added
stringdate 2024-06-03 18:26:11
2024-06-04 03:14:13
| created
stringdate 2013-04-29 18:49:42
2014-01-03 01:38:26
| id
stringlengths 32
32
| metadata
dict | source
stringclasses 2
values | text
stringlengths 237
356k
| version
stringclasses 1
value |
|---|---|---|---|---|---|---|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:25:08.000Z
|
abpv4qwgrfdqfehemrvua7hpuxfpno6g
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:35973",
"uncompressed_offset": 532475765,
"url": "www.perseus.tufts.edu/hopper/text?doc=urn%3Acts%3AgreekLit%3Atlg0527.tlg047.perseus-eng1%3A2.10",
"warc_date": "2013-11-22T19:23:51.000Z",
"warc_filename": "<urn:uuid:7e456d6f-9416-4fee-ba6f-dc7290ad0409>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=urn:cts:greekLit:tlg0527.tlg047.perseus-eng1:2.10"
}
|
cccc_CC-MAIN-2013-20
|
[10] Don't we all have one father? Hasn't one God created us? Why do we deal treacherously every man against his brother, profaning the covenant of our fathers?
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
load focus Latin (Saint Jerome, Bible Foundation and On-Line Book Initiative)
hide Places (automatically extracted)
View a map of the most frequently mentioned places in this document.
Visualize the most frequently mentioned Pleiades ancient places in this text.
Download Pleiades ancient places geospacial dataset for this text.
hide References (1 total)
• Cross-references in general dictionaries to this page (1):
hideData/Identifiers
Citation URN: urn:cts:greekLit:tlg0527.tlg047.perseus-eng1:2.10
Document URN: urn:cts:greekLit:tlg0527.tlg047.perseus-eng1
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:01:12.000Z
|
gf7w6r47at6yrgpde4knhchpag33vyjx
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:35980",
"uncompressed_offset": 574264364,
"url": "www.seroundtable.com/yahoo-blocking-googlebot-13268.html",
"warc_date": "2013-11-22T19:23:51.000Z",
"warc_filename": "<urn:uuid:7e456d6f-9416-4fee-ba6f-dc7290ad0409>",
"warc_url": "http://www.seroundtable.com/yahoo-blocking-googlebot-13268.html"
}
|
cccc_CC-MAIN-2013-20
|
Yahoo Blocking Googlebot From Yahoo Stores
Apr 14, 2011 • 8:08 am | (7) by | Filed Under Google Search Engine Optimization
Andrew Davis from the CPC Strategy blog informed me of a Google Merchant Center Help thread where dozens of Yahoo Store Merchants are complaining that their product images are not showing up in Google Image Search and the images are not showing up in Google Product Search and Product Ad results.
The reason appears to be because Yahoo recently decided to block Googlebot-Images from crawling the store's images. Do to this block, these merchants products won't show up in Google Image Search but more importantly is preventing the images and so other data from showing up in Google Product Search and the AdWords Product Ad results.
Andrew received a notification from Google that informed him of this, it read:
Hello,
Thank you for participating in Google Product Search. It has come to our attention that a robots.txt file is preventing us from crawling some or all of the images on your site. In order for us to access and display the images you provide in your product listings, we’d like you to modify your robots.txt file to allow user-agent ‘googlebot’ to crawl your site. Failure for Google to access your images may affect the visibility of your items on Google Product Search and Product Ad results.
To ensure the 'googlebot' is not being blocked, please add the following two lines of text to the end of your robots.txt file:
User-agent: googlebot
Disallow:
For more information on robots.txt files, please visit http://www.robotstxt.org. If you have any questions, please contact your webmaster directly.
Sincerely,
The Google Product Search Team
One person received a response from Yahoo on this where Yahoo downplayed the importance of merchants needing Google and other search engines from accessing and indexing their images. Yahoo said:
There is not any really good reason to have all of your images on Google image search. The only big reason for that is to grab images that are free and not link to your site, I can see it helping every so often but not worth the time or money at this time to go after. But that is just me. I have not seen any thing that supports merchants in Google image search.
Seriously? Yahoo! Seriously?
Forum discussion at Google Merchant Center Help.
Previous story: Daily Search Forum Recap: April 13, 2011
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:25:56.000Z
|
oerpfslvpuje5otnf2ccprvrsw55osjy
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:35998",
"uncompressed_offset": 661046701,
"url": "www.werelate.org/wiki/Place:Cherrywood,_Ontario,_Ontario,_Canada",
"warc_date": "2013-11-22T19:23:51.000Z",
"warc_filename": "<urn:uuid:7e456d6f-9416-4fee-ba6f-dc7290ad0409>",
"warc_url": "http://www.werelate.org/wiki/Place:Cherrywood,_Ontario,_Ontario,_Canada"
}
|
cccc_CC-MAIN-2013-20
|
Place:Cherrywood, Ontario, Ontario, Canada
Watchers
NameCherrywood
TypeHamlet
Coordinates43.867°N 79.133°W
Located inOntario, Ontario, Canada ( - 1974)
Also located inDurham, Ontario, Canada (1974 - )
See alsoPickering (township), Ontario, Ontario, Canadatownship in which Cherrywood was located until 1974
source: Getty Thesaurus of Geographic Names
Cherrywood is one of several communities, all no more than hamlets, located in the northern section of the Town of Pickering in Ontario, Canada. Other communities close by include Seaton, Green River, Whitevale and Brougham.
Research Tips
The primary source for basic documents (vital statistics, land records, wills) for people who lived in the Province of Ontario is the Archives of Ontario, 134 Ian Macdonald Blvd, Toronto, Ontario, Canada M7A 2C5.
Early Records
Civil registration did not begin in the province until 1869. Before then there may be church records of baptisms and burials. For the most part these are still held by the denomination who recorded them. Copies of marriage records made pre-1869 had to be sent by individual clergymen to the registrar of the county in which the marriage took place. These marriage records are available through Ontario Archives, on micorfilm through LDS libraries, and on paid and unpaid websites, but because they were copied at the registrars' offices, they cannot be considered a primary source.
Vital Records after 1869
Birth, marriage and death registrations are not open to the public until a specific number of years after the event occurred. Births to 1914 are now available [October 2012]; dates for marriages and deaths are later. Birth and death registration was not universally carried out in the early years after its adoption. Deaths were more apt to be reported than births for several years. The more rural the area, the less likely it would be that these happenings were reported to the authorities.
Images and indexes of civil registrations for the "viewable" years can be found on paid websites, and indexes only on FamilySearch. The latest year published is not yet available online. The FamilySearch Wiki on Ontario Vital Records explains how these records are organized and their availability.
Land Records and Wills
Information on how to access land records and wills is best sought on the Archives of Ontario website. An ancestor's land holding might be found on Canadian County Atlas Digital Project if he was in occupancy circa 1878.
Association for the Preservation of Ontario Land Registry Office Documents (APOLROD). A list of Land Registry Offices for all Counties of Ontario.
Censuses
The original censuses are in the hands of Library and Archives Canada. All of the original census (1851-1911) images are online with the exception of that for 1861. Not all of them are indexed. Later censuses are not yet available. Census divisions were redrawn as the population increased and more land was inhabited.
Other websites, some paid and some free, also provide Canadian census originals and/or indexes online. One can view censuses on microfilm at the Archives of Ontario or at big libraries throughout Canada.
E-books and Books
• The Internet Archive, particularly texts from Canadian universities, can contain interesting material
• Our Roots is a Canadian website similar to The Internet Archive
• Global Genealogy is an online bookshop specializing in Ontario material who will ship anywhere in the world.
=== Some websites with more local information on Ontario County ===
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:19:35.000Z
|
rbq4nybpulksrf4sbk7yr4rsqye44z4v
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36002",
"uncompressed_offset": 664381113,
"url": "www.wikidoc.org/index.php/Dorsal_cochlear_nucleus",
"warc_date": "2013-11-22T19:23:51.000Z",
"warc_filename": "<urn:uuid:7e456d6f-9416-4fee-ba6f-dc7290ad0409>",
"warc_url": "http://www.wikidoc.org/index.php/Dorsal_cochlear_nucleus"
}
|
cccc_CC-MAIN-2013-20
|
Dorsal cochlear nucleus
Jump to: navigation, search
The dorsal cochlear nucleus (DCN, also known as the "tuberculum acousticum"), is a cortex-like structure on the dorso-lateral surface of the brainstem. Along with the ventral cochlear nucleus, it forms the cochlear nucleus, where all auditory nerve fibers from the cochlea form their first synapse.
Brain: Dorsal cochlear nucleus
Dorsal cochlear nucleus is #4, at upper left
Latin nucleus cochlearis posterior
NeuroNames hier-718
Dorlands/Elsevier n_11/12580787
Anatomy
The DCN differs from the ventral portion of the CN as it not only projects to the central nucleus of the Inferior Colliculus (ICC) but also receives efferent innervation from auditory cortex, superior olivary complex and inferior colliculus. The architecture and wiring of the DCN is similar to that of the cerebellum, a concept that currently is important in theories of DCN function. Thus, the DCN is thought to be involved with more complex auditory processing, rather than merely transferring information.
The fusiform (also called pyramidal) and giant cells are the principal cells of the DCN. There is no known physiological difference between these two cell types. These cells are the target of two different input systems. The first system arises from the auditory nerve, and carries acoustic information. The second set of inputs is relayed through a set of small cells called "granule" cells in the cochlear nucleus. The granule cells in turn are the target of a number of different inputs, including both those involved in auditory processing and, at least in lower mammals, somatosensory inputs associated with the head, the ear, and the jaw.
Projections from DCN principal cells form the dorsal acoustic stria, which ultimately terminate in the ICC. This projection overlaps with that of the LSO in a well defined manner[1], where they form the primary excitatory input for ICC type O units[2]
Physiology
Principal cells in the DCN have very complex frequency intensity tuning curves. Classified as cochlear nucleus type IV cells[3], the firing rate may be very rapid in response to a low intensity sound at one frequency and then fall below the spontaneous rate with only a small increment in stimulus frequency or intensity. The firing rate may then increase with another increment in intensity or frequency. Type IV cells are excited by wide band noise, and particularly excited by a noise-notch stimulus directly below the cell's best frequency (BF).
While the VCN bushy cells aid in the location of a sound stimulus on the horizontal axis via their inputs to the superior olivary complex, type IV cells may participate in localization of the sound stimulus on the vertical axis. The pinna selectively amplifies frequencies, resulting in reduced sound energy at specific frequencies in certain regions of space. The complicated firing patterns of type IV cells makes them especially suited to detecting these notches, and with the combined power of these two localization systems, an ordinary person can locate where a firework explodes without the use of his eyes.
Somatosensory inputs inhibit type IV cell activity, possibly silencing their activity during head and pinna movements [4]. While this has not been studied extensively, it may play an important role in sound source localization in elevation. A similar effect is seen in the visual system in an effect known as change blindness.
Current auditory models of the DCN employ a two-inhibitor model. Type IV cells receive excitation directly from the auditory nerve, and are inhibited by type II (vertical) cells and a wide band inhibitor (onset-c cells).
References
1. Oliver, D. L., G. E. Beckius, et al. (1997). "Simultaneous anterograde labeling of axonal layers from lateral superior olive and dorsal cochlear nucleus in the inferior colliculus of cat." J Comp Neurol 382(2): 215-29.
2. Davis, K. A. (2002). "Evidence of a functionally segregated pathway from dorsal cochlear nucleus to inferior colliculus." J Neurophysiol 87(4): 1824-35.
3. Shofner, W. P. and E. D. Young (1985). "Excitatory/inhibitory response types in the cochlear nucleus: relationships to discharge patterns and responses to electrical stimulation of the auditory nerve." J Neurophysiol 54(4): 917-39.
4. Young, E. D., I. Nelken, et al. (1995). "Somatosensory effects on neurons in dorsal cochlear nucleus." J Neurophysiol 73(2): 743-65.
Navigation WikiDoc | WikiPatient | Popular pages | Recently Edited Pages | Recently Added Pictures
Table of Contents In Alphabetical Order | By Individual Diseases | Signs and Symptoms | Physical Examination | Lab Tests | Drugs
Editor Tools Become an Editor | Editors Help Menu | Create a Page | Edit a Page | Upload a Picture or File | Printable version | Permanent link | Maintain Pages | What Pages Link Here
There is no pharmaceutical or device industry support for this site and we need your viewer supported Donations | Editorial Board | Governance | Licensing | Disclaimers | Avoid Plagiarism | Policies
Personal tools
Namespaces
Variants
Actions
Navigation
Toolbox
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T20:48:58.000Z
|
5krdrpnix2tb22oc4ndnb3yscnffgasl
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36005",
"uncompressed_offset": 682119528,
"url": "www.zenbu.co.nz/entry/1182966-taste-of-malaysia",
"warc_date": "2013-11-22T19:23:51.000Z",
"warc_filename": "<urn:uuid:7e456d6f-9416-4fee-ba6f-dc7290ad0409>",
"warc_url": "http://www.zenbu.co.nz/entry/1182966-taste-of-malaysia"
}
|
cccc_CC-MAIN-2013-20
|
New Zealand (NZ) My Account
This entry has been archived
Why?: Closed
Taste of Malaysia
48 Queens Road, Panmure, Auckland 1072
New Zealand
Nearest Zenbu Listings
Sponsored Links
Nearest Restaurant listings
About Zenbu
Zenbu is a collaboratively edited directory of businesses, places or things. You can help build Zenbu, edit this entry, report an error or email it to a friend.
Login required: Edit, Export, Add branch / neighbour / new
Zenbu ID 1182966, 10 views since 12/05/2011
Last updated 19/04/2013 by zenbu
References
Map View | Street View
Map Loading...
Directions: From here - To here
Exactly here Near here; needs pinpointing Around here; mobile or no public location
Mapped with number precision
Latitude, Longitude = -36.899215, 174.853203
About Zenbu Forum Blog Twitter Facebook
Zenbu content is licensed under a Creative Commons Attribution 3.0 License
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:51:57.000Z
|
ueuzfh4pvl6abn7nzhthdforo7h4ugmf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36011",
"uncompressed_offset": 8586269,
"url": "answers.onstartups.com/questions/35251/contracting-for-the-first-time-constructing-a-contract",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://answers.onstartups.com/questions/35251/contracting-for-the-first-time-constructing-a-contract"
}
|
cccc_CC-MAIN-2013-20
|
Tell me more ×
Answers OnStartups is a question and answer site for entrepreneurs looking to start or run a new business. It's 100% free, no registration required.
An old employer of mine has approached me to do some freelance work to which I have said I am interested. I explained that since leaving I have never done any freelance work so I would have to set up all the admin of that before hand.
I know I need to register as self employed but I am in the dark about offering them my contract. What is typically the etiquette/procedure of doing this and is it something that's done days in advance of actually working? They've offered me two tasks shall we say on the job but I'm clear in my mind that I am only prepared to do offer my services in one of these tasks so how to I go about putting MY TERMS down in writing, making it clear but at the same time professional without causing offence. I do already know what my price is having done some research.
They messed me about as an employer and now I just feel they've come crawling back asking for my help so I want to make it clear that I'm the boss not them. Having never freelanced I'm not sure what steps to take here. For example I will work 8 hours per day, if they ask me to work on how does this work being a contractor? As an employee you just felt compelled/pressured to say yes all the time.
Further to this, how do I handle the matter of money and payment? What sort of documentation do I need to present to them on this? What I guess I'm really asking in this post is what steps I need to take to protect my self and not get fleeced or taken for a ride or messed about with.
share|improve this question
3 Answers
1. Get a good template services agreement. (Feel free to contact me through my profile and I will send you one) This agreement should lay out your legal position as an independent contractor, scope of services, financial responsibilities, and payment structure.
2. You have less rights as a contractor than as an employee. You are not the boss now. They are still the "boss of you" -- because as a client they are "always right" You will not be protected by employee rights. Your only power will be that you always had -- the right to walk away. If my client asks me to stay I ask how long. If they ask me to jump -- I ask how high.
3. You are not an hourly employee. Don't think like an hourly employee. You are a contractor. They pay you for a deliverable. A project. You are responsible for managing the time to accomplish the promised deliverable. Your quote or bid may be based on hours, but you are not an hourly employee. There might be contractors that hang it up after 8 hours. I don't know. I have never met one.
4. Trust is Important: The fact that you have already expressed concerns about how you will be treated is a yellow flag at best. Be concerned. You have your own reasons to have left. Are you really ready to go back? I have never found that it is "better" as a contractor. If you are going back to "prove something" -- I am very doubtful that will be successful.
5. Each client is different so each of your contracts will be different. Based on what you have said I would recommend that you consider personalizing the service agreement to include: Pre-payment/retainer on work, Payment penalties for the delay of dependent deliverable; "Do it myself" clause for dependent deliverable that are not delivered on time; Pre-agreed upon reporting structure
6. Logistics. Have a service agreement with a scope of service. Be paid for deliverable. Invoice according to the agreement. Provide the invoice to the accounting department. have them write a check and provide it to you. Deposit the check in your account. Start working on the next period, deliverable, milestone.
share|improve this answer
Since you have dealt with this firm before (as an employee) and have a track record where they messed with you, then you should approach this cautiously and protect yourself.
No matter how good a contract you write, if a dispute arises and they owe you money it can be very expensive to take them to court to collect. A rule I have always followed when doing work is to not allow any client, no matter how attractive, to have an outstanding balance that is more than I can afford to write off.
When doing fixed price work, I generally ask for 1/3 up front before work starts. If the client does not agree, I do not do the project.
Another thing you can do to protect yourself is to make clear that if the client is to get source code, you will not turn it over until after the bill is fully paid. This provides you with excellent leverage should they start pulling stunts like "the check is in the mail" etc.
Finally don't do this on the cheap, your hourly rate should probably be at least double what you made as an employee. If you are billing by the hour (rather than fixed price) you could ask that they pay the first week in advance and make further payments weekly; always in advance, that way you will always have at least as much money in your pocket as you earned. If they are ever late on a payment, stop work and tell them that you will resume work once the check has cleared.
share|improve this answer
First off the contract needs to be explicit as to exactly the work you are doing and how you are going to be paid.
Second, you have two options with regards to payment: fixed price or hourly. Personally I find fixed price to be easier on everyone; however, if you are unsure as to how long something is really going to take or it has a lot of unknowns then hourly is a better way to go.
For fixed price I ask for between 25% and 50% up front. It depends on the size of the contract (smaller deals = more upfront), amount of my own money I'll have to expend (servers, tools such as compilers, etc) and the amount of risk I think there is for non-payment.
If it's a small project then it is balance billed at the end along with customer acceptance. Once paid I deliver the source NOT before then. If it's a larger project then there are deliverables along the way in which they release a certain percentage of the funds with the balance done at the end.
For hourly, I'm usually on site. This may not be an option for you. However, be prepared that they may argue the actual number of hours you worked off site when you bill them. Regardless, you need to have established, in the contract, how often you bill and how often you get paid. Some companies like NET 30.. meaning you send a bill and they pay you 30 days later. This may or may not be acceptable and is certainly negotiable.
Each task should have a time estimate involved. If for some reason you believe the task will take longer, discuss it with them immediately. Preferably BEFORE you get to the point of spending 8 hours on a 1 hour item. The key here is that you do not want to surprise them. Each task should have time for coding, testing, discussing and deploying that piece of code. Sometimes this means a 30 minute thing will have 4 hours assigned to it. In the event you are able to complete the task in less time allowed be sure they know of it and bill for the smaller time.
Now, onto the work you want to do versus that you don't. This needs to be clear. From a fixed price perspective the contract must clearly define the exact scope of project. Any deviation should be handled through change requests along with the cost of the change, again requiring management signature.
With hourly, you can be a little more vague but be prepared to be asked to do things outside of scope. Bearing in mind that if you decline to do the additional work they may decline to continuing using your services.
With expected payments there should be a bit about what happens if they are late paying you. You need to think about this situation. Is work going to come to a complete stop? How does it escalate? Are late fees attached after a certain time period? Do you offer a discount if paid earlier or on time? As a contractor, this is a tough situation however it is a little easier if it is thought through and spelled out before hand.
There are very few situations in a fixed price bid that I would consider deploying code without payment. I've had even long term customers screw me over by renegotiating after the fact. Regardless, you should NEVER consider putting time bombs or engaging in any practice that might disrupt their business in the event of non-payment. That could land you in a world of legal hurt. There are legal means of getting the customer to pay you and those are the only ones to consider.
Finally, communication is an absolute must. Build this time into any proposal you have. Don't go a week without talking to them. People want to know what's going on, even if it's just an email or phone call saying X, Y and Z tasks complete, working on A and B now.
share|improve this answer
Your Answer
discard
By posting your answer, you agree to the privacy policy and terms of service.
Not the answer you're looking for? Browse other questions tagged or ask your own question.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:45:48.000Z
|
avvsdzackd4quzbb5jy52tuvl7qtjxuk
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36015",
"uncompressed_offset": 10563044,
"url": "archive.mises.org/9289/false-deflationary-fears-in-dangerous-inflationary-waters/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://archive.mises.org/9289/false-deflationary-fears-in-dangerous-inflationary-waters/"
}
|
cccc_CC-MAIN-2013-20
|
1. Skip to navigation
2. Skip to content
3. Skip to sidebar
Source link: http://archive.mises.org/9289/false-deflationary-fears-in-dangerous-inflationary-waters/
False Deflationary Fears in Dangerous Inflationary Waters
January 23, 2009 by
Listening to the media, the political pundits, and the majority of mainstream economists, you would have the impression that America is facing a severe deflation just around the corner.
In fact, what we face is the serious danger of rising prices due to a massive monetary expansion by the Federal Reserve.
I discuss this in a new article of mine, “False Deflationary Fears in Dangerous Inflationary Waters.”
The media and those mainstream economists are in a panic because the Consumer Price Index (CPI) declined by 0.7 percent in the month of December. And for the entire calender year of 2008, the CPI “only” increased by 0.1 percent.
Of course, falling or rising prices in general are not “deflation” or “inflation.” Such price movements are the effect of a preceding causal factor: changes in the quantity of money and credit. It is these underlying monetary changes that are “inflationary” or deflationary.”
Once we understand this, things are seen to be completely different. Between September and December of 2008, the Federal Reserve increased the Monetary Base by 95 percent. And at an annualized rate over period, M-1 has gone up by 40 percent and M-2 has grown by nearly 17.5 percent.
The Fed has created a tidal wave of monetary expansion. And if they were not to radically reverse the growth in the money supply they have created, signficantly rising prices will be facing the American consuming and taxpaying public the months and years to come.
There is a reason by economists like the French free marketeer, Jacque Rueff, long ago called our times the “age of inflation.”
Richard Ebeling
Previous post:
Next post:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:38:15.000Z
|
lqbrzk6v4cgtvp4plkadzoupbb2bxs4g
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36021",
"uncompressed_offset": 16185374,
"url": "awoiaf.westeros.org/index.php/Blackfyre_Rebellion",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://awoiaf.westeros.org/index.php/Blackfyre_Rebellion"
}
|
cccc_CC-MAIN-2013-20
|
Blackfyre Rebellion
From A Wiki of Ice and Fire
Jump to: navigation, search
The Blackfyre Rebellion
First Blackfyre Rebellion
Part of Blackfyre Pretenders
Date 195AL-196AL
Location Westerlands, the Riverlands, the Reach
Battles Battle of the Redgrass Field
Result Decisive Targaryen victory
Belligerents
House TargaryenHouse Blackfyre
Notable commanders
Daeron II Targaryen
Brynden Rivers
Lord Hayford
Baelor Targaryen
Maekar Targaryen
Daemon Blackfyre
Aegor Rivers
Quentyn Ball
One of the biggest threats to the Targaryen line, the Blackfyre Rebellion developed out of a dynastic dispute involving the children of King Aegon IV. The conflict was between the Targaryens and the pretenders of House Blackfyre and resulted in open civil war that divided the realm over the Iron Throne.
Contents
Background
King Aegon IV Targaryen had legitimised all of his bastards on his deathbed. His noble bastards were called the Great Bastards, the most notable of whom was Daemon Blackfyre, a great warrior and wielder of the Targaryen sword of kings, Blackfyre. In 184 Al, Aegon IV was succeeded by Daeron II. King Daeron was a cultured, scholarly man and reigned over a sophisticated court, attended by maesters and learned men, which was perceived as effete and overly-refined, not pleasing to many of his more martial courtiers and nobles. His marriage to the Dornish princess Myriah introduced foreign influences and manners to the court, further adding to the displeasure with his reign. In addition, popular rumors held that King Aegon IV's sister-wife Naerys had shared her affections with their other brother, Aemon the Dragonknight, leading to the possibility that Daeron II was not the son of Aegon IV.
War
After more than a decade of building tension, open warfare erupted in 195 AL. The immediate cause was Daemon Blackfyre's rage over Daeron betrothing his sister Daenerys to Maron Martell, Prince of Dorne. Daeron sent the Kingsguard to arrest him, but Daemon escaped with the aid of Ser Quentyn Ball, the master-at-arms of the Red Keep. Blackfyre mustered a sizable army against Daeron and was joined by his half-brother Aegor "Bittersteel" Rivers, a fellow Great Bastard. Brynden "Bloodraven" Rivers, another Great Bastard, remained loyal to the King. On the small council, Bloodraven advocated a hard line against the rebels, winning out over Prince Baelor Breakspear's desire to pardon. Daemon began to mint his own coinage.[1]
Heavy fighting erupted over the next year, with the Riverlands particularly afflicted. Ser Quentyn "Fireball" attacked the Westerlands, killing Lord Lefford at the gates of Lannisport and then defeating Lord Damon Lannister in turn. At the crossing of the Mander, Ser Quentyn slew all of Lady Penrose's sons except for the youngest, whom he spared as a favor to the lady. A key general, he was slain on the eve of the Battle of the Redgrass Field by an archer.[2]
Finally, at the Battle of the Redgrass Field in 196 AL Bittersteel and Blackfyre led a strong force against a royalist army commanded by Prince Maekar and Lord Hayford, the King's Hand. The fighting was very heavy, with Lord Hayford slain. During the battle Blackfyre came face-to-face with Ser Gwayne Corbray of the Kingsguard, wielder of the Valyrian steel blade Lady Forlorn. Their duel was said to have lasted nearly an hour before Blackfyre gained the upper hand. However, by this time a second royalist force was approaching from the south led by Prince Baelor. Perhaps even more critical was that Bloodraven and his archers, the Raven's Teeth, captured and assumed a position atop the Weeping Ridge, which overlooked the battlefield and allowed them to rain arrows down among Blackfyre and his commanders. Bloodraven personally killed Daemon Blackfyre and his twin sons Aemon and Aegon. The rebels began to rout, but Bittersteel rallied them by leading a charge that decimated the Raven's Teeth, taking out Bloodraven's eye in the process. However, Prince Baelor's Dornish spearmen gained the battlefield and crushed the rebel army against Maekar's shield wall.[3]
It is unknown how many men took part in the final battle, but it is known that more than ten thousand died in the engagement, earning it the name Redgrass Field. With Daemon dead and his forces defeated, the Rebellion was over.
Aftermath
Singers would later immortalize the Battle of Redgrass Field with the song "The Hammer and Anvil", referring to Baelor and Maekar's strategy.
Bittersteel was able to recover the sword Blackfyre from the battlefield and escape to the Free Cities, where Blackfyre's other sons had already fled. In exile, Daemon's descendants continued their struggle for the Iron Throne. The last of his line, Maelys the Monsterous, was slain during the War of the Ninepenny Kings by Barristan Selmy, forever ending the Blackfyre threat to the throne.
Houses by Allegiance
Loyalist (Targaryen supporters)
Rebels (Blackfyre supporters)
References and Notes
This page uses content from the English Wikipedia. The original content was at Blackfyre_Rebellion#Blackfyre_Rebellion. The list of authors can be seen in the page history of Blackfyre_Rebellion#Blackfyre_Rebellion. As with A Wiki of Ice and Fire, the content of Wikipedia is available under the Creative Commons Attribution-ShareAlike License.
Personal tools
Namespaces
Variants
Actions
Navigation
Connect with Us
Order Related Products
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:00:11.000Z
|
pf7m7cg76p6ouivg5el5h3bhhufwrkus
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36029",
"uncompressed_offset": 26184886,
"url": "blog.mozilla.org/labs/2008/10/concept-series-design-jams-at-university-of-michigan/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://blog.mozilla.org/labs/2008/10/concept-series-design-jams-at-university-of-michigan/"
}
|
cccc_CC-MAIN-2013-20
|
Concept Series Design Jams at University of Michigan
Mozilla
1
In September a group of HCI students at the University of Michigan’s School of Information began a series of design jams focused on the future of the browser. These awesome events aim to contribute ideas to the Concept Series. When we launched the series we put out a call for “industry, higher education and people from around the world to get involved and share their ideas and expertise as we collectively explore and design future directions for the Web”. These students are doing just that.
Headed by Liz Blankenship, a current Masters student in the HCI program, the first satellite Labs night encouraged brainstorming around how to create a better browser. The students divided into four groups – Tabs, History, Automation, and Web Apps – and discussed use cases present in each. Check out a complete wrap up of the event on the Student Organization for Computer-Human Interaction website. The second event, held in October, took ideas generated at the first session and expanded them into mockups and sketches. The students again broke into teams and dove into fleshing out details around each concept. More details here. The third and final jam will tackle creating functional prototypes.
Great work by these students. We would love to hear about similar projects. What are your thoughts on the future of the browser?
Add them to the Concept Series in any state – crazy idea, sketch, mockup, prototype, all are welcome!
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:17:51.000Z
|
mdqx3iex2iout7ttpjo2si2thfaugh4b
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36039",
"uncompressed_offset": 34718465,
"url": "buffalo.nas-central.org/w/index.php?oldid=16008&title=Talk%3AHacking",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://buffalo.nas-central.org/w/index.php?title=Talk:Hacking&oldid=16008"
}
|
cccc_CC-MAIN-2013-20
|
Talk:Hacking
From NAS-Central Buffalo - The Linkstation Wiki
Revision as of 10:00, 19 May 2005 by Hanno (Talk)
Jump to: navigation, search
> bg and Sec hacked the password for the 1.05 firmware and were able to make, pack and apply ower own firmware image.
Great! What is the password?
And now what? Only a few paragraphs above you say:
> For the time being it's not possible to hack the TeraStation without adding a serial console first.
So can I hack the TS without a serial console now or not?
--Hanno 12:00, 19 May 2005 (CEST)
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:46:54.000Z
|
onw6nzbjjm55pjddgjfv7sgfofwvrvmp
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36043",
"uncompressed_offset": 39577413,
"url": "ccsenet.org/journal/index.php/elt/article/view/19959",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://ccsenet.org/journal/index.php/elt/article/view/19959"
}
|
cccc_CC-MAIN-2013-20
|
ESL Pre-service Teachers’ Perceptions on the Use of Paragraph Punch in Teaching Writing
Melor Md Yunus, Hadi Salehi, Norazah Nordin
Abstract
The development of Information and Communication Technologies (ICTs) provides broad opportunities in teaching English in ESL countries. Given the rapid development in computer applications, it is important to look at how these applications can be used in language teaching specifically for writing skills. The purpose of this paper is to investigate the pre-service teachers’ perceptions of a writing software called ‘Paragraph Punch’ as a tool for assisting beginner writers. This software is designed to help learners of English as a second language to develop and organise paragraphs in essay writing. This paper provides an overview of the development of computer-assisted language learning (CALL) over the years, and the background and features of Paragraph Punch. Data for this study have been gathered from third-year TESL students in a state university in Malaysia using a questionnaire survey to elicit their views on the use of Paragraph Punch as a potential writing tool. The descriptive analysis of the data showed that the (i) respondents have a positive view towards Paragraph Punch as a potential writing tool, (ii) Paragraph Punch is more suited for beginner writers, and (iii) the software can still be improved in terms of interactivity and layout to enhance writing. The findings have been discussed with regard to ESL writing.
Full Text: PDF DOI: 10.5539/elt.v5n10p138
This work is licensed under a Creative Commons Attribution 3.0 License.
English Language Teaching ISSN 1916-4742 (Print) ISSN 1916-4750 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:51:24.000Z
|
2ph6h6doqqbf3lor53rcc63oka7wikhx
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36059",
"uncompressed_offset": 68665546,
"url": "dotnetkicks.com/stories/14395/Employee_Info_ASP_NET_Starter_Kit",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://dotnetkicks.com/stories/14395/Employee_Info_ASP_NET_Starter_Kit"
}
|
cccc_CC-MAIN-2013-20
|
Error!
Success!
Employee Info ASP.NET Starter Kit
0
kicks
Employee Info ASP.NET Starter Kit (Unpublished)
This is a starter kit, which includes very simple user requirements, where we can create, read, update ad delete (crud) the employee info of a company. The primary purpose of this starter kit is, to provide a solid guideline with respect to building enterprise level projects, by utilizing new asp.net 2.0 and sql server 2005 features, as well as latest best coding practices. The starter kit includes several cases where we can perform multi-table joining and/or write operations. Combining high performance and security features this starter kit shows how we can solve in real world problems and challenges, from a wide range of view point.
Kicked By:
Drop Kicked By:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:05:32.000Z
|
wyopt3c2sunpuyxqjgqhoamgzupr4fm2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36064",
"uncompressed_offset": 73478774,
"url": "elinux.org/index.php?action=info&title=Template%3AInfobox%2Frow",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://elinux.org/index.php?title=Template:Infobox/row&action=info"
}
|
cccc_CC-MAIN-2013-20
|
Information for "Template:Infobox/row"
Jump to: navigation, search
Basic information
Display titleTemplate:Infobox/row
Default sort keyInfobox/row
Page length (in bytes)479
Page ID13267
Page content languageEnglish (en)
Search engine statusIndexable
Number of views346
Redirects to this page0
Page protection
EditAllow all users
MoveAllow all users
Edit history
Page creatorPeter Huewe (Talk | contribs)
Date of page creation10:35, 28 October 2011
Latest editorPeter Huewe (Talk | contribs)
Date of latest edit10:39, 28 October 2011
Total number of edits2
Total number of distinct authors1
Recent number of edits (within past 91 days)0
Recent number of distinct authors0
Page properties
Page transcluded on (1)
Template used on this page:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:25:26.000Z
|
2crelkh4zjmregjbhgtnhagffozfnj7i
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36083",
"uncompressed_offset": 98420722,
"url": "globalvoicesonline.org/2012/03/07/africa-interview-with-africa-desk-officer-at-the-committee-to-protect-journalists/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://globalvoicesonline.org/2012/03/07/africa-interview-with-africa-desk-officer-at-the-committee-to-protect-journalists/"
}
|
cccc_CC-MAIN-2013-20
|
GlobalVoices in Learn more »
Africa: Interview With Africa Desk Officer at the Committee to Protect Journalists
This post also available in:
Español · África: Entrevista con el encargado de la sección africana del Comité para la Protección de los Periodistas
Abdoulaye Bah (AB): First of all, who is Mohamed Keita ?
Mohamed Keita (MK): I run the Africa desk of the Committee to Protect Journalists (CPJ), which is based in New-York.
AB: What are the aims of CPJ?
MK: CPJ is a nonpartisan, not-for-profit, nongovernmental organization dedicated to defending press freedom worldwide since 1981. CPJ was founded by a group of eminent American journalists, including the late Walter Cronkyte and Dan Rather, to support their colleagues around the world during a period of kidnappings and murders of journalists in Lebanon and Latin America in the 1980s. CPJ cherishes its independence from any government and does not take any contributions from any state.
Logo of the Committee to Protect Journalists. Image source: http://cpj.org/.
AB: What are the African countries where freedom of expression is most at risk?
MK: Eritrea: President Isaias Afewerki brutally closed down the independent press in this Red Sea nation in a September 2001 crackdown on dissent. Since then, Isaias’ information minister Ali Abdu runs and directs the propaganda machine of the state-controlled press. The government directs journalists what and how to report on. It is the African country whose prisons are holding the largest number of journalists (at least 28). All the journalists are held in secret prisons without charge or trial and without contact with their families, with many of them thought to have died in custody. Only Iran is imprisoning more journalists worldwide.
Ethiopia: In February 2011, Ethiopian police threatened to throw into prison dissident blogger Eskinder Nega if he did not stop comparing the Arab Spring uprisings to Ethiopia’s 2005 pro-democracy protests. Eskinder was arrested 9 months later on terrorism charges and faces a possible life sentence in a politicized case based on his critical online writings. Ethiopia operates sub-saharan Africa’s most extensive snd sophisticated Internet censorship infrasctructure and was ranked among CPJ’s top 10 Online Oppressors.
The government of Prime Minister Meles Zenawi is trailing only Eritrea in imprisonment of journalists. Almost all the journalists, including two Swedish reporters, have been charged with terrorism for reporting on opposition and rebel groups. With a series of restrictive laws, Meles’ ruling EPRDF has tightned absolute grip over media licensing and regulation, the public state media and all public institutions. The independent press is limited to a handful of private newspapers and one radio station. The government also jams radio programs from Voice of America and Deutsche Welle and bans journalists’ access to the Ogaden where a rebellion is taking place. Meles’ government has driven into exile the largest number of journalists in the world over the last decade.
Gambia: President Yahya Jammeh's years of intimidation of the press, a series of arson attacks on media houses, the closure of newspapers and radio stations, the unsolved murder of Deyda Hydara and the disappearance in government custody of reporter Ebrima Chief Manneh, have created a climate of terror for journalists in Gambia and forced the best journalists into exile.
Zimbabwe: Zimbabwe arrested and prosecuted a man last year for posting a political comment on Facebook. President Robert Mugabe's ruling ZANU-PF has allowed only a handful of independent newspapers to operate in Zimbabwe while retaining absolute grip over media licensing and regulation and national airwaves. Journalists operate under some of the world's most restrictive security and media laws.
Equatorial Guinea: President Teodoro Obiang's grip on the oil-rich nation is based on strict control of news and information. The president and his associates control all the media outlets in the country and no journalist is able to report independently about national priorities or spending or corruption.
Rwanda: Paul Kagame justifies restrictions on the press by invoking Radio Milles Collines, which in fact was a government-sponsored radio station, not an independent station. Kagame's government also abuses laws against “genocide ideology” and “ethnic divisionism” to prosecute and jail critical journalists and opinions contradicting the official version of the 1994 genocide.
Somalia: all belligerents in Somalia's conflict target journalists who are caught in the crossfire between rival militias, warlords, government and insurgents. Somalia is the deadliest country for the press in Africa: at least 40 journalists have been killed since 1992.
South Africa: President Jacob Zuma's ruling African National Congress has faced press criticism over its record on corruption, crime and poverty. To silence the critics, the government has introduced a series of legislative proposals that would criminalize investigative journalists, including the controversial Protection of State Information Bill, which critics have called the secrecy bill. Verbal and physical intimidation of journalists, particularly by the ANC’s youth league is on the rise.
Angola: President Jose Eduardo Dos Santos and his associates of the ruling MPLA control most of Angola's media outlets and enforce censorship of news and information. only 2 newspapers and 2 radio stations were not controlled by the government. Journalists reporting about official corruption are prosecuted and given prison sentences. Security forces attacked and intimidated journalists reporting on anti-government protests by youths calling for Dos Santos to step down.
Angola and Cameroon have introduced legislative measures to combat “internet crime” but the laws punish the electronic dissemination of photos and videos of public events with prison terms.
Democratic Republic of Congo: Journalists operate at the mercy of security forces, rebel groups and powerful politicians who abuse journalists in total impunity. at least 8 journalists have been murdered since 2005 with justice falling short of solving the murders.
Ethiopia's dissident blogger Eskinder Nega. Photo courtesy of Lennart Kjörling.
AB: Bloggers from North Africa have contributed significantly to the success of revolts in the countries of North Africa. Is it conceivable that in sub-Saharan Africa bloggers play a similar role?
MK: Social media tools have become platforms for the kind of dissent that is repressed offline and they are used to organize protests offline. Some governments, such as Ethiopia, Angola, and Cameroon, are beginning to crack down on this use of the Internet, by passing laws against “cyber crime” or intimidating bloggers. In addition, Facebook, Twitter and Youtube users who are posting photos and videos from the streets using their cell phones are breaking some of the biggest news in Africa these days, and traditional media is trying to keep up with them.
AB: In Mozambique, in 2008 and 2010, well before the revolutions in the Arab world, the civil society was able to organize a demonstration against the rising cost of living using SMS. In Ghana, in 2010, citizens participated massively in constitutional review by using Facebook and mobile phones. Should these examples be regarded as exceptional cases or other similar events may occur elsewhere?
MK: Social media in the hands of young citizen journalists is fueling protest movements in Angola, Nigeria and Senegal.
The cover of CPJ
AB: What role do you attribute to social media in Africa and what are the obstacles?
MK: They have democratized news and information – making it more difficult for governments and the enemies of press freedom to keep a nation into the dark. it has created a virtual bridge between Africans in the Diaspora and those in the home countries. but the users are still largely unprepared to the dangers lurking online. Zimbabwe arrested and prosecuted a man last year for posting a political comment on Facebook. and many governments regularly demand email passwords of journalists in custody. Data security is the next challenge for journalists as more of them start to mostly work online.
AB: What can we expect from the African Union?
MK: The AU has a Special Rapporteur on Freedom of Expression but she works only part time and lacks the resource to do her job. AU member states still lack the political will to respect press freedom and protect journalists. Regional human rights instruments like the Court of Justice of the Economic Community of West African states (ECOWAS) give us hope. The court issued landmark rulings against the Gambia on cases of disappearance and torture of journalists, but the problem is enforcement.
AB: The year 2011 was difficult for the press freedom in Africa, how do you see the year 2012?
MK: Each new year brings new challenges in this battle to keep the press free. The secrecy bill in South Africa has to be defeated, because South Africa is a model of democracy and free press for the continent, and this bill threatens to undo 18 years of progress since the end of Apartheid. South Sudan, the world's newest nation, is already abusing press freedom, this is also worrying. Ethiopia and Burundi's abuse of terrorism laws to prosecute and jail critical journalists is a disturbing new trend that has to be stopped. Press freedom is on the brink of extinction in Ethiopia, Angola, Gambia and Rwanda. Niger is probably the best example of a country where press freedom has advanced.
You can follow Mohamed Keita on Twitter @africamedia_CPJ and also read his articles on CPJ blog.
World regions
Countries
Languages
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:38:48.000Z
|
mritqvmw42d3wrlzh574qlekiomvxwjk
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36102",
"uncompressed_offset": 124475536,
"url": "kauaimark.blogspot.com/2012/05/whats-sup.html",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://kauaimark.blogspot.com/2012/05/whats-sup.html"
}
|
cccc_CC-MAIN-2013-20
|
Search This Blog
Loading...
Thursday, May 10, 2012
What’s SUP?
It’s been a few weeks since the last post. We went on vacation for a couple weeks and I didn’t want to advertise that the house was empty while we were gone. We’re back now and I’m scheduled to be in a 5th grade class tomorrow...
Here are a few pics for you to try and guess where…
(SUP: Stand Up Paddling)
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:53:22.000Z
|
kappe3hbmpinwpqsqms37wbdgqqr7ugc
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36126",
"uncompressed_offset": 164589419,
"url": "openwetware.org/index.php?diff=72640&oldid=54217&title=Hoatlin%3AContact_Info",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://openwetware.org/index.php?title=Hoatlin:Contact_Info&diff=72640&oldid=54217"
}
|
cccc_CC-MAIN-2013-20
|
Hoatlin:Contact Info
From OpenWetWare
(Difference between revisions)
Jump to: navigation, search
(Email)
(Mailing Address)
Line 1: Line 1:
====Mailing Address====
====Mailing Address====
Hoatlin Lab<br>
Hoatlin Lab<br>
+
MRB 518<br>
3181 SW Sam Jackson Park Road<br>
3181 SW Sam Jackson Park Road<br>
Mail Code L224<br>
Mail Code L224<br>
Revision as of 14:09, 21 September 2006
Contents
Mailing Address
Hoatlin Lab
MRB 518
3181 SW Sam Jackson Park Road
Mail Code L224
Portland, OR 97239
Tel. 503-494-5427
Fax. 503-494-8393
Email
OWW users: Post a message on my talk page or send me an email: Hoatlinm at OHSU dot edu
• note that OHSU email continues to be unstable and forgetful. Recent big example; If you sent me email between June 16th beginning at 7 p.m. PST through Tuesday, June 20th, I did not get it and it has been lost forever. If urgent, it's better to call me or use my gmail address (same prefix as OHSU but AT gmail DOT com).
Location on Campus
Our lab is located in MRB 518. Go past the fountain and into Mac Hall, noting ducks if present. Follow the main hall around counter-clockwise until you get to the sketchy elevaters and ride them up to the 5th floor. Yell when you get here so we can come dig you out of the rubble (you'll understand when you see it).
Parking
If you're a visitor, Good Luck! No, seriously, you can park in Patient and Visitor Parking, indicated by a yellow circle with a "P" in it. The closest lot is across from the ER. Two hour street-side parking is also available in various locations. If you're an employee, you'll have to sell a piece of your soul for a parking permit on the hill. Other methods to try are breaking a limb and bringing a doctor's note (The Alexis Strategy), and pretending to live with someone on the hill (The Stacie Strategy). If you know ahead of time you will be visiting we can arrange, for a price, a temporary parking permit. Or if you are Eric Brown (Maureen's son), you just park in a "primo spot you found, right out front" (ie, the President's spot). We're not bitter about parking or anything.
Public Transportation
Bus #8 comes up the hill from downtown all day long. Express busses 61, 64, 65, 66, 68 run during peak hours. Certain Townies make for very interesting bus rides.
Maps
Return to Main Page Hoatlin Lab
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:44:05.000Z
|
3o3rro3ltyg3zdakm4mz423v7cvymzru
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36140",
"uncompressed_offset": 178723155,
"url": "quotationsbook.com/quote/21426/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://quotationsbook.com/quote/21426/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
...of women?
MRS. CHEVELEY. Science can never grapple with the irrational. That is why it has no future before it, in this world.
SIR ROBERT CHILTERN. And women represent the irrational.
MRS. CHEVELEY. Well-dressed women do.
SIR ROBERT CHILTERN. [With a polite bow.] I fear I could hardly agree with you there. But do sit down. And now tell me, what makes you leave your brilliant Vienna for our gloomy London - or perhaps the question is indiscreet?
MRS. CHEVELEY.
Questions are never indiscreet. Answers sometimes are.
SIR ROBERT CHILTERN. Well, at any rate, may I know if it is politics or pleasure?
MRS. CHEVELEY. Politics are my only pleasure. You see nowadays it is not fashionable to flirt till one is forty, or to be romantic till one is forty-five, so we poor women who are under thirty, or say we are, have nothing open to us but politics or philanthropy. And philanthropy seems to me to have become simply the refuge of people who wish to annoy their fellow-creatures. I prefer politics. ...
Wilde, Oscar
Source: Maxims · Excerpt from An Ideal Husband · This quote is about interviews · Search on Google Books to find all references and sources for this quotation.
A bit about Wilde, Oscar ...
Oscar Fingal O'Flahertie Wills Wilde (October 16, 1854 November 30, 1900) was an Anglo-Irish playwright, novelist, poet, and short story writer. One of the most successful playwrights of late Victorian London, and one of the greatest celebrities of his day, known for his barbed and clever wit, he suffered a dramatic downfall and was imprisoned after being convicted in a famous trial of "gross indecency" for homosexual acts.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:52:20.000Z
|
qsy6lwjfd75efisvlrrfm73kznqvebcy
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36141",
"uncompressed_offset": 178730302,
"url": "quotationsbook.com/quote/31678/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://quotationsbook.com/quote/31678/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
Those in possession of absolute power can not only prophesy and make their prophecies come true, but they can also lie and make their lies come true. Hoffer, Eric
This quote is about power · Search on Google Books to find all references and sources for this quotation.
A bit about Hoffer, Eric ...
Eric Hoffer (July 25, 1902 May 21, 1983) was an American social writer. He produced ten books and won the Presidential Medal of Freedom in February 1983 from Ronald Reagan. His first book, The True Believer, published in 1951, was widely recognized as a classic. This book, which he considered his best, established his reputation, and he remained a successful writer for most of his remaining years.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:12:44.000Z
|
tmtkys2j5nnknivww4ltsvzhbw2uty52
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36142",
"uncompressed_offset": 178736770,
"url": "quotationsbook.com/quote/36961/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://quotationsbook.com/quote/36961/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
The soul is made of love and must ever strive to return to love. Therefore, it can never find rest nor happiness in other things. It must lose itself in love. By its very nature it must seek God, who is love. Magdenburg, Mechthild of
This quote is about soul · Search on Google Books to find all references and sources for this quotation.
A bit about Magdenburg, Mechthild of ...
We don't have a biography.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:09:38.000Z
|
efjxep5yleu2bbmnnnbxnktezije4ey4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36143",
"uncompressed_offset": 178743214,
"url": "quotationsbook.com/quote/gift/1780/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://quotationsbook.com/quote/gift/1780/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
If God had an agent, the world wouldn't be built yet. It'd only be about Thursday. Reynolds, Jerry
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:48:25.000Z
|
ejwvxscromx4pxtvaxkm32ea4lcd722s
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36198",
"uncompressed_offset": 248184103,
"url": "wikitravel.org/en/Special:RecentChangesLinked/Talk:Dokdo",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://wikitravel.org/en/Special:RecentChangesLinked/Talk:Dokdo"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Changes related to "Talk:Dokdo"
Jump to: navigation, search
This is a list of changes made recently to pages linked from a specified page (or to members of a specified category). Pages on your watchlist are bold.
Recent changes options Show last 50 | 100 | 250 | 500 changes in last 1 | 3 | 7 | 14 | 30 days
Hide minor edits | Show bots | Hide anonymous users | Hide logged-in users | Hide my edits
Show new changes starting from 07:52, 18 May 2013
Page name:
No changes on linked pages during the given period.
