and abdominal examinations were unremarkable. There were no signs of deep venous thrombosis and the Wells-score was 4.5. The electrocardiogram (ECG) showed sinus tachycardia, normal electrical heart axis and normal PR- and QRS-intervals, but inverted T-waves in both antero- and inferolateral leads (Figure 1). A low hemoglobin level (5 mmol/L), elevated c-reactive protein (102 mg/ml), troponin-I (1036 ng/L, cut-off is <20) and NT-pro-BNP (366 ng/L, normally <100) levels were the most prominent abnormal laboratory results.\nComputed tomography angiography of the thorax (CTA) ruled out pulmonary embolism, but demonstrated pericardial and pleural effusion. Subsequent transthoracic echocardiography (TTE) confirmed circumferential pericardial effusion of ~4.5 cm with signs of haemodynamic compromise (dilated and poor collapsing inferior caval vein, early systolic right atrial (RA) collapse and >25% respiratory variation in peak mitral E-wave). Urgent evacuation of ~1 L of hemorrhagic fluid after pericardiocentesis immediately ameliorated symptoms. Investigation of this pericardial fluid did not reveal a tuberculous, bacterial, viral, or malignant etiology. A respiratory viral panel by polymerase chain reaction (influenzas A and B and respiratory syncytial virus) and a serum HIV antibody test were negative. After recurrent pericardial effusion was ruled out 1 week later, she was discharged home. While unconfirmed, a discharge diagnosis of post-infectious/post-viral pneumonia related pericardial and pleural effusion was made.\nAlready 5 days later, she presented again with progressive dyspnea, coughing, and nausea. A further decrease in hemoglobin (4.7 mmol/L) was noted and TTE showed recurrent circumferential pericardial effusion (~3 cm) but now a dense structure suggesting thrombus in the pericardial sac (Figure 1). Coronary angiography (CAG) was performed after which coronary artery disease including dissection could be ruled out.\nShe was transferred to a tertiary university center and received a blood transfusion. Additional viral serology (adenovirus, coxsackievirus, echovirus, borrelia burgdorferi, cytomegalovirus, Epstein-Barr virus, and parvovirus), immunological testing (systemic lupus erythematosus, rheumatoid arthritis, vasculitis, complement screening, and M-protein), a tuberculosis test and blood culture analyses were normal. To re-assess the possibility of a malignant cause, a repeat CTA of the thorax and abdomen was performed. While macroscopic malignancies could be ruled out, the scan showed contrast extravasation into the pericardial space, suggesting active bleeding. After a multidisciplinary consultation between cardiologists and cardiothoracic surgeons, and given the observation that the patient remained hemodynamically stable, it was decided that urgent surgery was not yet indicated and that there was still sufficient time for additional diagnostic workup. On cine cardiac magnetic resonance imaging (CMR), left (LV) and right ventricular (RV) systolic function were preserved and pleural and pericardial effusion confirmed. During contraction, the LV apex remained remarkably \"fixed\" to the pericardium (Supplementary Video 1). On the delayed enhancement (DE) images, the high intra-pericardial signal again suggested contrast-extravasation into the pericardial sac, whereas an extensive, hypo-enhanced circumferential layer against the inner parietal pericardium suggested thrombus (Figure 1). No intramyocardial abnormalities were observed.\nIt was concluded that ongoing, albeit slow, intra-pericardial bleeding was present. Since other diagnostic clues were missing at this time, an initial post-viral and subsequent recurrent traumatic or reactive pericardial effusion after pericardiocentesis were still considered causative and urgent surgery was yet indicated.\nSince focal bleeding from a traumatic ventricular lesion after initial pericardiocentesis could not be excluded, it was decided to first perform a limited thoracotomy via a left-sided submammary incision. After evacuating 2.5 L hemorrhagic pericardial fluid with thrombi, careful inspection did not reveal a focal bleeding site. Because of persistent bleeding, the incision was extended further but again no focal bleeding source was discernable. Instead, multiple active venous hemorrhages on the entire epicardium were visible and hemostasis was attempted by placing multiple fibrin sealant patches Tachosil (Baxter healthcare cooperation, Illinois, USA). In addition, multiple biopsies of the pericardium and pericardial fluid and thrombi were sent for pathological examination.