id
int32
0
398k
text
stringlengths
204
42k
educational_score
float32
1
5
domain
class label
3 classes
document_type
class label
4 classes
64,863
Anteroposterior (AP) and lateral radiographs confirmed the confined cancellous nature of the defect in the medal distal femur and did not reveal any adverse bony reactions for either material at any time. The Faxitron radiographs were of little to no value in evaluating bone healing or implant resorption and are not presented micro-computed tomography, on the other hand, provided a unique insight into the radiographic signal and performance of the two materials. Increased signal intensity suggesting newly formed woven bone was seen at the defect margins as well as extending into the centre of the defects with the Sorrento BMA material at 3 weeks which progressed with time (Fig 5). Intimate bone–CaP contact as well as bone remodelling and CaP resorption was noted with time. In contrast, micro-computed tomography for the Vitoss Foam Strip BMA group did not demonstrate new bone formation at 3 weeks while some new bone formation at the margins could be seen at 6 weeks this did not progress into the centre of the defect with time. The autograft treated defects healed well with time while the empty defects remained empty demonstrating the critical nature of the model (Fig 5).
4
0biomedical
0Study
331,109
Furthermore, previous animal studies had revealed that ATV-NDV vaccine stimulated significantly higher CTL responses from MTCs than ATV vaccine without virus (NDV) infection . The increased response was due to secreted IFN-α . Apart from type I IFN, also cytokines released during a secondary immune response, such as IL-2, IL-12, IL-15, IL-18, and IL-21, determine the memory potential of antigen-specific CD8+ T cells . The CD8+ T cell response to a solid tumor required the availability of a third signal provided by IL-12 or type I IFN and their corresponding receptors .
4
0biomedical
0Study
371,160
To generate a standard calibration curve for directly converting the measured florescence intensity into absolute protein concentration, purified GFP at various indicated concentrations were injected into the homemade flow chamber, and the fluorescence intensity at each concentration was measured using the same imaging parameters (Olympus IX73 microscope, 12-bit image and exposure 60 ms for COS7 cells; Zeiss 780 upright confocal microscope, 16-bit image, laser power 2.0, and gain value 850 for NBs), as for the whole cell or puncta/crescent quantifications. With these calibration curves, the measured fluorescence intensity for GFP-Par3N in COS7 cells or GFP-Baz in NBs can be converted into absolute molar concentration, according to each standard calibration curve. Identical parameters (laser power, detector gain, bit depth, and exposure time) were used during the imaging processes for COS7 cells or NBs, respectively. Images were analyzed by the ImageJ software.
4
0biomedical
0Study
273,479
Twenty trajectories in joint space are sampled out from the conditioned distribution. For the twenty joint space trajectories, the corresponding end-effector trajectories in task space are found out and are also shown in Figure 3. Figure 6 shows the cost of each of the trajectories and the trajectory which has the minimum cost. For this trajectory, the induced motion on the spacecraft is shown in Figure 7.
1
2other
1Other
256,858
Plants have evolved a suite of adaptive mechanisms in response to low P stress, including the enhancement of the expression of Pi transporters, the induction of secretion of root exudates, such as organic acids and acid phosphatase, and the reconstruction of the root system architecture (RSA) including root morphology, growth angle, and spatial distribution (Péret et al., 2014). RSA is a highly plastic trait that varies among and within species (Liu, 2021). Li et al. (2001) reported that P deficiency increased the root dry weight, number, and length of lateral roots in rice, while Vejchasarn et al. (2016) found that the lateral root length of rice was reduced by P deficiency. Similarly, a previous study reported that the shallower root distribution of Arabidopsis was caused by a reduction of primary root length and an increase in lateral roots under limited P conditions (Williamson et al., 2001). However, low P stress stimulated the growth of primary roots, inhibited the formation of lateral roots, and increased root depth in maize (Li et al., 2012). In addition, P deficiency weakened root gravitropism and enlarged the growth angle of lateral roots, leading to basal root shallowness in common bean (Liao et al., 2001). The diversity of RSA under low P stress indicates that RSA plasticity depends on external environmental and internal genetic factors.
4
0biomedical
0Study
38,605
RASF were characterized for levels of ACPA (commercial anti-cyclic citrullinated peptide (CCP)-2 ELISA, Eurodiagnostica), HMGB1, and S100A8/A9 using commercial ELISA kits (Diagnostik Service GmbH, Hycult and IBL International, respectively) according to the manufacturers’ protocols. Antibody reactivity against the citrullinated form of linear peptides derived from fibrinogen and histone 2A were determined by ELISA. Sequences of citrullinated peptides used in the assay are presented in Additional file 1. Ninety six well plates (Nunc) were coated and incubated overnight with peptides in their native or citrullinated form, all at a concentration of 10 μg/mL. Plates were washed and blocked (1 h, 4 °C) with 2 % BSA in PBS. For the detection of specific IgG, RASF samples diluted 1:50 in 2 % BSA, 2 M NaCl in PBS were added and incubated (1 h, 4 °C). Plates were then washed prior to adding an anti-human IgG Fc-horseradish peroxidase (HRP) (Sigma; 1 h). Tetramethylbenzidine (Sigma) was added and the reaction stopped with 2 N H2SO4.
4
0biomedical
0Study
43,727
In Table 5, the essential amino acid composition (mg/g protein) of the samples was compared to the reference levels required by children in mg/g protein recommended by FAO/WHO/UNU (2007) for children of 1–2 years old in mg/g protein. In fact, the body is unable to synthesize essential amino acids and children 1–2 years need the most of these amino acids for their development. The histidine in all samples met the recommended children requirement (18 mg/g protein) except in Ekwang and Tenue militaire. The threonine in all sauce samples met the recommended children requirement (27 mg/g protein) except in Tenue miliatire. The valine met the recommended requirement for children (41 mg/g protein) only in Ekwang. The combination of methionine and cysteine in all samples was lower than the recommended value (25 mg/g protein). The isoleucine met the recommended requirement for children (31 mg/g protein) only in Koki. The leucine in all samples met the recommended requirement for children (63 mg/g protein) except in Ekwang. The combination of phenylalanine and tyrosine in all sauce samples met the recommended requirement for children (46 mg/g protein); the lysine met the recommended children requirement (52 mg/g protein) only in Koki.
4
0biomedical
0Study
373,770
Peroxynitrite fluxes were generated by combining an NO• donor and paraquat (PQ), a redox cycler superoxide-generating compound . This combination produces peroxynitrite through reaction between NO• and O2•− radicals , and is herein referred to as the PQ/NO• donor.
4
0biomedical
0Study
129,844
The definition of loss function is critical for the performance of GAN-based image denoising method. To a great extent, the loss function of deep learning influences the noise image restoration process . Many researchers studied different image denoising models by employing various loss functions. The mean squared error (MSE) or L2 loss function is the most widely used for many GAN-based models [14, 15, 24]. However, it includes the regression-to-mean problem, which causes oversmoothing and texture information loss. Furthermore, with the introduction of the networks of VGG-16 and VGG-19 pretrained on ImageNet, the perceptual loss was proposed to cope with the problems caused by MSE [27–29]. In this paper, we conduct some experiments with perceptual loss, and the performance of the results is poor. To effectively deal with various noises and preserve image structure, a structural loss integrates reconstruction loss and WGAN loss and is defined as the final objective loss function.
4
0biomedical
0Study
176,671
Here, we probe the effects of M2-TAM-derived exosomes (M2-TAM-Exo) on CC. In addition, we found that miR-183-5p was enriched in M2-TAM-Exo. Through gain- and loss-of-function assays of miR-183-5p, it was found that miR-183-5p accelerated the progression of CC. Further studies manifested that miR-183-5p targeted THEM4 and activated Akt and NF-κB pathways to aggravate CC development. This study reveals the regulatory mechanism of M2-TAM-Exo on CC and provides a new reference for clinical CC therapy.
4
0biomedical
0Study
377,381
The flesh of the studied fishes (the entire volume of muscles of underyearlings and yearlings) was homogenized in glass vials in chloroform/methanol (2:1, v/v) solution (10 mL per 1–3 g wet weight). The total lipids (TLs) were extracted using the Folch method . The homogenate was filtered, and the residue retained on the paper filter was rinsed with 30 mL of the extractive mixture. Then, the extract was mixed by adding chloroform and deionized water, which was left to settle in a separatory glass funnel until the complete separation of organic phases. Lipids remain in the lower chloroform layer, while non-lipid substances move to the upper aqueous methanol phase. Then, the chloroform layer was withdrawn for evaporated in a vacuum on a rotary evaporator (Hei-VAP Advantage HL/G3, Heidolph, Schwabach, Germany), and dried in a vacuum over phosphoric anhydride to constant weight. The total lipids were dissolved in chloroform/methanol and stored at −20 °C.
4
0biomedical
0Study
4,018
The ranking and percentages of frequency of specific antibiotic prescriptions differed between the two groups (Table 3).Table 3Top 7 antibiotic groups used by the registered Pen-A and non-Pen-A patients during follow-upRegistered Pen-A patients (n = 1254)Non-Pen-A patients (n = 3756)1Macrolides: N = 850 (25.2%)Beta-lactam, penicillins: N = 1733 (33.9%)2Tetracyclins: N = 677 (20.1%)Other antibacterials: N = 1087 (21.2%)3Other antibacterials: N = 602 (17.8%)Tetracyclins: N = 973 (19.0%)4Beta-lactam, penicillins: N = 509 (15.1%)Quinolones N = 511 (10.0%)5Sulfanomides and trimethoprim: N = 397 (11.8%)Sulfanomides and trimethoprim: N = 379 (7.4%)6Quinolones N = 325 (9.6%)Macrolides: N = 379 (7.4%)7Beta-lactam, others: N = 16 (0.5%)Beta-lactam, others: N = 55 (1.1%)Multiple prescriptions of the same antibiotic during hospitalization were counted only onceOther antibacterial: ATC class J01X (Glycopeptide, Polymyxin, Imidazol derivates, nitrofuran derivates ect.) Pen-A penicillin allergy label
4
0biomedical
0Study
10,823
Comprehensive validation studies on adult patients with different arthritis have shown good agreement of FOI with GSUS, PDUS, and MRI as well as variable sensitivity and specificity dependent on FOI phase and joint, by comparison [22–24]. These results cannot be simply transferred to children and adolescents as the altered vascularity of the juvenile cartilage and growth-related changes might affect the imaging. There are few data regarding its use in pediatric patients, yet first examinations of children by FOI were promising and the examination was well tolerated [25–27].