Personal tools
Namespaces
Variants
Views
Actions
Navigation
feeds
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:01:55.000Z
|
xxtumeh4bnlwxno22ghdfzceh6qwoqz5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36199",
"uncompressed_offset": 248240525,
"url": "wikitravel.org/wiki/en/index.php?action=history&title=Tongshan",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=Tongshan&action=history"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Revision history of "Tongshan"
Jump to: navigation, search
Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:46:18.000Z
|
h7s7y7nbnjaurzhd3miphfwo6o5ewbfy
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36200",
"uncompressed_offset": 248250466,
"url": "wikitravel.org/wiki/en/index.php?action=history&limit=100&title=Wikitravel%3AHuge_city_article_template",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=Wikitravel:Huge_city_article_template&limit=100&action=history"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Revision history of "Wikitravel:Huge city article template"
Jump to: navigation, search
Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
Personal tools
Variants
Actions
Navigation
feeds
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:23:37.000Z
|
hwf3jqizbedyybdbx4gdnl5v3fqjztz4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36223",
"uncompressed_offset": 390115160,
"url": "www.familysearch.org/learn/wiki/en/Special:RecentChangesLinked/York_District,_South_Carolina",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Special:RecentChangesLinked/York_District,_South_Carolina"
}
|
cccc_CC-MAIN-2013-20
|
Changes related to "York District, South Carolina"
From FamilySearch Wiki
This is a list of changes made recently to pages linked from a specified page (or to members of a specified category). Pages on your watchlist are bold.
Recent changes options Show last 50 | 100 | 250 | 500 changes in last 1 | 3 | 7 | 14 | 30 days
Hide minor edits | Show bots | Hide anonymous users | Hide logged-in users | Hide my edits
Show new changes starting from 08:23, 18 May 2013
Page name:
No changes on linked pages during the given period.
New to the Research Wiki?
In the FamilySearch Research Wiki, you can learn how to do genealogical research or share your knowledge with others.
Learn More
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:46:14.000Z
|
pfvqrgwuoi4yy7vb7j56k6y6mahwr7yg
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36231",
"uncompressed_offset": 419424243,
"url": "www.go4expert.com/community/introduction-t28604/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.go4expert.com/community/introduction-t28604/"
}
|
cccc_CC-MAIN-2013-20
|
Introduction!!!
Banned
20Jun2012,15:11 #1
Hi this is annahussy and It's my warm welcome to everyone. I am glad that I am overhere and get to know more things with sharing lots of knowledge.
Thanks
annahussy
Go4Expert Founder
20Jun2012,15:17 #2
Any specific reason to have this in Assembly Language Programming sub forum?
Banned
20Jun2012,15:24 #3
For getting good knowledge and sharing the information with all of guys.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:49:24.000Z
|
m4ksztceyowdqyg3jehkjroxzm47isrp
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36236",
"uncompressed_offset": 435165470,
"url": "www.hindawi.com/isrn/nursing/2012/750363/abs/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.hindawi.com/isrn/nursing/2012/750363/abs/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
ISRN Nursing
Volume 2012 (2012), Article ID 750363, 6 pages
doi:10.5402/2012/750363
Research Article
Gentle Human Touch and Yakson: The Effect on Preterm's Behavioral Reactions
1Faculty of Medicine, Kerman Medical University, Kerman 7616913555, Iran
2Razi Faculty of Nursing and Midwifery, Kerman Medical University, Kerman 7616913555, Iran
3Research Center for Modeling in Health, Kerman Medical University, Kerman 7616913555, Iran
Received 14 March 2012; Accepted 8 April 2012
Academic Editors: R. A. Benkert and E. Kim
Copyright © 2012 Bahare Bahman Bijari et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Objective. Touch is one of the first strong positive senses that develop in neonate. Therapeutic touch could be considered as a complementary treatment in Neonate intensive care units (NICU). Methods. This quasi-experimental study was conducted to compare the effect of Yakson and GHT on behavioral reaction of preterm infants hospitalized in NICU in south-east of Iran. 90 preterm infants participated in this study. They are randomly divided into 3 groups: (1) Yakson group, , (2) GHT group, , (3) control group, . Each infant received the GHT and Yakson interventions twice a day for 5 days. Each session lasted 15 minutes. The control group received routine nursing care. Results. In interventional group, an increase was found in sleep state score after the Yakson and GHT intervention. Their awake and fussy states' scores decreased after both interventions. No significant difference was found between Yakson and GHT group in their behavioral state scores. Conclusion. The findings suggest that Yakson and GHT had soothing and calming effect on preterm infants and could be beneficial in nursing interventions.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:28:16.000Z
|
gn4xz2aol25jbm67p24emag2umc5mqot
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36237",
"uncompressed_offset": 435170991,
"url": "www.hindawi.com/journals/aoe/2011/539382/abs/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.hindawi.com/journals/aoe/2011/539382/abs/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
Advances in OptoElectronics
Volume 2011 (2011), Article ID 539382, 5 pages
doi:10.1155/2011/539382
Research Article
Novel Approach for the Synthesis of Nanocrystalline Anatase Titania and Their Photovoltaic Application
1International Center for Young Scientists, International Center for Materials Nanoarchitectonics, National Institute for Materials Science, 1-1 Namiki, Tsukuba, Ibaraki 305-0044, Japan
2Photovoltaics Materials Unit, National Institute for Materials Science, 1-2-1 Sengen, Tsukuba, Ibaraki 305-0047, Japan
3Center of Excellence for Research in Engineering Materials (CEREM), College of Engineering, King Saud University, Riyadh 11421, Saudi Arabia
Received 30 April 2011; Accepted 26 May 2011
Academic Editor: Idriss M. Bedja
Copyright © 2011 Pavuluri Srinivasu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
High surface area titania with crystalline anatase walls has been synthesized using ordered large mesoporous carbon as a template. The pore structure of mesoporous carbon is infiltrated with titanium tetraisopropoxide solution at room temperature and the mixture is subjected to heat treatment at in presence of air to complete removal of the template. The prepared crystalline anatase frameworks are characterized by XRD, N2 adsorption and HR-TEM. The nitrogen adsorption-desorption analysis of the prepared anatase titania particles exhibits BET specific surface area of 28 m2/g. The dye-sensitized solar cells performance of this anatase titania material has been tested and energy conversion efficiency of 3.0% is achieved under AM 1.5 sunlight. This work reports a new approach for fabrication of nanocrystalline anatase titania by simple hard templating technique for the first time and their applications for dye-sensitized solar cell.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:47:26.000Z
|
o5bf7xyfaeh57p3ofbwvf5lh4qvd6s7v
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36238",
"uncompressed_offset": 435184522,
"url": "www.hindawi.com/journals/jr/2010/130285/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.hindawi.com/journals/jr/2010/130285/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
Journal of Robotics
Volume 2010 (2010), Article ID 130285, 16 pages
doi:10.1155/2010/130285
Research Article
Robotic Vision with the Conformal Camera: Modeling Perisaccadic Perception
Department of Computer and Mathematical Sciences, University of Houston-Downtown, One Main Street, Houston, TX 77002, USA
Received 21 September 2009; Revised 17 January 2010; Accepted 8 February 2010
Academic Editor: Noriyasu Homma
Copyright © 2010 Jacek Turski. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Humans make about 3 saccades per second at the eyeball's speed of 700 deg/sec to reposition the high-acuity fovea on the targets of interest to build up understanding of a scene. The brain's visuosaccadic circuitry uses the oculomotor command of each impending saccade to shift receptive fields (RFs) to cortical locations before the eyes take them there, giving a continuous and stable view of the world. We have developed a model for image representation based on projective Fourier transform (PFT) intended for robotic vision, which may efficiently process visual information during the motion of a camera with silicon retina that resembles saccadic eye movements. Here, the related neuroscience background is presented, effectiveness of the conformal camera's non-Euclidean geometry in intermediate-level vision is discussed, and the algorithmic steps in modeling perisaccadic perception with PFT are proposed. Our modeling utilizes basic properties of PFT. First, PFT is computable by FFT in complex logarithmic coordinates that also approximate the retinotopy. Second, the shift of RFs in retinotopic (logarithmic) coordinates is modeled by the shift property of discrete Fourier transform. The perisaccadic mislocalization observed by human subjects in laboratory experiments is the consequence of the fact that RFs' shifts are in logarithmic coordinates.
1. Introduction
In this article, we demonstrate that a mathematical data model we have developed for image representation intended for biologically-mediated machine vision systems [16] may be useful to process visual information during the motion of a camera with silicon retina that resembles saccadic eye movements. Our data model is based on the projective Fourier analysis that we have constructed in the framework of representation theory of the Lie group by restricting the group representations to the image plane of the conformal camera—the camera with image projective transformations given by the action of [4, 5]. The analysis provides an efficient image representation that is well adapted to (a) the projective transformations of retinal images and (b) the retinotopic mappings of the brain's oculomotor and visual pathways. This latter assertion stems from the fact that the projective Fourier transform (PFT) is computable by a fast Fourier transform (FFT) algorithm in coordinates given by a complex logarithm that transforms PFT into the standard Fourier integral, while simultaneously approximating the local retinotopy [7]. Consequently, PFT of the conformal camera integrates the head, eyes, and retinotopic mapping of the visual pathways into a single computational binocular system [6]. As already suggested in [8], this integrated system may efficiently model visuomotor processes during saccadic eye movements that reposition the high-acuity fovea—the retinal region of a central angle subtending a US quarter an arm length from the eyes—on the targets of interest to build up understanding of a scene.
Humans make about three saccades per second at the eyeball's maximum speed of deg/sec, producing about saccades per day [9]. As we are not aware of these fast moving retinal images, the brain, under normal circumstances, suppresses visual sensitivity during saccadic eye movements and compensates for these incessant interruptions. This visual stability is maintained by the brain's widespread neural network [10]. Converging evidence from psychophysics, functional neuroimaging, and primate neurophysiology indicates that the most attractive neural basis that underlies visual stability is the mechanism causing visual cells in various visual and visuomotor cortical areas to respond to stimuli that will fall in their receptive fields (RFs) before the eyes move them there, commonly referred to as the shifting RFs mechanism [1115]. The identification of the visuosaccadic pathways (see references in [10]) supports the idea that the brain uses a copy of the oculomotor command of the impending saccade, referred to as efference copy or corollary discharge (see [16] for a review), to shift transiently the RFs of stimuli. This shift of RFs, starting 50 ms before a saccade onset and ending 50 ms after the saccade landing, is hypothesized to update (or remap) the retinotopic maps in the anticipation of each upcoming saccade. In fact, in a recent experiment [17], when human subjects shifted fixation to the clock, their reported time was earlier than the actual time on the clock by about 40 ms.
Although interruptions caused by saccades remain unnoticed in our daily life, in laboratory experiments, it becomes possible to probe the unexpected consequences of the saccadic eye movement. Specifically, laboratory experiments in lit environments have shown that briefly flashed probes around the saccade's onset are perceived as compressed toward the saccadic target [1821], while, in total darkness, the probes' localizations are characterized by a uniform shift in the direction of the saccade [2224]. The experimental studies [2527] investigating the influence of the saccade's parameters on perisaccadic mislocalization showed that perisaccadic visual compression and the unidirectional shift are probably governed by different neural processes. Although the perisaccadic shift can be mainly explained by delays in the processing of visual information [24], the mechanism of perisaccadic compression, commonly related to the neural processes of the RF shift [28], remains relatively elusive.
In this article, we argue that the conformal camera's complex projective geometry and the related harmonic analysis (projective Fourier analysis) may be useful in perisaccadic perception. In particular, the image representation in terms of PFT may efficiently model the RFs shift that remaps cortical retinotopy in the anticipation of each saccade and the related phenomenon of perisaccadic perceptual space compression. During fixations the brain acquires visual information, resolving inconsistencies of the brief compression resulting from remapping. The computational significance of this remapping, when incorporated into neural engineering design of a foveate visual system, stems from the fact that it may integrate visual information from an object across saccades, eliminating the need for starting visual information processing anew three times per second at each fixation and speeding up a costly process of visual information acquisition [29]. This transfer of object features across saccadic eye movements [3033] that is believed to maintain visual stability of transsaccadic perception is not considered here because, at present not much is known about the whole process [13].
This paper is organized as follows. We outline the neural processes of the visuosaccadic system involved in the preparation, execution, and control of the saccadic eye movement in Section 2 and later continue in Section 6. In Sections 3 and 4, we lay out the background that explains the mathematical tools we use in modeling human visual system. To this end, in Section 3, we introduce the conformal camera, discuss its conformal geometry, and evaluate the effectiveness of this geometry in the early- and intermediate-level vision computational aspects of natural scene understanding. Then, in Section 4, we show that the conformal camera possesses its own harmonic analysis—projective Fourier analysis—which provides image representation given in terms of the discrete PFT (DPFT) fast computable by FFT in coordinates given by a complex logarithm. Section 5 of this article deals with the implementation of the DPFT in retinocortical image representation that efficiently integrates the head, eyes, and retinotopic maps into one computational system. We also mention hardware setups that could be supported by DPFT-based software and compare conformal camera-based modeling to other approaches in foveate vision. Using this integrated visual system, in Section 6, we model perisaccadic perception, including the perisaccadic compression observed in psychophysical laboratory experiments. Finally, in Section 7, we discuss and compare our model with other numerical approaches to perisaccadic perception and discuss the directions in advancing our modeling. The paper is summarized in the last section.
2. The Visuosaccadic System
One of the most important functions of any nervous system is sensing the external environment and responding in a way that maximizes immediate survival chances. For this reason, the perception and action have evolved in mammals by supporting each other's functions. This functional link between visual perception and oculomotor action is well demonstrated in primates when they execute the eye-scanning movements (saccades) to overcome the eye's acuity limitation in building up the scene understanding.
In fact, humans can only see clearly the central part of the visual field of a deg central angle. This region is projected onto the central fovea, where its image is sampled by the hexagonal mosaic of photoreceptors consisting mainly of cone cells, the color-selective type of photoreceptors for a sharp daylight vision. The visual acuity decreases rapidly away from the fovea because the distance between cones increases with eccentricity as they are outnumbered by rode cells, photoreceptors for a low-acuity black-and-white night vision. Moreover, there are a gradual loss of hexagonal regularity of the photoreceptor mosaic and an increased convergence of the photoreceptors on the ganglion cells whose axons carry visual information from the eye to the brain. For example, at deg radius, which corresponds to the most visually useful region of the retina, acuity drops . In Figure 1, (b) shows a progressively blurred image from (a), simulating the progressive loss of acuity with eccentricity.
Figure 1: (a) San Diego skyline and harbor. (b) Progressively blurred image of (a) simulating the progressive loss of retinal acuity with eccentricity. The circle encloses the part of the scene projected onto the high-acuity fovea of a 2 deg diameter. The circle encloses the part projected onto the visually useful foveal region of a 5 deg diameter. (c) A scanning path the eyes may take to build up the scene understanding. Adapted from [34].
With three saccades per second, the saccadic eye movement is the most common bodily movement. The eyes remain relatively still between consecutive saccades for about 180–320 ms, depending on the task performed. During this time period, the image is processed by the retinal circuitry and sent, mainly, to the visual cortex (starting with the primary visual cortex, or V1, and reaching higher cortical areas, including the cognitive areas), with a minor part sent to the oculomotor midbrain areas. During the saccadic eye movement, the visual sensitivity is markedly reduced, although some modulations of low spatial frequencies (contrast and brightness) are wellpreserved or even enhanced [35]. This phenomenon is known as saccadic suppression. The sequence of saccades, fixations, and, often, smooth-pursuit eye movements for tracking a slowly moving small object in the scene, is called the scanpath and was first studied in [36]. In Figure 1(c) we depict the scanpath that eyes might actually take to build up understanding of the scene.
Although they are the simplest of bodily movements, the eyes' saccades are controlled by a widespread neural network that involves nearly every level of the brain. In Figure 2 we show the diagram of well-established pathways of the primate visuosaccadic system. They includes most prominently, the superior colliculus (SC) of the midbrain for representing possible saccade targets, and the parietal eye field (PEF) and the frontal eye field (FEF) in the parietal and frontal lobes of the neocortex (which obtains inputs from many visual cortical areas) for assisting the SC in the control of the involuntary (PEF) and voluntary (FEF) saccades. They also project to the simple neural circuits in the brainstem reticular formation (pons) in the midbrain that ensure the saccade's outstanding speed and precision. The course of events in the visuosaccadic system, which is based on [10], is outlined in the caption of Figure 2.
Figure 2: The visuosaccadic system. The course of events is the following. () Fixations (300 ms). When eyes complete a saccade, visual information is acquired and sent via LGN to V1 and higher cortical areas including FEF and PEF (yellow paths). The next saccade's target is selected in FEF/PEF and its position is calculated in SC (blue paths) and the oculomotor command (OC) is prepared (Pons). However, before the saccade is executed, a copy of OC is sent via MD of Thalamus to FEF/PEF (black paths) to shift the receptive fields of the current fixation landmarks to the receptive fields of their future positions centered at the impending saccade's target. () Saccades (30 ms). The OC executes the eyes' saccade with the motor neurons (red paths). The shift of receptive fields (starting 50 ms before the saccade onset and ending 50 ms after the saccade landing) gives access to the upcoming saccade's target before eyes arrival, integrating objects' features between fixations and maintaining stability of perception.
Although many of the neural processes involved in saccade generation and control are amenable to precise quantitative studies [37], some neural processes of the visuosaccadic system remain virtually unknown. The saccadic suppression, the fact that we do not see moving retinal images, is barely understood. There is accumulating evidence that viewers integrate information poorly across saccades during tasks such as reading, visual search, and scene perception [38]. This means that, three times per second at each fixation, there are instant large changes in the retinal images without almost any information consciously carried between fixations. Furthermore, because the next saccade target selection for the voluntary saccades takes place in the higher cortical areas involving cognitive processes [39], the time needed for the oculomotor system to plan and execute the saccadic eye movement could take as long as 150 ms. Therefore, it is critical that visual information is efficiently acquired during each fixation without repeating much of the whole process since it would require too much computational resources. However, visual constancy, the fact that we are not aware of any discontinuity in the scene perception when executing the scanpath, is not perfect. About 50 ms before the onset of the saccade, during saccadic movement (30 ms), and about 50 ms after the saccade, the salient stimuli are not perceived in veridical locations. In particular, a transient compression around the saccade target, called perisaccadic mislocalization, is observed in lit laboratory experiments; see Section 1. We continue this discussion in Section 6 where we present the algorithm for modeling some of the neural processes underlying perisaccadic perception.
3. The Conformal Camera, Geometry, and Perception
We model the human eyes’ imaging functions with the conformal camera; the name of which will be explained later. In the conformal camera, shown in Figure 3, the retina is represented by the image plane with complex coordinates , on which a D scene is projected under the mapping The implicit assumption will be removed later.
Figure 3: The conformal camera. (a) Image projective transformations are generated by iterations of transformations covering translations “” and rotations “” of planar objects in the scene. (b) The 2D section of the conformal camera further explains how image projective transformations are generated and how the projective degrees of freedom are reduced in the camera; one image projective transformation in the conformal camera corresponds to different planar objects translations and rotations in the 3D world.
The image projective transformations are generated by the two basic transformations and shown in Figure 3. Both transformations have the form of linear-fractional transformations with . Therefore, all finite iterations of the mappings and give the group acting on the image plane of the conformal camera by linear-fractional, or Möbius, transformations Because have the same action, we need to identify matrices in that differ in sign. The result is the quotient group , where is the identity matrix, and the action (3) establishes a group isomorphism between linear-fractional, or Möbius, mappings and . Thus, gives the image projective transformations of the intensity function .
3.1. Geometry of the Conformal Camera
In the homogeneous coordinate framework of projective geometry [40], the conformal camera is embedded into the complex plane
In this embedding, the “slopes” of the complex lines can be numerically identified with the points on the extended image plane where corresponds to the line . In fact, if and , the slope corresponds to the point at which the ray (line) in that passes through the origin is intersecting the image plane of the conformal camera. Then, the standard action of the group , on nonzero column vectors , implies that the slope is mapped to the slope agreeing with the mappings in (3). However, the action (3) must be extended to include the line of “slope” as follows:
The stereographic projection (with in (1)) establishes isomorphism and gives a concrete meaning to the point such that it can be treated as any other point. The set is referred to as the Riemann sphere and the group acting on consists of the bijective meromorphic mappings of [41]. Thus, it is the group of holomorphic automorphisms of the Riemann sphere that preserve the intrinsic geometry imposed by complex structure, known as Möbius geometry [42] or inversive geometry [43].
The mappings in (4) are conformal, that is, they preserve the oriented angles of two tangent vectors intersecting at a given point [41]. Because of this property, the camera is called “conformal”. Although the conformal part of an image projective transformation can be removed with almost no computational cost, leaving only a perspective transformation of the image (see [4, 5]), the conformality provides an advantage in imaging because the conformal mappings rotate and dilate the image's infinitesimal neighborhoods, and, therefore, locally preserve the image pixels.
The image plane of the conformal camera does not admit a distance that is invariant under image projective (linear-fractional or Möbius) transformations. Therefore, geometry of the conformal camera does not possess a Riemannian metric; for instance, there is no curvature measure. It is customary in complex projective (Möbius or inversive) geometry to consider a line as a circle passing through the point Then, the fundamental property of this geometry can be expressed as follows: linear-fractional mappings map circles to circles [41]. Thus, circles can play the role of geodesics.
3.2. The Conformal Camera and the Intermediate-Level Vision
As discussed before, circles play a crucial role in the conformal camera geometry and it should be reflected in psychological and computational aspects of natural scene understanding whether this camera is relevant to modeling primate visual perception.
Neurophysiological experiments demonstrate that the retina filters impinged images extracting local contrast spatially and temporally. For instance, center surround cells at the retinal processing stage are triggered by local spatial changes in intensity referred to as edges or contours. This filtering is enhanced in the primary visual cortex, the first cortical area receiving the retinal output. This area itself is a case study in dense packing of overlapping visual submodalities: motion, orientation, frequency (color), and oculomotor dominance (depth). In psychological tests, humans easily detect a significant change in spatial intensity (low-level vision), and effortlessly and unambiguously group this usually fragmented visual information (contours of occluded objects, for example), into coherent, global shapes (intermediate-level vision). Considering its computational complexity, this grouping is one of the difficult problems that primate visual system has to solve [44].
The Gestalt phenomenology and quantitative psychological measurements established the rules, summarized in the ideas of good continuation [45, 46] and association field [47], that determine interactions between fragmented edges such that they extend along continuous contours joining the edges in the way they will normally be grouped together to faithfully convey a scene meaning. Evidence accumulated in psychological and physiological studies suggests that the human visual system utilizes a local grouping process (association field) with two very simple rules: collinearity (receptive fields aligned along a line) and cocircularity (receptive fields aligned along a circle with the preferred orientation orthogonal to the tangents of the circle [48]) with underlying scale invariant statistics for both geometric arrangements in natural scenes. These rules were confirmed in [49, 50] by statistical analysis of natural scenes. Two basic intermediate-level descriptors that the brain employs in grouping elements into global objects are the medial axis transformation [51], or symmetry structure [52, 53], and the curvature extrema [54, 55]. In fact, the medial axis, which the visual system extracts as a skeletal (intermediate-level) representation of objects [56], can be defined as a set of the centers of maximal circles inscribed inside the contour. The curvatures at the corresponding points of a contour are given by the inverse radii of the circles.
This discussion shows that the conformal camera should effectively model the eye's imaging functions related to lower- and intermediate-level visions of natural scenes.
4. Projective Fourier Analysis
The projective Fourier analysis has been constructed by restricting geometric Fourier analysis of —a direction in the representation theory of the semisimple Lie groups [57]—to the image plane of the conformal camera [5, Section ]. The resulting projective Fourier transform (PFT) of a given image intensity function is the following: where , and, if , then is the Euclidean measure on the image plane.
In log-polar coordinates given by , takes on the form of the standard Fourier integral Inverting it, we obtain the representation of the image intensity function in the -coordinates: where . We stress that although and are numerically equal, they are given on different spaces.
4.1. Discrete Projective Fourier Transform
In spite of the logarithmic singularity of log-polar coordinates, PFT of any function integrable on is finite: This observation is crucial in constructing the discrete PFT as follows. By removing a disk , we can regularize such that the support of is contained within and approximate the integral in (10) by a double Riemann sum with partition points Then, introducing and defining by we obtain Both expressions (16) and (17) can be computed efficiently by FFT algorithms.
On introducing complex coordinates into (16) and (17), these expressions are referred to as the discrete projective Fourier transform (DPFT) and its inverse, respectively [4, 5]. When “pixels” locations are transformed by the conformal camera's action of so that the function undergoes projective transformation , its representation in (17) is given in terms of and (instead of and ) but with unchanged. We refer to the representation transformations as projectively adapted characteristics of the projective Fourier transforms [4, 5]. These projective transformations are not given explicitly here since they are not used in this work.
5. DPFT in Computational Vision
We discussed before the relevance of the conformal camera to the intermediate-level vision task of grouping image elements into individual objects in natural scenes. Here we discuss the relevance of the data model of image representation based on DPFT to image processing in biologically mediated machine vision systems.
5.1. Modeling the Retinotopy with DPFT
The mapping , where removes logarithmic singularity and indicate, for different signs, the left or right brain hemisphere, is the accepted approximation of the retinotopic structure of primate visual cortical areas and the midbrain SC [7, 58]. However, the DPFT that provides the data model for image representation can be efficiently computed by FFT only in log-polar coordinates given by the complex logarithm . This mapping has distinctive rotational and zoom symmetries important in image identification (rotations and dilations in the retinal space corresponding to translations in the cortical (log-polar) space). Thus, we see that the Schwartz model of the retina comes with drastic consequences by destroying the rotation and zoom symmetries.
The following facts support our modeling of retinotopy with DPFT. First, for small , is approximately linear while, for large , it is dominated by . Secondly, to construct discrete sampling for DPFT, the image is regularized by removing a disc representing the fovea, which is possible because PFT in log-polar coordinates does not have a singularity at the origin; see (12). Thirdly, there is accumulated evidence pointing to the fact that the fovea and periphery have different functional roles in vision [59, 60] and very likely involve different image processing underlying principles. Finally, by the split theory of hemispherical image representation, the foveal region has a discontinuity along the vertical meridian, with each half processed in a different brain hemisphere [61].
We conclude this discussion with the following remark. Both models discussed above, as well as all other similar models, are, in fact, fovea-less models [62]. However, because the fovea is explicitly removed in our model, we plan to complement it in the future by including the foveal image representation.
5.2. Image Sampling for DPFT
The DPFT approximation was obtained using the rectangular sampling grid in (14), corresponding, under the mapping to a nonuniform sampling grid with equal sectors but with exponentially increasing radii where is the spacing and , where is the radius of the disc that has been removed to regularize logarithmic singularity. This sampling interface is shown in Figure 4.
Figure 4: The retinocortical sampling interface. (a) The exp-polar sampling (the distance between circles displayed in the first quadrant changes exponentially) of a bar pattern. (b) The bar pattern in the cortical coordinates rendered by the inverse DPFT computed with FFT. The cortical uniform sampling grid, obtained by applying the complex logarithm to the exp-polar grid in (a), is shown in the upper left corner.
Let us assume that we have been given a picture of the size in pixel units, which is displayed with dots per unit length (dpl). Then, the physical dimensions, in the chosen unit of length, of the pixel and the picture are and , respectively. Also, we assume that the retinal coordinates' origin (fixation) is the picture's center.
The central disc of radius represents the fovea with a uniform distribution of grid points, the number of the foveal pixels given by . This means that the fovea cannot increase the resolution, which is related to the distance of the picture from the eye. The number of sectors is obtained from the condition , where . Here is the closest integer to . To get the number of rings , we assume that and . We can take either or . Thus, and .
Example 1. We let and per mm, so the physical dimensions in mm are and . Furthermore, we let , so and . Finally, and The sampling grid consists of points in polar coordinates: .
5.3. Imaging with the Conformal Camera
In the example from the previous section, the number of pixels in the original image is , whereas both foveal and peripheral representations of the image contain only pixels. Thus, it results in about times less pixels than in the original image. However, this reduction in the number of pixels comes at a price: not only does the small central region have the resolution required for a clear vision, it also has to be removed to regularize the logarithmic singularity. Therefore, the conformal camera with the DPFT-based image processing in the present state of development can support only the peripheral imaging functions of the visual system.
The most basic and frequent eye's imaging functions are connected with an incessant saccadic eye movement (about saccades per day). The neural mechanisms of the RFs shifts and perisaccadic mislocalization, hypothesized to be involved in maintaining visual stability, are mainly supported by the peripheral visual processing. We use DPFT to model these phenomena in Section 6. The DPFT-based image representation could support the following hardware setup. A set of samples of an image , where , is obtained from a camera with anthropomorphic visual sensors (silicon retina) [63] or from an “exp-polar” scanner with the sampling geometry similar to the distribution density of the retinal ganglion cells. The DPFT is applied to according to (16), and is efficiently computed with FFT. Next, the IDPFT of , given in (17), is again computed with FFT. However this output from IDPFT renders the retinotopic image (numerically equal to ) of the retinal samples in the cortical log-polar coordinates.
When the eyes remain fixed, motion of objects is perceived by the successive stimulation of adjacent retinal loci. These image transformations are modeled in the conformal camera by the corresponding covariant transformations of the image representation in terms of DPFT; see the end of Section 4.1. These transformations are not important in modeling perisaccadic perception and are not dealt with in this work. However, they will become important in modeling smooth-pursuit eye movements, which we plan to undertake in the near future.
5.4. Other Approaches to Foveate Vision
Of the numerical approaches to foveate (also called space-variant) vision, involving, for example, Fourier-Mellin transform or log-polar Hough transform, the most closely related to our work are results reported by Schwartz' group at Boston University. We note that the approximation of the retinotopy by a complex logarithm was first proposed by Eric Schwartz in 1977. This group introduced the fast exponential chirp transform (FECT) [64] in their attempt to develop numerical algorithms for space-variant image processing. Both FECT and its inverse were obtained by the change of variables in the spatial and frequency domains applied to the standard Fourier integrals. The discrete FECT was introduced somehow ad hoc and some basic components of Fourier analysis, such as underlying geometry or Plancherel measure, were not considered. In comparison, projective Fourier transform (PFT) provides an efficient image representation well adapted to projective transformations produced in the conformal camera by the group acting on the image plane by linear-fractional mappings. Significantly, PFT can be obtained by restricting geometric Fourier analysis of the Lie group to the image plane of the conformal camera. Thus, the conformal camera comes with its own harmonic analysis. Moreover, PFT is computable by FFT in log-polar coordinates given by a complex logarithm that approximates the retinotopy. It implies that PFT can integrate the head, eyes, and visual cortex into a single computational system. This aspect is discussed, with special attention to perisaccadic perception, in the remaining part of the paper. Another advantage of PFT is the complex (conformal) geometric analysis underlying the conformal camera. We demonstrated in Section 3.2 the relevance of this geometry to the intermediate-level vision problem of grouping local contours into individual objects of natural scenes.
The other approaches to space-variant vision use the geometric transformations, mainly based on a complex logarithmic function between the nonuniform (retinal) sampling grid and the uniform (cortical) grid for the purpose of developing computer programs for problems in robotic vision. We give only a few examples of such problems: tracking [65], navigation [66], detection of salient regions [67], and disparity estimation [68]. However, in contrast to our projectively covariant image processing carried out with FFT, they share high computational costs in the geometric transformation process for dynamic scenes.
6. Perisaccadic Perception with DPFT
A sequence of fast saccadic eye movements is necessary to process the details of a scene by fixating the fovea successively on the targets of interest. Given the frequency of three saccades per second and limited computational resources, it is critical that visual information is efficiently acquired without starting anew much of this acquisition process at each fixation. This is critically important in robotic designs based on the foveate vision architecture (silicon retina), and in this section we propose the front-end algorithmic steps in addressing this problem.
The model of perisaccadic perception presented in this section is based on the theory in [29] that states (as is most classically assumed) that an efference copy generated by SC, a copy of the oculomotor command to rotate the eyes in order to execute the saccade, is used to briefly shift the flashed probes' RFs in FEF/PEF toward the cortical fovea. Because the shift occurs in logarithmic coordinates approximating retinotopy, the model can also explain observed in laboratory experiments perisaccadic compression shown in Figure 5.
Figure 5: Experimental data (see [20]) of the absolute mislocalization (lower row) referenced to the true position of a flashed dot randomly chosen from an array of 24 dots and three different saccade amplitudes (upper row) are shown.
We recall the time course of events (Figure 2) that we are going to model. During the eyes' fixation, lasting, on average, ms, the retinal image is sampled by ganglion cells and sent to cortical areas, including higher areas in the parietal and the frontal lobes. In particular, the next saccade's target is selected in PEF/FEF areas and its position computed in subcortical SC area. About 50 ms before the onset of the saccade, during the saccade (30 ms), and about 50 ms after the saccade, the visual sensitivity is reduced, and probes flashed around the impending saccade's target are not perceived in veridical locations; see Figure 5. Instead, a copy of the oculomotor command (efference copy) is used to translate the receptive fields of flashes recorded in the fovea-centered frame of the current fixation, remapping them into a target-centered frame. This internal remapping results in the illusory compression of flashes about the target. The cortical locations of the neural correlates of remapping are uncertain; it is required that these areas are retinotopically organized. These areas, of which most likely include PEF/FEF and V4 (and to a progressively lesser degree V3, V2, and V1), can be represented here by one retinotopic area [69].
6.1. The Model
The modeling steps are the following.
Step 1 (see Figure 6). The eye initially fixated at F is making the saccade to the target located at T. The four probes flashed around the upcoming saccade's target at T are projected into the retina and sampled by the photoreceptor/ganglion cells to give the set of samples . Next, DPFT is computed by FFT in log-polar coordinates , where . The inverse DPFT, computed again by FFT (the gray arrow), renders the image representation in Cartesian log-polar coordinates–-the four dots in -coordinates. The fovea, which is shown in yellow in Figure 6, is not included in log-polar coordinates, for these coordinates approximate only the extrafoveal part of the retina. For simplicity, we can take the radius of the fovea to be so that the -coordinate starts at .
Figure 6: The local retinotopic mapping of four probes flashed around the saccade target at T.
Step 2 (see Figure 7). The log-polar image is multiplied by two characteristic set functions, , or ; the domain of each is shown in Figure 7 in a different color, the blue-enclosed region for and the green-enclosed for . We obtain two images , representing cortical half-images into which the image would be divided by the retinal vertical meridian after the fovea landed on the target at T. We recall that the characteristic function of a set is defined by the following condition: takes on if and if . The blue-enclosed image is reflected both in the vertical ( line where is the midpoint of the projection of into the -axis) and in the horizontal ( line) axes and translated (blue arrow) while the green-enclosed image is only translated in the -direction (green arrow).
Figure 7: Modeling shifts of RFs of flashed probes. See text for detailed description.
These transformations are shown on the left of the gray arrow in Figure 7 while the results of these transformations (red dots) are shown on its right. The translation in the -coordinates (blue arrow) is obtained by the shift of the IDPFT (here ) which can be computed by FFT. The formula in (22) is the standard shift property of Fourier transform; the cortical image is translated by pixels in the -coordinate and by pixels in the -direction, as the blue arrow shows in Figure 7. (Equivalently, the coordinate system is translated by pixels in the -coordinate and by pixels in the -direction.) In (22), the inverse discrete Fourier transform is applied to where , , is the spacing in the -coordinate (see (21) in Section 5.2) and is the original Fourier transform with the normalizing area factor in log-polar coordinates.
Further, the image reflection about the vertical axis of the region can be done with two consecutive transformations, each computable with FFT. These transformations consist of the reflection followed by the translation . We note that the reflection can be obtained by applying Fourier transform twice to the original image, which follows directly from the Fourier transform definition. The red dots represent peripheral receptive fields shifted to the frame centered at the upcoming saccade target.
Step 3 (see Figure 8). This perisaccadic compression is obtained by decoding the cortical image representation to the visual field representation:
Figure 8: Perisaccadic compression of flashed probes perceived briefly during the saccadic eye movement. Note that this perception does not involve the visual sensory system.
where and , . We see that, under the shift of the coordinate system by , the original position of a dor at is transformed to , resulting in the compression shown in the scene in Figure 8 with red dots referenced by red arrows to the original positions of flashed probes (black dots). Although this step is not supported by FFT, a commonly used look-up table [65] could efficiently decode the cortical image see the discussion in Section 7.1. Where and how the brain accomplished this step is the greatest mystery of primate perception.
In the modeling steps we presented above, the cortical translation shown by the green arrow in Figure 7 gives only compression of the two corresponding probes in the scene because . However, in the translation shown in Figure 7 by the blue arrow, and the corresponding image undergoes the compression and rotation, both needed to have the fovea at the center of the four red dots in the scene shown in Figure 8, when the saccade lands at T. Because of this rotation, we need two reflections to have the original parity of the image.
Although we do not show here quantitative results of the modeling steps, the qualitative results can be seen if we translate the cortical image of the bar in Figure 4(b), say in the -coordinate to the left by a number of pixels (pixels are shown in the left upper corner), and trace out mentally its retinal copy using the square lattice in (a) and its log-polar image in (b). We can see that the bar in (a) will be compressed with respect to the origin of -coordinates. We note that, as mentioned in Step 3, we cannot apply FFT to render this compressed retinal image.
The model presented in this section complements the theory proposed in [29]. Experimental results suggest a very tight time course followed by perisaccadic compression with its duration of about ms and with the maximum mislocalization immediately before the saccade. In the model we propose here, this saccadic dynamics can be easily accounted for: the distance of the shift (in terms of cortical pixels) can be taken as a function of time. Another aspect of perisaccadic compression that is accounted for in our modeling is the fact that not all of RFs undergo shift during eyes saccadic motion. In Step 2, the translations are applied to selected (salient) retinotopic areas. These two aspects of perisaccadic perception are not supported in a natural way by the model presented in [29].
6.2. On Modeling Global Retinotopy
The global retinotopy reflects the anatomical fact that the axons in the optic nerve leaving each eye split along the retinal vertical meridian when the axons originating from the nasal half of the retina cross at the optic chiasm to the contralateral brain's hemisphere and join the temporal half, which remains on the eye's side of the brain. This splitting and crossing reorganize the local retinotopy (log-polar mapping) such that the left brain hemisphere receives the right visual field projection and the right brain hemisphere receives the left visual field projection. According to the split theory [61, 70], which provides a greater understanding of vision cognitive processes than the bilateral theory of overlapping projections, there is a sharp foveal split along the vertical meridian of hemispherical cortical projections. Both hemispheric projections are connected by a massive corpus callosal bridge of about M of neuronal fibers [71].
Although crucial for synthesizing D representation from the binocular disparities in the pair of D retinal images, we cannot fully address the global retinotopy here because the foveal image representation is not included in out modeling. However, the fovea-less global retinotopy can be easily modeled with DPFT by two reflections (cf., Step 2 in our modeling) both computable with FFT. Figure 9(b) shows the result of the reflection about the line of the peripheral region given by . It is followed in 9(c) with the result of the reflection about .
Figure 9: Two consecutive reflections that can be computed with FFT account for the global retinotopy without the foveal region.
At this point, we can only graphically show what we expect to obtain when the foveal image representation complements the peripheral (log-polar) image representation we have developed in terms of projective Fourier transform. To this end, Figure 10 shows the peripheral region (gray) and the central foveal region (yellow). These two regions are connected by the transitional region (shaded with gray lines). The green curve in Figure 10 shows the cortical projection of a straight line making an angle of with the retinal horizontal meridian and passing through the center of the fovea.
Figure 10: Schematic depiction of the global retinotopy with the peripheral region (gray) and the foveal region (yellow). Shaded in gray lines is the perifoveal region, which connects the other two regions. The red dots show the shifted neuronal activity in the receptive fields from the veridical position (gray dots) resulting in the illusory space compression.
7. Discussion
Our model, which is based on PFT, uses the approximation of the retinotopy given by the complex logarithmic mapping with , where represents, with the appropriate normalization, the radius of the foveal region removed in our modeling. This mapping transforms PFT into the standard Fourier integral that is computable by FFT, providing the benchmark of efficiency not available in any other computational modeling of perisaccadic perception. Although the foveal system is indispensable to primate vision, it is rather less important to the proper functioning of the visuosaccadic system. In fact, neuronal cells in FEF/PEF, the higher cortical areas implicated in the RF shift mechanism that obtain retinotopic projections from the occipital cortex, have larger RFs and primarily code stimuli spatial locations rather than stimuli features [72]. We should note that, although we use the complex logarithmic approximation for all retinotopically organized brain areas, this approximation is well established only for the first visual cortical areas and SC of the midbrain [7, 58]. This is justified if we realize that most algorithmic principles employed by natural visual systems need to be reformulated to better fit modern computational algorithms (FFT in our case).
The results obtained in the simulations in [29], where the Schwartz' retinotopic mapping was used to approximate the cortical magnification factor, showed the unidirectional shift component of mislocalization superimposed on perisaccadic compression. However, it was noticed there that this component did not scale with the compression according to the experimental data. The unidirectional shift is absent in the model presented here because, in our approximation of retinotopy, the parameter is zero. Since the unidirectional perisaccadic shift has a different neural origin (as it is primarily caused by delays in neuronal signals) than perisaccadic compression (caused by remapping), it should not be accounted for by just this parameter.
Further, in both our model and the model in [29], perceptual compression is attributed to a translation of the origin of the logarithmic coordinate system, which results in a linear relation between perceived and actual probes' positions. Thus, the nonlinearity observed in [19, 21] is not accounted for in our modeling. However, asymmetry and nonlinearity present in experimental data could have casual origin resulting from multiple sources; we mention here three: () an asymmetric distribution of photoreceptor/ganglion cell density [73], () the average preferred fixation area located from the point of the highest cone density a distance of about half of the central fovea's radius (m) [74], and finally, () fluctuations of the cortical surface curvature (and therefore the lengths of the geodesics) across hemispheres [75]. Given the incomplete understanding of the neural processes underlying perisaccadic perception, it is impossible to distinguish between these “accidental” causes and the real neural mechanisms captured in modeling.
7.1. Relations to Other Models and the Current Research
Two computational theories of transsaccadic vision that have been proposed in visual neuroscience are related to our modeling, both with similar functional explanation of perisaccadic mislocalization by the cortical magnification factor. The first theory [29], which motivated our research, was discussed and compared with our model in the previous sections. In summary, our modeling can be seen as complementing the approach proposed in [29] by providing efficient image representation suitable for processing visual information during saccadic eye movement, and in particular, the classically assumed process of active remapping compensating for receptive fields displacements.
The second theory [18, 20] explains perisaccadic compression by spatial attention being directed to the target of a planned saccade. The authors proposed an elaborate computational modeling that assumes that the flashed stimuli RFs in cortical areas dynamically change position toward the saccade target RF as the result of the gain of feedback of the retinotopically organized activity hill of the saccade target in the oculomotor SC layer. This attention directed to the target increases spatial discrimination at the saccade target location before the saccade onset. The perceived spatial distortion of stimuli is the result of the cortical magnification factor of the visuo-cortical mapping (or retinotopy of the visuomotor pathways) when the position of each stimulus is decoded from activity of the neural ensemble. Thus, in this theory, different neural processes to those proposed in [29] are assumed: a local and transient change in the gain control around the saccade target in retinotopic-organized stimulus position represented by a hill of neural activity is inducing perisaccadic distortion of the perceived stimulus location. However, because circuitry underlying receptive field remapping is widespread and not well understood, it cannot be easily decided whether saccadic remapping is the cause or consequence of saccadic compression [29].
What really sets apart our modeling from other models is the fact that the computational efficiency is built into the modeling process, as all algorithmic steps (except the last one) involve computations with FFT. This is especially important because the incessant occurrence of saccades and the time needed for the oculomotor system to plan and execute each saccade require that visual information is efficiently processed during each fixation period without repeating, afresh, the whole process at each fixation [29].
All models proposed so far capture only the initial, front-end stage of remapping for a particularly simple scene of flashed probes and, though they explain the perisaccadic mislocalization phenomenon, they leave out the crucial modeling step of the integration of the objects' features (pattern, color, ) across saccades [3033] that achieves stability of perception [14, 76]. Many issues must be understood better before this crucial modeling step is achieved. We give two examples. During a scene viewing, a salient map of the landmarks and behaviorally significant objects of the scene is created and the RF shift updates the retinotopy of only this saliency map [13]. Although it is still unclear what a saliency map should be when viewing complex natural scenes, it points to the possibility of working with a sparse visual information data when performing Step 3 in the model outlined in Section 6.1. Thus, a lookup table approach [65] could be efficient enough for this step even when viewing a complex scene. Further, the time course of different stages in visual information processing in trans-saccadic perception and their influences on other cognitive processes is unclear. It is well known that scene gist recognition, when the scene is viewed for 50 ms [77], is critical in the early stage of scene perception, influencing more complex cognitive processes, such as directing our attention within a scene, facilitating object recognition, and influencing long-term memory. Only very recently [78] has it been found that peripheral vision is more useful for recognizing the gist of a scene than central vision (i.e., foveal + parafoveal vision) is, even though central vision is more efficient per pixel at processing gist.
Although the understanding of neural mechanisms involved in trans-saccadic perception is incomplete, a significant progress in understanding dynamic interaction taking place between different pathways in the visuosaccadic system has been recently made. In particular, the fundamental principles underlying perception of objects across saccades have been outlined [13]. Therefore, we should expect major advances in the near future. As a consequence, in robotic vision research, which is still wedged in-between the limited knowledge about biological visual processing and technological and software restrictions imposed by current cameras, scanners, and computers, it is becoming more important than ever to propose different, even if competing, perspectives on how to model known processes involved in trans-saccadic perception. In this article we proposed a comprehensive, biologically mediated engineering approach to model an active vision system. Our modeling, which is efficiently supporting both hard-wired eccentricity-dependent visual resolution and front-end modeling of mechanisms that may contribute to continuity and stability of trans-saccadic perception, is based on an abstract and less intuitive camera model with underlying nonmetric (conformal) Möbius geometry. However, our initial study of the smooth-pursuit eye movements, which complement fixations and saccades in the scanpath, indicates that the conformal camera with its DPFT-based image representation will also be important in processing visual information during the pursuits.
Further, the conformal camera geometry's effectiveness in the intermediate-level vision problems and the perspectively covariant projective Fourier analysis, well adapted to retinotopy, strongly suggest that DPFT-based image representation should be useful in modeling the neural processes that underlie the transfer of the objects' features across saccades and maintain the continuity and stability of perception.
Finally, it was observed that saccades cause not only a compression of space, but also a compression of time [79]. In order to preserve visual stability during the saccadic scanpath, receptive fields undergo a fast remapping at the time of saccades. When the speed of this remapping approaches the physical limit of neural information transfer, relativistic-like effects are psychophysiologically observed and may cause space-time compression [80, 81]. Curiously, this suggestion can also be accounted for in our model based on projective Fourier analysis since the group of image projective transformations in the conformal camera is the double cover of the group of Lorentz transformations of Einstein's special relativity; for a simple presentation [82, Section ].
8. Summary
In this article, we presented a comprehensive framework we have developed for computational vision over the last decade, and we applied this framework to model some of the processes underlying trans-saccadic perception. We have done this by bringing, in one place, physiological and behavioral aspects of primate visual perception, the conformal camera's computational harmonic analysis, and the underlying conformal geometry. This allowed us to discuss the conformal camera's effectiveness in modeling a biologically mediated active visual system. First, the conformal camera geometry fully accounts for the basic concepts of cocircularity and scale invariance employed by the human vision system in solving the difficult intermediate-level vision problems of grouping local elements into individual objects of natural scenes. Second, the conformal camera has its own harmonic analysis—projective Fourier analysis—providing image representation and processing that is well adapted to image projective transformations and the retinotopic mapping of the brain visual and oculomotor pathways. This later assertion follows from the fact that the projective Fourier transform integrates the head, eyes (conformal cameras), and visual cortex into a single computational system. Based on this system, we presented a computational model for some neural processes of the perisaccadic perception. In particular, we modeled the presaccadic activity, which, through shifts of stimuli current receptive fields to their future postsaccadic locations, is thought to underlie the scene remapping of the current foveal frame to the frame at the upcoming saccade target. This remapping uses the motor command of the impending saccade and may help maintain stability of primate perception in spite of three saccadic eye movements per second with the eyeball's maximum speed of deg/sec producing saccades per day. Our modeling also accounted for perisaccadic mislocalization observed by human subjects in laboratory experiments. Finally, we compared our model with the other computational approaches in the modeling trans-saccadic perception and discussed further developments.
Acknowledgment
The author thanks Dr. Noriyasu Homma for helpful comments.
References
1. J. Turski, “Projective fourier analysis in computer vision: theory and computer simulations,” in Vision Geometry VI, A. Y. Wu and L. J. Latecki, Eds., vol. 3168 of Proceeding of SPIE, pp. 124–135, 1997.
2. J. Turski, “Harmonic Analysis on SL(2,) and projectively adapted Pattern representation,” Journal of Fourier Analysis and Applications, vol. 4, no. 1, pp. 67–91, 1998.
3. J. Turski, “Projective Fourier analysis for patterns,” Pattern Recognition, vol. 33, no. 12, pp. 2033–2043, 2000.
4. J. Turski, “Geometric Fourier analysis of the conformal camera for active vision,” SIAM Review, vol. 46, no. 2, pp. 230–255, 2004. View at Publisher · View at Google Scholar · View at MathSciNet
5. J. Turski, “Geometric Fourier analysis for computational vision,” Journal of Fourier Analysis and Applications, vol. 11, no. 1, pp. 1–23, 2005. View at Publisher · View at Google Scholar · View at MathSciNet
6. J. Turski, “Computational harmonic analysis for human and robotic vision systems,” Neurocomputing, vol. 69, no. 10–12, pp. 1277–1280, 2006. View at Publisher · View at Google Scholar
7. E. L. Schwartz, “Computational anatomy and functional architecture of striate cortex: a spatial mapping approach to perceptual coding,” Vision Research, vol. 20, no. 8, pp. 645–669, 1980. View at Publisher · View at Google Scholar
8. J. Turski, “Harmonic analysis for cognitive vision: perisaccadic perception,” in Human Vision and Electronic Imaging XIV, B. E. Rogowitz and T. N. Pappas, Eds., vol. 7240 of Proceeding of SPIE, pp. 72401A-1–72401A-5, 2009.
9. P. H. Schiller, “The neural control of visual guided eye movements,” in Cognitive Neuroscience of Attention: A Developmental Perspective, J. E. Richards, Ed., pp. 3–50, Erlbnum Associates, Lawrence, Kan, USA, 1998.
10. R. H. Wurtz, “Neuronal mechanisms of visual stability,” Vision Research, vol. 48, no. 20, pp. 2070–2089, 2008. View at Publisher · View at Google Scholar · View at PubMed
11. C. L. Colby and M. E. Goldberg, “Space and attention in parietal cortex,” Annual Review of Neuroscience, vol. 22, pp. 319–349, 1999. View at Publisher · View at Google Scholar · View at PubMed
12. J.-R. Duhamel, C. L. Colby, and M. E. Coldberg, “The updating of the representation of visual space in parietal cortex by intended eye movements,” Science, vol. 255, no. 5040, pp. 90–92, 1992.
