added
stringdate 2024-06-03 18:26:11
2024-06-04 03:14:13
| created
stringdate 2013-04-29 18:49:42
2014-01-03 01:38:26
| id
stringlengths 32
32
| metadata
dict | source
stringclasses 2
values | text
stringlengths 237
356k
| version
stringclasses 1
value |
|---|---|---|---|---|---|---|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:05:20.000Z
|
tcqqhllevx7julwqsq3krow7wnqfzuxi
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52152",
"uncompressed_offset": 262650296,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/ProductsbyReleaseDate/774B105BBC0053C8CA25743C001A07E9",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/ProductsbyReleaseDate/774B105BBC0053C8CA25743C001A07E9?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
8501.0 - Retail Trade, Australia, Feb 2008
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 04/04/2008
Page tools: Print Page Print All RSS Search this Product
FEBRUARY KEY FIGURES
Feb 08
Jan 08 to Feb 08
$m
% change
Turnover at current prices
Trend estimates
20 154.1
0.2
Seasonally adjusted estimates
20 083.1
-0.1
Monthly turnover, Trend estimates - % change
FEBRUARY KEY POINTS
TREND ESTIMATES
• The trend estimate of turnover for the Australian Retail and Hospitality/Services series increased by 0.2% in February 2008. This follows revised increases of 0.3% in both January 2008 and December 2007.
• In February 2008, all states and territories had an increase in the trend estimate, except Queensland (-0.1%) and Western Australia (-0.3%). The largest increase occurred in South Australia and the Northern Territory (both +0.9%).
SEASONALLY ADJUSTED ESTIMATES
• The seasonally adjusted estimate of turnover for the Australian Retail and Hospitality/Services series decreased by 0.1% in February 2008. This follows a revised decrease of 0.1% in January 2008 and a revised increase of 0.3% in December 2007.
• All states and territories except Victoria (-1.6%) and Western Australia (-0.6%) had increases in the seasonally adjusted estimate. The largest increases occurred in the Northern Territory, the Australian Capital Territory (both +1.2%) and Queensland (+0.9%).
ORIGINAL ESTIMATES
• In original terms, Australian turnover decreased by 7.5% in February 2008 compared with January 2008. Chains and other large retailers (which are completely enumerated) decreased by 10.0%, while the estimate for 'smaller' retailers (the sampled units) decreased by 4.0%.
• Australian turnover increased by 9.7% in February 2008 compared with February 2007. Chains and other large retailers increased by 11.9%, while 'smaller' retailers increased by 6.8%.
NOTES
FORTHCOMING ISSUES
ISSUE Release Date
March 2008 2 May 2008
April 2008 2 June 2008
May 2008 2 July 2008
June 2008 31 July 2008
July 2008 2 September 2008
August 2008 30 September 2008
CHANGES IN THIS ISSUE
There are no changes in this issue.
SAMPLING ERRORS
Standard errors for the Australian estimates (original data) for February 2008 contained in this publication are:
Data Series
Estimate
Standard error
Level of retail turnover ($m)
18 345.9
129.2
Change from preceding month ($m)
-1 493.3
78.5
% change from preceding month (%)
-7.5
0.4
For more information see the Explanatory Notes, paragraphs 32-36.
INQUIRIES
For further information about these and related statistics, contact the National Information and Referral Service on 1300 135 070 or Graham Phillips on Canberra (02) 6252 5625.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:01:23.000Z
|
oueogs7ypwyerpwm2hmtnxhkrjsmdaye
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52161",
"uncompressed_offset": 347447854,
"url": "www.crummy.com/2006/10/18/0",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.crummy.com/2006/10/18/0"
}
|
cccc_CC-MAIN-2013-20
|
< Sumana Guest Entry #2
The Perfect Powerpoint Slide >
(5) Trivia: Did you know that the Three Stooges were briefly Nethack characters?
Comments:
Posted by Kevan at Thu Oct 19 2006 05:02
Yes, except that I'd forgotten. They must have been in the Atari ST version I was playing in the early nineties (which required a second floppy drive for its scratch files).
Posted by Leonard at Thu Oct 19 2006 08:34
I had either 1.4f or some version of PC Hack, before I got into BBSes and found 3.1 and the excellent WCST spoilers.
Posted by Pthag at Thu Oct 19 2006 10:45
Why did they take them out?
Posted by pedro at Sat Oct 21 2006 15:14
Read the linked article -- they apparently were a significant cause of YASD.
Posted by pedro at Sat Oct 21 2006 15:15
...if you suffer from YASD, ask your doctor if Nethack is right for you.
[Main] [Edit]
Unless otherwise noted, all content licensed by Leonard Richardson
under a Creative Commons License.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:00:35.000Z
|
3jwmg6fnjoyew4rfaihlsrbdlhxlwyxx
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52162",
"uncompressed_offset": 347451163,
"url": "www.crummy.com/2009/1/12",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.crummy.com/2009/1/12"
}
|
cccc_CC-MAIN-2013-20
|
<D <M <Y
Y> M> D>
Starslip Crises: It's tough to keep my big mouth shut, but now that Kris is name-checking me I guess I can say something. Over the course of the last week Kris and I have been hashing out the future of his comic strip Starslip, on which he just changed up his art style. Originally he wanted to reboot the strip to tell a new story, but like all comics nerds (which I guess I technically am) I love continuity, and we were able to figure out a way for him to tell the story he wants to tell within the existing metaverse. And a byproduct was some interesting plot twists and gags which you should see soon.
There's a very boring bit of continuity that I doubt Kris will want to discuss within the strip, but that should be interesting for continuity nerds. So if the story stays consistent with the thing I came up with, I may give a noncanonical explanation of "what happened".
PS: If you're a super Starslip nerd, see if you recognize anybody in the background of the third panel. There's a minor clue in there.
: Brandon Bird has started a weblog and dubbed himself the "Painter of Might".
Vague Thoughtcrime Experiments Update: It hasn't been two weeks since our first submission and we haven't sent out any responses yet, but it's not too early for me to be amazed. We've been sent a lot of good stuff. And honestly, not nearly as much bad stuff as I'd been expecting. I'm also learning a lot about writing, especially from the elusive "good stuff I don't want to buy" pile. I totally understand all my rejection letters now.
Speaking of which, while reading slush I got a rejection email from an anthology I'd submitted to. So... yeah.
[Main]
Unless otherwise noted, all content licensed by Leonard Richardson
under a Creative Commons License.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:00:34.000Z
|
l7py7tg4huusd3efrn2sykmxsgm2gej3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52166",
"uncompressed_offset": 373919364,
"url": "www.eea.europa.eu/themes/households/events/events_topic/sendto_form",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.eea.europa.eu/themes/households/events/events_topic/sendto_form"
}
|
cccc_CC-MAIN-2013-20
|
Personal tools
Sign up now!
Get notifications on new reports and products. Currently we have 55591 subscribers. Frequency: 3-4 emails / month.
Follow us
Twitter
Facebook
YouTube channel
RSS Feeds
Notifications archive
Write to us
For the public:
For media and journalists:
Contact EEA staff
Contact the web team
FAQ
Call us
Reception:
Phone: (+45) 33 36 71 00
Fax: (+45) 33 36 71 99
next
previous
items
Skip to content. | Skip to navigation
Sound and independent information
on the environment
You are here: Home / Environmental topics / Household consumption / Upcoming events
Send this page to someone
Fill in the email address of your friend, and we will send an email that contains a link to this page.
Address info
(Required)
The e-mail address to send this link to.
(Required)
Your email address.
A comment about this link.
European Environment Agency (EEA)
Kongens Nytorv 6
1050 Copenhagen K
Denmark
Phone: +45 3336 7100
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:53:36.000Z
|
naaia3zdb5syknyagni3cnz7feveit4v
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52167",
"uncompressed_offset": 378405130,
"url": "www.eoearth.org/article/Anthrax",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.eoearth.org/article/Anthrax"
}
|
cccc_CC-MAIN-2013-20
|
Rate This Article
Average: 0/5
Anthrax
Anthrax
This article has been reviewed by the following Topic Editor: Sidney Draggan Ph.D.
Introduction
U.S. Geological Survey
Wildlife Health Connection to Emerging Infectious Diseases
"Wildlife, domestic animals and humans share a large and increasing number of infectious diseases. The continued globalization of society, human population growth, and associated landscape changes will further enhance interfaces between wildlife, domestic animals, and humans, thereby facilitating additional infectious disease emergence. These interfaces are such that a century-old concept of “the one medicine” is receiving greater attention because of the need to address these diseases across species if their economic, social, and other impacts are to be effectively minimized. The wildlife component of this triad has received inadequate focus in the past to effectively protect human health as evidence by such contemporary diseases as SARS, Lyme disease, West Nile Fever, and a host of other emerging diseases. Further, habitat loss and other factors associated with human-induced landscape changes have reduced past ability for many wildlife populations to overcome losses due to various causes. This, disease emergence and resurgence has reached unprecedented importance for the sustainability of desired population levels for many wildlife populations and for the long-term survival of some species"[1]
U.S. Department of Agriculture
Photomicrograph - Bacillus anthracis bacteria. (Source: CDC)
The U.S. Department of Agriculture's Food Safety and Inspection Service characterizes Anthrax as a disease of mammals and humans caused by a spore-forming bacterium called Bacillus anthracis. Anthrax has an almost worldwide distribution and is a zoonotic disease, meaning it may spread from animals to humans. All mammals appear to be susceptible to anthrax to some degree, but ruminants such as cattle, sheep, and goats are the most susceptible and commonly affected, followed by horses, and then swine.
The U.S. Department of Agricultures (USDA) main diagnostics laboratory in Ames, Iowa, the National Veterinary Services Laboratories (NVSL), maintains small quantities of anthrax to use as reference material in making confirmatory anthrax diagnoses in animals.
Disease Epidemiology
Scanning electron micrograph - Bacillus anthracis spores. (Source: CDC; Credit: Laura Rose)
Anthrax is endemic to the United States, occurring sporadically throughout the country as environmental conditions allow. The Del Rio, Texas, region has reported ongoing outbreaks of anthrax in deer and livestock this summer. The most recent outbreak there occurred on Sept. 21, 2001. Other recent outbreaks include an outbreak in cattle and horses in Minnesota in June-July 2000; in cattle, horses, and bison in North Dakota in August 2000; and in cattle in Nebraska in January 2001.
During their vegetative stage, cells of the anthrax agent multiply in the lymph nodes of susceptible animals, including humans. When cells of B. anthracis escape from the animal's body and are exposed to oxygen, they form spores. These spores are highly resistant to heat, cold, chemical disinfectants, and long dry periods. B. anthracis spores are reported to survive for years in the environment. Environmental persistence may be related to a number of factors, including high levels of soil nitrogen and organic content, alkaline soil (a pH level higher than 6.0), and ambient temperatures higher than 60 degrees Fahrenheit.
Gazelle killed by the bacterium Bacillus anthracis, which causes anthrax. (Source: WHO.)
The anthrax organism may be spread within an area by streams, insects, wild animals and birds, and contamination from wastes of infected animals. Anthrax may be perpetuated in nature by hosts such as a wildlife reservoir, which in turn spills over into the livestock population. Animals are usually infected by ingesting soilborne spores, such as in contaminated food or water. Spores can be picked up directly from the soil through grazing or from feed grown on infected soil. When periods of drought cause livestock to forage much closer to the ground, animals may ingest spores in soil they accidentally eat along with forage. After flooding, the concentration of spores caught in standing water increases when preexisting or transitory ponds begin to evaporate.
Although rare, it is possible for animals to inhale dust harboring anthrax spores. Bites from flies and other insects that may harbor vegetative anthrax have also been reported to be vehicles for mechanical transmission.
Clinical Signs
Disease occurs when spores enter the body, germinate, multiply, and release toxins. The incubation period of natural infection in animals is typically 3 to 7 days with a range of 1 to 14 days, or more.
In cattle and sheep, the course of illness may last about 1 to 2 hours. Clinical signs, such as fever up to 107 degrees Fahrenheit, muscle tremors, respiratory distress, and convulsions, often go unnoticed. After death, there may be bloody discharges from the natural openings of the body, rapid bloating, a lack of rigor mortis, and the presence of unclotted blood. This failure of blood to clot is due to a toxin released by B. anthracis.
Anthrax in horses and related animals is acute and can last up to 96 hours. Clinical manifestations depend upon how the infection occurred. If due to ingestion of spores, as in cattle, septicemia, fever, colic, and enteritis are prominent. Anthrax due to insect bite introduction (mechanical transmission) is characterized by localized hot, painful, edematous, and subcutaneous swellings at the bite location that spread to the throat, lower neck, floor of the thorax, abdomen, prepuce, and mammary glands. These horses may have a high fever and dyspnea due to swelling of the throat or colic due to intestinal involvement.
Swine, dogs, and cats usually show a characteristic swelling of the neck secondary to regional lymph node involvement, which causes dysphagia and dyspnea following ingestion of the bacteria. An intestinal form of anthrax with severe enteritis sometimes occurs in these species. Many carnivores apparently have a natural resistance, and recovery is not uncommon.
Centers for Disease Control and Prevention
The Centers for Disease Control and Prevention has prepared answers to frequently asked questions about Anthrax, and about the organism that causes this disease:
What is anthrax?
Anthrax is an acute infectious disease caused by the spore-forming bacterium Bacillus anthracis. Anthrax most commonly occurs in wild and domestic lower vertebrates (cattle, sheep, goats, camels, antelopes, and other herbivores), but it can also occur in humans when they are exposed to infected animals or tissue from infected animals.
How common is anthrax and who can get it?
Anthrax is most common in agricultural regions where it occurs in animals. These include South and Central America, Southern and Eastern Europe, Asia, Africa, the Caribbean, and the Middle East. When anthrax affects humans, it is usually due to an occupational exposure to infected animals or their products. Workers who are exposed to dead animals and animal products from other countries where anthrax is more common may become infected with B. anthracis (industrial anthrax). Anthrax in wild livestock has occurred in the United States.
How is anthrax transmitted?
Anthrax infection can occur in three forms:
• cutaneous (skin);
• inhalation; and
• gastrointestinal.
B. anthracis spores can live in the soil for many years, and humans can become infected with anthrax by handling products from infected animals or by inhaling anthrax spores from contaminated animal products. Anthrax can also be spread by eating undercooked meat from infected animals. It is rare to find infected animals in the United States.
What are the symptoms of anthrax?
Symptoms of disease vary depending on how the disease was contracted, but symptoms usually occur within 7 days.
• Cutaneous: Most (about 95%) anthrax infections occur when the bacterium enters a cut or abrasion on the skin, such as when handling contaminated wool, hides, leather or hair products (especially goat hair) of infected animals. Skin infection begins as a raised itchy bump that resembles an insect bite but within 1-2 days develops into a vesicle and then a painless ulcer, usually 1-3 cm in diameter, with a characteristic black necrotic (dying) area in the center. Lymph glands in the adjacent area may swell. About 20% of untreated cases of cutaneous anthrax will result in death. Deaths are rare with appropriate antimicrobial therapy.
• Inhalation: Initial symptoms may resemble a common cold. After several days, the symptoms may progress to severe breathing problems and shock. inhalation anthrax is usually fatal.
• Intestinal: The intestinal disease form of anthrax may follow the consumption of contaminated meat and is characterized by an acute inflammation of the intestinal tract. Initial signs of nausea, loss of appetite, vomiting, fever are followed by abdominal pain, vomiting of blood, and severe diarrhea. Intestinal anthrax results in death in 25% to 60% of cases.
Where is anthrax usually found?
Anthrax can be found globally. It is more common in developing countries or countries without veterinary public health programs. Certain regions of the world (South and Central America, Southern and Eastern Europe, Asia, Africa, the Caribbean, and the Middle East) report more anthrax in animals than others.
Can anthrax be spread from person-to-person?
Anthrax is not known to spread from one person to another person. Communicability is not a concern in managing or visiting with patients with inhalation anthrax.
Is there a way to prevent infection?
In countries where anthrax is common and vaccination levels of animal herds are low, humans should avoid contact with livestock and animal products and avoid eating meat that has not been properly slaughtered and cooked. Also, an anthrax vaccine has been licensed for use in humans. The vaccine is reported to be 93% effective in protecting against anthrax.
What is the anthrax vaccine?
The anthrax vaccine is manufactured and distributed by BioPort, Corporation, Lansing, Michigan. The vaccine is a cell-free filtrate vaccine, which means it contains no dead or live bacteria in the preparation. The final product contains no more than 2.4 mg of aluminum hydroxide as adjuvant. Anthrax vaccines intended for animals should not be used in humans.
Who should get vaccinated against anthrax?
The Advisory Committee on Immunization Practices has recommended anthrax vaccination for the following groups:
• Persons who work directly with the organism in the laboratory
• Persons who work with imported animal hides or furs in areas where standards are insufficient to prevent exposure to anthrax spores.
• Persons who handle potentially infected animal products in high-incidence areas. (Incidence is low in the United States, but veterinarians who travel to work in other countries where incidence is higher should consider being vaccinated.)
• Military personnel deployed to areas with high risk for exposure to the organism (as when it is used as a biological warfare weapon).
The Anthrax Vaccine Immunization Program in the U.S. Army Surgeon General's Office can be reached at 1-877-GETVACC (1-877-438-8222).
Pregnant women should be vaccinated only if absolutely necessary.
What is the protocol for anthrax vaccination?
The immunization consists of three subcutaneous injections given 2 weeks apart followed by three additional subcutaneous injections given at 6, 12, and 18 months. Annual booster injections of the vaccine are recommended thereafter.
Are there adverse reactions to the anthrax vaccine?
Mild local reactions occur in 30% of recipients and consist of slight tenderness and redness at the injection site. Severe local reactions are infrequent and consist of extensive swelling of the forearm in addition to the local reaction. Systemic reactions occur in fewer than 0.2% of recipients.
How is anthrax diagnosed?
Anthrax is diagnosed by isolating B. anthracis from the blood, skin lesions, or respiratory secretions or by measuring specific antibodies in the blood of persons with suspected cases.
Is there a treatment for anthrax?
Doctors can prescribe effective antibiotics. To be effective, treatment should be initiated early. If left untreated, the disease can be fatal.
Where can I get more information about the recent Department of Defense decision to require men and women in the Armed Services to be vaccinated against anthrax?
The Department of Defense recommends that servicemen and women contact their chain of command on questions about the vaccine and its distribution. The Anthrax Vaccine Immunization Program in the U.S. Army Surgeon General's Office can be reached at 1-877-GETVACC (1-877-438-8222).
References
1. ^ Milton Friend, USGS Emeritus Scientist. Founding Director, USGS National Wildlife Health Center.
Further Reading
Citation
USGS::USDA::CDC (Content Source);Sidney Draggan Ph.D. (Topic Editor) "Anthrax". In: Encyclopedia of Earth. Eds. Cutler J. Cleveland (Washington, D.C.: Environmental Information Coalition, National Council for Science and the Environment). [First published in the Encyclopedia of Earth August 21, 2008; Last revised Date August 21, 2008; Retrieved May 18, 2013 <http://www.eoearth.org/article/Anthrax>
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:23:10.000Z
|
mdctsi4b2trky2dgi7stcvfqw2thyvsa
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52168",
"uncompressed_offset": 386276943,
"url": "www.familysearch.org/learn/wiki/en/FamilySearch_Wiki:Format_for_Citing_and_Linking_to_Works_in_FHLC,_Worldcat_%28OCLC%29",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/FamilySearch_Wiki:Format_for_Citing_and_Linking_to_Works_in_FHLC,_Worldcat_(OCLC)"
}
|
cccc_CC-MAIN-2013-20
|
FamilySearch Wiki:Format for Citing and Linking to Works in FHLC, Worldcat (OCLC)Edit This Page
From FamilySearch Wiki
If a work is available in both WorldCat and FHLC, both references should be given with OCLC reference first and FHLC reference second, in this format:
Grenham, John. Tracing Your Irish Ancestors: The Complete Guide. Dublin, Ireland: Gill and Macmillan, 1992. (WorldCat 68627254; FHL 941.5 D27gj.)
For more information, see the discussion page.
Related Pages
Manual of Style
• This page was last modified on 7 January 2011, at 07:31.
• This page has been accessed 394 times.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:22:54.000Z
|
cp6e5i4mkn53gkadi6wsmnka7uapsden
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52169",
"uncompressed_offset": 386287703,
"url": "www.familysearch.org/learn/wiki/en/Magheraculmoney,_Fermanagh",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Magheraculmoney,_Fermanagh"
}
|
cccc_CC-MAIN-2013-20
|
Magheraculmoney, FermanaghEdit This Page
From FamilySearch Wiki
Ireland County Fermanagh Magheraculmoney Civil Parish
The following information is a starting point for records about the civil parish of Magheraculmoney. The information is based on locations and records before 1922.
Contents
Historical Overview
History
Add a brief statement about historical background, including a Web site link if available.
Localities
List the names of townlands in this civil parish List the names of the surrounding parishes List the names and give a description of a district, poor law union, etc.
Maps and gazetteers
Add a Web site link for a map or gazetteer site, and/or add a printed source. Read more about maps and gazetteers.
Records
Cemeteries
Add references to indexes to gravestones or monumental inscriptions.
Census
The purpose of a census was to gather information about people who lived in an area. While the government began census taking in 1821, only fragments exist before 1901. Censuses for 1901 and 1911 are available. Read more about the records in the Ireland Census article.
