added
stringdate 2024-06-03 18:26:11
2024-06-04 03:14:13
| created
stringdate 2013-04-29 18:49:42
2014-01-03 01:38:26
| id
stringlengths 32
32
| metadata
dict | source
stringclasses 2
values | text
stringlengths 237
356k
| version
stringclasses 1
value |
|---|---|---|---|---|---|---|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:20:58.000Z
|
636i27o4oh5tw6zsykq3wy5qjk3uisg6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5342",
"uncompressed_offset": 92507940,
"url": "familysearch.org/learn/wiki/en/Malolos_Philippines_Family_History_Center",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://familysearch.org/learn/wiki/en/Malolos_Philippines_Family_History_Center"
}
|
cccc_CC-MAIN-2013-20
|
Malolos Philippines Family History CenterEdit This Page
From FamilySearch Wiki
This article describes the services and resources available at a Family History Center, a branch facility of the Family History Library.
(Add a brief paragraph about your center here and the area it serves. Information in italics below is guidance for you and should be deleted as you fill out the page. Remove italics from other text by selecting the text and clicking the "I" box in the Toolbar above.)
Contents
Center Contacts and Hours
• Language: Tagalog
• Location & Map:
• (Address)
• (Include information about your center that would be helpful for first time visitors such which entrance in the building to use, parking, etc. Use as many or as few bullet points as needed.)
• (Link to map using Google or other map sites)
• Phone:
• E-mail:
• Open Hours:
• Holiday Schedule:
Calendar and Events
Upcoming Events
Class Schedule
Staff Training Meetings
Center Resources
Collections
• (List additional collections you have such as the types of books and microfilm you have on indefinite loan; though you will not want to list every single item you have. Just give visitors to this page a general idea of your resources.)
Databases and Software
• FHC Portal This center has access to the Family History Center Portal page which gives free access in the center to premium family history software and websites that generally charge for subscriptions. (Note to FHC: Not all FHCs have access to this portal. If you do not, you will want to remove this entire bullet. If you do have access to it, just remove this text in italics.)
Hardware and Equipment
• (Include the resources you have to help individuals do their research - computers, microfilm readers, printers, etc. )
Center Services
Staff Research Specialties
(Include sections for any other services your center provides. Add additional sections for those services. See the Mesa and Logan FHC pages for examples.)
Resources in the Local Area
(This section is to highlight other resources in your area that will be helpful for individuals doing research there in your location, if there are any, such as government offices, historical societies, etc.)
Links
(Include links to other websites of interest to those who visit your center such as links to the city, county and state wiki pages where your center is located.)
Volunteer at the Center
(Include information here about the volunteers you are looking for.)
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 11 April 2013, at 20:11.
• This page has been accessed 134 times.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:28:58.000Z
|
ugomj6qa36i363rrojxwyrr4cuczxspm
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5357",
"uncompressed_offset": 115378114,
"url": "guides.lib.umich.edu/profile.php",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://guides.lib.umich.edu/profile.php?uid=50599"
}
|
cccc_CC-MAIN-2013-20
|
Alternate Page for Screenreader Users
Research & Technology Guides - Jamie Vander Broek
Library Contact
Jamie Vander Broek
Contact Info:
The University of Michigan
2178 Shapiro Library
919 S. University
Ann Arbor, MI 48109-1185
Guides
Campus Information Centers
by Jamie Vander Broek - Last Updated Apr 6, 2012
A guide for Campus Information Centers staff
English 125 Kelly Allen
by Harold Tuckett, Jamie Vander Broek - Last Updated Jan 29, 2013
Research help for students in Kelly Allen's English 125 class.
Tags: course_guide, english125, research, subject:english course:125, ugl, undergrad, undergraduate
English 225
by Amanda Peters, Jamie Vander Broek - Last Updated Feb 15, 2013
Entrepreneurship
by Leena Lalwani, Jamie Vander Broek - Last Updated Feb 11, 2013
This subject guide provides a starting point for research in Entrepreneurship.
Finding Tests & Measurement Instruments
by Marija Freeland, Carol Shannon, Susan Turkel, Jamie Vander Broek, Sue Wortman - Last Updated Apr 16, 2013
This guide will help those who are looking for tests or measurement instruments in either the health or behavioral sciences. It offers resources, tips and tricks for finding tests.
Google for Academic Research
by Jamie Vander Broek, Sue Wortman - Last Updated Feb 12, 2013
This guide will give some tips and tricks on using Google for academic research.
HA 255: Visual Mythology
by Sigrid Cordell, Jamie Vander Broek - Last Updated Oct 4, 2012
Resource guide for Professor Pat Simons's class, HA 255: Visual Mythology.
Mirlyn
by Jamie Vander Broek - Last Updated Jan 14, 2013
This is a guide to using Mirlyn, the University of Michigan Library Catalog.
Tags: books, journals_and_magazines, mirlyn
Mirlyn Classic
by Jamie Vander Broek - Last Updated Dec 20, 2011
This is a guide to using Mirlyn Classic, the classic University of Michigan Library Catalog.
Tags: books, journals_and_magazines
Contact
We welcome your feedback on our web site.
Copyright
Except where otherwise noted, this work is subject to a Creative Commons Attribution 3.0 license. Details and exceptions.
©2012, Regents of the University of Michigan
Description
Loading...
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:01:05.000Z
|
cqkiqjsarrbepsx4ulr5t46ddsx6gmoe
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5367",
"uncompressed_offset": 133957135,
"url": "ipkitten.blogspot.com/2006/03/gis-and-parallel-imports.html",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://ipkitten.blogspot.com/2006/03/gis-and-parallel-imports.html"
}
|
cccc_CC-MAIN-2013-20
|
For the half-year to 30 June 2013, the IPKat's regular team is supplemented by contributions from guest bloggers Stefano Barazza, Matthias Lamping and Jeff John Roberts.
Two of our regular Kats are currently on blogging sabbaticals. They are Birgit Clark and Catherine Lee.
Tuesday, 21 March 2006
GIs AND PARALLEL IMPORTS
EU alters GI rules (but just a little bit)
Businessweek reports that EU agricultural ministers have OK’d changes to the geographical indications rules. The changes are in response to last year’s WTO ruling that the EU was not in compliance with international law in this area by discriminating against non-EU producers. The EU has now removed the requirement that non-EU countries must operate a similar system in order to benefit from European GI protection.
GIs from other countries (left) - now welcome in the EU
The IPKat can see the sense in this. If GIs deserve protection, they deserve protection wherever they originate.
Judge Fysh at QMIPRI
Next Monday at 5.30pm, Judge Fysh is speaking at QMIPRI (the Queen Mary Intellectual Property Research Institute, London) on ‘Consenting to Parallel Imports – is Economic Linkage the Correct Test?’
As ever, all are welcome and it’s free, but please RSVP to Ilanah
Subscribe to the IPKat's posts by email here
Just pop your email address into the box and click 'Subscribe':
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:19:16.000Z
|
lz3iqrjrwnvatxoy7crtutyxrrwkjoat
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5368",
"uncompressed_offset": 133980036,
"url": "ipkitten.blogspot.com/2008/03/court-of-appeal-for-england-and-wales.html",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://ipkitten.blogspot.com/2008/03/court-of-appeal-for-england-and-wales.html"
}
|
cccc_CC-MAIN-2013-20
|
For the half-year to 30 June 2013, the IPKat's regular team is supplemented by contributions from guest bloggers Stefano Barazza, Matthias Lamping and Jeff John Roberts.
Two of our regular Kats are currently on blogging sabbaticals. They are Birgit Clark and Catherine Lee.
Wednesday, 19 March 2008
DSS's patent deceased -- in the UK, at any rate
The Court of Appeal for England and Wales gave its ruling today on the controversial and vigorously-litigated dispute of European Central Bank v Document Security Systems Incorporated [2008] EWCA Civ 192, with Lord Justice Jacob delivering judgment on his own behalf and for his colleagues (Lord Justice Lloyd and Sir John Chadwick). You can read the text in full here on BAILII. This was an appeal against the decision of Mr Justice Kitchin here (noted by the IPKat here). In short, Kitchin J found that DSS's banknote anti-forgery technology patent had been amended so much in the course of its early life that, by the time it was granted, it was quite different from the invention for which patent protection was originally sought.
Right: the IPKat applauds the Court for its use of illustrations. If he can't follow the words, he can at least enjoy the pictures ...
In a fairly short decision by modern English standards (just 52 paragraphs) the Court of Appeal firmly dismissed DSS's appeal. The vast bulk of this judgment consisted of a helpful review of the technological background and a painstakingly careful review of the evidence. Having done all this, the Court of Appeal had no doubt that the trial judge's reasons for his holding were absolutely sound.
The IPKat feels that disputes of this nature, involving allegations of infringement and claims fo revocation in a range of closely connected jurisictions with the same substantive laws, though different evidential and procedural rules, are a good argument in favour of mediation [says Merpel -- if you're man enough to handle it] or centralised patent litigation in Europe.
Other ECB/DSS disputes have been noted by the IPKat here (Dutch patent held valid), here (French patent revoked) and here (German patent valid).
Subscribe to the IPKat's posts by email here
Just pop your email address into the box and click 'Subscribe':
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:11:44.000Z
|
4xi77n3yjhlpedpiylaxbdod4llwyn7o
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5369",
"uncompressed_offset": 134004477,
"url": "ipkitten.blogspot.com/2008/11/new-uk-ipo-cartoon-crew.html",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://ipkitten.blogspot.com/2008/11/new-uk-ipo-cartoon-crew.html"
}
|
cccc_CC-MAIN-2013-20
|
For the half-year to 30 June 2013, the IPKat's regular team is supplemented by contributions from guest bloggers Stefano Barazza, Matthias Lamping and Jeff John Roberts.
Two of our regular Kats are currently on blogging sabbaticals. They are Birgit Clark and Catherine Lee.
Sunday, 23 November 2008
The new UK-IPO cartoon crew
A couple of days ago, the IPKat posted this about the new logo/name for the Patent Office. As one commenter confirmed, this is no joke. The Secretary of State for Innovation, Universities and Skills, John Denham MP (not David Lammy - see comment below), applied for a UK trade mark for the new logo on 7 November 2008. The application has now been published as TM number 2501853.
Another curious IPKat reader, Guy Selby-Lowndes, then looked a little further and noticed that, two days before applying for the new logo mark, five other applications were filed to register what appear to be the name and appearance of various cartoon characters, all in classes 09, 16, 28, 35 and 38. Here they are, in glorious black and white:
TM Number 2501719:
TM Number 2501757:
TM Number 2501761:
TM Number 2501756:
TM Number 2501755:
The IPKat and Guy both wonder what the Secretary of State could possibly be up to. Is he intending to publish an IP comic? Will this be a development of the comic-style 2007 Annual Review, featuring Filament Fred (but none of the other characters)? If so, why the need for trade mark protection? Is this all part of a masterplan to educate the children of this nation into the ways of patenting (the names certainly seem to evoke the various necessary conditions to making patents work)? Can other readers shed any further light on this? Merpel thinks the characters look a bit scary, and is particularly worried what Norvello is intending to do with that big spike he is carrying.
Subscribe to the IPKat's posts by email here
Just pop your email address into the box and click 'Subscribe':
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:44:24.000Z
|
mtslwrhcfwtqdeyduhs4qeu6heaa72qc
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5396",
"uncompressed_offset": 187999873,
"url": "openwetware.org/index.php?oldid=18102&title=PNK_Treatment_of_DNA_Ends",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://openwetware.org/index.php?title=PNK_Treatment_of_DNA_Ends&oldid=18102"
}
|
cccc_CC-MAIN-2013-20
|
PNK Treatment of DNA Ends
From OpenWetWare
Revision as of 16:59, 24 January 2006 by Kathmc (Talk | contribs)
Jump to: navigation, search
Introduction
This protocol is used to add a phosphate group to the 5' end of a single or double stranded DNA molecule. Most primers, for example, are ordered without this being added as it requires an extra synthesis step and hence greater cost. However subsequent ligation steps are more efficient if these phosphate groups are added.
• T4 Polynucleotide Kinase is an enzyme that can perform this on blunt or overhanging DNA ends. T4 polynucleotide kinase phosphorylates single-stranded DNA most efficiently, followed by overhanging ends, and then by blunt-ended double-stranded DNA.
• The above website outlines a protocol for use that is modified and summarized below.
• If you plan on PNK treating complementary oligos it is best to do so prior to annealing the oligos since phosphorylation of single-stranded DNA is more efficient (see above) and also because the heat inactivation step may be close to the melting temperature of the annealed oligos.
• T4 PNK can also be used to phosphorylate RNA, and is commonly used for radiolabeling RNA. Ensure that the enzyme you are using for labeling RNA is RNase-free (this is the case for most commercial enzymes).
Reaction Mix (10μl)
• 1 μL PNK stock (10,000 U/ml)
• 1 μL T4 Ligase Buffer
• 8 μL Substrate
Reaction Conditions
1. 37°C for 30mins
2. 65°C for 20mins
3. Store at 4°C
Notes
• The T4 Ligase Buffer provides the required ATP and substitutes for the PNK Buffer and ATP in the NEB protocol. It is actually possible to perform the PNK step and a ligation step simultaneously although I has not done this.
• Performing this protocol on an insert along with a phosphatase step on the vector can greatly improve the efficiency of a ligation by reducing the likelihood of a vector religating at the same time as making the ligation of vector and insert more likely.
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:09:40.000Z
|
o6smh2xtvvzye4b2simufy5vrdrejtw5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5397",
"uncompressed_offset": 188011879,
"url": "openwetware.org/index.php?oldid=430285&title=User%3ATorsten_Waldminghaus",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://openwetware.org/index.php?title=User:Torsten_Waldminghaus&oldid=430285"
}
|
cccc_CC-MAIN-2013-20
|
User:Torsten Waldminghaus
From OpenWetWare
Jump to: navigation, search
Me after being productive
Hi, my name is Torsten Waldminghaus, and I'm currently Postdoc at the Norwegian Radium Hospital in Oslo (Norway) in Skarstad lab. I was let to OpenWetWare by google, searching for certain protocols. I just started my Postdoc time and I'm going to set up a bunch of methods that have not been done in my new lab. So I benefit a lot from people sharing their protocols on the internet and thought it might be a good idea to also let the world participate on my wisdom and experince. That's why I'm here. If you still want to you can email me through OpenWetWare. Below I'll describe a bit more about myself and the stuff I'm interested in.
Contents
CV
• 2008: Bought T-shirt of the University of Oxford
• Since 2007: Postdoc at the Department of Cell Biology, Institute for Cancer Research, The Norwegian Radium Hospital, Oslo (Norway) in the lab of Kirsten Skarstad
• 2004-2007: PhD at the Ruhr-University Bochum (Germany) PhD-thesis: ‘RNA-thermometers in bacteria’ in the lab of Franz Narberhaus
• 2002-2004: Studies in bioinformatics at the University of applied science Berlin (Germany) Master-thesis: ‘In silico analysis and selection of RNA secondary structures’ at the Max Planck Institute for Infection Biology under supervision of Volker Patzel
• 1999-2002: Studies in biology at the Ernst-Moritz-Arndt-University Greifswald (Germany) Diploma-thesis: ‘Investigations on the expression of clpX in Bacillus subtilis’ at the Division for Microbial Physiology and Molecular Biology in the lab of Michael Hecker
• 1996-1999: Basic studies in biology at the University of Potsdam (Germany)
Grants and Awards
• 2008-2010: Two year postdoc grant of the German Research Council (DFG)
• 2008: Ruth Massenberg Prize of Ruhr-University Bochum (Germany) for outstanding PhD thesis
• 2008: Travel grant of FEMS
• 2006: Travel grant of Ruth und Gert Massenberg Stiftung
Research interests
In general I like bacteria and complex systems.
A bit more detailed I enjoy working on:
• Regulation of replication in bacteria
• RNA dependent or other gene regulation
• Searching funny patterns on chromosomes or in proteins
Publications
1. Waldminghaus T and Skarstad K. . pmid:20602746. PubMed HubMed [Waldminghaus-2010]
2. Waldminghaus T, Gaubig LC, Klinkert B, and Narberhaus F. . pmid:19535917. PubMed HubMed [Waldminghaus-2009-RNAbiology]
3. Waldminghaus T and Skarstad K. . pmid:19254745. PubMed HubMed [Waldminghaus-2009]
4. Waldminghaus T, Kortmann J, Gesing S, and Narberhaus F. . pmid:18713019. PubMed HubMed [Waldminghaus-2008]
5. Waldminghaus T, Gaubig LC, and Narberhaus F. . pmid:17647020. PubMed HubMed [Waldminghaus-2007-MGG]
6. Waldminghaus T, Heidrich N, Brantl S, and Narberhaus F. . pmid:17630972. PubMed HubMed [Waldminghaus-2007-MolMicro]
7. Narberhaus F, Waldminghaus T, and Chowdhury S. . pmid:16438677. PubMed HubMed [Narberhaus-2006]
8. Waldminghaus T, Fippinger A, Alfsmann J, and Narberhaus F. . pmid:16336122. PubMed HubMed [Waldminghaus-2005]
9. Gerth U, Kirstein J, Mostertz J, Waldminghaus T, Miethke M, Kock H, and Hecker M. . pmid:14679237. PubMed HubMed [Gerth-2004]
All Medline abstracts: PubMed HubMed
Links to follow
Personal Links
OWW
Lost and found protocols:
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T04:47:32.000Z
|
seuuaohdkbnzpr2xt4exorcv62zf66cn
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5414",
"uncompressed_offset": 204651453,
"url": "quotationsbook.com/book/RueGrl33/page=12/",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://quotationsbook.com/book/RueGrl33/page=12/"
}
|
cccc_CC-MAIN-2013-20
|
RueGrl33's bookmarks
"Most of the shadows of this life are caused by standing in one's own sunshine"
Emerson, Ralph Waldo on adversity
63 fans of this quote
"A wounded deer leaps the highest."
Dickinson, Emily on adversity
31 fans of this quote
"In order for the light to shine so brightly, the darkness must be present."
Devito, Danny on adversity
24 fans of this quote
"I bring to my life a certain amount of mess."
Coppola, Francis Ford on adversity
9 fans of this quote
"Constant success shows us but one side of the world; adversity brings out the reverse of the picture."
Colton, Charles Caleb on adversity
10 fans of this quote
"What I am looking for is a blessing not in disguise."
Collins, Kitty O'neill on adversity
20 fans of this quote
"In every adversity there lies the seed of an equivalent advantage. In every defeat is a lesson showing you how to win the victory next time."
Collier, Robert on adversity
23 fans of this quote
"You must take action now that will move you towards your goals. Develop a sense of urgency in your life."
Brown, Les on action
9 fans of this quote
"Action springs not from thought, but from a readiness for responsibility."
Bonhoeffer, Dietrich on action
14 fans of this quote
"But be doers of the word, and not hearers only, deceiving yourselves. [James 1:22]"
Bible on action
3 fans of this quote
"Life is a series of experiences, each one of which makes us bigger, even though sometimes it is hard to realize this. For the world was built to develop character, and we must learn that the setbacks and grieves which we endure help us in our marching onward."
Ford, Henry on adversity
20 fans of this quote
"He who knows no hardships will know no hardihood. He who faces no calamity will need no courage. Mysterious though it is, the characteristics in human nature which we love best grow in a soil with a strong mixture of troubles."
Fosdick, Harry Emerson on adversity
9 fans of this quote
"One can be very happy without demanding that others agree with them."
Goethe, Johann Wolfgang Von on agreement
9 fans of this quote
"Too much agreement kills the chat."
Cleaver, Eldridge on agreement
"I love to see a young girl go out and grab the world by the lapels. Life's a bitch. You've got to go out and kick ass."
Angelou, Maya on aggression
22 fans of this quote
"Every adversity, every failure, every heartache carries with it the seed of an equal or greater benefit."
Hill, Napoleon on adversity
31 fans of this quote
"Prosperity is a great teacher; adversity is a greater. Possession pampers the mind; privation trains and strengthens it."
Hazlitt, William on adversity
5 fans of this quote
"Sometimes your medicine bottle has on it, Shake well before using. That is what God has to do with some of His people. He has to shake them well before they are ever usable."
Havner, Vance on adversity
18 fans of this quote
"Never bear more than one kind of trouble at a time. Some people bear three kinds; all they have had, all they have now, and all they expect to have."
Hale, Edward Everett on adversity
10 fans of this quote
"The greatest difficulties lie where we are not looking for them."
Goethe, Johann Wolfgang Von on adversity
14 fans of this quote
"March on. Do not tarry. To go forward is to move toward perfection. March on, and fear not the thorns, or the sharp stones on life's path."
Gibran, Kahlil on adversity
13 fans of this quote
"One may not reach the dawn save by the path of the night."
Gibran, Kahlil on adversity
10 fans of this quote
"Forget the times of your distress, but never forget what they taught you."
Gesser on adversity
23 fans of this quote
"Even if you fall on your face, you're still moving forward."
Gallagher, Robert C. on adversity
22 fans of this quote
"Suffering! We owe to it all that is good in us, all that gives value to life; we owe to it pity, we owe to it courage, we owe to it all the virtues."
France, Anatole on adversity
10 fans of this quote
"Do unto others as you would have others do unto you. [Matthew 7:12]"
Bible on action
5 fans of this quote
"The measure of a man is the way he bears up under misfortune."
Plutarch on achievement
21 fans of this quote
"Having once decided to achieve a certain task, achieve it at all costs of tedium and distaste. The gain in self confidence of having accomplished a tiresome labor is immense."
Bennett, Thomas A. on achievement
8 fans of this quote
"It's your aptitude, not just your attitude that determines your ultimate altitude."
Ziglar, Zig on achievement
16 fans of this quote
"Out of the strain of doing and into the peace of the done."
Woodruff, Julia on achievement
5 fans of this quote
"Don't mistake activity for achievement."
Wooden, John on achievement
20 fans of this quote
"To get what you want, STOP doing what isn't working."
Weaver, Dennis on achievement
25 fans of this quote
"Accomplishment is easiest when we work the hardest, and it is hardest when we work the easiest."
Unknown, Source on achievement
11 fans of this quote
"Disciplining yourself to do what you know is right and important, although difficult, is the highroad to pride, self-esteem, and personal satisfaction."
Tracy, Brian on achievement
13 fans of this quote
"Look at a day when you are supremely satisfied at the end. It's not a day when you lounge around doing nothing; it's when you've had everything to do, and you've done it."
Thatcher, Margaret on achievement
13 fans of this quote
"Where there is a will there is a way. is an old true saying. He who resolves upon doing a thing, by that very resolution often scales the barriers to it, and secures its achievement. To think we are able, is almost to be so -- to determine upon attainment is frequently attainment itself."
Smiles, Samuel on achievement
6 fans of this quote
"The average estimate themselves by what they do, the above average by what they are."
Schiller, Johann Friedrich Von on achievement
9 fans of this quote
"The will to win, the desire to succeed, the urge to reach your full potential... these are the keys that will unlock the door to personal excellence."
Robinson, Eddie on achievement
22 fans of this quote
But wait... my book has more: prev 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 next
Christi Huff Clements's quote collection
I'm female and made my book on 3rd October 2010.
My book as a pdf
My feed
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:52:45.000Z
|
cqyiziwp3nkx2yt6exoo4dyctrcrghgx
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5415",
"uncompressed_offset": 204661389,
"url": "quotationsbook.com/quote/22804/",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://quotationsbook.com/quote/22804/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
Leaders don't inflict pain -- they share pain. Depree, Max
This quote is about leadership · Search on Google Books to find all references and sources for this quotation.
A bit about Depree, Max ...
We don't have a biography.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:35:53.000Z
|
becqgiffxn2jufw6uis3kpuyhox5dojt
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5416",
"uncompressed_offset": 204667761,
"url": "quotationsbook.com/quote/32605/",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://quotationsbook.com/quote/32605/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
Sperm is a bandit in its pure state. Cioran, E. M.
This quote is about creation · Search on Google Books to find all references and sources for this quotation.
A bit about Cioran, E. M. ...
We don't have a biography.
These people bookmarked this quote:
• Nobody has bookmarked this quote yet.
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:34:16.000Z
|
2ymip5ebdeg4u2adenkby6tb6jqefeb7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5417",
"uncompressed_offset": 204673876,
"url": "quotationsbook.com/quote/gift/3059/",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://quotationsbook.com/quote/gift/3059/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
In order for the artist to have a world to express he must first be situated in this world, oppressed or oppressing, resigned or rebellious, a man among men. Beauvoir, Simone De
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:50:19.000Z
|
4h7mvrwrpa2sgo3l7tb6clygrm2ojctd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5418",
"uncompressed_offset": 205791045,
"url": "rationalwiki.org/wiki/Tarot_cards",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://rationalwiki.org/wiki/Tarot_cards"
}
|
cccc_CC-MAIN-2013-20
|
Tarot
From RationalWiki
(Redirected from Tarot cards)
Jump to: navigation, search
Dolphins and money
New Age
Key cosmic concepts
Spiritual selections
I played poker once with Tarot cards. I got a full house and 3 people died.
—Steven Wright
Did tarot imagery predict 9/11? Probably not. The number at the top is 16.
Tarot (of obscure origin, though from the Italian tarocco) is a term used to describe a type of playing card deck consisting of 78 cards. The Tarot originated in northern Italy in the 15th century, and was created by adding a series of 22 trump cards to a 56-card Latin-suited deck (coins, batons, swords, and cups).[1] Several games across central and western Europe developed around this enhanced deck, most of them trick-taking games vaguely similar to bridge, and the French tarot (using the more familiar suits of hearts, diamonds, spades, and clubs) is one of the most popular card games in France today.
Contents
[edit] Symbolism
In English-speaking countries, they are frequently used today as a method of divining the future; they first came to be used for divination in the 18th century, and have become the subject of myths and pseudohistory after being appropriated by occultists. The Marseilles Tarot in particular used a series of personages (e.g. 1: the Popess; 5: the Pope; 13: Death; 15: the devil) on the trump cards that many occultists took to have deeper meanings; in somewhat modified form, these characters were carried on to modern divination decks.[2]
Many neopagans put a lot of stock in tarot readings. Some of the more rationalistic kind see it as a way for the brain to relax and let patterns form, without there being anything spiritual behind the cards themselves. Others really believe that it is a way for the universal consciousness to impart information to them. It should be noted that most professional tarot card "readers" do so through cold reading, rather than actually caring about what the cards say. However, if you see an amateur group (like your college pagan group), you can usually find some really earnest people.
It should also be noted that many fundamentalist Christians consider tarot decks to be Satanic, and many occultists believe that playing games with a divination deck is an act of desecration. It thus follows that the best place to play a game of tarot is either on the front lawn of any fundamentalist church on a Sunday morning or in Salem, Massachusetts, on Pickering Wharf, in front of Laurie Cabot's store.[3]
And if you are one of a jury at a murder trial you mustn't find the defendant guilty till you've Consulted the other side and asked the deceased who did it. Now what's that about mistaking a parody for the real thing?
[edit] Styles
Cards from an Austrian tarot playing deck.
A full discussion of the styles of tarot decks is outside the scope of a RationalWiki article, but essentially they can be broken down into playing and divination decks. A playing deck (using either Latin or French suits) is similar to a standard deck of cards with the addition of the trumps; the exact content of the trumps is generally irrelevant for gameplay and is not standardized. Divination decks, on the other hand, are usually highly artistic in nature and can represent a large part of an artist's portfolio; however, their pips are often incorporated into the card image in a somewhat hard-to-read manner, making them somewhat inconvenient for gaming, but excellent for fleecing the rubes. Divination decks are almost always Latin-suited or a derivation thereof.
The most well known tarot deck in English speaking countries, the Waite-Rider tarot, was heavily influenced by the Golden Dawn, and through them, the Kabbalah, and was based on the Marseilles tarot. There are 22 "Major Arcana," each of which (supposedly) corresponds to a node on the Kabbalah. These represent large ideals, such as Death, the Devil, or the Wheel of Fortune. There are also 56 "Minor Arcana," with 14 cards in 4 suits. These are more familiar to non-mystics, as they represent 1-10, and the Page, Knight, Queen and King of each suit, corresponding to the same in a deck of playing cards (minus the Knight, of course). However, these are flexible, as are the correspondences.
[edit] Games
Tarot card games (also known as "tarock" and "tarochi") are popular in France, much of Central Europe formerly ruled by the Habsburgs and, to a lesser extent, Italy. Playing decks, not intended for divination, are normally used for playing those games.
[edit] How to make a tarot playing deck
You will need two decks of 54 standard playing cards with identical backs and different faces; in the US, a Bicycle Standard or Jumbo Index deck and a Bicycle Lo-Vision four-color deck will do. (This example is based on that combination.)[4]
Take the cards from the standard deck minus one joker (the other joker will be the Fool). Mix in the A->10 cards from the clubs (blue) and diamonds (green) from the Lo-Vision deck along with the Ace of Spades (black) and the jacks from all four suits; the clubs will be trumps 1-10, the diamonds (because a diamond's worth more than a stick) will be trumps 11-20, the big-index jacks will act as cavaliers,[5] and the ace of spades will be trump 21. You are now ready to play any tarot game using a standard 78-card deck, and you won't have to frustrate yourself with the artsy-fartsy markings on a cartomancy deck or pay obscene shipping charges to import a playing deck from France or Italy.
[edit] See also
[edit] External links
[edit] Footnotes
1. In occult decks, particularly the Rider-Waite, the coin and baton suits are sometimes renamed, to pentacles and wands.
2. Incidentally, these decks, while lavishly illustrated and sometimes great works of art, tend to be rather poor gaming decks due to large card size and less-than-convenient markings with no corner indices.
3. Laurie Cabot is the official witch of Salem. Has a curious fixation with Harry Potter.
4. Total cost, approximately US$7 depending on supplier.
5. You could also use three decks with three different index sizes, making the cavalier-jacks the middle-size index cards, but it's probably a waste of money to tear apart a third deck just for the jacks.
Personal tools
Namespaces
Variants
Actions
Navigation
Community
Toolbox
support
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:59:18.000Z
|
37ogred2fj37nlk3wvlggrtntcbukz4c
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5467",
"uncompressed_offset": 277406263,
"url": "wikitravel.org/en/Portland_%28Victoria%29",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://wikitravel.org/en/Portland_(Victoria)"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Portland (Victoria)
From Wikitravel
Jump to: navigation, search
Portland is a town in Victoria, Australia.
[edit] Get in
Sharp Airlines [1] fly to Portland from Adelaide and from Melbourne.
The township is a very short diversion from the Princes Highway, around 360km east of Melbourne.
V/Line train service connects with a coach service to Portland, and on to Mount Gambier.
[edit] Get around
[edit][add listing] See
Portland was Victoria's first permanent settlement, which gives it a rich heritage feeling with more than 200 historical buildings from the 1800s.
Portland has a long seafaring history beginning with the sealers and whalers that took shelter during southern storms in Portland's natural deep water harbour. Portland's Maritime Discovery Centre provides you with fascinating displays of this era as well information on whales with a Sperm Whale Skeleton, Southern Right Whale, Shark Showcase, the Portland Lifeboat from the 1850s, shipwreck displays and many other exhibits.
Today's waterfront is a hub of activity with ships from around the world loading up with local produce, the local fishing fleet bringing in their catch in the early mornings and locals and visitors alike strolling along the wide foreshore reserve.
Whales often visit in the winter months.
[edit][add listing] Do
[edit][add listing] Buy
[edit][add listing] Eat
[edit][add listing] Drink
[edit][add listing] Sleep
• Arbour Potter's Cottage +61 3 5526 5265 [2]
• Admella Motel 5 Otway Court, +61 3 5523 3347
• Cape Bridgewater Bay House +61 3 9439 2966
• Grosvenor Motel[3] 206 Hurd Street
• Victoria House 5-7 Tyers Street. +61 3 5521 7577, [4] - Centrally located, four star heritage listed accommodation dating back to 1853. Nine fully restored ensuite rooms from $140 per night, including breakfast. Family room overlooking cottage-style garden also available. Free broadband access and airport transfers.
• Victoria Lodge Motor Inn and Serviced Apartments[5] - 4 1/2 star motel accommodation and fully self-contained serviced holiday units on 155 Percy St- Ph: 61 3 5523 5966 | Fax: 61 3 5523 5755 | Toll free 1800 032 232
[edit] Get out
This article is an outline and needs more content. It has a template, but there is not enough information present. Please plunge forward and help it grow!
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:28:14.000Z
|
km3z7r2lopgyk2dbxavdnmzcffdin7vs
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5468",
"uncompressed_offset": 277416761,
"url": "wikitravel.org/wiki/en/index.php?action=history&title=Baluran_National_Park",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=Baluran_National_Park&action=history"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Revision history of "Baluran National Park"
Jump to: navigation, search
Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:55:45.000Z
|
ls6yndxlt3xlw53l6k5jq5abc2htr36u
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5469",
"uncompressed_offset": 277454576,
"url": "wikitravel.org/wiki/en/index.php?oldid=125706&title=San_Cipriano",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=San_Cipriano&oldid=125706"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
San Cipriano
From Wikitravel
Revision as of 17:29, 10 October 2005 by Ronald (Talk | contribs)
Jump to: navigation, search
San Cipriano is tine town of 500 inhabitants close to Buenaventura in Colombia.
Getting there is half the fun, but the beautifull surrounding can keep you busy for a day.
Get in
The only connection to the town is by railroad. With the lack of trains locals have set up their own transportation system with motorbike or man propelled vehicles.
To get there take a bus from Cali to Buenaventure and get off at a place called Cordoba. There locals will approach you and lead you to the railroad track. Negotiate the price for your trip (local pay COP$2.000, but you will probably pay more).
See
Do
Buy
Eat
Drink
Sleep
Hotel David, about 500 meters down the road, offers basic cheap accomodation.
Get out
External links
This article is still a stub and needs your attention. It does not have a template. Please plunge forward and help it grow!
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:28:37.000Z
|
z7ajn5fliimuykzhcfrbeq6cjh77vgvl
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5470",
"uncompressed_offset": 277477003,
"url": "wikitravel.org/wiki/en/index.php?oldid=1028235&title=Template%3AOutline",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=Template:Outline&oldid=1028235"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Template:Outline
From Wikitravel
Revision as of 16:14, 4 January 2009 by Eliovir (Talk | contribs)
Jump to: navigation, search
This article is an outline and needs more content. It has a template, but there is not enough information present. Please plunge forward and help it grow!
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:09:43.000Z
|
2tvdqxpwi2y6qtvchpjm4375jlfmwgv6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5478",
"uncompressed_offset": 287875611,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/Products/1350.0~Aug%2B2010~Chapter~State%2BComparison",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/Products/1350.0~Aug+2010~Chapter~State+Comparison?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1350.0 - Australian Economic Indicators, Aug 2010
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 30/07/2010
Page tools: Print Page RSS Search this Product
Contents >> State Comparison
STATE COMPARISON
This section contains the following subsection :
Table spreadsheets
Long time series spreadsheets
Links
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:55:57.000Z
|
dzj6k3jn3c2rwrj2lyvrripqxh6aumsz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5483",
"uncompressed_offset": 334702761,
"url": "www.biomedcentral.com/1471-2407/11/498",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.biomedcentral.com/1471-2407/11/498"
}
|
cccc_CC-MAIN-2013-20
|
This article is part of the series BMC Cancer's 10th anniversary special edition.
Editorial
A decade of progress in cancer research
Christna Chap* and Jigisha Patel
Author Affiliations
BMC Cancer, BioMed Central, Gray's Inn Road, London, WC1 8HB, UK
For all author emails, please log on.
BMC Cancer 2011, 11:498 doi:10.1186/1471-2407-11-498
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2407/11/498
Received:23 November 2011
Accepted:30 November 2011
Published:30 November 2011
© 2011 Chap and Patel; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Editorial
BMC Cancer [1] was launched ten years ago at a time when open access publishing was in its infancy. Although initially looked upon with skepticism, the open access publishing model, which provides an unrestricted and free access to scientific and scholarly work, has become increasingly accepted as a viable model, with more than 7, 000 open access journals now operating worldwide [2]. In a decade, this model has moved from the fringe to the core of the publishing industry.
BMC Cancer was one of the first journals to be open access and exclusively published online. The journal published 20 articles during its first year and has steadily grown since then with over 490 articles already published this year. BMC Cancer now boasts an impact factor of 3.15, which places it in the first quartile of the "oncology" category. To celebrate this first very successful decade for the journal, we present a special series of commissioned articles that not only highlight the most important advances in cancer research over the last ten years, but also discuss the new developments we might expect to see in the near future.
One major challenge in the treatment of cancer is to diagnose the disease at an early stage in order to improve prognosis. While several screening programmes exist for common cancers such as colorectal and breast cancer, they only detect cancers of one particular type [3,4]. In his commentary, Ian Cree [5] discusses how technical improvements in tests to detect circulating tumor markers, and indeed the potential for some molecules to act as general tumor markers, raise the possibility of blood test-based general screening for multiple cancers - in effect, screening for who to screen. Recently, an increasing number of studies have suggested that micro-RNAs (miRs) represent a promising new class of biomarkers for human malignancies [6-8]. In their review, Fei-Fei Liu and colleagues [9] specifically focus on the potential role of micro-RNAs as diagnostic and prognostic biomarkers in human epithelial tumors.
The last decade has also seen huge developments in sequencing technologies and several projects such as the Cancer Genome Atlas [10] and the International Cancer Genome Consortium [11] have aimed to provide a more complete picture of the mutational profile of cancer via large-scale analysis of cancer genomes. Hans Kristian Moen Vollan and Carlos Caldas [12] discuss how results of next generation sequencing hold the potential to refine molecular classification of breast cancer by integrating information from genomic signatures to existing knowledge derived from histopathological sub-classification. These advances could thus improve targeted cancer therapy and prognosis.
It is becoming increasingly clear that a multi-drug approach to targeted cancer therapy is needed due to increasing drug resistance to individual therapeutic agents [13,14]. In particular, Joanna Pancewicz and Christophe Nicot [15] discuss how recent advances on the role of Notch signaling pathway in the pathogenesis of human leukemia suggest that multi-drug chemotherapy targeting Notch signaling might be a promising therapeutic strategy in various hematological disorders.
In his commentary, Dirk Vordermark [16] discusses how the individualization of radiotherapy concepts and the combination of radiotherapy with molecular approaches are central to major developments in the field of radiation oncology, and he outlines the particular role of BMC Cancer as a platform for disseminating this research. Individualized and targeted therapy approaches hold great promise in oncology but resistance to therapy remains to be overcome. It is well-established that low tumor oxygenation can cause poor response to radiation therapy [17,18]. Kevin Bennewith and Shoukat Dedhar discuss in their review [19] how the clinical potential of hypoxic tumor cells extends beyond the treatment of primary tumors, and they elaborate on the promising role of hypoxic tumor cells as targets for the treatment and prevention of metastatic cancer.
This special issue sets the stage for 'hot topics' we might expect to see in the coming decade, and BMC Cancer is poised to be at the forefront of disseminating this research in a rapid and freely-accessible manner.
We would like to thank all our external academic editors and Editorial Board Members for their continuing support, and our Section Editors in particular for their contribution to this special anniversary issue.
We hope you enjoy reading it.
References
1. BMC Cancer [http://www.biomedcentral.com/bmccancer/] webcite
2. Directory of Open Access Journals [http://www.doaj.org/] webcite
3. Ahlquist DA, Sargent DJ, Loprinzi CL, Levin TR, Rex DK, Ahnen DJ, Knigge K, Lance MP, Burgart LJ, Hamilton SR, Allison JE, Lawson MJ, Devens ME, Harrington JJ, Hillman SL: Stool DNA and occult blood testing for screen detection of colorectal neoplasia.
Ann Intern Med 2008, 149:441-450.
W81
PubMed Abstract
4. Vinnicombe S, Pinto Pereira SM, McCormack VA, Shiel S, Perry N, Dos Santos Silva IM: Full-field digital versus screen-film mammography: comparison within the UK breast screening program and systematic review of published data.
Radiology 2009, 251:347-358. PubMed Abstract | Publisher Full Text
5. Cree IA: Improved blood tests for cancer screening: general or specific?
BMC Cancer 11:499.
6. Calin GA, Croce CM: MicroRNA signatures in human cancers.
Nat Rev Cancer 2006, 6:857-866. PubMed Abstract | Publisher Full Text
7. Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, Visone R, Iorio M, Roldo C, Ferracin M, Prueitt RL, Yanaihara N, Lanza G, Scarpa A, Vecchione A, Negrini M, Harris CC, Croce CM: A microRNA expression signature of human solid tumors defines cancer gene targets.
Proc Natl Acad Sci USA 2006, 103:2257-2261. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
8. Si ML, Zhu S, Wu H, Lu Z, Wu F, Mo YY: miR-21-mediated tumor growth.
Oncogene 2007, 26:2799-2803. PubMed Abstract | Publisher Full Text
9. Hui A, How C, Ito E, Liu F-F: Micro-RNAs as diagnostic or prognostic markers in human epithelial malignancies.
BMC Cancer 11:500.
10. The Cancer Genome Atlas [http://cancergenome.nih.gov/] webcite
11. International Cancer Genome Consortium [http://www.icgc.org/] webcite
12. Vollan HKM, Caldas C: The breast cancer genome-a key for better oncology.
BMC Cancer 11:501.
13. Fossati R, Confalonieri C, Torri V, Ghislandi E, Penna A, Pistotti V, Tinazzi A, Liberati A: Cytotoxic and hormonal treatment for metastatic breast cancer: a systematic review of published randomized trials involving 31, 510 women.
J Clin Oncol 1998, 16:3439-3460. PubMed Abstract | Publisher Full Text
14. Carrick S, Parker S, Thornton CE, Ghersi D, Simes J, Wilcken N: Single agent versus combination chemotherapy for metastatic breast cancer. In Cochrane Database of Systematic Reviews. Chichester, UK: John Wiley & Sons, Ltd; 1996.
15. Pancewicz J, Nicot C: Current views on the role of Notch signaling and the pathogenesis of human leukemia.
BMC Cancer 11:502.
16. Vordermark D: Ten years of progress in radiation oncology.
BMC Cancer 11:503.
17. Greco O, Patterson AV, Dachs GU: Can gene therapy overcome the problem of hypoxia in radiotherapy?
J Radiat Res 2000, 41:201-212. PubMed Abstract | Publisher Full Text
18. Wouters BG, Weppler SA, Koritzinsky M, Landuyt W, Nuyts S, Theys J, Chiu RK, Lambin P: Hypoxia as a target for combined modality treatments.
Eur J Cancer 2002, 38:240-257. PubMed Abstract | Publisher Full Text
19. Bennewith KL, Dedhar S: Targeting hypoxic tumour cells to overcome metastasis.
BMC Cancer 11:504.
Pre-publication history
The pre-publication history for this paper can be accessed here:
http://www.biomedcentral.com/1471-2407/11/498/prepub
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:03:51.000Z
|
p5b4xnrjsjhlosapw2nwkvszbndptv5g
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5484",
"uncompressed_offset": 334719712,
"url": "www.biomedcentral.com/1471-2458/10/118/abstract?fmt_view=mobile",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.biomedcentral.com/1471-2458/10/118/abstract?fmt_view=mobile"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Socioeconomic determinants of psychotropic drug utilisation among elderly: a national population-based cross-sectional study
Eva Lesén1*, Karolina Andersson1, Max Petzold1 and Anders Carlsten1,2
Author affiliations
1 Nordic School of Public Health (NHV), Box 121 33, 402 42 Gothenburg, Sweden
2 Department of Research and Development, the National Corporation of Swedish Pharmacies, Gothenburg, Sweden
For all author emails, please log on.
Citation and License
BMC Public Health 2010, 10:118 doi:10.1186/1471-2458-10-118
Published: 9 March 2010
Abstract
Background
Psychotropic drugs are commonly utilised among the elderly. This study aimed to analyse whether two socioeconomic determinants - income and marital status - are associated with differences in utilisation of psychotropic drugs and potentially inappropriate psychotropic drugs among elderly in Sweden.
Methods
All individuals aged 75 years and older who had purchased a psychotropic drug in Sweden during 2006 were included (68.7% women, n = 384712). Data was collected from national individual-based registers. Outcome measures were utilisation of three or more psychotropic drugs and utilisation of potentially inappropriate psychotropic drugs, as classified by the Swedish National Board of Health and Welfare.
Results
Individuals with low income were more likely to utilise three or more psychotropic drugs compared to those with high income; adjusted odds ratio (aOR) 1.12 (95% confidence interval [CI] 1.10-1.14). The non-married had a higher probability for utilising three or more psychotropic drugs compared to the married (aOR 1.22; CI 1.20-1.25). The highest probability was observed among the divorced and the never married. Potentially inappropriate psychotropic drugs were more common among individuals with low compared to high income (aOR 1.14; CI 1.13-1.16). Compared to the married, potentially inappropriate psychotropic drug utilisation occurred more commonly among the non-married (aOR 1.08; CI 1.06-1.10). The never married and the divorced had the highest probability.
Conclusions
There was an association between socioeconomic determinants and psychotropic drug utilisation. The probability for utilising potentially inappropriate psychotropics was higher among individuals with low income and among the non-married.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:55:09.000Z
|
ff5xvjpahrwrntpwp37g4d2kw4yy5bve
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5485",
"uncompressed_offset": 334731554,
"url": "www.biomedcentral.com/1471-2458/8/216/?fmt_view=mobile",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.biomedcentral.com/1471-2458/8/216/?fmt_view=mobile"
}
|
cccc_CC-MAIN-2013-20
|
Study protocol
Vitalum study design: RCT evaluating the efficacy of tailored print communication and telephone motivational interviewing on multiple health behaviors
Hilde M van Keulen1*, Ilse Mesters1, Johannes Brug2, Marlein Ausems1, Marci Campbell3, Ken Resnicow4, Paul J Zwietering5, Gerard van Breukelen6, Willem van Mechelen7, Johan L Severens8 and Hein de Vries1
Author affiliations
1 Department of Health Education and Health Promotion, School for Public Health and Primary Care (Caphri), Maastricht University, P.O. Box 616, 6200 MD Maastricht, The Netherlands
2 EMGO Institute, VU University Medical Centre, Van der Boechortstraat 7, 1081 BT Amsterdam, The Netherlands
3 Department of Nutrition, University of North Carolina at Chapel Hill, School of Public Health, 4102 McGravan-Greenberg Hall, Chapel Hill, NC 27599-7461, USA
4 Faculty of Health Behavior and Health Education, University of Michigan, School of Public Health, 109 South Observatory, Ann Arbor, MI 48109-2029, USA
5 Department of General Practice, School for Public Health and Primary Care (Caphri), Maastricht University, P.O. Box 616, 6200 MD Maastricht, The Netherlands
6 Department of Methodology and Statistics, School for Public Health and Primary Care (Caphri), Maastricht University, P.O. Box 616, 6200 MD Maastricht, The Netherlands
7 Department of Public and Occupational Health, EMGO Institute, VU University Medical Centre, Van der Boechortstraat 7, 1081 BT Amsterdam, The Netherlands
8 Department of Health Organization, Policy, and Economics and Department of Clinical Epidemiology and Medical Technology Assessment, School for Public Health and Primary Care (Caphri), University Hospital Maastricht and Maastricht University, P.O. Box 616, 6200 MD Maastricht, The Netherlands
For all author emails, please log on.
Citation and License
BMC Public Health 2008, 8:216 doi:10.1186/1471-2458-8-216
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2458/8/216
Received:16 May 2008
Accepted:19 June 2008
Published:19 June 2008
© 2008 van Keulen et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
A large proportion of adults fail to meet public health guidelines for physical activity as well as fruit, vegetable and fat intake. Interventions are needed to improve these health behaviors. Both computer tailoring and motivational interviewing have shown themselves to be promising techniques for health behavior change. The Vitalum project aims to compare the efficacy of these techniques in improving the health behaviors of adults aged 45–70. This paper describes the design of the Vitalum study.
Methods/Design
Dutch general medical practices (N = 23) were recruited via a registration network or by personal invitation. The participants were then enrolled through these general practices using an invitational letter. They (n = 2,881) received a written baseline questionnaire to assess health behaviors, and potential psychosocial and socio-demographic behavioral determinants. A power analysis indicated that 1,600 participants who were failing to meet the guidelines for physical activity and either fruit or vegetable consumption were needed. Eligible participants were stratified based on hypertension status and randomized into one of four intervention groups: tailored print communication, telephone motivational interviewing, combined, and control. The first two groups either received four letters or took part in four interviews, whereas the combined group received two letters and took part in two interviews in turns at 5, 13, 30 and 43 weeks after returning the baseline questionnaire. Each letter and interview focused on physical activity or nutrition behavior. The participants also took part in a telephone survey 25 weeks after baseline to gather new information for tailoring. There were two follow-up questionnaires, at 47 and 73 weeks after baseline, to measure short- and long-term effects. The control group received a tailored letter after the last posttest. The process, efficacy and cost-effectiveness of the interventions will be examined by means of multilevel mixed regression, cost-effectiveness analyses and process evaluation.
Discussion
The Vitalum study simultaneously evaluates the efficacy of tailored print communication and telephone motivational interviewing, and their combined use for multiple behaviors and people with different motivational stages and education levels. The results can be used by policymakers to contribute to evidence-based prevention of chronic diseases.
Trial Registration
Dutch Trial Register NTR1068
Background
Cardiovascular disease is a major cause of mortality throughout the world [1]. Both morbidity and mortality can be reduced by improving individuals' cardiovascular risk profile by, for example, preventing hypertension, lowering blood pressure in hypertensive people, increasing physical activity (PA) and fruit and vegetable consumption, and reducing saturated fat intake [1-9]. International public health guidelines have been developed for reducing the risk of cardiovascular diseases. Based on these, the Dutch guidelines recommend that Dutch people consume at least two pieces (approximately 200 grams) of fruit and 200 grams of vegetables a day, be moderately physically active at least 5 days a week for at least 30 minutes a day, and have a maximum saturated fat intake of 10% of their total energy intake [1,7,10-15].
Various studies have shown that large percentages of adults fail to meet these public health recommendations [16-23]. De Vries and colleagues [23] showed that more than half of Dutch adults fail to meet the PA guideline, that 69.5%, 86.2% and 38.9% fail to meet the guidelines for fruit, vegetable and fat intake respectively and that only 3% adhere to all guidelines for PA, fruit, vegetable and fat intake, and smoking. Thus, interventions are needed to improve these health behaviors.
Computer tailoring and motivational interviewing (MI) are both innovative and promising intervention methodologies that are being used to improve health behaviors. Tailoring has been defined as "any combination of information or change strategies intended to reach one specific person, based on characteristics that are unique to that person, related to the outcome of interest, and have been derived from an individual assessment" (p. 1) [24]. Computers are useful tools to tailor messages for large groups of people at low costs [25]. Research has reported that computer tailoring has a positive effect on PA [26-30], fruit and vegetable consumption [26,31-38] and saturated fat intake [39,40], also compared to generic information on changing these behaviors [27,33,37,40,41].
MI is defined as "a client-centered, directive method for enhancing intrinsic motivation to change by exploring and resolving ambivalence" (p. 25) [42]. Evidence exists of the effectiveness of MI on PA [43-45], fruit and vegetable consumption [46-48] and saturated fat intake [49,50], and also when compared to standard advice on changing these behaviors [45,47,48,50].
Research into tailoring emphasizes the need to compare these methods with others concerning their effects on changing behavior [25,51]. The Vitalum study contributes to this need. Its design was inspired by the NC STRIDES Project, which compared the effects of computer tailoring to those of MI in a colon cancer prevention and control study on PA and fruit and vegetable consumption in participants aged 50 or older [52-54]. Vitalum examines the efficacy of computer tailoring and MI on PA, fruit and vegetable consumption and saturated fat intake in participants aged 45 to 70 with and without hypertension. We also assess Vitalum's efficacy for different education levels since health disparities between SES groups are increasing [55] and health behavior adoption varies between these groups [56,57].
Older adults are an important target group for research and the development of lifestyle interventions for several reasons. First, adults between 45 and 70 represent more than 20% of the population in European countries [58]. Second, this percentage is likely to increase in the coming years [59]. Third, most blood pressure-related deaths or nonfatal events occur in middle age or in the elderly providing a cue to action for this age group [8]. Finally, older adults are important targets for prevention because health improvements due to increased PA, fruit and vegetable consumption, and lowered saturated fat intake still contribute to reduced risk of morbidity and mortality rates in this group [1,7,60].
When Vitalum began in 2003 no results were available of studies that compared the economic consequences of interventions using computer tailoring and motivational interviewing. Physical inactivity, consuming too little fruit and vegetables and eating too much saturated fat may result in disease and loss of quality of life [8,61]. Therefore, Vitalum also aims to evaluate and compare the cost-effectiveness of computer tailoring and motivational interviewing.
This article describes the Vitalum study design, which may help others in developing of equivalent interventions.
Methods/Design
Participants and recruitment
Vitalum was approved by the Medical Ethics Committee of Maastricht University and the University Hospital Maastricht, and is registered with the Dutch Trial Register (NTR1068).
In 2004 and 2005, Dutch general practices (GPs) from the southern Netherlands were invited to join in the recruitment of 1,600 participants via a registration network (Registration Network Family Practices; RNH) [62,63] or by personal invitation. Twenty-three agreed to participate; 19 from the province of Limburg and 4 from Brabant. GPs that declined were participating in other research trials or had too little time.
Figure 1 shows the selection and enrollment of Vitalum participants. The population of the participating GPs consisted of 103,915 people, of whom 6,420 (6%) were randomly selected to participate using five inclusion criteria: 1) aged 45–70; 2) about 50% diagnosed by their GP as hypertensive according to the International Classification of Primary Care (ICPC) [3,64,65] under ICPC code K86 or K87 in the GP database (i.e., hypertension without or with organ damage respectively); 3) about 50% male; 4) not participating in other studies according to the GP database; and 5) maximum one person per address. To ensure participants' suitability for the study, they could be excluded (n = 875, 14% of the selection) by GPs before being invited. Exclusion was based on several criteria (see Figure 1), for example, having a "life-threatening or malignant disorder." After this exclusion, 5,545 eligible participants (86% of the selection) received an invitation from their GP to participate in Vitalum, in which the content of the study and group assignment was briefly explained. Those (n = 2,341, 36% of the selection) who did not respond received a reminder after four weeks. Ultimately, 4,379 people (68% of the selection) responded, of whom 2,881 (45% of the selection) consented and 1,498 (23% of the selection) refused to participate. Reasons for refusal included lack of time or interest. There was no response from 18% (n = 1,166 of the selection). Those who did agree to participate received a written baseline questionnaire, which was returned by 2,568 people (89% of the consenters). Because it was logistically impossible to treat them all at the same time, participants were recruited and enrolled in 27 batches of maximum 200 participants. The duration between the first and last group to enroll and finish baseline data collection was 18 months (March 2005–August 2006).
Figure 1. Flow diagram of the selection and enrollment of Vitalum participants.
Study design
To ensure that we selected participants not satisfying the Dutch public health guidelines, people who returned the baseline questionnaire were included in Vitalum if they failed to meet at least two of these guidelines: PA and either fruit or vegetable consumption. Adequate saturated fat intake was not taken into account as an exclusion criterion, because most Dutch adults (90%) fail to meet the guideline for this behavior [66]. Saturated fat intake received less attention in Vitalum than PA and fruit and vegetable consumption for a practical reason – to reduce the length of the tailored letters and motivational interviews.
Participants were stratified based on hypertension status prior to randomization. In total, 1,629 (63%) of the 2,568 participants who filled out the baseline questionnaire were randomized in one of the four groups. A description of the study sample at baseline is shown in Table 1. Because data of the selected people (n = 6,420) were only available at group level, attrition analyses were executed at group level for age, gender and hypertension status. Participants in the sample (N = 1,629) were compared with those who had been excluded or refused to participate (i.e., non-participants; n = 4,791). These analyses revealed no significant differences in age between participants (M = 57.15, SD = 7.13) and non-participants (M = 57.02, SD = 7.38; t(6,418) = 0.62, p > .05), nor for gender, (χ2(1, n = 6,420) = 1.92, p > .05). However, participants (52% with and 48% without hypertension) were more likely to suffer from hypertension than were non-participants (49% with and 51% without hypertension; χ2(1, n = 6,420) = 4.53, p < .05).
Table 1. Vitalum sample description (N = 1,629)
Participants were stratified and randomized into the following four groups by a computer program.
1. The tailored print communication (TPC) group, in which participants received four tailored letters. The first and third letter focused on PA, the second and fourth on fruit and vegetable consumption, and the fourth also addressed fat intake.
2. The telephone motivational interviewing (TMI) group, in which participants received four telephone calls based on MI. Participants chose the order of the conversation topics in the first and third call. If they chose to focus on PA in the first call, fruit and vegetable consumption was discussed in the second, and vice versa; they could also choose to discuss fat intake in the fourth call.
3. The combined group (TPC+TMI), in which participants received two tailored print letters and two telephone motivational interviews in turns. The first letter and call addressed PA; the second letter and call focused on fruit and vegetable consumption. Participants could also choose to discuss fat intake in the fourth call. The total number of intervention components (4) was kept to a similar total number as that of the first two groups. Also, we exposed participants to an equal amount of each intervention type (2*TPC, 2*TMI) to keep the influence of both methods as comparable as possible.
4. The control group, in which participants received one tailored letter based on the last follow-up questionnaire.
Participants from the three intervention groups received their four intervention components at 5, 13, 30 and 43 weeks after they had returned the baseline questionnaire. This timeframe was chosen to spread delivery of the components throughout the year [48]. Vitalum used a two-way design (TMI * TPC) except for the fact that the combined group received half of each treatment type (2*TPC and 2*TMI instead of 4*TMI and 4*TPC). The study design and timeline is depicted in Figure 2.
Figure 2. Design and timeline of Vitalum. * TPC = Tailored print communication. ** TMI = Telephone motivational interviewing.
Participants' behaviors and determinants were assessed by an intermediate telephone survey after two intervention components, 25 weeks after returning the baseline questionnaire, to gather the most recent information for the computer tailoring intervention. This survey also assessed the effects of the intervention. In addition, participants in the TPC group were telephoned 39 weeks after returning the baseline questionnaire, again to collect the most recent data on behavior and its determinants. Intervention effects were assessed by two follow-up paper questionnaires, 47 and 73 weeks after the baseline questionnaire. Two reminders were sent to participants who failed to respond at baseline and both follow-ups; a postcard after 3 weeks and a letter including the questionnaire after 6 weeks. For the telephone surveys 25 and 39 weeks after baseline, 4 and 3 weeks respectively were used to contact participants and carry out the survey.
Participants received a pedometer as a reward for their participation, with short instructions encouraging them to gradually increase their number of steps to at least 10,000 a day [67]. By rewarding participants, we were also able to assess the effect of this reward on their physical activity levels. Therefore, half the participants in the TPC, TMI and TPC+TMI groups received their reward before the third intervention component (29 weeks after returning the baseline questionnaire); the remainder received the reward after the last follow-up. Participants were stratified on hypertension status prior to randomization in two groups (receiving a pedometer during or after the study). In the first follow-up questionnaire, 47 weeks after returning the baseline questionnaire, all participants were asked if they owned and used a pedometer. We were thus able, first, to study intervention effects via the telephone questionnaire after two intervention components, and second, to study the effect of the pedometer reward on participants' physical activity levels. This aspect was later treated as an independent variable in the analyses.
Intervention materials
Tailored print communication (TPC)
The message content and message algorithms of the TPCs were based on prior effective theory-based computer-tailored interventions on PA and fat, fruit and vegetable intake developed by Brug et al. [33], Oenema et al. [37] and Smeets et al. [30,68] and on focus group interviews held with people from the target population. An important addition was that Vitalum's tailored messages were based on more items and feedback was item-specific (instead of scale-based, as in the previous studies) to further personalize and tailor the feedback. This level of tailoring was also chosen to make TPC more comparable with TMI, given that in TMI the counselor can tailor the conversation to determinants mentioned by the participant (e.g., specific advantages of PA).
The computer-tailored interventions were based on the integrated model for exploring motivational and behavioral change (I-Change Model) [69-71]. The I-Change Model states that behavior is determined by people's motivation or intention to perform a certain behavior. Barriers can decrease the chance that intentions will result in action. Individuals' abilities, such as being able to plan specific actions to reach the target behavior (i.e., action plans), can increase the chance that intentions will result in action. Motivation factors, like attitudes, social influences and self-efficacy expectations determine a person's intention to change. These motivation factors are influenced by (a) awareness factors, such as knowledge; (b) information factors, such as message quality; and (c) predisposing factors, namely behavioral, psychological, biological and social and cultural factors. Behavioral determinants according to the I-Change Model were measured and used to tailor the information in the letters. The I-Change Model, in line with the Transtheoretical Model [72], posits that individuals can move forward and backward through different motivational phases towards behavior change. Precontemplators are people who do not plan to change their behavior in the next six months; contemplators do intend to change their behavior in the next six months; preparators plan to change their behavior in the next month; actors have changed their behavior in the past six months; and maintainers have maintained their changed behavior for longer than six months. Consequently, Vitalum participants received stage-matched advice [72-74], based on the Transtheoretical Model stages of change algorithm [72]. Tailoring variables were current behavior according to validated questionnaire, self-rated behavior, stage of change, attitude, self-efficacy expectations, awareness, action plans, age and gender.
The letters, TPC1 and TPC2 (each 3–6 pages), were personalized with the participant's name and provided with the following tailored elements:
1. Introduction, explaining the purpose of Vitalum and what to expect from the letter.
2. Specific behavioral feedback about targeted behavior, in order to stimulate self-regulation in line with Carver and Scheier's [75] behavioral self-regulation model, including current behavior compared to: (a) the public health recommendation, (b) participants' estimation, and (c) others of the same age.
