id
int32 0
398k
| text
stringlengths 204
42k
| educational_score
float32 1
5
| domain
class label 3
classes | document_type
class label 4
classes |
|---|---|---|---|---|
299,126 |
In conclusion, PM intake reduced serum total and LDL cholesterol levels, and abdominal fat accumulation via suppression of the digestion and absorption pathway in the ileum, and activation of the hepatic PPAR signaling pathway. Changes in the glucose metabolism pathway, by PM intake, were not detected in the GO classification and KEGG pathway analysis. PM intake might enhance sIgA concentrations via promotion of the immunoglobulin production pathway in the ileum. However, key molecules, such as endogenous ligands, to upregulate hepatic PPARα expression and intracellular signaling related to immunoglobulin production, were not determined. Further investigation is required to elucidate the molecular mechanism behind the improvement in lipid metabolism by PM intake. The improvement in lipid metabolism and enhanced gastrointestinal immune function suggests that PM intake may be useful in people who are sensitive to intestinal fermentation, such as those with gut fermentation syndrome.
| 4 | 0biomedical
| 0Study
|
101,273 |
In the search for new catalysts for the silylation of C–H bonds, we envisaged an NHC–Ir species featuring labile ligands that would allow for the coordination of substrates and additives 19b,21 while facilitating the C–H and Si–H activation processes thanks to the unique properties of the NHC ligand.22 On these grounds, complex [Ir(H)2(IPr)(py)3][BF4] (IPr = 1,3-bis-(2,6-diisopropylphenyl)imidazol-2-ylidene) (1) would be an excellent candidate for this study since the pyridine ligands can be straightforwardly substituted23 and the two hydrides may be removed with a hydrogen acceptor or expelled as molecular hydrogen.24
| 4 | 0biomedical
| 0Study
|
271,523 |
Human dermal fibroblast (HDF) cell was purchased from Royan Institute for Stem Cell Biology and Technology and cells were seeded in a 96-well microplate (1 × 104 per well) in RPMI-1640 culture medium supplemented with a 10% fetal bovine serum (FBS), 0.01 M of HEPES (4-[2-hydroxyethyl]-1-piperazineethanesulfonic acid), 1% mixture of antibiotic/antimycotic, 0.001 M of sodium pyruvate, and 0.02 M of L-glutamine and then incubated in an incubator with a humidified atmosphere with 5% CO2 for 24 h.
| 4 | 0biomedical
| 0Study
|
108,776 |
Streptococcus pneumoniae (ATCC 6303 serotype 3) (Sp) infection was made as previously described (7). Briefly, mice were instilled intranasally with 105 or 106 CFU of Sp in 40 µL and were euthanized at 48 h post infection. The data were not shown, and it is only mentioned in the Section “Result.”
| 2 | 0biomedical
| 0Study
|
336,469 |
PPM1D is the second most frequently mutated gene, accounting for 20% of t-MN cases and, as mentioned, it has been linked to previous cancer treatment exposure . In particular, DNA-damaging agents such as cisplatin are typically involved in selecting lesions in this gene . PPM1D-mutated patients represent only <5% of de novo AML/MDS cases and, different from TP53, they usually do not present other detectable co-occurring chromosomal abnormalities. Mutations in this gene are usually truncating (either frameshift or nonsense), mapping within exon 6, with no particular hotspot. PPM1D truncating lesions generate an overexpression of the mutant protein, with a gain-of-function mechanism which constitutively inhibits DNA damage activation of p53 . Hsu and colleagues showed that PPM1D-mutated clones presented a growth advantage in case of cisplatin treatment, which was reversed after administration of GSK2830371, a PPM1D inhibitor, confirming the selective advantage provided by this mutation. As demonstrated by apoptosis assays, the authors also showed that this advantage derived by the acquisition of an “apoptosis-resistant” phenotype and that, once again, the administration of GSK2830371 was able to restore normal apoptotic levels in mutant cells. Finally, the specificity of platin-based chemotherapy over other types of cellular stress in selecting for PPM1D mutations was underlined by experimental data of competitive BM transplant in mice, in which PPM1D mutant cells showed reduced engraftment capacity, reconstituting the peripheral blood less effectively than wild-type counterparts .
| 4 | 0biomedical
| 0Study
|
265,636 |
For this study, HCPs from all care settings and a panel of people with diabetes were involved to identify a core set of evaluation questions that were appropriate and acceptable for use in all sites and care settings, which would allow for pooled and comparative analyses. The short-form questionnaires evaluated experiences of people with diabetes and HCPs related to the use of PRO data in their diabetes visit, such as the extent to which the data were used, impact on engagement, dialogue and person-centered care qualities of the visit, impact on self-management and on care quality, and overall satisfaction and interest in continued use. The questionnaires also briefly assess the perceptions of people with diabetes and HCPs on the general quality of the dialogue and aspects of person-centered communication .
| 4 | 0biomedical
| 0Study
|
286,034 |
The complex geometry of the collimating optical part presents great challenges and limitations from the point of view of its manufacture. The thickness ratio of the piece understood as the ratio between the maximum thickness of the piece and the minimum thickness is 15:4. This ratio makes it extremely difficult to design uniform cooling by increasing the cooling time. Likewise, the piece has intersection areas at the base of the collimating truncated cones, which produce significant accumulations of material. This accumulation of thicknesses can greatly influence the warping of the optics, preventing the piece from meeting the photometric requirements demanded by the client. The gate of the collimating piece is located on a lateral flange with a thickness of 4 mm. The flange is aligned with the thickest area of the piece, creating a hot spot that is very difficult to cool.
| 1 | 2other
| 1Other
|
340,764 |
The modified Sun1GFP fusion sequence fragment was synthesized by Integrated DNA Technologies and contained flanking restriction sites for SgsI and BspoI. The Sun1GFP sequence was inserted into an AAV DIO backbone vector with an Ef1a promoter using standard restriction cloning. pAAV-Ef1a-DIO-EGFP-WPRE-pA was a gift from Bernardo Sabatini (http://addgene.org/; 37084; RRID:Addgene_37084) (Saunders et al., 2012). The ligation was transformed into electrocompetent bacteria from which we selected positive clones and confirmed the sequence with Sanger sequencing. The cSNAIL genome vector pAAV-Ef1a-DIO-Sun1GFP-WPRE-pA is available on Addgene; RRID:Addgene_160141.
| 4 | 0biomedical
| 0Study
|
214,196 |
Additional file 5: Figure S5. Transcription of PSR is reduced under LowN availability. Scatter plot showing the distribution of transcript accumulation (log2 fold change, LFC) of 1, 555 genes in A) leaves and B) roots in LowP and lowN. Dotted lines represent LFC of − 1 and 1. Dots filled using heat-colors showing LowNP transcript accumulation. C) Differential transcript accumulation (z, row standardized LFC) with respect to Full of the top 30 (ranked by FDR) classic genes. Figure accompanies MZ67_Selected_Classics in Supplemental File 2.
| 2 | 0biomedical
| 0Study
|
12,846 |
Repeated measures ANOVA showed no significant effect of monaural beat stimulation on long-term memory performance in terms of correctly recalled words (F(3,72) = 0.963; p = 0.410; ɛ = 0.918). The average performance scores (mean and SEM) for the percentage of correctly recalled words are: 6 Hz (M = 55.8%; SEM = 2.7%); 10 Hz (M = 58.3%; SEM = 3.0%); 40 Hz (M = 61.8%; SEM = 2.9%); control (M = 58.8%; SEM = 3.1%).
| 4 | 0biomedical
| 0Study
|
40,570 |
The HEXACO questionnaire comprises 100 items and incorporates the same five main personality dimensions as the well-known Big Five and Five-Factor models (Costa and McCrae, 1992), i.e., Emotionality, Extraversion, Agreeableness, Conscientiousness, and Openness to experience. Additionally, it contains the trait Honesty-Humility. Ashton et al. (2004) compared six-factor solutions observed in eight independent investigations involving seven different languages (among these the Italian language was included) and found that a similar structure emerged from each language. All items are measured on a five-point scale ranging from completely disagree to completely agree. We considered only emotionality and extraversion scales that are traditionally associated with well-being. Cronbach alphas in the present sample ranged from 0.82 (extraversion) to 0.84 (emotionality).
| 4 | 0biomedical
| 0Study
|
114,505 |
Even with subtle differences in methods between all the reviews, findings were similar. Rossi reported that iuMR was accurately able to identify brain abnormalities in 94.3 % of included foetuses, van Doorn reported 80 % and our study 91 %, an increase of 15–20 % when compared to USS alone. Both Rossi and van Doorn reported that the highest proportion of disagreement between USS and iuMR was related to midline abnormalities, particularly the posterior fossa. iuMR was better able to diagnose abnormalities in this anatomical region, also consistent with the findings of this systematic review which incorporates a further four studies published since 2012.
| 4 | 0biomedical
| 1Other
|
139,677 |
Effect of GCE on gastric wall mucus in the EtOH-induced ulcer group. Values are expressed as means ± S.E.M. (n = 6 in each group); +p < .001 compared to the respective control group. ap < .05, bp < .01 compared to the respective EtOH-induced ulcer control group.
| 4 | 0biomedical
| 0Study
|
356,057 |
Table 1 refers to the accuracy scores (accuracy, accuracy_±1h, accuracy_time-ind) of our encoder–decoder model and the four baselines, on the Dutch-to-Korean dataset. Our model (ENC-DEC) is shown to greatly outperform the baseline approaches, yielding a 90% improvement, compared to the best baseline result, in terms of accuracy, 86% improvement in terms of accuracy_±1h, and 60% improvement in terms of accuracy_time-ind. The most traveled model (MT) and the highest similarity model (HS) report very close accuracy score values, even slightly overcoming the hidden Markov model (HMM). The simple copying model (CP) is the worst baseline, indicating a difference in the motion behavior of the two nationalities. None of the baselines performs even close to ENC-DEC, which exceeds the best baseline’s accuracy of over 30 percentage points, demonstrating its powerful capability of translating motion patterns.
| 1 | 2other
| 0Study
|
354,159 |
In contrast, almost none or only slight changes are observed in the Cu2p3/2 spectrum, so that formation and interaction between Cu0 or Cun+ species and the support seem unlikely. This is because, neither with Mg measurements (due to superposition with Zn2p3/2, Zr3d5/2 and Ni2p3/2 peaks) nor with Al source, no significant changes in the Auger peaks and, consequently, no clear valence differences of copper could be observed. The presence of an important satellite peak indicates, without ambiguity, that most of the copper are Cu2+ species. The shoulder could be, however, interpreted as Cu2p3/2 spectral peak with included partly low-valence copper.
