text
stringlengths 199
648k
| id
stringlengths 47
47
| dump
stringclasses 1
value | url
stringlengths 14
419
| file_path
stringlengths 139
140
| language
stringclasses 1
value | language_score
float64 0.65
1
| token_count
int64 50
235k
| score
float64 2.52
5.34
| int_score
int64 3
5
|
|---|---|---|---|---|---|---|---|---|---|
"In place of writing they used some strands of cord or thin wool strings, like the ones we use to string rosaries; and these strings were called *quipos.* By these recording devices and registers they conserved the memory of their acts, and the Inca's overseers and accountants used them to remember what had been received or consumed. A bunch of these *quipos* served them as a ledger or notebook. The *quipos* consisted of diverse strings of different colors, and on each string there were several knots. These were figures and numbers that meant various things. Today many bunches of very ancient *quipos* of diverse colors with an infinite number of knots are found. On explaining their meaning, the Indians that know them relate many things about ancient times that are contained in them. There were people designated for this job of accounting. These officials were called *quipos camayos,* and they were like our historians, scribes, and accountants, and the Incas had great confidence in them.
"These officials learned with great care this way of making records and preserving historical facts. However, not all of the Indians were capable of understanding the *quipos;* only those dedicated to this job could do it; and those who did not study *quipos* failed to understand them. Even among the *quipo camayos* themselves, one was unable to understand the registers and recording devices of others. Each one understood the *quipos* that he made and what the others told him. There were different *quipos* for different kinds of things, such as for paying tribute, lands, ceremonies, and all kinds of matters pertaining to peace and war. And the *quipo camayos* customarily passed their knowledge on to those who entered their ranks from one generation to the next. The *quipo camayos* explained to the newcomers the events of the past that were contained in the ancient *quipos* as well as the things that were added to the new *quipos;* and in this way they explain everything that that transpired in this land during all the time that the Incas governed. These *quipos* are still used in the *tambos* to keep a record of what they sell to travellers, for the *mitas,* for herders to keep track of their livestock, and for other matters. And even though many Indians know how to read and write and have traded their *quipos* for writing, which is without comparison a more accurate and easier method, still, in order to show the great subtlety of this method of preserving history and keeping accounts for people who had no writing and what they achieved with it, I wish to give the following example of what happened in our times.
"Two Spaniards left together from the town of Ica to go to the city of Castro Virreina, and arriving at the *tambo* of Cordoba, which is a day's travel from Ica, one of them stayed there and the other continued his trip; at this *tambo* this latter traveller was given an Indian guide to accompany him to Castro Virreina. This Indian killed the Spaniard on the road and returned to the *tambo.* After some time passed, since the Spaniard was very well known, he was missed. The governor of Castro Virreina, who at that time was Pedro de Cordoba Mejia, a native of Jaen, made a special investigation to find out what had happened. And in case the man had been killed, he sent a large number of Indians to look for the body in the puna and desert. But no sign of him could be found, nor could anyone find out what had become of him until more than six years after he had been killed.
"By chance the body of another Spaniard was found in a cave of the same desert. The governor ordered that this body be brought to the plaza so that it could be seen, and once it was brought, it looked like the one the Indian had killed, and, believing that it was he, the governor continued witht he investigation to discover the killer. Not finding any trace or evidence against anybody, he was advised to make an effort to find out the identity of the Indian who was given to the deceased as a guide at the *tambo* or Cordoba. The Indians would know this in spite of the fiact that more than six years had passed because by means of the record of the *quipos* they would have kept memory of it. With this the governor sent for the caciques and *quipo camayos.* After they were brought to him and he continued with the investigation, the *quipo camayos* found out by their *quipos* the identity of the Indian who had been given as a guide to the aforementioned Spaniard. The Indian guide was brought prisoner immediately from his town, called Guaytara, and, having given his declaration in which he denied the crime, he was questioned under torture, and at once confessed to having killed the man, but explained that the wrong body had been brought. However, he would show them the place where he had killed the man and where the body was located. Police officers went with him to the puna, and they found the body where the Indian guide had hidden it, and it was in a cave located some distance from the road. With the great cold and dryness of the paramo, the body had not decomposed, but it had dried out, and thus it was whole. The first body that was brought was never identified, nor was the killer. The extent of the achievement of the record and memory of the *quipos* can be appreciated by this case."
|
<urn:uuid:0d93e371-054c-4da4-9649-32534dac812b>
|
CC-MAIN-2016-26
|
http://www.deadmedia.org/notes/0/001.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395039.24/warc/CC-MAIN-20160624154955-00078-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.984774 | 1,203 | 3.25 | 3 |
ESA have recently passed the next stage in selecting the next in the line of Earth Explorer missions. This process will choose the next satellite to continue the series which so far includes CryoSat-2, SMOS, GOCE, Swarm, ADM-Aeolus & EarthCARE.
The shortlist has now been reduced from six to three. The candidate missions are briefly outlined below. Follow the links for more information.
BIOMASS – aims to measure the distribution and temporal changes of forest biomass at a global scale. Note a secondary objective of this mission is measurement of ice thickness.
CoReH2O – aims to measure fresh water stored in snow on land surfaces and in snow accumulation on glaciers and ice sheets.
PREMIER – aims to quantify processes controlling global atmospheric composition in the mid- to upper-troposphere and lower stratosphere.
To give you some idea of the timescales involved in planning satellite missions, whichever mission is finally selected the launch is anticipated in 2016.
|
<urn:uuid:77b1d3d9-ccfe-4517-b2ed-07c93ae27ba1>
|
CC-MAIN-2016-26
|
http://blog.antarctica.ac.uk/eo/2009/03/12/candidates-for-next-esa-mission-reduced-to-three/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393093.59/warc/CC-MAIN-20160624154953-00057-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.917191 | 207 | 2.65625 | 3 |
The COELIX astronomy program lets you print detailed maps of the sky that can show a total of more than 15 million stars, 28,000 deep sky objects, paths of planets, comets and over 380,000 asteroids.
Designed for the amateur astronomer, COELIX also generates accurate astronomical ephemeris (satellites of Jupiter, eclipses, occultations and so on) and many catalogues with selection criteria. A search engine enables you to find any celestial body to get its ephemeris data, its related views and graphics.
COELIX can generate a lot of tables and a graphic almanac that show all the phenomena that can occur during one year, one month, or any other period selected by the user.
With its virtual planetarium functions, it contains a multitude of views, tables, graphics and animations to view and analyze the celestial phenomena from any observing site on Earth. You can choose a site in a list or configure and add your own observing station.
Also, COELIX can control several models of motorized telescopes, using the ASCOM platform. In COELIX, you can command the telescope to point to a celestial body found with the search engine, on a sky map or listed in one of several lists or catalogues.
|
<urn:uuid:a54dd97c-27ea-44d6-b34d-cc886c20dc03>
|
CC-MAIN-2016-26
|
http://www.ngc7000.com/en/coelix/index.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396029.85/warc/CC-MAIN-20160624154956-00101-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.885823 | 260 | 2.890625 | 3 |
Elementary school teacher, Angela Rathjen, shares, "In my experience, some kids only need the opportunity. Others need a little more encouragement. I find that brainstorming ideas helps kids get excited and can inspire creativity." Remember that during brainstorming sessions, there isn't a right or wrong answer — if there were, you wouldn't need to brainstorm at all. This is a chance for kids to test the creative waters and use their imagination to come up with unique solutions to solve a problem. "If I have a specific (creative) task for my students," Rathjen adds, "I find that modeling the brainstorming process and getting them involved in it helps offer ideas and encouragement to those who need it and helps to provide focus for others."
After all, rules were made to be broken, and it's impossible to get messy in a room that's already destroyed. Play therapist and counselor, Kathy Eugster, explains on her website that children need a clean and organized space for play. She writes, "Even though it is important to encourage your child to help in cleaning up the toys, it is your job to provide your child with a clean and organized play space and with the necessary toys and materials for creative and imaginative play." Additionally, consider noise as a factor that can detract from an organized space. Turn off the television, even if it is just on for background noise, to avoid cluttering the space and detracting from your child's creative time.
Stock your child's organized play area with toys like finger puppets, building blocks, age-appropriate art supplies and even noise makers. Eugster recommends providing props for dress-up to inspire imaginative play. Look outside of the pre-assembled toys that already have a story associated with them, and seek out toys that require your child to come up with a story of their own.
To a certain extent, it is important to allow kids enough room to play, explore and create on their own, without parental intervention. Once you have provided kids with the space and the tools they need, then it's important to resist the urge to lead their imaginative playtime. This doesn't mean that you shouldn't play with them, just let your child lead the activities and avoid the urge to correct them, unless it's a matter of safety.
As you watch your kids step out of their comfort zone and look to their imagination to create, play and solve problems, let them know that you are proud of them. Positive feedback that accurately reflects their effort will encourage more imaginative play and self-confidence.
And you'll see personalized content just for you whenever you click the My Feed .
SheKnows is making some changes!
|
<urn:uuid:f3def2ca-c707-42ce-ada1-2bc2d5554302>
|
CC-MAIN-2016-26
|
http://www.sheknows.com/parenting/articles/845257/encouraging-kids-to-use-their-imaginations
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783403825.35/warc/CC-MAIN-20160624155003-00112-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.966768 | 544 | 3.125 | 3 |
The Grumman HU-16 Albatross is a large twin-radial engine amphibious flying boat. Originally designated SA-16, it was renamed HU-16 in 1962.
The Albatross was designed to be able to land at sea in open ocean situations in order to effect the rescue of downed pilots. Its deep-V cross-section and substantial length helped make it possible for it to land in wavy conditions. Since it weighs over 12,500 pounds, pilots must have a type rating in order to act as pilot or co-pilot on board the Albatross. There is a yearly Albatross fly-in at Boulder City, Nevada, where Albatross pilots can renew their type ratings.
|
<urn:uuid:0c1daa89-5eef-4ab9-8f80-45b89b538cb5>
|
CC-MAIN-2016-26
|
http://www.aircraftspruce.com/catalog/stpages/AHU16T.php
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783400572.45/warc/CC-MAIN-20160624155000-00153-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.963511 | 151 | 2.796875 | 3 |
McDonald Astronomers Help Confirm CoRoT Satellite's New Crop of Extrasolar Planets
14 June 2010
Today, France's space agency, the Centre National d'Études Spatiales (CNES), announced that its CoRoT satellite has found seven new extrasolar planets. A significant component of the ground-based confirmation and follow-up research for four of these (CoRoT-11b, 12b, 14b, and 15b) was undertaken by McDonald Observatory astronomers.
Michael Endl, Bill Cochran, and Phillip MacQueen used Hawaii's Keck 1 Telescope together with its HIRES spectrograph to confirm the four planets. They used Keck to make radial velocity measurements of extremely faint stars — three of these are about 10,000 times fainter than the human eye can see. This work requires the world's largest telescopes and the best instruments, Endl said.
The team received additional help from professor Chris Sneden of the University of Texas at Austin astronomy department and McDonald Observatory's Stuart Barnes.
For more information on the planets themselves and about the CoRoT mission, see the CNES press release.
— END —
Science contact: Michael Endl, McDonald Observatory Research Scientist, 512-471-8312.
|
<urn:uuid:bd19e7ab-9c8b-4e9b-8e72-cd27d42d96de>
|
CC-MAIN-2016-26
|
http://mcdonaldobservatory.org/news/releases/2010/0614.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783392527.68/warc/CC-MAIN-20160624154952-00141-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.8752 | 265 | 3.171875 | 3 |
This is part of a consultation on the Red List implications of extensive changes to BirdLife’s taxonomy for non-passerines
Lynx Edicions and BirdLife International will soon publish the HBW-BirdLife Illustrated Checklist of the Birds of the World, building off the Handbook of the Birds of the World series, and BirdLife’s annually updated taxonomic checklist.
The new Checklist will be based on the application of criteria for recognising species limits described by Tobias et al. (2010). Full details of the specific scores and the basis of these for each new taxonomic revision will be provided in the Checklist.
Following publication, an open and transparent mechanism will be established to allow people to comment on the taxonomic revisions or suggest new ones, and provide new information of relevance in order to inform regular updates. We are also actively seeking input via a discussion topic here regarding some potential taxonomic revisions that currently lack sufficient information.
The new Checklist will form the taxonomic basis of BirdLife’s assessments of the status of the world’s birds for the IUCN Red List. The taxonomic changes that will appear in volume 1 of the checklist (for non-passerines) will begin to be incorporated into the 2014 Red List update, with the remainder, and those for passerines (which will appear in volume 2 of the checklist), to be incorporated into subsequent Red List updates.
Preliminary Red List assessments have been carried out for the newly split or lumped taxa. We are now requesting comments and feedback on these preliminary assessments.
Philippine Hawk-owl Ninox philippensis is being split into N. philippensis, N. mindorensis, N. spilonota, N. spilocephala, N. rumseyi, N. leventisi and N. reyi.
Prior to this taxonomic change, N. philippensis (BirdLife species factsheet) was listed as Least Concern, as it was estimated to have a very large range, and hence was not thought to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence [EOO] of less than 20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appeared to be stable, and hence the species did not approach the thresholds for Vulnerable under the population trend criterion (at least a 30% decline over ten years or three generations). The population size has not been quantified, but it was not believed to approach the thresholds for Vulnerable under the population size criterion (fewer than 10,000 mature individuals with a continuing decline estimated to be at least 10% over ten years or three generations, or with a specified population structure).
N. rumseyi is found on Cebu, where it inhabits remnant forest fragments (Rasmussen et al. 2012). This newly defined species may qualify as Endangered under criteria B1ab(ii,iii,v); C2a(ii), on the basis that it has a very small range (with an EOO estimated at c.4,400 km2),in which suitable habitat is severely fragmented and in decline, with a continuous decline inferred in the population, which is estimated to be very small (c.400 mature individuals; Jakosalem et al. in press per Rasmussen et al. 2012) and probably forms a single subpopulation.
N. leventisi is found on Camiguin Sur (Rasmussen et al. 2012). It may qualify as Endangered under criterion C2a(ii), on the basis that it is estimated to have a very small population (fewer than 2,500 mature individuals), which likely forms a single subpopulation and is inferred to be in decline owing to on-going habitat loss and fragmentation.
N. reyi is found on Sulu, Siasi, Tawi-Tawi, Sanga Sanga, Bongao and Sibutu (Rasmussen et al. 2012). It may qualify as Vulnerable under criterion C2a(i), on the basis that, although it probably has a very small population (fewer than 2,500 mature individuals), and the overall population is inferred to be in decline owing to on-going habitat loss and fragmentation, some subpopulations probably number more than 250 mature individuals (thus the subcriteria are not met for listing as Endangered).
N. mindorensis is found on Mindoro (Rasmussen et al. 2012). It may qualify as Vulnerable under criterion B1ab(ii,iii,v), on the basis that it has a small range (with an EOO estimated at c.9,900 km2), in which suitable habitat is severely fragmented and being lost and degraded owing primarily to clearance for agriculture, with a decline inferred in the population as a result.
N. spilonota is found on Sibuyan and Tablas (Rasmussen et al. 2012). It is suggested that it be listed as Near Threatened under criteria B1ab(iii,v); C2a(i), on the basis that, although it has a very small range (with an EOO estimated at c.1,100 km2), in which the area and quality of habitat are in decline, it is not yet severely fragmented; the species’s population is thought to be small (fewer than 10,000 mature individuals) and is inferred to be in decline, but there are probably more than 1,000 mature individuals in each subpopulation (thus the subcriteria for listing as Vulnerable are not met).
N. spilocephala is found on Mindanao. It is suggested that it be listed as Near Threatened under criteria A2c+3c+4c, on the basis that it could be undergoing a moderately rapid population decline (approaching 30% over three generations [c.12 years]) owing to on-going habitat loss and degradation.
N. philippensis (as defined following the taxonomic change) is found on Biliran, Bohol, Boracay, Buad, Carabao, Catanduanes, Guimaras, Leyte, Lubang, Luzon, Marinduque, Masbate, Negros, Panay, Polillo Samar, Semirara, Siquijor and Ticao (Rasmussen et al. 2012). It is suggested that it be listed as Near Threatened under criteria A2c+3c+4c, on the basis that it could be undergoing a moderately rapid population decline (approaching 30% over three generations [c.12 years]) owing to on-going habitat destruction throughout its range.
Comments are invited on these suggested categories and further information would be welcomed.
Rasmussen, P. C., Allen, D. N. S., Collar, N. J., DeMeulemeester, B., Hutchinson, R. O., Jakosalem, P. G., Kennedy, R. S., Lambert, F. R. and Paguntalan, L. M. (2012) Vocal divergence and new species in the Philippine Hawk Owl Ninox philippensis complex. Forktail 28: 1-20.
Tobias, J. A., Seddon, N., Spottiswoode, C. N., Pilgrim, J. D., Fishpool, L. D. C. and Collar, N. J. (2010) Quantitative criteria for species delimitation. Ibis 152: 724–746.
|
<urn:uuid:95ff4ec6-a011-489e-bf8a-90be0c44bd32>
|
CC-MAIN-2016-26
|
http://www.birdlife.org/globally-threatened-bird-forums/2013/09/philippine-hawk-owl-ninox-philippensis-is-being-split-list-n-leventisi-and-n-rumseyi-as-endangered-n-reyi-and-n-mindorensis-as-vulnerable-and-n-spilonota-and-n-philippensis-as-near-threaten/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783403502.46/warc/CC-MAIN-20160624155003-00158-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.904952 | 1,591 | 2.71875 | 3 |
Harpers Ferry, Virginia, lay sleeping on the night of October 16, 1859, as 19 heavily armed men stole down mist-shrouded bluffs along the Potomac River where it joins the Shenandoah. Their leader was a rail-thin 59-year-old man with a shock of graying hair and penetrating steel-gray eyes. His name was John Brown. Some of those who strode across a covered railway bridge from Maryland into Virginia were callow farm boys; others were seasoned veterans of the guerrilla war in disputed Kansas. Among them were Brown's youngest sons, Watson and Oliver; a fugitive slave from Charleston, South Carolina; an African-American student at Oberlin College; a pair of Quaker brothers from Iowa who had abandoned their pacifist beliefs to follow Brown; a former slave from Virginia; and men from Connecticut, New York, Pennsylvania and Indiana. They had come to Harpers Ferry to make war on slavery.
From This Story
The raid that Sunday night would be the most daring instance on record of white men entering a Southern state to incite a slave rebellion. In military terms, it was barely a skirmish, but the incident electrified the nation. It also created, in John Brown, a figure who after a century and a half remains one of the most emotive touchstones of our racial history, lionized by some Americans and loathed by others: few are indifferent. Brown's mantle has been claimed by figures as diverse as Malcolm X, Timothy McVeigh, Socialist leader Eugene Debs and abortion protesters espousing violence. "Americans do not deliberate about John Brown—they feel him," says Dennis Frye, the National Park Service's chief historian at Harpers Ferry. "He is still alive today in the American soul. He represents something for each of us, but none of us is in agreement about what he means."
"The impact of Harpers Ferry quite literally transformed the nation," says Harvard historian John Stauffer, author of The Black Hearts of Men: Radical Abolitionists and the Transformation of Race. The tide of anger that flowed from Harpers Ferry traumatized Americans of all persuasions, terrorizing Southerners with the fear of massive slave rebellions, and radicalizing countless Northerners, who had hoped that violent confrontation over slavery could be indefinitely postponed. Before Harpers Ferry, leading politicians believed that the widening division between North and South would eventually yield to compromise. After it, the chasm appeared unbridgeable. Harpers Ferry splintered the Democratic Party, scrambled the leadership of the Republicans and produced the conditions that enabled Republican Abraham Lincoln to defeat two Democrats and a third-party candidate in the presidential election of 1860.
"Had John Brown's raid not occurred, it is very possible that the 1860 election would have been a regular two-party contest between antislavery Republicans and pro-slavery Democrats," says City University of New York historian David Reynolds, author of John Brown: Abolitionist. "The Democrats would probably have won, since Lincoln received just 40 percent of the popular vote, around one million votes less than his three opponents." While the Democrats split over slavery, Republican candidates such as William Seward were tarnished by their association with abolitionists; Lincoln, at the time, was regarded as one of his party's more conservative options. "John Brown was, in effect, a hammer that shattered Lincoln's opponents into fragments," says Reynolds. "Because Brown helped to disrupt the party system, Lincoln was carried to victory, which in turn led 11 states to secede from the Union. This in turn led to the Civil War."
Well into the 20th century, it was common to dismiss Brown as an irrational fanatic, or worse. In the rousing pro-Southern 1940 classic film Santa Fe Trail, actor Raymond Massey portrayed him as a wild-eyed madman. But the civil rights movement and a more thoughtful acknowledgment of the nation's racial problems have occasioned a more nuanced view. "Brown was thought mad because he crossed the line of permissible dissent," Stauffer says. "He was willing to sacrifice his life for the cause of blacks, and for this, in a culture that was simply marinated in racism, he was called mad."
Brown was a hard man, to be sure, "built for times of trouble and fitted to grapple with the flintiest hardships," in the words of his close friend, the African-American orator Frederick Douglass. Brown felt a profound and lifelong empathy with the plight of slaves. "He stood apart from every other white in the historical record in his ability to burst free from the power of racism," says Stauffer. "Blacks were among his closest friends, and in some respects he felt more comfortable around blacks than he did around whites."
Brown was born with the century, in 1800, in Connecticut, and raised by loving if strict parents who believed (as did many, if not most, in that era) that righteous punishment was an instrument of the divine. When he was a small boy, the Browns moved west in an ox-drawn wagon to the raw wilderness of frontier Ohio, settling in the town of Hudson, where they became known as friends to the rapidly diminishing population of Native Americans, and as abolitionists who were always ready to help fugitive slaves. Like many restless 19th-century Americans, Brown tried many professions, failing at some and succeeding modestly at others: farmer, tanner, surveyor, wool merchant. He married twice—his first wife died from illness—and, in all, fathered 20 children, almost half of whom died in infancy; 3 more would die in the war against slavery. Brown, whose beliefs were rooted in strict Calvinism, was convinced that he had been predestined to bring an end to slavery, which he believed with burning certitude was a sin against God. In his youth, both he and his father, Owen Brown, had served as "conductors" on the Underground Railroad. He had denounced racism within his own church, where African-Americans were required to sit in the back, and shocked neighbors by dining with blacks and addressing them as "Mr." and "Mrs." Douglass once described Brown as a man who "though a white gentleman, is in sympathy, a black man, and as deeply interested in our cause, as though his own soul had been pierced with the iron of slavery."
In 1848, the wealthy abolitionist Gerrit Smith encouraged Brown and his family to live on land Smith had bestowed on black settlers in northern New York. Tucked away in the Adirondack Mountains, Brown concocted a plan to liberate slaves in numbers never before attempted: A "Subterranean Pass-Way"—the Underground Railroad writ large—would stretch south through the Allegheny and Appalachian mountains, linked by a chain of forts manned by armed abolitionists and free blacks. "These warriors would raid plantations and run fugitives north to Canada," says Stauffer. "The goal was to destroy the value of slave property." This scheme would form the template for the Harpers Ferry raid and, says Frye, under different circumstances "could have succeeded. [Brown] knew that he couldn't free four million people. But he understood economics and how much money was invested in slaves. There would be a panic—property values would dive. The slave economy would collapse."
Political events of the 1850s turned Brown from a fierce, if essentially garden-variety, abolitionist into a man willing to take up arms, even die, for his cause. The Fugitive Slave Law of 1850, which imposed draconian penalties on anyone caught helping a runaway and required all citizens to cooperate in the capture of fugitive slaves, enraged Brown and other abolitionists. In 1854, another act of Congress pushed still more Northerners beyond their limits of tolerance. Under pressure from the South and its Democratic allies in the North, Congress opened the territories of Kansas and Nebraska to slavery under a concept called "popular sovereignty." The more northerly Nebraska was in little danger of becoming a slave state. Kansas, however, was up for grabs. Pro-slavery advocates—"the meanest and most desperate of men, armed to the teeth with Revolvers, Bowie Knives, Rifles & Cannon, while they are not only thoroughly organized, but under pay from Slaveholders," John Brown Jr. wrote to his father—poured into Kansas from Missouri. Antislavery settlers begged for guns and reinforcements. Among the thousands of abolitionists who left their farms, workshops or schools to respond to the call were John Brown and five of his sons. Brown himself arrived in Kansas in October 1855, driving a wagon loaded with rifles he had picked up in Ohio and Illinois, determined, he said, "to help defeat Satan and his legions."
In May 1856, pro-slavery raiders sacked Lawrence, Kansas, in an orgy of burning and looting. Almost simultaneously, Brown learned that Charles Sumner of Massachusetts, the most outspoken abolitionist in the U.S. Senate, had been beaten senseless on the floor of the chamber by a cane-wielding congressman from South Carolina. Brown raged at the North's apparent helplessness. Advised to act with restraint, he retorted, "Caution, caution, sir. I am eternally tired of hearing the word caution. It is nothing but the word of cowardice." A party of Free-Staters led by Brown dragged five pro-slavery men out of their isolated cabins on eastern Kansas' Pottawatomie Creek and hacked them to death with cutlasses. The horrific nature of the murders disturbed even abolitionists. Brown was unrepentant. "God is my judge," he laconically replied when asked to account for his actions. Though he was a wanted man who hid out for a time, Brown eluded capture in the anarchic conditions that pervaded Kansas. Indeed, almost no one—pro-slavery or antislavery—was ever arraigned in a court for killings that took place during the guerrilla war there.
The murders, however, ignited reprisals. Pro-slavery "border ruffians" raided Free- Staters' homesteads. Abolitionists fought back. Hamlets were burned, farms abandoned. Brown's son Frederick, who had participated in the Pottawatomie Creek massacre, was shot dead by a pro-slavery man. Although Brown survived many brushes with opponents, he seemed to sense his own fate. In August 1856 he told his son Jason, "I have only a short time to live—only one death to die, and I will die fighting for this cause."
By almost any definition, the Pottawatomie killings were a terrorist act, intended to sow fear in slavery's defenders. "Brown viewed slavery as a state of war against blacks—a system of torture, rape, oppression and murder—and saw himself as a soldier in the army of the Lord against slavery," says Reynolds. "Kansas was Brown's trial by fire, his initiation into violence, his preparation for real war," he says. "By 1859, when he raided Harpers Ferry, Brown was ready, in his own words, ‘to take the war into Africa'—that is, into the South."
In January 1858, Brown left Kansas to seek support for his planned Southern invasion. In April, he sought out a diminutive former slave, Harriet Tubman, who had made eight secret trips to Maryland's Eastern Shore to lead dozens of slaves north to freedom. Brown was so impressed that he began referring to her as "General Tubman." For her part, she embraced Brown as one of the few whites she had ever met who shared her belief that antislavery work was a life-and-death struggle. "Tubman thought Brown was the greatest white man who ever lived," says Kate Clifford Larson, author of Bound for the Promised Land: Harriet Tubman, Portrait of an American Hero.
Having secured financial backing from wealthy abolitionists known as the "Secret Six," Brown returned to Kansas in mid-1858. In December, he led 12 fugitive slaves on an epic journey eastward, dodging pro-slavery guerrillas and marshals' posses and fighting and defeating a force of United States troops. Upon reaching Detroit, they were ferried across the Detroit River to Canada. Brown had covered nearly 1,500 miles in 82 days, proof to doubters, he felt sure, that he was capable of making the Subterranean Pass-Way a reality.
With his "Secret Six" war chest, Brown purchased hundreds of Sharps carbines and thousands of pikes, with which he planned to arm the first wave of slaves he expected to flock to his banner once he occupied Harpers Ferry. Many thousands more could then be armed with rifles stored at the federal arsenal there. "When I strike, the bees will swarm," Brown assured Frederick Douglass, whom he urged to sign on as president of a "Provisional Government." Brown also expected Tubman to help him recruit young men for his revolutionary army, and, says Larson, "to help infiltrate the countryside before the raid, encourage local blacks to join Brown and when the time came, to be at his side—like a soldier." Ultimately, neither Tubman nor Douglass participated in the raid. Douglass was sure the venture would fail. He warned Brown that he was "going into a perfect steel trap, and that he would not get out alive." Tubman may have concluded that if Brown's plan failed, the Underground Railroad would be destroyed, its routes, methods and participants exposed.
Sixty-one miles northwest of Washington, D.C., at the junction of the Potomac and Shenandoah rivers, Harpers Ferry was the site of a major federal armory, including a musket factory and rifle works, an arsenal, several large mills and an important railroad junction. "It was one of the most heavily industrialized towns south of the Mason-Dixon line," says Frye. "It was also a cosmopolitan town, with a lot of Irish and German immigrants, and even Yankees who worked in the industrial facilities." The town and its environs' population of 3,000 included about 300 African-Americans, evenly divided between slave and free. But more than 18,000 slaves—the "bees" Brown expected to swarm—lived in the surrounding counties.
As his men stepped off the railway bridge into town that October night in 1859, Brown dispatched contingents to seize the musket factory, rifle works, arsenal and adjacent brick fire-engine house. (Three men remained in Maryland to guard weapons that Brown hoped to distribute to slaves who joined him.) "I want to free all the negroes in this state," he told one of his first hostages, a night watchman. "If the citizens interfere with me, I must only burn the town and have blood." Guards were posted at the bridges. Telegraph lines were cut. The railroad station was seized. It was there that the raid's first casualty occurred, when a porter, a free black man named Hayward Shepherd, challenged Brown's men and was shot dead in the dark. Once key locations had been secured, Brown sent a detachment to seize several prominent local slave owners, including Col. Lewis W. Washington, a great-grandnephew of the first president.
Early reports claimed that Harpers Ferry had been taken by 50, then 150, then 200 white "insurrectionists" and "six hundred runaway negroes." Brown expected to have 1,500 men under his command by midday Monday. He later said he believed that he would eventually have armed as many as 5,000 slaves. But the bees did not swarm. (Only a handful of slaves lent Brown assistance.) Instead, as Brown's band watched dawn break over the craggy ridges enclosing Harpers Ferry, local white militias—similar to today's National Guard—were hastening to arms.
First to arrive were the Jefferson Guards, from nearby Charles Town. Uniformed in blue, with tall black Mexican War-era shakos on their heads and brandishing .58-caliber rifles, they seized the railway bridge, killing a former slave named Dangerfield Newby and cutting Brown off from his route of escape. Newby had gone north in a failed attempt to earn enough money to buy freedom for his wife and six children. In his pocket was a letter from his wife: "It is said Master is in want of money," she had written. "I know not what time he may sell me, and then all my bright hopes of the future are blasted, for their [sic] has been one bright hope to cheer me in all my troubles, that is to be with you."
As the day progressed, armed units poured in from Frederick, Maryland; Martinsburg and Shepherdstown, Virginia; and elsewhere. Brown and his raiders were soon surrounded. He and a dozen of his men held out in the engine house, a small but formidable brick building, with stout oak doors in front. Other small groups remained holed up in the musket factory and rifle works. Acknowledging their increasingly dire predicament, Brown sent out New Yorker William Thompson, bearing a white flag, to propose a cease-fire. But Thompson was captured and held in the Galt House, a local hotel. Brown then dispatched his son, Watson, 24, and ex-cavalryman Aaron Stevens, also under a white flag, but the militiamen shot them down in the street. Watson, although fatally wounded, managed to crawl back to the engine house. Stevens, shot four times, was arrested.
When the militia stormed the rifle works, the three men inside dashed for the shallow Shenandoah, hoping to wade across. Two of them—John Kagi, vice president of Brown's provisional government, and Lewis Leary, an African-American—were shot dead in the water. The black Oberlin student, John Copeland, reached a rock in the middle of the river, where he threw down his gun and surrendered. Twenty-year-old William Leeman slipped out of the engine house, hoping to make contact with the three men Brown had left as backup in Maryland. Leeman plunged into the Potomac and swam for his life. Trapped on an islet, he was shot dead as he tried to surrender. Throughout the afternoon, bystanders took potshots at his body.
Through loopholes—small openings through which guns could be fired—that they had drilled in the engine house's thick doors, Brown's men tried to pick off their attackers, without much success. One of their shots, however, killed the town's mayor, Fontaine Beckham, enraging the local citizenry. "The anger at that moment was uncontrollable," says Frye. "A tornado of rage swept over them." A vengeful mob pushed its way into the Galt House, where William Thompson was being held prisoner. They dragged him onto the railroad trestle, shot him in the head as he begged for his life and tossed him over the railing into the Potomac.
By nightfall, conditions inside the engine house had grown desperate. Brown's men had not eaten for more than 24 hours. Only four remained unwounded. The bloody corpses of slain raiders, including Brown's 20-year-old son, Oliver, lay at their feet. They knew there was no hope of escape. Eleven white hostages and two or three of their slaves were pressed against the back wall, utterly terrified. Two pumpers and hose carts were pushed against the doors, to brace against an assault expected at any moment. Yet if Brown felt defeated, he didn't show it. As his son Watson writhed in agony, Brown told him to die "as becomes a man."
Soon perhaps a thousand men—many uniformed and disciplined, others drunk and brandishing weapons from shotguns to old muskets—would fill the narrow lanes of Harpers Ferry, surrounding Brown's tiny band. President James Buchanan had dispatched a company of Marines from Washington, under the command of one of the Army's most promising officers: Lt. Col. Robert E. Lee. Himself a slave owner, Lee had only disdain for abolitionists, who "he believed were exacerbating tensions by agitating among slaves and angering masters," says Elizabeth Brown Pryor, author of Reading the Man: A Portrait of Robert E. Lee Through His Private Letters. "He held that although slavery was regrettable, it was an institution sanctioned by God and as such would disappear only when God ordained it." Dressed in civilian clothes, Lee reached Harpers Ferry around midnight. He gathered the 90 Marines behind a nearby warehouse and worked out a plan of attack. In the predawn darkness, Lee's aide, a flamboyant young cavalry lieutenant, boldly approached the engine house, carrying a white flag. He was met at the door by Brown, who asked that he and his men be allowed to retreat across the river to Maryland, where they would free their hostages. The soldier promised only that the raiders would be protected from the mob and put on trial. "Well, lieutenant, I see we can't agree," replied Brown. The lieutenant stepped aside, and with his hand gave a prearranged signal to attack. Brown could have shot him dead—"just as easily as I could kill a musquito," he recalled later. Had he done so, the course of the Civil War might have been different. The lieutenant was J.E.B. Stuart, who would go on to serve brilliantly as Lee's cavalry commander.
Lee first sent several men crawling below the loopholes, to smash the door with sledgehammers. When that failed, a larger party charged the weakened door, using a ladder as a battering ram, punching through on their second try. Lt. Israel Green squirmed through the hole to find himself beneath one of the pumpers. According to Frye, as Green emerged into the darkened room, one of the hostages pointed at Brown. The abolitionist turned just as Green lunged forward with his saber, striking Brown in the gut with what should have been a death blow. Brown fell, stunned but astonishingly unharmed: the sword had struck a buckle and bent itself double. With the sword's hilt, Green then hammered Brown's skull until he passed out. Although severely injured, Brown would survive. "History may be a matter of a quarter of an inch," says Frye. "If the blade had struck a quarter inch to the left or right, up or down, Brown would have been a corpse, and there would have been no story for him to tell, and there would have been no martyr."
Meanwhile, the Marines poured through the breach. Brown's men were overwhelmed. One Marine impaled Indianan Jeremiah Anderson against a wall. Another bayoneted young Dauphin Thompson, where he lay under a fire engine. It was over in less than three minutes. Of the 19 men who strode into Harpers Ferry less than 36 hours before, five were now prisoners; ten had been killed or fatally injured. Four townspeople had also died; more than a dozen militiamen were wounded.
Only two of Brown's men escaped the siege. Amid the commotion, Osborne Anderson and Albert Hazlett slipped out the back of the armory, climbed a wall and scuttled behind the embankment of the Baltimore and Ohio Railroad to the bank of the Potomac, where they found a boat and paddled to the Maryland shore. Hazlett and another of the men whom Brown had left behind to guard supplies were later captured in Pennsylvania and extradited to Virginia. Of the total, five members of the raiding party would eventually make their way to safety in the North or Canada.
Brown and his captured men were charged with treason, first-degree murder and "conspiring with Negroes to produce insurrection." All of the charges carried the death penalty. The trial, held in Charles Town, Virginia, began on October 26; the verdict was guilty, and Brown was sentenced on November 2. Brown met his death stoically on the morning of December 2, 1859. He was led out of the Charles Town jail, where he had been held since his capture, and seated on a small wagon carrying a white pine coffin. He handed a note to one of his guards: "I John Brown am now quite certain that the crimes of this guilty land: will never be purged away; but with blood." Escorted by six companies of infantry, he was transported to a scaffold where, at 11:15, a sack was placed over his head and a rope fitted around his neck. Brown told his guard, "Don't keep me waiting longer than necessary. Be quick." These were his last words. Among the witnesses to his death were Robert E. Lee and two other men whose lives would be irrevocably changed by the events at Harpers Ferry. One was a Presbyterian professor from the Virginia Military Institute, Thomas J. Jackson, who would earn the nickname "Stonewall" less than two years later at the Battle of Bull Run. The other was a young actor with seductive eyes and curly hair, already a fanatical believer in Southern nationalism: John Wilkes Booth. The remaining convicted raiders would be hanged, one by one.
Brown's death stirred blood in the North and the South for opposing reasons. "We shall be a thousand times more Anti-Slavery than we ever dared to think of being before," proclaimed the Newburyport (Massachusetts) Herald. "Some eighteen hundred years ago Christ was crucified," Henry David Thoreau opined in a speech in Concord on the day of Brown's execution, "This morning, perchance, Captain Brown was hung. These are the two ends of a chain which is not without its links. He is not Old Brown any longer; he is an angel of light." In 1861, Yankee soldiers would march to battle singing: "John Brown's body lies a-mouldering in the grave, but his soul goes marching on."
On the other side of the Mason-Dixon line, "this was the South's Pearl Harbor, its ground zero," says Frye. "There was a heightened sense of paranoia, a fear of more abolitionist attacks—that more Browns were coming any day, at any moment. The South's greatest fear was slave insurrection. They all knew that if you held four million people in bondage, you're vulnerable to attack." Militias sprang up across the South. In town after town, units organized, armed and drilled. When war broke out in 1861, they would provide the Confederacy with tens of thousands of well-trained soldiers. "In effect, 18 months before Fort Sumter, the South was already declaring war against the North," says Frye. "Brown gave them the unifying momentum they needed, a common cause based on preserving the chains of slavery."
Fergus M. Bordewich, a frequent contributor of articles on history, is profiled in the "From the Editor" column.
|
<urn:uuid:5fd2f0db-2abd-4513-8ee3-4922d1da668d>
|
CC-MAIN-2016-26
|
http://www.smithsonianmag.com/history/john-browns-day-of-reckoning-139165084/?all
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783400572.45/warc/CC-MAIN-20160624155000-00105-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.983641 | 5,589 | 3.453125 | 3 |
CLINICAL: the back
Are you Retina Ready?
Prepare your practice by employing the necessary technology.
SHERROL A. REYNOLDS O.D., F.A.A.O., AND JOSEPH PIZZIMENTI O.D., F.A.A.O., FT. LAUDERDALE, FLA.
Retinal disease is on the rise. For example, an estimated 13 million people are currently afflicted with AMD, and we can expect to see more patients with AMD in our practices as the population ages.
With the ever-increasing volume of patients with retinal disease, it is critical for clinicians to be equipped to properly diagnose and educate — and retain — these patients.
Here, we discuss the technologies clinicians can employ to improve their ability to detect and manage retinal disease.
1 Condensing lenses
An array of new condensing lenses allow for either a larger field of view, fantastic views of the posterior pole or more magnification.
The slit lamp and binocular indirect ophthalmoscope provide excellent retinal views when a condensing lens is introduced. However, some clinical signs can still be overlooked. A good tip is to use the red-free filter to help assess changes in specific retina layers and determine lesion depth. A deeper lesion (i.e., choroidal nevus) may disappear when using red-free.
The slit beam, or Watzke-Allen, test provides a subjective assessment of visual function in testing for a full-thickness retinal defect. For suspected macular holes that are equivocal or do not lend themselves to observation, consider performing this technique. The test is performed at the slit lamp using a fundus lens and placing a narrow vertical slit beam through the fovea. A positive result is obtained when patients with full-thickness macular defects detect a central break in the vertical light beam. Or, the target can be presented using a Maddox rod or a direct ophthalmoscope.
OCT reveals an anomalous posterior vitreous detachment (PVD) leading to vitreopapillary traction syndrome (VPTS).
A three-mirror lens provides a detailed view of retinal architecture. Each mirror is tilted at a different angle to give a magnified view of mid-peripheral or peripheral pathologies. Consider using this technique with suspicious choroidal lesions (i.e., nevus or melanoma) or retinal breaks. The central lens enables the assessment of the posterior pole, especially in cases of subtle maculopathies, such as cystoid macular edema (CME), optic nerve disorders or elevation, or when fine stereoscopic detail is critical.
Peripheral retinal lesions may be difficult to identify and evaluate. Scleral indentation (depression) enables the view of the peripheral retina in profile. It can be performed using any number of metal depressors or a cotton tip applicator. This technique is part of a detailed evaluation of the anterior retina and peripheral vitreoretinal interface, especially when looking for small retinal breaks, cystic tufts or traction. This method can also assess the elevation of retinal lesions.
2 Digital fundus camera
Fundus photography not only aids in diagnosis, it captures retinal pathologies, such as early DR, that may be missed by the naked eye. It is beneficial in documenting, managing, but most importantly, educating the patient on his or her condition(s).
Some of the new cameras can adapt to your smartphone. Others are available in combination with an OCT system, thus providing cross-sectional views of retinal layers. Widefield retinal imaging offers panoramic fundus assessment in one capture.
OCT has improved our ability to understand, diagnose, monitor and incorporate therapy for a wide range of vitreoretinal conditions. OCT provides information about structural changes, and it enables early diagnosis of subtle vitreomacular traction or vitreopapillary traction.
In addition, OCT has allowed us to better assess early macular damage in patients on hydroxychloroquine (Plaquenil, Sanofi Aventis) or chloroquine (Aralen, Sanofi Aventis) therapy. OCT is valuable in optic nerve disorders, such as glaucoma, by providing retinal nerve fiber layer analysis as well as ganglion cell complex analysis.
SD-OCT can help assess neurological disease (axonal deficits) like multiple sclerosis, where retinal nerve fiber layer and macular thickness loss occurs. SD-OCT, when paired with tests of visual function such as visual field testing, can provide a structural-functional paradigm of brain injury.
Future generations of OCTs will have increased sensitivity and specificity for early disease detection. Swept-source laser (SS-OCT) will soon provide a greater range of imaging depth and better penetration through opacities. The Doppler OCT can measure blood flow velocity through retinal vessels, which may prove useful in retinal vascular diseases, such as DR.
Back to Basics
Certain regions of the retina can be difficult to visualize, especially when dealing with media opacity or a challenging patient. We, as O.D.s, can sharpen our retinal evaluation by going back to some basic skills that allow for more detailed views. Some of us may not have used these techniques in a while, so now is a good time to fine-tune and practice them.
For example, we often take a quick glance at the vitreous, but numerous studies show that abnormal separation of the vitreous from the retina plays a key role in the pathogenesis of many vitreoretinal disorders. A clinical pearl: Have the patient look up and down while in the slit lamp so you can better visualize red blood cells, inflammatory cells or pigmented cells (“tobacco dust” or “Shafer’s sign”) from a retinal tear or detachment. This should be done meticulously in patients with complaints of flashes and/or floaters, as well as in our growing elderly population. Note a complete posterior vitreous detachment, indicated by the presence of a Weiss ring, or if there is a partial (incomplete) separation.
4 Fundus autofluorescence (FAF)
Fundus autofluorescence (FAF) detects and tracks changes in the retinal pigment epithelium (RPE) lipofuscin, a metabolic biomarker of disease or aging. FAF has played a significant role in analyzing the progression of AMD in that it reveals accumulation of lipofuscin molecules in the retinal pigment epithelium (RPE). The benefits of FAF have been demonstrated with hereditary retinal disorders, toxic maculopathy (Plaquenil screening), choroidal melanoma and other retinal disease processes. More and more manufacturers are producing retinal cameras and OCTs that include FAF.
5 MPOD-measuring devices
Macular pigment optical density (MPOD) enables clinicians to identify at-risk patients, as well as gauge the effects of dietary changes and supplementation. Results from the recently published AREDS 2 confirmed the benefits of lutein and zeaxanthin in AMD patients. Increased MPOD is associated with improved contrast sensitivity, glare tolerance and improved night-driving ability.
6 Multispectral imaging
Multispectral imaging (MSI) allows visualization of the retina in spectral slices, from the inner limiting membrane to the choroid. MSI can assist in the diagnosis of DR, CME, AMD and conditions that masquerade as AMD, such as polypoidal choroidal vasculopathy. It is available with FAF capability.
7 Ultrasound imaging and Electrophysiology
Both ultrasound imaging and electrophysiology (electroretinogram-ERG) techniques have become progressively more sophisticated. New generation ocular ultrasound offers high-resolution diagnostic imaging that allows for a rapid assessment of retinal pathology. Multifocal electroretinography (mfERG) provides a detailed assessment of the health of the central retina. mfERG offers a precise mapping of dysfunctional areas of the retina.
Optometry is on the forefront of retinal disease. By being retina ready, we can better educate and manage our patients. Clinicians can prepare for tomorrow’s patients today by being properly equipped to provide optimum care. OM
Return on Investment
For some practitioners, the initial cost associated with obtaining new devices (such as an OCT or digital fundus camera) may be viewed as a barrier. However, those who “take the plunge” and appropriately use new technology can realize a sound return on their investment by retaining current patients who develop retinal disease and gaining new ones through expanded treatment offerings.
Dr. Reynolds is an associate professor at the Nova Southeastern University College of Optometry. She is the clinical preceptor/attending in the college’s diabetes and macular clinic and a fellow in the Optometric Retinal Society. She serves as the chairperson for the Florida Optometric Association Healthy Eyes Healthy People Committee. E-mail her at email@example.com.
Dr. Pizzimenti is an associate professor at Nova Southeastern University College of Optometry. He is also a frequent speaker and writer on age-related eye disease. E-mail him at firstname.lastname@example.org, or send comments to email@example.com.
Optometric Management, Volume: 49 , Issue: July 2014, page(s): 26-28
|
<urn:uuid:f9428089-0320-4845-8ade-1d50204018dc>
|
CC-MAIN-2016-26
|
http://www.optometricmanagement.com/articleviewer.aspx?articleID=111435
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397696.49/warc/CC-MAIN-20160624154957-00135-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.89289 | 1,988 | 2.5625 | 3 |
- CYAC Home
- About CYAC
- Descriptive Cataloging
- Subject Cataloging
- Frequently Asked Questions
Classifying CYAC Material
Subject Cataloging | Children’s and Young Adults’ Cataloging Program (CYAC)
Generally, either the Library of Congress Classification or Dewey Decimal Classification (DDC) is used to arrange juvenile material. These systems allow you to arrange books and other library materials by topic. Items cataloged by the Library of Congress are assigned an LC Classification number, displayed in the 050 field, and a DDC number, displayed in the 082 field. Regardless of which you choose to use, you must follow the practices and procedures outlined in each system, although there is nothing wrong with making adjustments to suit your patrons in your local catalog.
Library of Congress Classification PZ
The majority of juvenile fiction cataloged by the CYAC Program is classed in PZ7, which is a general number for “Juvenile belles lettres” or juvenile fiction, for authors whose first works have been published between 1870 and 2014. General juvenile fiction by authors whose first works are published in 2015 and beyond are classed in PZ7.1. This classification number is followed by a “Cutter number” that, in most cases, arranges the books by author. For each author’s books, a work mark subarranges the books by title. The final element of a call number is the year of publication. More information about this can be found in the Shelflisting document.
Other PZ numbers you may see include PZ5 for collections of works by different authors, PZ7.5 for novels in verse, PZ7.7 for graphic novels, PZ8 for traditional fairy tales, PZ8.1 for folklore and legends, PZ8.2 for fables, PZ8.3 for nursery rhymes and stories in rhyme, PZ10.3 for realistic animal stories, PZ10.4 for sign language and Braille books, and PZ10.5 for polyglot books written in three or more languages. Higher PZ numbers are used for juvenile fiction in foreign languages.
All of these classification numbers are used for fictional juvenile materials only.
Dewey numbers vs. E and Fic
[E] and [Fic] appear on CYAC records in the 082, Dewey Decimal Classification number field.
[E] is used for easy fiction intended for children through grade 3 or age 8. With the exception of alphabet and counting books, [E] is not used on nonfiction material. [Fic] applies to fiction for children beyond grade 3 or age 8, as well as young adults through high school. These designations are added by CYAC catalogers.
Traditional folklore and fairy tales, poetry, and certain other works are classed by the Dewey Section at the Library of Congress in the same numbers used for adult works on those topics.
|
<urn:uuid:6db74e92-f558-4c0f-b3e8-630a4c423062>
|
CC-MAIN-2016-26
|
http://loc.gov/aba/cyac/classification.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783394987.40/warc/CC-MAIN-20160624154954-00061-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.91112 | 627 | 2.65625 | 3 |
Oct 12, 2012
Asians and European Americans rely on different cognitive styles—i.e., the ways they reason and make sense of the world—and in the East, the general reliance on being more holistic allows for Asians to focus on the positive, along with the negative, aspects of death. Asians’ holism allows them to focus on the reality that there would be no death—and death would not have its sting—if it were not for the glorious, wonderful life we have now, right in front of us. As a result, they strive harder to enjoy life in the face of death.
Westerners can react in a similar way; it starts with awareness that there may be different ways of approaching the world around us, and a long history of cultural psychology has shown that culture is extremely adaptable.
Christine Ma-Kellams is a social psychologist at Harvard University.
|
<urn:uuid:963f2c28-ea07-4cdc-9503-b9cd26dd050b>
|
CC-MAIN-2016-26
|
http://www.scienceandreligiontoday.com/2012/10/12/why-do-asians-and-european-americans-react-differently-to-reminders-of-death/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783402516.86/warc/CC-MAIN-20160624155002-00002-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.957366 | 183 | 2.59375 | 3 |
A Hero in Blue
Born in 1826, in what is now known as Murphysboro, Illinois, Logan was the son of Dr. and Mrs. John Logan, a prominent family in the area. After completing his education at Shiloh Hill, Illinois, Logan became interested in politics and as early as 1856, began serving in the Illinois legislature. In 1858, he was elected to Congress. In 1861, with the war in its early stages, Logan left his political career in order to establish the 31st Illinois Infantry in which he was commissioned as a colonel.
He was nicknamed Black Jack because of his black eyes and hair and dark-skinned complexion. As the war progressed, Logan advanced in rank. On March 13, 1863, two months before the Battle of Raymond, he was commissioned major general and led the 3rd Division of McPherson's 17th Corps. It was the young and newly appointed General John Logan, who led the Union attack in the Battle of Raymond.
During the opening moments of the battle,
the Union Army, surprised by the suddenness and fierceness of the Rebel
attack, almost broke and ran. It was General Logan who, riding his horse
up and down the front line, managed to control the attack and prevent his
men from breaking.
One of the men who wanted to run was Osborn Oldroyd, who was fighting on the front line with the 20th Ohio. "The regiment to the right of us was giving way," he later wrote, "but just as the line was wavering and about to be hopelessly broken, Logan dashed up, and with the shriek of an eagle turned them back to their places, which they regained and held. Had it not been for Logan's timely intervention, who was continually riding up and down the line, firing the men with his own enthusiasm, our line would undoubtedly have been broken at some point."
The fact that General Logan had urged his division to victory came as no surprise to Oldroyd, a young soldier from Ohio who held the general in high esteem. Just the night before, while camping at the Roach Plantation, Oldroyd had made an entry into his diary praising his commander: "Logan is brave and does not seem to know what defeat means. We feel that he will bring us out of every fight victorious. I want no better or braver officer to fight under."
Logan certainly lived up to Oldroyd's expectations the day of the Battle of Raymond. His stand on Fourteen Mile Creek won him accolades not only from the men under his command but from other generals as well. The hero status would continue. Logan's popularity as a commanding officer and battlefield hero escalated to an all time high. Northern newspapers clamored for news of Black Jack. On May 29, 1863, the Chicago Tribune stated, "We echo the opinion of his superior that he is a whole division in himself." The Chicago Tribune also used terms such as "courageous, skillful and full of pluck" to describe Logan's military persona.
By July of 1863, Logan's popularity in the north was second only to that of U. S. Grant. No one could have been more pleased with Logan's success than his wife, Mary. A steady flow of letters affirmed her devotion. The letters also reflected the pride she took in her husband's achievements. Acknowledging his newfound national popularity, Mary wrote from her home in Carbondale, Illinois, saying, "Everything is Grant and Logan." On July 4, 1863, Grant honored General Logan by inviting his division to lead the Union advance into Vicksburg. Never was Logan so proud. The next day, still on an emotional high, he wrote to his wife saying, "The victory is the greatest triumph of modern times…My division has immortalized itself in the eyes of the whole army."
Adding to Logan's delight, Grant honored him by naming him temporary commander of Vicksburg. His orders were to provide guards to prevent prisoners from escaping and to protect against looting. Logan went on to command the 15th Corps and briefly the Army of the Tennessee during the Atlanta, Georgia, and Carolinas campaigns. His reputation as a hero never waned.
Following the war, the military giant became a hero to all Union veterans. He threw his efforts into securing veteran's rights for the men who served their country. Following Logan's death in 1886, family member, C. H. Logan wrote of his character: "The character of General Logan was compounded of an unusual number of the strongly typical elements. Of the elements going to make up this rich combination, apart from those exclusively related to strong intellectuality, the chief were honesty; great energy; iron determination; unflinching courage; much religious sentiment; great love of fellow-man and a laudable ambition to play the life-part well."
To his wife and best friend, Mary Logan, who supported him in all facets of life, he left his most treasured possession - The Union Medal of Honor presented to him by Congress for Meritorious Conduct.
| Home | Grant's March | Gregg's March | Battle of Raymond | Order of Battle | Commanders | Soldiers Who Fought | Diaries & Accounts |
Copyright (c) James and Rebecca Drake, 1998 - 2002. All Rights Reserved.
|
<urn:uuid:bd111d93-812f-4ae1-ae07-131c80fe585b>
|
CC-MAIN-2016-26
|
http://www.battleofraymond.org/command5.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393997.50/warc/CC-MAIN-20160624154953-00187-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.986089 | 1,096 | 3.203125 | 3 |
What the world's most wondrous ruins look like from the heavens
- Collection captured by Earth-observing satellites shows just how incredible these ancient feats of engineering are
With so many ancient ruins built along astronomical alignments, there is little doubt that their architects were keen observers of the stars.
But it would have been beyond those architects' wildest dreams to imagine that one day people of the future would be able to see them from the reverse viewpoint.
These pictures show some of the world's most famous ancient ruins - as seen from space.
The temple of Angkor Wat in Cambodia, as seen by the Ikonos satellite: Situated in the ancient capital of the Khmer Empire located in modern-day Cambodia, Angkor Wat was built between 1113 and 1150 AD by Suryavarman II as a temple to the Hindu god Vishnu
Angkor Wat basks in the evening sunlight: The buildings in the centre consist of five towers, each shaped to represent the peaks of Mount Meru. Surrounding the complex is a 174-metre-wide moat. The site was largely abandoned sometime in the 15th Centur, but remains in use to this day as a Buddhist holy site
Machu Picchu perched high up on a mountainside in the Andes, Peru: Sitting at around 8,000ft above sea level, the hidden city is surrounded by forest and rivers in deep valleys. A road winds up from one of these river valleys to this ancient site, built by the Incas from around 1460 but abandoned around the time of the Spanish conquest
Lost in the clouds: Although known locally, Machu Picchu was lost to the outside world before being brought to international attention in 1911 by the American historian Hiram Bingham. Since then, it has become an important tourist attraction and popular site for visitors following Peru's Inca Trail
Green and pleasant land: Stonehenge, the circle of standing stones in Wiltshire, England, which archaeologists believe was built anywhere from 3000 BC to 2000 BC
Prehistoric astrological sun-dial? It is thought that the alignment of the standing stones at Stonehenge was planned so that sunlight would shine on particular areas on important astronomical dates, such as the summer solstice, the longest day of the year
Machu Picchu in Peru, Egypt's Pyramids of Giza and our own Stonehenge, in Wiltshire, all appear in the eye-opening collection, which was captured by the Ikonos observation satellite.