3. Stage-matched advice to change behavior: (a) participants without plans to change their behavior received tailored feedback on the advantages of change; (b) precontemplators received feedback on advantages and disadvantages of change; (c) contemplators received feedback on advantages, disadvantages and action plans; (d) preparators received feedback on self-efficacy expectations and action plans; and finally (e) actors and maintainers received tailored feedback on action plans.
4. Conclusions and preview of the next letter.
An example of such stage-matched advice is shown in the appendix; a summary of the elements in a TPC can be found in Figure 3.
Figure 3. Tailored print communication elements.
Subsequent letters, TPC3 (2–4 pages) and TPC4 (4–6 pages), reinforced tailored feedback on behavioral progress and stages of change, and used similar strategies to those mentioned above. Information on saturated fat intake only addressed behavior rather than stages of change, to reduce the length of the fourth letter. The tailored letters for participants in the combined group took the same format as those described above. The message algorithm and messages were examined by an expert before implementation. The letters were computer generated, mailed to participants' home addresses and signed by the principal researchers (authors IM, MA and HMvK).
Telephone motivational interviewing (TMI)
In Vitalum, motivational interviewers were trained by two certified trainers during six 3-hour sessions. Eligible interviewers were bachelor's and master's students of Health Education and Health Promotion, Mental Health Sciences or Psychology at Maastricht University. Though these students were being educated in health sciences disciplines, they had not yet developed counseling routines and were therefore expected to be easier to train in MI skills than experienced counselors; they would not have to unlearn or replace counseling habits with new ones. In total, 53 students were trained in four separate groups. At the end of the training they performed one TMI guided by a Vitalum interview protocol. All calls were tape-recorded and assessed by two raters with the 1-PASS [76], a tool to measure MI intervention fidelity. The general conclusion was that they performed very well; both the training and the interview protocol guaranteed good quality performance. Those who had a 100% attendance and an adequate score on the MI qualities were then able to apply for a contract to work as a Vitalum motivational interviewer. Sixteen applicants were contracted.
To assist the interviewers in applying MI, an interview protocol was developed and used for each interview in the intervention groups. The protocols were based on those used by Resnicow et al. in the Healthy Body Healthy Spirit trial [47,77] and were pretested with experts and representatives from the study population. The protocols followed the basic steps of MI outlined by Miller and Rollnick [42]. Each protocol included the following elements:
1. Introduce self and build rapport – the interviewer introduces him/herself, explains the reason for the call, and asks if it is okay to continue.
2. Assess current behaviors and progress – the interviewer summarizes the participants' behavior based on a participant profile generated from the questionnaire or survey and checks whether this profile fits their current behavior.
3. Discuss the public health guideline of a certain behavior in relation to the participant's current behavior.
4. Assess and enhance motivation and self-efficacy for behavior change with the importance and confidence ruler as described by Resnicow et al. [77] and Miller and Rollnick [42] and developed by Rollnick [78]. Importance and confidence were examined subsequently in four steps: (a) assess importance and confidence with ruler, (b) ask "Why did you not choose a lower number?", (c) ask "Why did you not choose a higher number?", and (d) ask "What would it take for you to reach a higher number?".
5. Assess readiness to change. For those ready to change (a) brainstorm possible actions, (b) facilitate commitment to change and goal setting, (c) explore barriers or concerns and brainstorm solutions. For those not ready to change (a) explore lack of interest or ambivalence, and (b) encourage participant to think about change.
6. Summarize interview and ask for feedback on summary.
7. Explain when the next call can be expected and close the session.
The elements included in the interview protocol are summarized in Figure 4.
Figure 4. Telephone motivational interviewing protocol elements. * Only in the third interview protocol of the TMI group and second interview protocol of the combined group
The protocols of the second, third and fourth interviews in the TMI group and of the second interview in the combined group contained an extra element after the introduction: Discuss progress on action plans, if plans were made, and discuss the current situation, if participants had no plans to change. This extra element was added to help participants make progress in changing their behavior or thinking about behavioral change. The interview protocols of the combined group contained an extra topic after the introduction: Discuss the tailored letter. The third protocol of the TMI group and the second of the combined group also contained the possibility for the interviewers to use the values clarification strategy described by Resnicow et al. [77].
Besides the interview protocols, interviewers received general information about cardiovascular diseases, hypertension and the specific health behaviors (physical activity, fruit and vegetable consumption and fat intake), and an MI-Change Talk card on which methods to evoke and strengthen change talk and confidence talk were summarized as described by Miller and Rollnick [42].
The TMIs were expected to take on average 20 minutes. The interviewers wrote a summary of each interview to assist in the next interview. Interviewers were scheduled to interview the same participants as far as possible; however, due to job transfers and availability, this was not always possible. To assess the interviewers' competence in the use of MI, the interviews were computer recorded. A random 20-minute segment of a random sample of 20% of the interviews will be coded, 20% of these (4% of all interviews) will be examined by two trained coders for inter-coder reliability with the use of the Motivational Interviewing Treatment Integrity (MITI 3.0) code [79,80] and the 1-PASS Coding System for Motivational Interviewing (1-PASS) [76]. The MITI 3.0 consists of two components: global scores and behavior counts. The global scores of empathy, MI spirit (evocation, collaboration and autonomy support) and direction capture an overall impression of the interview (1 = poor, to 5 = ideal), whereas the behavior counts examine specific interviewer behavior; the number of open and closed questions, simple and complex reflections, the provision of information, and MI adherent and non-adherent utterances. Recommended competency thresholds as described in the MITI 3.0 [80,81] will be used to determine interviewer competency for the behavior counts as well as the global scores. The 1-PASS consists of 16 items (1 = poor/never to 7 = excellent/always) that measure, for example, whether the interviewer effectively uses the importance ruler or values clarification strategy. The average 1-PASS score is calculated by dividing the sum of the items by the number of applicable items. As described in the 1-PASS manual, an average score of 5 is regarded as sufficient [76].
Tailored print communication versus telephone motivational interviewing
Because TPC and TMI are different methods, they are also expected to have different effects. The first reason for this stems from their media differences. TPC is print-based and essentially a passive, one-way form of communication. It is therefore assumed to have less impact on people with a lower education level [25], whereas TMI is more interactive and assumed to be more effective for these people. The second reason concerns individuals' motivation to change behaviors. The Protection Motivation Theory [82,83] states that people can be motivated to protect their health by two processes: threat appraisal and coping appraisal. Threat appraisal is influenced by individuals' perceived seriousness of the situation and their susceptibility. A higher perceived threat may lead to more motivation to protect oneself. In line with Protection Motivation Theory, people without hypertension are assumed to have less interest in and motivation to change than people with hypertension. Since people less ready to change may benefit more from motivation-enhancing interventions [48,84,85] it is possible, therefore, that people without hypertension will benefit more from TMI, because they may be more ambivalent and less ready to follow advice than people with hypertension. The largest effect is anticipated for the combined (TPC+TMI) group, as we assume that the positive aspects of both TPC and TMI will be reinforced in this group.
Hypotheses
Effect size estimates for our intervention and control conditions were difficult to determine, because similar studies were not available at the start of Vitalum (2003). However, one study on MI [48] and others on computer tailoring [27,33,40] found increases of at least 10% in one or more of the target behaviors (i.e., PA, fruit or vegetable consumption, or saturated fat intake) in participants who received single or multiple MI or tailoring compared to control group participants. As PA and fruit and vegetable consumption will receive more attention than saturated fat intake, we also expect to find larger effects for these. Therefore, we formulated the following hypotheses:
1. Compared to those in the control group, participants receiving either TMI or TPC will (a) increase PA as well as fruit and vegetable intake by 10% at the first follow-up from the expected mean at baseline; and (b) decrease saturated fat intake by 5%.
2. Participants receiving TPC+TMI will have resulting behavioral changes which exceed the sum of the changes expected given each intervention.
3. Participants with a low education level benefit more from TMI than TPC.
4. Participants without hypertension benefit more from TMI than TPC.
Outcome measures
Primary outcome measures
To measure the efficacy of TPC, TMI and TMI+TPC, the primary outcome measures of Vitalum were PA, fruit and vegetable consumption and whether participants adhered to public health guidelines with regard to these behaviors. These were measured at baseline, the intermediate telephone survey and both follow-ups (25, 47 and 73 weeks after baseline respectively). Since PA and fruit and vegetable consumption receive more attention in Vitalum, saturated fat intake was seen as a secondary outcome measure. Other studies showed that multiple-item measurements may result in people overestimating their behavior [86-95] and that adjusting the results of a multiple-item measurement with those of a single-item measurement let to reduced overestimation [86-88,92,93]. Therefore, the primary outcome measures are single – as well as multiple-item measurements, and both are combined into a measure as described below to reduce overestimation.
Physical activity (PA): single-item measurement
PA was assessed using one item, the final question of the Short Questionnaire to Assess Health-enhancing physical activity (SQUASH) [96]: "How many days a week do you cycle, engage in do-it-yourself (DIY) activities, do gardening, play a sport or engage in other strenuous physical activities for at least 30 minutes a day?" The SQUASH has been validated with an accelerometer (CSA activity monitor, rspearman = .45, p < .01). In terms of the single-item adherence measurement, participants were classified as adhering to the Dutch PA guideline if their answer to this question was 5 or more days [7,11,13].
Multiple-item measurement
PA was also measured using 28 items from the modified CHAMPS physical activity questionnaire [97], which assesses the frequency of an activity (times per week) and its duration (hours per week). This questionnaire has been validated with cardiorespiratory fitness (VO2 maximum) estimated by a submaximal treadmill test (rpearson = .17, p < .05) [97]. Activities that were measured included: walking leisurely; walking fast or briskly; cycling leisurely; cycling fast or briskly; doing light gardening; doing heavy gardening; doing light housekeeping; doing heavy housekeeping; jogging or running; swimming; playing tennis, table tennis or badminton; playing a team sport indoors or outdoors; doing light exercises to maintain a physical condition, for example, stretching or flexibility exercises; and doing heavy exercises, for example aerobics, fitness or strength training. Metabolic equivalents (METs) were determined for each activity on the basis of the PA compendium by Ainsworth et al. [98]. MET levels were used as cut-offs to calculate the total number of weekly PA hours with at least a moderate intensity. Only activities with at least four METs were considered moderate for participants younger than 55, and activities with at least three METs considered moderate for participants aged 55 and older [11]. In terms of multiple-item adherence measurement, participants were classified as adhering to the PA guideline if they were physically active with at least moderate intensity for at least 2.5 hours a week.
Combined measure
Multiple- and single-item measurements were also recoded into a combined measure to classify adherence: participants were only coded as "meeting the PA guideline" if they did so according to both the multiple- and single-item measurements.
Fruit and vegetable consumption: single-item measurement
Both fruit and vegetable consumption were assessed using single-item measurements: one for fruit ("How many days a week do you eat at least two pieces of fruit?") and one for vegetables ("How many days a week do you eat at least 200 g of vegetables?"). In terms of the single-item adherence measurement, participants were classified as adhering to the guideline for fruit and vegetable consumption if their answer to both these questions was 7 days [10].
Multiple-item measurement
Fruit and vegetable consumption was also measured using 16 items from the short questionnaire for fruit and vegetable intake [99]. The questionnaire has been validated with blood levels of carotenoids (rspearman = .39, p < .001 for fruit; rspearman = .24, p < .001 for vegetables) and vitamin C (rspearman = .37, p < .001 for fruit; rspearman = .26, p < .001 for vegetables) [99]. This questionnaire measured frequency (days per week) and quantity (pieces/serving spoons per day) of vegetables (cooked and raw) and fruit (fruit juice, citrus fruits, tangerines, apples or pears, bananas and other fruits). Two tangerines were considered one piece of fruit. Frequency and quantity were used to determine daily consumption. In terms of the multiple-item adherence measurement, participants adhered to the fruit consumption guideline if they consumed at least two pieces (two servings) a day, and to the vegetable consumption guideline if they consumed at least 200 g (4 serving spoons) a day [10].
Combined measure
Multiple- and single-item measurements were recoded into a combined measure to classify adherence: participants were only coded as "meeting the fruit guideline" if they did so according to multiple- and single-item measurements. The same applied for vegetable consumption.
Secondary outcome measures
Secondary outcomes include saturated fat intake, health-related quality of life, body mass index (BMI) and cognitive behavioral determinants. Except the latter, these were measured at baseline and both follow-ups (43 and 73 weeks after baseline). Cognitive determinants of primary behavioral outcomes were also measured at the first telephone survey (25 weeks after baseline); but because Vitalum's main focus was to measure behavior change, cognitive behavioral determinants of all outcomes – except for intention – were not measured at the second follow-up (73 weeks after baseline). This also reduced the length of the second follow-up questionnaire, thereby possibly reducing dropout.
Saturated fat intake was measured using a 35-item short food frequency questionnaire, the Fat list [100]. The list has been validated with a 7-day diet record (rpearson = .69 for saturated fat intake, p not reported) [100]. Saturated fat intake was assessed using questions about frequency and quantity of 19 food items (dairy products, bread spreads, cheese, meat, gravy, savory snacks and sweet snacks). Frequency, quantity and item type were used to calculate a total fat score for the 19 items (0–5 points per item). One fat point represents about 2 g of saturated fat intake. Respondents were classified as adhering to the guideline for saturated fat intake depending on gender: men with a total fat score of 15 or less and women with 13 or less [100].
Health-related quality of life was measured with the RAND 36-item Health Survey 1.0 [101,102] which measures individuals' physical and social functioning, role limitations due to physical or emotional problems, mental health, pain, general health perception and health change.
BMI was calculated from self-reported body weight and height (kg/m2).
Cognitive behavioral determinants were measured using variables that represent the I-Change Model [69-71]. Behavioral determinants were measured for each behavior, fruit and vegetable consumption separately, and included stages of change [103,104], attitudes [30], social influence [30], self-efficacy expectations [105], ability factors (i.e., action plans) [106], habit [107], and awareness based on self-rated behavior and the assessment of behavior by questionnaire [108,109]. These questions were also based on previous questionnaires (see references for each construct) as well as unpublished results of focus group interviews with people from the study population. The baseline questionnaire was piloted for comprehension and conceptual salience with representatives of the study population.
Socio-demographic variables
Socio-demographic variables that were measured included highest completed level of education, marital status, work situation, native country, presence of diabetes, smoking behavior [73,110], alcohol consumption [111], family history of cardiovascular disease, and stress [112]. In addition, the Physical Activity Readiness Questionnaire (PAR-Q [113]) was used to assess barriers to participation in physical activity, for example, chest pain during physical activity or bone or joint problems.
Gender, hypertension status and age were used as variables for selecting participants from the GP database and these data were provided by the GP only when participants agreed to participate. The other socio-demographic variables were measured at baseline; smoking behavior and alcohol consumption were also measured at both follow-ups (47 and 73 weeks after baseline).
Statistical analyses
Sample size and power
The required sample size was determined using the formula for unpaired t-tests [114], as each effect test in a balanced 2 × 2 between-subject design (i.e., the TMI and the TPC main effects and their interaction) comes down to such t-tests (apart from having less residual variance). The sample size calculation was based on the following assumptions: (a) since results of similar studies were not available at the start of Vitalum, the sample size calculation was based on a small expected effect size (Cohen's d) of .3 [115]; (b) a power of .9; (c) an alpha of .01 to correct for multiple testing; (d) an intra class correlation of .02, where the correlation is based on random treatment by GP interaction (a random GP main effect does not affect the sample size in the event of person randomizations within GPs) [116]; and (e) an expected average number of participants per general practice of 70. Loss of power due to random dropout or a gain in power from including the pretest as a covariate in the analyses [117] was not taken into account in the sample size calculation. However, the loss of power due to 20% random dropout can be compensated by including the pretest as a covariate if it correlates .5 with the posttest – the latter correlation being a realistic assumption. These assumptions resulted in a required sample size at baseline of 1,600. Thus, Vitalum aims to assess 400 participants per group at baseline. Assuming 50% of people refuse participation, and 40% of the remaining group meet the recommendations for PA and nutrition and are thus excluded, at least 5,400 people must be invited to secure 1,600 for the study.
Primary and secondary outcome analyses
Primary and secondary outcome measures will be used in the primary and secondary outcome analyses respectively. Vitalum's short-(week 47) and long-(week 73) term results will be analyzed with a 3-level multilevel mixed regression using Statistical Package for Social Sciences 15.0 (SPSS) and MLWiN. The three levels in the multilevel mixed regression were GPs, participants and measurements, given that participants are nested in GPs, and measurements (at baseline, 25, 47 and 73 weeks after baseline) are nested in participants. The quantitative dependent variables were the number of hours participants were moderately physically active per week, the number of days they engaged in moderate PA, the average daily intake of fruits, the average daily intake of vegetables, the number of days they consumed at least 2 pieces of fruit, the number of days participants consumed at least 200 g of vegetables, their total fat scores, BMIs, health-related quality of life and stage of change. The dichotomous dependent variables assessed whether participants met the public health guidelines measured with a combination of multiple items and one item, as described above. The independent variables were gender, education level, hypertension status, age, intervention group, behavioral determinants, whether they received a pedometer as a gift during the intervention period, batch number and region. Due to multiple testing, an alpha of .01 was used to evaluate results.
Process evaluation
The telephone survey at week 25 and the first follow-up also contained process questions that addressed the quality of the intervention delivery. For TPC, these questions measured, for example, participants' overall satisfaction with the letter, whether they had received and read the letter, and whether the letter was personal, comprehensible and interesting. For TMI, the questions measured, for example, overall satisfaction with the interview, whether the interviewer listened to and understood the participant, whether there was sufficient time to ask questions, and whether the interview was interesting. The competence of the motivational interviewers in MI use was also assessed with the MITI 3.0 and 1-PASS as described above.
Cost-effectiveness analysis
A cost-effectiveness analysis of Vitalum will be executed if the interventions are found to affect the primary outcome measures [118]. The cost-effectiveness analysis, executed from a healthcare viewpoint, examines the costs and effects of intervention implementation. Direct medical costs involved in carrying out the intervention (e.g., printing and mailing letters for TPC, call charges for TMI) are measured [118]. Other healthcare consumption costs are expected to be equal between the groups and are therefore not part of the analysis. Because Vitalum's goal was to examine the intervention's effectiveness, the developmental costs of the intervention are considered sunk costs and not included in the cost-effectiveness analysis. This also holds for protocol-driven costs (i.e., costs of data gathered as part of a clinical trial [118]); for example, the cost of recording the motivational interviews or that associated with measuring control group participants' behavior and its determinants. Direct non-medical costs (e.g., traveling costs, which were not applicable to Vitalum) and indirect non-medical costs (e.g., productivity costs) are irrelevant given the healthcare perspective chosen.
Since Vitalum may affect both health behavior and health-related quality of life, cost-effectiveness analyses will focus on both levels. To measure cost-effectiveness on a behavioral level, Vitalum's primary outcome measures will be combined into two overall outcome measures: the percentage of improvement in a participant's health behaviors compared to baseline measured using multiple-item measurements; and the number of public health guidelines met by a participant according to the combined measure (0–3: PA, fruit consumption and vegetable consumption). Intervention costs per patient who improved at least 10% of one health behavior as well as costs per patient who reached a specific number of public health guidelines will be examined. For health-related quality of life, the average improvement in quality of life score (Quality Adjusted Life Years) will be assessed by the RAND 36-item Health Survey 1.0 [101,102], and intervention costs per patient related to health-related quality of life score will be examined.
Discussion
This paper described the design of the Vitalum study. Vitalum aims to evaluate the efficacy of TMI and TPC in changing PA and fruit, vegetable and fat intake among Dutch adults aged 45 to 70. Its strengths are: (a) testing TPC and TMI for multiple behaviors; (b) evaluating TPC versus TMI and both versus TPC+TMI; (c) testing TPC and TMI for people with expected different motivational stages (e.g., participants with and without hypertension); and (d) testing TPC and TMI for people with different education levels.
Vitalum's development was accompanied by practical and operational difficulties. First, although the recruitment of participants via GPs resulted in the required number of participants, this method was time consuming and difficult for both researchers and GPs. GPs had to invest time by providing participant data and excluding certain people; yet, since GPs prioritize patient care and cure and not research, recruitment took more time than planned. Second, the data had to be collected and treated in batches. Combined with the recruitment delay this meant that 18 months lapsed between the enrollment and baseline data collection of the first and last groups. Third, questionnaires with many items were needed to measure and target multiple behaviors and their determinants [25]. This may have increased chances of dropout and invalid data due to participants becoming annoyed [119]. Furthermore, although telephone surveys were planned to reduce dropout risk, they appeared too restrictive and more expensive than paper questionnaires. Thus, paper questionnaires were used to collect baseline and posttest data. To reduce dropout risk, however, we used telephone surveys (at 25 and 39 weeks after baseline) instead of paper questionnaires to gather new data for the computer tailoring interventions. Moreover, although sometimes recommended, we could not use relatively objective reference instruments such as biomarkers for fruit and vegetable consumption [99,120] to validate the self-report questionnaires because they were considered too time consuming and expensive [67,95]. We thus used validated self-report questionnaires only [97,99,100]. Also, participants were more likely to suffer from hypertension than non-participants. This may be caused by selection bias, in that people with hypertension are more willing to participate than those without. This was confirmed by the fact that people who completed the baseline questionnaire were also more likely to suffer from hypertension than people who were excluded or refused to participate. However, this bias may also have been increased by including participants who failed to meet at least two guidelines, since high blood pressure is associated with lack of physical activity and low fruit and vegetable consumption [8]. In addition, the cost-effectiveness analysis does not meet the criteria of a full economic evaluation from a societal perspective; but the cost-effectiveness outcome is not the primary goal of our study. Finally, participants in the TPC group received stage-matched advice based on the stages of change algorithm of the Transtheoretical Model [72]. Although the usefulness and validity of stage models in nutrition and PA research has been criticized [105,121,122], their use in tailoring is still regarded promising [123].
Despite these difficulties, Vitalum aims to generate data on the efficacy of TPC and TMI in changing health behaviors. Its results will help policymakers decide which approach deserves future dissemination; the results on nutrition behavior and PA may also be of value in preventing other risk factors and diseases such as cancer or diabetes [1,7,8,124]. Vitalum's results are expected in July 2008.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
HMvK, IM and MA developed and executed the study. KR, MC, JB, GvB, WvM, HS, PJZ and HdV advised on its development and execution. HMvK, IM and MA significantly contributed to writing this paper, while KR, MC, JB, GvB, WvM, HS, PZ and HdV were involved in revising the manuscript. All authors have approved of the version to be published.
Appendix
Example of stage-matched tailored PA advice to a contemplator
What are your future plans?
The next part of the letter concerns the future. What plans do you have with regard to physical activity? Do you want to increase or maintain your activity level?
You mentioned in the questionnaire that you have plans to increase your physical activity level to 5 days a week for 30 minutes a day. You also indicated that you want to execute this plan within the next 6 months. This means that you seriously plan to change your activity level. The following information about the advantages of being more physically active may help you in your preparation.
You indicated in the questionnaire seven reasons why increasing your physical activity level would benefit you; that if you are physically active 5 days a week for 30 minutes a day:
- you will consider yourself a better person;
- you will consider yourself a 'sporty' person;
- you will be proud of yourself;
- you will feel younger;
- you may lose weight;
- you will decrease your chances of cardiovascular diseases;
- you will meet new people.
There are good reasons why increasing your level of physical activity is important: your health as well as your physical condition will improve. After 30 years, your muscle and bone strength declines. This is a natural process, but is substantially delayed by being physically active. This means you will be less likely experience bone fractures and will stay lithe.
Other advantages: being physically active positively affects your metabolism and bowel movement, and your risk for cardiovascular diseases and some types of cancer decreases. People who increase their level of physical activity consider themselves better people, are proud of themselves, and feel younger and sportier.
Finally, increasing your physical activity level is also good for your appearance and social contacts. Your chances of meeting people when out walking is higher than when watching a quiz show on television!
You also mentioned two disadvantages of increasing your physical activity level. You indicated that, if you are physically active on at least 5 days a week for 30 minutes a day:
- You run the risk of an injury. If you decide to increase your physical activity level, we recommend that you start easily. Take a break when you become tired – it is not a competition. It is also important that you wear good, solid shoes for walking.
- You will sweat. If you increase your physical activity level, your muscles produce more warmth. This warmth has to be lost to prevent your body temperature getting too high. Fortunately, you lose warmth by sweating; therefore, sweating is absolutely necessary to maintain a healthy body temperature. We recommend that you wear clothes with good ventilation when you exercise.
We hope that reading about the positive and possible negative sides of physical activity has reinforced your plans to increase your activity level in the next six months. We conclude this letter with advice that may help you achieve your goal.
First, it is important to choose the type of physical activity that suits you. We asked you in the questionnaire how you might increase your physical activity level. You indicated that:
- You want to use your car less. We often take the car without thinking, for example, to go shopping or to work, though these distances may also be easily walked or cycled.
- You want to take a fast or brisk walk each day. This is a very good idea. If you try to walk at a fixed time each day, this increases the chance that it will become a regular part of your day. By doing this, you can make physical activity a healthy habit.
- You want to be more physically active in your spare time. You may probably have some ideas about this. What one person likes, another might find boring or annoying. This also goes for physical activity. It is therefore important that you choose a type of activity that suits you; otherwise, the chance increases that it will not get past the planning stage, or that you will quit.
Acknowledgements
This study was funded by The Netherlands Organization for Health Research and Development (ZonMw, 22000120).
Vitalum was based on previous studies:
- Computer Tailored Lifestyle Education by Smeets, T., Brug, H. & de Vries, H. (ZonMw, 22000049);
- Computer Tailored Nutrition Education by Brug, H., van Assema, P., de Vries, H. & Kok, G. (Dutch Cancer Society);
- Promoting Awareness of Fat, Fruit and Vegetable Intake by Oenema, A. & Brug, H. (ZonMw, 21000001);
- Healthy Body Healthy Spirit by Resnicow, K. (National Heart, Lung, and Blood Institute, HL64959);
- North Carolina Strategies to Improve Diet, Exercise, and Screening Study (NC STRIDES) by Campbell, M.K. & Resnicow, K (National Cancer Institute).
The authors would like to thank:
- the Registry Network of GPs (Registratienetwerk Huisartspraktijken; RNH) and the Coordination Institute of Primary Care (Coördinatiebureau Eerstelijn; CEL) of the Department of General Practice at Maastricht University in the recruitment of GPs;
- the GPs in the recruitment of participants;
- the motivational interviewers for carrying out the interviews;
- the participants for taking part in Vitalum;
- the MEMIC centre for data and information management, for the data entry;
- DD&H Digital Communication for hosting the computer tailoring program.
References
1. WHO: Diet, nutrition and the prevention of chronic diseases. In WHO technical report series. Geneva , WHO; 2003:149.
2. Hyson D: The health benefits of fruits and vegetables. A scientific overview for health professionals. Willington , Produce for Better Health Foundation; 2002.
3. Nederlands Huisartsen Genootschap: NGH-Standaard cardiovasculair risicomanagement M84 [Dutch College of General Practitioners (NGH)-Guidelines cardiovascular riskmanagement M84].
2006, 1-26.
4. Graham I, Atar D, Borch-Johnsen K, Boysen G, Burell G, Cifkova R, Dallongeville J, De Backer G, Ebrahim S, Gjelsvik B, Herrmann-Lingen C, Hoes A, Humphries S, Knapton M, Perk J, Priori SG, Pyorala K, Reiner Z, Ruilope L, Sans-Menendez S, Op Reimer WS, Weissberg P, Wood D, Yarnell J, Zamorano JL, Walma E, Fitzgerald T, Cooney MT, Dudina A, Vahanian A, Camm J, De Caterina R, Dean V, Dickstein K, Funck-Brentano C, Filippatos G, Hellemans I, Kristensen SD, McGregor K, Sechtem U, Silber S, Tendera M, Widimsky P, Zamorano JL, Altiner A, Bonora E, Durrington PN, Fagard R, Giampaoli S, Hemingway H, Hakansson J, Kjeldsen SE, Larsen ML, Mancia G, Manolis AJ, Orth-Gomer K, Pedersen T, Rayner M, Ryden L, Sammut M, Schneiderman N, Stalenhoef AF, Tokgozoglu L, Wiklund O, Zampelas A: European guidelines on cardiovascular disease prevention in clinical practice: executive summary. Fourth Joint Task Force of the European Society of Cardiology and other societies on cardiovascular disease prevention in clinical practice (constituted by representatives of nine societies and by invited experts).
Eur J Cardiovasc Prev Rehabil 2007, 14 Suppl 2:E1-40. PubMed Abstract | Publisher Full Text
5. Lewington S, Clarke R, Qizilbash N, Peto R, Collins R: Age-specific relevance of usual blood pressure to vascular mortality: a meta-analysis of individual data for one million adults in 61 prospective studies.
Lancet 2002, 360(9349):1903-1913. PubMed Abstract | Publisher Full Text
6. Jansen M, Van de Vijver L: Fruit and vegetables in chronic disease prevention. Second update. Zoetermeer , Holland Produce Promotion; 2004.
7. USDHHS: Physical activity and health: A report of the surgeon general. Department of Health and Human Services, Centers for Disease Control and Prevention, National Center for Chronic Disease Prevention and Health Promotion, Atlanta; 1996.
8. WHO: The World Health Report 2002. Reducing risks, promoting healthy life. Geneva, WHO; 2002:248.
9. Hu FB, Stampfer MJ, Manson JE, Rimm E, Colditz GA, Rosner BA, Hennekens CH, Willett WC: Dietary fat intake and the risk of coronary heart disease in women.
N Engl J Med 1997, 337(21):1491-1499. PubMed Abstract | Publisher Full Text
10. Gezondheidsraad: Richtlijnen goede voeding 2006 - achtergronddocument [Guidelines for good nutrition 2006 - background document]. Den Haag, Gezondheidsraad; 2006.
11. Kemper HGC, Ooijendijk WTM, Stiggelbout M: Consensus over de Nederlandse norm gezond bewegen [Consensus about the Dutch recommendation for physical activity to promote health].
TSG 2000, 78:180-183.
12. Krebs-Smith SM, Kantor LS: Choose a variety of fruits and vegetables daily: understanding the complexities.
J Nutr 2001, 131(2S-1):487S-501S. PubMed Abstract | Publisher Full Text
13. Pate RR, Pratt M, Blair SN, Haskell WL, Macera CA, Bouchard C, Buchner D, Ettinger W, Heath GW, King AC, et al.: Physical activity and public health. A recommendation from the Centers for Disease Control and Prevention and the American College of Sports Medicine.
Jama 1995, 273(5):402-407. PubMed Abstract | Publisher Full Text
14. USDHHSA: Nutrition and your health: dietary guidelines for American. 2005 Dietary guidelines advisory committee report. Department of Health and Human Services and Agriculture; 2005.
15. Health Council of the Netherlands: Dietary reference intakes: energy, proteins, fats, and digestible carbohydrates. Den Haag, Health Council of the Netherlands; 2001.
16. Berrigan D, Dodd K, Troiano RP, Krebs-Smith SM, Barbash RB: Patterns of health behavior in U.S. adults.
Prev Med 2003, 36(5):615-623. PubMed Abstract | Publisher Full Text
17. Fine LJ, Philogene GS, Gramling R, Coups EJ, Sinha S: Prevalence of multiple chronic disease risk factors. 2001 National Health Interview Survey.
Am J Prev Med 2004, 27(2 Suppl):18-24. PubMed Abstract | Publisher Full Text
18. Ford ES, Ford MA, Will JC, Galuska DA, Ballew C: Achieving a healthy lifestyle among United States adults: a long way to go.
Ethn Dis 2001, 11(2):224-231. PubMed Abstract
19. Miller RR, Sales AE, Kopjar B, Fihn SD, Bryson CL: Adherence to heart-healthy behaviors in a sample of the U.S. population.
Prev Chronic Dis 2005, 2(2):A18. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
20. Pronk NP, Anderson LH, Crain AL, Martinson BC, O'Connor PJ, Sherwood NE, Whitebird RR: Meeting recommendations for multiple healthy lifestyle factors. Prevalence, clustering, and predictors among adolescent, adult, and senior health plan members.
Am J Prev Med 2004, 27(2 Suppl):25-33. PubMed Abstract | Publisher Full Text
21. Reeves MJ, Rafferty AP: Healthy lifestyle characteristics among adults in the United States, 2000.
Arch Intern Med 2005, 165(8):854-857. PubMed Abstract | Publisher Full Text
22. Schuit AJ, van Loon AJ, Tijhuis M, Ocke M: Clustering of lifestyle risk factors in a general adult population.
Prev Med 2002, 35(3):219-224. PubMed Abstract | Publisher Full Text
23. De Vries H, Kremers S, Smeets T, Reubseat A: Clustering of diet, physical activity and smoking and a general willingness to change.
Psychol Health 2007, 1-14.
24. Kreuter MW, Skinner CS: Tailoring: what's in a name?
Health Educ Res 2000, 15(1):1-4. PubMed Abstract | Publisher Full Text
25. Brug J, Oenema A, Campbell M: Past, present, and future of computer-tailored nutrition education.
Am J Clin Nutr 2003, 77(4 Suppl):1028S-1034S. PubMed Abstract | Publisher Full Text
26. Campbell MK, James A, Hudson MA, Carr C, Jackson E, Oakes V, Demissie S, Farrell D, Tessaro I: Improving multiple behaviors for colorectal cancer prevention among African American church members.
Health Psychol 2004, 23(5):492-502. PubMed Abstract | Publisher Full Text
27. Marcus BH, Bock BC, Pinto BM, Forsyth LH, Roberts MB, Traficante RM: Efficacy of an individualized, motivationally-tailored physical activity intervention.
Ann Behav Med 1998, 20(3):174-180. PubMed Abstract | Publisher Full Text
28. Vandelanotte C, De Bourdeaudhuij I, Sallis JF, Spittaels H, Brug J: Efficacy of sequential or simultaneous interactive computer-tailored interventions for increasing physical activity and decreasing fat intake.
Ann Behav Med 2005, 29(2):138-146. PubMed Abstract | Publisher Full Text
29. Spittaels H, De Bourdeaudhuij I, Vandelanotte C: Evaluation of a website-delivered computer-tailored intervention for increasing physical activity in the general population.
Prev Med 2007, 44(3):209-217. PubMed Abstract | Publisher Full Text
30. Smeets T, Brug J, de Vries H: Effects of tailoring health messages on physical activity.
Health Educ Res 2008, 23(3):402-413. PubMed Abstract | Publisher Full Text
31. Anderson ES, Winett RA, Wojcik JR, Winett SG, Bowden T: A computerized social cognitive intervention for nutrition behavior: direct and mediated effects on fat, fiber, fruits, and vegetables, self-efficacy, and outcome expectations among food shoppers.
Ann Behav Med 2001, 23(2):88-100. PubMed Abstract | Publisher Full Text
32. Baker AH, Wardle J: Increasing fruit and vegetable intake among adults attending colorectal cancer screening: the efficacy of a brief tailored intervention.
Cancer Epidemiol Biomarkers Prev 2002, 11(2):203-206. PubMed Abstract | Publisher Full Text
33. Brug J, Glanz K, Van Assema P, Kok G, van Breukelen GJ: The impact of computer-tailored feedback and iterative feedback on fat, fruit, and vegetable intake.
Health Educ Behav 1998, 25(4):517-531. PubMed Abstract | Publisher Full Text
34. Campbell MK, Bernhardt JM, Waldmiller M, Jackson B, Potenziani D, Weathers B, Demissie S: Varying the message source in computer-tailored nutrition education.
Patient Educ Couns 1999, 36(2):157-169. PubMed Abstract | Publisher Full Text
35. Irvine AB, Ary DV, Grove DA, Gilfillan-Morton L: The effectiveness of an interactive multimedia program to influence eating habits.
Health Educ Res 2004, 19(3):290-305. PubMed Abstract | Publisher Full Text
36. Lutz SF, Ammerman AS, Atwood JR, Campbell MK, DeVellis RF, Rosamond WD: Innovative newsletter interventions improve fruit and vegetable consumption in healthy adults.
J Am Diet Assoc 1999, 99(6):705-709. PubMed Abstract | Publisher Full Text
37. Oenema A, Tan F, Brug J: Short-term efficacy of a web-based computer-tailored nutrition intervention: main effects and mediators.
Ann Behav Med 2005, 29(1):54-63. PubMed Abstract | Publisher Full Text
38. Winett RA, Anderson ES, Bickley PG, Walberg-Rankin J, Moore JF, Leahy M, Harris CE, Gerkin RE: Nutrition for a lifetime system: a multimedia system for altering food supermarket shoppers' purchases to meet nutritional guidelines.
Computers in Human Behavior 1997, 13(3):371-392. Publisher Full Text
39. Campbell MK, DeVellis BM, Strecher VJ, Ammerman AS, DeVellis RF, Sandler RS: Improving dietary behavior: the effectiveness of tailored messages in primary care settings.
Am J Public Health 1994, 84(5):783-787. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
40. De Bourdeaudhuij I, Brug J: Tailoring dietary feedback to reduce fat intake: an intervention at the family level.
Health Educ Res 2000, 15(4):449-462. PubMed Abstract | Publisher Full Text
41. Kroeze W, Werkman A, Brug J: A systematic review of randomized trials on the effectiveness of computer-tailored education on physical activity and dietary behaviors.
Ann Behav Med 2006, 31(3):205-223. PubMed Abstract | Publisher Full Text
42. Miller WR, Rollnick S: Motivational Interviewing: Preparing People for Change. Second edition. New York, The Guilford Press; 2002.
43. Sims J, Smith F, Duffy A, Hilton S: Can practice nurses increase physical activity in the over 65s? Methodological considerations from a pilot study.
Br J Gen Pract 1998, 48(430):1249-1250. PubMed Abstract | PubMed Central Full Text
44. Harland J, White M, Drinkwater C, Chinn D, Farr L, Howel D: The Newcastle exercise project: a randomised controlled trial of methods to promote physical activity in primary care.
Bmj 1999, 319(7213):828-832. PubMed Abstract | PubMed Central Full Text
45. Carels RA, Darby L, Cacciapaglia HM, Konrad K, Coit C, Harper J, Kaplar ME, Young K, Baylen CA, Versland A: Using motivational interviewing as a supplement to obesity treatment: a stepped-care approach.
Health Psychol 2007, 26(3):369-374. PubMed Abstract | Publisher Full Text
46. Resnicow K, Campbell MK, Carr C, McCarty F, Wang T, Periasamy S, Rahotep S, Doyle C, Williams A, Stables G: Body and soul. A dietary intervention conducted through African-American churches.
Am J Prev Med 2004, 27(2):97-105. PubMed Abstract | Publisher Full Text
47. Resnicow K, Jackson A, Blissett D, Wang T, McCarty F, Rahotep S, Periasamy S: Results of the healthy body healthy spirit trial.
Health Psychol 2005, 24(4):339-348. PubMed Abstract | Publisher Full Text
48. Resnicow K, Jackson A, Wang T, De AK, McCarty F, Dudley WN, Baranowski T: A motivational interviewing intervention to increase fruit and vegetable intake through Black churches: results of the Eat for Life trial.
Am J Public Health 2001, 91(10):1686-1693. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
49. Mhurchu CN, Margetts BM, Speller V: Randomized clinical trial comparing the effectiveness of two dietary interventions for patients with hyperlipidaemia.
Clin Sci (Lond) 1998, 95(4):479-487. PubMed Abstract | Publisher Full Text
50. Brug J, Spikmans F, Aartsen C, Breedveld B, Bes R, Fereira I: Training dietitians in basic motivational interviewing skills results in changes in their counseling style and in lower saturated fat intakes in their patients.
J Nutr Educ Behav 2007, 39(1):8-12. PubMed Abstract | Publisher Full Text
51. Kreuter MW, Bull FC, Clark EM, Oswald DL: Understanding how people process health information: a comparison of tailored and nontailored weight-loss materials.
Health Psychol 1999, 18(5):487-494. PubMed Abstract | Publisher Full Text
52. James AS, Campbell MK, DeVellis B, Reedy J, Carr C, Sandler RS: Health behavior correlates among colon cancer survivors: NC STRIDES baseline results.
Am J Health Behav 2006, 30(6):720-730. PubMed Abstract | Publisher Full Text
53. Campbell MK, Quintiliani LM: Tailored interventions in public health: where does tailoring fit in Interventions to reduce health disparities?
Am Behav Sci 2006, 49(6):775-793. Publisher Full Text
54. Reedy J, Haines PS, Campbell MK: The influence of health behavior clusters on dietary change.
Prev Med 2005, 41(1):268-275. PubMed Abstract | Publisher Full Text
55. Mackenbach JP, Bos V, Andersen O, Cardano M, Costa G, Harding S, Reid A, Hemstrom O, Valkonen T, Kunst AE: Widening socioeconomic inequalities in mortality in six Western European countries.
Int J Epidemiol 2003, 32(5):830-837. PubMed Abstract | Publisher Full Text
56. James WP, Nelson M, Ralph A, Leather S: Socioeconomic determinants of health. The contribution of nutrition to inequalities in health.
Bmj 1997, 314(7093):1545-1549. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
57. Droomers M, Schrijvers CT, van de Mheen H, Mackenbach JP: Educational differences in leisure-time physical inactivity: a descriptive and explanatory study.
Soc Sci Med 1998, 47(11):1665-1676. PubMed Abstract | Publisher Full Text
58. Eurostat: People by age classes. Share of total population (%). [http:/ / epp.eurostat.ec.europa.eu/ portal/ page?_pageid=1996,39140985&_dad=por tal&_schema=PORTAL&screen=detailref &language=en&product=Yearlies_new_p opulation&root=Yearlies_new_populat ion/ C/ C1/ C11/ caa15632] webcite
59. Eurostat: Projected old-age-dependency ratio. [http:/ / epp.eurostat.ec.europa.eu/ portal/ page?_pageid=1996,39140985&_dad=por tal&_schema=PORTAL&screen=detailref &language=en&product=REF_SD_DE&root =REF_SD_DE/ sd_de/ sd_de_cxt/ tsdde511] webcite
60. American College of Sports Medicine Position Stand. Exercise and physical activity for older adults
Med Sci Sports Exerc 1998, 30(6):992-1008. PubMed Abstract | Publisher Full Text
61. Hoeymans N, Hoogenveen RT, Poos MJJC: Ziektelast in DALY's. Oorzaken en gevolgen [Burden of disease in DALY's. Cause and effect]. [http://www.rivm.nl/vtv/object_document/o2879n18840.html] webcite
62. Metsemakers JF, Hoppener P, Knottnerus JA, Kocken RJ, Limonard CB: Computerized health information in the Netherlands: a registration network of family practices.
Br J Gen Pract 1992, 42(356):102-106. PubMed Abstract | PubMed Central Full Text
63. Van den Akker M, Metsemakers JF, Limonard CB, Knottnerus JA: General Practice: a gold mine for research. Data and scientific use of the Registration Network Family Practices. Maastricht, Unigraphic; 2004.
64. Lamberts H, Wood M: ICPC International Classification of Primary Care. Oxford, Oxford University Press; 1987.
65. Walma EP, Thomas S, Prins A, Grundmeyer HGLM, Van der Laan JR, Wiersma T: NHG - Standaard hypertensie (derde herziening) [Dutch College of General Practitioners (NHG) - Guidelines for hypertension (third revision)].
Huisarts Wet 2003, 46:435-449.
66. Voedingscentrum: Zo eet Nederland 1998. Resultaten van de Voedselconsumptiepeiling 1998 [How the Dutch eat 1998. Results of the food consumption measurement 1998]. Den Haag, Voedingscentrum; 1998.
67. Welk GJ: Physical activity assessments for health-related research. Champaign, Human Kinetics; 2002.
68. Smeets T, Kremers SP, de Vries H, Brug J: Effects of tailored feedback on multiple health behaviors.
Ann Behav Med 2007, 33(2):117-123. PubMed Abstract | Publisher Full Text
69. De Vries H, Lezwijn J, Hol M, Honing C: Skin cancer prevention: behaviour and motives of Dutch adolescents.
Eur J Cancer Prev 2005, 14(1):39-50. PubMed Abstract | Publisher Full Text
70. De Vries H, Mesters I, van de Steeg H, Honing C: The general public's information needs and perceptions regarding hereditary cancer: an application of the Integrated Change Model.
Patient Educ Couns 2005, 56(2):154-165. PubMed Abstract | Publisher Full Text
71. De Vries H, Mudde A, Leijs I, Charlton A, Vartiainen E, Buijs G, Clemente MP, Storm H, Gonzalez Navarro A, Nebot M, Prins T, Kremers S: The European Smoking Prevention Framework Approach (EFSA): an example of integral prevention.
Health Educ Res 2003, 18(5):611-626. PubMed Abstract | Publisher Full Text
72. Prochaska JO, DiClemente CC, Norcross JC: In search of how people change. Applications to addictive behaviors.
Am Psychol 1992, 47(9):1102-1114. PubMed Abstract | Publisher Full Text
73. De Vries H, Mudde AN, Dijkstra A, Willemsen MC: Differential beliefs, perceived social influences, and self-efficacy expectations among smokers in various motivational phases.
Prev Med 1998, 27(5 Pt 1):681-689. PubMed Abstract | Publisher Full Text
74. Maibach E, Cotton EW: Moving people to behavior change: A staged social cognitive approach in message design. In Designing Health Messages. Edited by Maibach E, Parrott RL. Thousand Oaks, CA, Sage Publications; 1995:41-64.
75. Carver CS, Scheier MF: Attention and self-regulation: a control-theory approach to human behavior. New York , Springer Verlag; 1981.
76. Resnicow K: 1-PASS coding system for motivational interviewing: introduction and scoring. Atlanta , Rollins School of Public Health, Emory University; 2002:1-7.
77. Resnicow K, Jackson A, Braithwaite R, DiIorio C, Blisset D, Rahotep S, Periasamy S: Healthy Body/Healthy Spirit: a church-based nutrition and physical activity intervention.
Health Educ Res 2002, 17(5):562-573. PubMed Abstract | Publisher Full Text
78. Rollnick S, Butler CC, Stott N: Helping smokers make decisions: the enhancement of brief intervention for general medical practice.
Patient Educ Couns 1997, 31(3):191-203. PubMed Abstract | Publisher Full Text
79. Moyers TB, Martin T, Manuel JK, Hendrickson SM, Miller WR: Assessing competence in the use of motivational interviewing.
J Subst Abuse Treat 2005, 28(1):19-26. PubMed Abstract | Publisher Full Text
80. Moyers TB, Martin T, Manual JK, Miller WR, Ernst D: Revised Global Scales: Motivational Interviewing Treatment Integrity 3.0 (MITI 3.0). University of New Mexico, Center on Alcoholism, Substance Abuse and Addictions (CASAA); 2007:28.
81. Moyers TB, Martin T, Manual JK, Miller WR: The Motivational Interviewing Treatment Integrity (MITI) Code: Version 2.0. Volume 2007. University of New Mexico, Center on Alcoholism, Substance Abuse and Addictions (CASAA); 2003:19.
82. Rogers RW: A protection motivation theory of fear appeals and attitude change.
J Psychol 1975, 91:93-114.
83. Rogers RW: Cognitive and physiological processes in fear appeals and attitude change: a revised theory of protection motivation. In Social psychophysiology: a source book. Edited by Cacioppo JT, Petty RE. New York , Guilford Press; 1983:153-176.
84. Butler C, Rollnick S, Cohen D, Bachman M, Russell I, Stott N: Motivational consulting versus brief advice for smokers in general practice: a randomized trial.
British Journal of General Practice 1999, 49:611-616.
85. Heather N, Rollnick S, Bell A, Richmond R: Effects of brief counselling among male heavy drinkers identified on general hospital wards.
Drug Alcohol Rev 1996, 15(1):29-38. PubMed Abstract | Publisher Full Text
86. Amanatidis S, Mackerras D, Simpson JM: Comparison of two frequency questionnaires for quantifying fruit and vegetable intake.
Public Health Nutr 2001, 4(2):233-239. PubMed Abstract | Publisher Full Text
87. Block G, Woods M, Potosky A, Clifford C: Validation of a self-administered diet history questionnaire using multiple diet records.
J Clin Epidemiol 1990, 43(12):1327-1335. PubMed Abstract | Publisher Full Text
88. Bogers RP, Dagnelie PC, Westerterp KR, Kester AD, van Klaveren JD, Bast A, van den Brandt PA: Using a correction factor to correct for overreporting in a food-frequency questionnaire does not improve biomarker-assessed validity of estimates for fruit and vegetable consumption.
J Nutr 2003, 133(4):1213-1219. PubMed Abstract | Publisher Full Text
89. Kristal AR, Vizenor NC, Patterson RE, Neuhouser ML, Shattuck AL, McLerran D: Precision and bias of food frequency-based measures of fruit and vegetable intakes.
Cancer Epidemiol Biomarkers Prev 2000, 9(9):939-944. PubMed Abstract | Publisher Full Text
90. Sallis JF, Saelens BE: Assessment of physical activity by self-report: status, limitations, and future directions.
Res Q Exerc Sport 2000, 71(2 Suppl):S1-14. PubMed Abstract
91. Serdula M, Byers T, Coates R, Mokdad A, Simoes EJ, Eldridge L: Assessing consumption of high-fat foods: the effect of grouping foods into single questions.
Epidemiology 1992, 3(6):503-508. PubMed Abstract | Publisher Full Text
92. Subar AF, Heimendinger J, Patterson BH, Krebs-Smith SM, Pivonka E, Kessler R: Fruit and vegetable intake in the United States: the baseline survey of the Five A Day for Better Health Program.
Am J Health Promot 1995, 9(5):352-360. PubMed Abstract
93. Tjonneland A, Overvad K, Haraldsdottir J, Bang S, Ewertz M, Jensen OM: Validation of a semiquantitative food frequency questionnaire developed in Denmark.
Int J Epidemiol 1991, 20(4):906-912. PubMed Abstract | Publisher Full Text
94. Urlings IJM, Douwes M, Hildebrandt VH, Stiggelbout M, Ooijendijk WTM: Relatieve validiteit van een vragenlijst naar lichamelijke activiteit volgens de 'beweegnorm' [Relative validity of a questionnaire to measure physical activity according to the ‘physical activity recommendation’].
Geneesk Sport 2000, 33(4):17-22.
95. Van Assema P, Brug J, Ronda G, Steenhuis I, Oenema A: A short Dutch questionnaire to measure fruit and vegetable intake: relative validity among adults and adolescents.
Nutr Health 2002, 16(2):85-106. PubMed Abstract
96. Wendel-Vos GC, Schuit AJ, Saris WH, Kromhout D: Reproducibility and relative validity of the short questionnaire to assess health-enhancing physical activity.
J Clin Epidemiol 2003, 56(12):1163-1169. PubMed Abstract | Publisher Full Text
97. Resnicow K, McCarty F, Blissett D, Wang T, Heitzler C, Lee RE: Validity of a modified CHAMPS physical activity questionnaire among African-Americans.
Med Sci Sports Exerc 2003, 35(9):1537-1545. PubMed Abstract | Publisher Full Text
98. Ainsworth BE, Haskell WL, Whitt MC, Irwin ML, Swartz AM, Strath SJ, O'Brien WL, Bassett DR Jr., Schmitz KH, Emplaincourt PO, Jacobs DR Jr., Leon AS: Compendium of physical activities: an update of activity codes and MET intensities.
Med Sci Sports Exerc 2000, 32(9 Suppl):S498-504. PubMed Abstract | Publisher Full Text
99. Bogers RP, Van Assema P, Kester AD, Westerterp KR, Dagnelie PC: Reproducibility, validity, and responsiveness to change of a short questionnaire for measuring fruit and vegetable intake.
Am J Epidemiol 2004, 159(9):900-909. PubMed Abstract | Publisher Full Text
100. Van Assema P, Brug J, Ronda G, Steenhuis I: The relative validity of a short Dutch questionnaire as a means to categorize adults and adolescents to total and saturated fat intake.
J Hum Nutr Diet 2001, 14(5):377-390. PubMed Abstract | Publisher Full Text
101. Brazier JE, Harper R, Jones NM, O'Cathain A, Thomas KJ, Usherwood T, Westlake L: Validating the SF-36 health survey questionnaire: new outcome measure for primary care.
Bmj 1992, 305(6846):160-164. PubMed Abstract | PubMed Central Full Text
102. Van der Zee KI, Sanderman R: Het meten van de algemene gezondheidstoestand met de RAND-36. Een handleiding [Measuring general health with the RAND-36. A manual]. Groningen , Noordelijk Centrum voor Gezondheidsvraagstukken. Rijksuniversiteit Groningen; 1993:1-28.
103. Armitage CJ, Arden MA: Exploring discontinuity patterns in the transtheoretical model: An application of the theory of planned behaviour.
Br J Health Psychol 2002, 7(Pt 1):89-103. PubMed Abstract | Publisher Full Text
104. Laforge RG, Velicer WF, Richmond RL, Owen N: Stage distributions for five health behaviors in the United States and Australia.
Prev Med 1999, 28(1):61-74. PubMed Abstract | Publisher Full Text
105. de Vet E, de Nooijer J, de Vries NK, Brug J: Determinants of forward stage transition from precontemplation and contemplation for fruit consumption.
Am J Health Promot 2005, 19(4):278-285. PubMed Abstract
106. De Vries H, Kremers S, Smeets T, Brug J, Eijmael K: The effectiveness of tailored feedback and action plans in an intervention addressing multiple health behaviors.
Am J Health Promot, in press.
107. Verplanken B, Orbell S: Reflections on past behavior: a self-report index of habit strength.
Journal of Applied Social Psychology 2003, 33(6):1313-1330. Publisher Full Text
108. Brug J, Van Assema P, Kok G, Lendering T, Glanz K: Self-rated dietary fat intake: association with objective assessment of fat, psychosocial factors, and intention to change.
J Nutr Educ 1994, 26(5):218-223.
109. Ronda G, Van Assema P, Brug J: Stages of change, psychological factors and awareness of physical activity levels in The Netherlands.
Health Promot Int 2001, 16(4):305-314. PubMed Abstract | Publisher Full Text
110. Mudde AN, Willemsen MC, Kremers S, Vries H: Meetinstrumenten voor onderzoek voor roken en stoppen met roken [Measures for research with regard to smoking behavior or smoking cessation]. Den Haag , Stivoro; 2000.
111. Lemmens P, Tan ES, Knibbe RA: Measuring quantity and frequency of drinking in a general population survey: a comparison of five indices.
J Stud Alcohol 1992, 53(5):476-486. PubMed Abstract
112. Corbin CB, Welk GJ, Corbin WR, Welk KA: Concepts of Physical Fitness. Active Lifestyles for Wellness. 12th edition. New York , McGraw-Hill; 2004.
113. Thomas S, Reading J, Shephard RJ: Revision of the Physical Activity Readiness Questionnaire (PAR-Q).
Can J Sport Sci 1992, 17(4):338-345. PubMed Abstract
114. Kirkwood BR: Essentials of medical statistics. Oxford, Blackwell Scientific Publications; 1988:234.
115. Cohen J: Statistical power analysis for the behavioral sciences. 2nd edition. Hillsdale, NJ, Lawrence Erlbaum; 1988.
116. Moerbeek M, van Breukelen GJ, Berger MP: A comparison between traditional methods and multilevel regression for the analysis of multicenter intervention studies.
J Clin Epidemiol 2003, 56(4):341-350. PubMed Abstract | Publisher Full Text
117. Senn SJ: The use of baselines in clinical trials of bronchodilators.
Stat Med 1989, 8(11):1339-1350. PubMed Abstract | Publisher Full Text
118. Drummond MF, O'Brien BJ, Stoddard GL, Torrance GW: Methods for the Economic Evaluation of Health Care Programmes. Second edition. New York, Oxford University Press; 1997.
119. Kremers SP, Visscher TL, Seidell JC, van Mechelen W, Brug J: Cognitive determinants of energy balance-related behaviours: measurement issues.
Sports Med 2005, 35(11):923-933. PubMed Abstract | Publisher Full Text
120. Resnicow K, Odom E, Wang T, Dudley WN, Mitchell D, Vaughan R, Jackson A, Baranowski T: Validation of three food frequency questionnaires and 24-hour recalls with serum carotenoid levels in a sample of African-American adults.
Am J Epidemiol 2000, 152(11):1072-1080. PubMed Abstract | Publisher Full Text
121. Adams J, White M: Why don't stage-based activity promotion interventions work?
Health Educ Res 2005, 20(2):237-243. PubMed Abstract | Publisher Full Text
122. De Vet E, de Nooijer J, de Vries NK, Brug J: The Transtheoretical model for fruit, vegetable and fish consumption: associations between intakes, stages of change and stage transition determinants.
Int J Behav Nutr Phys Act 2006, 3:13. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
123. Brug J, Conner M, Harre N, Kremers S, McKellar S, Whitelaw S: The Transtheoretical Model and stages of change: a critique: observations by five commentators on the paper by Adams, J. and White, M. (2004) why don't stage-based activity promotion interventions work?
Health Educ Res 2005, 20(2):244-258. PubMed Abstract | Publisher Full Text
124. World Cancer Research Fund: Food, nutrition and the prevention of cancer: A global perspective. Washington, World Cancer Research Fund and American Institute for Cancer Research; 1997.
125. European Commission: Task force on core social variables. Final report. Luxembourg, Office for Official Publications of the European Communities; 2007:127.
126. Ministerie van Onderwijs Cultuur en Wetenschappen: Onderwijsprofiel van Nederland [Education profile of the Netherlands]. Den Haag, Ministerie van Onderwijs, Cultuur en Wetenschappen; 2003:20.
127. United Nations Educational Scientific and Cultural Organization: International Standard Classification of Education, ISCED 1997. Paris, United Nations Educational Scientific and Cultural Organization (UNESCO); 1997:42.
Pre-publication history
The pre-publication history for this paper can be accessed here:
http://www.biomedcentral.com/1471-2458/8/216/prepub
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:14:19.000Z
|
aaafbwexojuhfcqzqo6njvqt4cy6sm5l
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5491",
"uncompressed_offset": 383925883,
"url": "www.crummy.com/2005/6/9",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.crummy.com/2005/6/9"
}
|
cccc_CC-MAIN-2013-20
|
<D <M <Y
Y> M> D>
: Remember the Game Roundup about a year ago where I gushed about a game called Metal Blob Solid? Well, the game is now complete, and there's a postmortem along with postmortems of the designers' other games. I've always loved game postmortems, especially for open source games.
[Main]
Unless otherwise noted, all content licensed by Leonard Richardson
under a Creative Commons License.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:09:45.000Z
|
y3jjvt3hkdgxl3iqkwndxj34fj4fcxk4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5497",
"uncompressed_offset": 416030035,
"url": "www.elinux.org/index.php?diff=119294&oldid=117500&title=Flameman%2Farticle",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.elinux.org/index.php?title=Flameman/article&diff=119294&oldid=117500"
}
|
cccc_CC-MAIN-2013-20
|
Difference between revisions of "Flameman/article"
From eLinux.org
Jump to: navigation, search
(Orphaned pages)
(linux programming interfaces)
Line 112: Line 112:
You can find a [http://lwn.net/Articles/423417/ Review] at LWN.net
You can find a [http://lwn.net/Articles/423417/ Review] at LWN.net
[http://man7.org/tlpi/ Book's Homepage]
+
[http://man7.org/tlpi/ Book's Homepage]
+
== Apple OpenFirmware ==
+
+
[[Flameman/openfirmware-apple]]
== who are Flameman and Legacy ? ==
== who are Flameman and Legacy ? ==
Revision as of 19:32, 18 April 2012
For more interesting projects done by Flameman, be sure to checkout his project index
Contents
Flameman & legacy's articles
who (and why to) runs projects like these ?
an interesting article http://lwn.net/Articles/222773/
ipaq -> openmoko alternative, see http://openpandora.org/index.php
using videoram as swap
Graphic cards contain a lot of very fast RAM, typically between 64 and 512 MB. it's possible to use it as swap space, or even as RAM disk.
using gcc
a brief about PowerPC
cross compiling
using qemu
using qemu/freedos
http://www.fdos.info/bootdisks/
what is an OS ?
article idea (early proof version)
flameman/os
using gcc
tini java embedded processor, written in VHDL
bus
using git
uclibc
linux.2.4 internal
what is the book of the day ?
-> Flameman/books
proof
-> Flameman/proof
opencores
-> [[1]]
OE/bitbake
--> Flameman/bitbake
framebuffer
Flameman/framebuffer
find good code
http://www.koders.com
trasmission line
http://openbookproject.net/electricCircuits/AC/AC_14.html
homemade pcb
flameman/pcb
piratebus
pinout http://dangerousprototypes.com/docs/Bus_Pirate_I/O_Pin_Descriptions
idea from sparkfun http://www.sparkfun.com/products/9544
linux programming interfaces
The Linux Programming Interface, by Michael Kerrisk, No Starch Press, ISBN 978-1593272203, 1552 pages, October 2010
This really heavy tome (1552 pages!) tries to explain each and every system call and system library you'll probably need some time or the other. While many of the content can be found in traditional manpages, the example code is quite nice as a reference implementation and helps to understand the topic explained - and if all else fails, throwing it hard enough at your computer/co-worker/boss will also solve a lot of problems (but will also create more severe ones).
You can find a Review at LWN.net
Book's Homepage
Apple OpenFirmware
Flameman/openfirmware-apple
who are Flameman and Legacy ?
How to contact them Flameman/who
Orphaned pages
--> http://www.elinux.org/index.php?title=Special:LonelyPages&limit=500&offset=0
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:50:31.000Z
|
t6iyaygtgnlspguc42w67bu7ukcnt5th
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5500",
"uncompressed_offset": 428642224,
"url": "www.familysearch.org/learn/wiki/en/Linn_County,_Missouri",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Linn_County,_Missouri"
}
|
cccc_CC-MAIN-2013-20
|
Linn County, MissouriEdit This Page
From FamilySearch Wiki
United States Missouri Linn County
Guide to Linn County Missouri genealogy. Birth records, marriage records, death records, census records, family history, and military records.