Add information here about census substitutes that you know about.
Church records
Read general information about church records.
Catholic
Name(s) of ecclesiastical parish, records, availability, archive, online indexes, notes.
Church of Ireland
Name(s) of ecclesiastical parish, records, availability, archive, online indexes, notes.
Presbyterian
Name(s) of ecclesiastical parish, records, availability, archive, online indexes, notes.
Methodist
Name(s) of ecclesiastical parish, records, availability, archive, online indexes, notes.
Society of Friends
Name(s) of ecclesiastical parish, records, availability, archive, online indexes, notes.
Others
Name(s) of ecclesiastical parish, records, availability, archive, online indexes, notes.
Civil Registration
Government registration of births and deaths began in 1864. Registration of Protestant marriages began in 1845, with all marriages being registered by 1864. Go to the Ireland Civil Registration article to read more about these records.
Land records
The Registry of Deeds started in 1708. Land transactions were recorded, including immovable property passed on in a will and property given to a daughter at her marriage. Read more about these records in the Ireland Land and Property article.
Probate records
Probate dealt with the property of a deceased person. Read more about these records in the Ireland Probate Records article.
Add information about probate records for this parish.
School records
Read more about these records in the Ireland Schools article. Add records for this parish.
Tax records
The valuation of property for tax purposes was started in the 1840s by Richard Griffith. A tax paid to the church, call Tithe Applotments, began in the 1820s. Read about these records in the Ireland Taxation and Ireland Land and Property articles. Add records for this parish that you know about.
Web Sites
Add a site for this civil parish.
Further Reading
Add sources here.
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 1 July 2010, at 20:55.
• This page has been accessed 365 times.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:51:11.000Z
|
kjvmn43refeo3exfl3hjvbp2xzvrvgv2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52170",
"uncompressed_offset": 400902647,
"url": "www.forensicswiki.org/w/index.php?action=history&title=User%3ACobalt2020",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.forensicswiki.org/w/index.php?title=User:Cobalt2020&action=history"
}
|
cccc_CC-MAIN-2013-20
|
Revision history of "User:Cobalt2020"
Jump to: navigation, search
Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
Personal tools
Namespaces
Variants
Actions
Navigation:
About forensicswiki.org:
Toolbox
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:46:55.000Z
|
vvehg4r6q36ulfvhj2uuwyyad4gyqpbg
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52171",
"uncompressed_offset": 400909674,
"url": "www.forensicswiki.org/wiki/Paraben",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.forensicswiki.org/wiki/Paraben's_Device_Seizure"
}
|
cccc_CC-MAIN-2013-20
|
Paraben's Device Seizure
From Forensics Wiki
Jump to: navigation, search
Paraben's Device Seizure is a handheld device for capturing the data on cell phones and PDAs. It uses a physical acquisition method. It supports phones made by LG, Motorola (including the iDen), Nokia, Siemens, Samsung, Sony-Ericsson, and the iPhone, although the amount of data acquired from the iPhone plug-in can vary depending on the version of the operating system and whether the phone has been unlocked using Jailbreaking software. The tool also supports GSM SIM cards with use of a SIM card reader. Paraben also sells such products.
The tool also supports PDAs running Palm OS, Windows CE, Pocket PC, and Windows Mobile, Blackberry, Symbian, and EPOC, although not all versions of all operating systems are supported.
The vendor claims the product can recover data from Garmin GPS devices, but this has not yet been verified.
External Links
Personal tools
Namespaces
Variants
Actions
Navigation:
About forensicswiki.org:
Toolbox
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:42:04.000Z
|
cit7lwus7vzasbcwy5627sesdencdrc4
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52187",
"uncompressed_offset": 431895480,
"url": "www.hindawi.com/journals/bmri/2010/527850/",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.hindawi.com/journals/bmri/2010/527850/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
Journal of Biomedicine and Biotechnology
Volume 2010 (2010), Article ID 527850, 13 pages
doi:10.1155/2010/527850
Review Article
Skeletal Muscle Insulin Resistance in Endocrine Disease
1Endocrine Unit, Second Department of Internal Medicine-Propaedeutic, Research Institute and Diabetes Center, Athens University Medical School, Attikon University Hospital, 1 Rimini Street, Haidari, 12 462, Athens, Greece
2Hellenic National Center for the Research, Prevention and Treatment of Diabetes and Its Complications (H.N.D.C), 3 Ploutarchou Street, 10675 Athens, Greece
Received 10 November 2009; Accepted 3 February 2010
Academic Editor: Guy M. Benian
Copyright © 2010 Melpomeni Peppa et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
We summarize the existing literature data concerning the involvement of skeletal muscle (SM) in whole body glucose homeostasis and the contribution of SM insulin resistance (IR) to the metabolic derangements observed in several endocrine disorders, including polycystic ovary syndrome (PCOS), adrenal disorders and thyroid function abnormalities. IR in PCOS is associated with a unique postbinding defect in insulin receptor signaling in general and in SM in particular, due to a complex interaction between genetic and environmental factors. Adrenal hormone excess is also associated with disrupted insulin action in peripheral tissues, such as SM. Furthermore, both hyper- and hypothyroidism are thought to be insulin resistant states, due to insulin receptor and postreceptor defects. Further studies are definitely needed in order to unravel the underlying pathogenetic mechanisms. In summary, the principal mechanisms involved in muscle IR in the endocrine diseases reviewed herein include abnormal phosphorylation of insulin signaling proteins, altered muscle fiber composition, reduced transcapillary insulin delivery, decreased glycogen synthesis, and impaired mitochondrial oxidative metabolism.
1. Introduction
Insulin resistance (IR) constitutes a common and broadly prevalent metabolic disorder, which seems to govern the pathophysiology of diabetes mellitus, metabolic syndrome, and obesity [1]. Furthermore, IR appears to be a clinically important manifestation of various endocrine diseases, including polycystic ovary syndrome (PCOS), thyroid and adrenal diseases, as well as their complications [25]. From a pathophysiological point of view, IR appears to be the end result of a complex interaction between genetic predisposition and environmental factors.
In general, IR indicates the presence of an impaired peripheral tissue response to endogenously secreted insulin. It is typically manifested as both decreased insulin-mediated glucose uptake (IMGU) at the level of adipose and skeletal muscle (SM) tissue, and as an impaired suppression of hepatic glucose output. A significant body of evidence supports the critical role of SM for the development of IR, most commonly through an interactive cross-talk with adipose and liver tissue [68].
2. Skeletal Muscle and Glucose Homeostasis
SM plays a crucial role in maintaining systemic glucose metabolism, accounting for 85% of whole body insulin-stimulated glucose uptake [7]. In SM, insulin stimulates glucose uptake by increasing the translocation of glucose transport molecules, mainly GLUT4, from intracellular vesicles to the cell surface [9]. This process is initiated upon binding of insulin to the transmembrane receptor and is mediated through an intracellular molecular signaling cascade, including the consecutive phosphorylation of several cytosolic proteins, such as insulin receptor substrate molecules (IRS), phosphatidylinositol 3-kinase (PI3K), and protein kinase B (PKB/Akt) [9]. To date, among the four different IRS molecules that have been cloned, IRS-1 and IRS-2 appear to be the predominant isoforms expressed in SM. IRS molecules serve as docking sites for specific signaling proteins, such as PI3K, and play a key role for downstream insulin signaling [9]. Recent studies have proposed four different PI3K isoforms in human SM, involved in the insulin-dependent PI3K signaling pathways [9]. These isoforms elicit different, rather specific, insulin-induced responses. Although the exact molecular link between PI3K and glucose transport has not been fully elucidated yet, protein kinase B (PKB) or Akt (Akt/PKB) and members of the protein kinase C (PKC) family have been suggested as important molecules in the metabolic pathway of insulin-signaling, leading ultimately to increased intracellular glucose transport [9].
The activated insulin-signaling cascade results in the release of GLUT4 from an intracellular reservoir compartment and its translocation and final fusion with the plasma membrane. This is the rate-limiting step for the uptake of glucose, which is transported across the plasma membrane and further processed by either oxidative (glycolysis) or nonoxidative pathways (glycogen synthesis) [9].
However, glucose disposal in SM is not entirely independent from the metabolic effects of insulin on other peripheral tissues, such as adipose tissue (AT). It seems that IR at the level of SM might be also secondarily induced to adipose tissue IR. More specifically, it has been shown that mice with AT-specific knockout of GLUT4 had an impaired IMGU in SM as well, despite preserved GLUT4 expression in this tissue [6]. Moreover, AT overexpression of GLUT4 reversed the impaired IMGU observed in SM-specific GLUT4 knockout mice, without concomitantly restoring glucose transport in SM [8]. These experimental findings have highlighted the importance of interactive communication (cross-talk) between AT and SM in terms of regulating glucometabolic balance.
3. Skeletal Muscle and Insulin Resistance
SM is a principal tissue responsible for IMGU which has recently gained a lot of interest, as a major site involved in peripheral IR. Most of the available data have derived from studies in type 2 diabetes mellitus (T2DM), where SM has emerged as an important insulin-resistant peripheral tissue, via molecular mechanisms that are currently being extensively investigated.
In vitro and in vivo data from humans and laboratory animals support a selective insulin-signaling defect at the level of glucose transport in SM. In type 2 diabetic patients, IMGU in SM has been found to be significantly reduced by about 50%, without clarifying whether this is a permanent defect or rather a short-term downregulation secondary to the diabetic state. Furthermore, an additional possible explanation for the development of IR in SM is related to specific alterations in the insulin-signal transduction pathway, including decreased IRS-1 protein content, impaired IRS-1 phosphorylation, reduced PI3K activity, or altered protein expression of the regulatory subunit of PI3K [9, 10]. Alterations in the expression or translocation of GLUT4 to the plasma membrane have been also implicated as potential pathogenetic mechanisms. However, whether these defects are actually a primary cause of IR or rather a secondary effect to an altered metabolic milieu remains still unresolved [11].
Despite the considerable body of evidence supporting the critical role of SM for the development of IR in many clinical entities, the exact underlying mechanisms have not been fully delineated and most commonly represent a complex interaction between multiple extrinsic and intrinsic factors.
3.1. The Role of Adipokines in Skeletal Muscle IR
Most commonly, IR in SM is considered to be the end result of a complex interaction involving several different tissues. AT can induce IR at the level of SM via secretion of adipokines, inflammatory mediators, and growth factors. Tumor necrosis factor (TNF-), adiponectin, and leptin are the main adipokines that appear to be implicated in the development of cross-communication between AT and SM.
TNF is the main autocrine/paracrine AT-derived factor, triggering the release of free fatty acids (FFAs) from AT into bloodstream circulation. This is mainly dependent on nuclear factor B (NFB) activation and is mediated by the suppression of many genes responsible for glucose and FFA uptake and utilization [12, 13]. TNF-mediated FFA release impairs insulin-signaling in insulin responsive peripheral tissues such as SM [10]. According to the lipid supply hypothesis, the increased FFA availability provides the predominant substrate for intermediate metabolism, resulting in increased NADH/NAD+ and acetyl-CoA/CoA ratios. Elevated FFA concentrations promote beta-oxidation, which diminishes glucose uptake and oxidation. In parallel, FFA clearance is decreased and their storage as triglyceride droplets in SM is significantly enhanced [14].
In addition, adiponectin, a protective adipokine secreted by adipocytes, plays a pivotal role for SM insulin sensitivity. Adiponectin stimulates FFA catabolism, either directly or indirectly through stimulation of PPAR nuclear receptors, and promotes a marked decrease of circulating FFA and glucose levels [15]. Last but not least, leptin, a hormone secreted predominantly by AT, acts both on hypothalamus and on target tissues including SM and is significantly involved in the regulatory mechanisms determining peripheral insulin action and sensitivity [16].
3.2. Defects in Skeletal Muscle Glycogen Synthesis
The primary site of postabsorptive glucose disposal is SM and the primary mechanism of glucose storage is through its conversion to glycogen. In states of IR, a deficiency in the nonoxidative glucose disposal has been primarily related to a defect in glycogen synthesis. Freymond et al. studied biopsies of vastus lateralis muscle, both before and during a hyperinsulinemic-euglycemic clamp, and demonstrated that human subjects with IR display decreased insulin-stimulated glycogen synthase activity [17]. This defect at the level of glycogen synthase activity and thus glycogen synthesis in SM, provides a further pathogenetic mechanism, underlying systemic and muscle IR.
3.3. Glucocorticoids and Muscle IR
Chronic glucocorticoid excess, a typical biochemical feature of Cushing’s syndrome, has been traditionally associated with IR in general. However, recent experimental observations suggest that glucocorticoids, as well as glucocorticoid receptor (GR) activity, can have adverse effects on peripheral insulin sensitivity. Reynolds et al., found increased GR mRNA levels and increased expression of glucocorticoid receptors in SM of men with IR and hypertension, implicating the dysregulation of glucocorticoid receptor expression and/or function as a possible underlying pathogenetic mechanism for IR in SM [18].
3.4. Skeletal Muscle Vascular Bed, Blood Flow, and Insulin Action
Insulin-mediated increased blood flow seems to be an important step for insulin delivery and glucose metabolism in peripheral tissues, including SM [19]. This theory was first introduced by Baron, et al. who showed a remarkable correlation between insulin-mediated whole body glucose uptake and leg blood flow over a broad spectrum of insulin sensitivities in normal and IR states [20]. These correlations were typically observed several hours after the initiation of an insulin clamp, namely, under steady state conditions [21, 22]. In addition, metacholine infusion increased leg blood flow and glucose uptake, while these were diminished after L-N-monomethyl arginine infusion [23]. The above observations support the important role of insulin-mediated blood flow for glucose uptake and insulin action.
Insulin regulates blood flow in peripheral tissues through a variety of mechanisms. Insulin induces dilatation of terminal arterioles and provides a constant rate of vasodilatation or vasoconstriction, in order to maximally extend the period of peripheral tissue perfusion. In this way, insulin enhances nutrient delivery and expands the surface area available for exchange of insulin, glucose, and other nutrients in peripheral tissues, including SM. Furthermore, after its binding to the receptor, insulin seems to promote its own translocation across the endothelial cell barrier [24]. Most of the research work in this field has been conducted on skin microvasculature [25], without, however, ensuring that the insulin-mediated vascular responses observed in skin reflect also those in SM. Although far more data need to be obtained, it is currently proposed that various factors impair the insulin-mediated vascular response and tissue delivery of nutrients such as glucose and insulin, mediating the process of IR in SM.
4. Muscle Insulin Resistance and Endocrine Disease
Although generalized and muscle IR remains a hot topic for the investigation of metabolic disease, it would be quite interesting to expand this research to a number of common and clinically relevant endocrine diseases, including PCOS, adrenal dysfunction, and thyroid disorders.
4.1. PCOS and Muscle IR
PCOS is a common endocrine disorder with a worldwide prevalence of 6%-7% among premenopausal women [26]. However, despite its steadily increasing prevalence, the fundamental underlying defect remains still speculative and seems to be multifactorial in origin. Beyond the reproductive abnormalities (chronic anovulatory dysfunction, infertility), women with PCOS display several metabolic abnormalities as well, including disorders of glucose metabolism and insulin action, which underlie the increased risk of developing impaired glucose tolerance and type 2 diabetes [27].
Women with PCOS exhibit basal hyperinsulinemia, decreased glucose-stimulated insulin release and IMGU, due to reduced hepatic insulin clearance and pancreatic cell dysfunction. In addition, they exhibit a generalized IR, which mainly involves an impaired insulin responsiveness of adipose tissue and SM [2, 28].
IR in PCOS is associated with a unique postbinding defect in insulin receptor signaling due to a complex interaction between intrinsic (genetically determined) and environmental factors [29]. It is supported that the disrupted insulin receptor tyrosine kinase activity in adipocytes and IRS-1-associated PI3K activity in SM are the key elements in the IR pathogenetic process [30]. In addition, extrinsic factors including inflammatory mediators, adipokines, androgens, free fatty acids (FFAs), amino acids, and increased glucose levels have been all implicated in the pathogenesis of IR in PCOS.
4.1.1. Adipokines, Inflammatory Mediators, FFAs, and Muscle IR in PCOS
In vitro studies have shown that cultured SM cells from women with PCOS display normal insulin sensitivity, while SM cells from in vivo studies in PCOS exhibit resistance to insulin, suggesting the important role of extrinsic factors in producing muscle IR in PCOS [28]. Among them, adipokines, TNF-, FFAs, amino acids, androgens, and increased glucose levels have been all postulated to be involved in the pathogenesis of IR in PCOS [31]. Increased TNF- levels and elevated plasma interleukin-6 (IL-6) concentrations have been consistently reported in both obese and normal weight women with PCOS, indicating the significant contribution of chronic low-grade inflammation to IR [32, 33]. As far as leptin is concerned, Pehlivanov and Mitkov reported higher serum leptin in PCOS demonstrating a positive correlation with IR, independently of markers of adiposity [34]. Data regarding adiponectin and resistin levels are rather conflicting in women with PCOS. These adipokines have been found either increased or conversely decreased, depending on the obesity status of the studied population [35, 36].
The existing data indicate that adipose tissue, which is also an insulin resistant site in PCOS, and especially when it is centrally accumulated, secretes increased levels of adipokines, FFA, and inflammatory mediators (TNF-, IL-6), which in turn promote IR at the level of SM via a vicious cycle. In particular, elevated FFA levels have been consistently suggested in PCOS, especially when increased visceral fat is also present. This was well described by Ek et al. who reported an increased rate of visceral fat lipolysis in PCOS, suggesting a genetically determined upregulation in visceral fat lipolysis, associated with a selective increase in the function of both protein kinase A (PKA) and hormone-sensitive lipase (HSL) [37]. It is obvious that the increased FFA influx has detrimental effects for insulin metabolic signaling in SM [28, 37].
4.1.2. Androgens and Muscle IR
Multiple studies suggest the association between androgen excess and IR in women with PCOS, but their cross-sectional nature does not allow safe conclusions about causality [31].
On one hand, hyperandrogenemia in women with PCOS appears to be an effect of the augmented steroidogenesis by hyperinsulinemia secondary to IR [38, 39]. On the other hand, hyperandrogenemia induces generalized and muscle IR, through either a direct effect of androgens on insulin action in AT and SM, or indirectly by affecting lipid metabolism and body fat distribution [31]. Hyperandrogenemia-induced IR is selective, affecting mainly the metabolic but not the mitogenic actions of insulin, since insulin-stimulated ovarian steroidogenesis is perfectly maintained [40]. Androgen excess has been associated with some of the typical insulin-signaling defects in PCOS [41]. Most of these effects have been mostly studied in female rats, while there is a relative paucity of similar clinical studies. Testosterone administration to female adult rats for 8–12 weeks caused hyperinsulinemia in both intact and ovariectomized animals [42], while in the latter it induced a 50% reduction in IMGU into SM. Impaired SM insulin action was combined with fewer type 1 muscle fibers (slow twitch, oxidative) and increased type 2 fibers (fast twitch, insulin resistant). In the same study, a decreased SM capillary density and an impaired muscle glycogen synthase activity were also reported, contributing to the observed IR of SM [43]. It seems that postinsulin receptor signaling events are involved in testosterone-induced IR in SM in this rat model. In support of this, experimental data in primary differentiated rat myotubes have demonstrated a synergistic interaction between testosterone and insulin in phosphorylation of intracellular signaling proteins (phosphorylation of IRS-1 at serine residues), resulting in a dissociation of insulin receptor from the PI3K signaling cascade and an impaired insulin metabolic signaling [44].
Summarizing the existing data, androgens promote IR at the tissue level of SM by reducing capillary network formation for adequate delivery of insulin to SM, switching muscle fiber isoforms, reducing glycogen synthase activity and impairing insulin-mediated GLUT4 plasma membrane translocation [44].
However, the finding of hyperinsulinemia in PCOS patients raises the questions what the cause is and what the effect is. Most of the existing clinical data suggest, without providing definitive confirmation, that hyperinsulinemia causes hyperandrogenism, more than the other way around [45].
4.1.3. Molecular Defects and Muscle IR in PCOS
(a) In Vitro and In Vivo Studies
Current evidence suggests that excessive serine phosphorylation of the insulin receptor or downstream signaling molecules plays a pivotal role for the pathogenesis of muscle IR in PCOS [46]. In vitro studies in cultured SM cells from obese and nonobese patients with PCOS reported an abnormal phosphorylation pattern, consisting in decreased tyrosine autophosphorylation of the insulin receptor and increased serine phosphorylation, similarly to the phosphorylation abnormalities observed in PCOS cultured skin fibroblasts [46].
Corbould et al. who studied cultured SM cells of obese nondiabetic women with PCOS and of age- and BMI-matched control women, did not observe a decrease in IMGU and basal autophosphorylation in vitro, while insulin-stimulated tyrosine phosphorylation of the insulin receptor was found to be normal [29]. Moreover, the protein expression of insulin receptor subunit, IRS-2, PI3K, and GLUT4 was similar to that of controls. However, a number of molecular signaling abnormalities were documented including a 35% increased expression and a two-fold increased constitutive phosphorylation of IRS-1 at serine 312, decreased IRS-1-associated PI3K activity after adjusting for the increased expression of IRS-1, decreased baseline IRS-2-associated PI3K activity, a tendency for decreased insulin-stimulated IRS-2-associated PI3K activity, and higher GLUT1 expression, being positively correlated with increased basal glucose uptake in PCOS SM [29]. The apparently normal insulin response of PCOS SM in terms of glucose uptake is possibly attributed to the increased IRS-1 and GLUT1 expression. Furthermore, the fact that IMGU is maintained in vitro but significantly impaired in vivo indicates that IR is not an intrinsic feature in PCOS SM but is greatly influenced by adverse in vivo environmental conditions.