Also captured are the city of Angkor, the ancient capital of the Khmer Empire, in modern-day Cambodia, and Chichen Itza, Teotihuacan and Uxmal - all part of the Maya civilisation in Mexico.
Ikonos is a commercial earth observation satellite, and was the first to collect publicly available high-resolution imagery at 1- and 4-meter resolution.
At its launch in 1999 it was hailed as 'one of the most significant developments in the history of the Space Age' with the private sector gaining spy in the sky capabilities previously only available to powerful militaries.
Lost in the jungle: Satellite image of the ruins of the ancient Mayan city of Chichen Itza in Mexico. One of the largest of the Mayan cities, Chichen Itza, believed to have been started in 600AD, was a major focal point in the northern Maya lowlands until, it is believed, around 1200AD
The Pyramid of Kukulcan seen from the Temple of the Warriors at Chichen Itza: The pyramid at Chichen Itza was built so that sunlight shone down its northern stairway at sunset on the equinoxes. The resulting sunlight and shadow which 'slid' down the stairs is thought to represent Kukulkan, the feathered serpent god
Claimed back by nature: The ruins of the city of Mayapan city, surrounded by forest in Mexico. Situated about 60 miles west from Chichen Itza, Mayapan was the political and cultural capital of the Maya in the Yucatán Peninsula during the Late Post-Classic period from the 1220s until the 1440s
Blue skies above the ruins at Mayapan: Spanning 4.2 sq/km, the city has over 4000 structures, most of them residences, packed into a compound within stone perimeter walls. Archaeologists estimate 10-12,000 people lived within the walled parameter, while built-up areas extend a half kilometre beyond in all directions
The ruins of the ancient Mayan site of Dzibilchaltun, Mexico: In the view of the modern researchers, the builders of Dzibilchaltún may have chosen the site of the city to be as close possible to the coastal salt-producing region (some 22 km away), while still being located on fertile and habitable terrain
Holy site: Dzibilchaltun's the Temple Of The Seven Dolls, so named because of seven small effigies found at the site when the temple was discovered in the Fifties under the ruins of a later temple pyramid. On the Spring equinox, the sun rises so that it shines directly through one window of the temple and out the other
Once a great city: Satellite image of the ruins of Uxmal, Mexico, which is regarded as one of the most important archaeological sites of Maya culture. Its buildings are noted for their size, decoration and unusually high build quality which left it in better conditions than many other Maya sites
The Pyramid of the Magician: This ancient structure is Uxmal's tallest and most recognisable structure. The name of the structure is derived from Maya folk legends which say a magician-god named Itzamna single-handedly erected the pyramid in one night, using his might and magic
More ancient still: This satellite image shows the ruins of the ancient city of Teotihuacan, north-east of Mexico City. The city is thought to have been established around 100 BC and may have lasted until the 8th Century. At its height, Teotihuacan was the largest city in the Americas, with a population of perhaps 125,000 or more
Teotihuacan's Pyramid of the Sun: It is thought that the pyramid venerated a god within Teotihuacan society but the deliberate destruction of the temple on top prior to the archaeological study of the site has prevented its identification with any particular deity
Many ancient Maya sites in Mexico - including Chichen Itza, Mayapan, Dzibilchaltun and Uxmal - are pictured.
It is thought that many of the
structures in these ancient cities were aligned so that sunlight shone
on particular areas on important astronomical dates such as solstices
The pyramid at Chichen Itza was built
so that sunlight shone down its northern stairway at sunset on the
equinoxes. The resulting sunlight and shadow which 'slid' down the
stairs is thought to represent Kukulkan, the feathered serpent god.
Teotihuacan, also in Mexico, with its
great Pyramid of the Sun, was built by the Toltec civilisation and
abandoned about 1,500 years ago.
In Peru, the hidden city of Machu
Picchu can be seen perched high up on a mountainside in the Andes,
surrounded by forest and rivers in deep valleys. A road winds up from
one of these river valleys to this ancient city, built by the Inca
civilisation from around 1460.
In Asia, there are aerials of the
city of Angkor - the ancient capital of the Khmer Empire located in
modern-day Cambodia. The Angkor Wat temple was built between 1113 and
1150 AD by Suryavarman II as a temple to the Hindu god Vishnu.
The buildings in the centre of the image consist of five towers, each shaped to represent the peaks of Mount Meru. Surrounding the complex is a 174-metre-wide moat. The site was abandoned sometime in the 15th Century.
Satellite image of the ancient city of Baalbek in eastern Lebanon's Bekaa Valley: Known as Heliopolis during the period of Roman rule, Baalbek was one of the largest sanctuaries in the empire and contains some of the best preserved Roman ruins in Lebanon
Baalbek's Temple of Jupiter: The gods worshipped at the temple, the triad of Jupiter, Venus and Bacchus, were grafted onto the indigenous deities of Hadad, Atargatis and a young male god of fertility. Local influences are seen in the planning and layout of the temples, which vary from the classic Roman design
Amazing work of engineering: The Great Wall of China, which extends 5,500 miles from west to east fortifying the Chinese border against intrusion from Mongolia. Several walls were being built as early as the 7th century BC; these were later joined together, strengthened and unified during the Ming Dynasty
A section of the Great Wall of China north of Beijing: The wall stretches from Shanhaiguan in the east, to Lop Lake in the west, along an arc that roughly delineates the southern edge of Inner Mongolia. Other purposes of the Great Wall have included regulation or encouragement of trade and the control of immigration and emigration
Elsewhere is The Great Wall of China,
built 600 years ago in the Ming dynasty. Older, Sui Dynasty sections of
wall, appear as a broken line immediately to the right of the Ming
In Africa, the Pyramids of Giza -
which are thought to have been built sometime between 2600 and 2500BC as
tombs and monuments of the ruling dynasties of ancient Egypt - are also
The largest pyramid was built for
King Khufu. It took slaves more than 20 years to build and was the
tallest building in the world for many centuries.
Most of the ruins have been given UNESCO world heritage status, such as Baalbek in Lebanon.
The city was devoted to the Phoenician sun god Baal, or Bel during the
first millennium BC before becoming part of the Roman Empire.
Back in the UK, Stonehenge, in
Wiltshire, England, was erected from around 2000 BC by a Stone Age
civilisation known as the Beaker culture.
It is thought that the alignment of the standing stones was planned so that sunlight would shine on particular areas on important astronomical dates, such as the summer solstice, the longest day of the year.
Satellite image of the three pyramids at Giza, in northern Egypt: They are thought to have been built sometime between 2600 and 2500BC as tombs and monuments of the ruling dynasties of ancient Egypt. The largest is believed to have been built for King Khufu and was the tallest building in the world for many centuries
Wondrous: The pyramids, which have historically loomed large as emblems of ancient Egypt, were popularised in Hellenistic times when the Great Pyramid was listed by Antipater of Sidon as one of the Seven Wonders of the World. It is by far the oldest of the ancient Wonders and the only one that remains in existence
The two temples of Abu Simbel on the shores of Lake Nasser, Egypt: The temples were carved out of the mountainside during the reign of Ramesses II in the 13th century BC, as a monument to himself and his queen Nefertari, to commemorate his alleged victory at the Battle of Kadesh, and to intimidate his Nubian neighbours
Saved: The temples were relocated to stop their being submerged during the creation of Lake Nasser, formed after the building of the Nile's Aswan High Dam. Between 1964 and 1968, the entire site was carefully cut into collossal blocks, dismantled and reassembled in a new location 65m higher and 200m back from the river
City of the dead: Saqqara is a vast, ancient burial ground in Egypt, serving as the necropolis for the Ancient Egyptian capital, Memphis. It features numerous pyramids, including the world famous Step pyramid of Djoser which is the oldest complete stone building complex known in history
Tourist attraction: Visitors stand around near the 3,500-year-old tombs near Saqqara's Step Pyramid. Another 16 Egyptian kings built pyramids at Saqqara, which are now in various states of preservation or dilapidation and it remained an important complex for non-royal burials and cult ceremonies for more than 3,000 years
These pictures of historical sites peppered the Earth's most ancient sites of civilisation show just how much benefit such a detailed eye on the Earth can offer.
But as many questions as they answer, they yet deepen the mystery of just how people in ancient times were able to perform feats of engineering that would be difficult to match today.
It is still not really understood, for instance, how the Incas of 15th Century Peru were able to move and place the enormous stones from which the mountain city Macchu Picchu was constructed.
|
<urn:uuid:bd359bd0-99ad-462c-8903-4f397e1d774f>
|
CC-MAIN-2016-26
|
http://www.dailymail.co.uk/news/article-2317119/Machu-Picchu-Stonehenge-Worlds-incredible-ancient-ruins-seen-space.html?ITO=1490&ns_mchannel=rss&ns_campaign=1490
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783404826.94/warc/CC-MAIN-20160624155004-00148-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.963832 | 2,694 | 3.296875 | 3 |
African American Activism in Santa Barbara
December 1, 2008 - February 11, 2009
Slideshow of Roots of Community Exhibit Reception - February 2, 2009
This year’s winter exhibit focuses on the African American leaders of Santa Barbara and their legacy of activism for civic improvement, equity, and social justice. Their many decades of selfless dedication contributed to the betterment of Santa Barbara, lifting the quality of life for many of our citizens.
These were unsung heroes who were instrumental in the founding of many institutions and programs that continue to meet real needs. Among these are the Goleta Valley Cottage Hospital, the Franklin Neighborhood Center, the Food Bank of Santa Barbara, and the UCSB Community Affairs Board.
In the 1920s African American leaders were already organizing and meeting with civic activist Pearl Chase. In the 1940s the George Washington Carver Club had a history of addressing educational inequities and raising scholarship support to send African American youth to college. The NAACP’s local chapter had already been organized and supporting both local and national social justice issues.
By the 1950s Dr. Horace McMillan was exposing racially discriminatory practices in housing and employment and was instrumental in desegregating our local hospitals. In the early 1960s the NAACP won legal judgments that reversed discriminatory hiring practices among local banks. Also in the early 1960s, journalist Bill Downey, upon his arrival here wrote an incisive series in the Santa Barbara News Press on the inequities towards our Black citizens.
There is a long history of social service providers with such leaders as Herman and Valencia Nelson, William Simms, and Anita Mackey. Herman and Valencia Nelson, for example, responded to the needs of hungry citizens, taking it on themselves to distribute food to needy Eastside residents, renting a truck to pick up government surplus food in Oxnard, starting a program that would later become the Food Bank of Santa Barbara. Women leaders left their civic imprint on Santa Barbara, including Willie Rowan, Shirley Kennedy and Anita Mackey, who lent much needed wisdom and inspiring leadership to the boards of many civic organizations.
The historical narrative for this exhibit begins in the mid-19th century with the first documented African American resident, Jerry Forney. Originally brought here from North Carolina as a slave, Forney resisted further enslavement by refusing to return to North Carolina with his master. He declared his freedom, and by 1881 presented a plan to recruit 500 African Americans from North Carolina to come to Santa Barbara to live and work.
In the ensuing decades African American leaders emerged from our community to lead important civic organizations such as the George Washington Carver Club, the Jack and Jill Clubs of America, The National Association for the Advancement of Colored People Santa Barbara Chapter, and the Martin Luther King Committee.
The exhibit pays tribute to the predominantly African American churches that sustained our local African American population, providing spiritual guidance, an enduring sense of community, and a safe haven from the racial injustices that swirled throughout the community in housing, employment, and in education. Many of the leaders of the civic organizations were also leaders in these churches.
The exhibit includes historical photographs, letters, documents, and ephemera from throughout Special Collections. Past presidents of the NAACP Santa Barbara Chapter and others donated additional materials. Exhibit selections are being outreached to community centers through the use of digitized facsimiles and interpretive texts, culminating with a community workshop on archival preservation, planned for February, to commemorate Black History Month. In this way the exhibit brings to the fore the legacy of these great leaders amidst the continuing movement for equity and social justice.
|
<urn:uuid:43ea9167-89b7-4338-b4ec-c8d2427d9d00>
|
CC-MAIN-2016-26
|
http://www.library.ucsb.edu/special-collections/cema/rootsexhibit
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396455.95/warc/CC-MAIN-20160624154956-00148-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.955115 | 738 | 3.03125 | 3 |
by May Swenson
0 A mouth. Can blow or breathe,
be a funnel, or Hello.
1 A grass blade or cut.
2 A question seated. And a proud
3 Shallow mitten for a two-fingered hand.
4 Three-cornered hut
on one stilt. Sometimes built
so the roof gapes.
Read the poem in its entirety.
I love the notion of writing about the shape of things. What do you see in the number 6? Or the letter Y? What kind of ideogramatic poem can from the word L-O-V-E? (Ideogramatic? Yeah, I just made that up!)
Visit Joyce Sidman's site to see how she used the words in her name to write an ideogram poem. Now it's your turn to write an ideogram poem. Leave me a note about your work and I'll share the results here later this week.
|
<urn:uuid:f65f4d2b-901e-4cfb-a31a-0e0d2c132a6d>
|
CC-MAIN-2016-26
|
http://missrumphiuseffect.blogspot.com/2011/11/monday-poetry-stretch-ideograms.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783403826.29/warc/CC-MAIN-20160624155003-00056-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.930308 | 197 | 2.640625 | 3 |
Dec. 10, 2010 (San Antonio) -- Women with metastatic breast cancer who have no tumor cells circulating in their blood after the first round of treatment live longer than those who do, French researchers report.
Circulating tumor cells, or CTCs, are cells that break off from a tumor and escape into the bloodstream. These cells can travel to other organs and establish new tumors.
Several studies have shown that higher levels of CTCs are associated with an increased risk for recurrence and death in metastatic breast cancer patients.
But the new study is the largest to look at the topic, and the CTCs predicted prognosis even after taking other markers of survival into account, says Jean-Yves Pierga, MD, PhD, professor of the medical oncology department at Institut Curie and Universite Paris Descartes, France.
The study also suggests CTCs can be used to monitor whether a woman is responding to treatment, he tells WebMD.
Pierga reported the findings at the annual San Antonio Breast Cancer Symposium.
Circulating Tumor Cells Predict Breast Cancer Progression
The study involved 267 women whose cancer had spread to other parts of their body (metastasized) and who were receiving chemotherapy with or without the targeted drug Avastin for the first time.
Before treatment, two-thirds of the women had one or more CTCs; 44% had five or more CTCs.
After two years, cancer had progressed in about 95% of those with five or more CTCs, compared with about 70% of those with fewer or no CTCs.
Looked at another way, women with five or more CTCs were 90% more likely to have their cancer worsen and nearly two-and-a-half times more likely to die, even after other tumor markers were taken into account, Pierga says.
Then the researchers looked at women's CTC levels after their first round of treatment. At two years, cancer had progressed in about 70% of those with fewer than five CTCs, but in all of those with more CTCs. Over 90% of those with fewer than five CTCs were still alive, compared with less than half of the women with more CTCs.
The study also showed that after three rounds of treatment, CTCs dropped more in women who received Avastin plus chemotherapy, compared with those who just got chemo.
|
<urn:uuid:d3532910-f8e6-42cc-8ce0-cc0101d9c1b9>
|
CC-MAIN-2016-26
|
http://www.webmd.com/breast-cancer/news/20101210/wandering-tumor-cells-predict-poor-outcome
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393463.1/warc/CC-MAIN-20160624154953-00115-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.976018 | 507 | 2.703125 | 3 |
Mother mine, a woman good,
she Darerca hight;
Father, of Molt’s Latharna
he was Beoit the wright.
Of the Ciarraige of Irluachra was his mother, that is, more especially, of the Glasraige. Glas the Poet was her grandfather. Now this was the cause of the coming together of those twain. When Beoit went to visit his brethren who were in the territory of Cenel Fiachrach, and when he saw the maiden Darerca before him, he asked for her of her [friends and her] parents, so that she was given him to wife. Thereafter she bore five sons to him, and this is the order in which they were born: Lucoll her firstborn, Donnan the second, Ciaran the third, Odran the fourth, Cronan the fifth—he was a deacon, but the other four sons were archpresbyters. Furthermore she bore three daughters to him; two of them were virgins, to wit Lugbec and Rathbeo; Pata was the third daughter, and she was a pious widow. These are the graveyards wherein are the relics of those saints; Lucholl and Odran in Isel Chiarain, Donnan and Ciaran in Cluain maccu Nois, Cronan the deacon and Beoit and the three daughters in Tech meic in tSaeir.
Now there was an impious king in the land of Ui Neill at that time, Ainmire son of Colgan his name. He impressed the tribelands and the septs under a grievous tax. So Beoit went, a-fleeing from that king, into the land of the Connachta, to Cremthann son of Lugaid son of Dallan King of Ireland, to Raith Cremthainn in Mag Ai. The day on which Ciaran was conceived was the sixth of the calends of June, and he was born on the sixth of the calends of March.
The birth of Ciaran was prophesied by Lugbrann the wizard of the aforesaid king. The wizard dixit—
Oengus’ steed he made alive,
while he yet in cradle rested;
God this marvel did contrive,
by Ciaran, in swathing vested.
One day when the wizard heard the sound of the carriage [he spake thus: “See, lads,” said he, “who is in the carriage]—for here is the sound of a carriage that bears a king.” When the lads went out they saw no one save Beoit and Darerca in the carriage. When the lads mocked the wizard, thus spake he: “The child who is in the womb of the woman,” said he, “shall be a great king: as the sun shineth among the stars of heaven, so shall he shine, in signs and wonders that cannot be related, upon the earth.”
Thereafter was Saint Ciaran born, in Mag Ai at Raith Cremthainn. He was baptized by deacon Iustus, for it was fitting that the true one should be baptized by a True One.
III. HOW CIARAN RAISED THE STEED OF OENGUS FROM DEATH
3. A certain day the horse of Oengus son of Cremthann died, and he had great sadness because of the death of his horse. Now when Oengus slumbered, an angel of God appeared to him in a dream, and thus he spake with him: “Ciaran son of the wright shall come, and shall raise thy horse for thee.” And this was fulfilled, for Ciaran came at the word of the angel, and blessed water, and it was put over the horse, and the horse arose from death forthwith. Then Oengus gifted a great land to God and to Ciaran in return for the raising of the horse; Tir-na Gabrai is the name of the land.
|
<urn:uuid:df26ecc3-60ab-4085-94bf-a27b5e09a635>
|
CC-MAIN-2016-26
|
http://www.bookrags.com/ebooks/16479/41.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397864.87/warc/CC-MAIN-20160624154957-00184-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.974664 | 879 | 2.53125 | 3 |
- Category: Raspberry Pi
- Last Updated on Tuesday, 28 August 2012 10:29
Slice of PI/O is an MCP23017 breakout, adding 16 I/O pins to the Raspberry Pi via the I2C bus.
Each I/O pin is capable of sourcing or sinking 25mA and they are 5v tolerant.
Data-sheet for the MCP23017 chip can be found here.
Special mention should go to Nathan for coming up with the original idea, see his blog post here
Silk Screen Error
There was a mistake on the silk screen for the first batch of boards. Port B is numbered incorrectly.
The port number should from top to bottom read A0->A7 then B7->B0
The slice of PI/O has 3 power options 3v3, 5v or external. Use the red jumper to select between 3v3 and 5v direct from the Raspberry Pi's GPIO headers or remove the jumper and wire a power source to the "EXT POWER" pad.
Two Interrupt Pins A & B have been broken out to pads, these can be wired back the Raspberry Pi's normal GPIO's.
Interrupts can be configured to trigger on input pin changes, for more info please refer to the MCP23017 data-sheet.
On the underside of the PI/O there are 6 solder pads used for the 3 address selection pins on the MPC23017.
You need to tie the 3 pins either high(to PWR) or low(to GND) in order to select the I2C address,
Soldering all 3 pins low as shown will give an address of 0x20. More details can be found in the MCP23017 data-sheet
There are an optional 4 pads to allow extenion of the I2C bus, this could allow daisy chaining of multiple MCP23017 or any other I2C device
Parts laid Out
Solder the IC Socket
Solder the IO and GND headers
Solder the capacitor and jumper
Solder the Raspberry Pi GPIO header to the other side of the board
Add the required power jumper and go
Using the latest Raspbian image is recommended as it already has I2C support built into the kernel and just needs the i2c enabling and i2c-tools installing before you can start playing.
Enable i2c by editing the following files
Comment out the line
Add a new line
Installing i2c-tools requires two commands, replace 'your-userid' with your login name (the default is pi)
$ sudo apt-get install i2c-tools $ sudo adduser your-userid i2c
Once everything is installed and rebooted, you should be able to detect the MCP23017 using the following command.
$ i2cdetect -y 0
It should show up on the address you selected
|
<urn:uuid:ce153d26-9e41-4914-982d-7406e5350f9e>
|
CC-MAIN-2016-26
|
http://openmicros.org/index.php/articles/94-ciseco-product-documentation/raspberry-pi/223-slice-of-pio
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783404826.94/warc/CC-MAIN-20160624155004-00074-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.856978 | 611 | 2.546875 | 3 |
Friday, October 7 — The prostate specific antigen (PSA) test for prostate cancer has been the subject of controversy for some time. Many doctors contend that the screening leads to overtreatment and has little effect on death rates, while others argue that it's a life-saving screening tool. Now, with the news that the United States Preventive Services Task Force (USPSTF) is planning to recommend against the test next week, the debate is heating up again, inciting reactions from experts and patients on both sides of the issue.
The USPSTF is no stranger to controversy. Back in 2009, the group caused a similar firestorm when it recommended scaling back on routine mammograms for breast cancer. Previous guidelines recommended that all women age 40 and older should have annual screenings, but the USPSTF report suggested that women should start getting mammograms at age 50, and then only every other year. Breast cancer advocates worried then — as many prostate cancer advocates are concerned about now — that the decision would cause people to skip screenings altogether and miss out on early detection of dangerous tumors.
PSA opponents argue, however, that the tumors detected by the test often aren't dangerous and just end up causing unnecessary physical and emotional stress. "This test cannot tell the difference between cancers that will and will not affect a man during his natural lifetime," Dr. Virginia Moyer, a professor of pediatrics at Baylor College of Medicine and chairwoman of the task force, told the Times. "We need to find one that does."
PSA supporters don't necessarily disagree with that sentiment but contend that we shouldn't throw out the old screening method until we have a new one to replace it. "Though it is clear that we still need to find a better test to improve early detection of significant disease and to curtail over-treatment, it is not advisable to discourage use of a currently existing test that is proven to save lives," said Lionel L. Banez, MD, an assistant professor in the division of urologic surgery at Duke University Medical Center. (Find out more about the new recommendations and resulting controversy here.)
The issue is of particular interest to prostate cancer survivors, some of whom credit the PSA test with saving their lives. Many expressed their concerns in communities within the American Cancer Society's Cancer Survivors Network and Us Too's Inspire Support Groups:
What We Really Need Is More Awareness
"[We need] education to make this disease more public. At our state fair last August, we had prostate screenings, [and the volunteers] were women, wives dragging their husbands to the information table. Where were the men helping other men with this disease? If all the guys on this board start a local Man to Man group, maybe we can do something to help." — Sharon, USTOO
What Other Option Do We Have?
"I agree with the PSA test. How do we detect cancer? Do we wait until other problems show up? Maybe the test is not the greatest option available, but when it is the only option other than a DRE [digital rectal exam], it sounds like a winner to me." — Dakotarunner, ACS
"So we get rid of the PSA test. Then how do you detect cancer? I realize that the test is unreliable, but what else is there?" — NowRest, ACS
We Have to Weigh the Negatives Against the Positives
"The problem doesn't seem to be getting the test — the problem is acting on the test. As it stands now, we are treating all men if there's a positive biopsy, and as a result, many unnecessarily suffer the negative consequences of surgery (mainly incontinence and erectile dysfunction). On the other hand, the few men [with] high risk cancer are saved, making the effects of surgery less consequential." — Swingshiftworker, ACS
Early Detection Is Key
"Almost everything we read is that early detection is the key. What you do with the information [and results] can be harmful, but it can also be enlightening." — Dan, USTOO
Why Wait Until It's Too Late?
"I know young guys, under 65, who are diagnosed and seem to have a more aggressive prostate cancer. What do you do — wait until symptoms rear their ugly heads when a simple blood test can be watched?" — Kalchic, USTOO
PSA May Have Saved My Life
"My PSA had gone up from 3 to 5 in one year, so I had a DRE (negative) followed by a biopsy (positive). If I hadn't had the PSA test, I wouldn't have had the biopsy, and the cancer would have grown without being treated." — Tom, USTOO
Last Updated: 10/7/2011
|
<urn:uuid:b507df9d-7587-43c8-8a29-735018b17c99>
|
CC-MAIN-2016-26
|
http://www.everydayhealth.com/prostate-cancer/1007/survivors-react-to-new-prostate-cancer-screening-controversy.aspx
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783394937.4/warc/CC-MAIN-20160624154954-00160-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.963018 | 986 | 2.6875 | 3 |
The Rehabilitation Engineering Research Center on Telecommunications Access at Gallaudet University is conducting an online survey to learn about the experiences of adults who are hard of hearing, deaf or have hearing loss in their use of voice telecommunications technology in the U.S. (regular telephones, cell phones, captioned phones, Skype, etc.).
Our goal is to better understand how such adults use current voice telecommunications technology, what barriers they face using it, and what needs they have for improved accessibility.
For the purposes of this survey, voice telecommunications means that you both listen and talk for yourself during telephone calls, even if you also supplement your listening experience by using text (for example, relay or captioning) to read what the other person on the call is saying while you listen.
To take this survey you:
1. must be 18 years or older
2. have hearing loss and
3. use voice telecommunications regularly (at least once a week).
4. have access to the Internet in order to complete the survey.
The survey will take approximately 15-30 minutes to complete, depending on the extent of your telephone use.
To participate in the survey go to http://tap.gallaudet.edu/telecomsurvey/
For questions about the survey, contact: Linda Kozma-Spytek at Linda.email@example.com.
This study has been approved by the Gallaudet University Institutional Review Board.
|
<urn:uuid:74764b69-de24-42ca-ad53-ff7ba20acbfb>
|
CC-MAIN-2016-26
|
http://www.hearingloss.org/content/gallaudet-online-survey-voice-telecommunications-use
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395548.53/warc/CC-MAIN-20160624154955-00135-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.914311 | 303 | 2.78125 | 3 |
What is a domain Name?
A domain name is a unique name that can be entered into a browser to resolve
the numeric address (called the IP address) of your web site or email
server. A domain name tells people (and the computers they use) how to
find your homepage on the Internet. Your hosting provider assigns each
domain name to a numerical IP (Internet Protocol) address. It takes the
form of a name of your choice coupled with an extension relating to the
type of site. Current gTLD ("generic Top Level Domain) extensions
are .com (meant for business sites), .org (meant for non-profit organizations),
and .net (meant for internet service providers). People remember names
better than numbers, but computers translate www.yourname.com into IP
Why should I register a
Registering a domain name for your business or organization is essential
to your marketing efforts. A domain gives your business credibility and
a unique identity on the World Wide Web.
If you use the Internet, you will eventually want your own presence on
the world wide web. Post your interests and hobbies on the web. Soon you
will begin receiving emails from others around the world who share your
interests. Families researching their genealogy post their web sites and
are found by relatives they didn't even know they had. People are making
new friends from the four corners of the world simply because of the ease
of communications, and the ability of this tool to virtually eliminate
Registering your own domain name gives you presence on the web that is
easy to remember, descriptive, and an enhancement to your professional
image. And, if you ever need to switch Internet service providers, you
can take your domain name with you, whether across the street or to the
other side of the world. You'll never need to reprint your business materials,
change your email address, or send notifications to your clients.
What does it mean to "register"
a domain name?
When you register a domain name, you are inserting an entry into a directory
of all the domain names and their corresponding computers on the Internet.
What are the components
of a domain name?
A domain name consists of two or more words separated by a period. The
last word (the far right) is called a "top-level domain". Here
are some common top-level domains and their use:
Used for commercial entities. It is the most popular top-level domain.
Anyone can register a .com domain.
Originally used for networking organizations such as Internet Service
Providers and backbone providers. Today, anyone can register a .net domain.
Designed for miscellaneous organizations, including non-profit groups.
Today, anyone can register a .org domain.
Four-year, accredited colleges and universities.
I choose a .com, a .net, or a .org domain name?
There is no doubt but that .com is trump. It is the most popular extension
on the Internet, and it is firmly established in the public mindset as
associated with all things Internet. Even your newer browsers automatically
search for the .com version of a name first.
What characters can be included in a domain name?
You can use the characters a-z and 0-9 (in any combination). You can also
use hyphens (-). Mind your domain name cannot start or end with a hyphen.
You cannot use any other characters, nor should you use punctuation. Other
special characters like the underscore "_" or an exclamation
mark "!" are NOT permitted. Example: your name.com (not correct,
no spaces allowed) Example: your-name.com (is correct) A domain name can
be up to 72 characters long -- including the 4 characters used to identify
the Top Level Domain (.NET, .COM, .ORG, or .EDU). Do not type the www.
before your domain name when registering.
I register a domain name containing only digits?
What information will I receive when ordering a domain name?
Some registrars will mail you a paper record of your domain name registration.
The e-mail confirmation is also available as a form of documenting a domain
name opening. Others simply display a confirmation screen in your web
browser upon completing an order. It is always a good idea to print out
any information supplied by your registrar during the registration process
so that you will have access to it later.
What extra services can
I expect when I register a domain name?
Some registrars offer "name only" services, where they do nothing
more than register the domain name for you. Others offer a wide variety
of other services (but they may charge a higher registration price to
reflect these additional services). The most common such services include:-
• email forwarding: email sent to [email protected] is forwarded
to your current email address. This is a very cheap and easy way of having
your own "custom" email address
• website forwarding : This comes in two flavours: pointing your
website at a given IP address, and pointing your website at a directory.
The latter is great for anyone hosting a site on an ISP's site, as you
will not need to move the site. The name will automatically be resolved
to point to the correct directory.
• under construction page : depending on your personal preference,
you may prefer to have www.YOURNEWNAME.com point at a standard "under
construction" page rather than not point at anything at all.
• sample page : some registrars allow a single free "sample"
page so that visitors to the site www.YOURNEWNAME.com would see your company
name and address and maybe a phone number or a simple description of the
services your company provides.
What if the domain name
I want is already taken?
You can offer
to buy the name off its current owner, or look for an alternative domain
name. If your company holds a trademark on the terms in the domain name,
it may be worth seeking legal advice about the possibility of recovering
your domain name.
When you do your domain name search on the whois, you may find that someone
else on the Internet has already registered that name for his or her own
site. Try a slight variation on that name. Consider a hyphenated form.
Think of a name that might be a synonym. Consider a name using "the",
"this", "e-" or other additions that may be suitable.
See if the same name is available with a different domain extension.
I registered a domain name,
but I made a mistake while registering and registered the wrong name/changed
my mind about registering it after paying. Can I cancel my registration?
Under the current Domain Name Service Agreement that all accredited Registrars
operate under, all sales are final. If you want to register a different
domain name, you'll have to pay again.
I'm thinking of registering
the ".org" of a well-known .com domain name. Is that a good
While this tactic may get you some "free" traffic, it's also
a great recipe for a lawsuit. If the .com domain is trademarked, it's
better to steer clear of trouble. If the .com domain is "generic"
(that is, it is a dictionary word which is not trademarked) then you're
safer. Ultimately, it's your decision.
I'm thinking of registering
a misspelling of a popular site's domain name (example: Yahhoo.com, AOLL.com).
Is that a good idea?
This is commonly known as "typosquatting" i.e. buying a domain
name with the expectation of siphoning traffic off of the legitimate site
by snaring people who can't spell well. There have been a number of court
cases as a result of this kind of behavior - most were decided in favor
of the site owner. Ultimately, it's your decision.
is a URL?
It stands for Univesal Resource Locator. Some people refer to it as a
web address (although URL is not limited to the web). An example of a
URL is http://www.hostreview.com. Please note that a URL is a unique identifier.
No two websites can have the same URL. This is the reason why you should
register your domain name before someone else does.
is an IP address?
Every computer on the Internet has a numeric address called IP-Address
that is used to identify the location of the computer. An example of an
IP address is 18.104.22.168. This kind of addressing system is cumbersome
and hard to remember for humans. Having a domain name will eliminate the
need to remember an IP address.
is a DNS?
DNS stands for "Domain Name Server". It translates domain names
into IP addresses that computers understand. For example, if someone wants
to access our website (www.hostreview.com), the DNS will translate the
domain into the IP address 22.214.171.124 , which will allow the computer
to locate our web server. Domain Name Service (DNS) is the system by which
hosts on the Internet have both domain name addresses (such as blueleaf.prairienet.com)
and IP addresses (such as 126.96.36.199). DNS is the means by which you are
able to type in an easily remembered name in order to go to a URL, instead
of using an IP address. The Domain Name System (DNS) helps users to find
their way around the Internet. Every computer on the Internet has a unique
address - just like a telephone number - which is a rather complicated
string of numbers. It is called its "IP address" (IP stands
for "Internet Protocol"). IP Addresses are hard to remember.
The DNS makes using the Internet easier by allowing a familiar string
of letters (the "domain name") to be used instead of the arcane
IP address. So instead of typing 188.8.131.52, you can type www.hostreview.com.
It is a "mnemonic" device that makes addresses easier to remember.
To the left of the top-level domain is what is called the "second-level
domain." In domainleak.com, “domainleak” represents a
second-level domain within the top-level domain of .com.
I have secured my name, how long may I use it?
If there are no trademark disputes, your secured domain name will be yours
for as long as you maintain the yearly registration fees.
do I choose a good domain name?
It is important to choose a domain that will reflect the intent and purpose
of your website or business. Try to keep it short and simple. Your domain
name will be one of the ways people recognize or evaluate the site for
their interests when they are searching via Yahoo! or other search engines.
Can anyone register to own a domain
Yes, anyone is able to register for ownership of a domain name. It does
not matter what country your are from. Anyone can easily register their
own a (.com, .net, or .org) website address for present, or future use.
Should I register all
three extensions of my domain name?
The answer to this question depends entirely on how you intend to use
If you are planning to have a commercial site, an on-line store or service,
it is probably a good idea to protect your name. There is nothing so frustrating
as working hard and putting out a great deal of expense to develop and
market a fantastically successful .com web site, only to find that someone
has registered your name as a .net or .org, hoping to reap some of the
benefits of your success.
How long before changes
I make to the name servers associated with my domain become active?
When you register your domain, your registration is available immediately
in the shared registry. However the information, particularly your DNS
servers that will point your domain, are not uploaded immediately to the
root servers which control the actual propagation of the information.
Root server uploads occur twice daily, usually beginning at 0500 and 1700
Eastern Time (US). After the upload is complete, your name will begin
working from some locations. However, it could be another 24-72 hours
before the information is propagated world-wide and functional from every
When should I renew my
You must pay your renewal fees by the current expiration date of your
domain name. Your domain registrar will notify you 30 days before your
name is due to expire.
However, you do not need to wait until the expiration date. You can renew
your domain name at any time and for any number of years up to a total
of ten. With a 10 year renewal, you won't have to worry about your domain
name expiring for a long long time.
I just registered a domain
name and it’s still showing as available! Is it registered?
It will take between 24-48 hours for DNS Propagation. DNS Propagation
is the process by which the computers on the Internet update their records
(DNS tables) to reflect new site name(s). When this is complete, your
name can be accessed and recognized on the Internet.
Will my name and contact
information be publicly available?
Information about who is responsible for domain names is publicly available
to allow rapid resolution of technical problems and to permit enforcement
of consumer protection, trademark, and other laws. The registrar will
make this information available to the public on a "Whois" site.
It is however possible to register a domain in the name of a third party,
as long as they agree to accept responsibility -- ask your registrar for
How long does a registration
last? Can it be renewed?
Each registrar has the flexibility to offer initial and renewal registrations
in one-year increments, with a total registration period limit of ten
years. How much does a domain-name registration
Each registrar sets the price it charges for registering names, and prices
vary significantly among different registrars. In addition, some registrars
offer discounted or free registration services in connection with other
offerings, such as web hosting.
Can I change registrars
after registering a domain name?
Yes, you may change the registrar sponsoring your domain name (60 days
after intial registration.) For details on the transfer process, contact
the registrar you would like to assume sponsorship of the registration.
ICANN is the new non-profit corporation that is assuming responsibility
from the U.S. Government for coordinating certain Internet technical functions,
including the management of Internet domain name system. More information
about ICANN can be found at http://www.icann.org.
I have customer service questions or problems related to my domain name
registration, who should I contact?
You should contact the registrar that registered your domain name.
What are the rules for registration of .biz, .com, .info, .name, .net
and .org names?
The .com, .info, .name, .net, and .org TLDs are open and unrestricted.
Traditionally, however, names in .net have been used by organizations
involved in Internet infrastructure activities and .org is frequently
used by noncommercial organizations. .biz is reserved for use by businesses.
|
<urn:uuid:848a643d-2642-4c5b-8820-5c23faf07b3c>
|
CC-MAIN-2016-26
|
http://www.domaininformer.com/FAQ/FAQs.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783408828.55/warc/CC-MAIN-20160624155008-00061-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.891483 | 3,292 | 2.90625 | 3 |
Second Information Technology in Education Study 2006
The IEA Second Information Technology in Education Study (SITES) 2006 was an international comparative study of pedagogy and information and communication technology (ICT) use in schools. The study focused on the role of ICT in teaching and learning in mathematics and science classrooms.
SITES 2006 examined how teachers and students used ICT and the extent to which certain pedagogical practices considered to be conducive to the development of "21st century" skills were present in comparison to traditionally important ones. These 21st century skills were defined in terms of students' abilities to engage in lifelong learning (collaborative and self-directed inquiry) and their connectedness (ability to collaborate with and learn from peers and experts). In addition, analyses were conducted to identify conditions at the system, school, and teacher level that were associated with different pedagogical practices and different ways of using ICT for teaching and learning.
The study used questionnaires to collect information from school principals, technology coordinators, and mathematics and science teachers; a national context questionnaire gathered policy information on education and ICT use. For 15 countries that participated in SITES Module 1, SITES 2006 also provided an opportunity to examine changes in pedagogy and ICT use since 1998. The main data collection took place in 2006. In 18 countries, the data were collected online.
SITES 2006 consisted of two survey components: a survey of schools (school principals and technology coordinators), and a survey of mathematics and science teachers of students in the eighth grade.
Participating education systems
Canada (Alberta and Ontario), Chile, Chinese Taipei, Denmark, Estonia, Finland, France, Hong Kong SAR, Israel, Italy, Japan, Lithuania, Norway, Russian Federation (with Moscow as a benchmarking system), Singapore, Slovak Republic, Slovenia, South Africa, Spain (Catalonia), and Thailand.
ICT use in education
Twenty of the participating education systems reported having a system-wide policy relating to ICT in education, though their policy concerns differed. The majority of countries had at least slightly increased their ICT spending in the last 5 years and reported some level of government funding for the provision of hardware and software. With the exception of one country, nearly all of the schools in the participating countries reported having computer and Internet access for pedagogical use. However, the percentage of teachers reporting that they used ICT for teaching was comparatively low. ICT use was generally more prevalent among science teachers than mathematics teachers in most countries, but the extent to which teachers had adopted ICT differed considerably across countries, varying from 20% to 80%. Furthermore, there was no correlation between the level of ICT access (student-to-computer ratio) and the percentage of teachers who reported using ICT in their teaching.
The perceived availability of technical, administrative, and infrastructural support was the most consistent positive predictor of teachers' use of ICT. The extent of ICT use depended not only on school-level conditions, however, but also on national curriculum policies, as evidenced by large differences in the use of ICT among mathematics and science teachers within the same schools in some countries. For example, in Japan and Israel, the percentages of mathematics teachers reporting ICT use (around 22.5% in both countries) were much lower than those for science teachers from the same samples of schools (44% and 53% respectively).
21st century skills and ICT use
The perceived impact of ICT use on students was highly dependent on the pedagogical approaches adopted by teachers when using ICT. Greater student gains in 21st century skills such as collaboration and inquiry were reported by teachers with a lifelong-learning orientation (taking on a more facilitative role, providing student-centered guidance and feedback, and engaging more frequently in exploratory and team building activities with students).
Changes in ICT provisions and priorities in teaching practice
Between 1998 and 2006, great improvements in access to computers and the Internet were reported, though considerable diversity in terms of the ICT infrastructure available in schools remained. In most countries, there was a general increase in teaching practices that involved information handling (e.g., searching for information, processing data, and presenting information).
There was considerable diversity in countries' trends in development. In most countries, there was a general increase in the perceived presence of lifelong-learning pedagogy. Substantial increases were evident in several Asian countries that reported the lowest presence in 1998 (Hong Kong, Japan, Singapore); conversely, a decrease in presence was reported in the three European countries (Norway, Slovenia, Denmark) that registered the highest presence of lifelong-learning pedagogy in 1998.
Brese, F., & Carstens, R. (Eds.). (2009). Second Information Technology in Education Study: SITES 2006 user guide for the international database. Amsterdam: IEA.
Carstens, R., & Pelgrum, W.J. (Eds.). (2009). Second Information Technology in Education Study: SITES 2006 technical report. Amsterdam: IEA.
Law, N., Pelgrum, W.J., & Plomp, T. (Eds.). (2008). Pedagogy and ICT use in schools around the world: Findings from the IEA SITES 2006 study. Hong Kong: CERC-Springer.
Plomp, T., Anderson, R.E., Law, N., & Quale, A. (Eds.). (2009). Cross-national information and communication technology: Policies and practices in education (Rev. 2nd ed.). Charlotte, NC: Information Age Publishing.
|
<urn:uuid:6df34170-a9b3-4c8e-b6cc-bd2ed4c120d5>
|
CC-MAIN-2016-26
|
http://www.iea.nl/sites_2006.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396147.66/warc/CC-MAIN-20160624154956-00046-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.944552 | 1,164 | 2.640625 | 3 |
13 Sep 2012, BioSpectrum Bureau , BioSpectrum
Singapore: The Coalition against Typhoid (CaT) called on policymakers and ministries of health across Asia to make typhoid vaccination a priority in their countries at the 14th Asia Pacific Congress of Pediatrics. CaT, an initiative of the Sabin Vaccine Institute, brought together leading pediatricians from across Asia to discuss the hyper-endemic burden of typhoid in the region and offer solutions to combat this growing epidemic.
"Pediatric associations and others across the region recognize typhoid's serious impact, particularly the rising and widespread threat of drug resistant typhoid. Many including India and Indonesia have made recommendations supporting the use of typhoid vaccines," said Dr Zulfiqar A Bhutta, founding chair, women and child health division, The Aga Khan University, Karachi, Pakistan. "National stakeholders and policymakers should review the evidence and discuss the adoption of typhoid vaccines."
Despite the World Health Organization's (WHO) recommendation to prioritize typhoid vaccines for "immediate" implementation at a 2009 WHO meeting, many countries in Asia have yet to recommend or introduce typhoid vaccines.
"Since 1997, the Vietnamese Ministry of Health has used typhoid vaccination to effectively control disease in high risk districts," said Dr Nguyen Van Cuong, deputy head, National Immunization Program, Vietnam. "Successful programs have also been implemented in China and Thailand."
According to the WHO, typhoid impacts an estimated 21 million people and causes more than 200,000 deaths annually, predominantly among pre-school and school-age children in developing countries of Asia and Africa. The WHO reports that 90 percent of typhoid deaths occur in Asia.
|
<urn:uuid:b60ba1d1-667b-42b9-b9dd-113b88316b83>
|
CC-MAIN-2016-26
|
http://www.biospectrumasia.com/print_article/biospectrum/news/22188/asia-calls-urgency-typhoid-vaccine
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395160.19/warc/CC-MAIN-20160624154955-00034-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.92081 | 343 | 3.046875 | 3 |
Movement exercises for parents, teachers and therapists of children with difficulties in speaking, reading, writing and spelling
Mary Nash-Wortham and Jean Hunt
To my mind no therapist or remedial teacher should be without this edition by their side.
( Dr. Béve Hornsby PhD, MSc, MEd, MSCT
Consultant Speech Therapist and Clinical Psychologist
From the Foreword )
Take Time has been used in Waldorf schools by Extra Lesson teachers for years and is regarded with love and gratitude by everyone who has benefited from this wonderful marriage of curative eurythmy and speech therapy. It is recommended for by all the major advisory and learning support organizations in the UK and many more in other English-speaking countries. Because it is highly readable, it has also become one of the most popular resources for parents.
The authors of Take Time tackle some of the root causes behind difficulties in speaking, reading, writing and spelling, especially where there is a lack of co-ordination, rhythm and timing.
The innovative movement exercises, based on curative eurythmy, and the other activities described in Take Time can be tailored specifically to individual situations. This feature has resulted in the enormous popularity of the book, especially for use by parents. It is recommended by all centres concerned with dyslexia, dyspraxia and other difficulties.
Take Time features:
- ‘Pointers’ to clarify areas of difficulty, including timing and rhythm, direction, spatial orientation and movement, sequencing, laterality and fine motor control needed for clear speech and successful writing and reading.
- general exercises for co-ordination and body awareness.
- specific exercises to help with particular areas of difficulty and individual situations.
- details of useful resource equipment, books and contact addresses.
|
<urn:uuid:de841552-2eba-4db5-a491-8b9d865d3d8d>
|
CC-MAIN-2016-26
|
http://www.waldorfbooks.com/item_1341.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396147.66/warc/CC-MAIN-20160624154956-00153-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.955563 | 374 | 2.703125 | 3 |
Cross-sectional study of the prevalence of feather pecking in laying hens in alternative systems and its associations with management and disease
UNSPECIFIED. (2000) Cross-sectional study of the prevalence of feather pecking in laying hens in alternative systems and its associations with management and disease. VETERINARY RECORD, 147 (9). pp. 233-238. ISSN 0042-4900Full text not available from this repository.
A cross-sectional study of risk factors for feather pecking In layings hens in alternative systems was carried out in July 1998. A total of 637 questionnaires were sent out to farmers and producer groups and, after two reminders, the final response rate was 51.5 per cent. The outcome variable was feather pecking after point of lay. Over 55 per cent of the farmers reported that feather pecking had occurred in the last depopulated flock. This outcome was compared with the management procedures reported by flock managers by using univariate statistics. Factors associated with feather pecking with a significance less than or equal to 0.05 were then tested in two logistic regression models. In the first model the following factors were associated with an increased risk of feather pecking: less than 50 per cent of the flock using the outdoor area on a fine and sunny day, the occurrence of egg peritonitis and the occurrence of infectious bronchitis. The direction of the association between feather pecking and these infectious diseases was unclear, so in the second model only factors which were consistent throughout the laying period were tested. The following factors were associated with an increased risk of feather pecking: less than 50 per cent of the flock using the outdoor area on a fine and sunny day; three or more changes of diet during lay; the inspection of the flock by one person; an absence of loose litter at the end of lay; a temperature in the hen house of less than 20 degrees C; turning the lights up when the flock was inspected; and the use of bell-drinkers. It is concluded that some of these factors could inhibit foraging and dust-bathing behaviour and others may increase competition or frustration, both of these changes having been shown experimentally to initiate feather pecking behaviour.
|Item Type:||Journal Article|
|Subjects:||S Agriculture > SF Animal culture|
|Journal or Publication Title:||VETERINARY RECORD|
|Publisher:||BRITISH VETERINARY ASSOC|
|Official Date:||26 August 2000|
|Number of Pages:||6|
|Page Range:||pp. 233-238|
Actions (login required)
|
<urn:uuid:db68d286-44df-48f1-943c-a4ae9f7d12f9>
|
CC-MAIN-2016-26
|
http://wrap.warwick.ac.uk/12986/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397428.37/warc/CC-MAIN-20160624154957-00045-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.939447 | 546 | 2.96875 | 3 |
2. Student Learning Outcomes
After completing this course, students should be able to
design, program, document and test Visual Basic for Applications (VBA) programs that accurately comply with a given specification.
use applications such as spreadsheets and databases to effectively solve computational problems in science, engineering, commerce and humanities.
gain an understanding of the limitations/advantages of some of the emerging IT technologies, and how to exploit them in solving engineering problems.
Lab exercises and assignment problems will test knowledge and skills you have acquired throughout the session (in particular for the first two topics). Questions in the Mid-Session test and the Final Written Exam will challenge your understanding of all the above three topics.
|Week 1:||Digital Revolution|
|Week 2:||Networks and the Internet|
|Week 3, 4:||
Spreadsheets - Basics of a Spreadsheet, Predefined functions (statistical, lookup, etc), Filters, Charts, etc
Analyzing Data - Descriptive Statistics, What-If Analysis, Goal Seek, Solver, etc
|Week 5:||Databases - Introduction and Case studies|
|Week 6-12:||Problem Solving and Programming: Introduction to procedural programming and VBA, data types, variables and constants, operators and statements, selection (If and Select Case statements) and iteration (While and For statements), modularity using functions/subprograms, parameter passing. Program design, development, testing and debugging. Arrays, strings, collections, Excel object model, Macro Recorder. Problem solving case studies.|
|Week 13, 14:||Introduction to some of the current and emerging Information Technologies|
Laboratory Classes give you a chance to practise problem solving and programming skills on small, well defined examples. The examples have been chosen to highlight particular aspects of problem solution, and will give you enough grounding in problem solving to assist you in completing your assignment work. Your tutor will be present in your Lab Class to answer any questions you may have.
All lab class exercises must be shown to your tutor during your
scheduled lab class. The lab exercises will be available during the
session via the course's web page. Students are advised not to fall
behind in laboratory work.
In order to get a mark for a lab exercise you must show your tutor
a completed or substantially completed solution before the end of
your scheduled lab class in the week that the exercise is released.
To gain a mark you must at
the very least:
show your tutor a partial solution at the end of your scheduled lab
class in the
week that the exercise is released. If you fail to do
so, you will not receive a mark for
that particular lab exercise. If you cannot complete
the exercise by the end of the scheduled lab, you may
complete it in your own time and show it to your tutor in the next
scheduled lab class.
Your tutor will only mark it at the very beginning of
the next scheduled lab class.
Note that, after this time, you will
not receive a mark for that particular lab exercise.
Please note that at the time
of marking your lab exercises, your tutor will ask you to solve other
similar problems. You need to demonstrate that you are
able to solve lab exercises and related problems, in order to
receive any marks for your lab work. In other words, copying lab
solutions is pointless!
If you are unable to attend your scheduled lab class due to illness or misadventure, then you should apply for special consideration and an extension may be granted. You can only have your lab work marked during your scheduled lab class. It is not possible to have your work marked in another class.
Your weekly lab class is 2 hours long and it starts in Week 2 of
Each week, starting from Week 2, the lecturer(s) or a tutor will be available to discuss with you, on a one-on-one basis, any aspect of the course that you are having problems with. This is the most personalised form of teaching for this course, and you should take every advantage of it, particularly if you are experiencing difficulties. There will be at least 4 consultation hours available every week. However, depending on the requirements, we may even increase number of consultation hours.
Please check the class web page for current consultation times (see "Consultations" in the left panel of the class web page).
Every effort will be made to see as many students as possible. Please come prepared in order to maximise the time that's available to you.
Assignments give you the chance to practise what you have learned on relatively large problems (compared to the small exercises in the Lab Classes). Assignments are a very important part of this course, therefore it is essential that you attempt them yourself. There will be three assignments:
Assignments are to be completed in your own time. To maximise the learning benefits from doing assignments, it is essential that you start work on assignments early. Do not leave your assignments until the last minute. If you submit an assignment late, the maximum available mark is reduced by 10% per day that it is late.
Assignment 1: the aim in this assignment is to carry out "smart"
online research on a given topic. You need to find the required
information available online on a given topic, properly organise this
information, and produce an online report in the form of a web page(s).
There are no explicit marks for this assignment however the concepts will form
an integral part of the Mid-Session Test and you must complete it.
Assignments 2 and 3: the aim for these assignments is to develop skills in all stages of the programming process: start by understanding the specification; design a method to solve the problem; refine this design; implement and document the design in a source file that consists of both the documentation and the program code; and test extensively to validate that the program meets the specification.
A Mid-Session Test will be held in Week 7 during your scheduled lab class.
The final written examination will be held during the examination period. It will examine all material covered in the course, but will emphasise the material in the second half of the course.
The document Important Advice for Students states the supplementary assessment policy for the School of CSE. The following criteria will be used when considering a student for a supplementary exam:
http://www.cse.unsw.edu.au/~studentoffice/policies/yellowform.htmlPlease take the time to read it carefully. If you are granted a Supplementary examination, then it will be held on the date specified in the above document. If you think that you may be eligible for a supplementary exam, then make sure you are available on that day. It is your responsibility to check at the School Office for details of Supplementary examinations. Please note that there will be NO further supplementary dates for this course. In other words we will NOT be able to offer you supplementary examination at any other time.
The assessable components of the course are:
Component Mark Assignment 1 0 Assignment 2 10% Assignment 3 10% Lab Exercises 10% Mid-Session Test 10% Final Written Exam 60%
Units of Credits
6 units of credit
There are no pre-requisites for this course.
|Staff Name||Role||Phone (ext)
||9385-6556 (ext 56556)
|Geoff Whale||Lecturerfirstname.lastname@example.org||9385-4046 (ext 54046)
|Mei Cheng Whale
||Course Administratoremail@example.com||9385-5683 (ext 55683)
|Tue 2pm - 4pm||Mathews Theatre A|
|Wed 4pm - 5pm||Mathews Theatre A|
From time to time, various problems may arise in your study of this course. Below is a list of typical problems, with suggestions for where you might seek help with them:
One final piece of advice. If you have a problem, do not wait until late in the session before you seek help. Problems that are dealt with early are usually quicker and easier to resolve than ones that are left to the last minute.
Problem Solution Help with problems unrelated to this course CSE Web Help Page Can't understand lecture material Ask the lecturer after the lecture times, OR ask your tutor during your lab class, Or go to a consultation. Stuck with assignments, lab work Ask your tutor during your lab. Or go to a consultation. Want to change lab-tute class Email class account (firstname.lastname@example.org)
Problems with lab workstations CSE Help Desk Problems with your account CSE Help Desk Problem with Dial-Up access from home DIS-Connect Helpdesk (9385 1777)
All work submitted for assessment must be your own work. Lab exercises and assignments must be completed individually. We regard copying of assignments or lab exercises, in whole or part, as a very serious offence. We use plagiarism detection software to search for multiply-submitted work, or work derived from other students or from other sources. Be warned that:
|
<urn:uuid:eb9a6573-f918-4316-bf55-8653f0ae26b2>
|
CC-MAIN-2016-26
|
http://www.cse.unsw.edu.au/~en1811/07s1/en1811_CourseIntro.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783399428.8/warc/CC-MAIN-20160624154959-00175-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.919409 | 1,924 | 2.875 | 3 |
Where on the evolutionary tree is rotifera?
miller at diamond.jcn1.com
Sat Oct 5 11:41:10 EST 1996
I was lead to believe that rotifera was produced after colenterata, ie,
that rotifers evolved from jellyfish and that the rotifers were the first
to produce the innovation of an alimentary canal as well as an organized
nervous system (centralized in pseudo'brain'). From the rotifers then
were produced trocophorita (which branched out into mulloska,
brachiopada, most worms, annelida (segmented worms), trilobita,
crustacia, millipedes, centipedes, arachnids, and insecta) and the other
branch which produced echinodermata and the chordates (vertebrates and
man). Am I wrong in saying that rotifera has those traits that place
them between jellyfish and the more advanced forms? If not what exists
with regard to the relations of those forms?
