id
int32 0
398k
| text
stringlengths 204
42k
| educational_score
float32 1
5
| domain
class label 3
classes | document_type
class label 4
classes |
|---|---|---|---|---|
22,437 |
As such, teachers who continued to beat often described the ‘value’ of beating so long as it was ‘deserved’ and done in a controlled manner. In general, staff protagonists and those who were engaged in the intervention were less supportive of beating although some continued to beat occasionally.
| 1 | 2other
| 1Other
|
57,315 |
Diameters of the coronary artery cross-sectional areas in their proximal sections with their ellipticity index (height-to-width ratio; Fig. 7); in cases of the Cx branching from the RCA and the absence of the left coronary artery (LCA), left anterior descending coronary artery (LAD) diameters were used for this analysis instead;Fig. 7Box-plot graph presenting the difference between the ellipticity index (height-to-width ratio) in the proximal part of the left and right coronary arteries
| 3 | 0biomedical
| 0Study
|
257,602 |
Data from our participants suggest that self-management is a relatively new concept in the Ethiopian health care environment. It is a complex term to translate into Amharic, and its definition may result in overlapping concepts with self-care and self-treatment.
| 2 | 0biomedical
| 0Study
|
8,174 |
The inhibition of NMDAR activation by Aβ restores the facilitatory effect of BDNF upon 𝜃-burst-induced LTP. (A,C,E) Panels in the left side show the averaged time courses changes in field excitatory post-synaptic potential (fEPSP) slope induced by a 𝜃-burst stimulation in the absence or in the presence of BDNF (20 ng/mL) in the second stimulation pathway in rat hippocampal slices without (A, n = 4) or with a pre-exposure for 3 h to aCSF solution containing 25 μM Aβ25–35 (C, n = 3) and 25 μM Aβ25–35 in the presence of 1 μM Mem (E, n = 7). Tracings from representative experiments are shown to the right of panels A,C,E; each tracing is the average of six consecutive responses obtained before (1 and 3) and 46–60 min after (2 and 4) LTP induction. Tracings are composed by the stimulus artifact, followed by the pre-synaptic volley and the fEPSP. Tracings 1 and 2 and tracings 3 and 4 were obtained in the absence and presence of BDNF, respectively. (B,D,F) Histograms depicting LTP magnitude (change in fEPSP slope at 46–60 min) induced by 𝜃-burst stimulation in the presence and absence of BDNF for each group of pretreated slices (control, Aβ25–35, Aβ25–35+Mem). (∗p < 0.05, n = 3–7, paired t-test) Values are mean ± SEM.
| 4 | 0biomedical
| 0Study
|
67,957 |
The system of equations (eq. 18) is nonlinear and too complex to solve analytically. We therefore analyze it numerically, starting from a system made entirely of free nucleotides, amino acids, as well as charged p-tRNA, and letting the system evolve until it settles into a steady configuration.
| 3 | 0biomedical
| 0Study
|
125,336 |
In vivo, C. parvum stages (i.e., sporozoites, trophozoites, merozoites, and gametocytes) reside in a very specialized niche through their epicellular intracellular but extracytoplasmic location, thereby being separated only by a thin membrane from the intestinal contents. There are many commensal and pathogenic microorganisms in the gut that make it a unique ecosystem with its own physiological oxygen pressure atmosphere known as “physioxia/normoxia,” and which is one of the largest human organ surfaces . With numerous studies proving the value of physioxic circumstances in the NETs production , the metabolism of gut epithelium , as well as on the metabolic signatures of C. parvum-infected primary bovine small intestinal epithelial cells (BSIEC) and ex vivo explants of bovine small intestine (BSI), the concern of intrinsic pathological environment has achieved significant importance in recent years . Therefore, we investigated the metabolic signature of C. parvum-induced NETosis under both oxygen conditions (physioxia-5% O2 and hyperoxia-21% O2). PMN in humans and cattle have a variety of fast-acting effector mechanisms including respiratory burst, phagocytosis, NETosis and degranulation, all of which are fueled by high energy and metabolic demands to function properly . Only three studies (to our knowledge) have been published on the metabolic demand of PMN during parasite-induced NETosis dealing with N. caninum- , B. besnoiti- and T. b. brucei . Consequently, N. caninum- and T. b. brucei-induced NETosis was reported to depend on purinergic receptor-mediated ATP binding , whilst a dependency on MCT1/2-, P2X1- and glycolysis was stated for B. besnoiti-triggered NETs formation . In this investigation, we sought to better understand the role of particular metabolic pathways in parasite-induced suicidal NETosis in intestinal physioxia by mimicking real circumstances in the small intestine . Current data reveals that parasite exposure did not boost glycolytic responses in bovine PMN; however, glycolysis inhibitor treatments (2-DG) did not reduce C. parvum-mediated NETs formation. Similar findings were stated for B. besnoiti tachyzoites, where FDG treatments reduced NETosis . Of note, increased glycolytic activity is generally linked to enhanced lactate production and release. MCTs are responsible for the transfer of lactate throughout cell membranes, including those of PMN. The MCT family consists of 14 members, with MCT1-4 serving as the primary transporters for lactate absorption and outflow in both humans and animals . However, inhibition of MCT1 and MCT2 via chemical blockers (ARC-15858 and ARC-141990) had no statistically significant impact on NETosis triggered by C. parvum. MCT1 is often involved in the import of lactate in oxidative cells, while MCT4 is more involved in the export of lactate obtained from aerobic glycolysis. As a result, according to Alarcón et al., additional transporters other than MCT1/2 may be implicated in parasite-driven NETosis as well . Nevertheless, by tendency, a reduction of NET formation was apparent after MCT1/2-inhibitor treatments, thereby indicating that lactate efflux may indeed be of importance in order to prevent adverse cytosol acidification due to enhanced glycolytic activities after C. parvum stimulation. Interestingly, acidosis due to enhanced lactic acid production was already reported in neonatal calves suffering from acute cryptosporidiosis . These data may indirectly support enhanced glycolytic responses not only in circulating PMN but also in recruited PMN into C. parvum-infected gut mucosa.
| 4 | 0biomedical
| 0Study
|
380,474 |
In this work, we considered seven different software defect datasets named AR1, AR3, CM1, JM1, KC2, KC3, and MC1. Using these datasets, we apply a software defect prediction system where the performance of all employed ML techniques is compared with each other based on correctly and incorrectly classified instances, true-positive and false-positive rates, MAE, RAE, RMSE, RRSE, recall, and accuracy. Table 5 presents the benchmark analysis of correctly classified instances (CCI), while Table 6 presents the benchmark analysis of incorrectly classified instances (ICI) using ML techniques. In both tables, the first column represents techniques employed, while the rest of the columns show details of each dataset concerning CCI and ICI. Figure 5 shows the inclusive performance CCI and ICI evaluation of each employed ML technique.
| 1 | 2other
| 0Study
|
241,910 |
The sNFL levels were 31.1 (24.4–60.9) pg/ml in 21 NMOSD patients who had not received the therapies after their attacks. We assessed the association between sNfL levels and disease severity and indicators of prognosis of NMOSD. As a result, sNfL levels in NMOSD patients in the acute phase were positively correlated with EDSS scores at attack (R2 = 0.487, p<0.001, Figure 5). This means that NMOSD patients with more severe attacks are prone to have higher levels of sNfL at the onset stage. However, there was no difference in sNfL levels between the groups divided by therapeutic responses at discharge or at the 1-month follow-up or recurrence or not during the next 6 months of follow-up.
| 4 | 0biomedical
| 0Study
|
234,056 |
The SVS WIfI classification system is the topic of ongoing debate when the subject is improving treatment for patients with TLL. The majority of validation studies of this classification demonstrate that it is associated with factors linked to limb salvage, such as rates of minor and major amputations, AFS, prediction of RAS events, and wound healing. Concerted efforts are still needed to optimize treatment for patients with TLL, improving the ways that they are analyzed and stratified and, as a consequence, managed clinically.
| 4 | 0biomedical
| 2Review
|
194,636 |
The most popular experimental assay to detect TF-DNA interactions in vivo is chromatin immunoprecipitation followed by sequencing (ChIP-seq) . After mapping the reads generated by ChIP-seq to the genome of interest, the computational analysis aims at identifying genomic regions enriched for mapped reads when compared to a control. The identified genomic locations are known as ChIP-seq peaks. TF ChIP-seq peaks usually span a few hundred base pairs. They derive from direct and indirect TF-DNA interactions , where the latter can emerge from protein-protein interactions between the ChIP’ed TF and another protein binding the DNA. Moreover, ChIP-seq peaks could also derive from non-specific binding of the TF to the DNA and noise/bias/artifacts. Several repositories store ChIP-seq peaks [5–9] and are freely available to the community. Nevertheless, these resources do not provide precise locations of the underlying direct TF-DNA interactions.
| 4 | 0biomedical
| 0Study
|
67,488 |
The images used to measure attentional bias were taken from the Japanese Female Facial Expression Database and had been rated as expressive of anger, sadness, or neutrality, with predetermined emotional valence [18, 32]. The correlation between these expressions and emotional valence has been demonstrated in a previous study . Eight combinations of “threatening” expressions with high emotional valence and “neutral” expressions with low emotional valence were presented. The images were presented simultaneously, one above the other, at 1,600 (vertical) × 900 pixels (horizontal).
| 4 | 0biomedical
| 0Study
|
265,482 |
For q2(t), the ALPR shows a lower performance compared to q1(t). Several significant deviations from the ground-truth data can be observed throughout the investigated period. The matching rate of C2 shows an average rate of 59%. Nevertheless, it is observed that the matching rate around 17:30 is below 10%. The error metrics show a performance of ρ=0.61, and MAPE=12.64%. Figure 6 depicts the results for all data sources of q3(t) and q4(t), respectively.
