id
int32 0
398k
| text
stringlengths 204
42k
| educational_score
float32 1
5
| domain
class label 3
classes | document_type
class label 4
classes |
|---|---|---|---|---|
33,251 |
Microbiological cultures were carried out using BD BACTEC Fluorescent Test Technology (BM BACTEC™ plus aerobic/F and anaerobic/F culture vials). Culture bottles were incubated at 36.5 °C for 7 days. Each vial contains a chemical sensor able to detect increases in CO2 produced by the growth of microorganisms and fluorescence, subsequently monitored by a BACTEC fluorescent series instrument. Culture bottles showing evidence of growth after 7 days were gram stained, subcultured on blood agar plates and incubated for 48 h at 35/38 °C in a normal atmosphere, an enriched atmosphere of 5 % CO2, and an anaerobic atmosphere. Samples were then processed under a Biohazard Class II laminar flow hood and all bacteria identified with the standard biochemical procedure. Lastly, an antibiogram was drawn up for each bacterium isolated and Minimal Inhibitory Concentration estimation performed in the standard media used in clinical practice. Samples were also cultivated in a Lowenstein-Jensen medium to isolate mycobacteria. Microbiological cultures and analyses were carried out by an accredited in-hospital Microbiology laboratory and interpreted by a microbiologist with specific expertise.
| 4 | 0biomedical
| 0Study
|
338,514 |
A total of 185 health controls and 222 patients with BD were recruited. The patients included both outpatients and inpatients who attended Taipei Veterans General Hospital, Taiwan. Each patient diagnosis was confirmed by an experienced physician according to the “Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition” (First et al., 1995) and was based on structured clinical interviews. Potential participants were excluded if they had a neurological illness or any other disorder that affects cerebral metabolism, had substance abuse history or dependence during the previous 6 months, or had a history that included head injury with a documented sustained loss of consciousness and/or neurological sequelae. The clinical assessment of the patients with BD involved using the young mania rating scale (YMRS) and the Montgomery–Åsberg depression rating scale (MADRS), but only some of the patients received a complete rating. The patients were being treated with a variety of atypical antipsychotics, antidepressants, and mood stabilizers before participating in the study. The investigation was conducted according to the latest version of the Declaration of Helsinki. All participants gave written informed consent prior to their participation, and this was after the procedures had been fully explained to them. The present study was approved by the Research Ethics Committee of Taipei Veterans General Hospital.
| 3 | 0biomedical
| 0Study
|
260,010 |
The affective states that give rise to facial expressions are instantiated by distinct patterns of neural activity (Panksepp, 2004) in areas of the brain that have projections to the facial motor nucleus in the pons. The axons of the motor neurons in the facial nucleus distribute to the facial musculature, including the muscles that move the pinna (Jenny and Saper, 1987; Welt and Abbs, 1990). Of all possible facial muscle movements, only a small set of coordinated movements give rise to unique facial configurations that correspond, with some variations, to primary affective states. Human studies of facial expressions proposed six primary affective states or “universal emotions” that were present in facial displays across cultures (Ekman and Friesen, 1986; Ekman and Oster, 1979; Ekman and Friesen, 1988; for review, see Ekman et al., 2013). The cross-cultural features of facial expressions allowed the development of an anatomically based Facial Action Coding System (FACS; Friesen and Ekman, 1978; Ekman et al., 2002). In this system, a numerical code is assigned for each elemental facial action that is identified as an action unit (AU). Considering the phylogenetic continuity in the facial musculature across primate species (Burrows and Smith, 2003; Burrows et al., 2006, 2009; Parr et al., 2010), a natural extension of human FACS was the homologous Macaque FACS (MaqFACS; Parr et al., 2010), developed for coding the facial action units in Rhesus macaques (for multispecies FACS review, see Waller et al., 2020).
| 4 | 0biomedical
| 2Review
|
297,915 |
In particular, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$H^{\alpha _0}(A)=\emptyset $$\end{document}Hα0(A)=∅ for some countable ordinal \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\alpha _0$$\end{document}α0 iff A is countable.
| 1 | 2other
| 1Other
|
263,015 |
Old World scorpion genera of Buthidae, including Androctonus and Leiurus, have very potent neurotoxins specific for mammalian or insect Na+ channels, whereas New World scorpion genera, such as Centruroides and Tityus, have potent toxins acting on both mammalian and insect channels . Despite the dangerous, painful and fatal effects caused by scorpionism, therapeutic properties of scorpion venoms have been explored for thousands of years and several scorpion venom compounds may represent promising leads for the development of new pharmaceuticals [11, 57].
| 4 | 0biomedical
| 2Review
|
74,577 |
Children illness and hospitalization with different reasons is an inevitable event that can disrupt the natural process of child’s life and even affect his/her development.1,2 In this situation, parents are faced with high level of stress and anxiety3; They may feel confused, angry and sinful; and even demonstrate their frustration with inappropriate behaviors such as; restlessness, irritability and isolation.4 Results of articles published from 1942 to 1956 presented scientific evidence about the adverse effects of separation of mother and child.5 Also, the unpleasant effects of hospitalization on children’s psychological health was the most important reason that led to introduction of family centered care (FCC) as an important approach in the care of hospitalized children.6
| 4 | 0biomedical
| 2Review
|
179,479 |
The information in this study is important for several reasons. All patients in our series underwent LNF in one department by the same team of surgeons, which makes this group homogenous in terms of analysis. The study is based on surgeries from 7 years ago, following a standardized technique that keeps this work up to date. Moreover, the data were collected prospectively, and the mean follow-up time is 50 months (21.2–76.3 ± 16.6 months), which makes it a long-term study. This study may help physicians and patients advise considering surgery as a treatment for GERD.
| 4 | 0biomedical
| 0Study
|
129,171 |
At two weeks post-infection, guinea pigs were euthanized and spleens and lungs were collected in for quantification of C. burnetii genomic DNA (gDNA) using qPCR (26). Tissues were homogenized and DNA extracted using the High Pure PCR template preparation kit (Roche, Basel, Switzerland) according to the manufacturer’s recommendations. Samples were analyzed on a StepOne Plus real time PCR System (Applied Biosystems) using com1-specific primers and probe (com1_L1 [CGCGTTGTCTTCAAAGAACT], com1_R1 [GCGTCGTGGAAAGCATAATA], and 5=-6-carboxyfluorescein-[FAM]-CGGCCAATCGCAATACGCTG-3’-6-carboxytetramethylrhodamine [TAMRA]).
| 4 | 0biomedical
| 0Study
|
252,955 |
Unwarranted demands from the patients’ side for any specific drug is another leading factor for irrational prescriptions. Such practices are predominant in the low-and middle-income countries (LMICs)71. Above all, poor infection control practices in the LMICs are often neglected but significant factor in the rapid spread of drug-resistant pathogens48.
| 2 | 0biomedical
| 1Other
|
217,849 |
The glioma cell lines U87MG and T98G were obtained from the American Type Culture Collection (Manassas, VA, USA). The cells were maintained in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific, Waltham, MA, USA), supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Cultilab, Campinas, Brazil) and antibiotics (100 units/mL penicillin, 100 µg/mL streptomycin), in a humidified atmosphere with 5% CO2 at 37 °C. Cell line authentication was performed by short tandem repeat DNA analysis with the GenePrint 10 System (Promega, Fitchburg, WI, USA).
| 4 | 0biomedical
| 0Study
|
302,838 |
G protein‐coupled receptors (GPCRs) are an extensive family of membrane receptors known to share seven‐transmembrane α‐helix domains, with an intracellular C terminus and a large extracellular N terminus. Generally, the extracellular region senses extracellular ligands such as ions, metabolites, chemokines and temperature, causing conformational changes in the receptor and subsequent transduction of the signal into intracellular responses, activating further downstream signalling pathways. Canonical GPCRs are classically modulated by the intracellular region ligands: G proteins, which activate downstream signalling, or β‐arrestins, which can control excessive activation [66, 67]. GPCRs are the most common class of targets for therapeutic drugs (~35% of approved drugs) due to their relevance in several human diseases, restricted expression and structure. However, only about 16% of the ~800 different GPCRs have been targeted for therapeutic drugs, leaving a substantial number of distinct GPCRs to be explored as potential therapeutic targets [68, 69].
| 4 | 0biomedical
| 2Review
|
208,841 |
A unique characteristic of our framework is the inclusion of course correction during implementation. In the implementation literature, most papers focus on how implementation fidelity could be achieved(27,42,50,60). However, few reviewed frameworks considered how to make course corrections. Concurrent evaluation may generate evidence around the implementation process that is adjustable and the short-term and long-term outcomes. This has improved implementation fidelity and coverage of a home-fortification intervention in Bangladesh(65). The combination of concurrent evaluation and course correction creates an opportunity to improve implementation fidelity as well as reducing the uncertainty, which ultimately contributes to implementation sustainability.
| 4 | 0biomedical
| 0Study
|
186,427 |
Finally, in terms of profession, F(4,1123) = 6.45, p < 0.0001, ηp2 = 0.01, the Other group showed the biggest discrepancy, followed by the Exact science group, then the Humanities, Health, and Biological sciences group. Three significant post hoc Tukey HSD tests showed that the Other group differed significantly from the Health (p = 0.0030), Humanities (p = 0.0020), and Biological sciences groups (p < 0.0001), respectively.
| 3 | 2other
| 0Study
|
81,904 |
(A) Hierarchal cluster analysis of change in AA metabolites due to young and aging with and without SO diet. Color code bar representing change in expression from green (-1 lowest decrease) to red (+1 highest increase). (B) Venn diagram representing the number of AA metabolites affected due to age (young and aging) and SO-diet post-MI. (C) PCA analysis of AA metabolites of post-MI with respect to age and diet. (D) Bar graph representing change in AA metabolite production at pre-MI (No-MI controls) and d1 post-MI.