A putative serine kinase, extrinsic to the insulin receptor, has been implicated in the abnormal pattern of phosphorylation in PCOS but has not been identified yet. Although there are at least 50 known potential serine/threonine phosphorylation sites on IRS-1, phosphorylation at both serine 312 and serine 636/639 has been frequently reported in several studies associating IRS-1 serine phosphorylation with IR [47].
The defective activation of aPKC (atypical protein kinase C), a downstream effector of PI3K, in SM of PCOS obese patients has been also involved in the pathogenesis of muscle IR in this syndrome. In humans, marked defects in aPKC activation in SM have been reported in T2DM, obesity, obesity-associated PCOS, and impaired glucose tolerance [48]. These defects in aPKC activation in SM are due to both impaired activation of IRS-1-dependent PI3K and diminished responsiveness of aPKCs to a lipid product of PI3K, called PI-3,4,5-(PO4)3 or PIP3. Although it is still uncertain which underlying defect comes first, the resultant defect in aPKC activation in SM contributes significantly to the development of muscle IR [48].
Despite the well established identification of several molecular abnormalities in PCOS, it remained initially unclear whether the observed defects in insulin-signaling are actually intrinsic, genetically determined to SM, or rather acquired secondary to exposure to in vivo environmental factors such as hyperinsulinemia, hyperandrogenemia, increased circulating FFAs, or sustained hyperglycemia. According to Corbould et al. muscle IR is not an intrinsic feature in PCOS but appears rather to be significantly influenced by endogenous environmental factors [29].
Indeed, exposure to a number of molecules, including FFA, TNF-, glucose, amino acids, diacylglycerol (DAG), and fatty acyl-CoA, increases serine phosphorylation of IRS-1 and results in impaired insulin-signaling. These molecules are thought to act on IRS-1 through a variety of serine/threonine kinases including mTOR (mammalian target of rapamycin) and S6K. More specifically, FFA reduce IRS-1-associated PI3K activity, impair Akt/PKB phosphorylation, and activate PKCθ (protein kinase C theta), a serine kinase that increases serine phosphorylation of IRS-1 [28]. Concerning diacylglycerol, a potent activator of PKC, it is thought to be an additional important lipid mediator of muscle IR [49]. High insulin levels can also stimulate IRS-1 serine phosphorylation in human myoblasts, indicating that insulin can modulate its own signaling pathway [44]. Androgen excess induces muscle IR in PCOS by affecting, most possibly, postinsulin receptor signaling events. Recent in vitro data, in primary differentiated rat myotubes, have demonstrated a synergistic interaction between testosterone and insulin in phosphorylation of intracellular signaling proteins (phosphorylation of IRS-1 at serine residues) and a consequent dissociation of the insulin receptor from the PI3K signaling cascade, resulting in impaired insulin metabolic signaling [44].
(b) Human Studies
In vivo studies of PCOS patients, where serial SM biopsies were performed during hyperinsulinemic-euglycemic clamps, have revealed a significant impairment in IMGU, an increased expression of IRS-2, and normal expression of insulin receptor, IRS-1, and PI3K. These data suggest that the increased expression of IRS-2 might represent a compensatory adaptation for the decreased insulin-mediated IRS-1-associated PI3K activity, which is not, however, completely effective, since IMGU was not restored to normal [50]. Most recently, Hojlund et al. reported small reductions in insulin-stimulated phosphorylation of Akt (PKB) and AS160 (Akt substrate of 160 kDa) in intact muscle of women with PCOS, which was partially reversed by treatment with insulin-sensitizing agents such as pioglitazone [51].
Recently, another candidate pathogenetic mechanism for muscle IR in women with PCOS has been proposed, consisting in a defective insulin regulation of ERK 1/2 (extracellular signal-regulated kinases 1/2). Rajkhowa et al. compared the relative contribution of two distinct insulin-signaling pathways to muscle IR in nine women, diagnosed with PCOS. The study involved the Ras-ERK and the IRS-PKB pathways, mediating the mitogenic and metabolic effects of insulin, respectively, and found no significant difference in the expression, basal activity, or insulin activation of IRS-1 and PKB between PCOS subjects and controls [52]. However, there was a severe attenuation of insulin stimulation of the ERK pathway and an accompanying trend for higher basal phosphorylation of ERK 1/2 in SM biopsies obtained from nearly all women with PCOS [52]. Interestingly, the investigators observed a reduced ERK activity after acute in vivo exposure of SM to insulin, in almost all PCOS subjects of the study, contrasting with the physiologically expected increase in mitogenic ERK activity, in response to insulin stimulation. These results suggest that ERK activation might influence regulation of glucose uptake in SM and might be involved in muscle IR in women with PCOS [52].
Based on the few existing human in vivo studies, it seems that in PCOS there is a severe functional defect in the insulin-signaling cascade within SM, consisting in an abnormal phosphorylation pattern of the insulin receptor or downstream key signaling proteins.
4.1.4. Transcriptional Defects Involved in Muscle IR in PCOS
It has been recently demonstrated that PCOS is associated with impaired mitochondrial structural integrity and oxidative metabolism. Skov et al. studying insulin resistant women with PCOS, demonstrated a significant downregulation of the expression of nuclear-encoded genes representing mitochondrial oxidative phosphorylation, ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation (OXPHOS), compared to control women. This effect was mainly mediated by a decrease in PGC-1a expression (PPAR- coactivator-1a) and was partially restored after treatment with pioglitazone [53]. Thus, the insulin-sensitizing effects of pioglitazone may include reversal of preexisting abnormalities in ribosomal protein biosynthesis and mitochondrial biogenesis in women with PCOS [54].
Calcium transporter activity was also significantly downregulated in PCOS patients. Increasing evidence supports a modulating role for calcium influx, calmodulin and /calmodulin-dependent protein kinase (CaMK) in IMGU in SM [55]. An increase in cytosolic calcium and activation of CaMK induce mitochondrial biogenesis and GLUT4 expression via activation of different transcription factors, including NRF-1 and -2 (nuclear respiratory factor) and the coactivator PGC-1a [56]. Any potential dysregulation of calcium homeostasis could, therefore, have a pronounced disturbing effect on IMGU and mitochondrial functional capacity [57].
Future studies, unraveling the exact molecular mechanisms of IR in general or in SM in particular in PCOS, may help develop effective gene-based strategies in order to prevent the increased risk of early onset type 2 diabetes in women suffering from this condition.
4.2. Adrenal Disorders and Muscle IR
Adrenal disorders characterized by increased secretion of adrenocortical or adrenomedullary hormones such as hyperaldosteronism, Cushing’s syndrome, hyperandrogenism, and pheochromocytoma have been associated with various metabolic disorders, including impaired glucose tolerance, IR, and overt diabetes [58]. These abnormalities constitute the end result of the adverse effects of adrenal hormones on various components of insulin action and glucose metabolism.
Adrenal hormone excess is associated with decreased insulin secretion by the pancreatic cell or disrupted insulin action in peripheral tissues. SM has been recently recognized as an important insulin-target site with a major role in the pathogenesis of the glucometabolic abnormalities associated with hypersecreting adrenal disorders [59].
4.2.1. Aldosterone Excess and Muscle IR
Aldosterone is the final mediator of the renin-angiotensin-aldosterone system (RAS), which mediates blood pressure control and electrolytic balance in the kidney. However, a significant body of evidence indicates that aldosterone—in concert with other independently acting mediators of RAS axis (renin and angiotensin)—impairs insulin secretion and metabolic signaling, resulting in impaired glucose tolerance and overt diabetes. Focusing on aldosterone, which can be significantly elevated in some patients with hypersecreting adrenal lesions, it promotes IR, inflammation, fibrosis, oxidative stress, and sodium retention, with detrimental cardiometabolic effects [60]. Recent literature data support that most of the adverse metabolic changes observed in primary hyperaldosteronism can be totally reversed after the surgical removal of the adrenal tumors or treatment with mineralocorticoid receptor blocking agents [61].
Mounting evidence supports that aldosterone exerts its diabetogenic actions by a direct effect on insulin receptor function and metabolic signaling cascade in several peripheral tissues, including cardiovascular and renal tissue, fat, liver and SM [60]. In addition, hypokalemia, as a result of aldosterone excess, can also impair both pancreatic insulin secretion and peripheral insulin action, providing an alternative explanation for the observed abnormalities in primary hyperaldosteronism [62].
However, the underlying molecular and cellular mechanisms linking aldosterone excess with changes in the glucose and insulin metabolism remain still elusive, especially regarding the contribution of SM.
In addition to its classic effects, aldosterone induces rapid (nongenomic) adverse responses in both vascular smooth muscle cells and SM. This effect is mediated by NADPH oxidase (nicotinamide adenine dinucleotide phosphate), which generates excess reactive oxygen species (ROS), redox imbalance, and oxidative stress [63]. Oxidative stress activates redox-sensitive serine kinases in these tissues, including PKC (protein kinase C), MAPKs (mitogen-activated protein kinases), c-Jun NH2-terminal kinase, extracellular signal-regulated kinases 1 and 2 (ERK 1/2), and p-kinase. The activation of these kinases leads to increased serine phosphorylation of IRS-1, which impairs normal binding with PI3K and results in decreased activation of PKB (Akt) and adverse downstream metabolic effects such as impaired glucose transport in many tissues, including SM [64]. This effect is further substantiated by the significant improvement in systemic insulin sensitivity, insulin-signalling, and glucose uptake by SM, after treatment with mineralocorticoid receptor blocking agents in experimental animal models of RAS hyperactivation and IR [65]. The improvement in insulin sensitivity was closely associated with decreased NADPH oxidase activity in SM, suppressed levels of ROS, and improved mitochondrial structure and function. In addition, in rat vascular smooth muscle cells, aldosterone downregulated IRS-1 expression via stimulating the production of ROS, an effect which was markedly attenuated by treatment with the selective mineralocorticoid receptor antagonist eplerenone [66].
4.2.2. Glucocorticoid Excess and Muscle IR
Chronic exposure to glucocorticoid excess, a typical feature of Cushing’s syndrome, is associated with various metabolic disorders, including glucose intolerance, IR, or overt diabetes [67]. Glucocorticoids (GCs) interfere with several steps of glucose metabolism and insulin-signaling cascade, resulting in reduced IMGU and IR in most peripheral tissues, including SM. GCs may induce IR, either directly by interfering with the insulin receptor cascade in SM, or indirectly through GC-induced changes in protein and lipid metabolism [67].
Since studies into the effects of GCs on the expression of insulin receptor in SM have yielded contradictory results, the markedly reduced IMGU under conditions of GC excess has been proposed as a postreceptor defect. In vitro studies using isolated SM cells treated with dexamethasone showed a decreased expression and phosphorylation of IRS-1, PI3K, and PKB/Akt as well as reduced GLUT4 migration to the cell surface [68, 69]. In addition to reducing glucose uptake, GCs have also been shown to decrease glycogen synthesis rate in Wistar rats by reducing PKB/Akt and GSK-3 (glycogen synthase kinase-3) phosphorylation [70]. Beyond experimental results, there are limited available data concerning the exact molecular effects of GCs on insulin-signaling in humans. As early as in 1988, Rebuffé-Scrive, was the first investigator who studied in detail the morphology and metabolism of SM in female patients with Cushing’s syndrome [71]. In his study, leg muscle tissue of women with Cushing’s syndrome was found to contain a relatively low proportion of type I fibers (insulin sensitive) and a high proportion of type IIb fibers (insulin resistant), a similar pattern of muscle fiber composition to that observed in android obesity. He also found a significantly low glycogen synthase activity in the lateral vastus muscle of the same women. This is the first study suggesting an abnormal muscle fiber composition (relative shift from type I to type IIb fibers) in a common clinical condition of chronic endogenous corticosteroid excess. In addition, healthy volunteers treated with dexamethasone for 5 days and patients exposed to long-term high-dose GCs after renal transplantation, displayed reduced glycogen synthesis rates with concomitant decreased concentration and activity of glycogen synthase in SM biopsies [72].
Some data support an indirect effect of GS on SM insulin-signaling, which is mediated through enhanced proteolysis, and thus increased circulating amino acid levels. Elevated circulating amino acids seem to inhibit insulin-stimulated IRS tyrosine phosphorylation and activation of PI3K in vitro [73]. In addition, they reduce IMGU and glycogen synthesis in humans [74].
Another indirect negative effect of GCs on SM insulin sensitivity appears to be mediated through the GC-induced dyslipidemia. GCs promote whole body lipolysis, resulting in increased plasma levels of FFAs, which enhance in turn the accumulation of intramyocellular lipids (IMCLs), such as fatty acyl CoA, diacylglycerol, and ceramide, affecting negatively glucose uptake and disposal [75]. It was originally proposed by Randle in 1963 that intracellular lipids decrease insulin-mediated glucose uptake by competing with glucose for oxidation [76]. However, more recent studies have demonstrated that IMCLs reduce IMGU by interfering directly with insulin-signaling. Intracellular lipids may activate various serine kinases, such as c-Jun aminoterminal kinase (JNK) and IKB kinase (IKK), which phosphorylate serine sites on IRS-1, resulting in suppressed insulin-signaling [75].
In summary, GCs reduce insulin sensitivity and consequently IMGU in SM, not only by directly perturbing insulin-signaling and glycogen synthesis, but also secondarily to unfavorable changes in protein and lipid metabolism, which further affect negatively the insulin-signaling cascade, in peripheral tissues, including SM.
4.2.3. Adrenal Androgens and Muscle IR
The exact relationship between increased adrenal androgens and IR remains to be elucidated. It has been shown that experimentally induced hyperinsulinemia elicited an acute decline in dehydroepiandrosterone (DHEA) and dehydroepiandrosterone sulfate (DHEA-S). However, the regulatory role of insulin on adrenal androgen production and metabolism in normal physiology or disease remains still speculative [58]. In several animal models, DHEA appears to exert potent antiobesity and antidiabetogenic actions, but such effects have not been persuasively demonstrated in humans [58]. Human studies on DHEA are limited, and more research needs to be conducted in order to determine whether the experimental observations made in animal models can be also extrapolated to man. Recent experimental evidence indicates that DHEA may act at multiple steps in the regulation of glucose metabolism in the liver, suppressing the activity of hepatic gluconeogenic enzymes [77]. However, there are no data concerning the relationship of increased adrenal androgen production and peripheral insulin action, especially at the level of SM.
4.2.4. Catecholamine Excess and Muscle IR
Pheochromocytoma, typically characterized by endogenous catecholamine excess, is associated with several glucometabolic abnormalities, ranging from impaired glucose tolerance (25%–75%) to overt diabetes [78]. The main underlying pathogenetic mechanism for pheochromocytoma-associated glucose dysmetabolism is the catecholamine-induced decreased insulin secretion through a2 adrenoreceptors, while the effects of catecholamines on peripheral glucose uptake seem to be less important [79]. However, in animal studies, epinephrine has been shown to induce IR in rat muscle [80]. Furthermore, Raz et al. [81] studied the effect of epinephrine in eight healthy patients and detected an inhibition of insulin-mediated glycogenesis because of an inactivation of glycogen synthase, suggesting that epinephrine inhibits insulin-mediated glucose utilization at the major site of IR namely, skeletal muscle. An additional study by Laakso et al. showed that epinephrine impairs the ability of insulin to increase SM glucose extraction in humans [82].
In summary, excessive catecholamines in patients with pheochromocytoma can induce or aggravate IR in peripheral tissues including SM, while the surgical treatment of pheochromocytoma can reverse the hyperinsulinemia and cardiometabolic abnormalities observed in these patients [79].
4.2.5. Adrenal Incidentalomas and IR
Adrenal incidentalomas (AIs) are defined as randomly discovered adrenal masses, which are diagnosed by abdominal ultrasound or computed tomography scan, performed for unrelated causes. Recent literature suggests that 10%–20% of solid AIs demonstrate a subclinical hormonal dysfunction, which may place patients at a higher risk for metabolic derangements such as IR [83]. Subclinical hypercortisolism is the most common abnormality detected in patients with AIs, with an average incidence of 9% [84]. Patients with AIs have a higher prevalence of diabetes or glucose intolerance (20%–75%), compared with the general population [85]. AIs are considered to be both a cause and an effect of hyperinsulinemia. The alternative hypothesis that AIs are actually caused by hyperinsulinemia has been formulated by Reincke et al. [86], who studied 13 patients with AIs and found that they were all insulin resistant. He also observed a proliferative effect of insulin on adrenal cell lines in vitro, indicating that insulin can stimulate adrenocortical tumor formation. The proposed theory was that AIs can be perceived as the clinical result of sustained hyperinsulinemia, just as PCOS is regarded as the result of insulin-mediated stimulation of ovary growth [86].
In a study from Japan, all 12 patients with AIs exhibited IR, based on the steady state of plasma glucose [87]. After surgical removal of the tumors, steady state of plasma glucose was significantly decreased, compared to pre-adrenalectomy values. A further study by Ivovic et al. assessed insulin sensitivity in 22 patients with AIs and concluded that patients with AIs manifested lower insulin sensitivity than healthy controls [88].
Trying to provide an explanation for the increased risk of developing IR in patients with nonfunctioning AIs (NFAIs), Ermetici et al. have recently formulated the hypothesis of adipokine involvement [89]. Plasma IL-6, adiponectin, resistin, TNF-a, and monocyte chemoattractant protein 1 (MCP-1) levels were all found to be significantly higher in patients with NFAIs compared to controls. The pathogenetic role of proinflammatory cytokines in patients with AIs merits definitely further investigation.
In a recent study by our research team [90], in 29 patients with NFAIs, we demonstrated significant hepatic and peripheral IR, documented by both higher fasting glucose and insulin levels and abnormal glucose tolerance data, as well as an increased prevalence of several components of metabolic syndrome, such as hypertension, dyslipidemia, fatty liver disease, and central obesity. It is, therefore, useful to evaluate routinely IR in patients with AIs, since results can be quite helpful in clinical decision making [87].
4.3. Thyroid Disorders and Muscle IR
Thyroid hormones (THs) constitute important mediators of body metabolism and affect various metabolic aspects involving glucose and insulin metabolism, through a variety of mechanisms. Data from animal studies have shown that THs play a key role in the regulation and activation of insulin receptor and glucose transporter proteins, in signaling pathways and in the expression of different isoforms of SM myosin heavy chains [91]. In addition, THs regulate the differentiation, growth, and metabolism of virtually every cell in the human body. In SM, triiodothyronine (T3) regulates muscle fiber type and mitochondrial content through a genomic action, consisting in a direct modulation of gene transcription by ligand-dependent activation of TH receptors (TRs) and specific TH response elements (TREs). Other TH effects, such as modulation of ion channel activity, intracellular mobilization, phospholipase, and kinase activation, have been attributed to nongenomic actions of TH. This mode of action explained the TH-induced activation of a signaling cascade involving phospholipase C activation, inositol triphosphate (IP3) accumulation, intracellular mobilization and phosphorylation of PKC and ERK 1/2, resulting ultimately in activation of plasma membrane exchangers and increased intracellular pH in rat SM cells [92]. Furthermore, with the same mode of action, induces a rapid phosphorylation of both p38 and AMPK (AMP-dependent kinase) in SM fibers and stimulates mitochondrial biogenesis [93].
4.3.1. Hypothyroidism and Muscle IR
Hypothyroidism (HP) has been associated with disorders of glucose and insulin metabolism, involving defective insulin secretion in response to glucose, hyperinsulinemia, altered peripheral glucose disposal, and IR.
According to in vivo data, HP is associated with a decreased glucose-induced insulin secretion by the cells due to changes in the physicochemical properties of the islet membranes and decreased amount of islets [94].
In addition, it is suggested that HP is an insulin resistant state. Interestingly, even subtle decreases in the levels of TH within the normal range have been shown to correlate inversely with markers of IR [95]. In vivo data, emerging from studies in propylthiouracil-induced hypothyroid animals during euglycemic-hyperinsulinemic clamps, showed an association of HP with an adipokine-mediated IR [96]. Mitrou et al. showed that euglycemic patients with clinical and subclinical HP were insulin resistant. In a recent study, the same authors supported the important role of adipokines in IR, showing a meal-induced IL-6 increase, primarily involved in the observed IR, and a concomitant increase of TNF-α, which seems to be the result rather the cause in this process [4].