More information about the Bioforum
|
<urn:uuid:d31728b1-98b1-4b51-a6f0-5cf7fc2eceed>
|
CC-MAIN-2016-26
|
http://www.bio.net/bionet/mm/bioforum/1996-October/021076.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393997.50/warc/CC-MAIN-20160624154953-00005-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.91395 | 238 | 2.921875 | 3 |
NASA’s Mars Curiosity Rover
Posted on June 16, 2011 Comments (8)
Curiosity is the name of the new rover from NASA. It will be launched to continue the exploration of Mars so successfully done by Spirit and Opportunity (2 previous Mars rovers that did some amazing work and laster years longer than expected). The rover is NASA’s Mars Science Laboratory, a mobile robot for investigating Mars’ past or present ability to sustain microbial life.
Once on the surface, the rover will be able to roll over obstacles up to 75 centimeters (29 inches) high and travel up to 90 meters per hour. On average, the rover is expected to travel about 30 meters per hour, based on power levels, slippage, steepness of the terrain, visibility, and other variables.
The rover is about the size of a small SUV — 10 feet long (not including the arm), 9 feet wide and 7 feet tall. It weighs 900 kilograms (2,000 pounds)
The rover will carry a radioisotope power system that generates electricity from the heat of plutonium’s radioactive decay. This power source gives the mission an operating lifespan on Mars’ surface of a full martian year (687 Earth days) or more, while also providing significantly greater mobility and operational flexibility, enhanced science payload capability, and exploration of a much larger range of latitudes and altitudes than was possible on previous missions to Mars.
|
<urn:uuid:723f3cc8-f09c-413c-9fd7-d08de4b1459c>
|
CC-MAIN-2016-26
|
http://engineering.curiouscatblog.net/2011/06/16/nasas-mars-curiosity-rover/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397213.30/warc/CC-MAIN-20160624154957-00118-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.910308 | 294 | 3.359375 | 3 |
At a glance
- Major Australian contribution to the treatment of deafness
- Inventions at the leading edge of medical science
- Emeritus Professor Graeme Clark, AC
Hearing for the deaf
The prototype for the bionic ear, hailed as the first major advancement in the treatment of deafness since the introduction of sign language, has been donated to the National Museum of Australia.
The bionic ear pioneered by Professor Clark was the first cochlear implant to reliably give speech understanding to severely and profoundly deaf people, along with spoken language to children born deaf.
The prototype is one of 15 pieces of medical equipment and objects in the Graeme Clark/University of Melbourne/Cochlear Limited collection.
Professor Clark was appointed Foundation Professor of the Department of Otolaryngology at the University of Melbourne in 1970. He led the team that developed the prototype bionic ear, which was implanted into the first patient, Rod Saunders, in 1978.
This success led to commercial interest in the technology and, with the support of a federal government grant, in 1982 the Nucleus 22-channel was commercially produced by the Australian firm Cochlear Limited.
International approval and application
Following an international clinical trial the device was approved for use in 1985. It was the first multiple-electrode implant to be approved by any world regulatory body.
In 2008 about 125,000 people in more than 70 countries have received a cochlear implant. The bionic ear has been hailed by many as the first major advance in the management of deafness since the introduction of sign language some 200 years ago.
The collection acquired by the National Museum in 2009 includes key elements that figured in the development of the bionic ear. Among these are the prototype multi-channel cochlear implant received by Rod Saunders in 1978 and subsequently removed when it was replaced by an updated model. Various other pieces of equipment and tools make up the collection.
Professor Clark's story features in the National Museum's Eternity gallery.
|
<urn:uuid:c25dcb76-7958-42f2-8939-7b2222a730fb>
|
CC-MAIN-2016-26
|
http://www.nma.gov.au/collections/highlights/bionic-ear-prototype
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396106.71/warc/CC-MAIN-20160624154956-00185-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.967034 | 407 | 2.921875 | 3 |
|Location||southesat of Minhiriath, northwest of Rohan|
Enedwaith, also spelled Enedhwaith, originally referred to both a region of Middle-earth and the men that inhabited it, although the region Enedwaith retained that name even when the Enedwaith people were no more.
The boundaries of the Enedwaith, which is Sindarin for 'Middle-region' as well as 'Middle-folk', were defined in the north by the rivers Gwathló and Glanduin, to the east by the Hithaeglir, and to the west by Belegaer, 'The Great Sea'. The southern border was less clear, but was probably formed by the river Isen.
The Enedwaithrim themselves "were forest dwellers, scattered communities without central leadership." They were distantly related to the Haladin of old, but this wasn't recognized in time by Númenóreans, who were mainly descended from the First and Third Houses of the Edain, and therefore spoke a language which was not related. The Enedwaithrim were not ranked as Middle Men, friends and distant kin of the Edain, but were ranked among the "people of darkness", enemies and aliens.
The denuded forests of Enedwaith, and much of those to the north in Eriador, were finally destroyed by the War of the Elves and Sauron around 1700 S.A., during which much of what had survived the felling was burnt. Only remote corners like Eryn Vorn survived in Eriador, and the Old Forest still further north. Many surviving natives took refuge in the eastern highlands of Enedwaith, "the foothills of the Misty Mountains", which ultimately became Dunland.
After S.A. 3320, Enedwaith formed the most northern part of the new Kingdom of Gondor, at least officially. The south-east was still "in places well-wooded", but elsewhere Enedwaith was by this time "mostly grassland." Following the Great Plague in T.A. 1636 however, Gondor's authority permanently lapsed throughout the region.
Tharbad, originally one of two ancient cities on the Gwathló, and the only one to survive beyond the early Third Age, was finally abandoned following devastating floods in 2912 T.A., and thereafter, only two groups survived in Enedwaith: the Dunlendings in the far east, and a "fairly numerous but barbarous fisher-folk" wandering the coast.
|
<urn:uuid:10bce500-60de-436b-882e-82905a09c8a8>
|
CC-MAIN-2016-26
|
http://tolkiengateway.net/w/index.php?title=Enedwaith&oldid=84156
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397213.30/warc/CC-MAIN-20160624154957-00103-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.981056 | 541 | 3.125 | 3 |
Hamilton County NEGenWeb Project
Like branches on a tree,
Anywhere from 100,000 to 1 million years ago, in the Pleistocene period of geology, the Platte Valley was cut through the plains of western America. The process of its excavation is becoming more and more clear as we study the underlying strata and similar processes in other parts of the world It is quite clear that the sand hill areas were formed by long prevailing winds from the deposits of sand washed down from the mountains by a great volume of water.
When wells are dug in Hamilton County or deep cuts driven in constructing highways, frequent evidence is found of long ago time, in buried logs, bones of animals unknown in this region during the historic age. When did man first discover Hamilton County? The answer is difficult. When the first white man under Coronado came to these plains in 1541, they found different bands of Indians living in villages across the buffalo plains from the Arkansas River to the Platte. At the time of Lewis and Clark, three bands of the Pawnee nation were living in the Loup and Platte. The other band, called the Republican Band, had its chief village on the Republican between Guide Rock and Red Cloud. This was the village visited by Lieutenant Pike in 1806 when he made them haul down the Spanish flag and run up the Stars and Stripes.. So the Spanish found the Pawnee in the Nebraska region over 400 years ago and the long legends and traditions of the Pawnee indicate they were here a long period before Coronado It is safe to assume it is more than a thousand years since the American and Pawnee first arrived in the beautiful region of the Platte Valley.
There is evidence of the discovery of Hamilton County by these wandering bands, dug all over the county. Near the turn of the century a cache of the most beautiful white flint arrowheads were found near the York-Hamilton County line, and are displayed in the Nebraska State Historical Museum in Lincoln. One of the reasons for believing the Spaniards crossed this county is the existence of the old Pawnee Trail. This trail was first put on the map by Lieutenant John C. Fremont in 1842. The trail starting from the foot of Grand Island, cross Hamilton, Clay, Nuckolls and Webster counties to the Republican River and beyond. September 23, 1847, Lieutenant D.P. Woodbury, with 70 armed cavalry from the Missouri volunteers left Fort Kearny at Table Creek to reach by most direct route, the Grand Island area on the Platte River. Lieutenant Woodbury on this trip, made the first map of the Hamilton County region. He crossed the corner of Hamilton County and struck the Platte not many miles from the present site of Phillips. A well-traveled freighting road was established from the Missouri River at Nebraska City westward to the new Fort Kearny. Heavy freighting business was done from 1852 to 1860. It was called the Ox-Bow Trail for it was in the line of a bow, because the road ran far north to reach the Platte River near Morse Bluffs and then south to Fort Kearny. This old trail traveled the entire north border of Hamilton County.
In the spring of 1861, business men of Nebraska City, then the largest town in Nebraska, resolved to find the shortest route, to find a short cut to Fort Kearny, avoiding the long Ox-Bow Trail to the north and back again. The exploring expedition took a nearly west course across the prairie to Fort Kearny and reported a fine, easy route could be secured. The new trail was selected by men on horseback riding ahead of the outfit of wagons, mules and men with breaking plows, all from Nebraska City. In this was a furrow was run across the prairie to a junction with the Oregon Trail eight miles east of Kearney. The new road saved forty miles, had a better grade, with plenty of water and wood available. It soon became the most popular route to the mountains and 75% of the traffic followed it by 1862. It was called the Nebraska City-Fort Kearny cut-off. This road through Hamilton County, followed the head waters of Beaver Creek to their source near the west line of Hamilton County, then over the gentle divide into the Platte River valley. Numerous ranches and stations sprang up along the trail, one of the most noted being the Deep Well Ranch, about seven and one-half miles west and some south of the present site of Aurora. Thousands of cattle, wagons, men, women and children passed over this trail between 1860 and 1870.
The homesteaders began to settle the county about 1866. Before that time the only settlers were ranchmen who came to make their living off the overland travelers. The establishment of the Fort Kearny cut-off in 1861, made an immediate prospect for hardy frontiersmen familiar with the overland travel, and knowing how to make a profit therefrom.
THE FIRST RANCHES
The first of these pioneer ranchmen was David Millspaw, who located on Beaver Creek in the summer of 1861. After conducting his ranch a number of years he moved to Beaver Crossing in 1869, and spent the remainder of his years there. It was said of David Millspaw, "He was a tall, slouching grey-haired figure with chin whiskers and an enormous cud of tobacco in one side of his face. He and Mrs. Millspaw had one child, Rosie. She married Jack McClellan or Jack Stone, as he was sometimes called. There was nothing in those days to prevent a man wearing different names in different communities according to his fancy."
In 1862, a second ranch was located in Hamilton County by John Harris and Alfred Blue. This was the famous Deep Well Ranch, one of the best known places in all the early annals of the county.
After the Union Pacific was completed across Nebraska in 1867, freighting on the Wagon Road fell off, but immigrant travel began. Bold-hearted settlers picked out the choicest land, as they thought, along the West Blue, Beaver Creek, and Lincoln Creek. By 1869-1870, the homesteaders movement to Hamilton County was in full force. From 1869-1874, there was never a time of day when a string of white-topped wagons coming from the east ceased. All day long and into the night they traveled. Some had little strings of livestock with them. These were homesteaders, many of them soldiers of the Civil War, moving west to find free homes on the beautiful rich prairie of York and Hamilton counties.
ORGANIZATION AND FORMATION OF HAMILTON COUNTY --1870
The boundaries of Hamilton County were defined by an act of the Twelfth Session of the Territorial Legislature, Section 2 to 31, as follows:
Sec.2: That the territory included within the following described limits, to-wit: Commencing at a point where the west line of Range Four, west of the Sixth Principal Meridian, crosses the Platte River, and running from thence up the channel of said river to the point where the west line of Range Eight west of the Sixth Principal Meridian crosses the said river, and running from thence due south, to the southwest corner of Township No. Nine, Range Eight, and running from thence due east, to the southeast corner of Township No. Nine, Range Five, and running from thence due north to the place of beginning, be and the same shall constitute the county of Hamilton.
An act of the Legislature approved February 24, 1873, provides that section lines of the county shall be public roads and highways.
Hamilton County by the act of the Legislature of 1871, formed a part of the Twelfth Senatorial and Thirteenth Representative Districts, each of which was entitled to one member. The Twelfth Senatorial District included the counties of Saline, Gage, Jefferson, Fillmore, Clay, York, Polk, Hamilton, Nuckolls, Webster, Adams, Kearney and Franklin together with all that portion of the state not included in any other Senatorial District, and which lies south of the Platte River, west of the counties named. The Thirteenth Representative District included the counties of York, Polk, Butler, Platte, Hamilton, Filmore, Clay and Adams. By the Constitution adopted in 1875, the county was apportioned representatives as follows:
"District (Senatorial) No. 22 shall consist of the counties of York and Hamilton, and be entitled to one Senator. Representative District No. 28 shall consist of the county of Hamilton, and be entitled to one Representative."
In the reapportionment of 1881 Hamilton and Hall Counties constituted the Twenty-Fifth Senatorial District, while Hamilton County formed the Thirty-third Representative District, and was entitled to two members, which continued until 1887, when Clay and Hamilton County constituted the Forty-First Representative District, entitled to two members which continued until January 1, 1937, when the Unicameral or One-House Legislature began to function. Since then there have been Senators elected from Senatorial Districts on a non-partisan ticket.
Hamilton County was organized at a general election held May 3, 1870, at the home of John Harris, called for that purpose by a proclamation of Governor David Butler, issued March 13, 1870, of which the following is a copy:
THEREFORE, I, David Butler, Governor of Nebraska, by virtue of the authority vested in me, do hereby order that an election be held at the house of John Harris, said county, from 9 o'clock A.M. to 6 o'clock P.M. on Thursday, the Third day of May A.D., 1870, for the purpose of choosing three county commissioners, one county clerk , one county treasurer, one sheriff, one probate judge, one county surveyor, one superintendent of public schools, one coroner, three judges of, and two clerks of election.
AND, I have designate and appoint John Laurie, Norris M. Bray, and Jarvil Chaffee as judges, and Josias D. Westcott and William D. Young, clerks, to conduct said election in accordance with the act for the organization of counties, approved June 24, 1867, and the election laws of the State.
IN TESTIMONY WHEREOF, I have hereunto set my hand, and caused to be affixed the great seal of the State of Nebraska. Done at Lincoln, this thirteenth day of March, in the year of our Lord, one thousand eight hundred and seventy, of the independence of the United States, ninety-fourth , and of this state, and fourth.
Thomas P. Kennard, Secretary of State
In accordance with this proclamation eighteen citizens, the voting population, assembled at the house of John Harris, in what is now known as Farmers Valley Precinct, on the Blue River, May 2, 1870, and organized the county, electing the following, filed in the county clerk's office:
William D. Young . . . . . . . . . . . . . . Jarvil Chaffee
Clerks of Election . . . . . . . . . . . . . . Judges of Election
The county seat, as located by the vote of the people, was named Orville City, and was surveyed by John Harris. A court house was built in May 1872, in which the records of the county were kept until their removal to Aurora, January 1, 1976, at which date Aurora was made the county seat after a long and bitter contest, during which five elections were held to decide the question of removal
THE FIRST HOMESTEAD IN HAMILTON COUNTY
The first settlement in the county for the purpose of agriculture was made in the month of June, 1866, by Jarvil Chaffee, on the Blue River, near the south line of the county, Section 34, Town 9, Range 6. His Homestead Certificate was signed by Ulysses S. Grant on May 1, 1872, after Mr. Chafee had proved up on his land.
Mr. and Mrs. Chaffee came from Wisconsin to Hamilton County by team and wagon, just a few months prior to the time Nebraska was admitted as a state, and three years before Hamilton County was organized. The construction of a dug-out 10X12 feet on their claim near the fork of the Blue River, soon after their arrival, gave the first evidence of habitation in Hamilton County. Buffalo, deer and elk were plentiful, and were often brought down on their homestead. Mr. Chaffee served with the Wisconsin Volunteers Infantry during the Civil War, taking part in numerous engagements. Soon after the wear, he was married to Miss Nancy Markham of Ohio. Her death occurred in 1871. Her only child, Jesse, was born December, 1869, and is conceded to have been the second white male child born in Hamilton County, where he spent his entire lifetime.
At the time of Mrs. Chaffee's death, the neighbors were able to procure some rough pine boards from which to make the casket. The women folk shuddered at the bleak cold pine wood, but where could they improve it? Showing the ingenuity of the pioneer, they gathered wild grapes which were ripe, crushed them and stained the pine with grape juice to give a rich color. In 1876, Mr. Chaffee was married to Miss Sarah Frazier, also from Ohio, who survived Mr. Chafee by several years, residing on the old home farm with her two sons, Edward and Roy, until her death.
Deepwell Ranch was established in 1865, near the Beaver Creek in section 32, Hamilton precinct, by John Harris and Alfred Blue. It became a famous stopping place for early freighters for the deep well never failed to supply good cold water for man or beast. It was on the Oregon Trail which continued west through Hall County to old Fort Kearny. Harris and Blue came from Georgia after the Civil War and established Deepwell Ranch, building a big sod house and barn, and dug a well 65 feet deep, from which the ranch received its name. The barn was half-dugout and half sod and was capable of holding 165 head of horses. The men who accompanied the wagons usually camped outside. Harris reported that they had 25 men inside the house at one time, and never were lonesome , as wagon trains passed constantly between Nebraska City and Denver. Mr. Harris reported that shortly before they left Deepwell Ranch that Brigham Young Jr., with a Mormon wagon train of 83, six-mule teams passed through enroute to Utah. Great herds of buffalo were common on the prairie in those days and in the fall of 1868, about 4,000 Winnebago and Pawnee Indians camped about a mile west of Deepwell. They were returning from the warpath and carried five Sioux scalps. They remained five days and nights celebrating a war dance for each scalp.
Millspaw Ranch also furnished respite for the weary wagon train travelers. It was established in 1861, by David Millspaw in Section 11, Beaver precinct, for the accommodation of freighters and others traveling by oxen or horses and covered wagons along the Old Oregon Trail. At the time Millspaw ranch was located at this point, all of Section 11 belonged to the government, which issued a patent to the U.P.R.R. company dated March 1, 1875. The railroad sold part of this section in 1884, part in 1885, and the balance in 1889.
Briggs Fort (Briggs Ranch) was established by J.T. Briggs on the north half of the southwest quarter of section 26, in the old Cedar Valley precinct, now South Platte precinct on October 5, 1871. Mr. Briggs owned this land until he sold to Charles Lock in February 24, 1883. This ranch was known in the early 70's as Briggs Ranch, and also as Briggs Fort, and was the only point in Hamilton County ever known or referred to as a fort. The "Old Fort Kearny", also referred to as the "Pike's Peak Trail", following the Platte bottom, passed by this ranch. This trail was first traveled for military purposes, and was subsequently used by the "Forty-Niners". This ranch, along with others flourished until the advent of the railroad.
Prairie Camp consisted of a sod stable which was a half dugout in the side of the creek, to accommodate 20 or 30 head of horses. A sod house was also located near the south bank of Beaver Creek, in the northeast corner of the southwest quarter of section 17, in Beaver precinct. It was used as a relay station for the Overland stage line in 1863, between Nebraska City and Fort Kearny. In early days it was also known as the "Dirty Shirt Camp." The Oregon Trail passed just a few yards south of the camp, and the water was supplied for men and horses from Beaver Creek. Those familiar with this camp also related that in the early days an unusually large elm tree grew near the camp on the creek bank. The north half of the southwest quarter of the section 17, on which Prairie Camp was located belonged to the government at the time the camp was located here. On March 26, 1875, the U.P.R.R. company received their patent from the government and on January 20, 1881, sold to Daniel Lemley, who in turn sold the land to H.L. and R.L. Hall on November 30, 1883.
The first frame house was erected by F.H. Clark in 1870, the lumber being hauled from Grand Island.
The first birth in the county took place at the Milllspaw Ranch, a daughter to John and Rosie McClellan and the granddaughter of Daniel Millspaw. This transpired in the fall of 1861, and the first death, that of this little child, occurred in the summer of 1862. She was buried on the prairie near the site of the old ranch. This story however, has been disputed by some sources which say this child, a son, was born in Maryville, Kansas, and died here in 1865--one of the earliest deaths in the area.
The first birth on record was a son to Mr. and Mrs. C.O. Westcott, whom they named Orville, and from whom the town of Orville received its name.
The first marriage was that of Phillip Hart to Elizabeth Ellen Verley, August 21, 1870, by Robert Lamont, Probate Judge.
The first election was held in the house of John Harris on the Blue, May 3, 1870.
The first case tried in the District Court was a divorce suit at a term of the court presided over by Hon. George B. Lake. E.W. Denio, and Mr. Darnell were the counsel retained and were the first lawyers to practice in the county.
The first Fourth of July Celebration was help in the year 1870, in a grove on the south side of the Blue, the property of J.D. Westcott. The address was delivered by B.D. Brown, the orator of the day, it being his first attempt, and also the first oration listened to in the county.
The first crime was of the highest type--a murder of a Mr. Johnson of Illinois, in August 1870. In company with Mr. F. Sawyer of Lincoln, he had been in the county looking over land, and it was supposed Sawyer murdered him for his money, as they were returning to Lincoln. Johnson's body was found several days later on the prairie and Sawyer was arrested on suspicion of murder and returned to Hamilton County. He was later discharged from custody in Lincoln on a writ of habeas corpus.
Farmers Valley was the first post office in Hamilton County and was first located in the home of J.D. Westcott, who was first postmaster in the county. Location section 24, Farmers Valley precinct. His house was built in 1867, from logs hewn by himself from trees grown on his place. This post office was moved to the home of L.M.Hopkins when Westcott was elected county clerk. Now the post office was in a dug-out until 1880, when moved back to Westcott's until moved to a store near Farmers Valley Mill. The store was operated by George Littlefield, an uncle of Marion Lititlefield who was killed in a battle with the Sioux Indians in Garfield County in January, 1874. When the store closed the post office was moved into the mill where it was called "Farmvale Post office." It continued until 1902 when rural delivery started.
The second post office was established in 1870, on the Blue, at the house of Robert Lamont, who was appointed postmaster. This post office in Orville Precinct was named Verona and continued under that name until its removal to Orville City. In the spring of 1871, another post office was established in Grand precinct at the house of S.W.Spafford, who served as its postmaster. A weekly mail route was established by L.W. Hastings, Contractor, from Seward to Grand Island, via York and Spaffords Grove.
The first Platte River bridge known as the Chapman Bridge, which connects Hamilton and Merrick counties was built in 1878. This bridge was one of the best across the Platte in its day. It was 2800 feet long and was built at a cost of $14,000.
The first School District was organized September 27, 1870. Joseph Stockham was elected director, and the census returned of the district recorded 39children of school age. The building was made of logs and each settler furnished a log, two bachelors bough the windows and two pine boards for a desk, the seats being made of split logs. Situated on section 34, Town 9, range 5.
Miss Jennie Laurie taught the first school here with 10 pup8ils, and was paid by subscription, the settlers contributing money or wheat, as best they could, in the winter of 1870-71. A fire nearly ended the educational program, for a fires was discovered one night after a social gathering. Spotted by Robert Waddle and John Harris, they dashed to the school and put out the fir, after considerable damage had been done. It was repaired and school resumed. Miss Laurie became Mrs A. M. Glover.
Reverend Mr. Colwell preached the first sermon the county at the house of James Waddle in the spring of 1869. His labors covered a period of about three years.
The first church organization was effected at the house of R.M.Hunt in Beaver precinct August 13, 1871, consisting of these members: R.M. Hunt, S.B.Yost, Steph Pollard, Alvira Jones, and F.AnnDoty. It was called the Aurora Baptist Church and later reorganized.
United Presbyterian church, Monroe precinct was organized by Reverend N. C. Robinson, Synodical Missionary, June 4, 1875, with a membership of 34.
Avon Presbyterian Church, Bluff precinct was formed by Reverend H.M. Giltner, August 11, 1876, who became its pastor and continued until 1877, when he was succeeded by Reverend J.H. Patterson. He remained until 1881.
The Methodist Church had organizations in several parts of the county as follows: Whittemore Class, Otis precinct, organized by Reverend C.L. Smith, attached to Stromsburg circuit. VanWormer Class, Orville precinct, organized in 1873, attached to Aurora circuit. Seward Class, organized June, 1873, attached to St. Joe circuit in Union precinct. Boag Class, Union precinct, organized February, 1875. W.K. Ream organized a class at Klumb schoolhouse in the winter of 1875-76and another at Fairview schoolhouse in the summer of 1881. Another that summer was at Cain school where Reverend Clement Aldridge organized the class. Reverend C.L.Smith organized a class at Hoffman schoolhouse, February 1876.
FARMERS VALLEY -- FIRST SETTLEMENT IN HAMILTON COUNTY
Farmers Valley Cemetery
The earliest settlers in Hamilton County located in the south part of the county, in the precinct to become Farmers Valley. Brave men and women withstood the rigors of a new land. Following Jarvil Chaffee, the first white settler, and one who received the first homestead grant, came the Scotch Colony -- the Waddles, Lauries, Hendersons, Camerons, and Lamonts, to form the nucleus of the first settlement. But with the first settlers came the first deaths, and the hallowed grounds of Farmers Valley Cemetery, the final resting place for these honored dead. Today this beautifully- located cemetery is preserved and stands in silent tribute to the pioneer. Here this generation and many generations to come, can visit this revered spot and glean and dream much of the historic past.
Farmers Valley Cemetery is not only the first cemetery in the county, but its most historic. On three sides of this burying ground winds the Blue River, along whose banks the first pioneers built their soddies and log houses. On the headstones mellowed by years of rain and sunshine, are found the names associated with the finest traditions of the first settlement. John Brown, who first settled in Farmers Valley in January, 1867, and built the first log house, gave four acres from his homestead for the cemetery. This is a strangely silent, shadowed place, intermittent with sunshine. A quiet holiness, a feeling almost of restfulness comes over one, while lines from the great Elegy steal into his heart. Magnificent cinnamon pines, veterans of the years, stand as sentinels, guarding the dead. While birch, maple and the evergreen, all of less years, shelter many an early grave, while the old yellow, moss-grown stone is hardly decipherable. There are men and women resting here in this old burying ground on the banks of the river, who made the first settlement in Hamilton County -- Farmers Valley on the "Blue", and it is fitting that they should be laid to rest beside the river. Phillips Hunt was the first person buried in Farmers Valley Cemetery. He died September 6, 1874
Perhaps no one cemetery in Nebraska has a more exciting and colorful roster, history-wise, than does Farmers Valley. The cemetery is maintained by some help from the county, and by the contributions made by relatives and friends of those buried here. Each Memorial Day since early days, services have been held at this cemetery to pay homage to the pioneer men and women who blazed the way to develop a new country and make it what it is today, and also to the loved ones who have passed on since.
Farmers Valley Mill
No history would be complete without the story of the origin of the Farmers Valley Mill built in 1880, which provided such a vital service to the new settlers in the area. This mill was built on the south bank of the Blue River, section 25, Farmers Valley precinct, by John and Asa Martin. The mill was equipped with four sets of stone burrs, operated by water power supplied from the Blue River, and owned and operated by the Martin brothers.
In 1882, the mill and 33 acres of land on which the mill dam and race were located, was traded to Jacob George, who then operated the mill until 1888, when he traded one-half interest and became sole owner.
While owner, Mr. Hagemeister adopted the label and trademark, "Nancy Hanks" for his wheat flour. The label consisted of a race horse hitched to a sulky, with a driver. At the time this name was adopted "Nancy Hanks" held the world's record as a race horse. This label was known far and wide by the pioneers in the trade territory of Farmers Valley Mill. In 1892, Mr. Hagemeister did some remodeling of the mill, replacing the stone burrs with rools and more modern equipment. Fred Jr. was in charge of the mill when Mr. Will Hagemeister was elected to the State Legislature in 1907.
In 1910, the mill was sold to Conrad Yost, who continued to own and operate this oldest commercial enterprise in Hamilton County for many years. However, during the years which followed his ownership, mills were being opened in the various towns, with much greater volume and Mr. Yost finally closed down the mill in about 1940. At this time he sold the mill and land to Harry Borcher, and moved from the county. The mill was never reopened.
OLDEST FAIR IN NEBRASKA
The Hamilton County Fair is unique in the state in that it is the oldest county fair in continuous annual operation, having begun in 1872, and it provides a continuous link to the pioneer past. It has never failed to draw splendid exhhibits of livestock, produce, latest in equipment, educational and handwork, in addition to a variety of entertainment for young and old.
According to best information sources, first steps were taken toward the organization of a fair association in Hamilton County in the store of David Stone, in the brand new "town" of Aurora in the fall of 1871. The plan thus inaugurated was perfected at Orville City, then the county seat. Joseph F. Glover was elected president; James Rollo, a vice-president; George F. Dixon, secretary; E. J. Lewis, assistant secretary; and John Laurie, treasurer. Others active in the enterprise were C. O. Westcott, T. C. Klumb and Norris Bray.
The first fair was held in Aurora in 1873, with several years interval before the second one in Aurora, but they were being held in Orville, hence the continuous fair in the county.
|
<urn:uuid:ee40a8d9-152a-42c4-9943-f7ecc840ef8d>
|
CC-MAIN-2016-26
|
http://www.rootsweb.ancestry.com/~nehamilt/hamhist.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783399106.96/warc/CC-MAIN-20160624154959-00200-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.980004 | 6,218 | 3.21875 | 3 |
Here is a remarkable fact but first guess how many IPv6 addresses can there be? Scroll down for the answer but here is the background. The IPv4 address system which is used by most people has run out of assignable addresses. The IP address that identifies you on the Internet looks like 184.108.40.206. There’s a possibility of 4.3 billion addresses (256*256*256*256). So there are well over that many devices on the Internet considering many devices share an IP address. They probably laughed when the powers that be said 4.3 billion. “That will last forever!”
The new IPv6 system was designed so it will be a very, very, long time until the problem of running out happens again and it isn’t a simple number so listen closely.
There will be 340,282,366,920,938,000,000,000,000,000,000,000,000 IPv6 addresses.
If you want a run down of how to say that easily it is 340 undecillion, 282 decillion, 366 nonillion, 920 octillion, 938 septillion, 463 sextillion, 463 quintillion, 374 quadrillion, 607 trillion, 431 billion, 768 million, 211 thousand and 456.
If you want some relativity to that number check out these links.
|
<urn:uuid:60713641-26d1-4e96-be8d-a269e5b526b3>
|
CC-MAIN-2016-26
|
http://anphicle.com/how-many-ipv6-addresses-can-there-be/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783394605.61/warc/CC-MAIN-20160624154954-00019-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.906788 | 288 | 2.703125 | 3 |
The Heimlich maneuver can be used safely on both adults and children, but most experts do not recommend it for infants less than 1 year old. You can also perform the maneuver on yourself.
For a conscious person who is sitting or standing, position yourself behind the person and reach your arms around his or her waist.
Place your fist, thumb side in, just above the person's navel and grab the fist tightly with your other hand.
Pull your fist abruptly upward and inward to increase airway pressure behind the obstructing object and force it from the windpipe.
If the person is conscious and lying on his or her back, straddle the person facing the head. Push your grasped fist upward and inward in a maneuver similar to the one above.
You may need to repeat the procedure several times before the object is dislodged. If repeated attempts do not free the airway, an emergency cut in the windpipe (tracheostomy or cricothyrotomy) may be necessary.
Manno M. Pediatric respiratory emergencies. In: Marx JA, Hockberger RS, Walls RM, et al, eds. Rosen’s Emergency Medicine: Concepts and Clinical Practice. 7th ed. Philadelphia, Pa: Mosby Elsevier; 2009:chap 166.
Braithwaite S, Perina D. Dyspnea. In: Marx JA, Hockberger RS, Walls RM, et al, eds. Rosen’s Emergency Medicine: Concepts and Clinical Practice. 7th ed. Philadelphia, Pa: Mosby Elsevier; 2009:chap 17.
Jacob L. Heller, MD, MHA, Emergency Medicine, Virginia Mason Medical Center, Seattle, Washington, Clinic. Also reviewed by David Zieve, MD, MHA, Medical Director, A.D.A.M., Inc.
|
<urn:uuid:0c58856e-a0cd-4eb8-a2f1-2c4068fbb123>
|
CC-MAIN-2016-26
|
http://www.northside.com/HealthLibrary/?Path=HIE+Multimedia%5C1%5C000047.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395620.56/warc/CC-MAIN-20160624154955-00086-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.837935 | 382 | 2.71875 | 3 |
For Faculty: Ideas for Assignments
Design assignments that promote information literacy and research skills.
Students find information about events transpiring during the week/year of their parent’s/grandparent’s birth. Information categories can include any or all of the following: sports, politics, fashion, science/technology, arts. They need to use the New York Times Historical database and a subject reference book (American Eras series, Eyewitness History series, All American Ads, Timetables of American History, Timetables of History, etc.) Prior to the assignment, students are shown how to use the various types of resources that they will be using, along with an explanation of the difficulties of Students are provided one week to complete the assignment. (Adapted from LOEX* of the West 2004)
Snapshot of a Year
Have the class develop a snapshot of a year that is significant for your course. Starting with a chronology (such as Timetables of History) have groups report on politics, the arts, science and technology, or whatever categories make sense for your course. Resources include New York Times Historical database American Eras series, Eyewitness History series, All American Ads, Timetables of American History, Timetables of History, etc. (From http://www.gustavus.edu/oncampus/academics/library/IMLS/assignmentsuggestions.html)
Identify significant people in your discipline. Have students consult a variety of biographical resources and subject encyclopedias to gain a broader appreciation for the context in which important accomplishments were achieved. (From Term Paper Alternatives. http://www.lib.berkeley.edu/TeachingLib/PaperAlternatives.html)
Identify a significant event or publication in your discipline. Have students ascertain the important people, impact, etc., involved by consulting a variety of library resources. Probably a good idea to keep the event/publication broad: The lunar landing, discovery of penicillin, Silent Spring, the rock opera Hair, the advent of the assembly line, etc. Suggested library resources will depend on the event, but lends itself neatly to reference tools. (Adapted from Term Paper Alternatives. http://www.lib.berkeley.edu/TeachingLib/PaperAlternatives.html)
Liberal and Conservative
Contrast two journal articles or editorials from recent publications reflecting conservative and liberal tendencies. (Consult Cannell Library’s handout, “A Selective List of Liberal and Conservative Periodicals.”) It might be interesting to carry out this exercise again using publications from the late 1960s.
(Adapted from Term Paper Alternatives. http://www.lib.berkeley.edu/TeachingLib/PaperAlternatives.html)
Popular and Scholarly
Provide students with a popular and a scholarly article on the same topic. (Or, alternatively, have students locate two articles on their own.) Students will use a prepared checklist to analyze the two types of publications and learn the distinguishing characteristics.
Popular and Primary
Students will find a short article in the popular press and locate the original research article [primary source] on which the popular article was based. Students will analyze the relationship between the popular article and original research, and critique the popular article with regard to its accuracy.
Update the Literature
Ask students to update a literature review done about five years ago on a topic in the discipline. They will have to utilize printed and electronic resources to identify pertinent information.
Update a Web Directory
Students will select a topic directory from the Cannell Library web site. Students will look at each of the recommended sites, then locate five more sites on the same topic that they determine should be added. For each site they recommend, students will complete a web page evaluation worksheet and write a short evaluation. Alternatively, students can locate their own directory to update, rather than using one from the library’s page.
Write and Produce a Newsletter
Have small groups of students produce a brief newsletter on a specific topic related to class. Students should include articles with relevant research, post information on upcoming related public events, and so on. Share these newsletters with faculty and students in related courses or in the major.
Have students create visual representations of models, ideas, and the relationships between concepts. They draw circles containing concepts and lines, with connecting phrases on the lines, between concepts. These models can be done individually or in groups, once or repeated as students acquire new information and perspectives, and can be shared, discussed, and critiqued. [Note: Inspiration software, a concept mapping tool, is available in all the Clark College computer labs]
Analyze Case Studies
Bring in case studies for students to read (for example, I will put a case example of sexual harassment on an overhead). Have students discuss and analyze the case, applying concepts, data, and theory from the class. They can work as individuals or in groups or do this as a think-pair-share. Consider combining this with a brief in-class writing assignment.
Mini-research Proposals or Projects
a class research symposium. Have the students work on designing a research study on a topic from the class. In some situations, you may be able to have them collect data during class time (observe some situation or give out some short surveys) or you may have them doing this as part of an outside-of-class project. Either way, have students present their research in a class research symposium similar to what we do at professional meetings. Invite other faculty and students.
Analyze Information Sources
Have students locate three sources—one an article published in a popular magazine, one an article in a refereed scholarly journal, one a web site—and have them analyze the sources in terms of language used, evidence presented for claims, qualifications of the author, and purpose.
This one uses the New York Times Historical database. Have students select a topic or an issue and examine it across time by locating articles in the New York Times for this year, 25, 50, 75, and/or 100 years ago. In addition to gaining an understanding of the shifts in language (and the need to brainstorm keywords) students can study the different approaches to the issue and the ways in the issue reflect the values and assumptions of the time. This exercise can be expanded by having students expand their knowledge of the different time periods with chronologies and other reference books.
Create an Anthology
Using the book catalog and databases, have students compile an anthology or reader of works on a theme or topic. Students will write critical introductions to the selections they have chosen. This exercise is good for teaching providing students practice with selecting particular sources out of many and relating pieces to a whole.
(Adapted from http://www.gustavus.edu/oncampus/academics/library/
Compile an anthology of readings by one person. Have students include an introduction with biographical information about the author, and the rationale for including the works [justify with reviews or critical materials].
Secondary Source Comparison
Provide the class with primary sources that recount an event that is open to more than one interpretation. Then have students locate and critique secondary source explanations of that event. Have students examine differences in secondary sources and relate these to their own interpretation of the available evidence. (Students are often surprised to find secondary sources tell the same story differently.)
Document an Editorial
Have students examine an editorial and discuss what evidence would need to be provided to turn it into an academic argument for a scholarly audience. Have the class locate and analyze evidence and write a response to the editorial based on their new knowledge.
Have students maintain a list of words related to the topic of the class (from lectures, the textbook, readings). Using words on the list students create an annotated glossary, for which they provide documented definitions for each of the words. The instructor can set a minimum number of words and sources (i.e. forty words from at least 10 different sources). Sources can include general and subject-specific dictionaries, people, web sites, a whole book on the topic, an article on the topic, etc.)
One of Kitty’s favorites from an Intro to Research Class
Prepare an annotated bibliography of books, journal articles, and other sources on a topic. Include evaluative annotations
· produce the annotated bibliography in the form of a web page
· Have students work in groups to compile a large annotated bibliography and present/defend their selections to the class.
Topic Across Sources
Select a topic and compare how that topic is treated in two to five different sources.
Analyze the content, style, and audience of three journals in a given discipline.
Locate primary sources on/or near the date of your birth. You may use one type of material only once, i.e., one newspaper headline of a major event, one quotation, one biography, one census figure, one top musical number, one campus event, etc. Use a minimum of six different sources. Write a short annotation of each source and include the complete bibliographic citation.
Web Site Evaluation
Students select a web site and evaluate it using a checklist, such as the W5 for W3 web site evaluation and checklist. As a variation, have students locate three websites on the same topic, and after completing the worksheet, have them write a short paper describing each site and ranking them in order of quality.
Teach the Class
Each student in the class is given responsibility for dealing with a part of the subject of the course. He or she is then asked to 1) find out what the major reference sources on the subject are; 2) find out "who's doing what where" in the field; 3) list three major unresolved questions about the subject; 4) prepare a 15 minute oral presentation to introduce this aspect of the subject to the class.
Assemble background information on a company or organization in preparation for a hypothetical interview. For those continuing in academia, research prospective colleagues' and professors' backgrounds, publications, current research, etc.
In biology or health classes, assign each student a 'diagnosis' (can range from jock itch to Parkinson's Disease). Have them act as responsible patients by investigating both the diagnosis and the prescribed treatment. Results presented in a two-page paper should cover: a description of the condition and its symptoms; its etiology; its prognosis; the effectiveness of the prescribed treatment, its side effects and contradictions, along with the evidence; and, finally, a comparison of the relative effectiveness of alternate treatments. This assignment can also be accompanied by oral or visual presentations, slideshow, poster session,etc.
Follow the Trail
Students follow a piece of legislation through Congress. This exercise is designed primarily to help students understand the process of government. It could, however, be used in something like a 'critical issues' course to follow the politics of a particular issue. (What groups are lobbying for or against a piece of legislation? How does campaign financing affect the final decision? etc.).
Follow the Policy
Have students follow a particular foreign policy situation as it develops. Who are the organizations involved? What is the history of the issue? What are the ideological conflicts?
Ask each student to describe a career they envision themselves in and then research the career choice. What are the leading companies in that area? Why? (If they choose something generic like secretarial or sales, what is the best company in their county of residence to work for? Why?) Choose a company and find out what its employment policies are-flex time, family leave, stock options. If the company is traded publicly, what is its net worth? What is the outlook for this occupation? Expected starting salary? How do the outlook and salaries vary by geography?
Write a biographical sketch of a famous person. Use biographical dictionaries, popular press and scholarly sources, and books to find information about the person.
Nobel Peace Prize
Nominate someone or a group for the Nobel Peace Prize. Learn about the prize, the jury, etc. Justify the nominations.
Internet & Search Engines
Choose a topic of interest and search it on the Internet. Cross reference several search engines. Select and evaluate x number of web sites; select a specified number to include on an annotated bibliography. As with a research paper, students will have to narrow and broaden accordingly. Students summarize the experience by describing the experiences in different search engines, overall coverage of the topic, best keywords, etc.
(Adapted from http://library.ups.edu/instruct/assign.htm)
Queen for a Day
Everyone becomes an historical figure for a day. Students research the person, time-period, culture, etc. They give an oral presentation in class and answer questions.
Similar to the above, students adopt a persona and write letters or journal entries that person might have written. The level of research required to complete the assignment can range from minimal to a depth appropriate for advanced classes. from http://library.ups.edu/instruct/assign.htm All the News
Write a newspaper story describing an event -- political, social, cultural, whatever suits the objectives -- based on their research. The assignment can be limited to one or two articles, or it can be more extensive. This is a good exercise in critical reading and in summarizing. The assignment gains interest if several people research the same event in different sources and compare the newspaper stories that result.
News conferences offer good opportunities to add depth to research and thus might work particularly well with advanced students. A verbatim transcript of an analytical description of a news conference can serve as a format for simulated interviews with well known people of any period. What questions would contemporaries have asked? What questions would we now, with hindsight, want to ask? How would contemporary answers have differed from those that might be given today? Here students have an opportunity to take a rigorous, analytical approach, both in terms of the questions to be asked and the information contained in the answers.
Write a review of a musical performance. Include reference not only to the performance attended, but to reviews of the composition's premiere, if possible. Place the composition in a historical context using timetables, general histories and memoirs when available, using this information to gain insight into its current presentation.
Write Your Own Exam
Write an exam on one area; answer some or all of the questions (depending on professor's preference). Turn in an annotated bibliography of source material, and rationale for questions.
All But the Research Paper
Conduct the research for a term paper. Do everything except write it. Students submit a clearly defined topic, an annotated bibliography of useful sources, an outline of a paper, a thesis statement, and an opening paragraph and summary.
Write a precise statement of the search topic and the keywords chosen for the topic. Run the search on two or more different search engines. List the steps taken to find the needed information. Evaluate the results from the two searches using particular criteria presented by the librarian. Purpose: Teaches the mechanics of Internet searching, the importance of evaluating all sources retrieved from the Internet, the importance of preparing a search before going online, and the value in using more than one source for an information search.
Prepare the search by selecting keywords or thesaurus terms, when available. Conduct a search in a pre-selected database (or have the students pick the most appropriate one). Find a specified number of references and write a short explanation on why the particular reference is relevant to the search topic.
Purpose: Shows the importance of advance preparation of the search and teaches how to use a particular database. Challenges students to find relevant sources and justify their selections.
Examine Coverage of a Controversial Issue
Examine the treatment of a controversial issue in several different sources such as newspapers, books, magazines, scholarly journals, and web sites. Write a paper that presents a balanced point of view on the issue or ask the students to take a position based on the information.
Purpose: Gives them experience in locating different kinds of sources and selecting from a large volume of references. Emphasizes that there are multiple perspectives on any issue and stresses the importance of making informed decisions.
Finding Supporting Information
Give the students an article to critique. Have them locate two sources (other articles, web sites) which support (or not) the points made in the original article. Purpose: Gives the students an opportunity to understand the importance of using more than one source when gathering information.
Comparing Print and Web Resources
Locate and examine a print source and a web site on the same topic to determine indicators of quality in each item; where exactly they found those indicators; and the appropriate use for each item.
Purpose: Students will learn that the Web has not replaced print resources but rather the Web should be used as a complement to them.
Students are to obtain an interesting empirical article on a topic of their choice from a published APA (American Psychological Association) journal. PsycInfo is an excellent source. An empirical article reports the results of a study, not a review of several studies or someone's opinion. Students are to read the article then prepare a 1- to 2-page commentary on the article in their own words.
(Psychology 101 assignment, adapted from: http://ublib.buffalo.edu/libraries/asl/courses/
Have students choose one ancient city from a list prepared by the instructor. Students research aspects such as: * Geographic features, size of the city, occupations ancient inhabitants (substinance farming, hunting and gathering, trade, etc.), religion/religious beliefs, significant folklore, and/or legend, secular/civil authority, governance system, artistic legacy, etc. Students must summarize the importance of the city and civilization in a ten-page research paper, using at least five sources.
(Psychology 101 assignment from: http://ublib.buffalo.edu/libraries/asl/courses/sample_assignments.html)
Have students choose any issue that has been the subject of protest or propaganda at any time in the past 500 years in any part of the world. Then write a paper detailing the issues of the protest/propaganda, putting the issues in the context of some sort of text or object. The text/object can be a film; a literary or musical work; a poster; a pamphlet; a sculpture or painting; a building; a symbolic act; or a historical moment. The overarching questions to address in the paper are: What historical forces -- technological, political, cultural -- brought this protested issue or point of propaganda to a critical point at the moment you are looking at?
What are the specific arguments being raised in the protest or propaganda? How does your object/text embody these historical forces and detailed arguments?
(World Civilizations Prehistory to 1500 assignment, from http://ublib.buffalo.edu/libraries/asl/courses/
Create a Pathfinder
Students select a topic and create a guide to researching the topic. The pathfinder is not an exhaustive list of source, but the steps on could follow to locate information in a variety of sources, plus a sample of sources each resource would yield. This assignment will help students understand the organization of traditional reference information as well as Internet reference information and its organization. . The pathfinder would include the following: Topic & summary; Subject Headings; tools (book catalog, indexes, newsgroups, etc.) with two sources from each.
One of Kitty’s favorite research assignments
Students keep a record of library research: methodology, sources consulted, keywords or headings searched, noting both successes and failures. Instructor can provide a sample entry to guide students in the structure. Provides a good introduction to how information is organized in libraries. Encourages students to think about the choices they must make as researchers. Focuses on the importance of terminology. A good follow up would be a class discussion with a librarian about search techniques.
(Adapted from http://ublib.buffalo.edu/libraries/asl/courses/sample_assignments.html)
Students research a topic and present it as a poster which other students will use to learn about the topic. Provides the opportunity to conduct a search and forces the students to express the important points succinctly.
(Adapted from http://ublib.buffalo.edu/libraries/asl/courses/sample_assignments.html)
Assignment: What is a reference source? When might you use one? Identify the major types (with examples of each type) of reference sources in the discipline. Cannell Librarians have a couple of reference tool worksheets for students to use locating and evaluating reference books.
Purpose: Shows how and why to use reference material.
(Adapted from http://ublib.buffalo.edu/libraries/asl/courses/sample_assignments.html)
Understanding "The Literature" of a Discipline
What does "the literature" of a discipline look like? What comprises it? Students investigate the production and dissemination of information in a given discipline. How is the knowledge produced? By whom? In which media is it presented/communicated? What is the publishing cycle? How important is informal communication in the field?
Purpose: Demystifies the elusive term "the literature"
to Promote Information Literacy and Research Skills
Journals in a Discipline
Assignment: How many journals are published in a given field? Identify [with professor's help] journals "basic" to the discipline. Compare and contrast them. Analyse their content, tone, audience and impact. Purpose: Emphasizes the importance of journal literature. Makes the point that journals differ in approach and perspective.
Read the References
Assignment: Read the articles cited in a research paper. Explain how each is related to the paper. In what circumstances is it appropriate to cite other papers? What different purposes do the citations serve?
Purpose: Shows when it is appropriate to recognize the contributions of previous authors in the development of new work.
Finding Suitable Information
Assignment: Give the students a set of Web pages to look at. Have them note any reasons why these pages are, or are not appropriate for university level student research or for in-class use.
Purpose: A source that is useful in one instance, may not be useful in all instances. Either scholarly or popular sites might be appropriate depending on the requirements of the class assignment.
Comparing Print and Web Resources
Assignment: In groups of 3-5, have students examine pairs of items (books, articles, web sites) to determine: indicators of quality in each item; where exactly they found those indicators; the appropriate use for each item. Have them report their findings to the class after the class has had a chance to also evaluate the sites.
Purpose: Students will learn that the Web has not replaced print resources, rather it should be used as a complement to them.
Flow of Information
Cannell Librarian Joan Carey adapted a great timeline that looks at different types of information sources (radio/TV/internet news, newspapers, magazines, journals, books, reference sources, web pages). A chart lists the time frame from an event to “publication” and lists the appropriate tools for searching the source. Assignment ideas: After a brief introduction to the types of sources, give students a list of questions or topics and have them select the most appropriate tool to use. Alternately, assign a topic to groups of students. Have each group explore a topic in each of the types of information, then have each group report on which type was most effective for the topic. Lots of other variations.
How to Read a Database
Using the databases available at Cannell Library, students will locate and read the HELP or SEARCH TIP menus. Students will complete a worksheet focusing on the features of one particular database, or they can compare the features across two or more databases.
Students look at a headline on the same day from three different online newspapers (i.e. New York Times, Los Angeles Times, Irish Times - Dublin). Students will analyze the headlines, language, story content. Kate Scrivener uses this exercise in class to discuss information ethics, but it could also be a written assignment. (From Kate Scrivener, Clark College English Department)
|
<urn:uuid:3fd45802-3f40-46e2-819d-e1dd9d76d88c>
|
CC-MAIN-2016-26
|
http://library.clark.edu/?q=faculty-ideas-assignments
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783400572.45/warc/CC-MAIN-20160624155000-00131-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.900203 | 5,083 | 3.109375 | 3 |
September 2008, Vol. 20, No.9
Michael H. Gerardi and Mel C. Zimmerman (2005). John Wiley & Sons Inc., 111 River St., Hoboken, N.J. 07030, 179 pp., $64.95, soft cover, ISBN: 0-471-20692-X.
Pathogens commonly found in wastewater — including viruses, bacteria, fungi, protozoa, helminthes (worms), allergens, and toxins — present health concerns to wastewater personnel due to frequent exposure. This practical book provides the reader with a comprehensive, microbiological review of significant pathogenic groups of organisms. It also covers specific pathogens of concern in wastewater and solids, including human immunodeficiency virus, West Nile virus, the hepatitis virus group, the bacterium Leptospira, and the protozoa Cryptosporidium and Giardia.
The book explores associated health hazards, disease transmission and immune-system defenses, pathogen inactivation and destruction, and appropriate protective measures, equipment, and immunizations to aid in the fight against infection and disease. It is best suited as a guide for wastewater personnel (such as treatment plant operators, collection system maintenance personnel, and solids disposal personnel) who are frequently exposed to wastewater, solids, aerosols, and compost. This target audience will benefit from a comprehensive look at common wastewater pathogens with which they are regularly in contact, as well as information on protective and deactivation measures that can be employed.
The book also would be a valuable desk reference for private consulting engineers and scientists who work on municipal wastewater projects. Considering the comprehensiveness and digestibility of this book, it also is well-suited for the academic world as a possible supplement for a wastewater treatment process or wastewater microbiology course.
Jerel J. Bogdan is an engineer in the Orchard Park, N.Y., office of Malcolm Pirnie Inc. (White Plains, N.Y.).
|
<urn:uuid:3cfb6536-c115-43d7-ae7f-24ead771a951>
|
CC-MAIN-2016-26
|
http://www.wef.org/publications/page_wet.aspx?id=4353&page=ca§ion=Water%20Volumes
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783399106.96/warc/CC-MAIN-20160624154959-00198-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.916238 | 400 | 2.828125 | 3 |
Rotheram-Borus, Mary Jane PhD; Swendeman, Dallas MPH; Comulada, W Scott MS; Weiss, Robert E PhD; Lee, Martha PhD; Lightfoot, Marguerita PhD
Young people represent approximately 50% of all HIV infections worldwide1 and 18% of reported HIV cases in the United States.2 Nationally, approximately 110,000 young adults less than 23 years of age are living with HIV3 and 23% of HIV-infected persons are less than 30 years of age.2 Because the number of sexual partners and sexual activity is highest in late adolescence and early adulthood,4 it is critical to ensure that transmission acts are reduced among young people living with HIV (YPLH). The goal of this article is to examine the efficacy of an intervention to reduce transmission acts.
YPLH who do not change their sexual risk acts or injection drug use may infect others and become reinfected with new viral strains.5 Previous research with persons living with HIV indicates that at least one third of YPLH are likely to continue their transmission behaviors after learning their serostatus.6,7 The primary motivation to reduce transmission risk acts is altruism,8,9 although self-preservation may motivate some youth to avoid acquiring other sexually transmitted infections or to avoid becoming reinfected with drug-resistant strains of HIV. To motivate YPLH to reduce transmission for the public good, it is necessary to address the young people’s need to improve their physical health and mental health, especially their adherence to health regimens.10 Adherence to medical regimens is likely to extend the quality and length of life for YPLH. With an extended lifespan, there is also a greater likelihood that YPLH may relapse into transmission behaviors.11 Thus, to reduce sexual and substance use transmission acts of YPLH, an intervention that addressed the needs of the YPLH (receiving and adhering to medications and health regimens and improving mental health) and society (reducing sexual and substance use transmission acts) was evaluated.
We previously demonstrated that attending a 3-module intervention delivered in small groups, Teens Linked to Care,7,12 reduced unprotected sexual acts and drug use and improved physical health and mental health outcomes among YPLH—the same goals as the intervention in this study. For example, YPLH in the intervention condition reported 82% fewer unprotected sexual acts, 45% fewer sexual partners, 50% fewer HIV-negative sexual partners, and a 31% reduction in substance use compared with YPLH in a delayed condition.7 Health-related coping skills improved for young women living with HIV,7 and mental health symptoms were significantly reduced in the intervention compared with the delayed condition.12 The intervention was cost-effective in reducing new infections (Lee MB, Leibowitz H, Rotheram-Borus MJ, unpublished data).
After demonstrating that an intervention is efficacious, researchers typically replicate the same intervention design and content and often demand fidelity to the initial intervention delivery.14,15 The strategy of replication with fidelity does not allow us to develop guidelines for when and how to tailor the intervention to different market segments or to improve on the initial intervention. This study deviated from the traditional replication strategy. Three types of adaptations were made in the current trial.
First, although there were significant improvements associated with Teens Linked to Care, 30% of YPLH did not attend even 1 intervention session.7 There were several significant barriers to attending groups delivered in a small group setting. First, when arriving at a group meeting for HIV-positive persons, one’s serostatus is disclosed to 8 to 10 unfamiliar persons simultaneously. Fears may arise about disclosure. Second, the low rate of HIV detection among YPLH16 often led to a delay of several months organizing a group, even in urban AIDS epicenters. Third, there were so few YPLH that young gay men, women, and heterosexual men were combined within 1 group; yet, the issues were significantly different for each subpopulation. Finally, anticipating challenges related to efficacious interventions, we realized it would be necessary to tailor the delivery modalities so that persons in different life situations (ie, different market segments)15 would have an intervention acceptable to them. Therefore, we adapted our previous intervention to be delivered in modalities that are consistent with the existing case management models being implemented nationally with funding from the Ryan White CARE Act and Centers for Disease Control and Prevention.17
Most existing prevention case management services are delivered in individual 1-on-1 counseling sessions. For persons who are too ill, live in rural settings, or are homeless, telephone interventions are seen as a viable alternative delivery format.18–20 Therefore, the Teens Linked to Care intervention,7 designed for small groups, was adapted to be delivered in individual sessions and on the telephone. The goals were the same (reducing sexual and substance use risk acts, improving physical health behaviors, and improving mental health), but the delivery format shifted.