| 2 | 0biomedical
| 0Study
|
202,571 |
BTLA plays an important role in immunoregulation and is involved in the pathogenesis of various respiratory diseases ( Figure 1 ). In spite of its importance in regulating immunity, the HVEM-BTLA signaling in respiratory system diseases has not been sufficiently analyzed. One reason is that BTLA does not merely serve as an immune suppression role in respiratory system diseases. In many circumstances, BTLA can promote immunity and fight against infection. BTLA contains structure of promotive function (63), so it may produce immune enhancement signals during signal transduction. Besides, the binding of BTLA to its ligand HVEM can form a bi-directional signal system. BTLA and HVEM can act as ligand and receptor for each other, delivering different signals. When BTLA binds to HVEM as a ligand, it generates positive immune regulation (9, 64). For example, the BTLA involvement can induce HVEM-mediated NF-κB activation, which is important for the induction of pro-inflammatory and cell survival genes (65). In addition, BTLA lays in a complicated network of immune modulation and signal transmission. Researches separating one pathway from the network may not be comprehensive enough. Since HVEM and BTLA are widely expressed by many cell types, the exact regulatory mechanism in different immune contexts need to be carefully determined. So far, most researches merely find how the level of BTLA changes in different respiratory diseases. The underlying mechanism is still unknown. How HVEM-BTLA signaling regulates immunity and influences the pathogenesis of respiratory diseases need to be elucidated. More researches on mechanisms should be conducted. Based on current research, the level of BTLA may be used as an indicator of disease severity, and may predict the prognosis. Anti-BTLA antibody has been used in animal experiments to treat severe community-acquired pneumonia and epithelial ovarian carcinoma (45, 66). Antibodies in researches exert different effects, either agonistic or antagonistic (40, 67), which may due to HEVM-BTLA bi-directional signal system. An anti-BTLA monoclonal antibody has been approved for clinical trial by FDA (68). Treatment of respiratory diseases by anti-BTLA antibody must be on the road, more and more application researches will be conducted.
| 5 | 0biomedical
| 2Review
|
188,221 |
In addition to ICD codes and MTS representations, we have also conducted experiments, where we provided the algorithm with one additional set of features, as well as with all features available. To validate whether the availability of additional features comes with an advantage for an accurate reproduction of the infected cases, we rely on the Pearson correlation coefficients that result from different feature selections in Table 2. For all experiments, we report the correlation of the autonomously learned syndromes with both, the number of reported cases used for training and the cases captured by the handcrafted syndromes. In the case of Influenza and SARS-CoV-2, the inclusion of vital parameters introduces a minor advantage for matching the reported numbers. Understandably, the use of additional features typically reduces correlation with the handcrafted syndromes, as they do not make use of these features. In the case of Norovirus, the Pearson correlation does not benefit from the availability of vital parameters. Regardless of any specific disease, this does also apply to the contextual and demographic information. We consider the absence of demographic indicators as positive, as none of the diseases appears to be specific to gender or age.
| 4 | 0biomedical
| 0Study
|
45,788 |
QTL Cartographer (Basten et al. 2002) was utilized to detect associations between phenotypes and genotypes. Single-marker analysis, linear regression analysis and composite interval mapping (CIM) was implemented. Zmap (model 6) was performed for CIM, using the ten most significant marker cofactors identified by forward and backward regression. QTL were scanned at intervals of 1 cM and at every marker while cofactors located within a window of 10 cM of the scanned position were excluded from the analysis. To determine LOD score thresholds of 5%, and significant QTL, 1000 permutations were performed for every trait. Two nearby QTL were considered as different when LOD peaks were localized 20 cM or greater apart. Effects of QTL are expressed relative to the B73 allele, where an effect with a positive sign represents an increasing allele from B73 and the one with a negative sign denotes an increasing allele from Mo17.
| 4 | 0biomedical
| 0Study
|
161,248 |
Hybrid assemblies were deposited on NCBI under BioProject PRJNA670073 and PRJNA670071 (isolates from local sources and travelers, respectively). Plasmid sequences were compared using BLASTn and visualized with the BLAST Ring Image Generator (BRIG) (v.0.95).
| 4 | 0biomedical
| 0Study
|
125,572 |
Comparison of raw and bioleached NC1 and NC2 limonite from SEM analysis (Figures 9, 10) showed that iron and chromium were abundant in both (representing Fe oxy-hydroxides and chromite) but that there was a significant reduction in abundance of Mn-rich grains in the bioleached residues, supporting chemical analysis of the leachate liquors.
| 3 | 0biomedical
| 0Study
|
347,099 |
ARH3 is a ubiquitous protein conserved in Animalia and Capsaspora (Oka et al. 2006). ARH3 localizes to the cytosol, mitochondria, and nucleus, and experimental data suggest that the precise subcellular distribution may depend on cell type as well as cellular requirement (Oka et al. 2006; Niere et al. 2012; Mashimo et al. 2013). For example, ARH3 was detected in the nuclei of mouse brain and MEFs, but was absent in the ones of HepG2 cells (Oka et al. 2006; Mashimo et al. 2013; Bonfiglio et al. 2017), which suggests that ARH3 may have cell type-specific functions.
| 4 | 0biomedical
| 0Study
|
312,770 |
A convenience sample of participants was recruited within a regional association of individuals with TBI, following receipt of ethics approval from the Research ethics board of the Centre intégré universitaire de santé et de services sociaux (CIUSSS) de la Capitale-Nationale. A case manager from the association made a preselection of participants based on the following inclusion criteria: have sustained an MSTBI (as documented in the association files), suffered the TBI no more than five years prior, have been discharged from a rehabilitation program, and are considered able, by the case manager, to take part of a discussion in the context of a small group for 45 minutes. An invitation was given to potential participants. Individuals willing to participate were contacted over the phone to confirm their interest and provide additional details.
| 4 | 0biomedical
| 0Study
|
192,689 |
How to allocate scarce dialysis treatment resources in the clinical course of chronic kidney failure entailed a longer time framework compared to acute respiratory difficulties, and one could claim that the same processes would not work equally well in the latter case, let alone the biased evaluations by the “God Committee”. Indeed, until not long ago it would have been impossible to summon a large committee and have them deliberate until a majority opinion is reached quickly enough to make decisions about how to allocate ventilators in a hospital ward. In fact, decisions about ventilator allocation should be made within hours or even, in some rare cases, a few minutes. This concern might be especially salient if the committee consisted of health experts with other critical responsibilities in a situation of healthcare crisis.
| 4 | 0biomedical
| 1Other
|
207,154 |
The mHb axons specifically express the DCC receptor (Quina et al., 2009; Schmidt et al., 2014); it has been proposed that this receptor is involved in the initial dorsoventral trajectory of the fr tract (Funato et al., 2000). Thus, we decided to test if this receptor was also involved in the SNc and VTA signaling in our in vitro system; the blockage of the receptor with the AF5 antibody prevented the redirection of the mHb axons by the ectopic SNc. This preliminary result prompted us to check the role of Ntn1, the specific attractive ligand of DCC (Keino-Masu et al., 1996).
| 4 | 0biomedical
| 0Study
|
331,960 |
• We appreciate the comment of the reviewer. As raised earlier we have evaluated the association between hepcidin and sTfR concentration with a linear regression model, table 3. See comment 4. The coefficient was indeed negative (-0.11) and reached significance. This may be explained by the fact that inflammation is an important factor upregulating hepcidin, whilst does not affects sTfR levels. Without markers to test for inflammation this remains speculative though. We have included this in the discussion: – Line 340 (page 14): Hepcidin may be influenced by multiple conflicting stimuli in this patient population including, iron deficiency, anaemia/hypoxia and inflammation. We found an inverse association between hepcidin and sTfR, which may indicate that inflammation was an important stimulus of hepcidin levels in our population. Without in-depth analysis including all relevant stimuli and repeated sampling it is very difficult to understand the complexity of hepcidin and iron metabolism in our population. Low hepcidin values could indicate that iron supplementation would be indicated and effective in reducing anaemia caused by iron deficiency. However the effectiveness and safety should be evaluated in a prospective trial design in this population.
| 4 | 0biomedical
| 0Study
|
237,585 |
With respect to diagnostic algorithms for monoclonal gammopathy, it is conceivable that using usual SPEP, SIFE and FLC-Modified SIFE could detect all specimens with pathologic monoclonal immunoglobulins, including light chain only lesions. To maximize resource utilization, initial screening studies could be performed with SPEP and a single lane of undiluted patient serum stained with a mixture of anti-kappa and anti-lambda antisera. Serum specimens with a positive result by SPEP or FLC-Modified SIFE using mixtures of anti-kappa and anti-lambda antisera could be further analyzed by conventional SIFE, UPEP and UIFE.
| 4 | 0biomedical
| 0Study
|
91,972 |
A number of USP domains are activated allosterically by binding partners (Sahtoe and Sixma, 2015). Recent structural insights into the USP46-UAF1 complex and the USP12-UAF1-WDR20 complex revealed that the activators interact with surfaces remote from the catalytic center and mediate activation via long-range allosteric mechanisms (Li et al., 2016, Yin et al., 2015).
| 4 | 0biomedical
| 0Study
|
212,576 |
Nucleic acid extractions were performed using multiple methods. For extraction of mouse tissues, 1 ml phosphate buffered saline and 1 μl of Dx solution (Qiagen) was added to tissue fragments followed by addition of 1 mm glass beads and homogenization. Ten μl of proteinase K was added, incubated 65 °C for 30 min, followed by centrifugation of cellular debris. Total nucleic acid (TNA) from 250 μl of the supernatant from mouse tissue samples in experiments 1 and 2 (Table 1) were extracted using the Easy Mag extraction platform (Biomerieux) and eluted in 40 μl. TNA from all tick samples examined in experiment 3 were also extracted using the EasyMag. DNA from whole blood (experiments 4–7) was extracted using 200 μl of each sample with the QIAamp DNA Blood Mini Kit (Qiagen) and eluted in 50 μl of water.
| 4 | 0biomedical
| 0Study
|
46,734 |
Instantaneous dose rates and mean dose rate at 1 cm in water in Gymin−1 for 192Ir for a 370 GBq (10 Ci) HDR 192Ir source replaced every three months (Scheme 1) and a 108 GBq (2.93 Ci) HDR 60Co source replaced every three years (Scheme 4), presented over a five‐year period.