| 1 | 2other
| 1Other
|
356,306 |
Figure 1 shows the significant (P < 0.05) log2 fold differences between the positive and the negative groups. For all significant BLV miRNAs, the positive group had greater number of sequences than the negative group. Blv-miR-B5-3p was not significant in serum or in WBC. In serum, blv-miR-B2-3p, blv-miR-B2-5p, blv-miR-B4-3p, and blv-miR-B5-5p, were significant and had an expression difference between the positive and the negative groups ranging from 7 to 8 log2 fold. In WBC, blv-miR-B2-3p and blv-miR-B2-5p had a 27 and 29 log2 fold difference between the two groups, respectively. The other significant BLV miRNAs in WBC had a difference in expression ranging from 7 to 8 log2 fold, which is similar to those observed in serum.
| 4 | 0biomedical
| 0Study
|
133,666 |
Two subscales of the Brief Symptom Inventory (BSI) scale (Derogatis and Melisaratos, 1983; Derogatis and Savitz, 1999) were employed in this study: depression (five items) and anxiety (three items). Because of ethical reasons, the item regarding suicidal thoughts was removed from the scale. The respondents reported the extent to which they are currently suffering from any of the problems presented on the scale. The response scale ranged from 1 = not at all to 5 = to a very large extent, and the internal reliability of this study was high: depression α = 0.86 and anxiety α = 0.71. Adawi et al. (2019) have significantly validated these scales against the level of nomophobia in a sample of healthy Italian volunteers.
| 4 | 0biomedical
| 0Study
|
363,878 |
Only two other studies reported survival times for dogs with CPSS treated non-surgically only. Watson and Herrtage (1998) described the follow-up in 23 dogs, of which 14 had been euthanized with a median survival time of 6 months. Nine dogs were still alive at the end of that study resulting in a median period of 51 months (range 36–96 months) [4.3 years (range 3–8 years)] between diagnosis and end of the study (Watson and Herrtage 1998). Greenhalgh et al. (2014) found an EMST of 27.4 months (2.3 years) for 24 dogs that died or had been euthanized during the study period and the three remaining dogs were lost at 5.5–96.7 months (0.5–8.1 years) of follow-up. These authors did not find a significant difference of EMST between EHPSS and IHPSS either. Both studies (Watson and Herrtage 1998; Greenhalgh et al. 2014) had a smaller study population and no overall EMST was reported. The median survival time of the deceased dogs reported here (13 months) is within the range of survival times in the two studies.
| 4 | 0biomedical
| 0Study
|
315,121 |
The most typical bacterial phospholipids include phosphatidylethanolamine (PE), phosphatidylglycerol (PG), and cardiolipin (CL). Zwitterionic PE is found in many groups of Gram-negative bacteria (e.g., Enterobacteriaceae) and in several Gram-positive bacteria, while anionic PG and CL are common in Gram-positive bacteria such as enterococci, streptococci, and staphylococci .
| 4 | 0biomedical
| 1Other
|
104,368 |
Analysis of septin 7 and CR levels in different cell lines of mesothelial origin and after experimental manipulations. a Relative expression levels of CR and septin 7 in various cell lines of mesothelial origin. b Semi-quantification of CR and septin 7: brown dots represent immortalized mesothelial cells, red dots epithelioid MM, orange dots bi-phasic and yellow dots sarcomatoid MM cell lines. c Effect of Bt administration on CR and septin 7 levels in MSTO-211H (C1) and ZL5 cells (C2). d Extracts of MSTO-211H cells infected with LV-septin7 or LV-GFP; note the decrease in CR in cells overexpressing septin 7. e MSTO-211H cells treated with Bt (+) or not (−) and subjected to down-regulation of septin 7 by shSEPT7; shGFP served as a negative control. f Up-regulation of CR by LV-CALB2 in SPC212 and HT-29 cells; note the decrease in septin 7 levels. The complete Ponceau-stained membranes corresponding to the Western blots shown in a and d are shown in Additional file 1: Figure S3
| 4 | 0biomedical
| 0Study
|
375,573 |
Knapp went on to outline that the discussion would be limited to the two major proposals: the proposal to change the whole of Div. III, and the proposal to change issues in the governance of nomenclature of fungi. The purpose of the discussion would be to ask questions, make comments and try to understand what the changes might mean, as many people may not have read them in their entirety. This would not be the time to make amendments or vote on the proposals.
| 1 | 2other
| 1Other
|
359,245 |
The influence of the tested compounds on the proliferation of RPMI 8226 and A549 cells was estimated with the MTT assay as described previously . Briefly, 1 × 104 cells/mL (RPMI 8226) or 0.2 × 104 (A549) cells per well were seeded into 96-well plates and cultured (in growth medium containing 10% FBS) with different concentrations of each compound ranging from 3.125 to 100 μM. The control cells were treated with the vehicle DMSO (0.1%). After 96 h exposure, the cells were incubated for 3 h with an MTT solution (5 mg/mL, Sigma-Aldrich) and then formazan crystals were solubilized overnight by adding SDS buffer (10% SDS in 0.01 N HCl). Absorbance was determined at a wavelength of 570 nm using an EL800 Microplate Reader (BioTek Instruments, Winooski, VT, USA). The absorbance of the control wells was taken as 100% and the results were expressed as a percentage of the control. IC50 values, defined as concentrations of the drugs necessary to inhibit 50% of growth compared to untreated control cells, were calculated from nonlinear regression (log(inhibitor) vs. normalized response-variable slope) using GraphPad Prism 5.0.
| 4 | 0biomedical
| 0Study
|
265,786 |
We found that CPAP therapy improved RV systolic function by significantly increasing TAPSE, a well-established marker of RV function . Although the trans-tricuspid gradient did not show improvement at follow up, it was slightly reduced when compared to baseline values in the CPAP group. There are several studies which confirm these findings .Karamanzanis et colleagues showed partially similar results, the differences between the findings consisting of the effect of CPAP on RV diameter and LVEF, parameters which did not improve through our follow up period. In an observational study , the group showed that 6 months of CPAP therapy improved pulmonary hypertension in OSA patients, these results being in accordance with other studies . Furthermore, increased pulmonary vascular reactivity to hypoxia was reversed by CPAP in patients with OSA and concomitant pulmonary hypertension . On the other hand, many of these studies lacked invasive hemodynamic assessment, so patients included did not necessarily have significant pulmonary hypertension at study entry .
| 4 | 0biomedical
| 0Study
|
303,613 |
The probability of attack for capitula growing on different plant sizes was examined by regressing the proportion of capitula with E. villosus larvae against the number of capitula per plant, a measure of plant size. None of the relationships were statistically significant (Nevada 1993: y = 0.034(x) + 35.12, r2 = 0.006, F1,31 = 0.174, p = 0.680; Nevada 1994: y = 0.264(x) + 31.17, r2 = 0.003, F1,10 = 0.035, p = 0.856; Napa 1994: y = 1.657(x) + 40.55, r2 = 0.266, F1,9 = 3.256, p = 0.105; Napa 1995: y = 0.298(x) + 40.99, r2 = 0.015, F1,10 = 0.151, p = 0.705), suggesting that the risk of attack for capitula was similar for large and small plants.
| 4 | 0biomedical
| 0Study
|
196,080 |
Student perceptions of how MLMS affected clinical empathy skills did not significantly differ between the first- and third-year student programs, despite differences in student orientation training modality (in person vs. videoconference), patient recruitment methods (recruited from community vs. inpatient setting), and patient interview method (phone or online video conference technology vs. in person). The total implementation process took less than a year, including securing support of curricular leaders, integrating the stories into the largest training sites’ EHRs, and evaluating the project. AMS funded one clinical year medical student to coordinate and initiate the program but had few other resource requirements, especially once the program was initiated. MLMS is a practical and adaptable medical education module that can be implemented within preclinical coursework, core clerkships, and elective courses.
| 4 | 0biomedical
| 0Study
|
145,765 |
Diffusion-weighted images were obtained prior to contrast enhancement to avoid interference by the contrast material. Diffusion analysis was performed by visual assessment of the lesion using different b values. According to the previous studies, the cutoff value for ADC between benign and malignant lesions was established at 1.09 × 10−3 mm2/s .
| 4 | 0biomedical
| 0Study
|
300,046 |
In the central nervous system (CNS), neurons are classified based on the neurotransmitters they express. While Dale’s principle originally stated that one neuron utilises one neurotransmitter, we now know that a cell can express multiple different molecules to communicate . However, even today, it is still regarded such that neurons have one main “classical” neurotransmitter type (e.g., excitatory glutamate (Glu) or inhibitory gamma aminobutyric acid (GABA)) and express numerous other secondary ones, mainly peptides. As these “classical” neurotransmitters are small molecules, they are often intermediates of the metabolism and thus detectable in all cells. Therefore, neuron classification is based mainly on the transporter proteins that pack the neurotransmitters into vesicles, from which the molecules are later released into the synaptic cleft . One of the most abundant types of neurons in the CNS is the glutamatergic cells, which exert excitation in most cases via the release of Glu. Two distinct protein families transport Glu through membranes: the excitatory amino acid transporters (EAATs) and the vesicular glutamate transporters (VGLUTs). EAATs, being responsible for the termination of the synaptic signal, can be found in the plasma membrane of pre- and postsynaptic neurons, as well as in glial cells, and thus cannot be used to characterise glutamatergic neurons .
| 4 | 0biomedical
| 0Study
|
76,805 |
Thus, the use of microfabrication in drug delivery applications has brought about advantages on several levels thanks to properties such as electrical sensitivity and controlled size, as well as the potential for high reproducibility of the delivery system . For instance, implantable anode-cathode microchip reservoirs allow for controlled and triggered release . Microelectronics can be incorporated in a pill-like sensor-reservoir device that could be administrated orally. Local delivery, preventing systemic adverse effects, is made possible through implantable devices, such as stents with embodied microneedles . Microparticle carriers with added ligands achieve targeted delivery , as well as protection of the drug from harsh body environment conditions. These are merely a few examples of the technological enhancements that originate from the interaction of microfabrication and drug delivery.