| 4 | 0biomedical
| 0Study
|
283,379 |
As shown in Figure 8, the number of H bonds of water molecules, cholinium, and phosphate ions with protein residues were calculated in different ionic liquid concentrations. Here, 40%, 30%, and 20% concentrations of each system were calculated by adding the solvent values for a separate system.
| 4 | 0biomedical
| 0Study
|
332,206 |
We collected citrate blood or saliva samples from unrelated patients with biochemical and/or clinical traits of FH referred to our laboratory (Biochemistry Service, Hospital de la Santa Creu i Sant Pau, Barcelona, Spain). The characteristics of this population have been described previously . In brief, the samples were sourced from 23 lipid clinic units around Catalonia participating in the Catalan Network of Lipids and Atherosclerosis (XULA in Catalan), a non-profit organization created to improve and assist clinical research in preventive cardiovascular medicine. The clinical diagnosis of FH was assessed after the application of the DLCN criteria , and clinical and/or biochemical data were provided in a summarized DLCN score form by the medical centers of origin. Although the genetic analysis of FH probands has been recommended only when DLCN ≥ 6, all the samples that arrived at our clinical laboratory were processed, since the suspicion of FH in some cases was not based only on the DLCN score. All the blood samples were obtained in accordance with the Helsinki Declaration of 1964, as revised in 2000. The Ethics Committee of the Hospital de la Santa Creu i Sant Pau reviewed and approved the study protocol (Project code IIBSP-DIS-2014-91, approved on 10/02/15), and only individuals who provided written informed consent were included. In the present study, we analyzed the first 670 patients of this collection of probands, including 250 mutation-positive and 420 mutation-negative FH patients. Also, 503 European samples from the 1000 Genomes (1000G) Project (www.internationalgenome.org, accessed on 18 October 2018), which include the genotype of 107 Spanish subjects, were used as controls. Since 107 was a low number to establish the percentiles with precision, the frequency in the Spanish population of each of the SNPs used in the score calculations was compared with the rest of the European populations. There were only differences with the Finnish population in two SNPs. Since only two of 44 (11 SNPs × 4) comparisons (4.5%) were significant, it was estimated that the heterogeneity of the European population for the analyzed variants allowed the use of the 503 European samples as controls in our study.
| 4 | 0biomedical
| 0Study
|
76,541 |
Regarding the determinants of physical activity in the general population, age, sex, PCS and education were found to be statistically significantly associated with total minutes per week spent on PA and per category of intensity (see Table 4). In the general population, BMI was associated with the number of min/week of moderate and vigorous intensity PA, but not with light intensity PA. Within both the arthroplasty groups, it was found that age was a significant determinant of total min/week of PA and the min/week of light intensity PA. Within the THA group, age was also a determinant for the min/week of moderately intensive PA. Sex was associated with the min/week of moderate and vigorous intensity PA in both arthroplasty groups and also with the min/week of light intensity PA in the THA group.Table 4Variables statistically significantly associated with min/week physical activity after correcting for age and sexGeneral Dutch populationTHATKABeta P Beta P Beta P Total physical activity Age0.973<0.001Age0.966<0.001Age0.966<0.001 Sexa 0.9530.037 BMI0.9950.022BMI0.9600.005 PCS1.016<0.001 Low educationb 0.774<0.001 Non-M.S. comorbiditiesc 1.0760.002 M.S. comorbiditiesd 1.0520.046 Sensory comorbiditiese 1.202<0.001Sensory comorbiditiese 1.5170.028Light physical activity Age0.966<0.001Age0.604<0.001Age0.973<0.001 Sexa 0.748<0.001Sexa 0.604<0.001BMI0.7590.044 PCS1.007<0.001 Low educationb 0.809<0.001 Medium education0.834<0.001Moderate physical activity Age0.991<0.001Age0.9840.031 Sexa 1.0840.02Sexa 1.5960.001Sexa 1.5380.009 BMI0.9120.022BMI0.9640.027 PCS1.016<0.001 MCS0.9890.001 Low educationb 1.1800.006 Medium education1.384<0.001Vigorous physical activity Age1.026<0.001 Sexa 1.189<0.001Sexa 1.4890.005Sexa 1.4320.022 BMI0.9860.003 PCS1.014<0.001PCS1.0210.027MCS0.9570.008 Medium educationb 1.1510.002 aFemales were reference bHigh education as reference cAffected with non-musculoskeletal comorbidities persons as reference dAffected with musculoskeletal comorbidities persons as reference eAffected with sensory comorbidities persons as reference
| 4 | 0biomedical
| 0Study
|
15,647 |
After 6 weeks of treatment, the LS mean difference of AZL-M from placebo on scSBP in patients < 65 years of age was − 14.7 (95% CI –20.5 to − 8.9; p < 0.001) for the AZL-M 40-mg group and − 14.1 (95% CI –19.8 to − 8.4; p < 0.001) for the AZL-M 80-mg group (Fig. 5a). For patients ≥65 years, the LS mean difference in scSBP was − 11.4 (95% CI –19.9 to − 2.9; p = 0.009) in the 40-mg group and − 16.4 (95% CI –25.1 to − 7.7; p < 0.001) in the 80-mg group. For patients aged < 65 years, the LS mean difference in scDBP of AZL-M compared with placebo was − 9.9 (95% CI –13.3 to − 6.4; p < 0.001) for the AZL-M 40-mg group and − 10.1 (95% CI –13.5 to − 6.7; p < 0.001) for the AZL-M 80-mg group. The LS mean difference in scDBP for patients aged ≥65 years was − 6.9 (− 11.3 to − 2.5; p = 0.002) for the AZL-M 40-mg group and − 8.5 (− 13.0 to − 4.0; p < 0.001) for the AZL-M 80-mg group.
| 4 | 0biomedical
| 0Study
|
100,807 |
Total cellular RNA was harvested with TRIzol LS Reagent® (Life Technologies), treated with DNase (Biolabs) for 40 min at 37° C, and reverse transcribed with M-MLV Reverse Transcriptase (Invitrogen), according to the manufacturer’s protocols. RT-qPCR was performed on the Applied Biosystems StepOne plus PCR System with PowerUp™ SYBR Green Master Mix (Life Technologies). The relative amount of each substrate was calculated by the 2–ΔΔCT method.
| 4 | 0biomedical
| 0Study
|
125,188 |
Thirty-nine major compounds identified in O. kilimandscharicum oil. D-camphor was the most abundant constituent (36.6%), followed by limonene (18.6%), camphene (7.1%), linalool (4.3%), terpinen-4-ol (3.9%), α-terpineol (3.6%), terpinolene (2.2%), and sesquisabinene (2.1%) (Table 1).
| 4 | 0biomedical
| 0Study
|
323,744 |
In order to describe the obtained results it is important to describe how the model molecules are built. Figure 1 demonstrates the constructed model molecules of graphene sheet (G), magnetite (Fe3O4), nickel oxide (NiO), graphene functionalized with Fe3O4 (G- Fe3O4), and graphene functionalized with NiO (G-NiO). Graphene is built as a 2D sheet composed of 42C atoms linked together with single and double bonds alternatively. Then, Fe3O4 and NiO are added to graphene sheet at nearly its central benzene ring; exactly at C16 and C17 atoms.Figure 1Model molecules of (a) graphene sheet (G), (b) magnetite (Fe3O4), (c) nickel oxide (NiO), (d) graphene functionalized with Fe3O4 (G- Fe3O4) and (e) graphene functionalized with NiO (G-NiO).Fig. 1
| 3 | 0biomedical
| 0Study
|
347,879 |
This study used seven mature samples of the cultivars Jinmang (JM), Qingmang (QM), Hongyu (HY), Guifei (GF), and Tainong (TN), which were purchased from the regional market in Guangzhou (133.35° N, 23.12° E), Guangdong Province (April 2019). The samples were shipped to the laboratory and kept at 25 °C until complete maturity (2 days). Full maturity and maturity of the mangoes were based on fruit color (green to yellow-orange or red, except for the green lawn, Table S1), odor (sweet scent), and hardness (pulp hardness index changed from 5.28 to 4.32 N). Finally, the mango samples with the same maturity were washed, and the peeled pulp was immediately frozen in liquid nitrogen, and then stored at −80 °C for further studies.
| 4 | 0biomedical
| 0Study
|
38,241 |
At the beginning of the RBCPSLP scheme, the minimum hop count to the sink is formed for each node. This process is described as follows: at the time of initialization, the sink sets its own hop count to 0 (i.e., v0.h1=0 where v0 denotes the sink and its attribute h1 represents the true number of hops used to reach the sink), and all the other nodes set their own hops to reach the sink to infinity. The sink broadcasts that its hop count to the sink is zero. Suppose the information field containing the hop count in the data packet B is hm. Then, the node receiving the data packet (e.g., node vi) updates its hop count to the sink according to the following comparison: (7)vi.h1<B.hm+1
| 1 | 2other
| 1Other
|
346,605 |
To evaluate the antiviral activity against the replication of HSV-1, a plaque reduction assay was performed using ACV as a standard antiherpetic drug as earlier detailed . The assay was initiated by infecting Vero cell monolayers with the virus (100 PFU) for 1 h at 37 °C. The infected cells were further overlapped with Eagle’s minimum essential medium containing carboxymethyl cellulose (1.5%; Sigma-Aldrich, Berlin, Germany) and treated with test compounds at different concentrations. The untreated cells were considered as controls. To determine the plaque reduction, cells were incubated for 72 h at 37 °C and then dyed with naphthol blue-black (Sigma-Aldrich, Berlin, Germany). The concentrations of test molecules that diminished 50% of the number of HSV-1 plaques were assessed in comparison with the untreated control cells and expressed as 50% inhibitory concentration (IC50 in µM) values. The ratio CC50/IC50 was assigned for each compound to calculate the selectivity index (SI).