| 4 | 0biomedical
| 0Study
|
58,951 |
Further, the ultrasound investigators were not blinded to the diagnoses of HH versus HOA (they were only blinded to the clinical findings). This might have influenced the results; however, given the similar results between HH-A and HOA in regard to several aspects (and assuming that a lack of blinding would have increased the difference between these groups) and the good inter-reader reliability between investigators, we believe that the bias due to lack of blinding to diagnosis was negligible.
| 4 | 0biomedical
| 0Study
|
193,572 |
ST and DS-K conceived the project, guided experimental design, and interpretation of the data. RI began to explore retina as a model system. RI and YM preformed original exploratory experiments. JR conducted the all IHC experiments for the manuscript and Nikon imaging. ZM conducted the Airyscan imaging. YM conducted the western blot experiments. YM and QX conducted the BaseScope experiments. JR prepared all the figures for the manuscript. JR, ST, and DS-K wrote the manuscript. All the authors read and edited the manuscript.
| 1 | 2other
| 1Other
|
121,569 |
Fibrosis at the wound site was evaluated by Sirius‐red staining for collagen deposition, as described in our previous study 27, 28. Briefly, 5‐μm tissue sections were used for Sirius‐red staining with 0.1% Sirius‐red F3BA and 0.25% Fast Green FCF. Sections stained for Sirius‐red then were assessed for the proportion of collagen using a Nikon Eclipse E600 microscopy system.
| 4 | 0biomedical
| 0Study
|
304,618 |
The six sample groups were defined as follows:Control. As-received material.HCl: The discs were immersed in a solution of hydrochloric acid (HCl) 20% (v) for 40 s at room temperature (HCl group). This type of passivation is the very common in the implants and prosthesis.Citric acid 20% 10′. The discs were immersed in a solution of citric acid 20% (v) for 10 min at room temperature.Citric acid 20% 20′. The discs were immersed in a solution of citric acid 20% (v) for 10 min at room temperature.Citric acid 20% 30′. The discs were immersed in a solution of citric acid 20% (v) for 10 min at room temperature.Citric acid 40% 10′. The discs were immersed in a solution of citric acid 40% (v) for 10 min at room temperature.
| 3 | 0biomedical
| 0Study
|
312,054 |
PPIA is a gene encoding for a cyclosporin binding-protein, TBP is a gene encoding for a TATA-binding protein, and PRLP0 encodes a ribosomal protein that is a component of the 60S subunit. In NF1 related Schwann cell lines, they were stably expressed irrespective of tumor pathology and severity. In a previous study, TBP was also proven to be a stable reference gene in Schwann cells derived from neurofibromas . However, the most frequently used reference gene GAPDH was proved to be an inappropriate option in two groups (M values > 0.5). As a multifunctional gene, the use of GAPDH as a reference gene has been also questioned and challenged in other cancers including lung cancer , breast cancer and bladder cancer . Accumulated evidences indicate that GAPDH is deregulated in various cancers under certain conditions and potentially participates in tumorigenesis and tumor progression [35–39].
| 4 | 0biomedical
| 0Study
|
4,852 |
In the past decade, remarkable progress has been achieved in the treatment of advanced CRC, particularly after the introduction of effective systemic chemotherapeutic regimens, including oxaliplatin and irinotecan, and molecular-targeted antibodies . These novel agents have enabled better tumour response rates and overall survivals (OS) in patients. However, despite these significant improvements, patients with ovarian metastases from CRCs have a worse prognosis than patients with CRCs that metastasised to other sites .
| 4 | 0biomedical
| 0Study
|
256,254 |
Additional file 1: Supplementary 1. Information, Consent and Online Survey ContentAdditional file 2: Supplementary 2. Schedules for Focus Groups and Individual InterviewsAdditional file 3: Supplementary 3. Summary of Thematic Analysis: Themes and Illustrative QuotationsAdditional file 4: Supplementary 4. Summary of Questions Resulting from Analysis to be Used in a Delphi Consensus Study when Developing Clinical Guidelines
| 2 | 0biomedical
| 1Other
|
50,263 |
Osteotomy was performed from the mesial of her second premolar to half of the ascending ramus. Maxillomandibular fixation was redone and the 2.7 mm reconstructive non-locking plate was re-installed. Extraoral suturing, fixation release and intraoral suturing were performed in sequence. At the end of the surgery, we used elastics for occlusal maintenance.
| 3 | 1clinical
| 3Clinical case
|
23,845 |
We extend the concept of measuring the similarity in CIS occurrence counts to compare the prevalence of interaction patterns across experimental treatments. To test if the difference between the two treatment levels is higher than we would expect by chance, we conduct a permutation test on our data. Our test statistic is the sum of all 121 pairwise distances between m-vectors in the two treatment levels (from 11 participant pairs for each treatment). We use the sum of all distances to ensure that we measure similarity within and between participant pairs. We randomize our data by switching the treatment level label for m-vectors within experimental pairs. In other words, for each participant pair we can either swap the data from the full cup treatment with the data from the empty cup treatment, or not. This yields 211 possible assignments of treatment labels to experimental runs. We evaluate our test statistic for all possible treatment-level permutations and report the fraction of values that are higher than or equal to the observed value as our p-value. This analysis yields that occurrence counts differ significantly across treatments and are generally higher for the full cup treatment (p = 5.86 × 10−3).
| 4 | 0biomedical
| 0Study
|
357,098 |
causes could be identified". I would prefer to adjudicate as cardiovascular deaths only the cases with clear evidence of cardiovascular disease as the underlying cause, non-cardiovascular deaths those where there were other obvious cases, and classify as "unclear" the cause of the death in the remaining cases.
| 4 | 0biomedical
| 0Study
|
187,596 |
Based on this study, the following conclusions are obtained:Compared with the previous strength models of FAGC, the tensile strength model in this study considers the effect of shape and size of tested specimens on strength, and the bond strength model in this study considers the cover to diameter ratio and the diameter to development length ratio. Therefore, the models in this study can be used as the design equations for estimating the tensile strength and reinforcement-concrete bond strength of FAGC.The strength models provide the corresponding 90% prediction intervals. The lower limit of the prediction intervals is the characteristic value of the strength.The splitting tensile strength of FAGC is slightly lower than that of PCC with the same compressive strength, while the scatter of the splitting tensile strength of FAGC is close to that of PCC.The scatter of the bond strength of FAGC is larger than that of PCC. This results in the fact that for the bond strength of FAGC, although the estimated mean value is higher than that of PCC in the same case, the characteristic value may be lower than that of PCC in the case of a small bar spacing.The strength prediction models of PCC cannot be used for FAGC.To ensure adequate anchorage and suitable design anchorage lengths of reinforced FAGC beams, the minimum bar spacing needs to be restricted in the design code for FAGC.Incorporating the models into the prediction models of the cracking behaviors for PCC gives good predictions on the cracking moment and crack spacing of reinforced FAGC beams.
| 4 | 2other
| 0Study
|
183,467 |
Similarly significant, in this case, is the fact that the situation was most likely aggravated by the restrictions mandated as part of the first lockdown in Madrid (Spain). Nonetheless, although CRC management in pandemic times now follows special guidance for delivering care (e.g., European Society for Medical Oncology), the first extended and restricted lockdowns decreased surveillance and advance-care planning worldwide . To prevent these consequences, one key factor involves precisely improving the communication strategy to deal with diagnosis and treatment backlogs by linking the clinical and personal components , in which SDM within PMM offers a solution still in progress due to complexities such as those highlighted in the first three cases.
| 4 | 0biomedical
| 1Other
|
120,130 |
Our first experiment was designed to test whether there are performance differences between 2D-embeddable (Figure 1C) and 2D-non-embeddable environments (Figure 1B). We reasoned that an embeddable structure might facilitate the building-up of an internal, explicit representation, i.e., a map of the environment. If participants take advantage of this structure, then a model-based reinforcement learning algorithm like Dyna-Q should provide the best fit to the data.
| 3 | 0biomedical
| 0Study
|
392,400 |
In our study, it is essential to emphasize that the gastric involvement was independently associated with inferior survival when compared with the intestinal BL. The 5‐year OS for gastric patients was 37.8%, much inferior to those with intestinal BL 70.2% and the whole BL 58.1%. The significantly lower OS in the gastric could be partially explained by the inclusion of more older patients (46.4% vs. 24.7% of intestinal BL, P < .001), more patients with advanced‐stage III/IV (60.7% vs. 34.8% of intestinal BL, P < .001), and more patients treated without chemotherapy (22.3% vs. 13.4% of intestinal BL, P = .023). However, the negative impact of gastric involvement on OS persists even when adjusted for age, stage, gender, year of diagnosis, and chemotherapy option. In stratified analysis, outcomes in gastric BL were consistently worse regardless of gender, stage, and year of diagnosis, and also in the subgroup of the white race, middle age and patients receiving chemotherapy. This is in contrast to what has been reported in a Korean study demonstrating that gastric BL has superior outcomes to other types of BL.16 One possible reason for this disparity is the fact that the Korean study is a small cohort of 21 gastric BL patients, with all of them receiving chemotherapy and approximately half of them (10/21) in early clinical stage I/II. However, despite 71% gastric BL achieving CR in the Korean study, the 2‐year OS was only 55%, which is also inferior to the outcomes of either the intestinal BL (5‐year OS of 70.2%) or the whole BL (5‐year OS of 58.1%) in our study. Interestingly, when focusing on the gastric cohort itself, we found improved survival in the recent era of 2010‐2015 compared to the earlier era of 2004‐2009 (HR = 0.529, 95% CI: 0.324‐0.865, P = .011), indicating advances in BL management have translated to outcome improvement in “real world”. However, this improvement was not observed in the intestinal cohort, possibly because of already favorable outcomes obtained for the intestinal BL in the earlier era. In contrast to the intestinal BL, there is no difference in survival between the early and advanced‐stage patients with gastric BL, possibly because the Ann Arbor staging system could not adequately describe the extent of extranodal involvement in the context of gastric patients.