Missouri
Online Records
Linn County, Missouri
Map
Location of Missouri in the U.S.
Facts
Founded January 6, 1837
County Seat Linneus
Courthouse
Address Linn County Courthouse
108 N High
Linneus, MO 64653
Phone: 660.895.5417
Linn County Website
Contents
County Courthouse
County Clerk has incomplete birth and death records 1883-1888;
County Recorder has marriage and land records from 1842;
Clerk Circuit Court has divorce records 1837; Probate Office has
probate records from 1840[1]
History
Parent County
1837--Linn County was created 6 January 1837 from Chariton County. County seat: Linneus [2]
Boundary Changes
See an interactive map of Linn County border changes at N2Genealogy.
Record Loss
Places/Localities
Populated Places
Neighboring Counties
Resources
Cemeteries
rootsweb has a great list of Linn County cemeteries with directions.
http://www.rootsweb.ancestry.com/~molinn/lccem.html
Church
Court
Land
Local Histories
The history of Linn county, Missouri: An encyclopedia of useful information (1882) is available online free from Google Books.
Maps
Military
Newspapers
Probate
Taxation
Vital Records
Births
• 1817-1907 - Linn County Birth Index 1817-1907. Batch C515457 at FamilySearch - free.[3]
• 1857-1885 - Linn County Birth Index, Volumes 2A and 2B, 1857-1885. Batch C515381 at FamilySearch - free.[3]
• 1875-1887 - Linn County Birth Index, Volume 1, etc., 1875-1887. Batch C515458 at FamilySearch - free.[3]
Marriages
• 1857-1885 - Linn County Marriage Books 2A and 2B Index 1857-1885. Batch M515381 at FamilySearch - free.[3]
• 1881-1885 - Linn County Marriage Book 1 Index 1881-1885. Batch M515382 at FamilySearch - free.[3]
Deaths
• Missouri State Archives provides on-line access to Missouri Death Certificates more than 50 yrs old starting in 1910.
• 1883-1887 - Linn County Death Index 1883-1887. Batch B515458 at FamilySearch - free.[3]
Societies and Libraries
Family History Centers
Web Sites
• USGenWeb project. May have maps, name indexes, history or other information for this county. Select the state, then the county.
• Family History Library Catalog
References
1. Handybook for Genealogists: United States of America, 10th ed. (Draper, Utah: Everton Pub., 2002), Linn County, Missouri. Page 402 At various libraries (WorldCat); FHL Book 973 D27e 2002.
2. The Handybook for Genealogists: United States of America,10th ed. (Draper, UT:Everton Publishers, 2002).
3. 3.0 3.1 3.2 3.3 3.4 3.5 Genealogical Society of Utah, Parish and Vital Records List (July 1998). Microfiche. Digital version at https://www.familysearch.org/learn/wiki/en/images/d/d8/Igimissourij.pdf.
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 23 April 2013, at 17:14.
• This page has been accessed 1,582 times.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:55:22.000Z
|
2u5uuced5fxoqro4qymwycouev6oja6m
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5503",
"uncompressed_offset": 442432715,
"url": "www.forensicswiki.org/w/index.php?oldid=6497&title=Internet_Explorer_History_File_Format",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.forensicswiki.org/w/index.php?title=Internet_Explorer_History_File_Format&oldid=6497"
}
|
cccc_CC-MAIN-2013-20
|
MP3Stego
From Forensics Wiki
Revision as of 21:06, 16 March 2007 by User24 (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
MP3Stego is a program that can hide data inside MP3 files using steganography.
External Links
MP3Stego homepage
Personal tools
Namespaces
Variants
Actions
Navigation:
About forensicswiki.org:
Toolbox
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:30:21.000Z
|
pcj5xnvvqcpelktjfwrefanpwgpoqojj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5504",
"uncompressed_offset": 442451182,
"url": "www.forensicswiki.org/w/index.php?oldid=11858&title=User_Account_Control_%28UAC%29",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.forensicswiki.org/w/index.php?title=User_Account_Control_(UAC)&oldid=11858"
}
|
cccc_CC-MAIN-2013-20
|
User Account Control (UAC)
From Forensics Wiki
Revision as of 01:45, 6 March 2013 by Joachim Metz (Talk | contribs)
Jump to: navigation, search
Please help to improve this article by expanding it.
Further information might be found on the discussion page.
User Account Control (UAC) is a Windows sub-system introduced in Windows Vista that limits application software to standard user privileges until an administrator authorizes an increase or elevation.
The file virtualization part of UAC is also referred to as LUA (LUAFV.SYS).
EventLogs
Related EventLogs:
C:\Windows\System32\winevt\Logs\Microsoft-Windows-UAC%4Operational.evtx
C:\Windows\System32\winevt\Logs\Microsoft-Windows-UAC-FileVirtualization%4Operational.evtx
External Links
Personal tools
Namespaces
Variants
Actions
Navigation:
About forensicswiki.org:
Toolbox
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:25:52.000Z
|
sdwjdlrzpxtjnhqibqd26ycw6ow4kawv
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5508",
"uncompressed_offset": 478354633,
"url": "www.hindawi.com/journals/arch/2002/307480/abs/",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.hindawi.com/journals/arch/2002/307480/abs/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
Archaea
Volume 1 (2002), Issue 1, Pages 9-18
doi:10.1155/2002/307480
Research Article
The ultrastructure of Ignicoccus: Evidence for a novel outer membrane and for intracellular vesicle budding in an archaeon
1Lehrstuhl für Mikrobiologie und Archaeenzentrum, Universität Regensburg, Universitätsstr. 31, D-93053 Regensburg, Germany
2Aventis Behring GmbH, Emil-von-Behring-Strasse 76, D-35041 Marburg, Germany
Received 9 July 2001; Accepted 13 August 2001
Copyright © 2002 Hindawi Publishing Corporation. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
A novel genus of hyperthermophilic, strictly chemolithotrophic archaea, Ignicoccus, has been described recently, with (so far) three isolates in pure culture. Cells were prepared for ultrastructural investigation by cultivation in cellulose capillaries and processing by high-pressure freezing, freeze-substitution and embedding in Epon. Cells prepared in accordance with this protocol consistently showed a novel cell envelope structure previously unknown among the Archaea: a cytoplasmic membrane; a periplasmic space with a variable width of 20 to 400 nm, containing membrane-bound vesicles; and an outer sheath, approximately 10 nm wide, resembling the outer membrane of gram-negative bacteria. This sheath contained three types of particles: numerous tightly, irregularly packed single particles, about 8 nm in diameter; pores with a diameter of 24 nm, surrounded by tiny particles, arranged in a ring with a diameter of 130 nm; and clusters of up to eight particles, each particle 12 nm in diameter. Freeze-etched cells exhibited a smooth surface, without a regular pattern, with frequent fracture planes through the outer sheath, indicating the presence of an outer membrane and the absence of an S-layer. The study illustrates the novel complex architecture of the cell envelope of Ignicoccus as well as the importance of elaborate preparation procedures for ultrastructural investigations.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:17:04.000Z
|
f2sfljwf2veycvoxtt3tqrdn5bqewejm
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5512",
"uncompressed_offset": 495749989,
"url": "www.indiaenvironmentportal.org.in/reports-documents/guidance-and-awareness-raising-materials-under-new-unep-mercury-programs-indian",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.indiaenvironmentportal.org.in/reports-documents/guidance-and-awareness-raising-materials-under-new-unep-mercury-programs-indian"
}
|
cccc_CC-MAIN-2013-20
|
Guidance and awareness raising materials under new UNEP mercury programs (Indian scenario)
Mercury distribution in the environment has been a focus of scientific attention because of the potential health risks posed by mercury exposure. Never before in the history of mankind has there been such a vast multiplicity of environmental risk factors, nor there has been such an expression of concern regarding inherent danger of mercury and its likely impact on diverse aspects on human health. Further organic mercury, mostly methyl mercury (MeHg) the most toxic species is bioaccumulating in the biota and subsequently biomagnified in the aquatic food chain, especially in fish. Given the human health concern, it is critical and important that awareness programme is launched to educate the populations to the risk and impact of mercury exposure in humans especially potentially vulnerable population viz pregnant women, breast feeding women, the fetus new born and young children residing in the hot spot area’s of the country and also consequences of MeHg exposure through fish consumption.
Attachment(s):
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:35:13.000Z
|
pxwdrr6zxcw4vfvnk5yngnnb64g4unke
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5514",
"uncompressed_offset": 501544512,
"url": "www.isfdb.org/cgi-bin/pl.cgi",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.isfdb.org/cgi-bin/pl.cgi?205913"
}
|
cccc_CC-MAIN-2013-20
|
Publication Listing
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
• Title: Locus, #505 February 2003 (View All Issues) (View Issue Grid)
• Editors: Charles N. Brown
• Year: 2003-02-00
• Publisher: Locus Publications
• Price: $5.95
• Pages: 96+[2]
• Binding: quarto
• Type: MAGAZINE
• Title Reference: Locus - 2003
• ISFDB Record Number: 205913
• Notes: Vol. 50, No. 2
Most uncredited news items are not indexed here.
The double-sided Locus Poll and Survey is folded and bound between pages 48 and 49. The first four interior sheets and the center sheet (pages 3-10, 47-50, and 87-94) are made of the same slick paper as the cover.
• Bibliographic Comments: Add new Publication comment (LOCUSFEB2003)
Cover art hosted by ISFDB
Contents (view Concise Listing)
Verification Status
Reference Status
Primary Verified by Mhhutchins on 2011-09-04 11:55:37
Clute/Nicholls Not Verified
Clute/Grant Not Verified
Contento1 (anth/coll) Not Verified
Locus1 Not Verified
Reginald1 Not Verified
Reginald3 Not Verified
Tuck Not Verified
Miller/Contento Not Verified
Bleiler1 (Gernsback) Not Verified
Currey Not Verified
Primary (Transient) Not Verified
Bleiler78 Not Verified
OCLC/Worldcat Not Verified
Primary2 Not Verified
Primary3 Not Verified
Primary4 Not Verified
Primary5 Not Verified
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:35:47.000Z
|
jymu5dnif53mm6zikylzdxfe7gxilq5i
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5515",
"uncompressed_offset": 501551788,
"url": "www.isfdb.org/cgi-bin/title.cgi",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.isfdb.org/cgi-bin/title.cgi?1236785"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: Letter (Locus #392)
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Title: Letter (Locus #392)
Author: Nancy Kress
Year: 1993
Type: ESSAY
ISFDB Record Number: 1236785
User Rating: This title has fewer than 5 votes. VOTE
Current Tags: None Add Tags
Publications:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:15:52.000Z
|
qem5id6nspisujto6bbq7wlpytcyhxbi
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5540",
"uncompressed_offset": 597835438,
"url": "www.openwetware.org/index.php?oldid=108933&title=Computing",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.openwetware.org/index.php?title=Computing&oldid=108933"
}
|
cccc_CC-MAIN-2013-20
|
Computing
From OpenWetWare
Revision as of 20:13, 10 April 2007 by Ilya (Talk | contribs)
Jump to: navigation, search
General
Scientific
• In silico protocols on OWW
• Graphing high dimensional data
• MATLAB
• R for Statistical Computing
• The Really Easy Statistics Site
• Modeller
• Microfootprinter
• Genamics SoftwareSeek links to biotechnology software
• LIMS - Laboratory Information Management Systems
• bioPIXIE is a novel system for biological data integration and visualization that allows the user to discover interaction networks and pathways in which the user's gene(s)of interest participate
• PerlPrimer - open-source PCR primer design (Windows and Linux)
• BioPerl project is an international association of developers of open source Perl tools for bioinformatics, genomics and life science research
• BioJava is an open-source project dedicated to providing a Java framework for processing biological data
• BioPython is a distributed collaborative effort to develop Python libraries and applications which address the needs of current and future work in bioinformatics
• EnzymeX is a program for molecular biologists, developed to help you determine which restriction enzymes you should use to cut your DNA of interest
• Papers allows find, download, archive, and organize all your articles within a single application
• 4Peaks is a program that helps molecular biologists to visualize and edit their DNA sequence files
• LabAssistant is a scientific program developed to help you organize your experiments instead of using multiple timers, stickies, and a labjournal that you have to organize all manually
• iRNAi is a tool to help scientists quickly design error free oligos
MIT
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:05:18.000Z
|
3mrhsl6egw33ittrziugxkpxvlnkp4te
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5541",
"uncompressed_offset": 597855071,
"url": "www.openwetware.org/index.php?diff=prev&oldid=361329&title=Synthetic_Biology%3ACollaborative_Projects",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.openwetware.org/index.php?title=Synthetic_Biology:Collaborative_Projects&diff=prev&oldid=361329"
}
|
cccc_CC-MAIN-2013-20
|
Synthetic Biology:Collaborative Projects
From OpenWetWare
(Difference between revisions)
Jump to: navigation, search
Line 17: Line 17:
[[Error Detection & Correction in Replicating Machines]]
[[Error Detection & Correction in Replicating Machines]]
+
+
[[E. coli Automatic Directed Evolution Machine project]] (E.ADEM)
==Lab Projects==
==Lab Projects==
Revision as of 23:05, 21 October 2009
Home About Conferences Labs Courses Resources FAQ
Open Projects
These are projects ongoing in OpenWetWare labs, specifically looking for collaborators, so sign up!!
Standard E. coli Strain for BioBricks
Standardized GFP quantification
Barcodes
BioBrick Parts for Plasmid Engineering
Hydrogen Photobioreactor
Error Detection & Correction in Replicating Machines
E. coli Automatic Directed Evolution Machine project (E.ADEM)
Lab Projects
These are projects being worked on in various OpenWetWare labs. Please feel free to add links to your lab's project descriptions here.
Endy lab projects
Knight lab projects
This site is hosted on OpenWetWare and can be edited by all members of the Synthetic Biology community.
Making life better, one part at a time.
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:48:54.000Z
|
7sonkse2fzra7mzkwuzvpng7e3kt6l7t
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5550",
"uncompressed_offset": 656185592,
"url": "www.scp-wiki.net/scp-427",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.scp-wiki.net/scp-427"
}
|
cccc_CC-MAIN-2013-20
|
SCP-427
rating: +99+x
Photograph taken of SCP-427 while closed.
Item #: SCP-427
Object Class: Safe* (see containment procedures)
Special Containment Procedures: SCP-427 displays no means of self-locomotion or malicious intent at this time, and requires only minimal containment. Due to SCP-427's adverse effects, only medical staff of Class 3 or above may handle or utilize it.
All personnel using SCP-427 must record their total time using it in order to avoid unwanted mutations.
*Instances of SCP-427-1 (colloquially referred to as "Flesh Beasts") created by SCP-427 must be killed immediately as it is impossible to communicate with or experiment on them safely. For this reason instances of SCP-427-1 are classified as Keter level.
Description: SCP-427 is a small, spherical, ornately carved locket made of a polished silver material. The ornate carvings do not seem to serve any function; it is unknown whether SCP-427's outer casing was crafted by sentients or not. Its circumference at its widest point is roughly 3 cm.
SCP-427 was created after placing a pill of SCP-500 in the Input booth of SCP-914 and using the Fine setting. It displays no unusual activity when closed. When opened, a small glowing orb is visible at the center. The orb emits no radiation or energy aside from the visible spectrum.
When SCP-427 is opened and exposed to biological tissue, it rapidly regenerates cellular damage and somehow is able to purge invading compounds or infections. As a standard of measure, the Common Cold takes 3 to 10 days to be worked through the human immune system and eventually removed. In the presence of an opened SCP-427, this time is reduced to 2 to 4 minutes. Its healing abilities are directional, so anything not in line of sight with the central orb experiences no effects.
However, long-term exposure produces a significant health hazard. As the locket heals damage, it optimizes the body's natural systems. Resistance to disease and toxins is increased by 500% compared to accepted LD50 or death-rate values after a total of 10 minutes of exposure, and 1000% after 15. After 15 minutes of exposure, muscular systems begin optimizing, increasing strength and pain tolerance by 200-300%. All other systems continue to optimize. Class-D personnel exposed to the device for over an hour total began mutating into a shapeless mass of tissue. The conversion time accelerates with continued exposure to SCP-427.
The "Flesh Beasts" (so named due to their appearance) created by SCP-427 are incredibly aggressive, attacking any and all personnel on sight with lethal results. They are highly resistant to most known weaponry, but can be disabled with sufficient shock trauma or heat in excess of 1100 degrees Celsius (2000 degrees Fahrenheit). Intelligence cannot be accurately gauged, but mapping of biological enhancement of the brain as a direct relationship with optimization of other systems suggests intelligence could exceed levels measured in humans when fully transformed.
Instance of SCP-427 "Flesh Beast" Neutralized During Escape Attempt.
SCP-427 is currently being used as a partial replacement for SCP-500 pills, as it can cure most anything SCP-500 is able to. All "optimizations" imparted by SCP-427 are cumulative. Oversight has deemed the side effects an "acceptable risk" but users must carefully record their total exposure time as sufficient mutations are grounds for termination.
Unless otherwise stated, the content of this page is licensed under Creative Commons Attribution-ShareAlike 3.0 License
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:44:44.000Z
|
u4v72xewo7nwvh5y76uj5r3lbnohvzn7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5551",
"uncompressed_offset": 660683685,
"url": "www.seroundtable.com/archives/020637.html",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.seroundtable.com/archives/020637.html"
}
|
cccc_CC-MAIN-2013-20
|
Google Bolding Acronyms In Search Results
Aug 24, 2009 • 7:23 am | (3) by | Filed Under Google Search Engine
Ever notice when you do a search at Google for nfl or seo or ppc or other popular acronyms you see that Google will bold the longer version of the acronym? Yes, Google will not only bold the title and snippet for the words NFL, SEO or PPC but also for National Football League, Search Engine Optimization and Pay Per Click, amongst others.
Here are pictures:
This is not new, Google has been doing this for at least a year now. Yet, I thought I mention it again, since more threads on this topic of sprung up recently.
Forum discussion at WebmasterWorld and Search Engine Watch Forums.
Previous story: Google Webmaster Tools Now Reporting SSL Certificate Errors
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:00:13.000Z
|
za67zkolo5kyqmvb77li7sk76xeqi36v
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5561",
"uncompressed_offset": 757113776,
"url": "www.werelate.org/wiki/Place:Simonton_Lake%2C_Elkhart%2C_Indiana%2C_United_States",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.werelate.org/wiki/Place:Simonton_Lake%2C_Elkhart%2C_Indiana%2C_United_States"
}
|
cccc_CC-MAIN-2013-20
|
Place:Simonton Lake, Elkhart, Indiana, United States
Watchers
NameSimonton Lake
TypeCensus-designated place
Coordinates41.746°N 85.971°W
Located inElkhart, Indiana, United States
source: Getty Thesaurus of Geographic Names
the text in this section is copied from an article in Wikipedia
Simonton Lake is a census-designated place (CDP) in Elkhart County, Indiana, United States. The population was 4,678 at the 2010 census.
Research Tips
This page uses content from the English Wikipedia. The original content was at Simonton Lake, Indiana. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:50:01.000Z
|
nroahmq27vfduhlda2xrnlkercli6ese
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5563",
"uncompressed_offset": 762142698,
"url": "www.wikidoc.org/index.php/Category:Articles_with_unsourced_statements_since_September_2007",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.wikidoc.org/index.php/Category:Articles_with_unsourced_statements_since_September_2007"
}
|
cccc_CC-MAIN-2013-20
|
Category:Articles with unsourced statements since September 2007
Jump to: navigation, search
Articles with unsourced statements since September 2007
Pages in category "Articles with unsourced statements since September 2007"
The following 200 pages are in this category, out of 469 total.
(previous 200) (next 200)
1
A
B
C
C cont.
D
E
E cont.
F
G
H
(previous 200) (next 200)
Navigation WikiDoc | WikiPatient | Popular pages | Recently Edited Pages | Recently Added Pictures
Table of Contents In Alphabetical Order | By Individual Diseases | Signs and Symptoms | Physical Examination | Lab Tests | Drugs
Editor Tools Become an Editor | Editors Help Menu | Create a Page | Edit a Page | Upload a Picture or File | Printable version | Permanent link | Maintain Pages | What Pages Link Here
There is no pharmaceutical or device industry support for this site and we need your viewer supported Donations | Editorial Board | Governance | Licensing | Disclaimers | Avoid Plagiarism | Policies
Personal tools
Namespaces
Variants
Actions
Navigation
Toolbox
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T04:55:58.000Z
|
hv2qmkd6ycik2p6k5om3o3rjhieei4sj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5564",
"uncompressed_offset": 762154565,
"url": "www.wikidoc.org/index.php/Sigma-Aldrich",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://www.wikidoc.org/index.php/Sigma-Aldrich"
}
|
cccc_CC-MAIN-2013-20
|
Sigma-Aldrich
Jump to: navigation, search
Overview
Sigma-Aldrich Corporation Template:Nasdaq, headquartered in St. Louis, Missouri, is a supplier of reagents and materials for use in research and development, diagnostics and analysis. They have facilities in 36 countries and manufacture many of the chemicals they sell.
Product lines
Sigma-Aldrich has a variety of product lines, each offered under separate branding.
Subsidiaries
Aldrich
File:Aldrich.jpg
The Aldrich Logo
Aldrich is a supplier in the research and fine chemicals market. Aldrich provides materials for drug discovery, materials science and chemical synthesis. Aldrich is well known among research chemists for having a wide selection of products. Their trademark "Sure-Seal" bottle, which incorporates a PTFE-lined septum inside a crown cap, allows the contents to be easily dispensed under an atmosphere of inert gas. Also, the Aldrich "Atmos Bag", is a sealable glove bag which enables the user to handle materials that are air and moisture sensitive in an inert atmosphere, such as nitrogen. Aldrich's chemicals catalog, the "Aldrich Catalog and Handbook" is often used as a handbook due to the inclusion of structures, physical data, and literature references. Many students use it as a reference book, especially undergraduates, as it is offered free by request.
Sigma
File:Sigma (chem).jpg
The Sigma Logo
Sigma is the Sigma-Aldrich's main biochemical supplier, with offerings including antibiotics, buffers, carbohydrates, enzymes, forensic tools, hematology and histology, nucleotides, proteins, peptides, amino acids and their derivatives.
Sigma RBI
File:Rbi.jpg
The Sigma RBI Logo
Sigma RBI produces specialized products for use in the field of cell signaling and neuroscience. Their offerings range from standard biochemical reagents to the latest cutting–edge research tools, including new ligands for receptors and ion channels, novel enzyme inhibitors, phosphospecific antibodies, key signal transduction enzymes, and assay kits for cell signaling.
ISOTEC
File:Isotec.jpg
The ISOTEC Logo
ISOTEC provides isotopically labeled products for protein structure determination, peptide synthesis, proteomics, metabolic research, magnetic resonance imaging, nuclear magnetic resonance, breath test substrates, agriculture, as well as gas and gas mixes.
Fluka Riedel-de Haën
File:Fluka Riedel-de Haën.jpg
The Fluka/Riedel Logo
Fluka Riedel-de Haën works in the field of analytical chemistry, biochemistry and organic chemistry.
Supelco
File:Supelco.jpg
The Supelco Logo
Supelco is the analytical and chromotography products branch of Sigma-Aldrich. It provides analytical standards and reagents, vials and syringes, biocides, and sample preparation/purification products.
Sigma-Aldrich Fine Chemicals
File:Safc.jpg
The SAFC Logo
Sigma-Aldrich Fine Chemicals (SAFC) is the extremely-fine chemical supply branch of Sigma-Aldrich.
Sigma Life Science (formally Sigma-Genosys)
Sigma Life Science provides products such as custom DNA/RNA oligos; custom DNA and LNA probes; siRNA; isotopically-labelled peptides and peptide libraries.
External links
Template:NASDAQ-100de:Sigma-Aldrich
Navigation WikiDoc | WikiPatient | Popular pages | Recently Edited Pages | Recently Added Pictures
Table of Contents In Alphabetical Order | By Individual Diseases | Signs and Symptoms | Physical Examination | Lab Tests | Drugs
Editor Tools Become an Editor | Editors Help Menu | Create a Page | Edit a Page | Upload a Picture or File | Printable version | Permanent link | Maintain Pages | What Pages Link Here
There is no pharmaceutical or device industry support for this site and we need your viewer supported Donations | Editorial Board | Governance | Licensing | Disclaimers | Avoid Plagiarism | Policies
Personal tools
Namespaces
Variants
Actions
Navigation
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:13:54.000Z
|
w5ozluue267ehoicixqonrjpvr4ym7k4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5569",
"uncompressed_offset": 787305603,
"url": "yourretailhelper.blogspot.com/2012/07/disney-store-extra-25-off-everything.html",
"warc_date": "2013-11-22T14:54:25.000Z",
"warc_filename": "<urn:uuid:f9df8429-b483-4d7c-999d-9940a3ecfc31>",
"warc_url": "http://yourretailhelper.blogspot.com/2012/07/disney-store-extra-25-off-everything.html"
}
|
cccc_CC-MAIN-2013-20
|
Looking for a Store/Retail Deal? Search here.
Loading...
Thursday, July 19, 2012
Disney Store Extra 25% Off Everything = Backpacks $11.25 (Orig $19.50) + Lunch Totes $7.50 (Orig $12.50)
The Disney Store is offering an extra 25% off your entire purchase with Coupon Code DISNEYPAL. That will make their Backpacks $11.25 (Reg $19.50) and Lunch Totes $7.50 (Reg $12.50).
Don’t want to miss a single deal? Go here to get Hot Deals sent directly to your Inbox! Thanks for joining Your Retail Helper.
This post may contain affiliate links. Go here to see our full Disclosure Statement.
Copyright Information
©2010–2012 Your Retail Helper All rights reserved. No content on this site may be reused in any fashion without written permission.
This work is licensed under a Creative Commons Attribution 3.0 United States License. THIS WORK BY YOUR RETAIL HELPER IS LICENSED UNDER A CREATIVE COMMONS LICENSE. YOU ARE FREE TO USE ANY INFORMATION FOUND ON THIS SITE AS LONG AS PROPER CREDIT IS GIVEN TO YOUR RETAIL HELPER AND A LINK BACK IS PROVIDED. IF YOU HAVE ANY QUESTIONS, PLEASE CONTACT US.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:13:43.000Z
|
yblrml6xwzzxyjl6yqnfiremtd6gzcxb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5570",
"uncompressed_offset": 3108236,
"url": "abs.gov.au/ausstats/abs%40.nsf/productsbytitle/7796AACF5EDA47F7CA2570F30011CD97",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://abs.gov.au/ausstats/abs@.nsf/productsbytitle/7796AACF5EDA47F7CA2570F30011CD97?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
1362.0 - Information Paper: Regional Research in Australia - the Statistical Dimension: an Information Development Plan for Rural and Regional Statistics, 2005
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 11/01/2006 First Issue
Page tools: Print Page Print All RSS Search this Product
• About this Release
Sets out a series of statistical development recommendations to expand the future availability and relevance of rural and regional statistics in Australia.
Presents a detailed overview of the concepts, issues and themes associated with this field of statistics, with a particular focus on the nature and extent of current statistical demand. Through investigation of existing survey and administrative data sources, highlights specific gaps in the currently available suite of rural and regional information and proposes a plan via which significant gaps may be addressed.
Recommendations will be implemented collaboratively by the ABS and other key producers of rural and regional data over the next 3 to 5 years.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:20:16.000Z
|
al335fnrjdjks53qc26wdeu4h56n4lvk
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5571",
"uncompressed_offset": 3115341,
"url": "abs.gov.au/ausstats/abs%40.nsf/productsbytitle/B560D587549C7731CA25745F0016793D",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://abs.gov.au/ausstats/abs@.nsf/productsbytitle/B560D587549C7731CA25745F0016793D?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
4818.0.55.001 - Household Preparedness for Emergencies: NSW, Vic., Qld and ACT, Oct 2007 Quality Declaration
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 06/06/2008 First Issue
Page tools: Print Page Print All RSS Search this Product
SUMMARY OF FINDINGS
HOUSEHOLD PREPAREDNESS FOR EMERGENCIES
This publication presents results from the Household Preparedness for Emergencies survey which was conducted in New South Wales (NSW), Victoria (Vic.), Queensland (Qld), and the Australian Capital Territory (ACT) during October 2007. The survey examined the steps households had taken in preparing for emergencies. These steps included safety precautions such as installing smoke alarms, ensuring emergency phone numbers were accessible and having an emergency plan. Where households had experienced a recent emergency (in the last 2 years), the survey investigated how they responded during the emergency and whether any changes were made to ensure better preparedness in the future.
PRESENCE OF SAFETY PRECAUTIONS
The most common safety precaution that households had taken was to have smoke alarms or detectors installed in their homes. In each jurisdiction, 90% or more of homes had a smoke alarm installed (Vic. 97%, NSW 94%, Qld 94% and the ACT 90%).
State and territory legislation and building codes regarding smoke alarms are probably the main influences on the high proportion of homes with smoke alarms. In NSW, Vic. and Qld, it is (and was at the time of the survey) mandatory for all homes, new and old to have smoke alarms installed. In the ACT, it is mandatory for new homes and those undergoing significant renovations to have smoke alarms installed.
Electrical safety switches or circuit breakers were the second most common safety precaution. These were present in over three quarters of homes in the ACT (79%), NSW (76%) and Vic. (75%) and in 90% of homes in Qld.
As with smoke alarms, the proportion of dwellings with safety switches was influenced by jurisdictional legislation and building codes. It is (and was at the time of the survey) mandatory to have safety switches installed in new homes and those undergoing renovations or rewiring work in NSW, Vic. and ACT. In Qld all homes built since 1992 must have safety switches installed, whilst all properties which have changed ownership or are leased to tenants are required to have safety switches to be installed within 3 months and 6 months respectively.
Presence of selected safety precautions, Household estimates - October 2007
Aside from these legislated safety precautions, more than half the homes across all the surveyed jurisdictions had a portable first aid kit and around one-third had a household member with a current first aid qualification.
A written or rehearsed emergency plan was the least common safety precaution implemented by households in Vic. (15%), ACT (15%) and NSW (13%). In Qld the two least implemented precautions were fire blankets (19%) and a written or rehearsed emergency plan (20%).
For NSW a greater proportion of households in balance of state NSW had taken non-legislated safety precautions compared to households within Sydney. In Qld there was no significant difference between balance of state Qld and Brisbane in most implemented non-legislated safety precautions. The exception for Qld was written or rehearsed emergency plans, where in balance of state Qld 22% of households had an emergency plan compared to 17% of households in Brisbane.
In NSW and Vic. the biggest difference was in the proportion of homes with a portable first aid kit. While in both Melbourne and Sydney 54% of homes had a portable first aid kit, the balance of state for both jurisdictions reported higher proportions of homes with a portable first aid kit NSW (63%) and Vic. (60%).
In Qld, Vic. and NSW couple with children households were more likely than other household types to have a household member with a first aid qualification (Qld 53%, Vic. 43%, NSW 45%). These households were around 3 times more likely than lone person households to have a first aid qualification (16% in Qld, 15% in both NSW and Vic.)
In Qld and Vic. portable first aid kits were most commonly found in couple with children households (74% and 66% respectively). In NSW couple with children households (66%) and couple households (64%) were the household types most likely to have portable first aid kits.
Home ownership increased the likelihood of a household having the safety precautions to put out house fires, compared to homes that were rented. In particular, households who owned or were paying off their home were approximately twice as likely to have fire blankets and fire extinguishers compared to households who rented. This was evident in all of the jurisdictions surveyed.
ACCESS TO EMERGENCY PHONE NUMBERS
Household members' easy access to appropriate emergency phone numbers can be crucial to fast contact with emergency services when they are required. Approximately one-third of all households in the surveyed jurisdictions, did not keep emergency phone numbers in a location for ease of use (Qld 39%, ACT 38%, NSW 36% and Vic. 30%).
The most common locations to keep emergency phone numbers for all jurisdictions, was either on the fridge or near the phone. Vic. had the highest proportion of households with emergency phone numbers located on the fridge (34%), followed by ACT (29%), NSW (28%) and Qld (24%).
EMERGENCY PLANS AND SELECTED HOUSEHOLD CHARACTERISTICS
An indicator of preparedness for emergencies is whether households have an emergency plan. Of the households with a perceived risk of bushfire, a majority of the surveyed jurisdictions, except Vic., did not have an emergency plan. In Vic. 54% of households who perceived themselves at risk of bushfire had an emergency plan (compared to 41% in both NSW and Qld and 35% in the ACT).
In each of the surveyed jurisdictions, approximately one-fifth of all households had at least one household member who would have difficulties evacuating without help in an emergency. This however did not increase the likelihood of those households having an emergency plan. Across all jurisdictions over 60% of households had a household member who would have difficulties evacuating did not have an emergency plan.
Households with one or more household members who volunteered in the emergency services were more likely to have an emergency plan than households with no volunteer household members. At the state and territory level, this was most evident in ACT and Vic. where 58% and 57%, respectively, of volunteer households had an emergency plan, compared to 30% and 28%, respectively, of non-volunteer households.
RECENT EMERGENCIES
The ACT had the highest percentage of households (18%) who had experienced an emergency, in the two years prior to October 2007. This was followed by NSW (12%), Qld (10%) and Vic. (8%).
The most common type of emergency experienced in all jurisdictions surveyed was storm, wind or hail. Twelve percent of ACT households had experienced an emergency due to storm, wind or hail, compared to 7% of NSW households, 6% of Qld households and 3% of Vic. households.
MOST RECENT EMERGENCY(a), Household estimates - October 2007
Of the households who reported experiencing a recent emergency, approximately a quarter contacted emergency services in Vic. (24%), followed by NSW (21%), ACT (17%) and Qld (15%). The most commonly contacted emergency services were the Fire Service and the State Emergency Service.
Approximately half of Qld, NSW and Vic households who experienced emergencies implemented changes for better preparedness, compared to over a third of households who experienced an emergency in the ACT (37%) and made changes. These changes include installing and regularly testing smoke alarms, implementing an emergency plan and putting emergency phone numbers in an easily accessible place.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:27:23.000Z
|
ljb2yw3mfhivt5mvcx73yepkx2st2bk7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5581",
"uncompressed_offset": 9885293,
"url": "answers.onstartups.com/questions/552/project-management-software/921",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://answers.onstartups.com/questions/552/project-management-software/921"
}
|
cccc_CC-MAIN-2013-20
|
Tell me more ×
Answers OnStartups is a question and answer site for entrepreneurs looking to start or run a new business. It's 100% free, no registration required.
My, to put it mildly, understaffed and overworked startup is trying hard to not reinvent the wheel and outsource as much tasks as possible. So we are currently on the look out for a great project management software.
FogBugz and Basecamp look nice, and about a dozen others. Unfortunately there is no time (or desire) to try them all, so any thoughts and recommendations on project management tools are welcome.
share|improve this question
23 Answers
up vote 9 down vote accepted
I have 5 users and the server edition of FogBugz was the way to go. We had used BaseCamp for a year prior, without success. Cost-wise:
$50 Basecamp version = $600/year
FogBugz Server 5 users (@ $200/ea) = $1000 upfront
Depending on the # of users, and if you can afford the upfront investment, the server edition of FogBugz will pay for itself over time compared to other hosted services.
Setting deadlines, time tracking, and project discussion were among our top priorities. FogBugz may seem intimidating, but you'll dive right in and feel like an expert user in an hour. It's as easy as e-mail, and now they have great plugins like Clark Kent (for time reports aka billing) and Balsamiq (my favorite wireframing tool).
Another great feature--our customers email their support requests to an address that goes into fogbugz and assigns a case to the appropriate person. We can assign the case throughout the team and maintain a full history in the case. Then all the customer's cases can be used for billing if necessary.
share|improve this answer
Been using and unfuddle and fogbugz for 3+ months, we finally moved away from unfuddle and settled down with fogbugz.
Fogbugz has the worst usability but you'll get used to it.
Unfuddle has a great interface but it's limited in the functionality level. SVN support of unfudle is great as well. Especially if you want to separate SVN access for contractors.
Also Evidence based scheduling in fogbugz is a game changer, it's one of those killer features.
Basically neither of them is perfect. If you don't need so much advanced stuff and time tracking, estimation related reports then use unfuddle, it's easy to pick up and a joy to use.
If you looking for a terrible GUI yet advanced functionality go for Fogbugz. Don't forget you'll spot lots of stupid restrictions such as you can't delete tickets, you can't modify history, you can't use bold or italic in tickets (a total WTF!).
share|improve this answer
How many are you? How much do you follow agile processes? I've been really happy with PivotalTracker, even if we're not an "agile shop" per se: http://www.pivotaltracker.com for feature tracking / bug tracking / todo tracking.
It's super light weight, but plenty powerful. The real-time-collaboration aspect is killer. Highly recommended. Also, it's free but I'd be happy to pay a monthly fee for it.
share|improve this answer
Digital Dandelion tried Basecamp, but chose Manymoon for its tight integration with Google Apps for Business. https://www.manymoon.com/
share|improve this answer
What sort of "project management" did you have in mind? Hosted or locally installed?
Are you trying to manage work by external people, or just for your internal team? Interactions with customers?
More interested in task/time tracking, or general feature/release management?
I'd split it into a few groups (assuming hosted):
1. Software project management (managing software development, bug tracking, code checkins, versions, etc.)
FogBugz, JIRA, and Trac (open source) are good general candidates. Not sure if all of these can be had as hosted versions (FogBugz can, of course). For "Agile" methodology support, there's also VersionOne, ExtremePlanner, Rally, and the ones mentioned above (PivotalTracker, etc.). All have hosted options.
2. General project, task and time tracking (tracking hours, tasks, status, and usually files and conversations across multiple projects), not specifically tied to software development.
Basecamp, ClientSpot, Wrike (all hosted) are good options, along with FogBugz, etc. as above - tons of self-hosted and open source options too.
3. Customer support/interaction (helpdesk style with case or ticketing type support, email integration, reporting)
HelpSpot, FogBugz, ZenDesk, Kayako (all have hosted options)
share|improve this answer
We tried quite a few project management tools before we settled for Basecamp. It was by far the most:
1. User friendly
2. Shortest learning curve (Given you need to give access to outside vendors and partners for certain projects you really need the tool to be very intuitive and easy to use)
3. Competitively priced
4. Great feature set (Time tracking, collaborative whiteboards)
Overall we have been really happy using the service and would highly recommend it.
The 30 day free trial really lets you get your feet wet and see whether the service is for you or not.
share|improve this answer
I find that it's always important not to try to get a tool to solve a process problem.
Sure use a tool once the problem is solved.
I spent a long time evangelising about Agile and Scrum and in a particular development team experimented with a, then new, on-line trial of on-time which was great - but it didn't make any difference to the team.
Eventually we scrapped all of the tools and used simple manual techniques. White-board, index cards etc. and it worked a treat. By removing the complexity of the tools and getting down to basics we were able to focus on the process and make sure that was right first; tools could come later...
share|improve this answer
Short answer: Use one for some some time consuming tasks, but do not rely on a single tool as the ultimate solution.
Manage the project by managing your ideas. Your dreams. Your major goals. Discuss then with your associates, friends, meetings, social network sites. Give this high level your personal touch and time and opinion. Write emails, blog entries, word documents.
I think the biggest area in project management is handling all the tasks. Call them User Stories, product features, tasks, sub-goals. Find a tool for this. Assign priorities, assign resources. Open. Close. Track. Graph. For this almost any tool can be used, even free or almost free ones.
I personally prefer open source over monthly subscriptions. Make a list of what you need the software to do and then check out the below link:
http://en.wikipedia.org/wiki/Comparison_of_project_management_software
There are a few interesting ones that were recommended here, both are good to start with:
http://www.unfuddle.com https://www.manymoon.com/
share|improve this answer
I know this answer may sound very sales pitchy like, but I will try not to go there. Having gone through similar experiences ourselves, we decided to build a product that integrates all of these components into one, like the way they are "connected" in real-life.
Like Derek said above - its not just about project management.. its projects, tasks, project plan - charts, features, requirements, time, and managing all of this in one would be nice. I would actually love to hear your opinions about the product - www.trakeze.com (just launched this month)
share|improve this answer
Atlassian has a nice deal on right now ([1]) that gets you their suite for $10/tool, and Jira with Greenhopper is a great combination for agile projects.
share|improve this answer
We've used and find it quite helpful to use VersionOne's Team edition (comes for free but I guess 1st year of subscription). Quite easy to setup & use. Oh and we're an agile shop by the way.
Although we're migrating to Microsoft's Teams Foundation Server, I wouldn't recommend that as you already mentioned your startup understaffed & overworked. TFS requires a LOT of administration but it handled your Project Management (agile or not), Continuous Integration, Build Management, Version Control everything under one roof. VersionOne on the other hand is only Project Management tool for agile only I believe.
My current team is 6 developers 1 UI guy & 1 tester
share|improve this answer
We're very happy with fogbugz, although it can get expensive if you work closely with contract developers ($25/user). We use their wiki for spec'ing requirements and their case management capabilities for project management.
We tried other solutions and they didn't work for us (namely trac and rally). If I had it to do over again, I'd give unfuddle a hard look. We use them for subversion hosting and it would be nice to have an integrated solution for case management and version control (and it would be substantially cheaper). A company we shared a lease with used unfuddle and they were very happy with it.
share|improve this answer
Just analyzed a lot of project management tools and made the choice to go with Unfuddle (www.unfuddle.com). Cannot say much about the results as we just started with it but for what we needed and from everything we looked at it seemed like the best choice.
share|improve this answer
At a previous company, I used Fogbugz and found it quite useful for basic feature and defect tracking and VERy lightweight project management. I have used Rally at 3 different companies and think it is great for agile product development. They have a 10-user Community Edition that is free. I know those guys well and it is a very well-run and reputable company.
We are using BaseCamp now for basic collaboration, but I couldn't imagine using it for project management.
share|improve this answer
I more or less agree with the answers above. Here's something no one mentioned which might at least deserve a review:
GoPlan
share|improve this answer
We started off with Dot Project an open source tool and have recently migrated to BaseCamp! Love Basecamp and highly recommend it.
share|improve this answer
1. Basecamp is solid
2. Zoho may have something
3. http://www.dreamfactory.com/ Dream Factory has a cool tool that used to integrate very well with Salesforce when I was there.
share|improve this answer
Most of these are subscription based tools. The free ones can work well too, if you can host them yourself...
If you're doing mostly software-dev stuff with some project management, trac is an old standard for that.
We've been using Redmine for our projects, because it has good integration with version control, and the ticketing and assignment system is quite versatile. It has most of the features all these others have talked about - wiki, document upload, version control, ticketing assignment, time tracking, charts and reports, etc. It really meets our needs nicely.
Not paying a per-user fee is also really nice, since it means we can give our customers access to the appropriate parts of their projects without it costing us anything.
share|improve this answer
Take a look at ProjectPier.
It is open source (free) and self hosted. To be honest I can't tell the difference between that and Basecamp. The software does everything I require of it!
Yes, eventually you may want something a little more complex, or hosted off site. But startup = boot strap, why spend when you don't have to? Project Pier does enough to last you through these stages.
share|improve this answer
I've used Unfuddle at Lookery.com and now Shareaholic.com It's great for projects involving actual code because of how tightly it integrates tickets, etc with the actual code. It has a nice API too. I recommend it to everyone.
http://www.unfuddle.com
share|improve this answer
Depends on your project nature, but check it out Jira or active .
share|improve this answer
There is a very long list of alternatives, here are just a few of the alternatives
zoho.com freshbooks.com centraldesktop.com deskaway.com smartsheet.com 5pmweb.com teamworkpm.net activecollab.com aceproject.com teambox.com fengoffice.com huddle.com comindwork.com nozbe.com getharvest.com wrike.com goplanapp.com egroupware.org clarizen.com hyperoffice.com liquidplanner.com severa.com
I made a comparison chart of all of the features and costs of the various project management software alternatives here
http://www.timedoctor.com/project_management_comparison.html
share|improve this answer
I don't think you need any PM tool for small team of 2-3 people. It may just be an additional burden.
share|improve this answer
protected by Community Jul 9 '11 at 3:17
This question is protected to prevent "thanks!", "me too!", or spam answers by new users. To answer it, you must have earned at least 10 reputation on this site.
Not the answer you're looking for? Browse other questions tagged or ask your own question.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:55:03.000Z
|
hd34v3yjcrgswetj6lopvoz325445uwj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5609",
"uncompressed_offset": 48132802,
"url": "ccsenet.org/journal/index.php/ass/article/view/3972",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://ccsenet.org/journal/index.php/ass/article/view/3972"
}
|
cccc_CC-MAIN-2013-20
|
Philosophical Interpretation on E. A. Nida’s Definition of Translation
Shiyang Ran
Abstract
Since 1980s, E.A. Nida’s translation equivalence theory experiences a history of rising, booming and declining in China, and his translation theories and concepts are also widely quoted and discussed. However, the focuses are mainly on what is equivalence, the realization of equivalence, what levels of equivalence, the applicability of his theory and mistranslation of his translation in China, and no one discusses his definition of translation from the perspective of philosophy. As the definition of translation will represent the basis and starting point for translation studies, analysing on it will facilitate our understanding to the theory. In this article, based on the tendency of absolutization to his definition, it is to analyse the presupposition and shortage of the definition by philosophical analysis and to urge following researchers to adopt a dialectic and critical attitude to western translation theories, which may advance Chinese translation studies in future.
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
Asian Social Science ISSN 1911-2017 (Print) ISSN 1911-2025 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:29:02.000Z
|
4rslbpreh7e5z3vzrgiu76luadmfiko5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5625",
"uncompressed_offset": 67272657,
"url": "ddowiki.com/page/Item:Bloody_Hooked_Blade",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://ddowiki.com/page/Item:Bloody_Hooked_Blade"
}
|
cccc_CC-MAIN-2013-20
|
| Edit | | History |
From DDO wiki
Jump to: navigation, search
Bloody Hooked Blade
Proficiency Class Exotic Weapon Proficiency
Damage and Type [1d8] + 5 Slash, Magic
Critical threat range 19-20 / x3
Weapon Type Khopesh / Slashing weapons
Minimum Level 12
Required Trait None
Use Magical Device DC No UMD needed
Handedness One-handed
Damage Mod STR
Attack Mod STR
Binding Bound to Character on EquipBound to Character on Equip: This item is Bound to Character on Equip
Durability 115
Made from SteelSteel: Steel is the common metal used to make weapons and armor.
Hardness 15
Base Value 00050020005,002pp
Weight 12 lbs
Location Cauldron of Sora Katra, Upgraded version of Hooked Blade
Enchantments
Upgradeable?
Not upgradeable
Description This vicious, curved sword, capable of slicing straight through enemy limbs, can now grant life to its wielder as it draws blood from his or her foes.
Tips
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:56:12.000Z
|
gf4g4gg2wbfpozaz3dmitxcegkkatugl
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5630",
"uncompressed_offset": 78560822,
"url": "dotnetkicks.com/stories/18208/http_lostintangent_com_2008_08_11_net_35_enhancements_training_kit_r",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://dotnetkicks.com/stories/18208/http_lostintangent_com_2008_08_11_net_35_enhancements_training_kit_r"
}
|
cccc_CC-MAIN-2013-20
|
Error!
Success!
http://lostintangent.com/2008/08/11/net-35-enhancements-training-kit-r
0
kicks
http://lostintangent.com/2008/08/11/net-35-enhancements-training-kit-r (Unpublished)
The Visual Studio & .NET Framework evangelism team has released a revision of the .NET 3.5 Enhancements Training Kit, updated to work with Visual Studio 2008 SP1 & .NET 3.5 SP1 RTM! The release includes updated hands-on-labs as well as new presentations, demo scripts, and miscelaneous event materials.
Kicked By:
Drop Kicked By:
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:58:08.000Z
|
cckdtbgcduo4tumzfzklgzeghti3a6pa
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5632",
"uncompressed_offset": 84379880,
"url": "edri.org/node?page=5",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://edri.org/node?page=5"
}
|
cccc_CC-MAIN-2013-20
|
If you wish to help EDRI promote digital rights, please consider making a private donation.
European Digital Rights was founded in June 2002. Currently 35 privacy and civil rights organisations have EDRi membership. They are based or have offices in 21 different countries in Europe. Members of European Digital Rights have joined forces to defend civil rights in the information society. The need for cooperation among organisations active in Europe is increasing as more regulation regarding the internet, copyright and privacy is originating from European institutions, or from international institutions with strong impact in Europe.
News & announcements
UN Agencies: A growing threat for the Internet?
23 October, 2012
»
The United Nations Office on Drugs and Crime (UNODC), led by Russian diplomat, Yury Fedotov, has just released a report (pdf) arguing for more surveillance and retention of data on all communications, even in the total absence of suspicion. Coincidentally, the Coordinator of the elegantly named 1267 Committee that was in charge of the report is British – and the British government recently proposed (even if it is likely to be rejected at national level) the most extensive suspicionless monitoring ever considered in a democratic society – the Communications Data Bill.
The report was coincidentally launched just weeks before the World Conference on International Telecommunications in Dubai organised by the United Nations telecommunications agency, the International Telecommunication Union (ITU), led by Russian-educated Secretary General Hamadan Touré. Much of the discussion will be about whether and how much new responsibility should be given to the ITU's bureaucracy, which has been losing influence and competences in recent years due to the growth of the Internet. Somewhat surprisingly, the ITU is listed as an “additional partner” on the website of the Working Group on Countering the Use of the Internet for Terrorist Purposes which was responsible for the UNODC report (lead by the 1267 Committee).
EDRi has a new office!
11 October, 2012
20 Rue Belliard
1040 Bruxelles
Belgium
Phone: +32 2 274 25 70
Twitter: @edri_org
Clean IT – Leak shows plans for large-scale, undemocratic surveillance of all communications
21 September, 2012
»
This article is also available in:
Deutsch: CleanIT – Pläne zur Überwachung des Internets im großen Stil
A leaked document from the CleanIT project shows just how far internal discussions in that initiative have drifted away from its publicly stated aims, as well as the most fundamental legal rules that underpin European democracy and the rule of law.
The European Commission-funded CleanIT project claims that it wants to fight terrorism through voluntary self-regulatory measures that defends the rule of law.
Syndicate:
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:49:58.000Z
|
34cle7llnaa24usufv747nbtbavmif72
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5636",
"uncompressed_offset": 85308720,
"url": "elinux.org/index.php?diff=8363&oldid=8362&title=Memory_Management",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://elinux.org/index.php?title=Memory_Management&diff=8363&oldid=8362"
}
|
cccc_CC-MAIN-2013-20
|
Difference between revisions of "Memory Management"
From eLinux.org
Jump to: navigation, search
(Enhanced Out-Of-Memory (OOM) handling)
(Enhanced Out-Of-Memory (OOM) handling)
Line 48: Line 48:
See [[Accurate Memory Measurement]] for information on technology in this area.
See [[Accurate Memory Measurement]] for information on technology in this area.
Here are some I know about (these need to be researched and documented):
+
Here are some I know about (these need to be researched and documented better):
* Nokia OOM enhancements
* Nokia OOM enhancements
** Maemo application enhancements referenced at: http://lwn.net/Articles/267013/ (search for "killable" in the comments)
** Maemo application enhancements referenced at: http://lwn.net/Articles/267013/ (search for "killable" in the comments)
Revision as of 19:34, 2 December 2008
This page has information about various memory management projects and activities which are of interest to embedded Linux developers.
Contents
Areas of Interest
Most of these areas have wider reaching implications, but are of relatively simpler in the embedded case, largely thanks to not having to contend with swap and things of that nature. Simpler memory management as well as vendors not afraid of deviation from mainline for product programs makes for an excellent playground for experimenting with new things in the memory management and virtual memory space.
Huge/large/superpages
• This applies to both transparent large page usage as well as the more static usage models, primarily relating to work outside of the hugetlb interface/libhugetlbfs.
• Embedded systems suffer from very small TLBs generally using PAGE_SIZE'd pages (4kB) for coverage. In most cases this places the system under very heavy pressure for any kind of userspace work, and very visibly degrading performance, with most applications taking anywhere from 5-40% of their time on the CPU servicing page faults.
• Preliminary discussion on this subject as well as links to additional information is happening through the wiki here: Huge Pages
Page cache compression
• This relates to using various compression algorithms for performing run-time compression and decompression of page cache pages, specifically aimed at both reducing memory pressure as well as helping performance in certain workloads.
• More information can be found on the wiki here CompressedCaching as well as at the SF Compressed Caching home page.
Reserving (and accessing) the top of memory on startup
A quote from Todd's email on how to use the reserved physical memory in "mem=".
Given that you have a fixed address for your memory, and is already reserved, the easier way to use it is by calling mmap() over the /dev/ mem device, use 0 as the start address, and the physical address of the reserved memory as the offset. The flags could be MAP_WRITE| MAP_READ. That will return you a pointer on user space for your memory mapped by the kernel. For example
If your SDRAM base address is 0x80000000 and your memory is of 64MB, but you use the cmdline mem=60M to reserve 4MB at the end. Then your reserved memory will be at 0x83c00000, so all you need to do is
int fd;
char *reserved_memory;
fd = open("/dev/mem",O_RDWR);
reserved_memory = (char *) mmap(0,4*1024*1024,PROT_READ| PROT_WRITE,MAP_SHARED,fd,0x83c00000);
Enhanced Out-Of-Memory (OOM) handling
Several technologies have been developed and suggested for improving the handling out-of-memory conditions with Linux systems.
See http://linux-mm.org/OOM_Killer for information about the OOM killer in the Linux kernel.
Part of OOM avoidance is for the kernel to have an accurate measure of memory utilization. See Accurate Memory Measurement for information on technology in this area.
Here are some I know about (these need to be researched and documented better):
User "oak" writes (commenting on the mem_notify patches):
Posted Feb 3, 2008 14:02 UTC (Sun) by oak (guest, #2786) [Link]
...
I thought the point of the patch is for user-space to be able to do the
memory management in *manageable places* in code. As mentioned earlier,
a lot of user-space code[1] doesn't handle memory allocation failures. And
even if it's supposed to be, it can be hard to verify (test) that the
failures are handled in *all* cases properly. If user-space can get a
pre-notification of a low-memory situation, it can in suitable place in
code free memory so that further allocations will succeed (with higher
propability).
That also allows doing somehing like what maemo does. If system gets
notified about kernel low memory shortage, it kills processes which have
notified it that they are in "background-killable" state (saved their UI
state, able to restore it and not currently visible to user). I think it
also notifies applications (currently) through D-BUS about low memory
condition. Applications visible to user or otherwise non-background
killable are then supposed to free their caches and/or disable features
that could take a lot of additional memory. If the caches are from heap
instead of memory mapped, it's less likely to help because of heap
fragmentation and it requiring more work/time though.
• Google per-cgroup OOM handler
• mem_notify patches
• This set of patches provided a mechanism to notify user-space when memory is getting low, allowing for application-based handling of the condition. These patches were submitted in January 2008.
• See http://lwn.net/Articles/267013/
Additional Resources/Mailing Lists
• LinuxMM - links to various sub-projects, and acts as a centralized point for discussion relating to memory management topics (linux-mm mailing list and archives).
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:17:02.000Z
|
rv2whaebeuwwyhrsxef7l7w6szwqzvxt
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5637",
"uncompressed_offset": 85319275,
"url": "elinux.org/index.php?oldid=127688&title=RPi_Chromium",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://elinux.org/index.php?title=RPi_Chromium&oldid=127688"
}
|
cccc_CC-MAIN-2013-20
|
RPi Chromium
From eLinux.org
Revision as of 16:48, 8 May 2012 by Bredman (Talk | contribs)
Jump to: navigation, search
Back to RPi Guides.
Adding Chromium web browser to a Raspberry Pi
Contents
What does it do?
This guide shows you how to install a Chromium web browser, which should be faster than the standard Debian web browser.
These instructions will show you how to install a software from the command line. This is a very important skill if you wish to progress further with Linux.
What do you need?
• A Raspberry Pi, model B.
• A Debian SD card for the Raspberry Pi.
• A network connection (Ethernet or WiFi).
What skill level is required?
Suitable for absolute beginners. No Linux knowledge is needed.
It is assumed that you have used a computer before, for example a Windows PC.
Overview of this project
You need to
• Install Chromium software on the Raspberry Pi
• Start the Chromium web browser
Optionally, you might wish to remove the Chromium browser from your Raspberry Pi.
Installing the software
Insert a Debian SD card in the Raspberry Pi.
Connect the Ethernet cable from your Raspberry Pi to a modem or other internet service. You may also use a WiFi device, but you may need help to get this working.
Connect the power cable. Log in with your username and password.
To check if your internet connection is working, enter the following command and press enter at the end.
ping -c 1 www.raspberrypi.org
If your internet connection is working, you should see a statistics report which contains the following
1 packets transmitted, 1 received, 0% packet loss
If you get an error message instead, or a report of 100% packet loss, you have a problem with your internet connection. You must ask somebody to help fix this problem before you can proceed.
Enter the following command and press enter at the end.
sudo apt-get install chromium-browser
You will be asked for your password. Enter your password and press enter. Note that you will not be able to see your password.
You will be asked for permission (yes/no) to install new software. Press the 'y' key and enter to continue.
Wait for the installation to complete.
Opening the Chromium web browser
Enter the following command and press enter at the end.
startx
Wait for the desktop to finish loading.
Click on the LXDE icon (the strange X) in the bottom-left corner of the screen.
Move your mouse to point to "Internet".
Click on "Chromium Web Browser".
The Chromium web browser will open.
Removing the software
Use these instructions if you wish to remove the software.
Follow the instructions above to install the software, but use this command instead.
sudo apt-get remove chromium-browser
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:59:00.000Z
|
xomc2gahdk5u2dxaaw447rxlydjtsnl3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5663",
"uncompressed_offset": 113128456,
"url": "globalvoicesonline.org/2010/02/20/coup-in-niger-bloggers-sigh-in-relief-at-the-ousting-of-the-president/",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://globalvoicesonline.org/2010/02/20/coup-in-niger-bloggers-sigh-in-relief-at-the-ousting-of-the-president/"
}
|
cccc_CC-MAIN-2013-20
|
GlobalVoices in Learn more »
Coup in Niger: Bloggers sigh in relief at the ousting of President Tandja
This post also available in:
Français · Niger : Soulagement après le renversement du Président Tandja
Italiano · Niger: generale soddisfazione dei netizen per la deposizione del Presidente Tandja
Swahili · Mapinduzi Nchini Niger: Wanablogu Wapumua Pumzi ya Ahueni
Español · Golpe en Níger: Bloggers suspiran de alivio por el derrocamiento del Presidente Tandja
Português · Golpe no Níger: Alívio pela Destituição do Presidente Tandja
Magyar · Niger: A bloggerek felsóhajtottak Tandja elnök elűzésekor
A mural of Mamadou Tandja hanging in the office of President (Photo by Jacob Silberberg for Panos Pictures)
On Thursday, February 18th a coup took place in Niger in which President Mamadou Tandja was captured after a gun battle in the capital, Niamey, led by led by Col. Abdoulaye Adamou Harouna (who was was the former aide-de-camp of Niger's previous coup leader Maj. Daouda Mallam Wanke). In a quite unpoplar move, a few months ago Tandja illegally changed the constitution to allow him a third term in what was generally considered a mass fraud referendum (see Jen Brea's roundup on the reactions caused by that decision).
For a few hours, confusion reigned about what was going on. Raffaella Toticchi in Niamey wrote on Thursday afternoon [Es]:
Se han oído también disparos y algunas personas han sido heridas y trasladadas al hospital más cercano, pero de momento no se sabe mucho más.
Gunshots have been heard and some people have been wounded and taken to the nearest hospital, but for the time being we don't know much more than that.
In a televised announcement, spokesman for the plotters Abdoul Karim Goukouyé said Niger's constitution had been suspended and all state institutions dissolved. Instantanés du Niger [Fr], the blog of a French expat in Niamey, reported that the the national TV station ORTN broadcasted military music for most of the evening leading up to the announcement. She also reported that the rest of the evening and the following day were calm.
Blogger Texas in Africa gives some background on the reasons for the coup:
First, about 7.8 million (3/5) of Niger's citizens experience severe or moderate food insecurity. Mass starvation is never a stabilizing force.
Second, and more importantly, President Tandja had angered many Nigeriens in 2009 when he dissolved parliament and enacted constitutional reforms that gave him broad powers with few checks or balances. Tandja was constitutionally required to step down from office in December, as that was the end of his second five-year term in office, but the changes he made to the constitution allowed him to stay in office for three more years. These moves were extremely unpopular; 10,000 protesters came out on Sunday to dispute Tandja's actions.
Clearly, this coup is the result of the ongoing political crisis.
As put by Nigerien commenter Ali Dan-Bouzoua in a discussion list about internet in Niger, unfortuntely there hasn't been much citizen media covering the event:
Tres peu de blogs ou de tweeter, de photo … sur la situation au Niger.
On consomme sur le net mais on ne produit rien. Les guinéens sont tres actifs et tres present sur le net.
Very few blogs or tweets, photos… on the situation in Niger.
We consume online [content] but we produce none. Guineans are very active and present online.
However, Nigeriens have expressed themselves through comments left on news sites such as tamtaminfo.com seemed to approve of the ousting of President Tandja albeit with some reservations for the transitional government:
Ousman Diallo Yacoubou:
Militaires de notre cher pays tout le peuple nigerien vous salut vous avez prouve que vous etes les vrais garants du peuple et de la democratie. Mais il y'a une chose jusqu'a present on ne connait pas la duree de votre transition.
To the military of our dear country, the whole Nigerien people salute you, you have proved that you are the true guards of the people and democracy. But until now there is one thing that we don't know: the length of your transition.