| 4 | 0biomedical
| 0Study
|
55,576 |
To test the hypothesis that low glutamine-induced DNA damage is caused by ALKBH inhibition, we cultured Alkbh2-/- MEF, Alkbh3-/- MEF, and paired wild-type MEF cells in glutamine-free medium or complete medium overnight. We found that Alkbh2-/- and Alkbh3-/- MEF cells exhibited higher γH2AX levels in complete medium compared to the wild-type MEF cells (Fig 4E and 4F and S3B Fig), suggesting that ALKBH actively protects cells from endogenous alkylating agents. Importantly, glutamine depletion failed to further promote γH2AX induction in ALKBH3 knockout or ALKBH2 knockout MEF cells compared to the wild-type cells (Fig 4E and 4F and S3B Fig). Similarly, we found no further increase in γH2AX upon glutamine starvation in ALKBH3 knockdown PC3 cancer cells (Fig 4G and 4H). In contrast, treatment of the topoisomerase inhibitor camptothecin (CPT) further promoted DNA damage in the ALKBH3 knockdown cells (S3C Fig). In addition, we found that DM-αKG, which rescued low glutamine-induced DNA damage in control cells, failed to rescue the DNA damage in ALKBH-deficient cells (S4A and S4B Fig). Together, these data indicate that glutamine depletion, by reducing the key cofactor αKG, inhibits the ALKBH enzyme from repairing endogenous DNA alkylation damage.
| 4 | 0biomedical
| 0Study
|
56,407 |
The following compounds were either bath applied with aCSF or used to supplement the recording internal solution during pharmacology experiments: PP2 (20 μM), pp60cSrc 521–533, phosphorylated (200 μM), u0126 (20 μM), GW5074 (1 μM), (S)-3,5-DHPG (50–100 μM), MTEP (1 μM), (+)-2-methyl-4-carboxyphenylglycine (LY367385, 50 μM) and CNQX (50 μM). CNQX was purchased from Sigma-Aldrich. DHPG, MTEP and LY367385 were purchased from Abcam; all other pharmacological agents were purchased from Tocris Bioscience (Bristol, UK).
| 3 | 0biomedical
| 0Study
|
302,274 |
Place the inoculation bottle on a lower level than the bioreactor and transfer the PBS from the bioreactor into the inoculation bottle, by gravity. Tilt the bioreactor to further transfer remaining PBS. Place the inoculation bottle (while being attached to the bioreactor) under the flow hood and discard the PBS.
| 4 | 0biomedical
| 1Other
|
246,377 |
There was a significant difference in \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$q_{rel}$$\end{document}qrel between AF and HFCW effluent (Fig. 5d) (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p$$\end{document}p < 0.05). The significant drops in \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$q_{rel}$$\end{document}qrel during the beginning stages of the experiment were attributed to the presence of active and effective MTI pores as the SMP gradually wets; this concurs with the observations by Kanda et al.16. The time required for \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$q_{rel}$$\end{document}qrel to get to 50% (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$T_{{q_{rel} }} \le 50\%$$\end{document}Tqrel≤50%) under HFCW was low at 5 h as compared to AF at 15 h. This rapid decline for the HFCW effluent could be attributed to the high concentration of TSS in the effluent which according to the Bucks et al.42 hazard risk rating scale causes severe pore narrowing or clogging risk.
| 4 | 0biomedical
| 0Study
|
69,286 |
Despite the CNx effect on survival, the use of CNx declined to 34–38% in 2005–2010 since the introduction of TT, suggesting that more patients would eventually be treated with the primary tumor in situ11,27. The reason for this decline was that, unlike IT, TT alone could control the disease, particularly at the primary tumor site; thus, Nx might not be necessary. This might avoid the morbidity and mortality associated with surgery followed by a postoperative delay in starting systemic treatment allowing further disease progression.
| 4 | 0biomedical
| 0Study
|
387,025 |
Images of RAST plate of methicillin-resistant Staphylococcus aureus (MRSA) without (left) and with (right) measured inhibition zones automatically taken with the photo lab function of the total lab automation (TLA, BD Kiestra™) at the Department for Infectious Diseases at the University Hospital Heidelberg, Germany. The inhibition zone for cefoxitin (FOX) is measured with 11 mm. According to the EUCAST zone diameter breakpoints for RAST directly from blood culture bottles, this zone diameter is within resistant category and, hence, indicates an MRSA
| 4 | 0biomedical
| 1Other
|
254,704 |
Flrt2-LacZ KI mice were obtained and maintained on a CD1 background (Tai-Nagara et al., 2017). P0, P7, and adulthood (>6 weeks old) Flrt2-LacZ KI mice were used for LacZ staining. For electrophysiological and immunohistochemistry experiments, Flrt2lox/lox mice (Tai-Nagara et al., 2017) were crossed with Emx1-Cre (Iwasato et al., 2000) and Nestin-Cre (Isaka et al., 1999), respectively. For validating the conditional allele, FLRT2+/– (Yamagishi et al., 2011), FLRT2lox/+ and Nestin-Cre mice were crossed. Male mice aged 2–4 months were used for electrophysiological experiments. Primers pairs for genotyping were as follows: Flrt2-LacZ KI mice, 5′-TTACACAG ACTGCCACATCC, 5′-CCTGCAGCCCAAGCTGATCC and 5′-GAGCCCACCTGACATTATCC; (2) Flrt2lox/lox mice, 5′-GT GGAAGGAAGGAATTGTCTCAGG and 5′-GGAGCCAGGTT GGCAGGAGTTGGC; and (3) Cre mice, 5′-GCCTGCAT TACCGGTCGATGCAACGA and 5′-GTGGCAGATGGCG CGGCAACACCATT-3′. All animal experiments were approved by the Animal Research Committee of Hamamatsu University School of Medicine and were carried out in accordance with the in-house guidelines for the care and use of laboratory animals of the university.
| 3 | 0biomedical
| 0Study
|
33,343 |
When breast density measures are used as a tool to stratify women for different screening strategies, it is important that these measures are highly reproducible as it is undesirable that the likelihood of a woman being classified as having dense breasts is dependent on which radiologist she goes to. Another prerequisite is that these measures can be obtained in the daily practice of high-throughput screening.
| 4 | 0biomedical
| 1Other
|
181,844 |
Minimum dietary diversity: is the proportion of children 6–23 months of age who receive foods from 4 or more food groups with the food groups consisting; (I) grains, roots and tubers; (II) legumes and nuts; (III) dairy products; (IV) flesh foods; (V) eggs; (VI) vitamin A rich fruits and vegetables; and (vii) other fruits and vegetables during the previous day of study [5, 6]. Minimum meal frequency: is the proportion of breastfed and non-breastfed children 6–23 months of age, who receive solid, semi-solid, or soft foods (but also including milk feeds for non-breastfed children) the minimum number of times or more during the previous day.
| 2 | 0biomedical
| 1Other
|
103,069 |
Data are presented as mean (n>2) ± standard error. Significance was determined for more than two groups using ordinary one-way ANOVA with either comparison between groups by Dunnett test or multiple comparisons with the Tukey’s test. Student’s t-test was used for comparison between two groups. The non-parametric Mann-Whitney U test was performed to confirm the difference of two group comparison. Statistical significance was defined as P< = 0.05 (*), P< = 0.01 (**), P< = 0.001 (***), and P<0.0001 (****).
| 4 | 0biomedical
| 0Study
|
223,174 |
MLPA is a valuable method for the identification of large NF1 deletions but it has its limitations with regard to the accurate classification of the different NF1 microdeletion types. Whereas type-1 NF1 deletions appear to be classified relatively precisely by MLPA, this method fails to distinguish between type-2 and atypical group #2A NF1 deletions which represent 30% of all atypical NF1 deletions with breakpoints located within the type-1 NF1 microdeletion region (atypical NF1 deletions of group #2). Patients with atypical group #2 NF1 deletions may facilitate the establishment of genotype/phenotype correlations if they are associated with hemizygosity for only a subgroup of the genes located within the type-1 NF1 microdeletion interval. The precise characterization of these deletions in terms of their extent is a prerequisite for identifying such correlations.
| 4 | 0biomedical
| 0Study
|
184,979 |
Limitations of this study were that this was a retrospective study without the comparison with other surgical approaches and that we were unable to assess surgical volume as a potential contributing factor to the observed oncological outcome. Secondly, we divided the patients into three groups so that they had same total period without the cut-off values for division. Consequently, we could not avoid the statistical bias completely. In spite of the small number of enrolled patients, we could analyze survival outcomes after RRH clearly because we focused on only stage IB patients. Additionally, we evaluated a single surgeon experience of RRH for treatment of cervical cancer and the oncological outcomes with long-term follow-up. A single surgeon's experience afforded us the ability to evaluate the potential confounding factors with surgical consistency.
| 4 | 0biomedical
| 0Study
|
255,265 |
Cardiac arrhythmias, defined as the presence of sustained atrial tachyarrhythmias, bradyarrhythmias and sustained ventricular tachycardia, were observed in 21 patients (8.7%). Table 1 shows the demographic and clinicals characteristics of the patients with and without arrhythmias. Of those with arrhythmias, 16 (76.2%) had sustained atrial tachyarrhythmias, 3 (9.5%) had sustained ventricular tachycardia, and 2 (9.5%) had bradyarrhythmias. Patients with arrhythmias had higher mortality, 52.4% versus 24.1% (p=0.005). Cardiac arrhythmias were more frequent in men, patients on MV, and those with history of heart failure. Table 2 shows the results of the univariate and Cox multivariate analysis for the occurrence of cardiac arrhythmias. In that model, only the presence of heart failure associated significantly with a higher risk for cardiac arrhythmias (hazard ratio: 11.9; 95% CI: 3.6-39.5; p<0.001). When adjusted for the presence of heart failure, the occurrence of cardiac arrhythmias was associated with a higher risk for total mortality (hazard ratio: 3.4; 95% CI: 1.8-6.7; p<0.05).
| 4 | 0biomedical
| 0Study
|
140,388 |
Research findings will be disseminated in peer reviewed journals and at scientific and professional conferences. We will also aim to communicate the study findings at key practice and policy forums and using plain language summaries for participating parents, practice and policy stakeholders distributed via email and the program website infantprogram.org.
| 1 | 2other
| 1Other
|
213,219 |
For the catalysts containing 1 and 4 wt% vanadium, the selectivity at low temperatures was rather related to the formation of carbon monoxide. Ni-CP-V4.0 was more selective towards CO than Ni-CP-V1.0, although both of them mainly promoted the reverse water-gas shift reaction (RWGS). This is in good agreement with the study of Le et al., which confirmed that the main product of the reaction is carbon monoxide, formed mainly in the RWGS reaction . A similar effect was observed for other types of promoters such as copper, especially promoted on hydrotalcite-derived catalysts .
| 4 | 0biomedical
| 0Study
|
17,019 |
RJ, JG, and IS conceived the study. MS, EM, MG, IS, and NE carried out the laboratory work. RJ, NE, and MS compiled and analyzed the data. MS, NE, and IS collated the results. MS, NE, IS, and JG drafted the preliminary manuscript. All authors participated in the review and the editing of the final draft and also read and approved its final version.