4
0biomedical
0Study
91,627
X-ray data were collected on a single MERS-CoV PLpro-ΔUbl2 crystal using 1° rotations at 100 °K. X-ray data were indexed, processed, and scaled using HKL200030. To determine the initial phases for the structure, molecular replacement with Phaser was performed using the structure of MERS-CoV PLpro-Ubl2 apo (PDB code 4P16) as a search model15. Model building and refinement on the resulting structural solution containing one molecule in the asymmetric unit was completed using Coot31 and Phenix Refine32 using stimulating annealing for initial refinements to limit bias. Final data collection statistics and refinement parameters are shown in Table 1. Figures were generated with PyMOL (The PyMOL Molecular Graphics System, 1.8.0 Schrödinger, LLC).
5
0biomedical
0Study
107,204
Cellulose is the main component of plant lignocellulosic biomass and the most abundant terrestrial source of carbon. As a tightly packed microfibril of linear chains of β‐(1,4)‐linked glucose residues predominantly composed of crystalline domains that exhibit strong intra‐ and inter‐molecular bonding, cellulose has remarkable structural properties with a tensile strength equivalent to that of steel (Cosgrove, 1997). The strong inter‐chain hydrogen bonding network that gives cellulose its sturdy structural properties also makes it resistant to enzymatic hydrolysis, with an inverse correlation between cellulose crystallinity and the initial rate of cellulose hydrolysis (Hall et al., 2010). Hence, engineering approaches rendering crystalline cellulose more amorphous are a major research focus (for a comprehensive review see: Abramson et al., 2010). Initial studies, however, showed that such a target compromised other important plant agronomic traits. Harris et al. (2012) showed that in Arabidopsis two CESA mutants reduced the crystallinity of the cellulose microfibrils compared to the wild type. Lignocellulosic extracts of these mutants showed less recalcitrance in saccharification assays (49% increase in sugar release for the double mutant). However, the mutants, in particular the double mutant, exhibited dwarfed phenotypes. To this end, it seems that the targeted expression of exogenous cell wall degrading or modifying enzymes, explained in more detail in Section C, could provide a better route to alter cellulose crystallinity without compromising plant performance (Table 4).
4
0biomedical
0Study
41,040
In order to make the validation results of lncRNAs more comprehensive and credible, we carried out the validation in tumor cell lines in addition to the experimental validation of the tumor tissue samples by qRT-PCR. The results of validation and the microarray data were basically the same, except for three lncRNAs (CHL1-AS1, HAND2-AS1 and LINC01093) that could not be detected. The detailed expression level was shown in Supplementary Figure 1. Additionally, we performed the same assay for cell culture supernatants. There were five lncRNAs (CRNDE, LINC01419, A2M-AS1, LINC01146 and LOC101928505) that were detected in the supernatant of cell culture, and the results were basically consistent with the results of cell detection. The detailed expression level was shown in Supplementary Figure 2.
4
0biomedical
0Study
199,307
Our study is a retrospective study and the preventative effects proposed need to be assessed further in prospective studies and real clinical practice. Nonetheless, the proposed approach has clear benefits because it utilizes pre‐tested HLA data to prevent ADR occurrences without additional costs or patient discomfort. Given the rapid increase in the genomic data collection for research and clinical purposes, timely use of these valuable genomic data in clinical practice should be prioritized. 29 , 30 For the secondary use of the point‐of‐care of genomic tests, it is necessary to evaluate and confirm the clinical validity of the tests for the specific uses other than the primary purpose. Additionally, it is necessary to devise an effective and safe approach to deliver genomic information at the right time and in the right manner. The most appropriate method so far is to design and use a clinical decision support system that integrates the personal genomic information of the patient at the time of drug prescription and provides an appropriate PGx warning. Considering the diversity of genetic tests, various drugs, and individual genetic variations, it is necessary to design an optimal system to ensure efficiency and safety in clinical practice. Based on Table 3, if the HLA genotyping test was used for screening, the positive predictive value of SCAR occurrence by the HLA‐B*58:01 allopurinol drug was 0.32%, and the negative predictive value was 97.73%. This suggests that the HLA test can be used to predict in advance whether a patient is likely to develop SCAR when using a risk drug with known HLA‐related SCAR occurrence.
4
0biomedical
0Study
359,070
The demand for high-quality, reproducible ecological data is increasing in conjunction with the degradation of ecosystems globally . There is a need to further streamline existing biomonitoring methodologies without sacrificing the quality of data produced [4, 7, 40, 62]. With diatom assemblages providing a unique insight into the water quality status of lentic and lotic systems, fast-tracking diatom data collection for ecological assessments is a priority . We have demonstrated that kick-net methodology with DNA metabarcoding provides sufficient taxonomic coverage to potentially be utilised to opportunistically assess diatom biodiversity in freshwater systems along with macroinvertebrates.
4
0biomedical
0Study
105,561
Various applications have been developed to measure vital signs by means of piezoelectric material45678. A piezoelectric based system has been developed to monitor respiration rate7, heart rate456, and seismocardiography8. This paper presents a novel technique for the reconstruction of the ECG corresponding signal from a measured piezoelectric output voltage signal. The motivation behind this work rests on the following fact; both piezoelectric sensor and ECG produce voltage output signals for the parameter they are measuring. Thus, for the purpose of this work, it was found convenient correlating the two signals using signal processing techniques such as convolution theorem9 and Fourier transform10.
4
0biomedical
0Study
374,036
The persistence of cardiorespiratory symptoms in survivors of severe COVID-19 can be partly explained by the pathophysiology of organ damage during the initial phase of the disease. The SARS-CoV-2 virus predominantly affects the respiratory system, although other organ systems can be compromised as well. The virus uses angiotensin-converting enzyme-2 (ACE2) receptors in pneumocytes of the epithelial alveolar lining to infect the host, thus causing lung injury (Varga et al., 2020). Diffuse alveolar damage was showed by several post-mortem studies (Carsana et al., 2020; Schaller et al., 2020), leading to hypotheses of residual pulmonary function impairment at long term. These hypotheses are supported by the available evidence on previous coronavirus outbreaks. A recent meta-analysis (Ahmed et al., 2020) of studies on SARS-CoV and MERS-CoV reported that approximately one third of hospitalized patients had persisting lung abnormalities after their acute illness. Prospective studies on SARS-CoV, MERS-CoV as well as short-term follow-up studies on the current SARS-CoV-2 epidemic are summarized in Table 1. These studies demonstrate mostly a mild pulmonary function impairment and the functional disability appears out of proportion to the degree of lung function impairment. For example, a 2005 study on SARS-CoV by Hui et al. (2005) found that the exercise capacity 6 months after disease onset was considerably lower than that of normal controls in the same age groups. However, significant impairment of surface area gas exchange was only found in 15% of the patients. Along with Hui’ study, Ong et al. (2004) performed cardiopulmonary exercises testing in 46 SARS-CoV patients at 3 months after hospital discharge. Half of the patients had abnormalities in the pulmonary function tests, but the impairment was mild in almost all cases. However, 41% of the patients had impairment of exercise capacity not due to ventilatory limitation. The discordance of the results of pulmonary function and exercise testing has been attributed to several factors, such as physical deconditioning, muscle weakness and poor motivation. The recent data in SARS-CoV-2 by Arnold et al. (2020) demonstrates that even 74% of survivors complained of persistent breathlessness and excessive fatigue at 3 months after hospital discharge. Yet abnormal pulmonary function was found in only 10% of the patients. Major limitations have to be taken into account when considering available evidence on long-term pulmonary function abnormalities. The majority of information is derived from single-center studies with a small sample of patients and a relatively short-term follow-up. However, most of the data support the idea that persistent cardiorespiratory symptoms in COVID-19 survivors cannot be accounted for by impairment of pulmonary function alone.
5
0biomedical
2Review
217,836
T98G glioma cell line was also silenced for LOXL3 with siRNA1, with efficacy confirmed by RNA expression and protein analysis 4 days after transfection (Figure 6A). Morphological changes occurred in LOXL3-silenced T98G cells (Figure 6B), which exhibited enlarged cell surfaces. However, the tubulin rearrangement was not prominent compared to the observed alteration in U87MG-LOXL3-silenced cells (Figure 6C). Interestingly, the TCGA RNA-seq dataset of different molecular subtypes of GBM showed a significant correlation in expression between LOXL3 and tubulin alpha (TUBA1C and TUBA4A) in the mesenchymal subtype, which was not detected in classical and proneural subtypes (Figure 6D,E).
4
0biomedical
0Study
215,559
As expected, serum WHV DNA levels remained unchanged during the study in double placebo treated woodchucks of the Control Group (Figure 2). In animals treated with AIC649 alone, WHV DNA levels initially increased by 0.31 log10 on average during the first two weeks of active treatment and then declined transiently by 0.53 log10 during the next two weeks, when compared to the Control Group. Additional declines in viremia in the AIC649 Group started at week 9 of active treatment and continued during maintenance treatment (maximum average reduction, 0.91 log10 at week 20). As further anticipated, rapid and marked declines in WHV DNA levels were noted in all woodchucks treated with ETV alone (maximum average reduction, 6.69 log10 at week 12). After drug withdrawal, all surviving animals in the ETV Group experienced recrudescence of viral replication and WHV DNA levels returned close to the pretreatment baseline. A more pronounced decline in viremia was noted for woodchucks that underwent combination treatment with AIC649 and ETV (maximum average reduction, 7.57 log10 at week 12). Following the completion of ETV treatment, WHV DNA levels in woodchucks of the AIC649/ETV Group stayed suppressed or undetectable during maintenance treatment, except for one animal with a viral relapse. Since the WHV DNA levels in the AIC649/ETV Group were significantly different to the ETV Group at weeks 12, 16, and 19, immunomodulation with AIC649 enhanced and extended the antiviral effect mediated by ETV on viremia in most animals.
4
0biomedical
0Study
160,401
Birch seeds were placed in a glass bottle loosely wrapped with gauze and rinsed with water for 3 days. After filtering out most of the water, the seeds were evenly spread on the soil (soil:vermiculite:perlite = 3:1:1). A thin layer of soil was applied to cover the seeds, after which they were watered and sealed using preservative film with some holes in it. The film was removed from the seeds after germination. Once the seedlings grew to 3–4 cm, the seedlings with uniform growth and in good conditions were selected. One birch seedling was planted in one pot. After about 2 months cultivation, the healthy birch seedlings about 25 cm height with similar growth conditions were treated using 20% PEG6000 for 0.5, 1, 3, 6, 12, and 24 h in a reversed time order. The control plants were treated with fresh water for 24 h. Each birch seedling was watered with 1 L of 20% PEG6000 or water. The developing roots, stems, and leaves of the birch seedlings under drought treatments were collected after 24 h. All samples were immediately frozen in liquid nitrogen and stored at −80 °C. Three biological replicates were conducted in each experiment.