Second, Teens Linked to Care was delivered in 10 to 12 sessions for each of 3 modules, reflecting each of the intervention’s goals (reducing transmission, improving physical health, and improving mental health). To be more feasible for replication, we reduced the number of sessions per module from 10 to 12 to 6 sessions per module.
Third, because drug use has been consistently associated with sexual risk acts,4,6,7,12 we focused this study on drug-using youth. Only YPLH who had engaged in drug use at least 5 times during the previous 3 months were eligible for enrollment (criteria were set from inspection of rates of substance use in our previous trial7).
Behavioral changes are achieved when the desired goals are clear, consumers are motivated to change, the situations that elicit risk acts are identified, and patterns of coping with future risk situations are planned and rehearsed to proceed in a different way.21,22 Building on an extensive qualitative study of YPLH8,9,23 and our earlier interventions,7,12 the situations that YPLH typically encounter were identified; these situations were different for young gay men, women, young adults, adolescents, methamphetamine users, and injecting drug users. The in-person and telephone formats allowed us to tailor the situational contexts addressed in the intervention to the YPLH’s life challenges. The intervention then focused on helping YPLH to set goals; to become and remain motivated to change; and to plan and rehearse how to cope more effectively with situational challenges in sexual and substance use risk situations and medical care delivery settings and when using medications and experiencing negative emotional states. Situations in each domain were addressed for 6 sessions within each module, allowing rehearsal and planning several times in each domain.
To compare the cost-effectiveness of the in-person and telephone delivery formats with that of our previous study with YPLH in small groups,7,12 we monitored the costs of delivering each module of the intervention.
Although it is estimated that there are 110,000 YPLH in the United Sates, fewer than 10% of these YPLH have been identified through HIV testing, and it is estimated that only 10% of the identified YPLH are linked to care.3 Therefore, recruitment is a challenge nationally for YPLH. The first strategy to recruit YPLH was via the major adolescent AIDS clinics in Los Angeles (Children’s Hospital and Los Angeles Gay and Lesbian Center) and New York (Montefiore Medical Center and Kings County Medical Center). When insufficient numbers of YPLH were enrolled, we expanded to a broad range of community-based sites (eg, Los Angeles Youth Network, Gay Men’s Health Crises) and sites in San Francisco, with some sites securing institutional review board approval and the remaining agreeing to comply with the University of California at Los Angeles’ Institutional Review Board requirements. We then expanded recruitment procedures to include solicitation in newspapers, conferences, and community events that were likely to be attended or read by YPLH. YPLH were currently receiving medical care at the recruitment site or were linked to ongoing care at the time of enrollment into the study.
From 1999 to 2002, 253 YPLH aged 16 to 29 (median = 23) years were recruited with voluntary informed consent in Los Angeles, San Francisco, and New York. Across cities, YPLH were recruited from 17 medical providers (n = 66), 21 social service agencies (n = 121), 2 needle exchange programs (n = 6), 1 drug treatment center (n = 4), 4 other research studies (n = 5), or outreach on the street or at special events (n = 15) as well as through newspaper advertisements (n = 12) and referrals from friends (n = 19). Ten young people contacted the study from unknown sources. Many young people attended more than 1 service site concurrently, and others moved to new service sites over the course of the study; therefore, there is not only 1 site identified for each participant. Although many youth were part of a convenience sample, a consecutive series of youth were approached from each of the medical provider sites and social service treatment settings, allowing us to document 23 refusals. There were too few youth from any 1 site to make meaningful comparisons of youth recruited from different sites.
Parental consent was obtained for nonemancipated YPLH less than 18 years of age. All YPLH received an incentive of $20 to $25 per assessment.
In the previous intervention trial, significant numbers of YPLH did not engage in substance use at the assessment interview or over time.7 Because this study aimed at reducing transmission acts among substance users, we had an eligibility criterion of using illicit drugs at least 5 times in the last 3 months. A validity study of potential screening instruments to identify HIV-seropositive persons who engaged in risky acts demonstrated low reliability and validity; thus, a full 45-minute extended interview was the criterion to identify a valid response on sexual and substance use risk acts.24 Given these findings, each potential participant was initially recruited with voluntary consent for a baseline interview so as to assess eligibility. On the basis of the interview, YPLH were recruited for the intervention trial.
Eligibility rates varied across cities. In Los Angeles, 118 YPLH were recruited for the baseline assessment and 74% (n = 87) were eligible for participation. In New York, 68% (n = 68 of 100) of YPLH assessed were eligible, and 83% (n = 29 of 35) of YPLH were eligible in San Francisco. Fewer YPLH were recruited in San Francisco because this site was added a year later than the other cities. Of the 253 YPLH initially recruited, 72% (184 of 253) were eligible and 95% (176 of 184) were randomized into the trial. One baseline interview file was damaged, resulting in 175 participants.
Similar across intervention delivery format (in-person or telephone sessions), 3 modules of 6 sessions each focused on a different target behavior: improving physical health, reducing sexual and substance use acts, and improving mental health. Module 1 focused on improving one’s physical health regimen, particularly utilization and adherence to antiretrovirals (ARVs). In addition, the module addressed coping with learning one’s serostatus, implementing new daily routines to stay healthy, issues of disclosure, and participation in health care decisions. Health care was addressed first to address the needs of the YPLH8 before asking for altruistic behaviors with sexual and drug-using partners.
Module 2 aimed to reduce unprotected sexual acts and substance use by asking YPLH to identify situations that are likely to elicit risky acts and to modify their patterns of substance use as well as increase their skills in condom use self-efficacy and negotiation skills. Disclosure of serostatus was not endorsed by the intervention; we were concerned that disclosing one’s serostatus transferred responsibility to the informed partner to protect himself or herself. Regardless of the desire of the partner, YPLH were encouraged to use condoms if engaging in sexual acts.
Module 3 aimed to reduce emotional distress and to improve the quality of life of YPLH. The module focused on helping YPLH to anticipate situations that would raise negative emotions (eg, anxiety, depression, fear, anger). YPLH were taught a “Feeling Thermometer” to identify their affective states across difficult situations and then to self-control negative emotions through the use of relaxation, self-instruction, and meditation. Module 3 focused on helping YPLH to identify long-term life goals.
The format of each session was similar across each session and each module. Each session started with recognizing personal successes during the previous week, recognizing success in completing goals targeted during the previous session, introduction of new material (eg, strategies for remembering ARVs, proper use of condoms), rehearsal and planning for challenging situations that might arise in the next week and the future, review of the session’s progress, and goal setting for the next week.
A detailed manual (available online at http://chipts.ucla.edu/) guided the 3 intervention modules totaling 18 sessions of 2 hours each. Each participant received $10 for each session attended.
The in-person sessions were delivered 1-on-1 in private rooms available at collaborating sites or other community agencies. When these spaces were not available in locations accessible to a participant, arrangements were made to deliver sessions in the participant’s home (if it was judged to be safe and private) or, on rare occasions, in a nearby park or coffee shop.
Telephone sessions were delivered 1-on-1 at times convenient for participants. YPLH were provided with workbooks to supplement and provide concrete prompts to complete the session content. The original design called for small group meetings in a telephone chat-room. Slower than anticipated recruitment, coupled with challenges in coordinating mutually agreeable group schedules and poor initial adherence, caused us to revise the protocol to 1-on-1 delivery during the first telephone group attempted. Follow-up and recontact efforts consisted of weekly written letters or e-mail, followed by telephone calls. Three weekly attempts were made before shifting to monthly follow-up.
Intervention facilitators held masters degrees and were licensed therapists or clinical social workers or had completed their clinical training and were accumulating hours toward licensure. Most facilitators were female. Spanish-speaking facilitators were available for monolingual Spanish-speaking participants (approximately 3% of the sample).
The facilitators were supervised biweekly and received intensive 3-day training for each module from teams of experienced cognitive-behavioral intervention researchers. The training included review of the study’s theoretic orientation, the intervention manual, and videotapes of model sessions as well as practice in conducting each session of the intervention.
Quality assurance ratings were conducted from randomly selected videotapes and audiotapes of sessions. Ratings for more than 80% of the sessions exceeded criteria for content and process measures of fidelity.
Across modules, 78% (n = 94 of 120) of young people participated in at least 1 session: 87% (n = 53) attended at least 1 individual session and 69% (n = 41) participated in at least 1 session in the telephone intervention (attenders). Fewer young people completed all 18 sessions (35%): 41% of those receiving individual sessions and 29% of those receiving the telephone interventions. The mean number of sessions was 10.0 in the individual sessions and 7.5 in the telephone sessions. Attenders (n = 94) and nonattenders (n = 26) were compared on each baseline characteristic listed in Table 1. No significant differences were found between YPLH in either condition. After the 15-month assessment, young people in the delayed condition received the intervention; 56% attended the in-person intervention.
Retention was high and similar across sites and intervention conditions as YPLH were assessed at 3 months (86%), 6 months (78%), 9 months (86%), and 15 months (82%). Young people were individually interviewed at a site convenient to them. An ethnically diverse team of trained interviewers assisted by collecting data using computerized assessments. Quality assurance ratings were conducted on 20% of interviews through audiotape reviews, and 93% met criteria on ratings of completeness, positive tone, and crisis referrals. For all assessment domains, activities reported for the previous 3 months are defined as “recent” behaviors.
The following measures were evaluated at each assessment period:
1. HIV risky behaviors A. Sexual risk acts. Using a structured interview protocol,25 youth reported the total number of partners and sexual acts, specific sexual acts with each partner, and whether condoms were used during each of these sexual acts. A sexual partner was defined as a male or female partner with whom the youth engaged in vaginal or anal sex. A sexual act was defined as a single session of receptive or insertive vaginal or anal sex. Oral sex was reported but omitted in all calculations of risk because of its low association with HIV transmission.26,27 Based on extensive sexual history data obtained, we derived the following indices: (1) no recent sexual risk (abstinence or 100% condom use over the last 3 months); (2) the number of HIV-negative sexual partners or partners of unknown status; (3) the number of seroconcordant sexual partners; and (4) the proportion of vaginal and anal sex acts protected by condoms with all partners, seroconcordant partners, and HIV-negative partners (or partners of unknown status). Disclosure of serostatus before sexual intercourse was assessed for each sexual partner. The percentage of partners YPLH disclosed was calculated for seroconcordant and HIV-negative partners or partners of unknown status. B. Substance use. YPLH were queried about the prevalence, frequency, and quantity of use of alcohol and a broad range of drugs (marijuana, stimulants, cocaine, crack, opiates, club drugs, and steroids). For each substance, we obtained data on the periods of most frequent drug use over the participant’s lifetime, frequency of use in the last 3 months, means of use (oral, injection, or smoking), and symptoms associated with use. To evaluate dependency, we included 5 questions on the ability to limit use and physical symptoms of drug withdrawal. Based on YPLH’s responses, we derived 4 indices: (1) symptoms of dependency, classified as present if 2 of 5 questions on recent dependency were endorsed (1) or not (0); (2) use of hard drugs (1) or not (0) (including stimulants, opiates, club drugs, steroids, and barbiturates); (3) injection drug use (1) or not (0); and (4) a sum of the number of different drugs used. We compared self-reported substance use with urine sample test results at baseline for 82 YPLH.28 For each substance assessed, we also asked about risk during the time frame anticipated for the drug to stay active in the urine. For example, cocaine can be detected in urine samples for approximately 3 days after use, whereas marijuana can be detected for a period of at least 7 days after use. Therefore, we compared the urine screening results with the number of days since the last use as reported by participants. Percent agreement between positive test results and self-reported use is as follows: marijuana use, 84%; amphetamine or stimulant use, 83%; cocaine or crack use, 33%; and heroin use, 60%.
2. Health-related outcomes A. Medication adherence. At the time this study began, ARV medications were recommended for all persons living with HIV.29 We assessed lifetime and recent ARV utilization and adherence, classified as present (1) or not (0). ARV adherence was based on an adapted measure.30 YPLH reported the specific ARV medications they were taking; the number of times per day each medication was supposed to be taken; and how many times a dose was missed or skipped yesterday, 2 days ago, and 3 days ago. Adherence was defined as adhering to at least 90% of ARV medications that were supposed to be taken over the 3 days before the interview. B. Health behaviors. We assessed an index of medical adherence as the number of medical appointments missed. In addition, we used a measure of positive health behaviors7 to document the frequency of engaging in 12 behaviors used to maintain health at least once a week on average: yes (1) or no (0) (eg, balanced diet, exercise, vitamins, adequate sleep). C. Self-report health status. YPLH reported: (1) T-cell count, (2) viral load count, (3) knowledge of T-cell count, (4) whether or not symptoms of HIV had been experienced, and (5) whether or not AIDS had been diagnosed. Self-reported CD4 and viral load counts were compared with counts from medical charts for 38 randomly chosen YPLH. Self-reported counts that matched the most recent medical chart information were used when possible. Self-reported and medical chart information that differed by more than 6 months was not used, resulting in 33 cases being used to analyze CD4 counts and 29 cases being used to analyze viral load counts. The Pearson correlation between self-report and medical chart information was 0.80 for CD4 counts and 0.69 for viral load counts (both P < 0.0001).
3. Mental health outcome. The Brief Symptom Inventory (BSI),31 a 53-item reliable index of global severity of mental health symptoms, was administered (α = 0.97 at baseline). Participants rated the level of severity for each symptom during the previous week on a scale from 0 (not at all) to 4 (extremely). Scores are reported as the mean response of the 53 items. The logarithm of the score is used in analyses.
Research staff, supervisors, and university budget ledgers were monitored to calculate the resources expended for delivery of each intervention modality, including personnel, transportation, materials, food costs, overhead, and participants’ opportunity costs as well as training the session facilitators. The resources were inventoried at the time that the intervention was conducted in 1999 through 2002. Monetary incentives were given for participation to reimburse participants for their time. In-person intervention and telephone intervention were assessed separately. We also excluded resources associated with the scientific evaluation of the study, for example, the assessment.
Intent-to-treat analyses were conducted examining measures from the baseline assessment until 15 months. Mixed-effect regression models were used to evaluate the impact of the intervention condition on transmission-, physical health-, and mental health-related outcomes. Covariates included time since baseline assessment (months), intervention condition, ethnicity, gender, recruitment city, and a time by intervention condition interaction. A covariate for having traded sex during the lifetime of YPLH was included in models for sexual behavior outcomes, and a covariate for the amount of time since ARV initiation was included in the model for the ARV adherence outcome.
An autoregressive moving average (ARMA) covariance structure32 provided the best fit of several covariance structures we tested and was used in all longitudinal analyses. The ARMA covariance structure suggests that the correlation of outcomes between time points is dependent on the average correlation across time points and the proximity of time points. Outcomes measured closer together are more highly correlated.
Missing observations did not contribute to the fit of the model at time points where they were missing or affect how nonmissing observations were used in analyses. For the analysis of 2 outcomes composed of fractions, the fraction of protected sex acts and adherence to ARVs, the analyses excluded observations with 0 denominators. For example, in the analysis of adherence, observations for participants who were not using ARVs recently were excluded.
Results are presented using relative effect size (RES) at 15 months, defined as 100 × ([outcome T1 − outcome T2]/outcome T2). F-statistics (F), t-statistic absolute value (t), and corresponding degrees of freedom (df) are presented for intervention condition comparisons.
Baseline intervention condition differences of recent outcomes were tested by examining F-statistics for intervention main effects in the mixed-effect regression models; differences for demographics and other measures were tested using ANOVA; logistic regression; and Poisson regression for continuous, dichotomous, and count measures, respectively. Baseline intervention condition differences of recent outcomes were adjusted for by including an intervention condition covariate in all mixed-effect regression models.
To assess changes among YPLH in the delayed-intervention condition over time independently, we compared participants in the delayed condition on baseline and 15-month outcomes, performing a paired t test, McNemar test, and logistic regression, including a random effect for each pair, on continuous outcomes, dichotomous outcomes, and outcomes represented as a fraction, respectively.
All analyses were performed using SAS software, version 8.01 (SAS Institute, Cary, NC). Dichotomous and count (eg, number of protected acts) outcome measures were modeled using logistic and Poisson mixed-effect regressions, respectively, in the GLIMMIX macro, and continuous outcome measures were fit using linear mixed-effect regressions in the PROC MIXED procedure.
Table 1 gives characteristics of YPLH measured at baseline (n = 175). Most YPLH were male, gay or bisexual male (69%), and of ethnic minority heritage. About half of the YPLH were currently on ARVs and had experienced symptoms of HIV; most had used ARVs during their lifetime, had served time in jail, and had graduated from high school or received a GED certificate. Over their lifetime, YPLH had a median of 50 sexual partners; 2 YPLH reported being sexually abstinent, and 21 YPLH reported having 1000 or more sexual partners. Disclosure of serostatus and condom-protected sex seems to be higher among seroconcordant (HIV-positive) partners than among HIV-negative partners or partners of unknown status. As part of an eligibility criterion to be in the study, all YPLH had recently used substances 5 or more times. Most (78%) had used hard drugs over their lifetime.
Randomization successfully resulted in similar groups across demographic and most outcome measures, but we did find differences at recruitment across intervention conditions for the proportion of protected sex acts across all sexual partners (F = 9.49, df = 2, 155; P < 0.01), among HIV-positive sexual partners (F = 3.13, df = 2, 94; P = 0.05), and among HIV-negative sexual partners (F = 10.46, df = 2, 141; P < 0.01). The in-person intervention condition had a higher proportion of protected acts across all sexual partners, among HIV-positive sexual partners, and among HIV-negative sexual partners compared with the delayed-intervention condition (P < 0.05). The telephone intervention condition had a higher proportion of protected acts across all sexual partners and among HIV-negative sexual partners compared with the delayed-intervention condition (P < 0.05). The telephone intervention condition also had a higher proportion of protected acts across all sexual partners and among HIV-negative sexual partners compared with the in-person intervention condition (P < 0.05).
Table 2 summarizes the estimated outcomes at the baseline and 15-month assessments for each intervention condition as well as for the RES. Each outcome measure reflected a linear trend over time; therefore, we have not included the mean on each measure for the intermediate time points. Significant differences for time by intervention condition effects are indicated. There was a significant difference in the proportion of protected acts between intervention conditions over time across all partners (F = 3.38, df = 2, 380; P = 0.03) and among HIV-negative partners (F = 5.18, df = 2, 264; P < 0.01) but not among HIV-positive partners. YPLH in the in-person intervention increased their proportion of protected sexual acts across all sexual partners compared with YPLH in the delayed intervention over time (t = 2.57, df = 380; P < 0.01). The proportion of protected sexual acts in the telephone condition was not significantly different from that in the delayed intervention or in the in-person intervention over time. YPLH in the telephone group had a significant decrease in the proportion of protected acts among HIV-negative partners compared with YPLH in the in-person intervention over time (t = 2.65, df = 264; P < 0.01). The number of sexual partners and disclosure of serostatus to partners were similar over time across intervention conditions.
The proportion of YPLH using hard drugs, the proportion of injecting drug users, the proportion of YPLH with symptoms of dependency, and the number of different drugs used were similar among intervention conditions over time.
The proportion of ARV use and adherence to ARV medication were similar among intervention conditions over time. The proportion of those who changed their health behaviors (eg, exercised, ate a healthy diet, took supplements and vitamins) was similar between intervention conditions over time. On average, logs of the overall score for emotional distress on the BSI were similar between intervention conditions over time.
Changes in the Delayed Condition Over Time
Participants at 15 months in the delayed condition showed a trend toward having fewer sexual partners (mean decrease = 3.7, t-statistic = 1.97, df = 42; P = 0.06), using fewer different drugs (mean decrease = 0.42, t-statistic = 2.03, df = 42; P = 0.05), and having a lower mean global BSI score (mean decrease = 0.26, t-statistic = 2.06, df = 42; P = 0.05) compared with the participants at baseline. At 15 months, YPLH were also less likely to be using highly active antiretroviral therapy (HAART) compared with baseline ([McNemar test] df = 1; P = 0 .05). Of YPLH using HAART at baseline, 50% (10 of 20) of participants were not using HAART at 15 months. Of participants not using HAART at baseline, 13% (n = 3 of 23) were using HAART at 15 months.
The total cost of the in-person intervention for the 3 modules was $3500 per participant (approximately $1167 per module), which was higher than the cost of $2692 per participant for the telephone intervention (approximately $897 per module). The excess cost of traveling time and expenses for in-person sessions accounted for this difference. Personnel accounted for most of the total costs: 65% for in-person sessions and 60% for telephone sessions. Overhead costs averaged 25% and material and instrumental costs averaged 12% of total costs across intervention conditions.
This trial aimed to test the limits of the process of tailoring and adapting an efficacious intervention. Could we change the delivery format and reduce the number of sessions and retain efficacy with drug users? Because community providers typically adapt the intervention for delivery in their particular setting and for somewhat different populations, this is a key debate in the field of prevention today. This replication of an intervention for YPLH suggests some of the pitfalls in such adaptations.
We adapted a 3-module intervention delivered in a small group setting and examined individually delivered telephone and in-person sessions as alternative formats for preventing transmission and improving physical health and mental health outcomes for YPLH. These delivery modalities are consistent with the prevention case management models for persons living with HIV. We also reduced the number of sessions by 50% to examine the influence of less lengthy interventions with YPLH.
The proportion of protected sexual risk acts, especially with seronegative partners, was significantly higher among youth randomized to the in-person intervention condition delivered in individual sessions. This is consistent with the findings of our previous intervention trial.7 There were significant reductions in sexual risk when YPLH were randomized to individual sessions focused on encouraging reductions in sexual transmission acts, at a cost of $1167 per person for module 2. This finding is particularly impressive, because there was a significant difference across intervention conditions at recruitment. There was less opportunity for improvement among youth randomly assigned to the in-person condition; yet, the youth in the in-person group significantly increased their condom use compared with other groups.
Also similar to the previous intervention, approximately two thirds of YPLH attended interventions delivered in a small group format and in a telephone format in this study. At least 1 individual session was attended by 87% of youth, suggesting that a prevention case management approach may be an acceptable delivery modality for YPLH. In addition, we would anticipate that case management offers the potential to deliver the intervention over an extended period as YPLH work with their case managers. Small groups result in a lower per person cost per module ($547 vs. $1167) even with double the number of sessions. Yet, individual sessions have fewer concerns regarding disclosure of serostatus, and the interventions could be used in rural settings. Based on the results of this trial, an efficacious intervention for reducing sexual transmission among YPLH can be delivered in small group or in individual sessions.
One of the important implications of this trial is the need for screening among YPLH before service delivery. In reviews of a substantial number of studies with persons living with HIV33 and in our last 2 intervention trials,7,12,16 we found that more than half of persons living with HIV do not demonstrate any sexual risk transmission acts over the course of the trial. Substantial resources and diminished effect sizes occur when we include those not engaging in transmission acts for delivery of preventive interventions. In this trial, we screened on substance use risk acts, which we expected to be associated with inconsistent sexual risk practices. Unlike previous researchers’ findings4,6 and our own results in the previous intervention trial,7 however, hard drug users were not more likely to have unprotected sexual risk acts. Similarly, not all YPLH are in need of interventions to increase adherence to medical regimens or to improve mental health. More than half were on ARVs and adhering to more than 90% of their medication doses. Screening seems to be a key strategy for selecting YPLH in need of intervention.
The YPLH in the delayed-control condition improved over time on many outcome measures with only repeated assessments. The pre- and postanalyses among participants in the delayed condition indicated that most YPLH reduced their sexual and drug use behaviors over time, without interventions, but with repeated assessments of risk behaviors over time. Almost all participants in the control condition of every intervention trial have improved substantially.34–37 The consistent improvements associated with repeated assessments in the control conditions have led our research team to examine repeated assessments as a cost-effective intervention strategy for persons living with HIV; this strategy is currently being evaluated (M. Lightfoot, PhD, study in progress). The benefits of repeated assessments as a strategy for improving health-related HIV behaviors may significantly reduce the costs of intervention delivery.
Reducing illicit substance use was also a primary goal of this intervention, and all youth had used drugs at least 5 times in the previous 3 months to be eligible for the trial. The effect sizes for reductions in substance use among the in-person and telephone conditions compared with the delayed condition were relatively large yet did not reach significance. Retrospective analysis suggests that we were underpowered to observe significant results within the intervention and control conditions given the substantial reductions in substance use among YPLH in the control conditions. To show a significant difference in hard drug use in the immediate intervention groups compared with the delayed-intervention group over time, we would have needed 5.4 times more participants to show significance.* Future trials with YPLH must anticipate loss of power with abstinence.
Sexual risk outcomes seem to be robust; sexual risk behaviors are significantly reduced with efficacy in in-person delivery formats despite the number of reduced sessions. The other positive outcomes were not retained, however, including improvements in mental health, adherence to medical regimens (particularly ARVs), and improvements in healthy lifestyle behaviors. It may be important to note that YPLH reported 20 positive health behaviors (eg, exercise regularly) at recruitment and emotional distress scores in the normative range. In addition to tailoring interventions to those who have deficits in a specific area, interventions for YPLH may require a greater dose of an intervention to achieve positive outcomes in medical adherence and mental health outcomes for YPLH, similar to the number of sessions in our earlier intervention.7 The case management services being offered and the ongoing medical care provided to persons living with HIV offer important ongoing opportunities to deliver sufficient doses of interventions in highly accessible settings. These alternatives are currently being examined.
The authors thank Jeffrey Chen, Hsin-Hsin Foo, Danny Jenkins, Mark Kuklinski, Kris Langabeer, Linda Levin, Kathryn Mattes, Mabel Mendez, Peggy O’Hara, and Brian Ramos for their assistance. This study was approved by the University of California at Los Angeles Human Subjects Protection Committee.
© 2004 Lippincott Williams & Wilkins, Inc.
|
<urn:uuid:1e18f976-0be1-4ae6-8a10-1bfddcae2af1>
|
CC-MAIN-2016-26
|
http://journals.lww.com/jaids/Fulltext/2004/10012/Prevention_for_Substance_Using_HIV_Positive_Young.3.aspx
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396147.66/warc/CC-MAIN-20160624154956-00162-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.955364 | 7,723 | 3.0625 | 3 |
orgé: impulse, wrathOriginal Word: ὀργή, ῆς, ἡ
Part of Speech: Noun, Feminine
Phonetic Spelling: (or-gay')
Short Definition: anger, wrath, passion
Definition: anger, wrath, passion; punishment, vengeance.
3709 orgḗ (from orgáō, "to teem, swelling up to constitutionally oppose") – properly, settled anger (opposition), i.e. rising up from an ongoing (fixed) opposition.
3709 /orgḗ ("settled anger") proceeds from an internal disposition which steadfastly opposes someone or something based on extended personal exposure, i.e. solidifying what the beholder considers wrong (unjust, evil).
["Orgē comes from the verb oragō meaning, 'to teem, to swell'; and thus implies that it is not a sudden outburst, but rather (referring to God's) fixed, controlled, passionate feeling against sin . . . a settled indignation (so Hendriksen)" (D. E. Hiebert, at 1 Thes 1:10).]
NAS Exhaustive ConcordanceWord Origin
a prim. word
anger (6), wrath (30).
Thayer's Greek LexiconSTRONGS NT 3709: ὀργή
ὀργή, ὀργῆς, ἡ (from ὀργάω to teem, denoting an internal motion, especially that of plants and fruits swelling with juice (Curtius, § 152); cf. Latinturgerealicui forirascialicui in Plautus Cas. 2, 5, 17; Most. 3, 2, 10; cf. German arg, Aerger), in Greek writings from Hesiod down "the natural disposition, temper, character; movement or agitation of soul, impulse, desire, any violent emotion," but especially (and chiefly in Attic) anger. In Biblical Greek anger, wrath, indignation (on the distinction between it and θυμός, see θυμός, 1): Ephesians 4:31; Colossians 3:8; James 1:19f; μετ' ὀργῆς, indignant (A. V. with anger), Mark 3:5; χωρίς ὀργῆς, 1 Timothy 2:8; anger exhibited in punishing, hence, used for the punishment itself (Demosthenes or. in middle § 43): of the punishments inflicted by magistrates, Romans 13:4; διά τήν ὀργήν, i. e. because disobedience is visited with punishment, Romans 13:5. The ὀργή attributed to God in the N. T. is that in God which stands opposed to man's disobedience, obduracy (especially in resisting the gospel) and sin, and manifests itself in punishing the same: John 3:36; Romans 1:18; Romans 4:15; Romans 9:22a; Hebrews 3:11; Hebrews 4:3; Revelation 14:10; Revelation 16:19; Revelation 19:15; absolutely, ἡ ὀργή, Romans 12:19 (cf. Winer's Grammar, 594 (553)); σκεύη ὀργῆς, vessels into which wrath will be poured (at the last day), explained by the addition κατηρτισμένα εἰς ἀπώλειαν, Romans 9:22b; ἡ μελλουσα ὀργή, which at the last day will be exhibited in penalties, Matthew 3:7; Luke 3:7 (others understand in these two passages the (national) judgments immediately impending to be referred to — at least primarily); also ἡ ὀργή ἡ ἐρχομένη, 1 Thessalonians 1:10; ἡμέρα ὀργῆς, the day on which the wrath of God will be made manifest in the punishment of the wicked (cf. Winer's Grammar, § 30, 2 a.), Romans 2:5; and ἡ ἡμέρα ἡ μεγάλη τῆς ὀργῆς αὐτοῦ (Revelation 6:17; see ἡμέρα, 3 at the end); ἔρχεται ἡ ὀργή τοῦ Θεοῦ ἐπί τινα, the wrath of God cometh upon one in the infliction of penalty (cf. Winer's Grammar, § 40, 2 a.), Ephesians 5:6; Colossians 3:6 (T Tr WH omit; L brackets ἐπί etc.); ἔφθασε (ἔφθακεν L text WH marginal reading) ἐπ' αὐτούς ἡ ὀργή, 1 Thessalonians 2:16; so ἡ ὀργή passes over into the notion of retribution and punishment, Luke 21:23; Rom. (Romans 2:8);
Strong's Exhaustive Concordanceanger, indignation, vengeance, wrath.
From oregomai; properly, desire (as a reaching forth or excitement of the mind), i.e. (by analogy), violent passion (ire, or (justifiable) abhorrence); by implication punishment -- anger, indignation, vengeance, wrath.
see GREEK oregomai
Forms and Transliterationsοργαί οργάς οργη οργή ὀργή ὀργὴ ὀργῇ οργην οργήν ὀργήν ὀργὴν οργης οργής ὀργῆς orge orgē orgḗ orgḕ orgêi orgē̂i orgen orgēn orgḗn orgḕn orges orgês orgēs orgē̂s
LinksInterlinear Greek • Interlinear Hebrew • Strong's Numbers • Englishman's Greek Concordance • Englishman's Hebrew Concordance • Parallel Texts
Englishman's ConcordanceStrong's Greek 3709
ὀργὴ — 13 Occ.
ὀργὴν — 9 Occ.
ὀργῆς — 14 Occ.
Matthew 3:7 N-GFS
GRK: τῆς μελλούσης ὀργῆς
NAS: you to flee from the wrath to come?
KJV: to flee from the wrath to come?
INT: the coming wrath
|
<urn:uuid:8eb72569-5308-4cf5-b42e-b7387aa1fc8a>
|
CC-MAIN-2016-26
|
http://biblehub.com/greek/3709.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396887.54/warc/CC-MAIN-20160624154956-00071-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.769616 | 1,610 | 3.328125 | 3 |
The Reality Behind Gluten-Free Diets
A lifelong gluten-free diet is necessary for those who suffer from celiac disease, also referred to as celiac sprue, non-topical sprue, and gluten-sensitive enteropathy.
Celiac disease is an autoimmune disorder that damages the small intestine lining and prevents absorption of nutrients from foods that are consumed. The damage is due to a reaction to eating gluten, a protein found in wheat, barley, rye, and possibly oats.
Symptoms of celiac disease include gas, diarrhea, stomach pain, fatigue, joint pain, weight loss, and skin rashes. There are no medications or surgeries that can cure celiac disease, therefore following a life-long gluten-free diet is necessary.
The gluten-free diet has become popular among celebrities and has gained much media attention due to the claim of weight loss and boost in energy levels. It seems as if many are beginning to associate the gluten-free diet with weight loss rather than the medical condition for which it is prescribed.
There is no scientific evidence to show that eliminating gluten promotes weight loss. Many gluten-free products may have the same, if not more calories than products with gluten. Often times, gluten-free products have added sugar or fat mixed into the substitute flour to make the item more palatable leading to higher calories.
The Reality Behind Gluten-Free Diet Claims
Two popular claims of a gluten-free diet are weight loss and increased energy, but there may be other reasons why individuals experience those benefits.
Some claim they experience weight loss once initiating the gluten-free diet. Yes, some individuals may lose weight when beginning the gluten-free diet, but it depends on what foods they use to replace gluten-containing foods. For example, replacing wheat flour with potato starch will not result in weight loss, but replacing white bread with quinoa or another high-fiber grain may.
When beginning the gluten-free diet, individuals may decrease their total intake of processed foods and increase their intake of fruits and vegetables. Any weight loss can be achieved by eliminating high-calorie and high-fat foods, even if they are or are not gluten-free.
Once initiating the gluten-free diet, one must closely pay attention to food labels. It is known that when individuals are more aware of what they are consuming they tend to make healthier options, which can then lead to weight loss.
Sufferers of celiac disease are often thin, which may lead others to think that they are thin from eating gluten-free foods. In reality, they often are thin due to problems with malabsorption associated with the disease.
Some claim that they experience increased energy levels once adopting the gluten-free diet. An explanation for this claim may be that the individual is consuming more fruits and vegetables, rather than high-calorie and high-fat processed foods. When someone begins consuming a healthy, well-balanced diet they may feel that they have more energy, no matter if they are or are not eliminating gluten. No studies were found showing that eliminating gluten leads to increased energy levels.
The Risks of a Gluten-Free Diet
There are risks involved with following a gluten-free diet; therefore it is not recommended for everyone.
Avoiding grains on the gluten-free diet means that you are eating fewer products enriched with nutrients, which may lead to deficiencies in iron, calcium, thiamine, riboflavin, niacin, and folate.
Along with fruits and vegetables, the most common sources of dietary fiber are whole-grain breads and cereals, which contain gluten. Many people on gluten-free diets tend to eat inadequate amounts of fiber, which may lead to constipation.
Following a gluten-free diet may potentially cause a decrease in the amount of beneficial bacteria in the gut (Bifidobacterium and Lactobacillus), which can negatively impact the immune system.
Another negative aspect regarding the gluten-free diet is cost. Gluten-free products tend to be more expensive than gluten-containing products. Gluten-free products may be lacking in variety or may not be as accessible as gluten-containing products in some grocery stores. Gluten may also be found in cosmetics, lotions, shampoos, and medications.
Adopting the gluten-free diet is not an easy change. It takes time and dedication. You must pay close attention to food labels. If products state that they are "gluten-free", it means that the manufacturer guarantees that there is no gluten in that food item. If a product does not have a "gluten-free" claim then you must contact the manufacturer directly.
If you have not been diagnosed with celiac disease, it is not recommended that you follow a gluten-free diet. Contact your physician and meet with a Registered Dietitian if you are seeking a healthy and effective weight loss plan. If you suspect that you may have intolerance to gluten or have been diagnosed with celiac disease, contact your physician and meet with a Registered Dietitian to ensure that you are meeting all of your nutrition needs.
1. ADA Nutrition Care Manual. Weight Loss. http://nutritioncaremanual.org/vault/editor/Docs/WtMgmt_WeightLossTips_FINAL.pdf. Accessed February 1, 2011.
2. Celiac disease. ADA Nutrition Care Manual. http://nutritioncaremanual.org/topic.cfm?ncm_heading=Nutrition%20Care&ncm_toc_id=22684. Accessed January 26, 2011
3. Loftus CG, et al. Celiac disease. American College of Gastroenterology. http://www.acg.gi.org/patient/gihealth/celiac.asp. Accessed February 1, 2011
4. Mayo Foundation for Medical Education and Research. Nutrition and healthy eating: Gluten-Free Diet. Accessed February 1, 2011.
5. National Foundation for Celiac Awareness. Dietitian takes on gluten-free weight loss rumors. http://www.celiaccentral.org/News/News-Feeds/Celiac-in-the-News/Celiac-in-the-News/161/pg__1/vobId__4303/. Accessed February 1, 2011.
6. Palma GD, Nadal I et al (2009). Effects of a gluten-free diet on gut microbiota and immune function in healthy adult human subjects. British Journal of Nutrition. 102(8): 1154-60.
7. Rossi, M., & Schwartz, K (2010). Celiac disease and intestinal bacteria: not only gluten? Journal of Leukocyte Biology. 87: 749-51.
8. Thompson, T., Lee, A., and Thomas, G. (2010). Gluten Contamination of Grains, Seeds, and Flours in the United States: A Pilot Study. 110, 937-940.
|
<urn:uuid:9caf150c-79cf-4d8d-a04c-ef28c85a124b>
|
CC-MAIN-2016-26
|
http://www.uwhealth.org/nutrition-diet/the-reality-behind-gluten-free-diets/31084
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783408828.55/warc/CC-MAIN-20160624155008-00186-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.934528 | 1,445 | 2.765625 | 3 |
More followed, and it had become apparent that there was a real need for a book publishing arm of the Naval Institute. In 1898, the Board of Control made the decision that is today celebrated as the official beginning of the Naval Institute Press. The first book not produced as a hermaphrodite version of Proceedings appeared the following year as The Log of the Gloucester and was advertised as "the Official Report of the Principal Events of her Cruise during the Late War with Spain, including the destruction of the Spanish Destroyers, the Rescue of Admiral Cervera, and her famous capture of Guanica." The price for this inaugural hardcover book was $1.50. In 1902, what was to become the Naval Institute's all-time best-seller debuted. Virtually every Sailor who has gone to sea for most of the last century has done so with a copy of The Bluejacket's Manual— now in its 22nd edition—in his or her seabag.
For many years, the books published by the Naval Institute Press were designed specifically as texts for use by Naval Academy midshipmen, earning the Naval Institute the title of "University Press for the U.S. Naval Academy."
Typical titles serving as textbooks and manuals included such subjects as Notes on Steam Engineering, Ship and Gun Drills, Hydromechanics, and Grammatical Notes. Many of these early books succumbed to the vicissitudes of time and technological development, whjle others adapted and endured. An interesting case in point is The Manual of Wireless Telegraphy that first appeared in 1906 and survived for decades while evolving through eight editions into Robison's Manual of Radio Telegraphy and Telephony. An Aid for Executive and Division Officers, which included "Watch, Quarter, and Station Bill forms on paper especially tough to withstand erasures," eventually became The Division Officer's Guide and is still updated and published to this day.
These professional books were joined by many others over the years, and one would be hard pressed to find a ship in the Navy that did not owe some of its displacement to the presence of Naval Institute Press books. Among the many important titles that have contributed to the professionalism of the sea services are The Man-of-War's Man's Manual, The Watch Officer's Guide, Dutton's Navigation and Piloting, The Marine Officer's Guide, Handbook for Marine NCOs, The Coast Guardsman's Manual, The Naval Engineer's Guide, Crenshaw's Naval Shiphandling, The Naval Aviation Guide, and Farwell's Rules of the Nautical Road. A sea-service reference library is incomplete without such Naval Institute Press titles as Naval Terms Dictionary, Service Etiquette, Dictionary of Military and Naval Quotations, and Naval Ceremonies, Customs, and Traditions.
No experienced operations or staff officer is unfamiliar with The Ships and Aircraft of the U.S. Fleet (begun in 1939 by James C Fahey and carried on today by Norman Polmar) and Combat Fleets of the World by A.D. Baker III. These books and others, such as World Naval Weapons Systems by Norman Friedman and World Military Aviation by Rene Francillon, are works that should have been produced by the Navy but never were. They provide up-to-date, user-friendly, unclassified data-essential to serious naval professionals who must make important decisions or who just want to stay on top of their profession. In a similar vein, Dr. Friedman's series of Illustrated Design Histories are incomparable in tracing the development and understanding the complexities of the various combatant types that have been the mainstay of the Navy in modern times.
Like Proceedings and the seminars, the Press has served as a vehicle for members of the profession to formulate, debate, and implement policy. Because of the time involved in their production, books are less conducive to a dialogue than are magazines and seminars. But what they lack in timeliness, they more than recoup in depth. Often, they provide the background or the basis for a debate and therefore serve as an important component of an open forum. In 1988, the Naval Institute Press introduced the Classics of Sea Power series, which resurrected such seminal discussions of strategic thought as Sir Julian Corbett's Some Principles of Maritime Strategy, J. C. Wylie's Military Strategy: A General Theory of Control, and C.E. Calwell's Military Operations and Maritime Preponderance: Their Relations and Interdependence. These revived works are essential reading for those who would understand the origins and development of maritime strategy and the policies that support it.
How Navies Fight: The U.S. Navy and Its Allies, by Frank Uhlig, Jr., presents a comprehensive mosaic that puts naval forces in their proper perspective by relying—as Alfred Thayer Mahan once did—on historical precedent and example. By reviewing and analyzing the roles played by the U.S. Navy in the development of this maritime nation, this encyclopedic work serves both the neophyte and the seasoned strategist as the forerunner of a meaningful debate.
A more detailed look at a specific aspect of U.S. naval strategy can be found in Edward S. Miller's War Plan Orange: The U.S. Strategy to Defeat Japan, 1897-1945. Praised by former Secretary of the Navy John Lehman as "the most important book on military strategy published in years," and described by former Chairman of the Joint Chiefs of Staff, Admiral William J. Crowe Jr., as "a must read for historians, strategists, military planners, and students," this seminal work is an illuminating blueprint of U.S. strategic planning for the Pacific campaign in World War II.
Naval strategic planning and implementation in the Cold War years are the subjects of several books that appeared during that 40-plus-year "conflict." The U.S. Navy was a key component of that ideological clash and, by describing how that service adapted to a changing strategic situation in an era characterized by revolutionary technological development and a changing national security establishment, Michael Palmer's Origins of the Maritime Strategy: The Development of American Naval Strategy 1945-1955 provided the necessary background for further strategic development. By questioning the established wisdom regarding the Soviet threat, Robert Waring Herrick's groundbreaking book, Soviet Naval Strategy, stoked the fires of what proved to be a critical debate.
Admiral William A. Owens's High Seas: The Naval Passage to an Uncharted World added a readable and insightful discussion to the Navy's struggle for its identity and future course in the last decade of this century. Captain Wayne P. Hughes Jr. served the great debate on a different level by producing his stimulating treatise, Fleet Tactics: Theory and Practice in 1986. And an enlightening foray into the emerging world of joint operations was provided by Joint Air Operations: Pursuit of Unity in Command and Control, 1942-1991 , by retired Navy Rear Admiral James A. Winnefeld and Dana J. Johnson. Entering the prickly realm of combat ethics and the Law of War, Gary Solis's highly acclaimed Son Thang: An American War Crime tackled a difficult subject in 1997. Former Secretary of the Navy and well-known combat veteran James Webb wrote, "Gary Solis is one of the few writers today with the background and the narrative ability to bring both criticism and perspective to incidents that caused civilian deaths in the Vietnam War."
One of the earliest historical works published by the Press appeared in 1920 —The Yankee Mining Squadron or Laying the North Sea Mine Barrage— and was more memoir than history, having been written by the naval officer, Captain Reginald Belknap, who had supervised the operation in the last year of World War I.
We Build a Navy— ahistory of the origins of the U.S. Navy, from Revolutionary War days through the War of 1812—appeared in 1929 and was the first in a series of books by Holloway H. Frost. Other works produced by this career naval officer included The Battle of Jutland and On a Destroyer's Bridge, Frost's works were a part of the Naval Institute Press catalog for many years, and when he died in 1935, it was said that the Navy had at last been "deFrosted."
In 1937, Admiral William L. Rodgers's Greek and Roman Naval Warfare appeared and was followed three years later by Naval Warfare Under Oars. These books became classics and are in the Naval Institute Press catalog today. In the early 1950s, Theodore Roscoe, too, produced a pair of comprehensive and superbly illustrated (by Fred Freeman) works —United States Submarine Operations in World War II and United States Destroyer Operations in World War II —that are still in print.
In the last several decades, hundreds of significant works have been added to the pantheon of historical works published by the Naval Institute Press. Rowena Reed's Combined Operations in the Civil War not only serves the historian and the popular audience interested in that period of U.S. history, but it also provides an excellent foundation for those whose current bent is joint warfare operations. Paul Stillwell's The Golden Thirteen is a testament to the pioneering courage of a handful of African Americans who paved the way for a better Navy and a better nation by bridging the racial divide in the officer corps. Kemp Tolley's Yangtze Patrol, Clark Reynolds's The Fast Carriers, Paul Dull's The Imperial Japanese Navy, Victor Krulak's First to Fight, Tyrone Martin's A Most Fortunate Ship, Joseph Alexander's Utmost Savagery, and a host of other works uniquely scrutinize particular incidents, operations, or campaigns.
Guardians of the Sea: History of the United States Coast Guard by Robert Erwin Johnson and Soldiers of the Sea: The United States Marine Corps by Robert Debs Heinl Jr. focused on the comprehensive histories of the Navy's sister services, while the history of the Navy has been covered in a variety of ways by the likes of Nathan Miller (The US. Navy: A History), Craig Symonds (Historical Atlas of the US. Navy) and Jack Sweetman (An Illustrated Chronology of the US. Navy and Marine Corps).
Over the years, many biographical works have emerged from the Naval Institute Press. Some of the earliest biographies were written by Naval Academy Professor Charles Lee Lewis, whose first work —Matthew Fontaine Maury— the Naval Institute published in 1927. He followed that with a two-volume biography of David Glasgow Farragut that remained in print for many years as the definitive work on that subject. And his final work —Admiral de Grasse and American Independence— appeared in 1945, at a time when the career of another soon-to-be biographer was just beginning. E. B. Potter's biographies of Admirals Chester Nimitz and William Halsey were published in 1976 and 1985 respectively, and both remain in print today.
For those figures whose contributions may not lend themselves to full-length books, a number of useful "mini-biographies," written by appropriate authorities, have appeared in essay collections edited by prominent historians. Robert W. Love, Jr.'s The Chiefs of Naval Operations and Paolo Colleta's American Secretaries of the Navy are excellent examples.
Memoirs bridge the gap between recorded fact and human emotion and thereby breathing life into history.
The reality of the ground war in Korea is depicted graphically in Joseph R. Owen's front-line account, Colder Than Hell: A Marine Rifle Company at Chosin Reservoir.
Samuel Hynes's Flights of Passage was well received among critics for its unusually lyrical style, which lent a poetic element to the mundane aspects of a young man's coming of age in the midst of a world war.
Among the very best and in some ways the most relevant memoirs are those written by the so-called "troops," those Sailors and Marines who must man the guns, "hump the loads," and stand the watches. Alvin Kernan's Crossing the Line tells the story of aerial and shipboard combat in World War II from the view of an enlisted back-seat gunner. His account is full of grit and humor and is masterfully told. Battleship Sailor, "We Will Stand by You," and Rendezvous with Destiny comprise an excellent trilogy of Theodore Mason's experiences as an enlisted man in World War II.
For most of its 125 years the Naval Institute considered fiction to be uncharted waters, but beginning in 1984 Tom Clancy's The Hunt for Red October and Stephen Coonts's Flight of the Intruder in 1986 changed all that. Both novels climbed to the best-seller lists and forever broadened the editorial policy of the Naval Institute.
A less celebrated but important contribution emerged in the form of a new translation of Jules Verne's classic 20,000 Leagues Under the Sea, a fiction classic that was first published the year the Naval Institute was founded. This version corrects literally hundreds of errors that have long been included in the standard English version and restores a lost 23% of the novel.
One of the most successful endeavors of the Naval Institute Press has been its use of several special series of books. The Classics of Naval Literature series has resurrected many important titles that would have been lost to all but the most ardent library and used-bookstore miners. Through this series, great fiction, revealing memoirs, important hi stories, and various other titles have been brought back; into print and produced in quality bindings designed to last. Herman Wouk's The Caine Mutiny and Edward L. Beach's Run Silent, Run Deep are two excellent examples.
In a similar vein, the Bluejacket Books series has brought back many titles that would otherwise be extinct, but the emphasis here is upon economy rather than durability. These inexpensive paperbacks have revived gems such as Vice Admiral James Calvert's Surface at the Pole and astronaut Wally Schirra's memoir (with Richard N. Billings), Schirra's Space.
The Naval Institute Press is moving into the next century by producing CD-ROMs and audio books. Its presence can be seen in a number of high-quality feature movies and television programs, and it is alive and well in the cyber-world of the Internet. It is unlikely that those original founders would be entirely comfortable in the Naval Institute of today, but they would no doubt be proud.
Author of numerous Proceedings and Naval History contributions and two Naval Institute Press books —Brown Water, Black Berets: Coastal and Riverine Warfare in Vietnam and The 22nd Edition of The Bluejacket's Manual— Mr . Cutler served as the magazine's Books of Interest columnist for 13 years. In 1997, after a career in the Navy including enlisted and commissioned service, he became the organization's Associate Director of Membership and Development.
|
<urn:uuid:9ce8508e-ecc9-4b49-b8e7-c57610cf09b1>
|
CC-MAIN-2016-26
|
http://www.usni.org/magazines/proceedings/1998-10/100-years-naval-institute-book-publishing
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783391766.5/warc/CC-MAIN-20160624154951-00049-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.961613 | 3,035 | 2.671875 | 3 |
Tristagma is a mostly South American genus in the Alliaceae family that is related to Nothoscordum and Ipheion. The taxonomy of this genus is in question. This genus has leaves that are usually linear and flat, rarely canaliculate, terete of filiform. Many of the species are from Chile and Argentina and are alpine plants. In 1963 Hamilton P. Traub proposed moving Ipheion to Tristagma. Although not everyone is in agreement, this seems to be widely accepted at the moment. The plants previously included in Ipheion are mostly from Argentina and Uruguay but with one flowered inflorescences unlike some of the original species in this genus which are multi-flowered. They have leaves that smell like onions when crushed. Although they are dormant in summer in the wild, many of them grow in areas with year round rainfall and may benefit from some summer moisture. The species most often grown is Tristagma uniflorum (syn. Ipheion uniflorum) from Argentina. There are many selections of this species and you will see it listed on the web both ways. Until there is more study of all these plants, we are placing them on the wiki page with the names that our South American members Alberto Castillo and Germán Roitman suggest. Many of the yellow flowered species that are still considered Ipheion species by some who do not agree with Traub can be found on our Nothoscordum wiki page.
Tristagma bivalve (Lindl.) Traub syns. Ipheion bivale (Lindl.) Traub grows in the mountains above Santiago, Chile. It can be grown like a Cape bulb or better as a Texan Cooperia. T. bivalve looks like a several flowered medium sized Ipheion uniflorum. This species is not to be confused with Nothoscordum bivalve which is an entirely different plant that has a tall scape with minute flowers. Photo by Osmani Baullosa.
Tristagma hirtellum (Kunth) Traub, see Nothoscordum hirtellum
Tristagma 'Jessie' is a seedling of 'Rolf Fiedler' obtained by Tony Hall of Kew and named for his late sister, Jessie. 'Jessie' has the deepest blue flowers. Jane McGary writes 'Jessie' is indeed a remarkable color, a real gentian blue, very like the color of Commelina dianthifolia. Photo 1 of the flower was taken by Mary Sue Ittner. Photos 2 through 6 from M. Gastil-Buhl show the bulbs on a 1 cm grid, the color compared to blue painters tape, the underside tepal markings and blooms in March 2012. The bulbs multiply with up to a dozen offsets attached as shown in photo 6 on a 1 cm grid.
Tristagma recurvifolium (C.H.Wright) Traub is from Uruguay. It was originally named in 1915 by C.H. Wright as Brodiaea recurvifolia. It is listed as a synonym in the Kew checklist for Tristagma sessile (Phil.) Traub. See below for notes on that species for the confusion of what name to use for the photos below. Whatever the correct name should be, this species has white flowers and blooms in early winter, increasing well by offsets. Photos by John Lonsdale of plants originally known as Ipheion sessile.
Tristagma 'Rolf Fiedler' This is an unnamed species. It is a narrow endemic from Uruguay. So far it has been found on two hill tops after many years of being a plant of unknown origin. As those who have grown this and Tristagma uniflorum have found them to be very different. Moreover, they grow in the same region of Uruguay and over there they look different. This plant has bright blue flowers. This is another plant in this complex that is controversial. Some feel Rolf Fiedler is really Tristagma peregrinans P. Ravenna but this plant has not been verified by anyone except for the person who named it. It has not been found and the drawing submitted with the naming of this plant shows bulbs that look very different than the plant in cultivation. Photos by Sheila Burrow, Jay Yourch, John Lonsdale and David Pilling. Photo 5 shows bulbils appearing at the end of the growing season and photo 6 seed.
Tristagma sellowianum (Kunth) Traub, see Nothoscordum felipponei
Tristagma sessile (Phil.) Traub is listed in Kew as the accepted name for Ipheion sessile. But our South American authority says the correct name for what has been known as Ipheion sessile in the past should be Tristagma recurvifolium. IPNI lists this species as originally named by Philippi in 1858 (as Triteleia sessilis) who named plants from Chile. When Traub renamed it to Ipheion sessile (Phil.) Traub in 1953 and then to Tristagma sessile (Phil.) Traub in 1963 he was clearly using a record of a plant from Chile. The data bases that now list Tristagma sessile as the correct name list it as a species native to Uruguay. It's all very confusing.
Tristagma sp. is an alpine species from Chile different from T. bivalve. It has scentless flowers that are shaped like a narrow cup facing up. Photo by Osmani Baullosa.
Tristagma uniflorum (Lindl.) Traub, syn. Ipheion uniflorum, is still known by many under the synonym. It is native to Argentina and Uruguay. It has starry flowers and blooms over a long period in spring. This plant has naturalized in many parts of the world. Photos 1-2 taken by Mary Sue Ittner of plants growing in her garden. Photos 4-5 taken by Travis Owen show a form sold as "Ipheion uniflorum" with dark purple midveins. Photo 4 shows the flower closed at night. Photo 5 of seed by David Pilling.
Tristagma uniflorum 'Charlotte Bishop' is a form with large pink flowers.
Tristagma uniflorum 'Froyle Mill' is a selection with purple flowers. The first two photos by Mark Mazer.
Tristagma vittatum (Griseb.) Traub, see Nothoscordum vittatum
|
<urn:uuid:793a157e-adf2-48e1-83ac-c3505a4bc3dd>
|
CC-MAIN-2016-26
|
http://www.pacificbulbsociety.org/pbswiki/index.php/Tristagma
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395560.69/warc/CC-MAIN-20160624154955-00132-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.953977 | 1,425 | 2.71875 | 3 |
The alcohol abuse effects on teens are innumerable and perilous. Drinking is becoming a seriously destructive habit with the youngsters. There are extensive researches, studies and latest published reports to prove that around 40% of the youth populace initiate alcohol drinking by the time they are merely 15. It is proven that these teens have a severe tendency to develop alcohol dependency in their lifetime. This is not all. There are other startling statistics available. One of the recent studies on the alcohol abuse effects on teens reflect, that teenagers that drink habitually by the time they turn 14, risk a 50/50 likelihood of becoming an alcoholic in their adulthood.