| 1 | 2other
| 1Other
|
139,305 |
Mouse bone marrow was cultured in low glucose DMEM supplemented with 30% L929 cell-conditioned medium and 20% FBS for 6-7 days until the cells reached confluence. BMDMs were then reseeded in culture dishes overnight in RPMI 1640 medium containing 1% Nutridoma-SP medium (Sigma-Aldrich) before any treatment (24).
| 4 | 0biomedical
| 0Study
|
3,712 |
Red solid (63 %). Mp 97–100 °C. Rf = 0.71 (20 % EtOAc/Hex). 1H NMR (300 MHz, CDCl3): δ 6.61 (dd, J = 3.53, 1.72 Hz, 1 H), 6.95–7.02 (m, 1 H), 7.38 (s, 1 H), 7.64 (dd, J = 1.81, 0.54 Hz, 1 H). 13C NMR (75 MHz, CDCl3): δ 113.53, 113.59, 133.27, 146.60, 146.71, 160.27, 214.50. Calc. 200, found 201 [M+H]+.
| 4 | 0biomedical
| 0Study
|
27,849 |
Additionally, the significantly decreased levels of lipids and 3-hydroxybutate can also be observed in RMP groups. Ketone bodies, mainly 3-hydroxybutyrate, are generated from the lipolysis in the liver mitochondria (Guo et al., 2014). This indicated the reduction in energy production by the oxidation of fatty acid and that ketone body synthesis occurred to produce energy, thus used as fuel in the case of energy deficit, which was evidenced by the increased level of creatine in plasma samples. As the emergency cellular energy regulators, creatine can interact directly with ATP to produce phosphocreatine and store the energy of excess ATP (Ma et al., 2010). The higher levels of creatine suggested that RMP interfered with the creatine-phosphocreatine system an energy shortage and produced more ATP to supply energy, which generated the redundant free creatine.
| 4 | 0biomedical
| 0Study
|
187,236 |
From the anterior part of the superior sagittal sinus, a 16-gauge peripheral veinous catheter needle was inserted to the sagittal sinus and the outer needle was left in place. This outer needle was anchored with nylon thread. From the outer needle, the electrode of the eEEG was placed in the middle part of the sagittal sinus, parallel to the SDEs.
| 4 | 0biomedical
| 0Study
|
179,914 |
Additional file 2: Table S2 describes study characteristics related to LATAM countries only from those that reported other than patient-important or economic outcome. Ten studies [36, 45, 48, 50–54, 60, 61] evaluated in addition to burden outcomes, such factors as mutations in the fibroblast growth factor receptor 3 gene [48, 61]; growth velocity [52, 54]; and body proportions references .
| 2 | 0biomedical
| 0Study
|
179,439 |
White blood cells from mice with acute endotoxin-induced peritonitis were collected by centrifugation of 1 mL collected blood and subsequent red blood cell lysis with ACK lysis buffer. Cells from peritoneal lavage were collected by centrifugation. White blood cells and cells collected by peritoneal lavage were labeled by staining for 30 minutes on ice in the dark with the following fluorescently-labelled antibodies diluted in staining buffer: CD8-BV421 (1:100), CD4-BV510 (1:150), Ly6C-BV605 (1:600), CD11c-BV650 (1:100), F4/80-BV711 (1:100), CD45-BV785 (1:500), Ly6G-FITC (1:200), MHC-II-PerCP-Cy5.5 (1:400), CD19-PE (1:100), CD11b-PE-Cy7 (1:400), NK1.1-APC (1:200), CD3-AF700 (1:50) (all from Biolegend). Unspecific antibody binding was blocked by an anti-CD16/32 antibody (1:100, BD Bioscience) and dead cells were excluded from analysis after staining with fixable viability dye-e780 (1:1000, eBioscience). Fluorescence was captured using a BD LSR Fortessa and analyzed using FlowJo 10.0.7 analysis software.
| 4 | 0biomedical
| 0Study
|
250,401 |
Table 2 provides a detailed description of the agricultural tasks, showing the number of workers in each task overall and by pay arrangements. Among the 575 workers, about one third of workers (170 workers) worked on harvesting tasks, with about 110 workers harvesting tree fruits, and 60 workers harvesting other crops. Another 20% of workers (111 workers) work on thinning and pruning tasks, with about 74 workers thinning and pruning tree crops, and 37 workers thinning and pruning other crops. About 17% of workers work on harvest-related tasks, such as carrying (9 workers), sorting (48 workers), packing (23 workers) and supervising (18 workers). The rest of the workers work on other farm works such as irrigation (73 workers), hoeing and raking (29 workers), shoveling (9 workers) and nursery related tasks (12 workers).
| 1 | 2other
| 1Other
|
182,172 |
Confirmed cases in the detection of homologous depolymerases in phages belonging to different families are quite rare (Volozhantsev et al., 2020). Apart from depolymerases specific against the K57 capsule, described in our previous study (Volozhantsev et al., 2020), and depolymerases described in the current article, no similar cases of depolymerases encoded by phages from different families have been reported. In addition to the cases mentioned above, we can assume based on the phylogenetic analysis that similar patterns are observed for at least four other types of depolymerases specific against capsule types K1, K30/K69, K63, and KN2 (Supplementary Figure 6). Although some authors suggest the theoretical possibility of lateral transfer of RBPs or depolymerase domains (Latka et al., 2019), for the time being, there are no reliable ways to distinguish between lateral transfer and convergent evolution.
| 5 | 0biomedical
| 0Study
|
374,119 |
Large variations in the results of different studies have been reported. In a Saudi study by Aldhefeeri & Alsanosi Large vestibular aqueduct was commonest pathology (33.3%), followed by dysplasia of SCC (29.1%) and cochlear hypoplasia (4.1%).14While in another study of Chinese origin, by Sun B et al. revealed malformations of cochlea (31%), simple vestibular aqueduct (40.33%), and simple vestibular aqueduct/SCC/IAC in 7.35%. Of the malformations of the cochlea Michel deformity was noted in 1.13%, cochlea aplasia in 1.81%, common cavity deformity in 3.17%, incomplete partition type I in 8.62%, cochlea hypoplasia in 9.07% and incomplete partition type II was reported to be present in 76.19%.16 While in an Indian study by Agarwal SK et al. the prevalence of cochlear anomaly was 73%, 87.1% had vestibular malformations, 56.4% had vestibular aqueduct malformation, 30.7% were with IAC anomaly and 29.4% had 8th CN anomalies.17 In an imaging study by El Sheikh E et al. cochlear hypoplasia the commonest (4.5%), followed by common cavity (3%), IP-1 (3%), IP-2 (16.7%), IP-3 (7.6%), posterior rotated cochlea (6.1%), dilated vestibule (3%), isolated SCC hypoplasia (3.03%), SCC hypoplasia with common cavity (3.03%), dysplastic SCC (6.8%), dilated IAC (4.5%), hypo-plastic IAC (18.2%), VCN hypoplasia (18.2%), isolated EVA (36.4%).18 Also in a study by Dhanasingh A, found normal anatomy in four, enlarged vestibular aqueduct in 3, cochlear aplasia in 2, IP-I in 8, IP-II in 3, IP-III in four, CH in 17, common cavity (CC) in 5. Majority of CH cases had cochlear height shorter than four mm whereas the CC cases measured cochlear height above 6 mm. For all the other malformation types, cochlear height was between 4 and 6 mm.19
| 4 | 0biomedical
| 2Review
|
19,009 |
The identification of arousals was performed using the AR. An arousal is a fluctuation of the AR that has the minimal duration of 0.3s and an amplitude of at least three times the standard-deviation of signal background. In some cases arousals come not as a single peak but in a train of subsequent peaks (less than 0.5 sec of interval) that we identify as a single arousal. Previous works evidenced the occurrences of arousals in SWS in rodents with similar features to which we defined here [19–21]. However, in this work, we study arousal events based on the accelerometer fluctuation, rather than on the electromyography or LFP criteria which were used in those studies.
| 4 | 0biomedical
| 0Study
|
349,994 |
One of the important comfort factors at the residential level is the temperature of the living area, which corresponds to the thermal load. The thermal load can be defined for different devices, such as a HVAC system. Most of the studies in this area have tried to minimize the thermal load while maintaining the customer’s comfort. In , authors have scheduled HVAC energy consumption by increasing or decreasing the room’s temperature under a price consideration. Thus, customer comfort is considered as an energy cost. In several studies, authors have added other features addition to the thermal load to improve their calculations . In , the main goal was to minimize the HVAC’s cost of energy and also to maintain customer comfort. In their work, the authors looked for different parameters that affect room temperature, such as the number of occupants, indoor and outdoor temperature, and customer preference. They used a nonconvex formulation to solve their problem with tradeoff between cost and thermal comfort. The work in presented central demand management to control building Air Conditioner (AC) power consumption and preferred temperature. This scheme evaluated the system communication delay, outdoor temperature and other features. Meanwhile, the authors in proposed a MILP based on dynamic pricing to optimize the thermal load in a smart house and to maintain customer comfort. In , the authors addressed HVAC system energy conservation and wastage using a machine learning approach, using Internet of Things (IoT) sensor data to establish consumer consumption patterns.
| 2 | 2other
| 0Study
|
343,777 |
The percentage of Mo-MDSCs among CD11b+-expressing cells was not altered significantly. However, the total numbers of Mo-MDSCs from animals were significantly higher compared to the control animals on day 3 after stroke induction (p = 0.0324; Figures 3A,C). The percentage of PMN-MDSCs of CD11b+-expressing cells was increased on day 1 after stroke (p = 0.0238). In addition, their absolute numbers tended to be increased (p = 0.0568; Figures 3B,D).
| 4 | 0biomedical
| 0Study
|
361,068 |
The current leading form of treatment for HIV is a form of combined ART therapy, termed highly active antiretroviral therapy (HAART) . During the initial development of ART, treatments were used in a monotherapy form; however, the increased incidence of drug resistance led to the use of combination therapy to minimize morbidity and mortality of HIV-infection and efficiently control viral replication . ART is highly successful in reducing actively replicating virus; however, due to the presence of HIV reservoirs and incomplete elimination of virus, once ART is stopped, viremia rises to levels similar to those observed prior to ART treatment . No currently available treatment successfully clears integrated proviral DNA incorporated in the host genome . Thus, PLHIV must maintain strict lifelong treatment adherence in order to prevent viral rebound . Additionally, despite ART-mediated viral suppression aiding CD4 T cell recovery, this reversal constitutes an incomplete immune reconstitution, forcing PLHIV to face lifelong challenges with immune failure .