The mechanisms linking HP with IR in general and in SM in particular are still under investigation. IR in HP is associated with a negative regulation of one or more intracellular enzymes involved in glucose catabolism [97]. An impaired translocation of GLUT4 transporters on the plasma membrane has been also observed in the monocytes of subjects with clinical and subclinical HP, in relation to a decreased IMGU [98]. Dimitriadis et al. documented a decreased glycogen synthesis rate at supraphysiological insulin concentrations in SM of hypothyroid rats, as well as a decreased rate of glucose oxidation at all insulin concentrations [99, 100]. An effect of TH on insulin receptors has been suggested, but the existing data are rather conflicting, supporting either no relationship between thyroid status and the affinity of insulin receptors or diminished high affinity insulin receptors (HAIRs) in HP [101]. The effect of TH on insulin action in peripheral tissues such as SM has not been studied systematically in vivo. Dimitriadis et al. demonstrated a meal-induced increase in plasma insulin levels in subjects with HP and an unchanged rate of glucose uptake in the forearm muscles and AT, indicating that IR is possibly the result of diminished blood flow in AT and SM [96]. In support of this, Rochon et al. showed decreased forearm and AT blood flow and glucose disposal rates in patients with HP, during euglycemic-hyperinsulinemic clamps [102].
It is obvious that, although HP constitutes an insulin resistant state, more studies need to be done in order to clarify the underlying pathogenetic mechanisms. However, it has to be mentioned that IR appears to be similar in patients with overt clinical and subclinical HP [103, 104], while treatment with thyroxine does not restore IMGU in the forearm of patients with HP, suggesting that TH per se may not be entirely responsible for this manifestation, which seems to be a more complex interaction between tissues and molecules.
4.3.2. Hyperthyroidism and Muscle IR
Hyperthyroidism (HPR) is also associated with metabolic abnormalities, including disorders of the glucose and insulin metabolism [105].
Insulin secretory capacity seems to be disrupted in HPR, but the existing data are rather heterogeneous, suggesting increased, normal, or decreased insulin secretion. This estimation has been based on the measurement of circulating C-peptide levels. However, when individually derived C-peptide kinetic parameters were measured, the insulin secretory rate was significantly increased, possibly reflecting an increased response of cell to glucose, under increased TH levels. The limitation of these studies is the use of C-peptide as a marker of insulin secretion, which is biased, given its rapid clearance from the circulation in HPR [106]. However, an increase in the cell mass in HPR has been also reported [107]. In addition, Liggett et al. [108] showed an increased insulin secretory response to epinephrine (increased plasma C-peptide) after T3 administration, indicating an increased insulin secretory rate in HPR [108].
HPR has been also associated with hyperinsulinemia, which is considered to be compensatory for the increased insulin clearance [103, 104]. Insulin action and IMGU in HPR are ill defined, either in general, or in SM in particular. In vitro and in vivo studies of IMGU using euglycemic hyperinsulinemic clamps showed either normal or increased IMGU [109111]. However, IR has been documented in HPR, especially in the liver, since there is still uncertainty concerning the involvement of other peripheral tissues, including SM. Dimitriadis et al. documented IR at the fasting state in AT in HPR, which was suppressed postprandially, stimulating the glucose uptake in SM [112]. The same authors documented a postmeal induced hyperinsulinemia in subjects with HPR, as well as IR at the level of SM [113].
However, there are only few data regarding the underlying pathogenetic mechanisms of IR in HPR. The existing data regarding the number of high and low affinity insulin receptors are conflicting, suggesting either an increased or unaltered expression in HPR [114]. A decreased insulin stimulated glycogen synthesis has been also reported in SM from hyperthyroid subjects, indicating IR at the level of SM [103, 104]. Dimitriadis et al. documented a markedly decreased rate of IMGU in SM, which was compensated by an increase in blood flow, due to changes either in cardiac or in vascular function [113]. The same authors have demonstrated an IGF-1-induced increase in GLUT3 and GLUT4 translocation on the monocyte surface in HPR subjects [99].
A decreased insulin-mediated stimulation of major intracellular pathways of glucose metabolism has been also reported [99, 103, 109]. HPR has been associated with an increased activity and density of adrenergic receptor in SM [108, 115], as well as a decreased muscle oxidative capacity [116].
HPR is generally thought to be an insulin-resistant state, but further studies are definitely needed in order to prove this association and reveal the underlying pathogenetic mechanisms. It has been generally suggested that THs are not the only factors involved in the initiation of the IR cascade, but they most commonly interact with various tissues and molecules, in order to regulate glucose metabolism and insulin action.
5. Summary and Conclusions
SM constitutes an insulin-responsive peripheral tissue with a major role in maintaining systemic glucose metabolism. In a general overview of insulin-resistant states, including PCOS as well as adrenal and thyroid disorders, IR in SM appears to be a clinically important manifestation. Specific alterations at the insulin receptor level or the signal transduction pathway have been suggested as the main underlying pathogenetic mechanisms which lead to impaired IMGU and defective glycogen synthesis.
In PCOS, muscle IR has been associated with abnormal phosphorylation of insulin-signaling proteins, altered muscle fiber composition, reduced transcapillary insulin delivery, decreased glycogen synthesis, and impaired mitochondrial oxidative metabolism.
The metabolic abnormalities associated with hypersecreting adrenal disorders constitute the end result of the adverse effects of adrenal hormones on various components of insulin action and glucose metabolism. Aldosterone is associated with IR in SM either directly through its effects on the insulin receptor function and metabolic signaling cascade, or indirectly through oxidative stress induction. GCs reduce IMGU in SM, either directly by perturbing insulin-signaling and glycogen synthesis, or indirectly through unfavorable changes in protein and lipid metabolism. Catecholamine excess can induce or aggravate IR in SM. Furthermore, AIs—including NFAIs—are characterized by an increased prevalence of generalized and muscle IR, possibly due to the subclinical proinflammatory milieu and the biochemically silent endocrine abnormalities.
Thyroid disorders, including both hypo- and hyperthyroidism, have been associated with IR in SM and altered peripheral glucose disposal, due to impaired GLUT4 translocation, decreased glycogen synthesis, downregulated intracellular glucose catabolism, altered blood flow, and decreased muscle oxidative capacity.
Based on the data presented herein, it is strongly emphasized that all patients with common endocrine disorders such as PCOS as well as adrenal and thyroid disorders, should undergo a thorough metabolic evaluation, since IR—particularly at the level of SM—appears to be a prominent feature in these states. Far more clinical and experimental studies are required in order to fully clarify the underlying pathophysiology of the clinically meaningful relationship between endocrine disease and impaired SM insulin sensitivity.
List of Important Abbreviations
PCOS:Polycystic Ovary Syndrome
IR:Insulin Resistance
HP:Hypothyroidism
HPR:Hyperthyroidism
AIs:Adrenal Incidentalomas
NFAIs:Nonfunctioning Adrenal Incidentalomas
SM:Skeletal Muscle
AT:Adipose Tissue
IMGU:Insulin-mediated glucose uptake
GLUT4:Glucose Transporter 4
IRS-1:Insulin receptor substrate-1
PI3K:Phosphatidylinositol 3-kinase
Akt/PKB:Akt/Protein kinase B
aPKC:Atypical protein kinase C
GSK-3:Glycogen synthase kinase-3
ERK 1/2:Extracellular signal-regulated kinases 1/2
AS160:Akt substrate of 160 kDa
mTOR:mammalian Target Of Rapamycin
MAPKs:Mitogen-activated Protein Kinases
IP3:Inositol Triphosphate
AMPK:AMP-dependent kinase
PKA:Protein kinase A
HSL:Hormone-Sensitive Lipase
TNF-a:Tumor necrosis factor-a
FFA:Free Fatty Acid
Il-6:Interleukin-6
NFB:Nuclear Factor B
PPAR:Peroxisome-Proliferator Activated Receptor
PGC-1a:PPAR coactivator 1a
eNOS:Endothelial Nitric Oxide Synthase
NADPH:Nicotinamide Adenine Dinucleotide Phosphate
ROS:Reactive Oxygen Species
RAS:Renin-angiotensin-aldosterone system
OXPHOS:Oxidative Phosphorylation
GCs:Glucocorticoids
GRs:Glucocorticoid Receptors
THs:Thyroid Hormones
TRs:Thyroid hormone Receptors
TREs:Thyroid hormone response elements
DHEA:Dehydroepiandrosterone
IMCLs:Intramyocellular Lipids
HAIRs:High-Affinity Insulin Receptors.
References
1. D. B. Savage, K. F. Petersen, and G. I. Shulman, “Mechanisms of insulin resistance in humans and possible links with inflammation,” Hypertension, vol. 45, no. 5, pp. 828–833, 2005. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
2. A. Dunaif, “Insulin resistance and the polycystic ovary syndrome: mechanism and implications for pathogenesis,” Endocrine Reviews, vol. 18, no. 6, pp. 774–800, 1997. View at Publisher · View at Google Scholar · View at Scopus
3. E. Maratou, D. J. Hadjidakis, A. Kollias, et al., “Studies of insulin resistance in patients with clinical and subclinical hypothyroidism,” European Journal of Endocrinology, vol. 160, no. 5, pp. 785–790, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
4. P. Mitrou, E. Boutati, V. Lambadiari, et al., “Insulin resistance in hyperthyroidism: the role of IL-6 and TNFα,” European Journal of Endocrinology, vol. 162, p. 121, 2010. View at Publisher · View at Google Scholar · View at PubMed
5. C. Catena, R. Lapenna, S. Baroselli, et al., “Insulin sensitivity in patients with primary aldosteronism: a follow-up study,” Journal of Clinical Endocrinology and Metabolism, vol. 91, no. 9, pp. 3457–3463, 2006. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
6. E. D. Abel, O. Peroni, J. K. Kim, et al., “Adipose-selective targeting of the GLUT4 gene impairs insulin action in muscle and liver,” Nature, vol. 409, no. 6821, pp. 729–733, 2001. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
7. R. A. DeFronzo, E. Jacot, E. Jequier, E. Maeder, J. Wahren, and J. P. Felber, “The effect of insulin on the disposal of intravenous glucose. Results from indirect calorimetry and hepatic and femoral venous catheterization,” Diabetes, vol. 30, no. 12, pp. 1000–1007, 1981. View at Scopus
8. E. Carvalho, K. Kotani, O. D. Peroni, and B. B. Kahn, “Adipose-specific overexpression of GLUT4 reverses insulin resistance and diabetes in mice lacking GLUT4 selectively in muscle,” American Journal of Physiology, vol. 289, no. 4, pp. E551–E561, 2005. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
9. A. R. Saltiel and C. R. Kahn, “Insulin signalling and the regulation of glucose and lipid metabolism,” Nature, vol. 414, no. 6865, pp. 799–806, 2001. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
10. L. Pirola, A. M. Johnston, and E. Van Obberghen, “Modulation of insulin action,” Diabetologia, vol. 47, no. 2, pp. 170–184, 2004. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
11. J. R. Zierath, A. Krook, and H. Wallberg-Henriksson, “Insulin action and insulin resistance in human skeletal muscle,” Diabetologia, vol. 43, no. 7, pp. 821–835, 2000. View at Scopus
12. H. Ruan, N. Hacohen, T. R. Golub, L. Van Parijs, and H. F. Lodish, “Tumor necrosis factor-α suppresses adipocyte-specific genes and activates expression of preadipocyte genes in 3T3-L1 adipocytes: nuclear factor-κB activation by TNF-α is obligatory,” Diabetes, vol. 51, no. 5, pp. 1319–1336, 2002. View at Scopus
13. H. Ruan, P. D. G. Miles, C. M. Ladd, et al., “Profiling gene transcription in vivo reveals adipose tissue as an immediate target of tumor necrosis factor-α: implications for insulin resistance,” Diabetes, vol. 51, no. 11, pp. 3176–3188, 2002. View at Scopus
14. R. A. DeFronzo, R. Gunnarsson, O. Bjorkman, M. Olsson, and J. Wahren, “Effects of insulin on peripheral and splanchnic glucose metabolism in noninsulin-dependent (type II) diabetes mellitus,” Journal of Clinical Investigation, vol. 76, no. 1, pp. 149–155, 1985. View at Scopus
15. W.-S. Yang, W.-J. Lee, T. Funahashi, et al., “Weight reduction increases plasma levels of an adipose-derived anti-inflammatory protein, adiponectin,” Journal of Clinical Endocrinology and Metabolism, vol. 86, no. 8, pp. 3815–3819, 2001. View at Publisher · View at Google Scholar · View at Scopus
16. J. Tank, J. Jordan, A. Diedrich, et al., “Bound leptin and sympathetic outflow in nonobese men,” Journal of Clinical Endocrinology and Metabolism, vol. 88, no. 10, pp. 4955–4959, 2003. View at Publisher · View at Google Scholar · View at Scopus
17. D. Freymond, C. Bogardus, M. Okubo, K. Stone, and D. Mott, “Impaired insulin-stimulated muscle glycogen synthase activation in vivo in man is related to low fasting glycogen synthase phosphatase activity,” Journal of Clinical Investigation, vol. 82, no. 5, pp. 1503–1509, 1988. View at Scopus
18. R. M. Reynolds, K. E. Chapman, J. R. Seckl, B. R. Walker, P. M. McKeigue, and H. O. Lithell, “Skeletal muscle glucocorticoid receptor density and insulin resistance,” Journal of the American Medical Association, vol. 287, no. 19, pp. 2505–2506, 2002. View at Scopus
19. E. J. Barrett, E. M. Eggleston, A. C. Inyard, et al., “The vascular actions of insulin control its delivery to muscle and regulate the rate-limiting step in skeletal muscle insulin action,” Diabetologia, vol. 52, no. 5, pp. 752–764, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
20. A. D. Baron, “Hemodynamic actions of insulin,” American Journal of Physiology, vol. 267, no. 2, pp. E187–E202, 1994. View at Scopus
21. A. D. Baron, M. Laakso, G. Brechtel, and S. V. Edelman, “Mechanism of insulin resistance in insulin-dependent diabetes mellitus: a major role for reduced skeletal muscle blood flow,” Journal of Clinical Endocrinology and Metabolism, vol. 73, no. 3, pp. 637–643, 1991. View at Scopus
22. M. Raitakari, P. Nuutila, J. Knuuti, et al., “Effects of insulin on blood flow and volume in skeletal muscle of patients with IDDM: studies using [15O]H2O, [15O]CO, and positron emission tomography,” Diabetes, vol. 46, no. 12, pp. 2017–2021, 1997. View at Scopus
23. A. D. Baron, G. Brechtel-Hook, A. Johnson, J. Cronin, R. Leaming, and H. O. Steinberg, “Effect of perfusion rate on the time course of insulin-mediated skeletal muscle glucose uptake,” American Journal of Physiology, vol. 271, no. 6, pp. E1067–E1072, 1996. View at Scopus
24. H. Wang, A. X. Wang, Z. Liu, and E. J. Barrett, “Insulin signaling stimulates insulin transport by bovine aortic endothelial cells,” Diabetes, vol. 57, no. 3, pp. 540–547, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
25. E. H. Serné, R. G. Ijzerman, R. O. B. Gans, et al., “Direct evidence for insulin-induced capillary recruitment in skin of healthy subjects during physiological hyperinsulinemia,” Diabetes, vol. 51, no. 5, pp. 1515–1522, 2002. View at Scopus
26. D. A. Ehrmann, “Polycystic ovary syndrome,” New England Journal of Medicine, vol. 352, no. 12, pp. 1223–1236, 2005. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
27. R. S. Legro, A. R. Kunselman, W. C. Dodson, and A. Dunaif, “Prevalence and predictors of risk for type 2 diabetes mellitus and impaired glucose tolerance in polycystic ovary syndrome: a prospective, controlled study in 254 affected women,” Journal of Clinical Endocrinology and Metabolism, vol. 84, no. 1, pp. 165–169, 1999. View at Publisher · View at Google Scholar · View at Scopus
28. A. M. Venkatesan, A. Dunaif, and A. Corbould, “Insulin resistance in polycystic ovary syndrome: progress and paradoxes,” Recent Progress in Hormone Research, vol. 56, pp. 295–308, 2001. View at Publisher · View at Google Scholar · View at Scopus
29. A. Corbould, Y.-B. Kim, J. F. Youngren, et al., “Insulin resistance in the skeletal muscle of women with PCOS involves intrinsic and acquired defects in insulin signaling,” American Journal of Physiology, vol. 288, no. 5, pp. E1047–E1054, 2005. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
30. T. P. Ciaraldi, A. El-Roeiy, Z. Madar, D. Reichart, J. M. Olefsky, and S. S. C. Yen, “Cellular mechanisms of insulin resistance in polycystic ovarian syndrome,” Journal of Clinical Endocrinology and Metabolism, vol. 75, no. 2, pp. 577–583, 1992. View at Publisher · View at Google Scholar · View at Scopus
31. A. Corbould, “Effects of androgens on insulin action in women: is androgen excess a component of female metabolic syndrome?” Diabetes/Metabolism Research and Reviews, vol. 24, no. 7, pp. 520–532, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
32. F. Gonzalez, K. Thusu, E. Abdel-Rahman, A. Prabhala, M. Tomani, and P. Dandona, “Elevated serum levels of tumor necrosis factor alpha in normal-weight women with polycystic ovary syndrome,” Metabolism, vol. 48, no. 4, pp. 437–441, 1999. View at Scopus
33. I. Tarkun, B. Çetinarslan, E. Türemen, Z. Cantürk, and M. Biyikli, “Association between circulating tumor necrosis factor-alpha, interleukin-6, and insulin resistance in normal-weight women with polycystic ovary syndrome,” Metabolic Syndrome and Related Disorders, vol. 4, no. 2, pp. 122–128, 2006. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
34. B. Pehlivanov and M. Mitkov, “Serum leptin levels correlate with clinical and biochemical indices of insulin resistance in women with polycystic ovary syndrome,” European Journal of Contraception and Reproductive Health Care, vol. 14, no. 2, pp. 153–159, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
35. M. Yilmaz, N. Bukan, H. Demirc, et al., “Serum resistin and adiponectin levels in women with polycystic ovary syndrome,” Gynecological Endocrinology, vol. 25, no. 4, pp. 246–252, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
36. A. Senay, B. Mithat, T. Alpaslan, K. Ebru, and G. Deniz, “Serum resistin and adiponectin levels in women with polycystic ovary syndrome,” Gynecological Endocrinology, vol. 26, no. 3, pp. 161–166, 2010. View at Publisher · View at Google Scholar · View at Scopus
37. I. Ek, P. Arner, M. Rydén, et al., “A unique defect in the regulation of visceral fat cell lipolysis in the polycystic ovary syndrome as an early link to insulin resistance,” Diabetes, vol. 51, no. 2, pp. 484–492, 2002. View at Scopus
38. J. E. Nestler, D. J. Jakubowicz, A. F. de Vargas, C. Brik, N. Quintero, and F. Medina, “Insulin stimulates testosterone biosynthesis by human thecal cells from women with polycystic ovary syndrome by activating its own receptor and using inositolglycan mediators as the signal transduction system,” Journal of Clinical Endocrinology and Metabolism, vol. 83, no. 6, pp. 2001–2005, 1998. View at Publisher · View at Google Scholar · View at Scopus
39. J. E. Nestler, L. P. Powers, D. W. Matt, et al., “A direct effect of hyperinsulinemia on serum sex hormone-binding globulin levels in obese women with the polycystic ovary syndrome,” Journal of Clinical Endocrinology and Metabolism, vol. 72, no. 1, pp. 83–89, 1991. View at Scopus
40. E. Diamanti-Kandarakis, G. Argyrakopoulou, F. Economou, E. Kandaraki, and M. Koutsilieris, “Defects in insulin signaling pathways in ovarian steroidogenesis and other tissues in polycystic ovary syndrome (PCOS),” Journal of Steroid Biochemistry and Molecular Biology, vol. 109, no. 3–5, pp. 242–246, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
41. A. Corbould, H. Zhao, S. Mirzoeva, F. Aird, and A. Dunaif, “Enhanced mitogenic signaling in skeletal muscle of women with polycystic ovary syndrome,” Diabetes, vol. 55, no. 3, pp. 751–759, 2006. View at Scopus
42. A. Holmang, J. Svedberg, E. Jennische, and P. Bjorntorp, “Effects of testosterone on muscle insulin sensitivity and morphology in female rats,” American Journal of Physiology, vol. 259, no. 4, pp. E555–E560, 1990. View at Scopus
43. A. Holmäng, M. Niklasson, B. Rippe, and P. Lönnroth, “Insulin insensitivity and delayed transcapillary delivery of insulin in oophorectomized rats treated with testosterone,” Acta Physiologica Scandinavica, vol. 171, no. 4, pp. 427–438, 2001. View at Scopus
44. M. C. Allemand, B. A. Irving, Y. W. Asmann, et al., “Effect of testosterone on insulin stimulated IRS1 Ser phosphorylation in primary rat myotubes—a potential model for PCOS-related insulin resistance,” PLoS ONE, vol. 4, no. 1, article e4274, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