Sabitou Oumarou:
C'est domage que des democrates comme nous applaudisse un coup d”Etat. Mais nous devons savoir qu'il y a deux manière de combattre : l'une avec la raison et l'autre avec la force. La première est propre aux hommes la deuxième nous est commun avec les animaux. Mais quand la première montre c'est limites il faut bien recourir a la deuxième pour remettre l'ordre et fait respecter la loi.
It's a shame that democrats like us are applauding a coup d'Etat. But we have to realize that there are two ways of fighting: one with reason and one with force. The first one is unique to human beings, the second one we have in common with animals. But when the first one shows its limitations, it is necessary to reach to the second one to restore order and respect for the law.
Likewise, a few African bloggers and tweeterers have reacted to the coup, mostly expressing relief or celebrating Tandja's removal due to the illegal constitutional changes he approved last year. Like Ato Kwamena Dadzie from Ghana, who echoed a common sentiment:
Awada Ehemir from Chad [Fr] thinks the reactions to the coup are hypocritical:
Coup d'État in Niger… It is inmediately condemned, but next month it will be accepted by everybody. a classic in Africa…
And the African Union who pretends to condemn it! At the next meeting, they will roll out the red carpet for their new “friends”!
Tony Cassius Bolamba from the DRC [Fr] shows some understanding for the coup plotters in his blog:
Si je me penche du côté de la raison je condamnerai tout putsch et tout tripatouillage de constitutions en Afrique, mais la compréhension m’oblige de comprendre certains putschistes.
Raison aux pensées de Pascal ? « Ne pouvant justifier la justice, on a justifié la force ».
L’Homme ne récolte ce qu’il sème et t il faut avoir le flair de quitter les choses avant qu’elles ne vous quittent.
Espérant que ce nouveau coup de force au Niger bénéficiera au vrai détenteur du pouvoir: le peuple !
If I have to lean on the side of reason, I condemn all coups and constitutional tampering in Africa, but I'm obliged to feel some understanding for coup leaders.
Was Pascal right? “Not being able to justify justice, we justify force”.
Men reap what they sow and they need to sense when to leave things alone before things leave them.
Hoping that this new coup de force in Niger will benefit the real power holder: the people!
In a similar vein, the blog Guinée 50 [Fr] hopes for the coup to restore democracy in Niger:
Ni lui (Tandja) ni les militaires qui l’ont renversé, ne portent le manteau de la légalité constitutionnelle. Il n’est donc pas question pour nous citoyens africains, de juger la manière dont nous en sommes soulagés.
La bonne question n’est pas non plus de d’applaudir aveuglement ces militaires. Mais, d’exiger leur neutralité dans la restauration de la démocratie dans un bref délai.
[...]
Nous sommes optimistes pour la suite, car à force de mal aller, tout ira bien dans le sens voulu par nos peuples qui sont les seuls souverains.
Neither him (Tandja) nor the junta who overthrew him are enjoying a cover of consitutional legality. Therefore, there is no way that we African citizens can judge the way we felt relieved.
It isn't any better to applaud blindly these junta. But to demand their neutrality in the prompt restauration of democracy.
[...]
We are optimistic for what will come next since, when things keep going wrong, then everything will go well in the sense wished by our peoples, who are the only holders of power.
At the citizen media portal Sahara Reporters, many commenters from Nigeria drew parallels between the situation in Niger and the one in their own country. Here are two samples:
OHYN:
This is what happens when civilian and civil institutions are too weak, too cowardly, too much “talk-talk-only,” to defend their own freedom from usurping so-called leaders. This describes Nigeria perfectly: so, Nigeria is next in the coup movement: it is only logical and ripe.
Toyin Ade:
There is no difference b/w what has happened in Niger & Nigeria b/c in Nigeria, we have souless, wicked & unpatriotic cabals holding us to ransom as Tanja did in Niger. If there should be any coup at all in Nigeria, it should be targetted at those useless clowns calling themselves Yar'Adua's kitchen/toilet cabinet that have arrogated to themselves what they don't have.
Daniel Hongramngaye from Chad, also draws a parallel between Niger and his own country at the blog Makaïla [Fr]:
Ce qui se passe sous nos yeux chez nos voisins nigériens doit à plusieurs égards inspirer nos officiers supérieurs, nos militaires, nos dignes soldats s’il en existe encore. [...]
La situation politique au Tchad est pourtant plus exécrable que celle du Niger.
En effet, Idriss Deby Itno est identique à Mamadou Tandja si non pire.
What is happening under our eyes in neighboring Niger, in many respects ought to inspire our officers, our military, our worthy soldiers if there are still any left. [...]
The political situation in Chad is more execrable than the Niger's.
Indeed, Idriss Deby Itno is identical to Mamadou Tandja if not worse.
World regions
Countries
Languages
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:56:14.000Z
|
omdswvk2b42hau2kmpnpgih2fwtt6mgp
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5676",
"uncompressed_offset": 140836368,
"url": "itismymind.blogspot.com/2005/10/new-documentary-on-emmett-till.html",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://itismymind.blogspot.com/2005/10/new-documentary-on-emmett-till.html"
}
|
cccc_CC-MAIN-2013-20
|
Wednesday, October 12, 2005
New documentary on Emmett Till
There a video from CBS 2 Chicago with regards to a documentary on Emmett Till's lynching back in August 1955. Emmett's cousin, Simeon Wright is interviewed by Channel 2's entertainment reporter Bill Zwecker on a segment known as Zwecker's people. The Till case was back in the news earlier this year when in an effort to obtain justice for Emmett, who was 14 when he was murdered, when his body was exhumed.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:57:09.000Z
|
ixnmsa5smnchuomk4w35t46vqzasjlvj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5680",
"uncompressed_offset": 145716027,
"url": "journals.tdl.org/icce/index.php/icce/article/view/3666/0",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://journals.tdl.org/icce/index.php/icce/article/view/3666/0"
}
|
cccc_CC-MAIN-2013-20
|
WATER WAVES PROPAGATING ON BEACHES OF ARBITRARY SHAPE
Y.Y. Chen, H.H. Hwung
Abstract
When a small amplitude wave climbing along an arbitrary sloping beach from deep water toward the shore, the variation of characteristics in the process of wave motion has been described in this paper. From the results of theoretical derivation, it is found out that the variation of water surface and amplitude are function of beach slope) and dimensionless distance (kx~) from the shore. And under the condition of the beach slope is a = 0 and a = °o that the solution will become a progressive wave and a standing wave respectively.
Keywords
wave propagation; beach slope; waves on slope
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:58:36.000Z
|
sz6sx7s4npjdkvfynau5252ttl3kzzdd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5702",
"uncompressed_offset": 195591065,
"url": "palsolidarity.org/2013/02/action-not-words-stop-eu-funding-of-israeli-military-companies-and-illegal-settlements/",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://palsolidarity.org/2013/02/action-not-words-stop-eu-funding-of-israeli-military-companies-and-illegal-settlements/"
}
|
cccc_CC-MAIN-2013-20
|
A step in the right direction; as EU consuls urge sanctions against settlements, we call for an all-out suspension of trade agreements with Apartheid Israel
28 February 2013 | Palestine Solidarity Campaign and International Solidarity Movement
The European Union is actively supporting Israel with its current trade agreements. Enough is enough; keep the pressure up, 2013 is the time for justice in Palestine.
As more and more of us become aware of the systematic denial of Palestinians human rights by Israel military occupation, it is time to make our elected representatives aware of the growing and unstoppable pressure for peace and justice.
The EU should be playing a leading role in implementing policies to ensure that Israel ends its illegal occupation, uphold international law and respect Palestinian human rights.
Instead, they are supporting Israel’s occupation by:
• allowing illegal settlement products to be traded across Europe
• by using EU tax-payers money to fund Israeli military companies that are responsible for killing civilians and supporting Israel’s military occupation
As recommended by European Union consuls general in East Jerusalem and Ramallah in a recent report, the European Union must divest from settlements and economic sanctions should be put on bodies and companies involved in settlement industry. A report submitted to the UN´s Human Rights Council by an independent fact-finding mission, has also called on all relevant international actors, private or state-connected to take “all necessary steps” to ensure that they were respecting human rights, “including by terminating their business interests in the settlements”.
This is a step forward but not enough; keep the pressure on EU representatives to suspend trade agreements with Israel until they fully and completely abide by international law.
It is time for actions, not words. Tell the EU to act now.
Read the full letter and sign the call here today: http://psc.iparl.com/lobby/96.
Send letters to EU Prime Ministers and Foreign Ministers (in all EU languages!)
Send letters to Members of European Parliament (MEPs) (in all EU languages!)
Please, send letters today and spread widely.
When people lead, governments follow.
Sign up for ISM Email Digests
From the Archives
Ynet: “Israeli professor: UK boycott justified”
June 1, 2006
Yedioth Ahronoth, 31st May 2006. Professor Rachel Giora of the University of Tel Aviv backs boycott on her colleagues with different views; ‘I support every form of open criticism against the current policies of the Israeli government,’ she says In a special interview with Yedioth Ahronoth, Professor Rachel Giora of Tel Aviv University gives her reasons for...
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:25:46.000Z
|
rj4evnrpuceq2poszz3zsyevvpbzedoj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5703",
"uncompressed_offset": 195629511,
"url": "panarmenian.net/eng/news/118839/EIB_ready_to_discuss_NorthSouth_transport_corridor_funding_tranche_3",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://panarmenian.net/eng/news/118839/EIB_ready_to_discuss_NorthSouth_transport_corridor_funding_tranche_3"
}
|
cccc_CC-MAIN-2013-20
|
EIB ready to discuss North-South transport corridor funding tranche 3
PanARMENIAN.Net - On August 8, Armenian Minister of Transport and Communications Gagik Beglaryan met with European Investment Bank (EIB) director of planning and settlement of operations Heinz Olbers.
Minister Beglaryan commended EIB for the cooperation, stressing the need for speeding up preparatory works for Armenia-related programs.
Issues related to the schedule of technical analyses and preparatory works were further discussed.
EIB expressed readiness to allocate USD 50 mln. to repair Vanadzor-Bagratashen 92 km highway (border with Georgia).
Mr. Olbers accepted Minister Beglaryan’s proposal on speed-up of Armenia-related programs, with EIB voicing readiness to discuss North-South transport corridor funding tranche 3.
Partner news
Top stories
IFC invested $244 million in 40 projects across a range of sectors, including financial markets, manufacturing, and mining.
Armenian Prime Minister addressed a letter to Public Services Regulatory Commission over the reconsideration of gas prices.
Armenia’s Public Services Regulatory Commission plans to reconsider electricity generation and distribution prices.
Edmon Manukyan been addressed by the residents of Armavir and Aragatsotn provinces whose crops have been damaged over a strong hail.
Partner news
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:39:08.000Z
|
kfjik5ugk6fr3eovf2f66xxggkwnmvfa
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5722",
"uncompressed_offset": 212954806,
"url": "quotationsbook.com/quote/22139/",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://quotationsbook.com/quote/22139/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
During the last century, and part of the one before, it was widely held that there was an unreconcilable conflict between knowledge and belief. Einstein, Albert
This quote is about knowledge · Search on Google Books to find all references and sources for this quotation.
A bit about Einstein, Albert ...
Albert Einstein (March 14, 1879 - April 18, 1955) was a German-American theoretical physicist of Jewish descent, born in Ulm, Germany, who is widely regarded as the greatest scientist of the 20th century. He proposed the theory of relativity and also made major contributions to the development of quantum mechanics, statistical mechanics, and cosmology. He was awarded the 1921 Nobel Prize for Physics for his explanation of the photoelectric effect in 1905 (his "miracle year") and "for his services to Theoretical Physics."
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T04:47:04.000Z
|
42mft3neyhduqhnwwf7opqwpm4ioblc4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5723",
"uncompressed_offset": 212961411,
"url": "quotationsbook.com/quote/39537/",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://quotationsbook.com/quote/39537/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
Life is a journey that must be traveled no matter how bad the roads and accommodations. Goldsmith, Oliver
This quote is about travel · Search on Google Books to find all references and sources for this quotation.
A bit about Goldsmith, Oliver ...
Oliver Goldsmith (November 10, 1730(?) April 4, 1774) was an Irish writer and physician known for his novel The Vicar of Wakefield (1766), his pastoral poem The Deserted Village (1770) (written in memory of his brother), and his plays The Good-natur'd Man (1768) and She Stoops to Conquer (1773).
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:07:40.000Z
|
w3ptwqefj2vbi634gfillmy7nrzmlmif
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5724",
"uncompressed_offset": 212967830,
"url": "quotationsbook.com/quote/5547/",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://quotationsbook.com/quote/5547/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
We only think when we are confronted with problems. Dewey, John
This quote is about challenges · Search on Google Books to find all references and sources for this quotation.
A bit about Dewey, John ...
John Dewey (October 20, 1859 June 1, 1952) was an American philosopher, psychologist, and educational reformer, whose thought has been greatly influential in the United States and around the world. He is recognized as one of the founders of the philosophical school of Pragmatism (along with Charles Sanders Peirce, Oliver Wendell Holmes, Jr., and William James), a pioneer in functional psychology, and a leading representative of the progressive movement in U.S. education during the first half of the 20th century.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T04:48:34.000Z
|
4z2ciokke3cyyk6lzzgefcrao2lyicbb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5725",
"uncompressed_offset": 212989528,
"url": "quotationsbook.com/quote/gift/29889/",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://quotationsbook.com/quote/gift/29889/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
Do not waste a minute -- not a second -- in trying to demonstrate to others the merits of your performance. If your work does not vindicate itself, you cannot vindicate it. Higginson, Thomas Wentworth
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:04:03.000Z
|
khc4qlhpfoidako7kxd3p34ig5jba33z
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5726",
"uncompressed_offset": 212995099,
"url": "quotationsbook.com/quote/gift/38799/",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://quotationsbook.com/quote/gift/38799/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
It's the little details that are vital. Little things make big things happen. Wooden, John
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:33:57.000Z
|
2njvh2qvcnept2t7xz6b7tkcznh2itc6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5727",
"uncompressed_offset": 222497650,
"url": "robots.net/robomenu/988931108.html",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://robots.net/robomenu/988931108.html"
}
|
cccc_CC-MAIN-2013-20
|
Shadow
built by H.Gendov
Target Environment Locomotion Method
Indoors 4 Wheels
Sensors / Input Devices Actuators / Output Devices
bump switches
optrons
5v relays
DC motors
Control Method Power Source
Tethered 5 volt external supply
CPU Type Operating System
Intel 80x86 Windows 95/98/NT/2K/CE...
Programming Lanuage Weight
C++ N/A
Time to build Cost to build
2 days for basic prototype about $10
URL for more information
N/A
Comments
MY FIRST ROBOT !
Robot Name : SHADOW
Hardware,electronic circuits - H.Gendov
Programer ( Microsoft Visual C++ ) - V.Stavrev
Function of the robot are :
1) Education to basic robotics ,programing
2) Research of AI and AI systems
3) Just 4 FUN and robo-games
We use a old toy-car,10 meters ribbon cable to connect robot to PC parallel port, one DB-25 connector,8 - 5V relay,5 - optrons,plastic box,2 - bump switches, 5v external power supply.........
We have a problems only with software development.
Time to build - 2 days for basic prototype "SHADOW" Cost - about 10$ Now we mounted on robot color video camera with rotating servo. In future we build SHADOW 2 robot with more sensors,inrared comunication radio modem,and video sender. who can help with parts or info can write to this E-Mail-s: TazDevil_bse@yahoo.com Vasilen_soft@yahoo.com
Sorted by Robot
<< PreviousNext >>
Sorted by Builder
<< PreviousNext >>
Sponsored Ad
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:55:03.000Z
|
57ax4sabonm2wmpxj7ktogghi7xqypxs
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5780",
"uncompressed_offset": 288721749,
"url": "wikitravel.org/wiki/en/index.php?curid=12171&diff=1979250&oldid=1979236&title=Dali",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=Dali&curid=12171&diff=1979250&oldid=1979236"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Difference between revisions of "Dali"
From Wikitravel
Jump to: navigation, search
Line 1: Line 1:
'''Dali''' (大理; ''Dàlǐ'') [http://www.dali.gov.cn/DefaultStyle/DefaultStyle_NewPage.aspx?PageId=78114] is a city in [[Yunnan]] Province in [[China]] famous for its old town, Bad Monkey Bar, handicrafts, Mitch & Si Yu. It is an amazing place for Shenzhen degenerates to travel to for CNY and get absolutely wasted for a few days. Boozing, women, and the green stuff... it doesnt get better!
+
'''Dali''' (大理; ''Dàlǐ'') [http://www.dali.gov.cn/DefaultStyle/DefaultStyle_NewPage.aspx?PageId=78114] is a city in [[Yunnan]] Province in [[China]] famous for its old town, Bad Monkey Bar, and handicrafts. It is an amazing place for Shenzhen degenerates to travel to for CNY and get absolutely wasted for a few days. Expect lots of whiskey, good music, fireworks galore, boozing, druging and thuging.
+
==Understand==
==Understand==
Dali is one of the most popular spots for independent China travellers and hugely popular with those working, teaching and studying in China. 50 minutes by plane or three to four hours by bus from Kunming, Dali is the perfect place to relax.
Dali is one of the most popular spots for independent China travellers and hugely popular with those working, teaching and studying in China. 50 minutes by plane or three to four hours by bus from Kunming, Dali is the perfect place to relax.
Revision as of 10:30, 9 January 2013
Dali (大理; Dàlǐ) [1] is a city in Yunnan Province in China famous for its old town, Bad Monkey Bar, and handicrafts. It is an amazing place for Shenzhen degenerates to travel to for CNY and get absolutely wasted for a few days. Expect lots of whiskey, good music, fireworks galore, boozing, druging and thuging.
Contents
Understand
Dali is one of the most popular spots for independent China travellers and hugely popular with those working, teaching and studying in China. 50 minutes by plane or three to four hours by bus from Kunming, Dali is the perfect place to relax.
Dali is the capital city of the prefecture of the same name. It consists of Dali New City (下关; Xiàguān) and Dali Old Town (古城; Gǔchéng). Travellers visit Dali Old Town for its traditional architecture, minority cultures (mostly Bai but also with many Yi and Hui) and simply to relax. The Old Town has a population of 40,000 and the entire Dali Prefecture around three million people and an area of over 10,000 sq km. When discussing Dali, it is important to be clear whether you are talking about the entire city or just the Old Town. There is actually much to do and see in Dali City well outside the Old Town.
With the beautiful Cangshan Mountains a short distance to the west of Dali Old Town (4,122 metres at the peak) and Erhai Lake a few km to the east, it has a perfect natural setting. The climate is temperate with moderate summers and mild winters, though it can get rather windy in autumn and winter.
Despite its fame as a backpacker heaven, Chinese tourists hugely outnumber foreigners. Chinese tourists tend to stay in nearby Xiaguan Town so Dali becomes thankfully quiet in the evenings. Dali has recently been overshadowed by nearby Lijiang, and many foreign tourists either bypass it or give it 1-2 days stay. Dali deserves better than 1-2 days stay.
History
Dali has a long and rather glorious history. In 738 the Nanzhao Kingdom was established with Dali as its capital and covered a large area of Yunnan and northern Burma and parts of Sichuan and Guizhou. The original capital of the Nanzhao Kingdom was located in Weishan (within Dali Prefecture) and later moved to sites around Erhai Lake. The territory conquered was quite substantial and held over a long period. The kingdom survived almost 200 years and had 13 kings before collapsing. After several decades of chaos the Kingdom of Dali emerged in 937.
The Kingdom of Dali established by Duan Siping in 937 was controlled by the Duan clan and survived until conquered by the Mongols in the 12th century. The Kingdom retained a close alliance with the Tang Dynasty, and was one of the major transit points for the introduction of Buddhism throughout the rest of China. By 1000, Dali was one of the 13 largest cities in the world.
1856-1872 Dali was the headquarters of the Panthay Rebellion led by Du Wenxiu. That rebellion commenced as an uprising against local oppressive rulers by the Hui muslim minority and ended as open rebellion against the Qing Dynasty. The Palace of Du Wenxiu is on Fuxing Road and serves as the local museum (the museum exhibition on the rebellion paints it as a patriot workers revolt which it was not). The rebellion was brutally crushed by the Qing and hundreds of thousands of Yunnan muslims were killed in revenge.
Many local people in Dali have the surname Duan to this day (rare in other parts of China). These historical events are immortalised in the Martial Arts literature of Hong Kong author Jin Yong (read by every Chinese school kid), giving Dali a fame nationwide. Both the Nanzhao Kingdom and the Kingdom of Dali had a military alliance with the Tang Dynasty against the aggressive Turfan (Tibetan) Empire which made regular and aggressive incursions into their respective territories.
The rulers of the original Nanzhao Kingdom were probably precursors to the modern Yi peoples, while the Kingdom of Dali rulers were precursors to the modern Bai minority.
A huge memorial stele to the Pacification of Kingdom of Dali was built during the Ming Dynasty and remains standing at the end of Sanyue Street past the city's West Gate. Entrance is free. The Mongols destroyed the old capital and palace of the Kingdom of Dali, located just to the south of the Three Pagodas. Almost all records of both the Nanzhao and Dali Kingdoms were burnt or destroyed, leaving much unknown about these periods. In addition, the Mongols brutally displaced many of the inhabitants of the prefecture, with the result that Bai minority people were forced as far east as Hunan Province. Many ethnic Han also moved into the Kunming area during this period.
The old Dali City was rebuilt in the early 1400s by the Ming Dynasty. What you see in Dali Old Town today is the rebuilt Ming town. Since then, the fortunes of Dali have declined and its importance as a cultural and economic centre in the Yunnan area have been overtaken by Kunming, the provincial capital.
Get in
By bus
Buses from Kunming West Bus Station take about 4,5 hours and cost 100 yuan for an ordinary bus and around 130 yuan for an express luxury bus, and will bring you to Xiaguan (Dali New City). Some buses go to Dali, too, so check with the driver. In Xiaguan, there are three different bus stations, to reach the train station, go east along Jianshe Lu and Dianyuan Lu. From Xiaguan Train Station (in Dali New Town) you can take bus 8 and bus 4 (1.5 yuan, 20 minutes) to Dali Old Town 13 km to the north (Bus 4 also runs through the town). It's also possible to catch a white mini-bus on Jianshe Lu that run between Xiaguan and Dali, there's usually a white sign displayed inside the front wind shield that reads (大理<->下关) in Chinese. The cost for the mini-bus is 3 yuan per person. Taxi fare between Xiaguan and Dali should be around 40 yuan.
If the expressway is closed or under construction the bus may opt for the more scenic route akin to the notorious "road of death" in Bolivia, though paved.
Buses coming south from Lijiang are about 60-80 yuan and stop outside the old town, from where it is possible to get a taxi or walk to the main guesthouses. You can save about 20 yuan on the Lijiang bus by simply hailing one on the highway east of the old town.
There is a bus service to Xiaguan from Jinghong, Xishuangbanna province, which has buses running at 17:00 and 21:30, possibly earlier too. The ticket price was 195 yuan and the journey was about 17 hours. The bus used on this route is a sleeper bus so you get a fairly comfortably bed and a blanket. This service may be useful for people who have arrived in China from northern Laos, e.g. Luang Namtha.
By train
There are several night trains from Kunming to Dali Train Station (in Dali New City) leaving 8PM-11PM, and arriving from six to eight hours later. The cost is ¥105 for a night trains sleeper bunk, and ¥31 for day trains hard seat. Bus 8 to the old town leaves regularly for ¥1.5 from just outside the station, terminating at the West Gate. There are currently also 2 trains daily from Lijiang to Dali and back. The ride takes nearly 2 hours. Cost is 30¥ for hard seat. The train actually only has hard sleeper cars, but you are not allowed to lay down.
By plane
Dali has an airport located to the east of Dali New City, about 45 minutes drive to Dali old town. There are no airport busses. Taxis are waiting but cannot always be trusted to take you to the guesthouse/hotel you want to go to as they get commission at a lot of hotels. Better book an airport pick-up with the hotel you booked. Flights from/to Kunming: only morning flights at the moment (Nov, 2009). Depending on the time of year you can get discounted tickets (around 400 yuan one way Dali-Kunming) but you will need to book well ahead. Full price is 750 yuan (680 + 70 airport tax, nov 2009). From major Chinese cities (Beijing, Shanghai, Guangzhou) it is possible to book a flight to Dali but always with a stopover in Kunming. Best discounts apply to tickets booked 15 days+ in advance.
Alternatively, you can go to Kunming Wujiaba International Airport by plane. It is located in the southeast of Kunming, the capital city of Yunnan Province. (It is one of the most important and the busiest international airports of China.) You can then take the Airport Shuttle bus [2] from Kunming airport. They operate 6:30-22:00 (Beijing time).
Get around
Dali Old Town is small enough to get around on foot, and being laid out in a grid format it is relatively easy to navigate. The major landmarks are the South and North Gates with Fuxing Road running between them, and Yangren Street (Westerner's Street) lined with cafés and tourist shops. City maps are readily available for around ¥5 but tend not to follow the usual north-at-the-top standard because the natural orientation of someone in Dali is to look towards the huge looming Cangs Mountain which runs north-south next to the city. As you look at the mountains and face west, the lake is at your back, or east. This method of orientation makes even more sense when you realize that the entire town gently slopes from the mountains to the lake, making those two landmarks a natural way to find your bearings.
Bikes are also available at many guesthouses and rental huts around town and cost ¥5-40 per day. Bikes vary greatly in quality so shop around for the best deal. The Chinese brands Merida and Giant are among the better ones to consider.
Taxis in Dali Old Town generally cost ¥5 for under 3km (though most drivers will ask for ¥10). For other locations outside the old town, all prices are negotiable. A taxi to Dali New City will cost around ¥40.
In addition to the Old Town, Dali is a Prefecture of over 10,000 sq km. A whole range of destinations exist within the Prefecture that are perfect for the adventurous traveller. All are relatively easily accessible from either Dali Old Town or Dali New City, the major city 13km to the south. A lot of useful information is available from the cafes within the old town on day trips around the prefecture.
By bus
Xiaguan Northern Bus Station
Destinantion Price (¥) Departures (HH:MM) Duration (HH:MM) Lunch-Stop Last Update
Jianchuan 31.00 Every 15-30 mins from 6:20AM to 6:50PM. 3:00 approx. No 18 March 2010 (price November 2012)
See
Cangshan Mountains
If you visit Dali, plan to spend at least one day up in the mountains. You can also overnight at guesthouses behind Zhonghe Temple, enjoying the most blissful peace and quiet available in China. Well worth it!
The mountains are a national level Geopark and Nature Reserve and have much to offer plant, bird, flower and hiking enthusiasts.
Normally you'll take one of the chairlifts up the mountains and hike about 3-5 hours to the other chairlift to go down again (as of Apr 2012, the Zhonghe chairlift is not operating. As of August 2012 there seems to be a new chairlift going up to around 4.000 meters. Get tickets early, because they seem to stop selling them around 12. Price is a lot more than in the past, around 230 Yuan).
Cloud Traveller's Path
The path, called Cloud Traveller's Path, is extremely well built and in a better condition than many sidewalks in Chinese cities. It's supposed to be at an altitude of 2500m. Most signs along the way are in Chinese and English. There are chairlifts at Zhonghe and Gantong Temple. It makes sense to take them because the hike up the mountain is not that great, the paths are hard to find and rather painful.
Start at Zhonghe
As of 24/10 there are multiple road closures if you ascend by foot from the North side (where Zhonghe temple is). After dragon eye cave in the south and the north path is also closed.
From Zhonghe Temple you have a choice of paths running North or South, with each offering equally spectacular views of the mountains, valley and lake. Chairlift entrance is at walking distance from the city / Lily Pad / Jade Emu.
• The northern route of 6km of path offers one of the sharpest cliff views of the entire Dali valley, and on a clear day you can see Jizu Mountain well beyond Erhai lake. At the bend in the main valley it also offers a path up the mountains for 2 km which ends at a mountain pool where you can take a swim on a warm day.
Northern view on the Cloud Path in the Cangshan Mountains
• The southern route winds down for 11 km through a few valleys to Gantong temple. This hike will lead you to most of the sights mentioned below and will take 4-5 hours. You can even turn this into an 8 hour hike if you continue southwards Xiaguan along good paths (with several early exit points down the mountain) and enjoy the spectacular view.
• A suggested route would be to take the chairlift up to Zhonghe Temple, take the northern path for 3km enjoying the clearest view of the entire valley, then head back south past Zhonghe Temple towards Gantong Temple. You can buy refreshments at the temple, so take a break, then keep walking the full 11km until you reach Gangtong. If you are not up to the full walk, you can exit the mountain about 3km past Zhonghe Temple down a well made stairway behind Dali Tianlongbabu TV City.
Start at Gantong
You can also start Gantong temple and go the opposite direction. This seems to be the common way for Chinese tourists. If you go by public transport, take bus 4 (1.5y) and stop at guan yin tang (near a temple), after you need to walk about 30mn up to go to south chairlift.
As of 24/10 there are multiple road closures if you ascend by foot from the North side (where Zhonghe temple is). After dragon eye cave in the south and the north path is also closed.
Fees
Entrance to the Mountain Park costs ¥30 purportedly for keeping the mountain clean, and the chairlift 80 ¥round trip or ¥50 one way.
A taxi to/from the Zhonghe temple chairlift is ¥15, to/from Gantong temple (about 8km South of the old town) is ¥30.
If you are particularly dedicated, you can gain an access (also ¥30) to the mountain by taking a longer route behind the One Pagoda (follow the stone road) and up the stairway behind the Dali Tianlongbabu TV City.
Scenery
Each of the 4 valleys you walk through offers spectacular views of both the mountains and forests as well as the entire Dali valley.
The 7 Dragon Maidens pool, 6km from Zhonghe temple is a stunning set of mountain stream pools of varying colors and one of the highlights of the walk. (The pools are closed for construction work until Oct 2010.) In Aug 2010 the Phoenix' Eye Cave was also closed for unknown reasons. Both the pools and the cave are still closed as of May 2012.
Wildlife
The mountains themselves are home to beautiful wild camelias, orchids, rhodedendrons, azeleas and abundant birdlife. Dali is home to some of the rarest camellias in China and Cangshan was the source of most of these. The stock for most azealas grown in Europe was sourced from wild azealas on Cangshan. Most of the lower slopes are covered in replanted pine forests, with higher slopes, and steep valleys showing areas of more natural forest cover.
Wild azaleas in the Cangshan Mountains
The Temples
Zhonghe temple itself is an old Daoist temple and well worth a visit (but please do not make donations as the monks are nothing of the sort and have subcontracted the temple as a profit-making exercise).
Other sights
• Erhai Lake Villages (洱海湖山庄). . A total of 17 villages are spread along the Western shore of the Erhai Lake between Xiaguan and Xizhou. Take a tour by bike by riding East from Dali Old Town until you reach the lake in Caicun Village and then North beside the lake shore taking local paths and roads. A great opportunity to see village life at its best, meet locals, see the Banyan trees in each village square and admire local architecture. There are 3 Qing Dynasty bridges along the route.
• Erhai Lake. Visit Guanyin Temple and several islands. Go with a group and enjoy a great day out. Boats can be easily arranged as the owners come into town to drum up business and you can see what you are getting from the photobooks they carry. Ferry rides at real stations cost around ¥30. There are signs indicating that fishing boats and paddle boats can't carry tourists, although it is unclear what the definition of tourist is.
• Butterfly Spring, (If you really want to see this you can catch a minibus from outside the west gate). A shallow pool that periodically swarms with countless butterflies. Otherwise the site includes a fairly nice park, a small butterfly breeding centre and an uterly bizzare exhibition hall with various pictures made from hundreds of dead butterflies of different colours which were presumably raised and killed on-site. (Local guide informed that butterfly no more because of pollution - September 2009) ¥60.
• Wase Market. Combine a trip to Erhai Lake with a visit to the Wase Market on the eastern shore of the lake. Wase is a traditional and conservative Bai town with a weekly market aimed at both townpeople and nearby farmers. The market offers an interesting look at life in a quiet country town.
Dali's famous Three Pagodas
• Tang Dynasty Three Pagodas, (10 minutes by bike to the northwest of Dali Old Town (next door to Three Pagodas Hotel)). Offering one of the best preserved Buddhist structures in China. However, the compounds behind the pagodas were destroyed during the 1920s earthquake and later in the Cultural Revolution and were rebuilt starting in 1986. The Central Pagoda is almost 1200 years old and represents a period when Dali was a Buddhist Kingdom. The Congshen Temple behind the Three Pagodas has recently been rebuilt and reopened, after deteriorating in the 20th century due to earthquakes, fires and the Cultural Revolution. It is a massive complex that continues far up the mountain, where a climb to the top of the pagodas rewards with a beautiful overlook of Dali Ancient Town and Erhai Lake. Worth a visit for the Tang architecture, numerous statues of the Buddha and Guanyin with influences from both India and China, dragon fountains, and two small museum showcases. ¥121 (student ID gives a 50% discount).
• Shaping Market, (About 30km north of Dali). Shaping Town offers a lively weekly market with plenty of local color. The market starts early. A great chance to see local farmers out in force and literally watch plenty of horse trading. Not much to buy (unless you are a farmer) but gives you the feeling of life in a small country town.
• Xizhou, (About 20km north of Dali, can be visited on the way back from Shaping Market). Xizhou has almost 200 national heritage listed private houses dating from the Qing Dynasty. The houses are among the best examples of traditional Qing architecture in China and are exquisitely detailed. Chinese style with local touches. Building craftsmen from Xizhou were famous throughout Southeast Asia and travelled to Vietnam, Myanmar and throughout Southwest China to build and decorate houses. When they made their fortune, they returned to Xizhou to build their own dream home. As most of these houses are currently occupied, you will need to be on your best behaviour, knock and enter with permission. The best way to see the finest examples are with a local guide as many of the interesting houses are difficult to find. Nonetheless, with a little legwork and good manners you can locate plenty of interesting architecture on your own. The family estate of the Yan clan is preserved as a museum and open to the public, and while an excellent example of the architecture of the very rich is too commercial and compares poorly with more ordinary family homes in the township. Just this year (2012) a new tourist robbery place have been opened near at the entrance of the city, it has the name of (喜韵居) they ask for entrance ticket (20 yuen) or in the national holiday obligatory performance ticket (60 yuen), but it is actualy just a shopping place (tea/silver) with new buildings.
• Dali Bai Nationality Autonomous Prefecture Museum, Erhe Nanlu 8, Xiaguan, Zip: 671000 (云南大理市下关洱河南路8号, 邮编: 671000) (In the modern part of Dali, Xiaguan; take bus 8 from the old town and get off after the bridge, follow the river east (left) until just before the next bridge), 0872-2128614. closed between 11:30 and 14:00. Worth a visit. It has an extensive collection of exhibits, with most signs in both Chinese and English. The museum grounds are beautiful as well, the exhibits are set around a traditional garden. Free, but requires ID to enter.
• Eryuan, (West of Dali). Eryuan is a small town next to Cibihu lake. After taking a bus that leaves every hour for ¥13/p from the intersection with 214 National Road near the North Gate market you can get off in Eryuan town or anywhere along the way. If the bus is overloaded the bus driver's assistant will walk past police checkpoints with passengers that didn't have a seat. Cibihu lake is about 3km downhill from the usual bus stop in Eryuan. Very few motorbikes for hire go to the lake, so if you walk in, expect to walk out.
• Chiyumo art space (赤与墨), No.C1 Hong Long Jing Rd (Dali Old Town), (), [3]. Gives the opportunity to international artists to come exchanging an artistic experience in Dali, Yunnan, including Exhibition Shows, Artist in Residency programs, Artistic Creation and Meetings, indeed Collaboration with Chinese and foreign artists living in Dali.
• Foreigner Street (洋人街) In the ancient city of Dali," the road" in the beginning of Yunnan people against Yuan Shikai proclaimed himself Emperor, named after the war of asylum. The road east-west,1000 meters long,7 meters wide, green stone pavement. Dali of Foreigner's Street is located on the road in the West Dali section of.
Rock Climbing in Dali, China
• ClimbDali (大理攀岩), 20 Renmin Road, +86 131 50644701, [4]. Since 2008, ClimbDali has been leading the development of rock climbing in Dali, with 70 routes spread across 4 different crags since 2008. Visit website or shop in Dali Old Town for more info on rock climbing, hiking, kayaking, rafting, and cycling tours.
• Jizu Mountain (lit. Chicken Foot Mountain), (Further away from Dali to the northeast behind Wase on the east side of Erhai Lake, take a bus (2 hours) from Xiaguans Northern Bus Station to Binchuan and from there change to a minibus or bus (1 hour)). The mountain and its ranges look like a chicken's foot. Actually a 2-3 day trip in its own right. The top and slopes are covered in temples, many in a state of disrepair. Some have been restored and have resident monks. This is a difficult hike with the summit at 3200 metres. Be prepared. Or there are horse rides and a cable car that starts halfway up.
• Studying traditional Chinese martial arts, [5]. Study with Wudang Mountain Daoist monk Zhou Xuanyun.
• Rice and Friends Cooking School Dali (米饭和朋友们), (meeting point is the bad monkey bar, 59 renmin road), +86-151-2526-4065, [6]. The newly opened chinese cooking school target at westerners, that want to take some culinary skills back home. Courses are limited to 8 people and include a market tour, a brief introduction to chinese cooking theory and a hands-on 3 courses cooking workshop. Classes start at 10AM and take until afternoon. Teacher speaks very good english and lived overseas for a while. Tells you, how to replace ingredients with western alternatives if you can't find them at home. sign up the day before until 6PM ¥ 150 per Person.
• Johnny 'O palm reading, @Tibetan Cafe, (Remin Lu, across from Bad Monkey Bar). every day at 4PM. The guy, that looks like a retired Super Mario with dark sunglasses, reads your palm and gives your an interesting perspective of what happened to you in the past. Won't tell you the future until you explictly beg for it. Worth the ¥100 he's asking for. ¥100.
• Erhai Paradise, (By Erhai Lake). Certainly worth a visit. It is a magical Buddhist haven with giant statues, empty amphitheaters, demon-statues, tea gardens and an artificial beach. One way is to hire a taxi driver form Dali or Xiaguan for the entire day and negotiate a price. The driver can take you to the boat jetty and show you onto the island ferry. You will sail across the lake. Explore the island and come back by boat, where your driver will be waiting to take you to a restaurant for dinner, or temples and bars as you wish. However this is really unnecessary as there is never a shortage of taxi drivers waiting at the ferry and the local bus service is extremely inexpensive and accessible. Buses are lined up and ready to take you back to Dali at an intersection just 5 minutes walk down the road leading to the ferry. Total for the day about ¥500.
• Xiaguan Hot Springs (下关温泉), (From the train station take bus 21 (Bus 8 runs from the Old Town to the train station)). This swimming pool is called a hot springs resort because it probably really uses naturally hot water. Other than that it might be a little different from what most people might expect. These days it is a regular, pretty run down swimming pool (one pool on the inside, one on the outside, otherwise identical) with all the spa's (that are still on the price list) being closed. Interestingly there are places to stay in the resort with rooms around ¥280. ¥12.
• Peter's tourist center (李震票务中心), #65 Bo Ai Street, Dali Old Town, Yunnan,China中国 云南 大理古城 博爱路65号, 86 15125296978,e-mail:peter_lizhen@hotmail.com. fluent english speaking with 3 years in arranging tours around dali,specially cultural tours,like shaxi day tour andYi,Bai,Hui minority markets and villages.Air/bus/train ticket booking,hotel/guest house booking
• Dali Hash House Harriers, [7]. This social running and drinking club takes to the streets and back roads of Dali Old Town on every 1st and 3rd Saturday. The start for runs is in the Courtyard of the Dali Hump Hostel, and runs start promptly at 2PM You can find out more by visiting dalihash.com The cost of the run is ¥20 which includes all you can drink. ¥60 for run, beer, and an all you can eat BBQ at the Dali Hump. Open to all nationalities and drinking orientations.
• Rock Solid Adventures (Located at SleepyFish Lodge), Dali Old Town, Yu Er Lu Extension (Near New East Gate), +86 87 22678040, [8]. Rock Solid Adventures has great custom trips to get out and enjoy some of the less known areas in Dali! They offer Cycling, Hiking, Camping, Caving, Rappelling, Climbing, Kayaking and other exciting trips. (25°42'6.24N,100°10'12.51E)
Buy
As ever, be prepared to bargain when shopping in Dali. See Yangshuo#Tourist_stuff for advice on prices in Chinese tourist towns.
Dali has a number of famous local products.
• Fried cheese - You might want to try the local rushan that is a crispy snack often wound around bamboo skewers. Available at many restaurants or from street stalls.
• Marble - Dali has exquisite marble (a little difficult to carry) which is carved into all sorts of products: vases, ashtrays, carved animals and more. The marble stone can also be cut and polished revealing pictures on the surface. These are known as chushi and can be bought framed and make beautiful wall decorations. Many people can mistake them for traditional Chinese paintings. Cheaper chushi (generally the white and grey type) will sell for ¥60+ per item. More expensive and colored stone with clear mountain landscapes can be priced at ¥10,000+. The Chinese word for marble is Dalishi or Dali stone, indicating just how famous Dali marble is throughout China.
• Tie-dye - The local tie-dye fashioned from dye and wax is also popular and cheap. One of the main production places is the Bai village Zhoucheng, about 40 minutes ride from Dali. This village also has a nice daily small afternoon market and some nice old Bai houses as well.
• Embroidery - You can also purchase beautiful minority embroidery (generally Miao minority from Guizhou Province) at a number of shops. The embroidered items include baby carriers, clothing or decorative patches that were attached to traditional costume.
• Teahouse - Dali has great teahouses. Relax in a teahouse regularly, buy a little tea and you will be welcome to come back at any time, with friends, usually for free. Sample new teas and as long as you buy something every so often, you will be welcomed again and again.
• Antiques - There are many antique shops very close to each other on Yù'ěr Lù (玉洱路). Start at the intersection of Yěyú Lù (叶榆路) and walk west. It can be very interesting to browse here. Even if you're not a regular collector you will probably be tempted to buy something when you see how badly some of these treasures are being handled and stored.
• Rock Solid Adventures, Dali Old Town, Yu Er Lu Extension (Reach them at SleepyFish Lodge (near new East Gate)), [9]. Rock Solid Adventures has great custom trips to get out and enjoy some of the less known areas in Dali! They offer Cycling, Hiking, Camping, Caving, Rappelling, Climbing, Kayaking and other exciting trips.
• Rock Solid Adventures (Contact at SleepyFish Lodge), Dali Old Town, Yu Er Lu Extension (Located at SleepyFish Lodge (Near New East Gate)), +86 87 22678040, [10]. Rock Solid Adventures offer unique tours that get away from the crowds and let you take in the beauty and cultural wonder of Dali. They do Cycling, Hiking, Camping, Caving, Rappelling, Climbing, Kayaking, Group and other specialized trips. (25°42'6.24N,100°10'12.51E)
• Rock Solid Adventures (Located at SleepyFish Lodge), Dali Old Town, Yu Er Lu Extension (Near New East Gate), +86 87 22678040, [11]. Rock Solid Adventures offer unique tours that get away from the crowds and let you take in the beauty and cultural wonder of Dali. They do Cycling, Hiking, Camping, Caving, Rappelling, Climbing, Kayaking, Group and other specialized trips. (25°42'6.24N,100°10'12.51E)
Eat
In the old town, Western food is widely available and cheap. For a traditional Chinese meal served catering for four people along with beer expect to pay ¥80. Western meals average around ¥25, including a bottle of the local beer. Breakfast prix fixe menus are served everywhere and average around ¥25 including coffee.
Fruit stands and corner stores abound. Try to get a feel for prices before buying if you want to avoid paying exorbitant prices. You can buy apples for ¥1-2/shijin (a half kilo), a bottle of water for ¥1.5 and noodles/dumplings for ¥4/plate.
Budget
• Golden Local-Style Noodles, Renmin Road (Near Fuxing Road, several storefronts to the left of Bad Monkey). Noodle shop that specialized in Cross-the-Bridge Noodles, a local specialty where a bowl of hot broth is brought to the table, and then the rice noodles and a number of plates with small quantities of other foods is immediately added by the waiter. The menu is all in Chinese, but there are pictures displayed throughout, and ordering should be no problem.
• Vegetarian, Beef and Pork Dumplings, Renmin Road. Great place for fresh homemade dumplings. Nine dumplings with sauce just made and freshly steamed only cost ¥3.5.
• Vegetarian Buffet (一然堂), Boai Road (north of Mingcheng Art Garden Hotel, just off of Boai Road). 11:30AM - 1PM, 5:30PM - 7PM. All-you-can-eat vegetarian buffet operated by Buddhists, the choices are usually four different vegetable dishes, soup, rice, and pickled vegetables. ￥5. (25.688928,100.160961)
Mid-range
Chinese
• Marley's Cafe, Huguo Road (Central Old Dali Town cross with boai), +86 872 267-6651. First floor restaurant. Bai dishes. Cheap and has a narrow balcony great for people watching.
• Om Shanti, 245 Renmin Road (East, down towards lake), +86 872 2679306. Vegetarian restaurant which serves great food and has a laid back atmosphere. The staff are very helpful too and can give you loads of helpful information.
• September, +86 872 267-0266. Sichuan food.
• Sun Island Cafe (太阳岛; Tàiyángdǎo), 324 Renmin Road (Towards the East Gate), +86 872 267-6075. A couple of steps away from the main tourist avenues lies this hybrid of Chinese and Japanese culture. Genuine Japanese food cooked up by the Chinese/Japanese/English speaking owner or relax to some chilled out music. The Japanese crew that manages the place might even throw a Jombei, Didgeridoo, Jews harp party which guests are more than welcome to join in on using any of the plentiful instruments. If the night creeps up on you after to many drinks or smokes then there is also a dormitory for ¥20 a night.
Western
• Bakery 88 (88号西点店; 88hào Xīdiǎndiàn), 88 Boai Road (博爱路88号; Bó'àilù) (Next to Cafe de Jack), [12]. This German style bakery is easy to spot and has a great cake selection visible from the street. Run by a long term German resident, Karine, popular with visiting foreigners and locals alike. Delicious.
• Black Dragon Cafe (墨龙咖啡馆 mòlóng kāfēiguǎn), No.42 Centre Square, Foreigner Street 人街中心广场42号 (In the alley two doors down from Bakery 88), +86 13330556685 / +86 872-2670535, [13]. 09:00-?. coffee and generous, mouth-watering meals - the wraps (chicken, beef, smoked tofu) are a speciality. An amazing collection of books to borrow or buy, from classics to the latest best sellers. 28. (25.693305199641248,100.15970885753632)
• Cafe de Jack (樱花园咖啡; Yīnghuāyuán Kāfēi), 82 Boai Road (博爱路82号; Bó'àilù), +86 872 2671572. Definitely Dali's oldest Western cafe. Has a fireplace, great apple pie, pleasant atmosphere and a great rooftop garden. While the menu is a little tired, the breakfast is good, the chocolate cake legendary, and the lasagne just delicious. Spread over three levels, Cafe de Jack is the largest and most successful of the backpacker cafe/bars in Dali. Very popular with locals and travellers alike. The owners, local brothers Jack and Tim, are often on hand to provide good travel advice.
• Goodfella's Pizza, No.20 Renmin Road, Dali 671003, China (Follow Renmin Lu (the same road as the Bad Monkey) all the way to the western edge of Gucheng, nearly to the highway.). Philadelphia native owner serves up the only authentic pizza pies in all of Dali. Locally sourced ingredients (ranging from sun-dried tomatoes to the spinach that goes into the pesto) are all incredibly fresh and delicious. Pizza not your thing? Perhaps the homemade hummus or upstairs bouldering wall will wet your whistle!.
• Jim's Peace Cafe (大理吉姆和平饭店; Dàlǐ Jímǔhépíng Fàndiàn), Boai Road (With Jim's Guesthouse). Excellent Tibetan goulash, vegetarian or with yak meat. All-you-can-eat banquet for groups of four or more, ¥30 a head. Various other dishes. One of the town's oldest traveller hangouts.
• La Stella's Pizzeria (新星比萨房; Xīnxīng Bǐsàfáng), 21 Huguo Road, Dali Old Town (护国路21号, Hùguólù), +86 872 2679251. A well-run operation making generous portions of delicious woodfired pizzas, pastas, salads and Chinese dishes at good-value prices. They also have a wide selection of alcoholic beverages. The staff speak English and there is a travel agent out the back of the three-storey restaurant. Worth a visit.
• LP café (咖啡), A18 Hong Longjing Road (红龙井A18号). LP café is the sort of place every neighborhood would be lucky to have. The staff is friendly, the food thoughtfully composed and prepared! LP café offers delicious deli styled sandwiches and snacks made with high quality ingredients to ensure that taste buds are titillated. Don't miss their great selection of imported wine and liquors.Last but not least, their amazing Lavazza expresso with a potent aroma and a flavour similar to freshly ground coffee, will satisfy coffee lover.
• Old Dali Four Seasons Inn (四季客栈; Sìjì Kèzhàn), 55 Boai Road (博爱路55号; Bó'àilù) (Near East Gate), +86 872 2670382. Great place to meet people and pick up travel tips; the Inn is a major backpacker hangout and everyone discusses their next expedition over breakfast. Unfortunately, this place relocated and no longer provide all-you-can-eat breakfast.
• Ruben's Belgian Waffles (比利时挖福饼; bǐlìshí wāfúbǐng), Corner of Fuxing Road and Honglong Jing (waterfall street), next to Dico's (红龙井和复兴路的十字路口,德克士旁边), +86 13577015005 (), [14]. 7 days 14:00-22:30. This Belgian waffle place with a small terrace next to the water is run by Belgian expat Ruben and offers different types of delicious Belgian waffles. You can choose between Liege-style and Brussels-style Belgian waffles, with a choice of several toppings (hot Belgian chocolate sauce, whipped cream, chocolate/strawberry/mango/blueberry ice cream, etc). There's also a wide variety of Belgian beers available.
• The Sweet Tooth (Sweet Tooth 甜点屋; Sweet Tooth Tiándiǎnwū), 52 Boai Road (博爱路52号; Bó'àilù) (On a corner in Dali Old Town). This cafe specializes in pastries and desserts. The cafe is owned and operated by the local hard of hearing. The owner, having studied culinary arts in the United States, produces delicious and high quality desserts, coffee, and milkshakes among other items.
• Tin Tin Belgian Waffles (丁丁 挖福), 241 RenMin Road, 671003 Dali, YunNan ( 云南 大理古城人民路241号 ) (near the Dali No.4 Middle School), +86 872 267 2211 (), [15]. Tu-Su 10:00-22:00. In the old city, offering Brussels-style Belgian waffles, with a variety of toppings including their hand-made ice creams and fresh brewed locally-grown coffee, plus hot and cold teas, fresh fruit juices, and milkshakes. Both indoor and outdoor seating Menu items priced ¥8-18 (US$1-3).
Splurge
Dali Wall Hump Garden (驼峰厨房-点苍虹鳟）. 53 Hong Long Jing. At the top of Hong Long Jing (waterfall street), right before the Hong Long Jing gate on the right. This newly opened restaurant specializing in Rainbow trout is set in a beautiful garden built over the remains of the original Dali wall. Dali's rainbow trout is considered the best in China, and spring water carried down from the mountains is used for every step of the cooking process. This is sure be one of your best dinning experiences in China.
Drink
A 500ml bottle of Dali Beer will cost you around ¥10-12 in a bar and about ¥3-4 from a grocer. A large selection of beer is on offer but some are coloured green and require an acquired taste. But for the price, there is no excuse not to sample the lot.
• Bad Monkey (坏猴子; Huàihóuzi), 59 Renmin Road, Dali Old Town (人民路59号; Rénmínlù), [16]. From 9AM. Dali's longest running foreign bar. It is hosted by two well-traveled Englishmen Carl and Scott who entertain guests before the dancing starts later in the evening with a Derek and Clive patter of jokes and one-liners. The Monkey is a magnet to travelers both foreign and Chinese (many of whom seem to wander in and never leave), as well as remaining popular with Dali locals. The bar has a pool table, dancing pole, a huge selection of local and imported beers and spirits (as well as their own pints of various Bad Monkey Beers on tap, made locally at the bar's microbrewery [17], and regular performances by bands and DJs. Bad Monkey also opens from 9AM in the morning as a cafe, providing real Western breakfasts; Thai, Indian, Chinese and Western cuisine are also available throughout the day.
• Sun Island Cafe (太阳岛). A cool relaxed place where people come with music to spin. Owned by A Chun, an awesome, friendly girl from Lin Cang, this is a place to come and meet people and listen to music. Well worth a visit for a few drinks, well worth a stay in the rooms they have for visitors in the courtyard.
• ClimbDali (大理攀岩), 20 RenMin Lu, [18]. Boulder bar offers bouldering (and shoe rental), cheap beer, and information on rock climbing around Dali.
• 非常麻辣烫 (Fēicháng má là tàng), Xiaguan, Renminjie (下关，人民街） (It may be hard to find since this is deep territory, but well worth a trip into Xiaguan, so bring a Chinese friend if you can't speak any Chinese, though if not, then if coming from Old Town in the north, ask a taxi driver to take you to the intersection of Tiānbǎo lù （天宝路） and Rénmín nán jiē （人民南街）, from there it's a short walk south and on the right hand side, though the signage will be in its Chinese name.). For most people who stay in Dali for more than a couple days, Xiaguan tends to get extremely short shrift. Dismissed as the more developed and industrial reminder of China that most foreign travellers in China want to blissfully forget, it contains more than a few gems that are regrettably passed over by the wash and lure of Old Town's all too visible tourist scene. This restaurant/bar makes an evening trip to the south of the lake worth it, though those wishing to stop there first while arriving in town would not be disappointed, since it tends to stay open late. They offer extremely kitschy Revolution-era Chinese military and cultural memorabilia decor, as well as one of the most friendly and talkative owners in the area (for those who speak Chinese, though you can always pretend you don't if you want a quiet evening), but the real deal is in the food and booze. Try their various homemade flavored liquors made from every fruit in the area, the Plum Baijiu is one of the favorites (梅子酒）. The food is just unpretentious and absolutely delicious local comfort food, the stir-fried erkuai with peanuts and chives (炒饵块) and dumplings tossed in chili sauce shouldn't be passed over. Vegetarian options are limited, though its still worth the trip as a strictly drinking place for those coming from the Old Town. This place is closing within a year [as of March 2012] because the local government wants to demolish their block to probably make way for some fancy apartment buildings or drab retail center, and as one of the more interesting places in China outside of the huge metropolises, with honest staff and excellent quality food and drink, it deserves your patronage. Support this place and let them know their business would still be appreciated in a new location.
• Neverland Cafe. On Bo Ai lu, has homemade wine and fruit wines, needs your help in advising how to blend good wines. Great baked potatoes with tuna fish topping. Owner speaks English and listens to Billie Holiday.
Sleep
Dali has some of the cheapest accommodation options available in all China. Lots of accommodation to chose from. Expect to pay ¥15-30 for a dorm bed, ¥40 and up for rooms, ¥60-300 for a double room with private shower and toilet.
Budget
Hostels
• Bird Nest (鸟窝), 22 Renmin Road (Tucked into a courtyard Bai house at the top of Renmin Road), +86 872 2661843, [19]. Unique atmosphere and very comfortable range of rooms from dorm beds, single, double and suite rooms to a private, 3 bedroom courtyard house with kitchen. Free wifi, 24 hour hot water, chill bar, good pizza and great Greek style yogurt. ¥30-500.
• Dali Hump, 53 Hong Long Jing (Go to the intersection of Hong Long Jing with Bo Ai Road. Walk up Hong Long Jing towards the mountains. We're last on the right.), +86 872 267 6933, [20]. Run by a community of artists, musicians, performers, writers, tea enthusiasts, and food lovers from across China and around the world. Musicians can play and get free meals, and special prices for artists. Dorms and private rooms set around a Bai traditional style courtyard, all with private balconies and en-suite bathrooms (24hr hot water). Stay for one week and the 7th night is free. Nightly music jam sessions. Free Djembe drum lessons. Outdoor bar, foreign and local beers. Free internet and WiFi. Nightly bonfires. Pool Room. Board games. Special rates for long term accommodation available. Regular events, parties and exhibitions. ¥18-180.
• Dali Mingtong Yinxian Youth Hostel, Caicun Dock, Dali Old Town, +86 872 2691261, 13888635082. Just right on the lakeside of Erhai Lake, you can see the enjoyable view of the whole lake from the terrace on the third floor. Located in a Bai village, it is very quiet there at night. Dorms ¥25, ensuite doubles from ¥80.
• Dali Three Pagodas Youth Hostel (Hostelling International), (Situated north-west of the old town, just west of the main road, and only a five-minute walk away), +86 872 2666398, 13529651981 (). This hostel is quite new, has friendly staff and is clean and pleasant. They are still working on the courtyard and gardens but they already look great. There is a large comfortable lounge with two PCs and free internet access, self-catering kitchen, roof terrace with great views and a travel service. The hostel is empty off-season.
• Five Elements (五行客栈, wu xing ke zhan), Dali oldtown West Gate Dazhifang 69 or the west side of 214 Highway, opposite of Hong Long Jing gate, walk north for 50 meters. or 500 meters south of the West Gate, on your right side (Directions), 86-130-9985-0360 (), [21]. Facilities include: Staff that are fluent in both English and Japanese, comfortable rooms, organic food, freshly ground coffee each morning, clean spring water, convenient location(2 mins walk to the town, and a beautiful garden area. Oh, and two cute golden retriever dogs. Drinks are also available. Dorm bed: Starting at 15 Yuan... A room with queen size bed: Starting at 90 Yuan....
• Mama Naxi Guesthouse Dali (Joker's Guesthouse), 88 Fu An Alley. Ren Min Lu (Walk to the East Gate on the Ren Ming Lu. Go right after the No.5 guesthouse (should be on your right). You should also see Wang Jia Zhuang Hotel written on the wall at the end of the street. Go there and than turn left. Walk until you reach the end and turn right. You will see Mama Naxi.), +86 872 267 1168,+86 015198320421, [22]. This is the Mama Naxi in Dali offering the same services as the famous one in Lijiang. Competitive rates for clean comfy dorms, double and triple rooms. Quiet, convenient location with friendly, knowledgeable English-speaking staff. Free internet and WiFi. Bike rental. Bus, train and airplane bookings. Discount tickets for local sights. Breakfast and family dinner. There is a nice courtyard to sit and meet other people. ¥20-.
• Dragonfly Garden Guest House, (Erhai Lake, a short ride on bus 2), +86 15912600503, [23]. Beautiful gardens with mountain view. DVD players in rooms. Set in authentic Bai village next to great swimming spots. Rooms ¥10-100.
• Higherland Inn, Zhonghe Temple, Cangshan Mountains, +86 872 2661599, 13988539680, [24]. Up in the Cang Mountains behind the Zhonghe Temple at 2600m altitude, with a spectacular view of the lake and valley. Blissfully peaceful. A short cablecar ride away and a great place to overnight while exploring the Cangshan Mountains. Great food, highly recommended for vegetarians, you can taste the sattvas. Booking advised as capacity is limited.
• The Jade Emu and The Jade Roo International Guesthouses, (outside the west wall, 5 minutes walk to the centre of town), +86 872 2677311, +86 13887232726 or +86 15887399551 (), [25]. The Jade Emu International Guesthouse was built in 2008 and the Jade Roo opened in 2010. The Jade Emu Guesthouse won the Hostelbookers Award for Excellence, 2010 and 2012 - Top 3 Hostels/Guesthouses in Asia (see [26]). They are run by Dave (from Australia) and his partner Song (from China). Double, twin/triple share, singles, family suites and dorm rooms available, all are modern, clean and comfortable. Facilities include spacious courtyard and rooftop balcony, Facebook access, pool table, table tennis table, Fussball table, bar/cafe with outdoor home theatre system, free internet (6 PCs including Wi-Fi throughout the buildings), satellite TV, printing/scanning facilities, laundry service and/or free access to a washing machine, electric bike rental, discounted tours. Guests staying for ４＋ weeks are given a 40% discount． Dorms from ¥25-50, Private rooms from ¥65-180.
• Lee's Guesthouse, Dali Old Town, +86 872 2671385, 872 3156069 (). Setup in 2008 and run by Lee's family from Inner Mongolia. It provides quality accommodation for backpackers. Cozy, clean and comfortable. Facilities include local Bai minority courtyard, mosquito-free accommodation, free internet & Wi-Fi, free movie, family dinner 7PM (book one day ahead), fax/printing/scan, cd/dvd buring, laundry service, quality bike rental(shimano system), 1 yuan/min international call and travel agency. English spoken. Dorm rooms and double rooms ¥25-290.
• The Lily Pad (百合国际青年旅舍; Bǎihé GuójìqīngniánLvSshe), 13 Shizu, Ximen Village (西门村十组13号; Xīméncūn Shízǔ) (5 minutes from the center of Dali Old Town, in the street just behind Jade Emu), +86 13988569807, +86 872 2677807 (), [27]. Clean and friendly with beautiful bedrooms and from the roof it has views of the pagodas, lake and mountains. Some bedrooms are en-suite, all are good value. Free high speed internet and Wi-Fi in the rooms plus access to a printer. The hostess Erin speaks good English and is very helpful and kind. Dorms start from ¥20, Doubles with shared bathroom from ¥35, ensuite from ¥60, cheaper for longer stays.
• Rainbow‘s Nest International Guesthouse, 104 Guangwu Rd, Dali Old Town (two minutes from the center of Dali Old Town), 15348721086 (), [28]. Newly built Bai style house with six separate apartments each one equipped with living rooms, kitchens and private bathroom. Open sunny courtyard garden. Rooftop entertainment area and chill out room with free movies. Free laundry service, bike rental, comfortable and relaxed atmosphere. Free high speed internet and WiFi. Traveler information and bookings. Fluent English and Chinese staff. Discount Rates for weekly and monthly stay. Private rooms with living room and kitchen ¥170-288.