| 4 | 0biomedical
| 0Study
|
286,357 |
Several statistical methodologies were used to explore the microscopic properties, including the routine analysis of MD simulations, such as structural properties and radial distribution function (RDF). In addition, the structural distortion of glucose units was analyzed in terms of free energy, and the intermolecular interactions between guest and host molecules were analyzed using the independent gradient model (IGM) (Lefebvre et al., 2017; Lefebvre et al., 2018). The specific details are provided in the following Discussion section.
| 4 | 0biomedical
| 0Study
|
48,157 |
However, it should be stressed that, even if the connection weights of the second hidden layer were random at this initial stage, learning the comparison task at the read-out layer involved a consistent amount of experience as well as explicit feedback on the response. In order to assess whether read-out would be possible even when supervised training was significantly reduced, we randomly selected only 25% of the patterns (4600 images out of the 51 200 used in the original model) for learning the comparison task. We note that this reduced amount of feedback is in line with that used in training studies with humans and other mammals, such as macaques and dolphins . As shown in figure 3b, discrimination accuracy was still remarkably high, especially for large numerical ratios. Crucially, this held also for the network with random connection weights in the second hidden layer. Read-out performance was higher—and approached human performance —after unsupervised learning.
| 4 | 0biomedical
| 0Study
|
20,798 |
Along with RSC and parahippocampal cortex, the final area to represent room information was the posterior hippocampus. The similarity in spatial encoding between these regions might be predicted from their close functional and anatomical connectivity (Kobayashi and Amaral 2003; Kahn et al. 2008; Blessing et al. 2016). It is notable that in our previous fMRI study that examined 3D spatial representation, we also found that posterior hippocampus and RSC encoded the same type of spatial information (vertical direction) while anterior hippocampus encoded a different type of spatial information (3D location) (Kim et al. 2017). In that study, different vertical directions resulted in more distinguishable views, although direction information observed in the multivoxel patterns remained significant after controlling for low level visual similarities. Our current results do not fit precisely with accounts that associate the posterior hippocampus with a fine-grained spatial map (Poppenk et al. 2013; Evensmoen et al. 2015). In fact, our findings could be interpreted as evidence in the opposite direction, namely that coarser-grained representations of the whole building engage the posterior hippocampus. Nevertheless, overall our anterior and posterior hippocampal findings provide further evidence of functional differentiation down the long axis of the hippocampus (Baumann and Mattingley 2013; Poppenk et al. 2013; Strange et al. 2014; Zeidman and Maguire 2016).
| 4 | 0biomedical
| 0Study
|
154,902 |
In Reference , the authors aimed to validate a hypothesis that COVID-19 infection could lead to serious cardiovascular diseases or maybe worse. They utilized statistical analysis by employing a multi-factorial logistic regression model to analyze COVID-19-related causes. The study was conducted on 54 patients with different ages, genders, and vital signs, where 39 were diagnosed as severe COVID-19 cases and 15 as critical COVID-19 cases. The data was collected clinically from the patients with attached vital sign measurement devices updated every four hours. Results showed that elder males, diabetic patients, and hypotension patients are more likely to develop a serious heart-related condition and need more care. Their proposed study is limited due to the small sample size, and they suggested a higher sample size to conduct a more appropriate study and verify the results.
| 4 | 0biomedical
| 0Study
|
118,532 |
The determinants associated with screening for GBS colonization or identifying risk factors (Table 3), treatment of the woman (Table 4) and treatment of the child (Table 5) show a wide variety between the four strategies. Looking at all three tables together, most determinants were reported for the combination strategy (n = 53) and the screening strategy (n = 49), followed by the risk-based strategy (n = 25) and the Dutch guideline (n = 21). The determinants were 3.6 times more often (116 times) reported as impeding than they were reported as facilitating (32 times). Most determinants were associated with the user (n = 71), followed by the guideline itself (n = 39), the organisational context (n = 34) and the socio-political context (n = 4).Table 3Determinants related to identifying risk factors or screening for GBS colonization, mentioned by care providers (n = 25)Key activitiesDeterminantsScreening strategy 1.2 Risk-based strategy1,2 Combination strategy1,2 Dutch guideline 1,2 Identifying risk factors Procedural clarity (guideline)3333Unclear definition previous child with EOGBS N N N N No standard cut-off point urinary tract infection despite guideline N N N N No standard procedure PROM (referral after 18, 24, > 24 hours) N N N N Correctness (guideline)1111Symptoms of urinary tract infection are often missed N N N N Social support by other care providers (user)2222No adequate history taking of previous child with EOGBS N N N N Not standard GBS detection in urine culture by general practitioner, therefore AB treatment not directed at GBS because status unknown N N N N Legislation and regulations (socio-political context)1111Data exchange between care providers of previous pregnancy N N N N Screening for GBS colonization (swab taking) Procedural clarity (guideline)1011Local differences in swab taking (vaginal /vs vaginal rectal /vs urine) N N N Correctness (guideline)0001Test result swab taken during birth not available in time N Compatibility with current guideline (guideline)1010Collaboration with laboratory already in place P P Personal benefits / drawbacks (user)1010Extra work for primary care midwives N N Outcome expectations (user)4040Sensitivity/specificity swab not 100% because of intermittent carrier status N N Women can adequately take swab themselves (validity culture) N/P N/P Swab result not available for every woman at time of birth N N Client/patient satisfaction (user)3030Women do not like swab taking N N Women prefer swab taking for reassurance P P Increases anxiety in women and partners N N Social support by other care provider (user)2020Data exchange culture results N/P N/P Self-efficacy (user)1010Confidence in discussing test results with women P P Knowledge (user)1010Care providers know how to take a swab P P Time available (organisational context)1010Time consuming because of providing information and swab taking N N Staff capacity (organisational context)1010Sufficient capacity laboratory personnel P P Material resources and facilities (organisational context)3030Easy to administer in primary care P P Swabs not available N N Often delay if culture taken in primary care N N Financial resources (organisational context)2020Increased costs in primary care (swab taking) N N Increased costs in laboratory personnel N N Total numbers of determinants, related to287289the guideline itself6466the user (care provider)142142the organisational context7070the socio-political context1111 1 ‘P’ = positive determinant; ‘N’ = negative determinant; ‘N/P’ = both negative and positive determinant. 2 The numbers in each row reflect how many issues related to the determinant were mentioned by the care providers Table 4Determinants related to treatment of the woman, mentioned by care providers (n = 25)Key activitiesDeterminantsScreening strategy 1.2 Risk-based strategy1,2 Combination strategy1,2 Dutch guideline 1,2 Antibiotic prophylaxis in the woman Procedural clarity (guideline)0011Logistics birth at home GBS positive mother without risk factor N No standard treatment in case of PROM/ –preterm birth and unknown results swab N Complexity (guideline)0100Easy to follow P Compatibility (guideline)0101Is already in practice P P Outcome expectations (user)4360Over treatment (IAP, hospital birth, observation baby) N N N No over treatment N P Under treatment N N Increase AB resistance problem N No increase AB resistance problem P More tailored care in case of GBS carrier ship and PROM N P Increase hospital birth/decrease home birth N N Personal benefits / drawbacks (user)0110No extra work for primary care midwives P N Client/patient satisfaction (user)0020GBS positive without risk factor: AB prophylaxis desired by woman N Suits women critical of AB prophylaxis P Staff capacity (organisational context)1111Enough capacity in hospital N N P P Material resources and facilities (organisational context)1212No problem in daily practice P P Penicillin not always available in hospital because of pharmacy policy N N N N Financial resources (organisational context)1010No reimbursement N N Total numbers of determinants, related to79135the guideline itself0212the user (care provider)4490the organisational context3333the socio-political context0000 1 ‘P’ = positive determinant; ‘N’ = negative determinant; ‘N/P’ = both negative and positive determinant. 2 The numbers in each row reflect how many issues related to the determinant were mentioned by the care providers Table 5Determinants related to treatment of the child, mentioned by care providers (n = 25)Key activitiesDeterminantsScreening strategy 1.2 Risk-based strategy1,2 Combination strategy1,2 Dutch guideline 1,2 Treatment (AB) and observation of the child Procedural clarity (guideline)4242Logistics observation child at home GBS positive mother without risk factor N/P N/P AB treatment differs between 3 to 5 days treatment N N N N AB prophylaxis preterm children not specified N N N N Personal benefits/drawbacks (user)1010Resistance hospital staff admission child and mother after birth N N Outcome expectations (user)644240% of cases are missed N N N N Increase in yield infection N N AB resistance problem N N Mother or postpartum nursing-aid can adequately observe the child at home of GBS positive mother without risk factor N/P N/P Hospital not always safe for observation child N N N N Knowledge (user)1111Postpartum nursing-aid needs training because of insufficient knowledge N N N N Financial resources (organisational context)1111Increased costs because of culture taking in the child N N N N Time available (organisational context)1111Taking cultures in a child is time consuming N N N N Total numbers of determinants, related to149127the guideline itself4242the user (care provider)8563the organisational context2222the socio-political context0000 1 ‘P’ = positive determinant; ‘N’ = negative determinant; ‘N/P’ = both negative and positive determinant. 2 The numbers in each row reflect how many issues related to the determinant were mentioned by the care providers
| 4 | 0biomedical
| 0Study
|
74,833 |
In order to handle the problems of heavy computational burden and severe noise challenge that the direct-FFT method faces, we develop an averaging-FFT method. It employs the process of statistical averaging to obtain more clear power spectrum of the incoming signal, which contributes to the significant reduction of both computation load and noise effect. This section explains the main principle of the proposed technique and presents the mathematical derivation.
| 3 | 0biomedical
| 0Study
|
277,599 |
So far, and as mentioned, oral and dental research has either focused on establishing associations between risk factors/indicators and health outcomes in cross-sectional studies (e.g., smoking status and tooth loss), or has presented associations between risk factors/indicators and caries increment (new or progressing caries lesions in an individual), periodontal disease progression (new or progressing periodontal disease sites in an individual), caries or periodontal lesion progression on site or tooth level (lesion activity), or tooth loss in longitudinally followed populations. While the former type of study is unable to infer to any predictive value (as temporal links cannot be established), the latter type may allow to test for predictions. However, it is relevant to bear in mind that finding patterns and associations in a longitudinally followed sample does not mean one can predict anything—neither for this nor for any another sample: The minimum to demonstrate a predictive value would be to develop a model on a subset (training dataset) of this sample and then test it on a separate, independent second subset (hold-out test dataset) of this sample. Only when showing that what was learnt on a subset of data allows to predict an outcome on another (unseen) subset, one should claim predictive value.