| 4 | 0biomedical
| 2Review
|
79,578 |
where δij, a Kronecker delta variable, is equal to 1 when i = j, and 0 when i≠j. Note that the E- and M-steps are combined into one formula in equation (1). Thus, given the initial gametic frequency pij (i, j = 0, 1, 2), the gametic frequency at the next step p′uv can be calculated using equation (1). Then, replace pij in equation (1) with p′uv and recalculate p′uv at the next step. This iterative calculation is repeated until the convergence of gametic frequencies is attained.
| 3 | 0biomedical
| 0Study
|
86,984 |
BCG artifacts are caused by cardiac-related activities which distort the EEG signals in the static magnetic field. Its causes and characteristics are described in literature (Allen et al., 1998; Bonmassar et al., 2002). In general, the electrodes' movement is caused by heart beat-related activities (Allen et al., 1998) and the magnitude of the BCG artifacts may be as much as 400 μV in 3.0T (6–8 times that of EEG) (Allen et al., 2000). Moreover, considerable variation of BCG artifacts' shape, amplitude, and scale over time was another characteristic observed.
| 4 | 0biomedical
| 0Study
|
140,288 |
While it might theoretically be possible to quantify the probabilities of long-term harm effects, via correlation and conditional factors, the necessary level of data collection simply does not exist to sustain such an analysis. Hence, from the industrial perspective, it is important to be able to use the limited information available to produce some type of defendable analysis that can improve the situation for the benefit of workers.
| 2 | 0biomedical
| 1Other
|
344,690 |
The fermentations were carried out in a controlled glass bioreactor system with a working volume of 3 L (Bioengineering, Switzerland). The reactor was stirred at 300 rpm by a bottom‐driven stirrer. The feeding was started 8 h after inoculation at a rate of 3 g L–1 h–1 of glycerol and after 20 h reduced to 1 g L–1 h–1 overnight. The electricity aided‐fermentations were conducted with the help of a recently developed “All‐In‐One” electrode . The electrode was controlled chronopotentiometrically by an Interface 1000 potentiostat (Gamry, USA). The current supply was started together with feeding after 8 h of cultivation and kept at a constant level of –400 mA. Cell voltage was recorded. Gas volume fractions of hydrogen and carbon dioxide were measured by off‐gas analyzers from BlueSens (Germany). The gas volume off‐gas stream was measured by Milligascounters (Dr. Ing. Ritter Apparatebau, Germany). The cultivation system was equipped with redox and pH probes from Mettler‐Toledo (US). Before all fermentations, the probes were calibrated according to the manufacturer instructions. pH was maintained at 6.0 by the automated addition of 5 mol L–1 KOH. The temperature was controlled at 35°C. All reactors and periphery were sterilized for 20 min at 121°C. To establish anaerobic conditions after sterilization, reactors were purged with pure nitrogen for 10 min at 90°C and while cooling down to 35°C. The reactor system for the fed‐batch fermentations was coupled to a self‐developed automated fast‐filtration system.
| 5 | 0biomedical
| 0Study
|
312,124 |
In conclusion, this study has shown that the multimodal sensing of audio and physical motion during communication using wearable sensors is effective for improving utterance discrimination performance in real-world situations where many people participate and speak simultaneously. Further advancement of the method used in this study can enable a handy and widely available evaluation of communication in various dynamic real-world situations, where the number of participants and composition of a group are fluid, and many people speak simultaneously. Such technologies are expected to be useful in basic scientific studies to elucidate social processes and structures, as well as in engineering applications to provide support for improving efficiency, productivity, and soundness in a wide range of social groups and activities. Possible target fields in which communication is affected by noise include classrooms, office meetings, construction sites, hospitals, parties, public transportation, and other social activities.
| 4 | 0biomedical
| 0Study
|
200,073 |
After excluding those with missing data for serum 25(OH)D2 or D3 concentrations, 4655 cases were left for analysis. Rates of vitamin D deficiency or insufficiency are list in Tables 1. The 5th, 10th, 25th, 50th, 75th, 90th, and 95th percentiles of serum 25(OH)-D levels are listed in Additional file 2. The median serum 25(OH) D concentration was 24.7 ng/mL in SCS. We found 24.7% (95% CI, 23.5–26.0%) of children in SCS had a level below 20 ng/mL, and 51.3% (95% CI, 49.8–52.7%) were at risk of vitamin D insufficiency (20–30 ng/mL). A total of 22.9% (95% CI, 21.2–24.6%) of boys and 26.5% (95%CI, 24.7–28.4%) of girls had 25(OH) D levels less than 20 ng/mL, whereas 26.5% (95% CI, 24.7–28.3%) of boys and 21.6% (95% CI, 19.9–23.3%) of girls had serum 25(OH) D levels greater than 30 ng/mL.Table 1Prevalence rates of vitamin D deficiency or insufficiency among 2 years old children in SCSALL (N = 4655)Boys (N = 2364)Girls (N = 2291)25(OH)DPrevalence (%) (95% CI)Prevalence (%)(95% CI)Prevalence (%)(95% CI)< 20 ng/mL24.7 (23.5–26.0)22.9 (21.2–24.6)26.5 (24.7–28.4)> = 20 and < 30 ng/mL51.3 (49.8–52.7)50.6 (48.6–52.7)51.9 (49.8–54.0)> = 30 ng/mL24.1 (22.8–25.3)26.5 (24.7–28.3)21.6 (19.9–23.3)CI confidence interval; 25(OH) D 25-hydroxyvitamin D; SCS Sub-Cohort Study
| 4 | 0biomedical
| 0Study
|
204,825 |
Finally, the quality of the OH information produced by the system can be evaluated by examining the types of data collected by the system in relation to the OH surveillance objectives. For example, the evaluator can assess if all necessary data are collected from different animal species, humans, and in the environment in order to produce information with a OH perspective.
| 2 | 0biomedical
| 1Other
|
367,418 |
In order to measure an AE-induced strain wave, the main hurdles to be overcome are high data acquisition rate and sensitivity that is needed to recreate the AE signal and the amount of extraneous noise that the sensor senses through vibration and other interferences. The conventional FBG interrogation system is limited by its measurement frequency range of operation (typically in the range of 1–10 kHz) and sensitivity that would limit the system to measure AE signals. An ideal AE interrogation system should be one that can at best be able to work in a frequency range of 1–500 kHz and should have the capability to detect pico and femto strains as the AE induced strains from micro and nano-cracks/defects in structures would be in this range .
| 4 | 0biomedical
| 0Study
|
16,063 |
Diurnal vocal activity was analyzed in two time resolutions, showing that per-hour sums of detections (Fig 4A) mask many interesting details discernible in per-quarter-hour views (Fig 4B–4D). Generally speaking, V. chilensis acoustic activity peaked around dawn and dusk. However in the per-quarter-hour projections, but not in the per-hour view, it is perceptible that vocal activity varied in time even between the activity peaks at dawn and dusk; that is, activity tended to peak periodically every 45 to 120 min.
| 4 | 0biomedical
| 0Study
|
108,181 |
We also compared posting quantity differences based on the results of the depression screen within the ED. Among patients who screened positive for depression in the ED, the mean number of posts was 38 (95% CI 27-52), which was notably higher than the postings of individuals who did not screen positive for depression (mean 23, 95% CI 20-26, P=.003). Individuals with a history of depression or asthma in their past medical history also had higher mean Facebook postings compared to individuals without a history of depression (depression: mean 38, 95% CI 29-50; no depression: mean 22, 95% CI 19-22, P=.001) or asthma (asthma: mean 34, 95% CI 24-45; no asthma: mean 25, 95% CI 20-26, P=.02). There were no significant differences in Facebook posting frequencies between patients with and without the following conditions: hypertension, diabetes, headaches, back pain, anemia, and cancer. After using an ANCOVA model to control for age, race, and sex, the depression screen and depression medical history were the only health outcomes that showed significant differences in mean posting quantities between patients with and without a disease (Table 3).
| 4 | 0biomedical
| 0Study
|
132,728 |
Perhaps a more important point is where are the sequences? In this age of supplementary materials, providing the original data on which the analyses are carried out is routine for biomedicine, and should be for this kind of (nearly) unique study. Perhaps the source of the sequences is mentioned somewhere, but I certainly didn’t notice it.
| 2 | 0biomedical
| 1Other
|
77,498 |
Research in alcohol addiction has reported the existence of areas of the brain that may be particularly vulnerable to alcohol toxicity through interference with the activity of cell-signaling systems, particularly growth and trophic factors [7–8]. Indeed, studies in preclinical and clinical models of AUD provide evidence of the role of neurotrophic factors in alcohol-induced cognitive decline in brain areas, including the basal forebrain-cortex system [9–10].
| 4 | 0biomedical
| 0Study
|
52,233 |
The present analysis quantified the overlaps in protected area designations at a global, regional and national level using the best global protected areas dataset available. Three key messages can be drawn from this exercise. Firstly, overlap in protected area designations occurs in every region of the world, both in the marine and terrestrial realms, but is more prominent in the terrestrial realm and in some regions more than others. Secondly, in all regions, drivers for establishing protected areas under national or international designations are different, resulting in regional networks that have different characteristics, and different degrees of overlap. Finally, the higher amount of overlap reported in Europe is strongly influenced by regional designations.