In contrast, only 9% of the individuals who begin drinking when they are 21 years or above have a chance of developing alcoholism during some point in their lifetime. It can be concluded that the alcohol abuse effects on teens depend on the age of initiation of drinking. The earlier they start, the higher the chance of becoming an alcoholic later in life. This is of course a frightening statistics. Unfortunately, everyday the number is increasing.
Alcohol dependency is not the only problem among the major alcohol abuse effects on teens. In fact teenagers that have serious drinking problems have much higher tendency of smoking cigarettes and/or drug abuse. This practice can directly lead to another lifelong habit of substance abuse and addiction. This can severely damage the quality of life and permanently prevent the person from leading a healthy and happy life. Alcoholism is often blamed to be the precursor of depression and various mental illnesses, teens should stay away from this fatal habit at any cost.
To find an end to the alcohol abuse effects on teens the victims should choose an appropriate solution to safeguard them from a life of alcoholism. The solution depends on the individualâs family atmosphere, social environment and different aspects. The treatment of alcoholism should begin with the teenagers and children being told and made conscious about the alcohol abuse effects. Parents, authorities and peers should keep an eye on alcohol and drug abuse. To minimize the alcohol abuse effects on teens they must communicate through the listing on the menu bars. The parents should be sympathizing enough to participate in one on one discussion about the deadly effects of alcohol abuse.
Drinking is accepted as a part of this culture. So, we take time to realize the alcohol abuse effects on teens. It is already late when they become alcohol dependent. Alcoholic individuals run a major risk of different health problems. And in most of the cases the alcohol abuse effects on teens lead to mental and dangerous behavioral traits. The effects pose different kinds of detrimental side effects on the teensâ growing bodies and developing brain. Early age alcohol consumption can severe long term effects such as weak hand and eye coordination, memory loss, pancreas inflammation, cancer, cirrhosis and stroke among others. The alcohol abuse effects on teens have more implications like drunken driving, car accident, depression as well as contracting different sexually transmitted diseases as a result of dangerous sexual behavior.
According to researches done by the National Institute of Health, drinking is the substance of choice among young people. Among 12 to 20 years old, around 18% of the total population admit to engaging in binge drinking and 6% in heavy drinking. Underage drinking is a big factor in teenage death, injuries, and risky behavior such as sexual promiscuity, violence, and others.
There comes a point in teens' lives when parents feel that their influence is considerably less important than it used to be. While it's true that there are many strong influences in teens' lives, the influence of their parents still play an important part on how they will form their own decisions. Teens are always looking at parents' words, decisions, and actions. They take cues from this along with other strong influences coming from peers and other role models.
Whether teens will end up struggling with alcoholism down the line often relies on how parents respond to discovering their teens' underage drinking.
DO recognize that a sugar addiction often leads into a alcohol addiction. If you are addicted to sugar your body is getting it from a variety of sources, including alcohol. So, what you THINK is a temptation to drink alcohol is OFTEN just your body craving sugar.
|
<urn:uuid:1daaf6c5-ec4d-45da-bc71-132e1b612704>
|
CC-MAIN-2016-26
|
http://ehealthforum.com/health/alcohol-abuse-effects-on-teens-t236259.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398869.97/warc/CC-MAIN-20160624154958-00037-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.952738 | 844 | 2.671875 | 3 |
A poem that illustrates Stevens’s growing preoccupation with the hero and the nature of heroism, “Chocorua to Its Neighbor” features a mountain discussing the human hero myth. “Chocorua” consists of twenty-six five-line stanzas of blank verse, and it develops the definition of the heroic through images from alchemy. The creation of the hero, then, is a mystical process, like the transmutation of the base metals into gold. Like alchemy, the creation of the hero is really a process of self-refinement.
The poem begins with an indication of the mountain’s perspective. The mountain has the detachment of distance, of objectivity, of largeness. Armies and wars are perceived as mass movements of numbers, not as individual soldiers in combat. A war is “A swarming of number over number, not/ One foot approaching, one uplifted arm.”
Nevertheless, there is a “prodigious shadow” which represents humankind, visible on the mountain. It is “the self of selves” who is represented (in section 5) as a quintessence, or alchemical fifth essence, through references to the four elements of earth, air, fire, and water and to the “essay,” a vessel for the transmutation. The figure is “the glitter of a being,” half perceived, the blue “of the pole of blue/ And of the brooding mind”—that is, half real, half imagined. This figure speaks, explaining “the enlarging of the simplest soldier’s cry/ In what I am, as he falls.” That is, the mythic human gives meaning to an individual life. The soldier’s death has its significance because of this central human.
The man-myth doubts its own reality in...
(The entire section is 674 words.)
|
<urn:uuid:80d235e0-ceba-4567-96d3-78434471de91>
|
CC-MAIN-2016-26
|
http://www.enotes.com/topics/chocorua-its-neighbor
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396872.10/warc/CC-MAIN-20160624154956-00025-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.944221 | 407 | 3.0625 | 3 |
An example of runout tolerance is shown below. In the top figure the runout symbol is applied to the angled surface. The boxed symbols can be read "each circular element of this surface must have full indicator movement (FIM) of less than 0.1 relative to datum A". The bottom figure shows a sample measurement taken at one cross section, but multiple measurements are required to verify runout. Note that the indicator is applied perpendicular to the measured surface, and that this tolerance controls only individual circular elements and not the whole surface simultaneously (see total runout).
|
<urn:uuid:f30938da-3b43-4454-a210-354e4b6246d8>
|
CC-MAIN-2016-26
|
http://www.emachineshop.com/machine-shop/Runout/page607.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396945.81/warc/CC-MAIN-20160624154956-00048-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.890169 | 115 | 3.03125 | 3 |
|International Vegetarian Union (IVU)|
| IVU News|
Playing God The Horrors of
Biotechnology can now cross animals with plants, leaving the vegetarian confused. The scientific world today has the power to alter the very fabric of nature, not only by transferring characteristics between plants, but by cross-altering animals, plants and human beings. Genetic engineering, which is without ethical limitation, has a serious impact on the environment of animals and plants. It violates our relationship with the natural world. Most people believe that animals have a right to live their lives free from human interference with their original genetic structure. Also, animals can never serve as models of human disease because they are much too different. But scientists still keep trying after all, the human transplant market is worth well over $6 billion per year!
Biotechnology in recent years has been progressing by leaps and bounds. It represents a quantum leap in the exploitation of animals, allowing humans to move genes from one species of animal into another totally different species. Scientists and biotech companies in some major countries of the world want to create new animals which will produce more and better meat, give valuable products such as wool more easily, and have organs that can be used in human transplants. And it doesnt stop there: many of the genetically modified crops now being field-tested in the United States and around the world could not only have a devastating Jurassic Park type impact on the global eco-system, but could also hit agriculture-based third-world economies dependent on cash crops. Genetic engineering is a one-dimensional reductionist science which ignores the wider dynamics of life systems.
Genetic engineering primarily involves the introduction of genes containing DNA (dioxyribonucleic acid) procured from humans or animals into the cells of bacteria, yeast or other animals. One of the outcomes is termed a transgenic animal. These transgenic animals cannot be bred by natural/traditional selection or artificial insemination.
Donor females are given hormone injections and hormone-impregnated sponges are also inserted directly into their reproductive tracts, so as to make them produce lots of egg cells. This process has been termed super-ovulation. The eggs are then artificially inseminated either manually or surgically. Next the embryos are collected by further surgery or slaughter. The embryos are then injected with foreign DNA containing genes for preferred traits, and then transferred into foster mothers, again by surgery. It takes 80 donor and recipient animals to produce just one transgenic cow if everything works perfectly, which is very rare. Once the transgenic animal has been produced, its suffering begins: for example, non-porcine genes have been added to pigs, producing animals with gastric ulcers, liver and kidney disorders, lameness, damaged eye-sight, loss of co-ordination, susceptibility to pneumonia and diabetic conditions.
Genetic engineering research is most often carried out on animals such as mice, pigs, sheep, other farm animals and fish, as well as on plants such as tomatoes, tobacco and corn.
Vegetarians around the world are seriously wondering whether the food they are eating is actually vegetarian. In the case of the Flavr Savr tomato, as they are usually called, the tomatoes are genetically altered by introducing genes from a fish, the Arctic flounder, so as to reduce freezer damage and give them a longer shelf-life, to make them ripen longer on the tree while remaining firm at the time of picking and transportation, and to make them bigger and tastier as well. No layman can tell the difference between Flavr Savr and a normal tomato, which is primarily why staunch vegetarians want the altered tomatoes labelled.
Other such experiments with vegetables include chicken genes introduced into potatoes for resistance to disease and to increase shelf-life and size, tobacco altered with mouse genes to reduce impurities, or with a gene from fire-flies which makes the leaves glow at night. Some biotechnologists go to such lengths that playing around with the genes of animals becomes a game for them. This might result in some ghastly creature produced just to satisfy someones whims and fancies. Scientists in the U.S. have bred a mouse called the oncomouse, which has been genetically engineered to develop cancer and in due course to die a slow and painful death. The first oncomouse was bred in 1981; yet 15 years later a cure for cancer still seems to elude scientists. Genetic engineering on mice does not stop there. A mouse specially created to lack an immune system has been used to grow human organs, such as ears, externally and even internally. The absence of an immune system ensures that the mouse will not reject human tissue.
Scientists make a look-alike mould of a human organ, such as an ear, with biodegradable polyester fabric or other polymers. They then transfer the bone/muscle cells into the form and transplant it on to the mouse. When ready, the organ is grafted from the mouse, who somehow manages to remain alive after the ear is removed.
Similarly, scientists have managed to grow liver, skin, cartilage, bone, ureters, heart valves, tendons, intestines, blood vessels and breast tissue with such polymers. But if the idea of reversing the experiment (replacing the mice with humans) were contemplated, people would call it blasphemous. There is no thought for the animals involved. The extent to which these experiments will go is uncertain. A change will only come about when scientists acknowledge the animals right to live a normal healthy life without man tampering with their genes.
Pigs are also grown transgenically so that their organs can be transplanted into humans. Transgenic pigs were first produced in 1985. Scientists have succeeded in making the required organs in pigs capable of producing human cells. These proteins, they hope, will trick the human immune system while transplanting the organ(s) so that the recipient does not react to the foreign tissue.
Another example is that of sheep which have been injected with hormones bioengineered to cause wool-shedding so as to produce the so-called self-shearing sheep. This is done in Australia where, unfortunately for the sheep, the climate is mostly hot and sunny. As a result, some sheep experience an increased rate of abortion. Where on earth will it all end? Talking of sheep, Welsh mountain clone sheep are living proof that life can be created without sperm. A scientist at Rosalin Institute created them by fusing a cell grown in the laboratory with an empty sheep-egg through a spark of electricity. Imagine growing a sheep in a lab dish! Ironically, when pondering about doing the same with human beings, scientists find it unethical.
In another bizarre experiment, Indian scientists at the Nimbalkar Research Institute, Phaltan, Maharashtra, have created, by artificial insemination, an animal with the head of a goat and the body of a cow. This animal grows fatter faster and the volume of meat is therefore increased.
Scientists claim that they can and will make genetically altered animals that will help cure human diseases and illnesses. Transgenic research has been going on for nearly 20 years, but it still has not cured a single human illness, although illnesses such as diabetes, blindness, lameness and cancer (among others) have all been produced unexpectedly in animals subjected to these ridiculous experiments. Genetic engineering going to lengths such as these is a symbol of consumerism gone berserk. Is it really fair that animals and their environment should bear the brunt of our insatiable curiosity?
[Reprinted from Compassionate Friend published by Beauty Without Cruelty, India]
|
<urn:uuid:9b95d27b-9a28-49fb-ab69-54ed17e11d07>
|
CC-MAIN-2016-26
|
http://ivu.org/news/2-97/genetic.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395620.9/warc/CC-MAIN-20160624154955-00018-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.959976 | 1,568 | 2.515625 | 3 |
Classics > Poetry > Shakespeare's Plays > The Famous History of the Life of Henry the Eighth > Act I
Hautboys. A small table under a state for Cardinal Wolsey, a longer table for the guests. Then enter Anne and divers other Ladies and Gentlemen as guests, at one door; at another door, enter Guildford
Ladies, a general welcome from his grace Salutes ye all; this night he dedicates To fair content and you: none here, he hopes, In all this noble bevy, has brought with her One care abroad; he would have all as merry As, first, good company, good wine, good welcome, Can make good people. O, my lord, you're tardy:
Enter Chamberlain, Sands, and Lovell
The very thought of this fair company Clapp'd wings to me.
Sir Thomas Lovell, had the cardinal But half my lay thoughts in him, some of these Should find a running banquet ere they rested, I think would better please 'em: by my life, They are a sweet society of fair ones.
Sweet ladies, will it please you sit? Sir Harry, Place you that side; I'll take the charge of this: His grace is entering. Nay, you must not freeze; Two women placed together makes cold weather: My Lord Sands, you are one will keep 'em waking; Pray, sit between these ladies.
By my faith, And thank your lordship. By your leave, sweet ladies: If I chance to talk a little wild, forgive me; I had it from my father.
O, very mad, exceeding mad, in love too: But he would bite none; just as I do now, He would kiss you twenty with a breath.
Well said, my lord. So, now you're fairly seated. Gentlemen, The penance lies on you, if these fair ladies Pass away frowning.
Hautboys. Enter Cardinal Wolsey, and takes his state
You're welcome, my fair guests: that noble lady, Or gentleman, that is not freely merry, Is not my friend: this, to confirm my welcome; And to you all, good health.
My Lord Sands, I am beholding to you: cheer your neighbours. Ladies, you are not merry: gentlemen, Whose fault is this?
The red wine first must rise In their fair cheeks, my lord; then we shall have 'em Talk us to silence.
Yes, if I make my play. Here's to your ladyship: and pledge it, madam, For 'tis to such a thing,—
Drum and trumpet, chambers discharged
What warlike voice, And to what end is this? Nay, ladies, fear not; By all the laws of war you're privileged.
A noble troop of strangers; For so they seem: they've left their barge and landed; And hither make, as great ambassadors From foreign princes.
Good lord chamberlain, Go, give 'em welcome; you can speak the French tongue; And, pray, receive 'em nobly, and conduct 'em Into our presence, where this heaven of beauty Shall shine at full upon them. Some attend him.
Exit Chamberlain, attended. All rise, and tables removed
You have now a broken banquet; but we'll mend it. A good digestion to you all: and once more I shower a welcome on ye; welcome all.
Hautboys. Enter King Henry VIII and others, as masquers, habited like shepherds, ushered by the Chamberlain. They pass directly before Cardinal Wolsey, and gracefully salute him
A noble company! what are their pleasures?
Because they speak no English, thus they pray'd To tell your grace, that, having heard by fame Of this so noble and so fair assembly This night to meet here, they could do no less Out of the great respect they bear to beauty, But leave their flocks; and, under your fair conduct, Crave leave to view these ladies and entreat An hour of revels with 'em.
Say, lord chamberlain, They have done my poor house grace; for which I pay 'em A thousand thanks, and pray 'em take their pleasures.
They choose Ladies for the dance. King Henry VIII chooses Anne
Pray, tell 'em thus much from me: There should be one amongst 'em, by his person, More worthy this place than myself; to whom, If I but knew him, with my love and duty I would surrender it.
Whispers the Masquers
Such a one, they all confess, There is indeed; which they would have your grace Find out, and he will take it.
Let me see, then. By all your good leaves, gentlemen; here I'll make My royal choice.
Ye have found him, cardinal:
You hold a fair assembly; you do well, lord: You are a churchman, or, I'll tell you, cardinal, I should judge now unhappily.
An't please your grace, Sir Thomas Bullen's daughter— The Viscount Rochford,—one of her highness' women.
By heaven, she is a dainty one. Sweetheart, I were unmannerly, to take you out, And not to kiss you. A health, gentlemen! Let it go round.
Lead in your ladies, every one: sweet partner, I must not yet forsake you: let's be merry: Good my lord cardinal, I have half a dozen healths To drink to these fair ladies, and a measure To lead 'em once again; and then let's dream Who's best in favour. Let the music knock it.
Exeunt with trumpets
|
<urn:uuid:71a79ef6-e420-4532-a1cb-b773fcbf549c>
|
CC-MAIN-2016-26
|
http://www.infoplease.com/t/lit/shakespeare-plays/henryVIII-act1-4.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783400031.51/warc/CC-MAIN-20160624155000-00055-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.94619 | 1,197 | 2.796875 | 3 |
|Stephanie Chu (left) and Jennifer Henry of Beattie Elementary School, Fort Collins, Colorado, study air pressure at a workshop cosponsored by LEARN and the University of Colorado's Science Discovery Program. (Photo by Carlye Calvin.)|
Participants in LEARN need to have a high level of interest and commitment, the ability and desire to take on leadership roles, and--since the teachers will come to Boulder for three weeks for each of the next three summers--the ability to be absent from the daily demands of other occupations, such as farming and ranching.
The first phase of Project LEARN--also sponsored by NSF--trained 39 teachers from four states from 1992 to 1995. There were some rural participants, primarily from North Carolina, but the majority came from urban areas (see UCAR Quarterly, Winter 1994-95). The curriculum for the new LEARN group will build on the three teaching modules the first group produced: atmospheric dynamics, ozone, and cycles of the earth and atmosphere--their impact on climate.
"One of the reasons we decided to go with the more local format this time was so we could do more in-depth follow-up in the districts," explains McLaren. She and her colleagues will visit each participating school district twice, working with an additional 147 teachers beyond the group trained in Boulder. The first, two-day visit will begin with a hands-on workshop for both teachers and children by the University of Colorado Science Discovery Program in collaboration with LEARN. On the second day, an NCAR or UOP scientist will provide more in-depth content and answer questions. Margaret LeMone and Charles Knight of NCAR's Mesoscale and Microscale Meteorology Division have already begun working on these in-district trainings. The second visit, scheduled for the project's second year, will be a day-long session on computer-based technology, including the World Wide Web.
McLaren notes that the inauguration of the Colorado project coincides with adoption of new statewide content standards in January 1997. "The content we're offering really meshes with the state standards, so it should help support the districts," she adds. As schools across the country examine ways to strengthen their earth sciences curriculum, teachers can turn to the LEARN teaching modules for help building their own hands-on, student-centered curriculum in atmospheric sciences. For more information, call 303-497-8107 or visit the Project LEARN Web site.
To order teaching modules, contact NCAR Information Support Services (303-497-1162).
|
<urn:uuid:35baec81-39ab-49bd-8a67-f9d62b97ea1c>
|
CC-MAIN-2016-26
|
http://www.ucar.edu/communications/quarterly/spring97/explorers.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393093.59/warc/CC-MAIN-20160624154953-00045-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.925598 | 530 | 2.84375 | 3 |
USDA Dietary Guidelines 2015: The Sustainable Power Plate
A Recommendation for 2015 Dietary Guidelines for America: The Sustainable Plate
In an effort to promote sustainable eating patterns for optimal health, the Physicians Committee offers a visual guide for plant-based eating patterns. A diet rich in vegetables, fruits, whole grains, and legumes is a scientifically proven approach to help prevent and manage our nation’s largest public health threats: obesity, type 2 diabetes, heart disease, and certain forms of cancer. Additionally, we urge that water replace dairy as the drink of choice.
A diet higher in plant-based foods, such as vegetables, fruits, whole grains, legumes, nuts, and seeds, and lower in calories and animal-based foods promotes personal health and is associated with less environmental impact than the current U.S. dietary patterns, according to the most recent Scientific Report of the 2015 Dietary Guidelines Advisory Committee.
These healthy basics provide the good nutrition you need. Be sure to include a reliable source of vitamin B12, such as any common multiple vitamin or fortified foods.
Dietary Guidelines News:
|
<urn:uuid:f4cc08c0-874d-400e-a2da-9a50fbba7af0>
|
CC-MAIN-2016-26
|
http://www.pcrm.org/health/diets/pplate/dietary-guidelines-usda-sustainable-power-plate
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398516.82/warc/CC-MAIN-20160624154958-00138-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.918094 | 225 | 3.09375 | 3 |
A series by The New York Times about stopgap measures that could limit global warming.
Articles in the Series
New labels listing the carbon dioxide emissions associated with the production of foods are appearing on some grocery items and restaurant menus around the country.October 23, 2009 scienceSeries
Leaks from natural gas pipes are big contributors to climate change. Yet many solutions pay for themselves.October 15, 2009 businessSeries
Electronic devices are the fastest-growing source of power demand in the world, but there is resistance to efficiency.September 20, 2009 businessSeries
In an effort to prevent farmers from cutting down rain forest, environmental groups are offering money.August 22, 2009 scienceSeries
Some homeowners are embracing so-called “cool roofs” that reflect heat as an affordable tool against climate change.July 30, 2009 scienceSeries
Building inefficient homes locks in waste for decades, but construction codes for many states and cities are weak.July 18, 2009 businessSeries
Low-emission buses could greatly reduce heat-trapping gases produced in the developing world’s booming cities.July 10, 2009 worldSeries
Light emitting diodes could decrease carbon dioxide emissions by up to 50 percent in just over 20 years.May 30, 2009 scienceSeries
Scientists say that reducing soot from villages in developing countries is a relatively simple climate fix.April 16, 2009 scienceSeries
Sweden is drawing attention to emissions from food production by requiring new labels and encouraging farmers to adhere to greener standards in order to combat climate change.
In Brazil's breadbasket, Mato Grosso, there are efforts to fight climate change by paying landowners to preserve forests.
Bogotá‘s new public public transportation network, a system of sleek red buses, has improved traffic flow and reduced smog at a fraction of the cost of building a subway.
Ted Van Hyning, director of Event Technology at the Renaissance Hotel in Cleveland, Ohio, represents one of many businesses that are beginning to switch to LED lighting in their establishments.
Soot — also known as black carbon — from millions of villages like Kohlua, India, is emerging as a major source of global climate change.
|
<urn:uuid:362a2f0b-5342-4702-956e-58e8468a8550>
|
CC-MAIN-2016-26
|
http://topics.nytimes.com/top/features/timestopics/series/bydegrees/index.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395166.84/warc/CC-MAIN-20160624154955-00173-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.932395 | 444 | 2.75 | 3 |
What is a A/C?
A/C definition - The abbreviation for air conditioner or air conditioning. An air conditioner can mean any unit that changes the temperature or condition of the air.
Ideal Home Garden Explains
This appliance commonly uses a refrigeration cycle or evaporation cooler to lower the temperature of the air in a certain area. There are two major types of air conditioners: a wall unit and through-wall units. There are also many energy efficient a/c units available on the market that will cut down on energy cost, which in turn will save the consumer money over the long term.
|
<urn:uuid:033a7ef5-cfd6-4735-9bf3-096a39fcf59e>
|
CC-MAIN-2016-26
|
http://www.idealhomegarden.com/glossary/ac/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395548.53/warc/CC-MAIN-20160624154955-00083-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.880293 | 129 | 2.9375 | 3 |
Can social media give a "signal boost" to true social justice?
On Jan. 14—one day after National AMBER Alert Awareness Day—Tumblr, Twitter, and Facebook were flooded with thousands of posts and tweets spreading the word about the disappearance of Nailla Robinson, a 5-year-old abducted from her Philadelphia elementary school by someone claiming to be her mother.
In the middle of the frantic information chain occurring over Robinson, who was later found, Tumblr user lucids-dream raised an alarm of her own: for 15-year-old Callie McDonald, missing from her Florida home for the previous three days. "It would mean a lot to me if you guys reblogged this!" wrote lucids-dream. "She sits next to me in my 6th period and nobody has any idea where she is!"
The reblogs in search of Nailla Robinson? Countless.
The reblogs in search of Callie McDonald? Four.
Many factors influence which kinds of pleas for help get attention on Tumblr—the fabled "signal boost," a term that refers to passing along an item of interest. The unique circumstances of the Robinson abduction made it an event, an urban legend in the making. In McDonald's case, she and another girl went missing together, a likely case of two runaways and hardly something that would invest the average Tumblr user.
Or perhaps it's simply that lucids-dream and the handful of people who stopped to reblog her PSA just didn't have enough people following them.
It's well known that certain news subjects receive more media attention than others, even if the stories are relatively similar. Whether social media can balance out that disparity by giving equal weight to items that would otherwise go unnoticed, however, is a tricky subject. In the case of missing persons, it takes a village to locate a child—and sometimes not even a village is enough. But increasingly, on the Internet, the question isn't how can the village help, but how do you get the village's attention to begin with?
15-year-old Bedria Williams has been missing since Jan. 19. According to a post made by blackandmissing, her family fears that she might have fallen victim to the sex-trafficking industry in Sacramento, Calif., where she was last seen. Williams' sister allegedly contacted the Tumblr account, which broadcasts PSAs for missing African-Americans, to raise awareness:
"So far I have not been able to get our story aired on any station. I was told that they do not cover stories like Bedria’s because she ran away. 4 days after I rec’d that email that news station aired a story about a 14 year old boy who ran away from home, he just happened to be white.”
But while Williams' story, and her sister's plea, have gotten attention, racking up over 6,000 notes in less than 48 hours, hardly any of the other listings posted to blackandmissing in recent months have gotten more than several dozen notes. Daniel McCoy Moses, missing since June 2011—22 notes; autistic teen Chelsea Ramsey-Jones, missing since Jan. 14, 53 notes. Three people who never made it to Shreveport after New Year's: 6 notes.
The question of what to give our attention to in a world, and an Internet, that increasingly clamors for it, is one that marketing departments tend to solve via emotion: If we invest in it emotionally, then we'll buy it, support it, tell other people about it. The problem is that it's impossible in the long run to emotionally invest in everything—even for the scant amount of time it takes you to hit the "reblog" button on Tumblr. The Onion famously coined the term "outrage fatigue" in 2004, which basically boils down to what a lapsed women's rights activist once told me to explain the lapse: "It takes a lot of energy to stay that angry, all the time."
The Internet stays very angry, all the time. Ordinary, everyday injustices don't get any more attention in the midst of a raging sea of online anger than they do in the average police department. Just as with any other Internet project, for a signal boost to go viral, it has to have an edge.
The greater the emotional ploy, the more successful the plea—even if it's fake. On Tumblr and Facebook the proliferation of fake, unsourced, inaccurate, and non-fact-checked posts that still rack up thousands of reblogs, likes, and high volumes of outrage is well documented. These are the modern-day equivalent of the forest of scammers, political hoaxes, and unlikely urban legends that used to proliferate your inboxes before the days of spam filters and savvier modes of Internet etiquette. Among the false posts are a series of fake AMBER Alerts that have been circulating since roughly 2010: The most common has over 300,000 reblogs and prompted at least one user to attempt to make a fact-checking guide: "How to evaluate fake and biased posts on Tumblr."
But posts that urge readers to calm down and practice critical thinking—those seldom get passed on.
The upside is that when enough attention is drawn and a high enough level of investment takes hold, it can yield results, even if only one person is listening. Take the case of Jonnica Ellis, the alias of a woman who allegedly hoaxed a dying cancer victim and his family, all for the sake of getting closer to the Deadliest Catch star she idolized. After reading the story online, a Floridian named Amber McIntosh decided to take action. McIntosh told the Dot that she was "disgusted that somebody could do something like that... I'm pretty good at digging up random and obscure info online, so I just decided that I was going to help find this person."
And she did. McIntosh hacked the social networks of the "Jonnica Ellis" alias, enlisted the help of members of Anonymous, bank employees, and authorities, eventually locating the family whose Facebook photos Ellis stole. IP matches allegedly confirmed the woman behind the hoax, though the victim's family informed the Dot that the police investigation is still underway and no charges have been filed.
Still, while no official justice has been done, on the "Who is Jonnica Ellis?" Facebook page, the families involved have rallied hundreds of outraged supporters of their cause. McIntosh's one-woman efforts may not be enough to bring about prolonged media attention or a full FBI investigation—but it may be enough to validate and provide closure for a grieving family.
Social media's erratic social justice strikes again.
Photo via Aja Romano
|
<urn:uuid:16b42e33-a613-4800-bda3-cf1a736bc710>
|
CC-MAIN-2016-26
|
http://www.dailydot.com/opinion/social-justice-media-signal-boost/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395679.18/warc/CC-MAIN-20160624154955-00107-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.962093 | 1,377 | 2.640625 | 3 |
From 11:00PM PDT on Friday, July 1 until 5:00AM PDT on Saturday, July 2, the Shmoop engineering elves will be making tweaks and improvements to the site. That means Shmoop will be unavailable for use during that time. Thanks for your patience!
Tim is the youngest kid in the Meeker family. His mom and dad own a tavern/shop in colonial America. And his older brother Sam has just joined up with the rebels who are fighting against England.
Tim witnesses a huge fight between his brother and his dad, and Sam runs away. Tim is now left with a big huge question to answer: Does he support the Patriots, like Sam? Or does he prefer the Loyalists, like his father?
When Sam is hiding out in Tom Warrups' hut, Tim discovers that his brother has stolen their dad's gun, the Brown Bess. Tim sure isn't happy about what this war is doing to his family.
One day, once the war is in full swing, a bunch of Rebels come into the tavern to get the Brown Bess. A scared Tim steals it from Sam, but then Sam steals it right back.
Tim still doesn't know which side of the war he's on, but he does want to take part in a war-related adventure. He tries to deliver a letter for Mr. Heron, but fails when Betsy Read gets in the way.
In the fall of 1776, Tim joins his dad on a trip to Verplancks Point, where they trade cattle for goods. Just one thing: Tim and his dad get attacked by cowboys on the way. And then Tim's dad gets captured by cowboys on the way back.
A few months later, Tim watches as the British roll into Redding. He witnesses a skirmish between the Lobsterbacks and the Rebels, but he also gets briefly reunited with Sam.
Tim learns that his dad and his friend Jerry both died on prison ships.
A year and a half passes as Tim and his mom work hard to keep the tavern/shop afloat.
Tim gets to see Sam again, when his troop comes to town.
When Sam is arrested for cow-stealing (even though he's innocent), Tim tries to help his big bro out. All Tim's efforts fail, and he watches as his brother is executed.
After the war, Tim and his mom move to Pennsylvania. He becomes a surveyor, gets married, and has kids. Happy ending? That's for you to decide.
|
<urn:uuid:2a4c1703-09b8-4034-a45c-976d067a1276>
|
CC-MAIN-2016-26
|
http://www.shmoop.com/my-brother-sam-is-dead/tim-meeker-timeline.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397748.48/warc/CC-MAIN-20160624154957-00023-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.988579 | 522 | 2.84375 | 3 |
Whooping cranes are in the midst of their spring migration and sightings will increase as they make their way through North Dakota over the next several weeks. Anyone seeing these birds as they move through the state is asked to report sightings so the birds can be tracked.
Whoopers stand about five feet tall and have a wingspan of about seven feet from tip to tip. They are bright white with black wing tips, which are visible only when the wings are outspread. In flight they extend their long necks straight forward, while their long, slender legs extend out behind the tail. Whooping cranes typically migrate singly, or in groups of 2-3 birds, and may be associated with sandhill cranes.
Other white birds such as snow geese, swans and egrets are often mistaken for whooping cranes. The most common mistake is pelicans because their wingspan is similar and they tuck their pouch in flight, leaving a silhouette similar to a crane when viewed from below.
Anyone sighting whoopers should not disturb them, but record the date, time, location, and the birds’ activity. Observers should also look closely for and report colored bands which may occur on one or both legs. Young whooping cranes were marked during 1975-1988 with colored leg bands to help determine their identity.
Whooping crane sightings should be reported to the U.S. Fish and Wildlife Service office at (701) 387-4397, the North Dakota Game and Fish Department’s main office in Bismarck at (701) 328-6300, or to local game wardens around the state. Reports help biologists locate important whooping crane habitat areas, monitor marked birds, determine survival and population numbers, and identify times and migration routes.
|
<urn:uuid:ec62268e-adef-4e57-8aae-157bb384038d>
|
CC-MAIN-2016-26
|
http://dougleier.areavoices.com/2011/03/28/keep-your-eyes-to-the-sky-for-whooping-cranes/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395613.65/warc/CC-MAIN-20160624154955-00197-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.957956 | 363 | 3.28125 | 3 |
JEFFERSON — In what was said to be the first project of its kind at a public lake in New Jersey, two floating wetland islands were installed in Lake Hopatcong earlier this month in an effort to prevent the spread of algae.
The 250-square-foot islands, made up of a woven recycled plastic material that floats, mimic naturally occurring wetland islands and hold plants that remove the chemical element phosphorous from the lake.
That makes less phosphorous available to spur “nuisance aquatic plant growth and algae,” explained Fred Lubnow, a limnologist, or fresh water scientist, with the consulting firm Princeton Hydro, which has frequently worked on water quality projects at Hopatcong.
Mat algae exacerbate the weed problem at Lake Hopatcong by making it “difficult to navigate through. You want your water bodies to be swimmable and fishable,” noted Donna Macalle-Holly, grants and project coordinator for the Lake Hopatcong Foundation.
In addition, an overabundance of algae is “bad for the health of the lake” because it reduces the supply of oxygen, making life difficult for fish, Macalle-Holly said.
“Everything in the lake could die off” with too much algae, weeds, water chestnuts and other nuisances, Macalle-Holly said.
Each island is expected to remove about 10 pounds of phosphorous annually, which is significant because one pound of phosphorous can generate as much as 1,100 pounds of algae biomass, according to authorities involved in the project.
“The beauty of the project is that it’s very natural, so no maintenance is required,” except that the platforms would have to be replaced in 15 years, according to Macalle-Holly.
The islands were planted with native vegetation, including sweet-scented joe-pye weed.
Lake Hopatcong, owned by the state, is the first public lake in New Jersey to have the floating wetland islands, according to Macalle-Holly. Private water bodies that previously had them installed include the lake at Duke Farms in Somerset County, she said.
The islands were funded as part of an $800,000 grant awarded by the state Department of Environmental Protection to the Lake Hopatcong Commission in 2010 for a series of projects, Macalle-Holly said, with approval for this project coming in 2012.
The team that installed the islands in Jefferson Township’s Ashley Cove included employees from Princeton Hydro, along with the Jefferson Township Department of Public Works, the foundation, the New Jersey Water Supply Authority – Water Protection Program and a few volunteers. The islands were set up close to the shore near an open space area along Espanong Road.
Jessica Murphy, president of the private Lake Hopatcong Foundation, which took over many of the commission’s functions after it lost its state funding, said the islands are a project at the heart of the foundation’s purpose.
“We focus a lot on the Lake Hopatcong community and experience, but none of that will matter if the lake isn’t healthy,” she said. “Improving the water quality of the lake is truly the centerpiece of our mission, and this is a new and exciting way to do that.”
|
<urn:uuid:51fe6782-a9dc-4315-8bda-e7cf0caa5723>
|
CC-MAIN-2016-26
|
http://www.nj.com/morris/index.ssf/2014/07/floating_wetland_islands_installed_at_lake_hopatcong_to_prevent_algae_growth.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395160.19/warc/CC-MAIN-20160624154955-00127-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.962987 | 692 | 2.53125 | 3 |
Bracklesham Bay has long been one of the most productive and
easily accessible locations on the south coast to observe and
collect fossils. Throughout the year the sea erodes exposures of
fossil bearing clay (mostly offshore), formed during the Eocene
epoch around 46 million years ago. Each day, as the tide retreats, a
variety of fossils can be found deposited on the sand, including:
bivalve and gastropod shells, shark and ray teeth, corals and many
other marine fossils.
Left: Visitors on a
Discovering Fossils event use sieves to filter small fossils from
the sand. Right: A mixture of pale-brown fossils
and modern-day shells.
There are few natural dangers at Bracklesham besides the usual
risks associated with a tidal beach. The relatively safe environment
makes this stretch of coast an ideal starting point for young
families seeking their first fossil hunting experience. Likewise,
experienced visitors will find Bracklesham a refreshing change from
the usual hammering and digging associated with fossil hunting.
Parking, refreshments and toilet facilities are available at the
beach access point.
The geology of Bracklesham Bay
The clay formations at Bracklesham Bay belong to a group of
sediments called the Bracklesham Group, which extend continuously
from West Wittering in the north-west to Selsey in the south-east
(see fig.1 below). These sediments were deposited during the
Lutetian stage of the Eocene epoch, around 46 million years ago (+/-
1.5 million) by several rivers that supplied sediment into a large
estuary connecting to the North Sea. At this time southern Britain
lay 40°N of the equator (11° south of its current latitude),
equivalent to the present day latitude of Spain. Travelling
south-east along the foreshore the exposures become progressively
Figure 1: Geologic
map plotting the positions of the four formations of the Bracklesham
Group. The underlying London Clay is also shown to the north.
Throughout the Eocene epoch Britain's more southerly latitude
contributed to a warmer, sub-tropical environment, rich in
vegetation and fauna (animal life). Evidence for this is supported
by the fossils found at Bracklesham, which include crocodile
teeth/bones, turtle carapace, and various land derived seeds and
fruits, the latter of which were transported into the estuary by the
From car park at Bracklesham and extending 1
km towards Selsey is the Earnley Formation, a famous clay
responsible for the majority of fossils scattered across the sand at
low-tide. At certain times of the year large mushroom-shaped
pedestals of clay protrude from the sand (below-right), providing
access to fossils in situ (still in the bedrock as apposed to loose
on the beach).
of a Discovering Fossils event are accompanied by local expert David
Bone to see the Earnley Formation exposed in situ. Right:
For first time visitors to Bracklesham the concentration of the
bivalve Venericor and gastropod Turritella (see
above-right) is staggering and unlike any other UK location; it's
estimated that the ratio of fossils to clay is as much as 1:3. The
Earnley Formation is comprised of 8 numbered beds, with 3 (Venericardia
bed) and 4 (Turritella bed) most frequently exposed. The
Venericardia bed (shown above-right) contains abundant double-valved
Venericor, whereas the overlying Turritella bed contains
a much higher concentration of Turritella gastropods.
Note: A visit to Bracklesham is planned in the
near future to document the exposures further along the coast
towards Selsey. Once this is complete an expanded description of the
geology will be added here.
ADVERTISEMENT BY UKGE - OFFICIAL ADVERTISING PARTNER OF DISCOVERING FOSSILS
Where to look for fossils?
From the car park at Bracklesham fossils can be found in either
direction towards Selsey in the south-east (left when facing out to
sea) and Wittering in the north-west (right when facing out to sea).
Conveniently the greatest volume of fossils tends to be concentrated
in close proximity to the car park and for several hundred metres
towards Selsey (Earnley Formation - see geology notes above).
Fossil collecting is dependent on a low-tide, which occurs every 12
hours; the low beach gradient provides a brief window of time to
collect, before the incoming sea quickly obscures the sand and
fossils. For a relatively low one-off cost we
recommend the use of Neptune Tides software, which provides
future tidal information around the UK. To download a free trial
Alternatively a free short range forecast covering the next 7 days
is available on the BBC website
Beach conditions vary throughout the year and are largely
unpredictable. At certain times (particularly during the winter
months) the sea transports large volumes of sand away from the
beach, exposing the underlying fossil-rich clay. This provides an
opportunity to observe fossils in situ. There are also large
offshore exposures which ensure a constant supply of loose fossil
material throughout the year.
Left: Local expert David Bone explains where to find fossils on the
beach. Right: Fossils can also be found loose among the shingle at
the top of the beach.
The best place to begin searching for fossils is on the sandy
foreshore, in particular around the ends of the wooden breakwaters
(above-left). At low-tide it's hard to avoid finding fossils at
Bracklesham, although to the untrained eye it's not immediately
apparent which shells are millions of years old and which are
modern-day. The most revealing fossil characteristic is the colour:
during fossilisation the original colours are lost and the fossil
shells takes on a pale-brown, and wood and bone turns black (see
Left: Fossils are
scattered across the beach at low-tide. Right:
Venericor bivalve shells washed out of the
underlying Earnley Formation clay.
An effective technique for locating smaller fossils, in particular
shark and ray teeth, is the use of a sieve (see below); this
technique is not dissimilar to panning for gold! Certain areas of
the beach are more productive than others, in particular keep an eye
out for patches of broken shell material on the surface, as this
indicates natural grading - a process whereby the sea organises
beach material of similar sizes. The smaller the fragments, the
smaller the fossils you're likely to find; likewise the larger the
fragments the larger the fossils. The relatively flat beach provides
easy access to shallow water in which to sieve the sand and separate
Left: Robert and
Lucinda use a steel sieve to separate fossils from the sand.
Right: A close-up reveals an assortment of fossil
fragments and pebbles.
Fossils can also be found in situ just a short distance south-east
of the car park, although as discussed above, these outcrops are
unpredictable and can remain buried beneath sand for several years
at a time! On occasions where the sand has been swept away (usually
during the winter or after stormy weather) the resulting exposures
are worth examining (see below).
mushroom-shaped clay pedestal belonging to the Earnley Formation.
Right: The Venericardia bed exposed in
Please act responsibly when collecting near the clay exposures and
limit the number of specimens recovered to an absolute minimum.
There are usually large lumps of loose clay around the base of the
pedestals from which to collect; collecting in situ specimens is not
recommended and would cause unnecessary erosion to the exposures.
Bracklesham is designated a Site of Special Scientific Interest (SSSI),
which requires visitors observe a code of conduct. If you are not
familiar with collecting from SSSIs please visit the Natural Britain
website (formerly English Nature).
What fossils might you find?
The fossils at Bracklesham Bay are diverse and represent a
complex marine environment and neighbouring landmass. The close
proximity to land during deposition is revealed today by the
abundance of fossilised wood and fruits contained within the clay
outcrops and loose on the foreshore. Fossilised gastropod and
bivalve shells are also common, as are shark and ray teeth, fish
vertebrae, foraminifera, turtle carapace and crocodile scutes and
teeth, although the latter are relatively less so. Below are a
selection of finds made over several visits.
concentration of in situ Turritella gastropods and
Venericor bivalves, Earnley Formation / Turritella bed.
shell. Right: A complete Venericor
bivalve shell found in situ from
the Earnley Formation / Venericardia bed.
Left: A large
Venericor bivalve shell protruding in situ,
Earnley Formation. Right: A collection of
Left: The underside
of a Cubitostrea bivalve shell.
Right: Nummulites plankton-like foraminifera.
Left: The crushing
dental plate of a Myliobatis eagle ray. Right: A fragment of Aetobatus ray dental
Left: A small
unidentified fish vertebra. Right: A small (18mm)
unidentified shark vertebra.
Left: Robert and
Jonathan admire an intact Striatolamia
found on the foreshore. Right: Close-up.
Left: A small
unidentified shark tooth. Right: The tail or
defensive spine of a Myliobatis eagle ray.
Left: A gastropod
inside a section of clay originating from the Earnley Formation.
Right: A large Nypa
found in situ in the Earnley Formation.
Tools & equipment
fossils such as this fish vertebra are best extracted using a steel
A sieve is useful for filtering smaller fossils from the sand.
It's a good idea to spend some time considering the tools and
equipment you're likely to require while fossil hunting at
Bracklesham. Preparation in advance will help ensure your visit is
productive and safe. Below are some of the items you should consider
carrying with you. You can purchase a selection of geological tools
and equipment online from
Sieve: A sieve is ideal for
filtering smaller fossils from the sand, especially shark teeth
which are otherwise extremely difficult to find.
Steel point: In some instances
it's not necessary to use a hammer and chisel to remove the matrix
surrounding the fossil. Sometimes all that's required is some
careful precision work using a steel point. This is particularly
relevant with crumbly matrix, where chiselling may otherwise shatter
a fragile fossil.
Hand lens: A hand lens enables the fossil hunter to enjoy the finer
details of the specimens they find. It's often remarkable how well preserved
some of the most intricate structures can be. We recommend
a lens with x10 magnification that folds away into a metal casing to protect
it from damage.
Strong bag: When considering the type of bag to use it's worth setting aside
one that will only be used for fossil hunting, rocks are usually
dusty or muddy and will
make a mess of anything they come in contact with. The bag will also
need to carry a range of accessories which need to
be easily accessible. Among the features recommended include: brightly coloured,
a strong holder construction, back
support, strong straps, plenty of easily accessible pockets and a rain cover.
For more information and examples of tools and equipment
recommended for fossil hunting
or shop online at
ADVERTISEMENT BY UKGE - OFFICIAL ADVERTISING PARTNER OF DISCOVERING
Protecting your finds
It's important to spend some time considering the best way to
protect your finds onsite, in transit, on display and in storage.
Prior to your visit, consider the equipment and accessories you're
likely to need, as these will differ depending on the type of rock,
terrain and prevailing weather conditions.
wrapped in foam, ready for transport. Right:
A small compartment box containing cotton wool is ideal for
separating delicate specimens.
When you discover a fossil, examine the surrounding matrix (rock)
and consider how best to remove the specimen without breaking it;
patience and consideration are key. The aim of extraction is to
remove the specimen with some of the matrix attached, as this will
provide added protection during transit and future handling;
sometimes breaks are unavoidable, but with care you should be able
to extract most specimens intact. In the event of breakage,
carefully gather all the pieces together, as in most cases repairs
can be made at a later time.
For more information about collecting fossils please refer to the
following online guides:
Fossil Hunting and
Conserving Prehistoric Evidence.
Join us on a fossil hunt
Left: A birthday party with
a twist - fossil hunting at
Right: A family hold their prized ammonite at Beachy Head.
Discovering Fossils guided fossil hunts reveal evidence of life that
existed millions of years ago. Whether it's your first time fossil
hunting or you're looking to expand your subject knowledge, our fossil
hunts provide an enjoyable and educational experience for all. To find
|
<urn:uuid:ada603a5-2265-489a-8217-12e270c30f4d>
|
CC-MAIN-2016-26
|
http://www.discoveringfossils.co.uk/bracklesham.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393146.70/warc/CC-MAIN-20160624154953-00023-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.891608 | 2,952 | 3.609375 | 4 |
March 28, 1806, on Deer Island, above Cowlitz River, Washington.
Black with well-defined narrow back stripe, red blotches on sides, top of head red; in northern part of range black pigment usually extends onto belly; in California, black ends at indistinct light side stripe. Length: 18-51.6 in (45.7-131.1 cm).
Near waterówet meadows, marshes, prairie swales, irrigation and drainage ditches, damp woodland, farms, parks; sea level to 8,000 ft (2,450 m).
Northwestern Oregon and extreme southwestern Washington; coastal California, Humboldt County to San Diego County Valley.
The most commonly encountered snake in many parts of its range.
|
<urn:uuid:36f49435-4dc5-431e-b534-44459670339e>
|
CC-MAIN-2016-26
|
http://www.nationalgeographic.com/lewisandclark/record_species_189_16_5.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396959.83/warc/CC-MAIN-20160624154956-00190-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.87044 | 160 | 2.59375 | 3 |
The Kitchen Project | History Project | Contact Us | About Us | Free Food History Course | Food History Search
The History of Gonzales, Louisiana Jambalaya Contest
Chicken and Sausage Jambalaya 1978 Award Winning Chicken Jambalaya
it's pronounced <jahm-buh-LIE-uh> or <jum-buh-LIE-uh
According to the Online Etymology dictionary 1872, from Louisiana Fr., from Prov. jambalaia "stew of rice and fowl."
Gonzales, the "Jambalaya Capital of the World." In 1967, this term was only an inspiration in the mind of Steve Juneau to promote the City of Gonzales. Juneau, a native of Avoyelles, was very impressed with the Jambalaya prepared by area cooks. He thought this would be a great method to promote the city.
Here is the official web site for this festival
More Links and Recipes
Food History Course
5 free E-Lessons
Come Explore with me..
The History of Food
Have you ever wondered as I have.....
Who invented the first "Caesar Salad"?
How about the first salad or what was the first salad dressing?
How did Salad get the name Salad?
We explore different topics like famous restaurant dishes, famous fun foods like popcorn, famous Menus like Elvis's wedding reception, and popular food dishes that were invented by accident. Also tools and resources, that you can use to find information on different food and their origins
Just sign up here and you will get your first lesson instantly.
Click here to sign up
( We keep your address private )
|
<urn:uuid:9be92661-fcfd-4ebc-ae4f-6b05f1c174ea>
|
CC-MAIN-2016-26
|
http://www.kitchenproject.com/history/cajun/JambalayaContest.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783402516.86/warc/CC-MAIN-20160624155002-00085-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.909359 | 349 | 2.890625 | 3 |
Revista argentina de microbiología
versión On-line ISSN 1851-7617
The introduction of antibioticresistant bacteria to the environment, affects its hygienic-sanitary quality. The objective of this work is to study the prevalence and the antibiotic resistance patterns of enterococci species isolated from Bahía Blanca estuarine waters. One hundred and three isolates were biochemically identified as Enterococcus spp. The diffusion technique was implemented, by using disks of: vancomycin (Van 30 µg), gentamicin (GenH 120 µg), streptomycin (StrH 300 µg), teicoplanin (T 30 µg), ampicillin (Am 10 µg) and ciprofloxacin (CIP 5 µg) according to the Clinical and Laboratory Standards Institute. Seven Enterococcus species were identified, being Enterococcus faecium and Enterococcus faecalis the most frequent. High level resistance to aminoglycosides was shown by 1.9% of the enterococci whereas 12.6% of the isolates were resistant to CIP. No isolates showed simultaneous resistance to StrH and GenH. Neither resistance to glycopeptides nor to Am was detected. Thirty four per cent of the isolates exhibited susceptibility to all antibiotics tested. Surveillance studies on antimicrobial resistance are usually based upon microorganisms isolated from clinical samples. The findings of this work constitute relevant data for the control of resistant strains, which were believed to be circumscribed to the hospital environment, but are also widespread in the natural sites.
Palabras clave : Antibiotic-resistance; Enterococcus spp.; Estuarine waters.
|
<urn:uuid:2822ee52-0f41-454a-932d-c481e23b113e>
|
CC-MAIN-2016-26
|
http://www.scielo.org.ar/scielo.php?script=sci_abstract&pid=S0325-75412008000100011&lng=es&nrm=iso&tlng=en
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397562.76/warc/CC-MAIN-20160624154957-00043-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.896141 | 360 | 2.71875 | 3 |
Instructions: Move the mouse over each knot. Look at the ... Selection. The eight
knots in this section are the most basic knots - the building blocks of knot tying.
TIE KNOTS THE FUN AND EASY WAY. Better to ... Instructions: Move the mouse
over each knot. ... On the new page wait until the selected knot starts to tie itself.
How to tie knots. Clear step by step knot instructions plus animated knots for
boaters, scouts, climbers, search and rescue, arborists and sailors.
The Windsor Knot Tying Instructions. 1. Start with the wide end of the tie on the
right and the small end on the left. The tip of the small end should rest slightly ...
A comprehensive step by step guide on the different ways to tie a tie. Windsor, 4
in hand, Eldredge, Trinity, bow tie, and other simple knots from Ties.com.
How to tie knots in rope. Knotting instructions for scouts, climbers and sailors
fisherman outdoor and survival sporters. Clear knot descriptions and drawings.
www.ask.com/youtube?q=Knot Tying Instructions&v=Q9NqGd7464U
Apr 16, 2011 ... ... use a bowline knot. This is the most useful knot you will ever learn. ... Very well
thought out and easy to follow instruction, thank you so much..
Jan 5, 2015 ... If the only knot you know involves tying your shoes, then this infographic provides
clear, step-by-step instructions on tying some of the most ...
Knots Guide is a SIMPLE quick reference collection of different knots. - 92 knots. -
10 categories: Bend, Binding, Climbing, Decorative, Fishing, Hitch, Looping, ...
Knot Tying: Videos & Instructions on How to Tie Fishing Knots. Tying a fishing
knot is an important and essential skill of fishing. The knot is a critical link
|
<urn:uuid:f7d7bf62-f13c-425a-afc6-c77abb9b2284>
|
CC-MAIN-2016-26
|
http://www.ask.com/web?qsrc=6&o=102140&oo=102140&l=dir&gc=1&q=Knot+Tying+Instructions
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783403502.46/warc/CC-MAIN-20160624155003-00091-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.786346 | 416 | 2.53125 | 3 |
RC papers are known for their exceptional image quality that they impart to photographs. The black areas are rich deep and profound, whereas the white parts are highly developed on an RC paper. Outstanding picture quality is what makes RC papers the first choice of professional photographers when it comes to photo paper.
Fiber papers are made from wood pulp, but they also contain some distinctive plant fiber that gives them their unique character. They are handmade or manufactured by machines. Some papers are also supplemented with special additives. The substrate is usually cotton fiber or high-grade wood pulp. A surface coating is provided on the top of the paper base. But there is no resin layer here which makes it easy for the ink to pass through the porous layers and is held by the paper fiber itself.
This photo paper can hold more ink than the non-permeable resin layer photos. This is what gives the photos a richer quality with deeper colors. The photo reflects better print quality because the texture and quality of the base fibers can be seen through the receptive layer.
The biggest disadvantage of using fiber paper for photographs is the inconsistence quality that it delivers. This is because not all fiber paper uses high-quality cotton rag fiber or wood pulp. That is why they are all not of the same quality. Low-quality materials can produce low-grade prints that can look blurry and smudged.
With an RC paper, the imperfections in quality are compensated by the resin coating. Industry experts are unanimous in their opinion that coatings are the most important part of paper making. It is the coating that determines the ink-dispersing process – a factor that is intrinsically connected with the final picture quality. In RC paper, the porous top layers allow the ink to pass through and then dry up instantly when trapped between the coating and the resin layer. This is what is responsible for perfect consistency in quality, smooth texture, and ultra-high photo quality.
Photo paper cost with RC paper can be scaled down considerably by using low-grade paper fiber because they have little consequence on the final product. The disadvantage of using RC paper is the lower saturation levels that it sometimes reflects. Also, because of the consistency in quality, photos may look clinical and bland when compared to photos developed on a high-quality fiber-based paper.
By the same measure, photos developed on fiber paper are more expressive and give a certain depth to the images. Photo paper made of fiber, especially those made of low grade wood pulp and cotton fiber, can affect the quality of printing. Another disadvantage is the high cost of high-grade fiber paper.
About the Author: Andrew Yeung is president of CompAndSave, a leading online provider of premium printer ink cartridges, including remanufactured and compatible printer ink cartridges. With deals every month and a 1-year guarantee of quality, CompandSave provides an easy way for people and businesses to purchase printer ink and accessories.
Learn about CompandSave's deals and news from the world of printing by following us on Facebook, Twitter, LinkedIn and Google+!
Categories: photo paper
|
<urn:uuid:ed9e05d2-0730-4b82-8c3f-eae5d15f47e7>
|
CC-MAIN-2016-26
|
http://blog.compandsave.com/2011/08/photo-paper-which-one-to-use-for.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397749.89/warc/CC-MAIN-20160624154957-00155-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.952822 | 627 | 2.765625 | 3 |
South Carolina State University students William Dumpson, left, and Alejandra Chirino, center, talk with Savannah River National Laboratory Director Dr. Terry Michalske at a recent research exchange involving the laboratory and seven historically black colleges and universities.
Last week, student and faculty leaders at seven Historically Black Colleges and Universities (HBCUs) spent the day at the Center for Hydrogen Research at Savannah River National Laboratory, reporting on their work to professional scientists and engineers at the Laboratory during a poster display showcase.
These schools - Benedict College, Claflin University, Clinton Junior College, Denmark Technical College, Paine College, South Carolina State University, and Voorhees College – were awarded nearly $9 million in a grant from the Office of Environmental Management in 2010, along with Allen University and Morris College, who were not present at the event.
As Dr. Terry Michalske, Director of the Savannah River National Laboratory, reported to the Aiken Standard, “we have a tremendous resources here in the region – in our historically black colleges – and I’m making sure that we are tapping into it. It’s important for me that 10 years from now, 20 years from now that the Savannah River National Laboratory has the best scientists and engineers. And that means I need to find them today.”
The grant from the Office of Environmental Management was used to develop academic programs that promote minority involvement in science and technical research fields. HBCUs and other Minority Serving Institutions are key partners to the Department. The Office of Economic Impact and Diversity works to foster partnerships and advocates for Minority Serving Institutions’ engagement in the Department's work.