| 4 | 0biomedical
| 0Study
|
226,571 |
During the cell cycle, the levels of cyclins and cyclin-dependent kinases (CDKs) are tightly regulated. Several types of cyclin–CDK complexes function during the cell cycle, and the function is indispensable for normal cell cycle progression, appropriate induction of cell cycle arrest, and cell survival. The level of CDKs remains relatively constant, but the level of cyclins oscillates. Cyclins synthesize, bind, and activate CDKs that are then destroyed . Importantly, CDKs cannot be activated without the interaction with cyclins.
| 4 | 0biomedical
| 1Other
|
165,041 |
In our study we found evidence for differences between social and aspirational congruence as well as evidence for differences with respect to gender and subject area. Thus, our study supports the conclusion of Nguyen et al. (2016) that discipline-specific approaches are necessary when analyzing factors for university success and retention. Notably, our results also suggest that gender is an important factor to be considered.
| 2 | 2other
| 0Study
|
69,337 |
We recently showed that the clinically used autophagy inhibitors CQ and HCQ are not effective in blocking autophagy in the acidic environment of human tumors . This effect was associated with a complete lack of cytotoxicity in acidic conditions in several cancer cell lines. In search of new autophagy inhibitors active also in acidic conditions we focused on SAL, an acidic ionophore compound used as anticoccidiosis in veterinary medicine. SAL was reported to induce cell death via autophagy upregulation in some experimental models [45, 46]. However, it was recently reported that 2 μM SAL inhibits the autophagic flux in breast and hepatocellular carcinomas [43, 47]. In order to establish the activity of SAL on autophagic flux, we started our investigation by using HOS cells stably transfected with a GFP-LC3 vector, which allows the analysis of the autophagic flux by flow cytometry by monitoring the accumulation of GFP-LC3-positive autophagosomes in the presence of lysosomal inhibitors . BafA1 acts as inhibitor of the V-ATPase and raises lysosomal pH, thus inhibiting autolysosomes formation and leading to accumulation of GFP-LC3-positive autophagosomes. The autophagic flux here represents the ratio of GFP-LC3 fluorescence between presence and absence of saturating concentration of Bafilomycin A1 (BafA1). First, we observed that HOS-GFP-LC3 cells treated with 2 μM SAL for 6 hours accumulate a large number of intracellular vacuoles, with cells cultured at pH 6.8 showing an increased vacuolization with respect to cells kept at pH 7.4 (Figure 1A). As expected, autophagosomes-associated LC3-GFP fluorescence was increased in control cells treated with BafA1 at both pH conditions, indicating the presence of proficient autophagy in both pH conditions (Figure 1B), with autophagic flux being 2.2±0.23 and 2.2±0.36, respectively at pH 7.4 and 6.8. A significant increase in GFP-LC3 fluorescence was observed also in cells treated only with SAL in both pH conditions. The combined treatment with BafA1 showed only a minor increase in cells at pH 7.4, indicating that SAL reduces the autophagic flux without blocking it (1.5±0.1). Conversely, in cells kept at pH 6.8 and treated with SAL the GFP-LC3 signal intensity was similar in presence or absence of BafA1, suggesting that in HOS cells in acidic conditions SAL totally blocks the autophagic flux (1±0.1, Figure 1B). To further test the dose-dependent effects of SAL in these cells we used high-content fluorescence microscopy to quantify the number of GFP-LC3-positive vesicles in cells treated with different doses of SAL in absence or presence of BafA1. The data show that SAL induces a dose-dependent accumulation of GFP-LC3-positive vesicles (Figure 1C-1D) and that at 1-2 μM SAL the number of GFP-LC3-positive vesicles in BafA1 treated and untreated cells is similar, thus suggesting that SAL inhibits autophagic flux (Figure 1E).
| 4 | 0biomedical
| 0Study
|
198,928 |
MetRS∗-transduced MSCs were incubated in 1 mM ANL for 24 h and lysed in RIPA buffer supplemented with protease inhibitors (Sigma, United States); then, total protein was collected, and the Click-iT reaction was performed with a Click-iT Protein Reaction Buffer Kit (Invitrogen, Waltham, MA, United States) as directed by the manufacturer’s instructions. Briefly, up to 200 μg of ANL-labeled protein was reacted with 100 μL of Click-iT reaction buffer containing alkyne-Cy7 and copper-sulfate catalyst in a rotator for 20 min. Methanol and chloroform were added to remove residual reaction components and precipitate the proteins; then, the precipitated proteins were solubilized in Laemmli buffer and loaded for gel electrophoresis. Gels were immediately imaged with a ChemiDoc MP Imaging System (Bio-Rad, California, United States) under both stain-free mode and Cy7 mode.
| 4 | 0biomedical
| 0Study
|
338,185 |
Phylogenetic illustration of the 505 predicted laccases/MCOs in the representative dataset. (Sub)clades were collapsed as triangles where applicable. Classification of (sub)clades, molecular function, and taxonomic distribution were displayed alongside of the phylogenetic tree. The number of sequences for each subclade was shown in parenthesis next to the clade notation.
| 3 | 0biomedical
| 0Study
|
300,499 |
This retrospective study evaluated the utility of CT-derived radiomics for the prediction of factors relevant to the prognosis and therapy selection in patients with TET. The discriminatory performance was good for predicting histologic subtype and TNM stage, and poor for the detection of myasthenia gravis.
| 4 | 0biomedical
| 0Study
|
288,405 |
The above two pending issues are tackled below by shifting the focus from ZnSe-based systems to the leading percolation-type ZnTe-based one, i.e., Zn1−xBexTe. Both its Be- and Zn-based Raman doublets are expected to close under pressure10, just like with Zn1−xBexSe, so that a critical comparison is possible. Moreover, the zone-edge two-phonon acoustic bands are detuned from the zone-center Raman signal in ZnTe13,18. Hence we have good hope to achieve a reliable experimental insight into the pressure dependence of the (compact) Raman doublet due to the long Zn-based bond.
| 4 | 0biomedical
| 0Study
|
113,870 |
Using FISH with (TTAGGG)5 probe we have identified the karyotypes of 394 tadpoles total. Number of analyzed tadpoles in different clutches varied from 100% of surviving tadpoles (i.e. all surviving tadpoles were analyzed) in crosses 1_2013, 3_2013, 5_2013, 13_2014 to approximately 25% (i.e. about quarter of all obtained tadpoles were analyzed) in crosses 4_2013, 2_2013. We analyzed genomes transmitted in growing oocytes of 3 diploid and 9 triploid hybrid females used in the crossing experiments (Figs. 1, 2). Additionally, we have identified the genome composition of the oocytes in 3 diploid hybrid females used in crossing experiments and 3 triploid hybrid females that were not used in the crossings (Additional file 3: S1). Lampbrush chromosomes were identified according to earlier constructed cytological maps for both parental species (P. ridibundus and P. lessonae) [25, 28].
| 4 | 0biomedical
| 0Study
|
324,631 |
Locate the raw sequencing file (fastq.gz) in a directory named 1.Raw_data. Example files are available through the Github repository of STATR (https://github.com/robinald/STATR). Full files of previous studies are available via the European Nucleotide Archive (https://www.ebi.ac.uk/ena/data/view/PRJEB21199) (Choe et al., 2019).
| 3 | 0biomedical
| 1Other
|
218,312 |
Concerning Kaplan–Meier analysis, with clone QR, the low bud/high TIL group was the only group that showed a significantly longer DFS and OS in the case of overall PD-L1 positivity compared to PD-L1-negative cases (p = 0.045 for DFS and p = 0.049 for OS), whereas no differences were seen for TPS and IC as well as the other three budding/TIL groups. Kaplan–Meier analysis for OS for the low budding/high TIL group is shown as Fig. 2.Fig. 2Kaplan–Meier analysis showing overall survival (OS) for the low budding/high TIL group dependent on PD-L1 overall positivity (TPS and/or IC positive) with clone QR. The difference between the PD-L1-positive cases (blue) and the PD-L1-negative cases (green) was statistically significant (p = 0.049)
| 4 | 0biomedical
| 0Study
|
293,414 |
Across 7 VSD sites, we identified 7343 pregnancies that ended between October 26, 2015, and November 15, 2018, among girls and women with continuous insurance enrollment and 1 or more 4vHPV or 9vHPV vaccine exposures from 12 months before LMP through 20 weeks after LMP. We excluded 154 pregnancies (2.1%) because they received no pregnancy-related care or did not receive an HPV vaccine in the VSD health system. From the 7189 pregnancies remaining, we excluded 2130 (29.6%) because of a noneligible pregnancy outcome, 148 (2.1%) because of exposure to a teratogenic or abortifacient medication, and 3418 (47.5%) because their vaccine exposure did not occur during the pregnancy, peripregnancy, or in the distal window (Figure 2).
| 4 | 0biomedical
| 0Study
|
304,479 |
Brain tissue from male and female Alzheimer's disease subjects (n = 10) between 72 and 96 years of age (average age = 86.5 years at necropsy) were included in this study. Tissue was acquired from the Wisconsin Alzheimer's Disease Research Center (ADRC) brain bank, and comprised cases from the ADRC clinical core. All cases had a postmortem diagnosis of AD following the National Institute of Aging and the Alzheimer Association criteria for neuropathological AD (Hyman et al., 2012). Frozen tissue was sectioned and fixed in 10% neutral‐buffered formalin prior to histological analysis.
| 4 | 0biomedical
| 0Study
|
81,854 |
Recent genome-wide screens of siRNA demonstrate that depletion of various splicing factors results in defective repair of DNA double-strand breaks and genomic instability.9, 10 To examine whether downregulation of RNF8 could be the critical event in this context, we knocked down SF3B1 (component of U2 snRNP), pre-mRNA processing factor 8 (PRPF8) (component of U2 and U12 snRNPs) and RNA binding motif protein, X-linked (RBMX) (regulates alternative splicing), splicing-related proteins whose depletion was associated with defective repair in both screens. In all three cases, we observed the downregulation of RNF8 and significantly attenuated ubiquitylation of damaged chromatin (Figures 4a and b; Supplementary Figures S6a and b), confirming the involvement of these factors in the ubiquitin response critical for repair of DNA double-strand breaks.