| 1 | 2other
| 0Study
|
380,883 |
a Based on SF quantification, patients were assigned to two cohorts: the RefR cohort (open boxes) showing SF levels inside the reference range (i.e. below the 95th percentile) of the TINA-Quant ferritin assay and the ExtR cohort (black boxes) with SF levels elevated above the 95th percentile. Dotted lines refer to the median reference levels reported for healthy male and female donors.3 Note that only a minority of GBM patients (ExtR cohort) showed very high SF levels (462–1355 ng/ml; median = 727 ng/mL), which is in line with existing data, with only 4 of a total of 57 glioma patients investigated so far, showing extremely high SF levels (Supplemental Table 1). Meningioma patients showed lower SF levels, which is significant (p > 0.05) for the RefR cohorts, and the highest SF value observed in meningioma patients (766 ng/mL) locates close to the median SF level of GBM–ExtR patients. b Immunohistochemistry of resected GBM and meningioma tissue evaluated by the labelling index (i.e. the percentage of immune-positive cells) demonstrates a significantly (p < 0.005) higher immunoreactivity for ferritin in GBM samples. In both types of tumour specimens, labelling for the FTL subunit was significantly (p < 0.05; p < 0.005) higher compared with FTH. c In GBM tissue, no differences of ferritin labelling were found between samples obtained from the RefR and ExtR cohort, the highest FTL labelling being observed in RefR cohort samples: 328 ng/mL (upper dot) and 206 ng/mL (lower dot). *p < 0.05; **p < 0.005 compared with the healthy reference population in (a) (Wilcoxon sign test for median difference based on gender-specific SF values) or as indicated (Mann–Whitney U exact test for independent samples for the comparison between the two patient cohorts in (a, c), and Wilcoxon signed-rank test for paired samples in b); +p < 0.05; ++p < 0.005 compared with meningioma patients (Mann–Whitney U exact test for independent samples). The dots in meningioma RefR cohort (a) and (b) highlight statistical outliers. N refers to the number of investigated patients (a) or tumour specimens (b).
| 4 | 0biomedical
| 0Study
|
36,990 |
Although demonstrating faith in the potential advantages of industrial techniques, Ericksson-Lihr (1953: 55) recognized an interrelated aspect of women’s discontent which drew sharper distinctions between housework and outside employment. “How about the psychic troubles of the housewife”, she wondered. “Are they real or only imaginary? Did the long working hours by day and night, the hectic hurry, the economic difficulties, the loneliness and lack of appreciation, upset her balance?” Her approach, taking a parallel psychological inventory to detect signs of social isolation, restlessness, poor sleep, “monotony of life” or symptoms of an “inferiority complex”, hinted at existential difficulties which evaded resolution even by successful attempts at job design. The seclusion in which many women worked, in part a result of rising geographical mobility, but also attributable to spreading middle-class associations between privacy and respectability, carried psychiatric connotations that were just beginning to be seriously explored (Halmos, 1953). In addressing appreciation for household labour and pathological feelings of inferiority, Ericksson-Lihr was connecting unhappiness and fatigue with subjective perceptions of status. Claire Langhamer’s observation that post-war celebrations of domesticity often masked a steep decline in the prestige of domestic work was reflected in concerns voiced about women’s health across the 1940s (Riesman, 1950: 300; Langhamer, 2005: 359). One left-wing social researcher and feminist activist, Amber Bianco White (1941: 93), implicated the devaluation of housework in heightened experiences of anxiety. As long as housewives thought of what they did as an “unworthy, inferior, miserable sort of occupation”, it was impossible for them to derive any psychological rewards from their exertions. The principal difference between outside work and the “domestic salvage” that housewives performed, according to another critic, was that the latter had “surrendered its inherent dignity”. The toll that this took on women was the “price of home” (Luetkens, 1946: 111, 109). This was a world, fundamentally, that Ericksson-Lihr (1953: 54) surmised had “grown too narrow.” Housework alone, she concluded, “is not enough to make most women happy”.
| 1 | 2other
| 1Other
|
290,818 |
An interesting application to support social distancing is presented in . The idea is to help health authorities to promote social distancing by controlling the number of individuals in specific areas. The blockchain is run by different government authorities. Citizens create a wallet where they receive “movement passes” or time-based tokens which can be spent and expire after a period of time. This way, the authorities can restrict the total number of tokens released in a certain period of the day for a certain area to limit the number of people in that area.
| 2 | 2other
| 1Other
|
85,878 |
Whole wheat flour (GmbH Rigas Dzirnavnieks, Riga, Latvia), wheat protein isolate Arise 5000 (MGP Ingredients, Athinsone, Kansas, USA), sugar (GmbH Nordic Sugar, Riga, Latvia), salt, dry yeast (GmbH S.I. Lesaffre, Marcq-en-Baroeul, France) were procured from the local market of Jelgava, Latvia; while cumin and caraway seeds were purchased from the local market of Toulouse, France.
| 1 | 2other
| 1Other
|
172,231 |
How to recover quickly in elderly patients with colorectal cancer in perioperative period, How to make the concept of rapid recovery better reflected in the elderly patients, We apply modified ERAS therapy in part elderly patients(> the 70-year-old) with colorectal cancer in General Surgery of Shanghai Fourth People’s Hospital, It is compared with the conventional treatment patients in same period, conventional treatment is the treatment method before ERAS, without the concept and method of alleviating stress and complications to promote postoperative recovery of patients, To analyze the effect of the concept and measures of ERAS on postoperative recovery, the study was approved by the Ethics Committee of Shanghai Fourth People’s Hospital.
| 3 | 0biomedical
| 0Study
|
236,655 |
In steady-state conditions or upon inflammation, most tissue macrophages originate from bone marrow-derived monocytes in the blood circulation. The remaining portion of macrophages are termed specialized tissue-resident, such as alveolar macrophages in the lungs, microglia in the brain, or Kupffer cells in the liver, and are not derived from blood monocytes . When a tumor develops, it can recruit and induce macrophages in the TME with various chemokines and cytokines, such as CXCL12, CCL2, GM-CSF, colony-stimulating factor 1 (CSF-1), and IL-3. These special macrophages are then called tumor-associated macrophages (TAMs) . A recent study showed that certain TAMs may also originate from tissue-resident macrophages, representing a functionally distinct subpopulation . Although they form a continuous spectrum, TAM subpopulations are mainly divided into two opposite polarization states, namely M1 and M2. Typically, M1 macrophages are characterized by the secretion of pro-inflammatory cytokines and a tumoricidal function, while conversely, M2 macrophages secrete anti-inflammatory signals promoting tumor progression . In PDAC, the majority of TAMs display an M2-like phenotype, characterized by the expression of surface markers CD163 and CD206, and the cytokines IL-10 and TGF-β . They are primarily located at the invasive front of the tumor . Macrophage infiltration begins early and persists throughout cancer progression . TAM infiltration is correlated with perineural invasion , angiogenesis, lymph node metastasis , cancer cell epithelial–mesenchymal transition and extravasation . Therefore, macrophage depletion reduces lung and liver metastasis in an orthotopic mouse model of PDAC . Thus, TAMs appear to be involved in both regulating PDAC invasion and metastasis and are therefore correlated with worse OS. Finally, TAMs are partially responsible for the impaired efficacy of chemotherapy in PDAC. It has been shown that they are regulating the function of cytidine deaminase (CDA), which is a key metabolizer of gemcitabine, thereby contributing to gemcitabine-based chemotherapy resistance .
| 5 | 0biomedical
| 0Study
|
214,371 |
Performance in the change blindness task could be enhanced by presenting the companion images serially in time, relative to the classic side-by-side presentation . This improvement may be attributed to the reduced oculomotor demand, as there is no need for sequential eye movements between companion images when presented serially in time . In a similar manner, the fusion mode of gameplay too does not require any sequential eye movements between companion images to identify local feature differences and, this reduced oculomotor demand may contribute to the observed enhancement in task performance. Tracking the pattern of eye movements in the fusion and non-fusion modes of gameplay would provide future insights on this issue [5, 21]. It would also be interest in the future to adapt the serial presentation task of Josephs et al into a dichoptic temporal fusion paradigm where the two companion images are rapidly shuffled between the two eyes using a shutter-goggle type apparatus. Perhaps, spotting of local feature differences would be doubly enhanced with the combination of temporal shuffling and binocular fusion of images.
| 4 | 0biomedical
| 0Study
|
315,891 |
Several approaches focus on finding the optimal temporal alignment (i.e., frame-to-frame) between two or more video sequences (Tuytelaars and van Gool 2004; Wang et al. 2014; Douze et al. 2015; Dexter et al. 2009; Rao et al. 2003). Some of these works use a cost matrix to find the alignment (Wang et al. 2014; Dexter et al. 2009) similarly to our CMP candidate extraction (Sect. 5.1). Also this class of methods assumes that the input sequences can be aligned in their entirety, or at least have a significant temporal overlap.
| 2 | 2other
| 0Study
|
354,296 |
In the case of water electrolysis, as indicated above, only its simulation was carried out with DWSIM. The comparison of these values with respect to the references is also positive, and the small variations in the values of the thermal efficiencies can be justified by the uncertainty of the complete kinetics used by the authors of these references. In general, the results of the energy efficiencies provide coherence to the simulations as was also observed with the molar flow profiles.
| 2 | 2other
| 0Study
|
173,218 |
Adversarial learning is a technique of defending against adversarial samples . This approach attempts to improve the accuracy of neural network models by training adversarial samples and normal samples together and reducing the interference of the adversarial samples. The robustness and generalization ability of the resulting network are improved. Adversarial training can be expressed as follows:(4)minθmaxDx,x′<ηLadvx′,y;θ where x, x′ denote the original sample and adversarial sample, respectively, y is the label value, and θ is the weight of the networks. Dx,x′ represents the distance measurement between the original sample and the adversarial sample, and Ladvx′,y;θ represents the adversarial loss function. In the min–max form, the internal maximization optimization problem is to find the optimal adversarial sample, and the external minimization optimization problem is to minimize the loss function. The learning process of confrontation training is depicted in Figure 4.