| 5 | 0biomedical
| 2Review
|
293,808 |
In addition to mediating growth‐inhibitory effects of IFN, MX2 expression increased the sensitivity of melanoma cells to MAPK pathway inhibitors. Previously, it has been reported that in colon cancer, XAF1 expression is upregulated after inhibition of the MAPK pathway through transcriptional regulation, which mediated apoptosis. 35 However, even though we did observe an upregulation of XAF1 following MAPK pathway inhibition in melanoma cells, XAF1 downregulation did not affect responses to the drugs indicating that MX2 sensitization is achieved independent of XAF1. It has also been shown that type I IFN treatment can enhance the cytotoxic effect of MEK inhibition in melanoma cell lines with low activity of IFN pathway 39 and since MX2 can induce IFN response profile affecting multiple genes, it is likely that these additional downstream factors are mediating this sensitization.
| 4 | 0biomedical
| 0Study
|
252,801 |
The lung organoids (LOs) were generated as described previously . Briefly, induced pluripotent stem cells (IPSCs) were subjected to embryoid body induction using embryoid bodies (EB)/primitive streak media (10 μM Y-27632 and 3 ng/mL BMP4 in serum-free differentiation (SFD) media consisting of 375 mL Iscove’s Modified Dulbecco’s Medium (IMDM), 100 mL Ham’s F-12, 2.5 mL N2, 5 mL B27, 3.75 mL 7.5% BSA, 5 mL 1% penicillin–streptomycin, 5 mL GlutaMax, 50 μg/mL ascorbic acid, and 0.4 μM monothioglycerol) in ultra-low attachment plates, with the media being replaced with endoderm induction media (10 μM Y-27632, 0.5 ng/mL BMP4, 2.5 ng/mL FGF2, and 100 ng/mL Activin A in SFD media) the morning after. Extra media was added every day for 3 days. The embryoid bodies were collected and dissociated using 0.05% Trypsin/EDTA and plated on fibronectin-coated plates with a cell density of 85,000 cells/cm2. Cells were then incubated in anteriorization media-1 (100 ng/mL Noggin, and 10 μM SB431542 in SFD media), followed by an incubation with anteriorization media-2 (10 μM SB431542, and 1 μM IWP2 in SFD media). The anteriorization media-2 was replaced with ventralization media (3 μM CHIR99021, 10 ng/mL FGF10, 10 ng/mL FGF7, 10 ng/mL BMP4, and 50 nM all-trans Retinoic acid in SFD media) and incubated for two days. The cell monolayer was then lifted by gentle pipetting, and the suspended cells were transferred to an ultra-low attachment plate where they would form the lung organoids.
| 4 | 0biomedical
| 0Study
|
105,472 |
A simple and efficient ATPS has been successfully applied to separate oyster polysaccharides and proteins. Under optimum ATPS conditions, polysaccharides were separated in the bottom phase, and the extraction efficiency was 67.02%. This ATPS is a simple, fast, and green separation system that can be used to isolate and purify oyster polysaccharides on a large scale. These polysaccharides (OP-1) consisted of glucose and had an Mw of 3480 Da. OP-1 consisted of a backbone of (1→4)-α-d-glucosyl with α-d-glucosyl residues on the terminal of the side chains at the O-3 position. Moreover, OP-1 can stimulate the phagocytic activity and IL-2 production. OP-1 showed significant anti-tumor activity against HepG2 cells in vitro and had no direct toxicity to normal cells. These results can guide the direction of future research toward novel functional food or therapeutic agents.
| 4 | 0biomedical
| 0Study
|
345,994 |
Dependence of the thermal area expansion coefficient of POPE/POPG (3:1 mol/mol) bilayers on peptide concentration (circles: pure bilayer, triangles: MG2a, squares: L18W-PGLa, diamonds: L18W-PGLa/MG2a (1:1 mol/mol)). Error bars were derived from statistical averaging of all solutions. To see this figure in color, go online.
| 3 | 0biomedical
| 0Study
|
163 |
More direct evidence for synaptic localization of SALMs has come from electron microscopy, immunocytochemistry, biochemical and proteomic analyses. One early study using immunocytochemistry detected endogenous SALM2 signals at excitatory, but not inhibitory, synapses in cultured rat hippocampal neurons (Ko et al., 2006). A subsequent electron microscopy study detected endogenous SALM4 signals at various subcellular locations in rat brain hippocampal neurons, including synaptic and extra-synaptic sites, pre- and postsynaptic sites, and dendrites and axons (Seabold et al., 2008). Biochemical experiments further demonstrated that SALMs are enriched in the postsynaptic density (PSD)—electron-dense multiprotein complexes at excitatory postsynaptic sites that contain neurotransmitter receptors, adaptor/scaffolding proteins and signaling molecules (Sheng and Sala, 2001; Sheng and Hoogenraad, 2007); SALM1 (Wang et al., 2006), SALM2 (Ko et al., 2006), SALM3 (Mah et al., 2010), SALM4 (Lie et al., 2016) and SALM5 (Mah et al., 2010).
| 4 | 0biomedical
| 0Study
|
351,368 |
ϕSa2wa-st8, -st72, -st93, -st93mssa and ϕSa2USA probably represent a single bacteriophage that has transmitted between lineages of S. aureus. USA300 and the Queensland clone are two of the most virulent and widely disseminated CA-MRSA and in this and a previous study it is evident that there has been horizontal transmission of a ϕSa2USA/ϕSa2wa-st93-type bacteriophage between their CC8 and Singleton 93 ancestors, however there is no indication of when or where this occurred. USA300 acquired ϕSa2USA in North America following importation of its ancestor in the early 20th century . ϕSa2wa-st93mssa was present in ST93-MSSA, the most prevalent colonizer in remote WA in 1995, and this clone was the ancestor of the Queensland clone that emerged in Queensland, Australia in the early 2000’s [14, 48, 49]. ϕSa2wa-st93mssa was well adapted in ST93-MSSA and Australia before the clone acquired the SCCmec and before USA300 was imported into Australia . Against the background of PVL prophage diversity revealed in this study it is extraordinary that the ϕSa2USA/ϕSa2wa-st93 bacteriophage has remained stable over at least 20 years in different geographic and genetic environments. To gain insights into the success of this bacteriophage it would be informative to investigate the putative proteins of unknown function encoded by the unique modules of ϕSa2wa-st93 revealed in Table 3.
| 4 | 0biomedical
| 0Study
|
126,270 |
In the studies we reviewed, youth experiencing homelessness demonstrated misconceptions about abortion access, costs, and availability. Some youth avoided seeking abortion services, for instance, because of fears that their parents would be notified, or that it would cost “a couple thousand dollars” out of pocket, or because of previous traumatic experiences with reproductive health services. Based on the available data, it is unclear how these misperceptions arose and what informational interventions would be best suited to improve youth knowledge about abortion care. What are the decisional needs of youth experiencing homelessness who are considering abortion? How accessible and appropriate are existing resources and supports for abortion decision-making? It is critical for future health services research to investigate the information and decision-making needs of youth experiencing homelessness.
| 2 | 0biomedical
| 0Study
|
308,597 |
Intentional group practice of gratitude can set up a baseline boundary of the expectation of respect for every individual. The cumulative effect over time is to cultivate a positive prosocial environment that precedes the development of hopelessness and depressive symptoms, reciprocates positivity, and protects the mental health of hospitalists from any negativity that is present. A medical group practice that intentionally cultivates gratitude and a positive work environment is a practice that puts death, dying, and the human condition into the proper perspective of a greater positive humanity.
| 2 | 0biomedical
| 1Other
|
136,184 |
The results of this cross-sectional study suggests that the awareness of HPV among women visiting gynecological clinics in Kazakhstan is relatively high. However, the knowledge about HPV as a cause of cervical cancer and awareness of HPV vaccination should be improved. As the success of the governmental programs for cervical cancer prevention largely depends on the population’s knowledge and awareness of HPV and cervical cancer, there is an urgent need for educational intervention; both formal and informal. Population-based informational programs need to enhance the knowledge and awareness, which would increase understanding of the risks related to the HPV infection and its association with cervical cancer. Overall, this could improve the public’s acceptance of the cervical cancer screening program in Kazakhstan.
| 4 | 0biomedical
| 0Study
|
75,476 |
Apart from the risk for recurrence of XLP1 mentioned above, lymphoma was also been reported in SH2D1A female carrier due to nonrandom X-inactivation , suggesting that carrier females in an XLP kindred might be at the risk of developing XLP phenotype and should be monitored for early symptoms. Thus, screening SH2D1A may provide early molecular diagnosis for both XLP1 patients and the potential XLP1 carriers.
| 4 | 0biomedical
| 0Study
|
619 |
To follow the effects of the drug combination on the chromatin level, we analyzed changes in histone acetylation. Overall, acetylation of histones H3 and H4 increased after treatment with Romidepsin alone, but was further enhanced by combination treatment (Fig. 6a). We further analyzed H3K27 acetylation and H3K4 trimethylation, which are established markers for active transcription, around the transcriptional start sites of six genes affected by the drug combination using chromatin immunoprecipitation (ChIP). ChIP results for acetylated H3K27 revealed a broad and strongly enhanced enrichment of acetylation after combined treatment encompassing at least 2 kb upstream of the transcriptional start site (TSS) to 2 kb downstream of the TSS of all six investigated genes (Fig. 6b). By comparison, treatment with Romidepsin alone did not significantly increase H3K27 acetylation compared to DMSO controls. Strikingly, H3K4 trimethylation was increased at the TSS of BCL2, CDKN1C/p57, and SKP2 genes after treatment with JQ1 alone, but decreased, mostly significantly, at the TSS of genes downregulated by the combination treatment.Fig. 6Changes in histone modifications elicited by combination treatment. a Changes in H3 and H4 acetylation were detected after single and combined treatment in VM-Cub1 and UM-UC-3 cells by acid histone extraction and Western blot analysis. Total histone 3 served as a loading control. b Chromatin immunoprecipitation analysis of H3K27 acetylation at transcriptional start sites (TSS) as well as 2 kb upstream (− 2 kb) and 2 kb downstream (+2 kb) of BCL-2, BCL2L1/BCL-X, BIRC5/Survivin, c-MYC, CDKN1C/p57 and SKP2 genes after single and combined treatment of VM-Cub1 cells. Immunoprecipitated DNA amounts measured by qPCR for each condition are expressed as percentage of input DNA. Additionally, H3K4 trimethylation was analyzed at the TSS of the same genes. Rabbit IgG served as a background control. Differences between samples with combination treatment and DMSO treated cells were analyzed using Student’s t test (***p ≤ 0.001, **p ≤ 0.01, *p ≤ 0.05)
| 4 | 0biomedical
| 0Study
|
72,825 |
Amyloidosis is a disorder in which misfolded proteins lead to the formation of amyloid fibrils, which are deposited in various organs. Amyloid light chain amyloidosis (AL amyloidosis), the most common type of amyloidosis, is characterized by the misfolding of monoclonal light chains, which are secreted by plasma cells [1, 2]. The presence of misfolded light chain proteins is toxic and can cause irreparable tissue damage to organs. Any organ except the brain can be affected by AL amyloidosis , with the most commonly involved organs including the heart, liver, gastrointestinal tract, autonomic nervous system, and peripheral nervous system . Deposition of amyloid fibrils in the heart is associated with particularly poor long-term prognosis [3, 4]. Because of variation in the type and number of organ systems involved, symptoms of AL amyloidosis can vary markedly, which can provide additional challenges to both proper diagnosis and treatment. For example, patients with involvement of the autonomic nervous system frequently report diarrhea, while those with kidney involvement may experience edema of the legs [1, 2]. Additional symptoms include macroglossia (enlarged tongue), purpura (bleeding of small blood vessels) on the face or neck, fatigue, weight loss, light-headedness, and carpal tunnel [4–6]. Moreover, the toxic nature of many treatments for AL amyloidosis frequently introduces additional side effects .