| 4 | 0biomedical
| 0Study
|
368,698 |
Ninety-six-well polystyrene microtiter plates were purchased from Xiangyushun High Polymer Material Technology Development Tianjin Co., Ltd. (Tianjin, China). Cell culture plates were purchased from Costar (Corning, NY, USA). A direct-heat CO2 incubator (311), UV-Vis spectrophotometer (NanoDrop 2000), and microplate reader (Multiskan FC) were purchased from Thermo (Waltham, MA, USA). An electric-heating constant-temperature incubator (ZXDR-2800) was purchased from Shanghai Zhicheng Analytical Instrument Manufacturing Co., Ltd (Shanghai, China). An Agilent 1260 HPLC system was obtained from Agilent (Agilent Technologies, Santa Clara, CA, USA). Rheum officinale samples were collected from different regions of China.
| 1 | 0biomedical
| 1Other
|
209,526 |
Bambouskova et al. (73) described a mechanism whereby itaconate and iNOS synergize to tolerize late NLRP3 inflammasome activation using a model of longer LPS priming (12–24 hours) followed by signal 2 (the late inflammasome). Both caspase-1 and IL-1β processing was present in late inflammasome–induced Irg1–/– BMDMs, while wild-type BMDMs were unable to process caspase-1 and IL-1β at the later time point because of tolerance. In contrast to Hooftman et al., this study suggests that itaconate is acting downstream of ASC speck formation, as wild-type BMDMs activated classically had levels of ASC speck formation similar to those in tolerized macrophages (73). Additionally, GSDMD cleavage and pyroptosis were restored upon late inflammasome activation in Irg1–/– BMDMs, whereas these were completely abrogated in wild-type BMDMs. Interestingly, the addition of cell-permeable glutathione ethyl ester to wild-type BMDMs rescued IL-1β secretion upon activation of the late inflammasome, suggesting that electrophilic stress or thiol reactivity may be responsible for inflammasome tolerance induced by itaconate. To further ascertain the mechanism, a proteomic screen was performed, which identified numerous potential targets for itaconate during late inflammasome activation. Most notably, cysteine 77 of GSDMD was identified as a possible target of itaconate. Although GSDMD is traditionally understood to be downstream of caspase-1, caspase-1 activity upon late inflammasome activation was largely GSDMD dependent, suggesting that GSDMD may be required for late inflammasome activation and the processing of caspase-1. Therefore, it is reasonable to consider the alkylation of GSDMD by itaconate as a potential mechanism of NLRP3 inhibition by itaconate.
| 5 | 0biomedical
| 0Study
|
110,375 |
5) The authors mention in the Discussion that the 5 genes are altered in 37% of breast cancers, but do not offer describe any specifics of whether the data suggest oncogenic activation (e.g., amplification and over-expression), tumor suppressor inactivation (e.g., nonsense, frameshift inactivating), or simply passenger mutations. How do the cancer data clarify how the genes are connected in any way to PI3K signaling or one another?
| 4 | 0biomedical
| 1Other
|
141,170 |
One participant (ID:05) did not feel adequately taken care of at the hospital. She experienced a lack of coordination and had been misinformed about where and when to meet on the day of her surgery, leading to unnecessary long waiting. She further explained that the postoperative care was lacking as well, and she had not been given analgesics or a postoperative follow-up by the time of the interview.
| 2 | 1clinical
| 1Other
|
290,169 |
Next, we tested niflumic acid (NIFA), which has been described as a selective inhibitor of COX-2, with IC50 values of 16 and 0.1 µM for COX-1 and -2, respectively . We tested NIFA at 0.5 and 5 µM. As Figure 4D shows, the values of X¯SC obtained from these assays were: control (2.3 ± 0.1, n = 60), NIFA0.5 µM (2.3 ± 0.1, n = 55), NIFA 5 µM (2.3 ± 0.1, n = 59), ouabain (4.9 ± 0.1, n = 60), ouabain + NIFA 0.5 µM (2.8 ± 0.1, n = 65), ouabain + NIFA 5 µM (2.6 ± 0.1, n = 63). As can be seen, NIFA significantly abolished (p < 0.001) the ouabain-induced effect from the concentration of 0.5 µM, reducing the response to be undistinguishable from control (p = 0.02), so that there is little additional effect at 5 µM. This supports the idea that COX-2 is the enzyme responsible to produce the compound that in turn induces increased GJIC in MDCK-I cells treated with CM.
| 4 | 0biomedical
| 0Study
|
189,364 |
Many HCC patients suffer from macroscopic vascular invasion. It should be an intrahepatic lesion but still indicates a tendency of distant metastasis. Because extrahepatic micrometastasis is difficult to find, single local therapy may not be enough to treat such kind of HCC. So, people have introduced several therapies including SOR. The latter is one oral systemic agent which has been adopted to treat advanced HCC for more than 10 years . It is able to inhibit the development of both intrahepatic lesions and potential metastasis lesions in the body and has achieved satisfactory efficacy.
| 3 | 0biomedical
| 1Other
|
20,660 |
The pre-processing stage consists of noise filtering and rectification. First, the input event streams from each of the two sensors are individually noise filtered. A simple nearest neighbor filter was used, which filters out an event if no neighboring pixels generated an event in the preceding 30 ms (Czech and Orchard, 2016). Second, rectification is performed.
| 2 | 0biomedical
| 1Other
|
144,696 |
In conclusion, this study first elucidated the initial defensive secretory compounds emitted from the live millipedes. In particular, the monoterpenes induced apoptotic cell death. The millipede accumulates these cytotoxic monoterpenes derived from plant secondary metabolites and they would be used as defensive substances against predators as well as the chemical defense of plants.
| 4 | 0biomedical
| 0Study
|
339,801 |
Statistical heterogeneity was assessed using I2 statistic, assuming that values of 25%, 50%, and 75% suggest low, moderate, and high heterogeneity, respectively . The robustness of the results was examined by inspecting potential outliers using influence analyses (DIFITS, Cook’s distance, and COVRATIO statistics) . Findings from these analyses also served to examine whether a particular study may be accounting for a large proportion of heterogeneity.
| 4 | 0biomedical
| 0Study
|
339,677 |
Furthermore, co-expression of both transporters, ASCT2 and LAT1, has also been identified as an independent prognostic factor for lung adenocarcinoma and surgically resected esophageal squamous cell carcinoma . In fact, the combined expression of the transporters presented an overall poorer prognosis compared to the single-positive expression of ASCT2 or LAT1 in both models .
| 4 | 0biomedical
| 0Study
|
381,152 |
To test the proposed approach, and in particular the performance of BICH and AICH (Equations (5) and (6)), a series of systematic numerical tests has been performed. Synthetic data have been generated for four main families of models: polynomials, power law monomials, exponentials and power law monomials multiplied by squashing terms. Therefore, the basic functions, typically used in building deterministic models for the exact sciences, have been considered . Consequently, for coherence sake, the notation is typical of physics and chemistry; y indicates the dependent variables and x the generic regressor, which can be thought of as time or any other suitable quantity. The number of parameters of each model is indicated with k and includes the exponents and the multiplicative constants of the independent variables and their functions. As examples, in the accounting used in the paper, the number of parameters of a simple exponential a exp(bxc) is 3, as for a sine function a sin(bxc). In the case of power laws and polynomials, of course, the number of parameters is the sum of the coefficients and the exponents of the various terms.
| 4 | 0biomedical
| 0Study
|
82,273 |
When we made such a PIM-rewired HIV-1 genome in silico, it was immediately obvious that certain domains of the HIV-1 genome do not allow many changes, e.g. the Tat–Rev–Env region with gene overlaps (results not shown). One could even envisage an extension of this in silico survey by screening for the absence A nucleotides in this otherwise A-rich genome. These segments may encode yet unknown sequence motifs.
| 2 | 0biomedical
| 0Study
|
24,516 |
In this study, the stable collagen hydrolysate of Alaska pollock skin was prepared by successive simulated gastrointestinal digestion. The DHs, molecular weight distributions, amino acid compositions and antioxidant activities in vitro were evaluated. With the simulated gastrointestinal digestions, The DHs and antioxidant activities increased obviously. An antioxidant fraction (A1a3c–p) was purified by gel filtration chromatography, ion exchange chromatography and high performance liquid chromatography, and the IC50 value of hydroxyl radical scavenging activity was 7.63 μg/mL. Furthermore, four key peptides of A1a3c–p, including YGCC, DSSCSG, NNAEYYK and PAGNVR, were analyzed by high resolution mass spectrometry combined with de novo software and UniProt of MaxQuant software. This paper could provide some help for the application of fish skin collagen and the identification of key peptides from protein hydrolysates.
| 4 | 0biomedical
| 0Study
|
94,230 |
Following the resolution and identification of the 50 lettuce metabolites, the peak areas of the same MCR-ALS component profiles in every sample and for all components and treatments were arranged in a data table. This data table with the 50 metabolite peak areas for the 20 lettuce samples (X data block) was then correlated to the 5 morphological and physiological plant parameter responses in the 20 lettuce samples (Y data block) using PLS2 (see Method section). The X and Y data blocks were auto-scaled before PLS2. Cross-validation (CV) was used to test the number of significant latent variables (LVs) needed in the PLSR correlation model in a practical and reliable way. Ultimately, 4 LVs were considered in the model. The cumulative captured variances were 85.5% for the X block and 79.8% for the Y block. Table S1 shows the explained variance by LV.
| 4 | 0biomedical
| 0Study
|
243,531 |
In order to identify protein pathways modulating endogenous tau protein levels, we employed an unbiased high throughput CRISPR pooled screening strategy21 using an SH-SY5Y neuroblastoma cell line. Several candidate genes were then validated in human excitatory neurons. Additional in vivo validation of tuberous sclerosis protein 1 (TSC1), a critical component of the mTOR pathway, demonstrated that negatively regulates tau levels in neurons and in the brain. Hence, we provide a useful resource that has identified pathways and candidate genes that modulate the overall levels of tau protein in neurons, and could help in future identification of novel therapeutics for AD.