| 4 | 2other
| 0Study
|
193,274 |
Legates–McCabe’s Index (LM):35\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$LM = 1 - \left[ {\frac{{\mathop \sum \nolimits_{{{\text{i}} = 1}}^{{\text{N}}} \left| {UVI_{{{\text{for}} - }} UVI_{{{\text{obs}}}} } \right|}}{{\mathop \sum \nolimits_{{{\text{i}} = 1}}^{{\text{N}}} \left| {\left| {UVI_{{{\text{obs}} - }} \overline{UVI}_{{{\text{obs}}}} } \right|} \right|}}} \right]$$\end{document}LM=1-∑i=1NUVIfor-UVIobs∑i=1NUVIobs-UVI¯obs
| 2 | 0biomedical
| 1Other
|
22,977 |
Medical use of mother’s milk was not restricted to the indigenous cultures. According to physician John Tennent (circa 1700-1748) of Williamsburg, who wrote a collection of home remedies, “Common Sore Eyes may be cur’d by washing them with Breast Milk, warm Sage Tea, or with Rose Water . . .”61
| 2 | 0biomedical
| 1Other
|
183,059 |
To establish an in vivo model of asthma, WT and Parkin deficiency mice are intranasally inoculated with IL-13 or house dust mites. WT mice show significantly increased numbers of both neutrophils and eosinophils in BAL fluid following IL-13 treatment than Parkin deficiency mice. Treatment with IL-13 also increases mtDNA release and neutrophil chemokine levels in BAL fluid of WT mice compared with Parkin deficiency mice. In vitro, Parkin deficiency in IL-13-stimulated human tracheobronchial epithelial cells inhibits mtDNA release. This suggests a link of mitophagy, mtDNA, and inflammation in the pathogenesis of asthma . Increased accumulation of cytosolic double-stranded DNA is observed in the airway epithelium of ovalbumin- or house dust mite-exposed mice and in human bronchial epithelial cells treated with IL-33. Interestingly, Mito-TEMPO could reduce IL-33-induced cytoplasmic double-stranded DNA accumulation in human bronchial epithelial cells, which is possibly associated with suppressing the release of mtDNA into the cytosol . Altogether, mtDNA damage or release plays important roles in the pathogenesis of asthma.
| 4 | 0biomedical
| 0Study
|
377,743 |
Single nucleotide polymorphisms (SNPs) based phylogenomic analysis of 60 isolates of various sequence types of S. aureus including the five representative ST72 isolates were analyzed to determine the relatedness of ST72 with other sequence types as described earlier (Challagundla et al., 2018). The SNP phylogenetic tree of 60 isolates showed that ST72 isolates grouped in the same cluster irrespective of their location and time of isolation [COAS6070_JBPG01 (USA, 2013), 147_SAUR_JVSK01 (USA, 2014), K07-204_JACSIU000000000.1 (Korea, 2007), K07-561_JACORE000000000.1 (Korea, 2007) and 21259_AFTS01 (J. Craig Venter Institute, USA, 2011); (Figure 4A)]. This phylogenetic analysis also revealed that ST72 is closely related to ST22, ST902, ST101, and ST1082 (Figure 4A). The SNP-based phylogeny of ST72 with other isolates showed that the representative ST72 isolates are clustered together, and thus this analysis provided the closest relatives of ST72 (Figure 4A). Furthermore, the variability among the ST72 isolates was figured out by analyzing 29 ST72 genomes isolated from different locations and time by creating a matrix of SNPs using the CSI phylogeny wherein CN1 isolates of ST72 (GenBank Accession no. CP003979) was considered as reference genome (Figure 4B). Detailed analysis of the SNP matrix showed that the accumulation of SNPs in ST72 was highly variable across time and space ranging from zero between FORC_061_CP022607 (Korea, 2017) and MGYG-HGUT-02337_CABMHC01 (location: not disclosed, submitter EMBL_EBI, Europe, 2019) to 345 between HST_084_ AZTF01 (Lebanon, 2011) and M3140_OFYF01 (Denmark, 2014). Interestingly, both K07-204 and K07-561 were collected in 2007 from South Korea differed by 304 SNPs suggesting the existence of two distinct lineage at the point of isolation (South Korea, 2007) with different sets of antibiotic and virulence genes (Figure 4B). The accumulation of significant number of SNPs at the same time and place revealed that various ST72 isolates steered rapid acclimatization against challenges to adapt from CA-MRSA to one of the major MRSA in hospital settings. Furthermore, the SNP-based phylogram was created to analyze the relatedness of K07-204 and K07-561 among ST72 clones isolated across the globe (Figure 4C). On the other hand, the K07-204 is closely related to F17SA003_CP031130 with 38 SNPs although these isolates were collected from South Korea in 2007 and 2018, respectively. In the same way K07-561 is closely related to FORC_061_CP022607 with 72 SNPs even though these isolates were reported from South Korea in 2007 and 2017, respectively (Figure 4C). These results indicate that the SNPs as well as antibiotics and virulence genes are acquired differentially by CA-MRSA depending upon the challenges they faced with (hosts and antibiotic pressure, abiotic and biotic stresses) at various locations and adaptations to human hosts. The isolate-specific antibiotic resistance and virulence genes of various ST72 clones identified in this study can aid in assessment of current and future therapeutic options and rapid molecular diagnosis.
| 4 | 0biomedical
| 0Study
|
312,367 |
Although prediction of the emergence of novel pandemic agents often seems unachievable, efforts to reduce or prevent pandemic zoonoses before they emerge in people have also begun (4). For instance, Daszak et al. developed a model dividing cross-species transmission into three stages, animal infection without transmission to humans (stage 1), localized human infection (spillover; stage 2), and widespread human-to-human transmission (pandemic; stage 3) (5). Recent recognition that most emerging infectious disease events have wildlife origins highlights the need for a deep understanding of the evolutionary drivers for pathogens in stages 1 and 2 and the type of contact between animals and people that enables disease transmission (6). Opportunities for close contact between humans and wild animals are relatively rare compared to contact with domestic animals (7). Therefore, our ability to monitor the emergence and spread of pandemic diseases from farms to humans is critical to mitigate the exacerbation of the infectious disease crisis worldwide.
| 4 | 0biomedical
| 0Study
|
127,733 |
Uniquely, we analysed invasive bacterial disease data, OxCGRT indices, and Google COVID-19 Community Mobility Reports data per country, which provided the means to assess the associations between country-specific containment measures, changes in the movements of human populations, and the corresponding reductions in the incidence of invasive diseases.
| 4 | 0biomedical
| 0Study
|
75,344 |
A collection of 114 endophytes were previously isolated from wild populations of G. uralensis (Li et al., 2018) from three areas in Xinjiang province, representing 18 genera and 34 species. All isolates were submitted to NCBI GenBank under Accession Number (KY127308 – KY127422) and used in this study. Bacterial isolates were stored in 20% glycerol at the Key Laboratory of Biogeography and Bioresource in Arid Land, Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences under -20°C. Bacteria were routinely cultured on ISP2 growth medium, and incubated at 28 ± 2°C for 48–72 h.
| 4 | 0biomedical
| 0Study
|
266,570 |
We annotated the identified proteins using the UniProt database (http://www.uniprot.org/). Complete proteomic data set from mice infected with plasma EVs at different stages was presented in Supplementary Tables 1 and 2 . Additionally, we also functionally annotated the proteins, including gene ontology (GO) analysis (http://www.ebi.ac.uk/GOA/). In addition, we performed the REACTOME pathway analysis and PANTHER pathway analysis using the KOBAS database (http://kobas.cbi.pku.edu.cn/kobas3/). We used the WOLF PSORT software, an updated version of PSORT/PSORT II, for the prediction of eukaryotic sequences in order to predict subcellular localization. Moreover, we compared the identified proteins with those cataloged in the ExoCarta database (http://www.exocarta.org/).
| 4 | 0biomedical
| 0Study
|
340,351 |
Then, a mirror-biting test, which represented another modification of the novel tank test and also relevant to social behavior, was conducted. Traditionally, this test is used for studying zebrafish aggressive and social behavior by exploiting the mirror image stimulation . Based on the results, several zebrafish strains displayed a significantly different level of aggressiveness than the AB strain, including the TL and WIK strains. In the TL, this phenomenon may be related to their lower cortisol levels and expression levels of the stress-axis related genes than the AB fish after the learning task, as mentioned in the previous study . As it is already well known, serotonin, a steroid hormone, is secreted by the teleost fish adrenal system in response to acute and chronic stress and different levels of cortisol might contribute to the different behavior observed in this study . In addition, another prior experiment observed the difference in the baseline activity of the hypothalamic–pituitary–interrenal (HPI) axis between the AB and TL larvae . This finding may also help to elucidate this phenomenon since the HPI axis, which is homologous to the mammalian hypothalamic–pituitary–adrenal (HPA) axis, and behaviors are modulated in the presence of acute stress, including social stress . Social stress results in general behavioral inhibition, such as decreases in aggressive social interactions and appetite . In WIK strain, the slightly low level of aggressiveness might be related to the novel tank test result. As it is already mentioned above, the WIK strain displayed an obvious thigmotaxis, a sign of anxiety, and a lower level of the activity level of the zebrafish in the central area of the test tank can be considered as a decreased boldness, which is related to the aggression phenotype .
| 4 | 0biomedical
| 0Study
|
183,472 |
The description and discussion of the four cases, from the clinical and healthcare perspectives, show that the theoretical implementation of SDM within PPM is not so clearly established as it initially seemed based on a current state of the art . Nevertheless, although societies and international consortiums are starting to ask about patients’ involvement in their health decisions , more clinical and psychological research is needed to learn how to manage the personal component of this humanistic approach which cancer patients are requesting . In this study, the emerging scenarios are probably due to the individual variability, the critical time in which patients and surgeons managed this approach (i.e., the first waves of the COVID-19 pandemic ), the ethical considerations, and the lack of maturity in current evidence-based medicine regarding SDM medical practice.
| 4 | 0biomedical
| 0Study
|
160,537 |
Plant extracts that are reported to exhibit antimicrobial activity against potato phytopathogens from genus Fusarium include Caryophyllus aromaticus L. (clove), Lavandula angustifolia L. (lavender), Mentha piperita L. (peppermint), Rosmarinus officinalis L. (rosemary) and Thymus vulgaris L. (thyme) extracts . Rhizoctonia solani development inhibition was confirmed in several studies for Nigella sativa L. (blackseed) , Allium sativum L. (garlic) , Urtica dioica L. (nettle) , Allium cepa L. (onion) , and Salvia officinalis L. (sage) . Alternaria species growth was inhibited as shown in previous studies by Carum carvi L. (caraway) , Allium sativum L. , Thymus vulgaris L. , and Curcuma longa L. (turmeric) . Carum carvi L. has been additionally mentioned as a Pectobacterium carotovorum growth inhibition agent .