13. D. Melcher and C. L. Colby, “Trans-saccadic perception,” Trends in Cognitive Sciences, vol. 12, no. 12, pp. 466–473, 2008. View at Publisher · View at Google Scholar · View at PubMed
14. E. P. Merriam, C. R. Genovese, and C. L. Colby, “Remapping in human visual cortex,” Journal of Neurophysiology, vol. 97, no. 2, pp. 1738–1755, 2007. View at Publisher · View at Google Scholar · View at PubMed
15. M. A. Sommer and R. H. Wurtz, “A pathway in primate brain for internal monitoring of movements,” Science, vol. 296, no. 5572, pp. 1480–1482, 2002. View at Publisher · View at Google Scholar · View at PubMed
16. O. J. Grüsser, “On the history of the ideas of efference copy and reafference,” Clio Medica, vol. 33, pp. 35–55, 1995.
17. A. Hunt and P. Cavanagh, “Clocking saccadic remapping,” Journal of Vision, vol. 8, p. 818, 2008.
18. F. H. Hamker, M. Zirnsak, D. Calow, and M. Lappe, “The peri-saccadic perception of objects and space,” PLOS Computational Biology, vol. 4, no. 2, pp. 1–15, 2008. View at Publisher · View at Google Scholar · View at PubMed
19. M. Kaiser and M. Lappe, “Perisaccadic mislocalization orthogonal to saccade direction,” Neuron, vol. 41, no. 2, pp. 293–300, 2004. View at Publisher · View at Google Scholar
20. M. Lappe, H. Awater, and B. Krekelberg, “Postsaccadic visual references generate presaccadic compression of space,” Nature, vol. 403, no. 6772, pp. 892–895, 2000. View at Publisher · View at Google Scholar · View at PubMed
21. J. Ross, M. C. Morrone, and D. C. Burr, “Compression of visual space before saccades,” Nature, vol. 386, no. 6625, pp. 598–601, 1997. View at Publisher · View at Google Scholar · View at PubMed
22. H. Honda, “The time courses of visual mislocalization and of extraretinal eye position signals at the time of vertical saccades,” Vision Research, vol. 31, no. 11, pp. 1915–1921, 1991. View at Publisher · View at Google Scholar
23. L. Matin and D. G. Pearce, “Visual perception of direction for stimuli flashed during voluntary saccadic eye movements,” Science, vol. 148, no. 3676, pp. 1485–1488, 1965.
24. J. Schlag and M. Schlag-Rey, “Illusory localization of stimuli flashed in the dark before saccades,” Vision Research, vol. 35, no. 16, pp. 2347–2357, 1995. View at Publisher · View at Google Scholar
25. H. Awater and M. Lappe, “Mislocalization of perceived saccade target position induced by perisaccadic visual stimulation,” Journal of Neuroscience, vol. 26, no. 1, pp. 12–20, 2006. View at Publisher · View at Google Scholar · View at PubMed
26. F. Ostendorf, C. Fischer, C. Finke, and C. J. Ploner, “Perisaccadic compression correlates with saccadic peak velocity: differential association of eye movement dynamics with perceptual mislocalization patterns,” Journal of Neuroscience, vol. 27, no. 28, pp. 7559–7563, 2007. View at Publisher · View at Google Scholar · View at PubMed
27. S. M. C. I. Van Wetter and A. J. Van Opstal, “Experimental test of visuomotor updating models that explain perisaccadic mislocalization,” Journal of Vision, vol. 8, no. 14, pp. 1–22, 2008. View at Publisher · View at Google Scholar · View at PubMed
28. K. Matsumiya and K. Uchikawa, “The role of presaccadic compression of visual space in spatial remapping across saccadic eye movements,” Vision Research, vol. 43, no. 18, pp. 1969–1981, 2003. View at Publisher · View at Google Scholar
29. R. VanRullen, “A simple translation in cortical log-coordinates may account for the pattern of saccadic localization errors,” Biological Cybernetics, vol. 91, no. 3, pp. 131–137, 2004. View at Publisher · View at Google Scholar · View at PubMed
30. M. Demeyer, P. De Graef, J. Wagemans, and K. Verfaillie, “Transsaccadic identification of highly similar artificial shapes,” Journal of Vision, vol. 9, no. 4, article 28, pp. 1–14, 2009. View at Publisher · View at Google Scholar · View at PubMed
31. D. Melcher, “Dynamic, object-based remapping of visual features in transsaccadic perception,” Journal of Vision, vol. 9, no. 14, article 2, pp. 1–17, 2008.
32. D. Melcher, “Selective attention and the active remapping of object features in trans-saccadic perception,” Vision Research, vol. 49, no. 10, pp. 1249–1255, 2009. View at Publisher · View at Google Scholar · View at PubMed
33. M. Wittenberg, F. Bremmer, and T. Wachtler, “Perceptual evidence for saccadic updating of color stimuli,” Journal of Vision, vol. 8, no. 14, pp. 1–9, 2008. View at Publisher · View at Google Scholar · View at PubMed
34. S. Anstis, “Picturing peripheral acuity,” Perception, vol. 27, no. 7, pp. 817–825, 1998.
35. D. C. Burr, M. C. Morrone, and J. Ross, “Selective suppression of the magnocellular visual pathway during saccadic eye movements,” Nature, vol. 371, no. 6497, pp. 511–513, 1994. View at Publisher · View at Google Scholar · View at PubMed
36. Y. Yarbus, Eye Movements and Vision, Plenum Press, New York, NY, USA, 1967.
37. B. Girard and A. Berthoz, “From brainstem to cortex: computational models of saccade generation circuitry,” Progress in Neurobiology, vol. 77, no. 4, pp. 215–251, 2005. View at Publisher · View at Google Scholar · View at PubMed
38. J. Najemnik and W. S. Geisler, “Optimal eye movement strategies in visual search,” Nature, vol. 434, no. 7031, pp. 387–391, 2005. View at Publisher · View at Google Scholar · View at PubMed
39. P. W. Glimcher, “Making choices: the neurophysiology of visual-saccadic decision making,” Trends in Neurosciences, vol. 24, no. 11, pp. 654–659, 2001. View at Publisher · View at Google Scholar
40. M. Berger, Geometry I, Springer, New York, NY, USA, 1987.
41. G. Jones and D. Singerman, Complex Functions, Cambridge University Press, Cambridge, UK, 1987.
42. M. Henle, Modern Geometries. The Analytical Approach, Prentice Hall, Upper Saddle River, NJ, USA, 1997.
43. D. A. Brannan, M. F. Esplen, and J. J. Gray, Geometry, Cambridge University Press, Cambridge, UK, 1998.
44. S. Ullman, Higher-Level Vision: Object Recognition and Visual Cognition, MIT Press, Cambridge, Mass, USA, 1996.
45. K. Koffka, Principles of Gestalt Psychology, Harcourt & Brace, New York, NY, USA, 1935.
46. M. Wertheimer, Laws of Organization in Perceptual Forms, Harcourt, Brace & Jovanovitch, London, UK, 1938.
47. D. J. Field, A. Hayes, and R. F. Hess, “Contour integration by the human visual system: evidence for a local ‘association field’,” Vision Research, vol. 33, no. 2, pp. 173–193, 1993. View at Publisher · View at Google Scholar
48. P. Parent and S. W. Zucker, “Trace inference, curvature consistency, and curve detection,” IEEE Transactions on Pattern Analysis and Machine Intelligence, vol. 11, no. 8, pp. 823–839, 1989. View at Publisher · View at Google Scholar
49. C. C. Chow, D. Z. Jin, and A. Treves, “Is the world full of circles?” Journal of Vision, vol. 2, no. 8, pp. 571–576, 2002. View at Publisher · View at Google Scholar · View at PubMed
50. M. Sigman, G. A. Cecchi, C. D. Gilbert, and M. O. Magnasco, “On a common circle: natural scenes and gestalt rules,” Proceedings of the National Academy of Sciences of the United States of America, vol. 98, no. 4, pp. 1935–1940, 2001. View at Publisher · View at Google Scholar · View at PubMed
51. H. Blum, “Biological shape and visual science,” Journal of Theoretical Biology, vol. 38, no. 2, pp. 205–287, 1973.
52. M. Leyton, “A theory of information structure I. General principles,” Journal of Mathematical Psychology, vol. 30, no. 2, pp. 103–160, 1986.
53. M. Leyton, “A theory of information structure II: a theory of perceptual organization,” Journal of Mathematical Psychology, vol. 30, no. 3, pp. 257–305, 1986.
54. F. Attneave, “Some informational aspects of visual perception,” Psychological Review, vol. 61, no. 3, pp. 183–193, 1954. View at Publisher · View at Google Scholar
55. D. D. Hoffman and W. A. Richards, “Parts of recognition,” Cognition, vol. 18, no. 1–3, pp. 65–96, 1984.
56. I. Kovacs and B. Julesz, “Perceptual sensitivity maps within globally defined visual shapes,” Nature, vol. 370, no. 6491, pp. 644–646, 1994. View at Publisher · View at Google Scholar · View at PubMed
57. A. W. Knapp, Representation Theory of Semisimple Groups: An Overview Based on Examples, Princeton University Press, Princeton, NJ, USA, 1986.
58. N. Tabareau, D. Bennequin, A. Berthoz, J.-J. Slotine, and B. Girard, “Geometry of the superior colliculus mapping and efficient oculomotor computation,” Biological Cybernetics, vol. 97, no. 4, pp. 279–292, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at MathSciNet
59. Y. Petrov, M. Carandini, and S. McKee, “Two distinct mechanisms of suppression in human vision,” Journal of Neuroscience, vol. 25, no. 38, pp. 8704–8707, 2005. View at Publisher · View at Google Scholar · View at PubMed
60. J. Xing and D. J. Heeger, “Center-surround interactions in foveal and peripheral vision,” Vision Research, vol. 40, no. 22, pp. 3065–3072, 2000.
61. M. Lavidor and V. Walsh, “The nature of foveal representation,” Nature Reviews Neuroscience, vol. 5, no. 9, pp. 729–735, 2004. View at Publisher · View at Google Scholar
62. C. F. R. Weiman, “Log-polar Binocular Vision System,” Transition Research Corporation: NASA Phase II SBIR Final Report, 1994.
63. F. Berton, G. Sandini, and G. Metta, “Anthropomorphic visual sensors, in encyclopedia of sensors,” C. A. Grimes, E. C. Dickey, and M. V. Pishko, Eds., vol. 10, pp. 1–16, American Scientific, New York, NY, USA, 2006.
64. G. Bonmassar and E. L. Schwartz, “Space-variant fourier analysis: the exponential chirp transform,” IEEE Transactions on Pattern Analysis and Machine Intelligence, vol. 19, no. 10, pp. 1080–1089, 1997.
65. A. Bernardino, J. Santos-Victor, and G. Sandini, “Foveated active tracking with redundant 2D motion parameters,” Robotics and Autonomous Systems, vol. 39, no. 3-4, pp. 205–221, 2002. View at Publisher · View at Google Scholar
66. G. Baratoff, C. Toepfer, and H. Neumann, “Combined space-variant maps for optical-flow-based navigation,” Biological Cybernetics, vol. 83, no. 3, pp. 199–209, 2000.
67. N. Tamayo and V. J. Traver, “Entropy-based saliency computation in log-polar images,” in Proceedings of the 3rd International Conference on Computer Vision Theory and Applications, (VISAPP '08), vol. 1, pp. 501–506, 2008.
68. R. Manzotti, A. Gasteratos, G. Metta, and G. Sandini, “Disparity estimation on log-polar images and vergence control,” Computer Vision and Image Understanding, vol. 83, no. 2, pp. 97–117, 2001. View at Publisher · View at Google Scholar
69. M. A. Silver and S. Kastner, “Topographic maps in human frontal and parietal cortex,” Trends in Cognitive Sciences, vol. 13, no. 11, pp. 488–495, 2009. View at Publisher · View at Google Scholar · View at PubMed
70. C. D. Martin, G. Thierry, J.-F. Démonet, M. Roberts, and T. Nazir, “ERP evidence for the split fovea theory,” Brain Research, vol. 1185, no. 1, pp. 212–220, 2007. View at Publisher · View at Google Scholar · View at PubMed
71. E. Zaidel and M. Iacobini, The Parallel Brain: The Cognitive Neuroscience of the Corpus Callosum, A Bradford Book, MIT Press, Cambridge, Mass, USA, 2003.
72. A. P. Saygin and M. I. Sereno, “Retinotopy and attention in human occipital, temporal, parietal, and frontal cortex,” Cerebral Cortex, vol. 18, no. 9, pp. 2158–2168, 2008. View at Publisher · View at Google Scholar · View at PubMed
73. V. H. Perry and A. Cowey, “The ganglion cell and cone distributions in the monkey's retina: implications for central magnification factors,” Vision Research, vol. 25, no. 12, pp. 1795–1810, 1985.
74. N. M. Putnam, H. J. Hofer, N. Doble, L. Chen, J. Carroll, and D. R. Williams, “The locus of fixation and the foveal cone mosaic,” Journal of Vision, vol. 5, no. 7, pp. 632–639, 2005. View at Publisher · View at Google Scholar · View at PubMed
75. B. Fischl, M. I. Sereno, and A. M. Dale, “Cortical surface-based analysis. II: inflation, flattening, and a surface-based coordinate system,” NeuroImage, vol. 9, no. 2, pp. 195–207, 1999. View at Publisher · View at Google Scholar · View at PubMed
76. J. Gottlieb, “From a different point of view: extrastriate cortex integrates information across saccades. Focus on “Remapping in Human Visual Cortex”,” Journal of Neurophysiology, vol. 97, no. 2, pp. 961–962, 2007. View at Publisher · View at Google Scholar · View at PubMed
77. L. Fei-Fei, A. Iyer, C. Koch, and P. Perona, “What do we perceive in a glance of a real-world scene?” Journal of Vision, vol. 7, no. 1, article 10, pp. 1–29, 2007.
78. A. M. Larson and L. C. Loschky, “The contributions of central versus peripheral vision to scene gist recognition,” Journal of Vision, vol. 9, no. 10, article 6, pp. 1–16, 2009. View at Publisher · View at Google Scholar · View at PubMed
79. M. C. Morrone, J. Ross, and D. Burr, “Saccadic eye movements cause compression of time as well as space,” Nature Neuroscience, vol. 8, no. 7, pp. 950–954, 2005. View at Publisher · View at Google Scholar · View at PubMed
80. D. Burr and C. Morrone, “Time perception: space-time in the brain,” Current Biology, vol. 16, no. 5, pp. R171–R173, 2006. View at Publisher · View at Google Scholar · View at PubMed
81. M. C. Morrone, J. Ross, and D. Burr, “Keeping vision stable: rapid updating of spatiotopic receptive fields may cause relativistic-like effect,” in Problems of Space and Time in Perception, R. Nijhawan, Ed., Cambridge, UK, 2008.
82. S. Sternberg, Group Theory and Physics, Cambridge University Press, Cambridge, UK, 1994.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:53:08.000Z
|
p6fpsr6d6r6e4n5lh3fl5p76wnjxzegt
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36241",
"uncompressed_offset": 451788618,
"url": "www.indiaenvironmentportal.org.in/category/thesaurus/endosulfan-case",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.indiaenvironmentportal.org.in/category/thesaurus/endosulfan-case"
}
|
cccc_CC-MAIN-2013-20
|
The Endosulfan Peedhitha Janakeeya Munnani (EPJM) will convene a ‘Jagratha’ (Vigil) convention here on Friday to urge the authorities concerned to implement the promised package in a time-bound manner to the affected families of endosulfan victims..
The meeting will be inaugurated by poet and green activist Sugatha Kumari at the Municipal Conference hall at 10 a.m. on Friday, EPJM convener Ambalathara Kunhikrishnan told a press conference here on Wednesday.
The Endosulfan Victims Relief and Remediation Cell has been functioning effectively in Kasaragod district, an affidavit filed by the State government in the Kerala High Court said.
The affidavit was filed in response to a petition seeking a directive to the government to take follow-up actions on the welfare and rehabilitation measures of endosulfan victims.
The work of the Rs.200 crore worth projects funded by the National Bank for Rural Development (NABARD) aimed at infrastructure development in the endosuflan-affected localities in the district will be inaugurated at Bovikkanam near here on April 5.
The function would be inaugurated by Social Welfare Minister M.K. Muneer and Agriculture Minister K. P. Mohanan, P. Karunakaran, MP, said at a prèss conference here on Tuesday.
Panchayat-level monitoring cell to be floated
Having received clear cut assurances from the State government on majority of issues pertaining to the complex relief and rehabilitation package, the Endosulfan Peedhitha Janakeeya Munnani (EPJM) is now trying to evolve a mechanism to ensure that the authorities implemented the decisions in a time-bound manner.
Endosulfan Peedhitha Janakeeya Munnani has announced that it will go ahead with its agitation following failure of talks held with Chief Minister Oommen Chandy here on Thursday.
The Munnani convenor Ambalathara Kunhikrishnan told The Hindu that the Chief Minister had conceded hardly any of their demands. Regarding conduct of another medical camp to identify fresh victims, Mr. Chandy had only promised a decision at the next round of talks on Monday.
Environmentalists in the city have urged the state government to take immediate steps to save the life of Mohan Kumar who is on a hunger strike at the High Court Junction demanding a comprehensive compensation package for victims of endosulfan in Kasargod district.
Inaugurating a protest meeting at the High Court junction, environmentalist M K Prasad said the government could not back track from the responsibility of providing protection to the victims.
Formal discussion on Monday
As the indefinite hunger strike seeking swift and comprehensive rehabilitation of endosulfan victims in the district entered 31st day on Wednesday, a five-member delegation of agitating activists will hold preliminary talks with Chief Minister Oommen Chandy in Thiruvananthapuram on Thursday ahead of the formal talks scheduled on Monday.
Hunger strike protest completes a month
As the hunger strike for the cause of endosulfan victims in the district completed a month here on Monday, people formed a human wall to protest against the alleged laxity of the State government in rehabilitating the affected population. Inaugurating the protest, Ambalathara Muneesa, a victim born without sight who has two postgraduate degrees, sought the resignation of N.A. Nellikunnu and P.B. Abdul Razak, MLAs from the district, for the alleged callous approach of the government.
No minister to be allowed to step into district if apathy continues: T.V. Rajesh
Accusing Chief Minister Oommen Chandy of shying away from disbursing rightful assistance to endosulfan victims, the Democratic Youth Federation of India (DYFI) has warned that it will not allow any ministers to step into the district if the UDF government continued to show lethargy in taking care of the hapless victims.
An indefinite hunger strike launched by the Endosulfan Peeditha Janakeeya Munnai (EPJM) seeking effective and swift relief and rehabilitation for hundreds of endosulfan victims and their families crossed three weeks on Monday.
Environmentalist A. Mohankumar has been fasting at the strike venue for eight days. The doctors who examined him on Monday morning said his vital parameters were normal.
Pages
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:26:31.000Z
|
2bcfqxzron3i4keiig2sgkj62y2uoy2l
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36242",
"uncompressed_offset": 456494354,
"url": "www.isfdb.org/cgi-bin/title.cgi",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.isfdb.org/cgi-bin/title.cgi?1012674"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: The Age of Wonders
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Title: The Age of Wonders
Editor: Jeffry Dwight
Year: 2000
Type: ANTHOLOGY
Series: Darkfire Anthology
Series Number: 3
ISFDB Record Number: 1012674
User Rating: This title has fewer than 5 votes. VOTE
Current Tags: None Add Tags
Publications:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:49:27.000Z
|
hlultftlvzspa3ckgtmdveva4nuztupo
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36252",
"uncompressed_offset": 500894281,
"url": "www.mdpi.com/1422-0067/13/12/15801",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.mdpi.com/1422-0067/13/12/15801"
}
|
cccc_CC-MAIN-2013-20
|
Int. J. Mol. Sci. 2012, 13(12), 15801-15812; doi:10.3390/ijms131215801
Article
Cholesterol-Dependent Energy Transfer between Fluorescent Proteins—Insights into Protein Proximity of APP and BACE1 in Different Membranes in Niemann-Pick Type C Disease Cells
1 Department of Experimental Neurology, Ulm University, Helmholtz Str. 8/1, 89081 Ulm, Germany 2 Institut für Angewandte Forschung, Hochschule Aalen, Anton-Huber Str. 21, 73430 Aalen, Germany 3 Division of Molecular Medicine, Rudjer Boskovic Institute, Bijenicka 54, 10000 Zagreb, Croatia
* Author to whom correspondence should be addressed.
Received: 18 October 2012; in revised form: 14 November 2012 / Accepted: 15 November 2012 / Published: 26 November 2012
(This article belongs to the Special Issue Förster Resonance Energy Transfer (FRET))
Download PDF Full-Text [560 KB, uploaded 26 November 2012 11:02 CET]
Abstract: Förster resonance energy transfer (FRET) -based techniques have recently been applied to study the interactions between β-site APP-cleaving enzyme-GFP (BACE1-GFP) and amyloid precursor protein-mRFP (APP-mRFP) in U373 glioblastoma cells. In this context, the role of APP-BACE1 proximity in Alzheimer’s disease (AD) pathogenesis has been discussed. FRET was found to depend on intracellular cholesterol levels and associated alterations in membrane stiffness. Here, NPC1 null cells (CHO-NPC1−/−), exhibiting increased cholesterol levels and disturbed cholesterol transport similar to that observed in Niemann-Pick type C disease (NPC), were used to analyze the influence of altered cholesterol levels on APP-BACE1 proximity. Fluorescence lifetime measurements of whole CHO-wild type (WT) and CHO-NPC1−/− cells (EPI-illumination microscopy), as well as their plasma membranes (total internal reflection fluorescence microscopy, TIRFM), were performed. Additionally, generalized polarization (GP) measurements of CHO-WT and CHO-NPC1−/− cells incubated with the fluorescence marker laurdan were performed to determine membrane stiffness of plasma- and intracellular-membranes. CHO-NPC1−/− cells showed higher membrane stiffness at intracellular- but not plasma-membranes, equivalent to cholesterol accumulation in late endosomes/lysosomes. Along with higher membrane stiffness, the FRET efficiency between BACE1-GFP and APP-mRFP was reduced at intracellular membranes, but not within the plasma membrane of CHO-NPC1−/−. Our data show that FRET combined with TIRF is a powerful technique to determine protein proximity and membrane fluidity in cellular models of neurodegenerative diseases.
Keywords: FRET; cholesterol; APP; BACE1; NPC; TIRFM; neurodegeneration; laurdan; generalized polarization
Supplementary Files
Article Statistics
Click here to load and display the download statistics.
Cite This Article
MDPI and ACS Style
von Einem, B.; Weber, P.; Wagner, M.; Malnar, M.; Kosicek, M.; Hecimovic, S.; vonArnim, C.A.F.; Schneckenburger, H. Cholesterol-Dependent Energy Transfer between Fluorescent Proteins—Insights into Protein Proximity of APP and BACE1 in Different Membranes in Niemann-Pick Type C Disease Cells. Int. J. Mol. Sci. 2012, 13, 15801-15812.
AMA Style
von Einem B, Weber P, Wagner M, Malnar M, Kosicek M, Hecimovic S, vonArnim CAF, Schneckenburger H. Cholesterol-Dependent Energy Transfer between Fluorescent Proteins—Insights into Protein Proximity of APP and BACE1 in Different Membranes in Niemann-Pick Type C Disease Cells. International Journal of Molecular Sciences. 2012; 13(12):15801-15812.
Chicago/Turabian Style
von Einem, Bjoern; Weber, Petra; Wagner, Michael; Malnar, Martina; Kosicek, Marko; Hecimovic, Silva; vonArnim, Christine A.F.; Schneckenburger, Herbert. 2012. "Cholesterol-Dependent Energy Transfer between Fluorescent Proteins—Insights into Protein Proximity of APP and BACE1 in Different Membranes in Niemann-Pick Type C Disease Cells." Int. J. Mol. Sci. 13, no. 12: 15801-15812.
Int. J. Mol. Sci. EISSN 1422-0067 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:33:45.000Z
|
yoh437wsag6wdzhhcg5sb4d6hqocgx7d
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36267",
"uncompressed_offset": 549632655,
"url": "www.panarmenian.net/eng/news/123785/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.panarmenian.net/eng/news/123785/"
}
|
cccc_CC-MAIN-2013-20
|
Opera launches new Opera Mini for Android 7.5
PanARMENIAN.Net - Opera has just launched the latest version of its mobile browser. Opera Mini for Android 7.5 brings a few new touches, including a socially focused Smart Page, the VentureBeat reports.
The Smart Page includes a social tab, a news section, and a selection of links curated based on location. The social tab will bring updates from Twitter and Facebook into an at-a-glance interface.
“This is a real time saver,” said Opera CEO Lars Boilesen in a statement on the news. “There are just too many social networks, and I’m a busy man. Now, thanks to the Smart Page, I can get all the updates at a glance, even from my favorite Danish newspapers.”
The new version of the browser keeps current features such as Speed Dial, which stores shortcuts and displays them in new tabs.
On the technical side, the mobile browser compresses data to compensate for congested carrier networks and limited data plans. In fact, Opera is so confident about this particular feature, it’s claiming it can save users up to 90 percent of data charges on a pay-per-megabyte data plan.
Partner news
Top stories
It’s not the first time Yahoo CEO Marissa Mayer has been interested in the New York-based hipster blogging service.
The number of new smartphones delivered with Android jumped to 162.1 million in the first three months in 2013.
“We believe Samsung generates more revenue and profit from the Android platform than Google does,” Neil Mawston said.
The service now also makes it easier for users to add new contacts sent to them by friends, and has support for Simplified Chinese.
Partner news
Employers and job seekers: how to find each other
Arpine Grigoryan։ each job seeker should understand why to apply for this “x” job in this “x” company but not for “y” job in “y” company.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:20:28.000Z
|
albrdyzi3kqaatkgkx3neqpkgnqb663k
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36269",
"uncompressed_offset": 555914757,
"url": "www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A1999.01.0239%3Abook%3D1%3Achapter%3D2%3Asection%3D17",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A1999.01.0239%3Abook%3D1%3Achapter%3D2%3Asection%3D17"
}
|
cccc_CC-MAIN-2013-20
|
[17]
The customs of the inhabitants of Meninx1 closely correspond to the description of the Lotophagi. If any thing does not correspond, it should be attributed to change, or to misconception, or to poetical licence, which is made up of history, rhetoric, and fiction. Truth is the aim of the historical portion, as for instance in the Catalogue of Ships,2 where the poet informs us of the peculiarities of each place, that one is rocky, another the furthest city, that this abounds in doves. and that is maritime. A lively interest is the end of the rhetorical, as when he points to us the combat; and of the fiction, pleasure and astonishment. A mere fabrication would neither be persuasive nor Homeric; and we know that his poem is generally considered a scientific treatise, notwithstanding what Eratosthenes may say, when he bids us not to judge poems by the standard of intellect, nor yet look to them for history.
It is most probable that the line
“ Nine days by cruel storms thence was I borne
Athwart the fishy deep,3
Odyssey ix. 82.
should be understood of merely a short distance, (for cruel storms do not blow in a right course,) and not of being carried beyond the ocean, as if impelled by favourable winds. ‘And,’ says Polybius, ‘allowing the distance from Malea4 to the Pillars to be 22,500 stadia, and supposing the rate of passage was the same throughout the nine days, the voyage must have been accomplished at the speed of 2500 stadia per diem: now who has ever recorded that the passage from Lycia or Rhodes to Alexandria, a distance of 4000 stadia, has been made in two days? To those who demand how it was that Ulysses, though he journeyed thrice to Sicily, never once navigated the Strait, we reply that, long after his time, voyagers always sedulously avoided that route.’
1 At this place there was an altar consecrated to Ulysses. Meninx is now known as the island of Zerbi, on the side of the Bay of Cabus, on the coast of Africa.
2 The second book of the Iliad.
3 And from thence I was carried for nine days over t' fishy sea by baleful winds. Odyssey ix. 82.
4 Cape Maleo off the Morea. The distance from this point to Gibraltar is now estimated at 28° 34′. The 22,500 stadia of Polybius would equal 32° 8′ 34″. He was therefore out in his calculation by 3° 34′ 34″.
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
load focus Greek (1877)
hide References (3 total)
hideData/Identifiers
Citation URN: urn:cts:greekLit:tlg0099.tlg001.perseus-eng2:1.2.17
Document URN: urn:cts:greekLit:tlg0099.tlg001.perseus-eng2
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:00:50.000Z
|
cseylzqvuyflcqaz74ctbbyxj2jsqjtu
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36270",
"uncompressed_offset": 555947237,
"url": "www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A2001.05.0304%3Achapter%3D12",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A2001.05.0304%3Achapter%3D12"
}
|
cccc_CC-MAIN-2013-20
|
[63]
Charlestown schools after 1812
By Frank Mortimer Hawes
(Continued.)
Before continuing our account of the Charlestown schools, we wish to speak briefly of some of the earlier trustees who honored their office with years of valuable service. Charlestown can point with pride to the long list of men who served her so faithfully. One need but look to the original board of 1793 to see that only her first citizens were considered worthy to be directors of school affairs.
Trustees for 1793 and 1794, Richard Devens, Nathaniel Gorham, Josiah Bartlett, Aaron Putnam, Joseph Hurd, Nathaniel Hawkins, Seth Wyman.
1795 and 1796, the same, with the exception of Mr. Hawkins, who was succeeded by Timothy Tufts.
1797, 1798, 1799, the same, with the exception of Hon. Nathaniel Gorham, who was followed by his son, Nathaniel Gorham, Jr., and Timothy Tufts, who was succeeded by Samuel Tufts.
1800 and 1801, Seth Wyman, Samuel Tufts, Jonathan Teel, Rev. Jedediah Morse, Benjamin Hurd, Jr., Timothy Walker, Timothy Thompson.
1802, Samuel Tufts, Seth Wyman, Jonathan Teel, Captain Thomas Harris, Matthew Bridge, Deacon David Goodwin, Samuel Payson.
1803 and 1804, the same, with the exception of Samuel Payson, who was succeeded by Captain Nehemiah Wyman.
1805, Seth Wyman, Captain Harris, Matthew Bridge, Deacon Goodwin, John Stone, Peter Tufts, Jr., Joseph Phipps.
1806, Seth Wyman, Matthew Bridge, Peter Tufts, Jr., James Green, Elijah Mead, John Tufts, Samuel Thompson.
1807, James Green, Elijah Mead, Peter Tufts, Jr., Captain Daniel Reed, John Kettell, Daniel Parker, Samuel Kent.
1808, the same, with the exception of James Green, who was succeeded by Timothy Thompson.
1809, the same. [64]
1810, the same, with the exception of Timothy Thompson, who was succeeded by David Devens.
1811, Rev. William Collier, Jonas Tyler, William Austin, Joseph Phipps, Samuel Kent, Philemon R. Russell, Ebenezer Cutter.
1812, Rev. William Collier, Dr. Abram R. Thompson, Captain Nehemiah Wyman, Captain Daniel Reed, David Stetson, Captain Joseph Miller, George Bartlett.
1813, 1814, 1815, the same.
1816, the same, with the exception of Captain Miller, who is succeeded by Isaac Tufts.
Holding over for a number of years previous to the reorganization of 1793 is the name of Nathaniel Hawkins. Wyman, who gives him the title of colonel, says that Mr. Hawkins came to Charlestown from South Kingston, R. I., and that he was recorded in the census of 1789 with his children, Nathaniel, Christopher, Sarah, and Samuel. This was after the death of the first Mrs. Hawkins, and about the time of his second marriage. Both wives were the daughters of Samuel Kent (Vol. III., p. 89). Old residents of Union square will remember the two homes of the Hawkins families in that vicinity. At his own request, Mr. Hawkins' term on the school board ended May 6, 1795, when he received the thanks of the town for his valued services. As local committeeman for Milk Row district, his name has been mentioned frequently in these articles. After 1795 we find him holding various town offices, as surveyor of highways and selectman. He died October 3, 1817, aged sixty-nine (Wyman). On the board of trustees he was succeeded for two years by Timothy Tufts, Esq., and the next in succession from their district was Samuel Tufts, 1797-1804, inclusive. For a brief account of these two brothers the reader is referred to Vol. III., p. 92.
Another name which has already received our attention is that of Seth Wyman. For several years before 1793, and for fourteen years after, 1793-1806, inclusive, Mr. Wyman served continuously on the school board, perhaps the longest of any one individual after Samuel Kent. His home was in the upper [65] part of the town, in what is now Arlington, near the Mystic ponds. He was the son of Hezekiah Wyman, and was born in 1750. About 1774 he married Ruth Belknap, and was the father of eight children. He died in April, 1825, aged seventy-live (Wyman).
The names of Richard Devens, Nathaniel Gorham, and Josiah Bartlett would add lustre to the history of any municipality. All three were actively engaged in town affairs during the trying days of the Revolution and in the important years which followed, when state and national constitutions were being established, and each gained for himself in his special line of service more than a local reputation. Wyman's invaluable work gives an account of these gentlemen. Hon. Richard Devens, commissary-general in the Revolutionary army, was the first president of the school trustees. His portrait, painted by Henry Sargent, 1798, and bequeathed to his native town by Charlotte Harris, hangs in the Boston Branch Library at Charlestown, City square. A later generation has made the name of Devens still more illustrious. Our interest in Hon. Josiah Bartlett, M. D., Ll.D., (1759-1820) centres chiefly in his sketch of 1813, which may be called the first history of Charlestown. Hon. Nathaniel Gorham, regarded by Wyman as one of the most eminent men that ever lived in Charlestown, died while serving on the board of trustees, and was succeeded by his son and namesake the following May, 1797.
Two others elected to the original body of trustees should have more than a passing mention,—Aaron Putnam, Esq., and Joseph Hurd. The former was the first treasurer of the organization, an important office when we consider that it was for a better management of the school funds that a charter was granted by legislative act. Dr. Putnam's name deserves to be mentioned in connection with Charlestown affairs, for it was he who in 1801, sold to the United States four acres of his own, and as agent secured sixty-five acres, exclusive of flats, for a navy yard. Joseph Hurd, if we mistake not, served as the first secretary of the trustees. He was the son of Benjamin Hurd, [66] and, as we understand it, brother of Benjamin, Jr., who succeeded him on the board.
It is a noticeable fact that Messrs. Devens, Bartlett, Putnam, Hurd, and Gorham, Jr., all retired from office at the same time, and few of their successors, to judge from their terms of service, enjoyed a like degree of popular favor. Jonathan Teel was one of these; he stood for the outlying districts, and continued in office until May, 1805, five years. He died in Somerville June 7, 1828, aged seventy-four, and left worthy descendants to keep the family name in prominence. John Stone and Peter Tufts, Jr., next represent our part of the town, the former serving modestly for one year, the latter for six years. Seth Wyman, the last of the original board, retired in 1807, and was succeeded by Captain Daniel Reed, who for nine years represented the upper end of Charlestown.
Hon. Timothy Walker, Timothy Thompson, Captain Thomas Harris, Deacon David Goodwin, and John Kettell are names that stand for representative Charlestown families, but perhaps the most suggestive name on the list is that of Rev. Jedediah Morse, D. D. (1761-1826). This gentleman, a native of Connecticut, a graduate of Yale, and the leading minister of Charlestown from 1789 to 1820, was at this time delighting the educational world with his Geography, one of the first American text-books to gain an extensive and lasting circulation. For more than fifty years it was used in all parts of the country, but the later editions bore little resemblance to the feeble little volume which first saw the light in Charlestown. It served, where schoolbooks were scarce, not only as a geography, but also as a reading and spelling book. We of to-day are favored with a reminder of this pioneer in American education every time we pass his residence, which is marked with a tablet that proclaims the birthplace of his illustrious son, Samuel F. B. Morse, 1791.
With the election in 1811 and 1812, respectively, of Rev. William Collier, pastor of the First Baptist church of Charlestown, and Abram Rand Thompson, M. D., an old-time physician, whose eighty-five years of life came to an end in his native town [67] in 1866, a new order of things seems to have been introduced. We will now go back to the report for 1812, the first with which we are favored after that of 1802. From now on there will be no interruptions in these reports, and from some of them we shall expect to make copious extracts.
May 8, 1812, the board of trustees organized, with Rev. William Collier, president; Abram R. Thompson, secretary; Nehemiah Wyman, treasurer, who gave bonds for $10,000. Milk Row School, it will be noticed, at this time was represented by Captain Joseph Miller. The number of children in town was 1,167, or 457 between the ages of four and seven, and 710 from seven to fourteen. It appears that no children beyond the Neck, under seven and over fourteen years of age, were allowed to attend the town school. In reply to the complaints which came, in consequence, from the outlying districts, the report says that School No. 4 (Alewife Brook) contains thirty-four children, from four to fourteen, and yet this district receives for that number as much money as is expended within the Neck for fifty-one scholars. ‘This distinction in favor of the schools outside is, in the opinion of the trustees, an ample indemnification for all inconveniences arising from their local situation; besides, the money appropriated without the Neck is abundantly sufficient to defray the expenses of their schools through that part of the year when the inhabitants send their children to them, from seven years old and upward; and the expense of educating their children under seven, it seems as just and reasonable for them to pay out of their own pockets as it is for the inhabitants within the Neck to do it. When we consider that, of the 1,167 children in town, only 133 are without the Neck, or less than one-eighth, and that we expend upon them more than one-fourth of the money (contingencies excepted), it cannot be denied that the rule is not only favorable, but generous, to the people without the Neck.’
The teachers of the town schools were Israel Alger, with Oliver Jaquith for an assistant, and for the others Messrs. Fuller and Stickney. There had been two public examinations of each during the year, and frequent informal visit had been made, ‘as [68] a board.’ As a necessary and valuable auxiliary in teaching geography, the trustees had furnished a pair of globes and a map for the use of Mr. Alger's school.
A brief allusion is made to the schools taught by women. As an application for a school for black children had been made, one was established which was kept from June to November. Some mischievous boys that were detected in petty thefts were brought before the board, admonished, reproved, and exhorted, and their parents acquainted with their behavior. The three schools without the Neck were all visited in the spring (1813), ‘and the trustees can with sincere pleasure bestow the most unqualified approbation on them.’ ‘The sum required for the current year will be $3,000, the same as last year.’
From the report read May 2, 1814:—
The writing school, kept by D. Fuller, was vacated by him May 20, and Mr. Jaquith took the charge until June 8, when David Dodge was installed. July 18 Mr. Alger suddenly resigned as principal of the grammar school, on account of ill health, and Abraham Andrews, A. B., was elected his successor August 9. Mr. Stickney, at the Neck, gave up his position January 15, and was later succeeded by John Bennett. Mr. Jaquith was retained this year as Mr. Andrews' assistant. He resigned June, 1814, and was succeeded by Robert Gordon.
February 25 the trustees visited District No. 5, which contains twenty-eight scholars, under the care of Nathaniel Green, and also that under Jacob Pierce, No. 4, which has fifty-eight scholars. April 12 they visited the school in Milk Row, No. 3, containing sixty-nine scholars, under Moses Hall. April 19 they visited the school at the Neck, with ninety pupils, under Mr. Bennett, and April 26 and 29 the two schools at No. 1, under Messrs. Andrews, Jaquith, and Dodge. ‘They were perfectly satisfied with the good order and improvement of all.’ ‘The schools without the Neck are kept only part of the year, and are not confined to any age.’ The amount spent on the schools for small children (women's schools) was $872.48. Dr. Bartlett, in his address of 1813, says: ‘A public support of schools kept by women for primary instruction and free to every inhabitant, [69] under the direction of the trustees, though novel, is honorable to the town, and affords a pleasing presage of future improvement.’ If, as he says, twenty-one districts were established, and to each a schoolmistress was assigned for those from four to seven, then, as the whole number was 425; each teacher had about twenty pupils, and the cost for each child was a little more than $2. The address also informs us that two of the schoolhouses on the peninsula were of brick, two stories high. In eulogistic mood, Dr. Bartlett goes on to say: ‘The free schools were the glory of our ancestors, they are the boast of New England, and the palladium of our future prosperity. We cannot refrain from congratulating our fellow-citizens on a situation of their public schools so auspicious to the best interests of the town, so gratifying to the dearest hopes of parents, and bearing such honorable testimony to the eminent ability and fidelity of the instructors.’
The records of the school board that have come down to us begin with May, 1814. According to their By-Laws, the trustees met for organization the first Tuesday following the second Monday in January each year; other meetings to be held as desired. Special meetings could be called by the secretary on direction of the chairman or two members. The treasurer was to give bonds for $6,000. All bills were to be examined by tile chairman and secretary, and to be approved in writing, if found correct. The officers of the board were the same as last given.
August 18, 1814. Voted to Captain Miller $250 for the use of Districts No. 3 and 4. In November the school of Messrs. Andrews and Dodge was examined by the trustees, and a large number of highly respectable visitors. The reverend president opened the exercises with prayer. All were gratified with the behavior and proficiency of the children, and, considering the confused and agitated state of the town, this was highly honorable to the instructors. The exercises closed with prayer by Rev. Mr. Turner. February 10, 1815, the trustees met at Captain Daniel Reed's (end of the town) to visit No. 5, under
Nathaniel Green (number of scholars, twenty-eight), also No. 4, [70] under Jacob Pierce. Milk Row (No. 3) was visited Wednesday, April 12, at 2 o'clock. Present, Messrs. Wyman, Miller, and Thompson, of the trustees. This school, under P. T. Gray, was in ‘a respectable state of improvement. The females at this and every examination have been distinguished for their juvenile attainments, as well as propriety of behavior.’
Among the bills approved April 21 were those of A. Andrews, two quarters, $403.39; P. T. Gray, $82.85; Martha Ireland, $58.50; Jacob Pierce, $123.75; Philemon R. Russell, $80.54.
Abraham Andrews, having resigned, was ‘dismissed with encomiums.’ At the examination, April 27, of Messrs. Dodge and Andrews' school at the town hall, ‘it was a delightful sight to behold 330 children, all clean and decent in their apparel, all prompt in their exercises, all animated with youthful emulation, and hope, and joy, assembled on the floor of an invaluable common privilege. The trustees will not conceal their joy and gratification in view of the interesting scene.’ Jesse Smith, a graduate of Dartmouth College, for the past year preceptor of New Ipswich Academy, succeeds Mr. Andrews, at the established salary of $666.66. A school for black children, opened May 1, and kept through the summer months to the approbation of the trustees, was under the charge of Mrs. Eleanor Jackson. The sum of $1,000 was reserved exclusively for the women's schools within the Neck. Each schoolmistress was required to make a monthly report, together with an accurate return of ail children under her charge. These schools opened May 1, and closed the last of October. Five hundred children from four to seven were thus educated at the expense of the town. The report read May 1, 1815, says: ‘The trustees for two years past have kept a summer school at Winter Hill and the inhabitants have asked for a schoolhouse. The trustees would recommend one if, at the present time, our fellow-citizens were not struggling with great and accumulated burdens. They will endeavor to continue the school on its present establishment another year. They indulge the pleasing hope that, with the joyful return of peace, our fellow-citizens will be restored to their wonted occupations, [71] when they will cheerfully support additional means of education, as the increasing population of the town may require.’ （Signed A. R. Thompson.) This school was probably in the vicinity of Franklin street. Query: Was it in charge of Miss Martha Ireland, whose name has been already mentioned?
1815-1816.
May 16. Voted that Captain Miller open the summer schools in Districts No. 3 and No. 4, and Captain Reed in No. 5. Mr. Dodge is allowed $31.25 per quarter for his son Horace, who serves as his assistant in the writing school. ‘Mr. Smith recommended changing the evangelical instruction for Murray's English Reader and it was so decided.’
August 8 John Bennett resigned at the Neck. The trustees engaged Isaac Gates as his successor, and the same salary as for masters at other schools within the Neck was voted him, $666.66.
April 6, 1816, David Dodge resigned as writing master, and later Robert Gordon, formerly assistant, was promoted to the mastership. Samuel Campbell was elected to second place, at a salary of $500.
Friday, April 19, Milk Row School, under Yorick S. Gordon, was visited. Messrs. Miller and Thompson were present, with several of the inhabitants of the district. The school appeared very well, notwithstanding many difficulties under which they had labored during the winter. Mr. Gordon had discharged his duties acceptably.
May 6 the trustees met, and, taking into consideration the high price of living and, at the same time, appreciating the valuable and successful services of Mr. Gates as a teacher, recommended making him a special grant of $40. Schools in Districts No. 4 and 5 have been kept the past winter to the satisfaction of the board.
In reference to women's schools: ‘By making the privilege of instruction free to all has preserved the chain of education unbroken by the distresses of the people in the shock of war, and so has been an inducement to many to remain in our town. [72] Happily the scene is changed.’ ‘$4,400 will be wanted next year, in addition to the $1,500 for small children's schools.’
1816-1817.
Voted that Isaac Tufts, who has been elected a trustee, have particular charge of No. 3 and No. 4, in place of Captain Miller, resigned, and later, also, of No. 5, as Captain Reed resigned in September. In June Jesse Smith resigned as head of the reading or grammar school. He received the encomiums of the trustees. J. M. K. Wilkins was elected to fill the vacancy. Mr. Gates' salary is raised to $800. As the number of black children from four to fourteen is only ten, it is voted not to have a school for them. Voted that District No. 3 be continued till the Saturday before the first Monday in April. Voted, April 28, to Martha Ireland, $66.
April 15 the trustees discussed the Lancastrian plan of education, and it was voted to apply to J. Buchanan, Esq., British consul in New York, for information. From the report, signed May 5, 1817, we learn that District No. 3 is still maintaining two summer schools, namely, at Milk Row and Winter Hill. In speaking of No. 1, R. Gordon's services are highly praised.
1817-1818.
August 9, 1817, the trustees have looked up the Lancastrian system of education, and paid Mr. Dixon $20 for his information. They decide that it is not feasible for Charlestown.
March 25, 1818. The trustees examined School No. 3. Present, Rev. Mr. Collier, Messrs. I. Tufts, P. Tufts, and Thompson. ‘About fifty scholars attended the examination, and appeared well in all their performances.’ Eighty belong to this school, kept this term by Daniel Russell.
April 3 the trustees examined School No. 4, kept by J. Underwood. About forty were present, out of a total of fifty-two. From bills mentioned, D. Russell is paid $115, and Martha Ireland $71.50. A clock and bell purchased by a sub-committee is presented by Captain Wyman for the exclusive use of the [73] school at the Neck. The report recommends the separation of the sexes in the town school. The districts without the Neck have received a liberal allowance of the money appropriated, and No. 5, in particular, has expended more money than for many years before. ‘It is not to be denied that our schools are expensive, but,’ etc., etc.
1818-1819.
According to a recommendation in the report of a committee appointed to choose a site for a girls' school, I. Prentiss and Miss S. Carlisle were hired, the former at $800, the latter at $400, to have charge. As Mr. Campbell's services were no longer needed, he was discharged. Interesting exercises were held at the opening of this school, September 14, 1818. Later the trustees paid on a lease of eight years $130 for the building in which the girls' school was kept. It seems that it was built and owned by Rev. Mr. Collier, and stood adjacent to Mr. Collier's meeting house. The Baptist society was allowed the use of the building for a Sunday school. The school numbered 241 April 23, 1819. The boys' school, kept by Messrs. Wilkins and Gordon, numbered 200 in September, 1818. Miss Carlisle seems to have been the first woman to teach in Charlestown in a school above primary grade. ‘The trustees were of the opinion that an intelligent mistress would fill the place as well as a master.’ Their expectations seem to have been realized.
Isaac and Joel Tufts are to have charge of the schools without the Neck for the trustees. March 18, 1819, I. Hayward's school, No. 4, was visited. ‘An excellent teacher and gave fine exhibition.’ As the school at No. 5 was not satisfactory, it was closed early in consequence. Voted April 13 to report a statement of facts to the town respecting the territorial limits and number of children in District No. 3. This school went on very well under the care of Mr. Russell until the schoolhouse was destroyed by fire, and so there was no regular exhibition. This fire was the third of March. ‘The district commences in Cambridge road, sweeps around the Cambridge line, [74] runs across Milk row by Isaac Tufts' to Winter Hill, by the house of Joseph Adams, Esq., to Mystic river, and down to the cluster of houses near the entrance of 3 Pole lane, and over to the place of beginning. It contains sixty-one families, and 106 children from four to fourteen, about one-third of whom are below seven years. The remaining seventy-three would be at a fair calculation the highest number to be provided for. Of these, the largest number live on the Milk Row side.’ This is the first report signed by James K. Frothingham, secretary of the board. The following quotations seem worthy of a place here: ‘In populous towns the great mass of boys from seven to fourteen cannot be employed, and it is therefore necessary to keep them constantly at school as a measure of restraint and order, but schools for girls may be suspended with perfect safety, as they can assist at home.’ From observation of Mr. Hayward's school, ‘the trustees are of the opinion that a part of the year devoted to learning and the remainder to some other employment will in the end make quite as good scholars as spending the whole year in education.’
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
hide Places (automatically extracted)
hide People (automatically extracted)
Sort people alphabetically, as they appear on the page, by frequency
Click on a person to search for him/her in this document.