• Smile Cafe, Renmin Road, Dali Old Town (Five minutes further downhill from the tourist concentration), +86 872 2670565 (). Intimate, charming and cheap with the comforts of Dali's best Guesthouses. The young English speaking couple that run Smile Cafe have befriended many a traveler with laid back attitudes, approachability, and helpfulness. Smile Cafe is on Renmin Road, a main street. Cheap accommodation with nice rooms, laundry, free internet, hot water, courtyard with sun and Ping Pong, TV and DVD player. Dorms ¥25-30.
• TTF Cafe Hostel, 11 Luyu Road, Dali Old Town (大理古城绿玉路11号) (One minute walk on Luyu Road (绿玉路) from south end of Boai Road (博爱路) where intersects with Yita Road (一塔路)), +86 13988536165 (). This may be the best bargain in the area. Free green tea, internet machine, Wi-Fi, 24hr solar-hybrid hot shower, western-style toilet. Dorms and private rooms available. Dorms ¥15 (¥10 for members).
Hotels
• Bookworm Dali, Renmin Road, [29]. Run by a well travelled Beijing lady who speaks Japanese and French in addition to Mandarin and English. It was originally a bookstore and expanded to include a guesthouse at the urging of its customers. Bookworm is popular with the crowd who are in Dali for longer stays, making it useful to book in advance. They are among the few places in Dali who accept email bookings.
• Dali Private House, Dali Jiulong Ju A3-4 (opposite Gurong Hotel), 15894533443, [30]. checkin: 14; checkout: 14. Private house to rent with all appliances provided. Discount for socially active tenants (baking cakes, helping in BBQ, painting etc.) possible. 180.
• Jim's Tibetan Guest House, Bo Ai Lu 63 dali old town, +86 872 2671822 (), [31]. Very comfortable, clean and well appointed single and double rooms. Relaxed service. Downstairs is the cosy and good cafe & restaurant Jim's Peace Cafe. They own another more upmarket place called Jim's Tibetan Hotel, see listing below. Owner Jim (a local) is a fluent English speaker and was the first local to start business with foreigners, interesting guy! Together with his Dutch wife he organizes great (day)trips: trekkings, overland to Tibet etc, can be found on their website. Bookings accepted by e-mail Singles/doubles from ¥150.
• Koreana Guesthouse. This Korean-themed guesthouse is on the Foreign Street very close to the Chinese Construction Bank ATM. The staff is pleasant and well-trained and the manager speaks good English. They have Western toilets! They also provide a quick and free laundry service. Avoid rooms facing the street as they can be quite noisy in the evenings and mornings. ¥150-300.
• MCA Hotel, Wenxian Road (150m from South Gate), +86 872 2673666, [32]. checkout: 12:00. Charming courtyard with potential for a really nice hotel, this place currently is a mere shadow of itself - the empty pool says it all. Friendly staff with actual desire to be of help. Plenty of genuine regional, fair-priced restaurants just next door. Bus #19. double w/ bathroom from ¥80.
• New No. 5 Guest House, (Down Renmin Road near East Gate). A nice, quiet spot on the East end of Old Town. It's rooftop deck claims a very nice view of the area. English is spoken here, but the guests are typically Chinese. affordable and clean.
• No. 3 Guesthouse, Huguo Road, +86 872 2664941. Nice, inexpensive, quiet option just outside the gates of the old town. The helpful staff speak Korean, Chinese and English and will accommodate most reasonable requests. Rooms on the second floor are pricier than those on the first. Restaruant on the first floor specializes in Korean fare but offers other dishes as well. Rooms are relatively clean. You should be able to bargain a double down to ¥70-80, including private bathroom.
• Sam's Hotel, Yuxiu Road, 2 Yuyuan Street, Dali Old Town (Just outside South Gate), +86 13508724012, [33]. Run by Bai local Sam, the hotel offers peaceful and spacious modern bedrooms with bathtubs. The hotel also offers a family suite and a comfortable modern group room. There is a restaurant and a bar serving Chinese, Bai and Western food. There is a rooftop deck with a nice view. Sam speaks excellent English and he is of help to anyone journeying in China. ¥80 -120.
• Tibetan Lodge, 58 Renmin Road, Dali Old Town, +86 872 2664177, 2678917. A guest house and restaurant with a lot of character and atmosphere. Cheap but with mediocre service. Sometimes no A/C. Room types available include singles, doubles, triples, family, and suites. Slow but free internet is provided (wireless or on very slow desktops in the lounge). The restaurant downstairs is good, but a little on the expensive side. Single rooms start at ¥39.
• Yu Yuan Guesthouse, (A block West of the main tourist area), +86 872 2673267. New, clean, with friendly English-speaking staff. Doubles with bathtub and electric blankets. The breakfast is good. Doubles ¥80 including breakfast.
Mid-range
• Jim's Tibetan Hotel, Yuxiu lu 13 yu yuan 4 (located just outside the small south gate in dali old town), +86 872 2677824, 2440014 (), [34]. Beautiful spacious rooms with colouful and handmade furniture. Singles, doubles, 3 and 4 bed rooms + family rooms. Great garden, rooftop bar and terrace. Playground for kids. From 280 yuan incl BF. Same owner as Jim's Guesthouse (see above). Owner Jim (a local) is a fluent English speaker and was the first local to start business with foreigners, interesting guy! Together with his Dutch wife he organizes great (day)trips: trekkings, overland to Tibet etc, can be found on their website. Bookings accepted by e-mail
• Landscape Hotel (大理古城兰林阁酒店; Dàlǐgǔchéng Lánlíngé Jiǔdiàn), Yu'er Road, Dali Old Town (大理古城玉洱路96号; Dàlǐgǔchéng Yùěrlù) (At the foot of Cang Mountain close to Erhai Lake), +86 872 2666188 (, fax: +86 872 2666189), [35]. Spacious rooms with internet access against surcharge. Business center, currency exchange, gift shop, ticket office, massage and sauna available. Chinese restaurant, coffee shop and room service. Listed rates for doubles from ¥460, discounted from ¥250, including breakfast.
• The Linden Centre, 5 Cheng Bei Xizhou (Located twelve miles north of Dali in timeless village of Xizhou), +86 872 2452988, [36]. In one of Southwest China's most pristine examples of traditional Bai architecture. Developed and managed by an American couple who has been involved in China since 1984, offers 14 upscale double rooms in the completely restored, nationally-protected villa. The Centre also has a small museum, two restaurants, a cafe/bar, library, conference rooms, exercise room, and four elegant courtyards full of gardens and outdoor seating.
Splurge
• Regent Hotel (大理风花雪月大酒店; Dàlǐ Fēnghuāxuěyuè Dàjiǔdiàn), Yu'er Road, Dali Old Town (大理古城玉洱路; Dàlǐgǔchéng Yùěrlù) (On Cang Mountain facing Erhai Lake), +86 872 2666666 (, fax: +86 872 2682082), [37]. Five star hotel in Bai architecture style. Very large rooms with free internet. Business center, currency exchange, gift shop, beauty salon, ticket office, karaoke, night club, billiards, table tennis, fitness, tennis, massage and outdoor swimming pool available. Chinese and Western restaurants as well as coffee shop and bar. The hotel comes with everything you can expect from a Chinese five star hotel, but lacks something in taste, service and Western breakfast compared to what you will find in larger citires. Listed rates for doubles ¥880-5,800 including breakfast.
• Linden Centre[38]: in Xizhou, 20 km north of Dali. Lovely Bai architecture; very nice hosts and lovely surroundings. Very tasteful. ¥700 (incl breakfast).
Stay safe
There are a few scams and petty crime targeting tourists in Dali. Watch your belongings carefully to protect from pickpockets and theft, though perhaps the major risk you take if staying in cheap accommodation is theft by other foreign travellers. Overall Dali is a very safe place with little crime directed at tourists.
If you are planning to hike up the Cang mountains, travel in a group both to protect yourself from robbery and as back up in case of accident. Stay on the paths and don't take any risks climbing no matter how experienced you are, as fatal accidents do happen!
Drugs disguised as strange artifacts are usually sold by women in traditional Bai costume, who will then lead you to their homes. Marijuana was widespread in Dali's foreign bars before 2009, when police crackdowns and arrests forced the smokers back into the alleys and guesthouses. It is still widespread, of course, but it is no longer tolerated in public. It is not uncommon to see marijuana growing in the wild. Women may also offer you "opium," though it is just worthless garbage, possibly sesame oil pressed with some unknown substance. The summer of 2012 all the old ladies and other dealers have disappeared or do not sell any weed anymore, Things are very dry for marijuana. I am sure in the fall once the plants have grown again you can find some plants. There are only a few people selling anything on the sidewalks now and you will never see any one selling pipes. Dali is losing much of it color now
Don't get your shoes fixed by men approaching you on the corner of Fu Xing Rd and Foreigner St. Even if a price is agreed, they will add a couple of extra stitches and charge ridiculously inflated prices (¥200-300). You're in a difficult position to argue because they have your shoes! Just go to a regular established shoe shop (there are several towards the East end of Renmin Rd) where you can get your shoes repaired well for less than ¥10.
Get out
Most of the hostels and travel agents can organise bus tickets anywhere in Yunnan. They can also arrange flights farther afield.
Many travelers from Kunming continue on from Dali to Lijiang. Consider taking the smaller bus through the mountains toward Jianchuan (can be picked up at the main bus station in Xiaguan - "New" Dali City). Get off the bus at the fork in the road in the village of Diannan (about 8km south of Jianchuan). Get into a minibus and visit the Old Southern Silk Road town of Shaxi. The town has been well preserved and still holds much of its traditional character. The valley around it is littered with Qing and Ming Dynasty homes, bridges, theatres and temples. It is also the main jumping off point to visit the beautiful grottos at Shibaoshan. After your visit to Shaxi it is easy to continue your journey. A minibus from Shaxi or Shibaoshan can take you to the main bus station in Jianchuan. From there it is easy to get a bus on to Lijiang.
There is also a sleeper service to Shangrila, coming from Xiaguan, and passing Dali at 20:30h (¥120). However, it fills up quickly and can only be booked at a few agencies in Foreigners road (as of Oct 2009)
This is a guide article. It has a variety of good, quality information including hotels, restaurants, attractions, arrival and departure info. Plunge forward and help us make it a star!
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
other sites
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:29:26.000Z
|
i22pomteymausvkve75lzpp2iihx4y7k
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5781",
"uncompressed_offset": 288793038,
"url": "wikitravel.org/wiki/en/index.php?curid=19373&diff=1975709&oldid=1975647&title=Patna",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=Patna&curid=19373&diff=1975709&oldid=1975647"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Difference between revisions of "Patna"
From Wikitravel
Asia : South Asia : India : Plains : Bihar : Patna
Jump to: navigation, search
(added listing PATNA)
(Edit served no purpose)
Line 123: Line 123:
[[Image:Patna-boat.jpg|thumb|200px|Floating Restaurant in River Ganga, Gandhi Ghat, Patna]]
[[Image:Patna-boat.jpg|thumb|200px|Floating Restaurant in River Ganga, Gandhi Ghat, Patna]]
*<do name="PATNA" alt="" address="" directions="" phone="" url="" hours="" price="" lat="" long=""></do>
==Buy==
==Buy==
Revision as of 17:41, 1 January 2013
Patna is the capital of Bihar, and the second largest metropolis in eastern India.
Fluxed by the three sacred rivers Ganga, Sone and the Poonpun, the journey of Patna through the ages can quite be an object of envy for any place brooding over its life-chronicle. The city tweets of a glorious past and perches on the briskness of a bustling and an up-and-coming metropolis. Legend has it that a sanctified Ganga had watched with reverence as a hallowed Buddha blessed this place to be a realm of great Kings and their Empires. Belonging to the blue family of cities with a royal heritage,it is the land where the greatest emperors of India walked, and where the greatest saints chose to preach. Guru Gobind Singh, the 10th Sikh Guru was born here. For anyone with a taste for history and religion, this place flies high.
Today, it has become one of the fastest growing cities of India. With real estate booming at a dizzying pace, shopping malls, theaters, new businesses, food joints it carries all ingredients for a lively city life, and a tourist haven-to-be.
Contents
Understand
The ancient name of Patna was 'Pataliputra' and it was the capital of the Maurya and Gupta empires. Located at the site where Patna is today, the ancient city of Patliputra, with a glorious period of history spanning a thousand years (500BC-400AD), saw the rise and fall of India's first major kingdoms.
Ajastshatru, second in line of the Magadh Kings, built a fort at Pataligram on the banks of the Ganges river. This later became the famous Mauryan metropolis of Pataliputra and was ruled by Chandragupta Maurya and his grandson Asoka, acclaimed for the spread of Buddhism across India. Other emperors who ruled from Pataliputra were the Gupta and Pala Kings, Shershah Suri (16th Century) and Azimush-Shan (18th Century), the grandson of Mughal emperor Aurangzeb, who renamed it Azeemabad. Vestiges of this ancient city can be seen at Kumhrar, Bhikhnapahari, Agamkuan, Bulandi Bag etc.
Today Patna is an important business and education centre of eastern India. More significantly, it is a gateway to the Buddhist and Jain pilgrim centres of Vaishali, Rajgir, Nalanda, Bodhgaya, Keshariya and Pawapuri. The growing city of Patna is a great place to visit and a great place to live in.
Lying along the banks of the Ganges River, Patna is surrounded by important religious centers for the Buddhists, Sikhs and Jains. This city has been home to two great religions, Buddhism and Jainism, and myriad dynasties from ancient to modern times.
Get in
By plane
Patna Airport or Lok Nayak Jayaprakash Airport (IATA: PAT ICAO: VEPT) [1] is a domestic airport. Directly connected to Delhi, Lucknow, Kolkata, Mumbai, Bangalore,Hyderabad,Chennai,Ahmadabad, Indore and Ranchi, there are daily flights to and from Delhi, Mumbai and Kolkata. Indian Airlines [2], Jet Airways, Jet Light [3],Kingfisher Airlines [4], Indigo Airlines[5]& goAir[6] operate here.
By train
Patna is on the New Delhi - Howrah (Kolkata) railway main line (Patna Junction Code:PNBE) [7]. Long-distance trains arrive from many other major cities including Lucknow, Amritsar, Chandigarh, Vadodara, Surat, Nagpur, Pune, Raipur, Jaipur, Bhubaneswar, Puri, Allahabad, Varanasi, Ranchi, Chennai, Bangalore, Mysore, Hyderabad, Goa, Mangalore, Kozhikode and Kochi, Some of the important trains are:
From New Delhi
• Patna Rajdhani Exp (12309/12310) via Kanpur, Allahabad
• Samproon Kranti Exp(12393/12394) via Kanpur, Allahabad
• Sharmajeevi Exp(12391/12392) via Lucknow, Varanasi
• Magadh Exp. via Allahabad,Kanpur
• Vikramshila Exp(12367/12368) via Kanpur, Allahabad
• Garib Rath Exp(12353/12354) via Kanpur, Allahabad
• Kolkata Rajdhani(12305/12306) via Kanpur, Allahabad. Ends at Kolkata.
• Udyan Abha Toofan Exp(13007/13008) From Shri Ganganagar via Kanpur, Allahabad, Mugal Sarai, Patna, Durgapur. Ends at Kolkata.
• Lal Quila Exp(13111/13112) via Kanpur, Allahabad, Mugal Sarai. Ends at Kolkata.
From Kolkata
• Jan Shatabdi Exp(2023/2024)
• Danapur Exp(2351/2352)
• Garib Rath (All AC)(2359/2360)
From Bangalore
• Sanghmitra Exp.
From Mumbai
• Mumbai CST-RajendraNagar Patna Express(12141/12142)
• Mumbai LTT-Patna RajendraNagar Express(13201/13202)
From Varanasi
• Vihbhuti Exp(2333/2334)
• Mathura Patna Exp (13237/13238) via Kanpur, Ayodhya, Varanasi, Mugal sarai. Ends in Patna.
From Ranchi
• Patna Hatia Exp(8623/8624) via Gaya, Bokaro
• Patna Ranchi Jan Shatabdi Exp(2365/2366) via Gaya, Bokaro
Railway Enquiry: 139, 138
By car
Patna is connected by road with all major cities of the country via (National Highway 30,31 & 19). Here is the list of destinations by distance from Patna: BodhGaya (130km) ,Muzaffarpur (80km) Rajgir (103km), Vaishali (40 km), Kolkata (535km), Varanasi (300km), Delhi (988km), Ranchi (350km), Jamshedpur (470km) , Kathmandu (373km), Siliguri (380km), Darjeeling (430km), Nalanda (90km).
BSTDC (Bihar State Tourism Development Corporation) [8] offers deluxe bus/car rental services for the following destinations: Bodhgaya, Ranchi, Rajgir , Pawapuri, Nalanda & Vaishali,
On the other hand, the Inter-State Bus Terminus at Bankipore (Near Gandhi Maidan) and Mithapur, Luxury buses are available to the Nepal border (Raxaul/Birganj), sitamarhi, Gaya, Siliguri, Ranchi, Jamshedpur, Purnia etc.
File:Bsrtc-patna.jpg
BSRTC Luxury Buses available for Ranchi & Jamshedpur
Online Car rental Services at Patna Clear Car Rental
Get around
There are a few car rental companies available in Patna.
See
• Patna Museum has more than 50,000 rare art objects, with many related to India in the ancient, middle ages and the British colonial era. Don't forget to see the Holy Relic Casket with the sacred ashes of Lord Buddha, and the beautiful statue YakshaniEntry for Foreigners 250 Rs Indians 10 Rs additional 250 Rs to see Holy Relic Casket.
• Har Mandir Saheb - The Birth place of 10th Guru of Sikhs, Shri Guru Gobind Singh Jee .
• Golghar - Captain John Garstin built a Golghar for the storage of food for the British army with storing capacity of 140000 tons on 20th July 1786.
• Kumhrar - Explore the ancient ruins of Pataliputra. Of the 80 pillars (Fa Hien, in 5th century AD, found the pillars shining as bright as glass) excavated at the site, only one remains unfortunately.
• Patna Zoo Sanjay Gandhi Botanical and Zoological Garden, Patna.
• Mahavir Mandir, near Patna Junction
• Gandhi Maidan is the heart of this city today
• Gandhi Museum near Gandhi Maidan
• Padri Ki Haveli ("Mansion of Padre"), also known as St Mary's Church, it is the oldest church in Bihar. When Roman Catholics were arrived in Bihar, They built a small church in 1713 at a place now known as "Padri-ki-Haveli'.
• Pathar ki Masjid is built by Pervez, the elder brother of Shah Jahan and the first Mughal prince who made Bihar his residence
• Khuda Baksh Oriental Library Ashok Rajpath.
• Mahatma Gandhi Setu, the bridge over the river Ganges connecting Patna and Hajipur.
• Buddha Smriti Udyaan (Buddha Memorial Park), Near Railway Station. A large park with a stupa and meditation ground where ashes of Buddha are kept
• Sonepur Mela, Sonepur. This is the largest cattle and animal fair in Asia. It is held in November in Sonepur which across the Ganges from Patna.
• Vaishali Stupa. Buddhist site with one of the oldest stupa. This is also the site of world's oldest republic.
Do
• Play golf at the Patna golf club [9] With some very tough holes, this well-maintained course situated downton will prove interesting to amateur and pros alike. The Patna Golf Club is set in beautiful surroundings.
• Patna Planetarium
• Take a boat-ride in the Ganges., near Gandhi ghat
• Visit Kali Temple at Patna University Campus on the Bank of the Ganges
• Visit Vaishali-Ashokan Pillar(48km north of Patna)
• Maner-Sufi Saint Shrine(30km west of Patna)- you can buy famous Maner Ka Ladoo(Sweets). Maner Sweets is one of the popular shops that specializes in these. However, avoid going there in the late evening or night.
• Revolving Restaurant
Patna can now boast of a revolving restaurant, biggest of its kind in the country, situated atop the tallest tower in the city on the 18th floor of Biscomaun Bhawan near Gandhi Maidan. Based on the German technique, the 5HP motor that revolves the restaurant can be fixed to take one revolution in 45, 60 or 90 minutes.
You must visit P&M Mall,Patliputra Kurji Road, Patliputra
You can go on excursions to the various religious and historical places in and around Patna. Do not miss a boat ride on the mighty Ganges river. When in Patna, try food typical to the region such as pua-pittha, tilkut, chiwra, makhana, the famed sattu or the farmer's staple, litti chokha, and the famous paan.
File:Patna-boat.jpg
Floating Restaurant in River Ganga, Gandhi Ghat, Patna
Buy
Madhubani Paintings can be bought from emporiums at Mauyra Lok, a shopping center located on "Dak- Bunglow" road. You can visit many malls around Frazer road/Dak Bunglow Crossing such as Vishal Mega Mart, Maurya Lok Complex and Patna Market on Ashok Rajpath, Hathwa Market, Bari Path & Alankar Palace and other shopping arcades near Boring Road Crossing
New Attraction of the City is P&M Mall Patliputra Kurji Road, Patliputra
• Bandhan Boutique, G-9, Pushpanjali Complex, Opp. S.K. Puri Check Post, Boring Road, 8102306282.
Eat
What
• Litti chokha is a local specialty. Litti is a primarily ball-shaped stuffed preparation, and the shape of the ball varies depending on the preparation. With a shell made of wheat flour, the taste of litti very much depends on the filling, which includes gram flour and a combination of condiments and spices. Chokha a preparation of smoked eggplant/brinjal or tomato, accompanies litti. The smoked tomato or eggplant is mashed and dressed with coriander leaves, shredded green chilies and mustard oil, which gives a distinct flavor to the chokha.
• Chaat - Though chaat is a very popular snack item throughout India, the special thing about 'Patna Chaat' is its authentic tamarind flavor, as opposed to the sweet and salty Delhi Chaat. Take the opportunity to relish "samosa chaat" or "tikki chaat".
• Sweets, especially Peda and Kalakand, which are preparations of condensed milk from Sudha Dairy Parlours. The sweets must be consumed within 7 days.
• Anarsa is one of the finest sweet delicacies of Bihar. It has rice flour shell with khoya filling, with white til in the upper shell.
• Dahi Chura Chini, which is a mixture of curd, beaten rice and sugar, is the favourite food in North Bihar, especially in the Mithila region!
• Makhana is soft fruit grown in water. It is light fried and with little salt it serves the purpose of light snacks.
• Tilkut,Khaja are other delicacies of Bihar
Where
Restaurants
• Basant Vihar, Mauryalok Complex
• Domino's, Exhibition Road
• Kapil's Eleven, Frazer Road
• Kaveri, Mauryalok Complex
• Mayfair, Dak Bunglow Crossing(Frazer Road)
• Haldiram's, Jagdeo Path, Bailey Road, patna
• Soda Fountain, East Gandhi Maidan
• Moti Mahal, Frazer Road
• Roti, Boring Road
• Payal Restaurant, Ashok Rajpath
• Yo! China, Maurya Lok Complex
• Smokin Joes, Dak Bunglow Crossing
• Club City, New Dak Bunglow Road
• Bansi Vihar, Near Dak Bunglow Crossing
• Cloud 9, Boring Road
• Mirch Masala, Kadam Kuan
• China Garden, Frazer Road
• Cream Centre, P&M Mall
• Subway, Boring Canal Road
Sweets Parlours
• Sweet Home, Alankar Palace, Boring Road
• Kwality Sweets, Boring Road
• Lucknow Sweets, Dak Bunglow Crossing
• Cake Palace, New Dak Bunglow Road
• Cozy Confectioners, Keshav Palace, Bailey Road
• Sweet Garden, Keshav Palace, Bailey Road
• Maner Sweets, Maurya Lok Complex, New Dak Bungalow Road
• Celebration Sumati Palace, Opp. Alankar Palace, Boring Road Chauraha. Patna-01
• Celebration, 1st Floor, Sumati Place, Boring Road Chauraha (Opp. Alankar Place), 9334759145.
There are three cheap and good Indian restaurants just as you come out of the north train station overpass. The one in the middle has English menu's.
Drink
Sattu-pani is among the popular drinks, Lassi Made of Curd, Dry fruits & Sugar.
Restaurant & BAR
• The Purple Lounge, SP Verma Road
• Oasis, Boring Road
• The Velocity, Near Dak Bunglow Crossing
• Country Club International, Patliputra Colony
• Mamta Anarkali, Near Dak Bunglow Crossing
• Pind Balluchi (pind balluchi restaurant & Bar), Revolving Floor, Biscomaun Bhawan, Gandhi Maidan, Patna (Opposit Gandi Maidan). Pind Balluchi is a famous chain of restaurant in India with franchises in various cities such as Delhi, Jaipur, Amritsar, Chandigarh, Gurgaon, Noida, Faridabad and Now in Patna
• kfc, Regent theatre, South Gandhi Maidan, Patna.
Sleep
Patna is a growing business town, and as such hotels tend to be overpriced for the room provided. It also means that many hotels are full most nights, giving little incentive to improve facilities.
Budget
• Hotel Nesh Inn, Nandini Apartment, 28- Kidwaipuri, Patna, Bihar (Near Income-tax Roundabout), 0612 2522269, [10]. Hotel Nesh Inn is a premier Budget hotel in the heart of city Patna. Just 2-3 Kms. near Patna airport & Railway station. Fully A.C Rooms, In House Room Service, Laundry, Foreign Exchanger, Wifi Internet etc services are available. A very good accomodation. 1900-4700 INR.
• Country Club International , Patliputra colony
• Hotel Akash , Frazer Road
• Hotel Anand Regency, Near Patna Junction(Railway Station)
• Hotel Clark Inn, Jamal Road
• Hotel Magadh, Bhatacharya Road-Naya Tola crossing
• Hotel Marina , Frazer Road
• Hotel Mayur , Frazer Road
• Hotel Nand, Bhatacharya Road-Naya Tola crossing
• Hotel New Akash , Frazer Road
• Hotel President, Frazer Road
• Hotel Vijay Shree Deluxe, Exhibition Road NOT a budget hotel very average looking rooms start from 2750 INR a night.
• Maharaja Inn, Station Road, Rajendra Path
• Mamta Regency , Frazer Road
• Marwari Awas Grih, Dakbunglow Crossing
• Hotel Adarsh,Near Patna Junction(Railway Station)
• Heritage Regency, White House, Budh Marg, Near Bhumi Bikash Bank,Patna-800001. Just 0.5 km from Railway Station & 6 km from Airport.The “Heritage Regency” truly symbolizes the luxury and services; we continue to enhance our facilities and the level of our efficiency - as we believe in the great Indian adage "Atithi Devo Bhavah."
• Hotel Shubh Sartha, (Ganesh Kutir) Frazer Rd (It's at the back of a lane completely full of hotels, aptly called hotel lane. Walk up Frazer Rd from the train station and it's about 100m on the right just after the big mall. About 600m from the train station). checkout: 24 hours from checkin. Rude staff and dirty rooms, this is truly a last resort. However because of this, it can sometimes be the only place in town with a room left. Rs 800 for a double.
Other budget accommodation can be found on the road leading from the train station down towards the Mithapur bus stand. Very basic rooms start at Rs400.
Mid Range
• Hotel Kautilya Vihar, R Block
• Hotel Samrat International Dak Bunglow Crossing
• Hotel Satkar International, Frazer Road
• Hotel Rajasthan, Frazer Road
• Hotel Republic, Exhibition Road
• Hotel Windsor, Exhibition Road Crossing
Splurge
• Hotel Ashoka, Birchand Patel Path(Near IT Office)
• Hotel Chanakya, R Block
• Hotel Maurya, South Gandhi Maidan - Landmark of Patna
Learn
File:Pwc-patna.PNG
Patna Women's College
• Patna University - Seventh Oldest University of the Indian Subcontinent [11]
• Indian Institute of Technology, Patna [12]
• National Institute of Technology, Patna - one of the oldest engineering colleges of South Asia [13]
• National Institute of Fashion Technology, Patna [14]
• Birla Institute of Technology , Patna(BIT Mesra-Extension Centre)
• Chanakya National Law University, Patna [15]
• Chandragupt Institute of Management, Patna [16]
• L N Mishra Institute of Economic Development & Social Change, Patna
• Patna Womens College - one of the best Women's college in the State of Bihar & Eastern India [17]
• College of Arts & Crafts - Patna [18]
Get out
• Bodh Gaya, the place where Buddha achieved enlightenment
• Rajgir, the place Vishwa Shanti Shutpa you can joy on Areial Ropeway, You can enjoy Venuvana (Beautiful Garden)
• Nalanda - location of an ancient university with a nearby musuem.
• Pawapuri - The Place of Nirvana (Bhagwan Mahabir) - A holy site for the Jains.
• Kesariya - Perhaps the oldest Shanti Stupa, it is situated in East Champaran District(Motihari), 170km from Patna.
• Deoghar - A town containing a famous Babadham temple. It is 200km from Patna By Railway (drop at Jasidih Junction on Patna Howarh Main Line)in Jharkhand State
• Munger - A small town on the bank of Ganga famous for Yoga.
• Nepal and Raxaul - Buses are available to Raxaul and Jogbani at the Nepali border, where you can hop on a bus to Kathmandu and Pokhra. These buses leave at about 7am from the Mithapur bus stop 3km south of the train station. They don't leave at night during summer (tourist off season). The roads going north out of town are particularly bad - sit as far forward in the bus as you can!
Buddhist sector:Bodhgaya-Nalanda-Rajgir-Patna-Vaishali-Kesaria.
This is a usable article. It has information for getting in as well as some complete entries for restaurants and hotels. An adventurous person could use this article, but please plunge forward and help it grow!
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:08:02.000Z
|
e5lachqvaq3phiqg7rzncwuaqiqpqhqj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5790",
"uncompressed_offset": 300094718,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Latestproducts/BD9A932986DD5C7ACA25729E0008A899",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Latestproducts/BD9A932986DD5C7ACA25729E0008A899?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
2901.0 - Census Dictionary, 2006 (Reissue)
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 17/11/2006 Reissue
Page tools: Print Page RSS Search this Product
Contents >> Short Definitions and Classifications - 2006 >> Dwelling Structure (STRD) - Characteristics 2006
Dwelling Structure
On this page:
Description
Classification
Quality Statement
Description
This variable classifies the structure of private dwellings enumerated in the Census. The information is determined by the Census collector.
Data on dwelling structure are used to monitor changes in housing characteristics, to help formulate housing policies and to review existing housing stock.
More Detailed Description
Classification
Applicable to: Private dwellings
Separate house
Semi-detached, row or terrace house, townhouse etc.
Flat, unit or apartment
Other dwelling
&& Not stated
@@ Not applicable
Total number of categories: 12
More Detailed Description
Quality Statement - Dwelling Structure (STRD)
Interpreting Census counts of people in the category 'Improvised home, tent, sleepers-out'
Issue: Many users analyse the Census counts of people categorised as being enumerated in 'Improvised home, tent, sleepers-out'. Much of this analysis further focuses on this count where the people being enumerated also either:
a) Stated they were counted at home at their Usual Residence on Census night
or
b) Stated they were not counted at home on Census Night but reported having No Usual Address.
The data analysed excludes the Overseas Visitors category.
This update brings together some of the information that has been used in answering user queries regarding interpretation of the results of their analyses of Census information.
Background to field procedures:
A special enumeration strategy is targeted at known locations, identified by a variety of organisations, where people may be sleeping out on Census night, such as under bridges, in parks, in cars, in makeshift camps, etc. Special collectors use a special short form, with just 6 questions (age, sex, marital status, Indigenous status, birth country and income), to interview people found sleeping out. Responses for Census items not included on the short form are 'not stated' in the data, and some of the items asked may also appear as 'not stated' if the person did not respond to that question. About 3,000 such forms were used in the 2006 Census.
Census Collectors may also interview potentially homeless people living in improvised dwellings or sleeping out using the mainstream household form, via personal interview, and instructions note that some questions will not be relevant so can be ignored, such as the dwelling questions.
It is likely that, despite the best efforts of Census collectors, some people who were sleeping in improvised dwellings or sleeping out on Census night will be missed.
Many other people are enumerated in the 'Improvised home, tent, sleepers-out' structure category. ABS Census mainstream field collectors are asked to record a dwelling structure for each dwelling which they approach to enumerate in the Census. One of the dwelling categories is 'Improvised home, tent, sleepers-out', and the collector instructions ask them to include, in addition to campers, sleepers out and makeshift dwellings, any '... garage, shed etc occupied on a permanent or semi-permanent basis.'
For Census output purposes, the dwelling structure category 'Improvised home, tent, sleepers-out' can be cross tabulated by the 'usual residence' stated by any household members enumerated at the dwelling. Some people staying in these dwellings will be visiting away from home and report their usual address as being elsewhere. Others may state that they are being enumerated at their usual address, or state that they have no usual address. There were 16,375* people in the category 'Improvised home, tent, sleepers-out' on Census night 2006 and for whom this was either their usual address or they had no usual address.
Some of the 'Improvised home, tent, sleepers-out' dwellings enumerated on Census night would not be considered 'habitable' in terms of normal community standards. However, some of the 'Improvised home, tent, sleepers-out' dwellings would be considered 'habitable' in terms of normal community standards, such as sheds or garages with internal plumbing and other facilities. For example, some people may be living in a shed or garage erected on their land while their new home is under construction, or in a converted garage. All such housing circumstances fall within this Census dwelling structure classification 'Improvised home, tent, sleepers-out'.
Another example of people staying in improvised dwellings and possibly being enumerated 'at their usual address' on Census night includes building and construction workers. They may be sleeping in transportable sheds that travel with them from job to job. When completing the Census form this shed will be the place that they either have lived in, or intend to live in, for 6 months or more in the Census year, even though they may have a family home elsewhere that they 'visit' in between jobs. Again, such housing circumstances fall within this Census dwelling structure classification 'Improvised home, tent, sleepers-out'.
Looking at the counts:
In understanding the quite varied circumstances of the 16,375 people described above as living in an 'Improvised home, tent, sleepers-out', and either that dwelling was their usual residence or they had no usual residence, a range of Census characteristics are available.
Some summary measures that may be useful in understanding the population of people in 2006 that the Census counted as living in an 'Improvised home, tent, sleepers-out', and either that dwelling was their usual residence or they had no usual residence, include:
. Employment - 37% of those people aged 15 years and over were employed.
. Tenure type - 25% lived on properties which they had mortgaged, and the average reported monthly mortgage repayment they made was about $1,250 per month.
. Size of dwelling - 26% were living in dwellings of 3 or more bedrooms.
. Connection to infrastructure - 18% of those people lived in dwellings with dial-up internet connection, and a further 15% had a broadband service connected.
. Vehicles - 41% were enumerated in households that had two or more vehicles usually garaged there.
. Income - 19% of those people aged 15 years and over reported incomes of $600 or more per week.
These percentages are based on the above 16,375 population including those who did not respond to the question. Lack of response may be due to lack of opportunity to answer the question as it was not asked of the respondent or because the respondent themselves had the opportunity but chose not to respond. Characteristics of people who did not respond to the item are not known, therefore proportions for selected characteristics may be slightly understated.
Understanding the nature of these counts can be further improved by looking simultaneously at several of these characteristics.
It should be noted that the rates reported above are the averages for these selected characteristics across the Australia-wide population of 16,375 people categorised as living in 'Improvised home, tent, sleepers-out' and this was either their usual address or they had no usual address. However, the proportions do vary significantly across geography, and analyses for smaller areas should look specifically at the characteristics for the area under study.
* This figure excludes around 500 persons enumerated in Tweed Heads who were mistakenly coded into the 'Improvised home, tent, sleepers out' dwelling category.
General Data Quality
There are many aspects which can affect the quality of Census data; the following information should be considered when viewing data on Dwelling Structure (STRD).
Data is captured automatically from check box responses so the risk of processing error is minimal. Sample checks are undertaken to ensure an acceptable level of quality.
This data is collected by the Census Collector. In the small proportion of cases where Dwelling Structure (STRD) was not marked, values for STRD were imputed using information collected from surrounding dwellings. However some residual non-response does remain in the data - 0.1% compared with 0.9% for 2001.
Sometimes the Collector may find it difficult to differentiate a separate house from a semi-detached house when dwellings are close together and this may have a small effect on comparisons for these categories between 2001 and 2006.
The ABS aims to produce high quality data from the Census. To achieve this, extensive effort is put into Census form design, collection procedures, and processing procedures.
There are four principal sources of error in Census data: respondent error, processing error, partial response and undercount. Quality management of the Census program aims to reduce error as much as possible, and to provide a measure of the remaining error to data users, to allow them to use the data in an informed way.
When completing their Census form, some people do not answer all the questions which apply to them. In these instances, a 'not stated' code is allocated during processing, with the exception of non-response to age, sex, marital status and place of usual residence. These variables are needed for population estimates, so they are imputed using other information on the Census form, as well as information from the previous Census.
The processing of information from Census forms is now mostly automated, using scanning, Intelligent Character Recognition and other automatic processes. Quality assurance procedures are used during Census processing to ensure processing errors are kept at an acceptable level. Sample checking is undertaken during coding operations, and corrections are made where necessary.
The Census form may be completed by one household member on behalf of others. Incorrect answers can be introduced to the Census form if the respondent does not understand the question or does not know the correct information about other household members. Many of these errors remain in the final data.
More detailed information on data quality is available in the 2006 Census Dictionary (cat. no. 2901.0), in the section titled
Managing Census Quality.
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:49:54.000Z
|
hmmf6wnwl27276clx66wpcknuqeb2omb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5791",
"uncompressed_offset": 300105340,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Previousproducts/1304.6Main%20Features11Oct%202009?issue=Oct+2009&prodno=1304.6&tabname=Summary",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Previousproducts/1304.6Main%20Features11Oct%202009?opendocument&tabname=Summary&prodno=1304.6&issue=Oct%202009&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1304.6 - Tasmanian Key Indicators, Oct 2009
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 17/11/2009
Page tools: Print Page Print All RSS Search this Product
MORTALITY
Source
Tas. value
Aust. value
2007-08
Standardised death rate (per 1,000 population)
p6.95
p6.03
Infant mortality rate (per 1,000 live births)
p4.35(a)
p4.11(a)
p preliminary figure or series subject to revision
(a) Tasmanian infant mortality rates are based on relatively small numbers, so caution is advised when comparing with the Australian rate.
More Detailed Source Information
Australian Demographic Statistics (ABS cat. no. 3101.0)
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:23:03.000Z
|
tkaqxlkukjrsp4xgoavs47yaaqyrec7y
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5792",
"uncompressed_offset": 300112934,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/second%2Blevel%2Bview?issue=May+2011&prodno=6227.0.55.003&prodno=6227.0.55.003&tabname=Past+Future+Issues&viewtitle=Education+and+Work%2C+Australia+-+Additional+data+cubes~May+2011~Latest~30%2F11%2F2011",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/second+level+view?ReadForm&prodno=6227.0.55.003&viewtitle=Education%20and%20Work,%20Australia%20-%20Additional%20data%20cubes~May%202011~Latest~30/11/2011&tabname=Past%20Future%20Issues&prodno=6227.0.55.003&issue=May%202011&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
6227.0.55.003 - Education and Work, Australia - Additional data cubes, May 2011
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 30/11/2011 First Issue
Past Releases
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:23:59.000Z
|
josqtocpqzmlwcz37nqoopnisqvvyjv6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5793",
"uncompressed_offset": 300118430,
"url": "www.abs.gov.au/Ausstats/ABS%40.nsf/bb8db737e2af84b8ca2571780015701e/2BEB8F3D52534452CA2573D20010DEC3",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.abs.gov.au/Ausstats/ABS@.nsf/bb8db737e2af84b8ca2571780015701e/2BEB8F3D52534452CA2573D20010DEC3?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1301.0 - Year Book Australia, 2008
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 07/02/2008
Page tools: Print Page RSS Search this Product
Contents >> National accounts >> National accounts Bibliography
BIBLIOGRAPHY
ABS PRODUCTS
Australian National Accounts: Financial Accounts (5232.0)
Australian National Accounts: Input-Output tables - Electronic Publication (5209.0.55.001)
Australian National Accounts: National Income, Expenditure and Product (5206.0)
Australian National Accounts: Non-Profit Institutions Satellite Account (5256.0)
Australian National Accounts: State Accounts (5220.0)
Australian System of National Accounts (5204.0)
Australian System of National Accounts: Concepts, Sources and Methods (5216.0.)
Information and Communication Technology Satellite Account (5259.0)
Information Paper: Australian National Accounts, Introduction of Chain Volume and Price Indexes (5248.0)
Information Paper: Experimental Estimates of Industry Multifactor Productivity, 2007 (5260.0.55.001)
Measures of Australia's Progress (1370.0)
Tourism Satellite Account (5249.0)
REFERENCE
Organisation for Economic Co-operation and Development (OECD), Quarterly National Accounts, Vol. 2007/1
WEBSITES
Organisation for Economic Co-operation and Development, last viewed August 2007 <http://www.oecd.org>
United Nations Statistics Division, System of National Accounts, 1993 (SNA93), last viewed August 2007 <http://unstats.un.org>
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:56:37.000Z
|
crbopomcati4nfett7fxxaccs2dbqhoh
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5794",
"uncompressed_offset": 300126156,
"url": "www.abs.gov.au/Ausstats/abs%40.nsf/Previousproducts/4513.0Appendix12006-07?issue=2006-07&prodno=4513.0&tabname=Notes",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.abs.gov.au/Ausstats/abs@.nsf/Previousproducts/4513.0Appendix12006-07?opendocument&tabname=Notes&prodno=4513.0&issue=2006-07&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
4513.0 - Criminal Courts, Australia, 2006-07 Quality Declaration
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 25/01/2008
Page tools: Print Page Print All RSS Search this Product
APPENDIX 1 METHOD OF FINALISATION CLASSIFICATION
Code Division/Subdivision/Item
1 Adjudicated finalisation
10 Adjudicated finalisation n.f.d.
11 Charge proven n.f.d.
111 Guilty finding by court
112 Guilty plea by defendant
113 Guilty ex-parte
12 Charge unproven n.f.d.
121 Acquitted by court
122 Not guilty by reason of mental illness/condition
123 No case to answer at committal
129 Charge unproven n.e.c.
2 Finalisation by transfer between court levels
20 Finalisation by transfer between court levels n.f.d.
21 Transfer from a Magistrates'/Children's Court to a Higher Court
211 Committed for trial
212 Committed for sentence
219 Transfer from a Magistrates'/Children's Court to a Higher Court n.e.c.
22 Transfer from a Higher Court to a Magistrates' Court
23 Transfer from an intermediate court to a Supreme Court n.f.d
231 Transfer from an intermediate court to a Supreme Court for trial
232 Transfer from an intermediate court to a Supreme Court for sentence
24 Transfer from a Supreme Court to an intermediate court n.f.d
241 Transfer from a Supreme Court to an intermediate court for trial
242 Transfer from a Supreme Court to an intermediate court for sentence
25 Transfer from a Children's Court to a Magistrates' or Higher Court
29 Other transfers between court levels
3 Non-adjudicated finalisation
30 Non-adjudicated finalisation n.f.d.
31 Defendant deceased
33 Unfit to plead
34 Withdrawn by the prosecution
35 Transfer to non-court agency
39 Other non-adjudicated finalisation
9 Method of finalisation unknown/not stated
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:24:47.000Z
|
h4i73bn6xeejcttwyet2xbrya3iezzto
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5799",
"uncompressed_offset": 346808383,
"url": "www.biomedcentral.com/1471-2148/10/81",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.biomedcentral.com/1471-2148/10/81"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Genetic diversity, molecular phylogeny and selection evidence of the silkworm mitochondria implicated by complete resequencing of 41 genomes
Dong Li1,2, Yiran Guo2, Haojing Shao2, Laurent C Tellier2,3, Jun Wang2,3, Zhonghuai Xiang1 and Qingyou Xia1,4*
Author Affiliations
1 The Key Sericultural Laboratory of Agricultural Ministry, College of Biotechnology, Southwest University, Chongqing 400715, China
2 BGI-Shenzhen, Shenzhen 518083, China
3 Department of Biology, University of Copenhagen, Universitetsparken 15, 2100 Kbh Ø, Denmark
4 Institute of Agronomy and Life Sciences, Chongqing University, Chongqing 400030, China
For all author emails, please log on.
BMC Evolutionary Biology 2010, 10:81 doi:10.1186/1471-2148-10-81
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2148/10/81
Received:16 November 2009
Accepted:24 March 2010
Published:24 March 2010
© 2010 Li et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
Mitochondria are a valuable resource for studying the evolutionary process and deducing phylogeny. A few mitochondria genomes have been sequenced, but a comprehensive picture of the domestication event for silkworm mitochondria remains to be established. In this study, we integrate the extant data, and perform a whole genome resequencing of Japanese wild silkworm to obtain breakthrough results in silkworm mitochondrial (mt) population, and finally use these to deduce a more comprehensive phylogeny of the Bombycidae.
Results
We identified 347 single nucleotide polymorphisms (SNPs) in the mt genome, but found no past recombination event to have occurred in the silkworm progenitor. A phylogeny inferred from these whole genome SNPs resulted in a well-classified tree, confirming that the domesticated silkworm, Bombyx mori, most recently diverged from the Chinese wild silkworm, rather than from the Japanese wild silkworm. We showed that the population sizes of the domesticated and Chinese wild silkworms both experience neither expansion nor contraction. We also discovered that one mt gene, named cytochrome b, shows a strong signal of positive selection in the domesticated clade. This gene is related to energy metabolism, and may have played an important role during silkworm domestication.
Conclusions
We present a comparative analysis on 41 mt genomes of B. mori and B. mandarina from China and Japan. With these, we obtain a much clearer picture of the evolution history of the silkworm. The data and analyses presented here aid our understanding of the silkworm in general, and provide a crucial insight into silkworm phylogeny.
Background
Mitochondria have a genetic system which is different and distinct from the nuclear genome. They have a rapid tempo of nucleotide substitution and present a special form of maternal inheritance [1]. The domesticated silkworm, B. mori, is the model organism of Lepidoptera, which has been producing industrial silk for humans over a period of more than 5,000 years [2]. It embraces more than 1,000 inbred strains worldwide [3], and has recently been serving as a bioreactor [4]. There are two major populations of B. mandarina: notably the Chinese, with a haploid chromosome number of 28 (equal to those of B. mori), and the Japanese, with a haploid chromosome number of 27. They have different geographic distributions [3]. In 2006 Arunkumar et al. [5] analyzed six complete mt genomes to construct the phylogeny for the Bombycidae family, and although the concurrence of their methods found the Chinese B. mandarina to be the progenitor species of B. mori, some of their methods (ML phylogeny) also tentatively proposed that Chinese and Japanese B. mandarina share a clade, belonging to a single, monophyletic group on the phylogenic tree, distinct from B. mori. Based on the same data, Pan et al. [6] concurred with the consensus of Arunkumar et al., that the Japanese B. mandarina is a more distant taxon from the domesticated silkworm than the Chinese B. mandarina.
A clearer picture for the Bombycidae phylogeny in confirmation of this became desirable. Here, we take advantage of 41 mt genomes (covering both wild silkworm groups and the domesticated silkworms) to again infer the ancestor of B. mori, and arrive at compelling evidence confirming the conclusions of that the apparent progenitor of B. mori is the Chinese B. mandarina, in confirmation of both Arunkumar et al and Pan et al.
The domesticated silkworm has evolved to be completely dependent on humans for survival, and many domestication-related genes have been found to be selected for, when comparing the domesticated silkworm with the Chinese wild silkworm, accounting for 2.9% of the genome-wide genes [7]. This remarkable footprint by selection effect implied a potential selection imprint left in the silkworm mt genome. Moreover, previous studies have demonstrated that variants in mt genome were often subjected to selection [8-10]. With availability of genome-wide resequencing data from 40 silkworms, here we have the opportunity to make numerous comparisons and to investigate the phylogeny of silkworm mitochondria, in order to study whether the silkworm mt population has experienced any expansion or contraction, and to detect the selection effect shaping on the mt genome.
Methods
Whole genome resequencing of Japanese wild silkworm
The pupa of a single individual of Japanese wild silkworm was used to extract genomic DNA, based on a standard protocol for genomic DNA extraction. We followed the manufacturer's instructions (Illumina) to prepare DNA library. Briefly, we made it by following the workflow on Illumina Genome Analyzer II system: cluster generation, template hybridization, isothermal amplification, linearization, blocking, and denaturization and hybridization of the sequencing primers. Then the Illumina base-calling pipeline (SolexaPipeline-0.3) was applied to get sequences from the fluorescent images. Short read data have been deposited in the NCBI Short Read Archive under the accession number SRA009886.
Public data availability
Through NCBI Short Read Archive http://www.ncbi.nlm.nih.gov/Traces/home/ webcite with accession number SRA009208, we downloaded all of the 40 silkworm resequencing data (see Table 1), including 29 domesticated silkworms and 11 Chinese wild ones, detailed information of which can be found elsewhere [7], the silkworm nuclear reference genome sequence was derived from the SilkDB [11] (http://silkworm.swu.edu.cn/silkdb/ webcite or http://silkworm.genomics.org.cn/ webcite). From GenBank http://www.ncbi.nlm.nih.gov/ webcite we obtained three mt genome sequences (accession numbers AB070264, AY301620, and NC_003395) and their annotations, which were serving as references. We used these reference genomes in all of our consensus assembly below.
Table 1. The detailed information of samples and sequencing summary
AB070264 represents the strain C108, which served as the domesticated population reference. AY301620 was used as the Chinese wild mitochondria reference, which is from Ankang in Shanxi Province of China [6]. NC_003395 is a Japanese wild individual from Tsukuba, Ibaraki, Japan [12], and we map our resequencing data (Japanese wild silkworm) onto it. Mt genome sequence of Antheraea pernyi (NC_004622) and Eriogyna pyretorum (NC_012727) were also downloaded to be applied as outgroup when reconstructing phylogeny.
Reads alignment and consensus assembly
Although we only included the mt genome sequence in the analysis, we prefer to map raw short reads onto the whole genome [including nuclear DNA sequence and mitochondrial DNA (mtDNA) sequence], in order to make alignment more reliable. Due to the fact that three sorts of resequencing data of silkworm have been in hand - which are the domesticated group, the Chinese wild population, and the Japanese wild population - there must be three different references to be used by program SOAP v1.09 [13]. So we built three different reference genomes which are the silkworm nuclear reference genome sequence with C108 mtDNA sequence, with Chinese wild mtDNA sequence and with Japanese wild mtDNA sequence. The mapping results showed that Chinese wild silkworms have a higher mismatch rate than the domesticated ones (see Table 1), which suggests a high sequence diversity in Chinese wild group, even in the intraspecific comparison between Chinese wild variety Ankang and the Chinese wild reference (which is also from Ankang in Shanxi Province of China). Followed by SOAPsnp [14], which based on Bayesian theory, we calculate the posterior probability of each possible genotype at every genome position, from the alignment results for each sample. Then the consensus was structured by the highest probability. 41 consensus sequences have been put into the Genbank under accession number GU966591-GU966631.
SNP detection and experimental validation
We used SOAPsnp [14] to call SNPs for each variety. After setting
-u -r 0.01 -m,
six steps were used to filter out the unreliable variants: 1) we set Q20 quality cutoff; 2) two unique reads were allowed at least; 3) the SNPs had to be at least 5 bp away from each other; 4) the approximate copy number of flanking sequences had to be no more than 2; 5) P value of the rank sum test had to be no less than 0.05; 6) the number of unique mapped reads had to be greater than or equal to half of the number of total mapped reads.
To evaluate our SNP calling strategy, we randomly selected 50 sites for PCR-Sanger dideoxy sequencing validation using the AB 3730XL. After manually checking all the intensity trace files, we found that all the sites were confirmed by the PCR-sequencing results.
Linkage Disequilibrium (LD) measure calculation
To measure LD level in the silkworm mt population, we used the normalized measure of allelic association estimate D' [15], which can not be easily influenced by rare alleles examined [16]. We set the parameters in the software Haploview [17] as follows:
-maxdistance 200-dprime-minGeno 0.6-minMAF 0.1-hwcutoff 0.001. Then spot chart was plotted with R scripts which drew averaged D' against pairwise marker distance.
Phylogeny reconstruction
Five silkworm mt sequences (with accession number AB070264, AY301620, NC_003395, NC_004622, and NC_012727) were firstly aligned using MUSCLE v3.7 [18] with default settings, adjusting coordinates for the three resequencing groups. From this, we got 46 mt genomes, after integrating these five sequences and 41 consensus that we have, to perform phylogenetic reconstruction following MEGA v4 [19] by using Neighbour-Joining method and Mrbayes v3.1.2 [20] under the Bayesian theory. In Mrbayes, we chose the GTR+gamma+I model, and set the chain length to 50,000,000 (1 sample/1000 generations) and burned in the first 10,000 samples. Almost identical results were obtained in two independent runs. The quality of being dependable of the NJ trees was bootstrapped with 1000 replicate estimates. To evaluate the confidence level in the tree selection, we applied statistical tests with CONSEL [21]. The site-wise likelihood file is derived from PhyML calculatation [22].
Tests of effective population size
First, using the SNP information of each group, we inferred the mt sequence mismatch distributions for domesticated group and Chinese wild group, where a ragged distribution implies the stable population size, and where a bell-shaped pattern is often related to population growth [23,24]. Further, Tajima's D and Fu and Li's D tests for population size were also performed with DnaSP v5 [25].
Neutrality tests
It became clear to us that, during the domestication process of the silkworm, 354 genes in the nuclear genome bear a strong human selection footprint [7]. The mt genome may therefore also experience selective pressure. In order to examine mtDNA protein evolution, we compare the rate of nonsynonymous to synonymous mutation within and between species in each gene. If these ratios differ significantly, they provide evidence of selection pressure [26]. We then applied Williams' correction to calculate the G statistic [27]. Moreover, we also preformed the two likelihood ratio tests (LRTs), based on widely used branch-site models from PAML 4.2 [28], to detect any positive selection.
Results
Determining mapping strategy and mapping summary
Before applying the strategy of mapping raw reads onto different references, first round mapping was initiated, which only took a single mt genome C108 as a reference to be mapped. After SNP calling, there was an obvious separation among these three groups in phylogeny analysis (data not shown). This impressed us that we should use different reference datasets based on silkworm classification as a reference for each group, so that we can get more realistic genetic variation. Before we clearly acknowledge the separation among these three populations, it is essential to perform these alignments. Here, we just take the mt sequence into consideration; however, we must introduce the nuclear DNA sequence, because there are some similar regions between the mt sequence and nuclear genome. A sequencing read would have more than one hit mapped to the whole genome (the mt genome plus the nuclear genome), while it would be with unique hits to the mt sequence when we excluded the nuclear DNA sequence. The latter, exclusive mt genome situation would interrupt meaningful SNP detection [14].
After aligning short reads onto the reference genome by using the SOAP alignment program [13], we obtained a 2319.56 fold effective depth for all the 41 varieties and each ranged from 8.99 to 165.42 fold. The minimal depth 8.99 fold covering 93.71% of the mt genome (see Table 1) suggests that there was sufficient content to detect the variation. Though this fluctuation in depth was apparent, we found there was no significant difference [Mann Whitney U (MWU), P = 0.36] when one takes the depth between domesticated silkworms and wild ones into comparison.
Mitochondria diversity and the higher polymorphism level in wild silkworm
We then used SOAPsnp package [14], which checks the read quality and mapping positions to detect SNPs. Filtered by the criteria described in Method Section, we identified 88 SNPs when taking 29 domesticated mt sequences as a whole, 231 SNPs in Chinese wild population, and 46 SNPs in Japanese wild group (Table 2). We totally identified 347 SNPs for our 41 samples in brief. The randomly chosen subset of the SNPs was sequenced with PCR, and we found they are all consistent with the genotype calling. The polymorphism level (θπ) of mt sequence among Chinese wild population (6.20 × 10-3 nucleotide differences per site) is more than six times that among domesticated varieties (1.14 × 10-3) (Table 2), the relative larger reduction in polymorphism is most likely caused by inbreeding or population bottlenecking. Similar phenomenon was revealed in the nuclear DNA analyses [7]. However, the Japanese wild population, which only distributes in Japan and Korea [3], has a moderate sequence diversity (2.02 × 10-3), suggesting that it has a small effective population size compared to Chinese wild silkworm. This conclusion must be tempered somewhat by the low Japanese sample number.
Table 2. Statistical summary for three different groups.
No recombination event in silkworm mt genome
It is a point of frequent contention whether the mt genome undergoes recombination or not [29]. We used D', shown to be less sensitive to the effects of the allele frequency variation [30] than others measures, to assess the linkage disequilibrium (LD) rates in the domesticated silkworm and Chinese wild silkworm varieties, and to check whether silkworm mt genome has experienced recombination. No marker in the domesticated group passed all the thresholds set by Haploview, but 146 out of 231 markers have passed all criteria in the Chinese wild group, which could be applied to analyze the allelic association. Of the 10,585 pairs of the 146 polymorphic sites, 8,301 showed the maximum LD rate (|D'| = 1) (Figure 1). High proportion (78.4%) result suggested no evidence for the recombination in the silkworm mt genome.
Figure 1. The relationship between linkage disequilibrium, measured by |D'|, versus distance between sites for all the 11 complete Chinese wild mitochondrial genomes.
Furthermore, there was also no correlation between genome distance and |D'|, and distribution of site pairs with |D'| < 1 were randomly distributed with physical distance (Pearson's correlation coefficient, ρ = 5.31 × 10-3; P = 0.80). Although this is the first investigation for silkworm mitochondria recombination, there seems to be only limited occurrence, making it unnecessary to consider its effect on population structure or evolution.
Phylogenetic analysis
To quantify population structure, we used all the SNPs identified, and all the specific sites among groups, to reconstruct an accurate illustration of population history, which could distinguish the ancestor from which the domesticated silkworm was most recently bifurcated. Both Bayesian and Neighbour-joining methods were used to confirm the topology accuracy of the estimated phylogenetic tree, and similar results were obtained using different approaches. So, we only show here the Bayesian tree in Figure 2A and Figure 2B. Although some efforts have been made to elucidate the phylogeny of silkworms based on mtDNA sequence [5,6], here, it is also essential to perform a genome-wide analysis which includes more individual sequences, and which would get more comprehensive picture of silkworm clade. Using the mt genome sequences of Antheraea pernyi and Eriogyna pyretorum as the outgroup, we can see clearly and conclusively that the domesticated silkworm is closer to the Chinese wild silkworm than to the Japanese wild silkworm. Also, the high bootstrap values in topology provide compelling evidence that domesticated silkworm mtDNA was more recently bifurcated from the Chinese wild group, rather than from the Japanese wild group.
Figure 2. Silkworm mitochondrial phylogeny. (A) Phylogeny in different silkworm groups, based on whole mitochondrial genome. The tree was built using Bayesian method with GTR+gamma+I model. Bootstrap values measured by the posterior probabilities are shown at the nodes. We also reconstructed a Neighbour-joining tree in Mega, using the same consensus sequence. The support values (with 1000 bootstrap replicates) are listed following the posterior probabilities. Except for the outgroup Antheraea pernyi and Eriogyna pyretorum, as well as the domesticated group, each sample is represented by a combination of symbols representing respective silkworm groups (filled circles for Chinese wild group and boxes for Japanese wild group), sample names and sample IDs ("W01" to "W12", "WildAnKang-ref" for the reference genome of Chinese wild group, "WildJapan-ref " for the reference genome of Japanese wild group). The detailed information for samples could be found in Table 1. (B) More fine scale phylogeny for the domesticated silkworm using Mrbayes. For the tree has a very short branch length, only topology was shown in this picture. The posterior probabilities are listed at each node. Each sample is represented by sample names and sample IDs ("D01" to "D29", "C108-ref" for the reference genome of domesticated group).
To evaluate the level of confidence in tree selection, we test whether alternative placements of Japanese wild silkworm among the Bombycidae could be accepted on basis of the approximately unbiased (AU) test and the weighted Shimodaira-Hasegawa (WSH) test [31]. With our dataset, they reject all the alternative scenarios (P < 1 × 10-6). As mentioned in the Method section, the reference of the domesticated and Chinese wild group is from C108 and Ankang, respectively, but another individual from these two lines did not cluster together with its references (Figure 2A and Figure 2B). This result suggests the intraspecific mtDNA sequence diversity would be higher than the interspecific diversity.
Stable population size in domesticated and Chinese wild population
Previous studies have deduced that the domesticated silkworm effective population maintained a stable size posterior to the domestication event [7]. The frequency distribution of pairwise differences for domesticated and Chinese wild group all showed ragged pattern (Figure 3), indicating their effective population sizes remain constant [23,32]. Based on the number of segregating sites and the nucleotide diversity, we further performed Tajima's D [33] and Fu and Li's D [34] tests. They both show no indication of population expansion or contraction in the two groups (Tajima's Dwild = -0.41308, P > 0.10; Fu and Li's Dwild = -0.33548, P > 0.10; Tajima's Ddomesticated = -1.65367, P > 0.05; Fu and Li's Ddomesticated = -2.19707, P > 0.05).
Figure 3. Pairwise difference distribution for domesticated silkworm genome sequences (top) and Chinese wild silkworm genome sequences (bottom).
Positive selection detection
There is no recombination event in the Chinese wild silkworm mitochondria, and the population size of domesticated silkworm and Chinese wild silkworms both remain stable. So it is reasonable to infer selection forces shaping mtDNA by using McDonald-Kreitman test for each gene. The result showed the cytochrome b (cytb) gene had a significant (P = 1.8 × 10-3) deviation from neutrality (Table 3), indicating it has been effected by positive selection posterior to silkworm domestication [26].
Table 3. Number of replacement and synonymous substitutions within and between B. mori and B. mandarina
We also looked for positive selection using branch-site likelihood ratio tests for this gene, showing significant difference (P = 0.014) between the foreground and background. These two kinds of independent tests both show statistical power in this scenario, so we can believe the cytb gene is important to the domesticated silkworm, which will be elucidated in the discussion.