45. F. Giallauria, S. Palomba, C. Vigorito, et al., “Androgens in polycystic ovary syndrome: the role of exercise and diet,” Seminars in Reproductive Medicine, vol. 27, no. 4, pp. 306–315, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
46. A. Dunaif, J. Xia, C.-B. Book, E. Schenker, and Z. Tang, “Excessive insulin receptor serine phosphorylation in cultured fibroblasts and in skeletal muscle. A potential mechanism for insulin resistance in the polycystic ovary syndrome,” Journal of Clinical Investigation, vol. 96, no. 2, pp. 801–810, 1995. View at Scopus
47. K. Bouzakri, M. Roques, P. Gual, et al., “Reduced activation of phosphatidylinositol-3 kinase and increased serine 636 phosphorylation of insulin receptor substrate-1 in primary culture of skeletal muscle cells from patients with type 2 diabetes,” Diabetes, vol. 52, no. 6, pp. 1319–1325, 2003. View at Publisher · View at Google Scholar · View at Scopus
48. R. V. Farese, M. P. Sajan, and M. L. Standaert, “Atypical protein kinase C in insulin action and insulin resistance,” Biochemical Society Transactions, vol. 33, no. 2, pp. 350–353, 2005. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
49. M. Straczkowski and I. Kowalska, “The role of skeletal muscle sphingolipids in the development of insulin resistance,” Review of Diabetic Studies, vol. 5, no. 1, pp. 13–24, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
50. A. Dunaif, X. Wu, A. Lee, and E. Diamanti-Kandarakis, “Defects in insulin receptor signaling in vivo in the polycystic ovary syndrome (PCOS),” American Journal of Physiology, vol. 281, no. 2, pp. E392–E399, 2001. View at Scopus
51. K. Hojlund, D. Glintborg, N. R. Andersen, et al., “Impaired insulin-stimulated phosphorylation of akt and AS160 in skeletal muscle of women with polycystic ovary syndrome is reversed by pioglitazone treatment,” Diabetes, vol. 57, no. 2, pp. 357–366, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
52. M. Rajkhowa, S. Brett, D. J. Cuthbertson, et al., “Insulin resistance in polycystic ovary syndrome is associated with defective regulation of ERK1/2 by insulin in skeletal muscle in vivo,” Biochemical Journal, vol. 418, no. 3, pp. 665–671, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
53. V. Skov, D. Glintborg, S. Knudsen, et al., “Reduced expression of nuclear-encoded genes involved in mitochondrial oxidative metabolism in skeletal muscle of insulin-resistant women with polycystic ovary syndrome,” Diabetes, vol. 56, no. 9, pp. 2349–2355, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
54. V. Skov, D. Glintborg, S. Knudsen, et al., “Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome,” PLoS ONE, vol. 3, no. 6, article e2466, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
55. J. T. Lanner, A. Katz, P. Tavi, et al., “The role of Ca2+ influx for insulin-mediated glucose uptake in skeletal muscle,” Diabetes, vol. 55, no. 7, pp. 2077–2083, 2006. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
56. E. O. Ojuka, “Role of calcium and AMP kinase in the regulation of mitochondrial biogenesis and GLUT4 levels in muscle,” Proceedings of the Nutrition Society, vol. 63, no. 2, pp. 275–278, 2004. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
57. J. Levy, “Abnormal cell calcium homeostasis in type 2 diabetes mellitus: a new look on old disease,” Endocrine, vol. 10, no. 1, pp. 1–6, 1999. View at Publisher · View at Google Scholar · View at Scopus
58. J. E. Nestler and M. A. McClanahan, “Diabetes and adrenal disease,” Bailliere's Clinical Endocrinology and Metabolism, vol. 6, no. 4, pp. 829–847, 1992. View at Publisher · View at Google Scholar · View at Scopus
59. S. P. Thomson, C. S. Stump, L. R. Kurukulasuriya, and J. R. Sowers, “Adrenal steroids and the metabolic syndrome,” Current Hypertension Reports, vol. 9, no. 6, pp. 512–519, 2007. View at Publisher · View at Google Scholar · View at Scopus
60. J. R. Sowers, A. Whaley-Connell, and M. Epstein, “Narrative review: the emerging clinical implications of the role of aldosterone in the metabolic syndrome and resistant hypertension,” Annals of Internal Medicine, vol. 150, no. 11, pp. 776–783, 2009. View at Scopus
61. G. Giacchetti, V. Ronconi, F. Turchi, et al., “Aldosterone as a key mediator of the cardiometabolic syndrome in primary aldosteronism: an observational study,” Journal of Hypertension, vol. 25, no. 1, pp. 177–186, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
62. L. M. Mosso, C. A. Carvajal, A. Maiz, et al., “A possible association between primary aldosteronism and a lower β-cell function,” Journal of Hypertension, vol. 25, no. 10, pp. 2125–2130, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
63. S. L. Liu, S. Schmuck, J. Z. Chorazcyzewski, R. Gros, and R. D. Feldman, “Aldosterone regulates vascular reactivity: short-term effects mediated by phosphatidylinositol 3-kinase-dependent nitric oxide synthase activation,” Circulation, vol. 108, no. 19, pp. 2400–2406, 2003. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
64. G. E. Callera, R. M. Touyz, R. C. Tostes, et al., “Aldosterone activates vascular p38MAP kinase and NADPH oxidase via c-Src,” Hypertension, vol. 45, no. 4, pp. 773–779, 2005. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
65. G. Lastra, A. Whaley-Connell, C. Manrique, et al., “Low-dose spironolactone reduces reactive oxygen species generation and improves insulin-stimulated glucose transport in skeletal muscle in the TG(mRen2)27 rat,” American Journal of Physiology, vol. 295, no. 1, pp. E110–E116, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
66. H. Hitomi, H. Kiyomoto, A. Nishiyama, et al., “Aldosterone suppresses insulin signaling via the downregulation of insulin receptor substrate-1 in vascular smooth muscle cells,” Hypertension, vol. 50, no. 4, pp. 750–755, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
67. D. H. van Raalte, D. M. Ouwens, and M. Diamant, “Novel insights into glucocorticoid-mediated diabetogenic effects: towards expansion of therapeutic options?” European Journal of Clinical Investigation, vol. 39, no. 2, pp. 81–93, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
68. M. J. A. Saad, F. Folli, J. A. Kahn, and C. R. Kahn, “Modulation of insulin receptor, insulin receptor substrate-1, and phosphatidylinositol 3-kinase in liver and muscle of dexamethasone-treated rats,” Journal of Clinical Investigation, vol. 92, no. 4, pp. 2065–2072, 1993. View at Scopus
69. S. P. Weinstein, C. M. Wilson, A. Pritsker, and S. W. Cushman, “Dexamethasone inhibits insulin-stimulated recruitment of GLUT4 to the cell surface in rat skeletal muscle,” Metabolism, vol. 47, no. 1, pp. 3–6, 1998. View at Publisher · View at Google Scholar · View at Scopus
70. J. Ruzzin, A. S. Wagman, and J. Jensen, “Glucocorticoid-induced insulin resistance in skeletal muscles: defects in insulin signalling and the effects of a selective glycogen synthase kinase-3 inhibitor,” Diabetologia, vol. 48, no. 10, pp. 2119–2130, 2005. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
71. M. Rebuffé-Scrive, M. Krotkiewski, J. Elfverson, and P. Björntorp, “Muscle and adipose tissue morphology and metabolism in Cushing's syndrome,” Journal of Clinical Endocrinology and Metabolism, vol. 67, no. 6, pp. 1122–1128, 1988. View at Scopus
72. J. E. Henriksen, F. Alford, A. Vaag, A. Handberg, and H. Beck-Nielsen, “Intracellular skeletal muscle glucose metabolism is differentially altered by dexamethasone treatment of normoglycemic relatives of type 2 diabetic patients,” Metabolism, vol. 48, no. 9, pp. 1128–1135, 1999. View at Publisher · View at Google Scholar · View at Scopus
73. M. E. Patti, E. Brambilla, L. Luzi, E. J. Landaker, and C. R. Kahn, “Bidirectional modulation of insulin action by amino acids,” Journal of Clinical Investigation, vol. 101, pp. 1519–1529, 1998.
74. M. Krebs, M. Krssak, E. Bernroider, et al., “Mechanism of amino acid-induced skeletal muscle insulin resistance in humans,” Diabetes, vol. 51, no. 3, pp. 599–605, 2002. View at Scopus
75. G. Perseghin, K. Petersen, and G. I. Shulman, “Cellular mechanism of insulin resistance: potential links with inflammation,” International Journal of Obesity, vol. 27, supplement 3, pp. S6–S11, 2003. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
76. P. J. Randle, P. B. Garland, C. N. Hales, and E. A. Newsholme, “The glucose fatty-acid cycle. Its role in insulin sensitivity and the metabolic disturbances of diabetes mellitus,” The Lancet, vol. 281, no. 7285, pp. 785–789, 1963. View at Scopus
77. R. Yamashita, T. Saito, S. Satoh, K. Aoki, Y. Kaburagi, and H. Sekihara, “Effects of dehydroepiandrosterone on gluconeogenic enzymes and glucose uptake in human hepatoma cell line, HepG2,” Endocrine Journal, vol. 52, no. 6, pp. 727–733, 2005. View at Publisher · View at Google Scholar · View at Scopus
78. G. Stenström, L. Sjöström, and U. Smith, “Diabetes mellitus in phaeochromocytoma. Fasting blood glucose levels before and after surgery in 60 patients with phaeochromocytoma,” Acta Endocrinologica, vol. 106, no. 4, pp. 511–515, 1984. View at Scopus
79. T. D. Wiesner, M. Blüher, M. Windgassen, and R. Paschke, “Improvement of insulin sensitivity after adrenalectomy in patients with pheochromocytoma,” Journal of Clinical Endocrinology and Metabolism, vol. 88, no. 8, pp. 3632–3636, 2003. View at Publisher · View at Google Scholar · View at Scopus
80. M. Niklasson, A. Holmäng, and P. Lönnroth, “Induction of rat muscle insulin resistance by epinephrine is accompanied by increased interstitial glucose and lactate concentrations,” Diabetologia, vol. 41, no. 12, pp. 1467–1473, 1998. View at Publisher · View at Google Scholar · View at Scopus
81. I. Raz, A. Katz, and M. K. Spencer, “Epinephrine inhibits insulin-mediated glycogenesis but enhances glycolysis in human skeletal muscle,” American Journal of Physiology, vol. 260, no. 3, part 1, pp. E430–E435, 1991.
82. M. Laakso, S. V. Edelman, G. Brechtel, and A. D. Baron, “Effects of epinephrine on insulin-mediated glucose uptake in whole body and leg muscle in humans: role of blood flow,” American Journal of Physiology, vol. 263, no. 2, part 1, pp. E199–E204, 1992.
83. M. D. Stifelman and D. M. Fenig, “Work-up of the functional adrenal mass,” Current Urology Reports, vol. 6, no. 1, pp. 63–71, 2005. View at Scopus
84. N. S. Ross and D. C. Aron, “Hormonal evaluation of the patient with an incidentally discovered adrenal mass,” New England Journal of Medicine, vol. 323, no. 20, pp. 1401–1405, 1990. View at Scopus
85. L. Barzon, N. Sonino, F. Fallo, G. Palu, and M. Boscaro, “Prevalence and natural history of adrenal incidentalomas,” European Journal of Endocrinology, vol. 149, no. 4, pp. 273–285, 2003. View at Publisher · View at Google Scholar · View at Scopus
86. M. Reincke, M. Faßnacht, S. Väth, P. Mora, and B. Allolio, “Adrenal incidentalomas: a manifestation of the metabolic syndrome?” Endocrine Research, vol. 22, no. 4, pp. 757–761, 1996. View at Scopus
87. S. Midorikawa, H. Sanada, S. Hashimoto, T. Suzuki, and T. Watanabe, “The improvement of insulin resistance in patients with adrenal incidentaloma by surgical resection,” Clinical Endocrinology, vol. 54, no. 6, pp. 797–804, 2001. View at Publisher · View at Google Scholar · View at Scopus
88. M. Ivovic, S. Vujović, Z. Penezić, M. Zarković, and M. Drezgić, “Insulin sensitivity in patients with adrenal incidentaloma,” Srpski Arhiv za Celokupno Lekarstvo, vol. 134, no. 7-8, pp. 315–319, 2006. View at Scopus
89. F. Ermetici, A. E. Malavazos, S. Corbetta, et al., “Adipokine levels and cardiovascular risk in patients with adrenal incidentaloma,” Metabolism, vol. 56, no. 5, pp. 686–692, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
90. M. Peppa, E. Boutati, C. Koliaki, et al., “Insulin resistance and metabolic syndrome in patients with nonfunctioning adrenal incidentalomas: a cause-effect relationship?” Metabolism. (2010) In press. View at Publisher · View at Google Scholar · View at PubMed
91. F. Amati, J. J. Dubé, M. Stefanovic-Racic, F. G. Toledo, and B. H. Goodpaster, “Improvements in insulin sensitivity are blunted by subclinical hypothyroidism,” Medicine and Science in Sports and Exercise, vol. 41, no. 2, pp. 265–269, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
92. S. D'Arezzo, S. Incerpi, F. B. Davis, et al., “Rapid nongenomic effects of 3,5,3-triiodo-L-thyronine on the intracellular pH of L-6 myoblasts are mediated by intracellular calcium mobilization and kinase pathways,” Endocrinology, vol. 145, no. 12, pp. 5694–5703, 2004. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
93. I. Irrcher, D. R. Walkinshaw, T. E. Sheehan, and D. A. Hood, “Thyroid hormone (T3) rapidly activates p38 and AMPK in skeletal muscle in vivo,” Journal of Applied Physiology, vol. 104, no. 1, pp. 178–185, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
94. G. B. Diaz, A. A. Paladini, M. E. Garcia, and J. J. Gagliardino, “Changes induced by hypothyroidism in insulin secretion and in the properties of islet plasma membranes,” Archives Internationales de Physiologie, de Biochimie et de Biophysique, vol. 101, no. 5, pp. 263–269, 1993. View at Scopus
95. A. Roos, S. J. L. Bakker, T. P. Links, R. O. B. Gans, and B. H. R. Wolffenbuttel, “Thyroid function is associated with components of the metabolic syndrome in euthyroid subjects,” Journal of Clinical Endocrinology and Metabolism, vol. 92, no. 2, pp. 491–496, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
96. G. Dimitriadis, P. Mitrou, V. Lambadiari, et al., “Insulin action in adipose tissue and muscle in hypothyroidism,” Journal of Clinical Endocrinology and Metabolism, vol. 91, no. 12, pp. 4930–4937, 2006. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
97. M. P. Czech, C. C. Malbon, K. Kerman, W. Gitomer, and P. F. Pilch, “Effect of thyroid status on insulin action in rat adipocytes and skeletal muscle,” Journal of Clinical Investigation, vol. 66, no. 3, pp. 574–582, 1980.
98. E. Maratou, D. J. Hadjidakis, A. Kollias, et al., “Studies of insulin resistance in patients with clinical and subclinical hypothyroidism,” European Journal of Endocrinology, vol. 160, no. 5, pp. 785–790, 2009. View at Publisher · View at Google Scholar · View at PubMed
99. G. D. Dimitriadis, B. Leighton, M. Parry-Billings, D. West, and E. A. Newsholme, “Effect of hypothyroidism on the sensitivity of glycolysis and glycogen synthesis to insulin in the soleus muscle of the rat,” Biochemical Journal, vol. 257, no. 2, pp. 369–373, 1989.
100. G. Dimitriadis, M. Parry-Billings, S. Bevan, et al., “The effects of insulin on transport and metabolism of glucose in skeletal muscle from hyperthyroid and hypothyroid rats,” European Journal of Clinical Investigation, vol. 27, no. 6, pp. 475–483, 1997.
101. P. Mackowiak, E. Ginalska, E. Nowak-Strojec, and T. Szkudelski, “The influence of hypo- and hyperthyreosis on insulin receptors and metabolism,” Archives of Physiology and Biochemistry, vol. 107, no. 4, pp. 273–279, 1999.
102. C. Rochon, I. Tauveron, C. Dejax, et al., “Response of glucose disposal to hyperinsulinaemia in human hypothyroidism and hyperthyroidism,” Clinical Science, vol. 104, no. 1, pp. 7–15, 2003. View at Publisher · View at Google Scholar
103. G. Dimitriadis, B. Baker, H. Marsh, et al., “Effect of thyroid hormone excess on action, secretion, and metabolism of insulin in humans,” The American Journal of Physiology, vol. 248, no. 5, pp. E593–E601, 1985.
104. G. Dimitriadis, E. Maratou, E. Boutati, et al., “IGF-I increases the recruitment of GLUT4 and GLUT3 glucose transporters on cell surface in hyperthyroidism,” European Journal of Endocrinology, vol. 158, no. 3, pp. 361–366, 2008. View at Publisher · View at Google Scholar · View at PubMed
105. E. Resmini, F. Minuto, A. Colao, and D. Ferone, “Secondary diabetes associated with principal endocrinopathies: the impact of new treatment modalities,” Acta Diabetologica, vol. 46, no. 2, pp. 85–95, 2009. View at Publisher · View at Google Scholar · View at PubMed
106. P. E. Harris, M. Walker, F. Clark, P. D. Home, and K. G. M. M. Alberti, “Forearm muscle metabolism in primary hypothyroidism,” European Journal of Clinical Investigation, vol. 23, no. 9, pp. 585–588, 1993.
107. N. M. O'Meara, J. D. Blackman, J. Sturis, and K. S. Polonsky, “Alterations in the kinetics of C-peptide and insulin secretion in hyperthyroidism,” Journal of Clinical Endocrinology and Metabolism, vol. 76, no. 1, pp. 79–84, 1993. View at Publisher · View at Google Scholar
108. S. B. Liggett, S. D. Shah, and P. E. Cryer, “Increased fat and skeletal muscle β-adrenergic receptors but unaltered metabolic and hemodynamic sensitivitiy to epinephrine in vivo in experimental human thyrotoxicosis,” Journal of Clinical Investigation, vol. 83, no. 3, pp. 803–809, 1989.
109. J.-P. Randin, L. Tappy, and B. Scazziga, “Insulin sensitivity and exogenous insulin clearance in Graves' disease. Measurement by the glucose clamp technique and continuous indirect calorimetry,” Diabetes, vol. 35, no. 2, pp. 178–181, 1986.
110. M. Laville, J. P. Riou, and P. F. Bougneres, “Glucose metabolism in experimental hyperthyroidism: intact in vivo sensitivity to insulin with abnormal binding and increased glucose turnover,” Journal of Clinical Endocrinology and Metabolism, vol. 58, no. 6, pp. 960–965, 1984.
111. S. P. Weinstein, E. O'Boyle, and R. S. Haber, “Thyroid hormone increases basal and insulin-stimulated glucose transport in skeletal muscle: the role of GLUT4 glucose transporter expression,” Diabetes, vol. 43, no. 10, pp. 1185–1189, 1994.
112. G. Dimitriadis, P. Mitrou, V. Lambadiari, et al., “Glucose and lipid fluxes in the adipose tissue after meal ingestion in hyperthyroidism,” Journal of Clinical Endocrinology and Metabolism, vol. 91, no. 3, pp. 1112–1118, 2006. View at Publisher · View at Google Scholar · View at PubMed
113. G. Dimitriadis, P. Mitrou, V. Lambadiari, et al., “Insulin-stimulated rates of glucose uptake in muscle in hyperthyroidism: the importance of blood flow,” Journal of Clinical Endocrinology and Metabolism, vol. 93, no. 6, pp. 2413–2415, 2008. View at Publisher · View at Google Scholar · View at PubMed
114. J. P. Randin, B. Scazziga, E. Jequier, and J. P. Felber, “Study of glucose and lipid metabolism by continuous indirect calorimetry in Graves' disease: effect of an oral glucose load,” Journal of Clinical Endocrinology and Metabolism, vol. 61, no. 6, pp. 1165–1171, 1985.
115. W. H. Martin III, E. Korte, T. K. Tolley, and J. E. Saffitz, “Skeletal muscle β-adrenoceptor distribution and responses to isoproterenol in hyperthyroidism,” American Journal of Physiology, vol. 262, no. 4, pp. E504–E510, 1992.
116. W. H. Martin III, R. J. Spina, E. Korte, et al., “Mechanisms of impaired exercise capacity in short duration experimental hyperthyroidism,” Journal of Clinical Investigation, vol. 88, no. 6, pp. 2047–2053, 1991.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:41:05.000Z
|
xjuw5tbc5hmbdqrqwlb24gjejdbbsdtd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52188",
"uncompressed_offset": 447781639,
"url": "www.indiaenvironmentportal.org.in/reports-documents/researching-urban-dilemma-urbanization-poverty-and-violence",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.indiaenvironmentportal.org.in/reports-documents/researching-urban-dilemma-urbanization-poverty-and-violence"
}
|
cccc_CC-MAIN-2013-20
|
Researching the urban dilemma: urbanization, poverty and violence
In 2007, the world became a predominantly urban society. An estimated three-quarters of economic production now takes place in cities. Urbanization brings with it the possibilities of improved access to jobs, goods, and services for poor people in developing countries and beyond as globalization trends connect cities worldwide. However, new challenges in terms of conflict, violence, poverty, and inequalities have also emerged. Researching the Urban Dilemma: Urbanization, Poverty and Violence documents what is known about the connections between violence, inequalities, and poverty in urban centres and assesses the strength of the knowledge base; describes the state of theory on violence, urbanization, and poverty reduction; identifies key evidence gaps that require further investigation; maps out key actors (researchers and research organizations) that are producing knowledge on these issues; and provides an extensive bibliography.
Attachment(s):
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:51:25.000Z
|
aipmcrqaygj5kclry7cpgni5awfno2xu
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52191",
"uncompressed_offset": 452964316,
"url": "www.isfdb.org/cgi-bin/title.cgi",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.isfdb.org/cgi-bin/title.cgi?291261"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: The Denial
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Title: The Denial
Author: Bruce Sterling
Year: 2005
Type: SHORTFICTION
Storylen: shortstory
ISFDB Record Number: 291261
Note: First published in The Magazine of Fantasy & Science Fiction, September 2005.
