id
int32 0
398k
| text
stringlengths 204
42k
| educational_score
float32 1
5
| domain
class label 3
classes | document_type
class label 4
classes |
|---|---|---|---|---|
152,224 |
Likewise, all the subscales of the mental and kidney domains were significantly lower in the same group of poorest adequacy; findings confirming previously published data [49, 50], some of these subscales did not even show improvement after ameliorating the dialysis adequacy. It is worthwhile to note that the improvement in the mental health composite was two-fold higher than that in the physical health composite. This preferential improvement may possibly be ascribed to repeated patient-doctor interactions during the study which could raise the interest in the concept of quality of life among the patients. This might promote the doctors to pay more attention towards their patients’ psychological aspect during reassessment of the KDQol-SF.
| 4 | 0biomedical
| 0Study
|
244,553 |
More than 98% of transcriptional output is composed of non-coding RNAs (ncRNAs), which could regulate transcription, translation, epigenetic modification and various biological processes or diseases [, , ]. Circular RNAs (circRNAs), one emerging kind of ncRNAs with covalently closed loop structures formed by back splicing, exhibit high abundance, stability and tissue/stage specificity in the central nervous system (CNS) [, , , ]. Recently, accumulating evidence indicates that circRNAs expression profiles are significantly altered following acute CNS injuries, suggesting the close associations of circRNAs with the pathophysiology of SCI [, , , ]. This review highlights the characteristics and regulatory role of circRNAs in SCI, facilitating a further understanding of the pathogenesis of SCI and promoting the circRNA-based clinical applications.
| 4 | 0biomedical
| 2Review
|
351,440 |
Qualitative variables were compared using the chi-square test. The likelihood ratio test was used for data when the theoretical frequency was less than 5. The data are expressed as the mean ± standard deviation. Continuous variables were compared using ANOVA. If ANOVA indicated that there were differences between the three groups, the SNK (Student-Newman-Keuls) test was used for further verification. A P-value of < 0.05 was considered to be statistically significant. Statistical analyses were performed using SPSS software (version 19.0, IBM Corp, Armonk, NY). The study was reported following the STROCSS criteria.
| 4 | 0biomedical
| 0Study
|
269,916 |
The corrosion testing times and methods were chosen according to EN 13438. Since the SO2 resistance test only considers the evaluation of the damage on non-cut samples, while the GSB-ST requirements also require the evaluation of cut samples, despite the shorter testing time—the cut samples were also evaluated. The system tested was based on powder paints, which show good corrosion properties on aluminum substrates and are subjected to preliminary corrosion tests in IBDiM (Road and Bridge Research Institute, Warsaw, Poland) laboratory. For the purposes of publication and comparative research, the information on the coatings composition and preparation is confidential.
| 2 | 2other
| 0Study
|
28,926 |
Unfortunately, the majority of ORs is orphan, as the screening for ligands is highly complex and plethora of odorants exists. Not least because of the high number of potential odorants but also because of the obstacles of transfecting ORs in heterologous cell systems to screen for possible ligands, deorphanization of ORs is highly complicated. Due to the lack of an activating ligand for OR2B6, we cannot investigate the effect of the receptors functionality, which would be of great interest.
| 2 | 0biomedical
| 0Study
|
316,231 |
The time to the next exacerbation of COPD during the 180-day follow-up is defined as one primary outcome. The definition of exacerbation is deterioration of the cardinal symptom of dyspnea, increased sputum purulence and volume, and purulent sputum. This may be combined with one of the other symptoms: increased cough and wheeze, sore throat, nasal congestion due to cold, fever (oral temperature > 37.5 °C), increased cough, and increased wheezing. The above changes should last for ≥ 2 days at least. A minimum of 1 week between two exacerbations is needed in order for them to be considered as separate events. The duration of exacerbation is measured from the onset of acute exacerbation to a significant reduction which is defined as the symptoms return to the level before the exacerbation per the records in patients’ dairies. The diaries are distributed to participants during the treatment and after the treatment. Participants record changes of their symptoms and their health status by choosing the right description in terms of feeling. The primary symptom is measured with modified British Medical Research Council (mMRC) and COPD assessment test (CAT) scores. The days of exacerbation are calculated from the onset date of the primary symptom to the date when all symptoms disappear. The degree is classified as mild (treated with short acting bronchodilators only, SABDs), moderate (treated with SABDs plus antibiotics and/or oral corticosteroids), or severe (patient requires hospitalization or visits to the emergency room). Severe exacerbations may be associated with acute respiratory failure.The mean difference of CAT scores between day 6 or day 10 and baseline is another primary outcome. The CAT involves an 8-dimension measurement of health-status impairment in COPD. CAT is universally acknowledged as a reliable and valid measurement in evaluating the changes of COPD.
| 4 | 0biomedical
| 0Study
|
372,883 |
Flow chart for standard Nc dilution model (A) and the mNc dilution model (B). AGBlim and PNClim represent AGB and PNC corresponding to N limitation plots, respectively. AGBnon and PNCnon represent AGB and PNC corresponding to non-N -limitation plots, respectively. The k1 and k2 were parameters obtained by calibrating PNClim with AGBlim.
| 2 | 2other
| 1Other
|
327,828 |
Nigral degeneration in MSA-P is corroborated in our study by N1 loss, but it occurs without significant NM loss, by visual analysis. This contrasts to what has been described for PD in which there is both SN NM reduction (as also corroborated in our study) and N1 loss. Reimão et al. (2016) have shown that there is no technical interference of iron paramagnetic properties in the SN NM MRI signal, and the same study also suggested that NM loss and N1 loss in PD were independent mechanisms . Our findings in MSA-P, dissociating NM and N1 signals, also support the hypothesis that iron deposition and NM loss may be distinct and independent pathophysiological mechanisms.
| 5 | 0biomedical
| 0Study
|
186,142 |
The initial reduction of Au3+ by kenaf seed (KS) was confirmed through visual observation of the distinctive dark-purple coloration which arises due to the tiny dimensions of GNPs. At nanometer dimensions, GNPs expose both absorption and scattering effects, for example, an oscillation of the electron cloud at the surface of the nanoparticles resonates and absorbs electromagnetic radiation at a particular energy . This specific phenomenon known as surface plasmon resonance (SPR) which is not only depended on their size and shape, but also on various factors (solvent, temperature, and concentration) which can influence the exact frequency and band intensity. Generally, the dark-purple color appears when the synthesized GNPs possess a spherical shape with a size of less than 60 nm and the SPR peak demonstrates around 500–550 nm . Our synthesized KS@GNPs also manifested such dark-purple color after MWI (0.5 min) treatment (Figure 2A). Such color transformation is usually observed when a metal changes its oxidation state. Presumably, different functional groups present in plant extract caused rapid Au3+ reduction as well as contributing to the standard size and shape of GNPs production.
| 4 | 0biomedical
| 0Study
|
295,757 |
After 2 days of sexual development, wildtype and deletion strains did not produce any mdp/xpt metabolites (Figure 2—figure supplement 3). After 3 and 5 days, wildtype produced arugosin A (1) and the final xanthones emericellin (2), shamixanthone (3), and epishamixanthone (4) (Figure 2b, Figure 2—figure supplement 3, Supplementary file 2). As expected, loss of the first two enzymes of the biosynthesis MdpG and MdpF completely abolished the production of cluster metabolites. Deletion of the intermediate enzyme encoding genes mdpC and mdpL led to a loss of 1–4 but to the accumulation of the anthraquinones 2,ω-dihydroxyemodin (5), ω-hydroxyemodin (6) and emodin (7) in both strains and chrysophanol (8) in ΔmdpL. Deleting the biosynthetically final enzyme encoding genes mdpD, xptA, and xptB abolished the production of 1–4. ΔmdpD and ΔxptA accumulate the xanthones paeciloxanthone (9) and variecoxanthone A (10), respectively. ΔxptB accumulates the anthraquinone 5. In addition, these three strains accumulate some unidentified compounds. Deletion of xptC led to a loss of the final xanthones 3 and 4 but an increased accumulation of 2. After 7 and 10 days of sexual development, the accumulated emodins 5–7 of the deletion strains were decreased or even disappeared (Figure 2b, Figure 2—figure supplement 3), whereas the abundance of 8 increased and the xanthones 2–4 and 10 were still detectable in similar amounts as after 3 and 5 days.
| 4 | 0biomedical
| 0Study
|
190,475 |
All animals were sacrificed 11 weeks following the first STZ or PBS treatment and the following samples were harvested: 24 h urine, liver, heart, and kidney. Alongside, the following clinical data were recorded for each animal: total weight and blood glucose before STZ or PBS treatment and at sacrifice, urine volume and glucose concentration in 24 h collections before sacrifice.
| 3 | 0biomedical
| 0Study
|
27,549 |
The mB0 image of each subject was first linearly aligned to the T1 weighted image to match it spatially by using FMRIB’s Linear Image Registration Tool (FLIRT)14,35. Affine transformation measured with the FLIRT command was obtained and named \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${w}_{1}\cdots {w}_{N}$$\end{document}w1⋯wN. N is the number of subjects. Subsequently, the T1 weighted images of each subject were transformed to the MNI152-T1-2mm template by using FMRIB’s FLIRT and Non-Linear Registration Tools (FNIRT)36. Spline coefficients \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\varphi }_{1}\cdots {\varphi }_{N}$$\end{document}φ1⋯φN were obtained between T1 images and the MNI152-T1-2mm template (Fig. S1A).
| 4 | 0biomedical
| 0Study
|
323,172 |
Custom OA plates were used to genotype 960 individual An. gambiae and An. coluzzii mosquitoes at 54 tag SNP loci. The SNP call rate for one of the 54 loci fell below the 80% threshold (77.7%) and was eliminated from the panel (Figure S1). After filtering, the SNP call rate averaged 99.4% for the remaining 53 tags (range, 98.3–100%). Three specimens were dropped from analysis due to the belated determination that their cytogenetic genotypes were ambiguous. Four additional mosquito specimens were dropped from further OA analysis due to unacceptably low specimen call rates (ranging from 17.5 to 52.6%; Figure S1). The remaining 953 specimens had an average specimen call rate of 99.3% (range, 87.7–100%). The final number of OA tags per each inversion, and their approximate genomic position within the inversion, are shown in Table 1 and Figure 1.
| 4 | 0biomedical
| 0Study
|
192,886 |
Over the phone, the researcher explained the content of the Phone Pal study, covering the information described in the information sheet. Potential volunteers were invited to participate and were provided with an opportunity to discuss the study and ask questions. Information sheets were sent via e-mail. Individuals that met the inclusion criteria and maintained interest in the study were invited to meet the researcher in person.