| 4 | 0biomedical
| 2Review
|
40,002 |
The pooled prevalence of ECC among 5-year-olds was 66.1% (95% CI: 59.0–73.4%, ranging from 81.2% in 1988 to 56.1% in 2013. Figure 2 illustrated the trends in the prevalence at age 5 over time and a decreasing trend in ECC prevalence was observed during the study period.Figure 2The result of chow breakpoint test.
| 3 | 0biomedical
| 0Study
|
357,386 |
The field workers will collect all anthropometry data using in-field digital data capture on tablets with routines that immediately calculate Z scores and provide them with a warning about extreme values and the need for remeasurement to check for potential errors (ie, if first and second measurement differed by >0.7 cm for length and by >0.1 kg for weight). We will refer to children with very low weight-for-height (Z score<−3) to their local community health center for assessment and treatment of severe acute malnutrition.
| 4 | 0biomedical
| 0Study
|
263,910 |
The causal link between the UPR pathway and sterile inflammation has been elucidated in several studies [43, 44] using both genetic and pharmacological approaches, which provided independent support for the role of the PERK and IRE1α pathways in NF-κB activation.
| 4 | 0biomedical
| 0Study
|
269,073 |
Thus, from February 2012 to December 2016, the carboplatin infusion schedule was modified switching to a weekly administration: weekly carboplatin AUC 2 (maximum dose of 220 mg); paclitaxel 80 mg/m²; and cetuximab 400 mg/m² loading dose then 250 mg/m². A maximum of 16 cycles was performed followed by a cetuximab maintenance given weekly (250 mg/m²) or every 2 weeks (500 mg/m²) until progressive disease or unacceptable toxicities.
| 4 | 0biomedical
| 0Study
|
213,751 |
To determine the growth rates of GAS strains, overnight cultures of WT, ΔprsA1, ΔprsA2 and ΔprsA1/A2 were diluted with fresh medium to optical densities at wavelength 600 nm (OD600) of 0.1 and incubated for 5 hours at 37°C. Cultures were vortexed at each time point and the value of OD600 was measured with the use of SPECTRONIC™ 200 Spectrophotometer (Thermo Fisher Scientific).
| 4 | 0biomedical
| 0Study
|
73,084 |
HeLa cells were cultured in Dulbecco's Modified Eagle Medium (4.5 g/l glucose) (DMEM: Nacalai Tesque, Kyoto, Japan) supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich, MO, USA), 100 units/ml penicillin, and 100 μg/ml streptomycin (Life Technologies, USA) at 37°C in 5% CO2.
| 4 | 0biomedical
| 0Study
|
393,375 |
However, these articles did not evaluate fatigue reliability from the perspective of energy loss until the work of Italyantsev et al. . The entropy generation rate can be employed in predicting the reliability of a mechanical structure and the service life of its mechanical parts. In service life, the fatigue process produces hysteresis energy . A method for accessing fatigue life by calculating hysteresis energy has been proposed . This approach can simply be promoted to a multiaxial state of work conditions. Following this method, a number of experimental approaches using the second law of thermodynamics for mechanical reliability have been presented . For example, the fatigue degree and service life of Al and stainless steel have been analyzed with entropy theory . Naderi et al. judged the fatigue of metallic materials on the basis of the irreversibility of cyclic plastic strain energy in the aging process under different loads. Damage thermodynamic entropy can be applied to the evaluation of the degradation behavior of materials. With the continuous improvement of entropy generation theory in mechanical material fatigue, the total entropy from initial fatigue to failure can be regarded as a material property because the total entropy generation is a constant. An example of an aviation material is AA7075-T651 . In other words, the entropy accumulation for break failure life is a constant value in various loads. Similarly, fracture fatigue entropy (FFE) can be calculated on the basis of energy dissipation in the aging process (Figure 5) .
| 4 | 0biomedical
| 0Study
|
30,305 |
It has been reported that hCINAP is indispensable for cell viability and tumour cell growth28. We analysed hCINAP expression in colorectal cancers (CRC) based on the TCGA COAD (Colon adenocarcinoma) and READ (Rectum adenocarcinoma) cancer types, and found that the level of hCINAP protein was significantly higher in tumour tissue than that in adjacent non-tumour tissue (Supplementary Fig. 1d). Consistently, hCINAP protein was significantly upregulated in CRC tissues from 50 patients in comparison with its level in adjacent normal tissues (Fig. 1a; Supplementary Table 2; Supplementary Fig. 1a,b). Immunohistochemical analysis of hCINAP expression identified the heterogeneity of CRC (Supplementary Fig. 1c). We also investigated hCINAP expressions in different CRC stages and molecular subtypes based on a four consensus molecular subtypes (CMSs) classification29. No significant difference of hCINAP levels was observed in four CRC stages (Supplementary Fig. 1e), while the hCINAP level was relatively higher in CMS2 with marked activation of Wnt and Myc signalings, and CMS3 with disordered metabolism (Supplementary Fig. 1f). Hyperactive Wnt signalling and metabolic dysregulation are frequently revealed in CRC3031 and Wnt pathway contributes to CRCSCs self-renewal and metastasis32. As metastasis is the primary cause of mortality in patients with CRC, we assessed whether hCINAP affected CRC cell migration and invasion. hCINAP-depleted SW480 cells showed impaired migration potential in a wound-healing assay, while overexpressing hCINAP rendered SW480 cells more migratory (Fig. 1b). Of note, cells transfected with more effective shRNA showed worse migration (Fig. 1c). In addition, transwell assays showed that hCINAP silencing markedly impeded cell invasion, whereas hCINAP overexpression promoted SW480 cell invasion (Fig. 1d), suggesting that aberrant overexpression of hCINAP expedited CRC cell motility.
| 4 | 0biomedical
| 0Study
|
129,028 |
His family history was negative for autoimmune diseases. In the last 2 years, his past history showed five episodes of parotitis that have been investigated by a regional Children’s Hospital. Once immunological and rheumatological pathologies were excluded, a diagnosis of juvenile recurrent parotitis was made. Careful oral hygiene and periodic otorhinolaryngological follow up were recommended.
| 2 | 1clinical
| 3Clinical case
|
162,644 |
The following chiral higher-energy structure, with C2 point group symmetry, lies 4.70 kcal/mol energy above the putative global minimum. It is a chiral helix-type structure, as depicted in Figure 1k,l. It has four Be atoms located in the center of the boron spiral; this helix structure is similar to those found by previous theoretical works , and its probability of occurrence is negligible at room temperature.
| 4 | 0biomedical
| 0Study
|
284,994 |
Furthermore, SARS-CoV-2 is capable of inhibiting and delaying the induction of IFN type I by infected cells, leading to a general delay or suppression of IFN type I responses. This allows the virus to replicate and induce more tissue damage, triggering a greater immune response . The ineffective innate immunity of IFN has been strongly associated with a lack of control over the primary infection and a high risk of severe COVID-19, accompanied by innate cellular immunopathology and an increase in plasma cytokines (CXCL10, IL-6 and IL-8) . If the delay of the innate immune response is too long—due to particularly efficient evasion by the virus, defective innate immunity, or a combination of both—the virus has an advantage in replicating in the upper respiratory tract and lungs, and the host fails to mount an adaptive immune response fast enough, resulting in conditions that lead to more serious lung disease .
| 5 | 0biomedical
| 0Study
|
119,172 |
Flavonoid biosynthesis occurs in the endoplasmic reticulum of vascular and non-vascular plants following the phenylpropanoid metabolic pathway . Chalcones important in flavonoid biosynthesis are formed from 4-coumaroyl-CoA and malonyl-CoA in sequential enzymatic reactions with chalcone synthase. Further enzymatic modifications are required throughout the metabolic pathway to produce the other classes of flavonoids with the conjugate ring closure of chalcones resulting in the typical three-ringed flavonoid structure. For a comprehensive description of enzymes and genes involved in the formation of flavonoids in the biosynthetic pathway see . Genetic modification of the flavonoid biosynthetic pathway has been used in various plant species to achieve desirable traits such as increased production of plant-defence flavonoids and to extend floral pigmentation .
| 4 | 0biomedical
| 0Study
|
181,189 |
Classification of the carotid artery images to identify the presence of plaque deposit is performed by machine learning algorithms, CART decision tree, random forest, and logistic regression. Convolutional neural network (CNN)-based deep learning classification and Mobilenet and Capsulenet transfer learning approaches are performed in the carotid artery image database. The performance of these classification methods is analyzed with the true values confirmed by three radiologists.