4
0biomedical
0Study
95,450
Whether or not these aforementioned patient selection criteria constitute either ethical or social discrimination should also be considered. In Japan’s super-aging society, the justification for excluding patients for DT on the basis of their old age is questionable. Excluding patients over 65 years of age from the DT candidate pool is too arbitrary, and some would argue the wisdom in using age as a standard for health resource distribution. Controversy remains around the question of whether or not age-based selection is discrimination based on ageism or impartial distribution when deciding accessibility to treatment . Unlike very scarce donated organs, the LVAD used for DT can be produced according to demand, and thus, putting an age limit according to rarity may not be justified. In Japan’s super-aging society, limiting DT use by establishing an upper limit of 65 or 70 years of age would become increasingly more difficult. Exceptions for its use will increase steadily, and unless the ethical validity of patient selection criteria is justified, society would not accept an age-based exclusion criterion.
4
0biomedical
1Other
98,821
Multiple sequence alignments were performed with Clustal Omega2 and pairwise sequence alignments were obtained using EMBOSS Water3. Prediction of the presence of a signal peptide was conducted using Phobius and SignalP 4.1 (Käll et al., 2004; Petersen et al., 2011), whereas the presence of a NLS was predicted by NucPred (Brameier et al., 2007). Using SUBA3, protein subcellular localization was predicted (Hooper et al., 2014). BLASTn and tBLASTn searches against the expressed sequence tag (EST) database were performed using the NCBI website4. Using the eFP browser (Winter et al., 2007) and Genevestigator (Hruz et al., 2008), microarray expression data were analyzed to study the developmental expression as well as the gene expression under different stress conditions.
4
0biomedical
0Study
10,272
The genomic DNA was isolated by EDTA addition to the purified bacteriophage suspension, to the final concentration of 50 mM, triple extracted with phenol saturated with 20 mM phosphate buffer pH 7.0, and twice with chloroform. The DNA was precipitated with two volumes of ethyl alcohol, washed with 70% ethanol, dried and suspended in TE buffer (10 mM Tris-HCl, pH 8.0 at 25°C, 1 mM EDTA). Purified TP-84 bacteriophage DNA was subjected to Next Generation Sequencing using an Illumina HiSeq 2000 genomic sequencer in the PE250 mode. The genomic library was prepared containing short inserts of 100–600 bp. The reads were assembled and analysed using different programs: CutAdapt , CLC Genomic Workbench (https://www.qiagenbioinformatics.com/products/clc-genomics-workbench/) and PROKKA . A total of 140,683,713 nt sequences were obtained, 626,934 paired sequenced, resulting in a final assembled contig of 47,703 bp (GenBank KY565347.1) S1 File. The obtained sequence was further analysed using software: MyRAST , Kodon (http://www.applied-maths.com/kodon), BLASTP (https://blast.ncbi.nlm.nih.gov, ), HHpred and SnapGene (http://www.snapgene.com), as well as for visual corrections. Detection of genes encoding membrane-associated proteins was done using Phobius . The GC content distribution was calculated with GC Content Calculator (Biologics International Corp, Indianapolis, USA; http://www.biologicscorp.com/tools/GCContent/). Putative rho-independent terminators were searched for using ARNold .
4
0biomedical
0Study
24,895
Emerging data support that macrophages contribute to pathological neovascularization113132. To verify whether modulation of the angiogenic activity of macrophages contributes to the LMPs-mediated reduction of CNV, we first investigated the uptake of LMPs by macrophages in vivo (Fig. 6A,B). Fluorescent confocal microscopy revealed the presence of macrophages (IBA-1+ cells) in the CNV areas (Lectin-positive, in green), and LMPs co-localized with retinal macrophages after intravitreal injections of Dil-LMPs (in red) (Fig. 6B). Immunofluorescence staining also shown the expression of IL-10 and IL-12 in macrophages in the CNV areas, and LMPs induced expression of IL-12 in macrophages (Fig. 6C). To have a better understanding of the expression pattern of angiogenesis-related factors involved in this process, laser capture microdissection was performed to collect tissues in the CNV regions, the key factors were analyzed by quantitative PCR. Consistent with in vitro studies, LMPs significantly induced expression of IL-12 and TSP-1 but decreased the expression of VEGFa and IL-10 (Fig. 6D).
4
0biomedical
0Study
116,065
Because applied field gradients also cause signal decay, one needs to be cautious during the design of pulse sequences to minimize any encoding gradients before td because they will interfere with internal field encoding. Read and phase gradients can occur after td, and they induce, at most, td-independent diffusion-weighting. However, an unfocused slice gradient during the second π2-pulse or a crusher gradient before the second π2-pulse can induce td-dependent diffusion-weighting and interfere with the internal gradient during td. For example, the effective decay rate of the slice-selective gradient of the second π2-pulse (see Figure 2) can be estimated according to the equation, 1Teff=γ2(Gs2)2τp2D, where, τp, Gs and D correspond to the pulse length, slice-gradient strength, and diffusivity, respectively. γ is the gyromagnetic ratio. When τp = 2 ms and Gs = 4 G/cm, this estimation produces an additional decay rate of 0.3 (1/s). The total background decay rate of the DDIF imaging sequence in Figure 2 can be estimated as 1Teff+1T1=0.7 (1/s), assuming the T1 relaxation of free (unrestricted) water molecules. This correction is one example of the need to separate internal and external field effects when interpreting DDIF data. Future examples in this review will carry this idea further and illustrate the constructive and destructive interference patterns of the internal and external gradients.
4
0biomedical
2Review
322,393
Growers regularly observe pest in their farms once a week. If T. palmi are detected on sticky trap, growers will survey T. palmi in farm by random sampling. A hundred M. charantia shoots will be sampled and the number of thrips will be counted. If the average number of thrips is ≥ 5 thrips/shoot, an insecticide must be applied in accordance with DOA recommendation.
1
2other
1Other
393,042
The authors also note that when the molten substance was cooled in the channel of a fading micro-arc discharge, new compounds were formed in addition to the amorphous phase. Polymorphic transition β-TCP → α-TCP and the secondary HA formation occurred in both types of the coatings. Magnesium phosphate was also formed as a result of the interaction of a magnesium substrate with electrolyte components. Darband et al. also confirm this phenomenon. According to the elemental composition, a large amount of Mg was found in the coatings in addition to Ca and Sr. We supposed that magnesium was involved not only in the magnesium phosphate and in the amorphous phase, but also replaced Ca in the structure of calcium phosphates together with strontium. The ratio (Ca + Sr + Mg)/P was equal 1.64 and 1.47 for Sr-HA and Sr-TCP coatings, respectively. Thus, it can be assumed that the composition of Sr-HA and Sr-TCP coatings was predominantly presented by (Sr,Mg)-substituted hydroxyapatite and (Sr,Mg)-substituted tricalcium phosphate. The behavior of the coatings during the bioresorption in a model biological fluid confirmed this assumption. The solubility of Sr-HA was lower than that of Sr-TCP because hydroxyapatite is known to be more resistant to dissolution than tricalcium phosphate . The studies of the coatings electrochemical properties also showed that corrosion resistance of Sr-HA coatings deposited at 500 V was higher than that of the Sr-TCP coatings.
5
0biomedical
0Study
26,083
Based on the published experience that employing basic neural medium in combination with growth factors (promoting growth of neural precursors and stem cells) was sufficient for reprogramming of murine fibroblasts (Kim et al., 2016), we avoided small molecules promoting neural induction (Lu et al., 2013). The rationale behind this approach was to interfere as little as possible with the ongoing reprogramming process, as many small molecules employed during neural reprogramming also serve as morphogens and could change regional identity (e.g., purmorphamine and CHIR99021; Kriks et al., 2011). The composition of the neural medium followed a protocol for reprogramming of murine fibroblasts (Kim et al., 2014), which includes the well-established growth factors FGF-2 and EGF (Hitoshi et al., 2004; Deleyrolle and Reynolds, 2009), but also the less commonly used factor FGF-4. Nonetheless, evidence exists for it promoting the proliferation of neural stem cells (Kosaka et al., 2006). We were able to show that transfected adult fibroblasts changed their morphology as early as 7 days after transfection, reaching an appropriate size for mechanical isolation after roughly 30 days. The efficiency of the method lies between 0.02 and 0.04%, i.e., the range reported in the original publication which used the plasmid constructs for reprogramming to iPSC (Okita et al., 2011). Another protocol overexpressing PAX6 and SOX2 by plasmid transfection in fibroblasts for reprogramming to neural precursor-like cells reported an efficiency of 0.05% (Maucksch et al., 2012). Protocols using retroviral particles achieved higher rates of reprogramming (0.5–1%; Ring et al., 2012). We would attribute this to the in general lower transfection efficiency of plasmid-based transfection protocols compared to retroviral infection. (For an overview of published integration-free conversion protocols to NSC see Supplementary Table 7).
4
0biomedical
0Study
334,771
An influenza pandemic can be catastrophic, and in a typical year of seasonal outbreaks, influenza A viruses cause as many as 5 million cases of severe illness in humans and over 500,000 deaths. After the first confirmed cases of H1N1 influenza appeared in Mexico in February 2009, cases began to spread to the United States, and by the end of April 2009, cases had been reported in several United States cities and other countries on various continents, such as Canada, the United Kingdom, and New Zealand (108). During the last pandemic, the first activation of the International Health Regulations (IHR) provisions was prompted. The discussions that led to the IHR implementation were based on the SARS outbreak experience in 2003. These regulations describe the responsibilities of individual countries and the leadership role of the WHO in declaring and managing a public health emergency of international concern, establishing systematic approaches to surveillance, promoting technical cooperation, and sharing logistic support (108). However, because of the significant diversity of influenza viruses in animal hosts, extensive experimental testing and the development of pandemic preparedness measures against all viruses is unachievable (109).