Seth Wyman (8)
Joseph Miller (8)
Abraham Andrews (8)
Nehemiah Wyman (7)
William Collier (7)
Daniel Reed (6)
Nathaniel Hawkins (6)
Nathaniel Gorham (6)
David Dodge (6)
Josiah Bartlett (6)
Richard Devens (5)
Hezekiah Wyman (4)
Samuel Tufts (4)
Isaac Tufts (4)
Timothy Thompson (4)
Aaron Putnam (4)
Samuel Kent (4)
Oliver Jaquith (4)
Martha Ireland (4)
Timothy Tufts (3)
Signed A. R. Thompson (3)
Abram Rand Thompson (3)
Jonathan Teel (3)
Jesse Smith (3)
Jacob Pierce (3)
Joseph Hurd (3)
Benjamin Hurd (3)
Thomas Harris (3)
James Green (3)
Robert Gordon (3)
David Goodwin (3)
Isaac Gates (3)
John Bennett (3)
Israel Alger (3)
J. M. K. Wilkins (2)
Timothy Walker (2)
John Stone (2)
Stickney (2)
Philemon R. Russell (2)
Daniel Russell (2)
Joseph Phipps (2)
Samuel Payson (2)
Jedediah Morse (2)
Elijah Mead (2)
John Kettell (2)
I. Hayward (2)
Nathaniel Green (2)
P. T. Gray (2)
Yorick S. Gordon (2)
D. Fuller (2)
S. Carlisle (2)
Samuel Campbell (2)
James Underwood (1)
Jonas Tyler (1)
Edward Turner (1)
Peter Tufts (1)
John Tufts (1)
Joel Tufts (1)
Samuel Thompson (1)
Abram R. Thompson (1)
David Stetson (1)
Henry Sargent (1)
D. Russell (1)
English Reader (1)
I. Prentiss (1)
Daniel Parker (1)
Murray (1)
Samuel F. B. Morse (1)
Eleanor Jackson (1)
Frank Mortimer Hawes (1)
Charlotte Harris (1)
R. Gordon (1)
James K. Frothingham (1)
Dixon (1)
David Devens (1)
Ebenezer Cutter (1)
Charlestown (1)
J. Buchanan (1)
Benjamin (1)
Ruth Belknap (1)
George Bartlett (1)
William Austin (1)
Joseph Adams (1)
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:51:11.000Z
|
7eecqm4skkd6zs7xpfepvq2lokhrawt3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36271",
"uncompressed_offset": 556024016,
"url": "www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A1999.04.0060%3Aalphabetic+letter%3Dp%3Aentry+group%3D26%3Aentry%3Dporthmeus&toc=Perseus%3Atext%3A1999.04.0060%3Aalphabetic+letter%3Dp%3Aentry+group%3D23",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=Perseus:text:1999.04.0060:alphabetic%20letter=p:entry%20group=26:entry=porthmeus&toc=Perseus%3Atext%3A1999.04.0060%3Aalphabetic+letter%3Dp%3Aentry+group%3D23"
}
|
cccc_CC-MAIN-2013-20
|
porthmeus (disyl.), —, acc. ea, m
, πορτημεύς, the ferryman, i. e. Charon, Iu.
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
hide Dictionary Entry Lookup
Use this tool to search for dictionary entries in all lexica.
Search for in
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:00:38.000Z
|
f7evx22kwchmtcb42pckxhrtrk6xyiu3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36286",
"uncompressed_offset": 700499803,
"url": "www.yam-mag.com/category/pdf/page/2/",
"warc_date": "2013-11-22T19:23:41.000Z",
"warc_filename": "<urn:uuid:09afea15-6a16-435d-899a-0ec1ed35137b>",
"warc_url": "http://www.yam-mag.com/category/pdf/page/2/"
}
|
cccc_CC-MAIN-2013-20
|
Archive for yam pdf//
yam pdf/YAM – Issue 002
posted Saturday, February 14th, 2009
by | Comments (0)
Happy V-day! ~ not that I celebrate or anything, that’s why I bring you a non-Valentine YAM issue. Our second issue, in fact! We’ve kept styles, and we’ve changed a bit of content this time around. More reviews, NO news whatsoever…
yam pdf/YAM – Issue 001
posted Wednesday, December 24th, 2008
by | Comments (2)
First issue of YAM!!! Thank you to all who helped, but anyway… you’ll read inside.
UPCOMING EVENTS//
EVENTS//
ADS//
POLLS//
Who is your reigning Queen or Princess of Pop? [choose up to 5]
Total Voters: 252
Loading ...
Tweets//
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:23:49.000Z
|
lqpgy7gs5ht4zyfr4ekt6x4odo4wwzzi
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36330",
"uncompressed_offset": 71684357,
"url": "elinux.org/index.php?oldid=2128&title=Timer_Hash_Array_Project",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://elinux.org/index.php?title=Timer_Hash_Array_Project&oldid=2128"
}
|
cccc_CC-MAIN-2013-20
|
Timer Hash Array Project
From eLinux.org
Revision as of 03:38, 6 March 2007 by RBot (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
timer-hash-array patch
The patch: timer-hash-array.patch
The test data: timer-hash-tests.txt
The kernel instrumentation: timer-hash-array-test.diff
The user space test program: timer-utils.tar.gz
Handy patch with instrumentation: timer-hash-array-with-test.patch
The original with instrumentation: linux-2.6.7.orig-with-test.patch
Everything in one: timer-hash-array.tar.bz2
Other Links
CELF's HRT project page: Hrt Project
CELF's patch archive page: Patch Archive
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:19:35.000Z
|
5tzbqqtmn3tbav7y6uffnrmpy6b7hjd7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36342",
"uncompressed_offset": 79182653,
"url": "familysearch.org/learn/wiki/en/Loudoun_County,_Virginia_Land",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://familysearch.org/learn/wiki/en/Loudoun_County,_Virginia_Land"
}
|
cccc_CC-MAIN-2013-20
|
Loudoun County, Virginia LandEdit This Page
From FamilySearch Wiki
United States Virginia Loudoun County Land
See also the main article on genealogical research in Loudoun County, Virginia.
Early settlers maps are available for Loudoun County. The cartographers plot the locations of pioneers tracts. The Family History Library has copies: FHL Map 975.52 E7p and FHL Map 975.528 E7sn.
Contents
Deeds
The original deed books are held at the Loudoun County Courthouse in Leesburg, Va. FHL has acquired microfilms of the deed books (1757-1901) and indexes (1757-1916).
The Archives of the Clerk of the Loudoun County Circuit Court has made the following information available online:
Many of Loudoun County's deeds have been abstracted, published, and thoroughly indexed:
• Duncan, Patricia B. Index to Loudoun County, Virginia, Land Deed Books [1757-1800, 1811-1846]. 8 vols. Westminster, Maryland: Willow Bend Books, 2002-2006. Available at FHL. Free Lookups Available! for Deed Books A-Z (1757-1800) and 2A-2M (1800-1810).
• Fowler, Virginia B. and Daughters of the American Revolution. Ketoctin Chapter (Purcellville, Virginia). Loudoun County, Virginia, General Index to Deeds, etc., 1757-1812. Typescript, 1968. Available on microfilm at FHL.
• Johnson, Robert E., Daughters of the American Revolution. Thomas Nelson Chapter (Arlington, Virginia), and Arlington National Cemetery (Arlington, Virginia). Genealogical Records, 1600-1900: Records from 18 Family Bibles, 9 Wills, 11 Deeds, 2 Marriage Bonds, Miscellaneous Records. MSS., 1956, available on microfilm at FHL. [Includes: Copy of will of Arminda Swart, Loudoun County, Virginia (dated 1877); Copy of deed for Arminda Swart, Loudoun County, Virginia (dated 1851) and deeds for James Swart, Sr., (dated 1821-1833).]
• "Loudoun County Courthouse Books in Balch Library," Loudoun: The 1757 Legacy, Newsletter of the Loudoun Genealogy Club, Vol. 9, No. 4 (Dec. 2001):5-7. Available at FHL. [Microfilm reproductions of Deed Books B, C, E, F, G, I, L, M, O, 2-A, 4-V, 6-Q, 5-V (1760-1866); Will Books B, C, D, S, AA, 2-C, 2-E, G (1772-1868) are available at the Thomas Balch Library, Leesburg, Va.]
• Sparacio, Ruth Trickey and Sam Sparacio. A Digest of Family Relationships. 4 vols. Virginia?: R. & S. Sparacio, 1990-. Available at FHL. [Includes relationships drawn from Loudoun County, Virginia deeds.]
• Sparacio, Ruth Trickey and Sam Sparacio. Deed Abstracts of Loudoun County, Virginia [1757-1797]. 22 vols. McLean, Virginia: Antient Press, R. & S. Sparacio, 1987-. Available at FHL.
Grants and Patents
• Gray, Gertrude E. Virginia Northern Neck Land Grants, 1742-1775. Vol. II. Baltimore, MD, USA: Genealogical Publishing Co., 1997. Available at FHL; digital version at Ancestry ($). [Includes Loudoun County.]
• Gray, Gertrude E. Virginia Northern Neck Land Grants, 1775-1800. Vol. III. Baltimore, MD, USA: Genealogical Publishing Co., 1993. Available at FHL; digital version at Ancestry ($). [Includes Loudoun County.]
• Gray, Gertrude E. Virginia Northern Neck Land Grants, 1800-1862. Vol. IV. Baltimore, MD, USA: Genealogical Publishing Co., 1993. Available at FHL; digital version at Ancestry ($). [Includes Loudoun County.]
• Land Grants, 1757-1799. Virginia County Records, Vol. 6, No. 2 (Jun. 1909); Vol. 6, No. 4 (Dec. 1909).
• Schreiner-Yantis, Netti and C. Blair Tavenner. Loudoun County, Virginia Original Land Grants -- In Six Sections: Section "C". [Map]. Springfield, Virginia: N. Schreiner-Yantis, 1997. Available at FHL. Discussed in Netti Schreiner-Yantis's article, "Loudoun County Plat Maps," Northern Virginia Genealogy, Vol. 3, No. 3 (Jul. 1998):115-117. Available at FHL.
Land Causes
• Sparacio, Ruth Trickey, Sam Sparacio, and Dumfries, Va. District Court. Abstracts of Land Causes, Prince William County, Virginia. [1789-1793] 2 vols. McLean, Va.: Antient Press, 1992. Available at FHL. [Includes Loudoun County.]
• Wilson, Donald L. "Prince William County Land Causes," [1789-1793] The Newsletter of the Prince William County Genealogical Society, Vol. 3, No. 2 (Aug. 1984):5-7; Vol. 3, No. 7 (Jan. 1985):3-6; Vol. 3, No. 10 (Apr. 1985):6-7; Vol. 3, No. 12 (Jun. 1985):6-7; Vol. 4, No. 1 (Jul. 1985):4-6; Vol. 4, No. 2 (Aug. 1985):3-4; Vol. 4, No. 3 (Sep. 1985):5-7; Vol. 4, No. 7 (Jan. 1986):4-6; Vol. 4, No. 9 (Mar. 1986):3-4; Vol. 4, No. 10 (Apr. 1986):5-7; Vol. 4, No. 12 (Jun. 1986):5-7; Vol. 5, No. 1 (Jul. 1986):5-7; Vol. 5, No. 3 (Sep. 1986):6-9; Vol. 5, No. 6 (Dec. 1986):5-6; Vol. 5, No. 10 (Apr. 1987):5-7. Available at FHL.
Superior Court Deeds
• Superior Court Deed Book A, 1809-1844, Northern Virginia Genealogy. Lovettsville VA: 2004. Vol. 9.
References
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 9 July 2012, at 22:28.
• This page has been accessed 864 times.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:46:12.000Z
|
k27ohrausz4xqlzh52zu5rcgftzyey2b
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36346",
"uncompressed_offset": 89806992,
"url": "foswiki.org/Tasks/Item11409",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://foswiki.org/Tasks/Item11409"
}
|
cccc_CC-MAIN-2013-20
|
NOTE: If you are a developer, please use a private wiki based on foswiki/trunk on a daily base ...or use trunk.foswiki.org to view this page for some minimal testing.
Use Item9693 for docu changes for 1.2 and 2.0.
Item11409: HtpasswdUser issues when shared between multiple Foswiki instances
Priority: CurrentState: AppliesTo: Component: WaitingFor:
Normal Closed Engine HtPasswdUser
Looking over Foswiki::Users::HtPasswdUser the file lock is written to the working directory. This creates an exposure on Foswiki.org, where we allow password maintenance from both foswiki.org and trunk.foswiki.org. Each can lock the same file simultaneously.
Also, now that foswiki.org is running fcgi, password changes made by trunk won't be recognized by Foswiki.org until the fcgi processes restart.
• The lock file should probably be written to the same directory as the .htpasswd file so that multiple Foswiki instances use the same lock.
• The file timestamp should be tested before trusting the cached passwords. However this might be a configuration option since sharing the file externally is probably an unusual configuration and stat is costly.
-- GeorgeClark - 06 Jan 2012
Babar pointed out that not all installations will be able to create files in the directory containing .htpasswd, so this needs to be a configurable location.
Also in reviewing this a bit more, do we need to test the file timestamp anytime fcgi or fastcgi is used. I think each foswiki.fcgi handler gets it's own copy of the password cache.
-- GeorgeClark - 07 Jan 2012
AFAICT there's no point (unless you make rather more sweeping changes). As I recall, the password manager is not a glob object - it is instantiated from the user manager, which is in turn instantiated from the session. Since the session is cleared down for each request, the usefulness of this "cache" is questionable, and checking file dates for it even more so.
There are (at least) two tactics that would improve htpasswd performance; the first is to hash the user id to hit one of a number of different .htpasswd files, to reduce the load time for the PW file. The second would be to make a real cache which persisted over sessions. If the latter tactic were implemented, your recent change against this task would make sense.
-- CrawfordCurrie - 08 Jan 2012
See Tasks.Item11436 which makes the password cache global.
-- GeorgeClark - 11 Jan 2012
ItemTemplate edit
Summary HtpasswdUser issues when shared between multiple Foswiki instances
ReportedBy GeorgeClark
Codebase 1.1.4, 1.1.3, 1.1.2, 1.1.1, 1.1.0, trunk
SVN Range
AppliesTo Engine
Component HtPasswdUser
Priority Normal
CurrentState Closed
WaitingFor
Checkins Foswikirev:13555 Foswikirev:13556 Foswikirev:13557
TargetRelease patch
ReleasedIn 1.1.5
CheckinsOnBranches Release01x01 trunk
trunkCheckins Foswikirev:13557
Release01x01Checkins Foswikirev:13555 Foswikirev:13556
Topic revision: r9 - 11 Apr 2012, GeorgeClark
The copyright of the content on this website is held by the contributing authors, except where stated elsewhere. see CopyrightStatement.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:50:36.000Z
|
jgfmcidtb2yizmutvpribel5mxztg7eh
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36357",
"uncompressed_offset": 98456871,
"url": "googlesystem.blogspot.com/2007/02/view-your-site-through-googles-eyes.html?showComment=1170726720000",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://googlesystem.blogspot.com/2007/02/view-your-site-through-googles-eyes.html?showComment=1170726720000"
}
|
cccc_CC-MAIN-2013-20
|
An unofficial blog that watches Google's attempts to move your operating system online.
Send your tips to gostips@gmail.com.
February 5, 2007
View Your Site Through Google's Eyes
Google Webmaster Tools added a new feature: a complete of the links that point to your site and a list of your internal links. Google's link operator shows only some of the backlinks. Now, because Google trusts you (you validated the site, so you have access to it), you can see the number of backlinks for each page of your site and a list of backlinks.
The interface is pretty difficult to use, especially for large sites, so it's a good idea to download the data and analyze it Excel or other spreadsheet application.
Google's blog says there are some limitations: "We do limit the amount of data you can download for each type of link (for instance, you can currently download up to one million external links). Google knows about more links than the total we show, but the overall fraction of links we show is much, much larger than the link: command currently offers."
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:24:59.000Z
|
q5ha3mhpap4sgjaxdyuvkk5zblilunsz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36392",
"uncompressed_offset": 165464846,
"url": "online-journals.org/i-jim/article/view/526",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://online-journals.org/i-jim/article/view/526"
}
|
cccc_CC-MAIN-2013-20
|
The Role of Podcasts in Students’ Learning
Laurel Evelyn Dyson
Abstract
Podcasts have been employed extensively in some countries and are now being trialed at a number of universities in Australia. They allow ubiquitous learning whereby students can access a variety of educational material anywhere, anytime on iPods, MP3 players or even desktop computers. There remain many questions about the impact of podcasts on students’ learning. One issue is how podcasts can be used to support high quality, experiential learning rather than merely perpetuating the old transmission model of education. In this paper, we explore the reasons why students either use, or fail to use, podcasts provided for their education. We report on the motivation of students enrolled in a large first-year information systems subject. These varied considerably and show that podcasts are a useful adjunct for providing for the diverse range of learning styles of our students. However, we also conclude that further research is needed into the use of podcasts to promote deeper learning in our students and how podcasts can act as a support tool for other forms of m-learning.
Keywords
higher education, m-learning, podcast, ubiquitous learning
Full Text:
PDF
DOI: http://dx.doi.org/10.3991%2Fijim.v2i3.526
International Journal of Interactive Mobile Technologies. ISSN: 1865-7923
Indexing:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:51:10.000Z
|
xc2wxblivmxnbkctpgssfl3zg6fb7igi
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36409",
"uncompressed_offset": 179630142,
"url": "quotationsbook.com/quote/143/",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://quotationsbook.com/quote/143/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
The universe is full of magical things patiently waiting for our wits to grow sharper. Phillpotts, Eden
This quote is about abundance · Search on Google Books to find all references and sources for this quotation.
A bit about Phillpotts, Eden ...
Eden Phillpotts (November, 1862 - December 29, 1960) was a British novelist, poet, and dramatist. He was born in India, educated in Plymouth, Devon, and worked as an insurance officer for 10 years before studying for the stage and eventually becoming a writer.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:09:04.000Z
|
aed4dp2wdbhtv5gntioz2dostuhlyrhg
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36410",
"uncompressed_offset": 179636729,
"url": "quotationsbook.com/quote/14380/",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://quotationsbook.com/quote/14380/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
In the fevered state of our country, no good can ever result from any attempt to set one of these fiery zealots to rights, either in fact or principle. They are determined as to the facts they will believe, and the opinions on which they will act. Get by them, therefore, as you would by an angry bull; it is not for a man of sense to dispute the road with such an animal. Jefferson, Thomas
This quote is about fanatics and fanaticism · Search on Google Books to find all references and sources for this quotation.
A bit about Jefferson, Thomas ...
We don't have a biography.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:41:34.000Z
|
7xjxfu42bj7ucikf2ntcxpunxe2nchqf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36412",
"uncompressed_offset": 179649616,
"url": "quotationsbook.com/quote/45944/",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://quotationsbook.com/quote/45944/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by JamesJDye
Why not add this quote to your bookmarks?
Here’s what they’re doing: All power and wealth is going to the top of a compartmentalized pyramid system and then they plan to rule the entire world. Dye, James
Search on Google Books to find all references and sources for this quotation.
A bit about Dye, James ...
We don't have a biography.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:38:53.000Z
|
234zkjznkowuplzweqhczstmc46it5ss
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36413",
"uncompressed_offset": 179660785,
"url": "quotationsbook.com/quotes/author/4300/",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://quotationsbook.com/quotes/author/4300/"
}
|
cccc_CC-MAIN-2013-20
|
Quotes by Lee, Robert E.
Robert Edward Lee (January 19, 1807 October 12, 1870) was a career army officer and the most successful general of the Confederate forces during the American Civil War. He eventually commanded all Confederate armies as general-in-chief. Like Hannibal earlier and Erwin Rommel later, his victories against superior forces in an ultimately losing cause won him enduring fame. After the war, he urged sectional reconciliation, and spent his final years as president of the college that would come to bear his name. Lee remains an iconic figure of the Confederacy to this day..
"Duty is the sublimest word in the language. You can never do more than your duty. You should never wish to do less."
Lee, Robert E. on duty
"The education of a man is never complete until he dies."
Lee, Robert E. on education
7 fans of this quote
"Let the tent be struck."
Lee, Robert E. on famous last words
"Never do a wrong thing to make a friend or to keep one."
Lee, Robert E. on friends and friendship
4 fans of this quote
"My experience through life has convinced me that, while moderation and temperance in all things are commendable and beneficial, abstinence from spirituous liquors is the best safeguard of morals and health."
Lee, Robert E. on alcohol and alcoholism
"I like whiskey. I always did, and that is why I never drink it."
Lee, Robert E. on alcohol and alcoholism
"We have fought this fight as long, and as well as we know how. We have been defeated. For us as a Christian people, there is now but one course to pursue. We must accept the situation."
Lee, Robert E. on losers and losing
"The devil's name is dullness."
Lee, Robert E. on bores and boredom
"Wisdom is nothing more than healed pain."
Lee, Robert E. on wisdom
7 fans of this quote
"I have been up to see the Congress and they do not seem to be able to do anything except to eat peanuts and chew tobacco, while my army is starving."
Lee, Robert E. on congress
"Duty, then is the sublimest word in our language. Do your duty in all things You cannot do more, you should never wish to do less. "
Lee, Robert E. on uncategorised
"Still a Union that can only be maintained by swords and bayonets, and in which strife and civil war are to take the place of brotherly love and kindness, has no charm for me. "
Lee, Robert E. on uncategorised
"True patriotism sometimes requires of men to act exactly contrary, at one period, to that which it does at another, and the motive which impels themthe desire to do rightis precisely the same. "
Lee, Robert E. on uncategorised
"I cannot trust a man to control others who cannot control himself."
Lee, Robert E. on self-control
3 fans of this quote
"It is fortunate that war is so terrible, lest we become to fond of it."
Lee, Robert E. on war
Take a look at recent activity on QB!
Search Quotations Book
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:04:48.000Z
|
ag54twejexhbyj24ouvj4mvizuf2jtpd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36462",
"uncompressed_offset": 247636038,
"url": "wikitravel.org/wiki/en/index.php?action=history&title=Talk%3AU.S._Virgin_Islands",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=Talk:U.S._Virgin_Islands&action=history"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Revision history of "Talk:U.S. Virgin Islands"
Jump to: navigation, search
Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:46:38.000Z
|
l2hx2qcjdd3immn6gbperhvf5ltph56y
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36468",
"uncompressed_offset": 256009778,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Latestproducts/2015.0Media%20Release132001?issue=2001&prodno=2015.0&tabname=Summary",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Latestproducts/2015.0Media%20Release132001?opendocument&tabname=Summary&prodno=2015.0&issue=2001&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
2015.0 - Census of Population and Housing: Selected Social and Housing Characteristics, Australia, 2001
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 17/06/2002 Reissue
Page tools: Print Page Print All RSS Search this Product
Census records an increase in the Aboriginal and Torres Strait Islander population
In results from the 2001 Census of Population and Housing, 410,003 people (or 2.2% of the Australian population) are reported as being of Aboriginal and/or Torres Strait Islander origin, up 16% since the 1996 Census.
Natural increase (births and deaths) accounted for a 12% increase in the Indigenous population, with a further 4% increase due primarily to people who were not identified as Indigenous in the 1996 Census but are now identifying, or being identified as Indigenous in the 2001 Census.
In 2001 there were 366,429 people identified as being of Aboriginal origin only (89%), 26,046 (6%) people identified as being of Torres Strait Islander origin only, and 17,528 identified as being of both Aboriginal and Torres Strait Islander origin.
The Indigenous population is relatively young compared to the non-Indigenous population, with more than half (58%) aged under 25 years, and only 11,437 people (3%) aged 65 or over. In contrast, the Australian population had a much higher proportion of older people (13% aged 65 or over), with only about one-third (35%) aged under 25 years.
Most Indigenous Australians reported English as the language spoken in their home (327,042 or 80%). Aboriginal and Torres Strait Islander languages were recorded by 49,764 Indigenous Australians, and the majority (73%) of these were also proficient English speakers.
Of the 108,069 Indigenous children aged 5 to 14 years in 2001, 87% were recorded as attending school, compared with 92% of all children in this age group. For young people aged 15-19 years, 46% of Indigenous youth were recorded as attending school compared with 70% of all Australians in this age group. This disparity in rates of attendance at secondary school is also reflected in the relatively low percentage of Indigenous Australians who had completed Year 12 (10%) compared with the rate for Year 12 completion in the total population (30%).
Despite both computer usage being generally more prevalent amongst younger age groups, and the Indigenous population being younger than the non-Indigenous population, Indigenous Australians were less likely to use a computer at home than Australians in general (18% compared with 42%),
Media please note:
State, capital city, suburban and regional media - comparisons and rankings for your area are available in the Census publication Selected Social and Housing Characteristics, Australia (Cat. No. 2015.0). For those unable to attend the national launch or State/Territory events, a copy is available by emailing client.services@abs.gov.au
This site also has a vast array of 2001 Census data. The website contains a narrative snapshot series, plus basic community profile tables from the local to the national level.
Ethnic media - a special language profile for over 70 different languages has been developed for media and is available by facsimile. To receive a profile for your particular language, forward your details (including language of interest, telephone and facsimile numbers) to facsimile (02) 6252 8002 .
Indigenous media - Details are available in 2001 Census Community Profile Series: Indigenous Profile (Cat No. 2002.0). Indigenous profiles are available from the ABS website free of charge for the geographic levels of Australia, States/ Territories, ATSIC Regions and Indigenous Areas. These and other Census products can be found on this site.
2001 Census news file footage - of census processing and census form destruction has been distributed to major metropolitian and regional TV Newsrooms.
Stills images - are available at www.aapmedianet.com.au under the 2001 Census category.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:48:44.000Z
|
am5wac6ydng6f2mwwmhwaohsr6orxb2r
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36469",
"uncompressed_offset": 256018523,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Latestproducts/A26142D131C7BCB1CA2575D2001AB70B",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Latestproducts/A26142D131C7BCB1CA2575D2001AB70B?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
3228.0.55.001 - Population Estimates: Concepts, Sources and Methods, 2009
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 12/06/2009
Page tools: Print Page Print All RSS Search this Product
Contents >> Estimating births and deaths >> Revised estimates of births and deaths
REVISED ESTIMATES OF BIRTHS AND DEATHS
5.12 Revised estimates of quarterly birth and death occurrences are calculated by applying an inflation factor to birth and death occurrence data. They are published in Australian Demographic Statistics (cat. no. 3101.0) released 21 months after the end of each financial year.
Registration lags
5.13 There are two types of registration delays, or lags for births and deaths in a given period. The historical lag is the delay between births or deaths registered in the relevant period and their date of occurrence (i.e. looks into the past). Conversely, a future lag is the delay between births or deaths occurring in the target period and their (eventual) date of registration (i.e. it looks into the future).
5.14 The main principle behind the method used for revising birth and death occurrence estimates is that the historical and future registration lags for a quarter are similar, although this can change if registration procedures change. In other words, the historical lag derived from registration data can be used to indicate the future lag for occurrence data.
Estimating occurrences not yet registered
5.15 To determine the revised estimate for a particular period, the occurrence data that will be subject to inflation needs to be determined. To enable publication by 21 months after the financial year involved, registration data for the 15 months after the end of the financial year are available. For example, to publish revised data in March 2009, only registrations up to and including the September quarter 2008 were available for births and deaths which occurred in the 2006-07 financial year. This corresponds to 9 quarters (September quarter 2006 to September quarter 2008) in which births and deaths occurring in the 2006-07 financial year could have been registered. Thus, when inflating September quarter 2006 data, occurrence data with a future registration lag of less than or equal to 9 quarters are available.
5.16 Occurrence data for a particular quarter in the year (i.e. September, December, March or June) are adjusted based on registration data for the same corresponding quarter in the most recent year. This is so the most recent registration lag patterns available can be used. In the case of September quarter 2006 occurrences, a historical lag of 9 quarters is applied to registrations in the September quarter 2007 to obtain an inflation factor.
5.17 The proportion, p, of all registrations for the quarter that occurred within the historical lag period is determined by:
5.18 The inflation factor, f, for the quarter can be calculated such that:
5.19 For example, the inflation factor for births occurring in September quarter 2006 (termed fS06) would be:
where:
BRegS07 = the total number of births registered in the September quarter 2007; and
BRegS07,-9q = the number of births registered in the September quarter 2007 with an historical lag <= 9 quarters (i.e. occurring between the September quarter 2005 and September quarter 2007)
5.20 The estimate is calculated by applying the inflation factor to the count of births/deaths by state/territory on file. The birth estimate is expressed as:
B = f × BOccReg
where:
B = the estimate of births
BOccReg = the births occurring in the quarter and registered within the future lag period
5.21 For example, the estimate of births occurring in September quarter 2006 is:
BS06 = f × BOccS06RegS08,-9q
where:
BS06 = the estimate of births occurring in September quarter 2006
BOccS06RegS07,-9q = the number of births which occurred in September quarter 2006 registered in the period September quarter 2006 to September quarter 2008
5.22 This method is detailed further in Demography Working Paper: 1998/2 - Quarterly Birth and Death Estimates (cat. no. 3114.0), although the previous historical lag period of 7 quarters is discussed (in March 2009, the publication of the revised financial year data changed from 15 months after the end of the financial year to 21 months).
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:35:08.000Z
|
dockfsejewzfdkvyfq3jjhe6m7jniyqo
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36477",
"uncompressed_offset": 295935264,
"url": "www.biomedcentral.com/1471-2199/8/44/",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.biomedcentral.com/1471-2199/8/44/"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Hin-mediated DNA knotting and recombining promote replicon dysfunction and mutation
Richard W Deibler1,2,3, Jennifer K Mann2,4, De Witt L Sumners4 and Lynn Zechiedrich1,2,4*
• * Corresponding author: Lynn Zechiedrich elz@bcm.edu
• † Equal contributors
Author Affiliations
1 Interdepartmental Program in Cell and Molecular Biology, Baylor College of Medicine, Houston, Texas 77030-3411 USA
2 Department of Molecular Virology and Microbiology, Baylor College of Medicine, Houston, Texas 77030-3411 USA
3 Department of Systems Biology, Harvard Medical School, Boston, Massachusetts 02115 USA
4 Department of Mathematics, Florida State University, Tallahassee, Florida 32306-4510 USA
For all author emails, please log on.
BMC Molecular Biology 2007, 8:44 doi:10.1186/1471-2199-8-44
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2199/8/44
Received:23 January 2007
Accepted:25 May 2007
Published:25 May 2007
© 2007 Deibler et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
The genetic code imposes a dilemma for cells. The DNA must be long enough to encode for the complexity of an organism, yet thin and flexible enough to fit within the cell. The combination of these properties greatly favors DNA collisions, which can knot and drive recombination of the DNA. Despite the well-accepted propensity of cellular DNA to collide and react with itself, it has not been established what the physiological consequences are.
Results
Here we analyze the effects of recombined and knotted plasmids in E. coli using the Hin site-specific recombination system. We show that Hin-mediated DNA knotting and recombination (i) promote replicon loss by blocking DNA replication; (ii) block gene transcription; and (iii) cause genetic rearrangements at a rate three to four orders of magnitude higher than the rate for an unknotted, unrecombined plasmid.
Conclusion
These results show that DNA reactivity leading to recombined and knotted DNA is potentially toxic and may help drive genetic evolution.
Background
Much of DNA metabolism is understood in the context of the linear sequence of nucleotides that compose the nucleic acid. For example, gene promoters, replication origins, partitioning sequences and genes themselves are defined by their particular DNA sequences. However, the physical, mechanical and topological properties of DNA also exert significant influence over DNA metabolism [1]. Inside cells, the long (1.6 mm for Escherichia coli) and flexible (persistence length ≈ 50 nm) DNA must be compacted into a very small volume, achieving a liquid crystalline state of 80 – 100 mg/ml [2-4]. Understanding how DNA functions requires understanding its conformation under such compact conditions.
DNA conformation is affected not only by crowding but also by its physical structure. Intuitively, anything long, thin and flexible can become self-entangled. Interestingly, for 200 kb DNA molecules at thermal equilibrium, the most energetically favorable conformation is the trefoil knot, 31 [5]. 200 kb is ~20-fold smaller than the chromosome of E. coli. Thus, it is not surprising that when cells are lysed, a small portion (~1%) of plasmid DNA, which is only on the order of 4 kb, is found knotted [6-10]. The propensity for DNA to knot is predicted to be even greater for the longer and more folded eukaryotic chromosomes [11]. However, if we apply the figure of 1% DNA knotting to human chromosomes, then nearly every other diploid human cell would have a knot.
Figure 1. Physiological effects of Hin-mediated recombination/knotting. (A) Assay for the effect of knotting on the function of a gene. The ovals represent E. coli cells. The Hin expression vector, pHIN, and plasmid substrates pBR, pREC and pKNOT containing the bla gene (encoding β-lactamase) are depicted. Wild-type recombination sites are depicted as black arrows. The mutant hix site is shown as a grey arrow. (B) Effect of DNA knotting on ampicillin sensitivity of E. coli strain W3110 containing pHIN and either pBR, pREC or pKNOT. Single colonies were streaked from left to right across LB-agar that contained an ampicillin gradient and constant IPTG (1 mM) and spectinomycin (50 μg/ml) for Hin overexpression and maintenance. The experiment was repeated five times in either strain C600 or W3110, and was carried out either from high to low or from low to high ampicillin concentration with identical results. (C) Ampicillin sensitivity (MIC50) was quantified using the plate dilution method.
Although DNA knotting is clearly energetically favorable for DNA, several observations suggest that the intracellular environment should further exacerbate knotting. Experiments with the bacteriophage P4 demonstrated that the confinement of DNA in a small volume stimulates the knotting of DNA [12]. Furthermore, DNA inside the cell is negatively supercoiled. Negative supercoiling promotes a number of genetic processes, including gene expression and DNA replication, in part because it promotes opening of the DNA duplex [13-16]. DNA supercoiling also compacts the DNA and brings distant strands into close proximity [17,18]. As a consequence, supercoiling promotes strand collision and DNA tangling. Indeed, computer simulations have revealed that supercoiling should drive DNA knotting because writhe in a knot is less stressful on the DNA than writhe in an unknotted, supercoiled molecule [19,20].
Collisions of DNA helices with one another are potentially problematic because DNA is a self-reactive molecule. The repair of double strand breaks, single strand gaps and stalled replication forks involve recombination, which requires physical contact with a homologous DNA molecule. Similarly, transposition, site-specific recombination and modulation of transcription (by enhancers and other cis-regulatory elements) often involve DNA-DNA interactions. However, it has not been well established whether DNA strand collisions and the potential resulting entanglements affect DNA metabolism in the cell.
One indication that DNA knotting is deleterious to cells is the universal prevalence of type-2 topoisomerases. These are essential enzymes that cleave both strands of a DNA double helix, pass another duplex through this transient gate and reseal the break. Type-2 topoisomerases are the enzymes responsible for unknotting DNA, and, in E. coli, the responsibility falls solely on topoisomerase IV [21]. The loss of topoisomerase IV activity has additional affects in cells that include hyper-negative supercoiling and the inability to segregate newly replicated DNA [22-24]. Therefore, the effects of knots needed to be evaluated separately from supercoils and catenanes.
Here we use the previously characterized Hin site-specific recombination and DNA knotting system [21,25,26] to understand how the physical constraints placed upon intracellular DNA can alter its activity. This system ties knots topologically identical to those observed in vivo [6,8,10]. Although studying the effects of knots in chromosomal DNA would be optimal, it is not technically feasible because there is no direct way to measure chromosomal knotting. Therefore, we have examined what happens when DNA strands collide to recombine and knot a 5.4 kb plasmid containing a gene required for cell survival. Plasmids appear to be a reasonable model for chromosomal metabolism. For example, supercoiling changes in reporter plasmids [24] mirror changes in the supercoiling of the chromosome [27,28]. The recombined plasmid products generated by Hin are easily analyzed because of their small size. A recombination event occurring in the chromosome would be much more difficult to detect. Although Hin recombines and knots at the hix sites, the resulting knots can move during DNA metabolism. On the chromosome, this knot sliding could be as far as the size of a topological domain, ~10 kb [29], which would be more difficult to detect experimentally.
Here we show that Hin-mediated site-specific recombination and knotting led to dysfunction of the replicon and blocked expression of a gene on the plasmid. This process is highly mutagenic, and our results suggest that unless recombination and knotting are carefully controlled, intracellular DNA can be unstable. We suggest that such instability of the genetic material could help drive evolutionary variation.
Results
Experimental strategy
The experimental approach we use here to study the cellular effect of recombining and knotting DNA is outlined in Figure 1A. We have shown previously that Hin recombines and knots plasmid DNA in E. coli that topoisomerase IV unties [21]. The Hin site-specific recombination system models two in vivo processes: it tangles the DNA to create knots identical to those formed inside the cell and shuffles the DNA sequence to model DNA recombination [6-10]. The hin recombinase gene is provided by the plasmid pKH66 (hereafter referred to as pHIN) and is expressed from the tac promoter following induction by isopropyl-β-D-thiogalactopyranoside (IPTG). pHIN also encodes for spectinomycin resistance. E. coli cells harboring pHIN also contained either pBR322 (pBR), which lacks recombination sites and serves as a negative control, or one of two pBR22-derived plasmids pTGSE4 (pREC) or pRJ862 (pKNOT) that carry sites recognized by the Hin recombinase. All three plasmids contain the bla gene, which encodes β-lactamase and provides resistance to ampicillin. We used the bla gene as a reporter to assess the effects of recombining and knotting the DNA.
Hin binds two 26-bp recognition sites and makes double-stranded breaks at the center of these sites leaving a two-bp overhang within each break [30,31]. Next, Hin rotates the DNA strands in a right-hand direction as dictated by the required DNA negative supercoiling [26]. If both sites are wild-type hix (or gix) sites (black arrows Figure 1A), as in pREC, the two-bp overhangs are complimentary and religation may occur after a 180° rotation. However, if the Hin substrate has one wild-type and one mutant site (grey arrow Figure 1A), as in pKNOT, the overhangs are not complimentary and a 360° rotation (or some multiple of 360°) is necessary for religation to occur. Thus, Hin recombines pREC and knots pKNOT. Although we initially anticipated that pREC would serve to differentiate between effects caused by recombination and those caused by DNA knotting, we (data not shown) and others observed that, in vivo, Hin will occasionally mediate processive recombination events to knot plasmids containing wild-type recombination sites at a steady-state level of 2 – 3% (Table 1) [25]. pKNOT is extensively knotted by Hin because the mismatch between the sites requires processive recombination [21,25,26] for religation. Hin expression increases the steady-state knotting of pKNOT approximately 5- to 10-fold over endogenous levels in the presence of topoisomerase IV function and 35- to 45-fold when topoisomerase IV function is blocked [21,25]. Twist knots with three (31), five (52) and seven (72) negative nodes as well as composite knots with six (31#31), eight (31#52) and nine (31#31#31) nodes are readily generated when Hin knots pKNOT [25]. Higher noded knots are seen in decreasing abundance. Only twist knots with three (31) and four (41) nodes are seen when Hin knots a plasmid with two wild-type recognition sites [25]. Previous studies examined the effect of Hin and other site-specific recombinases on gene expression [32,33]. However, a key distinction between those studies and the experiments performed here is that in those experiments the recombinase binding sites were placed between the promoter and the gene whereas here the reporter gene is distant to the site of recombination. Thus, here we examine the global effects on the DNA molecule rather than the local effects on promoter function.
Table 1. Hin-mediated knotting.
Hin-mediated recombination and knotting of a plasmid alter function of a reporter gene
We first assessed the effect of Hin-mediated DNA recombination and knotting on resistance to ampicillin conferred by the bla gene on pBR, pREC and pKNOT. LB-agar contained a gradient of ampicillin [34], a constant concentration of spectinomycin to maintain the Hin expression vector and IPTG to induce expression of Hin. Wild-type E. coli K12 strains, C600 or W3110, containing pHIN and either pBR, pREC or pKNOT were streaked across the LB-agar. Whereas the strains containing pBR and pREC were able to grow on the highest ampicillin concentrations, growth of the strain carrying pKNOT was limited (Figure 1B). We determined whether this effect was specific to the gene encoded by the plasmid being targeted, pKNOT, or caused a general increased susceptibility to antimicrobial agents. Knotting (and recombination) had no effect on resistance encoded on a separate plasmid or on the chromosome: strains harboring the three plasmids were all growth inhibited at identical concentrations of spectinomycin (resistance encoded by pHIN) or norfloxacin (targets encoded by the chromosome) (data not shown). These results indicate that the sensitivity of E. coli to ampicillin is affected negatively when a knotted plasmid encodes its resistance. Knots impair the function of the replicon on which they form rather than cause a general effect on the cell.
We determined minimal inhibitory concentration (MIC50) values (the ampicillin concentration that inhibits 50% of bacterial growth) to quantify the Hin-mediated sensitivity to ampicillin. Strains harboring pKNOT were killed at a lower ampicillin concentration (1.4 mg/ml) than pBR (4.7 mg/ml) or pREC (2.3 mg/ml) (Figure 1C). The intermediate sensitivity of the pREC-containing strain to ampicillin compared to the pBR- and pKNOT-containing strains could be caused either by the intermediate level of DNA knotting that occurs in pREC or by Hin-mediated recombination of pREC.
Hin recombination and knotting alter β-lactamase levels
To dissect the molecular mechanism by which Hin affects the function of the bla gene on pREC and pKNOT, we performed immunoblots to assay β-lactamase levels. Strains were grown in liquid medium containing IPTG and spectinomycin until mid-logarithmic phase (OD600 = 0.3). Equal amounts of whole cell extracts were submitted to SDS-PAGE and either stained with Coomassie blue or subjected to Western blotting with anti-β-lactamase antisera (Figure 2). The Coomassie blue stained gels indicated that equal amounts of protein had been loaded (data not shown). The pHIN-containing C600 strain with pKNOT produced four- and three-fold less β-lactamase than the pBR- or pREC-containing strain, respectively, in either rich (LB; Figure 2A) or minimal M9 medium (Figure 2B). The reduction in β-lactamase levels correlates well with the reduction in ampicillin resistance (compare Figure 1C with Figure 2). There was no effect of pKNOT on levels of the chromosomally encoded topoisomerase IV subunits, ParC or ParE, or on levels of AcrA (Figure 2 and data not shown). Therefore, the reduction in protein levels is specific to genes encoded on the plasmid rather than a general inhibition of gene expression. Subsequently, AcrA levels were used to standardize loading.
Figure 2. Hin-mediated effect on β-lactamase protein levels. Cultures of C600 (left) and parCts (right) were grown in rich (LB) or minimal (M9) medium. Results here are from a typical experiment performed at 42°C. Immunoblotting was performed on total cellular lysates. Blots were probed with anti-AcrA, anti-β-lactamase, anti-ParC or anti-ParE antibodies. Shown below the blot from cells grown in LB is the mean of four independent experiments (except for parCts pREC, which was performed three times) and standard deviations. The values below the M9 experiment show the quantification of that blot, but the M9 experiment was repeated with the same results.
If it is knotting that caused the increased susceptibility to ampicillin, then, because topoisomerase IV resolves knots in E. coli, inhibiting topoisomerase IV should increase the amount of knots and cause an additional reduction of β-lactamase production from pKNOT. To test whether knotting increased ampicillin susceptibility, we utilized a temperature-sensitive topoisomerase IV mutant, parCts. Although cell growth and viability are reduced at the non-permissive temperatures for parCts, cell division continues to occur and produces enough viable offspring that we were able to obtain sufficient growth (OD600 = 0.3) to perform immunoblots. When either of the non-permissive temperatures, 37°C or 42°C, for the parCts allele was used, the results were the same. pKNOT in the parCts strain produced 8.5-fold less β-lactamase than pREC and 17-fold less than pBR when cells were grown in LB or M9 medium at the non-permissive temperature (Figure 2, right panels). Therefore, inhibiting the enzyme that unties the knots exacerbates the reduction in β-lactamase production. As with the MIC50 data above, it is unclear whether the β-lactamase differences between pBR and pREC are caused by Hin binding, recombining or knotting pREC. There is less β-lactamase produced in the parCts harboring pKNOT than C600 containing pKNOT. However, the plasmids carried in the two strains have different superhelical densities. In the parCts strain, DNA is more negatively supercoiled at the non-permissive temperature [24]. The increased negative supercoiling should, if anything, slightly stimulate β-lactamase production. However, the knots counter this increase in β-lactamase production. Thus, the inhibitory effects of DNA knotting may be greater than measured because some effects are potentially being masked by the increase in negative supercoiling.
Molecular analysis of Hin-mediated effects
It has been observed in vitro that DNA knots can diminish transcription [35]. Thus, the effect on β-lactamase production and ampicillin resistance we observed could be explained by an inhibition of bla transcription. However, it could also result from knots interfering with DNA replication, which would reduce the number of copies of the bla gene and, consequently, the amount of β-lactamase generated. An effect of DNA knotting on replication in vitro or in vivo has not been documented previously. Additionally, knots could reduce bla expression by causing pKNOT to break by weakening the tensile strength of DNA. Precedence of knots weakening and breaking polymers has been predicted by molecular dynamics simulations of polyethylene chains [36], shown using optical tweezers on actin filaments [37] and demonstrated with soft macroscopic strings [38] and with fishing line [39]. It is possible that Hin mediates its effects through a combination of blocking transcription, interfering with replication and breaking pKNOT.
To determine whether plasmid stability and copy number are affected by Hin activity we quantified the levels of pBR, pREC or pKNOT DNA. Cultures were grown to mid-logarithmic phase and divided in half. Plasmid DNA levels were measured from one half and β-lactamase levels from the other half. DNA levels were determined by densitometric analysis of agarose gels. Following Hin induction, cells contained roughly two-fold less pKNOT than pBR or pREC relative to pHIN (Figure 3A). There was even less pKNOT DNA isolated from the parCts strain grown at 42°C (Figure 3A, right side). When knotted, the copy number of pKNOT was reduced from ~20 – 40 copies/cell [40,41] to lower than pHIN levels in parCts cells (Figure 3A). β-lactamase levels were determined from immunoblotting and densitometry of total cell lysates following SDS-PAGE. Although the DNA knots caused a reproducible reduction of pKNOT copy number, the magnitude of this effect (two- to six-fold) was never as large as the effect on β-lactamase levels (eight- to twenty-fold). In addition, pREC copy number was unchanged although there was a less than two-fold decrease in β-lactamase production from pREC in parCts cells at 42°C. Therefore, decreased β-lactamase levels seen for pREC must not be at the level of replicon copy number. The difference between the effect on β-lactamase levels and the effect on plasmid copy number suggests that DNA knots mediate their effects through a combination of promoting replicon loss and blocking gene transcription.
Figure 3. Hin-mediated effect on plasmid replication. (A) Plasmid DNA was isolated from strains C600 or parCts containing the plasmids indicated. The DNA was linearized with HindIII, which cuts all the plasmids once, including pHIN. Shown is a representative ethidium bromide-stained agarose gel from an experiment performed at 42°C. Given below the gel image are the mean plasmid level values of three independent experiments with standard deviations. (B) Plasmid DNA was isolated 50 min. after IPTG induction of Hin, nicked, displayed by high-resolution gel electrophoresis and visualized by Southern blotting. Shown is an autoradiogram. All lanes contain plasmid DNA from the pHIN-harboring parCts cells with pBR, pREC or pKNOT. The positions of nicked dimer (), linear dimer () catenanes (e.g., ) are indicated.
It was possible that some cells had lost all their plasmid DNA to become plasmid free and other cells retained normal plasmid levels or that all cells generally had reduced plasmid levels. To distinguish between these possibilities, we grew cells harboring pHIN and either pBR, pREC or pKNOT in the presence of IPTG and spectinomycin, under conditions identical to those used to evaluate plasmid levels and β-lactamase production, except ampicillin was not included. Cell culture dilutions were spread on LB-agar and incubated overnight at 30°C. The following day, the colonies were replica plated onto LB-agar ± ampicillin, grown overnight at 30°C and counted. The frequency of plasmid-free cells was the same among all the three strains and was similar to what others have observed for loss of pBR in E. coli grown in a rich medium (LB) over the time period comparable to the one used here (~3 h) [42]. Thus, in these experiments, the Hin-mediated effect does not lead to complete loss of pKNOT. However, it is possible that given enough time complete plasmid loss might occur.
DNA catenanes are produced as intermediates of replication and they accumulate in temperature-sensitive topoisomerase IV mutants at the non-permissive temperature [22,23]. When DNA replication is disrupted, replication catenanes do not accumulate ([22] and data not shown). We examined the levels of catenanes in parCts carrying pHIN and either pBR, pREC or pKNOT. Plasmid DNA was isolated from parCts strains grown for 40 min. at 42°C as before, nicked to remove supercoiling and analyzed by high-resolution agarose gel electrophoresis [43]. Catenated pBR and pREC products were clearly visible, but DNA catenanes were greatly reduced for pKNOT (Figure 3B). Because catenanes were seen under conditions where either bla was fully functioning (pREC) or impaired (pKNOT), it does not seem likely that catenanes block replication and transcription (or cause mutagenesis). This experiment also provided an indirect method to examine the effect of knotted DNA on DNA replication. Because DNA replication is the only source of the catenanes, the observation that the level of DNA catenanes is reduced provides additional support that DNA replication is impaired in pKNOT.
Hin-mediated recombination/knotting is mutagenic
We propose two models to explain how Hin blocks the function of the bla gene (Figure 4). These possibilities are not mutually exclusive. The first is the "roadblock" model: Hin, bound to or cleaving DNA, or the knots themselves form an impasse to RNA and/or DNA polymerases. The second is the "breakage" model. Although it is not clear how knots localize in DNA, it has been suggested from numerical studies that knots may spontaneously pull into a tight conformation [44,45]. DNA within the cell is constantly being subjected to a number of pulling forces generated by transcription, replication and segregation. A force (15 pN) comparable to that generated by a single replication or transcription complex [46-49], has been shown to tighten a DNA trefoil to a diameter less than 25 nm [37,50]. Either the roadblock or the breakage model predicts that DNA knots would be mutagenic through replication fork arrest or through a DNA double-strand break. In addition, either could induce the SOS response, which could lead to a genome-wide increase in mutation frequency [51,52].
Figure 4. Potential models for the Hin-mediated effect. Plasmid pKNOT is recombined by Hin to knot the DNA (a single line represents the central axis of the double helix). In the roadblock model, the knot (or possibly Hin bound to or cleaving DNA) is impassable and stalls polymerase. Alternatively, in the breakage model, knots may break DNA as a result of forces on the plasmid.
While measuring the ampicillin resistance of pBR-, pREC- and pKNOT-containing cells, we observed that, following overnight growth, C600 or parCts strains harboring pKNOT formed large, robust colonies in the zone of drug-mediated clearing (Figure 5A). In contrast, no colonies were observed in the cleared zones around filter discs containing any concentration of ampicillin in lawns of C600 or parCts strains containing pBR or pREC (Figure 5A and data not shown). We found that the effect was specific to β-lactam (ampicillin or cefotaxime) resistance, as no colonies were found in the zones of drug clearance for pBR-, pREC- or pKNOT-containing C600 or parCts when norfloxacin was used (data not shown). These results suggest that increased mutation rate is occurring specifically for pKNOT and not the genome as a whole.