\nThe patient was subsequently transferred to the intensive care unit (ICU), but went into cardiogenic shock the following day. TTE showed recurrent pericardial effusion with a thrombus compressing the RA. A conventional emergency sternotomy was carried out. After thrombus removal, again diffuse hemorrhages were observed and a single bleeding focus in the RA was sutured.\nUnfortunately, within 3 days she had to be operated two more times to relief recurrent cardiac tamponade and a left-sided hemothorax. Repeatedly, extensive diffuse venous epicardial hemorrhages were found that were difficult to manage, causing her to remain hemodynamically unstable in the ICU. After 9 days, pathology of the pericardium revealed an epithelioid angiosarcoma. Given the disease extent and unfavorable prognosis, it was decided to refrain from additional aggressive therapy. She died the same day, 28 days after the initial presentation. A timeline is showcased in Figure 2.\nAfter obtaining consent from relatives, gross autopsy revealed a diffusely thickened residual pericardium with an irregular surface with multiple thrombi and hemorrhages. The pericardium was extensively adhered to ribs, myocardium, ascending aorta, and aortic arch. A nodular epicardial surface was found with diffuse hemorrhages and thrombi. The heart was only minimally enlarged (419 [normal 233-403] g). Microscopy showed an atypical vascular proliferation with focal papillary structures consisting of large epithelioid cells with high amounts of eosinophilic cytoplasm. The nuclei of these epithelioid cells were pleomorphic and hyperchromatic with numerous, sometimes atypical, mitoses. Because these epithelioid cells stained positive for the immunohistochemical vascular markers ERG, CD31 and CD34 but not for CD68, HHV-8 and keratin markers CK AE1/AE3, CK 5/6, and CK7, a diagnosis of epithelioid angiosarcoma was made. The angiosarcoma was predominantly localized in the pericardium and epicardium without deeply infiltrating the myocardium leading to epicarditis and pericarditis. A single longitudinal thickened lesion was found at the RA appendage that had been surgically sutured. Microscopic evaluation of this lesion revealed transmural invasion of the angiosarcoma (Figure 3).\nAdditionally, lympho-vascular invasion with intracapillary tumor cells in the lungs (hemangiosis carcinomatosa) and focal invasion from the pericardium into the left lung was found, explaining the hemothorax.",
"gender": "Female"
}
] |
PMC8634327
|
[
{
"age": 65,
"case_id": "PMC8383176_01",
"case_text": "The patient, a 65-year-old man, presented with swelling and pain in his right scrotum three months ago. He was first admitted to our hospital 5 years ago with a cough and fever. The CT scan of the abdomen showed multiple soft tissue densities behind the peritoneum and the serum IgG4 3200 mg/dL. The patient was definitively diagnosed with IgG4-RD as well as secondary retroperitoneal fibrosis by the gold standard of histopathology. He was in long-term remission after regular treatment with mycophenolate mofetil (1g Bid) and prednisone (0.6 mg/kg), followed by six months, four years, and a recent abdominal CT scan showed no progression of retroperitoneal fibrosis. He had no previous history of pulmonary or urinary tuberculosis and no significant family history. On examination, a mobile mass of approximately 2 cm in diameter was found in the right scrotum. The mass was hard and tender. No other positive signs were found. Laboratory tests showed erythrocyte sedimentation rate 69 mm/h (reference range 0-15 mm/h), C-reactive protein 29.9 mg/L (reference range 0-10 mg/L), complement C3 0.58 g/L (reference range 0.9-1.8 g/L), complement C4 0.03 g/L (reference range 0.1-0.4 g/L). Serological examination showed elevated IgG4 levels to 2070 mg/dL (reference range 6-130 mg/dL). Negative for prostate-specific antigen (PSA), tumor markers, and tuberculosis antibodies. Scrotal ultrasound demonstrating enlargement of the right testicle. Enhanced computed tomography of the scrotum showed a nodular hyperdense shadow with a diameter of approximately 23 mm on the right epididymis, with significant