4
0biomedical
2Review
389,116
Vascular risk factors collected included TC (mg/dL), LDL-C (mg/dL), HDL-C (mg/dL), TG (mg/dL), FG (mg/dL), systolic BP (SBP, mmHg), diastolic BP (DBP, mmHg), and body mass index (BMI, units). We assessed levels of these variables measured during the national health examination in 2009 or 2010. When health examinations were performed in both 2009 and 2010, the levels from 2010 were used. For the main analyses, continuous variables were categorized according to the current Korean guidelines for vascular risk factors and the categorized variables were analyzed as the main variables. The reference levels were < 200 mg/dL for TC, < 100 mg/dL for LDL-C, ≥ 60 mg/dL for HDL-C, < 150 mg/dL for TG, < 70 mg/dL for FG, < 120 mmHg for SBP, < 80 mmHg for DBP, and < 18.5 for BMI. Cutoff values for each category of the vascular risk factors are presented in Additional file 1: Table S1. We also constructed the pulse pressure (PP) variable by subtracting DBP from SBP. PP is considered a surrogate marker for arterial stiffness and known to be an independent predictor for cardiovascular diseases. The PP variable was categorized by its quartile cutoff due to the absence of the referent level for PP, and the first quartile (Q1) was used as a referent level. The quartile cutoffs were 42 mmHg for Q1–Q2, 50 mmHg for Q2–Q3, and 60 mmHg for Q3–Q4.
4
0biomedical
0Study
211,042
Vectors are imperative in spreading viruses from infected plants to healthy plants through various transmission strategies, including transovarial mode . More than 320 species of BGVs are known to be transmitted by B. tabaci (Hemiptera: Aleyrodidae), a cryptic species complex that includes more than 44 morphologically indistinguishable species . Accordingly, the potential permutations of interactions in nature could be over 320 species of BGVs × more than 44 putative cryptic B. tabaci species × 1000 s of crop species and varieties . Consequently, BGVs are considered fast-evolving DNA viruses due to the global expansion in the population, dispersal of their whitefly vector, and the worldwide movement of plant materials, usually driven by human movements . Previous studies have shown the differences in virus transmission efficiency in the races of B. tabaci isolated from OW and NW geographical regions . B. tabaci is a complex of at least 39 morphologically indistinguishable biotypes that are challenging or unmanageable to discriminate based on their morphology. For example, B. tabaci B or Middle East-Asia Minor 1 (MEAM1), which originated in Middle East-Minor Asia, and B. tabaci Q or MED, which originated in the Mediterranean region, are the two utmost invasive and destructive whiteflies . B. tabaci B and Q (basically B and Q) vary in feeding behavior, virus transmission efficiency, host range, endosymbionts, and insecticide resistance. However, both B and Q enormously damage plants by feeding on phloem tissue and transmitting BGVs . In the past 30 years, both biotypes have dominated many countries worldwide and banished some native cryptic biotypes. A recent study revealed that MED populations had a higher level of genetic variation with multiple invasions than MEAM1. Molecular genetic methods, such as mitochondrial cytochrome oxidase I (mtCOI) and nuclear (microsatellite) DNA , have been used to investigate the ecological and evolutionary aspects of biological invasions and their concurrent impacts on the genetic structure and variation of an invasive species .
4
0biomedical
0Study
377,450
The AD drug candidate J147 was identified using a phenotypic screening platform designed to select drug candidates that protect against toxicities associated with brain aging, some of which involve dysregulated Ca2+ homeostasis6. We have previously demonstrated J147’s therapeutic efficacy in mouse models of AD7–9 and accelerated aging10–12. The molecular target of J147 is the α-F1 mitochondrial ATP synthase (ATP5A)11, a central player in Ca2+ metabolism that can drive Ca2+ flux via changes in the ATP-generated H+ gradient or opening of the mitochondrial permeability transition pore (mPTP).
4
0biomedical
0Study
258,329
Two studies found a statistically significant increase in alpha diversity of acne patients’ microbiota following treatment in both the Shannon and Inverse Simpson indices. 8,10 Park et al. reported a significant increase in alpha diversity in the after-treatment group, compared to before treatment, following 6 weeks of oral doxycycline (Shannon index, 1.27-fold increase, P = .03, 95% CI 0.1-1.4; Inverse Simpson, 1.11-fold increase, P = .03, 95% CI 0.005-0.014). 10 Kelhala et al. found significant increases in alpha diversity after treatment in back (P ≤ .05) and cheek samples (P ≤ .01) following 6 weeks of treatment with either lymecycline or isotretinoin, although the specific treatment was not specified in the study for this analysis. However, the study also found a significant decrease in diversity in armpit samples after treatment (P ≤ .01). 8 Another study by Thompson et al. reported increased alpha diversity in comparison to baseline levels (P = .153) and acne-free controls (P = .264) using the Shannon index, although the changes were not statistically significant. 11 In contrast, Chien et al. reported a decrease in diversity following antibiotic treatment and while the overall change was not significant, analyses of individual patients revealed statistically significant decreases in alpha diversity for 2 of its 4 participants. 4
4
0biomedical
0Study
320,503
For example, by detecting the rapid changes of LED radiation reflected from surfaces, Rajagopal et al. achieved indoor localization and an error-free communication purpose simultaneously at a data rate of 1.25 bytes s−1 and a lighting level above 600 lux . In , an improved rolling shutter pattern demodulation algorithm was proposed based on reflected light from the wall. The system achieved an NLOS link distance of 1.5 m at a low illumination level of 145 lux in a dark environment. A novel 2 × N indoor NLOS OCC system was proposed and experimentally verified by Hassan et al. with a specially designed packet structure and a detection methodology to support a 30 fps data transmission rate at 5 m. The impacts of ISO levels and exposure time on the transmitted power were investigated as well. Similarly, the NLOS space–time division multiplexing OCC system proposed by Hassan et al. performed well over a transmission distance of 10 m with a 12 mW transmitting power, and its tolerance to the ambient radiation was improved by mask matching and equal gain combining techniques .
4
2other
0Study
13,573
The features of the proposed NPC algorithm are summarized in the following:When the symbol Xq is repeated frequently, it is compressed via Huffman coding and the compressed data is restricted to fewer than 8 bits. ECG signals in the QRS region can be compressed with almost no loss using the proposed NPC algorithm.The Huffman LUT can be implemented using low-cost hardware because we map only the portion of the data that appears frequently. This reduces the size of the LUT by 82%.
2
0biomedical
0Study
377,304
Work within ELIXIR has driven the establishment of a network of ELIXIR Beacons via strategic partnering with national data owners to enable data flow to the Beacon service. Development of the Beacon infrastructure has involved strong interactions with the ELIXIR Training, Compute and Interoperability Platforms, reflecting recognition that Beacons represent a simple and useful mechanism for data discovery. Our work further aims to increase the integration of the Beacon API with human data resources throughout ELIXIR and extend its application to other data resources, and currently, there are 42 international organisations using this API to serve > 1,000,000 anonymised human samples across 200 datasets.
2
0biomedical
1Other
233,678
A proactive management approach regarding the Asian coastal horseshoe crab (T. gigas) in Indonesia should consider population genetics. High haplotype diversity that occurs with low nucleotide diversity has been associated with population growth or expansion after a period of low effective population growth (Grant & Bowen, 1998). Our findings indicate that T. gigas in Indonesia have low genetic differentiation but high population connectivity and expansion. Therefore, our results suggest that there is a single stock of Indonesia coastal horseshoe crab. The best conservation strategy would be one that combines both local and regional management. To expand our knowledge base, an advanced population genetic analysis based on male and female horseshoe crabs and the nuclear genome (e.g., microsatellites or SNPs) should be conducted. This should also include expanding the scope of geographic sampling around Indonesia.
4
0biomedical
0Study
240,103
The RPL-UC model includes restrictions on the variance-covariance matrix of the random parameters that should be tested to justify the use of this model. These restrictions have been rejected in our case, and the application of the RPL-UC model is, therefore, inadequate. When we compared the output of this model with the other two more complex models, due to the limitation in sample size of our application, we found no differences in the distributions of the WTP values. Other applications may find differences between the models with similar sample size as ours. Therefore, this does not mean that the RPL-UC will always lead to the same outcome as the outcome from the RPL-C.
2
2other
0Study
318,706
All methods were carried out in accordance with relevant guidelines and recommendations. The microbial analysis was performed in a CPA accredited clinical laboratory, in accordance with recommendations and standard practices from the Institute of Biomedical Sciences and the Royal College of Pathologists.
2
0biomedical
1Other
46,445
Exergy inputs are used for different purposes, which we, according to Ayres and colleagues (2003), described along five types of useful work: electricity, prime movers, heat (HT, MT, and LT), light, and muscle work. Figure 2 shows the final exergy consumption by useful work type. The dominant trends over the century include the halving of muscle work, which accounted for 33% (143 PJ) of total consumption in 1900 and 17% (261 PJ) in 2012, and the dramatic increase in the use of electricity (10% [45 PJ] in 1900 to 27% [400 PJ] in 2012). The fraction of exergy consumed for heating has not changed a lot (38% [162 PJ] in 1900 and 31% [468 PJ] in 2012); however, this figure does not include the electricity subsequently used for heating, which we estimate as being roughly 30% of all electricity use.
1
2other
0Study
281,484
The number of total procedures as well as population-adjusted procedure rates per year increased during 2008–2017 for appendectomies, cholecystectomies, right hemicolectomies, and rectal resections (p < 0.01), while those for left hemicolectomies and gastrectomies remained stable (Fig. 2A). We found different proportions of MIS procedures over the whole 20-year period, ranging from 7.8% for gastrectomies, 19.4% to 26.7% for colorectal resections, 68.5% for appendectomies and 88.1% for cholecystectomies. The rates of MIS increased across all procedures during the study period (p < 0.001), with incremental amounts of robotic procedures observed for all 4 oncological operations. Cholecystectomy was already routinely (> 75%) performed laparoscopically in 1998. While half of all appendectomies were performed laparoscopically by 2005, minimally invasive oncological colorectal resections reached 50% by 2016 and stayed below 20% for gastrectomies in 2017 (Fig. 2B). Next, Elixhauser scores were calculated to assess comorbidities of patients undergoing OS and MIS and compared over groups of 5-year intervals. The degrees of comorbidities increased across all procedures studied, with OS being preferably used in patients with higher Elixhauser scores in all 6 procedures. For cholecystectomies, rates of OS were significantly higher during the entire 20 years in patients with increased comorbidities (Fig. 2C).Fig. 2Number of operations, implementation of minimally invasive procedures and comorbidities. A Total (brown) and population adjusted (blue) numbers of procedures performed per year from 1998 to 2017. B Representation of percent changes of open (red), laparoscopic (turquois) and robotic (green) surgeries over the 20-year period. C Comorbidities as assessed with Elixhauser score for open (dark red) and minimally invasive (blue) surgeries per procedure in 5-year strata. Single points depict yearly means, diamond & error bars show mean and SD of 5 years. *p < 0.05, **p < 0.01, ***p ≤ 0.001
4
0biomedical
0Study
376,292
Turland clarified that in a situation such as May described, the rule pertaining to registration of later typifications of names of fungi would be in Chapter F. An existing rule that formerly applied to algae, fungi, and plants would, of course, remain in the main body of the Code, but would no longer apply to fungi.