| 4 | 0biomedical
| 0Study
|
215,879 |
We drew a series of risk plots in which the samples were sorted in increasing order of risk scores for the training, validation, and entire TCGA datasets, including the heatmap of GInLncRNA expression, the distribution of somatic mutation of LGG patients, and the change of CDC20 expression pattern along with the increasing scores. As illustrated in Figure 7A, the expression levels of these risky lncRNAs (CRNDE, AL390755.1, TGFB2-AS1, and AC025171.5) in the training dataset were upregulated along with the increase of risk scores as expected. In contrast, the protective lncRNA AL049749.1 was downregulated along with the rise in risk scores. In addition, the numbers of somatic mutation and pattern of CDC20 expression presented an upward trend with increasing risk scores. In the training datasets, the high-risk group is significantly greater than the low-risk group in the number of somatic mutations (median of somatic mutation counts 36 vs. 25.5, p < 0.001, Mann–Whitney U test; Figure 7D). The patients in the high-risk group of the training dataset tended to have a greater expression level of CDC20 gene than the low-risk group (median of CDC20 expression level 2.484 vs. 1.052, p < 0.001, Mann–Whitney U test; Figure 7D). We further probed into whether the GInLncSig exhibited similar performance in the validation and entire TCGA datasets. As described in Figures 7B,C, the same procedures were repeated in the validation and entire TCGA datasets, and these similar results were observed. The high-risk group exhibited significantly higher somatic mutations than the low-risk group in both the validation (median of somatic mutation numbers 34.0 vs. 26.0, p < 0.001, Mann–Whitney U test; Figure 7E) and entire TCGA datasets (median of somatic mutation numbers 34.0 vs. 26.0, p < 0.001, Mann–Whitney U test; Figure 7F). Likewise, it could be observed that the high-risk group presented a higher expression level of CDC20 compared with the low-risk group in both the validation (median of CDC20 expression level 2.315 vs. 1.207, p < 0.001, Mann–Whitney U test; Figure 7E) and entire datasets (median of CDC20 expression level 2.451 vs. 1.079, p < 0.001, Mann–Whitney U test; Figure 7F).
| 4 | 0biomedical
| 0Study
|
126,609 |
Statistical analysis was performed using the Student’s t test for unpaired data or one-way ANOVA test (Prism 5.0 software, GraphPad). Data are expressed as the mean ± SD of samples derived from at least three biological repeats and P values ≤ 0.05 were considered significant. All the results shown are representative of at least three independent experiments, each in duplicate or triplicate.
| 3 | 0biomedical
| 0Study
|
20,409 |
Providing high quality care for patients remains the ultimate goal for all health care providers. One of the main measures to achieve this goal is to decrease preventable adverse events after discharge from the hospital. Forster et al. studied the adverse events caused by medical care after hospitalization discharge. It was approximated that one-quarter of patients develop an adverse event, half of which are preventable. Another study estimated that about 19.6% of Medicare fee-for-service patients are rehospitalized within 30 days of discharge; the authors concluded that this rate is both prevalent and costly among such populations . In 2011, approximately 3.3 million adults were readmitted to the hospital and the associated costs totaled about $41.3 billion . Researchers, hospitals, and policymakers are actively considering refinements to the Hospital Readmission Reduction Program and looking for ways to engage other providers and patients in reducing preventable patient readmissions to the hospital. The shares of hospitals receiving penalties for 30-day readmissions and total fines are both higher in 2015 . It was also suggested that an estimated $12 billion per year is spent on avoidable hospital readmission costs [2, 5]. Based on these statistics, the Medicare Payment Advisory Commission has suggested multiple interventions to prevent avoidable readmissions and is moving to impose financial penalties on hospitals with excess readmissions [5, 6].
| 4 | 0biomedical
| 2Review
|
144,540 |
Full details of the study design and participant recruitment, enrolment, and randomization have been described previously (Figure 1) . Of the 446 individuals who expressed an interest in the study, 127 individuals aged 60–80 years with a BMI > 27 kg/m2 attended the initial screening, which included physical assessments (body height and weight, resting BP, heart rate, and waist and hip circumference), laboratory assessments (serum creatinine, urea, sodium, potassium, bilirubin, uric acid, gamma-glutamyl transferase, alanine transaminase, aspartate transaminase, hepatic lipase, blood counts, lipids and lipoproteins, glucose, insulin, HbA1c, and high-sensitivity C-reactive protein (hs-CRP)), medical history, and a dietary questionnaire. Participants were included if they displayed at least three out of the following traits of metabolic syndrome: (i) visceral fat distribution (waist circumference ≥ 94 cm for men and ≥80 cm for women), (ii) pre-hypertension (systolic BP ≥ 120–139 mmHg and/or diastolic BP ≥ 80–89 mmHg) or hypertension (systolic BP ≥ 140–159 mmHg and/or diastolic BP ≥ 90–99 mmHg), (iii) elevated fasting glucose (≥5.55 mmol/L), dyslipidemia (fasting serum triglycerides ≥ 1.7 mmol/L or serum HDL cholesterol < 1.0 mmol/L for men and <1.3 mmol/L for women), and/or a pro-inflammatory state (high-sensitivity C-reactive protein ≥ 2.0 mg/dL). The following were defined as main criteria: smoking, insulin-treated diabetes mellitus, long-term dietary supplements intake, inflammatory disease, disease of the liver, kidney, or gastrointestinal tract, a history of cardiovascular events, abnormal thyroid function, cancer, recent major surgery or illness, substance or alcohol abuse, participation in a weight loss program, and malabsorption syndromes .
| 4 | 0biomedical
| 0Study
|
6,238 |
As we mention in the Introduction, the major challenge in current medical practice of oncolytic viral therapy is the complexity of the immune responses . The innate immune response tends to reduce the efficacy of oncolytic viral treatments by reducing new virus multiplication and blocking the spreading of infection. However, the stimulated adaptive immune response tends to reduce tumor cells. These two opposite functions increase the complexity of oncolytic viral therapy. A balance between two functions needs to be determined in order to improve the efficacy of oncolytic virotherapy. This is a very subtle question. There are not too much experimental or clinical data about this balance in the literature. Therefore, a mathematical study of this question is highly demanded. Our current mathematical model is only dealing with the innate immune system. The extension of our model to incorporate the adaptive immune system is expected. We plan to carry out such study in other articles.
| 4 | 0biomedical
| 0Study
|
1,401 |
A variety of antimony halide perovskites has been investigated with regard to the crystal structure [157, 160, 164, 166], phase transitions of polymorphous compounds [158, 159, 163, 165, 166], as well as ferroelectric and optical properties [162, 167, 168]. Only a few studies aim at a photovoltaic application [35, 55, 65].
| 4 | 0biomedical
| 2Review
|
138,556 |
Chitosan (Ch) (degree of deacetylation: 75–85 %, Mwt: 190,000–310,000), hexylamine (HA), purity 99%, ethylamine (EA), 66.0–72.0 % in water, 1,2-diaminopropane (DAP), purity 99% N,N-dimethyldodecylamine (DDA), purity 97%, potassium carbonate, K2CO3, purity over 99%, sodium carbonate, Na2CO3, purity over 99.5%, potassium hydroxide, KOH, purity > 85%, urea (U), purity over 99.5%, aniline (A), purity over 99.5%, chromium(VI) oxide, CrO3, purity 99.9%, and lead(II) nitrate, Pb(NO3)2, purity more than 99.0% were all purchased from Sigma-Aldrich (Schnelldorf, Germany). Dimethyldidodicylammonium bromide, DDAB, was prepared in our laboratory as described . CaCO3 nanoparticle (NPs) was purchased from Sky spring nanomaterials, (Houston, TX, USA) purity 99% and HCl (36.5–36 vol %) was purchased from J.T.Baker. All reagents and solvents were of analytical grade and were used without further purification. The N2 gas used was 99.999% pure (KOAC, Kuwait). All solutions were prepared with deionized water of a resistivity of 18.2 MΩ.cm.
| 2 | 0biomedical
| 0Study
|
277,105 |
Karst-related C sink could respond to future climate change quickly and needs to be considered in the modern carbon cycle model. SW China has experienced dramatic change in regional climate as regards total karst-related C sink (TSC). Between 1970 and 2010, TCS decreased by about 19% as a result of an increase in air temperature (from 0.33 °C to 1.04 °C) and a decrease in precipitation (from 156 to 106 mm) .
| 2 | 2other
| 0Study
|
29,373 |
To achieve these goals, we applied the CellSpot technology to anonymized human blood samples. To identify broadly reactive anti-IBV MAbs, we used HA antigens from representative members of the two major lineages of IBV strains: B/Florida/04/2006 (Yamagata lineage) and B/Malaysia/2506/2004 (Victoria lineage) (27). Eight blood donors were surveyed, with a total of approximately 2.5 million memory B cells being screened both in dedicated IBV screens and as controls in screens for other antigens. Memory B cell (CD19+/CD27+) abundance was measured and adjusted to equal levels in each screen. In the primary screen, for most blood samples the average frequency at which memory B cells secreted a MAb against IBV HA was 2 in 10,000, which was about 10-fold higher than what we previously found when screening for MAbs against IAV HAs. Of these anti-IBV MAbs, about half showed cross-reactivity to HAs from both the B/Florida/04/2006 and B/Malaysia/2506/2004 strains. For further characterization, 23 MAbs were expressed in HEK293 cells and confirmed as being double positive for both IBV HAs.
| 4 | 0biomedical
| 0Study
|
234,113 |
Subjects at high risk of future development of late onset AD can be identified based on dementia family history or carriership of the apolipoprotein gene epsilon 4 (APOEε4) allele, which is the main genetic risk factor for late-onset AD. 16 The APOE gene is associated with vascular integrity, mitochondrial function, synaptic plasticity and glucose metabolism. 17 Studies examining perfusion in APOEε4 carriers report mixed observations, with evidence of both hypo-18,19 and hyper-perfusion.20–22 Furthermore, studies on the Dominantly Inherited Alzheimer’s Network (DIAN) cohort (autosomal dominant forms of AD) have reported hypometabolism observed with FDG-PET approximately 19 years before the expected disease onset 23 and patterns of hyper-perfusion approximately 25 years from the expected onset. 21 These opposing findings could partly be attributed to different perfusion imaging modalities and post-processing approaches as well as on age differences of the examined cohorts. Apart from these potential interpretations, it has been suggested that these observations could be a result of combined vascular dysregulation and the concurrent build-up of a compensatory mechanism early on in the disease trajectory. 2 The existence of such a mechanism would therefore suggest that there is a crucial break-point during the course of the disease, whereby an early pattern of hyper-perfusion is succeeded by the more typical MCI/AD pattern of hypo-perfusion. 24 Hence, the trajectory of CBF changes in AD might follow a similar pattern to cholesterol levels and blood pressure, whereby higher values at midlife and decreases later on, have been associated with a higher risk of developing AD.25,26
| 4 | 0biomedical
| 0Study
|
237,186 |
The previous studies in Ethiopia mainly concentrated on individual-level factors and analysis was made using ordinary logistic regression. However, as EDHS data has a hierarchical nature, a multilevel logistic regression analysis is preferred to consider the individual and community level factors simultaneously and there are limited studies based on this multilevel analysis. The result will help policy makers, program officer and local authorities to map the community with optimal breastfeeding and to mitigate malnutrition and end hunger by 2030. Thus, this study aimed to identify factors associated with optimal breastfeeding among children age under six month in Ethiopia.