Discussion
The silkworm is the best-characterized model for biochemical, genetic, and genomic studies of the order Lepidoptera, and for insect domestication. Here we report a full-scale genome-wide mitochondrial map, which includes all the major silkworm classes in Bombycidae, and unveils - at a single base-pair resolution - the distinction between the two wild silkworm subgroups. This map will provide a valuable resource for further study on silkworm mitochondria evolution, and will accelerate the research of functional identification among silkworm genes.
We estimated θπ values for SNPs in mitochondria and found they were 1.14 × 10-3 and 6.20 × 10-3 in B. mori and B. mandarina, respectively, and we also know that θπ values in the nuclear genome were 1.36 × 10-2 and 1.53 × 10-2 in B. mori and B. mandarina, respectively [7]. The relatively larger polymorphism level increase in nuclear genome is mainly due to the background transposable element content [35] and rapid decay of LD [7]. The pattern in humans, whose mutation rate is 2.8 × 10-3 [36] and 0.8 × 10-3 [37] in our mt and nuclear genomes, respectively, provides an interesting contrast to that of the silkworm. But compared to Drosophila simulans, we found a similar phenomenon of a nuclear genome mutation rate (1.8 × 10-2) [38] being higher than the mitochondrial rate (1.1 × 10-3) [8]. This indicated that the insect nuclear genome could tolerate more alteration, and the differential of effective population size between nuclear genome and mt genome would be more distinct in the insect. Although the diversity of mitochondria was smaller than that of the nuclear, the difference between the domesticated silkworms and the wild silkworms was apparent, which suggested they had exclusive genetic background, and local inbreeding had produced more effect on the domesticated population.
In recent years, scientists have only used limited samples or partial genome datasets to infer the phylogenic relationship amongst silkworm clades. The main features of these analyses have been on the basis of incomplete genetic information. Although it is possible for them to reach the conclusion that the true ancestor of the domesticated silkworm is the Chinese wild group, representatives of several basal lineages remain missing. Here, taking advantage of 46 complete mt genomes, we can confidently verify the consensus phylogeny of Arunkumar et al and Pan et al that B. mori was domesticated from the Chinese B. mandarina. Both the AU test and WSH test also provided further support on this argument. We also endeavored to study the major genetic characteristics left by silkworm domestication process, such as the different level of polymorphisms within each group, and the selection force shaping on the mt genome. In the mitochondrion of eukaryotes and in aerobic prokaryotes, the cytb protein is a component of respiratory chain complex III, and is related to electron transfer. Mutation in the site 318 of human cytb gene causes severe deficiency in the respiratory chain enzyme involving in patient exercise intolerance [39]. In silkworms, previous studies also showed that nine midgut-enriched genes related to energy metabolism under selection play a critical role in food digestion and nutrient absorption [7]. The identification of cytb gene indicates that mt genes probably contribute equally to energy metabolism process, and is important to the domesticated silkworm. This is the first time we sort out a gene under positive selection in silkworm mtDNA, and it may provide a new insight into the silkworm mtDNA evolution process.
The constant population size inference for B. mori and B. mandarina in China indicated that the Chinese wild silkworm led diverse and distinct lifestyles in the wild mulberry, and the domesticated silkworm retained and conserved their abundant interspecific polymorphism. These results would pave the way for breeding strategies later.
B. mori is not only well adapted to human handling, but is wholly dependent on humans for survival, in addition to being well differentiated trait-wise from its wild cousin. This makes silkworm domestication a distinctive event in agricultural history, deserving the same attention as domestication of livestock and crop plants; especially as it took place in a different geographical region (Asia vs. the Fertile Crescent) [40], and in a distinctly different culture from the earliest known, and better studied domestication events.
Conclusions
Based on whole genome comparative analysis, with 41 silkworm mitochondrion and 5 other available mt genome sequences, we identified 347 SNPs in the silkworm mt genome. Using this data, we infer that the silkworm mt genome did not undergo recombination, and find it very strongly implied that the Chinese B. mandarina is the most recent ancestor of domesticated B. mori, in confirmation of the conclusions of Arunkumar et al and Pan et al. It is found that, after silkworm domestication and group divergence, the effective population sizes in both groups remained constant, and that identifiable genes underwent powerful selection pressures in B. mori.
These comprehensive overviews will provide new insight into the evolution of the silkworm. It is believed that the silkworm domestication event is of comparative significance equal to the concurrent domestication events of crop plants and animal livestock, during the same time period of human history.
Authors' contributions
DL designed the study, performed the data collection, carried out the molecular genetic studies, drafted and revised the manuscript. YRG and LCT revised the manuscript, and HJS participated in the data analysis. QYX and JW took part in conceiving the study and helped to revise the manuscript. ZHX coordinated the study. All authors read and approved the final manuscript.
Acknowledgements
We thank Dr. Kazuei Mita at National Institute of Agrobiological Sciences in Japan for his kindly providing the Japanese wild silkworm genomic DNA. We thank two anonymous referees providing valuable comments. This work is supported by grants from the National Basic Research Program of China (No. 2005CB121000), the Program for Changjiang Scholars and Innovative Research Team in University (IRT0750), and the Shenzhen Bureau of Science Technology & Information, China (JC200903190764A).
References
1. Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA, Saunders NC: Intraspecific Phylogeography - the Mitochondrial-DNA Bridge between Population-Genetics and Systematics.
Annu Rev Ecol Syst 1987, 18:489-522.
2. Xiang ZH, Huang JT, Xia JG, Lu C: Biology of sericulture. Beijing: China Forestry Publishing House; 2005.
3. Goldsmith MR, Shimada T, Abe H: The genetics and genomics of the silkworm, Bombyx mori.
Annu Rev Entomol 2005, 50:71-100. PubMed Abstract | Publisher Full Text
4. Tomita M, Munetsuna H, Sato T, Adachi T, Hino R, Hayashi M, Shimizu K, Nakamura N, Tamura T, Yoshizato K: Transgenic silkworms produce recombinant human type III procollagen in cocoons.
Nat Biotechnol 2003, 21(1):52-56. PubMed Abstract | Publisher Full Text
5. Arunkumar KP, Metta M, Nagaraju J: Molecular phylogeny of silkmoths reveals the origin of domesticated silkmoth, Bombyx mori from Chinese Bombyx mandarina and paternal inheritance of Antheraea proylei mitochondrial DNA.
Mol Phylogenet Evol 2006, 40(2):419-427. PubMed Abstract | Publisher Full Text
6. Pan M, Yu Q, Xia Y, Dai F, Liu Y, Lu C, Zhang Z, Xiang Z: Characterization of mitochondrial genome of Chinese wild mulberry silkworm, Bomyx mandarina (Lepidoptera: Bombycidae).
Sci China C Life Sci 2008, 51(8):693-701. PubMed Abstract | Publisher Full Text
7. Xia Q, Guo Y, Zhang Z, Li D, Xuan Z, Li Z, Dai F, Li Y, Cheng D, Li R, et al.: Complete resequencing of 40 genomes reveals domestication events and genes in silkworm (Bombyx).
Science 2009, 326(5951):433-436. PubMed Abstract | Publisher Full Text
8. Ballard JW, Kreitman M: Unraveling selection in the mitochondrial genome of Drosophila.
Genetics 1994, 138(3):757-772. PubMed Abstract | PubMed Central Full Text
9. Ballard JW, Kreitman M: Is mitochondrial DNA a strictly neutral marker?
Trends Ecol Evol 1995, 10:485-488. Publisher Full Text
10. Rand DM: The units of selection on mitochondrial DNA.
Annu Rev Ecol Syst 2001, 32:415-448. Publisher Full Text
11. Wang J, Xia Q, He X, Dai M, Ruan J, Chen J, Yu G, Yuan H, Hu Y, Li R, et al.: SilkDB: a knowledgebase for silkworm biology and genomics.
Nucleic Acids Res 2005, (33 Database):D399-402. PubMed Abstract | PubMed Central Full Text
12. Yukuhiro K, Sezutsu H, Itoh M, Shimizu K, Banno Y: Significant levels of sequence divergence and gene rearrangements have occurred between the mitochondrial genomes of the wild mulberry silkmoth, Bombyx mandarina, and its close relative, the domesticated silkmoth, Bombyx mori.
Mol Biol Evol 2002, 19(8):1385-1389. PubMed Abstract | Publisher Full Text
13. Li R, Li Y, Kristiansen K, Wang J: SOAP: short oligonucleotide alignment program.
Bioinformatics 2008, 24(5):713-714. PubMed Abstract | Publisher Full Text
14. Li R, Li Y, Fang X, Yang H, Wang J, Kristiansen K: SNP detection for massively parallel whole-genome resequencing.
Genome Res 2009, 19(6):1124-1132. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
15. Lewontin RC: The Interaction of Selection and Linkage. I. General Considerations; Heterotic Models.
Genetics 1964, 49(1):49-67. PubMed Abstract | PubMed Central Full Text
16. Wang WY, Barratt BJ, Clayton DG, Todd JA: Genome-wide association studies: theoretical and practical concerns.
Nat Rev Genet 2005, 6(2):109-118. PubMed Abstract | Publisher Full Text
17. Barrett JC, Fry B, Maller J, Daly MJ: Haploview: analysis and visualization of LD and haplotype maps.
Bioinformatics 2005, 21(2):263-265. PubMed Abstract | Publisher Full Text
18. Edgar RC: MUSCLE: multiple sequence alignment with high accuracy and high throughput.
Nucleic Acids Res 2004, 32(5):1792-1797. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
19. Tamura K, Dudley J, Nei M, Kumar S: MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0.
Mol Biol Evol 2007, 24(8):1596-1599. PubMed Abstract | Publisher Full Text
20. Huelsenbeck JP, Ronquist F: MRBAYES: Bayesian inference of phylogenetic trees.
Bioinformatics 2001, 17(8):754-755. PubMed Abstract | Publisher Full Text
21. Shimodaira H, Hasegawa M: CONSEL: for assessing the confidence of phylogenetic tree selection.
Bioinformatics 2001, 17(12):1246-1247. PubMed Abstract | Publisher Full Text
22. Guindon S, Gascuel O: A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood.
Syst Biol 2003, 52(5):696-704. PubMed Abstract | Publisher Full Text
23. Rogers AR, Harpending H: Population growth makes waves in the distribution of pairwise genetic differences.
Mol Biol Evol 1992, 9(3):552-569. PubMed Abstract | Publisher Full Text
24. Slatkin M, Hudson RR: Pairwise comparisons of mitochondrial DNA sequences in stable and exponentially growing populations.
Genetics 1991, 129(2):555-562. PubMed Abstract | PubMed Central Full Text
25. Librado P, Rozas J: DnaSP v5: a software for comprehensive analysis of DNA polymorphism data.
Bioinformatics 2009, 25(11):1451-1452. PubMed Abstract | Publisher Full Text
26. McDonald JH, Kreitman M: Adaptive protein evolution at the Adh locus in Drosophila.
Nature 1991, 351(6328):652-654. PubMed Abstract | Publisher Full Text
27. Sokal RR, Rohlf FJ: Biometry: the principles and practice of statistics in biological research. 3rd edition. New York: Freeman; 1994.
28. Yang Z: PAML 4: phylogenetic analysis by maximum likelihood.
Mol Biol Evol 2007, 24(8):1586-1591. PubMed Abstract | Publisher Full Text
29. Awadalla P, Eyre-Walker A, Smith JM: Questioning Evidence for Recombination in Human Mitochondrial DNA.
Science 2000, 288(5473):1931a. PubMed Abstract | Publisher Full Text
30. Guo SW: Linkage disequilibrium measures for fine-scale mapping: a comparison.
Hum Hered 1997, 47(6):301-314. PubMed Abstract | Publisher Full Text
31. Shimodaira H: An approximately unbiased test of phylogenetic tree selection.
Syst Biol 2002, 51(3):492-508. PubMed Abstract | Publisher Full Text
32. Watson E, Bauer K, Aman R, Weiss G, von Haeseler A, Paabo S: mtDNA sequence diversity in Africa.
Am J Hum Genet 1996, 59(2):437-444. PubMed Abstract | PubMed Central Full Text
33. Tajima F: Statistical method for testing the neutral mutation hypothesis by DNA polymorphism.
Genetics 1989, 123(3):585-595. PubMed Abstract | PubMed Central Full Text
34. Fu YX, Li WH: Statistical tests of neutrality of mutations.
Genetics 1993, 133(3):693-709. PubMed Abstract | PubMed Central Full Text
35. Xia Q, Zhou Z, Lu C, Cheng D, Dai F, Li B, Zhao P, Zha X, Cheng T, Chai C, et al.: A draft sequence for the genome of the domesticated silkworm (Bombyx mori).
Science 2004, 306(5703):1937-1940. PubMed Abstract | Publisher Full Text
36. Ingman M, Kaessmann H, Paabo S, Gyllensten U: Mitochondrial genome variation and the origin of modern humans.
Nature 2000, 408(6813):708-713. PubMed Abstract | Publisher Full Text
37. Wang J, Wang W, Li R, Li Y, Tian G, Goodman L, Fan W, Zhang J, Li J, Guo Y, et al.: The diploid genome sequence of an Asian individual.
Nature 2008, 456(7218):60-65. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
38. Begun DJ, Holloway AK, Stevens K, Hillier LW, Poh YP, Hahn MW, Nista PM, Jones CD, Kern AD, Dewey CN, et al.: Population genomics: whole-genome analysis of polymorphism and divergence in Drosophila simulans.
PLoS Biol 2007, 5(11):e310. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
39. Andreu AL, Hanna MG, Reichmann H, Bruno C, Penn AS, Tanji K, Pallotti F, Iwata S, Bonilla E, Lach B, et al.: Exercise intolerance due to mutations in the cytochrome b gene of mitochondrial DNA.
N Engl J Med 1999, 341(14):1037-1044. PubMed Abstract | Publisher Full Text
40. Driscoll CA, Macdonald DW, O'Brien SJ: From wild animals to domestic pets, an evolutionary view of domestication.
Proc Natl Acad Sci USA 2009, 106(Suppl 1):9971-9978. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:02:32.000Z
|
aqgincrhjwkpjtfkl4emsbknxkqj2ini
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5800",
"uncompressed_offset": 346843897,
"url": "www.biomedcentral.com/1471-2164/13/533/comments",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.biomedcentral.com/1471-2164/13/533/comments"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Analysis of the Lactobacillus casei supragenome and its influence in species evolution and lifestyle adaptation
Jeff R Broadbent*, Eric C Neeno-Eckwall, Buffy Stahl, Kanokwan Tandee, Hui Cai, Wesley Morovic, Philippe Horvath, Jessie Heidenreich, Nicole T Perna, Rodolphe Barrangou and James L Steele
BMC Genomics 2012, 13:533 doi:10.1186/1471-2164-13-533
No comments have yet been made on this article.
Post a comment
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:24:11.000Z
|
gipvadfugn2wruq4st25u2s6gmnulw5j
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5801",
"uncompressed_offset": 346873262,
"url": "www.biomedcentral.com/1752-0509/5/197/abstract",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.biomedcentral.com/1752-0509/5/197/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Research article
More than just a metabolic regulator - elucidation and validation of new targets of PdhR in Escherichia coli
Anna-Katharina Göhler1, Öznur Kökpinar2,3, Wolfgang Schmidt-Heck4, Robert Geffers5, Reinhard Guthke4, Ursula Rinas2,3, Stefan Schuster6, Knut Jahreis1 and Christoph Kaleta6,7*
Author Affiliations
1 Department of Genetics, University of Osnabrück, Barbarastraβe 11, D-49076 Osnabrück, Germany
2 Helmholtz Centre for Infection Research, Inhoffenstraβe 7, D-38124 Braunschweig, Germany
3 Institute of Technical Chemistry - Life Science, Leibniz University of Hannover, Callinstraβe 5, D-30167 Hannover, Germany
4 Systems Biology/Bioinformatics Group, Leibniz Institute for Natural Product Research and Infection Biology - Hans Knöll Institute, D-07745 Jena, Germany
5 Research Group Genome Analytics, Helmholtz Centre for Infection Research, Inhoffenstraβe 7, D-38124 Braunschweig, Germany
6 Department of Bioinformatics, School of Biology and Pharmaceutics, Ernst-Abbe-Platz 2, Friedrich Schiller University of Jena, D-07743 Jena, Germany
7 Research Group Theoretical Systems Biology, School of Biology and Pharmaceutics, Leutragraben 1, Friedrich Schiller University of Jena, D-07743 Jena, Germany
For all author emails, please log on.
BMC Systems Biology 2011, 5:197 doi:10.1186/1752-0509-5-197
Published: 14 December 2011
Abstract
Background
The pyruvate dehydrogenase regulator protein (PdhR) of Escherichia coli acts as a transcriptional regulator in a pyruvate dependent manner to control central metabolic fluxes. However, the complete PdhR regulon has not yet been uncovered. To achieve an extended understanding of its gene regulatory network, we combined large-scale network inference and experimental verification of results obtained by a systems biology approach.
Results
22 new genes contained in two operons controlled by PdhR (previously only 20 regulatory targets in eight operons were known) were identified by analysing a large-scale dataset of E. coli from the Many Microbes Microarray Database and novel expression data from a pdhR knockout strain, as well as a PdhR overproducing strain. We identified a regulation of the glycolate utilization operon glcDEFGBA using chromatin immunoprecipitation and gel shift assays. We show that this regulation could be part of a cross-induction between genes necessary for acetate and pyruvate utilisation controlled through PdhR. Moreover, a link of PdhR regulation to the replication machinery of the cell via control of the transcription of the dcw-cluster was verified in experiments. This augments our knowledge of the functions of the PdhR-regulon and demonstrates its central importance for further cellular processes in E. coli.
Conclusions
We extended the PdhR regulon by 22 new genes contained in two operons and validated the regulation of the glcDEFGBA operon for glycolate utilisation and the dcw-cluster for cell division proteins experimentally. Our results provide, for the first time, a plausible regulatory link between the nutritional status of the cell and cell replication mediated by PdhR.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:56:57.000Z
|
us7pm6sutdwg3loxfv4vq47vj53wjh53
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5802",
"uncompressed_offset": 348469360,
"url": "www.bizsugar.com/Startups/obstacles-are-no-match-for-entrepreneurs-/",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.bizsugar.com/Startups/obstacles-are-no-match-for-entrepreneurs-/"
}
|
cccc_CC-MAIN-2013-20
|
Obstacles are a part of life and business. Rather than allowing them to hold you back, it’s important to look for the lesson or opportunity that will lead the way around, over, or through it. Entrepreneurs do not lack determination when it comes to overcoming obstacles, so this week I posed the question -
What was your biggest business obstacle in 2010, and how did you successfully overcome it?
Our experts weighed in, sharing their biggest challenges and solutions from 2010. If you are facing what feels like an insurmountable challenge or uphill climb in your business, I hope the transparency of our panel will inspire you to find your way to success.
Subscribe
Jeffrey Fabian: Contributor of the Week
Our latest BizSugar Contributor of the Week is a real legal eagle as well as an entrepreneur. While already … More
Editor's Picks
See if you're one of our Top 10 Members this week!
Got small business blog posts? Register and submit them today!
Add BizSugar buttons and plugins to your small biz toolkit!
Shazam! Meet Contributor of the Week Paul Cox...Congrats, Paul!
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:20:45.000Z
|
t73bhwh4mikyktifpycyimtrcqjwkb74
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5817",
"uncompressed_offset": 433424114,
"url": "www.envirolink.org/topics.html?catid=3&do=catsearch&topic=Bird+Watching&topicsku=2002119151341&topictype=subtopic",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.envirolink.org/topics.html?topic=Bird%20Watching&topicsku=2002119151341&topictype=subtopic&do=catsearch&catid=3"
}
|
cccc_CC-MAIN-2013-20
|
advanced search
Bird Watching - General Information
Actions You Can Take (2)
Articles (0)
Educational Resources (5)
E-Mail Lists (0)
Events (0)
General Info (2)
Government Resources (1)
Organizations (9)
Jobs & Volunteer Opportunities (0)
Publications (2)
Displaying 1 - 2 of 2 resources in Bird Watching and General Information:
1. The Birding Home
Rehovot, Israel
Offers a collection of birding reports, and online checklist. ...
Category: General Information
2. Watershed & Coastal Resources of Orange County, CA
Santa Ana, CA, USA
Our new web site is a flood of information on the Coastal Resources and all 13 Watersheds in Orange County, California. ...
Category: General Information
Home | Site Map | About EnviroLink | Advanced Search | Suggest a Resource
All content on this website is governed by a Creative Commons license.
This site powered by WebDNA
Community Information Systems provided by Rhiza Labs
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:33:01.000Z
|
fxmofrkczkdspjra6i5aahuykscepd7k
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5818",
"uncompressed_offset": 433533495,
"url": "www.eoearth.org/video/view/177599/",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.eoearth.org/video/view/177599/"
}
|
cccc_CC-MAIN-2013-20
|
Rate This Video
Average: 0/5
Natural Hazards Affect Humans
Natural Hazards Affect Humans
Big Idea 8: Natural Hazards Affect Humans is the ninth of 10 short videos explaining what we all should know about the science of the Earth — how the planet's land, water, air, and life systems interact. The American Geological Institute has developed these videos to bring to life the core concepts identified by the U.S. National Science Foundation-funded Earth Science Literacy Initiative (www.earthscienceliteracy.org). For educational activities exploring each of the nine "Big Ideas of Earth Science" illustrated in the videos, visit Earth Science Week (www.earthsciweek.org).
In Why Earth Science?, stunning video sequences and images illuminate the importance of knowing how Earth works and illustrate opportunities for careers in the Earth sciences.
Publishing Information
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:20:30.000Z
|
x5jufpmgziis2ftziklhz2ikutcrmfx2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5820",
"uncompressed_offset": 442339589,
"url": "www.familysearch.org/learn/wiki/en/St._Philip_Parish,_Georgia",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/St._Philip_Parish,_Georgia"
}
|
cccc_CC-MAIN-2013-20
|
St. Philip Parish, GeorgiaEdit This Page
From FamilySearch Wiki
United States Georgia St. Philip Parish
Before the American Revolution, the state church of Georgia was the Church of England (the Anglican Church, or Protestant Episcopal Church). Besides keeping parish registers, the church kept many records of a civil nature in their vestry books. The Vestry was as much a political body as a religious one. The wardens and commissioners were responsible for the roads, education, the poor and orphans, voting and collecting taxes in addition to their church duties.
Contents
Founded
St. Philip Parish (location, GA) was officially created in 1758 as an original colonial parish.
Boundary
Borders: Christ Church, St. George, St. John, and St. Matthew parishes. For a map, see: Map of Georgia's Colonial Parishes (courtesy: GeorgiaInfo).
Areas Served: St. Philip Parish served: FIX
Modern equivalent: The original parish covered part of what is present-day county.
Resources
Cemetery
Parish History
Parish Records
Websites
References
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 29 March 2012, at 19:35.
• This page has been accessed 444 times.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:00:59.000Z
|
f3dzn7avm5itogih6j2otrvtmjo6uqru
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5833",
"uncompressed_offset": 496476715,
"url": "www.hindawi.com/journals/jnm/2012/201584/",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.hindawi.com/journals/jnm/2012/201584/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
Journal of Nanomaterials
Volume 2012 (2012), Article ID 201584, 9 pages
doi:10.1155/2012/201584
Research Article
Synthesis and Characterization of Metal Hydride/Carbon Aerogel Composites for Hydrogen Storage
1Department of Chemical Engineering and Materials Science, Fuel Cell Center, Yuan Ze University, Chungli 320, Taiwan
2School of Materials Science and Engineering, The University of New South Wales, Sydney, NSW 2052, Australia
Received 21 June 2012; Accepted 15 August 2012
Academic Editor: Hamed Bahmanpour
Copyright © 2012 Kuen-Song Lin et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Two materials currently of interest for onboard lightweight hydrogen storage applications are sodium aluminum hydride (NaAlH4), a complex metal hydride, and carbon aerogels (CAs), a light porous material connected by several spherical nanoparticles. The objectives of the present work have been to investigate the synthesis, characterization, and hydrogenation behavior of Pd-, Ti- or Fe-doped CAs, NaAlH4, and MgH2 nanocomposites. The diameters of Pd nanoparticles onto CA’s surface and BET surface area of CAs were 3–10 nm and 700–900 m2g−1, respectively. The H2 storage capacity of metal hydrides has been studied using high-pressure TGA microbalance and they were 4.0, 2.7, 2.1, and 1.2 wt% for MgH2-FeTi-CAs, MgH2-FeTi, CAs-Pd, and 8 mol% Ti-doped NaAlH4, respectively, at room temperature. Carbon aerogels with higher surface area and mesoporous structures facilitated hydrogen diffusion and adsorption, which accounted for its extraordinary hydrogen storage phenomenon. The hydrogen adsorption abilities of CAs notably increased after inclusion of metal hydrides by the “hydrogen spillover” mechanisms.
1. Introduction
Hydrogen is recognized as a clean fuel because of its almost complete combustion in air with notably high energy delivery ability. Recently, owning to the need for efficient and safe H2 storage, enormous attention has been paid on the advantages of synthesizing composite metal hydrides [13]. Complex metal hydride composites in the form of ABH4, where A is an alkali metal and B is a group III element, have been widely studied in solution as proton acceptors to enhance H2 adsorption abilities [47]. NaAlH4 is different from any other metal hydrides and borohydrides with similar structures since it is capable to reversibly store H2 after doping with transition metals (e.g., Ti, Fe, or Zr) [810]. Ti-doping also improves significantly the kinetic and cycling performance of NaAlH4 at moderate temperatures around 373 K and ambient pressures. All these properties make it suitable as mobile, lightweight H2 storage materials for potential application on a hydrogen fuel cell [1123]. Practically, achievable H2 storage capacity for Ti-NaAlH4 is only 3.7 wt%, falls short of the theoretical value of 5.6 wt% for NaAlH4 [2023].
Magnesium and its alloys are potential hydrogen storage material because of their very high hydrogen storage abilities. MgH2 is also relatively light and cheaper when compared with other metal hydrides. Magnesium is often alloyed with transition metals (e.g., Fe, Ti, Zr, Zn, or Mn) to increase the adsorption and desorption rates [2429]. Similarly, FeTi is a viable compound with a hydrogen adsorption capacity of around 1.90 wt%. However, activation process of FeTi is necessary to get rid of the TiO2 layer, which would otherwise hinder the hydrogenation/dehydrogenation. Consequently, higher temperatures and pressures are frequently required to achieve reproducible, maximum hydrogen adsorption/desorption capacities in the compounds [30].
Palladium-doped monolithic carbon aerogels (CAs) show a high surface area and pore volume. These characteristics are strongly influenced by the chemical nature, distribution and dispersion of the palladium particles [3133]. Furthermore, addition of 1 wt% Pd can be effective for the hydrogen adsorption capacity of FeTi to achieve its theoretical hydrogen storage capacity of 1.9 wt% [3133]. As carbon materials such as graphite or CAs have been shown to reduce the hydrogen adsorption and desorption temperatures of Mg [34], it is not unreasonable to expect that CA addition could also be able to improve the hydrogen adsorption behavior of the FeTi system. There is a further advantage of using Pd-doped CAs as it has been shown that an addition of 1 wt% Pd in the FeTi can effectively enhance its hydrogen adsorption capacity [3133].
X-ray absorption near edge structure (XANES)/extended X-ray absorption fine structure (EXAFS) spectroscopy offers a powerful tool to understand the oxidation states and fine structures of Ti atoms in the microstructure of metal hydride composites [3538]. Thus, a thorough study of the location of Ti species in metal hydrides may be helpful to explain the enhancement of hydrogen adsorptive kinetics by identifying the compounds in the hydrides. XANES/EXAFS spectroscopy is also an excellent technique for characterizing the valency and local structure of Ti species in a complex Ti-metal hydride with short-range orders [3741]. These studies are conducted to identify the optimum hydrogen storage capacity for hydrogen storage system. In this work, synthesis and characterization, and advantages/disadvantages of different metal-hydride systems such as Mg, TiFe, or Na-based metal hydrides, complex hydrides compounds, were investigated by field-emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), and XANES/EXAFS spectroscopy. In addition, the adsorptive H2 storage capacity was also studied using a high-pressure thermogravimetric analyzer.
2. Experimental
2.1. Preparation of Metal-Doped Carbon Aerogels
Metal-loaded organic aerogels were prepared following the method developed by Pekala [42] for resorcinol-formaldehyde aerogels. In a typical procedure, CA was synthesized by first stirring vigorously resorcinol (20.70 g), Na2CO3 (0.04 g), and equal amount of deionized water in a polypropylene jar at room temperature until resorcinol dissolved. Formaldehyde (30.94 g of purity 36.5%) was then added to the solution, followed by 0.01 M PdCl2 (Reagent ACS R.D.H., Germany) to acquire the doping of palladium. The solution was left at room temperature for 24 h, then at 323 K for the next 24 h, and finally at 365 K for another 72 h to obtain a dark black monolith. The product was rinsed with acetone three times and soaked overnight at room temperature, yielding the hydrogel materials. After drying at room temperature, the hydrogels were isolated by heating in an oven at temperatures from 273 to 1,100 K under an Ar atmosphere for several hours to obtain the Pd-doped CAs.
2.2. Preparation of Metal Hydrides
As received TiCl3 (Aldrich, 99.99%, anhydrous) was used as the catalyst precursor. Crystalline NaAlH4 (Fluka, 99.9%) was purified by tetrahydrofuran (THF) (Aldrich, 99.9%, anhydrous) solution and vacuum-dried while being filtered through 0.7 μm filter paper to remove any residual Al powder and other solids from the solution. The purified NaAlH4 was mixed with the catalyst precursor in THF to produce a Ti-doped sample containing up to 20 mol% metal (relative to either Na or Al). The THF was evaporated while the NaAlH4 and catalyst precursor were mixed manually for about 30 min, using a mortar and pestle, or until the sample appeared to be completely dry. A Ti-NaAlH4 sample was then ball-milled for 2 h using a SPEX 8000 high-energy mixer/mill at a milling speed of 1,000 rpm, and the weight ratio of ball to powder was 10 : 1. 0.5–1.0 gram of sample was subjected to ball-milling each time in a 65 cm3 SUS 304 vial by ZrO2 balls of 1.3 cm in diameter. Fe- and Ti-doped MgH2 was prepared following Yao et al. [43], where MgH2 was obtained by heating Mg powders (Alfa Aesar) to 400°C in a hydrogen storage rig. 90 wt% conversion to MgH2 was achieved according to the volumetric calculations. 1.5–2.0 grams of nanophase iron powder (100 nm), Ti (Aldrich Co), and MgH2 samples were mixed in the composition of MgH2-5.0 wt% (2Fe + Ti, molar ratio) and mechanically ball-milled by using a ZrO2 ball mixer/mill (model SPEX 8000). The samples were subjected to ball-milling as described above for 2 h, using a weight ratio of ball to powder of 8 : 1 The powder was then ball-milled again with 5.0 wt% of CAs for an additional 10 h at a milling speed of 1,000 rpm. All procedures described above were carried out in a flowing argon gas glove box to prevent the metal hydride samples from oxidation. The samples were then used for hydrogen adsorption property tests and microstructure characterization.
2.3. Hydrogen Adsorption Measurements
The hydrogen isotherms were measured gravimetrically at different temperatures using a method previously described by Eddaoudi et al. [44]. A Cahn Thermax 500 microgravimetric balance with a sensitivity of 1 μg was used to measure the change in mass of samples suspended within a glass enclosure under a certain atmosphere. A pressure sensor, with a range of 0 to 68 atm (at 1,000°C) and sensitivity of 0.011 atm, was used to measure the hydrogen pressure in the chamber. Samples were outgassed overnight until a constant mass was attained; these varied from 0.2 to 2.0 g. Prior to admittance of argon gas, the entire chamber and manifold were evacuated overnight. The system was purged at room temperature three times with the argon gas before cooling to 77 K, and gases were passed through a molecular sieve trap immersed in liquid nitrogen to remove any condensable impurities or moisture before being exposed to the sample. Pressures were measured with the range covering 1 to 30 atm. Hydrogen was added incrementally, and data points were recorded when no further change in mass was observed. The dynamic hydrogen adsorption data on Pd-, Ti-, Fe-doped CAs, NaAlH4, or MgH2 batch adsorption experiments were also conducted at room temperature (298 K) and different pressures. The adsorbed amount of hydrogen was calculated after the buoyancy correction.
2.4. Characterization of Carbon Aerogels and Metal Hydrides
The morphologies, crystallinity, particle size distribution, and the compositions of as-synthesized metal hydrides and metal-doped CAs were determined by FE-SEM equipped with EDS (Hitachi, S-4700 Type II) and HR-TEM (Zeiss 10C). XRD (MAC Science, MXP18) was performed to identify the phases and crystallinities in the samples. Complex of metallic hydride and CAs was scanned from 20 to 80° () with a scan rate of 4° () min−1, and monochromatic radiation was used. The recorded specific peak intensities and values can be further identified by a computer database system (JCPDS). The surface areas of the CAs were measured by BET (Brunauer-Emmett-Teller) nitrogen adsorption (Micromeritics ASAP 2010 Instrument). For the BET surface area measurement, the samples were scraped from the sample tube substrate and powdered so as to avoid any influence from the steel tube. Prior to measurement, all samples were degassed at 423 K for 1 h. For the calculation of the BET surface areas, the relative pressure range from 0.05 to 0.2 was used. The pore radius distribution was determined by Barrett, Joyner, and Halenda (BJH) method.
The XANES/EXAFS spectra were collected at BL16A1 and BL01C1 (SWLS) beamlines at the National Synchrotron Radiation Research Center (NSRRC) of Taiwan. The electron storage ring was operated with the energy of 1.5 GeV and a current of 100–200 mA. A Si(111) double crystal monochromator (DCM) was used for providing highly monochromatized photon beams with energies of 1 to 15 keV (BL16A1) and 5 to 30 keV (BL01C1) and resolving power of up to 7,000. Data were collected in fluorescence or transmission mode with a Lytle ionization detector [39] for Ti (4,966 eV) and Pd (24,350 eV) K-edge experiments at room temperature. The photon energy was calibrated by characteristic preedge peaks in the absorption spectra of Ti standards. The raw absorption data in the region of 50 to 200 eV below the edge position were fit to a straight line using the least-square algorithms [3740]. The XANES was extended to energy of the order of 50 eV above the edge. The -weighted and EXAFS spectra were Fourier transformed to space over the range between 2.5 and 12.5 . The EXAFS data were analyzed by using the UWXAFS 3.0 program and FEFF 8.2 codes [3741].
3. Results and Discussion
3.1. Morphology of Metal-Doped Carbon Aerogels and Metal Hydrides
The HR-TEM image and FE-SEM micrographs of metal hydride and CAs complexes synthesized are shown in Figure 1. Figure 1(a) is an HR-TEM observation of the Pd-doped aerogel structure consisting of spherical primary Pd(0) nanoparticles. It can be seen that palladium particles of size 3 to 10 nm were uniformly distributed throughout the gel. FE-SEM micrograph in Figure 1(b) reveals the pellet-like or irregularly shaped Ti-NaAlH4 crystalline nanoparticle, with diameters approximately 50–80 nm. Correspondingly, Fe and Ti nanoparticles with an average diameter of 50–80 nm were dispersed uniformly on the surface of the doped MgH2 surface as shown in Figure 1(c).
Figure 1: (a) HR-TEM image of 5 wt% Pd-doped carbon aerogels, FE-SEM microphotos of (b) 20 mol% Ti-NaAlH4, and (c) 5 wt% FeTi-CAs-MgH2 (Fe : Ti = 2 : 1, molar ratio).
3.2. X-Ray Powder Diffraction
The structure of the compound was confirmed by structural refinement of X-ray diffraction patterns shown in Figure 2. The intensive peaks appearing at small 2 angles were characteristics of porous materials which possess numerous pores or cavities. Whereas Figure 2(a) shows the characteristic peaks of 2 = 27.46, 31.75, 45.53, 56.54, 66.29, 75.36, and 84.06°, respectively, which indicates that the structure of Ti-NaAlH4 composites might not be affected by Ti added during ball-milling. From the intensity of (200) peak, the minimum grain size was measured to be around 60 nm [1720]. This grain particle size was calculated from Scherrer’s equation (with Warren’s correction for instrumental broadening) applied to the half-height of the maximum intensity diffraction peak. Metallic Na3AlH6 and Al were consistent with the characteristic peak at 32.92 and 38.6°, respectively [24]. From the FE-SEM measurement and XRD patterns, the titanium compound distributed on the surface of the NaAlH4 can be confirmed.
Figure 2: XRD patterns of (a) 20 mol% Ti-NaAlH4, (b) 5 wt% Pd-doped carbon aerogels, and (c) 5 wt% FeTi-MgH2 (Fe : Ti = 2 : 1, molar ratio).
The X-ray diffraction patterns of the Pd-doped CAs indicate that the Pd nanoparticles have a crystalline structure (Figure 2(b)). According to FE-SEM micrographs, the well dispersion of metallic Pd nanoparticles in the CAs apparently facilitated the porous structure. The XRD patterns of Pddoped CAs show those two characteristic sharp peaks with higher intensities around 40.12 and 46.77°, indicating a largely crystalline structure. The mean particle size was about 5–8 nm from HR-TEM observation that may help the mesoporous structure of CAs to adsorb hydrogen. The diffraction angles at around 20 and 44°, corresponding to the (002) and (101) diffraction peaks of graphite, respectively, are represented in Figure 2(b). In addition, hexagonal structure of the CAs started to become disordered with the heat treatment, owning to the progressive graphitization of the sample. Figure 2(c) represents the XRD patterns of FeTi-doped MgH2 structure. The peak of the Fe sample at 44.6° indicates that the decomposition of Fe onto the metal hydrides, whereas characteristic peaks of -MgH2 were observed at 27.81, 31.23, 39.7, 54.57, 65.45, and 75.54°, respectively. Thus, -MgH2 morphology was dominated in the sample, and the metallic Mg with -MgH2 structure represents the peaks at 36, 57.76, and 25.67°, respectively [43].
3.3. XANES and EXAFS
Figures 3(a)–3(e) show the preedge XANES spectra of Ti K-edge (4,966 eV) in nanophase Ti-NaAlH4 nanoparticles and anatase-typed TiO2 standard [45]. These spectra exhibit an absorbance feature of 4,966 eV for the 1s to 3d transition, which is forbidden by the selection rule in case of perfect octahedral symmetry. The sharp feature at 4,987 eV, due to the dipole allowed of 1s to electron transition, indicates the existence of Ti(IV). The intensity of the 1s to transition is proportional to the population of Ti(IV) of the Ti-NaAlH4 complexes. Oxygen atoms are the major atoms coordinated to the central Ti atoms in the Ti-NaAlH4 complexes.
Figure 3: Ti K-edge XANES spectra of (a) rutile and (b) anatase-typed TiO2 standards; (c) 20, (d) 12, and (e) 8 mol% Ti-NaAlH4 metal hydride composites after ball-milling for 2 h using a high-energy mixer/mill.
The reversible hydrogenation of NaAlH4 and dehydrogenation to NaH and Al occurred in two steps summarized as follows [16].
Remarkably, the addition of the Ti species lowers the activation energy of the adsorption/desorption processes and enhanced the kinetic rates of these reactions by several orders of magnitude [4650]. However, the exact mechanism still required further investigations. Notably, the hydrogen-depleted multicomponent products resulting from (2) were found to form large crystallites of the complex metal hydride upon the reverse reaction in the presence of Ti during hydrogenation [4547]. This is an important clue to understand the role of Ti where it implies a concerted migration of metal atoms over large distances. Local structural arrangements without the involvement of large-scale atomic migration would instead result in an amorphous or nanocrystalline structure.
The main scientific issues concerning the chemical forms (or speciation) of active species ultimately depend on molecular-scale structure and properties. Basic understanding at this scale is essential for further understanding the catalytic behaviors of Ti-NaAlH4 complexes synthesized at different mol% values of Ti. Generally, Ti K-edge EXAFS spectroscopy in Figure 4 can provide the information on the Ti atomic arrangement of catalysts in terms of bond distance, bond angle, coordination number, kind of near neighbors, and thermal or static disorders. Experimentally, the Ti species with a central Ti atom have a Ti–O bond distance of and a coordination number of 4.07, in a Ti-NaAlH4 composite after ball-milling for 2 h using a high-energy mixer/mill. Comparatively, however, a rutile-typed TiO2 has a central Ti atom with a Ti–Ti and a Ti–(O)–Ti bonds, and their bond distances are and , respectively [2932, 40]. Since the differences of mass density () and band structures between anatase- and rutile-typed TiO2, bond distances of Ti-O are and , respectively [914].
Figure 4: Fourier transformation (FT) spectra of (a) Ti-NaAlH4, (b) 20, (c) 12, and (d) 8 mol% Ti-NaAlH4 metal hydride composites after ball-milling for 2 h using a high-energy mixer/mill. The best fitting of the EXAFS spectra are expressed by the dotted lines.
The EXAFS data shown in Figure 4 reveals that the peak intensity of first-shell Ti–O bond increased with decreasing mol% values of Ti-dopants for a Ti-NaAlH4 composite after ball-milling for 2 h using a high-energy mixer/mill. These results may offer a further explanation on the higher oxidation states of Ti species for a Ti-NaAlH4 complex after ball-milling at higher rates and temperatures. Moreover, each Ti(IV) ion in the framework of nanophase Ti-NaAlH4 complex crystals is surrounded by six O2− ions [914]. Since the bond lengths of the first and second shells for Ti–O bonding are and , similarly with the coordination numbers of four and two, respectively, an octahedral structure of the Ti-NaAlH4 composites was found using EXAFS measurement [45]. As shown in Table 1 and Figure 5, the Ti species with a central Ti atom have a Ti–O bond distance of and a coordination number of 1.83, in a Ti-NaAlH4 composite in 8 mol% Ti-NaAlH4 metal hydride composites (more than 2 mol%) after the hydrogen adsorption processes. It can be seen that all Ti species in Ti-NaAlH4 metal hydride composites can be reduced in the hydrogen adsorption processes and be kept in the metallic Ti form.
Table 1: Fine structural parameters Pd/Ti atoms in Pd/Ti powder standards, 5 wt% Pd-doped carbon aerogels with or without hydrogen reduction, and 20 mol% Ti-NaAlH4 metal hydride composites analyzed by using EXAFS.
Figure 5: Ti K-edge XANES spectra of (a) TiO, (b) Ti2O3, (c) TiCl3, (d) rutile-, (e) anatase-typed TiO2 standards, (f) metallic Ti standard; (g) 20, (h) 12, and (i) 8 mol% Ti-NaAlH4 metal hydride composites after the hydrogen adsorption processes.
3.4. N2 Gas Adsorption Isotherms Analyses
Nonspecific physical adsorption of the CAs was carried out to measure the total surface area and pore size distribution for Pd-doped CAs, as shown in Figure 6. The surface area, pore size distribution, and crystalline diameter of CAs were calculated according to the adsorption data summarized in Table 2. A large surface area was generally observed for Pd-doped CAs and beneficial characteristic for a great variety of applications. The microcrystalline structure of Pd on the CAs is confirmed from the HR-TEM analysis (Figure 1(a)), resulting in an increase of the surface area. The nitrogen adsorption-desorption isotherms exhibit a hysteresis behavior, indicating the microstructural nature of the porous specimens. Moreover, the type IV hysteresis isotherm obtained is represented in Figure 6(a). The adsorption hysteresis was observed in the region of a relative pressure above 0.4. The specific surface areas of CAs and Pd-doped CAs are 687 and 725 m2 g−1, with the pore volumes of 0.62 and 0.64 cm3 g−1, respectively, as shown in Table 2. It also indicates that these resulting factors of surface enhancement depended on the doping of the Pd on the CAs and consisted of higher porous structure [49, 50]. These results may be caused by the dispersion of the Pd on the CAs surface and that indicated the metallic dispersion would be helpful for adsorption criteria.
Table 2: Values of specific surface area and pore size distribution of as-synthesized carbon aerogel samples calculated using BET or BJH nitrogen isotherms method.
Figure 6: (a) Nitrogen adsorption/desorption isotherms and (b) pore size distribution for the as-synthesized carbon aerogels, and 5 wt% Pd-doped carbon aerogels. Arrow mark in the upward direction is the adsorption process and downward is the desorption process, respectively.
The intensive peak of the Pd(0) K-edge region around 24,368 eV and the stronger peak at 24,392 eV were due to the orbital 3d5s or 4p hybridization caused by unoccupied bands, as shown in Figure 7. These quantified the doping of Pd on the surface of carbon aerogels. Therefore, in the absorption where the orbital 3d5s or 4p hybridization was intensive, the p-like density of states was notably enhanced and the absorption increased like the second absorption peak in the XANES/EXAFS spectra of the Pd standards (Figures 7(b) and 8(a)). The structural parameters of the Pd powder and the palladium doped CAs, obtained from the best fit to the EXAFS data, are shown in Table 1. The coordination numbers and bond lengths also were well compared with the Pd metal and palladium-doped CAs crystal structure data. The Debye-Waller factors (Δ) were less than 0.015 (), which indicated that the palladium confirmatively has center Pd atoms coordinated by Pd–Pd bonding. The bulk Pd metal possessed Pd–Pd bond distance of and a coordination number of 9.59. For comparison, fresh CAs–Pd clusters were found to have a Pd–Pd bond distance of 2.12 with a coordination number of 6.18. This shortening of the bond distance with a lower coordination number was caused by random motion of surface atom on the small Pd particles and was responsible for the increase in the surface area of the palladium doped CAs samples, whereas hydrogen reduced bulk CA-doped Pd cluster consisted with the Pd–Pd bond distance of 2.73 and a coordination number of 9.23. This revealed that the Pd nanoparticles were notably activated in the reduction process [48]. Moreover, the shortening of the bond distance with coordination number probably was caused by the random motion of surface atom on the small Pd particles and therefore increases the surface area of the Pd-doped CAs samples. Furthermore, this result also revealed that the Pd nanoparticles were well dispersed on the surface of CAs, which might improve the amount of hydrogen storage efficiency significantly.
Figure 7: Pd K-edge XANES spectra of (a) 5 wt% Pd-CAs, (b) metallic Pd, (c) PdO, and (d) PdCl2 standards.
Figure 8: Fourier transformation (FT) spectra of (a) 5 wt% Pd-CAs, (b) metallic Pd, (c) PdO, and (d) PdCl2 standards. The best fitting of the EXAFS spectra is expressed by the dotted lines.
3.5. Hydrogen Gas Adsorption Isotherms Analyses
Comparisons of the hydrogen adsorption of metal hydride and doped metal hydride with carbon aerogel are given in Figures 9(a)–9(e). Under a typical reaction condition of 298 K and 1–30 atm, the hydrogen adsorption curves of pure MgH2 (Figure 9(e)) were consistent with lowest adsorption criteria, whereas the FeTi with CA-doped MgH2 (Figure 9(a)) possessed the highest hydrogen adsorption capacity of 4.02 wt%. Mesoporous structure of the CAs, which has a very high surface area as confirmed from the BET nitrogen isotherm analysis, improved the hydrogen adsorption behavior. This is inline with the finding of Imamura et al. [34], who reported that the uptake of hydrogen in a C-Mg composite took place at a significantly lower temperature than that in pure magnesium. Similarly, Jung et al. [51] suggested that the faster adsorption kinetics of MgH2 systems may result from the very high defect densities of the damaged MgH2 surfaces caused by the ball-milling of Mg with hard and small oxide particles. Defects provide hydrogen an easy path to go into Mg powders. Therefore, the hydrogen adsorption capacity of 2.7 wt% was obtained with the addition of FeTi nanoparticles into the MgH2 samples by ball-milling (Figure 9(b)). Thus, minute particles of FeTi were found to be the most useful catalyst to improve the hydrogen adsorption properties of MgH2. Nitrogen adsorption by the CAs or Pd-doped CAs material clearly shows reversible type IV isotherms at each of the activation stages, indicative of permanent porosity in Figure 6(a). The selectivity of H2 adsorption over Pd–doped CAs was 1.6 wt%, as shown in Figure 9(c). Due to the doping of Pd on CAs, access of hydrogen was easier in the vacancies created by the mesoporous structure with a higher surface area that was confirmed with the BET nitrogen isotherms measurement. In addition, this suggests that an antidispersive force plays an important role in case of Pd-doped CAs samples and the expected specific interaction with Pd active sites. Thus, this work confirmed that metal doping by Pd on CAs may improve the hydrogen adsorption criteria. An intriguing observation concerns the dependence of the rehydrogenation kinetics on the amount of Ti doping. Moreover, as shown in Figure 9(a), it was observed that the hydrogen uptakes of FeTi-CAs-MgH2 systems could be enhanced markedly by the phenomenon of “hydrogen spillover” via a simple technique for building carbon bridges [52]. One of the possible reasons is that the hydrogen molecules do not readily dissociate on Mg surface. Experimentally, the catalytic effect was found on hydrogen adsorption of mixing transition metal of Ti atoms into Mg hydride powder during ball-milling. The likely mechanism proposed for the FeTi-CAs-MgH2 hetero-structures can be also summarized concisely: adsorption of hydrogen on the Ti surface, dissociation of hydrogen and chemisorption of atomic hydrogen on the surface, (3) migration of atomic hydrogen onto the CAs support, and finally (4) chemisorptive spillover onto the MgH2 substrate. In addition, spillover is facilitated through the use of a carbon bridging compound between the Ti/CAs complex and the MgH2 substrate. Typically, an 8 mol% Ti-dop onto the NaAlH4 (Figure 9(d)) revealed the maximum hydrogen adsorption capacity of 1.2 wt% within this class of adsorptive materials. In addition, perfect single crystal TiO2 was inert toward reaction with H2 [51]. However, H2 was absorbed by TiO2-surfaces that contained a higher density of defects in the crystal structure. Therefore, surface of MgH2 in the presence of the metal-doped Fe and Ti with CAs created a high defect density that introduced a higher hydrogen adsorption behavior in the adsorption or desorption processes.
Figure 9: Hydrogen adsorption curves of (a) 5 wt% FeTi-CAs-MgH2 (Fe : Ti = 2 : 1, molar ratio), (b) 5 wt% FeTi-MgH2 (Fe : Ti = 2 : 1, molar ratio), (c) 5 wt% Pd-CAs, (d) 8 mol% Ti-NaAlH4, and (e) fresh MgH2. The pressures of hydrogen adsorption processes for as-synthesized metal hydride composites ranged from 1–30 atm.
4. Conclusions
The synthesis, characterization, and H2 adsorption capacity of CAs/metallic hydride nanocomposites as a catalyst were investigated in the present work. Experimentally, the H2 storage capacity of metallic samples was conducted and measured by a TGA microbalance method. In addition, fine structures and crystallinity of metallic hydride were identified by BET nitrogen adsorption isotherms, HR-TEM, FE-SEM/EDS, XRD, and XANES/EXAFS. The CAs were very effective in improving the hydrogen storage capacity of the Fe-, Ti-doped MgH2 samples with the “hydrogen spillover” route. Metallic dispersion such as Pd nanoparticles onto the CAs may improve the hydrogen adsorption abilities. Higher surface area from CAs and the defect criteria of the MgH2 surface due to the doping of the metallic particle caused to improve the hydrogen adsorption capacities. On the other hand, Ti-doping onto the sodium aluminum hydride can only improve slightly the hydrogen storage capabilities.
Acknowledgment
The authors gratefully acknowledge the financial support of National Science Council (Contract no. NSC-95-2623-7-155-011) of Taiwan.
References
1. W. Lohstroh, M. Fichtner, and W. Breitung, “Complex hydrides as solid storage materials: first safety tests,” International Journal of Hydrogen Energy, vol. 34, no. 14, pp. 5981–5985, 2009. View at Publisher · View at Google Scholar · View at Scopus
2. J. Brouwer, “On the role of fuel cells and hydrogen in a more sustainable and renewable energy future,” Current Applied Physics, vol. 10, no. 2, pp. S9–S17, 2010. View at Publisher · View at Google Scholar · View at Scopus
3. M. Fichtner, O. Fuhr, O. Kircher, and J. Rothe, “Small Ti clusters for catalysis of hydrogen exchange in NaAlH4,” Nanotechnology, vol. 14, no. 7, pp. 778–785, 2003. View at Publisher · View at Google Scholar · View at Scopus
4. F. S. Yang, G. X. Wang, Z. X. Zhang, X. Y. Meng, and V. Rudolph, “Design of the metal hydride reactors—a review on the key technical issues,” International Journal of Hydrogen Energy, vol. 35, no. 8, pp. 3832–3840, 2010. View at Publisher · View at Google Scholar · View at Scopus
5. E. Rönnebro, “High-pressure techniques for discovering and re-hydrogenation of metal hydride materials,” Journal of Physics and Chemistry of Solids, vol. 71, no. 8, pp. 1154–1158, 2010. View at Publisher · View at Google Scholar · View at Scopus
6. H. W. Brinks, C. M. Jensen, S. S. Srinivasan, B. C. Hauback, D. Blanchard, and K. Murphy, “Synchrotron X-ray and neutron diffraction studies of NaAlH4 containing Ti additives,” Journal of Alloys and Compounds, vol. 376, no. 1-2, pp. 215–221, 2004. View at Publisher · View at Google Scholar · View at Scopus
7. D. J. Ross, M. D. Halls, A. G. Nazri, and R. F. Aroca, “Raman scattering of complex sodium aluminum hydride for hydrogen storage,” Chemical Physics Letters, vol. 388, no. 4-6, pp. 430–435, 2004. View at Publisher · View at Google Scholar · View at Scopus
8. R. A. Varin, T. Czujko, C. Chiu, R. Pulz, and Z. S. Wronski, “Synthesis of nanocomposite hydrides for solid-state hydrogen storage by controlled mechanical milling techniques,” Journal of Alloys and Compounds, vol. 483, no. 1-2, pp. 252–255, 2009. View at Publisher · View at Google Scholar · View at Scopus
9. P. Wang and C. M. Jensen, “Preparation of Ti-doped sodium aluminum hydride from mechanical milling of NaH/AI with off-the-shelf Ti powder,” Journal of Physical Chemistry B, vol. 108, no. 40, pp. 15827–15829, 2004. View at Publisher · View at Google Scholar · View at Scopus
10. E. Bruster, T. A. Dobbins, R. Tittsworth, and D. Anton, “Decomposition behavior of Ti-doped NaAlH4 studied using X-ray absorption spectroscopy at the titanium K-edge,” in Proceedings of the Materials Research Society Symposium, pp. 47–52, December 2004. View at Scopus
11. O. Kircher and M. Fichtner, “Kinetic studies of the decomposition of NaAlH4 doped with a Ti-based catalyst,” Journal of Alloys and Compounds, vol. 404-406, pp. 339–342, 2005. View at Publisher · View at Google Scholar · View at Scopus
12. I. P. Jain, P. Jain, and A. Jain, “Novel hydrogen storage materials: a review of lightweight complex hydridespuye,” Journal of Alloys and Compounds, vol. 503, no. 2, pp. 303–339, 2010. View at Publisher · View at Google Scholar · View at Scopus
13. R. Krishnan, D. Agrawal, and T. Dobbins, “Microwave irradiation effects on reversible hydrogen desorption in sodium aluminum hydrides (NaAlH4),” Journal of Alloys and Compounds, vol. 470, no. 1-2, pp. 250–255, 2009. View at Publisher · View at Google Scholar · View at Scopus
14. X. Fan, X. Xiao, J. Hou et al., “Reversible hydrogen storage behaviors and microstructure of TiC-doped sodium aluminum hydride,” Journal of Materials Science, vol. 44, no. 17, pp. 4700–4704, 2009. View at Publisher · View at Google Scholar · View at Scopus
15. J. W. Kim, J. H. Shim, S. C. Kim et al., “Catalytic effect of titanium nitride nanopowder on hydrogen desorption properties of NaAlH4 and its stability in NaAlH4,” Journal of Power Sources, vol. 192, no. 2, pp. 582–587, 2009. View at Publisher · View at Google Scholar · View at Scopus
16. Z. Xueping, L. Shenglin, and L. Donglin, “The effect of additives on the hydrogen storage properties of NaAlH4,” International Journal of Hydrogen Energy, vol. 34, no. 6, pp. 2701–2704, 2009. View at Publisher · View at Google Scholar · View at Scopus
17. P. Wang, X. D. Kang, and H. M. Cheng, “Exploration of the nature of active Ti species in metallic Ti-doped NaAlH4,” Journal of Physical Chemistry B, vol. 109, no. 43, pp. 20131–20136, 2005. View at Publisher · View at Google Scholar · View at Scopus
18. S. Zhang, C. Lu, N. Takeichi, T. Kiyobayashi, and N. Kuriyama, “Reaction stoichiometry between TiCl3 and NaAlH4 in Ti-doped alanate for hydrogen storage: the fate of the titanium species,” International Journal of Hydrogen Energy, vol. 36, no. 1, pp. 634–638, 2011. View at Publisher · View at Google Scholar · View at Scopus
19. H. W. Brinks, B. C. Hauback, S. S. Srinivasan, and C. M. Jensen, “Synchrotron X-ray studies of Al1-yTiy formation and re-hydriding inhibition in Ti-enhanced NaAlH4,” Journal of Physical Chemistry B, vol. 109, no. 33, pp. 15780–15785, 2005. View at Publisher · View at Google Scholar · View at Scopus
20. E. H. Majzoub, J. L. Herberg, R. Stumpf, S. Spangler, and R. S. Maxwell, “XRD and NMR investigation of Ti-compound formation in solution-doping of sodium aluminum hydrides: solubility of Ti in NaAlH4 crystals grown in THF,” Journal of Alloys and Compounds, vol. 394, no. 1-2, pp. 265–270, 2005. View at Publisher · View at Google Scholar · View at Scopus
21. T. Schmidt and L. Röntzsch, “Reversible hydrogen storage in Ti-Zr-codoped NaAlH4 under realistic operation conditions,” Journal of Alloys and Compounds, vol. 496, no. 1-2, pp. L38–L40, 2010. View at Publisher · View at Google Scholar · View at Scopus
22. M. Onkawa, S. Zhang, H. T. Takeshita, N. Kuriyama, and T. Kiyobayashi, “Dehydrogenation kinetics of Ti-doped NaAlH4—influence of Ti precursors and preparation methods,” International Journal of Hydrogen Energy, vol. 33, no. 2, pp. 718–721, 2008. View at Publisher · View at Google Scholar · View at Scopus
23. X. Xiao, L. Chen, X. Wang, Q. Wang, and C. Chen, “The hydrogen storage properties and microstructure of Ti-doped sodium aluminum hydride prepared by ball-milling,” International Journal of Hydrogen Energy, vol. 32, no. 13, pp. 2475–2479, 2007. View at Publisher · View at Google Scholar · View at Scopus
24. C. Milanese, A. Girella, G. Bruni et al., “Hydrogen storage in magnesium-metal mixtures: reversibility, kinetic aspects and phase analysis,” Journal of Alloys and Compounds, vol. 465, no. 1-2, pp. 396–405, 2008. View at Publisher · View at Google Scholar · View at Scopus
25. M. Danaie, S. X. Tao, P. Kalisvaart, and D. Mitlin, “Analysis of deformation twins and the partially dehydrogenated microstructure in nanocrystalline magnesium hydride (MgH2) powder,” Acta Materialia, vol. 58, no. 8, pp. 3162–3172, 2010. View at Publisher · View at Google Scholar · View at Scopus
26. R. Domènech-Ferrer, M. Gurusamy Sridharan, G. Garcia, F. Pi, and J. Rodríguez-Viejo, “Hydrogenation properties of pure magnesium and magnesium-aluminium thin films,” Journal of Power Sources, vol. 169, no. 1, pp. 117–122, 2007. View at Publisher · View at Google Scholar · View at Scopus
27. K. J. Jeon, A. Theodore, and C. Y. Wu, “Enhanced hydrogen absorption kinetics for hydrogen storage using Mg flakes as compared to conventional spherical powders,” Journal of Power Sources, vol. 183, no. 2, pp. 693–700, 2008. View at Publisher · View at Google Scholar · View at Scopus
28. S. G. Chalk and J. F. Miller, “Key challenges and recent progress in batteries, fuel cells, and hydrogen storage for clean energy systems,” Journal of Power Sources, vol. 159, no. 1, pp. 73–80, 2006. View at Publisher · View at Google Scholar · View at Scopus
29. I. E. Malka, T. Czujko, and J. Bystrzycki, “Catalytic effect of halide additives ball milled with magnesium hydride,” International Journal of Hydrogen Energy, vol. 35, no. 4, pp. 1706–1712, 2010. View at Publisher · View at Google Scholar · View at Scopus
30. B. Sakintuna, F. Lamari-Darkrim, and M. Hirscher, “Metal hydride materials for solid hydrogen storage: a review,” International Journal of Hydrogen Energy, vol. 32, no. 9, pp. 1121–1140, 2007. View at Publisher · View at Google Scholar · View at Scopus
31. J. Wang, A. D. Ebner, R. Zidan, and J. A. Ritter, “Synergistic effects of co-dopants on the dehydrogenation kinetics of sodium aluminum hydride,” Journal of Alloys and Compounds, vol. 391, no. 1-2, pp. 245–255, 2005. View at Publisher · View at Google Scholar · View at Scopus
32. S. Chaudhuri and J. T. Muckerman, “First-principles study of Ti-catalyzed hydrogen chemisorption on an Al surface: a critical first step for reversible hydrogen storage in NaAlH 4,” Journal of Physical Chemistry B, vol. 109, no. 15, pp. 6952–6957, 2005. View at Publisher · View at Google Scholar · View at Scopus
33. E. H. Majzoub, J. L. Herberg, R. Stumpf, S. Spangler, and R. S. Maxwell, “XRD and NMR investigation of Ti-compound formation in solution-doping of sodium aluminum hydrides: solubility of Ti in NaAlH4 crystals grown in THF,” Journal of Alloys and Compounds, vol. 394, no. 1-2, pp. 265–270, 2005. View at Publisher · View at Google Scholar · View at Scopus
34. H. Imamura, Y. Takesue, S. Tabata, N. Shigetomi, Y. Sakata, and S. Tsuchiya, “Hydrogen storage composites obtained by mechanical grinding of magnesium with graphite carbon,” Chemical Communications, no. 22, pp. 2277–2278, 1999. View at Scopus
35. S. Carter, A. S. Fisher, P. S. Goodall, M. W. Hinds, S. Lancaster, and S. Shore, “Atomic spectrometry update. Industrial analysis: metals, chemicals and advanced materials,” Journal of Analytical Atomic Spectrometry, vol. 25, no. 12, pp. 1808–1858, 2010. View at Publisher · View at Google Scholar · View at Scopus
36. A. Léon, O. Kircher, M. Fichtner, J. Rothe, and D. Schild, “Evolution of the local structure around Ti atoms in NaAlH4 doped with TiCl3 or Ti13·6THF by ball milling using X-ray absorption and X-ray photoelectron spectroscopy,” Journal of Physical Chemistry B, vol. 110, no. 3, pp. 1192–1200, 2006. View at Publisher · View at Google Scholar · View at Scopus
37. P. Canton, M. Fichtner, C. Frommen, and A. Léon, “Synchrotron X-ray studies of Ti-doped NaAlH4,” Journal of Physical Chemistry B, vol. 110, no. 7, pp. 3051–3054, 2006. View at Publisher · View at Google Scholar · View at Scopus
38. A. Léon, A. Balerna, G. Cinque, C. Frommen, and M. Fichtner, “Al K edge XANES measurements in NaAlH4 doped with TiCl 3 by ball milling,” Journal of Physical Chemistry C, vol. 111, no. 9, pp. 3795–3798, 2007. View at Publisher · View at Google Scholar · View at Scopus
39. F. W. Lytle, “The EXAFS family tree: a personal history of the development of extended X-ray absorption fine structure,” Journal of Synchrotron Radiation, vol. 6, no. 3, pp. 123–134, 1999. View at Scopus
40. S. D. Conradson, “Application of X-ray absorption fine structure spectroscopy to materials and environmental science,” Applied Spectroscopy, vol. 52, no. 7, pp. 252A–279A, 1998. View at Scopus
41. G. Vlaic, D. Andreatta, and P. E. Colavita, “Characterisation of heterogeneous catalysts by EXAFS,” Catalysis Today, vol. 41, no. 1-3, pp. 261–275, 1998. View at Scopus
42. R. W. Pekala, “Organic aerogels from the polycondensation of resorcinol with formaldehyde,” Journal of Materials Science, vol. 24, no. 9, pp. 3221–3227, 1989. View at Publisher · View at Google Scholar · View at Scopus
43. X. Yao, C. Wu, A. Du et al., “Mg-based nanocomposites with high capacity and fast kinetics for hydrogen storage,” Journal of Physical Chemistry B, vol. 110, no. 24, pp. 11697–11703, 2006. View at Publisher · View at Google Scholar · View at Scopus
44. M. Eddaoudi, H. Li, and O. M. Yaghi, “Highly porous and stable metal-organic frameworks: structure design and sorption properties,” Journal of the American Chemical Society, vol. 122, no. 7, pp. 1391–1397, 2000. View at Publisher · View at Google Scholar · View at Scopus
45. C. P. Baldé, A. M. J. van der Eerden, H. A. Stil, F. M. F. de Groot, K. P. de Jong, and J. H. Bitter, “On the local structure of Ti during in situ desorption of Ti(OBu)4 and TiCl3 doped NaAlH4,” Journal of Alloys and Compounds, vol. 446-447, pp. 232–236, 2007. View at Publisher · View at Google Scholar · View at Scopus
46. J. Wang, A. D. Ebner, T. Prozorov, R. Zidan, and J. A. Ritter, “Effect of graphite as a co-dopant on the dehydrogenation and hydrogenation kinetics of Ti-doped sodium aluminum hydride,” Journal of Alloys and Compounds, vol. 395, no. 1-2, pp. 252–262, 2005. View at Publisher · View at Google Scholar · View at Scopus
47. T. Vegge, “Equilibrium structure and Ti-catalyzed H2 desorption in NaAlH4 nanoparticles from density functional theory,” Physical Chemistry Chemical Physics, vol. 8, no. 42, pp. 4853–4861, 2006. View at Publisher · View at Google Scholar · View at Scopus
48. Y. Yamamoto, T. Matsuzaki, K. Ohdan, and Y. Okamoto, “Structure and electronic state of PdCl2-CuCl2 catalysts supported on activated carbon,” Journal of Catalysis, vol. 161, no. 2, pp. 577–586, 1996. View at Scopus
49. S. Cacchi, C. L. Cotet, G. Fabrizi et al., “Efficient hydroxycarbonylation of aryl iodides using recoverable and reusable carbon aerogels doped with palladium nanoparticles as catalyst,” Tetrahedron, vol. 63, no. 11, pp. 2519–2523, 2007. View at Publisher · View at Google Scholar · View at Scopus
50. L. C. Cotet, M. Gich, A. Roig et al., “Synthesis and structural characteristics of carbon aerogels with a high content of Fe, Co, Ni, Cu, and Pd,” Journal of Non-Crystalline Solids, vol. 352, no. 26-27, pp. 2772–2777, 2006. View at Publisher · View at Google Scholar · View at Scopus
51. K. S. Jung, E. Y. Lee, and K. S. Lee, “Catalytic effects of metal oxide on hydrogen absorption of magnesium metal hydride,” Journal of Alloys and Compounds, vol. 421, no. 1-2, pp. 179–184, 2006. View at Publisher · View at Google Scholar · View at Scopus
52. C.-S. Tsao, M.-S. Yu, C.-Y. Wang et al., “Nanostructure and hydrogen spillover of bridged metal-organic frameworks,” Journal of the American Chemical Society, vol. 131, no. 4, pp. 1404–1406, 2009. View at Publisher · View at Google Scholar · View at Scopus
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:47:42.000Z
|
7mwe5jckxrrtege7jggwlxfw2alxfb62
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5835",
"uncompressed_offset": 513436693,
"url": "www.indiaenvironmentportal.org.in/category/thesaurus/tehri",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.indiaenvironmentportal.org.in/category/thesaurus/tehri"
}
|
cccc_CC-MAIN-2013-20
|
Development-induced displacement has brought about a profound economic and sociocultural disruption to the victims of displaced communities. While forced displacement affects both men and women, women experience displacement and relocation in a particularly gendered way. This differential impact on women occurs due to the gendered division of labour that has arisen from socio-historical processes of men's traditional incorporation in the wage-earning and labour-oriented tasks while women remain on the land jobs and its management on a daily basis.