2
0biomedical
1Other
99,015
The microsatellite-based phylogeny containing more isolates illustrates some additional epizoological features with relevance to pathogen invasion and establishment. What is most striking about these data is the large amount of genetic diversity revealed among the North American isolates. Earlier studies indicated that 73 isolates of P. destructans from New York, Vermont, Pennsylvania, Ohio, West Virginia, North Carolina, Ontario, New Brunswick, Nova Scotia, and Prince Edward Island were genetically identical via MLST (20, 21, 31). Genotyping of these samples plus 78 others from eastern Canada and the United States resulted in a single genotype in 109 samples, plus two singleton genotypes from New Brunswick and one from Ontario. In contrast, microsatellite loci from our study defined 31 different genotypes among the isolates from North America. Another hallmark of these data is the lack of geographic or temporal correspondence between clades evident in the tree. For example, the Fig. 3 phylogeny shows that isolates collected from New York in 2008, at the beginning of the WNS outbreak, are distributed throughout the tree. Some isolates from the same sampling location and date (e.g., the Williams Hotel Mine) occur in different clades, indicating relatively high genetic diversity from this one region compared to other regions in North America. Unfortunately, these data do not indicate whether this diversity was present in the founding population or arose soon after introduction, a common problem with population genetic analyses of pathogens (38). New Brunswick and Nova Scotia isolates also occur in many clades associated with isolates from throughout the epizootic zone. A possible exception to the lack of geographic structuring we observed are several basal clades containing only northeastern Canadian isolates or isolates from New England and New York early in the outbreak. This region is relatively isolated and may represent an area that received P. destructans isolates geographically spreading from New England early in the outbreak and has had time since then to diversify genetically. Intense sampling in this region may also be contributing sampling bias to this observation, however.
5
0biomedical
0Study
205,991
Further research using realist evaluation methods to explore how integrated care systems have influenced how care is planned and delivered within complex health care settings such as alcohol and substance misuse would be useful. Once more evidence is available and has been critically analysed, clear ‘best practice’ guidance needs to be developed to encourage stakeholder involvement to become standardised within specialist public health services such as alcohol treatment services.
3
0biomedical
1Other
297,012
There are about 3,000 images Table 1 for each of three different cell types: Eosinophil, Lymphocyte, and Monocyte, respectively. The information of the data set is given in Supplementary Figure S1A. For training our models in this study, we encode the labels as: T , T , and T , which represents Eosinophil, Lymphocyte, and Monocyte, respectively.
3
0biomedical
0Study
65,394
P. aeruginosa was pelleted at 5000 g centrifugation for 20 min, then separated into periplasmic, cytoplasmic, inner membrane and out membrane fractions as described previously (Thein et al., 2010). The fractions were dialyzed against 10 mM NaCl overnight, and pre-cleared with Protein A/G resins for 1 h at 4°C with gentle rotation. Rabbit serum containing anti-KAMP-19 antibody (custom made by New England Peptide) (Tam et al., 2012) was covalently coupled to Protein A/G resin (Santa Cruz Biotechnology) with the cross-linker BS3 (Thermo Scientific) according to the manufacturer's instructions. Pre-cleared bacterial fraction (0.15–1 mg protein) was mixed with or without 80 μg of KAMP-19 and incubated for 1 h at 4°C with gentle rotation. All the samples were immunoprecipitated with 35 μl of anti-KAMP-19-coupled resins in a total volume of 400 μl for 2 h at 4°C with gentle rotation. Resins were washed 5 times with 10 mM NaCl, and eluted by heating for 5 min with 40 μl of SDS loading buffer (Biorad) containing no reducing agent. The eluates were supplemented with 62.5 mM of DTT (Amresco) and heated again for 5 min prior to 10% Tris-glycine SDS-PAGE. The gel was treated with silver staining (Thermo Scientific).
4
0biomedical
0Study
69,291
Induction of plant defence against pathogens can be mediated by elicitors, namely compounds able to trigger structural, biochemical, and/or molecular responses associated with the expression of plant disease resistance in host plants. Biotic elicitors belong to various biochemical classes corresponding to either evolutionarily conserved microbial signatures secreted by both non-pathogenic and pathogenic microorganisms, termed microbe/pathogen-associated molecular patterns (M/PAMPs), or plant endogenous molecules deriving from cell wall breakdown products or corresponding to released soluble peptides, referred to as damage-associated molecular patterns (DAMPs) (Bartels and Boller, 2015). Elicitors are perceived by plant recognition systems and activate signal transduction cascades (Boller and Felix, 2009), including initial events localized at the plant plasma membrane (PM) (for recent examples, see Matsui et al., 2014; Maruta et al., 2015).
5
0biomedical
0Study
18,401
(A) Graph of percent larval survival post-infection at 24 h and 48 h in replicate experiment 2. Ten larvae were in each infection group and in the control (PBS only) group. (B) Matrix of pairwise comparisons of survival curves between infection regimes obtained in Experiment 2 by the log-rank (Mantel-Cox) test.
2
0biomedical
0Study
351,252
A systematic review summarising 13 articles on the use of dating apps and associated risky sexual behaviours among the lesbian, gay, bisexual and transgender populations, which found that dating app users tended to engage in more high-risk sexual behaviours than nonusers, including having sex with multiple partners and engaging in condomless anal sex . This review affirms the need to promote safe sex and positive sexual health messages to dating app users. A study was conducted among university students in Hong Kong found that dating apps users were more likely than nonusers to have multiple sexual partners and condomless sex with more sexual partners, use condoms inconsistently, engage in casual sex, and sexual abuse [27–29]. Another study on MSM dating app users in Hong Kong found that about 30% of participants had had more than three sexual partners, 25% had engaged in condomless anal sex with casual partners, 20% had had condomless anal sex with internal ejaculation, 15% had used alcohol in conjunction with sex in the past 6 months, 13% had had group sex, 8% had had chemsex . These alarming findings indicate the urgent need for interventions to encourage better and safe sexual health in Hong Kong dating app users.
4
0biomedical
2Review
206,222
Colorectal cancer remains one of the most commonly diagnosed cancers worldwide, and a leading cause of cancer related deaths, posing an international burden which is anticipated to worsen according to future predictions20. With this knowledge, studies into alternative methods of identifying susceptibility, early diagnosis and treatment is imperative to those affected by CRC. Exploring new avenues through widening our knowledge on the roles played by non-coding RNAs, including miRNA and lncRNA in CRC etiology and progression provides great prospects in improving survival rates of CRC patients. We performed RNA-Seq and computation analyses to characterize the altered mRNA, miRNA and lncRNA expression in CRC compared to NT, as well as identifying the affected signaling networks and predicting the interaction between differentially expressed miRNAs and mRNAs, and miRNAs and lncRNAs in CRC.
4
0biomedical
0Study
313,067
Apoptosis was additionally evaluated using The DeadEnd™ Fluorometric TUNEL System (Promega, Walldorf, Germany), according to the manufacturer’s instructions. Cells were cultured on slides at a total number of 250,000. After 24 h, they were fixed in 4% methanol-free formaldehyde and permeabilized with Triton® X-100. DNA strand breaks were labeled with fluorescein-12-dUTP for 1 h and nuclei were counterstained with DAPI. Slides were observed under an AxioPlan2 microscope (Carl Zeiss, Jena, Germany).
4
0biomedical
0Study
36,799
The results for ripples as marker for the resection area were not better than those for spikes, and spikes were a good marker. Ripples should not replace spikes as a biomarker, but they can be an addition to the spike information, to strengthen the result of the MEG. Of course the added value of ripples would be larger if we can also find them in patients without spikes in MEG.
2
0biomedical
0Study
265,040
Finally, the TICO trial tested shortened DAPT in patients with ACS, including STEMI (36% of the population). This trial, which was conducted at 38 centers in South Korea, included 3,056 patients who underwent PCI with an Orsiro sirolimus-eluting stent, comparing acetylsalicylic acid + ticagrelor for 3 months followed by ticagrelor monotherapy with 12 months of acetylsalicylic acid + ticagrelor. A 34% reduction in the primary endpoint (major bleeding and cardiovascular events) was observed in the 3-month group (3.9% vs. 5.9%; HR, 0.66; CI 0.48-0.92; p = 0.01). The difference was due to the lower incidence of bleeding complications, with no significant difference in the incidence of cardiovascular events.41
4
0biomedical
0Study
201,903
We now know that PIs are involved in specific aspects of sensory function. For example, elevation of phosphatidylinositol (3,4,5)-trisphosphate (PIP3) within olfactory cilia can inhibit the CNGCs (Brady et al., 2006; Spehr et al., 2002), whereas odorant stimulation may induce dynamic redistribution of phosphatidylinositol (4,5)-bisphosphate (PIP2) in the dendritic knob of OSNs (Ukhanov et al., 2016). Recently, PIs were discovered to play a role in ciliogenesis and regulation of ciliary function (Garcia-Gonzalo et al., 2015; Phua et al., 2017). The interplay between the two PIs, PIP2 and phosphatidylinositol 4-phosphate (PI4P), is crucial to the organization of the cilia TZ, and controls protein trafficking and signaling within the PC (Garcia-Gonzalo et al., 2015; Garcia et al., 2018; Phua et al., 2017; Xu et al., 2016). The localization and relative abundance of these two PIs, were found to be in dynamic reciprocity to each other and under the tight control of INPP5E, a phosphoinositide 5′-phosphatase that hydrolyzes PIP2 and PIP3 (Bielas et al., 2009; Hasegawa et al., 2016; Kisseleva et al., 2000). Each of the PIs, hydrolyzed by INPP5E, represents a small fraction of all membrane-associated lipids, but plays an indispensable role in regulating many aspects of cellular physiology including cell division, vesicle trafficking and control of transmembrane ionic transport (Balla, 2013; Di Paolo and De Camilli, 2006; Hilgemann et al., 2018; Logothetis et al., 2015). Importantly, mutations in the Inpp5e gene cause its loss-of-function due to mislocalization or impairment in catalytic activity and manifest in a ciliopathy termed Joubert syndrome (JBTS).