| 2 | 0biomedical
| 0Study
|
241,637 |
In this study we have described an hiPSC-CM model of ARVC derived from a patient with a novel pathogenic mutation in DSG2 and demonstrated a distinct phenotype with altered DSG2 expression, enhanced inflammatory signaling, and electrophysiological aberrations compared with controls. The in vitro repolarization and conduction features correlated with the donor’s clinical features, and direct suppression of DSG2 in control CMs reproduced many of the mutant line’s most prominent phenotypic features. Our findings are generally consistent with observations of ARVC in human studies but differ in several aspects from other published hiPSC-CM models of the disease. This work contributes new evidence that in vitro models of ARVC vary in their behavior significantly, just as ARVC is known to present variably in patients, and underscores the challenge of defining ARVC in vitro in a way that is generalizable across models. Patient-specific hiPSC studies offer the opportunity to systematically investigate this phenotypic variation, which could allow investigators to identify pathophysiological pathways that are common across the disease and to develop broadly useful therapies. Such studies could also provide important insight into attributes of ARVC and other forms of ACM that are specific to different pathogenic variants, aiding the design of more narrowly targeted treatments.
| 4 | 0biomedical
| 0Study
|
173,217 |
Deep reinforcement learning is a representative intelligent machine learning algorithm, and adversarial learning can increase the stability and robustness of the model trained by reinforcement learning . They provide new research ideas for multi-agent pursuit–evasion decision-making. In this section, adversarial learning, the DRL-based DDPG algorithm, and the MADDPG algorithm are introduced.
| 2 | 2other
| 1Other
|
134,132 |
Representative growth data from the 3D scanner. a Plant height, b projected plant area, c total plant surface area, d convex hull canopy volume, e plant area index and f week-to-week area based relative growth rate (RGR) across 5 weeks. In panels a–e, solid lines and shaded regions represent genotype means ± SE (n = 5); whilst dashed lines represent individual plants. The main graphs of b–d are presented on a logarithmic scale, with non-log data shown in the inset graphs. In f the violins represent the range of RGR for each genotype each week, points are individual plants. Colours represent the three commercial genotypes Genesis Kalkee (yellow), PBA Hattrick (blue) and PBA Slasher (pink)
| 3 | 0biomedical
| 0Study
|
114,642 |
In patients with a history of PG or PSPG, the clinician or surgeon should always elucidate the mode of previous treatment, its efficacy, and note whether the patient has had subsequent trauma or surgical procedures with this treatment in place. Commonly, patients with known PSPG can be placed on high-dose pulsed oral steroids prior to further procedures to safely avoid new manifestations of PG at the new surgical site (level IV evidence).13 Alternatively, Zakhireh et al14 described stabilization with cyclosporine prior to the treatment of pyoderma wounds with split-thickness skin grafts. While the former study looked at the ability to operate on separate sites in the future, the latter study utilized immunosuppression in combination with grafting to heal primary PG wounds.
| 4 | 0biomedical
| 2Review
|
337,128 |
The term on the right-hand side of (2.12) is a computable error estimate, which has been investigated more closely in Sect. 3. It can also be interpreted in an alternative way. To this end we again proceed from the integral representation (2.8),6.1\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} L_m(t)v = \int _0^t \underbrace{E(t-s)\,D_m(s)}_{=:\;\varTheta _m(s,t)}v\,\mathrm {d}s. \end{aligned}$$\end{document}Lm(t)v=∫0tE(t-s)Dm(s)⏟=:Θm(s,t)vds.Due to \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \Vert D_m(t)v \Vert = {{\mathscr {O}}}(t^{m-1}) $$\end{document}‖Dm(t)v‖=O(tm-1),\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \tfrac{\mathrm {d}^j}{\mathrm {d}\,s^j}\,D_m(s)v\big |_{s=0} = 0, \quad j=0,\ldots ,m-2, \end{aligned}$$\end{document}djdsjDm(s)v|s=0=0,j=0,…,m-2,and the same is true for the integrand in (6.1),\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \tfrac{\partial ^j}{\partial s^j}\,\varTheta _m(s,t)v\big |_{s=0} = 0, \quad j=0,\ldots ,m-2. \end{aligned}$$\end{document}∂j∂sjΘm(s,t)v|s=0=0,j=0,…,m-2.Analogously as in , this allows us to approximate (6.1) by a Hermite quadrature formula in the form6.2\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \int _0^t \varTheta _m(s,t)v\,\mathrm {d}s \approx \frac{t}{m}\,\varTheta _m(t,t)v = \frac{t}{m}\,D_m(t)v. \end{aligned}$$\end{document}∫0tΘm(s,t)vds≈tmΘm(t,t)v=tmDm(t)v.From (2.10),\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \frac{t}{m}\,D_m(t)v = \tau _{m+1,m}\,\gamma _m\frac{(\sigma t)^{m}}{m!}\,v_{m+1} + {{\mathscr {O}}}(t^{m+1}), \end{aligned}$$\end{document}tmDm(t)v=τm+1,mγm(σt)mm!vm+1+O(tm+1),which is the same as (2.12). This means that the quadrature approximation (6.2) approximates the leading error term in an asymptotically correct way. From (6.2), (2.9) and (3.1a) we obtain6.3\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \Vert L_m(t)v\Vert _2 \approx \tau _{m+1,m}\frac{t}{m}|\delta _m(t)|. \end{aligned}$$\end{document}‖Lm(t)v‖2≈τm+1,mtm|δm(t)|.The quadrature error in (6.2) is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${{\mathscr {O}}}(t^{m+1}) $$\end{document}O(tm+1). It is useful to argue this also in a direct way: By construction, the Hermite quadrature formula underlying (6.2) is of order m, and its error has the Peano representation (cf. also )6.4\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \frac{t}{m}\,\varTheta _m(t,t) - \int _0^t \varTheta _m(s,t)v\,\mathrm {d}s = \int _0^t \frac{s\,(t-s)^{m-1}}{m!}\, \tfrac{\partial ^{m}}{\partial s^{m}}\,\varTheta _m(s,t)v\,\mathrm {d}s. \end{aligned}$$\end{document}tmΘm(t,t)-∫0tΘm(s,t)vds=∫0ts(t-s)m-1m!∂m∂smΘm(s,t)vds.Here, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \tfrac{\partial ^{m}}{\partial s^{m}}\,\varTheta _m(s,t)v = {{\mathscr {O}}}(1) $$\end{document}∂m∂smΘm(s,t)v=O(1), because \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \tfrac{\mathrm {d}^{m}}{\mathrm {d}s^{m}}\,D_m(s)v = {{\mathscr {O}}}(1) $$\end{document}dmdsmDm(s)v=O(1) which follows from \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ D_m(s)v = {{\mathscr {O}}}(s^{m-1}) $$\end{document}Dm(s)v=O(sm-1). This shows that, indeed, the quadrature error (6.4) is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ {{\mathscr {O}}}(t^{m+1}) $$\end{document}O(tm+1). Furthermore, a quadrature formula of order \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ m+1 $$\end{document}m+1 can be constructed by including an additional evaluation of\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \tfrac{\partial }{\partial s}\,\varTheta _m(s,t)v\big |_{s=t} = D_m^{}(t)v, \quad \text {with} \quad D_m^{}(t) = \tfrac{\mathrm {d}}{\mathrm {d}t} D_m(t) - \sigma A\,D_m(t). \end{aligned}$$\end{document}∂∂sΘm(s,t)v|s=t=Dm(t)v,withDm(t)=ddtDm(t)-σADm(t).A routine calculation shows6.5\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \int _0^t \varTheta _m(s,t)v\,\mathrm {d}s = \frac{2\,t}{m+1}\,D_m(t)v - \frac{t^2}{m(m+1)}\,D_m^{}(t)v + {{\mathscr {O}}}(t^{m+2}), \end{aligned}$$\end{document}∫0tΘm(s,t)vds=2tm+1Dm(t)v-t2m(m+1)Dm(t)v+O(tm+2),where the error depends on \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$ \tfrac{\mathrm {d}^{m+1}}{\mathrm {d}s^{m+1}}\,D_m(s)v = {{\mathscr {O}}}(1) $$\end{document}dm+1dsm+1Dm(s)v=O(1). This may be considered as an improved error estimate5 which can be evaluated using\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \tfrac{\mathrm {d}}{\mathrm {d}t} D_m(t)v = \sigma ^2 \tau _{m+1,m}\,e_m^*(T_m\,\mathrm{e}^{\sigma \,t\,T_m})e_1 v_{m+1}. \end{aligned}$$\end{document}ddtDm(t)v=σ2τm+1,mem∗(TmeσtTm)e1vm+1.With the solution in the Krylov subspace, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\mathrm{e}^{\sigma \,t\,T_m} e_1$$\end{document}eσtTme1 with \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$e_m^*\mathrm{e}^{\sigma \,t\,T_m} e_1 = (\mathrm{e}^{\sigma \,t\,T_m} e_1)_m$$\end{document}em∗eσtTme1=(eσtTme1)m, we can compute the derivative of the defect at \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\mathscr {O}}(1)$$\end{document}O(1) cost,\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \tfrac{\mathrm {d}}{\mathrm {d}t} D_m(t)v&= \sigma ^2 \tau _{m+1,m}\,e_m^*(T_m\,\mathrm{e}^{\sigma \,t\,T_m})e_1 v_{m+1} \\&= \sigma ^2 \tau _{m+1,m}\,\big ((T_m)_{m,m}\, (\mathrm{e}^{\sigma \,t\,T_m} e_1)_m + (T_m)_{m,m-1}\, (\mathrm{e}^{\sigma \,t\,T_m} e_1)_{m-1}\big )v_{m+1}. \end{aligned}$$\end{document}ddtDm(t)v=σ2τm+1,mem∗(TmeσtTm)e1vm+1=σ2τm+1,m((Tm)m,m(eσtTme1)m+(Tm)m,m-1(eσtTme1)m-1)vm+1.Also longer expansions may be considered, for instance\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} \int _0^t \varTheta _m(s,t)v\,\mathrm {d}s&= \frac{3\,t}{m+2}\,D_m(t)v - \frac{3\,t^2}{(m+1)(m+2)}\,D_m^{}(t)v \\&\quad + \frac{t^3}{m(m+1)(m+2)}\,D_m^{}(t)v + {{\mathscr {O}}}(t^{m+3}),\\&\quad \text {with} \quad D_m^{}(t) = \tfrac{\mathrm {d}}{\mathrm {d}t} D_m^{}(t) - A\,D_m^{}(t), \end{aligned}$$\end{document}∫0tΘm(s,t)vds=3tm+2Dm(t)v-3t2(m+1)(m+2)Dm(t)v+t3m(m+1)(m+2)Dm(t)v+O(tm+3),withDm(t)=ddtDm(t)-ADm(t),etc. This alternative way of computing improved error estimates is worth investigating but will not be pursued further here.