To learn more about our partnerships with HBCUs and other Minority Serving Institutions, visit our website: http://energy.gov/diversity/services/partnering-minority-serving-institutions
|
<urn:uuid:9de984d2-3b2a-4c81-b72e-bbf5bce66f81>
|
CC-MAIN-2016-26
|
http://energy.gov/diversity/articles/savannah-river-national-laboratory-meets-historically-black-colleges-and
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396100.16/warc/CC-MAIN-20160624154956-00198-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.943051 | 387 | 2.578125 | 3 |
Geerts Hopes to Answer Mysteries of Cloud Seeding Through Supercomputing Model
June 6, 2012 — Bart Geerts likes to chase storms high in the mountains. And, oftentimes, he helps contribute to them.
Geerts, a University of Wyoming professor of atmospheric science, studies cloud seeding and how different nuclei can affect and enhance snowfall.
During cloud seeding, a form of artificial weather modification, silver iodide is released into the clouds through generators that have been strategically placed upwind of the ridges of the Medicine Bow and Sierra Madre mountains in southern Wyoming. The silver iodide facilitates ice crystal formation in super-cooled water clouds.
During snowstorms, Geerts says it has been difficult to assess how much snowfall happens naturally and how much is artificially induced. Geerts uses Wyoming Cloud Radar and the UW King Air aircraft as tools to help him. But he needs more.
Geerts hopes that his use of the NCAR-Wyoming Supercomputing Center (NWSC) will provide snowfall models that are as detailed or more so than those currently captured on radar -- and perhaps answer the following questions: "When measuring snowfall, what amount is natural snowfall, and what is artificially induced through cloud seeding?" and "Where are the most effective regions to use cloud seeding?"
"We do not have a good understanding of the effectiveness of cloud seeding," Geerts says. "We don't yet know which clouds can be most effectively seeded. Through testing and observation, we can test the efficiency for seeding clouds in order to enhance snowfall."
Geerts uses lidar and radar to collect precipitation data. Lidar, an acronym for light detection and ranging, is an optic remote sensing technology that can detect and measure cloud droplets in the atmosphere. Snow is detected by radar.
From the aircraft, Geerts observes the effects of ground-based seeding. At the silver iodide generators located on the mountain ridges, propane burns a stick of silver iodide, which then releases the iodide crystals into the air. The radar and lidar map out the precipitation and clouds along the flight track in very fine detail, at a pixel resolution of about 100 feet.
"With the supercomputer, we want to simulate the airflow and cloud down to the same resolution, about 100 feet. We want to see if the model can reproduce what our radar sees," Geerts says. "In radar and the models, we want to see what cloud seeding really does."
Still, Geerts notes radar observations are limited in time and space. Radar observations are limited in time due to the high cost of operating a research aircraft for four hours. Because "the radar only captures transects of weather" below the flight level of the aircraft, very limited data are recorded and are not continuous in time or space, he says.
But Geerts notes a computer model can run for the entire duration of a flight, in three dimensions.
"It provides very rich data," he says.
In his research, Geerts has been trying to represent unresolved features in cloud seeding with parameterization, which is essentially trying to explain some effect you can't resolve.
"You know it's happening, but you can't see it. Modeling is intended to resolve these processes," he says. "These nuclei are microscopic to begin with. The airflow over mountains is very complex. That's why you really need high resolution. You can only get that through supercomputing."
Due to water shortages and droughts in some states and in countries around the world, cloud seeding is seen as a potential way to increase water supplies for communities and to irrigate crops. Cloud seeding is typically paid for by water resource managers, power companies (hydropower) and agricultural interests.
"Water is almost as important as oil is in the western United States. Water is quite a valuable commodity," Geerts says.
Geerts, who teaches courses on weather analysis and forecasting, as well as an introduction to meteorology at UW, says he has always been fascinated by the weather.
The NWSC is the result of a partnership among the National Center for Atmospheric Research (NCAR); the University of Wyoming; the state of Wyoming; Cheyenne LEADS; the Wyoming Business Council; Cheyenne Light, Fuel and Power; and the University Corporation for Atmospheric Research. NCAR is sponsored by the National Science Foundation (NSF).
The NWSC will contain some of the world's most powerful supercomputers (1.5 petaflops, which is equal to 1.5 quadrillion computer operations per second) dedicated to improving scientific understanding of climate change, severe weather, air quality and other vital atmospheric science and geo-science topics. The center also will house a premier data storage (11 petabytes) and archival facility that holds irreplaceable historical climate records and other information.
Bart Geerts, a UW professor of atmospheric science, plans to use the supercomputer in Cheyenne to better understand cloud seeding. He's particularly interested in determining how much snowfall is created due to the artificial inducement as well as figure out the best locations to use cloud seeding.
|
<urn:uuid:d899dc02-6d03-4542-91b9-8ce17e00f98d>
|
CC-MAIN-2016-26
|
http://www.uwyo.edu/uw/news/2012/06/geerts-hopes-to-answer-mysteries-of-cloud-seeding-through-supercomputing-model.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396459.32/warc/CC-MAIN-20160624154956-00057-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.959674 | 1,093 | 3.53125 | 4 |
Though the ratio of boys to girls born in the United States has been on the decline for decades, new research found that moms who use in vitro fertilization might increase the number of male babies.
The University of New South Wales study, published in BJOG: An International Journal of Obstetrics and Gynaecology, found that IVF treatment raised the sex ratio from 105 boys per 100 girls to 128 boys per 100 girls. Researchers will need to do further studies to determine why this happens. (More on Time.com: Boy or Girl? Change Your Diet, Micromanage Sex — and Other Pregnancy Myths)
Researchers tracked the live births of women in Australia and New Zealand between 2002 and 2006 who received either IVF or another type of fertility treatment, intracytoplasmic sperm injection (ICSI). The difference between the two treatments is simple numbers: during IVF, doctors allow many sperm to swim to the egg, while ICSI is the direct injection of a single sperm.
“The results from this study demonstrate that a particular [assisted reproductive technology (ART)] procedure or treatment course can alter the probability of having a male baby from the natural sex ratio at birth in Australia of about 51.5%, to a low of 48.7% (a decrease of 2.8%) or a high of 56.1% (an increase of 4.6%), depending on the procedure used,” said co-author Jishan Dean in a statement. (More on Time.com: What Goes on Inside the Brain of a Misbehaving Boy?)
In vitro fertilization is a process in which a woman’s egg is fertilized outside of her body and then implanted into the uterus after a number of days. Interestingly, the number of days mattered: the ratio of boys to girls grew higher the later the fertilized egg was transferred to the womb. Women who had eggs transferred after four days had boys 54% of the time, whereas eggs transferred at two to three days were 49.9% likely to be boys.
But BJOG‘s editor-in-chief, Philip Steer, cautioned against using these results to attempt to deliberately choose the sex of a baby, citing population imbalances in countries like China and India where male babies are preferred.
More on Time.com:
|
<urn:uuid:b9eea4ba-09cf-468f-9a3e-1ad395c78273>
|
CC-MAIN-2016-26
|
http://healthland.time.com/2010/09/29/study-ivf-causes-higher-rates-of-baby-boys/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783408828.55/warc/CC-MAIN-20160624155008-00115-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.946269 | 479 | 2.546875 | 3 |
Caillaux, Joseph (zhôzĕfˈ kāyōˈ) [key], 1863–1944, French statesman. Son of a former cabinet minister, he entered the French civil service as inspector of finance. He later became finance minister in the cabinet of René Waldeck-Rousseau (1899–1902) and in the cabinet of Georges Clemenceau (1906–9), winning considerable unpopularity by introducing the income tax. As premier in 1911, he reached a peaceful settlement of the crisis over Morocco with Germany. However, he was severely attacked by the nationalists, and his cabinet fell in 1912. In 1913 he again became minister of finance. He resigned in 1914 to defend his wife, who had shot and killed Gaston Calmette, editor of Le Figaro, for attacking Caillaux's private life. Mme Caillaux was acquitted. Caillaux expressed pacifist sentiments during World War I and allegedly made contact with the Germans to discuss a negotiated peace. He was arrested (1917) and sentenced (1920) to three years imprisonment for involvement with the enemy. After his civil rights were restored under a general amnesty, Caillaux served as finance minister in the cabinets of Paul Painlevé (1925) and Aristide Briand (1926), but after each appointment a hostile chamber of deputies forced his resignation. He was subsequently elected to the senate.
See R. Binion, Defeated Leaders: The Political Fate of Caillaux, Jouvenel, and Tardieu (1960).
The Columbia Electronic Encyclopedia, 6th ed. Copyright © 2012, Columbia University Press. All rights reserved.
|
<urn:uuid:0c6795eb-2492-491c-a406-1f5d3c86489c>
|
CC-MAIN-2016-26
|
http://www.factmonster.com/encyclopedia/people/caillaux-joseph.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396459.32/warc/CC-MAIN-20160624154956-00097-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.978321 | 347 | 2.578125 | 3 |
"This is additional evidence that exercise includes health benefits other than just lowering the risk for coronary disease, cancer and other diseases. We now have evidence that regular walking is also associated with benefits that are related to cognitive function later in life," said Robert D. Abbott, Ph.D., professor of biostatistics at the University of Virginia Health System and a co-author of the study.
Dementia is a chronic, or persistent, disorder of mental processes due to brain disease.
Symptoms may include personality changes, as well as losses in reasoning, orientation, and memory, that interfere with a person's usual activities.
So far, it is not clear why walking seems to protect the aging brain from dementia and Alzheimer's disease.
"If you've been active throughout your life it could have direct relationships with the same kind of healthy risk factors that are often associated with less obesity, diabetes and heart disease," Abbott said. "People who are active tend to adhere to a healthier life-style and a better diet than those who are inactive. All of these factors could be working together in determining overall vitality and how healthy our brain is. There is also the possibility that people who walk are less likely to get diseases later on in life that could lead to dementia versus people who are inactive."
The study was comprised of 2,257 physically-capable, nonsmoking Japanese-American men between the ages of 71 and 93 who were already participating in the Honolulu-Asia Aging Study, launched in the early 1990's as part of the Honolulu Heart Study.
Distance walked per day was assessed from 1991 to 1993. The men were then neurologically assessed for dementia in two follow-up examinations between 1994 and 1999. During follow-up, 158 cases of dementia were identified. After adjusting for age, men who walked less than a quarter mile per day experienced a 1.8 fold excess of dementia compared with men who walked over two miles per day.
"This finding is probably related to a lifetime of behavior," Abbott said. "Nevertheless, we continue to hear reports about the health benefits of walking, especially in terms of lowering the risk of heart disease and cancer. If I were sedentary, regardless of age, the finding that regular walking could have effects on late-life cognition is an additional reason to become more physically active. But I would do it carefully and with the advice of a physician. Also, keep in mind that walking is not a strenuous activity for most people." Abbott notes that the recommendations and findings from this study of men in Hawaii are likely to apply to women as well.
In addition to Abbott at U.Va., contributors to the study were: the Pacific Health Research Institute, the Department of Veterans Affairs, the Kuakini Medical Center and the John A. Burns School of Medicine at the University of Hawaii.
|
<urn:uuid:e61e4435-b2f1-4009-89aa-110042e809ff>
|
CC-MAIN-2016-26
|
http://www.eurekalert.org/pub_releases/2004-09/uovh-wmp091504.php
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395546.12/warc/CC-MAIN-20160624154955-00027-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.978006 | 576 | 3.15625 | 3 |
Frequently Asked Questions for the ACT
What subjects does the ACT test in?
The ACT consists of English, Mathematics, Reading, and Science. The ACT plus writing includes all four of the subjects and a 30 minute written essay. The format is 215 multiple choice questions in a given time of 3 and a half hours (or 4 hours if you are taking the writing section).
How does the ACT differ from the SAT?
The ACT is considered to be less abstract than the SAT. The ACT is a better exam for students who have a good recollection of specific subjects learned throughout high school. The ACT has a science section that is intended to test your reasoning skills and not actual science knowledge. There is no penalty for wrong answers on the ACT, unlike the SAT, which deducts a quarter of a point per wrong answer.
What should I bring with me to take the test?
When packing for the ACT, you must remember to bring your admission ticket and acceptable identification. You should also bring some Number 2 pencils, which is the only writing tool allowed. A basic four function calculator is allowed, if you wish to use one for the math section. Another suggested item that may help you throughout the test is a watch to help you pace yourself.
What is the format of the ACT?
The ACT is comprised of 4 sections and an optional writing section. The topics, number of questions, and time frame given for each section are:
English/75 Questions/45 min
Mathematics/60 Questions/60 Min
Reading/40 Questions/35 Min
Science/40 Questions/35 Min
Writing/1 prompt/30 min
For more information on the SAT, contact Dov Landau, Director of College Admissions at Top Test Prep. Top Test prep is the elite one on one tutoring and admissions company featuring some of the best and brightest tutors and admission experts in the business. Dov can be reached at 202-618-4474.
|
<urn:uuid:49d9a15e-fe4f-4c4b-bd89-47246954069d>
|
CC-MAIN-2016-26
|
http://toptestprep.com/frequently-asked-questions-act/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783403823.74/warc/CC-MAIN-20160624155003-00027-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.930123 | 402 | 2.78125 | 3 |
Behavioral animation is a type of procedural animation, which is a type of computer animation. In behavioral animation an autonomous character determines its own actions, at least to a certain extent. This gives the character some ability to improvise, and frees the animator from the need to specify each detail of every character's motion. These improvisational characters are, in the words of Ann Marion: "puppets that pull their own strings". An early example of behavioral animation was the 1987 boids model of bird flocking. While in some limited sense autonomous characters have a mind, their simplistic behavioral controllers are more closely related to the field of artificial life than to artificial intelligence.
Please contribute to this incomplete page!
Send comments to Craig Reynolds
Last update: April 6, 1997
|
<urn:uuid:8fec5e3e-5040-4059-be84-d8a7a3c55c3d>
|
CC-MAIN-2016-26
|
http://red3d.com/cwr/behave.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398869.97/warc/CC-MAIN-20160624154958-00020-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.907391 | 158 | 3.21875 | 3 |
| The profile view
shown here makes its gender identification easy-- females don't have a
brood pouch for carrying the developing young (this one is female). For
reproduction, the female deposits a long string of eggs into the male's
brood pouch, where the developing brood is nurtured until the baby
seahorses emerge, looking like miniatures of their parents, commonly
6-12 millimeters in length. Once born, the young seahorses receive no
care from their parents, and are particularly vulnerable to predators.
This species is commonly known as the spotted seahorse, yellow seahorse, or estuary seahorse. It is characteristically smoother in appearance than most other species, of medium size, 7-17 cm (2.7-6.7 inches).
Identification: Hippocampus kuda
|back to seahorse index page||back to Gallery IV|
|
<urn:uuid:fd505d3d-f092-43d1-b031-1feaea49987b>
|
CC-MAIN-2016-26
|
http://www.divegallery.com/seahorse_page3.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783394937.4/warc/CC-MAIN-20160624154954-00080-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.921157 | 191 | 3.046875 | 3 |
Mansurah, Al (äl mänsōrˈä) [key], city (1986 pop. 317,508), N Egypt, a port in the Nile River delta. It is an agricultural market and industrial center. Manufactures include ginned cotton, cottonseed oil, and textiles. Al Mansurah was founded in 1221 to replace Dumyat (Damietta), then occupied by Crusaders. In 1250, Crusaders under Louis IX of France suffered a crushing defeat there at the hands of the Mamluks. The city is the seat of a branch of the Univ. of Cairo, the Institute of Al Mansurah (affiliated with Al Azhar Univ. in Cairo), and Al Mansurah Polytechnic Institute.
The Columbia Electronic Encyclopedia, 6th ed. Copyright © 2012, Columbia University Press. All rights reserved.
|
<urn:uuid:c6188d7c-5f54-4d30-9db8-d9ef615f7413>
|
CC-MAIN-2016-26
|
http://www.factmonster.com/encyclopedia/world/mansurah-al.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393332.57/warc/CC-MAIN-20160624154953-00048-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.876505 | 179 | 2.828125 | 3 |
The Marlyland Court of Appeals has deemed pit bulls to be “inherently dangerous”, which means that in a civil case for damages, if the plaintiff can prove that the damages were caused by a pit bull, then she does not need to show–unlike in an ordinary negligence claim–a failure on the part of the dog owner to exercise due care:
Upon a plaintiff’s sufficient proof that a dog involved in an attack is a pit bull or a pit bull cross, and that the owner, or other person(s) who has the right to control the pit bull’s presence on the subject premises (including a landlord who has a right to prohibit such dogs on leased premises) knows, or has reason to know, that the dog is a pit bull or cross-bred pit bull, that person is liable for the damages caused to a plaintiff who is attacked by the dog on or from the owner’s or lessor’s premises. In that case a plaintiff has established a prima facie case of negligence. When an attack involves pit bulls, it is no longer necessary to prove that the particular pit bull or pit bulls are dangerous.
There is a discussion about this already going on at DrugMonkey’s blogge, with the usual apologetics of the pit bull enthusiasts.
I’m pretty convinced that this commenter has it exactly right, that pit bulls have been bred to be vicious and uncontrollable:
Genetics play a huge part in a dog’s behavior and temperament. The Belyaev experiment has been going on since the 1959, and has proven that selective breeding, in even a few generations, can produce an animal that is genetically friendly toward humans; it can also produce an animal that is genetically aggressive. If this can be easily accomplished in wild canids (foxes), it can be easily done in domestic dogs.
Pit bulls were bred by the dogmen to be “game”, which means that once they are engaged in a fight, they do not stop, despite pain and mortal wounds. They were selected through generations to be highly dog aggressive, and to not respond normally to canine body language. They ignore signals of submission. They have a high threshold for pain. They have an active defence reflex, and will chose fight over flight when challenged. They were bred to attack without the typical warning signals, since signaling intent to your opponent is a liability in the fighting pit.
While normal dogs use mostly ritualistic displays of aggression…. posturing, hackling, growling, pinning and air snapping; or use just enough force to open up a flight path, such as when a fearful dog bites and releases….pit bulls have been bred to grab, hold, and shake their opponent until it stops moving.
This behavior in pit bulls is a self rewarding behavior, just as the exagerated eye-stalk behavior of the border collie is. It is not the result of abuse or training. Current breeding practices for pit bulls continue to select for these traits…the vast majority of people breeding pit bulls todays are at best grossly irresponsible back yard breeders, who are ingoring temperament and just looking to make a quick buck, or are criminals, drug dealers, gang members and dog fighters, breeding aggressive pits as guard dogs for drug ops, or for the fighting pit.
It’s time to stop the fairy tales about “nanny dogs”, and the mental gymnastics of looking for triggers and excuses as to “why” pit bull attacks occur. The dogs are simply doing what they were bred to do. Dogs aren’t people, they are a eugenics experiment. Pit bulls were created for an activity that is now a felony in all 50 states. Its time to take a hard look at regulating them as a public safety measure.
|
<urn:uuid:5a5f2684-cb5e-4c0c-a002-59ce064cf8c5>
|
CC-MAIN-2016-26
|
http://freethoughtblogs.com/physioprof/2012/05/05/are-pit-bulls-inherently-dangerous/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395560.14/warc/CC-MAIN-20160624154955-00113-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.967478 | 794 | 2.703125 | 3 |
- Grades: PreK–K, 1–2, 3–5, 6–8
Reinforce new vocabulary words with these fun,
Four ways to explore Earth’s resources and inspire kids to conserve.
Creative projects inspired by artists and change-makers.
Science activities bring animal adaptations to life in your classroom.
Bring the season into your classroom with math craftivities and games.
Five getting-to-know-you activities to create a classroom community.
Learning doesn’t have to stop when students leave your classroom.
Travel to the moon and the depths of the sea without leaving your classroom.
Travel the world with five multicultural art lessons.
Get to know favorite authors with cross-curricular lesson ideas.
6 exercises to build motor skills and improve handwriting.
Say farewell to your students with these crafty creations.
Use these surefire kinesthetic activities in independent math centers around the classroom.
Teach students about the wonders of winter weather with these awe-inspiring experiments.
Try these multisensory strategies to prepare students for learning.
Make reading class feel like recess with hands-on activities for early learners.
6 activities to teach manners and feelings to young learners.
Activities to get kids ready for (safe) summer fun from Instructor Magazine.
Make math, phonics, and music come alive with activities to commemorate Presidents’ Day.
Pair books and activities to get kids thinking about habitat, hibernation, and migration.
Colorful, compelling books teach science and informational text features.
Use vibrant mentor texts to teach writing skills while introducing students to inspiring women.
It's a wacky world! Make the most of it by teaching social studies using fun facts, culture, and other novelties.
Use pop culture to teach science, technology, engineering, art, and math.
Hands-on activities to empower students to help the planet.
Use favorite books to help students develop their writing skills.
Bring landforms and landmarks to life with a variety of geography projects.
Pair these books with experiments for picture-perfect science lessons.
Rethink traditional book reports with these unique activities.
Round out the year with educational activities that have a summery twist.
Improve students' phonics, fluency, and vocabulary skills with these engaging poetry activities.
Take a cue from Dr. Seuss, get on a Magic School Bus, and Skype for Read Across America Day on March 3.
Engage students in hands-on learning with these six easy-to-make projects.
Use much-loved children’s books for real-world math activities with a cross-curricular twist.
4 core-ready lesson plans to introduce students to informational texts and key text features.
Reflect on lessons learned and friendships made with activities that wrap up the year from Instructor Magazine.
Kids have strong opinions about everything from school rules to the clothes they wear. Put their ideas to work writing persuasive pieces.
Get ready, get set, get reading with these nifty activities and other ideas to improve reading comprehension skills.
Bring color and creativity to National Poetry Month projects.
Tune in to theme and inference using songs, scripts, and adaptations.
Teaching science, tech, engineering, and math skills through real-world applications.
Jazz up student writing with figurative language activities.
Engineer a positive class environment while growing STEM skills.
Broaden students’ reading horizons with books that celebrate diversity.
Five strategies to promote cooperative learning in your classroom.
Four out-of-the-box ideas your class can do with younger students.
Shape up your geometry unit with these standards-based math activities. Perfect for Common Core classrooms.
Make persuasive, descriptive, expository, and narrative writing come alive through art-meets-literacy projects.
These five activities will prepare your information investigators for nonfiction summer reading success.
Teach kids the power of language—and meet Core standards—with these activities for National Poetry Month and beyond.
Make multiplication stick with these activities that reinforce automatic fact retrieval.
Help students build vocabulary and deepen comprehension with engaging word activities.
Four simple go-to activities to keep students calm, focused, and motivated in your classroom.
6 core-ready writing activities to help you get to know new students and meet ELA standards.
Common Core-ready lesson plans to develop public speaking skills from Instructor Magazine.
Human sundials, windowsill trash, and other creative, hands-on science experiments
Math skills become that much more meaningful when students use them to do good.
The election season offers a fresh reason to incorporate current events into your lesson plans.
Five ways to motivate independent readers and
Colorful lessons on grammar, poetry, and history based on the Bard's work.
Use graphic novels to teach literary devices, social studies, and more!
Hone students’ library and research skills with social studies and science projects.
Close out the year with reflection, celebration, and meaningful projects.
Creative, CCSS-aligned activities to get students to respond deeply to a text.
Use visual tools to help students grasp complex text.
Creative lessons to revitalize the way you teach beloved books.
4 ideas to teach informational texts in any subject area.
Help your students become socially-savvy through lessons on attitude, boundaries, and more .
Make the last month of school unforgettable with these standards-based games.
5 easy ways to check in with students before and after lessons
Go beyond raising a hand with teacher-tested strategies for getting students involved in class discussions and collaboration.
Integrate technology across the curriculum — while meeting Common Core.
Underline the importance of taking great notes with thoughtful activities for reading class.
Beloved YA authors Avi, Blue Balliet, Walter Dean Myers, Jennifer A. Nielsen, and Lauren Tarshis share their best advice for your middle school writers.
Celebrate the school year and keep students engaged with hands-on group projects from Instructor magazine.
Celebrate National Poetry Month with these poetry lesson plans.
Pair rich activities with key “firsts” in black America.
Turn book-shy kids into some of your most avid readers.
There’s a just-right activity for every kid’s learning superpower.
This STEM-based movement spurs critical thinking and creativity.
Three simple, affordable ways you too can jump into science activities.
Seven State Teachers of the Year share their best lessons ever.
Scholastic authors share their page-turning tips for the Summer Reading Challenge.
20 citizen science projects that let kids take control of real-world research.
The innovative Turnaround Arts program shows how arts integration can increase engagement and improve learning. Plus, how to incorporate the arts into your curriculum.
Nell K. Duke shares her tips for using the strengths of project-based instruction to teach informational text.
Service-learning projects are more than “feel-good” exercises—they can launch students into a hands-on world of learning.
Why handwriting instruction may be your secret weapon to academic success.
Pam Allyn shares her top tips for inspiring a love of literacy in your students.
The 2013 Scholastic Summer Challenge winners share their secrets for success.
The editors of SuperScience and Science World magazines share their favorite student-centered science experiments.
Hands-on “craftivities” to extend learning across your curriculum.
Math expert Marilyn Burns talks Common Core practice standards with Instructor.
Teacher-tested ideas to help you meet the new Common Core anchor standards.
20 new titles to satisfy every interest and keep students reading all summer long from Scholastic Instructor.
Key strategies to prevent the summer slide and help kids discover the power of a good book from Instructor Magazine.
As more K–8 programs focus on science, technology, engineering, and math, teachers are finding that chaos creates learning opportunities.
CCSS activities that bring literacy lessons into the science lab.
Whether you’re teaching science, social studies, or writing, integrating the arts will deepen students’ understanding.
You asked, we answered. Our experts weigh in on your biggest questions about ELA Common Core.
Your students may not be able to vote (this time around!), but these activities about elections and campaigning will show them what it means to be a good citizen.
Help your students figure out why they aren’t getting math concepts.
Think informational text = boring? Reinvent your reading lessons with dinosaurs, artists, and geologists!
|
<urn:uuid:08509375-2fda-4adc-977a-4a72658f0229>
|
CC-MAIN-2016-26
|
http://www.scholastic.com/teachers/collection/lesson-ideas
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783404382.73/warc/CC-MAIN-20160624155004-00187-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.900564 | 1,791 | 4.09375 | 4 |
ATLANTA (WAOK) – A new review of close to 100 past studies appears to be lending some credence to the concept of a so-called “obesity paradox.” The new study’s lead author, a scientist with the Centers for Disease Control and Prevention, says there is clear link between being somewhat overweight and having a lower risk of dying. While it would seem counterintuitive, the millions of people who took part in the earlier studies were found to have about a six percent lower risk of dying if they were overweight or just slightly obese, when compared to their normal weight peers. Severe obesity remains another issue, and was tied to a nearly 30 percent higher risk of death. Writing in the “Journal of the American Medical Association,” the researchers were unable to give a solid explanation for why the obesity paradox appears to exist.
(PHILIPPE HUGUEN/AFP/Getty Images)
|
<urn:uuid:2d8ba10f-e1d4-4798-bd29-44949135836e>
|
CC-MAIN-2016-26
|
http://atlanta.cbslocal.com/2013/01/02/review-of-past-studies-backs-up-claims-of-obesity-paradox/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783402746.23/warc/CC-MAIN-20160624155002-00050-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.97832 | 192 | 2.515625 | 3 |
Sterotype is a type of printing plate
used in letterpress, newspaper, and other high-speed press runs.
William Ged was the Scottish goldsmith
who invented stereotyping in 1725, a process in which a whole page of type
is cast in a single mold so that a printing plate can be made from it.
Until the invention of the stereotype printing type had to be reset if
a second printing was to be made. Ged took a plaster mould of the type
and then cast the whole page in metal. He was also the inventor of the
"Lost Wax" process of metal casting, used for reproducing delicate designs,
especially in the jewellery trade. Stereotyping, all though invented by
William Ged in 1725, was reintroduced in 1784 by Alexander Tilloch, who
improved upon the method of sterotyping.
Important disclaimer information about this About site.
|
<urn:uuid:e9f67783-ddfb-4dfa-a740-ffa2ba2a4172>
|
CC-MAIN-2016-26
|
http://theinventors.org/library/inventors/blged.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783403825.35/warc/CC-MAIN-20160624155003-00171-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.939785 | 193 | 3.359375 | 3 |
Paving the way for future innovators
A sustainable pipeline of skilled workers well-versed in the disciplines of science, technology, engineering and math is what our nation needs if we are to remain competitive in a world that is becoming more complex by the year. Fostering a strong education system will allow us to pave the way for future innovators. Driving innovation in educational delivery that prepares our students for the careers of the future is critical for America, and the visionary educators at our Center are doing just that.
A world-class educational system is the single most important factor in ensuring American students can compete for the best jobs. Meet the Center innovators who are working toward a brighter future for our nation's children.
Integrating education, environment and economy to create sustainable communities.
Connecting Gonzaga University students to projects with entrepreneurs housed in the Innovation Center.
Helping individuals and organizations develop sustainable business competency.
Working to ensure all our nation's children have access to a quality education.
Building a movement of excellence to deliver a quality education for every student.
Empowering Washington's parents and families to advocate for their children's learning.
Advancing innovation, equity and excellence in science, technology, engineering and mathematics (STEM) education in Washington state.
|
<urn:uuid:f8f303c1-cb23-4db5-bddb-8fb1bd828c4e>
|
CC-MAIN-2016-26
|
http://www.mckinstryinnovationcenter.com/currentinnovators/education.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395620.56/warc/CC-MAIN-20160624154955-00012-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.928205 | 261 | 2.515625 | 3 |
Help support New Advent and get the full contents of this website as an instant download. Includes the Catholic Encyclopedia, Church Fathers, Summa, Bible and more all for only $19.99...
A French Hellenist, born at Paris, 1467; died there 22 August, 1540. He studied at Paris and Orléans but with little success or application. Subsequently, however, he seemed to acquire a sudden passion for learning. After taking lessons in Greek from Hermonymus, and profiting by the advice of Joannes Lascaris, he attained great proficiency in that language. He studied at the same time, philosophy, theology, law, and medicine, in all of which he made rapid progress. Budé's abilities were recognized by Louis XII, whose secretary he became after his return from a successful embassy on occasion of the coronation of Pope Julius II. He was sent to Rome again on a mission to Pope Leo X (1515), but was recalled at his own request and accompanied Francis I in his travels. It was then that he suggested to the king the creation of a college for the study of the three languages (Greek, Hebrew, and Latin), afterwards the "College de France." Empowered to ask Erasmus to take charge of it (1517-18), he failed in his mission, and the college was not founded until 1530. At his suggestion, also, Francis declined to prohibit printing, as the Sorbonne had advised (1533). Literary France owes to Budé's efforts the foundation of the "Bibliothèque de Fontainebleau", which was the origin of the "Bibliothèque Nationale". His letters to Erasmus, Thomas More, Sadolet, Rabelais, and others written in Greek, Latin, or French, were the delight of scholars of the time. Budé was suspected of leanings towards Calvinism, and certain parts of his correspondence with Erasmus seemed to countenance this suspicion. However, it was disproved after his death. Having already translated into Latin many of Plutarch's Lives (1502-05), he published his "Annotationes in XXIV libros Pandectarum" (Paris, 1508), in which, by applying philology and history to the Roman law, he revolutionized the study of jurisprudence. Budé's treatise on Roman coins and weights, "De asse et partibus ejus" (Venice, 1522), was the best book on the subject written up to that time. In 1520 he published a philosophical and moral dissertation, "De contemptu rerum fortuitarum"; in 1527, "De studio litterarum", in which he urges youth not to neglect their literary studies. Greek, however, was his favourite study and we have from him, "Commentarii linguae graecae" (Paris, 1529), which greatly advanced the study of Greek literature in France, "De transitu helenismi ad Christianismum" (Paris, 1534), and various other works of similar scope though of minor importance. His complete works were published at Bêsle in 1557.
APA citation. (1908). Guillaume Budé. In The Catholic Encyclopedia. New York: Robert Appleton Company. http://www.newadvent.org/cathen/03034a.htm
MLA citation. "Guillaume Budé." The Catholic Encyclopedia. Vol. 3. New York: Robert Appleton Company, 1908. <http://www.newadvent.org/cathen/03034a.htm>.
Transcription. This article was transcribed for New Advent by Joseph P. Thomas.
Ecclesiastical approbation. Nihil Obstat. November 1, 1908. Remy Lafort, S.T.D., Censor. Imprimatur. +John Cardinal Farley, Archbishop of New York.
Contact information. The editor of New Advent is Kevin Knight. My email address is webmaster at newadvent.org. Regrettably, I can't reply to every letter, but I greatly appreciate your feedback — especially notifications about typographical errors and inappropriate ads.
|
<urn:uuid:32aa72f6-2c46-4031-bb33-f8c82d2d6409>
|
CC-MAIN-2016-26
|
http://www.newadvent.org/cathen/03034a.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783391519.0/warc/CC-MAIN-20160624154951-00121-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.966053 | 872 | 3.109375 | 3 |
Monday, December 9, 2013
ThinkProgress looks at the economic inequality that still lingers in the South African economy:
After an era of sanctions threatened to plunge South Africa into a dire economic crisis, Mandela traded his plan to nationalize banks and mines for a free market ideology that ushered in the longest period of growth in South African history and restored the nation’s economic standing in the world. However, Mandela’s pro-business policies essentially left poor black South Africans behind. Today, the average white family earns six times what black households make, and 73 percent of top business managers are white. Unemployment levels among young black workers is nearing 50 percent. The number of South Africans living on less than a dollar a day has doubled along with the number of millionaires in the country. Overall, unemployment is around 25 percent.
In order to restore economic stability, Mandela aggressively courted foreign investors who had avoided South Africa during apartheid, attracting major international companies that later bought many of the nation’s largest banks and manufacturers. However, the nation’s economic interests and natural resources are concentrated in the hands of a few conglomerates, making it very difficult for wealth to spread to most South Africans. In 2000, just five groups controlled 61 percent of stock market’s value. Small businesses, meanwhile, contribute just 30 percent to the nation’s GDP.
|
<urn:uuid:982a763c-e49e-468b-b05f-cb62d0c3065a>
|
CC-MAIN-2016-26
|
http://lawprofessors.typepad.com/property/2013/12/should-mandela-have-nationalized-the-banks-and-mines.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395160.19/warc/CC-MAIN-20160624154955-00197-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.945225 | 278 | 3.234375 | 3 |
Photograph by the Author
Taken at Gettysburg Nat'l. Military Park
The most common of the Parrott rifles, and one of the most utilized rifled cannon of the war, the 10 Pdr Parrott was originally manufactured with a 2.9 inch bore. In 1863, the bore was enlarged to 3.0 inches.
The 10 Pdr Parrott is easily identified by the think metal band around the weapon's breech.
This cannon was the army's first truly successful rifled field artillery piece.
Unlike earlier rifled cannon (such as the James Rifle) which were made of bronze, Parrott rifles were cast in iron.
Normally cast iron would be too brittle for such a use, so a wrought iron band was heat shrunk around the breech, adding considerable strength to the design.
Nonetheless, Parrott rifles were soon superceded technologically as it became possible to produce entire barrels from wrought iron, such as the 3 in. Ordnance Rifle
The 10 Pdr Parrott was manufactured by the West Point Foundry in the North, and by the Noble Brothers Foundry and Macon Arsenal in the South.
Hazlett, James, Edwin Olmstead, & M. Hume Parks. Field Artillery Weapons of the Civil War.
(Newark: University of Delaware Press, 1983).
Thomas, Dean. Cannons: An Introduction to Civil War Artillery.
(Gettysburg: Thomas Publications, 1985).
|
<urn:uuid:1fc5119f-918d-47b1-96e3-e4b1a86becae>
|
CC-MAIN-2016-26
|
http://artillery.onlineheadquarters.net/field_pieces.php?snum=&gun=parrott
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396106.71/warc/CC-MAIN-20160624154956-00103-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.965443 | 306 | 3.109375 | 3 |
An Introduction to Neuro-Linguistic Programming
Neuro Linguistic Programming
Some Basic Concepts in Neuro-Linguistic Programming
by Tad James, M.S., Ph.D., Certified NLP Master Trainer Copyright © 1985, 1999, 2012
Neuro-Linguistic Programming (NLP) is about noticing patterns. So, in NLP, we are not so much interested in content as in process. Often this is an interesting transition for us to make. The first step is to pay attention to the process of your interaction with others — listen to the form, watch the form, feel the form, and not get involved in the content.
What’s the Difference Between Content and Process?
First of all in life, most people tend to focus or to pay attention to content. If you ask them what happened they will give you all the details. The more they investigate a subject they will get more and more into the details. They will finally get lost in the proverbial forest because of all the trees.
We could, however, put our attention in an opposite direction and look toward the bigger picture. If we did that we might, just might, see the interconnections between the details at which we had been looking. When we look at the bigger picture and find the interconnections we are finding patterns. We are looking at the process or the structure of the details. We could then begin to see the patterns.
You may have heard that Neuro-Linguistic Programming (NLP) is about noticing patterns. So, the NLP Coach is not as much interested in content as in process. The first step is to pay attention to the process of your interaction with others — watch the patterns, listen to the structure, feel the process and do not get involved in the content. Because so many people are oriented to content, this can be a really interesting transition for us to make in our thinking. Of course, the next question then is how specifically do you “watch the patterns, listen to the structure, feel the process and do not get involved in the content?”
THE MODALITIES of NEURO LINGUISTIC PROGRAMMING
The modalities are one way of categorizing exactly what a person does inside their head as they think. They are a way of looking at process, or a model of what a person does in their head as they put together an Internal Representation (I/R).
In the process of creating Neuro Linguistic Programming, NLP discovered that by looking at someone else’s eyes as they move, you could tell HOW they think. Not what they think, but HOW they think. You can tell what they’re doing inside.
(This is how they look when you’re facing them.)
Based on initial observations in NLP, when people look up, they’re visualizing. When they look horizontally to the left and right, they’re either remembering or constructing sounds. When they look downward and to our left, they’re accessing their feelings. And when they look downward and to our right, they’re talking to themselves (Auditory Digital). The chart above is for a “normally organized” right handed person. Many left-handed people and some ambidextrous people will have eye movements that are reversed from this.
Vr Visual Remembered
(Visual Recall) – Seeing images from the memory, recalling things you’re have seen before. QUESTION: “What color was the room you grew up in?” “What color is your bedroom now?” “What does your coat look like?” (In addition, some people access visually by defocusing their eyes. When this happens, the eyes will usually stay in the center.)
Vc Visual Constructed
(Visual Created) – Images of things that you have never seen before. When you are making it up in their head, you are using Visual Constructed.
QUESTION: “What would your room at home look like if it were blue?” “What would your dog look like if it had the head of an elephant?”
Ar Auditory Remembered
(Auditory Recall) – Is when you remember sounds or voices that you’ve heard before or things that you’ve said to yourself before. When you ask someone, “What was the very last thing I said, they typically look in that direction.
QUESTION: “Can you remember the sound of your mother’s voice?”
Ac Auditory Constructed
(Auditory Created) – Is making up sounds that you’ve not heard before. For example
QUESTION: “What would I sound like if I had Donald Duck’s voice?” “What would Swan Lake sound like if it were played on bagpipes?”
(Feelings, Sense of Touch) – You generally look in this direction when you’re accessing your feelings
QUESTION: “What does it feel like to touch that rug?”
Ad Auditory Digital
(Talking to Yourself) – This is where your eyes move when you’re having internal dialogue.
QUESTION: “Can you recite the Pledge of Allegiance?”
Typically, each time we use our neurology to gain access to a particular type of thinking, we move our eyes in the direction which facilitates our using that part of the neurology. The mind and body are absolutely interconnected, so each time we access our Visual Memory, for example, we move our eyes upward and to our left. (If you’re watching someone access Visual Memory, you will see them move their eyes upward and to your right.)
Based on our Model of Communication, and how we make an internal representation, you’ll remember that people rely on their 5 senses to make I/R’s about the world around them. Internally, we also generally come to depend on one representational system or modality more than another as we access information, and also use that information to create I/R’s. So, some people are using their Visual representational system more, some people use their Auditory representational system more, and some people use their Kinesthetic more than the others.
Usually an individual will prefer to use a certain modality of neuro linguistic programming or will use primarily a certain modality as what we call their primary representational system. Let’s go through the three major modes of operation so you can notice what mode people are operating in, and begin to identify them. You can then begin to match the modes by using the predicates and physiology that match their representational system.
Visual Neuro Linguistic Programming
Typically, people who are in a visual mode stand, or sit, with their heads and/or bodies erect with their eyes up, and will be breathing from the top of their lungs. They often sit forward in the chair or on the edge of the chair. They tend to be more organized, neat, well-groomed and orderly. More deliberate. More appearance oriented, and sometimes quieter. Good spellers. Memorize by seeing pictures, and are less distracted by noise. Often have trouble remembering verbal instructions, and are typically bored by long verbal explanations because their minds tend to wander. They would rather read than be read to. A visual person will be interested in how someone looks at them, and will respond to being taken places, and being bought things. They will tend to use words like: See ya later, I want to look at it, Focus on it, Watch it, Be clear, Foggy, Picture that, Notice, Appears.
Auditory Neuro Linguistic Programming
Someone who is auditory will move their eyes sideways and also down to the right. They breathe from the middle of the chest. They typically talk to themselves, and can be easily distracted by noise. They often move their lips when they say words to themselves. They can repeat things back to you easily. They may find math and writing more difficult and spoken language easier. They like music and learn by listening. They memorize by steps, procedures, and sequence. An auditory person is often interested in being told how they’re doing, and responds to a certain set of words or tone of voice. They tend to use words and phrases like: Listen, Talk to, Said, Speak, Hear, and Sounds like, “Good to talk to you.”
Kinesthetic Neuro Linguistic Programming
They will typically be breathing from the bottom of their lungs, so you’ll see their stomach go in and out as they breathe. Their posture is often more slumped over, and they often move and talk verrrry slooowly. They will typically access their feelings and emotions to “get a feel” for what they’re doing. They respond to physical rewards, and touching. They also stand close to people and touch them. They are often physically oriented people (athletes). They may move a lot, and they memorize by doing, or walking through something. They use words like: Feelings, Get in touch, Hold, Grasp, and Handle.
|US Office: +1-888-440-4823||Australia toll free: 1800–133–433|
|From outside the US: +1-702 440-4823||Australia Office: +61 2 9221 9221|
|Email: [email protected]||Email: [email protected]|
|
<urn:uuid:2f2bc0a0-557b-48d5-899c-20e2f9722b56>
|
CC-MAIN-2016-26
|
http://www.nlpcoaching.com/an-introduction-to-nlp-some-basic-concepts-in-neuro-linguistic-programming/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783402479.21/warc/CC-MAIN-20160624155002-00172-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.958976 | 1,986 | 3.109375 | 3 |
Privacy and Security Notice
Digestion and Nutrition
1. The pouchlike muscular organ that secretes acids and digestive enzymes is the _________stomachesophagusintestines.
2. _________salivaenzymeschime is the watery material that results form digestion in the stomach.
3. Iron, potassium, and iodine are _________vitaminsmineralsamino acids.
4. The human body is about 60 percent _________saltwaternutrients.
5. The teeth break down food by _________chemical digestionmechanical digestion.
6. _________TeethYour tongueSaliva in the mouth helps to chemically digest food.
7. _________Mechanical digestionChemical digestion takes place in the mouth, stomach, and small intestine with the help of chemicals called _________amino acidsvitaminsenzymes.
8. Proteins are made up of smaller building blocks called _________mineralsvitaminsamino acids.
9. The muscle contractions that move food through the digestive tract are called _________flexingperistalsisnutrients.
10. _________FlagellaVilliStarches are tiny, fingerlike projections that cover the folds of the small intestine.
11. Chemical digestion is possible because of certain kinds of proteins called _________amino acidscarbohydratesenzymes.
12. There are six kinds of _________mineralsnutrientsvitamins available in food.
13. Three types of _________mineralsnutrientscarbohydrates are sugar, starch, and fiber.
This page is maintained by Steve Gagnon.
Citation and linking information
|
<urn:uuid:aa38f561-7ad4-4869-aca3-f72bd1162360>
|
CC-MAIN-2016-26
|
http://education.jlab.org/reading/nutrition_02.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783402699.36/warc/CC-MAIN-20160624155002-00172-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.796864 | 362 | 3.15625 | 3 |
Using a pacifier for too long may be detrimental to your child's speech. Research published in the open access journal BMC Pediatrics suggests that the use of bottles, pacifiers and other sucking behaviors apart from breast-feeding may increase the risk of subsequent speech disorders in young children.
A research team from the A research team from the Corporacion de Rehabilitacion Club De Leones Cruz del Sur and the University of Washington Multidisciplinary International Research Training Program, led by Clarita Barbosa, evaluated the associations between sucking behaviors and speech disorders in 128 three- to five- year old preschoolers from Patagonia, Chile. The team combined parents' reports of infant feeding and sucking behaviors with evaluations of their child's speech. They found that delaying bottle use until the child was at least 9 months old reduced the risk of later developing speech disorders while children who sucked their fingers, or used a pacifier for more than 3 years were three times more likely to develop speech impediments.
"These results suggest extended use of sucking outside of breast-feeding may have detrimental effects on speech development in young children", according to Barbosa. This finding is particularly relevant, as use of bottles and pacifiers has increased dramatically over the last few decades. However, Barbosa is careful to note, "Although results of this study provide further evidence for the benefits of longer duration of breast feeding of infants, they should be interpreted with caution as these data are observational."
Notes to Editors
1. The relationship of bottle feeding and other sucking behaviors with speech disorder in Patagonian preschoolers
Clarita Barbosa, Sandra Vasquez, Mary A Parada, Juan Carlos Velez Gonzalez, Chanaye Jackson, N. David Yanez, Bizu Gelaye and Annette L. Fitzpatrick
BMC Pediatrics (in press)
During embargo, article available here:
After the embargo, article available at the journal website:
Please name the journal in any story you write. If you are writing for the web, please link to the article. All articles are available free of charge, according to BioMed Central's open access policy.
Article citation and URL available on request at email@example.com on the day of publication
2. BMC Pediatrics is an open access journal publishing original peer-reviewed research articles in all aspects of health care in neonates, children and adolescents, as well as related molecular genetics, pathophysiology, and epidemiology. BMC Pediatrics (ISSN 1471-2431) is indexed/tracked/covered by PubMed, MEDLINE, CAS, Scopus, EMBASE and Google Scholar.
3. BioMed Central (http://www.
|
<urn:uuid:ed4b12cc-56f7-4d8e-bb90-97012a2fe6a8>
|
CC-MAIN-2016-26
|
http://www.eurekalert.org/pub_releases/2009-10/bc-pti101909.php
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783399385.17/warc/CC-MAIN-20160624154959-00107-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.901611 | 543 | 2.71875 | 3 |
TOEFL Essay Sample
Essay writing is part of the Writing section for both of the test formats TOEFL PBT and the TOEFL iBT. Through this section, your writing skills are put to test. In order to score high in this section, you must develop competent writing skills. You will come across many essay samples if you go online. First, carefully observe each one that you may come across. Notice the way it is written, in terms of language usage and content building. You can learn many things pertaining to writing from a good example. Any sample online is written based upon some general issue and reflects the opinions of the author. It not only expresses an individual's opinion but also reinforces the views with relevant examples.
In TOEFL, you are required to present an essay with examples and instances that can substantiate your point of view or expression. Practice is evident. When you see a sample, write an essay for the same topic reflecting your own opinions and compare it with the actual essay. This way, you can improve your skills a lot. ETS has published an official document that presents to the candidates some topics for practice. You must not miss it and make sure that you refer to all the sample topics contained in that particular document. Below is an essay written for one of the topics taken from the said official ETS document.
Some movies are serious, designed to make the audience think. Other movies are designed primarily to amuse and entertain. Which type of movie do you prefer? Use specific reasons and examples to support your answer.
The film industry today is undoubtedly one of the biggest industries in the world. It is no exaggeration to say that movies are the most highly regarded form of art. Although, there are other prominent forms of art, movies and theatre are considered the most esteemed. Apart from being one of the largest industries of the world, the film industry is very influential, powerful on monetary scale and in terms of work force involved. From such a big industry, there have been movies rolling out since as early as 1905, not considering the theatre plays. Since then, there have been scores of movies that have made an important mark in the history of films. Movies of different genres have impressed and captivated people.
There are many films that are made seriously and are made with an intention to make people think or reflect society's problems, bring awareness among people about scandals, expose socio-economic problems and much more. On the other hand, there are movies that are made just in order to amuse or entertain people. Movies of each of the above sect have their own importance and prominence among the audience. Movies must reflect what we are and the happenings around us. They are a medium for igniting vigilance in the society.
For instance, consider two great movies: Shawshank Redemption and the Harry Potter series. The former movie is a gripping narration of the lives of the inmates at the Shawshank jail and the way they get redemption in order to feel the real joy in life. On the other hand, Harry Potter is all about a super-world that might never exist and it takes the audience into a new world where magic is the driving force behind human beings. The Harry Potter series might have grossed more but Shawshank Redemption is considered a classic in the history of films. Considering a situation in our personal lives when we are low or in depression and if we were to watch a movie, then we would certainly pick up Shawshank Redemption.
In conclusion, movies with a point that can reflect our real lives,
situations, failures, love and emotions are certainly treasured more
than the movies that simply amuse or entertain us.
|
<urn:uuid:8794497b-4745-4eb2-b928-5627968adf9b>
|
CC-MAIN-2016-26
|
http://www.testpreppractice.net/TOEFL/toefl-essay-sample.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396459.32/warc/CC-MAIN-20160624154956-00101-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.962429 | 749 | 2.515625 | 3 |
Infrastructure protectionAssessing future sea level rise from ice sheets
Future sea level rise due to the melting of the Greenland and Antarctic ice sheets could be substantially larger than estimated in Climate Change 2007, the Fourth Assessment Report of the IPCC, according to new research
Future sea level rise due to the melting of the Greenland and Antarctic ice sheets could be substantially larger than estimated in Climate Change 2007, the Fourth Assessment Report of the IPCC, according to new research from the University of Bristol.
The study, published the other day in Nature Climate Change, is the first of its kind on ice sheet melting to use structured expert elicitation (EE) together with an approach which mathematically pools experts’ opinions. EE is already used in a number of other scientific fields such as forecasting volcanic eruptions.
A University of Bristol release reports that the ice sheets covering Antarctica and Greenland contain about 99.5 percent of the Earth’s glacier ice which would raise global sea level by some sixty-three meters if it were to melt completely. The ice sheets are the largest potential source of future sea level rise — and they also possess the largest uncertainty over their future behavior. They present some unique challenges for predicting their future response using numerical modeling and, as a consequence, alternative approaches have been explored.
One such approach is via carefully soliciting and pooling expert judgments — a practice already used in fields as diverse as eruption forecasting and the spread of vector borne diseases. In this study Professor Jonathan Bamber and Professor Willy Aspinall used such an approach to assess the uncertainties in the future response of the ice sheets.
They found that the median estimate for the sea level contribution from the ice sheets by 2100 was twenty-nine centimeters with a 5 percent probability that it could exceed eighty-four centimeters. When combined with other sources of sea level rise, this implies a conceivable risk of a rise of greater than one meter by 2100, which would have deeply profound consequences for humankind. The IPCC’s report provided figures ranging from eighteen centimeters to fifty-nine centimeters for six possible scenarios.
The researchers also found that the scientists, as a group, were highly uncertain about the cause of the recent increase in ice sheet mass loss observed by satellites and equally unsure whether this was part of a long term trend or due to short-term fluctuations in the climate system.
Professor Bamber said: “This is the first study of its kind on ice sheet melting to use a formalized mathematical pooling of experts’ opinions. It demonstrates the value and potential of this approach for a wide range of similar problems in climate change research, where past data and current numerical modeling have significant limitations when it comes to forecasting future trends and patterns.”
This study was part funded by Ice2sea — a major EU-funded program to improve the projections of future global sea levels.
— Read more in J. L. Bamber and W. P. Aspinall, “An expert judgement assessment of future sea level rise from the ice sheets,” Nature Climate Change (6 January 2013) (doi:10.1038/nclimate1778)
|
<urn:uuid:9b1b6546-f00d-467e-a1ad-825ff9492ba4>
|
CC-MAIN-2016-26
|
http://www.homelandsecuritynewswire.com/dr20130108-assessing-future-sea-level-rise-from-ice-sheets
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397636.15/warc/CC-MAIN-20160624154957-00051-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.930558 | 635 | 3.234375 | 3 |
|Physicians' Clinic of Iowa, PC
600 Seventh Street SE
Cedar Rapids, IA 52401 United States
Arthroscopy is a surgical procedure used to diagnose and treat problems inside a joint.
Arthroscopy utilizes a small fiber optic instrument called an arthroscope that enables the surgeon to see inside the joint without making large incisions into the muscle and tissue.
The wrist is a complex joint with eight small bones and many connecting ligaments. Arthroscopic surgery can be used to diagnose and treat a number of conditions of the wrist, including chronic wrist pain, wrist fractures, ganglion cysts, and ligament tears.
These incisions are less than half an inch long. The arthroscope, which is approximately the size of a pencil, is inserted through these incisions. The arthroscope contains a small lens, a miniature camera, and a lighting system.
The three-dimensional images of the joint are projected through the camera onto a television monitor. The surgeon watches the monitor as he or she moves the instrument within the joint.
Probes, forceps, knives, and shavers at the ends of the arthroscope are used to correct problems uncovered by the surgeon.
Diagnostic arthroscopy might be used if it is not clear what is causing wrist pain. It might also be used if wrist pain continues for several months despite nonsurgical treatment.
Before arthroscopic surgery, your doctor will do the following.
- Perform a physical examination of the hand and wrist
- Learn more about past medical conditions or concerns (medical history)
- Perform tests that locate the pain (provocative tests). These tests involve moving the hand in order to reproduce the pain.
- Secure images of the hand and wrist. These may include x-rays, magnetic resonance imaging (MRI) scans, or an arthrogram (an x-ray taken after a dye is injected into the joint).
Usually, arthroscopic surgery requires only that the hand and arm are numbed (regional anesthesia). A sedative may be given to further relax the patient.
Two or more small incisions (portals) are made on the back of the wrist. The arthroscope and instruments are inserted through those portals and the joint is observed through the camera on the end of the arthroscope.
After the surgery, the incisions are closed with a small stitch and a dressing is applied. Sometimes a splint is used.
Arthroscopic Surgical Treatment
Arthroscopic surgery can be used to treat a number of conditions of the wrist.
- Chronic wrist pain. Arthroscopic exploratory surgery may be used to diagnose the cause of chronic wrist pain when the results of other tests do not provide a clear diagnosis. Often, there may be areas of inflammation, cartilage damage, or other findings after a wrist injury. In some cases, after the diagnosis is made, the condition can be treated arthroscopically as well.
- Wrist fractures. Small fragments of bone may stay within the joint after a bone breaks (fractures). Wrist arthroscopy can remove these fragments, align the broken pieces of bone, and stabilize them by using pins, wires, or screws.
- Ganglion cysts. Ganglion cysts commonly grow from a stalk between two of the wrist bones. During an arthroscopic procedure, the surgeon can remove the stalk, which may reduce the change that these cysts will return.
- Ligament/TFCC tears. Ligaments are fibrous bands of connective tissue that link or hinge bones. They provide stability and support to the joints. The TFCC is a cushioning structure within the wrist. A fall on an outstretched hand can tear ligaments, the TFCC, or both. The result is pain with movement or a clicking sensation. During arthroscopic surgery, the surgeon can repair the tears.
- Carpal tunnel release. Carpal tunnel syndrome is characterized by numbness or tingling in the hand, and sometimes with pain up the arm. It is caused by pressure on a nerve that passes through the carpal tunnel. (The carpal tunnel is formed by the wrist bones and a thick tissue roof.) Pressure can build up within the tunnel for many reasons, including irritation and swelling of the tissue (synovium) that covers the tendons. If the carpal tunnel syndrome does not respond to nonsurgical treatment, one option is to repair the area surgically. The surgeon would cut the ligament roof and enlarge the tunnel. This would reduce pressure on the nerve and relieve symptoms. This can sometimes be done using an arthroscope.