heterogeneous enhancement on the enhanced scan (Figure 1). After ruling out testicular tuberculosis and hydrocele due to retroperitoneal fibrosis secondary to IgG4-RD, given the potential risk of malignancy, he underwent a pathological biopsy by puncture of the right epididymis. Pathological biopsy of the right epididymis showed infiltration of plasma cells, lymphocytes, and a few neutrophils with occlusive vasculitis changes in the tissue (Figure 2A). IgG4+ plasma cells stained positive, with an IgG4/IgG ratio of more than 40% and more than 30 IgG4+ plasma cells per high-power field (Figure 2B). A diagnosis of IgG4-RD involving the testicles was made. Prednisone 30 mg/d was given for three weeks. No scrotum swelling or pain was observed at the follow-up after six months. The timeline of diagnosis, treatment, and prognosis for this case is shown in Figure 3.",
"gender": "Male"
}
] |
PMC8383176
|
[
{
"age": 66,
"case_id": "PMC6803719_01",
"case_text": "A 66-year-old male was diagnosed in 2014 with MCD (proteinuria 15 g/L/ albuminemia 19 g/L). He was initially treated with steroids, which gave a good response, but he became steroid-dependent (20 mg/d). When corticosteroid therapy was decreased (<20 mg/d), proteinuria increased to 13 g/L. He, thereafter, received four infusions of rituximab (1 gr each) over a 3-year period, with low steroid doses. The first 3 infusions of rituximab allowed a complete remission during, respectively, 3, 1, and 8 months: at the time of each relapse proteinuria was found to be at 4, 7, and 5 g/L, respectively. At the time of the fourth relapse he received an infusion of rituximab (the 4th one); this induced partial remission; however, one month later proteinuria reincreased to 6 g/L.\nIn September 2018, he had a fifth relapse (proteinuria 6 g/L/albuminemia 28 g/L). At that point, he received DFPP (one daily session for 4 consecutive days) followed by one infusion of rituximab (1 gr), and subsequently, remission (>10 months) (>6 months) with proteinuria at 0.09 g/L and albuminemia at 46 g/L. He was weaned-off steroids at the end of DFPP sessions. His renal function remained normal (i.e., estimated glomerular-filtration rate (eGFR) at 89 mL/min/1.73 m2 according to CKD-EPI formula).",
"gender": "Male"
},
{
"age": 44,
"case_id": "PMC6803719_02",
"case_text": "A 44-year-old woman was diagnosed with MCD when aged 13. She achieved remission with steroids. During her second pregnancy in 2016, she had a relapse of MCD (proteinuria 2.5 g/L/albuminemia 21 g/L) and was placed on steroid therapy without success. Therefore, from early 2017 to November 2018, she was successively treated with MMF, rituximab, and tacrolimus without success. A second kidney biopsy confirmed MCD.\nIn November 2018, proteinuria was 6 g/L and albuminemia 19 g/L under tacrolimus. She was started on IA therapy, i.e., one daily session for 4 days, which induced remission (proteinuria 0.26 g/L albuminemia 23 g/L). After one week without IA, proteinuria reappeared (proteinuria 5 g/L, and albuminemia 25 g/L); thus, IA therapy was resumed (i.e., one session/day 4 days, then two sessions per week for two weeks). This resulted in partial remission (proteinuria 1.6 g/L albuminemia 40 g/L). However, she refused to continue IA therapy, corticoids, and tacrolimus. Currently, proteinuria fluctuates between 2 and 5 g/L, and albuminemia is between 20 and 25 g/L. Renal function is normal (i.e., eGFR is 106 mL/min/1.73 m2).",
"gender": "Female"
},
{
"age": 39,
"case_id": "PMC6803719_03",
"case_text": "A 39-year-old male was diagnosed in October 2017 with MCD; proteinuria was 8.8 g/L and albuminemia was 25 g/L. Partial remission was achieved with steroids. Tacrolimus was then added, but was stopped after 3 months because of no improvement in proteinuria (proteinuria 12 g/L albuminemia 13 g/L). In June 2018, apheresis was started, alternating DFPP (up to 18) and IA (up to 36 sessions). In addition, he received an infusion of rituximab (1 gr) every 3 months, and MMF was added. We were unable to stop apheresis because of a relapse within 8-10 days. At present, he receives one apheresis session/week and is no longer taking immunosuppressive therapy; proteinuria fluctuates between 3 and 10 g/L, and albuminemia between 25 and 35 g/L. His eGFR is 79 mL/min/1.73m2.\nTo summarize, these three cases of immunosuppressive-resistant INS that received apheresis allowed (i) full remission in one case (with steroid withdrawal), (ii) partial remission in one case with apheresis dependency (one session/week); and (iii) partial remission with IA dependency in the third case, but the patient refused long-term therapy.",