| 4 | 0biomedical
| 0Study
|
252,883 |
The limitations of this study are as follows. First, acupoint specificity is the main factor affecting the efficacy of EA therapy, in both clinical and animal studies. Our previous study found that 10 Hz EA treatment at the GV20 and ST36 acupoints can effectively and consistently induce cell pyroptosis. In this study, we found that the same treatment improved neuroplasticity; however, whether the excitatory neurotransmitter OxA is the main regulator of relevant biological changes needs to be further explored. Second, due to invasive detection methods such as adenovirus injection and microdialysis, we were unable to guarantee the survival of SAMP8 mice in the OxA RNAi group in the preliminary test. Therefore, the formal experimental protocol is not involved in behavioral and other related studies in the OxA RNAi group. Third, since the GV20 acupoint is on the head and the ST36 acupoint is on the legs, the exact pathway by which this nondrug therapy alleviates learning and memory deficits is unclear. The transmission of EA signals delivered at two relatively distance points to the hippocampus affects the translation of proteins related to the cAMP/PKA/CREB signaling pathway. Recently, a landmark study from Q. Ma's team uncovered that electroacupuncture at ST36 points can drive the vagus nerve-adrenal anti-inflammatory pathway and play a role in inhibiting inflammation. A class of PROKR-CRE-labeled DRG sensory neurons was revealed, which laid a neuroanatomical foundation for the existence of ST36 acupoint specificity. However, the neuroanatomical basis of the acupoint specificity of GV20 is still unclear and how the combined treatment of ST36 and GV20 plays a synergistic role in improving cognitive function needs to be further explored.
| 4 | 0biomedical
| 0Study
|
266,441 |
During the COVID-19 quarantine, a rise in the prevalence of anxiety and depression symptoms has been reported in comparison with the prevalence in general population prior to the pandemic (15). Several systematic reviews and meta-analyses show that the prevalence of anxiety and depressive symptoms varies between 6.33 and 50.9% and 14.6 and 48.3%, respectively, during the peak of the pandemic (16–23). Although previous studies (15, 24) and studies performed during the pandemic (16, 18, 23) have suggested that women may be more affected by symptoms of anxiety and depression than men, this does not correlate with some systematic reviews during the COVID-19 peak (19, 20), and some studies have even found that men have more anxiety symptoms (25). These controversial findings could be due to sociocultural aspects that do not allow extrapolation of these results in LAC countries. Similarly, people of non-binary gender have a high prevalence of disorders related to mental health (26). A multicenter study in countries in Europe and Southeast Asia suggested that mental health disorders increased during the pandemic (27). However, as with results in women, sociocultural aspects do not allow their extrapolation in countries in Latin America.
| 4 | 0biomedical
| 2Review
|
171,121 |
Bodyweight was recorded upon arrival (10 weeks of age), just before treatment (16 weeks of age), and 1 week after treatment. Bodyweight was not significantly changed between treated and vehicle mice in both sexes (Figure 6). Bodyweight changes are indicators of adverse side effects, and especially a loss of more than 10% of the initial bodyweight is a bad sign .
| 2 | 0biomedical
| 0Study
|
219,794 |
However, the potency ratio is often not constant for two drugs under consideration (Grabovsky and Tallarida, 2004; Geary, 2013; Lederer et al., 2018). A non-constant potency ratio results in two predicted additive effects for each dosing combination, as illustrated in Figures 3A,B. Accordingly, there will be two curved isoboles—two apparently equally valid, but different, predicted results. Loewe himself noted this was a likely outcome (Loewe, 1953). As posited by others, the fact that the linear isobole assumption fails for many drugs may have gone largely ignored due to the metaphorical descriptions Loewe used (Tallarida, 2007), or perhaps due to influential reviews in the field in support of the linear isobologram whose mathematical bases have since been shown to contain errors (Geary, 2013). Others have developed models for interaction analysis that allow for multiple isoboles (Grabovsky and Tallarida, 2004). However, these models are also specific for data that fit to a Hill-slope equation, and as such they are not appropriate for data that do not fit well to this equation. In sum, most existing applications of Loewe Additivity’s principles, including the widely-used Chou-Talalay method, incorporate a constraint—that there must be only one predicted additive effect. The DE/ZI method releases this constraint and calculates both predicted additive effects that result from Loewe Additivity.
| 5 | 0biomedical
| 0Study
|
37,494 |
Children were categorized into the following regional groups, based on their mother’s birth country: United States, Asia, Eastern Europe, Western Europe and Canada, Africa (excluding Somalia), Central and South America and the Caribbean, and Oceania/Other. Somalia and Mexico, the two largest groups of foreign-born mothers of children in the sample, were considered separately. All analyses were performed using statistical software. Statistical significance was set at p<0.05, using two-sided tests. Multivariate logistic regression models were adjusted for the following variables: maternal age, race, and educational attainment. These were then used to estimate unadjusted and adjusted odds ratios for up-to-date vaccinations recommended at ages 2, 6, 18, and 36 months, comparing children with at least one foreign-born parent with children with two U.S.-born parents.
| 2 | 0biomedical
| 0Study
|
58,626 |
The strengths of our findings should be interpreted in light of limitations. In the state of Acre, during the rainy season (from October to May) the condition of unpaved roads is poor. As a consequence, field studies were only carried out in the dry season. In urban areas, sympatric domestic dogs have restricted space and movements, depending on care and food given by their owners. Management of domestic dogs in rural landscapes is difficult because they often are allowed to roam freely and the size of local dog population is unknown. Although the owners reported they owned one or more dogs, we were unable to collect feces directly after being deposited by the dogs because they were absent during our visit or defecated elsewhere.
| 2 | 0biomedical
| 0Study
|
206,403 |
In this contribution, we will assess such anomalies in the phase data and the instantaneous (single-epoch) real-time kinematic (RTK) performance of two Samsung Galaxy S20 and two Google Pixel 4 smartphones, all forming their individual RTK baselines. In our model and different from other studies above is that all parameters will be unlinked in time, and the benefit of using the instantaneous RTK model is that it then becomes insensitive to cycle slips. For all analysed baselines we will make use of several hours of data with a one second measurement interval, so that our conclusions will be statistically significant. As a part of our analysis, we will explicitly investigate two setup configurations, namely having the smartphones in an (i) upright and (ii) lying down position, while tracking GNSS signals from both external and internal antennas. This is motivated by the fact that we want the internal smartphone antennas to be as uninfluenced from the surrounding environment as possible to minimize possibility of signal interference or other effects coming from the poor antenna gain of the smartphones .
| 4 | 2other
| 0Study
|
268,320 |
These patterns of functioning reveal the difficulty for the partners to free themselves from this vicious circle that gradually separates them at the emotional level. The second part, “The Adversity Is Not Unbearable, But Going It Alone Would Be,” illustrates how, for other couples, the awareness, at least partial, of this vicious circle allows them to wind back the relationship issues linked to the worsening of the symptoms. These couples, who otherwise might have allowed themselves to be overwhelmed by the disease, are more inclined to readjust and try to preserve their own identity, independent of their assigned role in the health process. This readjustment would make it possible, on the one hand, to alleviate the feeling of burden in the assisting partner (Tan et al., 2012) and, on the other hand, to maintain the autonomy and place of the afflicted partner outside their “status as a patient.” In these couples, the partners feel close to each other and display a sense of “collaboration” (Hodgson et al., 2004; Fergus and Skerrett, 2015; Smith and Shaw, 2017).
| 3 | 2other
| 2Review
|
295,452 |
By increasing the squeezing speed of the upper plate improve the velocity profile, it is because the velocity gradient is falling near the channel wall for η<0.5, while vertical velocity f′(η) is rising, due to narrowing the channel of the flow for the value η>0.5.
| 4 | 0biomedical
| 0Study
|
242,130 |
Common clinical features of LPLD include recurrent abdominal pain, acute pancreatitis, hepatosplenomegaly, eruptive xanthomas and lipemia retinalis. Some of these symptoms can be fatal for the patient, but none occurred in our patient. We attribute this to the early detection. The combination of results from biochemical examinations and genetic sequencing provides a clear direction for clinical diagnosis. More importantly, it has also led to early diagnosis and proper intervention. For LPLD patients, palliative treatment and medical nutrition therapy are commonly given depending on symptoms. Blood lipid-lowering medicines such as bezafibrate are usually administrated to negatively regulate blood lipid concentrations (Bezafibrate Infarction Prevention, 2000). The maintenance of plasma TGs at less than 11.30 mmol/L (1000 mg/dl) could prevent severe complications such as severe pancreatitis, further preventing the high morbidity and mortality rate (Garg and Rustagi, 2018). In the current case, the concentrations of plasma TGs and CHOL in the patient sharply declined under the action of bezafibrate and levocarnitine. Since this early and proper administration of drugs, the patient’s lipid levels are maintained at a normal level while severe complications did not occur. Meanwhile, medium-chain TGs are also recommended for daily diet, as they could be absorbed directly into the portal vein independent on chylomicrons (Burnett et al., 1993).
| 4 | 0biomedical
| 0Study
|
157,519 |
The strain gauge incorporates the resistance change linearly with deformation in its sensitive grids . During the measurement process, strain gauges sense the elastomeric strain and translate it into a change of resistance value. The term to describe the correlation between these two variables is called gauge factor (GF), which is defined as the ratio of the relative resistance change (RRC) to the strain : (1)GF=ΔR/Rε where the ΔR/R is RRC in strain gauges, and ε is the corresponding strain.
| 4 | 0biomedical
| 0Study
|
36,253 |
In order to verify the specificity of the detected antibodies fluid phase, competition, solid phase and antigen blocking assays were performed, which resulted in inhibition of absorbance (OD), as shown in Table 3. In the fluid phase assay the percentage of inhibition increased with elevated concentrations of hrSAA or hrSAA1α preincubated with sera samples from two HBDs. When using the competition assay, we outcompeted the human anti-SAA and anti-SAA1α within two human sera with increasing concentration of pooled rabbit anti-SAA antibodies. In the solid phase inhibition assay, serially diluted sera samples from two HBDs were transferred from one well to another and lowered levels of autoantibodies were detected by the in-house anti-SAA and anti-SAA1α ELISAs. The antigen blocking assay showed that preincubation of antigen with pooled polyclonal rabbit antibodies against SAA also resulted in the lowering of OD on ELISA.