Figure 5. Hin-mediated mutagenesis. (A) Ampicillin resistant colonies growing in the zone of clearance around a filter containing 4 mg ampicillin. (B) Quantitation of ampicillin resistance of individual colonies. (C) Ethidium bromide-stained gel of plasmid DNA isolated from mutant colonies growing within the zone of clearance and separated by agarose gel electrophoresis. Lane a is a supercoiled molecular weight standard. Lanes b, c and d contain plasmid DNA from the parental strains harboring pHIN and either pBR, pREC or pKNOT, respectively. Lanes e-j contain plasmid DNA isolated from mutant pKNOT colonies. (D) Total cell lysates of mutants grown in 1 mM IPTG were separated by SDS-PAGE and submitted to immunoblotting. Immunoblots were probed with anti-AcrA antibodies (for a loading control) or anti-β-lactamase antibodies. Shown below the blot are signal intensities in arbitrary units. AcrA and anti-β-lactamase levels for C600 strains containing pHIN and either pBR, pREC or pKNOT are shown for comparison.
One hundred percent of the colonies that grew in the drug-cleared zone had a higher resistance to ampicillin than the original pKNOT-containing C600 cells and 69% had higher resistance than pBR-containing cells (Figure 5B). Using the MIC50 values of the original pBR, pREC and pKNOT strains (Figure 1C), we performed fluctuation assays to determine the mutation rate to ampicillin resistance (Table 2). Ampicillin at 4.8 mg/ml (3.4-fold higher than the MIC50 for pKNOT) was high enough to block all growth and select for hyper-resistant mutants in the C600 strain containing pHIN and pKNOT. At this concentration of ampicillin, using the MSS maximum likelihood method [53], the pKNOT strain yields 3.4 × 10-6 mutations/cell/generation. At an ampicillin concentration of 16.1 mg/ml (3.4-fold higher than the MIC50), C600 containing pHIN and pBR yields 4.8 × 10-10 mutations/cell/generation. At an ampicillin concentration of 7.9 mg/ml (3.4-fold higher than the MIC50), C600 containing pHIN and pREC had a mutation rate of 4.7 × 10-7 mutations/cell/generation. Thus, Hin-mediated recombination and knotting increased the mutation rate three to four orders of magnitude compared to the spontaneous mutation rate of cells with pBR and Hin expression (Table 2).
Table 2. Hin-mediated mutation rates
To determine the molecular basis for the hyper-resistance to ampicillin, plasmid DNA was isolated from mutant colonies and analyzed (Figure 5C). There were two notable and unanticipated features of these rearrangements. First, the isolated plasmid DNA was much larger than the parental pKNOT. This result was surprising because any number of deletions or substitution mutations could disrupt Hin recombination and these types of changes would either result in a smaller plasmid or no change in plasmid size. However, these latter types of alterations were not apparent. Second, we found that not only was pKNOT altered, but pHIN was also changed in the hyper-resistant mutants. Gross genetic rearrangements of the plasmid were visible by restriction endonuclease digestion of each sample (data not shown). These results suggest that recombination between pHIN and pKNOT is responsible for the rearrangements and the phenotype of hyper-resistance to ampicillin. Although Hin does not directly recombine or knot pHIN, it is likely that recombination between pHIN and pKNOT results in a fused plasmid that is either refractory to additional knotting/recombination or expresses β-lactamase at a sufficient level to confer hyper-resistance to ampicillin. Without causing ampicillin hyper-resistance, pKNOT-pKNOT fusions would not be selected. In an attempt to analyze the role of homologous recombination in this plasmid rearrangement, we tried, but were unable to transform mutant strains lacking recA or recD with pHIN.
The plasmid changes and ampicillin hyper-resistance were heritable. Plasmid DNA was isolated from the colonies that arose in the zones of clearance and transformed into C600 cells harboring pHIN. The plasmids conferred a higher level of ampicillin resistance than pKNOT as determined by Kirby-Bauer assay (data not shown). We found that in four of five transformants tested, the mutant plasmid-transformed cells retained hyper-resistance to ampicillin and there were no visible colonies in the new zones of clearance. Because of this, it appears that either no further DNA rearrangements are occurring or, if they are, these additional rearrangements do not confer ampicillin hyper-resistance. The transformant (1/5) that behaved similarly to pKNOT-containing strains indeed harbored pKNOT. Thus, the fused mutant plasmid appears to have resolved back into pHIN and pKNOT. To compensate for reduced production of β-lactamase, the mutant plasmids could contain either a mutated bla gene that produces an enzyme more efficient at metabolizing ampicillin, or the mutations could allow for increased production of the enzyme. Using immunoblot analysis as described above, we found that all the cells carrying the rearranged plasmids that were examined had increased β-lactamase production relative to pKNOT (Figure 5D).
To determine whether the larger molecular weight plasmid that had replaced pKNOT and pHIN contained DNA originally present in both pHIN and pKNOT, we transformed C600 with total plasmid DNA from the ampicillin hyper-resistant isolates. Plasmid DNA from four of the ampicillin resistant colonies was used in independent transformations. For each transformation, half of the transformed cells was spread on LB-agar containing ampicillin (100 μg/ml, sufficient to select for the parental pKNOT), and half was spread on LB-agar containing spectinomycin (50 μg/ml, to select for pHIN). We found that 64/64 spectinomycin resistant transformants were also resistant to ampicillin and 28/32 ampicillin resistant transformants were also resistant to spectinomycin. These results are consistent with a fusion between pHIN and pKNOT being responsible for the ampicillin hyper-resistance phenotype observed in the majority of mutants.
Discussion
Intracellular DNA is supercoiled, compacted and highly concentrated. Consequently, DNA will collide frequently with itself, and the result of these collisions increases the potential for DNA recombining and knotting. We have analyzed what can happen when the collisions lead to recombining and knotting. The results are that both replication and transcription are blocked and genetic rearrangements are increased.
Mechanism of the Hin-mediated effect
DNA knots, and not recombination, are likely the predominant cause of Hin-dependent replication and transcription blocks and mutagenesis because the effect for pKNOT is more severe than for pREC. The effects were not caused by inherent differences in the three plasmids. Ampicillin MIC50 values of C600 strains harboring pHIN and either pBR, pREC or pKNOT grown in the absence of IPTG were identical (data not shown). In addition, the magnitude of the pKNOT-mediated effects was increased by compromising the activity of the enzyme, topoisomerase IV, responsible for unknotting DNA. However, in addition to unknotting, topoisomerase IV carries out two other cellular tasks: decatenation (reviewed in [54]) and DNA supercoil relaxation [24,55]. Removal of the decatenation activity of topoisomerase IV did not account for the increased pKNOT-mediated effects because far more catenated replication intermediates were seen in parCts cells containing either pBR or pREC than in those that contain pKNOT (Figure 3B). The DNA supercoiling shift resulting from the inhibition of topoisomerase IV is not enough to stimulate either the transcription of the supercoiling-dependent leu-500 promoter [24] or the λ integrase recombination system [56]in vivo, suggesting that the increase in negative supercoiling resulting from inhibiting topoisomerase IV activity is unlikely to affect Hin recombination. It is possible that mechanistic differences in recombination on a substrate with two wild-type sites (pREC) compared to a substrate with one wild-type and one mutant site (pKNOT) could account for the Hin-mediated effects. For example, in a purified system, DNA cleavage by Hin is stimulated by a single mutant recombination site [31]. Additionally, in vivo, DNA cleavage of pKNOT by pHIN has been detected [25].
Plasmids replicate completely in less than six seconds and do so asynchronously. Moreover, they transcribe constantly. Thus, a slight increase of a lethal DNA form could have large consequences. Although topoisomerase IV rapidly unties knots, perhaps knot-induced problems, such as stalled replication forks, or stalled or blocked transcription, persist longer than the knots themselves. Indeed because topoisomerase IV can resolve DNA knots as they are formed, then, as the copy number of the plasmid goes down, there should come a point at which topoisomerase IV can resolve all the knots produced by the Hin system. The result would not be a complete loss of plasmid, but instead a steady-state level lower than that found with unknotted DNA, which is what we observed (Figure 3A). It is difficult to envision a process analogous to topoisomerase IV unknotting that would reverse the effects of Hin-mediated site-specific recombination. Thus, if recombination were leading to the loss of plasmids, it would seem that the unchecked altered plasmid would be lost completely from a population of cells in the absence of selection, which was not observed.
The DNA knot- or recombination-created blockage could impinge upon either the initiation or elongation of gene transcription or DNA replication. Gene promoters and replication origins are small relative to plasmids. Unless DNA knots preferentially form in or are localized to promoters or origins, or are hotspots for recombination, then it is expected that the polymerase roadblocks would occur at arbitrary positions on the DNA. Thus, such blockages would likely be outside of where transcription or DNA replication initiates.
It has been demonstrated that when topoisomerase IV activity is reduced by mutation, priA, which encodes the PriA protein that plays an important role in restarting blocked replication forks, becomes an essential gene [57,58]. It is possible that the stalling of replication forks at knots is the cause of this need for PriA and would explain why the presence of gyrase, which can remove positive supercoils, but not knots, is insufficient to keep replication moving in these cells.
Implications for cellular physiology and evolution
Given (i) the abundance of recombinases, transposases and topoisomerases found in both prokaryotic and eukaryotic organisms, (ii) the lack of sequence specificity by these enzymes, (iii) the confined space for the chromosomes and (iv) the propensity of DNA to react and entangle with itself, DNA rearrangements that lead to cellular transformation or death, or that contribute to the mutations that shape evolution seem likely to occur. In other words, an intrinsic lack of DNA stability might have helped drive selection and genetic change. In addition, cellular stress causes a number of recombinases and transposases to be activated [59,60]. Perhaps this activation creates a transient "hypermutable state" that allows cells to develop a mechanism to overcome the stress. Such an event would be similar to that suggested to occur during adaptive mutagenesis when E. coli are starved for lactose [61-63]. Consistent with this idea, cells harboring transposons such as Tn10, which can recombine and knot DNA, will out-compete cells lacking Tn10 that are otherwise isogenic, which suggests that the transposon confers a greater evolutionary fitness [64,65].
Conclusion
Our results suggest that recombined and knotted forms of DNA are problematic for the cell. Thus, it is the DNA conformation, rather than the primary sequence, that causes malfunctions. Effects of transient changes in conformation may then persist through induced mutations in the primary sequence. Unexpectedly, the DNA molecule undergoing site-specific recombination/knotting can "attack" a bystander DNA, and thus both DNA molecules may be altered.
Methods
Strains and Plasmids
E. coli strains C600, ParC1215 (parCts) and W3110 were described previously [21,66]. Plasmid pKH66 (pHIN) contains the S. typhimurium hin gene under control of the tac promoter and expresses Hin upon addition of isopropyl-1-thio-β-galactoside (IPTG) [21,67]. pTGSE4 (pREC) [68] is a pBR322-derived plasmid containing the Gin recombination (gix) sites and enhancer from bacteriophage Mu. Gin, Hin and their respective recombination sites are interchangeable [69]. pRJ862 (pKNOT) contains hix recombination sites and the enhancer binding site for the Hin recombinase from S. typhimurium [26]. One hix site contains a single base pair change, which forces a second round of recombination to tie knots by preventing religation after only one round [26]. To create the strains used throughout this work, we used a CaCl2 method to transform wild-type E. coli with plasmid DNA (typically 100 ng).
Antibiotic resistance measurements
Gradient plates [34] and Kirby-Bauer [70] disc diffusion assays were used to measure antibiotic resistance. Saturated overnight cultures containing the strains were diluted 30- to 100-fold in LB containing 1 mM IPTG and 50 μg/ml spectinomycin. The freshly diluted cultures were grown at 37°C until they reached OD600 = 0.3. For the Kirby-Bauer disc diffusion assays, cells were spread on LB-agar containing 1 mM IPTG and 50 μg/ml spectinomycin. The plates were allowed to dry for 20 min. and discs containing 10 μl of different ampicillin concentrations (0 – 500 mg/ml) were placed onto the agar. The plates were then incubated overnight at 37°C. The diameter of the cleared zone around each disc was measured. For the gradient plate assay, cells were spread on square plates containing a gradient from 0 to 17.5 mg/ml ampicillin, and then incubated overnight at 37°C. The plate dilution method was used to determine the ampicillin MIC50 values. The three E. coli strains harboring pHIN and either pBR, pREC or pKNOT were grown overnight in LB medium containing 100 μg/ml ampicillin, 50 μg/ml spectinomycin and no IPTG. These cultures were diluted 500-fold in LB medium containing 50 μg/ml spectinomycin and 1 mM IPTG, but no ampicillin. The freshly diluted cultures were grown with shaking to mid-logarithmic phase (OD600 = 0.3 – 0.4) at 37°C. Appropriate dilutions (to final cell counts of approximately 100 and 1000 per plate) were spread onto LB-agar alone and LB-agar containing ampicillin concentrations from 1.3 to 4.8 mg/ml, 50 μg/ml spectinomycin, but no IPTG. Colonies were counted following overnight incubation at 37°C. For each of the three strains, regression analysis was performed to determine the best-fit curve through the data points (2670: n = 10, 2671: n = 9 and 2672: n = 8) in the plot of survival as a function of ampicillin concentration. From this best-fit curve, the ampicillin MIC50 values were extrapolated.
Antibodies and immunoblotting
Isogenic C600 and ParC1215 (parCts) strains were grown overnight in LB medium without IPTG. Cells were diluted 1/100 into LB medium and grown with shaking ± 1 mM IPTG and 50 μg/ml spectinomycin to mid-logarithmic phase (OD600 = 0.3 – 0.4) at 37°C or 42°C. Duplicate sets of whole cell extracts were made by resuspending equal amounts of pelleted cells in loading buffer (125 mM Tris-HCl, pH 6.8; 1.4 M β-mercaptoethanol; 20% glycerol; 2% SDS; 0.1% Bromophenol blue), boiling for 3 min. and subjecting to 10% SDS-PAGE. One set was stained with Coomassie blue to ensure equal protein amounts were loaded. The other set was blotted to a nitrocellulose Protran membrane. The blots were probed with (1:10,000 dilution for all) antisera to β-lactamase (a kind gift of T. Palzkill, Baylor College of Medicine, Houston), anti-AcrA (a kind gift of H. I. Zgurskaya, University of Oklahoma, Norman), anti-ParC or anti-ParE (kind gifts of the late N.R. Cozzarelli, University of California, Berkeley), incubated in SuperSignal West chemiluminescent reagent (Pierce, Rockford, IL) and visualized with a charge coupled display camera.
Plasmid loss assay
Cells were grown as for Western blot analysis. Plasmid DNA was isolated by the alkaline lysis method [71], linearized with HindIII (which cuts pKNOT and pHIN once) and separated by electrophoresis on 1% agarose (TAE) gels. Plasmid levels were quantified by densitometric scanning (NucleoVision software, NucleoTech Corp., San Mateo, CA) of images of ethidium bromide-stained gels. Assuming pHIN levels do not change among the strains, plasmid bands were first normalized within each lane to the pHIN vector. These standardized band values are shown relative to the value for pBR within each strain background. To determine whether entire plasmid populations were lost from cells, various dilutions of cells grown in LB medium were spread onto LB-agar and replica plated on agar ± 100 μg/ml ampicillin. Colonies were counted following overnight incubation at 30°C (C600 and parCts) or 37°C (C600).
DNA catenane analysis
DNA catenanes were analyzed as done previously [22]. parCts cells containing pHIN and either pBR, pREC or pKNOT were grown at 30°C to mid-logarithmic phase (OD600 = 0.3 – 0.4). IPTG was added to a final concentration of 1 mM to induce Hin expression. After 10 min., cells were shifted to 42°C to inactivate the mutant topoisomerase IV. Forty minutes later, plasmid DNA was isolated [71], nicked with DNase I to remove supercoiling [72] and displayed by high-resolution gel electrophoresis [22]. The DNA was then transferred to a Zeta Probe nylon membrane (Bio-Rad Laboratories, Hercules, CA) and probed with [α-32P]-dCTP (GE Healthcare, Little Chalfont, UK) labeled pBR322 (made by random priming, Amersham Megaprime™ DNA labeling systems, GE Healthcare, Little Chalfont, UK), which hybridizes all three plasmids.
Isolation of ampicillin resistant colonies and fluctuation analysis
Ampicillin resistant colonies that grew inside the zone of clearance (Figure 5A) were streaked onto LB-agar plates containing 1 mM IPTG, 50 μg/ml spectinomycin and 1 mg/ml ampicillin and incubated overnight at 30°C. These conditions were used to prevent the accumulation of revertants to ampicillin sensitivity. To determine the mutation rate, E. coli harboring pHIN and either pBR, pREC or pKNOT were grown overnight in LB medium containing 100 μg/ml ampicillin, 50 μg/ml spectinomycin and no IPTG. The overnight cultures were diluted 6,000-fold into LB medium (~105 cells/ml) containing no ampicillin, 50 μg/ml spectinomycin and 1mM IPTG and divided into ten 1.2-ml aliquots. These aliquots were grown with shaking to mid-logarithmic phase (OD600 = 0.3 – 0.4) at 37°C to obtain parallel, independent cultures. The number of ampicillin resistant mutants that originated in each culture was determined by spreading 2 × 70 μl (pBR- and pREC-containing strains) or 2 × 200 μl (pKNOT-containing strain) of undiluted culture onto LB-agar containing various ampicillin concentrations, 50 μg/ml spectinomycin, but no IPTG. 16.1 mg/ml ampicillin was used for the strain harboring pBR; 7.9 mg/ml ampicillin was used for the strain harboring pREC; and 4.8 mg/ml ampicillin was used for the strain harboring pKNOT. Each of these ampicillin concentrations is 3.4-fold higher than the corresponding strain's ampicillin MIC50. The total number of cells was determined by spreading dilutions of each culture on LB-agar. Colonies were counted after incubation overnight at 37°C. The probable number of mutations per culture (m) was calculated from the distribution of hyper-resistant mutants in the independent cultures using the MSS maximum likelihood method. Then the mutation rate (μ) was calculated as μ = m/2Nt, where Nt is the total number of cells per culture [53].
Authors' contributions
RWD carried out antibiotic resistance measurements, immunoblotting, plasmid loss assays, DNA catenane analysis and isolation of ampicillin resistant colonies, conceived of and participated in the design of the study and drafted the manuscript. JKM carried out antibiotic resistance measurements, plasmid loss assays, isolation of ampicillin resistant colonies and fluctuation analysis, performed the statistical analysis, participated in the design of the study and helped to draft the manuscript. DWS participated in the design and coordination of the study, analyzed experimental results and helped to draft the manuscript. LZ conceived of and participated in the design and coordination of the study, analyzed experimental results and helped to draft the manuscript. All authors read and approved the final manuscript.
Acknowledgements
We thank Dr. Stacy Merickel and Dr. Reid Johnson for Hin reagents pKH66 and pRJ862 and for sharing unpublished results. We are grateful to Dr. Timothy Palzkill and Dr. Helena I. Zgurskaya for providing antibodies. We are grateful to Dr. Mary-Jane Lombardo for comments on the manuscript. Funding for this work was provided by the National Science Foundation MCB-0090880, the National Institutes of Health RO1 AI054830, a Burroughs Wellcome Fund New Investigator Award in the Toxicological Sciences and the Curtis Hankamer Research Award to LZ. RWD and JKM were supported by pre-doctoral fellowships from the Program in Mathematics and Molecular Biology at Florida State University with funding from the National Science Foundation and the Burroughs Wellcome Fund Interfaces Program.
References
1. Cozzarelli NR, Cost GJ, Nollmann M, Viard T, Stray JE: Giant proteins that move DNA: bullies of the genomic playground.
Nat Rev Mol Cell Biol 2006, 7(8):580-588. PubMed Abstract | Publisher Full Text
2. Bohrmann B, Haider M, Kellenberger E: Concentration evaluation of chromatin in unstained resin-embedded sections by means of low-dose ratio-contrast imaging in STEM.
Ultramicroscopy 1993, 49(1-4):235-251. PubMed Abstract | Publisher Full Text
3. Reich Z, Wachtel EJ, Minsky A: Liquid-crystalline mesophases of plasmid DNA in bacteria.
Science 1994, 264(5164):1460-1463. PubMed Abstract | Publisher Full Text
4. Minsky A: Information content and complexity in the high-order organization of DNA.
Annu Rev Biophys Biomol Struct 2004, 33:317-342. PubMed Abstract | Publisher Full Text
5. Yan J, Magnasco MO, Marko JF: A kinetic proofreading mechanism for disentanglement of DNA by topoisomerases.
Nature 1999, 401(6756):932-935. PubMed Abstract | Publisher Full Text
6. Shishido K, Komiyama N, Ikawa S: Increased production of a knotted form of plasmid pBR322 DNA in Escherichia coli DNA topoisomerase mutants.
J Mol Biol 1987, 195(1):215-218. PubMed Abstract | Publisher Full Text
7. Martin-Parras L, Lucas I, Martinez-Robles ML, Hernandez P, Krimer DB, Hyrien O, Schvartzman JB: Topological complexity of different populations of pBR322 as visualized by two-dimensional agarose gel electrophoresis.
Nucleic Acids Res 1998, 26(14):3424-3432. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
8. Deibler RW: The biological implications of DNA knots and the in vivo activity of topoisomerase IV. Houston: Baylor College of Medicine; PhD thesis; 2003.
9. Shishido K, Ishii S, Komiyama N: The presence of the region on pBR322 that encodes resistance to tetracycline is responsible for high levels of plasmid DNA knotting in Escherichia coli DNA topoisomerase I deletion mutant.
Nucleic Acids Res 1989, 17(23):9749-9759. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
10. Ishii S, Murakami T, Shishido K: Gyrase inhibitors increase the content of knotted DNA species of plasmid pBR322 in Escherichia coli .
J Bacteriol 1991, 173(17):5551-5553. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
11. Sikorav JL, Jannink G: Kinetics of chromosome condensation in the presence of topoisomerases: a phantom chain model.
Biophys J 1994, 66(3 Pt 1):827-837. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
12. Arsuaga J, Vazquez M, Trigueros S, Sumners D W, Roca J: Knotting probability of DNA molecules confined in restricted volumes: DNA knotting in phage capsids.
Proc Natl Acad Sci USA 2002, 99(8):5373-5377. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
13. Baker TA, Sekimizu K, Funnell BE, Kornberg A: Extensive unwinding of the plasmid template during staged enzymatic initiation of DNA replication from the origin of the Escherichia coli chromosome.
Cell 1986, 45(1):53-64. PubMed Abstract | Publisher Full Text
14. Hatfield GW, Benham CJ: DNA topology-mediated control of global gene expression in Escherichia coli.
Annu Rev Genet 2002, 36:175-203. PubMed Abstract | Publisher Full Text
15. Liu Y, Bondarenko V, Ninfa A, Studitsky VM: DNA supercoiling allows enhancer action over a large distance.
Proc Natl Acad Sci USA 2001, 98:14883-14888. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
16. Steck TR, Franco RJ, Wang JY, Drlica K: Topoisomerase mutations affect the relative abundance of many Escherichia coli proteins.
Mol Microbiol 1993, 10(3):473-481. PubMed Abstract | Publisher Full Text
17. Vologodskii AV, Cozzarelli NR: Monte Carlo analysis of the conformation of DNA catenanes.
J Mol Biol 1993, 232(4):1130-1140. PubMed Abstract | Publisher Full Text
18. Vologodskii AV, Levene SD, Klenin KV, Frank-Kamenetskii MD, Cozzarelli NR: Conformational and thermodynamic properties of supercoiled DNA.
J Mol Biol 1992, 227(4):1224-1243. PubMed Abstract | Publisher Full Text
19. Podtelezhnikov AA, Cozzarelli NR, Vologodskii AV: Equilibrium distributions of topological states in circular DNA: interplay of supercoiling and knotting.
Proc Natl Acad Sci USA 1999, 96(23):12974-12979. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
20. Vologodskii AV, Marko JF: Extension of torsionally stressed DNA by external force.
Biophys J 1997, 73(1):123-132. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
21. Deibler RW, Rahmati S, Zechiedrich EL: Topoisomerase IV, alone, unknots DNA in E. coli.
Genes Dev 2001, 15:748-761. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
22. Adams DE, Shekhtman EM, Zechiedrich EL, Schmid MB, Cozzarelli NR: The role of topoisomerase IV in partitioning bacterial replicons and the structure of catenated intermediates in DNA replication.
Cell 1992, 71(2):277-288. PubMed Abstract | Publisher Full Text
23. Zechiedrich EL, Cozzarelli NR: Roles of topoisomerase IV and DNA gyrase in DNA unlinking during replication in Escherichia coli.
Genes Dev 1995, 9(22):2859-2869. PubMed Abstract | Publisher Full Text
24. Zechiedrich EL, Khodursky AB, Bachellier S, Schneider R, Chen D, Lilley DM, Cozzarelli NR: Roles of topoisomerases in maintaining steady-state DNA supercoiling in Escherichia coli.
J Biol Chem 2000, 275(11):8103-8113. PubMed Abstract | Publisher Full Text
25. Merickel SK, Johnson RC: Topological analysis of Hin-catalysed DNA recombination in vivo and in vitro.
Mol Microbiol 2004, 51(4):1143-1154. PubMed Abstract | Publisher Full Text
26. Heichman KA, Moskowitz IPG, Johnson RC: Configuration of DNA strands and mechanism of strand exchange in the Hin invertasome as revealed by analysis of recombinant knots.
Genes Dev 1991, 5(9):1622-1634. PubMed Abstract | Publisher Full Text
27. Rochman M, Aviv M, Glaser G, Muskhelishvili G: Promoter protection by a transcription factor acting as a local topological homeostat.
EMBO Rep 2002, 3:355-360. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
28. Hardy CD, Cozzarelli NR: A genetic selection for supercoiling mutants of Escherichia coli reveals proteins implicated in chromosome structure.
Mol Microbiol 2005, 57(6):1636-1652. PubMed Abstract | Publisher Full Text
29. Postow L, Hardy CD, Arsuaga J, Cozzarelli NR: Topological domain structure of the Escherichia coli chromosome.
Genes Dev 2004, 18(14):1766-1779. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
30. Glasgow AC, Bruist MF, Simon MI: DNA-binding properties of the Hin recombinase.
J Biol Chem 1989, 264(17):10072-10082. PubMed Abstract | Publisher Full Text
31. Johnson RC, Bruist MF: Intermediates in Hin-mediated DNA inversion: a role for Fis and the recombinational enhancer in the strand exchange reaction.
Embo J 1989, 8(5):1581-1590. PubMed Abstract | PubMed Central Full Text
32. Lee SY, Lee HJ, Lee H, Kim S, Cho EH, Lim HM: In vivo assay of protein-protein interactions in Hin-mediated DNA inversion.
J Bacteriol 1998, 180(22):5954-5960. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
33. Tam CK, Hackett J, Morris C: Rate of inversion of the Salmonella enterica shufflon regulates expression of invertible DNA.
Infect Immun 2005, 73(9):5568-5577. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
34. Eisenstadt E, Carlton BC, Brown BJ: Gene Mutation. In Methods for General and Molecular Bacteriology. Edited by Gerhardt P, Murray RGE, Wood WA, Krieg NR. Washington, D.C.: American Society for Microbiology; 1994:304.
35. Portugal J, Rodriguez-Campos A: T7 RNA polymerase cannot transcribe through a highly knotted DNA template.
Nucleic Acids Res 1996, 24(24):4890-4894. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
36. Saitta AM, Soper PD, Wasserman E, Klein ML: Influence of a knot on the strength of a polymer strand.
Nature 1999, 399(6731):46-48. PubMed Abstract | Publisher Full Text
37. Arai Y, Yasuda R, Akashi K, Harada Y, Miyata H, Kinosita KJ, Itoh H: Tying a molecular knot with optical tweezers.
Nature 1999, 399(6735):446-448. PubMed Abstract | Publisher Full Text
38. Pieranski P, Kasas S, Dietler G, Dubochet J, Stasiak A: Localization of breakage points in knotted strings.
New Journal of Physics 2001, 3:10. Publisher Full Text
39. Uehara H, Kimura H, Aoyama A, Yamanobe T, Komoto T: Effects of knot characteristics on tensile breaking of a polymeric monofilament.
New Journal of Physics 2007, 9:65. Publisher Full Text
40. Lee CL, Ow DS, Oh SK: Quantitative real-time polymerase chain reaction for determination of plasmid copy number in bacteria.
J Microbiol Methods 2006, 65(2):258-267. PubMed Abstract | Publisher Full Text
41. Lee C, Kim J, Shin SG, Hwang S: Absolute and relative QPCR quantification of plasmid copy number in Escherichia coli .
J Biotechnol 2006, 123(3):273-280. PubMed Abstract | Publisher Full Text
42. Noack D, Roth M, Geuther R, Muller G, Undisz K, Hoffmeier C, Gaspar S: Maintenance and genetic stability of vector plasmids pBR322 and pBR325 in Escherichia coli K12 strains grown in a chemostat.
Mol Gen Genet 1981, 184(1):121-124. PubMed Abstract | Publisher Full Text
43. Sundin O, Varshavsky A: Arrest of segregation leads to accumulation of highly intertwined catenated dimers: dissection of final stages of SV40 DNA replication.
Cell 1981, 25(3):659-669. PubMed Abstract | Publisher Full Text
44. Katritch V, Olson WK, Vologodskii AV, Dubochet J, Stasiak A: Tightness of random knotting.
Phys Rev E 2000, 61(5 Pt B):5545-5549. Publisher Full Text
45. Metzler R, Hanke A, Dommersnes PG, Kantor Y, Kardar M: Equilibrium shapes of flat knots.
Phys Rev Lett 2002, 88(18):188101. PubMed Abstract | Publisher Full Text
46. Wuite GJ, Smith SB, Young M, Keller D, Bustamante C: Single-molecule studies of the effect of template tension on T7 DNA polymerase activity.
Nature 2000, 404(6773):103-106. PubMed Abstract | Publisher Full Text
47. Maier B, Bensimon D, Croquette V: Replication by a single DNA polymerase of a stretched single-stranded DNA.
Proc Natl Acad Sci USA 2000, 97(22):12002-12007. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
48. Wang MD, Schnitzer MJ, Yin H, Landick R, Gelles J, Block SM: Force and velocity measured for single molecules of RNA polymerase.
Science 1998, 282(5390):902-907. PubMed Abstract | Publisher Full Text
49. Davenport RJ, Wuite GJ, Landick R, Bustamante C: Single-molecule study of transcriptional pausing and arrest by E. coli RNA polymerase.
Science 2000, 287(5462):2497-2500. PubMed Abstract | Publisher Full Text
50. Bao XR, Lee HJ, Quake SR: Behavior of complex knots in single DNA molecules.
Phys Rev Lett 2003, 91(26 Pt 1):265506. PubMed Abstract | Publisher Full Text
51. Beaber JW, Hochhut B, Waldor MK: SOS response promotes horizontal dissemination of antibiotic resistance genes.
Nature 2004, 427(6969):72-74. PubMed Abstract | Publisher Full Text
52. Friedberg EC, Walker GC, Siede W: DNA repair and mutagenesis. edn. Washington: ASM Press; 1995.
53. Rosche WA, Foster PL: Determining mutation rates in bacterial populations.
Methods 2000, 20(1):4-17. PubMed Abstract | Publisher Full Text
54. Levine C, Hiasa H, Marians KJ: DNA gyrase and topoisomerase IV: biochemical activities, physiological roles during chromosome replication, and drug sensitivities.
Biochim Biophys Acta 1998, 1400(1-3):29-43. PubMed Abstract | Publisher Full Text
55. Kato J-I, Nishimura Y, Imamura R, Niki H, Hiraga S, Susuki H: New topoisomerase essential for chromosome segregation in Escherichia coli .
Cell 1990, 63(2):393-404. PubMed Abstract | Publisher Full Text
56. Zechiedrich EL, Khodursky AB, Cozzarelli NR: Topoisomerase IV, not gyrase, decatenates products of site-specific recombination in Escherichia coli.
Genes Dev 1997, 11(19):2580-2592. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
57. Grompone G, Bidnenko V, Ehrlich SD, Michel B: PriA is essential for viability of the Escherichia coli topoisomerase IV parE10(Ts) mutant.
J Bacteriol 2004, 186(4):1197-1199. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
58. Heller RC, Marians KJ: Replication fork reactivation downstream of a blocked nascent leading strand.
Nature 2006, 439(7076):557-562. PubMed Abstract | Publisher Full Text
59. Posfai G, Plunkett G 3rd, Feher T, Frisch D, Keil GM, Umenhoffer K, Kolisnychenko V, Stahl B, Sharma SS, de Arruda M, Burland V, Harcum SW, Blattner FR: Emergent properties of reduced-genome Escherichia coli .
Science 2006, 312(5776):1044-1046. PubMed Abstract | Publisher Full Text
60. Haniford DB: Transpososome dynamics and regulation in Tn 10 transposition.
Crit Rev Biochem Mol Biol 2006, 41(6):407-424. PubMed Abstract | Publisher Full Text
61. Hastings PJ, Slack A, Petrosino JF, Rosenberg SM: Adaptive amplification and point mutation are independent mechanisms: evidence for various stress-inducible mutation mechanisms.
PLoS Biol 2004, 2(12):e399. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
62. Hersh MN, Ponder RG, Hastings PJ, Rosenberg SM: Adaptive mutation and amplification in Escherichia coli : two pathways of genome adaptation under stress.
Res Microbiol 2004, 155(5):352-359. PubMed Abstract | Publisher Full Text
63. Foster PL: Stress responses and genetic variation in bacteria.
Mutat Res 2005, 569(1-2):3-11. PubMed Abstract | Publisher Full Text
64. Chao L, McBroom SM: Evolution of transposable elements: an IS10 insertion increases fitness in Escherichia coli.
Mol Biol Evol 1985, 2(5):359-369. PubMed Abstract | Publisher Full Text
65. Chao L, Vargas C, Spear BB, Cox EC: Transposable elements as mutator genes in evolution.
Nature 1983, 303(5918):633-635. PubMed Abstract | Publisher Full Text
66. Kato J-I, Nishimura Y, Yamada M, Suzuki H, Hirota Y: Gene organization in the region containing a new gene involved in chromosome partition in Escherichia coli.
J Bacteriol 1988, 170(9):3967-3977. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
67. Hughes KT, Gaines PC, Karlinsey JE, Vinayak R, Simon MI: Sequence-specific interaction of the Salmonella Hin recombinase in both major and minor grooves of DNA.
Embo J 1992, 11(7):2695-2705. PubMed Abstract | PubMed Central Full Text
68. Crisona NJ, Kanaar R, Gonzalez TN, Zechiedrich EL, Klippel A, Cozzarelli NR: Processive recombination by wild-type gin and an enhancer-independent mutant. Insight into the mechanisms of recombination selectivity and strand exchange.
J Mol Biol 1994, 243(3):437-457. PubMed Abstract | Publisher Full Text
69. Plasterk RHA, Brinkman A, van de Putte P: DNA inversions in the chromosome of Escherichia coli and in bacteriophage Mu: relationship to other site-specific recombination systems.
Proc Natl Acad Sci USA 1983, 80(17):5355-5358. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
70. Bauer AW, Kirby WMM, Sherris JC, Turck M: Antibiotic susceptibility testing by a standardized single disk method.
Am J Clin Pathol 1966, 45:493-496. PubMed Abstract
71. Sambrook J, Fritsch EF, Maniatis T: Molecular cloning: a laboratory manual. 2nd edition. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1989.
72. Barzilai R: SV40 DNA: quantitative conversion of closed circular to open circular form by an ethidium bromide-restricted endonuclease.
J Mol Biol 1973, 74(4):739-742. PubMed Abstract | Publisher Full Text
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:03:35.000Z
|
m556ywbsrhmzwrlt4rjvxrbjyhm7i7e4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36483",
"uncompressed_offset": 366115954,
"url": "www.eea.europa.eu/publications/ENVISSUENo12/page009.html/sendto_form",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.eea.europa.eu/publications/ENVISSUENo12/page009.html/sendto_form"
}
|
cccc_CC-MAIN-2013-20
|
Personal tools
Sign up now!
Get notifications on new reports and products. Currently we have 55591 subscribers. Frequency: 3-4 emails / month.
Follow us
Twitter
Facebook
YouTube channel
RSS Feeds
Notifications archive
Write to us
For the public:
For media and journalists:
Contact EEA staff
Contact the web team
FAQ
Call us
Reception:
Phone: (+45) 33 36 71 00
Fax: (+45) 33 36 71 99
next
previous
items
Skip to content. | Skip to navigation
Sound and independent information
on the environment
Send this page to someone
Fill in the email address of your friend, and we will send an email that contains a link to this page.
Address info
(Required)
The e-mail address to send this link to.
(Required)
Your email address.
A comment about this link.
European Environment Agency (EEA)
Kongens Nytorv 6
1050 Copenhagen K
Denmark
Phone: +45 3336 7100
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:50:34.000Z
|
bidhcvg43yj5hbk5yveulxzhzzfhfeu5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36484",
"uncompressed_offset": 370334360,
"url": "www.envirolink.org/topics.html?catid=3&do=catsearch&topic=Beaches&topicsku=2002119151252&topictype=subtopic",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.envirolink.org/topics.html?topic=Beaches&topicsku=2002119151252&topictype=subtopic&do=catsearch&catid=3"
}
|
cccc_CC-MAIN-2013-20
|
advanced search
Beaches - General Information
Actions You Can Take (1)
Articles (1)
Educational Resources (1)
E-Mail Lists (0)
Events (0)
General Info (2)
Government Resources (1)
Organizations (12)
Jobs & Volunteer Opportunities (0)
Publications (1)
Displaying 1 - 2 of 2 resources in Beaches and General Information:
1. South Florida Aquatic Environments
Gainesville, FL, USA
Take an in-depth tour through three imperiled south Florida environments - the Everglades, Florida Bay, and Florida Keys. Test your knowledge with interactive games and ...
Category: General Information
2. Watershed & Coastal Resources of Orange County, CA
Santa Ana, CA, USA
Our new web site is a flood of information on the Coastal Resources and all 13 Watersheds in Orange County, California. ...
Category: General Information
Home | Site Map | About EnviroLink | Advanced Search | Suggest a Resource
All content on this website is governed by a Creative Commons license.
This site powered by WebDNA
Community Information Systems provided by Rhiza Labs
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:49:35.000Z
|
nmaznkwkinljpeqe7zcwrh7wivg6jlru
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36485",
"uncompressed_offset": 380487813,
"url": "www.familysearch.org/learn/wiki/en/index.php?hideminor=1&target=Addison%2C_Maine&title=Special%3ARecentChangesLinked",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/index.php?title=Special:RecentChangesLinked&hideminor=1&target=Addison%2C_Maine"
}
|
cccc_CC-MAIN-2013-20
|
Changes related to "Addison, Maine"
From FamilySearch Wiki
This is a list of changes made recently to pages linked from a specified page (or to members of a specified category). Pages on your watchlist are bold.
Recent changes options Show last 50 | 100 | 250 | 500 changes in last 1 | 3 | 7 | 14 | 30 days
Show minor edits | Show bots | Hide anonymous users | Hide logged-in users | Hide my edits
Show new changes starting from 08:49, 18 May 2013
Page name:
No changes on linked pages during the given period.
New to the Research Wiki?
In the FamilySearch Research Wiki, you can learn how to do genealogical research or share your knowledge with others.
Learn More
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:53:00.000Z
|
2b4qxvof2xnyulvp3pjryruwauvgybdr
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36492",
"uncompressed_offset": 423865861,
"url": "www.hindawi.com/journals/arth/2013/487615/abs/",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.hindawi.com/journals/arth/2013/487615/abs/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
Arthritis
Volume 2013 (2013), Article ID 487615, 11 pages
http://dx.doi.org/10.1155/2013/487615
Review Article
A Literature Synthesis Indicates Very Low Quality, but Consistent Evidence of Improvements in Function after Surgical Interventions for Primary Osteoarthritis of the Elbow
1Faculty of Health Sciences, University of Western Ontario, Elborn College, Room 1424, 1201 Western Road, London, ON, N6G 1H1, Canada
2Schools of Physical Therapy and Kinesiology, Faculty of Health Sciences, University of Western Ontario, Room 1400, Elborn College, 1201 Western Road, London, ON, N6G 1H1, Canada
3School of Rehabilitation Science, McMaster University, Hamilton, ON, L8S 1C7, Canada
4The Hand and Upper Limb Center, St. Joseph’s Hospital, 268 Grosvenor Street, London, ON, N6A 4L6, Canada
Received 10 August 2012; Accepted 29 November 2012
Academic Editor: Changhai Ding
Copyright © 2013 Joshua I. Vincent et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background. Primary osteoarthritis of the elbow is a debilitating disease with an overall incidence of about 2%. Pain and reduced motion (ROM) lead to disability and loss of functional independence. Purpose. To critically review the literature on patient-related important functional outcomes (pain, ROMs and functional recovery) after surgery for primary OA of the elbow, utilizing the 2011 OCEBM levels of evidence. Design. A literature synthesis. Results. Twenty-six articles satisfied the inclusion and exclusion criteria; 25 of the studies were at level IV evidence, and 1 at level III. All three surgical techniques led to improvement in pain, ROM, and functional recovery in the short- and medium-term follow-up. Long-term follow-up results, available only for open joint debridement, showed recurrence of osteoarthritic signs on X-ray with minimal loss of motion. Recently, there seems to be an increased focus on arthroscopic debridement. Conclusion. The quality of research addressing surgical interventions is very low, including total elbow arthroplasty (TEA). However, the evidence concurs that open and arthroscopic joint debridement can improve function in patients with moderate-to-severe OA of the elbow. TEA is reserved for treating severe joint destruction, mostly for elderly individuals with low physical demands when other intervention options have failed.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:03:30.000Z
|
cx5nvr3gjregdummjkzgh2q6zxn55gmo
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36499",
"uncompressed_offset": 444333995,
"url": "www.isfdb.org/cgi-bin/title.cgi",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.isfdb.org/cgi-bin/title.cgi?1258664"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: Traveller in Black
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Title: Traveller in Black
Author: John Brunner
Year: 1978
Variant Title of: The Traveler in Black (by John Brunner ) [may list more publications, awards and reviews]
Type: COLLECTION
Series: Traveller in Black
ISFDB Record Number: 1258664
User Rating: This title has fewer than 5 votes. VOTE
Current Tags: None
Publications:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:48:33.000Z
|
svyulhm3ofsklcyghaq5l6f5snxp4vlh
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36507",
"uncompressed_offset": 488753786,
"url": "www.mdpi.com/1422-0067/12/4/2325",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.mdpi.com/1422-0067/12/4/2325"
}
|
cccc_CC-MAIN-2013-20
|
Int. J. Mol. Sci. 2011, 12(4), 2325-2335; doi:10.3390/ijms12042325
Article
Dextran Sulfate Sodium Inhibits Alanine Synthesis in Caco-2 Cells
1 Department of Nutrition, University of California, Davis, One Shields Avenue, Davis, CA 95616, USA 2 Department of Food Science and Technology, University of California, Davis, One Shields Avenue, Davis, CA 95616, USA
* Author to whom correspondence should be addressed.
Received: 5 February 2011; in revised form: 12 March 2011 / Accepted: 28 March 2011 / Published: 4 April 2011
(This article belongs to the Special Issue Advances in Molecular Toxicology)
Download PDF Full-Text [378 KB, uploaded 9 February 2012 10:04 CET]
Abstract: To understand and characterize the pathogenic mechanisms of inflammatory bowel disease, dextran sulfate sodium (DSS) has been used to induce acute and chronic colitis in animal models by causing intestinal epithelium damage. The mechanism of action of DSS in producing this outcome is not well understood. In an effort to understand how DSS might impact epithelial cell metabolism, we studied the intestinal epithelial cell line Caco-2 incubated with 1% DSS over 56 hours using 1H NMR spectroscopy. We observed no difference in cell viability as compared to control cultures, and an approximately 1.5-fold increase in IL-6 production upon incubation with 1% DSS. The effect on Caco-2 cell metabolism as measured through changes in the concentration of metabolites in the cell supernatant included a three-fold decrease in the concentration of alanine. Given that the concentrations of other amino acids in the cell culture supernatant were not different between treated and control cultures over 56 hours suggest that DSS inhibits alanine synthesis, specifically alanine aminotransferase, without affecting other key metabolic pathways. The importance of alanine aminotransferase in inflammatory bowel disease is discussed.
Keywords: metabolomics; metabonomics; IBD; DSS; NMR; Caco-2; alanine transaminase; Crohn’s disease; ALAT; ALT
Retraction
• Retraction
This paper was retracted on 9 February 2012: http://www.mdpi.com/1422-0067/13/2/1804 (PDF, 25 KB)
It has been brought to our attention by the corresponding author that the results presented this article [1] are in error due to the fact that the media supplement glutaMAX was used in place of L-glutamine for culture of the control cells, while L-glutamine was used for culture of the treated cells. All authors have confirmed that the reported result could not be reproduced using the correct culture conditions. We would like to thank the authors for pointing out this error thereby upholding the ethics of scientific publication. The Editorial Team and Publisher have agreed with the authors that this manuscript should be retracted. We apologize for any inconvenience this may have caused.
Article Statistics
Click here to load and display the download statistics.
Cite This Article
MDPI and ACS Style
Ye, Z.; Mishchuk, D.O.; Stephens, N.S.; Slupsky, C.M. Dextran Sulfate Sodium Inhibits Alanine Synthesis in Caco-2 Cells. Int. J. Mol. Sci. 2011, 12, 2325-2335.
AMA Style
Ye Z, Mishchuk DO, Stephens NS, Slupsky CM. Dextran Sulfate Sodium Inhibits Alanine Synthesis in Caco-2 Cells. International Journal of Molecular Sciences. 2011; 12(4):2325-2335.
Chicago/Turabian Style
Ye, Zhong; Mishchuk, Darya O.; Stephens, Natasha S.; Slupsky, Carolyn M. 2011. "Dextran Sulfate Sodium Inhibits Alanine Synthesis in Caco-2 Cells." Int. J. Mol. Sci. 12, no. 4: 2325-2335.
Int. J. Mol. Sci. EISSN 1422-0067 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:02:58.000Z
|
dnlqfdcizqrtlbw2bimbnbyxf5jo6az5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36514",
"uncompressed_offset": 529638891,
"url": "www.openwetware.org/index.php?oldid=675256&title=CH391L%2FS13%2FIn_vitro_Selection_of_FNAs",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.openwetware.org/index.php?title=CH391L/S13/In_vitro_Selection_of_FNAs&oldid=675256"
}
|
cccc_CC-MAIN-2013-20
|
CH391L/S13/In vitro Selection of FNAs
From OpenWetWare
Jump to: navigation, search
Contents
Introduction
Although the vast majority of such ligand binding activities or enzymatic activities known are performed by proteins a secondary subset of these fall under the category of Functional nucleic acids (FNAs. FNAs are RNA, ssDNA, or XNA(nucleic acid analogues) that perform an activity such as binding or catalyzing a reaction. FNAs are grouped into three main categories Aptamers, Ribozymes, and Deoxyribozymes that are further classified into either natural or artificial depending on their origin. The exception being Deoxyribozymes as they have yet to be discovered in a living organism. Still, It was only in the 1980s that the 1st ribozyme was discovered that we started to study FNAs and have allowed for the discovery of new methods, such as the SELEX or In vitro selection process that we are expanding their potential both as tools for exploring biology and real world problem solving.
<!Note to self: mention RNA World>
Functional Nucleic Acids
[1],[2],[3],[4]
Ribozymes
As previously mentioned ribozymes fall under the category of enzymes. Most of the ribozymes studied up until recently in living organism fall into 9 classes. Of this most perform some type scission and ligation reaction. In the case of in vitro selected ribozymes their function has been expanded.
Natural Ribozymes [5]
• Cleaving Ribozymes
• 1 Self-cleaving i.e. The Hammerhead family (satellite RNA)
• 2 Trans-cleaving i.e. RNase P
• Splicing Ribozymes
• 3 Group I
• 4 Group II
• Riboswitches
• 5 Thermosensors
• 6 sRNAs
• 7 T-Boxes
• 8 Metabolites
• 9 Magnesium
Deoxyribozymes
Aptamers and Riboswitches
The word aptamer from the latin aptus and translates as the past participle of to fit were originally identified by employing the protocol SELEX. Therefore the word Aptamer describes their basic function as RNA or single stranded DNA (ssDNA)that can bind a ligand by assuming an specific structure.[6, 7] Yet, it would take several years until the discovery of the first in vivo aptamer or riboswitch [8]. See the following page to get a better understanding of aptamers and riboswitches.
In vitro Selection of Functional Nucleic Acids
The image presented describes the basic method for performing a SELEX or In vivo selection experiment using single stranded nucleic acids (RNA,ssDNA,XNA) that are chemically synthesizedan have a constant region (CR) and a random region. Having the CR allows later amplification using PCR. The first step is subjecting the population of single stranded nucleic acids to specific selective condition in which function is possible. Then a (2) diverse subset of the population will perform the desired function and will be then (3) PCR amplified to make double stranded nucleic acids with the use of the CR introduced previously. Therefore the selection can continue to a following round, while at the same time a sample is obtained and can be sequenced. [9]
New Methods and Tools that assit In vitro selections
Computational Methods
• Mfold - originally developed as a GUI or graphical user interface server for the prediction of the secondary structure of single stranded nucleic acids. The core algorithm predicts structures based on minimum free energies necessary to fold a structure. This algorithm can be used initially as a step to predict possible secondary structures of active sequences [10].
FRET
• Fluorescent analogues
Next Generation Sequencing
New Applications of FNAs
1. Kruger K, Grabowski PJ, Zaug AJ, Sands J, Gottschling DE, and Cech TR. . pmid:6297745. PubMed HubMed [Cech1982]
2. Guerrier-Takada C, Gardiner K, Marsh T, Pace N, and Altman S. . pmid:6197186. PubMed HubMed [Altman1983]
3. Ellington AD and Szostak JW. . pmid:1697402. PubMed HubMed [Ellington1990]
4. Tuerk C and Gold L. . pmid:2200121. PubMed HubMed [Gold1990]
5. Functional Nucleic Acids for Analytical Applications. Dordrecht: Springer, 2009. isbn:978-0-387-73711-9. [Silverman2009]
6. Wilson DS and Szostak JW. . pmid:10872462. PubMed HubMed [Wilson1999]
7. Winkler W, Nahvi A, and Breaker RR. . pmid:12410317. PubMed HubMed [Winkler2002]
8. Emilsson GM and Breaker RR. . pmid:12022469. PubMed HubMed [Breaker2002]
9. Zuker M. . pmid:12824337. PubMed HubMed [Zucker2003]
All Medline abstracts: PubMed HubMed
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:34:25.000Z
|
zxwrv6fjcm2sbp4eu3sg76lrbq442cma
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36515",
"uncompressed_offset": 529666385,
"url": "www.openwetware.org/wiki/User:Stuart_McKellar/Notebook/Bird_Sex_Testing/2013/01/20",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.openwetware.org/wiki/User:Stuart_McKellar/Notebook/Bird_Sex_Testing/2013/01/20"
}
|
cccc_CC-MAIN-2013-20
|
User:Stuart McKellar/Notebook/Bird Sex Testing/2013/01/20
From OpenWetWare
Jump to: navigation, search
Project name Main project page
Previous entry Next entry
Running Gels
• I already have some 1% gel made up, so I am going to try running the samples on it using the big gel bath. If if doesn't work, I am going to try 2% on the little bath. I am going to use 3ul of DNA/buffer per well to maximise the amount of samples I can run and compare.