| 4 | 0biomedical
| 2Review
|
62,628 |
For one-shot learning gesture recognition, the limited number of training samples requires that the detected keypoints are affine invariant, besides being scale, rotation and illumination invariant. The Harris-Affine corners are chosen as the candidate keypoints. Using the Harris-Affine corners can potentially increase the number of keypoints, which can improve the quality of the representation of the hand appearance and of its shape.
| 2 | 2other
| 1Other
|
64,380 |
Measures of (A) Species richness, (B) Shannon diversity, (C) Simpson diversity, (D) Pielou’s evenness, (E) Taxonomic diversity (delta+), and (F) Taxonomic evenness (lambda+) of the skin and gill samples. Mean values and standard deviations are plotted for wild-caught YTK (orange), healthy farmed YTK (pink), and farmed YTK exhibiting early (red) and late (dark blue) stages of enteritis. Differences were evaluated between the skin and gills for each group using Welch’s t-test and between states of health for each region using one-way ANOVA with Tukey’s post hoc test. Asterisks denote levels of statistical significance between groups, with alpha set at 0.05.
| 4 | 0biomedical
| 0Study
|
264,495 |
The reason for computing Ek(Yk) is that both static and motion information capable of providing useful information for motion object segmentation is considered. If the foreground motion region is different from the background, optical flow gradient magnitude is required to achieve high value close to the foreground region compared with background. Moreover, the static edge probability provides one instructing element in terms of the apparent boundaries by complying with the appearance in the RGB frame. When both kinds of information fused using (2), the final spatiotemporal edge probability map Ek(Yk) is able to point out the location of the foreground moving object.
| 2 | 2other
| 0Study
|
126,387 |
An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.
| 1 | 2other
| 1Other
|
351,244 |
From the rheological tests, we can observe that all tested samples exhibited a dominant elastic behavior, with G’ > G”, almost independent of the frequency value, stated for the stability of the crosslinked hydrogels in the considered frequency range (Figure 13 and Figure 14).
| 4 | 0biomedical
| 0Study
|
87,899 |
Using SST (Spine & Surface Topography) can significantly reduce the amount of harmful radiation in scoliosis treatment and follow-up during therapy. The SST under dynamic condition shoes the body movement, body mechanics and the activity of the muscles. People with scoliosis show under dynamic conditions reduced mobility and asymmetric lateral rotation.
| 3 | 0biomedical
| 1Other
|
126,072 |
Histograms of pore diameters, sampled in two Kir6.2 systems (6C3O, 6C3P). Minimum distances for three major constriction sites in Kir6.2 were measured in 5 × 1 μs MD simulations for both systems between two opposing subunits and averaged over the number of simulations, subsequently. Crosses mark the corresponding distances of the initial cryo-EM state before equilibration and production run, measured with the HOLE program. A vertical line is drawn at 6.6 Å, indicating the time-averaged hydration diameter of K+ (Conway 1981). Analogous average minimum-distance values, measured in the G-loop gate (narrowest passage in 3SYA), were associated with conduction in previously published Kir3.2 3SYA simulations (Bernsteiner et al., 2019) (*, gray curve).
| 5 | 0biomedical
| 0Study
|
353,690 |
The discovery of a novel JAK2V617F mutation, which is found in 50–90% of all classical MPNs and results in a substitution of valine to phenylalanine in the JAK2 gene, significantly contributed to the discovery of the molecular pathogenesis of myeloproliferative neoplasms . JAK2 is the most-frequently mutated gene in MPN and its mutant form encodes a constitutively active kinase. The JAK2V617F mutation usually arises in a multipotent hematopoietic progenitor clone and can be found in all myeloid lineages, but also in B-, T- and NK-cells . Another mutation of JAK2 in exon 12 is found less frequently in MPNs and is mainly restricted to JAK2V617F negative PV . Other more rarely seen genetic aberrations in MPN are mutations in the myeloproliferative leukemia virus (MPL; thrombopoietin receptor (TPOR)) gene resulting in a substitution of tryptophan at position W515 by leucine (MPLW515L) or lysine (MPLW515K) . These mutations are not as common as JAK2 mutations and are only found in 3–5% of all ET and PMF cases . More recent discoveries found frameshift mutations in exon 9 in the calretikulin (CALR) gene in the majority of JAK2- and MPL-negative PMF and ET, causing a 5-bp insertion or a 52-bp deletion . Genetic analyses could elucidate that the major MPN driver mutations, JAK2V617F, CALR, and MPL515, play a pivotal role in increasing the risk of leukemic transformations .
| 4 | 0biomedical
| 0Study
|
22,889 |
Summary of GRCh38 updates. (A) Chart showing issues resolved for GRCh38 on each chromosome by issue type. Each issue represents a unique assembly evaluation and corresponding curation decision. (B) Changes in placed scaffold N50 length from GRCh37 to GRCh38. Changes on Chromosomes 5, 13, 19, and Y are <55 kbp each. (C) Addition of whole-genome sequencing components (orange bars) resolves a GRCh37 gap, consolidating the split annotation of INPP5D and restoring a missing exon (asterisk) in GRCh38. The default 50-kbp gap in GRCh37 greatly overestimates the actual amount of missing sequence (∼6 kbp). (D) Schematic of a curated collapse in GRCh38 Chr 10. Clones from two incompatible haplotypes (pink and light blue) were mixed in the GRCh37 tiling path, creating a false gap and segmental duplication involving the single copy genes TMEM236 and MRC1 (top). In GRCh38 (bottom), clones from the blue haplotype have been eliminated (∼200 kbp), closing the gap and providing the correct gene content.
| 5 | 0biomedical
| 0Study
|
286,840 |
By targeting cells and stimulating complement activation and phagocytosis, many fungal-specific mABs can be utilized to treat invasive fungal infections, including black fungus (Casadevall and Pirofski, 2012). Synthetic AMPs have been in use in antifungal therapies; these have membrane lytic activity against fungal species. Certain species of AMPs have different mechanisms of action like toroidal pore formation, membrane curvatures induced by peptides, thickening or thinning of membranes, flip-flop of membrane, lipid clustering, or disrupting potential of membrane. The antifungal peptides in clinical and preclinical stages of development include NP213, CZEN-002, P113, HPX-124, hLF-11, omiganan, LTX-109, Isoganan (IB-367); NP399, D2A21, and EDT-151. All these exhibit some fungicidal properties (Mercer and O'Neil, 2020), which could be utilized as therapeutic alternatives for treatment of mucormycosis.
| 4 | 0biomedical
| 2Review
|
340,543 |
Two of the qAOP models are applicable in human health risk assessment (Burgoon et al. 2020; Perkins et al. 2019a; Zgheib et al. 2019), two qAOP models in ecological risk assessment (Chu 2018; Moe et al. 2018) and a single qAOP model in nanoparticle risk assessment (Jeong et al. 2018).
| 4 | 0biomedical
| 0Study
|
28,862 |
Recently, it has been reported that procyanidins regulate vascular endothelial functions, suggesting implication for cardiovascular health3, 40–43. Although the regulatory mechanisms of vascular endothelial functions by the oligomeric procyanidins in red wine remains unclear, they are hypothesized to bind to a potent specific cell surface protein involved in mechanosensing or to act as receptor agonists, initiating mechanotransduction signaling in the vascular endothelial cells. It would be interesting to examine functional and structural differences of potential target protein/receptor for epicatechin oligomers between cancer cells and endothelial cells.
| 4 | 0biomedical
| 0Study
|
148,159 |
Tranquilizers are generally misused to improve sleep and reduce stress, for recreational motives, and to increment the effect of illicit substances . The past decade witnessed an upward trend of tranquilizer misuse and a simultaneous use of tranquilizers with other drugs such as opioids or cannabis . In the United States, fatal and non-fatal drug overdoses from benzodiazepines taken alone or concurrently ingested with other drugs have substantially increased in recent years. The mortality rate attributed to overdose from concurrent use of tranquilizers with other drugs incremented 10 fold over the past decade , and related emergency department visits were stepped up by 90% . In 2020, more than half of emergency department visits due to benzodiazepine overdose included females (51.5%), and around 21% were young adults . In Europe, more than one-tenth of the population reported ever misusing tranquilizers and more than one-fifth of Europeans declared misusing sedatives in the past year . Tranquilizer misuse is not only a challenge for developed countries, but also for developing countries , yet there is a shortage of information about the public health consequences of tranquilizer misuse in those countries. In Lebanon, 15% of university students reported misusing prescription drugs that were mainly obtained from parents and pharmacists .