| 3 | 0biomedical
| 0Study
|
371,370 |
Heart tissue samples from mice were collected at 4 weeks after TAC. The specimens were fixed with 4% paraformaldehyde, embedded in paraffin, cut into 5-μm-thick sections and stained with haematoxylin and eosin (HE) according to the manufacturer’s instructions.
| 4 | 0biomedical
| 0Study
|
129,011 |
The DVN after capturing an image of the vehicle transmits it to the GN through its Bluetooth connectivity. The received image at the GN is fed as an input image to the modified Tiny-YOLOv3 that extracts the detected vehicle and discards the rest of the unwanted information, i.e., bytes that could cause significant costs in terms of the communication and energy cost of the radio. Although this cropped-out image has a lower resolution as compared to its source image, its quality in terms of the number of associated colors remains the same. For example, for an input UXGA image (i.e., Figure 9a), the corresponding detected and extracted images are shown in Figure 10a,b, respectively. Since the output images from Tiny-YOLOv3 for the rest of images as shown in Figure 9b–d look the same, they are omitted from the display. However, their details are summarized in Table 2. For example, the first row in Table 2 indicates that an input image of 1600 × 1200 resolution and 357.17 kB size is reduced to an image of 513 × 355 resolution and 66.97 kB size, i.e., 81% reduction in the size of the source image thanks to TINY-YOLOv3 extraction.
| 1 | 2other
| 0Study
|
296,434 |
We finally note that introduced prominent DNA structural anomalies can be detected by the routine high-resolution AFM as shown in the present study. The detailed information on the pitch, bend and twist perturbations is, however, hidden at the sub-nanometer scale. In order to acquire this information, the extreme microscopic resolution allowing the visualization of both strands of the DNA double helix is necessary. Such a capability is demonstrated by the modern FM-AFM measurements, which have been done up to now only for DNA adsorbed on a mica substrate [68–72]. Interestingly, even in this case (of the freely equilibrated conformations and a much weaker DNA/surface interaction), the large deviations from canonical B-form dimensions have been observed [68, 72].
| 4 | 0biomedical
| 0Study
|
94,896 |
Plant MYBs regulate secondary metabolism (Liu et al., 2015; Chezem et al., 2016). Several flavonoid-related MYB TFs were already identified in plants. TT2, the first identified proanthocyanidin (PA)-related MYB TF, induces the biosynthesis of PAs in seed coats of A. thaliana by activating DFR, ANS, and ANR (Nesi et al., 2001). In grapevines, VvMYBA1 and VvMYBA2 are specific regulators, which activate the UFGT of the anthocyanin pathway (Kobayashi et al., 2002). MdMYB10 alleles are the key regulatory factors during the coloration of apple fruits (Takos et al., 2006; Espley et al., 2007). VvMYBPA2 was identified as a direct regulator of several structural flavonoid pathway genes in grapevines (Terrier et al., 2009). MdMYB3 activates some flavonoid-biosynthesis-related genes, such as CHI, CHS, FLS, and UFGT, in apple fruits (Vimolmangkang et al., 2013). In strawberry, FaMYB10 regulates the anthocyanin-pathway-related genes, including most of the EBGs and LBGs in ripened fruit receptacles during ripening (Medina-Puche et al., 2014). Few MYB genes from H. brasiliensis have been reported. Overexpressed HbMyb1 in tobacco suppresses stress-induced cell death (Peng et al., 2011). Another MYB gene down-regulated in trees with tapping panel dryness was identified from the SSH library (Venkatachalam et al., 2007). The MYB gene was significantly induced by ET, ABA, JA, SA, and wounding treatments (Qin et al., 2014). To date, whether MYB TFs help regulate the NR synthesis pathway in rubber trees remains unknown. NR is synthesized from the precursor IPP (Archer and Audley, 1987; Madhavan et al., 1989; Cornish and Backhaus, 1990; Chow et al., 2007, 2012; Sando et al., 2008). During NR biosynthesis, FDPS and HRT, along with SRPP, are critical to NR biosynthesis and frequently used to determine the efficiency of a process (Light et al., 1989; Oh et al., 1999; Asawatreratanakul et al., 2003). However, the regulatory mechanism of rubber biosynthesis is incompletely understood (Yamashita et al., 2016; Tang et al., 2016). HbWRKY1 was identified as a negative transcription regulator of HbSRPP (Wang et al., 2013). Other WRKY proteins may participate in the regulation of NR biosynthesis (Li et al., 2014). HbMADS4 was also found as a negative transcriptional regulator of HbSRPP (Li et al., 2016b). HbCZF1, a CCCH-type zinc-finger protein, highly activates the hmg1 promoter, and HbCZF1 may help regulate NR biosynthesis (Guo et al., 2015). In the present study, HblMyb19 and HblMyb44 bind the promoters of HRT1, HbSRPP, and HbFDPS1 in yeast. Moreover, HblMyb19 and HblMyb44 activated the promoters of HRT1, HbSRPP, and HbFDPS1 in plants. These results strongly indicated that HRT1, HbSRPP, and HbFDPS1 are the target genes of HblMyb19 and HblMyb44, and HblMyb19 and HblMyb44 are transcriptional activators of HRT1, HbSRPP, and HbFDPS1. Moreover, JA signaling may regulate NR biosynthesis in laticifers (Zeng et al., 2009; Pirrello et al., 2014). The induction of the expression of HblMyb19 and HblMyb44 by MeJA showed that HblMyb19 and HblMyb44 may play a role in the JA signaling pathway. Additionally, HRT1, HbSRPP, and HbFDPS1 can be utilized to increase the NR content in rubber tree. As a result, upregulating HRT1, HbSRPP, and HbFDPS1 can improve NR productivity in the transgenic plants. The identification and characterization of the NR-biosynthesis-related MYB TFs would greatly help increase the understanding of the molecular mechanism of NR metabolism.
| 4 | 0biomedical
| 0Study
|
272,942 |
"Funding was provided by the National Science and Engineering Research Council (NSERC) and the Ontario Ministry of Agriculture Food and Rural Affairs (OMAFRA). NAV received stipend funding through the Ontario Veterinary College, the University of Guelph, and a National Sciences and Engineering Research Council Postgraduate Scholarship-Doctoral. In-kind support was provided by Public Health Agency of Canada. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. "
| 1 | 2other
| 1Other
|
315,337 |
The ecosystem service value evaluation model proposed by Costanza et al. was adopted in this study. ESV=∑Ai×VCi(1) where ESV is ecosystem service value (RMB), Ai is the area of Type i land use (hm2) and VCi is the ecosystem service value coefficient of Type i land use (RMB/hm2·a). As a unique form of surface water in the mining subsidence area, the subsided water body has caused the mining area to evolve from a single farmland terrestrial ecosystem into a wetland / aquatic ecosystem with climatic regulation, water conservation and raw material supply functions. Meanwhile, the mining area is susceptible to various forms of pollution, including "industrial waste", pesticides, fertilizers, domestic sewage and other pollutants and performs limited soil formation and protection, entertainment and cultural functions. Ecosystem service value coefficients of natural and collapsed water per unit of area are shown in Table 2 . The service value system per unit of area for China's ecosystems formulated by Xie et al. and the value systems of mining cities, towns and industrial ecosystems estimated by Zhang et al. are used, and the value coefficient of ecological services for the study area is obtained (Table 3).
| 4 | 0biomedical
| 0Study
|
297,629 |
All participants were right-handed and Han Chinese. Exclusion criteria for all participants were as follows: (1) other psychiatric disorders meeting the DSM-5 diagnostic criteria; (2) any history of neurological illnesses, severe physical illnesses, and substance abuse; (3) pregnancy; (4) abnormal cerebral structure after initial MRI scan; (5) any contraindications for the MRI scan.
| 3 | 0biomedical
| 0Study
|
33,455 |
Overall, the adjuvants studied herein differed in terms of the magnitude and kinetics of the transcriptional changes induced in both WB and dLNs. In dLNs, GLA-SE induced the highest levels and the earliest onset of transcriptional changes, whereas both CAF01 and IC31 induced later and less detectable changes in the transcriptional profile compared with GLA-SE. Alum induced the most subtle transcriptional changes in both WB and dLNs.
| 4 | 0biomedical
| 0Study
|
260,198 |
Sez6 family expression in the hippocampus. (A) Sez6, Sez6L, and Sez6L2 are expressed by principal (excitatory, pyramidal) neurons of the mouse hippocampus at much higher levels than other known complement regulators (namely Crry, C4BP, CFH, C1-INH, DAF, and MCP). Expression data was obtained from Hipposeq: a comprehensive RNA-Seq database of gene expression in hippocampal principal neurons [http://hipposeq.janelia.org (60)]. The RNA samples used in this database were isolated from mouse hippocampal principal neurons micro-dissected from the CA1, CA3, or Dentate Gyrus (DG) cell layers of the hippocampus at Postnatal Day 25-32. Differential gene expression is shown in the heatmap with the relative units of FPKM (Fragments per Kilobase of Exon per Million Reads Mapped.) (B) Brain sections from adult WT mice or Sez6 triple knockout mice (TKO) were immuno-stained for Sez6L2 (green) and DAPI and imaged in the CA1 region of the hippocampus. Scale Bar= 27 µm. High density Sez6L2 staining occurs around cell bodies in the pyramidal layer, but significant Sez6L2 is also found in the stratum radiatum and stratum oriens. (C) Higher magnification images of sections immuno-stained for Sez6L2 (green) and the postsynaptic protein, Homer1 (red), shows a subset of Sez6L2 is found near or co-localized with synapses in the stratum radiatum. Scale bar = 1.8 µm.
| 4 | 0biomedical
| 0Study
|
348,312 |
In the human GIT, acetogens, alongside methanogens, may cross-feed on the hydrogen and CO2 produced by saccharolytic members of the GIT microbial population (for a review, see Smith et al. ). High concentrations of hydrogen in the GIT reduce the efficiency of carbohydrate breakdown by many microbes [4–6] and the presence of an acetogen has been shown to mitigate this effect in rodents . Acetogens have also been investigated as a potential means of reducing the amount of hydrogen converted to the greenhouse gas methane in the rumen [8, 9], since they have proven effective hydrogen consumers in the GIT of other animals [10, 11].
| 4 | 0biomedical
| 0Study
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.