User Rating: This title has fewer than 5 votes. VOTE
Current Tags: None Add Tags
Variant Titles:
Publications:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:03:16.000Z
|
amfxahgx3bzt3x4ffzdoukusutkbpwjz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52204",
"uncompressed_offset": 535472140,
"url": "www.ohloh.net/p/lufa-lib/managers",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.ohloh.net/p/lufa-lib/managers"
}
|
cccc_CC-MAIN-2013-20
|
Very Low Activity
× You must be logged in to change this data. If you don't have an account, Please join.
Settings : Managers
Analyzed 8 days ago based on code collected 8 days ago.
abcminiuser
0 commits
I manage this project on Ohloh
I want to edit this project's settings and information on Ohloh. Do I need to sign up as a project manager?
If a project is locked, then project information can only be edited by managers. Otherwise, anyone with an Ohloh account can edit project information.
Who should register as a project manager?
Someone who works on the project. Ideally the owner, founder, lead developer, or release manager.
About Managers
Project managers can:
• Limit edits just to managers.
• Edit project information and settings if community editing has been limited.
• Approve or deny applications to be a manager.
• If a project's edits are limited, then project information can only be edited by managers. Otherwise, anyone with an Ohloh account can edit project information.
Learn More...
Copyright © 2013 Black Duck Software, Inc. and its contributors, Some Rights Reserved. Unless otherwise marked, this work is licensed under a Creative Commons Attribution 3.0 Unported License . Ohloh ® and the Ohloh logo are trademarks of Black Duck Software, Inc. in the United States and/or other jurisdictions. All other trademarks are the property of their respective holders.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:38:22.000Z
|
ybgludk2ocgcfrx45hciwhsaxaaheljp
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52211",
"uncompressed_offset": 538664490,
"url": "www.openwetware.org/index.php?oldid=379256&title=Bromodeoxyuridine_%28BrdU%29",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.openwetware.org/index.php?title=Bromodeoxyuridine_(BrdU)&oldid=379256"
}
|
cccc_CC-MAIN-2013-20
|
Bromodeoxyuridine (BrdU)
From OpenWetWare
Revision as of 11:06, 5 January 2010 by Jakob Suckale (Talk | contribs)
Jump to: navigation, search
BrdU next to the deoxynucleoside deoxythymidine (dT) it can replace during DNA synthesis
Bromodeoxyuridine (5-bromo-2-deoxyuridine, BrdU) is a synthetic nucleoside analogue of thymidine. BrdU is commonly used to detect cell proliferation.
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:01:06.000Z
|
t4kufz23uoh6m46wgrzgkmimnz7r2gnr
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52214",
"uncompressed_offset": 549732097,
"url": "www.perseus.tufts.edu/hopper/text?doc=urn%3Acts%3AgreekLit%3Atlg0093.tlg009.perseus-grc1%3A15.11",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=urn:cts:greekLit:tlg0093.tlg009.perseus-grc1:15.11"
}
|
cccc_CC-MAIN-2013-20
|
Click on a word to bring up parses, dictionary entries, and frequency statistics
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
load Vocabulary Tool
hideData/Identifiers
Citation URN: urn:cts:greekLit:tlg0093.tlg009.perseus-grc1:15.11
Document URN: urn:cts:greekLit:tlg0093.tlg009.perseus-grc1
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:25:39.000Z
|
6tpy45nz5kti2fmvkqxcxhbcbh3v3jnx
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52215",
"uncompressed_offset": 549742877,
"url": "www.perseus.tufts.edu/hopper/text?doc=urn%3Acts%3AgreekLit%3Atlg0526.tlg001.perseus-eng1%3A7.5.1",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=urn:cts:greekLit:tlg0526.tlg001.perseus-eng1:7.5.1"
}
|
cccc_CC-MAIN-2013-20
|
[96] A LITLLE while after this, he considered that he ought to make war against the Philistines, and not to see any idleness or laziness permitted in his management, that so it might prove, as God had foretold to him, that when he had overthrown his enemies, he should leave his posterity to reign in peace afterward: so he called together his army again, and when he had charged them to be ready and prepared for war, and when he thought that all things in his army were in a good state, he removed from Jerusalem, and came against the Philistines; and when he had overcome them in battle, and had cut off a great part of their country, and adjoined it to the country of the Hebrews, he transferred the war to the Moabites; and when he had overcome two parts of their army in battle, he took the remaining part captive, and imposed tribute upon them, to be paid annually. He then made war against Iadadezer, the son of Rehob, king of Sophene; 1 and when he had joined battle with him at 'the river Euphrates, he destroyed twenty thousand of his footmen, and about seven thousand of his horsemen. He also took a thousand of his chariots, and destroyed the greatest part of them, and ordered that no more than one hundred should be kept. 2
1 Whether Syria Zobah, 2 Samuel 3:8; 1 Chronicles 18:3-8, be Sophene, as Josephus here supposes; which yet Ptolemy places beyond Euphrates, as Dr. Hudson observes here, whereas Zobah was on this side; or whether Josephus was not here guilty of a mistake in his geography; I cannot certainly determine.
2 David's reserving only one hundred chariots for himself out of one thousand he had taken from Hadadezer, was most probably in compliance with the law of Moses, which forbade a king of Israel "to multiply horses to himself," Deuteronomy 17:16; one of the principal uses of horses in Judea at that time being for drawing their chariots. See Joshua 12:6; and Antiq. B. V. ch. 1. sect. 18. It deserves here to be remarked, that this Hadad, being a very great king, was conquered by David, whose posterity yet for several generations were called Benhadad, or the son of Hadad, till the days of Hazael, whose son Adar or Ader is also in our Hebrew copy (2 Kings 13:24) written Benhadad, but in Josephus Adad or Adar. And strange it is, that the son of Hazael, said to be such in the same text, and in Josephus, Antiq. B. IX. ch. 8. sect. 7, should still be called the son of Hadad. I would, therefore, here correct our Hebrew copy from Josephus's, which seems to have the true reading. nor does the testimony of Nicolaus of Damascus, produced in this place by Josephus, seem to be faultless, when it says that he was the third of the Hadads, or second of the Benhadads, who besieged Samaria in the days of Ahab. He must rather have been the seventh or eighth, if there were ten in all of that name, as we are assured there were. For this testimony makes all the Hadads or Benhadads of the same line, and to have immediately succeeded one another; whereas Hazael was not of that line, nor is he called Hadad or Benhadad in any copy. And note, that from this Hadad, in the days of David, to the beginning of Hazael, were near two hundred years, according to the exactest chronology of Josephus.
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
load focus Greek (B. Niese, 1892)
hide Places (automatically extracted)
View a map of the most frequently mentioned places in this document.
Visualize the most frequently mentioned Pleiades ancient places in this text.
Download Pleiades ancient places geospacial dataset for this text.
hideData/Identifiers
Citation URN: urn:cts:greekLit:tlg0526.tlg001.perseus-eng1:7.5.1
Document URN: urn:cts:greekLit:tlg0526.tlg001.perseus-eng1
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:34:12.000Z
|
jk5bgynmo25cpkehjc5ony3ki2sbq5ue
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52220",
"uncompressed_offset": 593111973,
"url": "www.seroundtable.com/photos/google-street-view-cars-15517.html",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.seroundtable.com/photos/google-street-view-cars-15517.html"
}
|
cccc_CC-MAIN-2013-20
|
Where Google Street View Cars Sleep
Aug 3, 2012 • 7:43 am | (7) by | Filed Under Search Engine Photo Of The Day
Richard Hay from Google posted a nice picture of a garage full of Google Street View cars, a fleet of them. I guess this is where they sleep?
The picture is on his Google+ page and from the looks of it, they are European versions.
This post is part of our daily Search Photo of the Day column, where we find fun and interesting photos related to the search industry and share them with our readers.
Previous story: Google Fiber Stickers
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:21:03.000Z
|
2r62fxon6mxqsaflq3hlngsdoacqdl2h
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52224",
"uncompressed_offset": 613657412,
"url": "www.stephankinsella.com/2012/09/afterword-to-hoppes-the-great-fiction/",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.stephankinsella.com/2012/09/afterword-to-hoppes-the-great-fiction/"
}
|
cccc_CC-MAIN-2013-20
|
Afterword to Hoppe’s The Great Fiction
by Stephan Kinsella on September 7, 2012
in Libertarianism
Professor Hoppe’s book The Great Fiction: Property, Economy, Society, and the Politics of Decline was published today by Laissez Faire Books. More information available here. My Afterword is repixeled below.
***
Afterword
by Stephan Kinsella1
The book you hold in your hands—or that resides in memory bits on your digital device—provides a perfect illustration of the power of Austro-libertarian ideas. Brainpower and genius alone are not enough to provide sound social analysis. One also needs a coherent understanding of economics, in particular of Misesian-Austrian praxeology-based economics. And one needs a coherent and realistic understanding of politics and the state—which is to say, anti-state libertarianism.
We all encounter and learn from brilliant thinkers, but there is often something missing. This is usually because they are insufficiently aware of the true predatorial nature of the state and the role it has played in the history of human society. Or there are, to put it kindly, gaps in their knowledge of economics. How many times have you read a brilliant thinker only to see them err on a crucial issue because of some mainstream economic or statist assumption? It is a frustrating experience.
So genius is not enough. But it helps. After all, the problems and issues at hand are not easy. Great intellect, combined with a realistic, sober view of politics and economics, and with a passion for truth, can achieve great things: a clarifying vision of the nature of the institutions of society. Dr. Hoppe was perfectly placed by the currents of fate to become today’s leading libertarian social theorist, which is to say: today’s leading social theorist.
Professor Hoppe’s genius is evident in the razor-sharp clarity and precision of his words and arguments, and his command of philosophy and economics and related fields such as history, sociology, and the philosophy of science. His formal education originated in his studies at the University of Saarland in Saarbrücken, the Johann Wolfgang Goethe University in Frankfurt am Main, and at the University of Michigan in Ann Arbor, which included a PhD in philosophy under the famous European philosopher Jürgen Habermas and a prestigious “Habilitation” degree on the Foundations of Sociology and Economics.
But Professor Hoppe’s real education was autodidactic. First, as a mainstream leftwinger, his eyes were opened by the Austrian economist Eugen von Böhm-Bawerk’s critique of Marxism. Later, after encountering and then rejecting the logical positivism of Milton Friedman and the Chicago school, he discovered Mises and his unique approach. As he wrote in an interview in the Austrian Economics Newsletter:
Independently, I had concluded that economic laws were a priori and discoverable through deduction. Then I stumbled on Mises’s Human Action. That was the first time I found someone who had the same view; not only that, he had already worked out the entire system. From that point on, I was a Misesian.2
And then, naturally, he discovered the work of Murray N. Rothbard (1926–1995), the most prominent American student of Mises and the fountainhead of the modern libertarian movement. In the mid-1980s Hoppe moved to the United States to study under, collaborate, and work with Rothbard. Since these days he has produced a cornucopia of political and economic insights, contained in his books: Handeln und Erkennen (1976), Kritik der Kausalwissenschaftlichen Sozialforschung (1983), Eigentum, Anarchie, und Staat (1987), his magnum opus A Theory of Socialism and Capitalism (1989), The Economics and Ethics of Private Property (1993, enlarged 2nd edition 2006), Democracy: The God that Failed (2001), and The Myth of National Defense (editor, 2003). His works have been translated into at least 23 languages, not counting English.3
But the point here is not to provide an encomium to the contributions of a single man. That has been done already, in the festschrift Property, Freedom, and Society: Essays in Honor of Hans-Hermann Hoppe (Mises Institute, 2009). Rather, it is to recognize the power of the anarcho-Austrian-libertarian intellectual framework, which we see realized in the work of Professor Hoppe.
Many scholars influenced by Mises and Austrian economics give praxeology—Mises’s apriori logic of action—lip service. But more so than any other living thinker, Hoppe actually applies praxeology, one of the most powerful modes of scientific analysis yet discovered. It permeates his writing. His reasoning is rooted in it. Hoppe swims in the plasma of praxeology.4 It informs all aspects of his theoretical edifice: not only economic theory and applications, but political theory, ethics, and epistemology.
The power of the Austro-libertarian framework is that it opens up new vistas of understanding in the social sciences. It permits clarity and understanding where before there was muddy water. Professor Hoppe is the best exemplar to date of this methodological approach; his system improves upon that even of his masters, Mises and Rothbard, if only because he has stood on their shoulders. But still. Read this book, and others, like A Theory of Socialism and Capitalism (TSC) and The Economics and Ethics of Private Property (EEPP), and you will see something special about Hoppe’s work. It is crystal clear, for one thing; what he means is never in doubt. It is rigorous, and systematic, and integrated. It is based on a coherent, realistic, and rational view of the world and of human interpersonal relations. It is obviously motivated by a passion for truth and justice.
And we see this in The Great Fiction, a magnificent collection of essays informed by this same spirit and approach. This book contains some of my favorite Hoppean essays, for example, “The Ethics and Economics of Private Property” (ch. 2), “Of Common, Public, and Private Property and the Rationale for Total Privatization” (ch. 5, first published in my journal Libertarian Papers), “On Certainty and Uncertainty” (ch. 14), “The Private Production of Defense” (ch. 12), “In Defense of Extreme Rationalism” (ch. 16, a good counterpart to Rothbard’s classic “In Defense of ‘Extreme Apriorism’”),5 and “Property, Causality, and Liability” (ch. 18, which I saw Hoppe present at the symposium on Reinach and Rothbard at the Mises Institute in March 2001).
Let me highlight a few examples of Professor Hoppe’s application of Austrian praxeology and the libertarian-realist understanding of the state to various issues, in The Great Fiction and in his other writings. We may note first his careful attention to rigorous, essentialist definitions. For example, Hoppe recognizes that while socialism typically refers to state or collective ownership of the means of production, its essence is the “institutionalized interference with or aggression against private property and private property claims” (TSC, 2). In other words, any public or institutionalized aggression is inherently socialistic, and gives rise to the problems that accompany standard central planning. Indeed, as Hoppe elsewhere notes, “Societies are not simply capitalist or socialist. Indeed, all existing societies are socialist to some extent.” (TSC, 10) The state is always socialistic, and socialism always implies a state.
As a counterpart to his essentialist definition of socialism, Hoppe’s definition of the state gets straight to the heart of the matter:
Let me begin with the definition of a state. What must an agent be able to do to qualify as a state? This agent must be able to insist that all conflicts among the inhabitants of a given territory be brought to him for ultimate decision-making or be subject to his final review. In particular, this agent must be able to insist that all conflicts involving him be adjudicated by him or his agent. And implied in the power to exclude all others from acting as ultimate judge, as the second defining characteristic of a state, is the agent’s power to tax: to unilaterally determine the price that justice seekers must pay for his services.
Based on this definition of a state, it is easy to understand why a desire to control a state might exist. For whoever is a monopolist of final arbitration within a given territory can make laws. And he who can legislate can also tax. Surely, this is an enviable position. [p. 3]
Once you see the state in these clear terms, its nature becomes clear. As Hoppe elaborates in TGF, the state has to coopt the intellectuals to maintain the illusion—the fiction—that it is necessary and good.
Among Professor Hoppe’s signal contributions to political theory is his recognition of the crucial importance of scarcity in political philosophy. Without scarcity, there would be no social or economic problem to solve. “A conflict is only possible if goods are scarce. Only then will there arise the need to formulate rules that make orderly—conflict-free—social cooperation possible.” (p. 9; see also p. 410 et pass.) This also gives rise to his crucial insight that property rights are rights to control physical resources, and thus are rights only to the physical integrity of these goods—not to the “value” of these resources. As he writes:
property ownership means the exclusive control of a particular person over specific physical objects and spaces. Conversely, property rights invasion means the uninvited physical damage or diminution of things and territories owned by other persons. In contrast, a widely held view holds that the damage or diminution of the value (or price) of someone’s property also constitutes a punishable offense. [p. 15]
The significance of this insight can hardly be overstated, as the fallacious view of property rights in “value” underpins a host of confused ideas, including intellectual property, which Hoppe also rightly, and explicitly, rejects (p. 397).
Hoppe’s notion of scarcity, interpersonal conflict, and the need for property allocation norms builds on Mises’s praxeological understanding of human action as employing necessarily scarce means to causally achieve one’s chosen ends. The ends one chooses and the means one decides to employ to causally bring about one’s ends are guided by one’s knowledge; scarce means are employed that are causally believed to help accomplish the desired goal. The means, being scarce, rivalrous, can only be used by one agent and thus, property norms are necessary to permit social cooperation. But the information or ideas that guide the actor’s selection of ends and knowledge of causal laws to permit him to determine what means to choose, need not be owned—indeed, cannot be owned—as information is nonscarce.
the idea of intellectual property rights is not just wrong and confused but dangerous. And I have already touched upon why this is so. Ideas—recipes, formulas, statements, arguments, algorithms, theorems, melodies, patterns, rhythms, images, etc.—are certainly goods (insofar as they are good, not bad, recipes, etc.), but they are not scarce goods. Once thought and expressed, they are free, inexhaustible goods. I whistle a melody or write down a poem, you hear the melody or read the poem and reproduce or copy it. In doing so you have not taken anything away from me. I can whistle and write as before. In fact, the entire world can copy me and yet nothing is taken from me. (If I didn’t want anyone to copy my ideas I only have to keep them to myself and never express them.)
Now imagine I had been granted a property right in my melody or poem such that I could prohibit you from copying it or demanding a royalty from you if you do. First: Doesn’t that imply, absurdly, that I, in turn, must pay royalties to the person (or his heirs) who invented whistling and writing, and further on to those, who invented sound-making and language, and so on? Second: In preventing you from or making you pay for whistling my melody or reciting my poem, I am actually made a (partial) owner of you: of your physical body, your vocal chords, your paper, your pencil, etc. because you did not use anything but your own property when you copied me. If you can no longer copy me, then, this means that I, the intellectual property owner, have expropriated you and your “real” property. Which shows: intellectual property rights and real property rights are incompatible, and the promotion of intellectual property must be seen as a most dangerous attack on the idea of “real” property (in scarce goods). [397]
This passage provides a sparkling example of the power of a consistent application of Misesian praxeology and Hoppe’s insights into the crucial role of scarcity in the institution of property in addressing the social problem of conflict. By an almost pure application of praxeological reasoning, Hoppe realized as far back as 1988, before the Internet, before so-called “intellectual property” was on the libertarian radar, that IP was incompatible with the property rights that were aimed at solving the problem of conflict among actors in the use of scarce resources.6 This is a brilliant demonstration of the power of praxeologically-informed social analysis.
By focusing on human action, Hoppe is able to see that the scarce means employed in action need to be owned, but that the very nature of this need implies a Lockean-style property assignment rule is the only one that can be justified. First, any property norm must always answer the question of who now may use a given item. The norm cannot depend on some future event, for otherwise the resource may not be used or there would be no conflict-avoiding norm for the present. As Hoppe explains:
What is the purpose of norms? The avoidance of conflict regarding the use of scarce physical things. Conflict-generating norms contradict the very purpose of norms. Yet with regard to the purpose of conflict avoidance, no alternative to private property and original appropriation exists. In the absence of prestabilized harmony among actors, conflict can only be prevented if all goods are always in the private ownership of specific individuals and it is always clear who owns what and who does not. Also, conflicts can only be avoided from the very beginning of mankind if private property is acquired by acts of original appropriation (instead of by mere declarations or words of latecomers). [p. 15]
The emphasis on latecomers seems trivial but it is of immense significance. For if a latecomer has a better or equal claim to a given resource than someone who had it earlier, no property is secure, and we are in a might-makes-right situation, not one in which there are applicable norms designed to permit productive, conflict-free use of scarce means. This leads Hoppe to emphasize the importance of the prior-later distinction: that it matters, as between two claimants for a given resource, who had it first: “every property right has a history (temporal genesis)” [p. 17]. By an almost Misesian monetary regression-theorem like analysis, Hoppe uses these insights to validate the central insight of Lockean-libertarian homesteading: that the first user of a resource has a better claim than anyone else:
All property must go back, then, directly or indirectly, through a chain of mutually beneficial and hence likewise conflict-free property-title transfers, to original appropriators and acts of original appropriation. [p. 87]
The above provides only a sampling of the profound insights and understanding that are possible with an Austro-libertarian foundation—especially when combined with the searing and honest intellect of a thinker like Professor Hoppe.
1. Stephan Kinsella is the Executive Editor of Libertarian Papers (libertarianpapers.org). []
2. Austrians and the Private-Property Society: An Interview With Hans-Hermann Hoppe,” The Austrian Economics Newsletter vol 18, 1 (Spring 1998). []
3. See www.hanshoppe.com/translations. []
4. Here I am borrowing from a vivid metaphor from Shael Herman, “Detrimental Reliance in Louisiana Law–Past, Present, and Future (?): The Code Drafter’s Perspective,” Tulane Law Review 58:3 (1984), pp. 707–57, at 708–709, which observes that legal principles staked out by articles of a civil code embody a “plasma that bathes and nourishes an entire code and its institutions. The obligations articles are traditionally rich in analogies, making them, in Portalis’ famous phrase, ‘fertile in effects.’” []
5. Published in Murray N. Rothbard, The Logic of Action One (Edward Elgar, 1997), pp. 100–108. []
6. See my blog post, Hoppe on Intellectual Property, C4SIF Blog (Dec. 27, 2010), http://c4sif.org/2010/12/hoppe-on-intellectual-property/. []
Previous post:
Next post:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:39:36.000Z
|
n6hp3myiqlgqds7q7fwdsdvlg3cd34cs
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52232",
"uncompressed_offset": 683643510,
"url": "www.wikidoc.org/index.php/Scopolamine",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.wikidoc.org/index.php/Scopolamine"
}
|
cccc_CC-MAIN-2013-20
|
Scopolamine
Jump to: navigation, search
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [2]
The fictional truth drug Hyoscine-pentothal does not describe real hyoscine accurately.