"gender": "Male"
}
] |
PMC6803719
|
[
{
"age": null,
"case_id": "PMC3417985_01",
"case_text": "A 24-hour-old female baby, product of spontaneous vaginal delivery, at term, in a village, weighing 2kg presented to emergency room with evisceration of intestine from abdomen. The patient was hypothermic and cyanosed. On examination baby had temperature of 96F, respiratory rate 45/min and pulse 80/min. Patient was placed under infant warmer and oxygen inhalation given via mask. Warm IV fluids infused and antibiotics started. After stabilization, the patient was shifted to the operation theatre.\nThe abdominal defect was about 7cm in diameter and on right side of the umbilical cord. It was extending down to the perineum. The entire GIT was eviscerated along with liver, gallbladder and urinary bladder. Spleen, ovaries and uterus were lying inside the abdominal cavity. The intestine, gallbladder and urinary bladder were matted together and a thick peel covered them in toto. Anus was absent. There was a labial prominence on right side of the defect in perineum while on left side an abnormal vestibule harbouring two openings, found. From one opening meconium was coming and from other urine passed out. There was another labial prominence lateral to the vestibule. There was no bladder or cloacal exstrophy (Fig. 1).",
"gender": "Female"
},
{
"age": null,
"case_id": "PMC3417985_02",
"case_text": "It was not possible to close the defect primarily because of very limited abdominal capacity, much increased size of abdominal viscera and unusual defect. We tried spring loaded silastic silo, but it was not technically compatible with the size and shape of the defect, a sterilized blood bag was then used as silo. Post operative course remained stormy. Later baby developed septic shock and died.",
"gender": "Unknown"
}
] |
PMC3417985
|
[
{
"age": 45,
"case_id": "PMC8051224_01",
"case_text": "A 45-year-old male presented two days after an accident of the public way with acute severe chest pain lasting for more than 30 minutes at rest. A pulmonary embolism has been eliminated. He had no history of diabetes mellitus or smoking. However, he is followed for polyarteritis nodosa since 2012 and has as antecedents a cerebral vascular accident (CVA) in 2017. He had no family history of any heart disease. He denied having had any febrile disease or weight loss within the previous several months. Physical examination revealed a hemiparesis of the right hemicorps as a sequela of his CVA, no neuromuscular weakness or skin abnormalities. His vital signs were normal. His cardiovascular exam was unremarkable with a regular rhythm, normal heart sounds, and no murmurs. The chest was clear on auscultation and limbs were warm without any edema. An electrocardiogram on admission revealed a sinus rhythm and sequelae of necrosis in the territories inferolaterobasal. Serum cardiac enzyme levels showed a rise in troponin-T to 30299ng/L. Transthoracic echocardiography revealed severe hypokinesia in the anterior, anterolateral, inferolateral and inferior segments of the left ventricle (LV).\nUnder the impression that the patient had had an AMI, he was initially treated with standard medical therapy, including acetylsalicylic acid 100 mg/d, clopidogrel 75 mg/d, bisoprolol 2.5 mg/d, ramipril 2.5 mg/d, and intravenous heparin. Coronary angiography revealed huge multiple aneurysmal changes and stenotic lesion involving the left main and all three major coronary arteries (Figure 1). The left circumflex (LCx) artery was totally occluded (Figure 2). Two stenosis were found on the left anterior descending (LAD) artery and we found a stenosis on the right coronary artery (RCA) (Figure 3). The patient was treated with high-dose steroids (prednisolone 60 mg/d) and an immunosuppressive agent (cyclophosphamide 100 mg/d) in addition to the aforementioned standard cardiac treatments and we decided to treat the two axes RCA and LAD. First, a drug-eluted stent was deployed to the mid segment in the right coronary artery, then two drug-eluted stents were deployed to the two consecutive lesions at the proximal and mid segments in the left anterior descending artery. No complications were encountered during the procedure and TIMI 3 flow was achieved in the two axes. The patient was followed up in the coronary care unit. Thereafter, he presented sudden cardiac arrest probably related with acute stent thrombosis.",