| 4 | 0biomedical
| 0Study
|
308,748 |
Cell viability was detected by CCK8 assay. 3,000 cells were seeded into each well of 96-well plates. After 0, 24, 48, 72, or 96 h of culture, CCK8 solution (Cell Counting kit-8, Dojindo, Kumamoto, Japan) was added to each well and the cells were further incubated at 37 °C for 1 h. The optical density (OD) was measured at 450 nm with a microplate reader.
| 4 | 0biomedical
| 0Study
|
253,499 |
Employed strategy for the automated assignment of 22 serum/plasma metabolites. (a) 1H NMR/SMolESY spectra are calibrated to the glucose anomeric proton doublet. Signals corresponding to the 1H highlighted in red font are used for assignment/quantitation of all metabolites. The glucose doublet and metabolites in the green boxes are assigned by pattern recognition (e.g., by imposing J-coupling constraints) in previously defined spectral windows with a width ≥0.01 ppm at 600 MHz. (b) Simple correlations, based upon 4023 plasma/serum unique spectra, with alanine and lactic acid methyl group signals are used as assignment constraints for metabolites in gray squares, which cannot otherwise be assigned using J-coupling constraints because they present either singlets or multiplets whose SMolESY components have a high risk of overlap (Table S2 and Figure S2). (c) Glycine singlet assignment is further supported by the minimization of the predefined spectral window owing to the decrease in line broadening achieved via SMolESY (≤0.004 ppm at 600 MHz). (d) Assignment of creatinine requires all previous constraints plus (e) extra correlations between intra molecular 1H NMR spin systems (e.g., between the −CH3 and −CH2 groups of creatinine). (f) The singlets from acetic acid, acetone, and formic acid were not found to significantly correlate with any other abundant metabolite; however, the predefined windows for these metabolites’ signals were sufficiently narrow (≤0.006 ppm for acetone/acetate and ≤0.008 ppm for formic acid) following spectral calibration to glucose which, combined with SMolESY and the general homeostatic nature of blood matrices, allows for their reliable identification.
| 4 | 0biomedical
| 0Study
|
277,113 |
Outside air temperature measurements near the entrance to Pivka Jama were compared with historical surface measurements in front of Postojnska Jama (Fig. 1) and also for Predjama Cave, since the latter is expected to have similar climatic conditions. The distance between Postojnska Jama and Predjama Cave is about 15 km as the crow flies.
| 1 | 2other
| 0Study
|
90,828 |
Our setup consisted of a conductive tactile device with a camera mounted on it that captures the contingent visuo-tactile signals from the experimenter’s hand moving above the artificial tactile sheet and continuously touching it on one point with a metallic weight, see Fig. 1(b). The experimenter was free to move his hand in all directions at a variable speed for a period of 5 minutes and at a system sampling rate of 30 Hz. New This sampling rate is low due to the signal processing done by the device but it is enough for detecting tactile displacement below the centimeter by the neural network. The raw incoming signals are sent to the neural networks, which then attempt to combine the visuo-tactile signals; see Fig. 1(a).
| 4 | 0biomedical
| 0Study
|
84,365 |
Listeria monocytogenes, a Gram-positive bacterium, infects a wide range of cell types, such as macrophages and epithelial cells, and causes listeriosis in humans. It can cross the intestinal, placental, and blood-brain barriers, leading, respectively, to gastroenteritis, maternofetal infections, and meningoencephalitis8. Early resistance to infection is attributed to the production of interferon-γ by natural killer cells and the resultant activation of macrophages9. Macrophages are generally thought to be the principal cells responsible for the killing of L. monocytogenes. Unfortunately, a key feature of the virulence of L. monocytogenes is its ability to evade the killing mechanisms of professional and non-professional phagocytic host cells, especially macrophages. It is therefore of great value to investigate the mechanisms by which L. monocytogenes escapes from macrophage-mediated immune defense10.
| 4 | 0biomedical
| 0Study
|
313,575 |
The mice were divided into four groups; saline/saline (n = 5), saline/AngII (n = 5), CGA/AngII (n = 5), and CGA/AngII/ZnPP (n = 5). Saline or AngII (1000 ng/kg/min) was infused via Alzet mini-osmotic pumps for 14 days. Mini-osmic pumps were implanted subcutaneously on the right flank, as described previously . In the CGA group, the mice were administered 40 mg/kg/day CGA via oral gavage for 14 days from the initial day of AngII infusion. In other groups, mice were given saline via oral gavage for 14 days from the initial day of AngII infusion. ZnPP (20 μg/mouse) was injected into the peritoneal cavities every other day for 14 days from the initial day of AngII infusion. All mice were sacrificed 14 days after AngII infusion .
| 4 | 0biomedical
| 0Study
|
277,696 |
We examined 210,907 projects spanning over a period from October 2015 to June 2020, from the Qingsong Chou platform and performed a preliminary analysis on the set of projects. Figure 1a illustrates the probability distribution of campaign donating counts nE. One can observe that most of the crowdfunding campaigns receive less than one thousand donations. The frequency of fundraising days is shown in Figure 1b. As the default setting of the fundraising days is 30, nearly 95% of the campaigns raise money within one month. Usually, the patients urgently need to pay their medical expenses and are allowed to both stop money collections and withdraw funds at any time. Thus, one can see that more than 50% of the campaigns take less than two weeks to raise funds. We also illustrate the contour plots of donating counts nE with respect to the elapsing days Δt in Figure 1c. It is observed that the darkest belt nearly exhibits a remarkable power-law behavior, wherein nE decays from to less than 10 within ten days. We further counted the number of projects whose donating counts were greater than 100 on each elapsing day and the corresponding number of projects #(nE>100) are plotted with respect to the elapsing days Δt in Figure 1d. We found that #(nE>100) sharply decreases with the increment of elapsing days. This indicates that the underlying diffusing process of crowdfunding projects usually dies out within several days. Thus, we only concentrated on the daily donating activities containing more than 100 events for a given crowdfunding project in the following analysis, as this ensures the obtaining of a reliable calibration .
| 4 | 0biomedical
| 0Study
|
154,652 |
Treatment-related fatigue should also be addressed, and is not limited to the use of corticosteroids. Fatigue has been found to be one of the main causes of methotrexate non-adherence in quantitative studies, although evidence from qualitative studies demonstrates a variation in patients’ experiences of fatigue when taking this drug .
| 4 | 0biomedical
| 2Review
|
145,738 |
By the administration of a contrast agent in DCI-MRI, different enhancement techniques could be identified. Benign lesion is indicated by a slow, continuous enhancement curve (type I), and benign/malignant lesion is indicated by a medium or strong enhancement followed by a plateau (type II). Type III, which is represented by fast initial enhancement and washout, is characteristic of malignancies that occur due to increased vascular permeability and interstitial fluid . Montemurro et al. have studied 75 patients of breast cancer who underwent DCE-MRI followed by core biopsy and found a statistically significant association between features of DCE-MRI and histopathological characteristics of the tumor .
| 4 | 0biomedical
| 0Study
|
134,180 |
Nakamura et al. analyzed 236 HP-negative cases with gastric disease but without a history of HPE, in which the HP-negative status was confirmed by negative results in rapid urease test, histological examination, and polymerase chain reaction (PCR) for detecting HP . They found that 49 cases were positive for NHPH, including Helicobacter suis (n = 20), H. heilmannii sensu stricto/H. ailurogastricus (Hhss/Ha) (n = 7), and non-Hhss/Ha (n = 22) . Among 49 cases of NHPH, 11 were diagnosed with gastric MALT lymphoma (four with H. suis, two with Hhss/Ha, and five with non-Hhss/Ha) . In a recent analysis of first-line HPE in 182 patients with gastric MALT lymphoma, Takigawa et al. showed that HP-negative patients had a higher prevalence rate of NHPH than HP-positive patients through Helicobacter sp.-specific PCR assay (16/29 [55%] vs. 3/29 [10%], p < 0.05) . Among 16 HP-negative NHPH-positive cases, five were positive for H. suis, eight for H. bizzozeronii, and three for both H. suis and H. bizzozeronii . Furthermore, among patients with neither HP infection nor BIRC3-MALT1 fusion protein, positive NHPH cases had a higher CR rate than those with negative NHPH (12/16 [75%] vs. 3/13 [23%], p = 0.0092) . These findings suggest that NHPHs are linked with the development of certain HP-negative gastric MALT lymphomas, and eradication of NHPH by first-line HPE can eradicate this subtype of gastric MALT lymphoma. Further large studies to assess the prevalence of NHPH in patients diagnosed with HP-negative gastric MALT lymphoma are warranted.
| 4 | 0biomedical
| 0Study
|
328,107 |
Based on the above, and the regulatory implications of Ames test results, it was considered beneficial to extend the aforementioned database to include Ames-negative substances. With this objective, a compilation of Ames-negative data was initiated, leading to a robust and highly curated database of 211 Ames-negative substances. The complementary data included in the database, corresponding to other genotoxicity endpoints in vitro and in vivo, as well as carcinogenicity results, has resulted in a database with approximately 6000 test results. This Ames-negative database is user-friendly and freely-accessible (Supplementary Table 1).
| 4 | 0biomedical
| 0Study
|
191,659 |
Of all the antimalarial medicinal plants studied from 2011 to 2020, very few have their active principles isolated and characterized, such as Coptis japonica, Heinsia crinata, Piper peltatum and Murraya koenigii. Some of the active principles have been previously isolated from other plants while others are novel. Most of the studies carried out on the active principles are mainly in vitro studies. This is partly due to the fact that these compounds were isolated in small amounts that allowed only in vitro studies, not a main focus of this review. To overcome such bottle-neck, it is important to start the process of isolation of compounds using large amount of plant materials. The isolated compounds evaluated for in vivo antimalarial activities were: 1) Coptisine Chloride from Coptis japonica, (Teklemichael et al., 2020); 2) 4-Nerolidylcatechol isolated from Piper peltatum (Rocha e Silva et al., 2011); and 3) Myristic Acid and β-Caryophyllene from Murraya koenigii (Kamaraj et al., 2014) (Tables 2, 3).