Scopolamine
Systematic (IUPAC) name
(-)-(S)-3-Hydroxy-2-phenyl-propionic acid (1R,2R,4S,7S,9S)- 9-methyl-3-oxa-9-aza-tricyclo[3.3.1.02,4]non-7-yl ester
Identifiers
CAS number 51-34-3
ATC code A04AD01 N05CM05, S01FA02
PubChem 5184
DrugBank APRD00616
Chemical data
Formula C17H21NO4
Mol. mass 303.353 g/mol
Pharmacokinetic data
Bioavailability 10 - 50% [1]
Metabolism ?
Half life 4.5 hours[1]
Excretion ?
Therapeutic considerations
Pregnancy cat.
C(US)
Legal status
P(UK) -only(US)
Routes transdermal, ocular, oral, subcutaneous, intravenous
Scopolamine, also known as hyoscine, is a tropane alkaloid drug with muscarinic antagonist effects. It is obtained from plants of the family Solanaceae (nightshades), such as henbane or jimson weed (Datura species). It is among the secondary metabolites of these plants. The drug can be highly toxic and should be used in minute doses. As an example, in the treatment of motion sickness, the dose, gradually released from a transdermal patch, is only 330 micrograms (µg) per day. An overdose can cause delirium, delusions, paralysis, stupor and death.
Etymology
Scopolamine is named after the plant genus Scopolia. The name "hyoscine" is from the scientific name for henbane, Hyoscyamus niger.
Physiology
Scopolamine acts as a competitive antagonist at specific muscarinic acetylcholine receptors, specifically M1 receptors; it is thus classified as an anticholinergic, or, more specifically, as an anti-muscarinic drug. (See the article on the parasympathetic nervous system for details of this physiology.)
Medical use
In medicine scopolamine has 3 primary uses: treatment of nausea and motion sickness, treatment of intestinal cramping, and for ophthalmic purposes. Use as a general depressant and adjunct to narcotic painkillers is also common. The drug is less commonly used as a preanesthetic agent and uncommonly for some forms of Parkinsonism. Scopolamine is also used as an adjunct to narcotic analgesia, such as the product Twilight Sleep which contained morphine and scopolamine, some of the original formulations of Percodan and some European brands of methadone injection, as well as use of tablets or patches to combat nausea as well as enhance the pain-killing ability of various opioids. Scopolamine can be used as an occasional sleep aid and was available in some over the counter products in the United States for this purpose until November 1990.
Nausea
Its use in the form of a transdermal patch to prevent post-operative nausea is perhaps its greatest current use in the US.
Ophthalmic
The drug is used in eye drops to induce mydriasis (pupillary dilation) and cycloplegia (paralysis of the eye focusing muscle), primarily in the treatment of eye disorders that benefit from its prolonged effect, e.g. uveitis, iritis, iridocyclitis, etc.
Memory research
Because of its anticholinergic effects, scopolamine has been shown to prevent the activation of medial temporal lobe structures for novel stimuli during working memory tasks.
Nicotine addiction
Scopolamine is being investigated for its possible usefulness alone or in conjunction with other drugs in assisting people in breaking the nicotine habit. The mechanism by which it mitigates withdrawal symptoms appears to be at least partially different from that of clonidine meaning that the two drugs can be used together without duplicating or cancelling out the effects of each other.
Other medical uses
• It can be used as a depressant of the central nervous system, and was formerly used as a bedtime sleep aid.
• Anesthetic; Its use in general anesthesia is favored by some due to its amnesic effect. Scopolamine causes memory impairments to a similar degree as diazepam.[2]
• In otolaryngology it is used to dry the upper airway (anti-sialogogue action) prior to instrumentation of the airway.
• In October 2006 researchers at the US National Institute of Mental Health found that scopolamine reduced symptoms of depression within a few days, and the improvement lasted for at least a week after switching to a placebo.[3]
• Due to its effectiveness against sea-sickness it has become commonly used by scuba divers.
Routes of administration
Scopolamine can be administered by transdermal patches,[4] oral, subcutaneous, ophthalmic and intravenous routes. The transdermal patch for prevention of nausea and motion sickness employs scopolamine base. The oral, ophthalmic and intravenous forms are usually scopolamine hydrobromide (for example in Donnatal).
Recreational use
Scopolamine, in common with the large percentage of anticholinergics which cross the blood-brain barrier such as diphenhydramine, dicyclomine, trihexyphenidyl and related drugs, is said to produce euphoria at and around therapeutic doses as well as to potentiate this and other effects of morphine, methadone, hydromorphone, oxycodone and other opioids. It is therefore occasionally seen as a recreational drug. The use of medical scopolamine (most often in the form of tablets) for euphoria is uncommon but does exist and can be seen in conjunction with opioid use. The euphoria is the result of changes in dopamine and acetylcholine levels and ratios and appears to be related to some part of the chemical structure of the drug and other factors known or unknown -- even closely related drugs like atropine and hyoscyamine do not produce euphoria whilst the others listed above certainly appear to.
Another separate group of users prefer dangerously high doses, especially in the form of datura or belladonna preparations, for the deliriant and hallucinogenic effects. The hallucinations produced by scopolamine, in common with other potent anticholinergics, are especially real-seeming and create a perception of a new world filled with frenzied, violent energy. The difference in realism of hallucinations caused by anticholinergics such as scopolamine and other hallucinogens such as the phenethylamines or dissociatives like PCP is quite large. Additionally, an overdose of scopolamine can quite often be fatal, unlike other more commonly used hallucinogens. For these reasons, naturally occurring anticholinergics are rarely used for recreational purposes.
Potential use in interrogation
The use of scopolamine as a truth drug was investigated in the 1950s by various intelligence agencies, including the CIA as part of Project MKULTRA. Nazi doctor Josef Mengele experimented on scopolamine as an interrogation drug.
Criminal use
Scopolamine has been used under the name burundanga, a jungle form of Rohypnol in Venezuelan and Thailand resorts in order to drug and then rob tourists. While there are unfounded rumours that delivery mechanisms include using pamphlets and flyers laced with the drug, not enough is readily absorbed through the skin to have an effect. However, spiked alcoholic drinks are occasionally used. [5][6]
A nine part series on the drug, also known as "Colombian Devil's Breath", can be found on VBS.TV.
In recent years the criminal use of scopolamine has become an epidemic. Approximately fifty percent of emergency room admissions for poisoning in Bogotá have been attributed to scopolamine.[7]
Victims of this crime are often admitted to a hospital in police custody, under the assumption that the patient is experiencing a psychotic episode. A telltale sign is a fever accompanied by a lack of sweat.
Scopolamine is used criminally as a date rape drug and as an aid to robbery,[8] the most common act being the clandestine drugging of a victim's drink[9]. It is preferred because it induces anterograde amnesia, or an inability to recall events a certain amount of time after its administration or during the time of intoxication.
Shamanic use
In Colombia a plant admixture containing scopolamine called Burundanga has been used shamanically for decades.
Adverse effects
The common side effects are related to the anticholinergic effect on parasympathetic postsynaptic receptors: dry mouth, throat and nasal passages in overdose cases progressing to impaired speech which can reach the extreme of the victim only being able to emit noises which sound like the vocalisations of a raccoon, thirst, blurred vision and sensitivity to light, constipation, difficulty urinating and tachycardia. Other effects include flushing and fever, as well as excitement, restlessness, hallucinations, or delirium, especially with higher doses. These side effects are commonly observed with oral or parenteral uses of the drug and generally not with topical ophthalmic use. An extreme adverse reaction to ultra-high doses of drugs and other preparations containing scopolamine is temporary blindness which can last up to 72 hours
The fever and dryness associated with scopolamine has caused some recreational users to stumble into bodies of water and drown on occasion.
Sometimes side effects of scopolamine can be mistaken for symptoms of cancer because of the nausea and anisocoria associated with brain tumors. However, scopolamine induced anisocoria clears up usually within 3 days.
Use in scuba diving to prevent sea sickness has led to the discovery of another side effect. In deep water, below 50–60 feet, some divers have reported pain in the eyes that subsides quickly if the diver ascends to a depth of 40 feet or less. Mydriatics can precipitate an attack of glaucoma in susceptible patients, so the medication should be used with extra caution among divers who intend to go below 50 feet.
Drug interactions
When combined with morphine, it produces amnesia and a tranquilized state known as twilight sleep. Although originally used in obstetrics, it is now considered dangerous for that purpose for both mother and baby.
History
Scopolamine was one of the active ingredients in Asthmador, an over the counter smoking preparation marketed in the 1950's and 60's claiming to combat asthma and bronchitis.
Scopolamine was used in the 1940s through the 1960s that put mothers in labor into a kind of "twilight sleep" that didn’t stop pain, but merely eliminated the memory of pain by attacking the brain functions responsible for self-awareness and self-control. Often, this resulted in a kind of psychosis, followed by post-traumatic stress-like memories in thousands of new mothers.[10]
Scopolamine was an ingredient used in some over-the-counter sleep aids prior to November 1990 in the United States, when the FDA forced several hundred ingredients allegedly not known to be effective off the market. Scopolamine shared a small segment of this market with diphenhydramine, phenyltoloxamine, pyrilamine, doxylamine and other first generation antihistamines, many of which are still used for this purpose in drugs like Sominex, Tylenol PM, NyQuil and so on.
Popular culture
• (1940) In one of crime fiction's all-time classic novels, Farewell, My Lovely (1940) by Raymond Chandler, Marlowe gets shot full of Scopolamine in a private sanitarium in order to both shut him up, and to pump him for knowledge, when he gets too close to the truth on a case, or rather several cases entangled into one another, that he is working on (the idenity of Velma and the whereabouts of Moose Malloy).
"I had been shot full of dope to keep me quiet. Perhaps scopolamine too, to make me talk." (quote by Marlowe in Farewell, My Lovely)
"There's a drug called scopolamine, truth serum, that sometimes makes people talk without their knowing it. It's not sure fire, any more than hypnotism is. But it sometimes works." (quote by Marlowe in "Farewell, My Lovely")
• (1957) In popular culture, scopolamine has achieved a moderate level of notoriety via its mention in the film I Was a Teenage Werewolf, where Dr. Alfred Brandon uses it as part of his endeavor to regress the titular character to his "primitive roots."
• (1968) In Carlos Castaneda's series of books The Teachings of Don Juan: A Yaqui Way of Knowledge, the Datura plant is the favored shamanic, revelatory drug of the titular character. The book explores, in depth, Castaneda's experiences under the influence of the drug, as well as the rites surrounding its use and preparation.
• (1974) In episode 1 "That'll Be The Day", of the fourth series of the TV Series Callan, Callan is interrogated by the KGB using the drug Scopolamine as a truth serum.
• (1979) Scopolamine is also mentioned several times in Robert Ludlum's Matarese Dynasty, a fictional spy novel in which the drug is known for its uses as a truth serum.
• (1990) Scopolamine is mentioned by the villain Cain as one of the cutting agents of the drug Nuke in Robocop 2
• (1990s) The X-Files Red Museum shows Scopolamine as a suspect agent in usage for kidnappings.
• (2000) In the pilot episode for Season 1 of CSI: Crime Scene Investigation, a female thief seduces a man to sleep with her. She applies scopolamine to her nipples, which knocks the man out when he ingests it orally. After she robs him and makes her escape, the scopolamine which she absorbed into her skin causes her to pass out as well.
• (2000) Scopolamine was the drug Michael claimed he was injected with either by the military and/or the aliens in "The Mars Records". It might be worth noting in this context that scopolamine can cause confabulation (the mixing of memory and facts).
• (2007) In the episode "Airborne", one character in the TV show House, M.D. is shown wearing a scopolamine patch.
External links
References
1. 1.0 1.1 Putcha L, Cintrón NM, Tsui J, Vanderploeg JM, Kramer WG (June 1989). "Pharmacokinetics and oral bioavailability of scopolamine in normal subjects". Pharm. Res. 6 (6): 481–5. doi:10.1023/A:1015916423156. PMID 2762223.
2. Jones DM; Jones ME, Lewis MJ, Spriggs TL. (May 1979). "Drugs and human memory: effects of low doses of nitrazepam and hyoscine on retention.". Br J Clin Pharmacol. 7 (5): 479-83. PMID 475944.
3. Furey, ML; Drevets, WC (October 2006). "Antidepressant efficacy of the antimuscarinic drug scopolamine: a randomized, placebo-controlled clinical trial". Archives of General Psychiatry, vol 63, p 1121 63: 1121.
4. White PF, Tang J, Song D, et al (2007). "Transdermal scopolamine: an alternative to ondansetron and droperidol for the prevention of postoperative and postdischarge emetic symptoms". Anesth. Analg. 104 (1): 92-6. doi:10.1213/01.ane.0000250364.91567.72. PMID 17179250.
5. Snopes Burudanga rumour page
6. The 13 best travel scams - Times Online
7. Wall Street Journal, July 3, 1995
8. http://www.sobercircle.com/index.asp?node=resources§ion=articles&fileid=8%7C Retrieved 20/11/07
9. http://www.sobercircle.com/index.asp?node=resources§ion=articles&fileid=8%7C Retrieved 20/11/07
10. The Business of Being Born, [1]
cs:Skopolamin
de:Scopolaminit:Scopolamina lt:Skopolaminas hu:Szkopolamin nl:Scopolaminesk:Skopolamín sv:Skopolamin
Navigation WikiDoc | WikiPatient | Popular pages | Recently Edited Pages | Recently Added Pictures
Table of Contents In Alphabetical Order | By Individual Diseases | Signs and Symptoms | Physical Examination | Lab Tests | Drugs
Editor Tools Become an Editor | Editors Help Menu | Create a Page | Edit a Page | Upload a Picture or File | Printable version | Permanent link | Maintain Pages | What Pages Link Here
There is no pharmaceutical or device industry support for this site and we need your viewer supported Donations | Editorial Board | Governance | Licensing | Disclaimers | Avoid Plagiarism | Policies
Personal tools
Namespaces
Variants
Actions
Navigation
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:49:21.000Z
|
5krgmxk736btdcnagoqauls6tigghlzs
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52233",
"uncompressed_offset": 683667856,
"url": "www.wikidoc.org/index.php/Ventral_ramus_of_spinal_nerve",
"warc_date": "2013-11-22T19:23:45.000Z",
"warc_filename": "<urn:uuid:9af9c15d-032a-477f-9eec-480d4aabf2ef>",
"warc_url": "http://www.wikidoc.org/index.php/Ventral_ramus_of_spinal_nerve"
}
|
cccc_CC-MAIN-2013-20
|
Ventral ramus of spinal nerve
Jump to: navigation, search
Nerve: Ventral ramus
The formation of the spinal nerve from the dorsal and ventral roots. (Ventral ramus labeled at lower left.)
Latin ramus anterior nervi spinalis
Gray's subject #210 925
Dorlands
/ Elsevier
r_02/12688799
Editor-In-Chief: C. Michael Gibson, M.S., M.D. [1]
The ventral ramus (anterior ramus, anterior branch, anterior divisions of the spinal nerves) supply the antero-lateral parts of the trunk, and the limbs; they are for the most part larger than the posterior divisions.
In the thoracic region they run independently of one another, but in the cervical, lumbar, and sacral regions they unite near their origins to form plexuses.
The Ventral rami, including the sinuvertebral nerve branches, supply structures anterior to the facet joint, including the vertebral bodies, the discs and their ligaments and joints other spinal nerves to form the lumbo-sacral plexus.
External links
This article was originally based on an entry from a public domain edition of Gray's Anatomy. As such, some of the information contained herein may be outdated. Please edit the article if this is the case, and feel free to remove this notice when it is no longer relevant.
Navigation WikiDoc | WikiPatient | Popular pages | Recently Edited Pages | Recently Added Pictures
Table of Contents In Alphabetical Order | By Individual Diseases | Signs and Symptoms | Physical Examination | Lab Tests | Drugs
Editor Tools Become an Editor | Editors Help Menu | Create a Page | Edit a Page | Upload a Picture or File | Printable version | Permanent link | Maintain Pages | What Pages Link Here
There is no pharmaceutical or device industry support for this site and we need your viewer supported Donations | Editorial Board | Governance | Licensing | Disclaimers | Avoid Plagiarism | Policies
Personal tools
Namespaces
Variants
Actions
Navigation
Toolbox
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:18:53.000Z
|
27omsxh4nhv4uzasp4uycfrykjm2qrz2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52239",
"uncompressed_offset": 2488233,
"url": "abs.gov.au/AUSSTATS/abs%40.nsf/ProductsbyReleaseDate/B0A09D3E58D1C7F5CA2570A40002A330",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://abs.gov.au/AUSSTATS/abs@.nsf/ProductsbyReleaseDate/B0A09D3E58D1C7F5CA2570A40002A330?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
5206.0 - Australian National Accounts: National Income, Expenditure and Product, Sep 2002
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 04/12/2002
Page tools: Print Page Print All RSS Search this Product
ABOUT THIS RELEASE
Previously: Australian National Accounts: National Income and Expenditure (ISSN: 1031-5128)
Absorbs: 5222.0
Detailed presentation of quarterly national accounts showing both current price estimates and chain volume measures in original, seasonally adjusted and trend terms. State details for components of state final demand are also included.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:51:29.000Z
|
ndsoplzbjxlakhowtmchrfph3rh7ipwa
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52246",
"uncompressed_offset": 9143368,
"url": "answers.onstartups.com/questions/23708/web-app-pricing-in-eur-or-usd",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://answers.onstartups.com/questions/23708/web-app-pricing-in-eur-or-usd"
}
|
cccc_CC-MAIN-2013-20
|
Tell me more ×
Answers OnStartups is a question and answer site for entrepreneurs looking to start or run a new business. It's 100% free, no registration required.
I'm about to launch my own web app. Being in Europe and thinking about pricing I'm wondering if I should charge in EURO or US DOLLAR?
I have no concrete numbers, but I expect 70-80% of the customers to come from the US.
I don't want to scare off the American customers, but I also don't want my income to depend on the exchange rate this much.
Ideas? Experiences? Studies?
share|improve this question
migrated from webapps.stackexchange.com Apr 20 '11 at 10:18
6 Answers
You should have prices in EUR and US. Some payment processors have mechanisms to auto-detect the visitor country and show the prices in appropriate currency. Another option is to have drop down selection to choose the currency and recalculate the prices.
share|improve this answer
Charge in US $, and also have a Price in € and £ if appropriate.
If you don't have a dollar price directly you will have purchase resistance, just as in the UK you have resistance for a non Sterling price.
How much resistance will depend on the demographic and target customers.
If you want to smooth out daily currency fluctuations you can always assess every month or something and come up with a new "nice" price $8.99 $9.99 etc.
If most of your market is US based and you're in the EU you're going to have to be subject to exchange rate fluctuations to some extent - if you're charging a monthly fee it will seem strange to many customers if that price changes every month.
share|improve this answer
You say "I don't want my income to depend on the exchange rate this much". So you want your customers to take the risk? You can want that but I promise you Americans will not sign up for a recurring fee in a currency other than dollars. So the bottom line is it doesn't matter what you want, what matters is what the market will tolerate. If you expect 70% of your business to come from the US, you will be putting 70% of your business at risk to not quote prices in USD.
share|improve this answer
You should geo-locate so as to not show both (ie if from non-EU address, show in $), and have some sort of pricing engine that takes the fluctuations over time but only adjusts in normal increments so as to not look weird.
share|improve this answer
I agree with Ross that you should offer prices in both Euro and USD. US customers will most likely not sign up for a subscription fee in a currency other than dollars so, no matter what, if you expect 70-80% of your customers to be from the US I would definitely recommend putting their "comfort" first.
With an online accounting software like E-conomic, you can easily invoice your customers in different currencies depending on their needs. Exchange rates are updated in E-conomic daily, or you can set your own fixed exchange rates if you would like. You can find out more on our website, or by giving us a call.
No matter what you choose, good luck with your new venture!
share|improve this answer
Just update the dollar prices manually on a regular basis if that is possible. It is at least better than charging americans in Euros. Ross's answer, is of course the more advanced answer.
share|improve this answer
Your Answer
discard
By posting your answer, you agree to the privacy policy and terms of service.
Not the answer you're looking for? Browse other questions tagged or ask your own question.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:50:56.000Z
|
bzm6nbxbu6xhlitvaxkhf7hiuudkby3i
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52247",
"uncompressed_offset": 9156918,
"url": "answers.onstartups.com/questions/37908/using-domain-name-in-eula-of-a-software-rather-than-my-name-in-the-licensor-fiel",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://answers.onstartups.com/questions/37908/using-domain-name-in-eula-of-a-software-rather-than-my-name-in-the-licensor-fiel"
}
|
cccc_CC-MAIN-2013-20
|
Tell me more ×
Answers OnStartups is a question and answer site for entrepreneurs looking to start or run a new business. It's 100% free, no registration required.