"gender": "Male"
}
] |
PMC8051224
|
[
{
"age": 62,
"case_id": "PMC4900045_01",
"case_text": "A 62-year-old black female presented with the complaint of a nonpainful palpable abnormality in her right breast. The patient's history was significant for a bilateral reduction mammoplasty two years prior and a hysterectomy 18 years prior. She also had a history of Cushings syndrome, metabolic syndrome, and smoking. She was currently on hormone-replacement therapy. A mammogram and right breast ultrasound were ordered in order to evaluate the abnormality.\nThe mammogram confirmed the presence of a 1.5-x-1.7-cm, well-circumscribed lesion of homogeneous density in the lower outer quadrant of the right breast (Fig. 1). Additionally, there was architectural distortion, possibly due to the reduction mammoplasty inferior to the mass.\nNext, a targeted ultrasound of the right breast showed the mass to be 1.5 cm, heterogeneously echoic, and well-defined in the 7:00 location (Fig. 2). In addition, at the 6:00 region, a smaller anechoic nodule was found abutting the chest wall (Fig. 3). This second mass measured 1.1 x 0.5 cm. Within the 7:00 mass, there were concentric hypoechoic and hyperechoic rings (Fig. 2). Neither lesion demonstrated hypervascularity on Doppler ultrasound. The lesions were considered suggestive of malignancy. Biopsy and a breast MRI were recommended for further evaluation.\nBreast MRI included gadolinium-enhanced T1 axial images and T2 fat-suppressed images. In the lower outer quadrant of the right breast, there was a thick-walled hypoenhancing nodule that corresponded to the palpable mass (Figure 4, Figure 5). As seen in Fig. 3, the mass had a hypoenhancing rim and an inner, thick, higher-signal ring, followed by another inner low-signal ring surrounding a central area of higher signal. The mass was located deep within the breast parenchyma, without obvious attachment to the dermis. The mass was rated BI-RADS IV, and a biopsy was recommended.\nUltrasound-guided biopsy was performed on the lower outer quadrant mass, and five core samples were obtained using a 14-gauge Viacore core-biopsy needle. The biopsy samples consisted of yellow-tan fragments of tissue and were determined to be fragments of an epidermoid cyst. Histopathologic analysis revealed fragments of epidermoid cyst.",
"gender": "Female"
}
] |
PMC4900045
|
[
{
"age": 33,
"case_id": "PMC9084904_01",
"case_text": "A 33-year-old man with Cowden's syndrome and a 10-year history of numerous (>50) small (1-to-5 mm diameter), firm, flesh-colored papules on his lower lip mucosa presented for evaluation and treatment considerations (Figure 1). The papules were previously biopsied with histopathologic confirmation of benign hamartomas. Medical history included a diagnosis of testicular cancer, which had been eradicated by orchidectomy 12 years prior to presentation. Previous treatment of the hamartomas with topical sirolimus provided no significant cosmetic improvement and the patient refused further topical treatment due to its associated inconvenience and skin irritation. Because the papillomatous papules on the lower lip and adjacent mucosa continued to increase in size and number with worsening friability and easy bleeding, the patient was inclined to seek in-office treatment.\nAfter written informed consent was obtained, treatment sites were anesthetized with topical and intralesional lidocaine. The lower lip papules were vaporized using multiple consecutive passes of a fractionated CO2 laser (Fraxel: repair; Solta Medical, Pleasanton, CA) with a 2-mm spot size at 225 mJ energy and 10 W of power. Intraoperative side effects consisted of lesional friability, difficulty with hemostasis, edema, and erythema. Dilute acetic acid and ice water compresses were applied to the ablated skin immediately post-treatment for 15 minutes and repeated 4 times daily. The wounds were kept well lubricated with a compounded mix of mupirocin and Aquaphor ointments which was applied after each application of the dilute acetic acid compresses until re-epithelization was complete (7 days). Topical sirolimus was not provided after treatment due to its previous untoward side effects and the patient's vehement refusal to resume its use. Marked lesional reduction and improved lip contour with the absence of tissue friability was evident and maintained at 6 weeks post-treatment (Figure 2). No lesional recurrence was reported 6 months hence.",