| 4 | 0biomedical
| 0Study
|
122,714 |
a The photoswitchable protein Dendra2 was fused to Httex1-Q46 to measure autophagy flux. Brief irradiation with short-wave-length visible light causes Dendra2 to undergo an irreversible conformational change (“photoswitch”) and emit red fluorescence that can be tracked until altered Httex1-Q46-Dendra2 is cleared. Scale bar is 10 µm. b Primary astrocytes were transfected with Httex1-Q46-Dendra2 and an empty plasmid (control, cont), or with Httex1-Q46-Dendra2 and a plasmid that encodes Beclin1 (Becl), or with Httex1-Q46-Dendra2 and a plasmid that encodes SK1 (SK1). Beclin1 was used as a positive control. After a “photoswitch,” astrocytes were longitudinally imaged. The change in the red fluorescence intensity over time was used to calculate the half-life of Httex1-Q46-Dendra2. The single-cell half-life of Httex1-Q46-Dendra2 was significantly reduced by SK1 expression. Fifty astrocytes per group were analyzed from two independent experiments. ***p (control vs Becl) = 0.0001, ***p (control vs SK1) = 0.0001; p (Becl vs SK1) = 0.255 (one-way ANOVA). n.s. not significant
| 5 | 0biomedical
| 0Study
|
268,601 |
Transforming growth factor beta (TGF‐β) isoforms, including TGF‐β1, TGF‐β2 and TGF‐β3, are 25‐kD secreted homodimeric signalling proteins. 1 TGF‐β isoforms exert their biological effects through initiating the TGF‐β signalling. Two of mature TGF‐β constitute a homodimer and then bind to transmembrane receptors TGF‐β receptor type I (TβRI) and TGF‐β receptor type II (TβRII) to form a heterotetramer, where TβRI is phosphorylated by TβRII. The phosphorylated TβRI not only activates Smad protein (SMAD)‐independent cascades but also promotes SMAD‐dependent cascades by phosphorylating receptor‐regulated SMADs (including SMAD2 and SMAD3), which subsequently form active SMAD complexes with SMAD4 and regulate the transcription of target genes, such as type I collagen alpha‐1 (COL1A1), vascular endothelial growth factor A (VEGFA) and interleukin‐17A (IL‐17A). 1 , 2 , 3 , 4 Recently, accumulated evidence indicated that activated TGF‐β signalling is involved in various cellular processes, such as cell recognition, differentiation, proliferation and apoptosis. 3 However, the role of different TGF‐β isoforms in the development of liver disease induced by hepatitis C virus (HCV) infection and the underlying mechanisms remain largely unclear.
| 5 | 0biomedical
| 0Study
|
283,268 |
All these results point to the UK as being a very typical prosperous EU country when it comes to ethno-religious prejudice generally, and specifically to prejudice against immigrant/foreign workers. A well-established indicator of prejudice—the desire to shun a certain type of person as a neighbor—shows that the British levels of prejudice against immigrant/foreign workers and people “of a different race,” Hindus, Jews, Gypsies, and especially Muslims are all relatively low. Moreover, British prejudice levels are just where they would be expected to be based on the general pattern of prejudice and socioeconomic development within the EU. They are also generally close to the other Anglophone countries. We find a general pattern of high prejudice and desire to discriminate in the less advanced countries with a strong decline in these emotions with socioeconomic development (to which the UK conforms) as predicted by the hierarchy of needs/post-materialist approach (Maslow, 1943; Inglehart, 1981; Inglehart and Welzel, 2010).
| 1 | 2other
| 0Study
|
114,138 |
Unstandardized coefficients of the peak VO2 change term [95% confidence interval] are presented after controlling for age, sex and education. Lean mass was lost for 1 individual due to equipment malfunction; only 57 people completed imaging at both timepoints. p<0.05*, p<0.01**.
| 3 | 0biomedical
| 0Study
|
314,211 |
Protein analysis was completed using Western blot analysis. Protein samples were extracted from cells using RIPA Lysis and Extraction Buffer (Thermo Scientific, Waltham, MA, U.S.A.), and then BCA Protein Assay Kit (Thermo Scientific, Waltham, MA, U.S.A.) was used for the quantitative analysis of protein. Twenty micrograms of protein lysate samples were separated adopting 10% SDS/PAGE. Then the protein samples were transferred on to polyvinylidene fluoride membrane (PVDF) (0.45 µm pore size; EMD Millipore, Billerica, MA, U.S.A.), and then blocked by 5% skim milk powder at room temperature for 2 h. Next, the membrane was incubated with specific primary antibodies at 4°C overnight. Adopted primary antibodies were from Abcam: anti-p-MEK1 antibody (1:5000, rabbit monoclonal antibody, ab96379), anti-p-ERK antibody (1:1000, rabbit polyclonal antibody, ab74032), anti-p38 MAPK antibody (1:10000, rabbit polyclonal antibody, ab197348), anti-p-JNK antibody (1:1000, rabbit polyclonal antibody, ab4821), anti-MEK1 antibody (1:5000, rabbit monoclonal antibody, ab32091), anti-ERK antibody (1:100, rabbit polyclonal antibody, ab137619), anti-MAPK antibody (1:1000, mouse monoclonal antibody, ab185145), anti-JNK antibody (1:1000, rabbit monoclonal antibody, ab179461) and anti-GAPDH antibody (1:10000, mouse monoclonal antibody, ab8245). GAPDH was employed as an internal control. Later, the membranes were incubated with secondary anti-rabbit IgG antibody (1:2000, Abcam, ab190492) at room temperature for 2 h. Band gray was analyzed using Chemi Genius gel imaging system.
| 4 | 0biomedical
| 0Study
|
16,011 |
We further study the impact of the graphene number on the bandwidth broadening of the designed PSR. As shown in Fig. 5(a), more graphene layers leads to a broader bandwidth for the PSR. This is because the ERI has a larger tunability when more graphene layers are involved18. It should be noted that the electric field of the TE mode is strongest at the centre of the waveguide. As a result, the graphene layer in the middle has the largest contribution to the variation of the ERI, while the graphene layers on the upper and lower sides have the smaller influence on the ERI. This is why the growth rate of the operation bandwidth is decreased with an increase in graphene number [Table 1]. In addition, we have investigated the influence of the gap distance between every two adjacent graphene layers on the performance of the PSR [Fig. 5(b)]. For three different gap distances between every two adjacent graphene layers (10, 20, and 30 nm), the resultant device performance is almost kept unchanged, indicating that this design is very robust to the fabrication variation.Figure 5Wavelength dependence of the PSR with the TM mode input. (a) Wavelength dependence for different number of graphene layer (1, 3, 5 and 7). (b) Wavelength dependence for three different gap distances between every two adjacent graphene layers for the PSR with 7-layer graphene embedded. In each case, the chemical potential of graphene is optimized to make the phase-matching condition precisely satisfied for the ADC. Table 1Bandwidth of the PSR before and after the optimization of graphene’s chemical potential.Number of graphene layerBandwidth of CE TM-TE > −0.5 dB before optimizing μ c (nm)Bandwidth of CE TM-TE > −0.5 dB after optimizing μ c (nm) L(μm)054—10.31546110.43577710.55598410.87588611.1
| 4 | 0biomedical
| 0Study
|
65,531 |
In this section, we present experiments to evaluate the proposed semi-supervised active learning methods. Firstly, we describe the 6 systematic review datasets which we used in our experiments. Secondly, we define the evaluation metrics for assessing the citation screening methods. Finally, we compare our method against two existing active learning approaches across the 6 evaluation datasets.
| 2 | 0biomedical
| 0Study
|
40,412 |
As introduced in Algorithm 2, we first calculate the matching directions of all matches according to Equation (11). Then, the code of every match is determined by: (12)Ci=floor((θiR−θminR)/θwidR)+1 where θiR is the matching direction of the ith match, θminR is the minimum of all matching directions, and θwidR is coding width. Experiments showed that we obtain the best results when θwidR = 0.01. Finally, we calculate the histogram of matching direction. When the ratio of its maximum to secondary maximum is more than α (typically, α=1.2), we save the matches with code corresponding to the maximum. Algorithm 2. Mismatch Elimination Based on Matching Direction1. Calculate the matching direction of each match.2. Encode every match using its matching direction.3. For every code, count the number of matches with this code to create the histogram of matching direction.4. Find the maximum value of histogram M1 and the secondary maximum value M2.5. If M1>α⋅M2, save the matches with code of the maximum; otherwise, abandon all.
| 4 | 0biomedical
| 0Study
|
153,109 |
Given previous work showing that T-independent B cell production of antibodies can protect against B. burgdorferi infection (20, 21), we sought to better characterize the phenotype of the unmutated IgM memory B cell subset. We found that unmutated IgM memory B cells, defined as having less than 1% mutation frequency, could not be detected in uninvolved skin from any subject. To confirm that unmutated IgM memory B cells were not misclustered naive B cells, we examined the expression of genes that may distinguish these subsets. We analyzed the entire gene expression profile of the unmutated IgM memory B cell subset (https://doi.org/10.5281/zenodo.4711465) compared with other memory B cells for genes associated with those reported previously for naive B cells (16). We did not find any naive B cell genes among the set of significantly DEGs. For example, among the marker genes CD27, CD23, and IL-4R, only IL-4R was observed to be more highly expressed among unmutated IgM memory B cells compared with other memory B cells, but this was not significant after FDR correction (IL-4R, paired t test P = 0.005, P = 0.053 after FDR correction; Figure 6, A and B). CD27 expression was not downregulated in the unmutated IgM memory B cell subset (P = 0.838).
| 5 | 0biomedical
| 0Study
|
236,575 |
HT29 (colorectal adenocarcinoma), U87 (glioblastoma), and MCF7 (breast cancer) and immortalised human umbilical cord endothelial cell lines (EC‐RF‐24, Applied Biological Materials, Canada) were maintained in 10% FCS (Sigma) supplemented DMEM and RPMI (Lonza), respectively. For EV isolations, 30% FCS was depleted of EVs by ultracentrifugation overnight (SW32 rotor, BeckmanCoulter, 100.000 RCF). The origins of the cell lines were authenticated by STR analysis (Identicell, Denmark). Hypoxia exposure experiments were performed using a modular atmosphere controlled system (Don Whitley Scientific). Cells were exposed to hypoxia for 16–20 h over night. Doxycycline‐inducible (1 μg/ml) shRNA targeting the 3′UTR of GABARAPL1 [5′TTACCTTACTTCATACTTGCCC 3′] or control shRNA (scrambled) [5′CGAGGGCGACTTAACCTTAGG 3′] was achieved through lentiviral pTripZ (Thermo Scientific) expression. Independent doxycycline inducible hairpins targeting the GABARAPL1 coding sequence were expressed using pLKO.1 based lentiviral expression (5′ACAGTGATGAGAGTGTCTATG 3′). GABARAPL1 knockdown was induced 3 days prior to experiments. Reintroduction of the wild type GABARAPL1 coding sequence was achieved through expression in pQCXIH backbones using lentiviral transduction. The pBABE‐puro mCherry‐EGFP‐LC3B was a gift from Jayanta Debnath (Addgene plasmid # 22418). Expression was achieved through retroviral transduction.
| 4 | 0biomedical
| 0Study
|
107,508 |
Autonomic dysfunction, also called dysautonomia, paroxysmal sympathetic hyperactivity, autonomic storming, or sympathetic storming, can be due to alterations in the hypothalamus in children with SNI. Symptoms include tachycardia, hyperthermia, flushing of skin, abdominal pain, vomiting, bowel dysmotility, constipation, urinary retention, excessive sweating, increased salivation, posturing, and agitation .
| 3 | 0biomedical
| 1Other
|
318,099 |
Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)
| 1 | 2other
| 1Other
|
237,894 |
An explanation for the lowest obtained OAR doses of the ART3 approach can be found in the way the SBRT treatment planning template was built. It prioritized a sparing of the OARs over maximum target coverage, while ART1 and ART2 approaches aimed at a reconstruction of the initial target coverage . Thus, a full re-optimization is only recommended for daily situations in which target structure deformations require large re-shaping of the MLC or OAR unexpectedly move into high dose areas. This outcome is in-line with findings of previous studies [45, 46] and, of course, dependent on the applied PTV margin .