For the first 2 or 3 days after surgery, the wrist should be elevated and the bandage should be kept clean and dry. Ice may help keep swelling down. There are exercises that can be used to help maintain motion and rebuild your strength. Although pain after surgery is usually mild, analgesic medications will help relieve any pain.
Complications during or after arthroscopic wrist surgery are unusual. They may include infection, nerve injuries, excessive swelling, bleeding, scarring, or tendon tearing. Your doctor will discuss the complications of arthroscopy with you before your surgery.
The American Academy of Orthopaedic Surgeons
9400 West Higgins Road
Rosemont, IL 60018
|
<urn:uuid:071184b0-c878-4232-9d34-cf52ac386a66>
|
CC-MAIN-2016-26
|
http://orthoinfo.aaos.org/topic.cfm?topic=A00001&grpwebid=2EDFE2
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783394987.40/warc/CC-MAIN-20160624154954-00165-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.923553 | 1,114 | 3.15625 | 3 |
Retort Furnace for Gold Bullion
This furnace is used to purify a gold concentrate. The gold concentrates, if non-pyritic, are treated in grinding pans in the bottom of which mercury is placed. The amalgam (mercury alloy), after squeezing out the excess mercury, is heated in the retort, to distil (separate) off the rest and leave the gold, which is then melted and cast into bars of gold bullion of varying fineness.
alloys, chemistry, elements, energy, evaporate, extraction, fire, furnace, gold, heat, iron, machine, machinery, mechanical, mechanize, melt, metal, mill, mine, Miner, mining, science, stamp, stamp mill, vaporization, vaporize
|
<urn:uuid:7112ab29-c1fc-4da5-ac03-b56354d16941>
|
CC-MAIN-2016-26
|
http://etc.usf.edu/clipart/87100/87122/87122_retort-furnace-for-gold-bullion.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783392159.3/warc/CC-MAIN-20160624154952-00036-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.861717 | 158 | 2.75 | 3 |
What In World History Would You Like To Learn About?
The Bantu Peoples
Around 1000 B.C., much of Africa was covered in small villages of primitive peoples who shared languages that were similar to one another. Because the languages they shared are known as Bantu, these people are referred to as the Bantu peoples.
The Bantus lived in small villages that were governed by a chief, council, or by elders. These villages were typically made up of extended families, but marriage among people of different villages was common.
The locations of Bantu villages was temporary. They tended to remain in one location until the resources in that area were exhausted. As life became more difficult, or the ground less fertile, they would move on to a new location.
|
<urn:uuid:d0c784f0-8c1b-497a-a7ab-4ae16e84a9d4>
|
CC-MAIN-2016-26
|
http://www.kidspast.com/world-history/0098-bantu-peoples.php
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395679.92/warc/CC-MAIN-20160624154955-00108-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.993577 | 159 | 4 | 4 |
Click on image for larger version
This HiRISE image shows a volcanic vent in the Tharsis region of Mars.
Tharsis is primarily a volcanic highland, containing several of the largest shield volcanoes in the Solar System and many smaller volcanic edifices.
rise is riddled with faults and fractures. The area depicted in the sub-image (above) lies between three sets of fractures -- the Cyane Fossae, the Ceraunius Fossae, and the Olympic Fossae -- and on the flank of a low volcanic shield. The prominent trough in the HiRISE image is a volcanic vent.
Shallow depressions with scalloped edges span the western (left) half of the vent. These may be places where lakes of lava once stood. The lava that ponded in the lakes probably drained back into the vent towards the end of the eruption. On the eastern (right) side of the sub-image, small channels that once transported lava feed away from the vent to both the north and south.
Originally, the vent must have been a deep and narrow fissure, but it has become more trough-like with time as material tumbled from its walls and settled on its floor. This "mass wasting" process has exposed lava flows in cross section in the walls of the trough.
Image PSP_001695_2080 was taken by the High Resolution Imaging Science Experiment (HiRISE) camera onboard the Mars Reconnaissance Orbiter spacecraft on 06-Dec-2006. The complete image is centered at 27.6 degrees latitude, 246.9 degrees East longitude. The range to the target site was 280.4 km (175.3 miles). At this distance the image scale is 28.1 cm/pixel (with 1 x 1 binning) so objects ~84 cm across are resolved. The image shown here has been map-projected to 25 cm/pixel and north is up. The image was taken at a local Mars time of 03:29 PM and the scene is illuminated from the west with a solar incidence angle of 51 degrees, thus the sun was about 39 degrees above the horizon. At a solar longitude of 146.2 degrees, the season on Mars is Northern Summer.
NASA's Jet Propulsion Laboratory, a division of the California Institute of Technology in Pasadena, manages the Mars Reconnaissance Orbiter for NASA's Science Mission Directorate, Washington. Lockheed Martin Space Systems, Denver, is the prime contractor for the project and built the spacecraft. The High Resolution Imaging Science Experiment is operated by the University of Arizona, Tucson, and the instrument was built by Ball Aerospace and Technology Corp., Boulder, Colo.
|
<urn:uuid:4b689f33-d34c-493d-a2d2-49da1f962798>
|
CC-MAIN-2016-26
|
http://photojournal.jpl.nasa.gov/catalog/PIA09568
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783403823.74/warc/CC-MAIN-20160624155003-00094-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.918182 | 543 | 3.5625 | 4 |
Protecting Your Food Supply: A Practical Approach
By Donald Poore
Protecting the nation’s food supply has always been an integral part of what food professionals do. It is even more critical in today’s environment, where productivity has a heightened sense of urgency and food defense, while necessary, may take a back seat.
Across the food industry, we have seen a barrage of preventable contamination problems in recent years. While many of these troubles seemingly have been accidental or unintentional, one can only conclude that an intentional problem is just around the corner. What we don’t know is what it will look like, where it will be, who will be affected and what will be its long- and short-term effects on the industry.
Food safety, by definition, targets the unintentional contamination of a food product. However, food defense focuses on the intentional contamination of a food product. It looks at the entire process from “farm to fork.” Food terrorism is defined by the World Health Organization as “an act or threat of deliberate contamination of food for human consumption with chemical, biological or radionuclear agents for the purpose of causing injury or death to civilian populations and/or disruption of social, economic or political stability.”
Using Food as a Weapon
We only have to look at the news headlines to know that food is a vehicle for creating panic across the nation. Unfortunately, contamination may be construed as a natural event or be misdiagnosed. Food is the ideal vehicle for the dispersion of harmful agents because of the ability to mask the harmful agent by strong flavors, strong odors, various textures or intense colors. The list of possible and available agents contributes to the challenge of detection. There are more than 80,000 chemicals that can cause illness, given the right concentration. In addition, there are hundreds of naturally occurring biological pathogens, toxins, heavy metals, parasites, radioisotopes, genetically engineered organisms and other potential illness-causing agents. Food and food products are easily accessible at multiple points in any manufacturing process. Because food is so easily distributed over great distances, there is increased potential for widespread impact. On top of these challenges, the food industry is tasked to protect 350 million people from some type of attack.
Recently we have been made aware of the new 2009 Food Safety Enhancement Act (HR 2749), which has been passed by the House of Representatives. If signed into law, this Act will give the Food & Drug Administration (FDA) unprecedented power, but will it meet the challenge of food defense? Right now, the FDA inspects less than 2% of the food coming into the country, while 13% of our food is imported. In the past, Congress has been asked for millions of dollars to protect food and agriculture, and the FDA has indicated a desire to hire 300 more inspectors. Time will tell if increased inspection will improve food defense. Regardless of the outcome, the ultimate defender and protector of the food chain is the food professional.
A food defense program known as CARVER + SHOCK has been developed in the past few years and made available recently. CARVER is military-based in design, and CARVER + SHOCK has been adapted from CARVER by several government agencies into what is currently available.
CARVER is an acronym for the following six attributes, and each one is scored on a scale of 1 to 10 with 1 being the lowest value (least risk) and 10 being the highest (greatest risk):
• Criticality: Measure of public health and economic impact of an attack
• Accessibility: Ability to physically access and egress from the target
• Recuperability: Ability of the system to recover from an attack
• Vulnerability: Ease of accomplishing the attack
• Effect: Amount of direct loss from an attack as measured by loss in production
• Recognizability: Ease of identifying the target
In addition, there is a seventh attribute, SHOCK, which assesses the health, economic and psychological impact of the attack. Scoring of this attribute is the same as for the previous six, and software is available from the FDA that will walk you through the process.
CARVER + SHOCK together address the question, “How can we safeguard our food supply from an intentional contamination process?” The software guides the user through a risk-based analysis of the entire food system from a defensive perspective. It provides guidance to help determine the best direction to take to reduce or eliminate risk. The user takes the production system and breaks it down into subsystems, individual components and “critical nodes” or the smallest pieces of the system. It helps you to think like a terrorist and identify what would be the easiest and most attractive targets. It takes you to the “dark side.”
What does a terrorist look like? He/she may be an average person working in some part of the food chain or they might be an outsider. They may have ties to no one or they may be well connected and organized. They may be someone who has experienced financial, physical, emotional or religious changes in their life. They may be the person who feels that they have been taken advantage of by the company and wants to retaliate. They may be a thrill seeker or protester and may want to try something only to stand back and see the results. When you do your analysis, don’t overlook any personnel in the area.
For the purposes of the CARVER + SHOCK assessment, one should generally consider three types of attackers: a politically motivated outside person; a disgruntled employee; and a disgruntled employee with ties to an outside person.
Conducting the Analysis
Determine the parameters. (This should be done first because it will drive the entire analysis.)
1. Determine what you are trying to protect and from what or whom.
2. What is the food you are going to protect?
3. What is the concern—foodborne illness, death or economics?
4. Who or what does the attacker look like? A politically motivated outside person, a disgruntled employee or a disgruntled employee with ties to an outside person(s)?
5. What agent will be used in the scenario/attack? This is perhaps the most difficult aspect of the analysis. Careful consideration should be given to the overall process in the choice. For instance, a liquid Salmonella solution may be easier to introduce than powdered ricin. Be practical in your choice and choose the worst case.
6. Once you have done this, do not be tempted to change parameters in the middle of the evaluation. Stick to the original ones. If you want to change the parameters, start from the beginning on a new analysis.
Assemble your team
It is suggested that your team consist of a group of skilled, educated professionals. However, you should use those who know the processes best. So, include a blend of trusted hourly employees as well as educated professionals in areas such as microbiology, food science and so on. They could be the same people you have on your HACCP team.
Develop a flowchart
Create a well-documented diagram (flowchart) of the process from beginning to end. This needs to include any subsystems, complex parts of the system and nodes. There may be subprocessing facilities within the facility. It is vital that this diagram is clear and identifies everything down to the smallest detail. Elements could include kettles, hoppers, small vats, liquefiers, fillers, ingredient injectors, small bins for holding blends or spices and so on. The HACCP plan flowcharts could be a good start but may not have enough information. Like the HACCP flowchart, the CARVER + SHOCK flowchart should also have a physical walkthrough to verify that all of the parts of the system have been captured on the chart. As you do the walkthrough with the team ask yourself, “Where could I add an agent easily?”
When the flowchart is complete, rank each of the areas as a team for each of the seven attributes identified previously. Use the 1–10 rating scale. The node with the highest value will be the one that represents the greatest risk. The rating should be based on a team decision. (A sample scoring sheet can be found below.) The calculation of the Criticality Criteria should be done first (Worksheet 1). You will have multiple nodes that have varying volumes of the food product; therefore, the concentration of an agent may be different, and thus there will be varying results on the worksheets.
As an example, consider a fluid milk plant making 8-ounce, gable-top cartons, utilizing a pasteurized silo with constant agitation, holding 10,000 gallons of milk.
• The node will be the pasteurized silo for introduction of the agent (we could have chosen the milk tanker, raw tank, constant level tank at the pasteurizer, blender area, or the filler as a node).
• The agent used will be ricin, at a rate of 2.0 mg per serving.
• Eighty-seven percent of the units were sold before the warning went out, and 50% of the units were consumed before the warning.
• One unit will be consumed per person.
• Mortality rate is 50%.
• The distribution of the product will occur through retail outlets.
• The majority of the sales in the retail outlets are in areas that have colleges or universities.
• Market share is approximately 75% in the area.
• The plant is one of five in the corporation. There are three fluid milk plants, one ice cream plant and one cultured products plant.
• Sanitation of the processes has specific guidelines designed to meet—at a minimum—the Pasteurized Milk Ordinance.
We will use these assumptions for the entire analysis of CARVER + SHOCK and draw some simple conclusions. For a profile and treatise on how to score each attribute of CARVER + SHOCK, readers are encouraged to refer to www.fsis.usda.gov/PDF/Carver.pdf— An Overview of the Carver Plus Shock Method for Food Sector Vulnerability Assessments.
A target is critical when an agent can be introduced and cause significant health or economic impact. This only takes into account a successful introduction. Ask, “Does this achieve the goal of the terrorist?” Calculate the Criticality first (Worksheet 1). Using the above information, complete the worksheet.
The Criticality scale should not imply that a certain loss of life is “acceptable,” but should be used to determine the impact of an attack on certain nodes within the process.
Based on the above analysis from our scenario, the attack would be very successful. Refer to Table 1 for scoring criteria. The scoring for Criticality would be 10. You would repeat the same analysis for each node, starting at the beginning of the process.
Pasteurized tanks are in an upper level of the plant without much traffic, but workers pass through this area to access the pasteurizer. The lighting is kept dim to save energy, and there are no cameras in the area. The tanks are filled from the top and have vents to the side of the fill tubes that are accessible. There is an attached ladder on the front of the tank, which allows access to the fill tubes and vents. The fill tubes are generally not capped after filling. The employees have poor GMP practices. The tanks are only required to be washed every 24 hours and can be filled multiple times between washings.
Based on the description, the tanks would be fairly accessible and somewhat undetected. A camera system would only help if it were continuously monitored by a person. Proper exclusion practices are not exercised. Refer to Table 2 for the scoring criteria. When scoring, take into account that some criteria fit, but others do not. This is independent of the success of introduction. Scoring for this aspect would be 6 or 7.
As described, this scenario has been a major disaster to the plant. The concern is to estimate how long it will take for the plant to recover from the publicity associated with the contamination. Also, consider how long it will take to clean the facility (should it survive) and how challenging it may be to regain market share.
Based on the fact that there were so many deaths, it is highly unlikely that the plant or even the entire organization will ever recover from this. Refer to Table 3 for the scoring criteria. Scoring of this attribute would be 10.
Each of the tanks has a ladder on the front of it. A person would have to climb the ladder and introduce the contamination agent through the 2.5-inch filling port on the top of the tank. The port is 6 feet from the floor of the platform. The tanks are not labeled to indicate that they contain pasteurized product, but “everyone” knows the tanks are for pasteurized milk.
It may not be easy to add approximately ¾ of a pound of a dry solution through a 2.5-inch port, especially considering that the port is an access point to the pasteurizer for other employees as well. If the perpetrator is detected, an employee might ask why the individual is adding something to the port. Refer to Table 4 for the scoring criteria. The score for this attribute would be 6.
The plant is a well-known entity in this area. It produces a regional, name-brand product. It has a 75% market share for the product that it manufactures and sells within the region. The plant would be shut down, the milk sales would drop to zero and other product sales would suffer greatly. Refer to Table 5 for the scoring criteria. Scoring for this aspect would be 10.
The tanks are made of stainless steel, are located close to the pasteurization system and are very large. They would be an easy target for an untrained person to identify. A picture would be adequate to show what the target should look like. Refer to Table 6 for the scoring criteria. Scoring for this attribute would be 8.
This attribute is a combined evaluation of individual emotions. Shock is considered on a national level. It is especially dramatic if the event occurs on or close to a holiday, or affects children or the elderly. Consider all of the emotional factors involved when choosing this value.
The number of deaths is very high. However, consider that it would affect young adults going to a college or university. Because the product is sold at the retail level, the incident would affect individuals of all ages. A serving size of 8 fluid ounces could be targeted to smaller children or the elderly who do not drink a lot of milk.
Ask, “How would you feel if this were to happen?” This is a key attribute. Refer to Table 7 for the scoring criteria; the score for this factor would be 10.
After the attributes have been scored, complete the summary sheet (Worksheet 2). The nodes (items) that have the highest scores need to have a mitigation strategy to reduce or eliminate the risk of an attack.
CARVER + SHOCK is an extremely valuable tool to help protect the food chain “from farm to fork.” When completing the analysis process, don’t forget to consider the people, visitors, contactors, vendors, haulers, records, equipment and supplies, interior and exterior factors and all processes from incoming to outgoing products. It has been observed—wisely—that “food at rest is food at risk.”
We are saddened to report that before this article could be published, Donald Poore passed away. He was a Quality Assurance Manager with Wells’ Dairy Inc. with over 20 years of experience in HACCP, food plant sanitation, quality systems, SQF systems and food plant production. He held positions in Quality Assurance, Production and Sanitation in the dairy and packaged food industry.
We thank his colleague Tom Sauer at Wells’ Dairy for serving as the contact for this article. Tom can be reached at email@example.com.
|
<urn:uuid:b8d7d2c0-1ae0-46c0-8446-6f32cee31310>
|
CC-MAIN-2016-26
|
http://www.foodsafetymagazine.com/magazine-archive1/februarymarch-2010/protecting-your-food-supply-a-practical-approach/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396222.11/warc/CC-MAIN-20160624154956-00035-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.94767 | 3,319 | 2.78125 | 3 |
Take a sneak peek at the new NIST.gov and let us know what you think!
(Please note: some content may not be complete on the beta site.).
Compact JILA System Stabilizes Laser Frequency
For Immediate Release: July 26, 2005
A compact, inexpensive method for stabilizing lasers that uses a new design to reduce sensitivity to vibration and gravity 100 times better than similar approaches has been demonstrated by scientists at JILA in Boulder, Colo. JILA is a joint institute of the National Institute of Standards and Technology (NIST) and the University of Colorado at Boulder.
The method, described in the July 15 issue of Optics Letters,* stabilizes laser light to a single frequency, so that it can be used as a reliable reference oscillator for technologies such as optical clocks and light-based radar (lidar). The new stabilizer design performs better than similar systems of comparable size and is much smaller and less expensive than the best-performing systems, according to physicist John Hall, a co-author of the paper.
Laser systems are highly sensitive to environmental disturbances, such as electronic "noise" and vibration from soft drink vending machines or other equipment with mechanical motors. To stabilize operations in cases when high precision is needed, lasers are often "locked" to a single wavelength/frequency using an optical "cavity," a small glass cylinder with a mirror facing inward on each end. Laser light bounces back and forth between the mirrors and, depending on the exact distance between them, only one wavelength will "fit" that distance best and be reinforced with each reflection. Information from this stabilized laser light is then fed back to the laser source to keep the laser locked on this one frequency. But the cavity can vibrate, or expand in response to temperature changes, causing corresponding slight frequency changes. Researchers have tried various improvements such as using cavities made of low-expansion glass.
In the latest advance, the JILA team made the cavity shorter and positioned it vertically instead of horizontally, with symmetrical mounting supports so that gravity and vibration forces yield opposing distortions in the two halves, and thus balance out to zero net effect. The system was demonstrated with an infrared laser. "We designed the cavity so it doesn't care if it's vibrating," says Hall, who helped develop a leading resonant cavity design two decades ago. "We get good performance with a complete reduction of complexity and cost."
The work was supported by the Office of Naval Research, National Aeronautics and Space Administration, National Science Foundation and NIST.
*M. Notcutt, L.S. Ma, J. Ye, and J.L. Hall. 2005. Simple and compact 1-Hz laser system via improved mounting configuration of a reference cavity. Optics Letters. July 15.
|
<urn:uuid:0bf05642-1d8d-4f4a-a53e-673b1b69ba94>
|
CC-MAIN-2016-26
|
http://www.nist.gov/pml/div688/jila_072605.cfm
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397213.30/warc/CC-MAIN-20160624154957-00128-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.938304 | 576 | 3.21875 | 3 |
Almost half of GPs have admitted prescribing antibiotics even though they know they will not treat the patient's condition, a survey shows.
Ninety per cent of doctors who responded to a recent questionnaire said they felt pressure from patients to hand out the medications.
The Longitude Prize survey compiled responses from 1,004 GPs across the UK, and found 28% have prescribed antibiotics several times a week even when they are not sure if it is medically necessary, and 45% have done so knowing they will not help.
The findings come after experts at Public Health England and University College London revealed earlier this month that the number of patients given antibiotics for minor ailments has soared in recent years.
While 36% of patients were given antibiotics for coughs and colds in 1999, by 2011 this figure had soared to 51%, the study published in the Journal of Antimicrobial Chemotherapy found.
Last month, Prime Minister David Cameron said that resistance to antibiotics was a "very real and worrying threat" as he pledged to put Britain at the forefront of the fight against drug-immune bacteria threatening to send medicine "back to the dark ages".
The latest research comes ahead of the £10 million Longitude Prize which will open later this year for entries to find an easy and cost-effective test for bacterial infections that doctors can use to determine if and when to give out antibiotics.
Seventy per cent of GPs surveyed said they prescribe because they are not sure whether the patient has a viral or bacterial infection, and 24% say it is because there is a lack of easy-to-use diagnostic tools.
Dr Rosemary Leonard said she understands the pressures GPs are faced with to prescribe antibiotics when they are not actually necessary.
"The more antibiotics taken, the more resistant bacteria come to them," said Dr Leonard. "Antibiotic resistance is a real issue and more needs to be done to conserve antibiotics for the future.
"Diagnostics play a valuable role in making this happen. Not only can diagnostics help determine the type of infection someone has, they could gather valuable data and aid the global surveillance efforts."
Tamar Ghosh who leads the Longitude Prize, said accurate diagnostic tools can help curb the unnecessary use of antibiotics across the globe.
"In the next five years, the Longitude Prize aims to find a cheap and effective diagnostic tool that can be used anywhere in the world," said Ms Ghosh.
"We recognise that stemming the misuse and overuse of antibiotics is just one piece of the jigsaw to slow bacterial resistance to antibiotics.
"Nevertheless it's an important step when we could be waiting many years for other solutions, including novel alternatives to antibiotics coming to the market."
Just 6% of 1,074 patients surveyed by Populus earlier this month said they would push their GPs to give them antibiotics, despite the high number of doctors saying they feel under pressure to do so.
|
<urn:uuid:232de714-e201-4526-9b21-e3ea65a63c1c>
|
CC-MAIN-2016-26
|
http://www.yorkpress.co.uk/news/national/11417761.GPs__pressured__over_antibiotics/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397636.15/warc/CC-MAIN-20160624154957-00114-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.94783 | 595 | 2.515625 | 3 |
Product: Punxsutawney Phyllis
Category: Groundhogs Day
Book Review for Kids
Age: toddler, preschool, kindergarten, elementary
Punxsutawney Phyllis by Susanna Leonard Hill, Jeffrey Ebbeler (Illustrator)
Young Phyllis' goal is to be the next Punxsutawney Phil - the spring weather predicting groundhog. She wakes up one February morning to see the snow melting, the brook running, and the air smelling sharp--all indicators of an early spring. Her sleepy uncle is reluctant to get out of bed and she offers to make the spring prediction for him. Uncle predicts 6 more weeks of winter and Phyllis predicts an early spring. Uncle Phil doesn't make the right predicition on Groundhog Day, and Phyllis proves to him that she's got what it takes. He officially names her his successor even though tradition has always called for male predictors. Phyllis' wit, perceptions, and trust in her own instincts are the things that lead her to her achievements - inspirational for both boys and girls of all ages.
|
<urn:uuid:8b07677b-ea83-4032-b873-ef2df7c885e9>
|
CC-MAIN-2016-26
|
http://www.apples4theteacher.com/holidays/ground-hog-day/kids-books/punxsutawney-phyllis.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396029.85/warc/CC-MAIN-20160624154956-00015-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.939655 | 230 | 2.734375 | 3 |
How do a population's genes change?
Remember, without change, there cannot be evolution. Together, the forces that change a population's gene frequencies are the driving mechanisms behind evolution.
Forces of Evolution
The conditions for Hardy-Weinberg equilibrium are unlikely to be met in real populations. The Hardy-Weinberg theorem also describes populations in which allele frequencies are not changing. By definition, such populations are not evolving. How does the theorem help us understand evolution in the real world?
From the theorem, we can infer factors that cause allele frequencies to change. These factors are the "forces of evolution." There are four such forces: mutation, gene flow, genetic drift, and natural selection.
Mutation creates new genetic variation in a gene pool. It is how all new alleles first arise. In sexually reproducing species, the mutations that matter for evolution are those that occur in gametes. Only these mutations can be passed to offspring. For any given gene, the chance of a mutation occurring in a given gamete is very low. Thus, mutations alone do not have much effect on allele frequencies. However, mutations provide the genetic variation needed for other forces of evolution to act.
Gene flow occurs when individuals move into or out of a population. If the rate of migration is high, this can have a significant effect on allele frequencies. The allele frequencies of both the population they leave and the population they enter may change.
During the Vietnam War in the 1960s and 1970s, many American servicemen had children with Vietnamese women. Most of the servicemen returned to the United States after the war. However, they left copies of their genes behind in their offspring. In this way, they changed the allele frequencies in the Vietnamese gene pool. Was the gene pool of the American population also affected? Why or why not?
Genetic drift is a random change in allele frequencies that occurs in a small population. When a small number of parents produce just a few offspring, allele frequencies in the offspring may differ, by chance, from allele frequencies in the parents. This is like tossing a coin. If you toss a coin just a few times, you may, by chance, get more or less than the expected 50 percent heads or tails. In a small population, you may also, by chance, get different allele frequencies than expected in the next generation. In this way, allele frequencies may drift over time. There are two special conditions under which genetic drift occurs. They are called bottleneck effect and founder effect.
- Bottleneck effect occurs when a population suddenly gets much smaller. This might happen because of a natural disaster such as a forest fire. By chance, allele frequencies of the survivors may be different from those of the original population.
- Founder effect occurs when a few individuals start, or found, a new population. By chance, allele frequencies of the founders may be different from allele frequencies of the population they left. An example is described in the Figure below.
Founder Effect in the Amish Population. The Amish population in the U.S. and Canada had a small number of founders. How has this affected the Amish gene pool?
- There are four forces of evolution: mutation, gene flow, genetic drift, and natural selection.
- Mutation creates new genetic variation in a gene pool.
- Gene flow and genetic drift alter allele frequencies in a gene pool.
Use this resource to answer the questions that follow.
→Biology for AP* →Search: The Process of Genetic Change
- What drives evolution?
- Describe genetic drift.
- Distinguish between the bottleneck effect and the founder effect.
- What is gene flow?
- What is meant by nonrandom mating?
- Why may inbreeding be dangerous?
- Describe sexual selection.
- Describe natural selection.
1. Identify the four forces of evolution.
2. Why is mutation needed for evolution to occur, even though it usually has little effect on allele frequencies?
3. What is founder effect? Give an example.
4. Explain why genetic drift is most likely to occur in a small population.
|
<urn:uuid:13b0ad55-c9ce-49da-9ec0-a8dd857ded36>
|
CC-MAIN-2016-26
|
http://www.ck12.org/biology/Forces-of-Evolution/lesson/user:dGhhc2FuZWUuY2hhbnRhcm9qd29AZHlzYXJ0Lm9yZw../Factors-That-Allow-for-Evolution/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783392099.27/warc/CC-MAIN-20160624154952-00073-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.928302 | 850 | 4.46875 | 4 |
1879 – Birth of Eustace Broke Loraine, pioneer British aviator and first Royal Flying Corps officer to be killed in an aircraft crash.
1917 – England-based single-seat scout aircraft operate at night for the 1st time, when three Sopwith Camels of No.44 Squadron fly patrols against Gotha bombers attacking Chatham. Although no interceptions are made, the sorties prove single-seat fighters can operate safely at night.
1953 – First flight of the Pilatus P-3, a Swiss military trainer.
1996 – Americans Ron Bower and John Williams break the round-the-world helicopter record with a Bell 430 helicopter, flying westwards from the UK with a time of 17 days, 6 hours and 14 minutes.
1997 – Death of Shui-Tin “Arthur” Chin (shown), Chinese-American pilot and Second Sino-Japanese War fighter ace; he was America’s first World War II ace.
2010 – UPS Airlines Flight 6, a Boeing 747-400F, crashes near Dubai International Airport , killing two crew members; it is the first fatal accident for the cargo carrier.
|
<urn:uuid:0315c3a0-ca7c-42fd-b156-5d2e3e1aa9b4>
|
CC-MAIN-2016-26
|
http://www.flightjournal.com/blog/2014/09/03/on-this-day-in-aviation-history-360/
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397749.89/warc/CC-MAIN-20160624154957-00083-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.891548 | 238 | 2.703125 | 3 |
In 1930, not anticipating the advent of the computer, Paul Valery said that the arts could no longer escape the influence of modern science and technologies. Great innovations would change all techniques of the arts influencing creativity and perhaps going so far in the end as to transform the concept of art itself (1). Today, with it's wide spread use, the computer appears to have become an innovation of this sort.
Over time, many technological innovations have influenced the arts. No one would have anticipated how far reaching Senefelder's laundry list dashed off on an inking slab in 1796 would be, yet today we think of lithography not only as a means of commercial printing but also as a fine art print-making process. Similarly, with the advent of photography, the challenge of justifying an art which relied so heavily on a machine became real. Edward Weston said of photography "Wouldn't it be funny, if one could pierce the future, and find that [photography] was accepted as a great art form, because the mind-- 'intelligence', that is --could be directed through a machine in a purer form, without the bungling interference of the hand!" (2). Warhol went further - not only did he advocate the use of modern technology in art, but commented that he'd actually like to be a machine. Unselfconscious about his reliance on machines, Warhol's soup cans and Coke bottles, both in their everyday subject matter and mechanical methods of execution, are prime examples of an artist working with, and reacting to, the technology afforded him by the time in which he worked.
The rapid growth of the computer graphics field, and the dramatic changes it has undergone, make it impossible to identify all of the processes one can employ. At times it is impossible to even ascertain if the computer has been used at all. Initially, output or hard copy was not of importance for computer artists, who in the 50's merely photographed their computer screen. By the 80's, many artists were outputting onto 35mm film and either projecting the image onto canvas, having it photoengraved or printing in traditional photographic format.
It will be, and for some of us already is, the responsibility of the conservator to maintain and care for these collections. To do that effectively we must understand, first of all, what we're looking at. The 'digital imaging' profession classifies these print technologies in a similar manner to traditional print-making processes -- relief, intaglio, planographic and serigraphic. The four digital systems investigated here are: thermographic, ink jet, electrographic and fujix printing systems.
These systems rely on the application of heat to form an image. Specifically, thermal transfer systems, introduced in the late 1970's and early 80's, employ heat to transfer colorant from a carrier to a final substrate. Each color is transferred individually, the paper passing under the printhead three times allowing for the transfer of cyan, magenta and yellow colorants. There are a number of processes which fall into this broad class of printers. The two currently investigated are only related in their use of heat to transfer colorant.
Direct Thermal Transfer (commercially known as: thermowax)
This is an inexpensive system which produces fairly low resolution images. A sheet of smooth paper and a donor ribbon with a thermoplastic, wax containing ink layer, move in contact under a thermal printhead. The application of heat through the donor ribbon causes the ink to release and transfer onto the paper.
Dye Diffusion Thermal Transfer (commercially known as: dye sublimation)
Dye diffusion thermal transfer prints are billed as near photographic in quality. A ribbon, carrying dye based colorants, and a sheet of chemically-coated paper, move in contact under a thermal printhead. The application of heat makes the colorant gaseous, which then condenses on the support. The amount of dye transferred from the ribbon is determined by the amount of heat supplied by the printhead, allowing for what the industry terms: 'continuous' tonality.
Ink jet systems are based on the emission of streams of colored ink from a nozzle, deposited on a support to form an image. Ink jet technology was invented in 1965 and finally became commercially available in the late 1970's. Two classes of ink jet technology have been studied, differing in the system which controls the flow of ink.
Impulse Jet (commercially know as: drop-on demand, phase change)
Impulse jet printers are inexpensive machines which produce fairly low resolution images. These printers expel drops of colorant in response to an applied signal in the form of heat, pressure or a pulsed electric current. As the support moves under the print head, ink is projected from the nozzles to form an image. This technology often employs water based dyes, however, solvent based or hot-melt colorants which have a high wax component have also been used. A wide variety of supports are available, including: paper, coated plastic, glass, and metal.
Continuous Jet (manufactures: IRIS, Stork)
Continuous jet printing, produces very high resolution images. The technology employs a steady emission of water based dyes through a nozzle. This stream of colorant is either allowed to break up naturally into individual droplets or separated by ultrasonic vibrations. Drops are selectively charged according to the image. They pass through a high voltage deflection field and are either deflected onto the support or collected in a reservoir for recycling. A range of papers or coated plastic supports can be used, although highly absorbent papers are often chosen to increase the visual resolution. Although it is conceivable to have pigment dispersions in water, rather than dyes, their use is presently limited due to the small size of the nozzles and problems of clogging.
In this process a charged drum or belt is selectively discharged to form a latent image. This electronic or latent image is rendered with opaque toner and fused to paper. This type of imaging system was invented in 1938, and called xerography. In 1959 Haliod, now Xerox, produced the first commercially available automatic copier. There are a number of similar systems based on the same basic principle, with many different names: xerography, ionography, magnetography, and electrostatic printing systems. These can also be classified as toner based technologies.
Electrophotographic (commonly known as: laser printers, standard photocopiers etc.)
Specifically, electrophotographic systems employ a light sensitive photoreceptor as the drum or belt. The colored toner is laid down in three or four passes, requiring the photoconductor to be sensitive over the entire visible spectrum. At each pass one of the colored toners is presented to the electrophotographic surface. As a final step the complete image is transferred to paper and fused by means of heat, pressure or a combination of the two. The colorants used are synthetic dyes in thermoplastic resins, and the support is often plain paper. Although a range of papers can be used, the fusing subsystem is most effective with a relatively smooth paper.
Fujix systems are silver halide photographic processes which do not require chemicals for image development. Sometimes referred to as 'thermal silver development dye diffusion color imaging'. There are two processes: the pictrograph and the pictrostat. Both use the same photographic process, however, the pictrograph outputs from digital image data and the pictrostat prints from transparencies, negatives or positive originals. In both, photosensitive donor paper is exposed by laser diodes at levels which correspond to the input image. There is a small amount of silver in the donor paper which aids in the capture of light. Heat and a small amount of water is applied to create a dye image in the donor paper, which is then transferred to the receiver sheet. The dyes in the receiver sheet do not contain any silver.
The computer has become an instrument for contemporary artists. In this arena, digital imaging technology is being employed to produce hardcopy art. The identification of these works is crucial to understanding their storage, handling and display needs as well as treatment options and limitations. Identifying all of the digital imaging processes currently available is an enormous task, and despite our best efforts, the rapid development of this technology will continue to make that a challenge.
1. Crone, R. (1989). "Form and Ideology: Warhol's Techniques From Blotted Line to Film" in The Work of Andy Warhol: Dia Art Foundation #3. Seattle: Bay Press, page 70.
2. Stainback, C. (1993). "From Those Wonderful People Who Brought You Innovation" in Iterations: The New Image Massachusetts: The MIT Press, page 9.
Crone, R. (1989). "Form and Ideology: Warhol's Techniques From Blotted Line to Film" in The Work of Andy Warhol: Dia Art Foundation #3. Seattle: Bay Press.
Druckrey, T. (1993). "Revisioning Technology" in Iterations: The New Image Massachusetts: The MIT Press.
Druckrey, T. (1998). Digital Photography: Captured Image, Volatile Memory, New Montage. San Francisco: SF Camerawork.
Goodman, C. (1987). Digital Visions: Computers and Art New York: Harry N. Abrams
Mitchell, J.W. (1992). The Reconfigured Eye : Visual Truth in the Post-Photographic Era. Massachusetts: The MIT Press.
Pomeroy, J. (1998). Digital Photography: Captured Image, Volatile Memory, New Montage.
San Francisco: SF Camerawork.
Stainback, C. (1993). "From Those Wonderful People Who Brought You Innovation" in Iterations: The New Image Massachusetts: The MIT Press.
Struckey, C.F. (1989). "Warhol in Context" in The Work of Andy Warhol: Dia Art Foundation #3. Seattle: Bay Press.
Andreottola, M.A. (1991). "Ink Jet Technology" Chapter 12 in Handbook of Imaging Materials. New York: Marcel Dekker, Inc.
Bugner, E. (1991). "Review of Electrographic Printing" in Journal of Imaging Science. Vol 35 #6 Nov./Dec.
Gruber, R.J. & Julien, P.C. (1991). "Dry Toner Technology" Chapter 4 in Handbook of Imaging Materials. New York: Marcel Dekker, Inc.
Haas, W.E. (1989). "Non Impact Printing Technologies" Chapter 13 in Imaging Processes and Materials: Neblette's Eighth Edition. New York: Van Nostrand Reinhold.
Hays, D.A. (1991). "The Evolution of Color Xerographic Development Systems" in Journal of Imaging Technology. Vol 17 #6 Dec.
Jones, L.O. (1991). "Carrier Materials for Imaging" Chapter 5 in Handbook of Imaging Materials. New York: Marcel Dekker, Inc.
Kang, H.R. (1991). "Water Based Ink Jet Ink 1. Formulation" in Journal of Imaging Science. Vol 35 #5 May/June.
Kang, H.R. (1991). "Water Based Ink Jet Ink 2. Characterization" in Journal of Imaging Science. Vol 35 #5 May/June.
Kang, H.R. (1991). "Water Based Ink Jet Ink 3. Performance Studies" in Journal of Imaging Science. Vol 35 #5 May/June.
Komerska, J.F. (1991). "Thermal Imaging Materials" Chapter 11 in Handbook of Imaging Materials. New York: Marcel Dekker, Inc.
Martin, G. (1992). Non Impact Printing. Surrey: Pira International.
Schaffert, R.M. (1975). "Electronic Imaging Hardcopy Systems" Chapter 8 in Electrography, London: Focal Press
Scharfe, M.E., Pai, D.M. & Gruber, R.J. (1989). "Electrophotography" Chapter 5 in Imaging Processes and Materials: Neblette's Eighth Edition. New York: Van Nostrand Reinhold.
Schmit, S.P. & Larson, J.R. (1991). "Liquid Toner Technology" Chapter 6 in Handbook of Imaging Materials. New York: Marcel Dekker, Inc.
Starkweather, G.K. (1989). " A Survey of Electronic Color Printer Technologies" in Society of Photographic Imaging Engineering (SPIE) Vol 1082.
Wilhelm, H. (1995). "Digital Color Prints for Your Desktop" in The Commercial Image, May.Narelle Jarry
Paper delivered at the Book and Paper specialty group session, AIC 24th Annual Meeting, June 10-16, 1996, Norfolk Virginia.
Papers for the specialty group session are selected by committee, based on abstracts and there has been no further peer review. Papers are received by the compiler in the Fall following the meeting and the author is welcome to make revisions, minor or major.
Timestamp: Wednesday, 03-Aug-2011 10:44:35 PDT
Retrieved: Saturday, 02-Jul-2016 07:23:03 GMT
|
<urn:uuid:cd502ef4-2928-4822-869d-853f166745b9>
|
CC-MAIN-2016-26
|
http://cool.conservation-us.org/coolaic/sg/bpg/annual/v15/bp15-08.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783408840.13/warc/CC-MAIN-20160624155008-00004-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.911525 | 2,772 | 3.03125 | 3 |
FREE SHIPPINGON EVERY ORDER!
In this succinct, yet comprehensive book, leading authority James A. Banks gives readers a forward-reaching look toward increasing their understanding of what multicultural education means for classroom teaching in contemporary classrooms. Here he explores the concepts, principles, theories, and practices of multicultural education in such key areas as: the goals and misconceptions of multicultural education; citizenship education and diversity in a global age; curriculum transformation; curriculum reform; and, school reform and intergroup education. Included are checklists for evaluating informational materials and evaluating multicultural education. An Introduction to Multicultural Education is ideal for pre-service and practicing educators who require a concrete approach but have little time to devote to the topic.
|
<urn:uuid:6ba63999-a032-44ab-8e4c-4128e9d92028>
|
CC-MAIN-2016-26
|
http://www.knetbooks.com/introduction-multicultural-education-5th/bk/9780132696333
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783404382.73/warc/CC-MAIN-20160624155004-00058-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.899074 | 142 | 2.921875 | 3 |
St. Andrew's Roman Catholic Cathedral
St. Andrew's Roman Catholic Cathedral National Historic Site of Canada
Cathédrale catholique St. Andrew's
Links and documents
1890/01/01 to 1892/01/01
Listed on the Canadian Register:
Statement of Significance
Description of Historic Place
St. Andrew’s Roman Catholic Cathedral National Historic Site of Canada is an imposing heritage landmark in the urban core of Victoria, B.C. The cathedral’s twin-towered design has a strong vertical emphasis and a picturesque asymmetry that is enhanced by a soaring spire and a bold combination of red brick, pale grey stone, slate and metal building materials. Ornate vaulting, stained glass and galleries contribute to the sense of grandeur within the well-preserved interior. The designation refers to the cathedral on its legal lot at the time of designation in 1990.
St. Andrew’s Roman Catholic Cathedral was designated a national historic site of Canada in 1990 because:
- it is a fine representative example of the Gothic Revival Style.
Designed in 1892 by Perrault and Mesnard of Montreal, and built by contractor J.H. Donovan, St. Andrew’s was inspired by the medieval cathedrals of Europe, whose emphatic verticality and picturesque asymmetry greatly appealed to 19th-century architectural taste. The influence of French Gothic Revival style is evident in the twin towered façade, centre rose window and the triple entrance portal. Features such as the rich array of contrasting colours and materials created by the red-brick walls with grey stone trim and slate roof were characteristic of the High Victorian Gothic Revival Style.
Aspects of this site which contribute to its heritage value include:
- the complex cruciform plan, including the complementary but not identical front towers, single tall spire, narthex, nave, transepts, polygonal apse and two galleries above the narthex, reflecting the influence of French Gothic sources on the design;
- the use of French Gothic-inspired detailing including triplet entranceway, corner piers and wall buttresses, decorated parapets, the rose window located above the main entrance, polished granite columns and wall surrounds on the main entrance, rose windows on both transept end walls, and trefoil windows on the walls of the nave and apse;
- the High Victorian taste for rich and varied surface design evident in the use of polychrome in the slate roofing, detailing of red brick wall surfaces with limestone, the use of polished granite details, the diaper-work panels on the front façade, ornate metal eaves and roof ornamentation;
- interior features including the ornamental vaulting, stained and coloured glass windows, decorative plaster detailing, columns and galleries.
Government of Canada
Historic Sites and Monuments Act
National Historic Site of Canada
Theme - Category and Type
- Building Social and Community Life
- Religious Institutions
- Expressing Intellectual and Cultural Life
- Architecture and Design
Function - Category and Type
- Religion, Ritual and Funeral
- Religious Facility or Place of Worship
Architect / Designer
Perrault and Mesnard
Location of Supporting Documentation
National Historic Sites Directorate, Documentation Centre, 5th Floor, Room 89, 25 Eddy Street, Gatineau, Quebec
Cross-Reference to Collection
|
<urn:uuid:00f53967-0cb5-462f-b524-7cbb0a2be736>
|
CC-MAIN-2016-26
|
http://www.historicplaces.ca/en/rep-reg/place-lieu.aspx?id=13349&pid=0
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783400572.45/warc/CC-MAIN-20160624155000-00155-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.873034 | 706 | 2.9375 | 3 |
Small stem cells, such as spore-like cells, blastomere-like stem cells (BLSCs), and very-small embryonic-like stem cells (VSELs) have been described in recent studies, although their multipotency in human tissues has not yet been confirmed. Here, we report the discovery of adult multipotent stem cells derived from human bone marrow, which we call StemBios (SB) cells. These isolated SB cells are smaller than 6 ìm and are DAPI+ and Lgr5+ (Leucine-Rich Repeat Containing G Protein-Coupled Receptor 5). Because Lgr5 has been characterized as a stem cell marker in the intestine, we hypothesized that SB cells may have a similar function. In vivo cell tracking assays confirmed that SB cells give rise to three types of cells, and in vitro studies demonstrated that SB cells cultured in proprietary media are able to grow to 6–25 ìm in size. Once the SB cells have attached to the wells, they differentiate into different cell lineages upon exposure to specific differentiation media. We are the first to demonstrate that stem cells smaller than 6 ìm can differentiate both in vivo and in vitro. In the future, we hope that SB cells will be used therapeutically to cure degenerative diseases.
Citation: Wang J, Guo X, Lui M, Chu P-J, Yoo J, Chang M, et al. (2014) Identification of a Distinct Small Cell Population from Human Bone Marrow Reveals Its Multipotency In Vivo and In Vitro. PLoS ONE 9(1): e85112. doi:10.1371/journal.pone.0085112
Editor: Nanette H. Bishopric, University of Miami School of Medicine, United States of America
Received: May 28, 2013; Accepted: November 30, 2013; Published: January 17, 2014
Copyright: © 2014 Wang et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This study was funded by TriMax SBT LLC of Los Angeles, a venture investment company. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have received funding from a commercial source, TriMax SBT LLC. One or more of the authors are employed by a commercial company, StemBios Technologies, Inc. Both of these affiliations does not alter the authors' adherence to all the PLOS ONE policies on sharing data and materials.
Stem cells have been derived from the inner cell mass (hESCs: human Embryonic Stem Cells), adult tissues –, and adult somatic cells (iPSs: induced Pluripotent Stem Cells) , . Although hESCs and iPSs are capable of becoming almost any type of specialized cell in the body and may have the potential to generate replacement cells for a broad array of tissues and organs , future transplantations using these cells are hindered by immune rejection and teratoma formation –. As a result, the search for multipotent or pluripotent stem cells from adult tissue has become increasingly important in stem cell research. Adult stem cells, unlike hESCs and iPSs, do not undergo teratoma formation , or immune rejection in autologous transplants.
Currently, adult stem cell studies have focused on MSCs (mesenchymal stem cells) , which are considered a promising therapeutic approach for many diseases –. They can be isolated from sources such as umbilical cord blood and bone marrow , among others , . However, plasticity of MSCs for trans-differentiation is questionable because they appear to differentiate into mesoderm lineages only . Thus, obtaining multipotent or pluripotent adult stem cells that can differentiate into different germ layers is crucial for future cell therapy.
The race to discover adult pluripotent stem cells began early this century. In 2002, Jiang et al. reported their findings on multipotent adult progenitor cells (MAPCs) from bone marrow that could differentiate into ectoderm, mesoderm, and endoderm cells, introducing a new avenue in the discovery of pluripotent or multipotent stem cells from adult tissue. Other types of cells including marrow-isolated adult multi-lineage inducible cells (MIAMI) and single cell clones derived from bone marrow demonstrated the same multi-potential ability for differentiation. Unfortunately, the difficulty associated with obtaining, culturing, and expanding these pluripotent stem cells has proven to be a challenge.
In this study, we present our discovery of one group of novel cells isolated from human Bone Marrow (hBM). These cells, which we call SB cells, are less than 6 µm in diameter, express Lgr5, and experience significant increases in size and population after incubation in vitro. The addition of specific differentiation media at this stage caused the SB cells to differentiate into endoderm-, mesoderm-, and ectoderm-derived cell types. In vivo tracking of SB cells that were intravenously injected into the tails of sub-lethally irradiated SCID mice showed that the SB cells were able to develop into hepatocytes (endoderm), neurons (ectoderm), and skeletal muscle cells (mesoderm). Overall, these characteristics suggested that SB cells could play large roles in future stem cell-based therapeutic applications.
Materials and Methods
1.1. Ethics Statement
All mouse injections and organ preparations were carried out at Charles River Laboratories (protocol numbers: BA-p042 and BA-e219) in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and the Animal Welfare Act. The protocol was approved by the Institutional Animal Care and Use Committee of Charles River Discovery Research Services in North Carolina (permit number: 990202).
1.2. Samples and reagents
This study was conducted using data obtained from 70 fresh hPB and 30 fresh hBM samples purchased from AllCells, LLC. A list of the reagents and antibodies used in this study is available upon request. The antibodies used for flow cytometry are as follows: SYTO Green nucleic acid staining (Life Technologies), CD9 (Biolegend), CD235a (eBioscience), Lgr5 (Origene), Lin (BD), CD45 (BioLegend), CD34 (eBioscience), CXCR4 (eBioscience), CD117 (eBioscience), CD105 (eBioscience), CD133 (Miltenyi Biotech) and CD66e (Santa Cruz Biotechnology). A custom Y-chromosome FISH probe (Empire Genomics) was used for FISH staining.
1.3. Isolation of the SB mixture
hBM and hPB were collected in anti-clotting tubes and incubated at 4°C for 72 hours, after which the blood and bone marrow were separated into two layers. The SB mixture was collected from the top layer.
1.4. Isolation of Lgr5+ cells from the SB mixture
The Lgr5+ cells were isolated using two methods: the magnetic enrichment of Lgr5+ cells (performed seven times) and FACSorting (performed five times). The PE Selection Kit (StemCell Technologies, catalog number: 18551) was used to isolate the Lgr5+ cells. The SB mixture was incubated with a PE selection cocktail (using an Lgr5-PE antibody) for 15 minutes and magnetic nanoparticles for 10 minutes at room temperature (RT). The mixture was placed into the magnet and incubated for 5 minutes at RT. The supernatant was then discarded, and the cells were plated for further culturing. Alternatively, the cells of the SB mixture were stained with the Lgr5-PE antibody and isolated via FACSorting using the BD FACSAria cell sorter at the UCLA Flow Cytometry Core Facility.
1.5. SB cell cultures
Purified SB cells were plated onto a collagen-coated 6-well plate (Thermo Scientific, catalog number: 152034) in SB medium and monitored daily until the cells attached to the well. The SB cell suspension was cultured in Stem Pro 34 medium (Life Technologies) with 1X antibiotic, 1X L-glutamine, 5 ng/mL G-CSF, 5 ng/mL SCF, 40 ng/mL EGF, 20 ng/mL bFGF, 5 ng/mL PDGF, 10 ng/mL R-spondin-1, and 10 ng/mL Noggin to allow for cell expansion and enlargement to a size of 6∼25 µm for several days until cell attachment. After the cells attached, they were cultured in Mesengro MSC medium (Stem RD) and were ready for differentiation. For SB cell induction, please refer to the differentiation assay described below.
1.6. Doubling Time and Cell Cycle Assay
For the doubling time assay, purified Lgr5+ cells and Lgr5- cells were plated in 48-well plates at 3×104 cells/well. A volume of 200 µl medium was added to each well (10 ng/ml GCSF (eBioscience), 10 ng/ml SCF (Peprotech), 10 ng/ml EGF (Peprotech), 10 ng/ml R-spondin-1 (StemRD), PDGF (eBioscience), and Opti-MEM Reduced-Serum Medium (Invitrogen)). The total number of cells in each well was counted in triplicate using a hemocytometer at 0 hrs, 24 hrs, 48 hrs, and 96 hrs of incubation. For the cell cycle assay, purified Lgr5+ cells were starved in 1% BSA/PBS solution for 16 hrs at 4°C. The Lgr5+ cells were plated in the same media as the doubling time assay and fixed in 70% ethanol at specific time points of 0 hrs, 8 hrs and 14 hrs. The cells were centrifuged at 6000 rpm for 15 minutes and the ethanol was removed. The cells were then stained with propidium iodide (PI) for DNA content and incubated for 5–10 minutes at room temperature. After staining, the sample was subjected to flow cytometry and the data were analyzed with ModFit software.
1.7. In vivo study: injection of SB cells into mice
SB cells from the BM of a 25-year-old, male human donor were purified and re-suspended in PBS with 5% human albumin for injection at Charles River Laboratories. Two groups of six female SCID mice (6–8 weeks old) received a sub-lethal (2Gγ) gamma-irradiation prior to injection. Each mouse was injected twice with 1×105 SB cells, first immediately after the radiation and again 24 hrs later. The negative control group consisted of mice injected with PBS only. Tissues were collected 60 days after the first injection. Half of the tissues were prepared as frozen sections by Charles River Laboratories, and the remaining tissues were sent to StemBios in RNAlater reagent for gene expression analysis at the RNA level.
1.8. DAPI staining
The cells were smeared onto slides and incubated with 100% EtOH for 20 minutes at −20°C and then with DAPI for 30 minutes at RT. The slides were then washed twice with PBS and mounted with Vectashield mounting media (Vector, catalog number: H-1200).
1.9. Differentiation assay
SB cells were cultured in differentiation medium, which was changed every 2–3 days. As previously described , for hepatocyte differentiation, the cells were cultured in three different types of media: high glucose DMEM with 3% horse serum, 1X antibiotic, 1X L-glutamine, and 5 ng/mL activin for 4 days; high glucose DMEM with 3% horse serum, 1X antibiotic, 1X L-glutamine, 20 ng/mL bFGF, and 5 ng/mL hBMP2 for 10 days; and Hepato ZYME SFM (Life Technologies Gibco) with 2% horse serum, 1X antibiotic, 10 ng/mL HGF, 1×10 nM Dex, and OSM 10 ng/mL for 10 to 15 days. For neurogenic and adipogenic differentiation, the cells were grown in neuronal differentiation medium (Promocell, catalog number: C-28015) for 8–10 days and adipocytic differentiation medium (Life Technologies, catalog number: A10070-01) for 10 days, respectively, in accordance with the manufacturer's protocols. Adipocyte detection kits were used for adipocyte staining and detection.
1.10. Transwell test
Five-µm transwell plates (Corning, catalog number: 3421) were used for the co-culture experiments. Female stromal cells were plated at the bottom of the wells, and male SB cells were seeded on top. The cells were cultured in stromal cell medium (Life Technologies, catalog number: A1033201). After two days of incubation, the cells at the bottom of the wells were assayed by FISH staining.
1.11. Flow cytometry
Cells from the 70 hPB and 30 hBM samples were stained using the following antibodies: CD235a-APC, CD9-FITC, Lgr5-PE, CD133-APC, CD45-APC, CD34-APC, CXCR4-APC, CD117-APC, CD105-APC, Lin-FITC and SYTO-FITC. The cells (1×105) were re-suspended in PBS containing 1% BSA (staining buffer) and incubated with the indicated antibodies (or labeled isotype control antibodies) for 30 min at 4°C. The cells were washed in flow cytometry staining buffer and analyzed with a C6 accuri flow cytometer.
A human albumin ELISA kit (Bethyl Laboratories, catalog number: E88-129) was used to test the amount of albumin secretion from the cells in culture. The samples and standards were loaded in 96-well plates according to the manufacturer's instructions and were measured at an absorbance of 450 nm.
SB cells grown in vitro were first smeared onto Fisherbrand Colorfrost microscope slides and fixed in −20°C MeOH/CH3COOH (3∶1) for 1 hour at RT. The tissue section slides were prepared by Charles River Laboratories. All of the slides were washed in 2X SSC, pretreated with pepsin at 37°C, fixed with 1% formaldehyde in 0.5% MgCl2/PBS, and dehydrated with serial concentrations of ethanol. Fluorescence human Y chromosome probes (Empire Genomics) were loaded onto the slides and denatured at 80°C. The slides were then incubated overnight at 37°C and washed with 0.4X SSC/0.3% IGEPAL at 37°C and 2X SSC/0.1% IGEPAL at RT for 2 minutes each. The slides were then counterstained with DAPI (Vector Vectashield) and observed under a Nikon Ti-S fluorescence microscope.