"gender": "Male"
}
] |
PMC9084904
|
[
{
"age": 37,
"case_id": "PMC9249508_01",
"case_text": "A 37-year-old female was referred to otolaryngology by her primary care provider for chief complaint of right ear pain of two-year duration which reportedly began after a dog bite to the right lip and face. She had also experienced numbness in the right face from the lateral canthus to the jawline since the dog bite and reported that she had felt a mass in the right preauricular area for approximately five months. Six weeks prior to ENT consultation, she reported an episode of Bell's palsy, now with subjective incomplete recovery and residual facial asymmetry.\nPhysical exam revealed tenderness and fullness in the right preauricular region, but no definite mass, and weakness of the frontal and zygomatic/buccal branches of the right facial nerve, complete right eye closure, and near-normal symmetry at smile and cheek-blowing. Imaging was ordered at that time, but the patient did not follow up. Less than three weeks later, the patient complained of another episode of Bell's palsy, with an inability to close her right eye, followed by worsening symptoms including dry eye and blurry vision, right occipital headache, worsening right ear and facial pain, and increase in size of the preauricular fullness. Imaging was performed.\nCT with contrast revealed a focus of increased soft tissue density in the right parotid gland just lateral to the mandibular subcondylar region measuring 1.3 cm (Figure 1(a)). MRI showed an inflamed parotid gland with an area of enhancement possibly representing a mass. Inflammation and enlargement of the facial nerve was also noted (Figure 1(b)). Ultrasound showed an ill-defined hypoechoic nodule near the angle of the mandible/preauricular area (Figure 1(c)).\nAn ultrasound-guided fine needle aspiration of the right parotid gland was attempted, but the patient could not tolerate the procedure and there was insufficient material for diagnosis. Subsequent biopsy showed atypical cells embedded in a mostly myxoid background, highly suggestive of EHE (Figure 2(a)). However, this specimen was also very scant, and tissue was exhausted before a definitive diagnosis could be made.\nWithout a clear diagnosis, the patient underwent a right total parotidectomy and selective neck dissection. In the interval before surgery, she developed first bite syndrome and near complete paralysis of the superior division of the facial nerve. Intraoperatively, the superior division of the facial nerve grossly had been infiltrated with tumor and was sacrificed. The inferior division of the facial nerve was preserved. Due to technical constraints surrounding facial nerve preservation, the specimen was received as multiple unoriented fragments of tan-pink lobulated tissue. The largest fragment contained a 1.2 x 1.0 x 1.0 cm tan-white firm mass, free of the surgical resection margins.\nHistologic sections demonstrated atypical single cells and occasional small clusters of cells in a fibromyxoid stroma. Some areas exhibited spindled features and foci of more marked cytologic atypia were also identified. Mitotic rate was less than 1/10 high-power fields. Multiple foci of perineural invasion were identified; however, lymphovascular invasion and tumor necrosis were not seen (Figures 2(b)-2(d)). Immunohistochemistry showed the tumor cells were positive for vascular markers ERG, CD31, and CD34 (Figures 3(a)-3(b)). Cytokeratin AE1/AE3 was negative.\nFluorescence in situ hybridization (FISH) of the tumor revealed a t(1;3)(p36;q25) involving the CAMTA1 and WWTR1 genes, confirming a diagnosis of epithelioid hemangioendothelioma. All 16 lymph nodes from the selective neck dissection were negative for tumor. No additional therapy was given. Follow-up PET imaging up to one year postsurgery demonstrated good response to surgical treatment in the right parotid bed with no evidence of residual/recurrent or metastatic tumor.",
"gender": "Female"
}
] |
PMC9249508
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.