1ul buffer to 5ul DNA, 2ul buffer to 10ul DNA, 4ul buffer to 20ul DNA. I think I will make up 4ul buffer and then add 20ul of DNA. This should allow me to run the samples 6 times.
no visible results. Try again on smaller gel
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:01:31.000Z
|
adfjotwzwksmnaccfb2aznoumfd75z25
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36516",
"uncompressed_offset": 534402216,
"url": "www.panarmenian.net/eng/news/122886/",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.panarmenian.net/eng/news/122886/"
}
|
cccc_CC-MAIN-2013-20
|
European Parliament adopts resolution of release of Azeri axe-killer
PanARMENIAN.Net - Members of European Parliament voted on adoption of a previously debated resolution on Hungary-extradited Azeri criminal Ramil Safarov convicted for murdering an Armenian officer.
Some amendments to resolution text were also voted for.
The initial text of the resolution ran as follows,
“The European Parliament,
- having regard to its previous resolutions on Azerbaijan with regard, in particular, 24 May 2011,
- having regard to the joint Statement by the EU High Representative Catherine Ashton and Commissioner Füle of 4 September 2012,
- having regard to the statement of the Secretary General of the Council of Europe Thornbjorn Jagland of 4 September 2012,
- having regard to the Partnership and Cooperation Agreement between the EC and Azerbaijan which entered into force in 1999 and to the ongoing negotiations between the two parties of EU-Azerbaijan Association Agreement,
- having regard to Rule 122(5) of its Rules of Procedure,
A. whereas on 31 August 2012 Ramil Safarov, who was convicted for murder and sentenced to life imprisonment in Hungary, was transferred to Azerbaijan,
B. whereas Ramil Safarov had been jailed at a Hungarian penal facility since 2004 after brutally killing an Armenian colleague during a course sponsored by NATO Partnership for Peace Programme in Budapest; whereas Safarov pleaded guilty and expressed no remorse defending his action on the ground that the victim was Armenian,
C. whereas Liutenat Safarov had been declared a national hero in Azerbaijan and a few hours after his return was granted a presidential pardon, set free and in a public ceremony promoted to major,
D. whereas the announcement of the transfer was accompanied by a clarification of the Hungarian authorities stating that the extradition to Azerbaijan was approved in accordance with the terms of the 1983 European Convention of the Transfer of Sentenced Persons, to which Azerbaijan is party,
E. whereas Hungarian officials affirmed that they had received assurances from Azerbaijani government that once returned to his home country Safarov would continue his prison term in an Azerbaijani penitentiary; whereas Azerbaijani authorities reject that assurances were given to Hungary on the case of Safarov;
F. whereas after the extradition of Safarov Armenia suspended diplomatic relations with Hungary,
G. whereas the Safarov release risks to escalate the conflict between Azerbaijan and Armenia,
H. whereas Azerbaijan is actively participating in the European Neighbourhood Policy and the Eastern Partnership, is a founding member of Euronest and is committed to respecting democracy, human rights and the rule of law that are core values of these initiatives,
I. whereas Azerbaijan will take up a non-permanent seat in the United Nations Security Council (UNSC) for the period of 2012 - 2013, and has committed to uphold the values as expressed in the UN Human Rights Charter,
J. whereas Azerbaijan is a member of the Council of Europe and a party to the European Convention on Human Rights (ECHR);
K. whereas Azerbaijan and the European Union is engaged in the negotiations of the Association Agreement;
1. Deplores the pardoning and military promotion of a convicted and sentenced for life imprisonment murderer Ramil Safarov and stresses that such a move undermines Azerbaijan's commitment to respect justice and the rule of law;
2. Rejects any glorification of Ramil Safarov as this runs contrary to the principles of human dignity and justice;
3. Considers that while the presidential pardon granted to Safarov is in line with the letter of the European Convention on the Transfer of Sentenced Persons, it runs contrary to the spirit of the agreement and undermines affirmations by Hungarian government of the assurances received on the case of Safarov;
4. Recognises that European Convention on the Transfer of Sentenced Persons was established on the basis of all states committing to the establishment of justice and respect for the rule of law;
5. Considers it important that the Hungarian authorities defend credibility of their actions by taking formal diplomatic and legal steps towards Azerbaijan with regards to the assurances of continuous imprisonment that Hungarian government claims were received prior to the transfer of Ramil Safarov;
6. Calls on the Hungarian authorities to ask officially for information on enforcement of art 15(c) of the Convention and inform the European Committee on Crime Problems under art 23 of this Convention;
7. Calls on Azerbaijan and Armenia to exercise restraint in order to prevent escalation of the situation in the region;
8. Calls on the High Representative Vice President Catherine Ashton to maintain efforts towards both Armenia and Azerbaijan seeking to de-escalate the situation and find a possible line of dialogue among the conflicting parties;
9. Instructs its President to forward this resolution to the EEAS, European Council, European Commission, the governments and parliaments of the Republic of Armenia and Republic of Azerbaijan, Secretary General of the Council of Europe and UN Human Rights Council.”
Gurgen Margaryan
On February 19, 2004, Lieutenant of the Armenian Armed Forces Gurgen Margaryan, 26, was hacked to death, while asleep, by a fellow Azerbaijani participant, lieutenant Ramil Safarov, in Budapest during a three-month English language course in the framework of Partnership for Peace NATO-sponsored program. In accordance with Budapest District Court sentence dated April 13, 2006, Ramil Safarov was life imprisoned for murdering the Armenian officer.
On February 22, 2007, Budapest Court rejected the Azerbaijani military officer's appeal against a life sentence. The appeal court ruled that the decision brought by Budapest District Court against 30-year-old Lieutenant Ramil Safarov, should stand.
Partner news
Top stories
The Turkish government aggressively pushed for Turkey's inclusion in Investment Partnership between the U.S. and EU.
Possible ways to advance the peaceful settlement of Nagorno Karabakh conflict were in the focus of the discussion.
A meeting between Edward Nalbandian and Azerbaijani FM Elmar Mammadyarov will be held on the sidelines of the event.
Bergen began by recounting his 1997 meeting with Bin Laden in Afghanistan after a long process of negotiations.
Partner news
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:01:14.000Z
|
gqr54wjblx6b36zxpgkdgxtpxsycsdob
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36524",
"uncompressed_offset": 578810947,
"url": "www.seroundtable.com/google-title-languages-15515.html",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.seroundtable.com/google-title-languages-15515.html"
}
|
cccc_CC-MAIN-2013-20
|
Google: Title Tags Can Change Based Off Of Language/Country
Aug 2, 2012 • 8:41 am | (2) by | Filed Under Google Search Engine Optimization
This might be an obvious point to many SEOs but Pierre Far from Google clarified that if you have specific landing pages for the same product but targeting different languages/countries, you can change the title tag of the page without concern.
Pierre Far from Google posted this on Google+ saying:
In my last webmaster office hours hangout I got an interesting question: When a webmaster uses rel-alternate-hreflang annotations to mark up a cluster of equivalent pages that target different language-country combinations, can the titles be different for each country?
The answer is yes, use a title that makes sense for your users and your site.
I go more into detail about how to handle these specialized annotations over here.
Pierre Far then gives some more examples of how this applies on Google+.
Forum discussion at Google+.
Previous story: Google PageRank Update: August 2012
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:38:19.000Z
|
ewk66p7y3fnwjlronhp3scljhghzku36
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36539",
"uncompressed_offset": 652889707,
"url": "www.virology.ws/2013/01/14/petition-to-ban-intelligence-involvement-in-public-health-campaigns/",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.virology.ws/2013/01/14/petition-to-ban-intelligence-involvement-in-public-health-campaigns/"
}
|
cccc_CC-MAIN-2013-20
|
Petition to ban intelligence involvement in public health campaigns
14 January 2013
A petition has been created which asks the Obama Administration to ban intelligence involvement in public health campaigns:
We petition President Obama to amend Executive Order 12333, adding a paragraph after the prohibition on covert action related to US domestic politics. The amendment should ban persons in the intelligence community or acting on their behalf from joining or participating in any activity directly related to the provision of child public health services.
Charles Kenny of the Center for Global Development provides background on the petition.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:01:14.000Z
|
33gvqimtsajhqt5bdks4b257ktx4nzd6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36541",
"uncompressed_offset": 670090259,
"url": "www.wikidoc.org/index.php/Titanium",
"warc_date": "2013-11-22T19:24:12.000Z",
"warc_filename": "<urn:uuid:e4a8629d-84de-4339-8fd0-2dfc59d88434>",
"warc_url": "http://www.wikidoc.org/index.php/Titanium"
}
|
cccc_CC-MAIN-2013-20
|
Titanium
Jump to: navigation, search
<tr><td>Chemical series</td><td>transition metals</td></tr> <tr><td>Appearance</td><td>silvery metallic
File:Ti, 22.jpg <tr><td>Atomic radius</td><td>140pm</td></tr><tr><td>Atomic radius (calc.)</td><td>176 pm</td></tr><tr><td>Covalent radius</td><td>136 pm</td></tr> <tr><td rowspan="1" valign="top">Magnetic ordering</td><td>paramagnetic</td></tr><tr><td>Electrical resistivity</td><td>(20 °C) 0.420 µΩ·m</td></tr><tr><td>Thermal conductivity</td><td>(300 K) 21.9 W·m−1·K−1</td></tr><tr><td>Thermal expansion</td><td>(25 °C) 8.6 µm·m−1·K−1</td></tr><tr><td>Speed of sound (thin rod)</td><td>(r.t.) 5090 m·s−1</td></tr><tr><td>Young's modulus</td><td>116 GPa</td></tr><tr><td>Shear modulus</td><td>44 GPa</td></tr><tr><td>Bulk modulus</td><td>110 GPa</td></tr><tr><td>Poisson ratio</td><td>0.32</td></tr><tr><td>Mohs hardness</td><td>6.0</td></tr><tr><td>Vickers hardness</td><td>970 MPa</td></tr><tr><td>Brinell hardness</td><td>716 MPa</td></tr><tr><td>CAS registry number</td><td>7440-32-6</td></tr>
22 scandiumtitaniumvanadium
-
Ti
Zr
General
Name, symbol, number titanium, Ti, 22
Group, period, block 44, d
Standard atomic weight 47.867(1) g·mol−1
Electron configuration [Ar] 3d2 4s2
Electrons per shell 2, 8, 10, 2
Physical properties<tr><td>Phase</td><td>solid</td></tr><tr><td>Density (near r.t.)</td><td>4.506 g·cm−3</td></tr><tr><td>Liquid density at m.p.</td><td>4.11 g·cm−3</td></tr><tr><td>Melting point</td><td>1941 K
(1668 °C, 3034 °F)</td></tr><tr><td>Boiling point</td><td>3560 K
(3287 °C, 5949 °F)</td></tr><tr><td>Heat of fusion</td><td>14.15 kJ·mol−1</td></tr><tr><td>Heat of vaporization</td><td>425 kJ·mol−1</td></tr><tr><td>Heat capacity</td><td>(25 °C) 25.060 J·mol−1·K−1</td></tr>
Vapor pressure
P/Pa 1 10 100 1 k 10 k 100 k
at T/K 1982 2171 (2403) 2692 3064 3558
Atomic properties
<tr><td>Crystal structure</td><td>hexagonal</td></tr><tr><td>Oxidation states</td><td>2, 3, 4
(amphoteric oxide)</td></tr><tr><td>Electronegativity</td><td>1.54 (Pauling scale)</td></tr>
Ionization energies
(more)
1st: 658.8 kJ·mol−1
2nd: 1309.8 kJ·mol−1
3rd: 2652.5 kJ·mol−1
Miscellaneous
Selected isotopes
Main article: Isotopes of titanium
iso NA half-life DM DE (MeV) DP
44Ti syn 63 y ε - 44Sc
γ 0.07D, 0.08D -
46Ti 8.0% Ti is stable with 24 neutrons
47Ti 7.3% Ti is stable with 25 neutrons
48Ti 73.8% Ti is stable with 26 neutrons
49Ti 5.5% Ti is stable with 27 neutrons
50Ti 5.4% Ti is stable with 28 neutrons
References
This box: view talk edit
Titanium (pronounced /taɪˈteɪniəm/) is a chemical element with the symbol Ti and atomic number 22. It is a light, strong, lustrous, corrosion-resistant (including resistance to sea water and chlorine) transition metal with a grayish color. Titanium can be alloyed with other elements such as iron, aluminium, vanadium, molybdenum and others, to produce strong lightweight alloys for aerospace (jet engines, missiles, and spacecraft), military, industrial process (chemicals and petro-chemicals, desalination plants, pulp and paper), automotive, agri-food, medical (prostheses, orthopaedic implants, dental implants), sporting goods, jewelry, and other applications.[1] Titanium was discovered in England by William Gregor in 1791 and named by Martin Heinrich Klaproth for the Titans of Greek mythology.
The element occurs within a number of mineral deposits, principally rutile and ilmenite, which are widely distributed in the Earth's crust and lithosphere, and it is found in almost all living things, rocks, water bodies and soils.[1] The metal is extracted from its principal mineral ores via the Kroll process.[2], or the Hunter process. Its most common compound, titanium dioxide, is used in the manufacture of white pigments.[3] Other compounds include titanium tetrachloride (TiCl4) (used in smoke screens/skywriting and as a catalyst) and titanium trichloride (used as a catalyst in the production of polypropylene).[1]
The two most useful properties of the metal form are corrosion resistance, and the highest strength-to-weight ratio of any metal.[4] In its unalloyed condition, titanium is as strong as some steels, but 45% lighter.[5] There are two allotropic forms[6] and five naturally occurring isotopes of this element; 46Ti through 50Ti with 48Ti being the most abundant (73.8%).[7] Titanium's properties are chemically and physically similar to zirconium.
History
Titanium was discovered combined in a mineral in Cornwall, England in 1791 by amateur geologist and pastor William Gregor, the then vicar of Creed parish. He recognized the presence of a new element in ilmenite[3] when he found black sand by a stream in the nearby parish of Manaccan and noticed the sand was attracted by a magnet. Analysis of the sand determined the presence of two metal oxides; iron oxide (explaining the attraction to the magnet) and 45.25% of a white metallic oxide he could not identify.[5] Gregor, realizing that the unidentified oxide contained a metal that did not match the properties of any known element, reported his findings to the Royal Geological Society of Cornwall and in the German science journal Crell's Annalen.[8]
Around the same time, Franz Joseph Muller also produced a similar substance, but could not identify it.[3] The oxide was independently rediscovered in 1795 by German chemist Martin Heinrich Klaproth in rutile from Hungary.[9] Klaproth found that it contained a new element and named it for the Titans of Greek mythology.[8] After hearing about Gregor's earlier discovery, he obtained a sample of manaccanite and confirmed it contained titanium.
The processes required to extract titanium from its various ores are laborious and costly; it is not possible to reduce in the normal manner, by heating in the presence of carbon, because that produces titanium carbide.[8] Pure metallic titanium (99.9%) was first prepared in 1910 by Matthew A. Hunter by heating TiCl4 with sodium in a steel bomb at 700–800 °C in the Hunter process.[2] Titanium metal was not used outside the laboratory until 1946 when William Justin Kroll proved that it could be commercially produced by reducing titanium tetrachloride with magnesium in what came to be known as the Kroll process. Although research continues into more efficient and cheaper processes (FFC Cambridge, e.g.), the Kroll process is still used for commercial production.[3][2]
File:Titanium crystal bar.jpg
A titanium crystal bar made by the iodide process
Titanium of very high purity was made in small quantities when Anton Eduard van Arkel and Jan Hendrik de Boer discovered the iodide, or crystal bar, process in 1925, by reacting with iodine and decomposing the formed vapors over a hot filament to pure metal.[10]
In the 1950s and 1960s the Soviet Union pioneered the use of titanium in military and submarine applications (Alfa Class and Mike Class)[11] as part of programs related to the Cold War.[12] Starting in the early 1950s, Titanium began to be used extensively for military aviation purposes, particularly in high-performance jets, starting with aircraft such as the F100 Super Sabre and Lockheed A-12.
In the USA, the Department of Defense realized the strategic importance of the metal[13] and supported early efforts of commercialization.[14] Throughout the period of the Cold War, titanium was considered a Strategic Material by the U.S. government, and a large stockpile of titanium sponge was maintained by the Defense National Stockpile Center, which was finally depleted in 2005.[15] Today, the world's largest producer, Russian-based VSMPO-Avisma, is estimated to account for about 29% of the world market share.[16]
In 2006, the U.S. Defense Agency awarded $5.7 million to a two-company consortium to develop a new process for making titanium metal powder. Under heat and pressure, the powder can be used to create strong, lightweight items ranging from armor plating to components for the aerospace, transportation and chemical processing industries.[17]
Characteristics
Physical
A metallic element, titanium is recognized for its high strength-to-weight ratio.[6] It is a light, strong metal with low density that, when pure, is quite ductile (especially in an oxygen-free environment),[18] lustrous, and metallic-white in color. The relatively high melting point (over 1,649 °C or 3,000 °F) makes it useful as a refractory metal.
Commercial (99.2% pure) grades of titanium have ultimate tensile strength of about 63,000 psi (434 MPa), equal to that of some steel alloys, but are 45% lighter.[5] Titanium is 60% heavier than aluminium, but more than twice as strong[5] as the most commonly used 6061-T6 aluminium alloy. Certain titanium alloys (e.g., Beta C) achieve tensile strengths of over 200,000 psi (1380 MPa).[19] However, titanium loses strength when heated above 430 °C (800 °F).[5]
It is fairly hard (although not as hard as some grades of heat-treated steel) and is difficult to machine, as it will gall if sharp tools and proper cooling methods are not used. Like those made from steel, titanium structures have a fatigue limit which guarantees longevity in some applications.[20]
The metal is a dimorphic allotrope with the hexagonal alpha form changing into the body-centered cubic (lattice) beta form at 882 °C (1,619 °F).[5] The heat capacity of the alpha form increases dramatically as it is heated to this transition temperature but then falls and remains fairly constant for the beta form regardless of temperature.[5]
Chemical
The most noted chemical property of titanium is its excellent resistance to corrosion; it is almost as resistant as platinum, capable of withstanding attack by acids, moist chlorine gas, and by common salt solutions.[6] Pure titanium is not soluble in water but is soluble in concentrated acids.[21]
While the following pourbaix diagram shows that titanium is thermodynamically a very reactive metal, it is slow to react with water and air.
File:Titanium in water porbiax diagram.png
The Pourbaix diagram for titanium in pure water, perchloric acid or sodium hydroxide[22]
This metal forms a passive and protective oxide coating (leading to increased corrosion-resistance) when exposed to elevated temperatures in air, but at room temperatures it resists tarnishing.[18] When it first forms, this protective layer is only 1–2 nm thick but continues to slowly grow; reaching a thickness of 25 nm in four years.[8]
Titanium burns when heated in air 610 °C (1,130 °F) or higher, forming titanium dioxide.[6] It is also one of the few elements that burns in pure nitrogen gas (it burns at 800 °C or 1,472 °F and forms titanium nitride, which causes embrittlement).[23] Titanium is resistant to dilute sulfuric and hydrochloric acid, along with chlorine gas, chloride solutions, and most organic acids.[2] It is paramagnetic (weakly attracted to magnets) and has fairly low electrical and thermal conductivity.[18]
Experiments have shown that natural titanium becomes radioactive after it is bombarded with deuterons, emitting mainly positrons and hard gamma rays.[2] When it is red hot the metal combines with oxygen, and when it reaches 550 °C (1,022 °F) it combines with chlorine.[2] It also reacts with the other halogens and absorbs hydrogen.[3]
Occurrence
Producer Thousands of tons % of total
Australia 1291.0 30.6
South Africa 850.0 20.1
Canada 767.0 18.2
Norway 382.9 9.1
Ukraine 357.0 8.5
Other countries 573.1 13.6
Total world 4221.0 100.1
Source: 2003 production of titanium dioxide.[24]
Due to rounding, values do not sum to 100%.
Titanium is always bonded to other elements in nature. It is the ninth-most abundant element in the Earth's crust (0.63% by mass)[5] and the seventh-most abundant metal. It is present in most igneous rocks and in sediments derived from them (as well as in living things and natural bodies of water).[18][2] In fact, of the 801 types of igneous rocks analyzed by the United States Geological Survey, 784 contained titanium.[5] Its proportion in soils is approximately 0.5 to 1.5%.[5]
It is widely distributed and occurs primarily in the minerals anatase, brookite, ilmenite, perovskite, rutile, titanite (sphene), as well in many iron ores. Of these minerals, only rutile and ilmenite have any economic importance, yet even they are difficult to find in high concentrations.[3] Significant titanium-bearing ilmenite deposits exist in western Australia, Canada, New Zealand, Norway, and Ukraine. Large quantities of rutile are also mined in North America and South Africa and help contribute to the annual production of 90,000 tonnes of the metal and 4.3 million tonnes of titanium dioxide. Total known reserves of titanium are estimated to exceed 600 million tonnes.[8]
Titanium is contained in meteorites and has been detected in the sun and in M-type stars;[2] the coolest type of star with a surface temperature of 3,200 °C (5,792 °F).[8] Rocks brought back from the moon during the Apollo 17 mission are composed of 12.1% TiO2.[2] It is also found in coal ash, plants, and even the human body.
Production and fabrication
File:TitaniumUSGOV.jpg
Titanium (Mineral Concentrate)
The processing of titanium metal occurs in 4 major steps:[25] reduction of titanium ore into "sponge", a porous form; melting of sponge, or sponge plus a master alloy to form an ingot; primary fabrication, where an ingot is converted into general mill products such as billet, bar, plate, sheet, strip and tube; and secondary fabrication of finished shapes from mill products.
Because the metal reacts with oxygen at high temperatures it cannot be produced by reduction of its dioxide. Titanium metal is therefore produced commercially by the Kroll process, a complex and expensive batch process. (The relatively high market value of titanium is mainly due to its processing, which sacrifices another expensive metal, magnesium.[5]) In the Kroll process, the oxide is first converted to chloride through carbochlorination, whereby chlorine gas is passed over red-hot rutile or ilmenite in the presence of carbon to make TiCl4. This is condensed and purified by fractional distillation and then reduced with 800 °C molten magnesium in an argon atmosphere.[6]
A more recently developed method, the FFC Cambridge process,[26] may eventually replace the Kroll process. This method uses titanium dioxide powder (which is a refined form of rutile) as feedstock to make the end product which is either a powder or sponge. If mixed oxide powders are used, the product is an alloy manufactured at a much lower cost than the conventional multi-step melting process. The FFC Cambridge Process may render titanium a less rare and expensive material for the aerospace industry and the luxury goods market, and could be seen in many products currently manufactured using aluminium and specialist grades of steel.
Common titanium alloys are made by reduction. For example; cuprotitanium (rutile with copper added is reduced), ferrocarbon titanium (ilmenite reduced with coke in an electric furnace), and manganotitanium (rutile with manganese or manganese oxides) are reduced.[23]
2TiFeO3 + 7Cl2 + 6C (900 °C) → 2TiCl4 + 2FeCl3 + 6CO
TiCl4 + 2Mg (1100 °C) → 2MgCl2 + Ti
About 50 grades of titanium and titanium alloys are designated and currently used, although only a couple of dozen are readily available commercially.[27] The ASTM International recognizes 31 Grades of titanium metal and alloys, of which Grades 1 through 4 are commercially pure (unalloyed). These four are distinguished by their varying degrees of tensile strength, as a function of oxygen content, with Grade 1 being the most ductile (lowest tensile strength with an oxygen content of 0.18%), and Grade 4 the least (highest tensile strength with an oxygen content of 0.40%).[20] The remaining grades are alloys, each designed for specific purposes, be it ductility, strength, hardness, electrical resistivity, creep resistance, resistance to corrosion from specific media, or a combination thereof.[28]
The grades covered by ASTM and other alloys are also produced to meet Aerospace and Military specifications (SAE-AMS, MIL-T), ISO standards, and country-specific specifications, as well as proprietary end-user specifications for aerospace, military, medical and industrial applications.[29]
In terms of fabrication, all welding of titanium must be done in an inert atmosphere of argon or helium in order to shield it from contamination with atmospheric gases such as oxygen, nitrogen or hydrogen.[5] Contamination will cause a variety of conditions, such as embrittlement, which will reduce the integrity of the assembly welds and lead to joint failure. Commercially pure flat product (sheet, plate) can be formed readily, but processing must take into account the fact that the metal has a 'memory' and tends to spring back. This is especially true of certain high-strength alloys.[30][31] The metal can be machined using the same equipment and via the same processes as stainless steel.[5]
Applications
File:Ti covered watches.jpg
Watch with titanium cover
Titanium is used in steel as an alloying element (ferro-titanium) to reduce grain size and as a deoxidizer, and in stainless steel to reduce carbon content.[18] Titanium is often alloyed with aluminium (to refine grain size), vanadium, copper (to harden), iron, manganese, molybdenum, and with other metals.[32] Applications for titanium mill products (sheet, plate, bar, wire, forgings, castings) can be found in industrial, aerospace, recreational and emerging markets. Powdered titanium is used in pyrotechnics as a source of bright-burning particles.
Pigments, Additives and Coatings
File:Titanium(IV) oxide.jpg
Titanium dioxide is the most commonly used compound of titanium
About 95% of titanium ore extracted from the Earth is destined for refinement into titanium dioxide (TiO2), an intensely white permanent pigment used in paints, paper, toothpaste, and plastics.[33] It is also used in cement, in gemstones, as an optical opacifier in paper,[34] and a strengthening agent in graphite composite fishing rods and golf clubs.
TiO2 powder is chemically inert, resists fading in sunlight, and is very opaque: this allows it to impart a pure and brilliant white color to the brown or gray chemicals that form the majority of household plastics.[3] In nature, this compound is found in the minerals anatase, brookite, and rutile.[18] Paint made with titanium dioxide does well in severe temperatures, is somewhat self-cleaning, and stands up to marine environments.[3] Pure titanium dioxide has a very high index of refraction and an optical dispersion higher than diamond.[2]
Recently, it has been put to use in air purifiers (as a filter coating), or in film used to coat windows on buildings which when exposed to UV light (either solar or man-made) and moisture in the air produces reactive redox species like hydroxyl radicals that can purify the air or keep window surfaces clean.[35]
Aerospace and Marine
File:A380-trent900.JPG
The engines alone of the Airbus A380 use about 11 tons of titanium
Due to their high tensile strength to density ratio,[6] high corrosion resistance[2] and ability to withstand moderately high temperatures without creeping, titanium alloys are used in aircraft, armor plating, naval ships, spacecraft and missiles.[3][2] For these applications titanium alloyed with aluminum, vanadium and other elements are used for a variety of components including critical structural parts, fire walls, landing gear, exhaust ducts (helicopters) and hydraulic systems. In fact, about two thirds of all titanium metal produced is used in aircraft engines and frames.[20] The SR-71 "Blackbird" was one of the first aircraft to make extensive use of titanium within its structure, paving the way for its use in modern fighter and commercial aircraft. An estimated 58 tons are used in the Boeing 777, 43 in the 747, 18 in the 737, 24 in the Airbus A340, 17 in the A330 and 12 in the A320. The A380 may use 77 tons, including about 11 tons in the engines.[36] In engine applications, titanium is used for rotors, compressor blades, hydraulic system components and nacelles. The titanium 6AL-4V alloy accounts for almost 50% of all alloys used in aircraft applications.[37]
Due to its high corrosion resistance to sea water, titanium is used to make propeller shafts and rigging and in the heat exchangers of desalination plants;[2] in heater-chillers for salt water aquariums, fishing line and leader and for divers' knives. Titanium is used to manufacture the housings and other components of ocean-deployed surveillance and monitoring devices for scientific and military use.
Industrial
Welded titanium pipe and process equipment (heat exchangers, tanks, process vessels, valves) are used in the chemical and petrochemical industries primarily for corrosion resistance. Specific alloys are used in downhole and nickel hydrometallurgy applications due to their high strength (titanium Beta C) or corrosion resistance or combination of both. The pulp and paper industry uses titanium in process equipment exposed to corrosive media such as sodium hypochlorite or wet chlorine gas (in the bleachery).[38] Other applications include: ultrasonic welding, wave soldering,[39] and sputtering targets.[40]
Consumer and Architectural
File:GuggenheimBilbao.jpg
The Guggenheim Museum Bilbao is sheathed in titanium panels.
Titanium metal is used in automotive applications, particularly in automobile or motorcycle racing, where weight reduction is critical while maintaining high strength and rigidity. The metal is generally too expensive to make it marketable to the general consumer market, other than high end products. Late model Corvettes have been available with titanium exhausts,[41] and racing bikes are frequently outfitted with titanium mufflers. Titanium alloy is used for the connecting rods in the engine of the 2006 and later Corvette Z06. Other automotive uses include piston rods and hardware (bolts, nuts, etc.).
The Parker Pen Company used titanium to form the T-1 fountain pen, later expanded to T-1 ball pens and rollerballs. The T-1 fountain pen was introduced in 1970 and the T-1 rollerball and ball pen in 1971. Production was stopped in 1972 due to the high cost of manufacturing titanium. Parker T-1's are prized for their collectibility by collectors.
Hammer heads made of titanium were introduced in 1999. Their light weight allows for a longer handle which increases the velocity of the head and results in more energy being delivered to the nail, all while decreasing arm fatigue. Titanium also decreases the shock transferred to the user because a titanium head generates about 3% recoil compared to a steel head that generates about 27%.
Titanium is used in many sporting goods; tennis rackets, golf clubs, lacrosse stick shafts; cricket, hockey, lacrosse, and football helmet grills, and bicycle frames and components. Titanium alloys are also used in spectacle frames. This results in a rather expensive, but highly durable and long lasting frame which is light in weight and causes no skin allergies. Many backpackers use titanium equipment, including cookware, eating utensils, lanterns and tent stakes. Though slightly more expensive than traditional steel or aluminium alternatives, these titanium products can be significantly lighter without compromising strength. Titanium is also favored for use by farriers, since it is lighter and more durable than steel when formed into horseshoes. Titanium horseshoes can be found in horse racing, and are used by many Amish horse owners, who rely entirely on horse-drawn carriages for transportation. Titanium has even become somewhat popular for use in jewelry, such as rings and body piercings.
Because of its durability, titanium has become more popular for designer jewelry in recent years, whereas until recently the metal was too difficult to work into the intricate shapes with the precision necessary for fine jewelry. Today, titanium rings -- including engagement rings and wedding bands -- are one of the fastest growing segments of the titanium jewelry market, in part due to the ability of the metal to be grooved, inlaid, and carved without losing strength. Some titanium jewelry also incorporates diamonds or other gemstones, typically in close settings such as bezels, flush, or tension designs. Its inertness again makes it a good choice for those with allergies or those who will be wearing the jewelry in environments such as swimming pools.
Titanium has occasionally been used in architectural applications: the 120 foot (40 m) memorial to Yuri Gagarin, the first man to travel in space, in Moscow, is made of titanium for the metal's attractive color and association with rocketry.[42] The Guggenheim Museum Bilbao and the Cerritos Millennium Library were the first buildings in Europe and North America, respectively, to be sheathed in titanium panels. Other construction uses of titanium sheathing include the Frederic C. Hamilton Building in (Denver, Colorado).[43]
Due to its superior strength and light weight when compared to other metals traditionally used in firearms (steel, stainless steel, and aluminum), and advances in metal-working techniques, the use of titanium has become more widespread in the manufacture of firearms. Primary uses include pistol frames and revolver cylinders.
Medical
File:Hip prosthesis.jpg
A titanium hip prosthesis, with a ceramic head and polyethylene acetabular cup.
File:Lateralcephplated.JPG
This left lateral cephalametric radiograph shows a profile of the human skull. A fracture of the eye socket was repaired by stabilizing the fractured bones with small titanium plates and screws.
Because it is biocompatible (non-toxic and is not rejected by the body), titanium is used in a gamut of medical applications including surgical implements and implants, such as hip balls and sockets (joint replacement) that can stay in place for up to 20 years. Titanium has the inherent property to osseointegrate, enabling use in dental implants that can remain in place for over 30 years. This property is also useful for orthopedic implant applications.[8]
Since titanium is non-ferromagnetic, patients with titanium implants can be safely examined with magnetic resonance imaging (convenient for long-term implants). Preparing titanium for implantation in the body involves subjecting it to a high-temperature plasma arc which removes the surface atoms, exposing fresh titanium that is instantly oxidized.[8] Titanium is also used for the surgical instruments used in image-guided surgery, as well as wheelchairs, crutches, and any other product where high strength and low weight are important.
Its inertness and ability to be attractively colored makes it a popular metal for use in body piercing.[44] Titanium may be anodized to produce various colors.[45] A number of artists work with titanium to produce artworks such as sculptures, decorative objects and furniture.
Compounds
The +4 oxidation state dominates in titanium chemistry, but compounds in the +3 oxidation state are also common. Because of this high oxidation state, many titanium compounds have a high degree of covalent bonding.
Star sapphires and rubies get their asterism from the titanium dioxide impurities present in them.[8] Titanates are compounds made with titanium dioxide. Barium titanate has piezoelectric properties, thus making it possible to use it as a transducer in the interconversion of sound and electricity.[6] Esters of titanium are formed by the reaction of alcohols and titanium tetrachloride and are used to waterproof fabrics.[6]
Titanium nitride (TiN) is often used to coat cutting tools, such as drill bits. It also finds use as a gold-coloured decorative finish, and as a barrier metal in semiconductor fabrication.
Titanium tetrachloride (titanium(IV) chloride, TiCl4, sometimes called "Tickle") is a colourless liquid which is used as an intermediate in the manufacture of titanium dioxide for paint. It is widely used in organic chemistry as a Lewis acid, for example in the Mukaiyama aldol condensation. Titanium also forms a lower chloride, titanium(III) chloride (TiCl3), which is used as a reducing agent.
Titanocene dichloride is an important catalyst for carbon-carbon bond formation. Titanium isopropoxide is used for Sharpless epoxidation. Other compounds include; titanium bromide (used in metallurgy, superalloys, and high-temperature electrical wiring and coatings) and titanium carbide (found in high-temperature cutting tools and coatings).[3]
Isotopes
Main article: Isotopes of titanium
Naturally occurring titanium is composed of 5 stable isotopes; 46Ti, 47Ti, 48Ti, 49Ti and 50Ti with 48Ti being the most abundant (73.8% natural abundance). Eleven radioisotopes have been characterized, with the most stable being 44Ti with a half-life of 63 years, 45Ti with a half-life of 184.8 minutes, 51Ti with a half-life of 5.76 minutes, and 52Ti with a half-life of 1.7 minutes. All of the remaining radioactive isotopes have half-lives that are less than 33 seconds and the majority of these have half-lives that are less than half a second.[7]
The isotopes of titanium range in atomic weight from 39.99 u (40Ti) to 57.966 u (58Ti). The primary decay mode before the most abundant stable isotope, 48Ti, is electron capture and the primary mode after is beta emission. The primary decay products before 48Ti are element 21 (scandium) isotopes and the primary products after are element 23 (vanadium) isotopes.[7]
Precautions
File:Kopiva.JPG
Nettle contains up to 80 parts per million of titanium
Titanium is non-toxic even in large doses and does not play any natural role inside the human body. An estimated 0.8 milligrams of titanium is ingested by humans each day but most passes through without being absorbed. It does, however, have a tendency to bio-accumulate in tissues that contain silica. An unknown mechanism in plants may use titanium to stimulate the production of carbohydrates and encourage growth. This may explain why most plants contain about 1 part per million (ppm) of titanium, food plants have about 2 ppm and horsetail and nettle contain up to 80 ppm.[8]
As a powder or in the form of metal shavings, titanium metal poses a significant fire hazard and, when heated in air, an explosion hazard. Water and carbon dioxide-based methods to extinguish fires are ineffective on burning titanium; Class D dry powder fire fighting agents must be used instead.[3]
Even bulk titanium metal is susceptible to fire, when it is heated to its melting point. A number of titanium fires occur during breaking down devices containing titanium parts with cutting torches.
When used in the production or handling of chlorine, care must be taken to use titanium only in locations where it will not be exposed to dry chlorine gas which can result in a titanium/chlorine fire. Care must be taken even when titanium is used in wet chlorine due to possible unexpected drying brought about by extreme weather conditions.
Titanium can catch fire when a fresh, non-oxidized surface gets in contact with liquid oxygen. Such surfaces can appear when the oxidized surface is struck with a hard object, or when a mechanical strain causes the emergence of a crack. This poses the possible limitation for its use in liquid oxygen systems, such as those found in the aerospace industry.
Salts of titanium are often considered to be relatively harmless, but its chlorine compounds, such as TiCl2, TiCl3 and TiCl4, have presented several unusual hazards. The dichloride takes the form of pyrophoric black crystals, and the tetrachloride is a volatile fuming liquid. All of titanium's chlorides are corrosive.
See also
References
1. 1.0 1.1 1.2 "Titanium". Encyclopædia Britannica Concise. (2007).
2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 Titanium. Los Alamos National Laboratory (2004). Retrieved on 2006-12-29.
3. 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 Krebs, Robert E. (2006). The History and Use of Our Earth's Chemical Elements: A Reference Guide (2nd edition). Westport, CT: Greenwood Press. ISBN 0313334382.
4. Matthew J. Donachie, Jr. (1988). TITANIUM: A Technical Guide. Metals Park, OH: ASM International, p.11. ISBN 0871703092.
5. 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 Barksdale, Jelks (1968). The Encyclopedia of the Chemical Elements. Skokie, Illinois: Reinhold Book Corporation, 732-38 "Titanium". LCCCN 68-29938.
6. 6.0 6.1 6.2 6.3 6.4 6.5 6.6 6.7 "Titanium". Columbia Encyclopedia (6th edition). (2000 – 2006). New York: Columbia University Press. ISBN 0787650153.
7. 7.0 7.1 7.2 Barbalace, Kenneth L. (2006). Periodic Table of Elements: Ti - Titanium. Retrieved on 2006-12-26.
8. 8.0 8.1 8.2 8.3 8.4 8.5 8.6 8.7 8.8 8.9 Emsley, John (2001). Nature's Building Blocks: An A-Z Guide to the Elements. Oxford: Oxford University Press, pp. 451 – 53. ISBN 0-19-850341-5.
9. Origins of the Element Names: Names Derived from Mythology or Superstition
10. van Arkel, A. E.; de Boer, J. H. (1925). "Preparation of pure titanium, zirconium, hafnium, and thorium metal". Z. Anorg. Allg. Chem. 148: 345 – 50.
11. Yanko, Eugene; Omsk VTTV Arms Exhibition and Military Parade JSC (2006). Submarines: general information. Retrieved on 2006-12-26.
12. Stainless Steel World. "VSMPO Stronger Than Ever", KCI Publishing B.V., July/August 2001, pp. 16–19. Retrieved on 2007-01-02.
13. NATIONAL MATERIALS ADVISORY BOARD, Commission on Engineering and Technical Systems (CETS), National Research Council (1983). Titanium: Past, Present, and Future. Washington, DC: national Academy Press, R9. NMAB-392.
14. Titanium Metals Corporation. Answers.com. Encyclopedia of Company Histories,. Answers Corporation (2006). Retrieved on 2007-01-02.
15. Defense National Stockpile Center (2006). Strategic and Critical Materials Report to the Congress. Operations under the Strategic and Critical Materials Stock Piling Act during the Period October 2004 through September 2005. United States Department of Defense, § 3304.
16. Bush, Jason. "Boeing's Plan to Land Aeroflot", BusinessWeek, 2006-02-15. Retrieved on 2006-12-29.
17. DuPont (2006-12-09). U.S. Defense Agency Awards $5.7 Million to DuPont and MER Corporation for New Titanium Metal Powder Process. Retrieved on 2006-12-26.
18. 18.0 18.1 18.2 18.3 18.4 18.5 "Titanium". Encyclopædia Britannica. (2006). Retrieved on 2006-12-29.
19. Matthew J. Donachie, Jr. (1988). TITANIUM: A Technical Guide. Metals Park, OH: ASM International, Appendix J, Table J.2. ISBN 0871703092.
20. 20.0 20.1 20.2 Emsley, John (2001). Nature's Building Blocks: An A-Z Guide to the Elements. Oxford: Oxford University Press, 455. ISBN 0-19-850341-5.
21. Casillas, N.; Charlebois, S.; Smyrl, W. H.; White, H. S. (1994). "Pitting Corrosion of Titanium". J. Electrochem. Soc. 141 (3): 636 – 42. Abstract
22. Ignasi Puigdomenech, Hydra/Medusa Chemical Equilibrium Database and Plotting Software (2004) KTH Royal Institute of Technology, freely downloadable software at [1]
23. 23.0 23.1 "Titanium". Microsoft Encarta. (2005). Retrieved on 2006-12-29.
24. Cordellier, Serge; Didiot, Béatrice (2004). L'état du monde 2005: annuaire économique géopolitique mondial. Paris: La Découverte.
25. Matthew J. Donachie, Jr. (1988). TITANIUM: A Technical Guide. Metals Park, OH: ASM International, Chapter 4. ISBN 0871703092.
26. Chen, George Zheng; Fray, Derek J.; Farthing, Tom W. (2000). "Direct electrochemical reduction of titanium dioxide to titanium in molten calcium chloride". Nature 407: 361 – 64. doi:10.1038/35030069. Abstract
27. Matthew J. Donachie, Jr. (1988). TITANIUM: A Technical Guide. Metals Park, OH: ASM International, p.16, Appendix J. ISBN 0871703092.
28. ASTM International (2006). Annual Book of ASTM Standards (Volume 02.04: Non-ferrous Metals). West Conshohocken, PA: ASTM International, section 2. ISBN 080314086X. ASTM International (1998). Annual Book of ASTM Standards (Volume 13.01: Medical Devices; Emergency Medical Services). West Conshohocken, PA: ASTM International, sections 2 & 13. ISBN 080312452X.
29. Matthew J. Donachie, Jr. (1988). TITANIUM: A Technical Guide. Metals Park, OH: ASM International, pgs.13–16, Appendices H and J. ISBN 0871703092.
30. American Welding Society (2006). AWS G2.4/G2.4M:2007 Guide for the Fusion Welding of Titanium and Titanium Alloys. Miami: American Welding Society. Abstract
31. Titanium Metals Corporation (1997). Titanium design and fabrication handbook for industrial applications. Dallas: Titanium Metals Corporation.
32. Hampel, Clifford A. (1968). The Encyclopedia of the Chemical Elements. Van Nostrand Reinhold, p. 738. ISBN 0442155980.
33. United States Geological Survey (2006-12-21). USGS Minerals Information: Titanium. Retrieved on 2006-12-29.
34. Smook, Gary A. (2002). Handbook for Pulp & Paper Technologists (3rd edition). Angus Wilde Publications, p. 223. ISBN 0-9694628-5-9.
35. Stevens, Lisa; Lanning, John A.; Anderson, Larry G.; Jacoby, William A.; Chornet, Nicholas (June 14 – 18, 1998). "Photocatalytic Oxidation of Organic Pollutants Associated with Indoor Air Quality". Air & Waste Management Association 91st Annual Meeting & Exhibition, San Diego. Retrieved on 2006-12-26.
36. Sevan, Vardan (2006-09-23). Rosoboronexport controls titanium in Russia. Sevanco Strategic Consulting. Retrieved on 2006-12-26.
37. Matthew J. Donachie, Jr. (1988). TITANIUM: A Technical Guide. Metals Park, OH: ASM International, p.13,. ISBN 0871703092.
38. Matthew J. Donachie, Jr. (1988). TITANIUM: A Technical Guide. Metals Park, OH: ASM International, pgs. 11–16. ISBN 0871703092.
39. E.W. Kleefisch, Editor (1981). Industrial Application of Titanium and Zirconium. West Conshohocken, PA: ASTM International. ISBN 0803107455.
40. Rointan F. Bunshah, Editor (2001). Handbook of Hard Coatings. Norwich, NY: William Andrew Inc., Ch. 8. ISBN 0815514387.
41. National Corvette Museum (2006). Titanium Exhausts. Retrieved on 2006-12-26.
42. "Yuri Gagarin". Microsoft Encarta. (2006). Retrieved on 2006-12-26.
43. Denver Art Museum, Frederic C. Hamilton Building. SPG Media (2006). Retrieved on 2006-12-26.
44. Body Piercing Safety. Retrieved on 2006-12-30.
45. Alwitt, Robert S. (2002). Electrochemistry Encyclopedia. Retrieved on 2006-12-30.
External links
Look up titanium in
Wiktionary, the free dictionary.
Wikimedia Commons has media related to:
<span id="interwiki-pt-fa" /> <span id="interwiki-es-fa" />
af:Titaan ar:تيتانيوم az:Titan bn:টাইটানিয়াম be:Тытан bs:Titanijum bg:Титан (елемент) ca:Titani cs:Titan (prvek) co:Titaniu da:Titan (grundstof) de:Titan (Element) et:Titaan el:Τιτάνιοeo:Titanio eu:Titanio fa:تیتانیومfur:Titani gl:Titanio (elemento) ko:타이타늄 hy:Տիտան hi:टाइटानियम hr:Titanij io:Titanio id:Titanium is:Títan it:Titanio he:טיטניום sw:Titani ht:Titàn ku:Tîtanyûm la:Titanium lv:Titāns lb:Titan (Element) lt:Titanas jbo:jinmrtitani hu:Titán (elem) ml:ടൈറ്റാനിയം mr:टायटॅनियम nl:Titaniumno:Titan (grunnstoff) nn:Grunnstoffet titan oc:Titani uz:Titan (unsur) nds:Titan (Element)qu:Titanyuscn:Titaniu simple:Titanium sk:Titán sl:Titan (element) sr:Титанијум sh:Titanij fi:Titaani sv:Titan (grundämne) ta:டைட்டேனியம் th:ไทเทเนียมuk:Титан (хімічний елемент) yi:טיטאניום
Navigation WikiDoc | WikiPatient | Popular pages | Recently Edited Pages | Recently Added Pictures
Table of Contents In Alphabetical Order | By Individual Diseases | Signs and Symptoms | Physical Examination | Lab Tests | Drugs
Editor Tools Become an Editor | Editors Help Menu | Create a Page | Edit a Page | Upload a Picture or File | Printable version | Permanent link | Maintain Pages | What Pages Link Here
There is no pharmaceutical or device industry support for this site and we need your viewer supported Donations | Editorial Board | Governance | Licensing | Disclaimers | Avoid Plagiarism | Policies
Personal tools
Namespaces
Variants
Actions
Navigation
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:34:12.000Z
|
imre4thycqg4h6r2cyacjjoxmw4b32ej
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36548",
"uncompressed_offset": 3066922,
"url": "abs.gov.au/AUSSTATS/abs%40.nsf/ProductsbyReleaseDate/2B66716C2F9C7308CA25722E001C48F4",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://abs.gov.au/AUSSTATS/abs@.nsf/ProductsbyReleaseDate/2B66716C2F9C7308CA25722E001C48F4?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
8731.4 - Building Approvals, South Australia, Sep 1996
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 31/10/1996
Page tools: Print Page Print All RSS Search this Product
• About this Release
Monthly; ISSN:0810-4743; Number of dwelling units and value of residential buildings (houses and other residential) approved for private and public sectors, value of alterations and additions to residential buildings and value of non-residential building by class of building (eg. hotels, offices, etc.) approved. Value of building approved at average 1989-90 prices and seasonally adjusted and trend estimates of number of dwelling units approved. Includes some information for selected statistical local areas and number and value of houses approved by material of outer walls.
This publication has been converted from older electronic formats and does not necessarily have the same appearance and functionality as later releases.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:18:34.000Z
|
4hbgvrpjnmlkc44nf265abrhdrvuctnd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36549",
"uncompressed_offset": 3073967,
"url": "abs.gov.au/AUSSTATS/abs%40.nsf/ProductsbyReleaseDate/E535DD2F2CFBE42CCA2571D50017A1A4",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://abs.gov.au/AUSSTATS/abs@.nsf/ProductsbyReleaseDate/E535DD2F2CFBE42CCA2571D50017A1A4?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
7106.0 - Australian Farming in Brief, 2005
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 29/08/2005
Page tools: Print Page Print All RSS Search this Product
• About this Release
ABOUT THIS RELEASE
Summary information about agriculture and related statistics, e.g. land use; number and type of farm businesses; estimated value of agricultural operations; livestock numbers; production of crops, fruit, vegetables, meat, other livestock products; gross value of agricultural commodities produced; value of exports; and area of pastures and crops irrigated.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:49:00.000Z
|
gfxo23iaets5vqpinlmtquqofzioi6nd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36550",
"uncompressed_offset": 3080864,
"url": "abs.gov.au/ausstats/abs%40.nsf/ViewContent?Action=Expand&Num=1.7&view=DirClassManualsbyTopic",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://abs.gov.au/ausstats/abs@.nsf/ViewContent?readform&view=DirClassManualsbyTopic&Action=Expand&Num=1.7"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Methods & Standards > Directories Classifications and Manuals by Topic
Directories Classifications and Manuals by Topic
National Income
Earnings
Gross Domestic Product (GDP)
National Profits
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:39:03.000Z
|
b2g6axdosu2t2vek34occjmctesehmr7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36551",
"uncompressed_offset": 3086935,
"url": "abs.gov.au/websitedbs/censushome.nsf/home/CO-06?navpos=620",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://abs.gov.au/websitedbs/censushome.nsf/home/CO-06?opendocument&navpos=620"
}
|
cccc_CC-MAIN-2013-20
|
Census Area Supervisors - 3,500 job opportunities
10 February 2011 | CO/06
Would you like to combine your passion for the community with a part-time job that helps everyone in Australia?
If the answer is yes, then the Australian Bureau of Statistics has a Census job for you.
In every corner of Australia, 3,500 Area Supervisors are needed to help oversee the distribution and collection of approximately 14.2 million Census forms to Australia’s 9.8 million households.