5
0biomedical
0Study
395,215
Even though the majority of the vendors had adequate knowledge regarding the eight (8) COVID19, there was a deviation in knowledge among them on the following COVID-19 facts: Symptoms; elderly people, people with underlying chronic illnesses and the obese are more likely to develop severe cases of the infection; SARS CoV-2spreads via respiratory droplets of infected individuals; isolation and treatment of people who are infected with the SARS CoV-2are effective ways to reduce the spread of the virus, and could be attributed to the fact that the illness is a new one (36, 37). This fact is a pointer that the government should not relax its efforts on publicity on COVID 19, and strengthen the public's alertness to COVID-19, inform the public on the importance of protecting themselves with enough precautionary measures (38).
2
0biomedical
1Other
190,314
We adjusted for the following comorbidities and co-medications (recorded at any time in the patient record before the index date) in the final model based on previous clinical knowledge: BMI (categorical variable), smoking status (current, past, non-smokers, and unknown), CVD (including congestive heart failure, ischemic heart disease, myocardial infarction, hypertension, and stroke), osteoarthritis, use of insulin, bisphosphonates, systemic corticosteroids, low-dose acetylsalicylic acid, and current (last prescription within 30 before the index date) or past (last prescription > 30 days prior to index date) use of metformin or sulfonylureas. We additionally tested for effect modification by obesity status (non-obese versus obese, defined as BMI levels < 30 and ≥ 30) of the association between level of HbA1c and risk of VTE.
4
0biomedical
0Study
129,646
Bai et al. found that stem cells played a therapeutic role mainly through a paracrine secretion–related immune regulation, rather than self-regeneration (Bai et al., 2012). Th1 lymphocytes, which are known as CD4+IFN-γ+ T cells and characterized by the secretion of IFN-γ, have been proven to be closely linked to the pathogenesis of EAE (Cummings et al., 2018). Li et al. found that MSCs could promote the recovery of neural function in EAE mice by increasing the proportion and function of CD5+IL-10 + B cells (Li et al., 2019). Other studies have shown that Th17 lymphocytes were also one of the main inflammatory cells involved in the pathogenesis of MS and EAE mice (Waisman et al., 2015; Liu et al., 2019), and the secretion of IL-17 could promote astrocytes to produce IL-6 and aggravate the inflammatory infiltration of EAE mice (Shan et al., 2017). Some researchers have proposed that MSCs might inhibit the proliferation of peripheral pathogenic T lymphocytes or Th1 lymphocytes (Gerdoni et al., 2007; Bai et al., 2009). These results suggest that inflammatory factors such as IFN-γ, TNF-α, IL-6, and IL-10 may participate in the recovery progress of the neural function in EAE mice mediated by MSCs. In our study, serum levels of IFN-γ, TNF-α, IL-17, IL-6, and IL-10 in OMSC preventive treatment, UMSC preventive treatment group, and control groups were analyzed. However, the serum level of IL-17 in all groups could not be detected accurately using CBA due to its low concentration. It was found that the serum IFN-γ level of EAE mice was affected by OMSC or UMSC preventive treatment. The levels of serum IFN-γ in the OMSC and UMSC preventive treatment groups were lower than those in the control group. There were no significant differences in the serum levels of TNF-α, IL-6, and IL-10 among these three groups, but the serum TNF-α level of OMSC and UMSC showed a certain downward trend (p TNF-α = 0.089). Combined with previous studies and our results, OMSC preventive therapy may improve the neurological function of EAE mice by suppressing CD4+IFN-γ+ T cells and its IFN-γ secretion.
4
0biomedical
0Study
334,994
The secondary structure of ITS2 for the Pseudo-nitzschia strains obtained in the present study (Ps272 and Ps275 from Manzanillo Bay, and Ps290 and Ps291 from Todos Santos Bay) was predicted using ITS2 Database III [72–76]. Secondary ITS2 transcript structures were illustrated by using VARNA . The ITS2 of all the sequences of each P. subpacifica strain (our four, and strains Nezen and RdA8) were compared using the 4SALE program to identify compensatory base changes (CBCs) and hemi-compensatory base changes (HCBCs). The helices were named according to Mai and Coleman and Amato .
4
0biomedical
0Study
113,100
Urine creatinine levels were analyzed using an enzymatic assay according to the manufacturer’s instructions (Cayman Chemical, Ann Arbor, MI, USA; Cayman Chemical Company, 2012). All phthalate metabolite concentrations were adjusted for urine creatinine levels and expressed as micrograms per gram of creatinine.
4
0biomedical
0Study
10,771
Power calculation revealed that a minimum of 30 subjects should be included in each intervention group. The calculation was based on vitamin D tablets and an estimated change of 10% from pre- to post-intervention. Strength was set to 80%. It was also taken into account a measurement uncertainty of 10% on high-performance liquid chromatography (HPLC) used to analyse vitamin D metabolites, and an assumed dropout rate of approximately 20%.
4
0biomedical
0Study
366,859
Originally, AXL was identified as a downstream target of EMT in breast cancer, whereby vimentin was shown to upregulate Slug and ultimately AXL . Similarly, induction of EMT in the nontumorigenic epithelial MCF10a cell line through overexpression of the EMT transcription factors Snail, Slug, Twist, or Zeb2 resulted in elevated levels of AXL expression . AXL is expressed at higher levels in mesenchymal mammary cell lines compared to parental epithelial lines, and if the mesenchymal cells are induced to become more epithelial like through a mesenchymal to epithelial transition, then these cells have less AXL expression . Induction of EMT in MCF10a cells was also observed to promote autocrine GAS6 signaling . These studies indicate that AXL is downstream of EMT.
4
0biomedical
0Study
326,770
We measured the distances between desert bighorn sheep and the trail cameras imaging them, by printing out all of the sheep images, visiting the site, and positioning a human in the exact location that the sheep was imaged. We then used a range finder or metric tape to measure the distances. We supplemented these measurements by recording distances between the camera and several recognizable objects in the images (e.g. rocks, plants), to ensure accurate distance delineations for the sheep.
1
2other
0Study
140,633
P05: During the sessions they tell me that if you “think too much”, the soldiers in your body [CD4] decrease in numbers, that’s when you start getting sick. They tell us that we should not “think too much” and just accept it [being HIV-positive] because that’s what we are now and we are not alone in this. So that helped me a lot
1
0biomedical
1Other
249,054
Analysis procedures aligned with the study aim of conducting a qualitative participatory examination of experiences of health and integration for this specific population of women in their context over time. They commenced with a participatory approach in that participants, as opposed to the researchers, chose which photos they wished to share and discuss with the group. Data were transcribed verbatim and first analyzed independently by the authors, limiting the focus to the photos and accompanying texts chosen by participants. Data were organized with stories from transcripts matched with the photo that sparked the discussion, so both visual and textual data were included in the analysis.
3
0biomedical
0Study
83,295
At 8 weeks post-operation, the treatment group showed significantly increased stiffness in rotations than the control group (both the left and right; p < 0.01, Table 3a). But the biomechanical analysis in terms of displacement, lateroflexion in both directions and rotation showed less displacement in the treatment group compared to control (all p < 0.01, Table 3b).Table 3Biomechanical analysis in terms of stiffness—comparison between control and treatment group at different time intervalsMechanical analysis: stiffness8 weeks16 weeksControl group (n = 8)Treatment group (n = 8)Control group (n = 8)Treatment group (n = 8)Anteflexion (N/mm)206.16 ± 19.01205.61 ± 20.38293.30 ± 9.24307.66 ± 14.84# Dorsiflexion (N/mm)202.04 ± 21.76202.96 ± 20.98275.93 ± 11.50278.91 ± 18.60Left lateroflexion (N/mm)178.95 ± 16.19194.96 ± 19.72287.24 ± 12.50302.45 ± 15.12# Right lateroflexion(N/mm)179.74 ± 17.32193.53 ± 16.00273.48 ± 16.60295.01 ± 16.13# Left rotation (N/deg)2.10 ± 0.262.59 ± 0.26*3.67 ± 0.124.17 ± 0.19*Right rotation (N/deg)2.24 ± 0.122.61 ± 0.16*4.07 ± 0.224.59 ± 0.19* # p < 0.05, *p < 0.01
4
0biomedical
0Study
363,780
, and studied the dynamic behaviors of the fractional-order PWM converters, but their results are obtained via the MATLAB/Simulink simulations using the approximation of the fractional-order components. Furthermore, none of the above-mentioned literatures have investigated the non-linear behaviors via numerical analysis in time-domain. Ref. presented extensive experimental results, which exposes the operating mechanism of the limit cycle behavior in the integer-order boost converters. Nevertheless, its conclusions do not apply to the Grünwald-Letnikov (a.k.a. Riemann-Liouville and Caputo) definition-based systems. These fractional-order systems do not have periodic solutions [27–30], but only have the asymptotically limit cycle behaviors. Considering their impact on the device stress and the system efficiency during the switching periods, such asymptotically limit cycle behaviors require special attention in practical applications.
1
2other
0Study
361,898
Behavioral flexibility is a cognitive function which refers to the ability to dynamically adjust behavior to a changing environment1. A lack of behavioral flexibility results in rigid behaviors, echoing pathological conditions observed in OCD patients who are resistant to change. Thus, behavioral flexibility impairments have been proposed has one of the causes of compulsive behaviors2. However, there is no consensus whether such a deficit exists in OCD as inconsistencies were found between studies using reversal learning3,4, task switching5,6, or intra/extra-dimensional set shifting7,8 paradigms. Beyond methodological considerations such as small sample sizes9,10, the clinical heterogeneity of OCD patients may have contributed to these discrepant results11–15. In contrast, dysfunctional activations of OCD patients’ prefrontal regions, in particular the orbitofrontal cortex (OFC), during performance of flexibility tasks has been more consistently reported16,17. Similar neurobiological observations have been recently made in the Sapap3 knock-out mutant mice (Sapap3 KO), the current predominant genetic model of compulsive-like behavior18. These genetically engineered mice lack the SAP90/PSD95-associated protein 3, a postsynaptic scaffolding protein mainly expressed in the striatum19. This mutation results in the expression of excessive grooming behaviors, which can be defined as compulsive-like given the associated neurophysiological impairments of the prefronto-striatal circuits18,20, including the OFC21, and the reduction of grooming behavior after chronic administration of fluoxetine, a first-line treatment for OCD patients18. Regarding behavioral flexibility, two recent studies22,23 have challenged this model in a spatial reversal learning task and found that Sapap3 KO mice had impaired performances compared to controls after reversal event, although the type of deficit differed with increased perseveration found in one study23 but not the other22. Interestingly, both studies found that these deficits were not correlated with the severity of compulsive-like grooming, suggesting that compulsivity and flexibility dimensions may be distinctly affected in this model. Moreover, one of the studies identified a lack of flexibility only in a subgroup of Sapap3 KO mice23. This result highlights inherent model heterogeneity, which echoes the clinical heterogeneity observed in OCD patients.