| 4 | 0biomedical
| 0Study
|
311,162 |
Summary of scrapie transmission results in VRQ/ARQ and ARQ/ARQ sheep IC inoculated with varied blood components (i.e. macrophages, B-cells, or platelets) derived from two different donor sheep, B54 and S300. Genotype refers to recipient sheep that were either PRNP homozygous (ARQ/ARQ) or heterozygous (VRQ/VRQ) at codon 136. Shading highlights all positive results.
| 4 | 0biomedical
| 0Study
|
83,731 |
Having focused primarily on the neuroanatomy ASD at the mesoscale, we move on to discuss microscopic findings which may point towards the cellular and developmental basis of these neuroanatomical abnormalities and are likely to underlie some of the pathophysiological alterations in brain circuitry associated with ASD.
| 4 | 0biomedical
| 0Study
|
140,722 |
The loss of Pten induces cardiomyocyte hypertrophy,[ 48 ] and DNA methylation has been described to control cardiomyocyte genes in cardiac hypertrophy.[ 39 ] In our study, cardiomyocytes derived from Pten−/− ESCs showed larger cell size (Figure S9e,f, Supporting Information). The rescue of deficiency in cardiomyocyte differentiation by Dnmt3l−/−/Dnmt3b−/− suggests the Pten−/− ‐induced Dnmt3 may be involved in the regulation of cardiomyocyte hypertrophy. We measured the cell size of cardiomyocytes derived from Dnmt3l/Dnmt3b‐overexpressed (Dnmt3l/Dnmt3b‐OE) ESCs and found that Dnmt3l/Dnmt3b‐OE potently promoted the cell size of cardiomyocytes (Figure S9g,h, Supporting Information). In contrast, Dnmt3l−/−/Dnmt3b−/− rescued the hypertrophy induced by Pten deletion (Figure S9i,j, Supporting Information). These results indicate that Pten−/− ‐induced hypertrophy might be caused by the induction of DNMT3. We also identified DMRs in the context of mCG, mCHG, and mCHH when comparing the methylomes of WT and Pten−/− cardiomyocytes and EBs (Figure S10a,b, Supporting Information). Cardiac disease‐related signaling pathways were enriched when comparing the DMR‐related genes of WT and Pten−/− cardiomyocytes in the context of mCHG (Figure S10c, Supporting Information). These data indicate that cardiac development is regulated by DNA methylation, which is modulated by Pten.
| 5 | 0biomedical
| 0Study
|
188,358 |
This method is used to indirectly determine the number of the remaining unmodified lysine residues after the cross-reaction . TNBSA in 0.1 M aqueous buffer at pH 8.5 was added to a 20 mM peptide solution in H2O and the reaction was stirred for 2 h at 37 °C. The reaction mixture was quenched with a solution of 1 N HCl. Reaction with primary amines was observed by producing a chromogenic yellow colored derivative and the absorbance was recorded in the ultraviolet light at 335 nm using an Infinite M200 Pro plate reader (Tecan). Absorbance curve resulting from TNBSA assay was monitored at 0, 2, 4, 6, 8 and 24 h. All measurements were carried out in triplicate in 1 cm path length micro-fluorescence cells and processed with OriginPro using Boltzmann fitting.
| 4 | 0biomedical
| 0Study
|
203,221 |
Representation of main mechanisms of bacterial resistance against phage infection (from left in a clockwise sense). 1. (A) Phage recognizes bacterial membrane receptor and can carry out infection; (B) alterations in receptors are produced by mutations and prevent phage from recognizing receptor, so it Will not infect bacteria; (C) bacteria can block recognition by producing inhibitors that bind to receptors. 2. Production of exopolysaccharide or extracellular matrix. 3. OMVs are composed of membrane lipids, membrane proteins, and periplasmic components. Some bacterial species use them as a decoy against phages as a defense mechanism. 4. (A) Bacteria block injection of DNA from other phages, acquiring Sie systems through prophages with this type of protein; (B) once bacterium has prophage in its genome with proteins that code for Sie system, it will be able to block entry of DNA from other phages. 5. (A) R–M system distinguishes between methylated and unmethylated DNA. Restriction enzymes cannot cut methylated DNA, which is also a protection system for bacterial DNA; (B) if phage DNA is not methylated, this system can cut injected DNA. 6. CRISPR-Cas system is an adaptative defense system, which recognizes phage DNA sequences, incorporates them into system, and then produces enzymes that are capable of recognizing these sequences to cut them. 7. PICI system is found in bacterial genome and induced by helper prophages to produce mature phage particles that assemble PICI system itself to kill infected cells and to be able to spread this system to adjacent cells. 8. (A) One of most characterized Abi systems is toxin–antitoxin system. Under normal conditions, bacterium expresses both proteins equally, so cell death does not occur; (B) When organism is subjected to stress situations, such as phage infection, toxin is highly expressed in comparison with antitoxin, causing cell death, which consequently produces a reduction in phage replication.
| 5 | 0biomedical
| 2Review
|
124,695 |
In addition to research on HCC and NAFLD in this meta-analysis, Peter et al. determined HSD17B13:TA (rs72613567) variant by allelic discrimination real-time PCR in 586 Wilson’s disease (WD) patients. They get the conclusion that the HSD17B13: TA allele modulates the phenotype and outcome of WD. This allele likely ameliorates hepatic fibrosis and reduces the transition from copper induced hemolysis to fulminant disease in patients with WD.
| 4 | 0biomedical
| 0Study
|
340,141 |
The ability of ADSC-derived beige adipocytes to undergo elevated rates of uncoupled mitochondrial respiration and fatty-acid oxidation under basal and stimulated (+FSK) conditions was evaluated. Oxygen consumption rates (OCR) and extracellular acidification rates (ECAR) were used as readouts to determine respiratory and glycolytic rates, respectively (Fig. 3a, b). These analyses showed that beige adipocytes have significantly higher basal (Fig. 3a, c) and maximal (Fig. 3a, d) rates of mitochondrial respiration as well as significantly higher rates of glycolysis (Fig. 3b) compared with human ADSC-derived WA (Fig. 3a, b). As expected, the mitochondrial respiration and glycolytic responsiveness of beige adipocytes to FSK was significantly greater than that for WA (Fig. 3a, b). Basal and maximal respiration rates were also significantly elevated in beige cells compared with white adipocytes (Fig. 3c, d). Most importantly, the basal level of uncoupled respiration (proton leak) was fivefold higher in beige adipocytes compared with WA. Following stimulation with FSK, uncoupled respiration increased by 64.7% relative to basal conditions (Fig. 3e). These data demonstrate that beige adipocytes are metabolically distinct from WA in vitro and have a metabolic capacity for elevated glucose oxidation and uncoupled respiration, similar to that described for thermogenic adipocytes in vivo33.Fig. 3Metabolic activity of ADSC-derived beige adipocytes in vitro.a Oxygen consumption rates (OCR) following the Seahorse Mito Stress Test assay in beige adipocytes compared with white adipocytes (WA). Cells (ASC52telo) were stimulated with forskolin (FSK, 20 μM) for 24 hours prior to treatment, and oligomycin (3 μM), FCCP (3 μM) and antimycin A/rotenone (5 μM each) were added at indicated time points. Assays were normalized to total protein content. b Extracellular acidification rates (ECAR) of samples in a. c–e Basal respiration rate, maximal respiration rate and proton leak calculated from Seahorse assay performed in a. f Lipolysis assay for ADSCs and ADSC-derived beige adipocytes, either untreated or treated with FSK for the indicated times. g Immunoblotting of whole-cell lysates (25 μg) from ADSCs and ADSC-derived beige adipocytes ± FSK (1 hr, 20 μM). All data are presented as mean ± S.D. and representative of 10 biologically independent replicates. p values were calculated by unpaired two-tailed Student’s t test.
| 4 | 0biomedical
| 0Study
|
39,434 |
For examining PDF action on translating ribosomes, we have developed an assay for monitoring deformylation by PDF of N-formylated nascent peptides, based on radioactively labelled RNCs carrying f[35S]Met at the N terminus of the nascent peptide (Methods section). The extent of deformylation was measured by quantifying [35S]Met and f[35S]Met on TLC plates following proteinase K (PK) digestion of the nascent peptide (Methods section; Supplementary Fig. 1).
| 4 | 0biomedical
| 0Study
|
126,592 |
The ability of SARS-CoV-2 S protein to mediate fusion between the viral particle and the cellular membranes during virus entry has been largely studied and documented; however, there is recent evidence that the spike protein is also responsible for fusion of infected cells with neighboring uninfected cells [59, 68]. This process, known as ‘fusion from within’, is mediated by newly synthesized S protein reaching the cell surface, fusing with receptor-positive adjacent cells, and causing the formation of giant multi-nucleated cells (syncytia). Cell–cell fusion is used by different viruses, including the Pneumovirus RSV (Respiratory Syncytial virus), the measles virus (MV) and the human immunodeficiency virus (HIV) , to spread in a particle-independent way and promoting immune evasion .
| 4 | 0biomedical
| 0Study
|
49,964 |
We now focus on the rate by which a given spreading event propagates across the network, which we quantify as \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\,{S}_{r}=\frac{{S}_{n}}{t}$$\end{document}Sr=Snt, where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${S}_{n}$$\end{document}Sn refers to the spreading event size and t refers to the average number of simulation steps needed for all nodes affected (within that spreading event) to switch state from ‘non-affected’ to ‘affected’ (which is a variation of survival probability)37. As such, we define the average propagation rate, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\tilde{S}}_{r}^{{\rm{avg}}}$$\end{document}S˜ravg as the propagation rate for each spreading event, averaged across all events, and the maximum propagation rate, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\tilde{S}}_{r}^{{\rm{\max }}}$$\end{document}S˜rmax, as the propagation rate for the single largest spreading event.
| 4 | 0biomedical
| 0Study
|
108,651 |
Our study demonstrated that bst1Δ/Δ mutant strain could be recognized by the host innate immune cells and thus induced stronger immune responses. Neutrophils contribute to the initial response against fungi, and play a critically important role in individuals who are neutropenic or immunosuppressed323334. We demonstrated that neutrophils could kill bst1Δ/Δ mutant strains more efficiently, and produced more ROS when challenged (Fig. 5C). After encountering microbial pathogens, host macrophages secrete cytokines and chemokines and engulf the pathogens in phagosomes35. Not only did bst1Δ/Δ mutant strains elicited an enhanced recognition by macrophages, but an increased cellular responses of macrophages was observed. This response included Syk phosphorylation, activation of NF-κB and MAPK signaling, and triggering cytokine production (TNF-α, IL-6, IL-12p40, and IL-10) (Fig. 5A,B). IL-6 and IL-23 (consists of IL-12 p40 and p19) are key cytokines leading to the induction of Th17 cell differentiation36. TNF-α and IL-6 participate in the innate immune response against Candida infection by promoting neutrophils production and activation. Increased levels of these inflammatory cytokines may result in a recruitment of innate immune cells such as neutrophils to the infected organs to clear fungi. Using a peritoneal infection model, we demonstrated that the marked elevation of chemokines in peritoneal cavity stimulated by bst1Δ/Δ mutant strain resulted in an obvious recruitment of neutrophils and monocytes (Fig. 6). Besides β-(1,3)-glucan recognition by Dectin-1, mannan recognition by Dectin-2/Dectin-3 is important in resistance to fungal infection273738. The present study indicated that deletion of BST1 in C. albicans resulted in decreased mannose content and a more remarkable exposure of β-(1,3)-glucan on the cell surface. Based on our present result, it could not determine that the change of mannan or exposure of β-(1,3)-glucan contribute to the altered host immune responses. The role of mannan recognition and glucan recognition in the altered immune responses induced by bst1 mutant is worth to be further investigated.