1.14. RT-PCR for gene expression analysis
RNA was extracted from the SB cells using the Arcturus PicoPure RNA isolation kit from Life Technologies (catalog number: 12204-01); the extraction was followed by multiple steps of reverse transcription using the RiboAmp HS PLUS kit from Life Technologies (catalog number: KIT0525) and real-time PCR to detect Oct 4 and Nanog gene expression. For mouse tissue, RNA was extracted with the Qiagen RNA extraction kit (catalog number: 74104), reverse transcription was performed using the reverse transcription kit from Life Technologies (catalog number: 18080-051), and real-time PCR was performed using SYBR green mix from BioRad (catalog number: 170-8882) according to the manufacturer's instructions. The PCR products were analyzed on a 1.8% agarose gel. The PCR products that produced bands were sequenced to confirm that they corresponded to the genes of interest. The primer information is shown below:
GAPDH (F: 5′-AGCTGAACGGGAAGCTCACT-3′, R: 5′-TGCTGTAGCCAAATTCGTTG-3′)
mouse-specific β actin (F: 5′-AAGAGCTATGAGCTGCCTGA-3′, R: 5′-TACGGATGTCAACGTCACAC-3′)
α-1 anti-trypsin (F: 5′-GGGAAACTACAGCACCTGGA-3′, R: 5′-CCCCATTGCTGAAGACCTTA-3′)
human-specific Tau (F: 5′-CTCTTTCAGGGGTCCTAAGC-3′, R: 5′-AGCTGCAGGTCTGTAGATGG-3′)
human specific myogenic factor 4 (F: 5′-CAGTGCCATCCAGTACATCG-3′, R: 5′-AGGTTGTGGGCATCTGTAGG-3′)
alpha fetoprotein (F: 5′-AAATGCGTTTCTCGTTGCTT-3′, R: 5′-GCCACAGGCCAATAGTTTGT-3′)
albumin (F: 5′-GAAACATTCACCTTCCATGC-3′, R: 5′-ACAAAAGCTGCGAAATCATC-3′)
neurofilament (F: 5′-GCGTCTCCTCAGAAACAAAA-3′, R: 5′-GCACACAGGATAGAGGATGG-3′)
FoxA2 (F: 5′-CCATGCACTCGGCTTCCAGTATG-3′, R: 5′-CGCCGACATGCTCATGTACGTG-3′)
MAPT (F: 5′-CTCTTTCAGGGGTCCTAAGC-3′, R: 5′-AGCTGCAGGTCTGTAGATGG-3′)
Oct4 (F: 5′-GGACCAGTGTCCTTTCCTCT-3′, R: 5′-CCAGGTTTTCTTTCCCTAGC-3′)
Nanog (F: 5′–ATGAGTGTGGATCCAGCTTG–3′, R: 5′–CCTGAATAAGCAGATCCATGG-3′)
Sox2 (F: 5′-GAAATGGGAGGGGTGCAAAA-3′, R: 5′-ATCGCGGTTTTTGCGTGAGT-3′)
The frozen section slides were fixed in 3.7% formaldehyde, blocked with 10% normal horse serum from the ABC kit (VECTASTAIN Elite PK-6200; Vector), and incubated overnight with primary antibody at 4°C. The biotinylated universal secondary antibody (ABC Kit) complex method and the TSA Biotin system (Perkin Elmer, catalog number: NEL744001KT) were used for detection. In the final step, the slides were counter-stained with DAPI and observed under a Zeiss Upright LSM510 2-Photon confocal microscope.
1.16. Immunocytochemistry (ICC)
Frozen tissue section slides were fixed in 3.7% formaldehyde and blocked with 5% BSA in PBS. The slides were incubated with primary antibody overnight at 4°C and then secondary antibody for 1 hour in the dark at room temperature. For the final step, the slides were counterstained with DAPI and observed under a Nikon Ti-S fluorescence microscope.
1.17. Western Blot analysis
Cells were re-suspended in a RIPA buffer containing protease inhibitors (Thermo Scientific, catalog numbers: 78425 and 89900). The cell lysates were separated on 4–12% Bis-Tris gels (Life Technologies, catalog number: BG04120) and transferred to PVDF membranes (Life Technologies, catalog number: LC2005). After incubation with primary antibodies against beta-actin (Santa Cruz Biotech), Tau (Millipore), albumin (Abcam), and adiponectin (Abcam) at 4°C overnight, the membranes were incubated with an HRP-conjugated secondary antibody (1:50,000; Li-Cor) for 1 hour at room temperature. They were then incubated with WesternSure Premium Chemiluminescent Substrate (Li-Cor, catalog number: 926-95000) for 5 minutes and visualized using a Li-Cor C-Digit Blot Scanner.
1.18. Statistical analysis
T-tests were used to analyze the data from the adipogenesis assay and albumin ELISA. Statistical significance was defined as P<0.01.
2.1 SB cells are present in human bone marrow (hBM) and peripheral blood (hPB)
It has been suggested that small stem cells (smaller than 6 ìm in diameter), such as spore-like cells , , VSELs , , and BLSCs , may exist in all adult tissues. These cells primarily remain in a dormant state and may only be activated in harsh environments, such as in oxygen-deprived states and extreme temperature conditions. Injury or disease could also trigger activation, at which point these cells have the potential to regenerate into any tissue lineage. However, researchers have been skeptical regarding the characterization of these small stem cells as pluripotent or multipotent in humans . Our aim was to obtain potentially useful multipotent or pluripotent stem cells from adult tissue, specifically from hBM or hPB.
hBM or hPB were collected in anti-clotting tubes and separated into two layers after 72 hours at 4°C. The bottom layer consisted almost entirely of red blood cells (RBC) and white blood cells, while the top layer, which we referred to as the SB mixture layer, contained SB cells (Fig. 1A). Because the SB cells resided in the top layer, the general size of the SB cells was estimated as >6 ìm, the size of the RBCs, which was further confirmed by the flow cytometry results in shown Fig. 2. This separation narrowed the identity of the cells in the SB mixture layer to SB cells, platelets, and extracellular vesicles including microparticles, microvesicles, and apoptotic bodies, because all of these cell types conform to this size restriction , . Our results indicated that an average of less than 10% of the SB mixture cells were DAPI-positive; the DAPI-positive cells excluded platelets and extracellular vesicles, which lacked nuclei (Fig. 1C). To verify the presence of integral chromosome structures, we performed FISH Y-chromosome staining on the SB cells. The SB cells from the male donor were seeded at the top of the transwell, and the large stromal cells from the female donor were plated at the bottom. After 2 to 3 days of incubation, the SB cells were passed through a 5-ìm filter of the transwell, and the male SB cells were identified using Y-chromosome fluorescence. Around the large stromal cells, one small cell was identified that was positive for both FISH and DAPI staining (Fig. 1C), indicating that the SB cells contained an integral chromosome structure. Negative Annexin-V staining in these SB cells (Fig. 1B) further confirmed their identity by eliminating the possibility of apoptotic bodies. Thus, these cells were live SB cells and not apoptotic bodies, platelets or extracellular vesicles.
A) Presence of SB cells and DAPI staining. The SB cells in the SB mixture layer were visualized under a light microscope. The cells of the SB mixture are shown under white light (left) and UV (middle). The merged image (right) reveals SB cells with a size of approximately 3.5 µm. The SB cells are the only nucleated cells in the SB mixture; thus, the SB cell count is equivalent to the number of DAPI+ cells. Scale bars, 20 µm. B) Annexin-V staining. The SB cells were analyzed for the expression of Annexin-V (black), a marker of apoptotic bodies, and for the isotype control (red). As shown, 99.7% of these cells did not express Annexin-V, indicating that these cells were not apoptotic bodies. C) FISH and DAPI staining of SB cells in the 5-µm transwell assay. Male SB cells were seeded at the top of the transwell, and stromal cells from female bone marrow were seeded at the bottom. FISH staining was performed immediately after the SB cells passed through the 5-µm filter. The SB and stromal cells were both DAPI-positive, but only the SB cells contained the Y-chromosome. Thus, the SB cells were double-positive for nuclear and Y-chromosome staining. One FISH-positive cell (top left) and two DAPI-positive cells (bottom left) are shown. The merged image (bottom right) reveals that the FISH-positive cell was also DAPI-positive, indicating that it is an SB cell. Scale bars, 100 µm.
A) Flow cytometry of the SB mixture. Beads were purchased from Spherotech, Inc. and examined by flow cytometry to determine the size range standards (a). Using these ranges as a reference, the SB cells were estimated to be 2–6 µm in diameter. Flow cytometry for the hPB and hBM samples before separation (b) and the layer containing only the SB mixture after separation (d). The addition of red blood cell (RBC) lysis buffer revealed that G6 contained RBCs (c). G1 gating represents the background of the staining buffer (e). G2 gating contained particles that were <1 µm in size; most of these were microparticles and microvesicles. G3 contained three major populations (>1 µm): SB cells (G4), RBCs (G6), and white blood cells (WBCs) (G5). The WBCs (G5) were larger than 6–7 µm and have nuclei. B) Flow cytometry of the SB cells. The G4 region was further divided into P1 and P2. (a) P1 gating represents the platelet population. Nearly all of the cells in this gate were CD9+. (b) P2 gating represents the SB cells. We found that 68.3% of these cells were SYTO+, indicating chromosome structure. (c) Lgr5, a stem cell marker, was expressed by 32% of the P2 population. Black: staining with Lgr5; red: staining with the isotype control. C) Flow cytometry of RBCs in the SB cell mixture. G6 represents the RBC location. The RBCs were CD235a+. D) Flow Cytometry of VSELs and BLSCs in the SB cell mixture. Few cells expressed CD66e, a marker of BLSCs (left) and CD133, a marker of VSELs (right), in the SB mixture.
To further characterize the SB mixture, the cells were analyzed using flow cytometry. A total of 1,000,000 events were collected at a threshold of 10,000 in the CFlow software for each antibody-stained sample, and gates were created based on data from the 70 human Peripheral Blood (hPB) and 30 hBM samples. Flow cytometry size standard particles (Spherotech) were used to determine the size range of 2–6 µm (Fig. 2A-a) for gating analysis. Gate G2 was comprised of cells that were smaller than 2 µm, which were most likely microparticles or microvesicles. Gate G3, which included cells with a diameter greater than 2 µm, included three populations: G4, G5, and G6. Analysis using RBC lysis buffer indicated the presence of RBCs in the G6 region (Fig. 2A-c), where 99.6% of the cells in this region were confirmed as positive for CD235a (Fig. 2C) and negative for SYTO-stained nuclei (data not shown). The cells in the G5 region were also larger than RBCs (G6) and were presumed to be WBCs because these cells stained positive for CD11b (data not shown). The cells of the SB mixture were present in the G4 region, confirming that the SB cells were smaller than the RBCs (6 µm). The post-purification procedure removed nearly all of the RBCs (G6) and WBCs (G5) in the hPB and hBM samples (Fig. 2A-d), and staining with Lin antibodies excluded the lineage cells. In addition, more than 80% of the cells derived from hPB were positive for CD9, a platelet marker , in the G4 region; nearly all of these cells were captured in the P1 region (Fig. 2B-a). Approximately 10-20% of the G4 population did not express CD9, a platelet marker, and are shown in the P2 region. In this P2 region, 68.3% of the P2 region cells were positive for nuclear SYTO staining (Fig. 2B-b), and approximately 10%–60% of the cells (various individuals) expressed Lgr5 markers. These cells, which were both Lgr5+ and SYTO+, were named SB cells. In addition to existing in the peripheral blood, these SB cells were also found in the bone marrow. The SB mixture was also investigated for the presence of similar small stem cells, BLSCs and VSELs using the CD66e and CD133 markers, respectively. Less than 1% of the cells in the SB mixture expressed either CD66e or CD133 (Fig. 2D), suggesting that the VSEL and BLSC concentrations in this mixture were insignificant.
2.2 Characterization of Lgr5+ SB cells from hBM
Using magnetic beads or FACSorting, Lgr5+ SB cells were isolated from the SB mixture derived from BM. FACSorting was performed five times on five individual BM samples. Depending on each individual; approximately 0.3–3% of the SB mixture was composed of Lgr5+ cells. These Lgr5+ cells were further analyzed via DAPI staining. Positive DAPI expression was detected in approximately 70% of the Lgr5+ sorted cells; this result is detailed in Figure S1. A proliferation assay and cell cycle analysis were also performed on the Lgr5+ SB cells. The proliferation rate for the Lgr5+ cells was found to be 21.7 hours (Fig. S2A), and the cell cycle profile revealed that the proportions of cells in S and G2/M phase were larger than that in G1 phase (Fig. S2B). Both assays revealed characteristics that were similar to embryonic stem cells. To further investigate whether our Lgr5+ cells had similar characteristics to embryonic stem cells, we examined their embryonic stem cell marker expression (Fig. S3). According to our RT-PCR gel results, our Lgr5+ cells expressed Nanog and Oct4, which are also expressed on embryonic stem cells, but did not express Sox2 markers (Fig. S3). Flow cytometry was used to compare these cells with HSCs, MSCs and VSELs. According to the hBM flow cytometry data, the Lgr5+ cells were negative for lineage markers as well as CD34 and CD117 (markers of hematopoietic stem cells), CD105 (marker of MSCs) and CD133 (marker of VSELs) (Fig. S4). Interestingly, 50% of the Lgr5+ population was CXCR4+ (Fig. S4). In conclusion, our Lgr5+ SB cells had different markers from HSCs, MSCs, VSELs and hematopoietic cells and were thus determined to be a new type of stem cell.
2.3 Lgr5+ SB cells are able to differentiate in vitro
As shown in Figure 3A, after 2 weeks of culture, the SB cells from hBM had grown to 6 –25 ìm in diameter. This proliferation and size increase suggested the presence of small stem cells.
A) SB cell attachment. Purified Lgr5+ cells at day 0 (left) and after attachment (right). B) Mesoderm differentiation. Before (left) and after (right) Oil Red O staining for differentiated adipocytes. C) Quantification of Oil Red O- stained cells. Negative controls: SB cells cultured in adipogenesis medium only and SB cells cultured in Stem Pro 34 medium, which is not an adipocyte differentiation media. D) Endoderm differentiation. RT-PCR assay for hepatocyte formation; “-” indicates the negative controls without template cDNA. Expected product sizes: GAPDH (2), 184 bp; albumin, 152 bp; FoxA2, 164 bp; and alpha-fetoprotein, 272 bp. E) Ectoderm differentiation. RT-PCR assay for differentiated neurons; “-” indicates negative controls without template cDNA. Expected product sizes: GAPDH (2), 184 bp; MAPT, 235 bp; and NEFL (neurofilament), 184 bp. Note: * indicates P≤0.01. F) Immunocytochemistry using neurofilament (Cyc-3) staining. Filters (left to right): red (Cyc-3), UV (DAPI), FITC (background), and merged Cyc-3 + DAPI. All scale bars, 100 µm.
To illustrate the SB cells' ability to differentiate into the three germ layers in vitro, these cells were cultured in four different types of media and subsequently analyzed to confirm that the differentiation was successful. This in vitro characterization was performed four times (three times using the StemCell PE isolation kit and one time using FACSorting). To test for mesoderm differentiation, the cells were cultured in adipogenesis medium. Oil Red O staining indicated significant increases in the number of adipocytes compared with the negative control (Fig. 3B, 3C). The SB cells also differentiated into hepatocytes and endoderm cells in the hepatocyte differentiation media. These cells secreted 50 ng/ml albumin into the medium and expressed several hepatocyte-specific genes such as albumin, FoxA2, and alpha-fetoprotein (Fig. 3D). To investigate the potential of ectoderm differentiation, the SB cells were similarly cultured in neuronal differentiation medium. Neurofilament and MAPT expression increased with each successive day in culture (Fig. 3E). The results from the ICC neurofilament staining also confirmed the cells' potential to neuronally differentiate (Fig. 3F). In addition to ICC, western blot analysis was also used to determine the expression of Tau protein, albumin, and adiponectin on SB cells treated with neuronal differentiation medium, hepatocyte differentiation medium, and adipocyte differentiation medium (Fig. S5). Taken together, the SB cells were able to differentiate in vitro into the three different germ layer cell types.
2.4 SB cell engraftment in SCID mice
Because SB cells can differentiate in vitro, they may exhibit characteristics similar to those of embryonic stem cells, which differentiate as multipotent stem cells. Thus, we performed an in vivo cell tracking assay. Tail-vein injections with either 1×105 male SB cells from hBM or PBS were performed in sub-lethally irradiated female SCID mice. The use of SCID mice, which lack T cells and B cells, ensured that the sub-lethal irradiation would eliminate the NK cells, which have the potential to reject the SB cells in an immune system response. In addition, this type of irradiation creates an injury signal, which is important in the guiding stem cells to the injury site for repair. After 60 days, the organs of the mice were collected and analyzed. The FISH technique, which employs fluorescent human specific Y-chromosome probes, was used to detect the human cells in vivo. As observed in the mouse brain, liver, and muscle tissue samples, cells that were double-positive for Cyc-3 and DAPI were of human origin (Fig. 4). The 60× magnification images of the FISH analysis are found in Fig. S6. The lung, kidney, and intestine showed an increased amount of SB cells compared with the brain, which was associated with the fewest number of integrated SB cells (data not shown). These results were consistent for all six mice in the experimental group, suggesting that the injury signal guided the migration of the SB cells to the injury site. To determine whether the SB cells that migrated to the organs were capable of differentiating, RT-PCR was performed. β-actin, α1-anti-trypsin, myogenic factor 4, and Tau gene expression were assessed in these organs (Fig. 5). In this assay, primers against mouse beta-actin served as the positive control, and the primers for the liver, brain, and skeletal muscle were human-specific. The final gel analysis of the RT-PCR products demonstrated that human SB cells resided in the mouse brain, liver, and skeletal muscles and differentiated into hepatocytes, neurons, and skeletal muscle cells in the host. In addition to RT-PCR, IHC staining was also used to test the injected SB cells for differentiation in the host SCID-mice. The IHC results demonstrated that the injected SB cells, in addition to those migrating in the mouse body, also differentiated into neurons in the brain, hepatocytes in the liver, and myocytes in the muscle (Fig. S7). These data were consistent for all six mice in the experimental group.
Mouse organs were collected 2 months post-injection. For each tissue, the SB cell-injected mice (top rows) were compared with the PBS injected-mice (bottom row). The human Y-chromosome Cyc-3 probe was used for FISH staining. The sections were also counterstained with DAPI. Filters: merged Cyc-3 + UV, red (Cyc-3), UV (DAPI), and FITC (background) for top row and red (Cyc-3), UV (DAPI), and FITC (background) and merged Cyc-3 + UV for bottom row. Scale bars, 50 µm.
Mouse organs were collected 2 months post-injection. For each tissue, the SB cell-injected mice were compared with the PBS-injected mice. Marker: 100-bp DNA ladder. Expected sizes: beta-actin, 160 bp; Tau, 235 bp; α1-anti-trypsin, 175 bp; and myogenic factor 4, 225 bp.
The search for pluripotent or multipotent stem cells to treat degenerative diseases has been an ongoing effort. Our study makes a significant contribution to current stem cell research as we found novel multipotent stem cells in the hBM, which we refer to as SB cells. When cultured in conditioned media, these newly discovered SB cells exhibit the ability to expand and differentiate into neurons, liver cells, and muscle cells in vitro and in vivo, confirming their multipotency.
Flow cytometry and transwell experiments were used to characterize the SB cells. The cells in the SB mixture were smaller than RBCs, passed easily through a 5-µm filter and were positive for SYTO, DAPI, and Y-chromosome FISH staining. Based on this information, stem cells smaller than 6 ìm in diameter are present in hBM and hPB, which we named SB cells. Flow cytometry analyses showed that SB cells with a diameter of 1- 6 ìm expressed Lgr5, a Wnt target gene that may play a role in cell self-renewal and proliferation – and functions as a stem cell marker primarily in the stomach and small intestine . Our study revealed that Lgr5+ cells are also found circulating in the blood and BM and may perform a profound function in all tissues of the body. The knockout of Lgr5 in mice has been shown to be lethal , suggesting that Lgr5 may be an early marker of epithelial progenitors and, thus, a marker of multipotency. This idea is supported by the ability of the SB cells to proliferate and differentiate. Additionally, the Lgr5 ligand is thought to be similar in sequence to the receptors of LH, FSH, TSH, and BMP, hormones that regulate homeostasis . Thus, Lgr5 may participate in the maintenance of homeostasis through its circulation. The presence of the abovementioned markers suggests that SB cells have a similar phenotype to that of undifferentiated stem cells. Furthermore, the SB cells expressed Oct4 and Nanog (Fig. S3), two markers that are associated with embryonic stem cells – and adult MSCs . The expression of these factors suggested that SB cells have the potential to differentiate. This hypothesis was tested in our in vitro study (Fig. 3) and in vivo cell-tracking assay (Fig. 4 and Fig. 5).
These SB cells were characteristically different from the previously identified small stem cells. At least three types of stem cells smaller than 6 µm have been identified in previous studies, namely, spore-like cells, blastomere-like stem cells (BLSCs), and very small embryonic-like stem cells (VSELs). Spore-like cells , which are present in all tissues, are composed of greater than 50% nucleic acids by volume and are protected by a glycolipid membrane. When activated under extreme conditions such as low oxygen and high or low temperatures, they can proliferate and differentiate into any cell type. However, further examination of these cells is limited by the lack of well-characterized cell markers. BLSCs, which are considered to be totipotent stem cells smaller than 5 µm , have been identified using the surface marker CEA (CD66e). Furthermore, VSELs are characterized by CD133 and SSEA1 expression . Similar to embryonic stem cells, these cells exhibit a high ratio of nuclear volume to cytoplasmic volume and express Oct4, Nanog, and Sox2 .
Unlike spore-like cells, BLSCs, and VSELs, SB cells do not typically express CD66e, CD133, or Sox2, as shown in Fig. 2D. They also do not express the HSC and MSC markers CD34, CD105, and CD117. Rather, SB cells may be identified via their Lgr5 expression and positive nuclear staining with SYTO and DAPI, making them different from spore-like cells, BLSCs and VSELs. In addition, SB cells may differentiate into hepatocytes, neurons, and muscle cells in vivo and in vitro, a finding that has not yet been shown for VSELs , BLSCs or spore-like cells.
The use of the Lgr5 antibody to isolate Lgr5+ cells from hBM yielded a small homogenous suspension of SB cells. These cells were cultured in specific medium to obtain cells that ranged from 6 ìm to 25 ìm in diameter. Because our medium contained R-spondin-1, an agonist of Wnt signaling, and the SB cells expressed Lgr5 , Wnt signaling may be associated with successful SB cell growth and in vitro expansion. Once the Lgr5+ SB cells underwent expansion, they were able to differentiate into hepatocytes, neurons, and muscle cells. Interestingly, Lgr5+ and Lgr5- proliferation assays revealed that the doubling times were similar among both cell populations (Fig. S2), contrary to our hypothesis. Further study indicated that a portion of the Lgr5- population expressed CD349 (unpublished results), a cell marker that is linked to the Wnt receptor, which leads us to suspect that Wnt signaling plays a large part in small stem cell proliferation. These data have not been previously demonstrated, which further suggests that SB cells are distinct from other small stem cell populations. Finally, Danova-Alt et al. (2012) previously dismissed the existence of small human stem cells , most likely due to their incorrect isolation of a VSEL population . Miyanishi et al. (2013) also discovered that VSELs were not present in mice BM , which is similar to our result in the human SB mixture. However, VSELs may be able to originate from other human organs. Here, we provide evidence demonstrating the existence of LGR5+ small stem cells from hBM that have the potential to differentiate in vitro and in vivo.
Interestingly, SB cells were also found in hPB. The doubling time of the SB cells from hPB varied from 30∼60 hrs, depending on the person (data not shown). The ability of hPB-derived SB cells to differentiate has been demonstrated to be difficult to achieve. The disparity between SB cells from hBM and SB cells from hPB may be due to a niche difference because hBM contains many more supporting stromal cells than hPB . These stromal cells comprise a basic niche environment and provide proper signaling and regulation to the surrounding stem cells for differentiation. Thus, the co-culture of stromal cells with SB cells derived from hPB may be required to form larger SB cells (data not shown). Further investigation is necessary to determine a valid cause for the proliferation and differentiation of SB cells in hPB.
As previously described, SB cells are commonly found in the dormant G0 state, and these cells transition to G1 phase only upon proper activation, which can be induced by oxygen deprivation, extreme temperatures, injury or disease. In a previous study, VSEL activation via an Ezh2-dependent bivalent domain mechanism was proposed . Ezh2, a histone methyltransferase that catalyzes the trimethylation of histone H3 at lysine 27, is responsible for the gene repression of the lineage-regulatory genes for pluripotency, while the H3 lysine 4 trimethylation encodes for genes that are activated during differentiation . A decrease in Ezh2 expression caused this bivalent domain to become monovalent upon activation, opening the chromatin for transcription, which enables VSEL differentiation. Successful SB cell differentiation in vitro and in vivo likely follows the same mechanism; thus, we aimed to investigate whether the activation of SB cells could be elicited in response to injury. In our in vivo animal model, sub-lethal gamma-irradiation was used to provide the injury signal necessary for the mobilization of human SB cells throughout the mouse bodies into organs such as the brain, muscle, and liver in a similar fashion to that of VSELs, which have been shown to mobilize only to the site of craniotomy to form skeletal tissue . Such an injury signal may be critical for the activation, expansion, and differentiation of SB cells. This injury signal may also account for the existence of a very heterogeneous population of small stem cells (spore-like, BLSCs, VSELs, and SB cells). The degree of the injury or different types of stress signals may call for different responses that require specific cells. However, how this injury signal is associated with stem cell activation through pathways such as the Ezh2-dependent bivalent domain remains unclear and requires further investigation.
In the future, we hope to study this G0 to G1 activation by focusing our efforts on the SB cells post-activation. We propose that mobile SB cells from a particular patient could undergo in vivo expansion and enrichment in vitro prior to injection into an injured patient. This in vivo method would preserve any SB cell characteristics and chromosome epigenetics that may be altered using traditional in vitro culture. If this clinical trial proves to be successful, our SB cells may hold great promise for future cell therapy because adult stem cells do not induce autologous cell teratoma formation (unpublished result) or immune rejection nor do they raise any ethical concerns.
In summary, Lgr5-expressing SB cells isolated from human bone marrow can expand in vitro in culture and differentiate both in vitro and in vivo.
Quantitation of DAPI+ Lgr5+ cells. DAPI staining of the Lgr5+ cells obtained from the bead separation protocol revealed that 70% of these cells were DAPI+.
A) Proliferation rate of Lgr5+ and Lgr5- cells in the BM. The BM supernatant was collected and purified using magnetic beads to select the Lgr5+ cells. The proliferation rates of both the Lgr5+ and Lgr5- cells were determined. The purified Lgr5+ cells and Lgr5- cells were plated in triplicate for each time point in 48-well plates at 3×104 cells/well. For each well, 200 µl medium was added. The total amount of cells in each well was determined using a hemocytometer at 0 hrs, 24 hrs, 48 hrs, and 96 hrs of incubation. The proliferation rate of the Lgr5+ cells was 21.7 hrs (left), and the rate of Lgr5- cells was 18.8 hrs (right). B) Cell-cycle profile analysis of the SB cells. The DNA content in the purified Lgr5+ SB cells was analyzed by flow cytometry analysis in which the number of cells and the amount of DNA content were compared after 0 hrs, 8 hrs, and 14 hrs. The percentage of cells in each phase of the cell cycle was calculated using the ModFit software.
Gene expression in the SB cells. RT-PCR analysis indicated that the SB cells expressed GAPDH and the embryonic stem cell markers Oct4 and Nanog. Expected sizes: GAPDH (1), 296 bp; Oct4, 225 bp; Nanog, 190 bp; and Sox2, 159 bp.
Marker exression in Lgr5+ cells. Flow cytometry was applied to determine the expression of Lin, CD45, CD117, CD34, CD105, CD133, and CXCR4 in the Lgr5+ cells from the SB mixture derived from hBM. The data showed that the Lgr5+ cells were Lin-, CD345-, CD34-, CD105-, CD117-, and CD133-. In addition, 50% of the Lgr5+ cell population was positive for CXCR4 expression.
In vitro differentiation of SB cells. From left to right, the SB cells were treated with neuron differentiation medium, hepatocyte differentiation medium, and adipocyte differentiation medium, respectively. β-actin was used as a positive protein existence control for all samples. For the neuron differentiation medium-treated cells (right), Tau and β-actin expression were tested at 0 days and 8 days of incubation. The hepatocyte differentiation medium-treated cells (middle) were collected at 0 days and 7 days of incubation to test for the expression of albumin and β-actin. The cells cultured in adipocyte differentiation medium (left) were lysed to test for adiponectin and β-actin at 0 days and 20 days.
Xenograft SB cell migration in vivo: 60X images of frozen mouse tissue sections subjected to FISH staining. Fig. 4 illustrated the FISH staining of frozen mouse tissue sections at 40X. Mouse organs were collected two months post-injection. The human Y-chromosome Cyc-3 probe (red) was used for FISH staining. The sections were counterstained with DAPI. The organs collected were the brain, liver, and muscle (left to right). Filters (top to bottom): UV (DAPI), red (Cyc-3), FITC (background), and merged Cyc-3 + UV. Scale bars, 20 µm (DAPI, red, FITC) and 10 µm (merge).
Xenograft SB cell differentiation in vivo. IHC staining of post-injection tissues. Organs were collected two months post-injection. For each tissue, the SB cell-injected mice (top rows) were compared with the PBS injected-mice (bottom row). Filters (left to right): red (Cyc-3), FITC (background), UV (DAPI), and merged Cyc-3 + UV. Brain: Staining for neurofilaments (human-specific) and DAPI. T Liver: Staining for alpha-1-antitrypsin (human-specific) and DAPI. Muscle: Staining for dystrophin (human-specific) and DAPI.
We thank Michelle Lee and the Nature Publishing Group Language Editing Service (#5JAM1029) for their help in proofreading this manuscript.
Conceived and designed the experiments: JW YY. Performed the experiments: XG ML PJC JY MC. Analyzed the data: JW. Wrote the paper: JW XG JY MC.
- 1. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, et al. (1998) Embryonic stem cell lines derived from human blastocysts. Science 282: 1145–1147. doi: 10.1126/science.282.5391.1145
- 2. Blau HM, Brazelton TR, Weimann JM (2001) The evolving concept of a stem cell: entity or function? Cell 105: 829–841. doi: 10.1016/s0092-8674(01)00409-3
- 3. Kim NW, Piatyszek MA, Prowse KR, Harley CB, West MD, et al. (1994) Specific association of human telomerase activity with immortal cells and cancer. Science 266: 2011–2015. doi: 10.1126/science.7605428
- 4. Odorico JS, Kaufman DS, Thomson JA (2001) Multilineage differentiation from human embryonic stem cell lines. Stem Cells 19: 193–204. doi: 10.1634/stemcells.19-3-193
- 5. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, et al. (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131: 861–872. doi: 10.1016/j.cell.2007.11.019
- 6. Yamanaka S, Takahashi K (2006) [Induction of pluripotent stem cells from mouse fibroblast cultures]. Tanpakushitsu Kakusan Koso 51: 2346–2351.
- 7. Hoffman LM, Carpenter MK (2005) Characterization and culture of human embryonic stem cells. Nat Biotechnol 23: 699–708. doi: 10.1038/nbt1102
- 8. Hentze H, Soong PL, Wang ST, Phillips BW, Putti TC, et al. (2009) Teratoma formation by human embryonic stem cells: evaluation of essential parameters for future safety studies. Stem Cell Res 2: 198–210. doi: 10.1016/j.scr.2009.02.002
- 9. Bongso A, Fong CY, Gauthaman K (2008) Taking stem cells to the clinic: Major challenges. J Cell Biochem 105: 1352–1360. doi: 10.1002/jcb.21957
- 10. Talens-Visconti R, Bonora A, Jover R, Mirabet V, Carbonell F, et al. (2006) Hepatogenic differentiation of human mesenchymal stem cells from adipose tissue in comparison with bone marrow mesenchymal stem cells. World J Gastroenterol 12: 5834–5845.
- 11. Frankel MS (2000) In search of stem cell policy. Science 287: 1397. doi: 10.1126/science.287.5457.1397
- 12. Madden DT, Davila-Kruger D, Melov S, Bredesen DE (2011) Human embryonic stem cells express elevated levels of multiple pro-apoptotic BCL-2 family members. PLoS One 6: e28530. doi: 10.1371/journal.pone.0028530
- 13. Bang OY, Lee JS, Lee PH, Lee G (2005) Autologous mesenchymal stem cell transplantation in stroke patients. Ann Neurol 57: 874–882. doi: 10.1002/ana.20501
- 14. Mazzini L, Mareschi K, Ferrero I, Miglioretti M, Stecco A, et al. (2012) Mesenchymal stromal cell transplantation in amyotrophic lateral sclerosis: a long-term safety study. Cytotherapy 14: 56–60. doi: 10.3109/14653249.2011.613929
- 15. Keating A (2012) Mesenchymal stromal cells: new directions. Cell Stem Cell 10: 709–716. doi: 10.1016/j.stem.2012.05.015
- 16. Mannon PJ (2011) Remestemcel-L: human mesenchymal stem cells as an emerging therapy for Crohn's disease. Expert Opin Biol Ther 11: 1249–1256. doi: 10.1517/14712598.2011.602967
- 17. Sakata N, Goto M, Yoshimatsu G, Egawa S, Unno M (2011) Utility of co-transplanting mesenchymal stem cells in islet transplantation. World J Gastroenterol 17: 5150–5155. doi: 10.3748/wjg.v17.i47.5150
- 18. Borlongan CV, Glover LE, Tajiri N, Kaneko Y, Freeman TB (2011) The great migration of bone marrow-derived stem cells toward the ischemic brain: therapeutic implications for stroke and other neurological disorders. Prog Neurobiol 95: 213–228. doi: 10.1016/j.pneurobio.2011.08.005
- 19. Erices A, Conget P, Minguell JJ (2000) Mesenchymal progenitor cells in human umbilical cord blood. Br J Haematol 109: 235–242. doi: 10.1046/j.1365-2141.2000.01986.x
- 20. Friedenstein AJ, Petrakova KV, Kurolesova AI, Frolova GP (1968) Heterotopic of bone marrow. Analysis of precursor cells for osteogenic and hematopoietic tissues. Transplantation 6: 230–247. doi: 10.1097/00007890-196803000-00009
- 21. Huang GT, Gronthos S, Shi S (2009) Mesenchymal stem cells derived from dental tissues vs. those from other sources: their biology and role in regenerative medicine. J Dent Res 88: 792–806. doi: 10.1177/0022034509340867
- 22. Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, et al. (2001) Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng 7: 211–228. doi: 10.1089/107632701300062859
- 23. Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, et al. (2002) Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418: 41–49. doi: 10.1038/nature00870
- 24. D'Ippolito G, Diabira S, Howard GA, Menei P, Roos BA, et al. (2004) Marrow-isolated adult multilineage inducible (MIAMI) cells, a unique population of postnatal young and old human cells with extensive expansion and differentiation potential. J Cell Sci 117: 2971–2981. doi: 10.1242/jcs.01103
- 25. Yoon YS, Wecker A, Heyd L, Park JS, Tkebuchava T, et al. (2005) Clonally expanded novel multipotent stem cells from human bone marrow regenerate myocardium after myocardial infarction. J Clin Invest 115: 326–338. doi: 10.1172/jci22326
- 26. Shmilovici A (2007) Mammalian spore-like cells—a reservoir of spare parts for old-age? Med Hypotheses 68: 767–769. doi: 10.1016/j.mehy.2006.08.044
- 27. Vacanti MP, Roy A, Cortiella J, Bonassar L, Vacanti CA (2001) Identification and initial characterization of spore-like cells in adult mammals. J Cell Biochem 80: 455–460. doi: 10.1002/1097-4644(20010301)80:3<455::aid-jcb180>3.0.co;2-z
- 28. Ratajczak MZ, Zuba-Surma EK, Wysoczynski M, Ratajczak J, Kucia M (2008) Very small embryonic-like stem cells: characterization, developmental origin, and biological significance. Exp Hematol 36: 742–751. doi: 10.1016/j.exphem.2008.03.010
- 29. Kucia M, Reca R, Campbell FR, Zuba-Surma E, Majka M, et al. (2006) A population of very small embryonic-like (VSEL) CXCR4(+)SSEA-1(+)Oct-4+ stem cells identified in adult bone marrow. Leukemia 20: 857–869. doi: 10.1038/sj.leu.2404171
- 30. Stout CL, Ashley DW, Morgan JH 3rd, Long GF, Collins JA, et al. (2007) Primitive stem cells residing in the skeletal muscle of adult pigs are mobilized into the peripheral blood after trauma. Am Surg 73: 1106–1110.
- 31. Danova-Alt R, Heider A, Egger D, Cross M, Alt R (2012) Very small embryonic-like stem cells purified from umbilical cord blood lack stem cell characteristics. PLoS One 7: e34899. doi: 10.1371/journal.pone.0034899
- 32. Tetta C, Bruno S, Fonsato V, Deregibus MC, Camussi G (2011) The role of microvesicles in tissue repair. Organogenesis 7: 105–115. doi: 10.4161/org.7.2.15782
- 33. Gyorgy B, Szabo TG, Pasztoi M, Pal Z, Misjak P, et al. (2011) Membrane vesicles, current state-of-the-art: emerging role of extracellular vesicles. Cell Mol Life Sci 68: 2667–2688. doi: 10.1007/s00018-011-0689-3
- 34. Slupsky JR, Cawley JC, Kaplan C, Zuzel M (1997) Analysis of CD9, CD32 and p67 signalling: use of degranulated platelets indicates direct involvement of CD9 and p67 in integrin activation. Br J Haematol 96: 275–286. doi: 10.1046/j.1365-2141.1997.d01-2011.x
- 35. Dalton JWaS (2005) Cell Cycle Control of Embryonic Stem Cells. Stem Cell Reviews 1: 131–138. doi: 10.1385/scr:1:2:131
- 36. Katoh Y, Katoh M (2006) Hedgehog signaling pathway and gastrointestinal stem cell signaling network (review). Int J Mol Med 18: 1019–1023. doi: 10.3892/ijmm.18.6.1019
- 37. Duncan AW, Rattis FM, DiMascio LN, Congdon KL, Pazianos G, et al. (2005) Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol 6: 314–322. doi: 10.1038/ni1164
- 38. Iglesias-Bartolome R, Gutkind JS (2011) Signaling circuitries controlling stem cell fate: to be or not to be. Curr Opin Cell Biol 23: 716–723. doi: 10.1016/j.ceb.2011.08.002
- 39. Barker N, Huch M, Kujala P, van de Wetering M, Snippert HJ, et al. (2010) Lgr5+ve Stem Cells Drive Self-Renewal in the Stomach and Build Long-Lived Gastric Units In Vitro. Cell Stem Cell 6: 25–36. doi: 10.1016/j.stem.2009.11.013
- 40. Morita H, Mazerbourg S, Bouley DM, Luo CW, Kawamura K, et al. (2004) Neonatal lethality of LGR5 null mice is associated with ankyloglossia and gastrointestinal distension. Mol Cell Biol 24: 9736–9743. doi: 10.1128/mcb.24.22.9736-9743.2004
- 41. Barker N, Clevers H (2010) Leucine-rich repeat-containing G-protein-coupled receptors as markers of adult stem cells. Gastroenterology 138: 1681–1696. doi: 10.1053/j.gastro.2010.03.002
- 42. Chambers I, Colby D, Robertson M, Nichols J, Lee S, et al. (2003) Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113: 643–655. doi: 10.1016/s0092-8674(03)00392-1
- 43. Mitsui K, Tokuzawa Y, Itoh H, Segawa K, Murakami M, et al. (2003) The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 113: 631–642. doi: 10.1016/s0092-8674(03)00393-3
- 44. Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe-Nebenius D, et al. (1998) Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell 95: 379–391. doi: 10.1016/s0092-8674(00)81769-9
- 45. Tsai CC, Su PF, Huang YF, Yew TL, Hung SC (2012) Oct4 and nanog directly regulate dnmt1 to maintain self-renewal and undifferentiated state in mesenchymal stem cells. Mol Cell 47: 169–182. doi: 10.1016/j.molcel.2012.06.020
- 46. Ratajczak MZ, Liu R, Ratajczak J, Kucia M, Shin DM (2011) The role of pluripotent embryonic-like stem cells residing in adult tissues in regeneration and longevity. Differentiation 81: 153–161. doi: 10.1016/j.diff.2011.01.006
- 47. Kassmer SH, Krause DS (2013) Very small embryonic-like cells: Biology and function of these potential endogenous pluripotent stem cells in adult tissues. Mol Reprod Dev.
- 48. Ootani A, Li X, Sangiorgi E, Ho QT, Ueno H, et al. (2009) Sustained in vitro intestinal epithelial culture within a Wnt-dependent stem cell niche. Nat Med 15: 701–706. doi: 10.1038/nm.1951
- 49. de Lau W, Barker N, Low TY, Koo BK, Li VS, et al. (2011) Lgr5 homologues associate with Wnt receptors and mediate R-spondin signalling. Nature 476: 293–297. doi: 10.1038/nature10337
- 50. Miyanishi M MY, Seita J, Chen JY, Karten S, Chan CKF, Nakauchi H, Weissman IL (2013) Do Pluripotent Stem Cells Exist in Adult Mice as Very Small Embryonic Stem Cells? Stem Cell Reports 1: 198–208. doi: 10.1016/j.stemcr.2013.07.001
- 51. He Q, Wan C, Li G (2007) Concise review: multipotent mesenchymal stromal cells in blood. Stem Cells 25: 69–77. doi: 10.1634/stemcells.2006-0335
- 52. Shin DM, Liu R, Wu W, Waigel SJ, Zacharias W, et al. (2012) Global gene expression analysis of very small embryonic-like stem cells reveals that the Ezh2-dependent bivalent domain mechanism contributes to their pluripotent state. Stem Cells Dev 21: 1639–1652. doi: 10.1089/scd.2011.0389
- 53. Vastenhouw NL, Schier AF (2012) Bivalent histone modifications in early embryogenesis. Curr Opin Cell Biol 24: 374–386. doi: 10.1016/j.ceb.2012.03.009
- 54. Havens AM, Shiozawa Y, Jung Y, Sun H, Wang J, et al. (2013) Human very small embryonic-like cells generate skeletal structures, in vivo. Stem Cells Dev 22: 622–630. doi: 10.1089/scd.2012.0327
- 55. Wang J (2013) Treatment of Immunosuppression-Related Disorders. US Patent # 12391,581 50045-004001. 27 June 2013.
|
<urn:uuid:688c9e5e-948c-40ad-a082-24babf1a6131>
|
CC-MAIN-2016-26
|
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0085112
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783392527.68/warc/CC-MAIN-20160624154952-00152-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.908886 | 15,212 | 2.59375 | 3 |
A Debate About Assembler Design
Post-debate comments by David Forrest, 10 September 2005
Richard Jones, a physicist at U. Sheffield, has challenged the notion that the vision of molecular manufacturing systems proposed by Eric Drexler in Nanosystems offers the best design for productive nanosystems. In various places in his book, Soft Machines, Jones points out three issues that he claims will "scupper the entire enterprise" (p. 159): Brownian motion, thermal noise, and surface forces (p. 161). As an alternative he proposes that biologically-inspired systems that are adapted to and exploit Brownian motion are a better approach to develop molecular machine systems (in fact, he claims this is the only approach that will work). He elaborated on this to some extent in a debate in August 2005, but has not offered any specific alternative designs.
In response, we offer the following points:
- Until Jones proposes a specific design, it is not possible to evaluate whether his philosophy represents a superior alternative.
- With existing design tools, it is harder to design machines with the irregular surface conformations and electrostatic potential distributions found in most biological protein molecules than to design machines based on the regular geometric features of diamondoid materials.1
- As early as 1981, Drexler noted that biological structures can function as machine components, and proposed tailoring protein molecules to serve as more effective molecular machine components.2
- The designs proposed in Nanosystems do in fact exploit Brownian motion (during the sorting and purification operations, p. 374ff.).3
- Stiction is relevant to MEMS--not the designs proposed in Nanosystems, which have engineered atomic surfaces that exploit selective stickiness or provide low friction, as needed.
- A molecular motor based on carbon nanotubes has already been built, refuting the speculations by Jones that non-biological molecular motors based on rigid structures will not work.
- Nested carbon nanotubes have already been shown to have very low friction and they work as efficient bearings, refuting the claim by Jones that non-biological molecular bearings would have high friction and not work.
- A eutactic system, in which the trajectories and orientations of all atoms in the system are precisely controlled and directed to and from reaction sites at high speed, will be intrinsically more efficient than a system that relies on the random motion of molecules for transport and assembly processes. On a more primitive level, this is the principle behind catalysts, which are used to accelerate industrial chemical reactions by guiding molecules together in favorable orientations.
- The legitimate issue of thermal noise has been accounted for in the Nanosystems designs, and also treated by Merkle.
- Regardless of design approach, it is important to develop molecular machine systems with appropriate safeguards. Conformance to a set of guidelines, such as the Foresight Guidelines, and to consensus standards based on these principles, will help to insure safe development and instill public confidence in the process.
1Consider for example the complex shape of the ribosome, a natural molecular assembler, which is composed of two halves that adhere together according to matching geometries and potential energy surfaces.
2In addition to Drexler's first paper on nanotechnology there is a publication that provides a more specific approach to the concept of protein design for the construction of molecular machine components for productive nanosystems.
3Prof. Jones advocates developing systems that take advantage of Brownian motion, which is a good idea. There are certainly tradeoffs involved in terms of performance and reliability if you make the entire system dependent on Brownian motion, but there's not really much to debate--we encourage a diversity of approaches to the development of molecular manufacturing systems. Again, we need to see an actual design.
In chapter 4 of his book, Professor Jones provides a description of Brownian motion, explaining how molecules in liquids and gases are continually jostled about. He also states that one cannot engineer a system that does not contain Brownian motion (page 63). We note again that only part of the system proposed by Drexler in Nanosystems would exclude Brownian motion: the eutactic environment which is sealed from contaminants, and in which the trajectory of every atom is controlled. This is distinguished from the traditional phases of matter--solid, liquid, and gas--by the term "machine-phase."
|
<urn:uuid:662cadc3-24e1-4923-a9c5-e2b62699b006>
|
CC-MAIN-2016-26
|
http://davidrforrest.com/pub/forrest_debate_points.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397749.89/warc/CC-MAIN-20160624154957-00098-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.946849 | 907 | 2.9375 | 3 |
The highest ranking and the leading military rank within the Central Command held the position of Gul-Tar. (DS9 novel: Objective: Bajor) A unique position within the Cardassian government served the role of military liaison between the Central Command and the Obsidian Order. It was considered a neutral position and a highly important office. (TLE novel: Dawn of the Eagles)
Central Command was formed in the 19th century along with the Obsidian Order and the Detapa Council. At this time it was decided that both Central Command and the Obsidian Order would be under the control of the civilian Detapa Council, however in reality Central Command and the Order became separate entities who soon had all control of the Union.
However, this rule soon came to an end in 2372 when Central Command was overthrown and a new civilian Detapa Council came into existence. Unlike the destruction of the Obsidian Order in 2371, Central Command still existed in some form, but the Council had a liaison with Command who monitored their actions. (DS9 episodes: "The Wire", "Defiant", "The Way of the Warrior")
|Andorian Imperial Guard • Bajoran Militia • Benthan Guard • Breen Militia • Cardassian Central Command (Cardassian Guard) • Cardassian Self Defense Force • Earthfleet • Federation Starfleet • Klingon Defense Force • Romulan Republican Force • Romulan Star Navy • United Earth Starfleet|
|
<urn:uuid:fd6ab170-032d-4d8b-a71e-dc4a43e72ae0>
|
CC-MAIN-2016-26
|
http://memory-beta.wikia.com/wiki/Cardassian_Central_Command
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396875.58/warc/CC-MAIN-20160624154956-00142-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.928623 | 290 | 2.765625 | 3 |
(including the student who is failing to meet the required standard)
Recognise some of the common indicators of a student who’s performance
is not commensurate with his / her stage of training?
Identify a range of strategies for supporting ‘weak’ students
Identify the principles of giving feedback?
- Identify the principles of giving feedback?
- What are some of the common indicators of a ‘weak’ student?
- What strategies should a mentor adopt for supporting the ‘weak’ student?
- How might a student react to failure?
Failing a Student
Potentially clinical assessment of student nurses can safeguard professional standards, patients and the general public. It is inevitable that some students will not be able to meet the required level of practice and it is essential that mentors do not avoid the difficult issue of having to fail these students (Duffy, 2004)
As a named mentor, you are responsible for making the final assessment decision and are accountable for passing or failing the student (NMC, 2006).
References & Further reading
ASTON, L and HALLAM, P. (2014) Successful Mentoring in Nursing: Sage, London.
BESKINE D (2009) Mentoring students: establishing effective working relationships, Nursing Standard, 23(30) 35-40
DUFFY K. (2004) Failing students: a qualitative study of factors that influence the decisions regarding assessment of students' competence in practice. NMC: London
DUFFY K. (2007a) Supporting failing students in practice 1: assessment. Nursing Times, 103:47, 28-29
DUFFY K. (2007b) Supporting failing students in practice 2: management. Nursing Times, 103:48, 28-29
MALONEY D., CARMODY D., NEMETH E. (1997) Students experiencing problems learning in clinical setting in McALLISTER L., LINCOLN
M., McLEOD S., & MALONEY D. (eds) Facilitating Learning in Clinical Settings. Stanley Thornes: Cheltenham
NMC (2008) Standards to support learning and assessment in practice: NMC Standards for mentors, practice teachers and teachers. NMC: Londo
GOPEE, N. (2011) Mentoring and Supervision in Healthcare: Sage, London.
RCN (2007)Guidance for mentors of nursing & midwifery students. RCN: London
RCN (2007a) Helping students get the best from their practice placements. RCN: London
WALSH D. (2014) The Nurse Mentor's Handbook. Open University Press, Mc Graw Hill Education: Berkshire, England.
|
<urn:uuid:b7370734-ae54-402c-93f6-a87f77163dca>
|
CC-MAIN-2016-26
|
http://nurse-mentors.bangor.ac.uk/support.php.en
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395346.72/warc/CC-MAIN-20160624154955-00045-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.876194 | 565 | 2.515625 | 3 |
It was 390 years ago that 53 surviving Puritans in what would become Massachusetts gathered, with a number of neighboring Wampanoag Indians, to give thanks for having survived a brutal first year on a new continent, for a bountiful harvest that autumn of 1621 and for the assistance of those Indians in helping them survive.
Residents of the United States, circa 2011, generally have many more reasons to be thankful than did those early settlers we call Pilgrims. But, in a difficult economy, with our political leadership in a partisan standoff, our citizenry often just as bitterly divided, in a nation with too many homeless people, too much crime and far too many reports of abused and assaulted children, it’s often easy to see a bleak picture, not reasons to be grateful.
Still, there are plenty of reasons for people in western Colorado to be thankful this year. Here’s a list of some things for which we’re thankful today.
✔ The unemployment rate for Mesa County remained at 8.5 percent in October, the same as September. That’s still too high, but it’s a full percentage point below what it was a year ago and almost four points below the level reached at the peak of this recession.
The statewide unemployment rate also held steady in October at 7.7 percent, down from 8.4 percent a year ago. Additionally, the number of new jobless claims nationally have remained below 400,000 the past few weeks.
✔ The local housing market, while not exactly booming, has shown modest improvement this year. From January through October, Mesa County home sales have climbed 21 percent, compared to the same period in 2010. Average home prices are lower than they were a year ago, however.
✔ The Museum of Western Colorado received enough money from Mesa County to continue operating at the same level as it has been this year. The museum is curator of this community’s cultural heritage, and provides valuable programs and exhibits that add to the area’s vibrant cultural activities.
✔ The Mesa County commissioners had to make difficult decisions regarding a number of worthy community entities seeking financial assistance, including the museum. That is never an easy task. We should be thankful for all people who are willing to serve in elected or appointed positions — with municipalities, school districts, state government and special districts — to try to meet community needs, even in a tough economy. A willingness to serve, even when the rewards are small and criticism is abundant, is critical to our representative democracy.
✔ Regardless of what one thinks of the wars in Iraq and Afghanistan, we are thankful that our military personnel will soon be withdrawn from both dangerous locations as our military missions continue to wind down.
✔ We’re grateful that we live in a country where we are able to say what’s on our minds, publish various opinions in newspapers such as this, and worship how we please, without government interference or violent attacks from opposing groups.
✔ We’re also happy to live in western Colorado, with its wonderful scenery and abundant outdoor activities. Autumn is glorious.
✔ Finally, as always, we are thankful to have loyal readers and advertisers who make publication of The Daily Sentinel possible.
Happy Thanksgiving to all of you.
|
<urn:uuid:5cc2d3a0-2538-47bc-af46-c8b6217871fe>
|
CC-MAIN-2016-26
|
http://www.gjsentinel.com/opinion/articles/happy_thanksgiving2
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397562.76/warc/CC-MAIN-20160624154957-00104-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.969891 | 676 | 2.5625 | 3 |
Spruce Problems Continue in Illinois
This article was originally published on June 10, 2013 and expired on June 17, 2013. It is provided here for archival purposes and may contain dated information.
One of the saddest parts of my job is when I cannot help someone save a large tree. Unfortunately, this seems to happen too frequently. Sometimes the tree is too far along to help. Other times it is a problem that we simply cannot do anything about. Such is the case with far too many evergreen trees.
Questions about spruce trees and other evergreen problems are very common in our University of Illinois Extension offices. Over the past several years, spruce trees in Illinois have been plagued with various disease and pest problems. University of Illinois Plant Diagnostician and Outreach Specialist Stephanie Porter said that each year, the U of I Plant Clinic diagnoses hundreds of spruce samples with multiple pest and cultural issues.
Spruces are generally native to cooler regions and are adapted to cold conditions. They prefer full-sun locations with acidic and well-drained soils. Improper planting techniques as well as plantings in inadequate sites can be detrimental to spruce health. When exposed to unfavorable cultural or environmental conditions, spruce can become stressed and more susceptible to diseases and pests.
There are three different diseases that we often find on spruce trees. Rhizosphaera needle cast causes the trees older growth to turn purple/brown and fall. The newest growth usually remains green. Since evergreens do not re-foliate along the branches, the disease will cause bare areas scattered throughout the tree. There are fungicide applications available to treat this disease, but it must be done in very early spring to be effective.
The second disease we see regularly on spruce in Illinois is Cytospora canker. That disease causes entire branches to turn purple/brown. Cytospora affects all needles from the tip of the branch to the base. Often lower branches are affected first. The disease may progress up the tree slowly, killing branches over a number of years. There are no chemical controls for this disease.
Third, a new spruce disease in Illinois called Sudden Needle Drop (SNEED) has been found on Norway, white and Colorado blue spruce trees. Symptoms of SNEED are yellowing and eventual browning of older needles. Typically, by the end of summer, all of the needles on affected branches fall off except the newest needles on the tips of the branches. There are no control recommendations at this time for this disease.
Stephanie Porter, in collaboration with other U of I specialists, produced a spruce problem report titled Spruce Problems (Pest and Cultural Issues). It includes pictures and brief descriptions of spruce cultural issues as well as the most common disease, insect, and spider mite problems that affect spruce each year in Illinois. This report can be downloaded from the U of I Plant Clinic website at http://web.extension.illinois.edu/plantclinic/media.cfm. If you need a reasonable accommodation to participate in any event listed in this news release, contact your local Extension office.
Pull date: June 17, 2013
- Information about feeding damaged wheat to livestock
- Growing asparagus at home
- State Master Gardener conference set for Sept. 17-19
- Square foot Gardening still Popular in 2016
- Australia’s seed destructor could be Midwest’s new tool in the battle against weed resistance
- Agronomy Day 2015 field tour topics announced
|
<urn:uuid:f5ac8be6-c27c-4032-96e8-6bc10b061a4d>
|
CC-MAIN-2016-26
|
http://web.extension.illinois.edu/state/newsdetail.cfm?NewsID=29245
|
s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396959.83/warc/CC-MAIN-20160624154956-00024-ip-10-164-35-72.ec2.internal.warc.gz
|
en
| 0.947112 | 729 | 2.90625 | 3 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.