5
0biomedical
0Study
111,905
A total of 3674 adolescents aged 12–18 years with records in SACWIS met our inclusion criteria (Table 4). Demographic, entry and exit characteristics were similar between the EHR and SACWIS study cohorts, though the proportion of adolescents with undocumented reasons for entry into and exit from foster care in their EHR makes it challenging to compare these characteristics between cohorts. SACWIS contains minimal detail on the health care provided to children in foster care when compared to EHRs.
2
0biomedical
0Study
287,153
In the second part of this study, we used proteomics to discover potential proteins that could be indicative of reflux. First, a sample of gastric juice and one induced vomit sample from healthy dogs of other breeds were analysed to create a list of putative stomach-derived proteins. From gastric juice, 68 proteins were identified after trypsin digestion. Similarly, for the induced vomit sample, trypsin digestion revealed 63 proteins. Collectively, 126 proteins were identified in both gastric juice and induced vomit (Supplementary Table 2). Proteins of interest that might be used as potential markers of reflux aspiration were selected based on a high level of expression in the stomach. These included the trefoil factor family (TFF), gastrokines (GKNs), IgGFc-binding protein, pepsin A and gastric triacylglycerol lipase. Of note, these same proteins were identified in canine gastric juice in a separate study .
4
0biomedical
0Study
66,335
Polymerase chain reactions (PCR) were carried out in 0.2-ml PCR tubes and contained a final concentration of 1× PCR buffer (Invitrogen), 1.5 mM MgCl2, 0.2 mM of each d.NTP (Invitrogen), 0.5 μM forward and reverse primers, 50 ng template DNA and 1 U recombinant Taq DNA polymerase (Invitrogen). All PCR amplification was performed using a TC5000 Thermo cycler (Bibby Scientific Ltd., UK) and run under the following conditions: 1× initial denaturation cycle of 5 min at 95 °C, 30× cycles of denaturation at 95 °C for 30 s, annealing at 55–65 °C for 30 s and extension at 72 °C for 90 s followed by a final extension cycle at 72 °C for 10 min. Following amplification, PCR products were routinely held at 4 °C.
4
0biomedical
0Study
119,847
Obeid et al. have developed a continuous-flow chip (Figure 4 on the left) for DNA and RNA amplification in combination with laser-induced fluorescence (LIF) detection and SYBR Green I. The denaturation, annealing and extension steps were carried out in time ratios of 4:4:9. The product can be analyzed after 20, 25, 30, 35 and 40 cycles, which gives with a flow rate of 1.26 μL/s and a total cycle time of 5, 6, 7, 8 and 9 min, respectively. The smallest amount of DNA they could detect was 50 fg . In another publication, Obeid et al. showed that the complete process from sample injection to product collection after amplification takes 35 min. By using hand-driven injection, the reaction of a 10-μL sample could be completed (30 cycles) within 6 min .
4
0biomedical
0Study
70,857
(a) A breakpoint Read rj whose right end matches perfectly first 4 nucleotides whether the remainder bases are mismatched with the reference. The guessing breakpoint can be inferred at the 4th base of the right end on rj; (b) The actual breakpoints of SV can be determined by breakpoint reads.
4
0biomedical
0Study
218,420
Myriad local emission sources contribute to elevated NH4+-N deposition within urban areas. Lawn and greenspace fertilizer application [8, 53], industrial and fossil fuel combustion and wastewater treatment represent important sources of gaseous ammonia to the atmosphere. Off-site emissions from crop and livestock production also influence urban N deposition . In a recent study, measured and estimated on-road and agricultural NH3 emissions in Dallas and Tarrant counties––where the cities of Dallas and Fort Worth are located––were notably high . Although we cannot apportion sources of N at our study sites, high levels of traffic congestion , intensive and extensive landscaping , and growing proportions of land under agriculture likely contribute to the prevalence of NH4+-N deposition in DFW.
4
2other
0Study
29,441
Phylogenetic networks are a generalization of phylogenetic trees that are used to represent either non-tree-like evolutionary histories arising in organisms such as plants and bacteria, or uncertainty in evolutionary histories (Huson et al. 2010; Steel 2016). Here we are interested in unrooted binary phylogenetic networks on a finite set X of taxa, or networks for short. These are connected graphs in which every vertex has degree 1 or 3 and whose leaf-set is X (Gambette et al. 2012). An example of such a network is presented in Fig. 1(i). Note that if a network is a tree (i.e. it has no cycles), then it is also known as a phylogenetic tree. Networks can be generated from biological data using software such as T-REX (Makarenkov 2001) and have been used, for example, to study the origin of genomes in eukaryotes (Rivera and Lake 2004).
4
0biomedical
0Study
377,700
The parent and current study questionnaire were developed to measure subjective health, PTSD, anxiety, depression, economic security, energy, and bodily pain using validated research instruments and findings from this team's prior research in DRC (Glass et al., 2017). To address the logistical challenges of working in an extremely low-resource and conflict-affected setting, the team collected baseline data in two phases of five villages each between 21 May 2012 and 8 November 2012. Approximately 2 months after baseline assessment, the team assessed habitual physical activity and sleep quality using actigraphy (Actiwatch Score, Respironics Inc.) on which this study is based. Since study interviews were conducted when participants would be earning their daily income, compensation for their time (~60–90 min) was provided per local rates, ~US$1.50.
4
0biomedical
0Study
231,451
The search was conducted up until May 26, 2021, using keywords and MeSH or Emtree terms based on several field searches including titles, abstracts, and author keywords. The following search concepts were considered: periodontitis, prevalence, extent, severity, and partial-mouth recording. Limits or filters were not used when conducting the search to increase the search sensitivity. Medline and Embase were mainly searched via Ovid, and grey literature was searched at different sources as outlined in the protocol . Manual searches were done for reference lists and related citations in PubMed.
4
0biomedical
0Study
53,171
In addition, our study investigated a lung adenocarcinoma patient with ALK-positive. Disease progressed after the first-line chemotherapy (carboplatin + pemetrexed for 4 cycles). Subsequent molecular detection showed ALK-positive. So crizotinib (250 mg bid) was used as second-line therapy. However, the patient showed crizotinib resistance after 5 months. As the second generation ALK inhibitor cannot get in the mainland of our country, the patients received docetaxel monotherapy as third-line treatment. Disease progressed 1 month later. So, apatinib was used as fourth-line treatment. This patient achieved a PFS of more than 3 months. So, this result indicated that apatinib might be a potential option for patient with crizotinib resistance when the second generation of ALK inhibitor cannot be got.
5
0biomedical
3Clinical case
32,099
The depletion of variation at MHC loci, which play a crucial role in pathogen recognition, has been postulated to be one of the most important extinction risk factors for endangered populations (O'Brien & Evermann, 1988). Quickly evolving parasites, such as viruses, may adapt to the most common host genotypes and escape detection of their antigens by the host's adaptive immune system (Ejsmond & Radwan, 2011). The large amount of rare allelic variants described in our study could increase the immunological defense both penguin species have against parasites, because these are unlikely to adapt to new, less frequent variants (Borghans, Beltman, & De Boer, 2004). Furthermore, heterozygote advantage in resistance to parasites contributes to higher polymorphisms at MHC loci, and this allows a broader range of antigens to be presented (McClelland, Penn, & Potts, 2003). Although heterozygosity could not be evaluated, we observed high diversity for all populations for both species which allows more pathogenic antigens to be presented to T lymphocytes and thus offer a higher immunological defense. High MHC I and MHC II gene diversity described here in both Humboldt and Magellanic penguins is extremely advantageous for the survival of the species. Therefore, this diversity must be maintained by avoiding local population bottleneck in the wild, and to do so, conservation projects for both species have to be managed at a metapopulation level.
5
0biomedical
0Study
263,193
Colorectal cancer (CRC) is one of the most common types of cancer. In 2017, it was the second most common malignancy, following gastric cancer, and had the third-highest cancer mortality rate in South Korea (1). The incidence of CRC remains high compared to that of other cancers. To allow doctors to design treatment plans and determine a prognosis for each patient, patients diagnosed with CRC are often classified according to the American Joint Committee on Cancer (AJCC)’s tumor-node-metastasis (TNM) staging system.
3
0biomedical
1Other
73,110
Most of the mothers (89.0%) lived in a residential environment far from industry. Among obstetric information, the mean of first menstruation age was 13.3 ± 0.11 (range: 10–16). A proportion of 40.0% had more than two children, with a mean number of 2.39 ± 0.12 (range: 1–6). Forty percent of infants were ≤ 6 months old and the mean infant age was 11.0 ± 0.63 (range: 0–20). In our study, most of the mothers (76.0%) ate more than three meals a day. The frequencies of mothers who consumed fish and meat 2–3 times a week were 46.0% and 41.0%, respectively. Tap water (63.0%) was used mainly for drinking in the present sample, followed by bottled water (27.0%) and well water (10.0%).
2
0biomedical
0Study
307,144
Effect of lysophosphatidic acid (LPA) 18:1 and the LPA receptor 1, 3 (and 2) inhibitor Ki16425 on migration after 24 h, 48 h, and 72 h of different human breast (cancer) cell lines. n = 3 replicate experiments, a p-value ≤ 0.05 was considered significant (Kruskal–Wallis test and post-hoc Dunn’s test).
4
0biomedical
0Study
47,184
Notably, the prevalence of self-perceived food addiction amongst the general population is somewhat higher than the number of people who fulfil the YFAS diagnostic criterion for food addiction (typically 5–16%) [6, 17, 20]. In particular, in a recent study, we found that only 12% of self-perceived food addicts met this criterion [21•]. This may reflect fundamental differences between the lay public’s conceptualisation of food addiction and that proposed by clinical models of substance-dependence upon which the YFAS is based. To address this possibility, it is necessary to consider the way in which food addiction is commonly conceptualised within the lay public.