| 5 | 0biomedical
| 0Study
|
66,434 |
Relationships of radiation to PM2.5 (a), profiles of temperature anomaly (b) and water vapor maxing ratio (qv) anomaly (c) under high (HA, PM2.5 ≥ 75 μg cm−3) and low aerosols (LA, PM2.5 < 75 μg cm−3), and relationships of PM2.5 (d), qv (e), RH (f) to PBL.
| 2 | 2other
| 1Other
|
210,156 |
Protein lysates from cortical neurons, 3xTg-AD mice and human brains were separated by SDS-PAGE using 7.5% Tris-Glycine polyacrylamide gels (Bio-Rad). Electrophoresis was conducted in a Tris-Glycine buffer (25 mM Tris, pH 8.3, 192 mM glycine, 0.1% SDS in dH2O) by using the Criterion cell system (Bio-Rad). Blots were developed with rabbit anti-NR2B (1:1000, Millipore, #AB1557P), rabbit anti-pSer1303NR2B (1:1000, Millipore, #07-398), rabbit anti-NR2A (1:1000, Millipore, #AB1555P), rabbit anti-PSD95 (1:500, abcam, #ab18258), mouse anti-synaptophysin (1:500, Millipore, #MAB329), rabbit antiphosho PKC (1:1000, Cell Signaling, #9371), rabbit anti-PKC (1:1000, abcam, #ab179521) and rabbit anti-β-actin (1:5000; Sigma-Aldrich, #A2066). Secondary antibodies conjugated with horseradish peroxidase (HRP) were purchased from Sigma (1:5000, sheep antimouse-HRP #A6782, goat antirabbit-#HRP A6154).
| 4 | 0biomedical
| 0Study
|
126,658 |
Comparisons of the CP-scores of the resection specimens and the TMA cores clearly demonstrate that surface biopsies are suitable to determine the true PD-L1 status. Surprisingly, TMA cores of the invasive front of the carcinoma were not representative and showed reduced sensitivity. However, an adequate number of surface biopsies is required to achieve valid results. Here, the combined analysis of four surface biopsies yielded a PD-L1 distribution similar to the resection specimen and best test characteristics with a sensitivity of 0.733. Using fewer biopsies reduced sensitivity and would result in false-negative results in a clinical setting. If just one tumor-bearing biopsy was analyzed, the proportion of positive cases (CPS ≥ 1) would drop to 49.8% while the sensitivity would be 0.566. The proportion of false-negative samples would increase to 30.8% compared to 18.1% for four biopsies. The preoperative biopsies also showed reduced PD-L1 prevalence and sensitivity, which is likely related to the limited number of tissue particles per case.
| 4 | 0biomedical
| 0Study
|
351,653 |
The data corresponding to the percentage of callus induction, dry biomass of cell suspension cultures, total phenolics and flavonoids content, and the inhibition percentage of the mycelial growth were subjected to a normality test and then an analysis of variance (ANOVA), followed by Tukey’s multiple range test (p = 0.05). SAS 9.0 software (SAS Institute, Inc., Cary, NC, USA) was used for the statistical analysis. All experiments were conducted in triplicate.
| 4 | 0biomedical
| 0Study
|
200,811 |
OA is a frequent chronic orthopedic degenerative disease . Due to the limited understanding of the molecular mechanism of OA, available OA treatments are limited to pain relief or joint replacement [23, 24]. A large number of studies have proved that cytokines and growth factors produced by articular cartilage under the action of mechanical and physical and chemical factors such as trauma, inflammation and infection contribute to OA pathogenesis. They are closely related to the functional changes of the synovial membrane, cartilage, and so on [25, 26]. In this study, we used surgical DMM and IL-1β to induce in-vivo and in-vitro OA models and found that overexpressing miR-30b-5p accelerated the OA articular cartilage damage by boosting the contents of IL-1β, TNF-α, MMP3, MMP13 and NLRP3 inflammasomes (Figure 10).
| 4 | 0biomedical
| 0Study
|
100,601 |
Fig. S5‡ illustrates the photographs of G1 microfluidic strips wicking fluids with different viscosities (1.0–10.0 mPa s). The effect of having branched channels on the movement of the fluid front was also tested. As the number of branches was increased from 1 to 4 at a constant main strip width of 2 mm, wicking distances among these strips were comparable within 20 s while and decreased by 14% with increasing number of branches within 20 to 60 s (Fig. 2c). Fig. 2d shows the fabricated paper-based microfluidic devices with different number of branches. The G1 matrix consists of cellulose with porous structure having a particle retention value of 11 μm (Fig. 2e). Fig. 2f shows the photographs of the paper-based microfluidic devices as the Rhodamine B solution (10 mmol L–1) was wicked from the main channel. The optimized paper-based microfluidic device with four branches allowed the transport of fluid samples (<20 μL) from the inlet to the branches under 1.5 min (Fig. S6‡).
| 4 | 0biomedical
| 0Study
|
119,928 |
The graphics represent the values of δ13C in starch of leaves of (A) 26 DAS WT (Col-0) and aps1 plants, and (B) 22 DAS WT (Ws-2) and pgi1-2 plants exposed to 13C enriched CO2 for 5 hours and then chased for 15 additional hours. Plants were cultured in growth cabinets under long day (LD) conditions. The grey area indicates the 13CO2 pulse period. Starch content in leaves is shown in S4 Fig. Values represent the means ± SE determined from three independent experiments using 6 plants in each experiment.
| 4 | 0biomedical
| 0Study
|
127,297 |
Consequently, the use of SABAs by athletes in the winter and summer Olympic Games from 2002 to 2010 was higher in endurance sports such as cycling (17.2%) or Nordic combined (12.9%) than in ski jumping (3.1%) or boxing (1.7%) . Harmful substances found in inhaled air, added to heavy ventilation, might increase the probability of asthma. For example, chloramine is known to be harmful to the airways, which might explain why synchronized swimming is affected by asthma . Similarly, skaters have a high prevalence of respiratory pathologies that might be explained by the quality of the air inhaled in skating rinks due to ice resurfacing machines, which produce carbon monoxide, nitrogen dioxide, and fine and ultra-fine particles .
| 4 | 0biomedical
| 0Study
|
76,447 |
When the intracellular concentrations were decreased and allowed to vary between 0.01 μM and 50 mM, the gene encoding a serine palmitoyl transferase (E.C. 2.3.1.50) was incorrectly predicted as non-essential . The essential function of the ATP:UMP and ATP:GMP phosphotransferases (E.C. 2.7.4.4 and E.C. 2.7.4.8) was only lost when the lower bound of the intracellular concentrations was reduced four and ten orders of magnitudes, respectively, with reference to 1 μM. The available kinetic data, such as the Michaelis constant KM, provides a measure of the substrate concentration required for effective catalysis to occur. The KM of the enzymes usually varies between 10−1 and 10−7 M. The KM values found in the literature indicate that metabolite concentrations of 1 fM are not physiologically relevant, which further supports the essential function of the P. falciparum genes predicted with TFA and generic concentration ranges.
| 5 | 0biomedical
| 0Study
|
305,870 |
Patient 6 (Table 1) died on 6/2019 after multimodal long-term treatment of NF2-associated complications by respiratory paralysis in order to compression of the brainstem by incurable vestibular schwannomas. The patient was immediately transferred from the place of death to the Department of Legal Medicine and an autopsy was carried out the next day by a forensic pathologist with more than 40 years of experience.
| 2 | 0biomedical
| 3Clinical case
|
51,820 |
Recently, we introduced a chiral-at-metal iridium(iii) complex as novel type of chiral Lewis acid in which the octahedral iridium center is irreversibly cyclometalated by two achiral bidentate ligands in a propeller type fashion and thereby provides the sole source of chirality (Δ-Ir in Fig. 1).3,4 We here now wish to report for the first time that rhodium can also serve as the combined source of centrochirality and Lewis acidity in substitutionally labile octahedral metal complexes. Unexpectedly, despite the well established significantly higher coordinative lability of rhodium(iii) over iridium(iii), the substitutionally labile, reactive rhodium catalyst retains its absolute and relative configuration in solution over many days without any signs of isomerisation. Importantly, for most of the investigated transformations, the rhodium catalyst is superior to its isostructural iridium congener, which can at least in parts be attributed to the faster ligand exchange kinetic of the rhodium complex, permitting higher turnover frequencies and turnover numbers.
| 4 | 0biomedical
| 0Study
|
335,717 |
The Polish Polish Emotional Speech Database (PESD) was prepared and shared by the Medical Electronics Division, Lodz University of Technology. The database consists of 240 samples recorded in the aula of the Polish National Film Television and Theater School in Lodz. Samples were collected from separate utterances of 8 professional actors/actresses (4 male and 4 female). Each speaker was asked to utter five different sentences (They have bought a new car today, His girlfriend is coming here by plane, Johnny was today at the hairdresser’s, This lamp is on the desk today and I stop to shave from today on) with six types of emotional load: joy, boredom, fear, anger, sadness, and neutral (no emotion). Audio data was collected in the form of wav audio files (44,1 kHz, 16 bit). The samples were evaluated by 50 subjects through a procedure of classification of 60 randomly generated samples (10 samples per particular emotion). Listeners were asked to classify each utterance into emotional categories. The average emotion recognition rate was 72% (ranging from 60 to 84% for different subjects).
| 4 | 0biomedical
| 0Study
|
11,821 |
Effects of IL-17A on excitability and on TTX-resistant and TTX-sensitive Na+ currents in isolated and cultured DRG neurones. (a) Testing of the excitability of a neurone using a ramp-shaped current injection protocol. After application of IL-17A the first action potential appeared at a shorter latency (indicating that less current was necessary) and more action potentials were elicited during the ramp. (b) top: voltage-clamp recording from a control DRG neurone showing no increase of TTX-R Na+ currents between 5 min (5′, top, left) and 9 min (9′, top, right), bottom: voltage-clamp recording from another neurone showing an increase of TTX-R Na+ currents at 5 min after bath application of IL-17A. (c) I/V curve of control neurones (n = 10) at 5 min and at 9–12 min of recording. (d) I/V curve of control neurones (n = 11) before (5 min) and 5–7 min after bath application of IL-17A. (e) Normalised peak conductance (G/Gmax, open symbols) and steady-state inactivation (I/Imax, filled symbols) before (5 min) and 5–7 min after bath application of IL-17A.