| 4 | 0biomedical
| 0Study
|
31,009 |
Total RNA was extracted from whole tissue using TRIzol Reagent (Life Technologies, Inc., Frederic, MD, USA) according to the manufacturer’s instructions. RNA concentration was measured on a NanoDrop spectrophotometer (Thermo Scientific, Wilmington, DE, USA), and cDNA was synthesized with random primers and SuperScript II (Life Technologies, Inc.). cDNA samples were analyzed using microarray methods (V1: 4 × 44 K, Agilent Technologies, Palo Alto, CA, USA), and genes that showed some expression differences between control pigs and those in the ex-evacuation zone were selected for further PCR analysis. Primer sequences were designed using Primer-BLAST with sequences obtained from GenBank, and these are listed in Table 1.Table 1List of PrimersGenePrimer sequences (5′ to 3′)IFN-γ senseantisenseGGCCATTCAAAGGAGCATGGAGTTCACTGATGGCTTTGCGTLR3senseantisenseTCACCCTGCCTAGCATTTGAACAAGGCAAACTCCTGCTCACyclin G1senseantisenseCGATTCTCCTCGCCTCGTAGCAGGGCATTCAGCTGGTGTAAIFM1senseantisenseAGAGTAGCGGTTGCCGAAATCATGCCATCGCTGGAACAAGEPHX2senseantisenseAGTCATCTGCTCCTCCCGAAGCCCTCACTCTCTCAGGGTAGADD45AsenseantisenseATGCCCTCGAAGAAGTGCTCCGCTTGGATCAGGGTGAAGTOGG1senseantisenseCGTTCTGCCCCGTAGCATTCCTCAGTCTGGGTCAGTGTSmad7senseantisenseAGAGTGGGGAGGCTCTACTGTCTGCACCAGCTGACTCTTGXAB2senseantisenseGTGCCGAGGAGTACATCGAGTCCACGTTGAGAGACTGCACXPCsenseantisenseGGAAGAAGACGCACCTTCCATGTGTTCTCTCCCAAGCCACXRCC1senseantisenseGACCCTCCTGCGTCTTTCTGCCAGCTGGAGAACCACAGAG
| 4 | 0biomedical
| 0Study
|
347,823 |
The burden of iron deficiency varies by age, sex, inflammation, and malaria parasitemia. Error bars indicate 95% confidence intervals for prevalence of iron deficiency regression-corrected for inflammation and malaria. Darker colors indicate the WHO definition of iron deficiency while lighter colors show the gap in the prevalence of iron deficiency between the two definitions (referred to as “hidden iron deficiency”). The values in the bars indicate the percentage of children with iron deficiency unaccounted for by the WHO definition. Line plots indicate how the prevalence of inflammation (black) and malaria (red) changed with age
| 2 | 0biomedical
| 0Study
|
257,209 |
Here we thus examine 23 PWDs where Ca, Si, Mg, and Fe are measured with precision (see “Methods”). Because PWDs might reflect assimilation of entire planets (mantle + crust + core), we compare their bulk compositions to the bulk compositions of the inner planets of our Solar System, taking estimates of their silicate compositions19–27 and adding back their metallic cores28. Because pollution might be dominated by silicate fractions5, we also calculate bulk silicate planet (BSP) compositions that account for the removal of Earth-like core fractions17 from the bulk compositions, and we compare these (as well as bulk PWDs) to meteorites29, and rocks from Mars30, Earth31, and Moon32, as well as the putative silicate fractions of exoplanets calculated from main sequence star compositions in our galactic neighborhood16,17.
| 4 | 0biomedical
| 0Study
|
243,432 |
L440/441 – ‘the results of an intra-expert classification test to see whether inter-experts differences are smaller than than inter-class differences.’ I got confused here, although this may be my fault. Intra-expert classification test for inter-expert differences was confusing. Perhaps check this is the terminology you intended to use and also whether some of this terminology could be clearer. What is intra-expert? The within person variation for individuals in the expert group? (also typo with double than)
| 3 | 0biomedical
| 1Other
|
306,486 |
To elucidate the mechanism involved in NAG-1/GDF15-mediated enhanced insulin sensitivity, this study investigated the insulin signaling pathway in NAG-1 Tg mouse tissues using the HFD/STZ-induced diabetic mouse model. In addition to the adipose tissue, the skeletal muscle was considered as a target tissue28 in which NAG-1/GDF15 was expressed (Fig. 6E). Glucose uptake by this tissue accounts for the majority of glucose disposal during the postprandial period, as well as after the challenge with exogenous insulin. The expression of GLUT4 was upregulated in the skeletal muscle of NAG-1/GDF15 Tg mice (Fig. 6B–D), supporting the hypothesis that NAG-1/GDF15 expression in the skeletal muscle may increase systemic insulin sensitivity. The upregulated expression of Glut4 is accompanied by the induction of the expression of As160, which is required for the insulin-stimulated translocation of glucose transporter to the plasma membrane. Indeed, the expression of Glut4 was also upregulated in iWAT and BAT (Fig. 6).
| 4 | 0biomedical
| 0Study
|
337,252 |
Heat stress induces HSP70 expression in bovine granulosa cells: mRNA as well as protein expression of HSP70 (a, b) in bovine granulosa cells cultured under heat stress (39, 40 and 41 °C) and corresponding control (38 °C). β-ACTIN was used to normalize the expression of target protein expression of HSP70. The results are expressed as the mean ± SEM of n = 3. Superscripts (a, b, c) show significant difference, P < 0.05
| 4 | 0biomedical
| 0Study
|
287,130 |
In CH2Cl2 (5 mL) was dissolved 2-(5-Nitro-4H-1,2,4-triazol-3-yl)acetic acid (172 mg, 1.00 mmol, 10 eq) and DIC (0.155 mL, 1.00 mmol, 10 eq), DIPEA (0.524 mL, 3.00 mmol, 30 eq), and HOBt·H2O (152 mg, 1.00 mmol, 10 eq) were added. The mixture was stirred at rt for 20 min and then added to Aminomethyl-Polystyrene resin (100 mg, 0.100–0.150 mmol, 1–1.5 mmol/g, 1 eq) in a plastic column (PD-10 from GE Lifesciences) and shaken overnight at rt. The resin was then washed with MeOH, CH2Cl2, and Et2O. The beads were analysed by Kaiser test which gave negative results for amines suggesting quantitative coupling yields.
| 3 | 0biomedical
| 0Study
|
356,396 |
Animal experiments were performed with the approval of the Ethics Committee of Linyi People's Hospital and in accordance with the Guide for the Care and Use of Laboratory animals published by the US National Institutes of Health. All efforts were made to minimize the suffering of the animals included in the study.
| 3 | 0biomedical
| 1Other
|
332,271 |
However, the genetic basis of CPP includes either mutations in the KISS1 and KISS1R genes or loss-of-function mutations in the MKRN3 gene. To date, MKRN3 mutations have been described in 58 patients with CPP from 35 different families [2, 6, 12, 20–24]; these include 23 different loss-of-function and 11 missense mutations of MKRN3 and represent the most frequent genetic cause of CPP since being identified in 2013 . Makorin ring finger protein 3 is codified by an intron less gene on chromosome 15 and is thought to have an inhibitory effect on GnRH secretion. It belongs to a family of E3 ubiquit in ligases, but its mechanism of action is as yet unknown.
| 4 | 0biomedical
| 0Study
|
217,218 |
Using Pillai’s trace, a significant interaction effect between intervention and gender was identified, V = 0.067, F(2,95) = 3,416, p = 0.037, partial η2 = 0.067. There was no significant main effect of the post-coercion review session on the dependent variables AES-1 and AES-2, V = 0.025, F(2,95) = 1,201, p = 0.305, partial η2 = 0.025. Similarly, no main effects of the independent variable gender or the covariate age were found.
| 4 | 0biomedical
| 0Study
|
391,746 |
After an extensive search on the mentioned resources, 316 studies were initially inserted into the Endnote. After removing duplicate studies, titles and abstracts of 265 articles were assessed. In the next step, 2 researchers independently reviewed full-texts of 14 related studies in detail. Finally, 3 studies were selected for qualitative evaluation.
| 3 | 0biomedical
| 0Study
|
173,199 |
2,3-butanedione monoxime is only one way to inhibit cross bridge interactions, with other approaches including the use of different inhibitors such as N-benzyl-p-toluene sulphonamide (BTS; Pinniger et al., 2005), or chemical removal of troponin C (Joumaa et al., 2008). Because each method has its own limitations, it is important to repeat these fiber experiments with other cross-bridge inhibitors to compare with data from this study.
| 4 | 0biomedical
| 0Study
|
178,083 |
The quality of the sequences generated was evaluated using the FastQC tool. High-quality sequences (Phred score ≥ Q30) were trimmed on the Illumina iSeq 100 System at the time the FASTQ was generated. The data was de novo assembled on BaseSpace Cloud (Illumina) with the metaSPAdes genome assembler (Version 3.0). All assemblies were confirmed by mapping reads to contigs as previously described and using Geneious Prime software (Version 2020.2.1). The assembled contigs were examined in search of similarities to known sequences with BLASTN software using MegaBLAST . Sequences with E-values of ≤10−5 were classified as likely originating from a eukaryotic virus, bacteria, phages, eukaryote, or unknown, based on the taxonomic origin of the sequence with the best E-value as previously described . Open reading frames (ORF) predictions and genome annotations of the near-full-length genomes were performed using Geneious Prime software. The alignment of contigs and reads to a reference genome was used to generate the near near-full-length genomes using Geneious Prime software (Version 2020.2.1). Gene comparisons were performed with BLASTN (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 25 January 2021). Representative sequences of viruses belonging to the families Parvoviridae and Polyomaviridae were obtained from GenBank and aligned with the sequences identified in the present study using MUSCLE software . Phylogenetic trees were constructed using MEGA6 , applying the Neighbor-Joining (NJ) method through the p-distance model for Parvoviridae analysis and the Maximum-Likelihood (ML) method, General Time Reversible (GTR) model to Polyomaviridae family. All analyses were conducted with 1000 bootstrap replicates.
| 4 | 0biomedical
| 0Study
|
165,172 |
At the onset of the present study, only a few studies had been published using the Veggie Meter® and none in this specific population. As a result, refinement of the data collection protocol was required in order to collect these data more efficiently. At the first data collection time points, students were not asked to clean their hands prior to measurements and the index finger on the dominant hand was used. After the publication of more research using the Veggie Meter®, the protocol evolved to include hand cleaning and the use of the non-dominant ring finger . Since completion of this study, users of the Veggie Meter® worked together to create a comprehensive set of recommendations for use in different research settings . Future studies utilizing the Veggie Meter® in this population should follow these guidelines to ensure consistency with other research. When considering the feasibility of using the Veggie Meter® in school-based programs, being efficient with classroom time and minimizing how long students are away from learning is a critical consideration. With respect to other assessment methods that have been used to evaluate dietary intake, the Veggie Meter® can be a minimally disruptive choice; especially if youth are excused from class individually or in small groups as the measurements themselves only take about 60 s each. Previous SHCP research used FFQs with lengthy introductions and instructions therefore making this likely a time saving method, comparatively .