| 4 | 0biomedical
| 2Review
|
155,931 |
Co-expression network analysis can reveal potential associations between genes and regulatory factors, which undoubtedly helps us to search for potential downstream regulatory genes of CsABF and uncover the association between them to co-create the response network of drought stress. All candidate genes in Figure 6 were further validated by qRT-PCR to confirm that their expression patterns were indeed consistent with the corresponding ABF TFs. Therefore, mining the functions of these genes will help us understand how woody plants differ from herbaceous plants in responding to drought stress.
| 4 | 0biomedical
| 0Study
|
165,204 |
The impact of PDI activity was also investigated on early-stage biofilm, i.e., on biofilm formation. Firstly, we tested the impact of light and dissolved minerals in water on biofilm formation, and no difference could be observed between irradiated and nonirradiated samples and between water samples of different hardness. The only difference could be seen on the sample irradiated in DEMI, where a 1-log decrease was detected (Figure 10).
| 3 | 0biomedical
| 0Study
|
36,627 |
In a study from our group of ninety patients followed-up after treatment for CIN with conization via LEEP using a C-LETZ electrode, the presence of high-risk HPV genotype predicted all five cases of residual high-grade squamous intraepithelial lesion/CIN 2+, and the lack of persistent high-risk HPV infection was the most specific indicator of absence of recurrent or residual high-grade disease . A subsequent follow-up study of 149 patients showed that high-risk HPV predicted all cases of treatment failure among the women with high-grade disease . Moreover, a recent 5-year longitudinal investigation from Northern Italy of 310 patients with CIN2+ indicates that none of the 172 women with a negative HPV DNA test at six-months post-treatment had residual or recurrent CIN2+ during the two-year surveillance period. Thus, the authors conclude that that HPV DNA is highly predictive of disease eradication.
| 4 | 0biomedical
| 0Study
|
10,689 |
The sequence from Arg103 to Ser124 in the preS domain of the L protein is highly conserved among different HBV isolates. These 22 amino acid residues are involved in interaction with core particles leading to virion formation . Alignment of 2224 sequences of genotype B and 2227 sequences of genotype C available from the HBV database revealed genotype specific variations at two positions within this sequence , with most genotype B isolates having L108 (92.6%) and T115 (98.0%), in contrast to I108 (99.7%) and S115 (98.0%) found in genotype C isolates. To establish the impact of these two divergent positions on virion secretion, they were exchanged between clones of the two genotypes in the context of the 1.1mer construct. While the point mutations did not affect genome replication in either Huh7 or HepG2 cells (Figure 4A; Supplementary Figure S2A), the L108I/T115S substitutions increased virion DNA for the two genotype B clones in both cell lines (Figure 4C; Supplementary Figure S2C). Conversely, virion secretion in the two genotype C clones was diminished by the I108L/S115T substitutions. Therefore, the amino acid sequence difference at these two positions in preS1 domain of L protein at least partly accounts for different virion secretion efficiencies between the two genotypes.
| 4 | 0biomedical
| 0Study
|
158,966 |
Depression is considered one of the main causes of disability worldwide and plays a critical role in the global burden of disease at all ages (Arthur et al., 2020 ▶). Researchers used Forced Swimming Test (FST) and Tail Suspension Test (TST) to evaluate the antidepressant effects of hydroalcoholic extracts obtained from Z. tenuior, fluoxetine, and imipramine on immobility, climbing, and swimming in vivo. The findings indicate that different doses of the extract decreased the duration of immobility in the FST and TST. In other words, exposing animals to the Z. tenuior extract in a dose-dependent manner increases the duration of swimming, similar to that of fluoxetine. Since fluoxetine is also a serotonin reuptake inhibitor, this extract probably reinforces the serotonin neurotransmission. Although few studies have evaluated the antidepressant effects of this extract, some existing data confirm such an effect (Gharetapeh et al., 2014 ▶).
| 4 | 0biomedical
| 0Study
|
161,397 |
A process flow chart of the proposed fabrication process is shown in Figure 1. In the beginning, ultrathin chips were bonded face-up onto polyimide foil. Afterwards, the chip was covered in solder mask resist using conformal coating. Solder mask resist was locally removed in the area of the chip contact pads by photolithographic processes and cured. The chip contact pads were electrically connected and conductive tracks were formed by inkjet printing of silver and gold ink. Each element of the proposed process is explained in detail in the following subsection.
| 4 | 0biomedical
| 0Study
|
234,079 |
First, we studied the nature of distribution of our variable with the Shapiro–Wilk test. Since the results (Table 2) indicate distributions that do not follow the normal distribution, we performed non-parametric tests afterwards. Second, to study the effect of time on anxiety, depression, coping and health concerns, repeated measures ANOVAs with a Friedman test were performed. Theses analyses were conducted only on participants who responded to all measurement times. Third, to analyze the associations between coping strategies, health concerns and symptoms, we ran Spearman correlations analyses for each timepoint. Since our data do not follow the normal distribution, only non-parametric tests were performed.
| 4 | 0biomedical
| 0Study
|
212,475 |
LRBFCM interpolates the temperature field in the thermal model, and the governing equation is solved through explicit time stepping. The time step is chosen as 1 ms. The nodes of the mechanical and thermal models coincide. The solution is obtained through local interpolation for each influence domain without creating a global matrix. In the mechanical model, interpolation of displacement filed over each local influence domain can be assembled into a global solution matrix (A) by replacing the local collocation coefficients with the inverse of the local interpolation matrix and the local displacement vector. Hence, the system of equations can be written in the following form (7)AU=B, and solved for global column matrix of displacements U=[ux1,uy1,……,uxN,uyN]T with the size of two times the number of collocation nodes (2N). The adjacent vector B includes the boundary values. As a result of the nonlinear material model of steel, the solution matrix A depends on the current state of displacements. The solution can only be achieved iteratively. In this paper, a direct iteration method was chosen due to its simplicity and to avoid assembling the Jacobian matrix. The local solution of the system of equations leads to a sparse matrix A, and with the help of the Intel math kernel library , it can be solved efficiently by direct iteration with iteration index j. (8)A(Uj)Uj+1=B,
| 4 | 0biomedical
| 0Study
|
9,186 |
All examples discussed until this point consisted on s gates whose effect can be understood as a permutation of the basis elements. Let us consider now a different scenario in which the operations in the target subspace are phase gates, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${s}_{i}=1-\mathrm{2|}i\rangle \langle i|$$\end{document}si=1−2|i〉〈i|, therefore, the complete unitary operation reads \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$U=\sum |i\rangle \langle i|\otimes \mathrm{(1}-\mathrm{2|}i\rangle \langle i|)$$\end{document}U=∑|i〉〈i|⊗(1−2|i〉〈i|) with \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$i\in \mathrm{[1,}n]$$\end{document}i∈[1,n]. If we choose the reference target states to be,12\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$|{\rm{in}}\rangle =\frac{1}{\sqrt{2}}(|1\rangle +|n\rangle ),\quad |{\rm{out}}\rangle =\frac{1}{\sqrt{2}}(|1\rangle -|n\rangle ),$$\end{document}|in〉=12(|1〉+|n〉),|out〉=12(|1〉−|n〉),we know a priori that the only solution is given by \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$s=1-\mathrm{2|}n\rangle \langle n|$$\end{document}s=1−2|n〉〈n| associated to control \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$|c\rangle =|n\rangle \langle n|$$\end{document}|c〉=|n〉〈n|. We perform a numerical experiment to analyze how the initial equally weighted control state, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\frac{1}{\sqrt{n}}\sum |i\rangle $$\end{document}1n∑|i〉, converges to the solution under the action of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${H}_{1}=-2\sum |i\rangle \langle i|\otimes |i\rangle \langle i|$$\end{document}H1=−2∑|i〉〈i|⊗|i〉〈i| depending on the dimension of the system. See Fig. 5 for the simulations. The results show that our algorithm is particularly efficient for this selection of Hamiltonians, given that the solution is reached in \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$O(\sqrt{n})$$\end{document}O(n) for all the cases studied.Figure 5Learning curves for phase gates. (a) We plot the fidelity of the learning process as a function of the number of episodes for the problem of finding the appropriate phase gate.
| 4 | 2other
| 0Study
|
31,361 |
The mean SAS area of macular synapses was smaller (mean ± SEM = 61,737.72 nm2 ± 606.10) than horseshoe-shaped synapses (148,469.66 nm2 ± 6321.63; MW test, p < 0.001) and the mean SAS area of horseshoe-shaped synaptic junctions was smaller than that of perforated synapses (176,710.07 nm2 ± 5875.00; MW test, p = 0.005; Table 3). Despite the differences in the mean SAS areas, perforated and horseshoe-shaped synaptic junctions were intermingled with the predominant macular synaptic junctions (Figs. 5, 6). The perimeter of macular synapses was shorter (1,423.96 nm ± 10.22) than horseshoe-shaped synapses (3,124.70 nm ± 107.62; MW test, p < 0.001) and perforated synapses (3,106.10 nm ± 87.94; MW test, p < 0.001), while horseshoe-shaped and perforated synapses had similar perimeters (MW test, p = 0.59; Table 3).
| 5 | 0biomedical
| 0Study
|
201,643 |
HCT116/L cells in logarithmic growth phase were seeded into 24 well plates (500 μL/well) with cover glass at density of 1 × 104 cells/mL and cultured for 24 h. The culture medium was replaced with serum-free fresh culture medium containing MCP (12.5, 6.25, 3.125 μg/mL) and cultured for 1 h. Then, Cy7.5-PSVII@MCP-CaP was added into cell culture medium. After cells were cultured for 4 h, the cover glass was fixed with 4% paraformaldehyde solution for 15 min. Next, 1 mL DAPI solution (600 ng/mL) was used to stain cell nucleus on cover glass for 15 min. The cover glass was cleaned with PBS and sealed with glycerin. Finally, the fluorescence in HCT116/L cells was observed by LSCM.
| 4 | 0biomedical
| 0Study
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.