Head of the Population Census program Paul Lowe says Area Supervisors are crucial to the success of the Census and ensuring that everyone in Australia is accurately counted.
"Area Supervisors make an enormous difference to the quality and accuracy of the data that we produce from the Census.”
“Collecting accurate data to assist with planning decisions has never been more important, particularly in areas across Australia where flood waters have damaged communities,” Mr Lowe added.
Area Supervisors will receive between $4,300 and $7,500 for the part-time position and will be employed from 18 April until 7 October.
More information is available online at www.abs.gov.au/census
Key Census dates:
• February 2011 – Recruitment of Area Supervisors begins.
• 2 - 4 March 2011 – Census ‘Beyond the Count’ conference.
• Early April 2011 – Recruitment of Census Collectors begins.
• 28 July 2011 – eCensus opens to the public.
• 9 August 2011 – Census night.
• 10 August – Early September 2011 – Collection of Census forms.
• June 2012 – The first results from the 2011 Census will be released.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:18:47.000Z
|
nkyzxv4ogc466zn4gdvfh3wyusufg6xa
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36571",
"uncompressed_offset": 26671628,
"url": "blog.mozilla.org/metrics/2009/07/13/does-mozilla-champion-the-voice-of-firefox-users/",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://blog.mozilla.org/metrics/2009/07/13/does-mozilla-champion-the-voice-of-firefox-users/"
}
|
cccc_CC-MAIN-2013-20
|
Does Mozilla Champion the Voice of Firefox Users?
Ken Kovash
7
While presenting at and attending the eMetrics conference a couple months back, I noticed one concept heavily emphasized by several presenters — “Voice of the Customer.” Several leaders within the analytics world were able to show how they’ve transformed their organizations and industries by allowing “Voice of the Customer” to drive most actions and decision making across their respective enterprises.
Mozilla has traditionally been very much in-tune with the temperature and feelings of its users, much more so than I’ve seen at other organizations. However, we’ve sometimes noticed our own blind spots, and over the past year or so, we’ve been working to get on top of our “Voice of the User.”
What do I mean by “Voice of the User”?
Every day, across many avenues, tens of thousands of Firefox users describe a pain point they’ve encountered or comment about their experience with Firefox or make a suggestion. The sum of all of these voices constitutes what I’m referring to as “Voice of the User”. To provide more specificity, here is a list of some channels through which Firefox users are speaking to us every day:
This list is not fully exhaustive, but it provides a good overview for how we can think about “Voice of the User” at a high-level.
So, what strides have we made in the past year? And where do we go from here? First, let’s look at some of the ground we’ve covered so far (this is in no way meant to capture everything):
• Uninstall Surveydata was analyzed for the first time, a new version was launched, and the current data is now more accessible and usable
• Firefox Support — understands its role in quickly discovering emerging issues affecting users and escalating them, and more work is currently being done along these lines
• Installer Survey — was conceived and launched
• Major Update Survey — was conceived and launched (details coming soon!)
• Report Broken Web Site — we’ll be publishing the first breakdown and analysis of Reporter data this summer
• Bugzilla – there’s a current project underway aimed at answering some key analytical questions related to Bugzilla and providing folks with a bunch more information (e.g., bug burn down rate by product, issues by status and product, average days to resolution by priority and product, open vs close trend by product, etc.)
• Customer Satisfaction Survey – was conceived and launched
• Social media – we’ve started looking at tools allowing us to synthesize user feedback and comments
But we’re not done yet. We have more work ahead of us and I’m sure we’ll come across more stones unturned.
Taking a step back from all the specific examples just highlighted, how do you think we should be approaching “Voice of the User” more generally? How can we optimally stay on top of feedback from Firefox users on a daily basis, considering that that feedback comes from a wide range of channels and that it numbers in the tens of thousands (daily)? Are there broad organizational/community structures or strategies that can help us, i.e., structure/routines/culture that can transform the “Voice of the User” into decisions and actions?
(images from www.journalist.co.uk)
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:02:10.000Z
|
c4f7gojnejjt24p5xcp6ryw4tlczkwco
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36587",
"uncompressed_offset": 65508812,
"url": "dotnetkicks.com/tags/VEMapStyle",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://dotnetkicks.com/tags/VEMapStyle"
}
|
cccc_CC-MAIN-2013-20
|
Error!
Success!
By tag: VEMapStyle
showing: of
0
kicks
Virtual Earth: Convert Road Map Style to Shaded Like maps.live.com (Unpublished)
If you've used maps.live.com and Virtual Earth, then you've probably noticed that the Road map style in the Virtual Earth API isn't the same as it is on maps.live.com. This is because the Road map style on maps.live.com is actually not using the VEMapStyle.Road map style, but instead is using VEMapS...
Kicked By:
Drop Kicked By:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:45:12.000Z
|
g5ngztqnjgfmjn2xpo2ijoep3cxdza3p
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36588",
"uncompressed_offset": 68715216,
"url": "dungeons.wikia.com/wiki/SRD:Sleep_Effect?oldid=15530",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://dungeons.wikia.com/wiki/SRD:Sleep_Effect?oldid=15530"
}
|
cccc_CC-MAIN-2013-20
|
Wikia
SRD:Sleep Effect
Talk0
9,503pages on
this wiki
Revision as of 23:14, August 11, 2009 by Surgo (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Sleep Effect
Back to Main PageSystem Reference DocumentCombat
Advertisement | Your ad here
Photos
Add a Photo
1,231photos on this wiki
See all photos >
Recent Wiki Activity
See more >
Around Wikia's network
Random Wiki
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:49:21.000Z
|
wmewz2xy3vxh2cghojuqu2x3w7cjpatz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36596",
"uncompressed_offset": 80588617,
"url": "familysearch.org/learn/wiki/en/index.php?oldid=1195521&title=New_Jersey_Online_Collections",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://familysearch.org/learn/wiki/en/index.php?title=New_Jersey_Online_Collections&oldid=1195521"
}
|
cccc_CC-MAIN-2013-20
|
New Jersey Online Genealogy RecordsEdit This Page
From FamilySearch Wiki
Revision as of 12:29, 15 December 2012 by DiltsGD (Talk | contribs)
United States New Jersey Online Collections
New Jersey Statewide Online Databases
This is collection of links to New Jersey statewide databases.
Many of these links will be repeated on county pages.
Vital Records
Births
Marriages
Deaths
Biographies
Court Records
Immigration Records
Land Records
Military Records
Revolutionary War
Civil War
World War I
World War II
Other Military Records
Naturalization Records
Newspapers
Obituaries
Probate Records
State Census
Tax Records
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:19:54.000Z
|
tpzr7j6qw7utxuktbb55ixgjfvm6uznk
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36612",
"uncompressed_offset": 94616643,
"url": "genomebiology.com/2002/3/12/research/0081/abstract",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://genomebiology.com/2002/3/12/research/0081/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Software
An integrated computational pipeline and database to support whole-genome sequence annotation
CJ Mungall1*, S Misra2,3, BP Berman2, J Carlson4, E Frise4, N Harris3,4, B Marshall2, S Shu2,3, JS Kaminker2,3, SE Prochnik2,3, CD Smith2,3, E Smith2,3, JL Tupy2,3, C Wiel2,3, GM Rubin1,2,3,4 and SE Lewis2,3
Author Affiliations
1 Howard Hughes Medical Institute, University of California, Berkeley, CA 94720, USA
2 Department of Molecular and Cellular Biology, Life Sciences Addition, University of California, Berkeley, CA 94720-3200, USA
3 FlyBase-Berkeley, University of California, Berkeley, CA 94720-3200, USA
4 Genome Sciences Department, Lawrence Berkeley National Laboratory, One Cyclotron Road, Berkeley, CA 94720, USA
For all author emails, please log on.
Genome Biology 2002, 3:research0081-0081.11 doi:10.1186/gb-2002-3-12-research0081
This article is part of a series of refereed research articles from Berkeley Drosophila Genome Project, FlyBase and colleagues, describing Release 3 of the Drosophila genome, which are freely available at http://genomebiology.com/drosophila/.
Published: 23 December 2002
Abstract
We describe here our experience in annotating the Drosophila melanogaster genome sequence, in the course of which we developed several new open-source software tools and a database schema to support large-scale genome annotation. We have developed these into an integrated and reusable software system for whole-genome annotation. The key contributions to overall annotation quality are the marshalling of high-quality sequences for alignments and the design of a system with an adaptable and expandable flexible architecture.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:01:33.000Z
|
3v4h3n4tvth5bckk5u4hnfxb7rtvryvj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36623",
"uncompressed_offset": 102668843,
"url": "hitchwiki.org/en/Sch%C3%BCttorf",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://hitchwiki.org/en/Sch%C3%BCttorf"
}
|
cccc_CC-MAIN-2013-20
|
Schüttorf
From Hitchwiki
Jump to: navigation, search
Schüttorf
Information
Country: Germany
State: Lower Saxony
Population: 11,584
Licence Plate: NOH
Motorways: A30, A31
More Info:
Schüttorf is a small city in the outer South West of the German federal state Lower Saxony.
It's has a quite nice city center and it's nearby Bad Bentheim, where you can find the Burg Bentheim (castle). The city is located at the highways A30 and A31, which could be a good spot for hitching all directions into Germany and the Netherlands.
The city is also popular for the Index discotheque.
Hitchhiking out
West towards Bad Bentheim
From the train station, walk west for around 500 meter. Then you're already at the end of the city. Try to wave your thumb there. If you are too lazy to walk to the end of town, you can also give it a try directly at the train station. Walk down the 20m to the road, there you find a big bus bay where you can try to hitch a ride. Some traffic might go only some meters, so best is to make a sign saying Bad Bentheim.
West towards Oldenzaal, Hengelo or Amsterdam
Go towards the K&K parking lot by the Nordhorner Straße and stand beyond there with your sign. Most traffic headed on the A30 west from Schüttorf will actually use the Bad Bentheim ramp (3) and not the Schüttorf one (4). If someone is not going to Oldenzaal or further, they could at least drop you off at the ramp there.
Walking Out
West towards Bad Bentheim
Hitching from here to Bad Bentheim might be faster, but still, it's only 4 kilometres which can be walked in 45 minutes from Annaheim to Bentheimer Hof. Hitching Schüttorf to Bad Bentheim should only be considered when you're short in time or when the weather is nasty, or if you're a local and are well familiar with what the area has to offer the eye. If you're passing through, and have enough time, you should really consider spending an hour or two here. From Schüttorf railway station, go to Annaheim (old sanatorium, now used as a care home) and enter the forest there. Just follow the path, go straight ahead and it'll lead you right into the kurort. walk around here, and take the surfaced path right. Also, it's possible to take a left after "Am Waldbauern" (just over halfway from Annaheim) and cross the railway track and road. In front of is the Bentheimer Berg, made completely out of Bentheimer Sandstone, which has been used to construct most important buildings in the region, including almost all really important buildings in the Netherlands. Take a walk along the crags; if you're travelling west to Amsterdam it'll be the last of this you'll see. If you're in a car somewhere getting into Bad Bentheim, you can always ask your driver to drop you off near "Freilichtbühne" and walk around a bit there.
East towards Salzbergen
Try thumbing a car down. All is industry and farmland.
Trivia
Two Algerians, who gave Platschi a ride in November 2008, opened a new pizza restaurant the same day in Schüttorf. It's called Annaba, named after the 4th largest city in Algeria. Give them a visit if you might travel through this town once in a lifetime.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:20:02.000Z
|
tc4fho6blepukn2buovsz4gwfu55ug67
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36637",
"uncompressed_offset": 130853875,
"url": "linuxgamingnews.org/tag/undead-lily/",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://linuxgamingnews.org/tag/undead-lily/"
}
|
cccc_CC-MAIN-2013-20
|
Undead Lily Techdemo Released !
Posted on 14th June 2011 in Uncategorized
Undead Lily and the Elemental Avengers from Winter Wolves is not a usual visual novel . Instead it aims to be a 2D tag-team-fighting game something similar to the online game “Kongai“. There will be a story with different romance outcomes and will also have action-RPG and light strategy gameplay elements. There will be 12 [...]
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:59:18.000Z
|
wrqtw7ngn7f6eupumxcsftq27oyoygk5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36658",
"uncompressed_offset": 157721054,
"url": "newsgrist.typepad.com/underbelly/2009/07/some-ebooks-are-more-equal.html",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://newsgrist.typepad.com/underbelly/2009/07/some-ebooks-are-more-equal.html"
}
|
cccc_CC-MAIN-2013-20
|
Become a Fan
Twitter Updates
follow me on Twitter
CC License
Fair Use
Network
• blognetworks
Join NEWSgrist on Facebook
• Facebook
Blog powered by TypePad
Member since 04/2004
« Closings (UES) 113 | Main | Garden Gnome Opens Wound »
July 18, 2009
TrackBack
TrackBack URL for this entry:
http://www.typepad.com/services/trackback/6a00d8341c66f153ef01157121983c970c
Listed below are links to weblogs that reference Some E-Books Are Created More Equal...:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:20:31.000Z
|
poq62yarqhtbvniaer6wn552mgf4pak2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36660",
"uncompressed_offset": 166299255,
"url": "openwetware.org/index.php?oldid=8691&title=Site-directed_mutagenesis",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://openwetware.org/index.php?title=Site-directed_mutagenesis&oldid=8691"
}
|
cccc_CC-MAIN-2013-20
|
Site-directed mutagenesis
From OpenWetWare
Revision as of 21:16, 13 November 2005 by Nandita (Talk | contribs)
Jump to: navigation, search
Contents
General Information
Site-directed mutagenesis can be used to change particular base pairs in a piece of DNA. There are a number of methods for achieving this. The approach described here is adapted from the Stratagene site-directed mutagenesis kit, the manual can be found here. Even when using a kit it will be necessary to design primers that are suitable for the specific changes you want to make to your DNA. Most of the contents of the kit can be found in your favorite labs stocks so you may not need to buy the kit itself. If you have problems with this procedure, you can try 'Round-the-horn site-directed mutagenesis which uses PCR to amplify the desired mutant product.
General Procedure
1. Purify template plasmid DNA from a dam+ Escherichia coli strain (to ensure that all GATC sites are methylated for later digestion with DpnI).
2. Design forward and reverse primers that will bind to the region of DNA you want to mutate but that contain the modifications you wish to make.
3. Run a primer-extension reaction with a proof-reading, non-displacing polymerase such as PFU DNA polymerase. This results in nicked circular strands of the plasmid.
4. Cut up the template DNA with DpnI.
5. Transform the circular nicked DNA into a highly competent strain such as XL1-Blue. These cells will repair the nicks and not restrict the unmodified product DNA.
6. Select colonies with the correct DNA.
Specific Protocols
Notes
• This protocol is at a very early stage of development. Any contributions welcome!
• Although the manual recommends only 12 cycles for point mutations, I usually do more (at least 18 cycles). --Reshma 05:28, 14 Jul 2005 (EDT)
• I disagree here, further rounds of the reaction favor end-filling instead of primer extension on the template. This is not PCR! You need to primer extend on the original template each time. As the primers become depleted, the polymerase will find other things to extend. Smoore 18:52, 14 Sep 2005 (EDT)
• I tried using this protocol to do an insertion/deletion and I believe it failed suggesting that point mutations are easier to accomplish than insertions/deletions. --Reshma 05:28, 14 Jul 2005 (EDT)
• Leon Chan suggested that attempting to modify three consecutive bases is difficult. He suggested using 4-5 more cycles than recommended by Stratagene.
• See my 'Round-the-horn site-directed mutagenesis protocol to get around these limitations. Smoore 18:52, 14 Sep 2005 (EDT)
• Leon also recommended letting the DpnI digestion run for 2-3 hours.
• Doing a PNK step on the primers should boost efficiency.
• It is not necessary to use XL1-Blue cells. Any highly competent cells should be ok.
• Stratagene recommends trying various concentrations of template DNA in the PCR step.
• It IS NOT PCR people!Smoore 18:52, 14 Sep 2005 (EDT)
• I've had great luck with 'Overlap Extension PCR which uses a two-step PCR method to introduce substitutions as long as 7 - 8bp at a time. - Nandita
References
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:26:51.000Z
|
5my7rwanhsuwd2bwzfiujtmcvykdyqlx
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36676",
"uncompressed_offset": 182571737,
"url": "quotationsbook.com/quote/8391/",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://quotationsbook.com/quote/8391/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
When a thing ceases to be a subject of controversy, it ceases to be a subject of interest. Hazlitt, William
This quote is about controversy · Search on Google Books to find all references and sources for this quotation.
A bit about Hazlitt, William ...
William Hazlitt (10 April 1778 - 18 September 1830) was an English writer remembered for his humanistic essays and literary criticism, often esteemed the greatest English literary critic after Samuel Johnson. Indeed, Hazlitt's writings and remarks on Shakespeare's plays and characters are rivaled only by those of Johnson in their depth, insight, originality, and imagination.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:39:48.000Z
|
h7i2bkudxjzg4tdaqwzgjswqnylipju2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36677",
"uncompressed_offset": 182578184,
"url": "quotationsbook.com/quote/gift/1070/",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://quotationsbook.com/quote/gift/1070/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
Trouble is the common denominator of living. It is the great equalizer. Landers, Ann
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:30:04.000Z
|
esktcdq7kicdgzunddodvfl4q6absom3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36678",
"uncompressed_offset": 182583684,
"url": "quotationsbook.com/quote/gift/22868/",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://quotationsbook.com/quote/gift/22868/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
A leader has the vision and conviction that a dream can be achieved. He inspires the power and energy to get it done. Lauren, Ralph
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:55:05.000Z
|
yupwo2xhxigijs222eforwtkuygjtpsq
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36679",
"uncompressed_offset": 182589211,
"url": "quotationsbook.com/quote/gift/32056/",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://quotationsbook.com/quote/gift/32056/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
Prediction is very difficult, especially about the future. Bohr, Niels
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:38:18.000Z
|
34etnesz65c3jxbthwfbbu743fp25a3u
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36681",
"uncompressed_offset": 185005788,
"url": "redsarmy.com/2010/09/01/delonte-west-apartment-hunting-in-waltham/",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://redsarmy.com/2010/09/01/delonte-west-apartment-hunting-in-waltham/"
}
|
cccc_CC-MAIN-2013-20
|
The Salvation Of Delonte West
Jay September 1, 2010 Uncategorized Comments Off
First came the random texts into the 98.5 The Sports Hub radio show. Next came the 128-bit encrypted email to Redsarmy.com's inbox (which rumor has it, that John needed to hire the same hacker that framed Carmelo Anthony to decipher it). Next came the report from the Boston Herald's Inside Track about the infamous Delonte West supposedly doing some apartment hunting in Waltham. Giddy-up ladies and gentlemen, Delonte has returned to the 617.
The Celtics are truly intending on bringing him back for another go-around in green and it's a potentially a huge coup for Danny Ainge. Strictly speaking on basketball terms this is a proverbial no-brainer, especially if the deal is a rumored 1-year non-guaranteed minimum. Delonte has plenty of basketball skills, there is no debating that. He's a respectable outside shooter (44.7% FG, 32.5% 3PT career), an excellent free throw shooter (81.8% career) and gives you a little bit of everything else (10 points, 4 assists, 3 rebounds 1 steal, career). He gives an above average effort of defense and without question hustles hard, almost too hard, which has caused some nagging injuries.
Unfortunately anything involving Mr. West (as in James West, Will Smith's character from the awful film: Wild, Wild, West) includes some hefty baggage. By now we've all been aware of the madness surrounding Delonte. The stories are so surreal that even Hollywood turned down the script for Delonte movie, citing them as "too unrealistic." Go ahead and make jokes about Delonte and Gloria James, it's too easy. Have at it with the heat packing motorcycle rides he could be potentially taking up and down Storrow Drive. For Delonte's sake, this team could be more than his ticket to a championship. It could be his path towards his own salvation.
Danny Ainge and THIS Celtics organization do their homework. Ainge has never shied away from such madness. He's scoffed at the thought of Stephon Marbury infecting the locker room with his oddities. He traded solid veterans Eric Williams and Tony Battie for Ricky (that's spelled "R-I-C-K-I-I") Davis once upon a time. He acquired another gun-wielding guard, Sebatian Telfair, seemingly without hesitation. Tempting the destiny of that 2008 championship team (as well as a developing Rajon Rondo's psyche as a young and stubborn point guard) he brought in another loudmouthed veteran in Sam Cassell.
Ainge isn't afraid. He's brought on the one-time dominant LA Laker, Shaquille O'Neal to help solidify the Celtics front line while the incumbent starter, Kendrick Perkins "earns his starting role back." He brought the brain trust and the Big Three with him to Detroit to convince the brash Rasheed Wallace of all people to join them for one more run, even though Sheed had one foot in the proverbial retirement grave.
At the end of the day don't be surprised one bit that Ainge filled that final roster spot with a veteran's minimum deal for Delonte West. In fact, this may be the team best suited for Delonte both on and off the court. Sure he'd be fighting for minutes with Nate Robinson. But if you were counting on seeing Avery Bradley in green more often than Maine Red Claw red, then you're mistaken.
This group of veterans may be just what Delonte needs to get his life back on track. Several players throughout NBA history have lost their way only to be blackballed from the league. Guys like Roy Tarpley, Smush Parker, Craig Hodges, Mahmoud Abdul-Rauf, Rashad McCants and Michael Ray Richardson come to mind. But Delonte has a chance to change the path he's on, much like Chris Andersen of the Denver Nuggets did.
More importantly, Doc Rivers may be the most qualified basketball person to help guide him. Doc always loves to tell people that "Doc" is just a nickname. In my opinion however, now that Ainge has brought Delonte back to the green, then Doc will certainly earn an honorary green PHD in psychiatry and sports management. It's not easy massaging all of those egos and diverse personalities on the Celtics, and Doc has been exceptional at it. He will certainly pass his basketball dissertation if he can make it all work this year. Especially if he can guide this team to banner 18, along with the redemption of Delonte West.
Like this Article? Share it!
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:02:43.000Z
|
lsmlclr3kswi7uftqq4lm7iryiu2ujss
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36684",
"uncompressed_offset": 188361735,
"url": "robots.net/article/1074.html",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://robots.net/article/1074.html"
}
|
cccc_CC-MAIN-2013-20
|
Cyborg Geologists Take the Red Pill
Posted 12 Jan 2004 at 21:19 UTC by steve
A new research paper (PDF format) suggests that astrobiologists and geologists should work in a virtual world that extends their senses rather than using traditional approaches. The paper presents the argument using the Matrix films as an analogy. As an example, they offer the idea of a human with ViA wearable computer equipment that interfaces via neural network software to the vision system of a Mars probe. (the software is named, appropriately, the Neural EditOr or NEO). The human and the computer each provide the types of image processing they're good at resulting in some interesting views. See the Cyborg Astrobiologist project website for more information.
Telepresence, posted 12 Jan 2004 at 21:33 UTC by earlwb » (Master)
Telepresence, It's really neat, but....there is a 6-7 minute wait for a light speed signal to reach Mars, then you have a 6-7 minute wait for the light speed signal to return (or is it 6-7 minutes round trip total?).
Unless someone gets quantum twin particle communications going it's going to be hard to get a decent interactive speed going there from Earth with something on Mars that is real time.
I personally would go insane trying to telepresence a robot on Mars from Earth at those time delay speeds for everything you want to do.
Too much fiction, not enough science, posted 13 Jan 2004 at 07:35 UTC by motters » (Master)
Oh dear. Don't get me wrong, I like sci-fi movies. But to me a computer science paper should be about computer science, not just a promotion for a piece if fiction. Quoting scenes from sci-fi films and including many hollywood images in a science paper just makes me feel queasy.
See more of the latest robot news!
Recent blogs
18 May 2013 Flanneltron (Journeyer)
17 May 2013 mwaibel (Master)
14 May 2013 steve (Master)
13 May 2013 JLaplace (Observer)
10 May 2013 AI4U (Observer)
21 Apr 2013 Pi Robot (Master)
12 Apr 2013 Pontifier (Apprentice)
31 Mar 2013 svo (Master)
16 Mar 2013 gidesa (Journeyer)
12 Mar 2013 ixisuprflyixi (Master)
X
Share this page
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:49:00.000Z
|
bdr2ba5ypiq7giowsim4ztblb3lehaz4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36706",
"uncompressed_offset": 217710298,
"url": "talk.maemo.org/showthread.php?p=1237102",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://talk.maemo.org/showthread.php?p=1237102"
}
|
cccc_CC-MAIN-2013-20
|
Thread Tools Search this Thread
Posts: 139 | Thanked: 131 times | Joined on Jul 2010
#11
Well, obviously it is "worth it" if that's what you, as the successful bidder, have committed to paying for it. It's a good price, if that's what you're asking, I paid £135 for a decent second hand one a few months ago.
Of course, it is what it is... they offer to include a compatible charger but they don't warrant that it'll be a 1200mA Nokia AC-10X, the photo shows a UK keyboard, but the listing doesn't guarantee that it's a UK model. Yo also have no guarantee you won't get hit for customs charges and VAT on it, as it's a commercial purchase from abroad, worth over £18.
Whether it's "worth it" is subjective, I bought my first N900 from Vodafone on contract, and my spare one, second hand, from someone else who'd done the same. I personally only regard the hassle of importing as worth it for items that are small enough to drop through the letter box, cheap enough that they legally don't attract VAT and duty (that means below £18, in the UK). and inconsequential enough that if it screws up I'll chalk it up to experience rather than expect to send the item back.
But, you've bought it, and you've bought it at a good price for what it claims to be. If if turns out not to be, well that's a risk that you've chosen to take.
The Following 2 Users Say Thank You to magick777 For This Useful Post:
Posts: 131 | Thanked: 78 times | Joined on Dec 2010
#12
I have a brand new boxed N900 which i think im gonna put on ebay soon, any ideas what sort of reserve i should put on it?? I would be gutted if it went for a low price!
Posts: 139 | Thanked: 131 times | Joined on Jul 2010
#13
That's anybody's guess; you could try searching completed listings (needs you to be logged in) for an idea of the prices at which they're successfully selling.
Off the top of my head - and this is a few months old - there were many "barely used" at £150-£160 buy it now - which I was trying to avoid paying - and I jumped at £135 for one with a credible seller and a credible month's usage. I don't know what current prices are, but I suspect that you'll easily get £150 for it, but you'll struggle for £200. My advice would be try a Buy It Now at about £180 and be prepared to reduce to £150 if it doesn't sell. You'll probably get less at auction.
Posts: 12 | Thanked: 8 times | Joined on Jan 2011
#14
I bought my n900 from that same guy and it was refurbished, but he always tries to sell them as new.
I have bought 3 cellphones from him, 2 of them I am sure were refurbished, 1 of them is hard to know.
Thread Tools Search this Thread
Search this Thread:
Advanced Search
Forum Jump
All times are GMT -4. The time now is 04:49 AM.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:19:59.000Z
|
audczmqa6k63yfbtngbb5kgzsoophgph
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36729",
"uncompressed_offset": 244320935,
"url": "wiki.osgeo.org/index.php?action=history&title=Benchmarking_2010%2FConstellation-SDI",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://wiki.osgeo.org/index.php?title=Benchmarking_2010/Constellation-SDI&action=history"
}
|
cccc_CC-MAIN-2013-20
|
Revision history of "Benchmarking 2010/Constellation-SDI"
From OSGeo Wiki
Jump to: navigation, search
Diff selection: mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:25:25.000Z
|
eorz3itqdfleugyjd7bzyfly6xm3uuir
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36730",
"uncompressed_offset": 244574451,
"url": "wikitravel.org/en/Karratha",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://wikitravel.org/en/Karratha"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Karratha
From Wikitravel
Jump to: navigation, search
Karratha is a city in the Pilbara region of Western Australia.
[edit] Get in
[edit] By plane
Karratha airport (KTA) is located between Karratha and Dampier.
• Qantas, Skywest and Virgin Australia all fly to Perth
There is a coffee shop/bar in the terminal building.
[edit] Get around
[edit][add listing] See
[edit][add listing] Do
[edit][add listing] Buy
[edit][add listing] Eat
[edit][add listing] Drink
[edit][add listing] Sleep
• All Seasons Karratha, 1079 Searipple Rd (in the centre of town), +61 8 9185 1155 (, fax: +61 8 9185 4325), [1]. Featuring 60 rooms, with an outdoor pool, BBQ area and a bistro providing pleasant al fresco dining. Also features two bars, a bottle shop and a conference room. The hotel room rate includes free continental breakfast and 15 minutes free Internet access. A$180-250. edit
• Karratha International Hotel, Corner of Hillview and Millstream Roads, Karratha, WA, 6714, + 61 (0)8 9187 3333, [2]. 4 star hotel offering a high standard of accommodation, dining conferences and functions. It s located close to the business, shopping and entertainment centre. edit
[edit] Contact
[edit] Get out
This article is an outline and needs more content. It has a template, but there is not enough information present. Please plunge forward and help it grow!
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:00:33.000Z
|
yeynigyuh3xftnoqg2h5dooachboaezh
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36731",
"uncompressed_offset": 244584730,
"url": "wikitravel.org/en/Special:Contributions/Virginabenite",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://wikitravel.org/en/Special:Contributions/Virginabenite"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
User contributions
Jump to: navigation, search
This user is currently blocked. The latest block log entry is provided below for reference:
• 15:08, 6 February 2013 OVK (Talk | contribs) changed block settings for Virginabenite (Talk | contribs) with an expiry time of indefinite (account creation disabled, autoblock disabled) (Spambot: Spambot: Spambot)
View full log
Search for contributions
No changes were found matching these criteria.
Personal tools
Namespaces
Variants
Views
Actions
Navigation
feeds
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:49:20.000Z
|
gqi7253l5uwy5poo3sktqclnlkw6qcu6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36737",
"uncompressed_offset": 254208126,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Latestproducts/8BCB5E36C067660DCA25720A007D3EE3",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Latestproducts/8BCB5E36C067660DCA25720A007D3EE3?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
2901.0 - Census Dictionary, 2006 (Reissue)
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 17/11/2006 Reissue
Page tools: Print Page RSS Search this Product
Contents >> Glossary >> Overseas-born
Overseas-born
For the Census, people are classified as Overseas-born if:
• they were born in a country other than Australia; or
• they were born at sea; or
• their response was classified 'Inadequately described'; or
• their response was classified 'Not elsewhere classified'.
Australia is defined in the Standard Australian Classification of Countries (SACC). It includes the states and territories and the other territories of Christmas Island, Cocos (Keeling) Islands and Jervis Bay Territory, but excludes Norfolk Island and the other Australian external territories (Australian Antarctic Territory, Heard and McDonald Islands, Ashmore and Cartier Islands and the Coral Sea Territory).
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:36:01.000Z
|
swxkdohmtl4tmxnkccj46rwuan4acrsv
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36738",
"uncompressed_offset": 254215005,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/ProductsbyReleaseDate/709A5191B19BDE82CA257099008327D1",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/ProductsbyReleaseDate/709A5191B19BDE82CA257099008327D1?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
8752.5 - Building Activity, Western Australia, Mar 2003
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 31/07/2003
Page tools: Print Page Print All RSS Search this Product
• About this Release
ABOUT THIS RELEASE
Presents number of dwelling units and value of residential buildings (new houses and new other residential); value of alterations and additions to residential buildings and value of non-residential building by class of building (e.g. hotels, offices, etc.), for private and public sectors; stage of construction (commenced, under construction, completed); value of work done during the reference period, and value of work yet to be done. Seasonally adjusted series show number of dwelling units commenced and completed and value of work done. Also includes value of work commenced and work done in chain volume measures, with the reference year being the year prior to the latest complete financial year.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:00:49.000Z
|
4p4rrrw7lx5t5nizgpishh3j3iw2ern2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36739",
"uncompressed_offset": 254222038,
"url": "www.abs.gov.au/Ausstats/abs%40.nsf/Previousproducts/9FE74D44738727EACA256C3200241685",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.abs.gov.au/Ausstats/abs@.nsf/Previousproducts/9FE74D44738727EACA256C3200241685?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1384.6 - Statistics - Tasmania, 2005
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 13/09/2002
Page tools: Print Page Print All RSS Search this Product
Contents >> Fishing >> Wild fisheries >> Rock lobster >> Management of the rock lobster fishery
In 1998 the Tasmanian Government introduced a quota management system. The maximum amount of rock lobster that can be landed by commercial fishers annually is determined by the total allowable catch (TAC). The TAC for 2002 is 1,523 tonnes.
Other restrictions include the number of pots that can be used by a vessel, minimum size limits and closed seasons to protect spawning females.
Fishers are also required to report their activities by telephone and document their catch.
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:46:55.000Z
|
onrydwpciayfrccc54qj526yndm5tp7l
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36740",
"uncompressed_offset": 254229014,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/Latestproducts/4822.0.55.001Main%20Features99992004-05?issue=2004-05&prodno=4822.0.55.001&tabname=Summary",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/Latestproducts/4822.0.55.001Main%20Features99992004-05?opendocument&tabname=Summary&prodno=4822.0.55.001&issue=2004-05&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
4822.0.55.001 - Cancer in Australia: A Snapshot, 2004-05
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 22/08/2006
Page tools: Print Page Print All RSS Search this Product
This publication provides a brief overview of the incidence of the types of cancer suffered, prevalence and other characteristics, cancer screening practices, trends in morbidity and mortality in Australia. Data regarding persons living outside hospitals, nursing and convalescent homes and hospices in Australia are provided from the 2004-05 National Health Survey, while other data is provided from both ABS and other sources.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:47:12.000Z
|
yeignzwygpmisxxu6oo7mstg4op3hvyy
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36741",
"uncompressed_offset": 254235952,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/webpages/Current%2BIssue%2BNot%2BYet%2BReleased",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/webpages/Current+Issue+Not+Yet+Released?OpenDocument&6291.0.55.003"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home
Current Issue Not Yet Released
The publication that you have requested has not yet been released, but will be available shortly.
Here is a link to the previous issue: http://www.abs.gov.au/ausstats/abs@.nsf/mf/6291.0.55.003?OpenDocument
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:18:40.000Z
|
f4vqoqc4pouvy2ab57j6rmkdg5l3we2w
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36749",
"uncompressed_offset": 294438489,
"url": "www.biomedcentral.com/1471-2458/12/371/citation",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.biomedcentral.com/1471-2458/12/371/citation"
}
|
cccc_CC-MAIN-2013-20
|
Download references
Feasibility and effectiveness of a targeted diabetes prevention program for 18 to 60-year-old South Asian migrants: design and methods of the DH!AAN study
Everlina MA Vlaar*, Irene GM van Valkengoed, Vera Nierkens, Mary Nicolaou, Barend JC Middelkoop and Karien Stronks
BMC Public Health 2012, 12:371 doi:10.1186/1471-2458-12-371
Include
Format
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:39:09.000Z
|
xoe3hwfdluppu6khuwdpev7tlvezkoxz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36750",
"uncompressed_offset": 295887004,
"url": "www.bizsugar.com/OnlineMarketing/new-google-adwords-keyword-matching-behaviour-to-roll-out-in-mid-may-/",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.bizsugar.com/OnlineMarketing/new-google-adwords-keyword-matching-behaviour-to-roll-out-in-mid-may-/"
}
|
cccc_CC-MAIN-2013-20
|
Many end users tend to misspell or add plural variations on a keyword or phrase when they search for products or services especially if they have longer search queries. Due to this, many seasoned AdWords advertisers made it a point that whenever they create a keyword list, they include mismatch spellings, stemming, singular or plural forms and other variants of a keyword or phrase to ensure that their target market will be able to find them.
Subscribe
Welcome to Martin Zwilling: Contributor of the Week!
We always love the opportunity to salute BizSugar contributors who have helped to enrich the community. And … More
Editor's Picks
Got small business blog posts? Register and submit them today!
Add BizSugar buttons and plugins to your small biz toolkit!
See if you're one of our Top 10 Members this week!
Shazam! Meet Contributor of the Week Paul Cox...Congrats, Paul!
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:39:00.000Z
|
e6glf2jtutb53oze5itenrtri4s5c6ju
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36767",
"uncompressed_offset": 353924302,
"url": "www.diagnosticpathology.org/content/2/1/36?fmt_view=classic",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.diagnosticpathology.org/content/2/1/36?fmt_view=classic"
}
|
cccc_CC-MAIN-2013-20
|
Research
Immunohistochemical diagnosis of abdominal and lymph node tuberculosis by detecting Mycobacterium tuberculosis complex specific antigen MPT64
Manju R Purohit1,2,3, Tehmina Mustafa1,4*, Harald G Wiker4,5, Odd Mørkve1,6 and Lisbet Sviland1,2
Author Affiliations
1 Centre for International Health, University of Bergen, Bergen, Norway
2 Department of Pathology, Haukeland University Hospital, Bergen, Norway
3 Department of Pathology, R.D. Gardi Medical College, Ujjain, India
4 Section for Microbiology and Immunology, The Gade Institute, University of Bergen, Norway
5 Department of Microbiology and Immunology, Haukeland University Hospital, Bergen, Norway
6 Department of Thoracic Medicine, Haukeland University Hospital, Bergen, Norway
For all author emails, please log on.
Diagnostic Pathology 2007, 2:36 doi:10.1186/1746-1596-2-36
The electronic version of this article is the complete one and can be found online at: http://www.diagnosticpathology.org/content/2/1/36
Received:7 June 2007
Accepted:25 September 2007
Published:25 September 2007
© 2007 Purohit et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
The aim of this study was to evaluate the diagnostic potential of immunohistochemistry using an antibody to the secreted mycobacterial antigen MPT64, in abdominal and lymph node tuberculosis.
Methods
We used formalin-fixed histologically diagnosed abdominal tuberculosis (n = 33) and cervical tuberculous lymphadenitis (n = 120) biopsies. These were investigated using a combination of Ziehl-Neelsen method, culture, immunohistochemistry with an antibody to MPT64, a specific antigen for Mycobacterium tuberculosis complex organisms. Abdominal and cervical lymph node biopsies from non-mycobacterial diseases (n = 50) were similarly tested as negative controls. Immunohistochemistry with commercially available anti-BCG and nested PCR for IS6110 were done for comparison. Nested PCR was positive in 86.3% cases and the results of all the tests were compared using nested PCR as the gold standard.
Results
In lymph node biopsies, immunohistochemistry with anti-MPT64 was positive in 96 (80%) cases and 4 (12.5%) controls and with anti-BCG 92 (76.6%), and 9 (28%) respectively. The results for cases and controls in abdominal biopsies were 25 (75.7%) and 2 (11.1%) for anti-MPT64 and 25 (75.7%) and 4 (22%) for anti-BCG. The overall sensitivity, specificity, positive and negative predictive values of immunohistochemistry with anti-MPT64 was 92%, 97%, 98%, and 85%, respectively while the corresponding values for anti-BCG were 88%, 85%, 92%, and 78%.
Conclusion
Immunohistochemistry using anti-MPT64 is a simple and sensitive technique for establishing an early and specific diagnosis of M. tuberculosis infection and one that can easily be incorporated into routine histopathology laboratories.
Background
Extra-pulmonary tuberculosis (EPTB) accounts for approximately 10–15% of all tuberculosis infections and occurs in up to 50% of patients with human immunodeficiency virus (HIV)-tuberculosis co-infection [1-3]. The annual incidence rates of EPTB have increased not only in developing countries but globally over the last few years [1,2,4].
The diagnosis of EPTB has always been problematical. Clinically, the disease presents in protean ways and histological examination is usually required for the diagnosis. Due to overlap of the histological features with other granulomatous conditions, the diagnosis of tuberculosis is dependent on the demonstration of acid fast bacilli (AFB) by Ziehl-Neelsen (ZN) staining. The yield of this method is limited however, in paucibacillary EPTB [5-7] and fresh unfixed tissue with live bacilli is usually not available for culture. Moreover, culture takes several weeks and is often negative in EPTB. There is therefore, a great need for a better diagnostic test to provide an alternative to AFB microscopy and culture.
While, Mycobacterium tuberculosis is the most common causative agent of EPTB, the prevalence of non-tuberculous mycobacteria is increasing with or without HIV infection and ranges from 3.8 to 50% in different parts of world [7-9]. As treatment is different for the two conditions, it is important to make a definitive diagnosis. However, in areas of the world where the disease is endemic, less than half receives an accurate diagnosis leading to inappropriate empirical treatment [10-12].
Detection of mycobacterial antigens by immunohistochemistry (IHC) using polyclonal and monoclonal antibodies is an alternative to conventional acid-fast staining. A large number of different mycobacterial antigens including BCG, lipoarabinomannan [5,13-17] have been detected with varying results in tissues. These are all common mycobacterial antigens and thus cannot discriminate M. tuberculosis from non-tuberculous mycobacteria. However, in a pilot study, we have recently described the high sensitivity and specificity of an in-house rabbit polyclonal antibody in biopsies from patients with tuberculous lymphadenitis to detect a secretory mycobacterial antigen, MPT64, which is present only in M. tuberculosis complex [14,18].
The present study was undertaken to further evaluate the diagnostic potential of immunohistochemial staining to detect MPT64 using a larger sample size from a different population and including other sites. Formalin fixed paraffin embedded biopsies from patients with abdominal tuberculosis and tuberculous lympadenitis were examined and the performance of anti-MPT64 was compared with the commercially available anti-BCG.
Methods
Histologically diagnosed abdominal tuberculosis (n = 33) and cervical tuberculous lymphadenitis (n = 120) biopsies were obtained from the Department of Pathology, Ujjain Hospital, Ujjain, India between July 2004 to March 2006. The diagnostic categories included in the study for cases and controls are shown in table 1. Control biopsies were obtained from the Ujjain Hospital, and also the Department of Pathology, Haukeland University Hospital, Bergen, Norway. Two pulmonary tuberculosis biopsy specimens from the archive with numerous AFB on ZN staining were used as known positive control when required.
Table 1. Diagnostic categories of specimens tested.
Biopsies from patients with pulmonary tuberculosis, on corticosteroids, immunosuppressive therapy were excluded from the study. Detailed clinical history and examination results were obtained either from the clinical records or from the patients. The majority of lymphadenitis patients presented with a neck mass, while abdominal tuberculosis was mainly associated with abdominal pain. Informed written consent was obtained and the patients were ensured of confidentiality. Ethical approval was obtained from the Institutional ethical committee at Ujjain Hospital and the regional ethical committees in both Norway and India. All the patients were tested for HIV.
Culture, ZN staining & Histopathology
One-half of the fresh biopsy specimens were submitted for mycobacterial culture on Lowenstein-Jensen egg media. The other half of the biopsy was fixed by 4% phosphate buffered formaldehyde for conventional paraffin embedding followed by routine haematoxylin and eosin and ZN stain to detect AFB. ZN staining was performed by heat carbol fuchsin method.
For histopathology, the sections were examined for the presence of granulomas and subdivided into two groups for analysis. Well-organized granulomas were characterized by a central group of epitheloid histiocytes, Langhan's giant cells, a mantle of lymphocytes and fibrous tissue. Poorly-organized granulomas showed a diffuse mixture of lymphocytes, histiocytes, and plasma cells with occasional giant cells. Each granuloma was also analyzed for the presence or absence of necrosis. The number of granulomas per sections, their type of organization and presence of necrosis was noted.
Immunohistochemistry
IHC was performed using the DakoCytomation kit (EnVision + System-HRP; DakoCytomation Denmark A/S, Glostrup, Denmark). Tissue sections were deparaffinized, hydrated, and after microwave antigen retrieval, the endogenous peroxidase activity was inhibited by incubating the sections with hydrogen peroxide for 8 minutes. The slides were then treated with primary antibodies – (i) anti-BCG, (DAKO, Hamburg, Germany) at 1/5000 dilution for 1 hour after treating sections with 3% bovine serum albumin for 3 minutes, (ii) in-house absorbed polyclonal anti-MPT64 antibody at 1/250 dilution for 1 hour. Optimal dilutions were determined prior to these experiments. Sections were incubated with anti-rabbit dextran polymer conjugated to horseradish peroxidase for 45 minutes (30 minutes for anti-BCG). Antigen was visualized with 3-amino-9-ethylcarbazol- and hydrogen peroxide containing substrate and counter-stained with haematoxylin. All incubations were carried out at room temperature and the sections were thoroughly washed in-between incubations. In every experiment, one positive control and two negative controls were included. In one negative control primary antibody was substituted with antibody diluent and the other was with an irrelevant rabbit polyclonal antibody.
Mycobacterial antigen load was evaluated by counting the stained cells with light microscopy using a 40× ocular fitted with a 10 × 10 mm graticule and by evaluation of the staining intensity. For each section, three granulomas were selected for analysis. The number of stained epitheloid cells, stained giant cells and the total number of nucleated cells were counted for each granuloma and the results were presented as percentage of stained cells. The intensity of staining of section was evaluated separately and categorized as weak, moderate, and strong staining based on subjective assessment.
Nested Polymerase Chain Reaction for IS6110
Five to six, 8 μm sections from each paraffin embedded tissue blocks were collected in sample preparation tubes for nested PCR. Carry-over tissue contamination was prevented by cleaning the blade with 96% ethanol after sectioning each sample; negative controls were sectioned first, followed by test blocks and positive control blocks.
DNA extraction and nested PCR on paraffin sections were performed as described previously [14]. Briefly, following proteinase K digestion, bacterial genomic DNA was eluted in water using a MagAttract DNA mini M48 Kit (Qiagen, West Sussex, UK) on Biorobot M48 (Qiagen). A 123-base pair fragment from IS6110 was amplified using the following primers 5' CCTGCGAGCGTAGGCGTCGG 3' and 5' CTCGTCCAGCGCCGCTTCGG 3'. The product was subjected to a second round of PCR amplification using the primers 5' TTCGGACCACCAGCACCTAA 3' and 5' TCGGTGACAAAGGCCACGTA 3' to amplify a 92-base pair fragment. The PCR reaction mixture consisted of 5 μl eluted DNA, 25 μl of HotStarTaq master mix (Qiagen), 0.25 μl of each 100 μM primer stock solution, distilled water to make a final volume of 50 μl. For nested PCR, 1 μl of the first PCR product was used as template. The reaction cycle for the first PCR was – 94°C for 1 minute, 68°C for 1 minute, 72°C for 20 seconds for 45 cycles and for the nested PCR – 94°C for 1 minute, 58°C for 1 minute, 72°C for 20 seconds for 35 cycles. Both PCR's had an initial heat activation step of 95°C for 15 minutes and a final extension of 72°C for 10 minutes. The amplified product was analyzed in a 3% agarose gel stained with ethidium bromide. Mycobacterial DNA, and positive PCR product were included as positive controls and an extraction control (with all the steps but without any tissue), a reaction tube with substitution of distilled water for the test template and a sample which previously yielded negative result on PCR were included as negative control in each PCR run.
Data Analysis
Data entry and analysis was done using SPSS 12.0 for Windows. Pearsons chi-square test was used to determine the significance among categorical variables. Non-parametric tests were used for two-group comparisons. Differences were considered statistically significant if p ≤ 0.05. The diagnostic indices were calculated by decision matrix comparison.
Results
A total of 203 biopsy specimens were studied. All the patients were negative for HIV.
Acid-Fast Bacilli microscopy and Culture (table 2)
Table 2. Positive results of different diagnostic procedure on cervical lymph nodes and abdominal biopsies.
Acid fast bacilli were detected by ZN staining of abdominal and lymph node biopsies in 0/33 (0%) and 14/120 (11.7%) specimens respectively. Mycobacterium was isolated on culture from 4/33 (12.1%) and 27/117 (23%) specimens of abdominal and lymph node cases respectively. Culture results were not available from 3 cases and 24 controls. None of the control biopsies showed positive result for either of the tests.
Histopathology
Both well-organized and poorly-organized granulomas were observed in biopsies from abdominal and lymph node cases. In abdominal tuberculosis, all the mesenteric lymph nodes showed well-organized necrotic granulomas and in intestinal wall, necrotic granulomas were seen in 58% of the cases while other cases had non-necrotic granulomas with or without fibrosis.
Lymph nodes showed typical well-organized granulomas in 70% of cases, mixed in 18% and poorly-organized in 12% of cases. Ninety percent of cases showed necrosis, however, both necrotic and non-necrotic granulomas were often seen in the same section.
Immunohistochemistry
IHC with anti-MPT64 was positive in 14 (73.7%), 7 (77.7%) and 4 (80%) cases from intestinal wall, peritoneum, and mesenteric lymph node respectively and 2 (11%) controls. Similarly, the corresponding results for anti-BCG were 15 (78.9%), 6 (66%), 4 (80%) respectively for cases and 4 (22%) for controls (Table 2). In lymph node biopsies, IHC with anti-MPT64 was positive in 96 (80%) cases and 4 (12.5%) controls whereas anti-BCG was positive in 92 (76.6%) cases, and 9 (28.1%) controls.
A comparison of the two antibodies looking at percentage of stained cells, and intensity of staining in relation to necrosis and organization of granulomas is shown in table 3 and figures 1 and 2. In the well-organized granulomas, the percentage of stained cells (p = 0·04) and the intensity of staining (+2 or +3; p = 0.001) was significantly higher for anti-MPT64 than anti-BCG. No significant difference of staining percentage or intensity was detected between the two antibodies in poorly-organized granulomas. In non-necrotic granuloma the percentage of positive cells (p = 0.02) and the intensity of staining (p = 0.03) was significantly higher with anti-MPT64 than with anti-BCG. In the necrotic granulomas, the intensity of staining with anti-MPT64 was higher but there was no significant difference between the percentages of stained cells between the two antibodies.
Table 3. Intensity of immunohistochemical staining by two antibodies in relation to granuloma features.
Figure 1. A: Percentage of stained cells by two antibodies in relation to organization of granuloma. B: Percentage of stained cells by two antibodies in relation to necrosis in granuloma.
Figure 2. Immunohistochemical staining in abdominal tuberculosis. A-C : Staining by anti-BCG in granuloma in intestinal wall, D-F : staining by anti-MPT64 in granuloma in intestinal wall. The area in square is magnified in subsequent sections, G : staining by anti-BCG in granuloma in peritoneum, H : diffuse staining of giant cells in peritoneum by anti-BCG, I : same giant cell as shown in H showing strong, granular staining with anti-MPT64.
The location and pattern of expression of the two antibodies varied. Staining with anti-MPT64 was seen mainly in the inflammatory cells. The necrotic centres were generally negative, except in 8% of necrotic granulomas where occasional but strong signals were detected. Staining pattern was predominantly granular with anti-MPT64. With anti-BCG, positive signals were detected both in the necrotic centre and in inflammatory cells in all the necrotic granulomas. Unlike anti-MPT64, the staining pattern with anti-BCG was predominantly diffuse (fig. 2, 3).