4
0biomedical
0Study
205,081
Of note, similar to vegfc or flt4 mutants, treatment with 2.5 μM CDF did not completely inhibit craniofacial (eg. LFL) lymphatic development but did inhibit trunk lymphangiogenesis . CDF did not reduce vegfc or flt4 mRNA levels, and so CDF may inhibit Vegfc maturation, Vegfc/Flt4 binding, or downstream signalling driven at the level of the receptor. It is unlikely to inhibit more general MAPK signalling downstream of the ligand/receptor pairing because it does not inhibit ERK signalling in the embryo overall. Our kinase assay showed that CDF partially inhibits VEGFR2 kinase activity but not VEGFR3 activity. The ability of CDF to partially inhibit VEGFR2 kinase activity was not surprising as CDF at a higher concentration (10 μM) inhibits ISV formation in zebrafish. However, the overall inhibition of VEGFR2 kinase activity was less than 50% and so it is difficult to appreciate why this would lead to a loss of lymphatics. In addition, co-repression of Vegfr2 (Kdr) and Flt4 activity should result in complete inhibition of facial lymphatic development . Further mechanistic studies are clearly needed to uncover the precise target (or targets) of CDF activity in lymphangiogenesis. Despite this, just 12 h treatment with CDF resulted in prolonged inhibition of lymphangiogenesis via continued inhibition of the Vegfc/Flt4/Erk pathway compared with the FDA approved standard of care molecule in renal cell carcinoma and imatinib-resistant gastrointestinal stromal tumour, SM. This could suggest that CDF has an alternative and unique target compared with SM, or CDF may have unique pharmacodynamics and thus be capable of prolonged inhibition of known targets. Either way, these observations suggest that infrequent treatment with CDF may be sufficient to confer strong anti-lymphangiogenic effect. CDF is actively being investigated as an anti-cancer drug candidate and based on our findings it would seem important for these studies to assess its anti-tumour-associated lymphangiogenic and anti-metastatic activity.
5
0biomedical
0Study
307,467
Kaplan–Meier survival curve of post-operative BA patients and receiver operating characteristic curve demonstrating diagnostic value of circulating COMP in BA patients. (A) Comparing survival curves between BA patients with favorable and unfavorable outcomes. (B) Comparing survival curves between low and high circulating COMP levels in BA patients with unfavorable outcome. (C) Possibility of circulating COMP as a biomarker for distinguishing BA patients from healthy controls. (D) Possibility of circulating COMP as a biomarker for discriminating BA patients with unfavorable outcome from favorable outcome following KPE.
4
0biomedical
0Study
261,637
Process refers to the treatment process that includes interpersonal process factors and technical skills to render quality health care services.12 According to a report by the Department of Health in the United Kingdom, although health care professionals are experts in their fields, they may need further knowledge and technical skills to render quality health care services. Therefore, more acquired knowledge and technical skills will help to keep health care professionals up to date with what is changing in health care, such as new medications and more advanced equipment.14
2
0biomedical
1Other
372,323
MglB double mutants were created after analyzing the surface interacting with MglC and MglA. Site-directed mutagenesis was performed to create two double mutants, MglBE84A,R115A and MglBS54A,S57A. Single primers were designed to construct the mutants: MglBE84A primer, CGAGTTCCCCAACCAGTTCCACGCCGGGGCCAAGGACTCGCTG, was used to incorporate E84A mutation, and the obtained construct was further used to incorporate R115A mutation using MglBR115A primer 5′-CCAGCCTCGGCCTCGTCGCCCTTCGCATCAAGAAGGCCAGCG-3′. MglBS54A,S57A mutant was generated using primer 5′ -GACGCAGAACATCGACACCACGGCCCTGGCCGCCCTGACGGCCGGTAACGTGGCCG-3′. PCR amplification using the above designed primers was performed using pET-Duet-A-TEV-mglB as a template. The obtained PCR product was further digested using DpnI enzyme (ThermoFisher Scientific) and transformed into E. coli Top10 cells (Novagen). The colonies obtained were used to inoculate a 10-ml culture that was grown overnight at 37 °C. Plasmid isolation was performed using the plasmid isolation kit (Thermo Fisher Scientific). The incorporation of mutation was confirmed by DNA sequencing. The mutants were then transformed in E. coli Rosetta (DE3) cells (Novagen), and proteins were purified as described above for MglB WT.
5
0biomedical
0Study
179,722
The aim of this paper was to estimate inequalities in COVID-19 population health loss in Scotland, measured by DALYs in 2020. Our secondary aim was to scale overall, and inequalities in, COVID-19 DALYs against the level of pre-pandemic inequalities in all-cause DALYs, derived from the Scottish Burden of Disease (SBoD) study.
4
0biomedical
0Study
279,639
The purpose of this study was to develop a simulated arm with pressure sensors which can detect real-time skin pressure when applying a short arm cast or splint. In addition, we also bring the simulated arm to casting and splint workshops to see how it works. Fractures are common injuries, and cast or splint immobilization remains the primary treatment. Casting is not without risks and complications. The risk of morbidity is higher when casts are applied by less experienced practitioners .
3
0biomedical
0Study
387,380
Multiple crystal structures of dioxygenases that can catalyze the ring-opening cleavage of aromatic compounds have been reported30–32, but we are unaware of any reported crystal structures for an enzyme capable of catalyzing cleavage of a pyridine ring. It is notable that a phylogenetic analysis of non-heme Fe(II) dioxygenases indicated that NicX and Hpo comprise a subclass of non-heme iron dependent oxygenases (Fig. 1). Despite extensive efforts, we were unable to obtain a structure for Hpo, and structural comparison using the DALI server failed to identify any obvious homologs of full-length NicX.
4
0biomedical
0Study
324,027
The XPS spectra of N 1s and P 2p of NPAC are depicted in the Figure 3. Four peaks centered at 398.30, 399.65, 401.20, and 402.39 eV were observed in the N 1s spectrum, which represented pyridinic-N (N-6), pyrrolic-N (N-5), quaternary-N (N-Q), and oxidized N (N-X), respectively (Chen et al., 2016). As indicated above, the N in NPAC originated from the reaction of NH3 with O-containing groups during the pyrolysis process. The N-5 and N-6 were believed to be the cyclization products of N-containing intermediates, while the N-Q might come from the condensation reactions of N-6 (Chen et al., 2018a). These N species possessed different contributions to the electrochemical properties. In General, the N-5 and N-6 can improve the pseudocapacitance, while the N-Q can enhance the conductivity (Fu et al., 2019; Ma et al., 2020). For the P species in Figure 3B, the band at 132.4 eV was attributed to C3-P=O, the peaks centered at 133.78 and 135.61 eV were considered to be C–O–P and C–P–O (Liu et al., 2015). The introduction of P could not only improve the pseudocapacitance, but also widen the operating voltage window of the capacitor (Ma et al., 2018).
4
0biomedical
0Study
116,792
We found that all investigated halogenated guaiacol derivatives showed high odor potencies, which is reflected by their very low odor thresholds. Generally, the compounds elicited mostly pleasant odor impressions resembling those of guaiacol itself, namely smoky, vanilla-like and sweet. However, some compounds like 3-bromo-, 6-bromo-, 3-iodo-, and 6-iodoguaiacol were described as smelling unpleasant with musty, moldy and medicinal odor notes. Despite their low odor thresholds, none of the investigated substances has been previously identified in nature, only in wastewater of pulp and paper mills, and generally as contaminants. Due to the very low odor thresholds, especially of 5-chloroguaiacol with 0.00072 ng/Lair, it might be speculated, however, if there is any biological meaning of these halogenated guaiacol that developped through evolutionary processes, or if the halogen moiety itself renders the strong sensorial impact as non-intended side-effect. In any case, these questions may be better addressed in the future based on the analytical data (retention indices on two different columns, mass spectra, odor thresholds in air, and odor qualities) provided in this study, and may aid the future discovery and analysis of such halogenated derivatives.
4
0biomedical
0Study
396,128
I-SH: conception or design of the work and final approval of the version to be published. Y-CCho: acquisition. Y-CChe and I-SH: analysis, interpretation of data, and drafting the work or revising it critically for important intellectual content. Y-CChe, Y-CCho, and I-SH: agreement to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All authors contributed to the article and approved the submitted version.
1
2other
1Other
332,725
The knee joint angle was calculated using MATLAB R2016b (MathWorks Inc., Natick, MA, USA). The obtained knee joint angle was normalized while considering one gait cycle as heel contact to heel contact for the ipsilateral lower extremity. The knee joint data for three gait cycles were averaged and compared for the conditions with and without the insole. The patient was instructed to walk at his usual preferred speed. The measurements were performed for the patient walking without the insole first, followed by walking with the insole.
4
0biomedical
0Study
33,105
Pregnancy is associated with a wide range of pharmacokinetic [1, 2] and physiological [3, 4] changes. Those changes quite often present physiological complications during pregnancy. Apart from this, pregnant women also present with other concurrent medical illness [5, 6] and chronic diseases. Irrespective of the risk of drug therapy during pregnancy, drug use cannot be avoided in conditions where benefits potentially outweigh the risks involved . The risks associated with drug use in pregnancy can be two fold: incidence of adverse effects to the mother followed by teratogenic effects to the growing fetus [8, 9]. This demands that a careful consideration is required before drugs are prescribed to pregnant patients.
3
0biomedical
1Other
235,400
Across all sessions, the opportunity to provide written feedback at the end of each questionnaire was used 74 times, which is 42.53% of the cases. For a systematic evaluation, we regarded each single comment independent of session and participant but connected to one of the two conditions. First, we sorted the comments into negative, positive, and neutral (neither positive nor negative). We then derived categories from the most frequently mentioned statements, resulting in the categories below. We only reported comments with a minimal count of five.
2
0biomedical
0Study
198,571
In the analysis of Girard et al. some genes are mentioned as ‘no expression detected in the brain (n.e.d.)’ or ’no data available in the ABA database (n.d.)’, but when we cross referenced these genes with the HPA database, several of them were found. These genes are presented in Table 2 and Figure 6, Figure 7 and Figure 8.
2
0biomedical
0Study
112,156
M0, M1, and M2 signify that the quadrupole 1 was set to the mass of the M0, M1, and M2 mass isotopomer of the metabolite in question. m1, m2, and m3 denote that the quadrupole 3 was set to the mass of the m0, m1 and m2 tandem mass isotopomer of the fragment in question. The arising precursor-daughter mass transitions can be found in Electronic Supplementary Material S3. Bold face: measured experimental relative mass trace intensity, italic face: theoretical fractional abundance arising from the assumed carbon origin of the fragment indicated after the fragment mass. The theoretical abundance was calculated according to the method provided in Electronic Supplementary Material S8
4
0biomedical
0Study