NEW DELHI, 1 JULY: The government is planning to divest up to 25 per cent stake in Tehri Hydro Development Corporation this financial year, which could fetch the exchequer around Rs 1,300 crore.
As the government battles to save hydro-electric projects along the upper reaches of the Ganga from stiff opposition of religious activists, scientists from the National Environmental Engineering R
The government has planned 600 dams on the Ganga and its tributaries. So how can it be serious about saving the holy river, asks Brijesh Pandey
The health of rivers in Uttarakhand has deteriorated substantially due to violation of environment laws by various hydroelectric projects in the hill State.
Traffic on Char Dham Yatra routes was closed due to roads blocked by landslides caused by heavy rains on Sunday. However, Tehri SP Rajiv Swarup claimed that the Border Roads Organisation had opened most roads for passage of light vehicles by Sunday afternoon.
Forests provide multiple benefits to the society, which are both direct and indirect. A study was conducted in Dehradun and Tehri districts to quantify and assess the economic value of various provisioning services which local people derive from the forest to meet their day to day requirement.
Rishikesh: The residents of the Padagli village affected by the construction of the Tehri dam have alleged that the concerned department officials have been misinforming them since past many years.
Among cash crops, fish farming seems to hae become handy for the farmers of the hill State in recent years.
The fact remains that the fish seed production, which was only around 20 lakh seeds in the year 2000, today, it has gone over more four crore seeds resulting in fish production over 35,000 metric tonne(mt).
Keeping in view high fish farming prospects the State Fisheries Department has se
Land acquisition and rehabilitation & resettlement bill (LARR), 2011 - General problems and specific deficiences.
Pages
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:34:21.000Z
|
aqggbj5l67ydizbyqpmva5owez4464kx
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5836",
"uncompressed_offset": 519580982,
"url": "www.isfdb.org/cgi-bin/title.cgi",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.isfdb.org/cgi-bin/title.cgi?34358"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: A Nightmare's Dozen: Stories from the Dark
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Title: A Nightmare's Dozen: Stories from the Dark
Editor: Michael Stearns
Year: 1996
Type: ANTHOLOGY
ISFDB Record Number: 34358
User Rating: This title has fewer than 5 votes. VOTE
Current Tags: young-adult horror (1) Add Tags
Publications:
Reviews:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:54:34.000Z
|
i7tv6sapbcoukkgdmq2w2td7v5qgzp4a
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5841",
"uncompressed_offset": 554810511,
"url": "www.libreoffice.org/download/?lang=lv&type=mac-ppc&version=3.5.7",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.libreoffice.org/download/?type=mac-ppc&lang=lv&version=3.5.7"
}
|
cccc_CC-MAIN-2013-20
|
The free office suite
Download LibreOffice
LibreOffice Mac OS X (PPC), version 3.5.7, Latvian. Not the version you wanted? Change System, Version or Language
You need to download and install these files in order:
• Source code
LibreOffice is an open source project and you can therefore download the source code to build your own installer.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:08:26.000Z
|
jduxv4geemujjrrj4y6hfrxun36uvqif
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5852",
"uncompressed_offset": 616680316,
"url": "www.ohloh.net/p/IOSCSITape/estimated_cost",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.ohloh.net/p/IOSCSITape/estimated_cost"
}
|
cccc_CC-MAIN-2013-20
|
Very Low Activity
Estimated Cost
Analyzed 5 days ago based on code collected 5 days ago.
Project Cost Calculator
$ .00
1,490 lines
0 person-years
$ 16,572 *
*Using the Basic COCOMO Model
Estimate seems way too high?
Ohloh scans all files at any given code location to calculate the cost estimate.
Ohloh lets you exclude files and direc-tories from this calculation on the Code Locations page. You can get a more realistic estimate by excluding:
• External dependencies or libraries
• Non-code files
About Cost Estimates
• Software cost estimation is tricky business even when all the variables are known -- knowlegdge which we certainly don't have.
• We calculate the estimated cost of the project using the Basic COCOMO model.
• For those familiar with the details, we are using coeffcients a=2.4 and b=1.05.
• Please note that COCOMO was created to model large institutional projects, which often don't compare well with distributed open-source projects.
• COCOMO is meant to include the design, specification drafting, reviewing and management overhead that goes along with producing quality software.
• This model seems to be most accurate with mature, large projects. Young projects with little activity are typically overvalued.
Copyright © 2013 Black Duck Software, Inc. and its contributors, Some Rights Reserved. Unless otherwise marked, this work is licensed under a Creative Commons Attribution 3.0 Unported License . Ohloh ® and the Ohloh logo are trademarks of Black Duck Software, Inc. in the United States and/or other jurisdictions. All other trademarks are the property of their respective holders.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:18:57.000Z
|
uzmwshcsr62qhvekslgyson7cyptckqw
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5857",
"uncompressed_offset": 619340707,
"url": "www.openwetware.org/index.php?diff=prev&oldid=654791&title=BME103%3AT930_Group_1",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.openwetware.org/index.php?title=BME103:T930_Group_1&diff=prev&oldid=654791"
}
|
cccc_CC-MAIN-2013-20
|
BME103:T930 Group 1
From OpenWetWare
(Difference between revisions)
Jump to: navigation, search
(Initial Machine Testing)
(Results)
Line 141: Line 141:
KEY
KEY
-
* '''Sample''' = <!--- explain what "sample" means --->
+
* '''Sample''' = Describes sample number and patient <!--- explain what "sample" means --->
-
* '''Integrated Density''' = <!--- explain what "integrated density" means and how you did background subtraction to get this value --->
+
* '''Integrated Density''' = The Integrated Density of the Drop minus that of the background <!--- explain what "integrated density" means and how you did background subtraction to get this value --->
-
* '''DNA μg/mL''' = <!--- how you calculated this --->
+
* '''DNA μg/mL''' = 2 * IntDen of Sample/IntDen of Calf Thymus <!--- how you calculated this --->
-
* '''Conclusion''' = <!--- explain
+
* '''Conclusion''' = Whether exponential DNA replication has occured <!--- explain
Revision as of 15:36, 14 November 2012
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Contents
OUR TEAM
Joseph Heath:
Research & Development Scientist & PCR Machine Engineer
Jessica Kemper:
Experimental Protocol Planner
Maile Ravenkamp:
Experimental Protocol Planner
Nick Hool:
PCR Machine Engineer
Christian Boden:
PCR Machine Engineer & Research & Development Scientist
LAB 1 WRITE-UP
Initial Machine Testing
The Original Design
This machine is called an Open PCR machine. PCR stands for polymerase chain reaction, and this machine helps us create specific strands of DNA. It can hold 16 tubes of DNA and is compatible with any computer that has the appropriate downloaded software. The machine goes through a series of steps to recreate the DNA. First, it heats up to break apart the DNA strands. Then, it cools down to allow polymer chains to attach to the target DNA sequence. Once the primers are attached, the machine will heat up again so that the protein in charge of DNA construction will activate and bind to the polymers and then start to build the DNA sequences that are targeted. This machine is capable of replicating millions of segments of a specific DNA sequence in just an hour or two. This machine, like many others, can be improved but for standard use, this machine works fine as is. If we improve this machine, the process that the machine goes through will most likely be the same but the hardware of the Open PCR machine may be changed. For example, if we wanted to make the amount of time for each cycle shorter, we could improve the heating elements of the machine so that the heating and cooling will be faster and more effective.
Experimenting With the Connections
When we unplugged the mounting plate from the open PCR circuit board, the display screen on the PCR box did not work.
When we unplugged the white wire that connects the open PCR circuit board to the heating block, there was no temperature reading on the display screen.
Test Run
(First Open PCR test: 10/25/12. We had a successful and simple run of PCR)
Protocols
Polymerase Chain Reaction
Components of the PCR Master Mix
1. Modified Taq DNA polymerase
2. dNTP's
3. MgCl2
4. reaction buffers
1. Thaw the GoTaq Colorless Master Mix at room temperature. Vortex the Master Mix, then spin it briefly in a microcentrifuge to collect the material at the bottom of the tube.
2. Prepare the following reaction mix on ice:
Reagents and volumes used in PCR replication
3. If using a cycler without a heated lid, overlay the reaction mix with 1-2 drops of mineral oil to prevent evaporation during thermal cycling. Centrifuge the reaction mix in a microcentrifuge for 5 seconds.
4. Place the reactions in a thermal cycler that has been preheated to 95 degrees Celsius. Perform PCR.
How To Amplify A Patient's DNA Sample
1. Denaturation: a 2-minute denaturation at 95 degrees celsius.
2. Annealing: perform the reaction about 5 degrees Celsius below the calculated melting temperature of the primers and increasing the temperature in increments of 1°C to the annealing temperature; this should occur anywhere between 30 seconds and 1 minute.
3. Extension: performed between 72-74 degrees Celsius, extension allows 1 minute for every 1 kb of DNA to be amplified; the suggested time for extension is 5 minutes.
4. Refrigeration: refrigerate the tubes at 4 degrees Celsius for several hours; this will minimize the opportunity for DNA polymerase to continue to be active at higher temperatures.
5. Cycle Number: the optimal amplification is 25-30 cycles, but up to 40 may be performed.
Flourimeter Measurements
Flourimeter Procedure
1. turn on the excitation light using the switch for the Blue LED.
2. Place your smart phone on the cradle at a right angle from the slide.
3. Turn on the camera setting on the smartphone. Turn off the flash and set the ISO to 800 or higher and increase the exposure to maximum. You should also turn off the autofocus, if possible, and make sure that you can take an image where the drop on the slide will be in focus.
4. Adjust the distance between the smartphone on its cradle and the first two rows of the slide so that it is as close as you can get without having a blurry image.
5. The pipette should be filled with liquid only to the bottom of the black line. Then, carefully place two drops of water in the middle of the first two rows of the slide using the plastic pipette. Then add two more drops. The drop should then be pinned and look like a beach ball. It should be between 130-160 μL.
6. Align the drop by moving the slide so that the blue LED light is focused by the drop to the middle of the black fiber optic fitting on the other side of the drop (you will see that it has a small opening that is used for spectral measurement).
7. Cover the fluorimeter with the light box, but make sure you can access your smartphone to take the image. The light box should be used to remove as much stray light as possible, but do not worry if you have some light.
8. Take three images of the drop of water. Do not move your smartphone.
9. Remove the box and be careful not to move your smartphone. If you want to adjust for any movement, use the ruler provided to measure the distance so that you can return to that location. You can also use ImageJ to compensate for moving the camera, but it makes the analysis more complicated.
10. Use a clean plastic pipette to remove the water drop from the surface.
11. Push the slide in so that you are now in the next set of two holes.
12. Repeat steps 5-10 four more times so that you have now imaged all 5 positions on the slide.
13. Record the type of smartphone you used, the distance from the base of smartphone cradle to measurement device, and attach one image for each position of the drop.
Samples
Sample Labels and Patient Numbers
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
The r17879961 cancer-associated sequence (AAACTCTTACACTGCATACA) will produce a DNA signal because of its nucleotide variation (ACATTGC to ACACTGC). This T-C change results in an isoleucene to threonine substitution. In a study in Finland, patients with colorectal cancer (CRC), the most common cancer associated with the DNA sequence change, had the allele 7.8% of the time while patients without CRC had the allele in 5.3% of patients, showing a significantly higher association in CRC patients.[1] PCR detection will only give a signal if this allele is present.
Results
Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control 13908255 F6 clear
PCR: Positive Control 27282151 F7 green
PCR: Patient 1 ID 43417, rep 1 35526894 F8 green
PCR: Patient 1 ID 43417, rep 2 19073943 F9 green
PCR: Patient 1 ID 43417, rep 3 29391013 F10 green
PCR: Patient 2 ID 11260 , rep 1 1903450 F11 clear
PCR: Patient 2 ID 11260, rep 2 5214727 F12 slightly green
PCR: Patient 2 ID 11260, rep 3 5099077 F13 slightly green
KEY
• Sample = Describes sample number and patient
• Integrated Density = The Integrated Density of the Drop minus that of the background
• DNA μg/mL = 2 * IntDen of Sample/IntDen of Calf Thymus
• Conclusion = Whether exponential DNA replication has occured
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:44:36.000Z
|
7epa6yie4kfxjdl3oytfovcmpaycn7ns
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5866",
"uncompressed_offset": 684639876,
"url": "www.seroundtable.com/archives/003248.html",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.seroundtable.com/archives/003248.html"
}
|
cccc_CC-MAIN-2013-20
|
Google's Snack Room
Feb 6, 2006 • 9:05 am | (1) by | Filed Under Other Google Topics
If you were thinking of joining Google and the company's culture, company's stock price, company's free lunch, laundry service and so on didn't convince you. This entry may give you the information you need to make up your mind. You can learn a lot about a company by how they stock their snack room. And supposedly, this is a picture of Google's snack room (at least one of them).
View Large Image
Forum Discussion at DigitalPoint Forums.
Previous story: Should Google Allow Publishers to Set Minimum CPM Rates?
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T04:55:48.000Z
|
nqr3kkwnyw6wv2osnnnvh5dsszldeadk
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5879",
"uncompressed_offset": 786857979,
"url": "www.wikidoc.org/index.php/Splenius_muscles",
"warc_date": "2013-11-22T14:52:08.000Z",
"warc_filename": "<urn:uuid:8d41cfe3-8bad-47af-a8cc-72cbbec56147>",
"warc_url": "http://www.wikidoc.org/index.php/Splenius_muscles"
}
|
cccc_CC-MAIN-2013-20
|
Splenius muscles
Jump to: navigation, search
The splenius muscles
WikiDoc Resources for
Splenius muscles
Articles
Most recent articles on Splenius muscles
Most cited articles on Splenius muscles
Review articles on Splenius muscles
Articles on Splenius muscles in N Eng J Med, Lancet, BMJ
Media
Powerpoint slides on Splenius muscles
Images of Splenius muscles
Photos of Splenius muscles
Podcasts & MP3s on Splenius muscles
Videos on Splenius muscles
Evidence Based Medicine
Cochrane Collaboration on Splenius muscles
Bandolier on Splenius muscles
TRIP on Splenius muscles
Clinical Trials
Ongoing Trials on Splenius muscles at Clinical Trials.gov
Trial results on Splenius muscles
Clinical Trials on Splenius muscles at Google
Guidelines / Policies / Govt
US National Guidelines Clearinghouse on Splenius muscles
NICE Guidance on Splenius muscles
NHS PRODIGY Guidance
FDA on Splenius muscles
CDC on Splenius muscles
Books
Books on Splenius muscles
News
Splenius muscles in the news
Be alerted to news on Splenius muscles
News trends on Splenius muscles
Commentary
Blogs on Splenius muscles
Definitions
Definitions of Splenius muscles
Patient Resources / Community
Patient resources on Splenius muscles
Discussion groups on Splenius muscles
Patient Handouts on Splenius muscles
Directions to Hospitals Treating Splenius muscles
Risk calculators and risk factors for Splenius muscles
Healthcare Provider Resources
Symptoms of Splenius muscles
Causes & Risk Factors for Splenius muscles
Diagnostic studies for Splenius muscles
Treatment of Splenius muscles
Continuing Medical Education (CME)
CME Programs on Splenius muscles
International
Splenius muscles en Espanol
Splenius muscles en Francais
Business
Splenius muscles in the Marketplace
Patents on Splenius muscles
Experimental / Informatics
List of terms related to Splenius muscles
The splenius muscles are:
Navigation WikiDoc | WikiPatient | Popular pages | Recently Edited Pages | Recently Added Pictures
Table of Contents In Alphabetical Order | By Individual Diseases | Signs and Symptoms | Physical Examination | Lab Tests | Drugs
Editor Tools Become an Editor | Editors Help Menu | Create a Page | Edit a Page | Upload a Picture or File | Printable version | Permanent link | Maintain Pages | What Pages Link Here
There is no pharmaceutical or device industry support for this site and we need your viewer supported Donations | Editorial Board | Governance | Licensing | Disclaimers | Avoid Plagiarism | Policies
Personal tools
Namespaces
Variants
Actions
Navigation
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:43:15.000Z
|
6ykl45sqmh7xpcks6wgmxcbxrau646pa
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5887",
"uncompressed_offset": 2657744,
"url": "abs.gov.au/ausstats/abs%40.nsf/Products/3235.0~2011~Main%2BFeatures~New%2BSouth%2BWales",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://abs.gov.au/ausstats/abs@.nsf/Products/3235.0~2011~Main+Features~New+South+Wales?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
3235.0 - Population by Age and Sex, Regions of Australia, 2011 Quality Declaration
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 31/08/2012
Page tools: Print Page Print All RSS Search this Product
NEW SOUTH WALES
Total population
Age and sex distribution
Median age
Children (under 15 years of age)
Working age population (aged 15-64 years)
People aged 65 years and over
Sex ratio
TOTAL POPULATION
At June 2011, the estimated resident population of New South Wales (NSW) was 7.21 million people, an increase of 636,300 people (10%) since June 2001.
In 2011, there were 4.61 million people residing in Greater Sydney, accounting for 64% of the total NSW population. Of the 2.61 million people living in the rest of the state, almost half were in the coastal SA4s of Newcastle and Lake Macquarie, Illawarra, Richmond - Tweed, Mid North Coast and Coffs Harbour - Grafton.
AGE AND SEX DISTRIBUTION
The age distribution of Greater Sydney is younger than for the rest of NSW. At June 2011, 31% of Greater Sydney's population were aged 20 to 39 years, compared to 23% in the rest of NSW. In the rest of NSW, 24% of the population were aged 60 years or over, compared to 18% in Greater Sydney.
AGE AND SEX DISTRIBUTION (%), New South Wales - 30 June 2011
MEDIAN AGE
At June 2011, the median age (the age at which half the population is older and half is younger) of the NSW population was 37.7 years, an increase of 1.8 years since June 2001. Reflecting their higher life expectancy, the median age for females (38.5 years) was higher than for males (36.8).
In line with its younger age distribution, the median age of Greater Sydney (36.1 years) was lower than for the rest of NSW (40.8).
Within Greater Sydney, the SA2 with the lowest median age in 2011 was Kensington - Kingsford (28.9 years), which includes the University of NSW. Other areas with median ages below 30 years were Auburn (29.7 years) in the central west, Sydney - Haymarket - The Rocks (29.7) in the inner city, and Bidwill - Hebersham - Emerton (29.8) and Lethbridge Park - Tregear (29.9) in the west. The highest median ages within Greater Sydney were in Wentworth Falls (48.1 years) in the Blue Mountains, nearby Blackheath - Megalong Valley (46.7), and Erina - Green Point (47.2) and Toukley - Norah Heads (47.0) on the Central Coast.
Outside Greater Sydney, the ten SA2s with the highest median ages were all located on the coast. These included Tuncurry (58.8 years) and Tea Gardens - Hawks Nest (58.6) on the north coast, and Sussex Inlet - Berrara (58.1) and Narooma - Bermagui (54.3) on the south coast. The lowest median ages in the rest of NSW were in or near major regional centres. Wagga Wagga - North had the lowest median age, at 26.8 years, followed by Tamworth - West (28.1), and Shortland - Jesmond (28.8) near Newcastle.
CHILDREN (UNDER 15 YEARS OF AGE)
At June 2011, there were 1.36 million children under 15 years of age in NSW, an increase of 16,100 since June 2001.
In 2011, Greater Sydney had 859,700 children, an increase of 42,300 or 5.2% between 2001 and 2011. Almost two-thirds of children in NSW resided in Greater Sydney in 2011.
The highest proportions of children within Greater Sydney were in outer suburban growth areas. In 2011, SA2s with high proportions of children under 15 years of age were Rouse Hill - Beaumont Hills and Parklea - Kellyville Ridge in Greater Sydney's north-west growth corridor, Bidwill - Hebersham - Emerton and Lethbridge Park - Tregear in outer western Sydney, Mount Annan - Currans Hill in the outer south-west, and Warnervale - Wadalba on the Central Coast (all 27%).
The SA2s with the highest proportions of children outside Greater Sydney in 2011 were located in and around rural regional centres. Tamworth - West had the highest proportion under 15 years of age, at 29%. This was followed by Moree Region (26%), and Bourke - Brewarrina, Dubbo - West, and Queanbeyan West - Jerrabomberra (all 25%). In the Wollongong and Newcastle areas, Horsley - Kembla Grange and Maryland - Fletcher - Minmi also had high proportions of children, both at 24%.
POPULATION AGED LESS THAN 15 YEARS, Statistical Areas Level 2, New South Wales - 30 June 2011
WORKING AGE POPULATION (AGED 15-64 YEARS)
At June 2011, the working age population of NSW was 4.81 million people, around two-thirds of the state's total population. Between 2001 and 2011, the working age population in NSW increased by 433,900 people or 10%.
Just under two-thirds of the working age population of NSW lived in Greater Sydney. Over the ten years to 2011, the working age population of Greater Sydney increased by 12% compared to an increase of 6% in the rest of NSW.
High proportions of working age people resided in SA2s near the Sydney central business district. In 2011, 89% of the population in Sydney - Haymarket - The Rocks were aged 15 to 64 years, while many adjacent areas had proportions of at least 80%. These included Darlinghurst (88%), Pyrmont - Ultimo (87%) and Surry Hills (86%).
Many SA2s in or near regional cities and centres had high proportions of working age people. In 2011, 78% of residents in Newcastle - Cooks Hill were aged 15 to 64 years. There were also high proportions in nearby Wickham - Carrington - Tighes Hill (74%) and Shortland - Jesmond (71%). Other areas with high proportions of working age people were Queanbeyan - East (75%), Wollongong (73%), and Byron Bay (73%).
PEOPLE AGED 65 YEARS AND OVER
At June 2011, there were 1.04 million people aged 65 years and over living in NSW, representing 14% of the total population. In line with continuing ageing of the NSW population, the number of people in this age group grew by 22% between 2001 and 2011.
While almost two-thirds (64%) of the total population in NSW lived in Greater Sydney, only 56% of NSW residents aged 65 years and over resided there in 2011, indicating a preference for coastal and rural retirement.
There were high proportions of older people in long established areas or those which cater to retirees. Of the ten SA2s in Greater Sydney with the highest proportion of people aged 65 years and over, eight were on the Central Coast; Toukley - Norah Head, Erina - Green Point and Lake Munmorah - Mannering Park each had 26% of their population aged 65 years or above.
In 2011, nine of the ten SA2s in the rest of NSW with the highest proportions of people aged 65 years and over were located on the coast. These included Tuncurry (40%) and Tea Gardens - Hawks Nest (37%) on the north coast, and Sussex Inlet - Berrara (37%) and Narooma - Bermagui (29%) on the south coast. The only non-coastal SA2 in the top ten was Bowral (28%) in the Southern Highlands.
POPULATION AGED 65 YEARS AND OVER, Statistical Areas Level 2, New South Wales - 30 June 2011
SEX RATIO
At June 2011, there were 98.6 males for every 100 females in NSW. The sex ratio was slightly lower in Greater Sydney (98.2) than in the rest of NSW (98.9).
Males outnumbered females in a number of areas in and around Sydney's central business district in 2011. The SA2 of Darlinghurst had the highest sex ratio in Greater Sydney, at 142.0 males per 100 females. High sex ratios were also apparent in nearby Surry Hills (136.7), Redfern - Chippendale (125.2) and Potts Point - Woolloomooloo (118.4). Other areas with high sex ratios were Homebush Bay - Silverwater (121.9) and Parramatta - Rosehill (115.2) in western Sydney, and Yarramundi - Londonderry (116.1) in outer north-western Sydney, all of which contain male prisons. The lowest sex ratio in Greater Sydney was in Woollahra where there were 83.6 males per 100 females, followed by Kincumber - Picketts Valley (86.5) and Erina - Green Point (87.4), both on the Central Coast.
A number of rural and remote areas outside Greater Sydney had high sex ratios. In 2011, the SA2 with the highest sex ratio was Junee (which contains the Junee Correctional Centre), with 134.7 males per 100 females. This was followed by Wentworth - Balranald Region (119.7), and Far West and Jindabyne - Berridale (both 117.0). Low sex ratios were more common in larger regional centres and along the NSW north coast. The lowest sex ratio was in Wagga Wagga - North (89.2), followed by Bowral (89.3) and neighbouring Mittagong (89.4) in the Southern Highlands.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:49:17.000Z
|
32riitid5ldy3ufekxo2ejvxdf4zutud
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5895",
"uncompressed_offset": 12203801,
"url": "archive.mises.org/15986/feds-dudley-quit-bitching-about-food-prices-buy-an-ipad2/",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://archive.mises.org/15986/feds-dudley-quit-bitching-about-food-prices-buy-an-ipad2/"
}
|
cccc_CC-MAIN-2013-20
|
1. Skip to navigation
2. Skip to content
3. Skip to sidebar
Source link: http://archive.mises.org/15986/feds-dudley-quit-bitching-about-food-prices-buy-an-ipad2/
Fed’s Dudley: Quit Bitching About Food Prices, Buy an iPad2
March 11, 2011 by
William C. Dudley is the amazingly out-of-touch President of the New York Fed. Speaking in Queens today, he said the economy has improved, but a long way from improved employment and price stability.
The audience pressed Dudley about higher food prices, wherein Reuters reports “people forget that even as the price of food is rising, other prices are falling. He mentioned the price of the iPad 2, prompting guffaws from the audience.”
This whole commodity price thing is temporary he said. “While rising commodity prices may be giving some of you a bad headache, they are not likely to lead to a sustained rise in inflation to levels inconsistent with our dual mandate,” Dudley said.
After earning his PhD at the University of California, Dudley worked for the Fed. Then he went to work at Goldman Sachs where he was the firm’s Chief Economist for a decade. The is was back the New York branch of the Fed in 2007 and was made CEO in 2009.
Mr. Dudley has plenty of tools over there in the Fed garage that will keep inflation in check. “We are very, very confident that those tools will be completely effective at keeping inflation in check,” he said late last year defending the Fed’s QE2 policy. “We are completely willing to use those tools, when the time comes, to prevent an inflation problem. Higher inflation is not a way out. It is not a solution.”
“The problem with a price-level target is that it’s difficult to explain what you’re doing in a way that doesn’t create larger anxiety about the long-term inflation target,” he said. “We clearly want people to understand that we are committed to price stability over the long run.”
The Fed is committed and prices are stable. If you don’t believe it because the price of your groceries are going up, then the guys running the Fed would say these price movements are just too difficult for you to understand.
Previous post:
Next post:
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:48:30.000Z
|
24sqzglt4o5ni3p2s5apicozygp2dhl3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5905",
"uncompressed_offset": 27813695,
"url": "blog.mozilla.org/mobile/author/mfinklemozillacom/",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://blog.mozilla.org/mobile/author/mfinklemozillacom/"
}
|
cccc_CC-MAIN-2013-20
|
The Mozilla Mobile Blog
News, notes and ramblings from the Mozilla Mobile Project.
Posts by Mark Finkle
Firefox for mobile Bumping Its Version
Firefox for mobile (Fennec) is bumping its version numbering to more closely match desktop releases of Firefox. This means “Firefox 2.0b1 for Android & Maemo” is becoming “Firefox 4.0b1 for Android & Maemo” and will be released as “Firefox 4.0 for Android & N900″. We are aligning mobile Firefox and desktop Firefox since the web rendering engines used in both browsers are the same. Treating them as the same version seemed like the right thing to do.
Any add-ons hosted on addons.mozilla.org (AMO) that are marked as compatible for Fennec 2.0b1pre will automatically be bumped to support Fennec 4.0b1pre. If your add-on worked in Fennec 2.0b1pre, it will work fine in Fennec 4.0b1pre.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:11:24.000Z
|
rqrdw3n3gqri5p33utytlimb4ssediob
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5919",
"uncompressed_offset": 52096345,
"url": "cnx.org/content/m21216/latest/content_info",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://cnx.org/content/m21216/latest/content_info"
}
|
cccc_CC-MAIN-2013-20
|
Connexions
Sections
You are here: Home » Content » Om probleme in konteks op te los
About: Om probleme in konteks op te los
Module by: Siyavula Uploaders. E-mail the author
View the content: Om probleme in konteks op te los
Metadata
Name: Om probleme in konteks op te los
ID: m21216
Language: English (en)
Subject: Mathematics and Statistics
License: Creative Commons Attribution License CC-BY 3.0
Authors: Siyavula Uploaders (support@siyavula.org.za)
Copyright Holders: Siyavula Uploaders (support@siyavula.org.za)
Maintainers: Siyavula Uploaders (support@siyavula.org.za)
Latest version: 1.1 (history)
First publication date: Apr 1, 2009 2:34 am -0500
Last revision to module: Apr 1, 2009 2:38 am -0500
Downloads
PDF: m21216_1.1.pdf PDF file, for viewing content offline and printing. Learn more.
EPUB: m21216_1.1.epub Electronic publication file, for viewing in handheld devices. Learn more.
XML: m21216_1.1.cnxml XML that defines the structure and contents of the module, minus any included media files. Can be reimported in the editing interface. Learn more.
Source Export ZIP: m21216_1.1.zip ZIP containing the module XML plus any included media files. Can be reimported in the editing interface. Learn more.
Version History
Version: 1.1 Apr 1, 2009 2:38 am -0500 by Siyavula Uploaders
Changes:
Add solid lines
How to Reuse and Attribute This Content
If you derive a copy of this content using a Connexions account and publish your version, proper attribution of the original work will be automatically done for you.
If you reuse this work elsewhere, in order to comply with the attribution requirements of the license (CC-BY 3.0), you must include
• the authors' names: Siyavula Uploader
• the title of the work: Om probleme in konteks op te los
• the Connexions URL where the work can be found: http://cnx.org/content/m21216/1.1/
See the citation section below for examples you can copy.
How to Cite and Attribute This Content
The following citation styles comply with the attribution requirements for the license (CC-BY 3.0) of this work:
American Chemical Society (ACS) Style Guide:
Uploader, S. Om probleme in konteks op te los, Connexions Web site. http://cnx.org/content/m21216/1.1/, Apr 1, 2009.
American Medical Assocation (AMA) Manual of Style:
Uploader S. Om probleme in konteks op te los [Connexions Web site]. April 1, 2009. Available at: http://cnx.org/content/m21216/1.1/.
American Psychological Assocation (APA) Publication Manual:
Uploader, S. (2009, April 1). Om probleme in konteks op te los. Retrieved from the Connexions Web site: http://cnx.org/content/m21216/1.1/
Chicago Manual of Style (Bibliography):
Uploader, Siyavula. "Om probleme in konteks op te los." Connexions. April 1, 2009. http://cnx.org/content/m21216/1.1/.
Chicago Manual of Style (Note):
Siyavula Uploader, "Om probleme in konteks op te los," Connexions, April 1, 2009, http://cnx.org/content/m21216/1.1/.
Chicago Manual of Style (Reference, in Author-Date style):
Uploader, S. 2009. Om probleme in konteks op te los. Connexions, April 1, 2009. http://cnx.org/content/m21216/1.1/.
Modern Languages Association (MLA) Style Manual:
Uploader, Siyavula. Om probleme in konteks op te los. Connexions. 1 Apr. 2009 <http://cnx.org/content/m21216/1.1/>.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:12:13.000Z
|
h2ut3k5xh4fnndzsjebhuigals7ftdky
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5926",
"uncompressed_offset": 62606555,
"url": "daviswiki.org/Bros",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://daviswiki.org/Bros"
}
|
cccc_CC-MAIN-2013-20
|
Bros
Info
Search:
Bros is plural form of Bro and can refer to a group of Bros or just the idea of Bros in general. The Bro can be best characterized as the wannabe jock or wannabe fratboy, although many fratboys and jocks can fall into the Bro category. Bro, which can also be pronounced "Brah" or "Braw" is often used as a term of endearment amongst other Bros. A good place to go bro watching is the ARC. The Davis Players Society is a non-Fraternal social group who's members might be Bros.
*Sidenotes: A brah myself, I disapprove of the indiscriminate use of the term. Brahs are not necessarily associated with frats or idiocy, but can refer to those who resist selling out by keeping it real and having a good time regardless of social status or popularity. 40's are encouraged though. - ErnBro
I am pretty sure I am not a Bro, however I have been refered to as "Brah" by people who I believe to be die hard members of this division of the social structure. So either I am Bro, which I am not, or Bros refer to non-Bro's as "Brah" on occasion. I am not sure what is going on. - GeorgeLewis
"You have forgotten the term "Broham." A term of endearment between men to reaffirm heterosexuality, or a really cool fool, or a chill ass mofo." -JakeLippman
" I have lived and been a world class drunk in Davis for the past five years. I have partied with a variety of fraternities, and have regularly attended Soga's, and have never ever heard anybody supposed 'bro' referring to himself or his friends as 'bro's, except in certain ironic occurences. I think that this is an example of stereotypical pop cultural references appearing to be a reality by people who haven't aren't necessarily aware of so called 'bro's... that being said I don't support them that much, unless they give me booze, then I'd support that shit. Trust me, someone on a website once nominated me as a Party King." - JoshuaHeller
The Bro Lexicon:
Bros can be found wandering Frat Row and at many parties in Davis. They also have Bro Parties.
Comments:
Note: You must be logged in to add comments
2007-04-26 08:20:33 I just thought it was worth mentioning that "Bro" is used in the steroid-using community to refer to other steroid users. I don't know if Davis has a big steroid using community or what, so I don't know how relevant it is...but if they're in the gym working out for hours, they're either on steroids or overtraining. —BradBenedict
2009-10-03 03:31:09 Use of the term "bro" can be indicative of casual atmosphere. "Bro" is ideally used among friends when they're drunk, buzzed, high or otherwise intoxicated. The perpetually stoned character, Stoney (Pauly Shore) , in the film “Encino Man,” states, “The truth is bro, life's about greasing the 'do back, buddy, and wheezin' on the buff-fest, man.” “Bro” is also related to alternative sports, often associated with drug use; think surfing, snowboarding, and skateboarding. The other day I saw two girls long-boarding on campus; one girl said to the other, "slow it down bro!" Within the geography of language, use of “bro” insinuates its users are on the west coast or wannabe on the west coast. Think of Dutch Bros. Coffee, pronounced “broze,” not brothers. —Nan
2011-07-31 22:57:33 Wow. You forgot: Brobot, Bramadan, Broseph, Braap, and Brogan, to name a few. —CapitalBaller
This is a Wiki Spot wiki. Wiki Spot is a 501(c)3 non-profit organization that helps communities collaborate via wikis.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:02:16.000Z
|
i5wqt6jw3i4uanqcg52smn7nhf6ltsxq
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5927",
"uncompressed_offset": 62612391,
"url": "daviswiki.org/Where_Should_I_Eat_Today",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://daviswiki.org/Where_Should_I_Eat_Today"
}
|
cccc_CC-MAIN-2013-20
|
Where Should I Eat Today
Info
Search:
All knowing wiki bot, whose omniscience may even surpass that of the magic 8-ball, please foretell this lonely soul's soon-to-be grub. Oh, blessed wiki bot... Where should I eat, today?
Magical Wiki Oracle
My blessed child, you shall find your stomach comforted and your mind eased, surrounded by the comforting walls of Davis' one and only: Crepeville.
This is a Wiki Spot wiki. Wiki Spot is a 501(c)3 non-profit organization that helps communities collaborate via wikis.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:31:22.000Z
|
ukobmlyc6q6kvdw2urggfm2flnvyzjtu
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5936",
"uncompressed_offset": 76850621,
"url": "dotnetkicks.com/stories/44223/SharePoint_2013_Business_Intelligence_Features",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://dotnetkicks.com/stories/44223/SharePoint_2013_Business_Intelligence_Features"
}
|
cccc_CC-MAIN-2013-20
|
Error!
Success!
SharePoint 2013 Business Intelligence Features
0
kicks
SharePoint 2013 Business Intelligence Features (Unpublished)
This post discusses the new features introduced in SharePoint 2013 for Business Intelligence and how you can do the things in better way using SharePoint 2013, PowerPivot and Power View. SharePoint is really about organization, discovery, building out new solutions and managing those solutions. So With Microsoft BI tools how do you explore the data? How do you mine the data? How do you visualise and control that data?
Kicked By:
Drop Kicked By:
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:55:47.000Z
|
xtbgjclcv74hj6ksrkkg46qgjv3ezxzd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5938",
"uncompressed_offset": 81591286,
"url": "dungeons.wikia.com/wiki/SRD:Kraken",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://dungeons.wikia.com/wiki/SRD:Kraken"
}
|
cccc_CC-MAIN-2013-20
|
Wikia
SRD:Kraken
Talk0
9,502pages on
this wiki
This material is published under the OGL
KRAKENEdit
Size/Type: Gargantuan Magical Beast (Aquatic)
Hit Dice: 20d10+180 (290 hp)
Initiative: +4
Speed: Swim 20 ft. (4 squares)
Armor Class: 20 (–4 size, +14 natural), touch 6, flat-footed 20
Base Attack/Grapple: +20/+44
Attack: Tentacle +28 melee (2d8+12/19–20)
Full Attack: 2 tentacles +28 melee (2d8+12/19–20) and 6 arms +23 melee (1d6+6) and bite +23 melee (4d6+6)
Space/Reach: 20 ft./15 ft. (60 ft. with tentacle, 30 ft. with arm)
Special Attacks: Improved grab, constrict 2d8+12 or 1d6+6
Special Qualities: Darkvision 60 ft., ink cloud, jet, low-light vision, spell-like abilities
Saves: Fort +21, Ref +12, Will +13
Abilities: Str 34, Dex 10, Con 29, Int 21, Wis 20, Cha 20
Skills: Concentration +21, Diplomacy +7, Hide +0, Intimidate +16, Knowledge (geography) +17, Knowledge (nature) +16, Listen +30, Search +28, Sense Motive +17, Spot +30, Survival +5 (+7 following tracks), Swim +20, Use Magic Device +16
Feats: Alertness, Blind Fight, Combat Expertise, Improved Critical (tentacle), Improved Initiative, Improved Trip, Iron Will
Environment: Temperate aquatic
Organization: Solitary
Challenge Rating: 12
Treasure: Triple standard
Alignment: Usually neutral evil
Advancement: 21–32 HD (Gargantuan); 33–60 HD (Colossal)
Level Adjustment:
Six of the beast’s tentacles are shorter arms about 30 feet long; the remaining two are nearly 60 feet long and covered with barbs. Its beaklike mouth is located where the tentacles meet the lower portion of its body.
Krakens speak Common and Aquan.
COMBATEdit
Krakens strike their opponents with their barbed tentacles, then grab and crush with their arms or drag victims into their huge jaws. An opponent can make sunder attempts against a kraken’s tentacles or arms as if they were weapons. A kraken’s tentacles have 20 hit points, and its arms have 10 hit points. If a kraken is currently grappling a target with one tentacle or arm, it usually uses another limb to make its attack of opportunity against the sunder attempt. Severing a kraken’s tentacle or arm deals damage to the kraken equal to half the limb’s full normal hit points. A kraken usually withdraws from combat if it loses both tentacles or three of its arms. A kraken regrows severed limbs in 1d10+10 days.
Improved Grab (Ex): To use this ability, the kraken must hit with an arm or tentacle attack. It can then attempt to start a grapple as a free action without provoking an attack of opportunity. If it wins the grapple check, it establishes a hold and can constrict.
Constrict (Ex): A kraken deals automatic arm or tentacle damage with a successful grapple check.
Jet (Ex): A kraken can jet backward once per round as a full-round action, at a speed of 280 feet. It must move in a straight line, but does not provoke attacks of opportunity while jetting.
Ink Cloud (Ex): A kraken can emit a cloud of jet-black ink in an 80-foot spread once per minute as a free action. The cloud provides total concealment, which the kraken normally uses to escape a fight that is going badly. Creatures within the cloud are considered to be in darkness.
Spell-Like Abilities: 1/day—control weather, control winds, dominate animal (DC 18), resist energy. Caster level 9th. The save DC is Charisma-based.
Skills: A kraken has a +8 racial bonus on any Swim check to perform some special action or avoid a hazard. It can always choose to take 10 on a Swim check, even if distracted or endangered. It can use the run action while swimming, provided it swims in a straight line.
SEE WIKIPEDIA ENTRY: Kraken
Back to Main PageSystem Reference DocumentCreatures
Advertisement | Your ad here
Photos
Add a Photo
1,231photos on this wiki
See all photos >
Recent Wiki Activity
See more >
Around Wikia's network
Random Wiki
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:10:20.000Z
|
5hy2dumljzma34psy6xuf3izydtaeqyn
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5941",
"uncompressed_offset": 85253713,
"url": "elinux.org/index.php?oldid=2799&title=Disable_Console",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://elinux.org/index.php?title=Disable_Console&oldid=2799"
}
|
cccc_CC-MAIN-2013-20
|
Disable Console
From eLinux.org
Revision as of 22:06, 27 April 2007 by TimBird (Talk | contribs)
Jump to: navigation, search
Contents
Description
You can save time during kernel bootup by disabling the console output. The easiest way to do this is to use the "quiet" option on the kernel command line (described below).
Printk output is usually directed to a serial port or a VGA console during bootup. By disabling console output, the time taken to output the characters (and perform things like software scrolling of the display buffer) is eliminated.
How to implement or use
To disable console output during kernel bootup, use the "quiet" option on the kernel command line.
To do this, just put the word "quiet" (without the quotes) in the kernel command line, with no other arguments. This will suppress printk output during booting. Note that printk messages are still buffered in the kernel and can be retrieved after booting using the "dmesg" command.
Expected Improvement
This saves time during kernel bootup by suppressing printk output. Printk output delays depend on a number of factors, but in the use cases cited below, the savings were in the range of a few hundred milliseconds.
With a serial console, the time to output characters is dependent on the serial port speed. However, with a VGA console, the time to output the characters is dependent on the speed of the processor. Therefore, the slower your processor, the more savings you will gain from this technique.
Resources
Projects
None
Specifications
None
Patches
None
Case Studies
Case 1
Hardware KMC SH board, using VGA console
Kernel Version CELF-1 (040126)
Configuration relatively small configuration (details not available)
Time without "quiet" option 637878 usec
Time with "quiet" option 461893 usec
Time savings 176 milliseconds
From data submitted by Maruyama Kiyoyasu of Mitsubishi.
Case 2
Hardware TI OMAP board, using serial console
Kernel Version CELF-1 (040126)
Configuration Kernel booted with XIP, CRAMFS root file system, with preset-LPJ
Time without "quiet" option 551735 usec
Time with "quiet" option 280676 usec
Time savings 271 milliseconds
From data submitted by Noboru Wakabayashi of Hitachi.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:25:21.000Z
|
o5humacsa5xpr6jzqxr6jiburmce4zic
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5976",
"uncompressed_offset": 142274465,
"url": "journals.tdl.org/icce/index.php/icce/article/view/2640/0",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://journals.tdl.org/icce/index.php/icce/article/view/2640/0"
}
|
cccc_CC-MAIN-2013-20
|
IMPULSE WAVES GENERATED BY LANDSLIDES
J.W. Kamphuis, R.J. Bowering
Abstract
A study programme has been initiated to investigate the impulse waves generated by landslides originating entirely above the water surface It may be seen that the characteristics of this wave depend mainly on the slide volume and the Froude number of the slide upon impact with the water The resulting wave goes through a transition period For the highest wave (usually the first), the wave height becomes stable relatively quickly and decays exponentially during the period of transition, the wave period continues to increase for a long time, the velocity of propagation may be approximated very closely by solitary wave theory.
Keywords
impulse waves; landslide
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:59:06.000Z
|
zbi7kttbijku5hpnyorpoziy4gdhpo4d
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:5977",
"uncompressed_offset": 156276175,
"url": "listarchives.libreoffice.org/global/design/msg04535.html",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://listarchives.libreoffice.org/global/design/msg04535.html"
}
|
cccc_CC-MAIN-2013-20
|
[Date Prev][Date Next][Thread Prev][Thread Next][Date Index][Thread Index]
Re: [libreoffice-design] IRC chat
On Thu, Jun 7, 2012 at 2:48 AM, nick rundy <nrundy@hotmail.com> wrote:
>
> hey, is this irc chat open to users as well? or just programmers?
>
> if open to users, what server and channel do i find it at?
>
> They're open to everyone, though we mainly discuss design issues, so there
probably won't be many interested programmers.
Channel #libreoffice-design on Freenode (http://webchat.freenode.net/).
See http://wiki.documentfoundation.org/Design/Meetings for more info/past
logs.
--
Unsubscribe instructions: E-mail to design+help@global.libreoffice.org
Problems? http://www.libreoffice.org/get-help/mailing-lists/how-to-unsubscribe/
Posting guidelines + more: http://wiki.documentfoundation.org/Netiquette
List archive: http://listarchives.libreoffice.org/global/design/
All messages sent to this list will be publicly archived and cannot be deleted
References:
[libreoffice-design] IRC chat"Mirek M." <mazelm@gmail.com>
Re: [libreoffice-design] IRC chat"Stefan Knorr (Astron)" <heinzlesspam@googlemail.com>
Re: [libreoffice-design] IRC chat"Mirek M." <mazelm@gmail.com>
RE: [libreoffice-design] IRC chatnick rundy <nrundy@hotmail.com>
Privacy Policy | Impressum (Legal Info) | Copyright information: Unless otherwise specified, all text and images on this website are licensed under the Creative Commons Attribution-Share Alike 3.0 License. This does not include the source code of LibreOffice, which is licensed under the GNU Lesser General Public License (LGPLv3). "LibreOffice" and "The Document Foundation" are registered trademarks of their corresponding registered owners or are in actual use as trademarks in one or more countries. Their respective logos and icons are also subject to international copyright laws. Use thereof is explained in our trademark policy.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:11:36.000Z
|
75n6nb4yslvnfccfqqjwmsexvksl2j7a
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:6003",
"uncompressed_offset": 193343639,
"url": "openwetware.org/wiki/User:Steven_J._Koch/Notebook/Kochlab/2009/07/15/Feedback_modules",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://openwetware.org/wiki/User:Steven_J._Koch/Notebook/Kochlab/2009/07/15/Feedback_modules"
}
|
cccc_CC-MAIN-2013-20
|
User:Steven J. Koch/Notebook/Kochlab/2009/07/15/Feedback modules
From OpenWetWare
Jump to: navigation, search
Steve Koch 18:07, 15 July 2009 (EDT): Borrowed a USB DAQ board from Sasha (Thanks!) and now trying to update NI-DAQmx (to version 8.9) so the board can work on the old machine. Since the power modulation worked pretty well yesterday (perhaps not fast enough, but we'll see), I want to implement a variety of things that will allow us to use velocity clamp and other clamps. Things to do:
• Does power modulation give X, Y signals? If so, we need "create offset array" back in the mix (ugh)
• What are good integer value setpoints?
• Larry & Linh are making stuck beads so we can look at DOGs
• get Find Tether Center working
• Probably requires working force clamp
• get force clamp working
• get velocity clamp working
Contents
Laser power modulation
• Laser turned on, 10.31 amps setpoint (actual 10.17)
• Set power mod control voltage to zero using MAX
• Set power mod internal setpoint such that transmittance was about 36%
• 0V = 148.6 mW
• 1V = 37.5 mW
• -1V = 260 mW
• 0V repeat = 148.6
• (NOTE: laser still warming up probably, so these numbers not too accurate)
Detector power study
0V control, power is 148.6. Sum signal fluctuating around 1.33.
• 0V = 148.6 mW = 1.33 V
• 1V = 37.51 mW = 0.328 V +/- 0.001 V
• -1V = 259.9 mW = 2.32 V +/0 0.01 V NOTE it appears more unstable than above two instances
OK, detector X and Y zeroed at control voltage of -1
• -1V, X = -0.006 V +/- .002 (noise) .004 (drift)
• 0V, X jumped to -0.001
• 1V, X jumped to +0.001
• back to -1V, X jumped to -0.003
• back to 1V, X jumped to 0.001
Well, at first glance, this seems REALLY good to me. I don't see any signs of an offset problem. If the beam were actually moving on the detector, I think we'd see huge changes to these numbers. Better check Y too, though:
• 1V, Y -0.004 V
• -1V, Y -0.004 V (but drifty at first about +/- 0.003 V
• 0V, Y -0.001 V
• 1V, Y -0.002 V
• -1V, Y, -0.008V
• 1V, Y, -0.002 V
Slighty worse than X, but maybe due to zeroing being off (remember, we DO expect X and Y raw detector voltages to depend on Sum signal, since the detector does not do the division on-chip.
Front panel control of piezo and power
Steve Koch 04:24, 16 July 2009 (EDT): Holy Shit! I just spent a couple hours overhauling the feedback software. I put in the laser power modulation control, and everything compiles. Furthermore, I updated the front panel control stuff. So far I have only tested out that. But it works! You can now control the piezo and the laser power via the front panel controls:
• Laser power: 0 V is the minimum. A jump of 1 V is a lot (about 200 mW). Positive number increase = laser power increase.
• Piezo: Uses AOD center frequency (35 MHz) as "0V". Jump of 1 MHz is about 1.4 microns.
Feedback stepping
Steve Koch 04:29, 16 July 2009 (EDT): Still on a lucky roll: the stepping from step to step seems to work also. See the feedback program in data file 44 (July 09 Calibration).
• The thing I don't understand now is how the laser power reverts back to low power after the program. Maybe this is a feature of the software that I don't remember? Is it time to try Find Tether Center? Nah, I need a DOG first?
Took a DOG curve in files 45 and 46
45 was at voltage of 1 V. 46 at voltage of 0.2 V.
• file 45: Extent of curve is about +8000, -7000. Very wiggly even with no bead...not sure why that would be. Doesn't look too shabby, though.
• file 46: Much, much noisier. Also shifted. Extent of curve probably about the same. Looks shitty though.
For now, going to say that a good setpoint integer is 6000
Find Tether Center
Steve Koch 04:47, 16 July 2009 (EDT): First attempt failed. Stuck in loop for some reason (piezo not moving either)
Steve Koch 05:05, 16 July 2009 (EDT): Piezo sensor is not working. Doesn't appear to be working on either DAQ computer. Not good. Working fine on regular oscilloscope. Grounding issue? Working fine on USB DAQ now...cable? Now have it all hooked up with a new cable and seems to be working. I don't see how the cable could be bad, so I don't fucking know...
Steve Koch 05:16, 16 July 2009 (EDT): Discovered the QPD math was only enabled in the piezo ramp module. Thus, the setpoint was not going to work. Implementing it now in the core "START and read scan..." VI.
• turned off "reverse acting" and data file 47 may have a successful FTC. If so, this could indicate a polarity problem with the detector. That will be annoying and / or perhaps easy to fix.
• VC looks promising. At least the light flickers. Evident that I have a lot of work to do to get these going. Need to go sleep.
Personal tools
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T04:47:42.000Z
|
lxcsnlueqyxkche3vaharxpkcc5a5z6i
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:6022",
"uncompressed_offset": 210726253,
"url": "quotationsbook.com/quote/18009/",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://quotationsbook.com/quote/18009/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
Grief, and an estate, is joy understood, Nunn, Gregory
This quote is about grief · Search on Google Books to find all references and sources for this quotation.
A bit about Nunn, Gregory ...
We don't have a biography.
These people bookmarked this quote:
• Nobody has bookmarked this quote yet.
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T05:40:24.000Z
|
olwvsga7mizrqzwtjxuscgpo23gz4zr4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:6023",
"uncompressed_offset": 210732366,
"url": "quotationsbook.com/quote/6682/",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://quotationsbook.com/quote/6682/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
A woman's asking for equality in the church would be comparable to a black person's demanding equality in the Ku Klux Klan. Daly, Mary
This quote is about churches · Search on Google Books to find all references and sources for this quotation.
A bit about Daly, Mary ...
Mary Daly (born 1928) is a radical feminist theologian, a mother of modern feminist theology. Before obtaining doctorates in theology and philosophy from the University of Fribourg, Switzerland, she recieved her B.A. in English from The College of Saint Rose and her M.A. in English from the Catholic University of America . She taught at Boston College for 33 years, before agreeing to retire as part of a lawsuit settlement with Boston College.
These people bookmarked this quote:
• Nobody has bookmarked this quote yet.
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T04:49:10.000Z
|
apm7qj4ve6fxykgps6kyem53wbhgo67g
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:6024",
"uncompressed_offset": 210743932,
"url": "quotationsbook.com/quote/gift/27530/",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://quotationsbook.com/quote/gift/27530/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
Though it is very important for man as an individual that his religion should be true, that is not the case for society. Society has nothing to fear or hope from another life; what is most important for it is not that all citizens profess the true religion but that they should profess religion. Tocqueville, Alexis De
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:36:27.000Z
|
46k56ui2p75hwt47z7fs5563sroqehex
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:6025",
"uncompressed_offset": 210749546,
"url": "quotationsbook.com/quote/gift/31157/",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://quotationsbook.com/quote/gift/31157/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
Only very intelligent people don't wish they were in politics, and I'm dumb enough to want to be in there. Welles, Orson
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:13:11.000Z
|
kndlh6zy65r2m5cveqvllin75bgc6dev
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:6026",
"uncompressed_offset": 210755060,
"url": "quotationsbook.com/quote/gift/9668/",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://quotationsbook.com/quote/gift/9668/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
It is better to do thine own duty, however lacking in merit, than to do that of another, even though efficiently. It is better to die doing one's own duty, for to do the duty of another is fraught with danger. Bhagavad Gita
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:33:41.000Z
|
mevnw46qrozpog2vohjqewmd2agrliyr
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:6027",
"uncompressed_offset": 210760625,
"url": "quotationsbook.com/quotes/author/2007/",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://quotationsbook.com/quotes/author/2007/"
}
|
cccc_CC-MAIN-2013-20
|
Quotes by Dewar, Jeff
We don't have a biography. Please consult wikipedia.
"Ask yourself, If I had only sixty seconds on the stage, what would I absolutely have to say to get my message across."
Dewar, Jeff on present
"Change happens in the boiler room of our emotions... so find out how to light their fires."
Dewar, Jeff on change
7 fans of this quote
Take a look at recent activity on QB!
Search Quotations Book
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T07:20:34.000Z
|
re7e7iacmfbrf47lafnegvfnvnej4476
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:6029",
"uncompressed_offset": 212808177,
"url": "rationalwiki.org/wiki/Gamal_Abdel_Nasser",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://rationalwiki.org/wiki/Gamal_Abdel_Nasser"
}
|
cccc_CC-MAIN-2013-20
|
Gamal Abdel Nasser
From RationalWiki
Jump to: navigation, search
Gamal Abdel Nasser. He is seen here giving a job to a homeless person.
Gamal Abdel Nasser was the second president of Egypt from 1956 to 1970. The Suez Crisis occurred during his terms in office. He established friendly relations with the Soviet Union, but he was an opponent of communism. Despite his socialist economic policies, he persecuted atheist Marxists.