| 4 | 0biomedical
| 0Study
|
350,330 |
When categorizing the scores obtained by the athletes in two groups and seeking associations between a lower score and the appearance of a re-injury (x2), we found that they were significant for Questions 1, 4, 5, 6, 7,10 and for the total score (p < 0.05). In turn and as a measure of the permitted effectiveness , the relative risks (RR) were calculated to determine the association between the exposure (higher or lower score) and the event (re-injury or non re-injury). Only for Questions 4, 6, 7 and the total score was a significant risk detected (Table 5).
| 2 | 0biomedical
| 0Study
|
252,337 |
Rohr et al. (2016) identified the profile of pediatric globe injury in children under 15 who attended the Base Hospital in the Federal District between June 2012 and January 2013, of which only 20% had OGI (n = 103) . Vieira (2007) outlined the profile of 2844 patients treated during September 2003 at the same hospital, identifying that 62% of the patients were male, 17% were from other states, and 30% of the patients were due to eye injury . None of the two studies had the same focus as the present study, but they indicate the high frequency of eye injury in DF.
| 4 | 0biomedical
| 0Study
|
46,216 |
The analysis showed that the percentage of students classified as overweight did not change during the period among students in vocational subjects (χ22=4.909, p = 0.086), students with a specialization in general studies (χ22=2.000, p = 0.368), and students in sport subjects (χ22=3.000, p = 0.223). The percentages of students classified as overweight did not differ significantly with regard to the line of study at 14 years of age (χ22=3.436, p = 0.179) or at 16 years of age (χ22=4.956, p = 0.084), but they were significantly different with regard to the line of study at 19 years of age (χ22=8.502, p = 0.014). Figure 4 shows that students in vocational subjects had a higher percentage of students classified as overweight than the other groups at 19 years of age.
| 4 | 0biomedical
| 0Study
|
191,894 |
The number of people diagnosed with diabetes is rapidly increasing worldwide. The increase in the prevalence of diabetes is alarming as it can cause serious health complications, affecting the quality of life and even leading to death. Diabetes is not an acute disease that can be cured, but rather a chronic disease that requires effective continuous management. For diabetics, exercise burns calories, improves the effectiveness of diet, directly lowers blood sugar, prevents long-term complications, and relieves stress. Diet in diabetics should not be about reducing or limiting certain foods but about planning and practicing healthy eating habits. Regular eating habits as well as reducing the intake of simple sugars, such as sugar or honey that promotes increased blood sugar levels, as well as appropriate dietary fiber intake as it lowers blood sugar levels and blood lipid concentrations. In addition, it is important to maintain good nutrition by ingesting a variety of foods .
| 3 | 0biomedical
| 1Other
|
48,941 |
In addition to the need for provisioning, falling whale oil prices lead to the need to target species that could be of secondary commercial importance. The walrus boom of the mid‐ to late‐1800s resulted in the taking of upwards of 235,000 walruses by the American fleet with 90% of that occurring between 1867 and 1883 (Table S1, Bockstoce & Botkin, 1982), a total that represents the approximate modern census size of all walrus populations (Lowry, Kovacs, & Burkanov, 2008). Our data show 2,283 individual walruses being captured. Based on the 60%–70% capture efficiency presented in Bockstoce and Botkin (1982), the whalers in our data set killed a minimum of 3,192 walruses. Several forces led to the start of this walrus boom. Access to walruses was improved after The United States purchased Alaska in 1867, obtaining legal claim over the walrus populations therein. This period also coincided with reductions in bowhead whale populations and a steady market for walrus products (Bockstoce & Botkin, 1982). Walruses therefore temporarily offered monetary compensation for lost bowhead products. The period lasted approximately 20 years during which contemporary researchers and naturalists began to recognize how hunting by whalers posed a conservation threat to walruses and to the Indigenous communities that depended on them. Reports from the time indicate that as early as the 1880s, the walrus population had been reduced by at least 50%; Nelson et al. (1887) report: “it is only a matter of a few years when they (the walrus) will become comparatively rare where formerly abundant, and unknown in many of their former localities.” (p. 270). These early years of commercial hunting only portended additional cycles of overexploitation and recovery of walrus stocks (Fay et al., 1989).
| 4 | 2other
| 0Study
|
125,208 |
Depletion of lncRNA LINC00511 enhanced cell growth and invasion and reduced the apoptosis rate of CAOV3 cells . 17 beta-estradiol stimulation of ESR1 (ERα gene) increased the expression of lncRNA LINC00511, while the ESR1 inhibitor fulvestrant reduced expression of lncRNA LINC00511 in CAOV3 cells. It was predicted that lncRNA LINC00511 interacts with miR-424-5p and miR-370-5p via bioinformatics. These results suggest that ESR1-induced upregulation of lncRNA LIN00511 may promote proliferation and invasion of CAOV3 cells by regulating miR-424-5p and miR-370-5p.
| 4 | 0biomedical
| 0Study
|
150,838 |
This study was part of a cross-sectional study that examined exercise levels and patient-reported levels of masculinity, body image, and quality of life . Using the modified Godin Leisure Time Exercise Questionnaire , men able to achieve guideline levels of either aerobic or resistance activity (i.e., >150 min of moderate-to-vigorous aerobic exercise or > 2 days/week of resistance exercise, respectively) were considered active. Men exercising at levels below both aerobic and resistance thresholds were considered inactive . These definitions follow the American College of Sports Medicine (ACSM) guidelines for cancer survivors . Men who have previously participated in an exercise programming but did not continue with levels sufficient to be classified as active at the time of the study were considered inactive.
| 4 | 0biomedical
| 0Study
|
151,500 |
Gel mobility shift assay was performed as described by Bandyopadhyay with slight modifications. Briefly, E. coli cells were prepared as described earlier. Bacterial genomic DNA (gDNA) was extracted using an appropriate DNA extraction kit (Soleibao Biotechnology Co., Ltd., Beijing, China). An equal volume of BCp12 solution at different concentrations (0, 1, and 2 mg/mL) was added to 5.0 μL of gDNA, then incubated at 37 °C for 30 min. Electrophoresis was performed on agarose gel (1% mass fraction). DNA migration was visualized under UV illumination using a gel imaging system (Bio-Rad, Hercules, CA, USA).
| 4 | 0biomedical
| 0Study
|
179,933 |
A further limitation was the insufficient number of studies, which prevented completing statistical analyses that had initially been planned. We were unable to assess publication bias because there were less than 10 eligible studies addressing the same outcome in a meta-analysis. Subgroup analyses on LATAM countries (e.g., Brazil versus Argentina), and adults versus children were not possible since minimal criteria were not met (i.e., at least four studies available, with at least two in each sub-group).
| 2 | 0biomedical
| 0Study
|
130,700 |
Peer review. Radiological error and discrepancy are inevitable, but all possible efforts should be made to minimise significant error . One potential tool to achieve this is formal mandated submission of a percentage of every radiologist’s randomly-selected reports for second reading and peer review. Such systems are already in use in some countries . Although peer review adds somewhat to radiologist workload, with associated impact on staff resourcing, the ESR should advocate for its wider use, and the necessary resources to make it work, in the interests of patient safety and increased value. A key component of such peer review is establishment of an open and blame-free framework allowing radiologists share and learn from cases where error or discrepancy has occurred, without fear of sanction or legal consequences from such sharing [25, 27]. The ESR could encourage adoption of such practices (and the necessary legal protections and supports) across our member countries.
| 4 | 0biomedical
| 1Other
|
376,190 |
Knapp then suggested that Prop. K and Prop. L had been made equivalent and the Section would vote between them. Delegates would now discuss the two options as alternatives. There would be a vote to accept one of the Examples, which would be determined by a simple majority. The chosen Example would then be sent to the Editorial Committee with the understanding that they would add it to the Code. Knapp cautioned delegates to think about whether either of these proposals was contrary to something else in the Code. She suggested they be discussed rather than immediately voted upon.
| 1 | 2other
| 1Other
|
17,424 |
S. nigrum (Kakamachi) commonly known as black nightshade usually grows as a weed in moist habitats in different kinds of soils, including dry, stony, shallow, or deep soils and can be cultivated in tropical and subtropical agro-climatic regions by sowing the seeds during April-May in well-fertilized nursery beds. Description of S. nigrum is found in all Ayurvedic literature. This drug was explained the first time in Vedic Granthas and was also used in Samhita period, especially in the form of Shakdravya (vegetable). S. nigrum crude extracts, as well as its purified compounds, have been used in various animal models such as rat, mice, and chick.
| 2 | 0biomedical
| 1Other
|
211,005 |
This section includes the design of two B-DP mechanisms and their implementation algorithms. One is based on a classical LDP mechanism KRR, and the other is based on the newly constructed mechanism EXPQ in this paper. The number of domain values of both two mechanisms is more than 2. Moreover, we combine three data distributions with the typical non-uniformity and two B-DP mechanisms to directly show and analyze the two metrics proposed in this paper, including the point belief degree and the regional average belief degree.
| 2 | 2other
| 0Study
|
168,287 |
Schematic illustration of the analysis process. To delineate the diffusion tensor imaging (DTI) measures of the normal-appearing periependymal lining voxels, we analyzed the tissues as follows: (A) Using T1 imaging, we segmented the tissues into white matter, lateral ventricle (red), 3rd ventricle (blue), and 4th ventricle (green). (B) Then, we delineated the ventricle-lining voxels on the white matter mask using an open source MATLAB code25. (C) White matter lesion ROIs were manually drawn section by section on the T2-fluid attenuated inversion recovery (FLAIR) sequence. Then, the lesion masks were registered to T1 space, and both lesion mask and ventricular lining voxels in T1 space were registered to echo-planar imaging (EPI) space. (D) The figure shows the sagittal (upper), coronal (middle) and axial (lower) overlay of the periependymal lining voxels and the lesion masks on the nondiffusion-weighted image (B0). Red, lining voxels of the two lateral ventricles; Blue, lining voxels of the third ventricle; Green, lining voxels of the fourth ventricle; White, lesion masks.
| 4 | 0biomedical
| 0Study
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.