Figure 3. Immunohistocheminal staining of lymph node tuberculosis. A : Staining by anti-BCG in organized granuloma. The central necrotic area is also showing staining, B : staining by anti-BCG in poorly organized granuloma. There is diffuse staining with background staining, C : The diffuse and weak staining of giant cell by anti-BCG, D : staining by anti-MPT64 in organized granuloma. The central necrotic area is not showing staining, E : staining by anti-MPT64 in poorly organized granuloma. There is granular staining in clear background, F : The strong and granular staining of giant cell by anti-MPT64.
The performance of the two antibodies in giant cells was assessed separately. Unlike the epithelioid cells, there was no significant difference in the percentage of giant cells stained with either of the antibodies. However, the intensity of staining for anti-BCG in the giant cells was weak compared to anti-MPT64 (fig. 2C, 2F).
Polymerase Chain Reaction
The results of IS6110 PCR assay is shown in table 2. Overall PCR assay positivity was 132/153(86.6%) in histologcally diagnosed tuberculosis cases. Among these, eight cases were positive after the first PCR amplification while the majority (n = 124) were positive on nested PCR only. Cases which were positive with first PCR run had higher percentage of anti-MPT64 stained cells. All the positive controls were positive on both first PCR run and nested PCR.
Comparison and validation of the result of various tests
The results of various tests were compared using nested PCR as the gold standard. All ZN and culture positive cases were positive for anti-MPT64, anti-BCG and PCR while ZN was positive in only 14 culture positive cases. With IHC using anti-MPT64 and anti-BCG positive results were found in125 and 120 specimens respectively with a sensitivity of more than 85% by both antibodies (table 4). Of 67 PCR negative cases, anti-MPT64 and anti-BCG were negative in 65 and 57 respectively, thus giving a specificity of 93% for anti-MPT64 and 88% for anti-BCG (table 4). Overall comparison showed significant differences in the sensitivity of IHC compared with sensitivity of ZN staining and culture (p =< 0.001). No significant difference was found in the specificity of IHC when compared with the other tests. The proportion agreement between PCR and anti-MPT64 was 93% (kappa-0.85).
Table 4. Diagnostic validation of different tests using nested PCR as gold standard (all values are in percentage).
Comparison between Cervical Lymph Node and Abdominal Tissue Samples for various tests
In tuberculous lymphadenitis the sensitivity of ZN staining (13%) and culture (25%) was higher than in abdominal tuberculosis (0% and 12.5% respectively). The sensitivity of IHC with both the antibodies was high and there was no significant difference between cervical tuberculous lymph nodes and different sites of abdominal tuberculosis. The specificity of anti-BCG was, however, 60% in intestinal wall compared to 86% and 92.3% in cervical lymph nodes and mesenteric lymph nodes respectively. In contrast, specificity with MPT64 was very high and was found to be 100% in intestinal wall and mesenteric lymph nodes and 98% in cervical lymph nodes (table 4).
Discussion
There have been several reports describing the use of IHC in the diagnosis of tuberculosis (14). However, in this study we show that using an antigen against the secretory mycobacterial antigen MPT64, it is possible to achieve consistently high sensitivity (89-93%) and specificity (95-98%) with IHC on different types of tissues. The strength of this technology is that it is robust, readily available in routine surgical pathology laboratories and can detect fragmented tubercle bacilli [19]. Compared with ZN staining that has a sensitivity of 10–45% [19] and requires an intact cell wall this technique offers a major improvement in diagnostic potential and should be suited for the diagnosis of pauci-bacillary EPTB. IHC for tuberculosis has, however, been slow to catch on as a routine diagnostic method in histopathology laboratories probably due to the lack of a specific anti-mycobacterial antibody suitable for all types of tissue [5,14,16] and hence the exact diagnostic role of IHC for M. tuberculosis has to be assessed in appropriate control groups and with appropriate antisera in endemic areas. Our large study is the first to show that IHC with an antibody to MPT64 is sufficiently robust to establish etiological diagnosis of M. tuberculosis complex infection in different types of tissues of EPTB.
Our results show that IHC with anti-MPT64 has better specificity, sensitivity, and predictive values than anti-BCG (table 4). This was particularly clear in intestinal wall tuberculosis, where anti-MPT64 showed a 100% specificity compared with 60% for anti-BCG (table 3). Anti-MPT64 antibodies also gave sharp and strong signals with clear background compared with anti-BCG antibodies making interpretation easier and permitting a more confident diagnosis of M. tuberculosis complex organism. Lower specificity with anti-BCG could be due to cross-reactivity with other infectious organisms as described earlier [20-22].
The sensitivity of anti-MPT64 is also very high but not very different from anti-BCG. The amplification method used in IHC improves the recognition of positive fragments. The few false negatives could be caused by the length of formalin fixation prior to processing which is known to reduce sensitivity[23]. Another explanation for the false negative results may be that the number of mycobacteria present is below the sensitivity level of IHC (about 5 × 105 to 1 × 106 organisms per gram tissue) and the lesions are exuberant inflammatory responses to a minimal number of organisms[24].
Four of the negative controls were positive with both PCR and IHC with both antibodies. Among these were two lymph node samples with histological changes of non-specific lymphadenitis that may represent early or latent tuberculosis infection. According to Goel et al [25], early tuberculous lesions may not be identified by histopathology because the formation of granulomas and emergence of the classical histopathological tuberculous picture may be a late phenomenon. They suggest that such cases might represent the transition between the incubation and development of disease[25]. Perhaps, in some cases, our IHC method can play a role in the early diagnosis of tuberculosis when histological examination fails to provide a diagnosis. The high prevalence of tuberculosis together with parasitic infection is well known in tuberculosis endemic countries. One of our controls with intestinal parasite turned out positive with IHC and PCR [26] and may well be a case of tuberculosis. It is difficult to explain the positive results of both tests on foreign body granulomas from Norway, however, as suggested by Mustafa et al, the possibility of latent infection cannot be ruled out [14].
In endemic countries, the majority of granulomatous lesions without necrosis are considered to be tuberculosis but this may not be the case in the developed world. Interestingly, when we looked specifically for the bacilli in the different zones of the granuloma they were more frequently detected by anti-MPT64 in the epitheloid cells than in the necrotic area. Using anti-BCG antibodies antigens were also detected in necrotic area. We also found that the percentage of stained cells was higher in non-necrotic granulomas than in necrotic granuloma with anti-MPT64 compared to anti-BCG with clearer and stronger signals. Hence, non-necrotic granulomatous lesion staining with MPT64 will support a diagnosis of tuberculosis.
Ideally, culture should be used as gold standard when comparing diagnostic test performance in tuberculosis. This investigation is, however, associated with low sensitivity especially in EPTB and as in our series, the corresponding results from controls are usually not available [27]. Histopathology remains one of the most important methods for diagnosing tuberculosis, however; it cannot differentiate changes caused by M. tuberculosis, non-tuberculous mycobacteria or other granulomatous diseases. We used nested PCR as the reference for comparison. In recent years, the sensitivity and specificity of PCR for diagnosis of tuberculosis has been well documented and is in the range of 60–98% in reported series where PCR was compared with culture as gold standard [28,29]. Our results also showed strong association between PCR and culture with all culture positive samples also being PCR positive. While PCR is increasingly used in the detection of mycobacteria from the tissue sample, the cost of the instruments and reagents, sensitivity to contamination and technical demand limits its use in developing countries [30].
Conclusion
We have shown that IHC with an antibody to MPT64, a secreted antigen specific to the M. tuberculosis complex, is a specific and sensitive technique for diagnosis of EPTB. It is a cheap, robust and rapid method that can be used in a routine laboratory to provide a result in one working day and ensures the early institution of therapy. Being specific, anti-MPT64 would be of value in differentiating M. tuberculosis from other organisms, especially non-tuberculous mycobacteria, and other granulomatous inflammations.
Competing interests
The author(s) declare that they have no competing interests.
Authors' contributions
MRP, TM and LS designed the study, drafted the manuscript, and were also involved in the subject enrolment. MRP performed the experiments and data acquisition and analysis. All authors contributed, read and approved the final draft.
Acknowledgements
We are grateful to Dr V.K. Mahadik, Director of R.D. Gardi Medical College for his encouragement and support during this work. We are thankful to all laboratory technicians of Ujjain hospital for their support in data collection and Gerd Lillian Hallseth and Randi L. Nygaard for technical guidance. We gratefully acknowledge Prof. Laurence Albert Bindoff for his constructive comments and language correction. State Education Loan Fund, Norway and Helse-Vest and Norwegian trusts for research-funding funded this study.
References
1. Small PM, Schecter GF, Goodman PC, Sande MA, Chaisson RE, Hopewell PC: Treatment of tuberculosis in patients with advanced human immunodeficiency virus infection.
N Engl J Med 1991, 324(5):289-294. PubMed Abstract
2. Clark RA, Blakley SL, Greer D, Smith MH, Brandon W, Wisniewski TL: Hematogenous dissemination of Mycobacterium tuberculosis in patients with AIDS.
Rev Infect Dis 1991, 13(6):1089-1092. PubMed Abstract
3. Seibert AF, Haynes J Jr., Middleton R, Bass JB Jr.: Tuberculous pleural effusion. Twenty-year experience.
Chest 1991, 99(4):883-886. PubMed Abstract | Publisher Full Text
4. Galkin VB, Iagafarova RK, Khokkanen VM, Grashchenkova OV: [Epidemiological and clinical aspects of extrapulmonary tuberculosis in North-Western Russia].
Probl Tuberk 1998, 36-38. PubMed Abstract
5. Ulrichs T, Lefmann M, Reich M, Morawietz L, Roth A, Brinkmann V, Kosmiadi GA, Seiler P, Aichele P, Hahn H, Krenn V, Gobel UB, Kaufmann SH: Modified immunohistological staining allows detection of Ziehl-Neelsen-negative Mycobacterium tuberculosis organisms and their precise localization in human tissue.
J Pathol 2005, 205(5):633-640. PubMed Abstract | Publisher Full Text
6. Perkins MD, Roscigno G, Zumla A: Progress towards improved tuberculosis diagnostics for developing countries.
Lancet 2006, 367(9514):942-943. PubMed Abstract | Publisher Full Text
7. Mfinanga SG, Morkve O, Kazwala RR, Cleaveland S, Sharp MJ, Kunda J, Nilsen R: Mycobacterial adenitis: role of Mycobacterium bovis, non-tuberculous mycobacteria, HIV infection, and risk factors in Arusha, Tanzania.
East Afr Med J 2004, 81(4):171-178. PubMed Abstract
8. Jindal N, Devi B, Aggarwal A: Mycobacterial cervical lymphadenitis in childhood.
Indian J Med Sci 2003, 57(1):12-15. PubMed Abstract | Publisher Full Text
9. Evans MJ, Smith NM, Thornton CM, Youngson GG, Gray ES: Atypical mycobacterial lymphadenitis in childhood--a clinicopathological study of 17 cases.
J Clin Pathol 1998, 51(12):925-927. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
10. Mfinanga SG, Morkve O, Sviland L, Kazwala RR, Chande H, Nilsen R: Patient knowledge, practices and challenges to health care system in early diagnosis of mycobacterial adenitis.
East Afr Med J 2005, 82(4):173-180. PubMed Abstract
11. Aggarwal P, Wali JP, Singh S, Handa R, Wig N, Biswas A: A clinico-bacteriological study of peripheral tuberculous lymphadenitis.
J Assoc Physicians India 2001, 49:808-812. PubMed Abstract
12. Udwadia ZF: Controlling tuberculosis in India.
N Engl J Med 2003, 348(8):758-9; author reply 758-9. PubMed Abstract | Publisher Full Text
13. Furak J, Trojan I, Szoke T, Tiszlavicz L, Boda K, Balogh A, Roth E: [Histological and immunohistochemical structure of pulmonary tuberculotic granulomas in untreated cases and cases treated with antitubercular drugs].
Orv Hetil 2003, 144(27):1347-1352. PubMed Abstract
14. Mustafa T, Wiker HG, Mfinanga SG, Morkve O, Sviland L: Immunohistochemistry using a Mycobacterium tuberculosis complex specific antibody for improved diagnosis of tuberculous lymphadenitis.
Mod Pathol 2006, 19(12):1606-1614. PubMed Abstract | Publisher Full Text
15. Mustafa T, Phyu S, Nilsen R, Jonsson R, Bjune G: A mouse model for slowly progressive primary tuberculosis.
Scand J Immunol 1999, 50(2):127-136. PubMed Abstract | Publisher Full Text
16. Sumi MG, Mathai A, Reuben S, Sarada C, Radhakrishnan VV: Immunocytochemical method for early laboratory diagnosis of tuberculous meningitis.
Clin Diagn Lab Immunol 2002, 9(2):344-347. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
17. Barbolini G, Bisetti A, Colizzi V, Damiani G, Migaldi M, Vismara D: Immunohistologic analysis of mycobacterial antigens by monoclonal antibodies in tuberculosis and mycobacteriosis.
Hum Pathol 1989, 20(11):1078-1083. PubMed Abstract | Publisher Full Text
18. Nagai S, Wiker HG, Harboe M, Kinomoto M: Isolation and partial characterization of major protein antigens in the culture fluid of Mycobacterium tuberculosis.
Infect Immun 1991, 59(1):372-382. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
19. Gutierrez CMM Garcia M, J,F: Comparison of Ziehl-Neelsen staining and immunohistochemistry for detection of Mycobacterium bovis in bovine and caprine tuberculosis lesions.
J Comp Pathol 1993, 109: 361-370. PubMed Abstract
20. Arrese JE, Pierard GE: Immunostaining of various micro-organisms by a polyclonal anti-Mycobacterium bovis antibody.
J Am Acad Dermatol 1998, 39(5 Pt 1):810. PubMed Abstract | Publisher Full Text
21. Kutzner H, Argenyi ZB, Requena L, Rutten A, Hugel H: A new application of BCG antibody for rapid screening of various tissue microorganisms.
J Am Acad Dermatol 1998, 38(1):56-60. PubMed Abstract | Publisher Full Text
22. Closs O, Harboe M, Axelsen NH, Bunch-Christensen K, Magnusson M: The antigens of Mycobacterium bovis, strain BCG, studied by crossed immunoelectrophoresis: a reference system.
Scand J Immunol 1980, 12(3):249-263. PubMed Abstract | Publisher Full Text
23. Haines DM, Chelack BJ: Technical considerations for developing enzyme immunohistochemical staining procedures on formalin-fixed paraffin-embedded tissues for diagnostic pathology.
J Vet Diagn Invest 1991, 3(1):101-112. PubMed Abstract | Publisher Full Text
24. Kobayashi K, Blaser MJ, Brown WR: Immunohistochemical examination for mycobacteria in intestinal tissues from patients with Crohn's disease.
Gastroenterology 1989, 96(4):1009-1015. PubMed Abstract
25. Goel MM, Ranjan V, Dhole TN, Srivastava AN, Mehrotra A, Kushwaha MR, Jain A: Polymerase chain reaction vs. conventional diagnosis in fine needle aspirates of tuberculous lymph nodes.
Acta Cytol 2001, 45(3):333-340. PubMed Abstract
26. Borkow G, Weisman Z, Leng Q, Stein M, Kalinkovich A, Wolday D, Bentwich Z: Helminths, human immunodeficiency virus and tuberculosis.
Scand J Infect Dis 2001, 33(8):568-571. PubMed Abstract | Publisher Full Text
27. Li JYWMS, Lo STHMS, Ng CSFRCP: Molecular Detection of Mycobacterium tuberculosis in Tissues Showing Granulomatous Inflammation Without Demonstrable Acid-Fast Bacilli. [Article]. Diagnostic Molecular Pathology June 2000;9(2):67-74;
28. Cheng VC, Yam WC, Hung IF, Woo PC, Lau SK, Tang BS, Yuen KY: Clinical evaluation of the polymerase chain reaction for the rapid diagnosis of tuberculosis.
J Clin Pathol 2004, 57(3):281-285. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
29. Azov AG, Koch J, Hamilton-Dutoit SJ: Improved diagnosis of mycobacterial infections in formalin-fixed and paraffin-embedded sections with nested polymerase chain reaction.
Apmis 2005, 113(9):586-593. PubMed Abstract | Publisher Full Text
30. Sumi MG, Mathai A, Sheela R, Radhakrishnan NS, Radhakrishnan VV, Indhulekshmy R, Mundayoor S: Diagnostic utility of polymerase chain reaction and immunohistochemical techniques for the laboratory diagnosis of intracranial tuberculoma.
Clin Neuropathol 2001, 20(4):176-180. PubMed Abstract
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:18:33.000Z
|
ucozizimyjq5d7ivl5vnofm5wrgf6u33
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36771",
"uncompressed_offset": 372768150,
"url": "www.envirolink.org/resource.html?catid=5&itemid=781",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.envirolink.org/resource.html?itemid=781&catid=5"
}
|
cccc_CC-MAIN-2013-20
|
advanced search
Category: Organizations
Long Island SHAD
Anti-nuclear direct action Envrionmental group
Ratings/Review of this resource:
Phone: 516-265-9430
Fax: 516-265-9427
E-Mail: lishad@pobox.com
Website: http://printshop.home.ml.org/shad.html
Detailed Information:
SHAD (Sound and Hudson against Atomic Developement) formed in 1978 to oppose the (now closed) Shoreham nuclear power plant. We are now focussing on the Brookhaven National Lab and the dangers from its reactors.
Resources that may be related:
Home | Site Map | About EnviroLink | Advanced Search | Suggest a Resource
All content on this website is governed by a Creative Commons license.
This site powered by WebDNA
Community Information Systems provided by Rhiza Labs
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:35:52.000Z
|
j4cctu3doesugd35ebktqm6geo62l5em
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36772",
"uncompressed_offset": 382307993,
"url": "www.familysearch.org/learn/wiki/en/Special:RecentChangesLinked/France,_Coutances_et_d",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Special:RecentChangesLinked/France,_Coutances_et_d'Avranche_Diocese,_Inquiries_of_Consanguinity_(FamilySearch_Historical_Records)"
}
|
cccc_CC-MAIN-2013-20
|
Changes related to "France, Coutances et d'Avranche Diocese, Inquiries of Consanguinity (FamilySearch Historical Records)"
From FamilySearch Wiki
This is a list of changes made recently to pages linked from a specified page (or to members of a specified category). Pages on your watchlist are bold.
Recent changes options Show last 50 | 100 | 250 | 500 changes in last 1 | 3 | 7 | 14 | 30 days
Hide minor edits | Show bots | Hide anonymous users | Hide logged-in users | Hide my edits
Show new changes starting from 08:35, 18 May 2013
Page name:
No changes on linked pages during the given period.
New to the Research Wiki?
In the FamilySearch Research Wiki, you can learn how to do genealogical research or share your knowledge with others.
Learn More
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:48:28.000Z
|
dji6jb6dfa5jo2pdhwdwdrnu6usgqa7v
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36779",
"uncompressed_offset": 412808711,
"url": "www.go4expert.com/forums/better-than-aweber-t20297/",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.go4expert.com/forums/better-than-aweber-t20297/"
}
|
cccc_CC-MAIN-2013-20
|
Better than Aweber
Team Leader
7Dec2009,10:11 #1
I read many Articles on Blog about Aweber but I see in AWeber If you have multiple lists and you want to send to all of them but then resend to the un-opens you can't do so as Aweber can only see the unopens from the primary list you send from.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:40:50.000Z
|
63kfjorq2o6xeyh5ageooczulxvtyy3g
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36781",
"uncompressed_offset": 429475030,
"url": "www.hindawi.com/crim/oncmed/2012/232851/cta/",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.hindawi.com/crim/oncmed/2012/232851/cta/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
Case Reports in Oncological Medicine
Volume 2012 (2012), Article ID 232851, 3 pages
doi:10.1155/2012/232851
Case Report
Double Feature: Carcinoma and Sarcoma Present in a Single Breast Tumor
Department of General Surgery and Department of Family Medicine, West Virginia School of Osteopathic Medicine, 400 North Lee Street, Lewisburg, WV 24901, USA
Received 17 July 2012; Accepted 27 August 2012
Academic Editors: Y. Aoki and A. Kolacinska
Copyright © 2012 Catherine M. Stefaniuk and Timothy Jones. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
How to Cite this Article
Catherine M. Stefaniuk and Timothy Jones, “Double Feature: Carcinoma and Sarcoma Present in a Single Breast Tumor,” Case Reports in Oncological Medicine, vol. 2012, Article ID 232851, 3 pages, 2012. doi:10.1155/2012/232851
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:43:52.000Z
|
hqcjnhw3rvrplvine5jku4rldouyvlvp
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36792",
"uncompressed_offset": 478484305,
"url": "www.libertariannews.org/2012/01/18/logical-proofs-of-infinite-external-consciousness/",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.libertariannews.org/2012/01/18/logical-proofs-of-infinite-external-consciousness/"
}
|
cccc_CC-MAIN-2013-20
|
Logical Proofs of Infinite External Consciousness
January 18, 2012
By
1. n /∞ = 0 and ∞ / n = ∞
The argument that you exist now but cease to exist in the future requires that at some point infinitely in the future you are perceived as not having existed infinitely into the past. If you have not existed into the past from some future perspective and do not exist infinitely into the future from your current perspective then you never have and never will exist for all infinity. Obviously this is a logical paradox that can only be resolved by saying consciousness is external and infinite in nature.
2. If you believe in the theory of Quantum Mechanics, then you believe that conscious observation must be present to collapse a wave function. If consciousness did not exist prior to matter coming into existence, then it is impossible that matter could ever come into existence. Additionally, this rules out the possibility that consciousness is the result of quantum mechanical processes. Either consciousness existed before matter or QM is wrong, one or the other is indisputably true. Regardless, it is a logical paradox to conclude that consciousness is the result of QM processes.
Decoherence as an explanation results in either a many worlds or many minds interpretation. Decoherence on its own explains nothing. A many minds interpretation leads to a continuous infinity of minds existing in an infinite number of universes. This leads to a system that is unable to explain single photon interference patterns in experiments such as the double slit experiment, which clearly means this is not a logical or rational description of this present physical universe.
From wiki on decoherence:
“Decoherence does not generate actual wave function collapse. It only provides an explanation for the appearance of wavefunction collapse, as the quantum nature of the system “leaks” into the environment. That is, components of the wavefunction are decoupled from a coherent system, and acquire phases from their immediate surroundings. A total superposition of the global or universal wavefunction still exists (and remains coherent at the global level), but its ultimate fate remains an interpretational issue. Specifically, decoherence does not attempt to explain the measurement problem. ”…
To quote wiki on the ‘many worlds’ interpretation:
“decoherence by itself may not give a complete solution of the measurement problem, since all components of the wave function still exist in a global superposition, which is explicitly acknowledged in the many-worlds interpretation. All decoherence explains, in this view, is why these coherences are no longer available for inspection by local observers. To present a solution to the measurement problem in most interpretations of quantum mechanics, decoherence must be supplied with some nontrivial interpretational considerations (as for example Wojciech Zurek tends to do in his Existential interpretation). However, according to Everett and DeWitt the many-worlds interpretation can be derived from the formalism alone, in which case no extra interpretational layer is required.”
Further:
“The many-worlds interpretation should not be confused with the similar many-minds interpretation which defines the split on the level of the observers’ minds.The many-worlds interpretation leads to a deterministic view of nature in which there is no special role for the human mind.[71]“
oops, I guess we are back to determinism. I might also add that if you hold the ‘many worlds’ view to the standard of classical QM, it would require an infinite number of observers in an infinite number of universes to cause an infinite number of wave collapses.
3. Given that we have established that consciousness is either infinite and external to the brain, QM is wrong, or all processes are deterministic, we know that any attempt to explain consciousness as being local to the brain must do so using only deterministic biochemical processes. If biochemical processes are truly the source of consciousness, then you have no free will because all chemical processes are deterministic in nature. If this is the case, then you aren’t actually choosing to read this article. Nature has pre-destined you to read this article. Your life has no meaning since you don’t actually control it. It’s either that or consciousness is infinite, eternal and external to the brain and this physical universe.
4. Strong emergence, the supposition that new properties can emerge from component systems, is a logical impossibility. This means that either subatomic particles must be conscious or consciousness must arise from outside the brain. Given that there is no evidence to suggest subatomic particles are conscious and that attempting to do so by way of QM results in a logical contradiction, it is illogical to conclude consciousness is a product of biochemical processes.
5. The number of synapses in the brain is not large enough to hold all the memories of the brain. There is no known mechanism of memory transport in the brain. There is no center point in the brain that can be observed to initiate conscious thought. Any attempt to explain memory as being local to the brain requires a retention of state. If matter changes state, information is lost. This is a fundamental proven law of the universe. Because we know QM is not logically capable of explaining consciousness and because we know LTP is the only physical mechanism of state retention and because we know there are not enough synapses to account for human memory, it is illogical conclude that all memory is local to the brain. If consciousness is a product of deterministic biochemical processes, this again violates logic on grounds of emergence as well as invalidating free will.
So here in lies a choice. You can choose to believe that consciousness is the product of biochemical processes (which is illogical) and that you have no free will, or you can choose to believe that consciousness is eternal and external to the brain which allows for free will. No matter what, you can not say that consciousness is internal to the brain and that you have free will. This is not a logical option.
Chose wisely atheists… oops! I’m sorry, you don’t have a choice. Deterministic chemical processes already made that decision for you
Further supporting evidence: Lancet 2001; 358: 2039-45
http://profezie3m.altervista.org/archivio/TheLancet_NDE.htm
With lack of evidence for any other theories for NDE, the thus far assumed, but never proven, concept that consciousness and memories are localised in the brain should be discussed. How could a clear consciousness outside one’s body be experienced at the moment that the brain no longer functions during a period of clinical death with flat EEG?22 Also, in cardiac arrest the EEG usually becomes flat in most cases within about 10 s from onset of syncope.29,30 Furthermore, blind people have described veridical perception during out-of-body experiences at the time of this experience.31NDE pushes at the limits of medical ideas about the range of human consciousness and the mind-brain relation.
Credit to William Bray for his logical rigor in helping me form these arguments, along with countless other philosophers and physicists.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:39:27.000Z
|
44ol36inzt2pvcnehjv3kq3oyshj65sb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36797",
"uncompressed_offset": 514647951,
"url": "www.nanoscalereslett.com/content/6/1/496/abstract",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.nanoscalereslett.com/content/6/1/496/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Nano Express
Optical properties of as-grown and annealed InAs quantum dots on InGaAs cross-hatch patterns
Chalermchai Himwas, Somsak Panyakeow and Songphol Kanjanachuchai*
Author Affiliations
Semiconductor Device Research Laboratory (Nanotec Center of Excellence), Department of Electrical Engineering, Faculty of Engineering, Chulalongkorn University, Bangkok 10330, Thailand
For all author emails, please log on.
Nanoscale Research Letters 2011, 6:496 doi:10.1186/1556-276X-6-496
Published: 17 August 2011
Abstract
InAs quantum dots (QDs) grown on InGaAs cross-hatch pattern (CHP) by molecular beam epitaxy are characterized by photoluminescence (PL) at 20 K. In contrast to QDs grown on flat GaAs substrates, those grown on CHPs exhibit rich optical features which comprise as many as five ground-state emissions from [1-10]- and [110]-aligned QDs, two wetting layers (WLs), and the CHP. When subject to in situ annealing at 700°C, the PL signals rapidly degrades due to the deterioration of the CHP which sets the upper limit of overgrowth temperature. Ex situ hydrogen annealing at a much lower temperature of 350°C, however, results in an overall PL intensity increase with a significant narrowing and a small blueshift of the high-energy WL emission due to hydrogen bonding which neutralizes defects and relieves associated strains.
Keywords:
quantum dots; cross-hatch patterns; photoluminescence; annealing; InAs; InGaAs.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:49:09.000Z
|
lty3dgyb4oux2qk6dffooionkn22eo5s
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36798",
"uncompressed_offset": 514658772,
"url": "www.nanoscalereslett.com/content/6/1/598",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.nanoscalereslett.com/content/6/1/598"
}
|
cccc_CC-MAIN-2013-20
|
Nano Express
Co nanoparticle hybridization with single-crystalline Bi nanowires
Jin-Seo Noh, Min-Kyung Lee, Jinhee Ham and Wooyoung Lee*
Author Affiliations
Department of Materials Science and Engineering, Yonsei University, Seoul 120-749, Korea
For all author emails, please log on.
Nanoscale Research Letters 2011, 6:598 doi:10.1186/1556-276X-6-598
The electronic version of this article is the complete one and can be found online at: http://www.nanoscalereslett.com/content/6/1/598
Received:15 July 2011
Accepted:21 November 2011
Published:21 November 2011
© 2011 Noh et al; licensee Springer.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Crystalline Co nanoparticles were hybridized with single-crystalline Bi nanowires simply by annealing Co-coated Bi nanowires at elevated temperatures. An initially near-amorphous Co film of 2-7 nm in thickness began to disrupt its morphology and to be locally transformed into crystallites in the early stage of annealing. The Co film became discontinuous after prolonged annealing, finally leading to isolated, crystalline Co nanoparticles of 8-27 nm in size. This process spontaneously proceeds to reduce the high surface tension and total energy of Co film. The annealing time required for Co nanoparticle formation decreased as annealing temperature increased, reflecting that this transformation occurs by the diffusional flow of Co atoms. The Co nanoparticle formation process was explained by a hole agglomeration and growth mechanism, which is similar to the model suggested by Brandon and Bradshaw, followed by the nanoparticle refinement.
1. Introduction
Magnetic nanoparticles have unique size effects that may provide insights into potential applications in various fields, such as ultra-high density information storage, color imaging, bioprocessing, and ferrofluids [1-3]. Specifically, cobalt (Co) nanoparticles have been a subject of intensive research because of its high magnetocrystalline anisotropy (7 × 106 erg/cm3) and large estimated critical size for single domains (approx. 70 nm) [4]. To synthesize Co nanoparticles with a controlled size and size distribution, various techniques have been utilized, including evaporation in an inert gas [5], chemical vapor condensation by either heating or laser-irradiating Co2(CO)8 precursor [6,7], and solution phase reduction of CoCl2 in stabilizing agents [8]. Although these techniques have demonstrated monodisperse arrays of Co nanoparticles with sizes down to 2 nm, elaborate temperature control and/or the use of complex chemical species are in demand, limiting their widespread use.
Metallic and semiconducting nanowires are another class of nanostructures that have attracted a great deal of interest because of their intriguing quantum properties and potential use for advanced nanodevices. Bismuth (Bi) is a semimetal widely explored for understanding physics in nanowire systems, because of its highly anisotropic Fermi surface, low carrier concentrations, small carrier effective mass [9-11], and long carrier mean-free path [12]. In particular, Bi nanowires can be good building blocks for thermoelectric applications, since good thermoelectric properties [13] of bulk Bi such as the large thermoelectric power (-50 to -100 μV/K) and small thermal conductivity (approx. 8 W/mK) have been demonstrated to be further improved in nanowire systems [14]. The quality of Bi nanowires is a critical requisite for success in both fundamental study and applications. We previously demonstrated that high-quality single-crystalline Bi nanowires could be synthesized using the unique on-film formation of nanowires (OFF-ON) method [12,15].
Hybridizing Bi nanowires with Co nanoparticles may be an interesting research topic. That is not only a combination of 0D nanoparticle and 1D nanowire, but it can also provide fundamental understanding of mutual interaction between thermoelectrics and magnetism. Recently, the thermoelectrics has sought a link to spintronics via groundbreaking works performed by several research groups worldwide. The studies on the spin-Seebeck effect [16] and magneto-Seebeck effect [17] were typical. The spin-Seebeck effect refers to power generation from a magnetic material under a temperature gradient, while the magneto-Seebeck effect concerns a change in Seebeck coefficient of a magnetic multilayer structure with insulting barrier inside, depending on the relative magnetizations. Although these works laid cornerstones for the investigation of interactions between thermoelectrics and spintronics, none of them included a thermoelectric material in their experiments. In contrast, we try to combine a magnetic material with a thermoelectric material at the nanoscale toward an eventual elucidation of the effects of magnetic nanostructures on the thermoelectric performance in this study.
The first step of this research is to establish a simple and reliable platform for incorporating Co nanoparticles into Bi nanowires. In this article, we report a simple method to synthesize Co-nanoparticles-embedding Bi nanowires, using a combination of the OFF-ON growth of Bi nanowires, sputter-deposition of a thin Co film, and post-annealing. The synthesis method of our nano-heterostructures is simpler than that of the subtle magneto-Seebeck structures and the thermoelectric performance of our heterostructures are expected to be more pronounced than that from the spin-Seebeck structures because of the use of thermoelectric material as a backbone.
2. Experimental details
The whole process for distributing Co nanoparticles on the surface of Bi nanowires is schematically presented in Figure 1. First of all, Bi nanowires were grown on thermally oxidized Si (100) substrates using the OFF-ON method. The details of this Bi nanowire growth have previously been reported elsewhere [12,15,18]. Bi nanowires of 80-120 nm in diameter were used for this study. A very thin Co film was subsequently deposited onto the Bi nanowires by radio frequency (RF) sputtering at room temperature. This Co deposition was performed in situ to prevent potential surface oxidation, using the same sputtering system as for Bi nanowire growth. The thickness of Co film was varied from 2 to 7 nm by controlling the sputtering time. The as-prepared Co-coated Bi nanowires were confirmed to show Bi-Co core/shell structures with relatively uniform shell profile along the nanowire axis. The Co-coated Bi nanowires were put in a vacuum furnace for thermal annealing in the next step. The annealing temperature was controlled in the range of 200-240°C, which is below the melting point of Bi (271.3°C). The annealing time was also modulated between 1 and 5 h. A fine distribution of Co nanoparticles was obtained via optimization of the above-mentioned control parameters, as represented by the last picture of Figure 1. The evolution in the morphology and structure of the heterogeneous nanowires was investigated using scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The crystallinity and composition were analyzed by the support of TEM electron diffraction patterns and energy-dispersive X-ray (EDX) spectroscopy. The effects of Co film thickness and annealing conditions on the formation of Co nanoparticles were discussed from the obtained results.
Figure 1. Schematic illustration for the process of forming Co nanoparticles on the surface of Bi nanowires. Bi nanowires are first grown by the OFF-ON method and they are subsequently coated with a thin Co film by in situ sputtering. Co nanoparticles are finally formed on the surface of Bi nanowires via post-annealing at elevated temperatures.
3. Results and discussion
Figure 2 shows surface-focused TEM images of an as-prepared and annealed Bi-Co core/shell nanowires. From Figure 2a, a Co film of 3-4 nm in thickness coats a Bi core in a relatively uniform fashion and the Co/Bi interface is abrupt. Interestingly, the Co film is in general amorphous while the Bi core is single-crystalline, presumably because of the differences in crystal structures and lattice constants (Co: face-centered cubic (FCC) with a0 = 3.54 Å, Bi: rhombohedral with a0 = 4.55 Å). Once the Co-coated Bi nanowire is annealed at elevated temperatures, the Co shell begins to deform its morphology (see Figure 2b, c for morphological changes after annealing at 200°C). This is because the surface tension (1940 dynes/cm at its melting point [19]) of Co is high and Co atoms tend to relocate to reduce it under conditions where atomic motion is thermally stimulated. In addition to the intrinsic surface tension, film stress can be another driving force to induce the morphological change and it generally becomes significant at high temperatures. In this respect, additional tensile stress can be added to the surface tension of Co film at a given annealing temperature as a thermal expansion coefficient (13.0 × 10-6/°C) of Co is slightly smaller than that (13.4 × 10-6/°C) of Bi. It is found from Figure 2b, c that the morphological change is dependent on annealing time. Only multiple valleys are developed in the Co film after 3-h annealing and separate Co islands finally appear via 5-h annealing. The annealing time dependence of morphological evolution is attributed to the slowly proceeding diffusional mass flow, which is represented by the relatively low self-diffusion coefficient of Co: it is estimated to be 4.1 × 10-32 cm2/s at 200°C using D = 0.37 × e-67000/RT cm2/s from [20], where D is the self-diffusion coefficient of Co and R is the gas constant.
Figure 2. TEM images of (a) an as-prepared and (b, c) annealed Co-coated Bi nanowires. Annealing was performed at 200°C for (b) 3 h and (c) 5 h, respectively.
It is desirable to reduce the annealing time required for formation of Co nanoparticles. Because in this study, the Co nanoparticles are formed through solid-state diffusion of Co atoms, higher annealing temperatures accelerate the nanoparticle formation reaction following the simple Arrhenius equation. However, the annealing temperature is limited by the low melting point (271.3°C) of Bi core. Thus, it was reset at 240°C, which is the near-highest temperature where the Bi core still remains stable. Figure 3 shows low-resolution and high-resolution TEM images, selected area electron diffraction (SAED) patterns, and area-specific EDX spectra of the Co-coated Bi nanowire annealed at 240°C for 3 h. For comparison, a high-resolution TEM image of the same Bi-Co core/shell nanowire undergone annealing at 200°C for 3 h is also presented. The Co shell thickness was about 1 nm thinner than previous ones in Figure 2. Indeed, Co nanoparticles are found on the surface of Bi nanowire, as shown in Figure 3a. The nanoparticles are overall hemispherical in shape, but their sizes and inter-particle spacings are somewhat irregular, in the ranges of 8-27 and 3-32 nm, respectively. To closely examine the Co nanoparticles, high-resolution TEM was taken on the selected part of Figure 3a and its image is shown in Figure 3b. Two Co nanoparticles are approximately 16 nm distant from each other and no residual Co is observed in between them. The gray-colored layer on the surface of Bi nanowire is Bi oxide that was formed in ambient. Unlike the as-deposited Co film in Figure 2a that is almost amorphous, the Co nanoparticles look highly single-crystalline with a crystal orientation different from that of Bi core. This most likely occurs since Co atoms are ordered into a stable FCC structure through local diffusion at elevated temperatures to relieve surface tension and film stress and demonstrates the capability of our method for hybridizing high-quality nanoparticles with high-quality nanowires.
Figure 3. TEM images, SAED patterns, and EDX spectra of the annealed Co-coated Bi nanowires. (a) A low-resolution TEM image of a Co-coated Bi nanowire annealed at 240°C for 3 h. (b) A high-resolution TEM image of a selected part marked with red box in (a). (c) A high-resolution TEM image of another Co-coated Bi nanowire annealed at 200°C for 3 h. (d, e) SAED patterns of the 240°C-annealed nanowire at the different areas denoted by "1" and "2", respectively, in (b). The circled spots in (d) represent crystal planes from Co. (f) EDX spetra from the respective "1" and "2", showing a significant difference in Co content.
The single-crystalline Co nanoparticles are also observed from a Bi-Co core/shell nanowire annealed at 200°C for the same period of time (see Figure 3c). However, the degree of shape completion of the 200°C-formed Co nanoparticles is worse than those from 240°C annealing. Considering that a 1-nm-thicker Co film did not evolve into Co nanoparticles after annealing at 200°C for 3 h (Figure 2b), these results indicate that annealing temperature is indeed a key control parameter in nanoparticle formation. To further investigate the crystallinities and compositions of the above-mentioned Bi nanowire and Co nanoparticles, SAED and EDX analyses were performed on Co nanoparticle area (named "1") and Bi core area (named "2"), respectively. From two SAED patterns shown in Figure 3d, e, it is found that the area "1" contains extra spots (circled ones) other than characteristic Bi spots, which represent major crystal planes of FCC Co, while the area "2" shows only clear Bi spots. This indicates that the nanoparticles are really crystalline Co in accord with a TEM image in Figure 3b. The gray background of Figure 3d may come from the oxide layers on Bi core and Co nanoparticle. In addition, the EDX spectra (Figure 3f) from both areas show that significant Co peaks come out of the nanoparticles, whereas no meaningful Co peaks are observed on Bi core, reflecting that the identity of the nanoparticle is Co. The Co concentration (< 20 at.%) from "1" and non-zero concentration (0.5-1.5 at.%) from "2" are presumably caused by the limited spot size (approx. 20 nm) of electron beam.
We speculated on the mechanism for Co nanoparticle formation. Figure 4 schematically shows our suggested mechanism, in which a reduction of surface tension, hole agglomeration and growth, and nanoparticle refinement cooperatively work. First, a near-amorphous Co thin film including a plenty of vacancies begins to modify its morphology through local atomic diffusion in the initial stage of annealing (see the second panel of Figure 4 and 2b). This process spontaneously occurs to reduce the high surface tension and film stress of the Co film. This is thermally stimulated at elevated temperatures, and mediated by vacancy coalescence, leading to local holes in the Co film [21,22]. In this initial step, local Co crystallites already start to form inside the film, as shown in Figure 2b. In the next step (longer annealing), the holes grow until neighboring holes encounter each other, pushing out Co film finally to form Co islands (see the third panel of Figure 4). According to the model of Brandon and Bradshaw, the hole radius (R) has a relationship with annealing time (t) and film thickness (d) as R = 5π1/2Bt/2d3/2, where B is proportional to Dsγ/T [23,24]. Here Ds and γ are the surface diffusion coefficient and surface energy of Co, and T is the absolute temperature. From the model, the final hole size becomes larger as the annealing time and surface energy increase and film thickness decreases, which is the case in this study. The Co islands are refined in both shape and crystal quality in the last step (see the last panel of Figure 4). More hemispherical and more crystalline Co nanoparticles come out via this step to further reduce the surface tension and volume energy of individual nanoparticles.
Figure 4. Annealing-time-dependent morphological evolution of Co film based on our suggested mechanism. Many vacancies in the Co film coalesce into tiny holes and the holes are again agglomerated in the early stage of annealing. Further annealing drives the holes to grow until neighboring holes encounter each other, leaving behind Co islands. Lastly, the Co islands are reshaped into near-hemispherical nanoparticles. The bottom row shows top views at the respective stages.
4. Conclusions
We hybridized single-crystalline Bi nanowires with crystalline Co nanoparticles, using a combination of the OFF-ON nanowire growth, thin film deposition, and post-annealing. A Co thin film coated on a Bi nanowire began to deform its morphology via thermal annealing at elevated temperatures, which is driven by the high surface tension of the film. Local valleys developed in the Co film after a short time of annealing, and Co nanoparticles finally appeared on the surface of Bi nanowire through annealing for a time longer than a critical value, leaving behind Co-free Bi surface in between them. The time required for Co nanoparticle formation was shorter at a higher annealing temperature, suggesting that this process is governed by the diffusional flow of Co atoms. Interestingly, the crystalline Co nanoparticles were obtained from an initially near-amorphous Co film using our method. The whole process of Co nanoparticle hybridization with Bi nanowire was explained by the hole agglomeration/growth and nanoparticle refinement mechanism. The hybrid nanostructure would be a good testbed for exploiting multidisciplinary nanophysics. Various nanoparticles made of materials with high surface tension could be hybridized with a variety of nanowires, employing this simple method.
Abbreviations
Bi: bismuth; Co: Cobalt; EDX: energy dispersive X-ray spectroscopy; OFF-ON: on-film formation of nanowires; RF: radio frequency; SAED: selected area electron diffraction.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
JSN designed the experiment, analyzed the data, and drafted the manuscript. MKL conducted Bi nanowire growth and hybridization of Co nanoparticles with Bi nanowires. MKL and JH carried out SEM and TEM measurements. WL directed and coordinated all the experiments. All authors read and approved the final manuscript.
Acknowledgements
This research was supported by a grant from the Priority Research Centers Program (2009-0093823), a grant (2011K000198) from 'Center for Nanostructured Materials Technology' under '21st Century Frontier R&D Programs' and the Pioneer Research Center Program (2010-0019313) through the National Research Foundation of Korea.
References
1. Lu AH, Salabas EL, Schüth F: Magnetic nanoparticles: synthesis, protection functionalization, and application.
Angew Chem Int Ed 2007, 46:1222-1244. Publisher Full Text
2. Li Z, Wei L, Gao M, Lei H: One-pot reaction to synthesize biocompatible magnetite nanoparticles.
Adv Mater 2005, 17(8):1001. Publisher Full Text
3. Hütten A, Sudfeld D, Ennen I, Reiss G, Hachmann W, Heinzmann U, Wojczykowski K, Zutzi P, Saikaly W, Thomas G: New magnetic nanoparticles for biotechnology.
J Biotechnol 2004, 112:47-63. PubMed Abstract | Publisher Full Text
4. Leslie-Pelecky DL, Rieke RD: Magnetic properties of nanostructured materials.
Chem Mater 1996, 8(8):1770-1783. Publisher Full Text
5. Gangopadhyay S, Hadjipanayis GC, Sorensen CM, Klabunde KJ: Magnetic properties of ultrafine co particles.
IEEE Trans Mag 1992, 28(5):3174. Publisher Full Text
6. Dong XL, Choi CJ, Kim BK: Chemical synthesis of co nanoparticles by chemical vapor condensation.
Scripta Mater 2002, 47:857-861. Publisher Full Text
7. Robinson I, Volk M, Tung LD, Caruntu G, Kay N, Thanh NTK: Synthesis of co nanoparticles by pulsed laser irradiation of cobalt carbonyl in organic solution.
J Phys Chem C 2009, 113(22):9497-9501. Publisher Full Text
8. Sun S, Murray CB: Colloidal chemical synthesis of magnetic nanoparticles synthesis of monodisperse cobalt nanocrystals and their assembly into magnetic superlattices.
J Appl Phys 1999, 85:4325. Publisher Full Text
9. Zhang Z, Sun X, Ying JY, Heremans J, Dresselhaus MS: Electronic transport properties of single-crystal bismuth nanowire arrays.
Phys Rev B 2000, 61:4850-4861. Publisher Full Text
10. Liu K, Chien CL, Searson PC: Finite-size effects in bismuth nanowires.
Phys Rev B 1998, 58:R14681-R14684. Publisher Full Text
11. Heremans J, Hansen OP: Influence of non-parabolicity on intravalley electron-phonon scattering; the case of bismuth.
J Phys C 1979, 12:3483. Publisher Full Text
12. Shim W, Ham J, Lee K, Jeung WY, Johnson M, Lee W: On-film formation of Bi nanowires with extraordinary electron mobility.
Nano Lett 2009, 9(1):18-22. PubMed Abstract | Publisher Full Text
13. Gallo CF, Chandrasekhar BS, Sutter PH: Transport properties of bismuth single crystals.
J Appl Phys 1963, 34(1):144-152. Publisher Full Text
14. Roh JW, Hippalgaonkar K, Ham JH, Chen R, Li MZ, Ercius P, Majumdar A, Kim W, Lee W: Observation of anisotropy in thermal conductivity of individual single-crystalline bismuth nanowires.
ACS Nano 2011, 5(5):3954-3960. PubMed Abstract | Publisher Full Text
15. Ham J, Shim W, Kim DH, Oh KH, Voorhees PW, Lee W: Watching bismuth nanowires grow.
Appl Phy Lett 2011, 98:043102. Publisher Full Text
16. Uchida K, Takahashi S, Harii K, Ieda J, Koshibae W, Ando K, Maekawa S, Saitoh E: Observation of the spin Seebeck effect.
Nature 2008, 455:778. PubMed Abstract | Publisher Full Text
17. Walter M, Walowski J, Zbarsky V, Münzenberg M, Schäfers M, Ebke D, Reiss G, Thomas A, Peretzki P, Seibt M, Moodera JS, Czerner M, Bachmann M, Heiliger C: Seebeck effect in magnetic tunnel junctions.
Nat Mater 2011.
18. Shim W, Ham J, Noh JS, Lee W: Structure-dependent growth control in nanowire synthesis via on-film formation of nanowires.
Nanoscale Res Lett 2011, 6:196. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
19. Sheikh S, Boushehri A: Corresponding states correlation for the surface tension of melts.
High Temp High Press 2000, 32:233-238. Publisher Full Text
20. Nix FC, Jaumot FE Jr: Self-diffusion in cobalt.
Phys Rev 1951, 82:72-74. Publisher Full Text
21. Gimpl ML, McMaster AD, Fuschillo N: Amorphous oxide layers on gold and nickel films observed by electron microscopy.
J Appl Phys 1964, 35:3572. Publisher Full Text
22. Sharma SK, Spitz J: Hillock formation, hole growth and aggromeration in thin silver films.
Thin Solid Films 1980, 65:339-350. Publisher Full Text
23. Brandon RH, Bradshaw FJ: Royal Aircraft Establishment Research Report 1966, No. 66095.
24. Presland AEB, Price GL, Trimm DL: The role of microstructure and surface energy in hole growth and island formation in thin silver films.
Surf Sci 1972, 29(2):435-446. Publisher Full Text
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:34:57.000Z
|
kg3ocko2cqdd7a2e6lgj5o76bk4fcedh
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:36802",
"uncompressed_offset": 530979345,
"url": "www.ohloh.net/p/5944/contributors/25531433418413",
"warc_date": "2013-11-22T19:23:19.000Z",
"warc_filename": "<urn:uuid:777b216f-3160-4512-820c-3e61fc8c0c5d>",
"warc_url": "http://www.ohloh.net/p/5944/contributors/25531433418413"
}
|
cccc_CC-MAIN-2013-20
|
Moderate Activity
Contributors : Fabrice Dutron
Analyzed about 23 hours ago based on code collected about 24 hours ago.
Activity on Jajuk by Fabrice Dutron
All-time Commits: 1
12-Month Commits: 0
30-Day Commits: 0
Overall Kudo Rank:
First Commit: 10-Oct-2004
Last Commit: 10-Oct-2004
Names in SCM: Fabrice Dutron
Commit history:
Recent Kudos...
... for Jajuk given by:
There are no kudos for this contributor at this time.
Do you know this contributor?
Ohloh computes statistics about contributors by analyzing their commits on all FOSS projects. We would like to be able to attribute this work to the right person, so if you know the contributor, please help out:
Are you this developer?
Add this position to your profile!
Know this developer?
Send him or her an invite to join Ohloh.
Project Commits
Approximately one year of commit activity shown
Project Languages
Language Aggregate Coding Time Total Commits Total Lines Changed Comment Ratio
Java 1m 1 716 30.3%
XML 1m 1 3 -
All Languages 1m 1 719 30.1%
Copyright © 2013 Black Duck Software, Inc. and its contributors, Some Rights Reserved. Unless otherwise marked, this work is licensed under a Creative Commons Attribution 3.0 Unported License . Ohloh ® and the Ohloh logo are trademarks of Black Duck Software, Inc. in the United States and/or other jurisdictions. All other trademarks are the property of their respective holders.
|
v0
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.