[edit] Nasserism
Nasser was a believer in pan-Arabism and his political ideology is known as Nasserism. Nasserism was a mixture of Arab nationalism and socialism, but it was different from Soviet and western concept of socialism. The fundamental characteristics of Nasserism are:
• Arab nationalism and pan-Arabism
• Opposition to Western imperialism
• Opposition to atheism and Marxism
• Secularism
• Socialist economics
• Modernization
• Industrialization
• A belief that Zionism is an extension of European colonialism
Personal tools
Namespaces
Variants
Actions
Navigation
Community
Toolbox
support
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T08:02:40.000Z
|
ifix353gt6lcpsrbeuaathir3np4slid
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:6064",
"uncompressed_offset": 262599989,
"url": "thevaultofhorror.blogspot.com/2008/08/new-zealander-soils-himself-during-rec.html?showComment=1219380360000",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://thevaultofhorror.blogspot.com/2008/08/new-zealander-soils-himself-during-rec.html?showComment=1219380360000"
}
|
cccc_CC-MAIN-2013-20
|
"A REALLY INTELLIGENT INTERVIEWER." -- Lance Henriksen
"QUITE SIMPLY, THE BEST HORROR-THEMED BLOG ON THE NET." -- Joe Maddrey, Nightmares in Red White & Blue
**Find The Vault of Horror on Facebook and Twitter, or download the new mobile app!**
**Check out my other blogs, Standard of the Day, Proof of a Benevolent God and Lots of Pulp!**
Wednesday, August 20, 2008
New Zealander Soils Himself During [REC] Screening
Now, I've been a strong proponent of the Spanish zombie film [REC] since it was first released last November. And I can't think of a stronger endorsement for the picture than the incident reported on the New Zealand website Scoop, which alleges that an audience member literally crapped himself in sheer terror while watching the movie at the New Zealand International Film Festival last month.
The report is corroborated by a correspondent for the NZ website Incredibly Strange, who was also in attendance:
"What the individual left behind in the theatre seat was as horrifying as anything on the screen, and that's saying a lot."
There you have it, fright fans. If that doesn't convince you to see it, nothing will. If you happen to be in New Zealand, the flick opens there on August 28. Otherwise, it's available now on DVD in certain parts of the world. Find a way to acquire it at your earliest opportunity.
|
v0
|
2024-06-03T21:29:47.544Z
|
2013-05-18T06:56:10.000Z
|
oat6cmfsprzggwrdtdwufb5gtqqpqcqi
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:6094",
"uncompressed_offset": 291178215,
"url": "wikitravel.org/en/Xi",
"warc_date": "2013-11-22T14:51:11.000Z",
"warc_filename": "<urn:uuid:5c6b7e68-c155-4a6c-95ee-ab9ae5f404d3>",
"warc_url": "http://wikitravel.org/en/Xi'an"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Xian
From Wikitravel
(Redirected from Xi'an)
Jump to: navigation, search
The Terracotta Warriors
Xian (西安 Xī'ān, pron. SEE-ahn), is a historic city in Shaanxi Province in China.
[edit] Understand
Xi'an is more than 3,000 years old and was known as Chang'an in ancient times. For 1,000 years, the city was the capital for 13 dynasties, and a total of 73 emperors ruled here. Xi'an is the undisputed root of Chinese civilization having served as the capital city for the Zhou, Qin, Han, and Tang dynasties. With so much history within the ground the city lies upon, it is no wonder that there are so many historical ruins, museums and cultural relics to be found here. It was already influencing the world outside of the Great Wall of China as the eastern terminus of the Silk Road（丝绸之路). Here traders from far and wide brought goods and ideas for sale and took goods and ideas back with them to their native countries. In present day Xi'an not much of its former glory remains within the city confines, due to the constant warfare and political changes that swept China particularly throughout the 20th Century. Today the city has a pleasant cosmopolitan flair to it and it is worth visiting for the famed Terracotta Warriors alone. It has often been said that, "if you have not been to Xi'an, you have not been to China!"
[edit] Climate
Xi'an has most of its annual precipitation from August to late October in the form of rain. It is characterised by hot summers and cold, dry winters. Spring and autumn will be somewhat brief and dry.
[edit] Get in
[edit] By plane
Xi'an Xianyang International Airport (IATA: XIY) is located 40 km northwest of the city centre, in Xianyang. Flights are available to Beijing, Chengdu, Chongqing, Dunhuang, Fuzhou, Guangzhou, Harbin, Hangzhou, Hohhot, Kunming, Lhasa, Lanzhou, Nanjing, Shanghai, Shenzhen, Urumqi, Wuhan, Xining and Zhangjiajie within China, International flights are available to Bangkok, Hong Kong, Macau, Seoul as well as Nagoya, Fukuoka, Niigata, Tokyo and Hiroshima in Japan, and Singapore via Kunming. As Xi'an is located in the heartland of China, it takes no more than 2 hours to fly to most major Chinese cities. AirAsia recently launched [1] new route Bangkok-Xian.
Most people use taxis or the airport bus to reach town from the airport, however taking a taxi is not recommended, as most taxi drivers will raise the price for non-local tourists. A taxi will cost about ¥150 from the airport to the Bell Tower downtown. You will pay around ¥ 50-75 more if you take one of the climatized Japanese black taxis rather than the typical green taxis. At the airport, both types of taxis are waiting at the same spot to pick up passengers. The airport bus leaves every half-hour from 6AM to 6PM, a ticket costs ¥26 and takes about one hour; there are several lines but the most useful are Airport Bus No. 1 (no stop to the terminus in front of the Melody Hotel, at the beginning of West Street near the Bell Tower) and No. 2 (to the railway station). As long as there is an arriving flight, there will be a bus, so don't worry about arriving late at night or early morning; officially, on line 1 there is a bus every 20 minutes but buses will often depart as soon as they fill up. The airport bus route is the best way between city and the train station.
A good alternative to taking a taxi or bus from the airport is to book a Xi'an tour (or Terracotta Warriors tour) from a private tour company; many will then extend an airport pickup at a discounted cost (or, in some cases, at no cost). These pickups will typically be in an air-conditioned van with a licensed driver and are especially cost-effective and convenient for groups of two or more. For example, Emma's Tours[2], a well-known private day tour company, charges ¥200 for a trip to or from the airport, when any tour is booked.
Getting to the terracotta warriors from the airport is not complicated. Immediately when you walk out of the airport you can take a taxi and it would cost around 200 RMB.
[edit] By fast train
The high speed train from Xi'an North to Luoyang-Longmen is now available many times a day, starting 7am. The distance of 400km takes about 1.5 hours. The high speed train station is located about 10km north from the Xi'an north gate (do not get mix up with the Xi'an North gate train station). The last train returns around 7pm. Schedules may change, so it is best to check it out at the station or website.
[edit] By train
There are plenty of trains transporting passengers to and from most of the major cities inside China. Keep in mind train tickets may only be available if booked far in advance (most ticket sales open 10-21 days in advance; an agent can help book but will probably charge significant commission fees). Traveling in a seat (hard or soft-class) means you will share the car space with lots of locals. You will most likely encounter smokers, loud noise, and constant activity in the aisle while you try to sleep. *Do not* travel hard class if you are uncomfortable with these settings. Sleeper cabins are limited to 6 people each (4 for deluxe soft sleepers, which are only on a few trains from Beijing); bottom bunks cost a bit more because they're a couple cm wider and could be sit on. If traveling alone, be especially careful of your luggage! Also note that bathrooms and washrooms may be closed (and locked!) 30-60 minutes before getting to the train station.
Trains run to several domestic cities including: Beijing (5-13 hours), Chengdu (13-18 hours), Chongqing (14 hours), Guangzhou (8–24 hours), Kunming (36-53 hours), Lanzhou (8-10 hours), Lhasa (36 hours), Shanghai (11-20 hours), Urumqi (31-56 hours), Wuhan (4-18 hours), and Zhengzhou (2–6 hours).
Xi'an Station is at the north end of Jiefang Road (解放路; pinyin: jiěfànglù), just outside the northeast city wall. As you exit, there will probably be lots of people offering cheap hotel rooms; just ignore them if you already have a room booked. Even if you don't, you probably don't want to get one from them anyway. Also, don't fall for the people who offer to exchange a Xi'an map for your used train ticket - they reuse them for some shady purposes, e.g. re-selling them to people who just want to get into the station or try to sneak on a train.
In Xi'an, it is very easy to get to the railway station by city bus from anywhere in the city. There are several stops within 200 m of the station (look for train station East or North on a bus route (火车站东/北). Many hostels also offer free pick-up if you arrive between 6 and 9 AM.
Xi'an North Station serves the high-speed rail. It is connected by the metro system. Destinations include Luoyang, Zhengzhou, Wuhan, Shijiazhuang, Beijing, Shanghai, Nanjing, Changsha, Guangzhou and Shenzhen.
[edit] By bus
The main long-distance bus station - Shaanxi Province Long-distance Bus Station is located Approx.100m south to the exit or entry to Xi'an railway station, city wall in the middle of them, while both west and east there is a gate.
Bus service is available to: Huashan (2-3 hours), Lanzhou (8-10 hours), Luoyang (5-7 hours), Taiyuan (12 hours), and Zhengzhou (9-12 hours).
If you are arriving from PingYao by bus, you will most likely arrive at the east bus station. Catch the bus 203 right next to the bus station to get to the city centre.
[edit] By car
Traffic is heavy, right of way is unheard of, and the rule of thumb is "keep going no matter what" (although drivers do note red lights).
Bell Tower （钟楼 Zhonglou)
[edit] Get around
The city is surrounded by a city wall, in its middle the Bell Tower (Chinese:钟楼; pinyin: Zhōnglóu). From this one, the four main streets descend into the four points of the compass.
• North-Street (北大街 Běidàjiē).
• East-Street (东大街 Dōngdàjiē).
• South-Street (南大街 Nándàjiē).
• West-Street (西大街 Xīdàjiē).
Do not get confused by different names in tourist guides, addresses and bus stops: Nandajie, Nanda-Street, South-Street, South-Avenue are all the same.
Locals often speak about Within city walls and Outside city walls when talking about locations. Outside the walls, the southern part is the most interesting, it offers shopping streets, bars and some nightlife.
There are plenty of buses departing everywhere in short-intervals (main lines every 5-10 minutes). If you are not confident enough with orientation, or if you do not like packed buses, the cheap taxis are the best alternative, broadly available, except for during rush hours.
[edit] By train/subway
The first subway line, running north/south, although still partially under construction at the southern most end, opened September 2011. You can connect to and from the Xi'an North Train Station (Chinese: 西安北站; pinyin: Xī'ān-běi Zhàn) for the high speed rail network. Since the subway is now only partly completed, the stops are limited, and it is, therefore, of limited use to tourists.
Bus 306 To Terracotta Warrior Museum
[edit] By bus
Regular buses within the city cost ¥1 (¥2 for air-conditioned, marked with a snow-flake) no matter how far you go. Since there are many buses in the city, it can be useful to go to the Tourism Office Center (which is situated near the Bell Tower) and ask for a free map of the city, with the buses' lines on it.
A popular line for tourists is #610 (also labeled "游8" in Chinese, which means "tourist #8") which connects the railway station, the Bell Tower, the Small Goose Pagoda and Xi'an Museum, the Shaanxi Historic Museum and the Big Goose Pagoda. Unfortunately it is not one of the most frequent (sometimes you can wait for half an hour, though usually it comes in a few minutes). Near the Bell Tower, it stops at the beginning of West Street; take it westwards to then go south to the museums and pagodas, take it eastwards to then go north to the railway station. Near the railway station (there are many stops for different lines) you can catch it at the third block on the main street going straight south from the station.
Another useful line is #609 that connects the Bell Tower, the South Gate and the Big Goose Pagoda. Near the Bell Tower, it stops at the beginning of South Street.
Although the 609 and 610 can be infrequent, the 611 is very regular, and connects the train station and the Bell Tower. Look for it over the road from the station.
There are many buses leaving regularly for the Terracotta Warrior museum in front of the Xi'an bus station (east to the train station, outside (in the north) the city walls).
• Bus 306 (Chinese bus green 5) leaves from the lot in front of the train station and will take you to a parking lot right in front of the museum site in about an hour (it can take up to 90 minutes in case of traffic jams). A one-way ticket costs ¥7 (just get on and sit down, then a conductor will come and give you a ticket). It also stops at several other tourist attractions along the way, e.g. the hot springs. Make sure you don't make the mistake of going to the bus station on the inside of the wall near the train station. That's where there are touts with signs saying bus 5 and bus 306, trying to hustle you onto their private bus. Although they do take you to the destinations, you are forced to go to visit attractions you might not want to go to. If you're facing the train station directly, the lot where the bus departs from will be on your right - it's near a Dico's. Look out for a sign with a bunch of Chinese characters with 306 (5) in between them.
• Small buses which are used by the locals (e.g. number 914). These buses will also take you to the Museum however they go through local small roads (no highway express like bus 306) therefore it will take longer to arrive. Not a bad trip if you want to see the local bumpy rural roads. Note: local bus 915 will take you to the museum site in about an hour as it takes the highway express too like the 306. The ride is not as comfortable as the 306 since the buses are usually packed (with people even standing). But it is cheaper (¥4 as of Nov 26, 2012) and seems to runs more frequently.
• Most hostels and hotels run tours to the warriors with an English speaking guide. These aren't necessarily better, be prepared to spend a good portion of the day (as with any Chinese tour) visiting "terracotta factories," "museums", "Chinese medicine shops", and other tourist traps. But, you will get to your destination without dealing with the bus (the warriors are quite far outside of town) and not all of the public buses that go there are legitimate.
[edit] By taxi
Taxis are *very* limited. It can take a rather long time to find a vacant one and even then - given their choice of fares - they may decide to decline your destination for a more profitable one that is closer. Watch the taxi drivers in Xi'an as the industry is not regulated as it is in other larger cities. You may find yourself being taken on a long ride around town to get where you are going. It can also be difficult to convince them to take you anywhere (even to the railway station). If in doubt get your hotel or hostel to write down the place you want to go in Chinese. Between 3 and 5 o'clock in the afternoon the taxis change their shifts. This means the drivers are rushing to their handover points, so they won't pick you up even they are empty.
Trips within the city walls are generally around ¥10, longer trips to the attractions south of the city are ¥12-20. Especially when you take a longer ride, like to or from the airport, it is always good advice to insist on using the taxi meter.
The rate for the normal (green) taxis is ¥6 for the first 2 kilometer and then ¥1.5 for every additional kilometer. Waiting times longer than 2 minutes will be charged ¥1.5 per minute. As of 2012, there is a fuel-surcharge on every ride of ¥1, so the price you have to pay is ¥1 higher than the meter shows (there is a sign on the taxi's dashboard showing this "rule"). After 11:00 PM the starting price is ¥7. At the airport and around some of the big hotels you might also find black taxis. They charge ¥2.4 per kilometer, but are more spacious and comfortable. There is a road fee of ¥10 for the Airport Expressway. This is not included in the price the taxi meter shows. So going to or coming from the airport is usually ¥10 more than what the meter shows.
Be careful when taking a cab to areas outside Xi'an City, for example the bing ma yong. Such trips cost up to ¥120 and will not bring you all the way as the road is "apparently under maintenance and only the local cabs know the rest of the road to bing ma yong". So the cab will drop you off outside a building where you can view a model of bing ma yong for ¥30. Other local cab drivers will offer to bring you to a blue jade factory or a smaller version of bing ma yong after you view the replica. Be careful to reject going to such places as the cab drivers earn a commission from bringing you such places, which are no substitute for an authentic experience touring the actual bing ma yong. Thus, it is generally much safer and reliable to take the buses if you want to travel to bing ma yong.
[edit] By bike
Fortunately Xi'an's main sites (with the notable exception of the Terracotta Warriors) are bunched fairly close together. Be wary of the narrow streets and cars that squeeze you out of the way. Bike lanes are available on some streets, however, places to lock bikes, typically are not.
Shop in the Muslim Street
Kites Flying at XiAn street
[edit][add listing] See
[edit] Inside/Near the city
• Shaanxi Intangible Cultural Heritage Museum, No.279, Xiqi Road, Xi'an., [3]. Folk arts from all Shaanxi areas are displayed here, depicting traditional local daily life.
Shaanxi Intangible Cultural Heritage Museum
free. edit
Red martial art
Xiqin Embroidery
paper cutting
• City Wall of Xi'an (西安城墙; Xīānchéngqiáng), [4]. As the world's largest city wall, the Xi'an city wall has been restored and is 12m high, 18m wide is its bottom, 15m wide on the top, 13.7km long, and bikes(also bikes for two or three persons) are provided for renting, now it's ￥40 per 90 minutes/bike. You can hire one at the top of the South or East gate; you may return it to other stations on the wall (there is one at each of the four main gates), but be sure to verify this before stating your ride. Be aware that bikes will not be rented if there is any chance of rain, because the top of the wall becomes slippery. Check the weather forecast before you buy a ticket to enter the wall. If you want to foot it though, a complete loop of the walls takes 4-5 hours. The landscaped park around the base of the exterior walls and moat also makes for a pleasant stroll and gives a different perspective on the battlements and towers. The wall is lit up at night and makes for a pleasant stroll. The present city wall was built in the Ming dynasty(A.D.1368-A.D.1644) on the foundation of the Chang'an Imperial city wall of Tang dynasty(A.D.618-A.D.907). The Xi'an City Wall International Marathon is held each year in Nov. since 1993, running on top of the wall, athletes from amore than 50 countries and regions have participated in the competition during the last 16 sessions. Also, the Xi'an city wall Cycling Race are held on top of the wall since two years ago.
The entrance to Xi'an City Wall Museum,Xi'an,China
An inside view of Xi'an City Wall museum,Xi'an,China
There is a small museum inside the city walls at Hanguang Gate, about halfway between the southwest corner and the South Gate, accessible from the top of the city wall itself. Look for a staircase down inside a covered structure. Inside are the unrestored remains of a gatehouse and a calligraphy collection.
¥40, ¥20 students (Sept 2010). edit
• Shaanxi Historic Museum (陕西历史博物馆; Shǎnxī Lìshǐbówùguǎn; also known as Shaanxi History Museum), xiaozhai, Xian,China (500m northwest to the Big wild goose pogoda), [5]. This museum houses a collection of local artefacts that span the entirety of the province's history from the Neolithic through the Qing dynasty. In particular it contains fabulously well preserved pottery from nearby Banpo neolithic village (also worth a visit) and many excellent Shang Dynasty bronzes. Although some guidebooks call it "one of the best museums in China", its old fashioned pots-and-arrowheads-behind-glass format may appeal mainly to enthusiasts, though they also feature some well-made but glorifying high-definition movies in the exhibition halls. The most eye-catching articles are those from the Tang Dynasty, originally used by the royal family. Arrive either really early or before 1pm to get one of 4000 free tickets each day. Make sure to bring your passport, it's one ticket per id! Museum is limited to 6000 visitors per day to avoid overcrowding. It closes at 5 (July 2012). edit
the Nestorian Stele tablet
• Forest of Steles (碑林; Xīānbēilín), (Just inside the southern city wall, near the Wenchang Gate), [6]. This collection of 2,300 stone tablets (many written to provide an "official text" of the Chinese classics) and epitaphs is the largest and oldest of its kind in China.
stone tablet in Beilin
This includes the famous Nestorian Stele, dating back to the 7th century. It depicts the coming of Nestorian Christianity to China. The Nestorian Stele is in Showroom Number 2 and is the first stele on the left.
¥50/¥25 Beilin Museum, foreign student cards not accepted (January 2012). edit
• Wolong Temple (卧龙寺), (One block North and East of the Forest of Steles museum). This active Buddhist temple dates back to 200BC. Recently restored, the temple is vibrant and busy. edit
• Big (Wild) Goose Pagoda (大雁塔; Dàyàntǎ), (At Ci'en Temple, take bus 41 or 610 from the main train station). Built by Emperor Gaozong Li Zhi（高宗李治) in 652AD. Emblem of the city of Xi'an. In the fountain in front of the pagoda there is a very nice water and music show sometimes during the day with pleasant parks and western eateries nearby. ¥50 to enter the temple complex, another ¥40 to enter the pagoda. edit
• Little (Wild) Goose Pagoda (小雁塔; Xiǎoyàntǎ), (At Jianfu Temple). Completed in 709AD. To enter you will have to buy a joint ticket with the adjoining Xi'an Museum ¥30, Jul 11 (Note that the ticket still states the old price of ¥50, however ¥30 is charged).. edit
• Bell Towers (钟楼; Zhōnglóu), (In the exact center of the city). ¥27 (or ¥40 including Drum Tower). edit
• Drum Tower (鼓楼; Gǔlóu), (Just to the northwest within the Muslim Quarter). Performances at 9:10, 10:00, 11:00, 15:00, 16:00 and 17:00. ¥27 (or ¥40 including Bell Tower). edit
Busy Muslim Street
• Grand Mosque (大清真寺; Qīngzhēnsì), (Behind Drum Tower). Built in a perfect mixture of Islamic and Chinese architecture styles with seating for 1,000 worshipers and the Muslim Street district (回民街 Huímín Jiē) around it. It is famous as the very first mosque ever to be built in China. It can be quite difficult to find through the winding back streets but is very well known to locals. Only Muslims are permitted entry to the actual mosque but there is plenty to see in the many accompanying courtyards. Ladies are asked to cover up with a scarf according to Muslim tradition. ¥25. edit
• Eight Immortals Temple (八仙庵; Bāxiān'ān). An active Daoist temple built for the famous Eight Immortals, including the Eight Immortals Bridge, lots of steles in the walls with text and illustrations, and multiple worship halls. edit
• DaMing Palace and Park. This is, first of all, a huge park with both green spaces and an enormous open square with an equally-impressive ancient palace gate (the palace is Tang dynasty, built in 634 AD). There's a model of the palace next to the gate. The square sometimes hosts public performances. The park even has an IMAX theatre. The park, gate and square are accessible for free. If you pay for admission, you can actually go into the partially restored palace ruins and other sections of the park protected by a moat. Worth seeing for the sheer size of it - it's a very surreal effect compared to the crowding in the rest of Xian. Immediately north of the railway station (though you have to go around using side streets, since there are railway tracks in the way). You may also be able to get there via DaMing Xi subway station. edit
[edit] Outside the city
• Army of Terracotta Warriors and Horses (兵马俑; Bīngmăyŏng), (A short distance away from the Qinshihuang Mausoleum, it is the last stop of bus 306).
the No. bronze chariot earthed from the terracotta warriors and horses excavation site.
This mighty army of terracotta warriors and horses, found in three vaults, is perhaps the most popular tourist attraction of Shaanxi and one of the most popular in all of China. An in-site museum has been built over these pits, covering a floorspace of 20,000 square meters and displaying 8,000 life-like terracotta warriors, 100 or so chariots, and 30,000 weapons.
terracotta warriors have their personal hairstyles.
The assemblage has been billed by the tourist industry as the Eighth Wonder of the World and a world cultural heritage site by UNESCO in 1987. The ticket office is next to the parking lot, which is a 5/10 minute walk away from the entrance to the museum. Buy your tickets at the ticket office or you can also buy them from resellers at the entrance for a 5 Yuan fee. For 5 Yuan, you can opt to take a small bus from the ticket counter to the entry to the site, which saves you about 10 minutes of walking. On the way back, however, you are forced to walk in order not to "miss" the countless opportunities to buy small terracotta warriors, other tourist articles and food. For those not interested in Chinese food, there is a KFC very near to the ticket counter.
¥150, students ¥75. edit
• Banpo Village Ruins （半坡遗址）. 6,000 year old ruins of a village site including the residential and pottery-making areas, ancient tools, as well as a burial ground. Take bus #42 from the train station. Visit also the Shaanxi Historic Museum to see the best examples of the pottery found at Banpo. edit
• Famen Temple (法门寺). This Buddhist temple, which records mention as far back as 67AD, contains a 13-storied brick pagoda as part of the monastery. This pagoda fell down in the rain in August 1981 and revealed a 1000 year old underground vault full with 2,400 treasures belonging to the Tang and previous dynasties given as offerings. These included gold and silver utensils, glazed wares, porcelains, pearls, precious stones and textiles, as well as religious items. The biggest treasure is a finger bone of Buddha offered to the Emperor of China during the Tang dynasty. edit
• Huaqing Palace (华清池; Huáqīngchí), (First stop of bus 306). 9:00AM-5:00PM. Built by the Tang emperor Xuanzong near hot springs at the foot of Li Shan in Lintong County so he could frolic with his favoured Imperial Lady Yang to his heart's content. It is possible to take hot baths inside. You may also take the nearby cable car (60 yuan return) to catch a Birdseye view of the area. ¥110, ¥60 Student. edit
• Mao Ling Mausoleum （茂陵博物馆）. The tomb of the fifth emperor of the Han Dynasty, includes many stone carvings. edit
• Qinshihuang's Mausoleum (秦始皇陵), (Third stop (second for the museum) of bus 306 before the Terracota Warriors). Mausoleum of the First Emperor of China. You can visit the surrounding gardens and mountains, but you can not get inside the mausoleum. There is a low quality museum with a reconstruction of the Mausoleum. Taking pictures in the dimly lit museum is forbidden, although staff will not control it too much. Mausoleum ¥40, museum ¥15. edit
• Qian Ling Mausoleum （乾陵博物馆）. The only shared tomb of the first empress of China Wu Zetian, and her husband Emperor Gaozong of Tang Dynasty. edit
• Taiping National Park (太平国家公园), (44 km SW of Xi'an, N slope of Qinling Mountain).
Taiping National Park
Famous for its waterfall and the largest area of wild Zijing flower (the city flower of Hong Kong) in north China.
edit
• Xiangyu Forest Park (祥峪森林公园), (37 km S of Xi'an, N slope of Qinling Mountain).
Xiangyu Forest Park
edit
• Huashan Mountain （华山）, (About 2.5 hr outside of Xi'an, or 40 minutes by high-speed train. High-speed rail station is about 30minutes away from the bell tower by cab. Cab ride is about ¥35. Once arriving at the Huashan high-speed train station it is a quick taxi ride (¥20) to the mountain trailhead.). This is one of China's sacred mountains. Very beautiful misty mountain where you can climb steep stairs while holding on to chain railings for support. If you take the cable car up, you can climb around the four peaks in about 3-4 hours. Cable car is ¥80/150 round trip and is located at the east gate and goes directly to the north peak. If you want to walk up you have to go to another entrance, the Yu Quan Yuan （玉泉院） entrance.There are many tours that drive to the Mountain, just be aware that half of the time you will be stoping for jewelry, Chinese medicine, etc. Worthwhile if you get a nice coach. edit
• Tang Paradise[7] Tang Paradise is the largest tourist program in northwest China. It covers and area of 1,000 mu (about 165 acres) and was established with and investment of 1.2 billion yuan. Located to the north of the original Tang Dynasty Lotus Garden site, the present Tang Paradise is the first theme park fully demonstrating the charm and grandeur of the royal garden in Tang Dynasty. The Tang Paradise boats many new records: the largest movie on water screen in the world, the first theme park of five senses (sight, sound, taste, touch, and smell), the biggest outdoor fragrance project in the world and the biggest reproduction of the Tang royal garden comples in China. Ever since its opening to public on April 11, 2005, Tang Paradise has attracted people from different walks of life with its surprising charm, including some prominent political figures like Lian Zhan, Chairman of Kuomingtang from Taiwan. It has become a must see attraction in Xi’an.
• Tomb of Emperor Jingdi, (Near the airport), [8]. Han dynasty tomb (known locally as HanYangLing) containing 50,000 doll-sized terracotta figures. There are human figures (think small and naked version of the terracota warriors) as well as a whole army-like formation of life-like animals (pigs, dogs, etc). The "Underground Museum" at the excavation site has a glass floor so that you can look down on the ongoing excavations and is definitely worth a visit (especially easy to do if done as part of a journey to or from the airport). There's a very unique holographic movie experience as part of the exhibit (no 3D glasses required, English and some other language translation available, 10 RMB though it is unclear if it's a legitimate fee). It's also worth getting a guide or following one around (note that English ones are more expensive than Chinese ones) because they will explain things in much more detail than the captions. Some people also climb up to the top of the burial mound (you can see a worn trail going up the side). If you cross the road you can see the Archaeological Exhibit Center (where some of the best figures are kept), a deer park (with actual live deer), and ruins of a "sacrifice temple" (not too impressive). The grounds around the mausoleum are nice to stroll in, with fragrant wild grasses and a rose garden next to the Arch. Ex. Center. It is possible to get to the site via tour or share a taxi (around ¥200 round-trip, not including waiting time). By public transit, take the subway to XingZheng ZhongXin station (North of the city, 3 RMB). When you exit, you'll see a huge roundabout. You need to catch bus #4 from there, which can be a bit tricky. You can take exit B3 from the subway (South road from the roundabout, West side), go south until you see Hotel Liu Lian on your right - there's a bus stop right next to it. Or, take exit A2 from the subway (North road from the roundabout, West side), go North until you see a bus stop (the East entrance to City Sports Park and a stadium will be on your left). Both stops seem like they go the wrong way (South instead of North), but don't worry, the bus turns around soon after them. As of June 2012, bus #4 seems to be a small pink bus, comes every 30min or so, and costs 2 RMB. Be careful since it may not actually stop! You must actively flag it down. If you miss it, you can run to the other, East side of the road (be very careful crossing all these lanes of traffic) and you can flag it down as it turns around and starts going North. This is a bit easier to do at the City Sports Park stop. As of November 2012, the easiest way seems to be to take the subway to XingZheng ZhongXin station, then take exit B3. After leaving exit B3 walk for 100 yards straight ahead, you will see a bus stop across the street. Bus #4 stops here at the following times: 08:30/09:30/10:30/12:00/13:30/15:00/16:00/17:00. The departure times from the Tomb are approximately half an hour to an hour after these times. 80 RMB; half-price students. edit
The painted female figures with modeled clothes
underground museum of Han Yangling Mausoleum
One of the burial pits
[edit][add listing] Do
• Hui Muslim Quarter, Huimin Street (回民街; Huímínjiē). Walk through the Muslim quarter sampling food and buying souvenirs. edit
• Walk the City Walls. Walk along the city walls and see the South Gate (南门; Nánmén), which is illuminated at night. edit
• Bike the City Walls. Bicycling around the city walls will take about 2 hours. Bicycles can be rented on each of the four main gates for 100 minutes, ¥40 per person, and it may to be returned to any of the other stations (however, be sure to verify this before starting your ride). Remember to take your passport with you as a deposit for the bike that you rent, or ¥200. Make sure that you keep the deposit ticket, as the bike vendor will not give you the deposit back without it! Also - the bikes are generally relatively new and well maintained - however, check the tire pressure and whether the brakes work before choosing yours. You can also rent tandems for 80 Yuan for 100 minutes. edit
[edit] Work
Native and non-native English speakers can easily find jobs teaching English.
[edit][add listing] Buy
[edit] Souvenirs
Xi'an souvenirs include small copies of terracotta warriors, wood-carved Buddhas and dragons, Tang Tricolored Pottery, hand made paper cut (by many regarded as the most important arts form in Xi'an), all other kind of folk art and also fake western products.
• Terracotta Warriors (秦始皇兵马俑). If you are visiting the Terracotta Warriors, be prepared to meet some of the most hardcore hawkers you are likely to meet anywhere. If you keep quiet, they will usually bargain themselves down in front of you in desperate pleas for your money. A box of 15cm high Terracotta warriors cost ¥5-10 (if you're lucky) or ¥15-25 (more likely) even if they offer it to you for ¥45. Wood-carved Buddhas and Dragons for about the same. They are fortunately kept at a distance from the actual site. Many travelers report enjoying this experience. It is definitely not a reason to avoid seeing the Terracotta Warriors. The exit from the pit areas to the parking lot leads through long avenues lined with souvenir stalls and shops. The barkers will try to get your business, but are not as aggressive as the touts at the entrance or immediate exits. edit
• Bazaar Area, (Behind the Drum Tower in the Muslim Quarter around the Great Mosque). The best place to buy souvenirs in the city center is the bazaar area. The seller usually offers you a very high price, and even if you bring them down by 50%, they will still make a big profit. This is also a good place to buy folk art, specifically folk style block prints in a single shop which go for about ¥50 if you can stand bargaining when the older gentleman artist himself is standing right there. This area is also full of fake name-brand products like watches, bags, clothes. Bargain hard. Shop owners will typically sell such fake branded products to expatriates at three times the price they offer to Chinese people. For instance, a Louis Vuitton wallet going at 80 yuan will be touted to Westerners at 200 plus yuan. If your haggling skills are exceptional, you can bring down the price to a mere 30 yuan. edit
• Calligraphy Street （书院门步行街）, (Near South Gate inside the city wall towards the east, walking down South Street on the left side, continue to where the road splits in front of South Gate and turn left to find the entrance gate next to a small pagoda, midway do a slight dog leg to the right, at the far end is the Forest of Steles). This is another souvenir shopping area. Less hectic than the Muslim Quarter. edit
• Tang Tricolored Pottery Factory (唐朝三色陶器厂). Tang Tricolored Pottery is a style that was lost and has now been recreated from pieces of pottery found in tombs. It is graphic in image and eye-pleasing in color. The factory recreating the style offers over 100 varieties of items, like statues, animals and utensils. edit
[edit] Clothes
Xi'an is a great place to buy clothes.
• East Street (Dong Dajie), (The eastern of the four big streets descending from the central Bell Tower). Has regular fashion shops. edit
• South Street (Nan Dajie). Has finer clothes and shoes, and is home to boutiques like Prada, Louis Vuitton, Gucci and Marc Jacobs. edit
• Baihui Market (百汇市场), (In Xiaozhai (小寨), ¥10 by taxi from the city center). Local youngsters shop here. It is one of those fake-brand markets. Sport shoes should be less than ¥150, pullovers and nice jeans sometimes less than ¥100, lots of cheap fashion accessories. This is also a great place for DVDs and CDs but understand these are mostly pirated copies. edit
• Kangfu Road, (Outside the east city wall, straight through the Northeast Gate). A great place for a bargain. Nothing is (bargained for) over ¥50 and most clothes can be bargained down to about ¥20 if you are really aggressive. But this place is full of poor quality stuff. edit
• Shida Lu. A trendy place to shop in a largely student populated area in the south of the city. Shida Lu has lots of hair salons, and clothing botiques. edit
• Century Ginwa. This luxury shopping mall has two locations in Xi'an. One downtown by the Drum Tower, the other in Gaoxing on Keji Lu. edit
[edit] Books
Foreign Language Bookstore 外文书店 The best place to hunt down an English language novel or book is the Foreign Language Bookstore. Almost every major city in China has one these days, but don't expect to be overwhelmed by the fabulous selection of English books – whether in Xi'an or in any city in China. Expect to find a handful of popular novels and classic prose. You'll also find bucket loads of English language text books and dictionaries for studying purposes.
Add: 349 Dong Dajie, Xincheng District, Xi'an 地址：西安市新城区东大街349号 Tel: 029 8721 9872?
Jiahui Hantang Book City 嘉汇汉唐书城 The largest bookstore in Xi'an, Book City has a fairly decent selection of imported English books. You'll find a wide range of books here, from educational ones, to classic novels, and modern literature to children's books. The place gets swamped with people at the weekends, so for a more pleasant browsing experience, come during a weekday.
Add: 111 Chang’an Zhonglu, Yanta District, Xi’an 地址：西安市雁塔区长安中路111号 Tel: 029 85219888 Opening times: 09:00-21:00
Xi'an Book Building 西安图书大厦 Another place worth checking out is the Xi'an Book Building, four floors of books as far as the eye can see. Though the vast majority of books are in the Chinese language, you will find a small selection of English books on the second floor. The building also houses a small audio and video section, as well as a café.
Add: 214 Jiefang Lu, Xi’an 地址：西安市新城区解放路236 Tel: 029 87416666 Opening hours: 09:00-21:00
Bell Tower Xinhua Bookstore 钟楼新华书店 Another very small English language book selection can be found at the Bell Tower Xinhua Bookstore. Unless you're nearby, your best bet for English books is still the Foreign Language Bookstore or even the Book City. However, if you're also looking for stationary, cards, wrapping paper etc. then it may be worth checking out and to trying to kill two birds with the one stone. Otherwise don't expect an English-language book Mecca here.
Add: 377 Dong Dajie, Xi'an 地址：西安市东大街377号 Tel: 029 8724 0844 Opening hours: 09:00-20:00
[edit][add listing] Eat
Xi'an specialties include:
• Yang Rou Pao Mo （羊肉泡馍） is one of the signature dishes of the area: it consists of a piece of thick, chewy bread and a kettle of mutton soup. The diner shreds the bread with his hands and places the shreds in a bowl, the soup is then poured over the shreds (along with meat, maybe some noodles or scallion, etc.) The trick is to shred the bread into pieces that are "as small as possible". Most first-timers will shred their bread in pieces that are too large. In some restaurants, they have already shredded the bread for you. It is normally also served with pickled garlic and chili. If you don't like mutton, some restaurants also offer a beef (niu rou) version. Tong Sheng Xiang Restaurant and the Lao Mi Jia are recommended.
• Biang Biang Mian is a local provincial specialty noodle dish that is extremely good. The wide noodles are spiced, have a broth, and include toppings such as eggs, tomatoes, beef, etc. The character for "biang" isn't yet possible to type into a computer, but look for a complex character with about 57 strokes repeated twice before "面". A popular chain has a red sign with white characters, and includes the face of the "Noodle King".
• Rou Jia Mo 肉夹馍 is the closest thing to a beefburger. This is a local tradition and should be very easy to locate. Sandwich-like, with pork, beef or lamb, this is a must-try item for anyone who is in this area.
• Xiao long bao-zi 小笼包子 are basket-steamed dumplings (one basket ¥3), common as a midnight snack. Look for its big brother "Da bao-zi" only available first thing in the mornings, like a steamed cornish pastie, but very nice.
• Guan Tang bao-zi 灌汤包子 are steamed buns served with sauces inside.
• Shi Zi Bing 柿子饼 are buns made from persimmons, stuffed with something (e.g. black sesame paste), and deep-fried, so they're quite sticky-sweet. You can find many sellers in the Muslim Quarter, and they are only ¥1 each!
• Lu dou gao 绿豆糕 are literally green bean cakes (come in small cubes), but they're more moist than you may find elsewhere and also come with a variety of mixings (e.g. sesame). Half a Jin should be about six cubes and cost about ¥5 at a cart in the Muslim Quarter.
Some good places to look for restaurants are:
• The Muslim Quarter close to the Drum Tower is a vibrant area with many restaurants spilling out onto the street and mixing with the street sellers. If you're looking for snacks, this area is also full of people selling dried fruit (especially dates) and nuts/seeds (sunflower, melon, pumpkin, etc.) Prices are per Jin (500 g) and are pretty much standardized throughout the area, so you can't really bargain unless you're buying a lot. Watch out for the pits in the jujube!
• Street food (mostly sold after sunset, or some near night clubs/bars after 11:00 PM) presents a variety of local/regional dishes, ranging from noodle soups, dumplings, hot pot, and so on by tens of little food vendors on street side, each with a red lamp. There are a few roads running perpendicular to the Muslim Quarter road that have a larger variety of streetside food (at cheaper prices because these roads are harder to access). As streetside stores are nearly a model of perfect competition, look out for food sold at significantly higher prices, yet maintain a long queue as these are likely to be tastier. For instance, some vendors may unscrupulously sell beef mixed with lamb and pass the meat off as pure lamb meat to cut their cost, however those who sell real lamb meat usually charge a higher price.
[edit] Budget
A good way if you do not want the expensive hotel food or just want to try real Chinese cuisine, is to simply go into a small restaurant and point to a dish somebody else is having and you will get a meal for less than ¥10 (seldom ¥20) per person.
A good street for eating is Xiyang Shi running east-west near the mosque in the Muslim quarter. However, be warned that the food that is sold may have been exposed to heat and sun for a longer period of time without cooling, so particularly meat, fish or egg products may cause trouble to Western stomachs that are not accustomed to this.
• Wen Xin Jiaozi Guan (温馨饺子馆), 123 Xushimiao Street (Next to the Good World Hotel, off of Lian Hu Lu). A good cheap place for jiaozi (Chinese dumplings). There is no menu, but endless supplies of fresh jiaozi of many flavors. From ¥4-5 a bowl. edit
• Lao Sun Jia, G/F Dong Dajie. Has fantastic yangrou paomo which is very cheap but flavoursome. No English spoken but easy to communicate with sign language! At this time you can only find a mound of fresh rubble at the original site of the restaurant, also as currently wrongly indicated in GoogleMaps as a duplicate site. The right place of the two indicated is the one at NW position. The new site is very near to the original place, diagonal on the other side of the intersection. Look for a modern new building with a big signpost. edit
[edit] Mid-range
McDonalds, Pizza Hut, KFC or its Chinese brother, Dicos, are widely available within city walls for a change from the daily Chinese cuisine. There are also three Starbucks within a 5-minute walk of the Bell Tower.
• Highfly Pizza (高飞), (Down the right hand street after coming out of South Gate (南门)). Real pizza and other western food. edit
• Green Molly Restaurant & Pub (绿茉莉), (200m north of Ginwa Shopping Center on the intersection of Gaoxin Road and Keji Road (西安市高新区高科大厦副楼一层 (世纪金花商场后门向北200米路东))), +86 29 81883339. 10AM-11PM. A restaurant where you can indulge in the tastes of home, whether that be in the U.S., Europe or even Mexico. The restaurant owns only the second authentic pizza oven in Xi'an. Downstairs, the first and only real pub in Xi'an has a wide selection of beverages ranging from imported beers to wine and delicious cocktails. edit
• Small World Cafe (Jianguomen 建国门), Huancheng Nanlu Dongduan 90# (Outside Jian Guo Gate （建国门外）). 11:00AM-10:30PM. Run by a Dutch woman. Great European cafe feel. Good food. Pizza, salad, fried chicken and real cake. From the windows, one could see busy Huancheng Nanlu (环城南路)，while it is really quiet inside. edit
• Small World Cafe (Dayanta 大雁塔), Ynataxilu 雁塔西路 (Southeast to Big Goose Pagoda （大雁塔东南角）). 10:30AM-10:30PM. Run by a Dutch woman. Great European cafe feel. Good food. Pizza, salad, fried chicken and real cake. Out of the north windows, one could see Big Goose Pagoda. edit
• Delhi Darbar (新德里餐厅), Dayanta West Road (雁塔区大唐通易坊东头路北) (Directly west of the Big Goose Pagoda on a street full of upscale bars and restaurants). Authentic North Indian food run by a wonderful Indian manager. Service is good, food is devinely delicious, and prices are very affordable. Mango Lassi for only ¥10 is a must have. Average meal price is about ¥40 per person. Highly Recommended. edit
• Village Cafe. A nice urban cafe on Shi Da Lu that offers burgers, steaks, and all sorts of drinks and desserts. From ¥30-60 per person. edit
[edit] Splurge
• La Seine, Nandajie (南大街) (Near Bell Tower). French style restaurant. edit
• Tang Paradise Hotel, (Near the Wild Goose Pagoda in the Qujiang Resort of Xi'an). Dinner Show in a large 165 acres theme park. The charm lies in that all the buildings in the park are built in the luxurious style of the Tang Dynasty. The best time to visit is at night when most of the shows, including fireworks and dances, are performed. edit
• Koi, Sofitel on Ren Min square. Japanese cuisine. edit
• Village Cafe (32 Shi Da Lu, opposite of Bank of China). If you miss your burger, this is the place to go.
[edit][add listing] Drink
Night clubs in Xi'an are not abundant. All clubs play the same music, a mix of Chinese disco and some pop music. Most people go out between 10PM and 1AM, but clubs are generally open until 4AM.
Be mentally prepared to be aggressively approached by club operators desperate for patrons.
In summer time, the area around South Gate (南门) is beautiful. East of it are three nice bars with terraces and gardens.
Along the short Nandajie (南大街) are the most clubs (you can also eat on the street as there are restaurants open past midnight).
• MIX, (Big light ad). Rather nice places to sit and drink. edit
• Palando. Rather nice place to sit and drink. edit
• Night Cat. Dance floor, some foreigners and OK-DJs. edit
• Kulala. Dance floor. edit
Other options include:
To get started on a Friday or Saturday night you can have some drinks in one of the bars in "De Fu Xiang" street. There are around 10 bars next to each other. If you are coming in from the south gate, just enter Xiangzimiao street westwards. The street will take a right turn, then you can see the first bars. In case you are heading from the north (Bell Tower), you enter Fenxiang street to the west and turn left into DeFuXiang street (there is a chinese "gate" at the entrance of the street.
1+1, Dongdajie (东大街) (In the middle of the street). Remains one of the most popular clubs and definitely the most popular amongst foreigners. The club has 2 dance floors: first floor is mostly J-pop music, second floor is mostly hip-hop. There is a relaxed open air bar on the 5th floor which has live music every night. edit
• De Fu Lou Cafe & Bar (De Fu Lou Paulaner Bar), De Fu Xiang Street. In Bar Street (De Fu Xiang), one of the first bars ever to open in Xi'an and a favourite hangout for locals. Live football on the big screen and live music every night. edit
• Salsa (莎莎; Shasha), 7F, Parkson building, No.107 West Street. Is probably the most popular club. This club is your best bet on Fridays and Saturdays however yi-jia-yi is more consistent during the week. The dance floor, while smaller than yi-jia-yi's, is usually less crowded, so you have a bit more room to dance. Be careful if your group is mainly non-chinese as they sometimes decide to limit the number of foreigners allowed in. edit
• Off-road Tea Bar, Jiefang Road (800 m S direct to Xi'an Railway Station). Has been checked by Google Business. Here, one could enjoy the fresh green tea in Southern Shaanxi and could meet local cycling and trekking lover. edit
• Havana Bar, Renmin Square (In Sofitel Hotel). Has a Colombian band and makes good cocktails. It's not your average Buena Vista Social Club, though: they play loud music inbetween band performances and the band plays a wide array of pop and salsa. This location is more of a club than an actual latin bar. edit
• The Belgian Bar, 69 Shun Cheng Nan Lu Dong Duan (150m east inside the South Gate), 13201672369, [9]. The first and only Belgian bar in Xi'an. Friendly pub atmosphere and huge range of beers. Popular with expats and locals. Awesome location facing onto the city wall. edit
• Vice Versa, Wen Chang Men (Wen Chang Gate) (Beilin History Museum (Beilin Bo wu guan)), 151 092 72480, [10]. 3PM-5AM. Vice Versa is a cultural mix of east and west, found in one of the older districts of Xi'an. With a relaxed cafe/restaurant open during the day, a lively bar serving a mix of western and asian beers/cocktails at night, and a crowd of expats and Xi'an locals. Has a skate shop on the third floor, run by Converse pro-skater Xiao Jian. Located next to the front gate of the Forest of Steles History Museum, next to the city wall at Wen Chang Gate, you can call Mike at 151 092 72480 if you get lost. edit
[edit][add listing] Sleep
As with most Chinese cities several cheap run down hotels can be found near the train station. There are a few decent ones inside the city walls on a road called Jie Fang Lu going directly south from train station. Bargaining is possible especially if you are staying for more than one night. Expect to pay under ¥100 for a single room as getting a room for as low as ¥30 is possible.
[edit] Budget
There are at least six international youth hostels right in the center of the city, easy to find.
Booking on the Internet will usually save you money, prices start around ¥15.
• 3e Hotels International, 54 Nandajie (located between the South Gate and the Bell Tower, right next door to a KFC on the W side of the street). Single room with free broadband internet is ¥154. Right outside the door is a coffee shop. edit
• Bob's Guesthouse, 85 Huan Cheng Bei Lu Rd (just outside the city walls, a short walk from the train station), [11]. Doubles with en-suite bathroom for ¥100; dorms from ¥25 (summer 2006). edit
• Ludao Binguan, 80 Xi Ba Lu （西八路）, +86 29 87420308 (fax: +86 29 82101222). A nicer-than-average hotel and hostel. Dorm rooms are between ¥25-50, depending on the season. Reasonably nice hotel room for around ¥75. The manager Jim Beam is friendly. edit
• Hq Guesthouse in Xi'an, Hong Cheng Guoji Gong Yu, Xihuamen Shizi, 西安市, 陕西省, 710003, +86 13149250037, [12]. Small but cozy setup in a brand new apartment complex located by the Muslim Quarter in Xi'an. Free pickup, free internet. 1 bedroom apartments from ¥300.. edit
• Xi'an Shuyuan International Youth Hostel, Xi Nanmen, +86 29 87287720 (fax: +86 29 87287721). Excellent location just next to the South Gate. 8 people dorm from ¥35/night. There is an excellent pub under the hostel, and a very nice coffee house. Perfect place to hang out, surf internet, just 10 minute walk from Drum Tower and the magical moslim snack street! Updated: 09.02.2012 edit
• Han Tang Inn Youth Hostel, 7 South Long Alley, +86 29 87231126, +86 29 87287772, [13]. The hostel is in a 4 floor building down a alley near the Bell Tower. Rates range from ¥30-160; doubles with ensuite bathroom costs ¥120/night (as of June 2010; booked on hostelworld.com). The hostel includes a bar on the 4th floor with TV, pool table, movies and 3 guitars. Free computer use for internet in the lobby. wifi in the rest of the building is iffy but you can ask for an Ethernet cable. The staff run lots of events (e.g. a dumpling party) each wee. Have a partner, Shuyuan Hostel, near the South Gate. edit
• duolamaer gallery international youth hostel, 7 Shuncheng Avenue, Zhuque Gate (10 m from South Gate), +86 15129032007, [14]. Duolamaer is a painting-themed hostel providing a vibrant accommodation for independent travellers who require basic but clean living facilities. It is run by a bunch of arts enthusiasts, who give that place a creative and aesthetic atmosphere. edit
• Warriors International Youth Hostel, No.98 Bei Ma Dao Xiang (Across the street from the West Wall, North from the main West Gate and South of the Lama Temple). Great budget option, in a quiet spot along the inside of the West City Wall. Opened April 2012 - facilities are clean, spacious, and comfortable. Staff are young, friendly, have a good grip on English. Free train station pickup, A/C, Wifi, computer use, and one beer/coffee ticket. Train 103 within easy walking distance to/from train station. Dorms posted as ¥50, book online through a 3rd party for ¥20/night. edit
[edit] Mid-range
• Citadines Gaoxin Xi'an (西安馨乐庭高新服务公寓), No 13, Gaoxin Si Road, Hi-Tech Zone, +86 29 8843-7888 (, fax: +86 29 8843-7999), [15]. This residence in the centre of the Hi-Tech Development Zone offers 251 apartments that are fitted with a kitchen, home entertainment system, ensuite bathroom, and broadband internet access. Daily rates starts from ¥430. edit
• Xian Central Serviced Apartments, Xihuamen Shizi, +86 15829031947. Xian central serviced apartments are more than 100 sq m. Spacious, newly furnished, clean and about 1 min walk to the Muslim Quarter. Free PC and internet in every apartment. Provide free use of mobile phone for guests to use while out exploring the city edit
• Qindao Business Hotel (西安秦道商务酒店), 100 Nan Guang Ji Jie (It is along Xi Dajie across from the Parkson Shopping Center and entrance to the Muslim Quarter), +86 29 87615888. Free internet and cable TV in the rooms. Travel office and public computer available in the lobby. Complimentary breakfast at 4th floor restaurant of mediocre quality, but their regular menu items are quite good and the view from the balcony is great. Laundry service: 2 day turnaround ¥10/item. Beware of the massage place on the 7th floor. It is nasty. ¥286 for a double room (2 people) and up. edit
• Grand Mercure on Renmin Square (西安豪华美居人民大厦), 319 Dongxin St (In the grounds of Renmin Square.), +86 29 87928888 (), [16]. A heritage hotel of 202 rooms, 21 suites, first opened in 1957 and reflects the Sino Russian style of architecture. edit
• Mercure on Renmin Square Xi'an (西安美居人民大厦), 319 Dongxin St (In the grounds of Renmin Square.), +86 29 87928888 (), [17]. A heritage hotel of 113 rooms, first opened in 1957 and reflects the Sino Russian style of architecture. From ¥ 594. edit
• Nanlin International Hotel, +86 29 87216000, [18]. Nanlin International Hotel is a four star hotel located in Xincheng District. It is just 3 km from Xi'an Railway Station and 40 km from Xianyang International Airport. Air-con room equipped with cable TV and free high-speed Internet access. Best rates on official website start at ¥287+. edit
• Warriors apartments, Building B, Hongcity International apartment, No.15 Xihuamen St., Xi'an, +86 13519197819 (), [19]. Family run, boutique apartment hotel. Qin-styled accommodations with 40 life-size warriors in the three apartments. Each apartment has terracotta warriors and has 1 or 2 bedrooms, bathroom, dining area, color TV, bed quilts, oven, full kitchen facilities and broadband internet access. edit
• Ibis Hotel, 59, Heping Road, Xian, +86 2987275555. Part of Accor Group. Very basic facilities. Free broadband internet access. Price per night starts from ¥ 199.. edit
[edit] Splurge
• Hyatt Regency Xi'an (西安凱悅酒店), 158, Dong Dajie (At the corner of Dong Dajie and Heping Lu (和平路), 10 minutes walk from the Bell Tower), +86 29 87691234 (), [20]. 5 star hotel within the the historic City Wall, in the heart of shopping and entertainment area of Xi'an. edit
• Howard Johnson Ginwa Plaza Hotel (金花豪生國際大酒店), 18 West Section, Huancheng S Rd (60 minutes from Xi'an International Airport and 15 minutes from Railway station). 2 tall modern architectural buildings are separated by a spacious and bright lobby. Opened in 2003 with 324 rooms. edit
• Xi'an Golden Flower Hotel. Very popular 5 star hotel, 5 min taxi ride from the Bell tower. Luxury, large rooms with views. Swimming pool, spa, 3 restaurants, lobby bar and shops. Dble US$160. edit
• Sheraton Xi'an Hotel, 262 Feng Hao E Rd, +86 29 84261888. The location of this hotel is not a good choice for tourists, because it is far from the scenic spot of the city. However, it is near the freeway and the airport. edit
• Xi'an Garden Hotel, 40 Yanyin Rd, Yanta District, +86 21 61226688, ext 7800, [21]. Four-star hotel with a stunning imperial-inspired facade and 292 beautifully appointed rooms. Facilities include conference and banquet venues, three restaurants, and an indoor swimming pool. edit
• Kempinski Hotel Xi'an(西安中新凯宾斯基酒店), 6 West Section, Euro-Asia Avenue, Chanba Ecological District (30 min from Xi'an Int'l Airport), [22]. The official site of the Euro-Asia Economic Forum. A leading luxury hotel in town with fascinating river view and extensive conference facilities. edit
[edit] Learn
• Chang'an University(长安大学) Directly under the administration of Ministry of Education, Chang'an University is one of the State "211 Project" key development universities. It was merged by the former Xi'an Highway University, Xi'an Engineering Institute and Northwest Institute of Construction Engineering on April 18th, 2000. Chang’an University is located in the historical and cultural city of Xi'an, and it covers over an area of 2980 Ares.
• Northwest A&F University（西北农林科技大学）
• Northwestern Polytechnical University（西北工业大学）
• Xi'an Electronic and Science University(西安电子科技大学)
• Northwest University of Politics and Law(NWUPL)(西北政法大学)
• XI AN MEDICAL UNIUERSITY(西安医学院)
• Xi'an International Studies University(西安外国语大学)
[edit] Contact
Xian Tours: http://www.emmastours.com[23]
[edit] Stay safe
Xi'an is, like other Chinese cities, generally quite safe. Just watch out for pickpockets (usually children) in crowds.
Pickpockets are more common during holidays. Pickpocketing is more likely to happen on the bus, in the East Street (the most properous commercial street in Xi'an), and some of the more crowded resorts like the North Square of the wild goose pagoda where there is a fountain show every night. Keep an eye on your camera. There are also alot of people asking for your money and beggars.
Note also that, like many places in China, the standard of driving is abysmal. This, combined with the swathes of ancient coal trucks that career down the roads, can lead to some pretty spectacular crashes.
[edit] Cope
Look at the Beijing#Cope notes as they apply to Xi'an, too. The air qaulity in the region is dreadful; be prepared for constant exhaust and limited visibility. Most importantly, take paper tissue with you to toilets.
Generally, Western style accommodation will have western toilets, whereas the very inexpensive guest house (zhao dai suo) will usually have squat toilets. If you need to use western toilets, learn to plan your day accordingly. Major tourist attractions will have western toilets.
If you arrive in Xi'an by train, try not to be overwhelmed when you exit Xi'an's train station. There are usually aggressive hotel touts looking for customers. Just insist that you already have a place to stay and tell them no, with a serious faced, 不要！ / Bú yào！
It is a good idea to leave your bags at the left luggage office and then go into town to look for accommodation. This way you will not be overwhelmed by the burden of carrying your heavy bags or luggage around.
[edit] Get out
Chen Lu Porcelain Town
• Chen Lu Pottery. 2.5-3hours drive north of Xi'an, this community of potters has been producing pottery since the Tang dynasty and is well worth the look if pottery is your thing, private transportation recommended. Winter is not a good time to visit here due to its location in the deep maintain, if there's a snow fall the icy snow covered road makes trouble. The Yaozhouyao Kiln Museum locates on the way from Xi'an to Chenlu Town, about 90km north of Xi'an, on the western side of the older road, not the high way. Articles here in 9 exhibition halls depicts the development of the Yaozhou procelain, which reaches its highest level during the Song Dynasty(960A.D.-1279), ranked first in Northern China for its beautiful celadon porcelain. The excavation sites of the original kiln lies 500m north of the museum, you could walk there, which is also well preserved.
Yaozhouyao Kiln Museum
celadon produced in Yaozhouyao kiln
celadon produced in Yaozhouyao kiln
• Hu Kou Waterfall (壶口瀑布 Húkǒu Pùbù). Located 150 km north of Xi'an, private transportation recommended; can be combined with a day trip to Huang Di Mausoleum. If arriving by public transportation, take note that as of 2008 there was only one bus returning to Xi'an from the waterfall. It departs around 10AM and must be flagged down as it does not stop.
• Huashan National Park. Approximately 2 hours by train or bus east of Xi'an. Huashan is a 2000 metre mountain with spectacular views. It is possible to take the 2-3 hour (6 km) walk up or take the 10 minute cable car for ¥70. Though the cable car often has lines lasting 2 hours. It is best to go for sun rise on the East peak. Take plenty of warm clothing for when the sun goes down. Basic accommodation is available, but can be quite pricey. Guesthouses with dormitory style lodging are available on the mountain.
[edit] Daqin Pagoda
• The Daqin Pagoda (Mandarin Chinese: 大秦塔 Pinyin: Dàqíntă "Roman tower" 大秦寺 Pinyin: Dàqínsì "Roman temple"), the oldest known church building in China, is approximately 62 km west-southwest from Xian city centre. It's in Zhouzhi county (周至县 zhouzhi xian) and close to Tayu village (塔峪村 tayucun), approximately 1.5 km West of Louguantai Daoist temple (楼观台寺）. The coordinates are approximately 34 03'32.92" N 108 18'26.19" E.. It was built in 635 AD by Nestorian (Assyrian Church of the East) Christian missionaries who had come from Persia through Central Asia, Xinjiang and Gansu provinces via the silk road to Chang'an (modern day Xian, Shaanxi province) during the Tang dynasty. The site includes a replica of the Nestorian Steele, the original of which has been moved to the Xian Beilin Museum (The Forest of Steeles) and the site also includes a small exhibition room with information about the pagoda's Christian history and some information about Nestorian Christianity in China. The pagoda fell out of use as a Christian building after several centuries, as Nestorian Christianity lost adherents in China, and after some time was taken over by Buddhists. Today it is used by Buddhist monks as a monastery and a Buddhist shrine / temple. Half of the premises around the pagoda is used by the Buddhist monks and the other half is made up of historical monuments to Nestorian Christianity. Unless you make special arrangements before going there, you may only be able to see the bottom floor of the pagoda, which is now filled with an array of Buddhist statues. There are several floors in the pagoda which could only be reached with ladders or other climbing equipment. These floors contain paintings and sculptures depicting various Christian scenes. The exhibition room may also be locked unless you check beforehand.
To get there, go to Xian City Bus Station (西安汽车站）, also known as the Xi'an Long-distance bus station （市长途汽车站） or Shuisi bus station（水司汽车站） just outside the city wall on the southwest edge of city. It is close to the corner of Fengqing road (丰庆路） and the Western Ring road （城西路）. The entrance is in a smaller side street called Jiejiacun road (解家村路）, which is about 300 metres west from the Fengqing lu / Western ring road intersection.
At this bus station take the bus which is going to Louguan （楼观）. Buses are quite frequent and the last buses for the day are around 5:30-6:00pm to and from Louguan.
Some buses take 1-2 hours and some take 2-3 hours. The quicker buses go down the expressways the longer ones drive through the countryside through many small villages stopping frequently to let passengers on and off, before finally arriving at the carpark of Louguantai (楼观台） which is a famous Daoist temple complex. You can confirm with the driver that you are going to the Louguantai carpark; if you can't speak Chinese, show him the Chinese characters. When you arrive at the carpark you should be at the corner of 108 Provincial road (S108 or 108 Sheng Dao) and 220 County road (220 Xian Dao). At this corner there will likely be some taxis waiting nearby some people selling snacks and refreshments. You should also see a small police station opposite this corner, next to a small supermarket. Ask one of the local taxi drivers to show you the way. You may have to negotiate a price without using the meter. The pagoda is approximately 2 km south west of this corner. The taxi driver should drive about 1 kilometre westwards on the S108, then turn left into tayucun road (塔峪村路). He should drive up the hill, and pass 2 or 3 bunches of small houses, before driving up a dirt (or mud) road before stopping. From here you will have to hike up the hill, which takes about 10 mins through some muddy footpaths past some corn fields and up onto the side of the hill where you will find the pagoda.
Routes through Xian
LanzhouXianyang W E SanmenxiaZhengzhou
This is a usable article. It has information for getting in as well as some complete entries for restaurants and hotels. An adventurous person could use this article, but please plunge forward and help it grow!
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
other sites
|
v0
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.