| 4 | 0biomedical
| 0Study
|
231,676 |
A total of 17 unique regimens were available for analysis, including the following drugs and doses: bedaquiline (BDQ, B) 25 mg/kg, ethambutol (EMB, E) 100 mg/kg, isoniazid (INH, H) 10 mg/kg or 25 mg/kg, linezolid (LZD, L) 100 mg/kg, moxifloxacin (MXF, M) 100 mg/kg, rifampin (RIF, R) 10 mg/kg, pretomanid (Pa) 100 mg/kg, and pyrazinamide (PZA, Z) 150 mg/kg. Treatments were administered orally once per day on a 5 out of 7 days per week dosing schedule in all studies, except for one study that dosed moxifloxacin 100 mg/kg twice daily for a total daily dose of 200 mg/kg. Regimen designations were assigned based on standard abbreviations for regimen components with regimens containing an initial 2-month (8-week) intensive phase followed by a separate continuation phase delineated by a “/” according to the convention (i.e., HRZE/HR). Treatment duration in months was included as the independent, continuous variable for the analysis.
| 4 | 0biomedical
| 0Study
|
335,774 |
When the place of injury was reported, the home was the most commonplace in all age groups. Likewise, data form Alharthy et al. shows that most burn injuries (35%) are typically sustained at the home compared with 2.7% that occurred outside the home. . This implies a need for greater responsibility for parents and guardians in the prevention of childhood injuries. Home safety for children is not a well-covered issue neither by health care workers nor by other related parties in this community. More has to be done to raise public awareness and to implement trauma preventive measures at homes and public places.
| 2 | 0biomedical
| 1Other
|
10,855 |
Correlation between FOIAS and cJADAS10 was moderate (P2, β = 0.42 (p = 0.002)), as well as correlations with physician’s global assessment of disease activity (P2, β = 0.38 (p = 0.005)). FOI PVM correlated moderately with CRP level (β = 0.48 (p = 0.0001)). There was no correlation between FOIAS and CHAQ or between FOIAS and patient-reported outcome measurements of pain and fatigue.
| 4 | 0biomedical
| 0Study
|
40,585 |
Another limitation of the current study concerns the relatively small sample size, which may limit the generalizability of this study. Even though the size of the sample was consistent with several other within-subject studies, due to the difficulty in recruiting women in specific phases of the ovulatory cycle (Derntl et al., 2008, 2013; Cantú et al., 2013; Kaighobadi and Stevens, 2013; Wu et al., 2014), we are fully aware that further larger studies are required to confirm these results.
| 4 | 0biomedical
| 0Study
|
256,543 |
A: Relationship between the adapted systemic inflammation score (aSIS) and OS. Loge(HRs) plots of the OS rate in aSIS 0 (low) and aSIS 1, 2 (high) groups are shown. B: Kaplan–Meier curves for OS in patients with esophageal squamous cell carcinoma, according to the aSIS stratification. The upper panel includes patients who did not receive any preoperative treatment. The lower panel includes patients who received preoperative treatment. aSIS, modified systemic inflammation score; OS, overall survival; HRs, hazards ratio
| 4 | 0biomedical
| 0Study
|
266,453 |
Authorization was obtained from the University of Maryland to carry out the study and the institution that provided access to the analyzed database. The database was downloaded without identifiers of the survey participants, safeguarding the non-identification of participants.
| 1 | 0biomedical
| 1Other
|
21,004 |
The root mean square fluctuation (RMSF) reveals the fluctuation of certain residues during simulation process around its average position, which is also a tool to assess the dynamics stability of system. Here, RMSF values of Cα atoms in the last 50 ns were calculated by employing the first parallel trajectory of each system. RMSF of DC3 residues were shown in Figure 4A to explore the stability of the DC3. It can be seen that, different from the great fluctuation in other systems, DC3 residues in system 2 experienced minor motions. It demonstrated that DC3 in system 2 showed obvious superiority in the stability. RMSF of AR residues in these four systems were compared with apo-AR system (made up by AR only) to determine whether the binding of DC3 affects the stability of AR. As shown in Figure 4B, the overall RMSF of system 2 is lower than apo-AR system, especially the residues 840-870 (corresponding to H9, loop 843-849, H10), 880-905 (corresponding to H10, H11, loop888-893, H12). Moreover, only in apo-AR system and system 2, the RMSF values of all residues were under 10Å. Whereas, residues in other systems showed apparently larger conformational changes comparing to apo-AR system. These results demonstrated that the combination of DC3 to AR in site 2 (corresponding to Helix 11, loop 888-893, Helix 12) could stabilize androgen receptor. However, DC3 combination in other sites could visibly reduce AR stability. These RMSF analyses indicated that site 2 is the most possible site of DC3 binding to AR.
| 4 | 0biomedical
| 0Study
|
56,891 |
Using the RT-PCR, immunoblot and flow cytometric analyses, we revealed that mifepristone elicited a concentration-dependent decrease in CXCR4 expression at the levels of mRNA, cell surface proteins and total proteins at the presence and absence of SDF-1 (Figure 1). As downstream signalings of the SDF-1/CXCR4 chemokine axis, Akt and ERK were CXCR4-dependent cell survival factors . Through suppression of CXCR4 expression, mifepristone down-regulated the intracellular expression of Akt, ERK, p-Akt and p-ERK in ovarian cancer cell lines (Figure 2A). The overall reduction in the ratios of p-Akt/Akt and p-ERK/ERK resulted in the inhibition by mifepristone of cell viability in the presence and absence of SDF-1 (Figure 2).
| 4 | 0biomedical
| 0Study
|
240,425 |
In Germany, the Vespidae are represented by four subfamilies, including the Eumeninae, Masarinae, Vespinae, and Polistinae. A recent study of the latter subfamily revealed substantial BIN divergence in some species (Schmid-Egger et al. 2017). In the present release we included representatives of all German Polistes species to provide a complete dataset of German Vespidae. In addition, the Asian Hornet Vespavelutina Lepeletier, 1836 was included, a species that has recently been introduced into Germany (Witt 2015), and the Oriental Hornet Vespaorientalis Linnaeus, 1771 from south-eastern Europe. The dataset also includes DNA barcodes of the rare northern species Dolichovespulapacifica (Birula, 1930) (Figs 20–22, 26). The species occurs in Northern Europe, southwards to central Sweden, and in northern Russia east to the Far East. With these additions included, the present dataset comprises all Western Palaearctic species of social wasps (Vespinae and Polistinae).
| 4 | 0biomedical
| 0Study
|
143,299 |
Compared with flame-retardant EP monomer, flame retardant curing agents are easily prepared and flexibility, and these have become a hot research area . Recently, some flame retardant curing agent, such as P-modified Schiff-base, anhydride, aliphatic amine and imidazole, have been prepared to flame retard EP resins. For instance, Huo et al. synthesized a DOPO-modified Schiff base curing agent (PBI) from 9,10-dihydro-9-oxa-10-phosphaphenanthrene-10-oxide (DOPO), 2-aminobenzothiazole and 1H-Imidazole-4-carbaldehyde for EP. The EP modified with PBI showed good flame retardance (UL-94 V-0; LOI ≥ 36%) and heat resistance. Liang et al. developed a P-containing anhydride curing agent (BPAODOPE) for EP, and the EP/BPAODOPE system passed a V-0 rating when the phosphorus content reached to 1.75 wt%. Zhao et al. prepared a phosphaphenanthrene/triazine-containing anhydride curing agent (TDA) that showed higher flame retardance than BPAODOPE at the same phosphorus content, which was attributed to the synergism of triazine and phosphaphenanthrene.
| 4 | 0biomedical
| 0Study
|
306,584 |
The pre–post studies by Huang et al. , Eshaghi et al. , and Maheshwari et al. investigated the effect of VDS on sleep quality assessed by the PSQI. All three trials showed a significant improvement in overall sleep quality with VDS. However, the three trials were heterogeneous and did not contain ample information allowing pooling; hence, performing a meta-analysis of their results was impossible.
| 4 | 0biomedical
| 2Review
|
200,089 |
Since pain is a leading cause of morbidity and disability worldwide and may contribute to adverse health outcomes in children with ASD , it is important to understand pain in ASD and the potential influence of parental mental health on interpretation of reports of child pain. We sought to explore a relationship between ASD and parental reported child pain, with further consideration of the presence of parental MHCs as a contextual factor using data from the combined 2016-2017 NSCH.
| 4 | 0biomedical
| 0Study
|
343,998 |
To achieve more accurate risk prediction of this complex disease, we developed a Random Forest machine learning approach to quantify the power of different combinations of pathogenicity-associated elements (classifiers) to predict the source of isolates (carriage/disease) from their genome. A simple analysis, in which all isolates were used to train the model, achieved a classification accuracy of 76.9%. Among the classifiers that provided the most accurate prediction were elements in a gene associated with polymyxin resistance (ugd90) and a gene participating in the oxidative pentose phosphate metabolic pathway (gnd47,91) located in the highly recombinant rfb region associated with the avoidance of host defence systems92. This may be explained by the use of polymyxin in the treatment of colibacillosis in poultry production93 and HGT among strains, and provides clues about the functional basis of the pathogenicity-associated elements. However, as APEC emerges in multiple E. coli lineages, generalising the risk prediction method required that the training and test datasets were phylogenetically distinct. Focussing on the ST-117 lineage, that is thought to be an emergent bird pathogen49 achieved a risk prediction accuracy of 72.7% when the model was trained on phylogroups A, B1 and B2. This suggests that relatively few ‘global’ pathogenicity markers may provide a basis for risk prediction and that model training on ever larger reference genome datasets may have potential for early identification emergent APEC in healthy flocks to inform targeted interventions.
| 4 | 0biomedical
| 0Study
|
122,929 |
Percentage of FoxP3+ (a,b) and of FoxP3+CD39+ cells (c,d) within naïve and memory Treg cells. MFI of FoxP3 in naïve (e) and memory (f) Treg cells. Blue dots: healthy donors (n = 12); red dots: MS patients (n = 13). Statistical comparisons were performed by Student’s unpaired T test. Significant values: **p < 0.005, ***p < 0.001, ****p < 0.0001.
| 4 | 0biomedical
| 0Study
|
56,564 |
Investigating shape changes in mitochondria may help elucidate their dynamic behavior in cardiac health and disease. Deficiencies in proteins which regulate the shape of cardiac mitochondria induce a range of cardiac pathologies, including susceptibility to ischemia/reperfusion injury, dilated cardiomyopathy, heart failure, left ventricular hypertrophy, and vascular smooth muscle cell‐induced atherosclerosis (Zhou et al. 2010; Chen et al. 2011, 2012a; Papanicolaou et al. 2012; Ikeda et al. 2015; Lim et al. 2015; Hall et al. 2016), highlighting the importance of mitochondrial morphology in the normal functioning of the adult heart. In spite of being a 3D structure, organelles such as mitochondria are often quantified using 2D approaches, thereby ignoring their 3D structure (Boyce et al. 2010). 2D quantification is unable to accurately measure 3D morphometric parameters. Additionally, cardiac mitochondria extend along and across the myofibers and hence disparate parts of the same mitochondria may appear as different individual mitochondria in one single 2D plane. Therefore, 3D evaluation of mitochondrial shape can reaffirm the results of 2D analysis and rectify any bias that may rise from the 2D quantification of mitochondrial shape.
| 5 | 0biomedical
| 0Study
|
193,744 |
1. In the Abstract section, the authors claim that "… the detection of cancer-related fusion circRNAs…". However, the authors did not provide any data or literature suggesting that the fusion circRNAs they identified by circFL-seq are really "cancer-related" or biologically meaningful. The claim needs to be revised or proved.
| 3 | 0biomedical
| 1Other
|
175,960 |
In addition to single-turnover target DNA cleavage in cis, Cas12a proteins can carry out non-specific multi-turnover degradation of ssDNA in trans via their RuvC domain23–26. This occurs because Cas12a remains in an activated state after the crRNA-target DNA duplex is formed and target-bound Cas12a RNP persists post-cis cleavage. Based on structural analysis it has been proposed that ssDNA should be the only substrate for trans nuclease activity as it can fit in the active site of the activated crRNA-FnoCas12a RNP, but dsDNA would have steric clashes25. Despite this, trans nuclease activity of LbaCas12a was reported to affect dsDNA as well23,24,55. It has been proposed that the partially single-stranded nature of negatively supercoiled DNA and fraying at the ends of linear dsDNA explain why dsDNA appears to be affected by trans nuclease activity27. Our work shows that there are differences between Cas12a orthologs that impact trans nuclease activity. We show that the tolerance of mismatches between crRNA and target DNA varies between the orthologs (Fig. 9). All orthologs produced trans nuclease activity with most of the single-nucleotide substitutions spanning the target sequence, although Cme and Yme showed slightly more discrimination at a few positions. This result is perhaps not entirely surprising as the lack of discrimination towards single-nucleotide substitutions has necessitated the design of guide RNAs with intentional mismatches to differentiate between sequences with single-nucleotide polymorphisms in detection assays with Cas12b proteins56. In contrast to single substitutions, a strong discrimination against double substitutions at many positions was observed. Surprisingly, Lba primarily tolerated double substitutions proximal to PAM region and discriminated against those distal from the PAM, whereas the opposite was true for Yme. In addition, Fno and Cme discriminated against the majority of double substitutions while Asp largely tolerated all except those between positions 15 and 18. These results highlight the underlying diversity between Cas12a orthologs and the need to carefully design and test guide RNA-target DNA combinations for assays that utilize trans nuclease activity.
| 5 | 0biomedical
| 0Study
|
219,092 |
Studies found that virtual communities provide their members a sense of community, especially in emergencies . According to Neubaum et al , in a time of crisis, social media platforms serve as a space for social sharing of emotions and pursuing empathetic concerns. Twitter is currently the most popular form of social media used for health care communication . Moorhead et al recognized social media as a dimension of health care and a powerful tool that offers collaboration between users and a social interaction mechanism for a range of individuals.
| 2 | 2other
| 1Other
|
63,472 |
Medical records from both patients and HCs were checked for a history of herpes zoster within 2 years before disease onset or sample collection. In The Netherlands, zoster vaccination is not advised and costs are not compensated in the national health-care system. Since all patients were Dutch, it could safely be presumed that none of the study subjects had been vaccinated against herpes zoster.
| 2 | 0biomedical
| 0Study
|
372,672 |
In this study, we conducted a pan-cancer analysis and identified a key role of succinylation regulators in ccRCC. Mechanistically, our results suggested that succinylation regulators might promote the malignant progression of ccRCC by regulating tumor immunity and m6A methylation regulators. This study offers a novel perspective on the role of succinylation regulators in ccRCC, provides useful insight into the screening of ccRCC patients for immune therapy and reveals a potential regulatory relationship between succinylation modification and RNA m6A methylation.
| 4 | 0biomedical
| 0Study
|
376,211 |
Knapp announced that the Section had reached the end of Art. 60 [Applause] noting that everyone had survived, and no one had been eaten by orcs. As President, Knapp proposed that the Section would not deal with issues of governance 15 minutes before the end of the session. The Rapporteur-général had suggested that the Section continue by debating App. I. She proposed to start with the Div. III proposals the next morning when everyone was fresh.
| 1 | 2other
| 1Other
|
219,261 |
For the synthesis of β-sitosteryl sinapate, K2CO3 (0.069 g, 0.5 mmol) was added to the solution of β-sitosteryl (4-O-acetyl)sinapate (1.657 g, 2.5 mmol) in chloroform:methanol (2:1, 100 mL) under nitrogen, and the solution was refluxed for 8 h. Next, the solution was cooled to room temperature and saturated aqueous NH4Cl (5 mL) was added. Then, dichloromethane (25 mL) was added and the organic layer was washed with water (2 × 20 mL) and saturated solution of NaCl (20 mL). Organic mixture was dried with MgSO4, filtered, and evaporated. β-Sitosteryl sinapate was purified by flash column chromatography (n-hexane/dichloromethane/ethyl acetate; 6:3:1) to yield 1.350 g—87%.
| 4 | 0biomedical
| 0Study
|
23,164 |
Mercier hadseveral very good French books of physic and surgery, likewise a fine set of surgeon’s instruments. He has the scar of a cut over his left eye, and another small scar in his upper lip, and dresses gentleman-like . . . He . . . speaks Latin very well.300
| 1 | 2other
| 1Other
|
281,842 |
First, a demographic model needs to be specified that appropriately describes the neutral genetic variation of the system, allows for inferences of selection through changes in demographic parameters (e.g., NE or ME), and is sufficiently simple to remain computationally tractable. A preliminary analysis of model choice may therefore constitute a prerequisite to successfully recapitulate the signal of complex evolutionary histories in the simulated data. Importantly, the model should always be validated by demonstrating that the observed data can be accurately and sufficiently captured (Figure S15).
| 4 | 0biomedical
| 0Study
|
93,252 |
Next, we examined mechanisms by which RNS60 increased the activation of CREB and upregulated myelin gene expression in oligodendrocytes. Recently we have demonstrated that RNS60 activates PI3K in microglial and neuronal cells [13, 32]. Therefore we investigated whether RNS60 involved PI3K for upregulation of myelin genes in oligodendrocytes. While in resting condition, subunits of PI3K are located mainly in cytoplasm, upon activation, these are translocated to the plasma membrane. Therefore after 1 h treatment with RNS60, we isolated plasma membrane from primary oligodendrocytes followed by monitoring the activation of class IA and IB PI3K by the recruitment of p110α, p110β and p110γ to the plasma membrane. Western blotting results from Fig. 7a, b showed that RNS60 specifically increased the recruitment of p110α and p110β to the membrane. On the other hand, RNS60 did not induce membrane localization of p110γ (Fig. 7a, b). In fact, RNS60 inhibited membrane localization of p110γ in oligodendrocytes (Fig. 7a, b). These results demonstrate that RNS60 is capable of specifically activating type IA PI3K p110α and p110β, but not type 1B PI3K p110γ, in primary oligodendrocytes.
| 4 | 0biomedical
| 0Study
|
293,166 |
Analysis of the subcellular patterns of gene expression can also provide new biological insights. For example, an in situ RNA velocity approach has been developed to use subcellular RNA localization information to infer the transcription rates (Xia et al. 2019). Because newly transcribed RNAs are cumulated in the nucleus, whereas mature mRNA needs to be transported to the cytoplasm for translation (Fig. 6D), the relative composition of nuclear versus cytoplasmic transcripts associated with each gene can be used to estimate the transcriptional activity. This is performed by using a similar mathematical formulation as in the original RNA velocity paper (La Manno et al. 2018).
| 4 | 0biomedical
| 0Study
|
278,125 |
The larvicidal activity of different Bti concentrations was performed on third instar larvae. Twenty larvae were placed in 100 ml beaker that containing appropriate concentration of Bti solutions that corresponding to Group A, B, C and D, respectively. Mortality was assessed after 24 h, during which larvae were fed to avoid the influences caused by starvation. The assays were done in five replicates. The percentage of larval mortality was calculated for each concentration using Abbott’s formula37. In addition, dilutions of the stock were cultured on Potato Dextrose Agar (PDA) medium to evaluate spore counts of each Bti concentration.
| 4 | 0biomedical
| 0Study
|
369,899 |
Reconstructions of the slice that yields the worst NMSE performance for MS-RDNZ5 in Fig. 4a. Reconstructions from all investigated methods are shown in (a). The zoomed regions of the central part of the breast tissue with a calcification are shown in (b). The display window is \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$[0.15, 0.35]\, \text {cm}^{-1}$$\end{document}[0.15,0.35]cm-1.
| 2 | 0biomedical
| 0Study
|
205,426 |
This study aimed to identify factors associated with response to a novel in-home light therapy for fatigue and sleep disturbance in individuals with TBI or stroke. We examined the association of a range of variables with changes in the primary outcome of fatigue, and secondary outcomes of sleep disturbance, psychomotor vigilance and productive activity in response to this treatment, including demographic and injury-related variables, baseline symptoms, and factors that may have impacted an individual's sensitivity to light including chronotype, eye color and use of antidepressant medication.
| 4 | 0biomedical
| 0Study
|
180,696 |
Bladder outlet obstruction is a common urodynamic finding among women with advanced POP . Approximately 21% of women with stage II POP and 33% of those with stage III or IV POP report difficulty of bladder emptying . To our knowledge, this study is the first to examine cervical elongation and its association with urodynamic parameters. However, no correlation between cervical elongation and urodynamic parameters was identified. It is suggested that cervical elongation did not disturb the voiding function. A previous case series study in women with cervical elongation following sacrospinous hysteropexy noted that most patients have minimal symptoms, even in those sexually active. Only one out of five women required partial trachelectomy due to bothersome symptoms of vaginal protrusion .
| 3 | 0biomedical
| 0Study
|
321,871 |
Similar to our findings from male participants, women’s HIV status was strongly linked with past year alcohol use in unadjusted models (OR = 1.7, 95% CI 1.5, 1.8, p<0.01) but after controlling for confounders this relationship was no longer significant (aOR = 1.1, 95% CI 1.0, 1.2, p = 0.11).
| 3 | 0biomedical
| 0Study
|
317,946 |
Supplementing mammals with additional HMOs leads to beneficial cognitive outcomes under certain specific circumstances (Table 1, Figure 2). In general, both fucosylated and sialylated HMOs contribute to an improved memory performance and faster learning speed (tests described in Figure 1A–G) when tested in mature adulthood, irrespective of the age of administration of these HMOs (e.g., during infancy or adulthood) .
| 4 | 0biomedical
| 0Study
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.