I intend to sell a software solution.I have already registered a domain but i dont have a registered company.Can i use my website/domain name eg:myproduct.com for the licensor field in the EULA rather than using myname.I will renew my domain yearly is there a problem with this.Do you know any software companies that work like this.Im confused about the users point of view will they find it a bit different. Please help me out.
share|improve this question
1 Answer
up vote 1 down vote accepted
What you have is a doing business as (DBA) situation. You own the business (you are the business) and your name is myname. The customer is licensing the software from myname. You also have the situation where you would like to use some other name for your business when dealing with the public and licensing the software, right now that name is somedomain.com. So what you have is myname doing business as somedomain.com.
That is perfectly fine. Depending on where you are located you may need to file a DBA certificate with the appropriate governmental authority.
share|improve this answer
Your Answer
discard
By posting your answer, you agree to the privacy policy and terms of service.
Not the answer you're looking for? Browse other questions tagged or ask your own question.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:39:22.000Z
|
nyaa7q33bf3ecwqkt2yigocomvvvbxcz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52265",
"uncompressed_offset": 25692134,
"url": "blog.wikimedia.org/2012/05/08/walters-museum-uploads-19000-photos-to-wikimedia-commons/",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://blog.wikimedia.org/2012/05/08/walters-museum-uploads-19000-photos-to-wikimedia-commons/"
}
|
cccc_CC-MAIN-2013-20
|
Wikimedia blog
News from the Wikimedia Foundation and about the Wikimedia movement
Walters Museum uploads 19,000 photos to Wikimedia Commons
The Tulip Folly, Jean-Léon Gérôme, from the Walters Museum collection
The Walters Art Museum in Baltimore, Maryland, has donated more than 19,000 freely-licensed images of artworks to Wikimedia Commons. The Walters’ collection includes ancient art, medieval art and manuscripts, decorative objects, Asian art and Old Master and 19th-century paintings. The images and their associated information will join our collection of more than 12 million freely usable media files, which serves as the repository for the 285 language editions of Wikipedia.
The project began taking shape in February 2012, as part of the GLAM-Wiki initiative (Galleries, Libraries, Archives, and Museums). During GLAMcamp DC, a three-day conference hosted by the National Archives and Records Administration in Washington, D.C., the Walters Museum worked with several Wikimedians to develop a documented process for uploading images to Commons. The basic details of the upload procedure were established during the conference, and during the weeks that followed, the uploads were conducted, monitored and tested, while collaboration continued online.
”The Walters has gone above and beyond throughout this collaboration with the GLAM-Wiki community, working alongside Wikipedians to serve as a model for our mass image upload process,” said Lori Byrd Phillips, U.S. Cultural Partnerships Coordinator for the Wikimedia Foundation. “The release of these images will not only improve articles in Wikipedia, but will also have the potential to be used freely throughout the web.”
The image donation is part of the Walters Museum’s larger initative to provide free public access to its collection, both online and offline, beginning with the removal of admission fees in 2006. In 2011, the Walters launched a redesigned works of art website with 10,000 online artwork images freely licensed under a Creative Commons license.
Sarasvati image from Walters Museum
”By uploading our information in this way, we can share items of cultural heritage from around the globe, directly with people in those parts of the world. Already our images have been used in 48 different languages. The Walters’ collection is well-suited for this project because of its size and its breadth of topic areas,” said Dylan Kinnett, Manager of Web and Social Media for the Walters Art Museum. “By developing documentation and tools for this type of work, we hope that our upload project can serve as a prototype for other cultural institutions.”
Already, the museum’s images have had an impact in improving content on Wikipedia, such when they are used as illustrations in entries whose topic is not the artwork itself, but a related idea, such as a mythological figure, or a time or place. The Walters’ painting of the Hindu goddess Saraswati, for instance, has been added to five different language Wikipedia entries about the goddess.
We would like to thank to the Walters Museum for their donation and their commitment to promoting free knowledge on Wikimedia Commons, and to the GLAM volunteers who helped make this endeavor possible.
Matthew Roth, Global Communications Manager
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:00:03.000Z
|
htmlonxboaiup36kuwmtwfhjk6e6p7tc
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52284",
"uncompressed_offset": 53283365,
"url": "dangerouslyirrelevant.org/tag/michael-pershan",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://dangerouslyirrelevant.org/tag/michael-pershan"
}
|
cccc_CC-MAIN-2013-20
|
Tag Archives: Michael Pershan
A Japanese approach to Khan Academy
Got 13 minutes? Watch this video from Michael Pershan. Plain and simple, American math teachers teach differently than Japanese (and other international) math teachers. What would Khan Academy look like if it came from Japan? Well, it would look more like the work that Dan Meyer’s doing
Michael’s video was the winner of the #MTT2K prize. Happy viewing!
Switch to our mobile site
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:51:01.000Z
|
pfzsn63zvynvktvca4wmfnmfht2ydgzf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52286",
"uncompressed_offset": 67678021,
"url": "elinux.org/Topic-by-topic_Review",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://elinux.org/Topic-by-topic_Review"
}
|
cccc_CC-MAIN-2013-20
|
Topic-by-topic Review
From eLinux.org
Jump to: navigation, search
This page describes the topic-by-topic review project for the elinux wiki.
This project consists of going through each major topic area on the wiki, and reviewing the content for accuracy and up-to-date-ness. Obsolete material will be moved to an "archive" section of the page (and dated, if possible). The latest areas of work in that topic will be added, and any appropriate page re-organizations will be made.
The idea is to overhaul the content over time, to make it better and more uniform, and especially to deprecate material that is obsolete or no longer relevant. Part of this concept is to do this one topic at a time, over a period of months and years, so that there can be focus in each area and visible progress as work is done.
Contents
Topic List
Here are the major portals or topic areas on the wiki (independent of the hardware areas):
• Embedded Linux Glossary - definitions of general terms
• Boot Time
• Memory Management
• Security
• Events (skip this one)
• Multimedia
• Power Management
• System Size
• Hardware Hacking
• File Systems
• Real Time
• Resource Management
• Development Platforms (skip this one)
• Networking
• Firmware
• Legal Issues
• Toolbox
• build systems
• embedded distributions
• Android Portal
• Debugging Portal
• Category:Categories
It seems to me that this misses one major area of work, which is embedded distributions and build systems. These are both in the "toolbox" area, which may need to be broken out for individual sub-sweeps of it's own.
Issues
In order to do a methodical sweep of the site, there needs to be a mechanism to keep track of the status of a page (whether it has been reviewed, by whom, when it was last reviewed, what needs work on the page, etc.) Usually, the Discussion page for each page has meta-information like this about a page. Can we work out a way to automatically scan the discussion pages, and generate reports. This would be useful for finding pages that still need work.
It would be nice to have a quality metric, with objective criteria for when a page has reached some threshold of utility or quality, so that we can know when we're "done".
Finding experts
Another idea is to find experts to come in and help review material, on a one-time basis, for each topic area. Volunteer editors may not have the subject matter expertise to know how to edit an area. And it can take a very steep learning curve to come up to speed enough to contribute (even to know what material is now obsolete). We should determine a way of involving subject matter experts, such that they don't have to become wiki experts, and we minimize the impact on their time, at the same time leveraging their expertise.
Ideas?
• here's one: have volunteer editor send page (or page fragment) by e-mail to a subject matter expert, with specific questions about the content (what is obsolete?, what is the status of this thing?, what is the next project in this area?)
• Problems: relies on volunteer editor knowing who the expert is, getting their e-mail address, and communicating with them.
• Possible Solutions: Ask on the Embedded Linux mailing lists. Solicit input from community on IRC.
• Maybe we should keep the list of experts on the Discussion page for each portal? (Maybe this policy could apply to all
pages???)
Sequence
This is the sequence of operations for cleaning up a topic area:
Building a proper checklist is a work-in-progress...
• First, create the glossary
• Make sure that definitions related to a topic area are available on a glossary page for that area
• Check the portal page
• check index for related pages (search for terms on the glossary page, to find pages related to this topic)
• make sure all linked pages are categorized
• check the topic category to find pages that are not linked in
• Check individual pages
• is the material obsolete (if so, move to a history section)
• are any major new features or technology areas missing (if so, at least put stubs for them)
• Check for external/new material:
• Check for LWN.net articles on the given topic
• Check for stackoverflow articles
• Scan presentations for unlinked articles
• check for stubs, and replace with content
• This may require research or discussion with experts
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:34:46.000Z
|
nm2aw2ntgpndplzmnrmpg3rthyacisei
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52308",
"uncompressed_offset": 93093977,
"url": "genomebiology.com/2000/1/6/spotlight-20001218-01/abstract",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://genomebiology.com/2000/1/6/spotlight-20001218-01/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Research news
Celera submits to Science - or is it the other way around?
Peter Moore
• Correspondence: Peter Moore
Genome Biology 2000, 1:spotlight-20001218-01 doi:10.1186/gb-spotlight-20001218-01
Published: 18 December 2000
Celera will be allowed to publish its research in Science while retaining some control over the intellectual property that it contains. Welcome to the future, says Editor-in-Chief of Science Donald Kennedy.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:18:39.000Z
|
aqtmt6yi2vq5xhvjcoptlkjzhr2g76ut
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52332",
"uncompressed_offset": 129315132,
"url": "lists.maemo.org/pipermail/maemo-developers/2008-February/014700.html",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://lists.maemo.org/pipermail/maemo-developers/2008-February/014700.html"
}
|
cccc_CC-MAIN-2013-20
|
[maemo-developers] hildon.TimePicker: HOW TO SET INITIAL TIME?
From: Darren Enns darethehair at gmail.com
Date: Wed Feb 20 19:22:11 EET 2008
OK, my ignorance is showing again...
http://maemo.org/development/documentation/apis/3-x/python-maemo-3.x/pyhildon_timepicker.html
I know how to call 'hildon.Timepicker', but the widget starts up with
'06:00' as the initial value. From the docs, it *looks* like I should
be able to override this with my own initial values for 'hour' and
'minute', but I don't know enough about Python (yet) to understand how
to do this (from simply reading the docs and not having an example to use).
It would appear (from the docs) that I should use something like this in
my code:
|hildon.Class.set_time(hours, minutes)
|The 'hildon.CalendarPopup' is more intuitive to me, since setting the
initial year/month/day is part of the call to the function itself.
Thanks
|
|
More information about the maemo-developers mailing list
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:51:57.000Z
|
qzqeybqstz5onal6hutdkujklelzhdya
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52374",
"uncompressed_offset": 179977123,
"url": "quotationsbook.com/quote/13514/",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://quotationsbook.com/quote/13514/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
Where there is no extravagance there is no love, and where there is no love there is no understanding. Wilde, Oscar
This quote is about extravagance · Search on Google Books to find all references and sources for this quotation.
A bit about Wilde, Oscar ...
Oscar Fingal O'Flahertie Wills Wilde (October 16, 1854 November 30, 1900) was an Anglo-Irish playwright, novelist, poet, and short story writer. One of the most successful playwrights of late Victorian London, and one of the greatest celebrities of his day, known for his barbed and clever wit, he suffered a dramatic downfall and was imprisoned after being convicted in a famous trial of "gross indecency" for homosexual acts.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:26:38.000Z
|
aaarwqrfbqmjsuifbwh5ooft3jdjkcsi
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52375",
"uncompressed_offset": 179988916,
"url": "quotationsbook.com/quote/gift/4759/",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://quotationsbook.com/quote/gift/4759/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
There is no robber worse than a bad book. Proverb, Italian
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:39:07.000Z
|
pabjzc6atjes7trmxmgsdow25mhe4nuc
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52428",
"uncompressed_offset": 242615872,
"url": "wiki.gentoo.org/wiki/PostgreSQL",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://wiki.gentoo.org/wiki/PostgreSQL"
}
|
cccc_CC-MAIN-2013-20
|
PostgreSQL
From Gentoo Wiki
Jump to: navigation, search
PostgreSQL is a free and open source relational database management system (RDBMS). It supports such things as transactions, schemata and foreign keys, and is often touted to more strictly adhere to the SQL standards and to be more secure, by default, than any other database, commercial or otherwise.
Visit the About page on postgresql.org for more information.
Installation, Upgrading, and Migration
See Gentoo's PostgreSQL Quick Start Guide for details about installing, upgrading, or migrating PostgreSQL.
Add User
user $ psql -U postgres -d postgres
psql (9.1.1)
Type "help" for help.
postgres=# CREATE ROLE username WITH LOGIN;
CREATE ROLE
postgres=# \password username
Enter new password:
Enter it again:
postgres=# CREATE DATABASE testdb WITH OWNER username; -- username has all privileges on testdb
CREATE DATABASE
postgres=# GRANT CONNECT ON DATABASE otherdb TO username; -- username can now connect to otherdb
GRANT
postgres=# \c otherdb
You are now connected to database "otherdb" as user "postgres".
otherdb=# GRANT SELECT ON test TO username; -- username can now query (SELECT statements) the test table on otherdb.
GRANT
See Chapter 20. Database Roles of the official PostgreSQL documentation for more on role management.
See the PostgreSQL documentation for more on GRANT and REVOKE,
Changing the default encoding of new databases to UTF-8
When creating a new database (e.g. with createdb mydb) PostgreSQL actually copies a template database. There are two predefined templates: template0 is vanilla, while template1 is meant as an on-site template changeable by the administrator and is used by default. In order to change the default encoding of new databases, one of the options is to change on-site template1. To do this, log into PostgresSQL shell (psql) and execute the following:
1. First we need to drop template1. As templates cannot be dropped, we first need to change it to an ordinary database:
UPDATE pg_database SET datistemplate = FALSE WHERE datname = 'template1';
2. After that, it is possible to drop it:
DROP DATABASE template1;
3. The next step is to create a new database from template0 with a new default encoding. (Gotcha: In PostgreSQL, Unicode is synonymous with UTF-8.)
CREATE DATABASE template1 WITH TEMPLATE = template0 ENCODING = 'UNICODE';
4. Now we need to change template1 back to the template:
UPDATE pg_database SET datistemplate = TRUE WHERE datname = 'template1';
5. (OPTIONAL) If you do not want anyone connecting to this template, set datallowconn to FALSE:
UPDATE pg_database SET datallowconn = FALSE WHERE datname = 'template1';
Now you can create a new database by running from regular shell:
user $ createdb -U postgres testdb
If you log in back to psql and check the databases, you should see the proper encoding of your new database:
user $ psql -U postgres -d postgres
psql (9.1.1)
Type "help" for help.
postgres=# \l
List of databases
Name | Owner | Encoding | Collation | Ctype | Access privileges
----------+----------+-----------+-----------+-------+----------------------
testdb | postgres | UTF8 | C | C |
postgres | postgres | SQL_ASCII | C | C |
template0 | postgres | SQL_ASCII | C | C | =c/postgres
: postgres=CTc/postgres
template1 | postgres | UTF8 | C | C |
Personal tools
Namespaces
Variants
Actions
Go to: Gentoo Home Documentation Forums Lists Bugs Planet Store Wiki Get Gentoo!
Navigation
Toolbox
Categories
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:33:47.000Z
|
bseopjaun7rla2oltaiomm7wx75uba65
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52431",
"uncompressed_offset": 243052845,
"url": "wikitravel.org/wiki/en/index.php?action=history&title=Talk%3ALafayette_%28Indiana%29",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=Talk:Lafayette_(Indiana)&action=history"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Revision history of "Talk:Lafayette (Indiana)"
Jump to: navigation, search
Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Toolbox
In other languages
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:32:46.000Z
|
mr4pocdwo2x6ilokicx7jkvbipsrrvso
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52437",
"uncompressed_offset": 251995632,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Latestproducts/62C064E6A177AE42CA256AAF001FCAB3",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Latestproducts/62C064E6A177AE42CA256AAF001FCAB3?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
1272.0 - Australian Standard Classification of Education (ASCED), 2001
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 22/08/2001
Page tools: Print Page RSS Search this Product
Contents >> Field of Education Structure and Definitions >> Definitions >> 09 Society and Culture >> 0913 Librarianship, Information Management and Curatorial Studies
NARROW FIELD 0913 LIBRARIANSHIP, INFORMATION MANAGEMENT AND CURATORIAL STUDIES
LIBRARIANSHIP, INFORMATION MANAGEMENT AND CURATORIAL STUDIES is the study of selecting, acquiring, organising, storing and facilitating the use of collections of information, and locating, identifying and assessing cultural heritage resources.
The main purpose of this narrow field of education is to develop an understanding of different methods and practices in library and information management, the methods of selecting and organising library resources, and the technology used in the storage, retrieval and dissemination of information. It also involves analysing cultural materials, preserving artefacts and planning exhibitions.
Courses in Narrow Field 0913 Librarianship, Information Management and Curatorial Studies develop skills in:
. conserving and exhibiting artefacts of cultural importance
. identifying and meeting the information needs of individuals, groups and organisations
. managing and maintaining information collections
. using various technologies and media for recording, storing and retrieving information
This narrow field comprises the following detailed fields:
091301 Librarianship and Information Management
091303 Curatorial Studies
091301 Librarianship and Information Management
Librarianship and Information Management is the study of selecting, acquiring, organising and storing collections of information, and facilitating the use of information.
Examples of subjects in this detailed field include:
. archival studies
. cataloguing and classifications
. collection management
. information retrieval and dissemination
. library administration
. records management
091303 Curatorial Studies
Curatorial Studies is the study of locating, identifying and assessing cultural heritage resources.
Examples of subjects in this detailed field include:
. conservation of objects
. exhibition planning
. museography
. museology
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:51:52.000Z
|
ea2exsgf4jm7wpx3ygyvu2k3e6kxl4fs
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52439",
"uncompressed_offset": 252011922,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/second%2Blevel%2Bview?issue=1997&prodno=1302.0&prodno=1302.0&tabname=Past+Future+Issues&viewtitle=Pocket+Year+Book%2C+Australia~1997~Previous~26%2F02%2F1997",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/second+level+view?ReadForm&prodno=1302.0&viewtitle=Pocket%20Year%20Book,%20Australia~1997~Previous~26/02/1997&tabname=Past%20Future%20Issues&prodno=1302.0&issue=1997&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1302.0 - Pocket Year Book, Australia, 1997
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 26/02/1997
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:44:35.000Z
|
75n7qpy3jb3nxjz3kstzxbolkx7zcmxh
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52440",
"uncompressed_offset": 252017506,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/second%2Blevel%2Bview?issue=Oct+1993&prodno=6203.0&prodno=6203.0&tabname=Past+Future+Issues&viewtitle=The+Labour+Force%2C+Australia~Oct+1993~Previous~29%2F11%2F1993",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/second+level+view?ReadForm&prodno=6203.0&viewtitle=The%20Labour%20Force,%20Australia~Oct%201993~Previous~29/11/1993&tabname=Past%20Future%20Issues&prodno=6203.0&issue=Oct%201993&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
6203.0 - The Labour Force, Australia, Oct 1993
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 29/11/1993
Past Releases
First Release
• First Issue: Feb 1969
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:36:32.000Z
|
hdy6jgxex3roqdcjmirhapltrbl7qkes
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52441",
"uncompressed_offset": 252027078,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/94713ad445ff1425ca25682000192af2/7763d75321031035ca256dea0005399b!OpenDocument",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/94713ad445ff1425ca25682000192af2/7763d75321031035ca256dea0005399b!OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1301.0 - Year Book Australia, 2004
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 27/02/2004
Page tools: Print Page RSS Search this Product
Contents >> Energy >> Energy resources
Australia has large identified resources of fossil fuels and uranium. It is ranked in the top six countries in the world for economic demonstrated resources (EDR) of black and brown coal, and has the world's largest EDR of uranium. Australia also has significant reserves of natural gas and crude oil. For a more detailed outline on Australia's energy and mineral resources, see Mining.
Australia has substantial resources of high quality black coal. Most of these resources are located in New South Wales and Queensland. Small but locally important coal resources occur in Western Australia, South Australia and Tasmania. Brown coal occurs mainly in Victoria with other known resources in Western Australia, South Australia and Tasmania (Geoscience Australia 2002a).
Map 17.2 shows the extent of access to gas resources and major transmission pipelines in Australia. At June 2002, EDR of natural gas totalled 2,219 billion cubic metres, with the Carnarvon Basin accounting for over 50% of total reserves. The total length of Australia's transmission pipeline system has increased from 9,000 kilometres (km) in 1989 to over 20,000 km in 2001 (APIA 2001).
17.2 GAS RESOURCES - 2002
Source: The Australian Gas Association.
EDR of non-renewable energy assets were estimated at 1.9 million PJ in 2001 (table 17.3). Black coal accounted for 59%, followed by brown coal (19%) and uranium (16%). Australia has the world's largest resources of uranium in the low cost (EDR) category, with 29% of the world's total EDR (recoverable at <US$80/kg U). Other countries with significant EDR of uranium include: Kazakhstan (19%), Canada (14%), South Africa (10%), Brazil (7%), Namibia (6%), the Russian Federation (6%) and the United States of America (5%).
Changes in EDRs can be due to various factors, one of which is production activity. Others include discoveries and reclassification of resources due to reassessments (such as with black and brown coal in 1999, when some resources previously considered economic were reclassified as subeconomic).
17.3 ECONOMIC DEMONSTRATED RESOURCES OF PRIMARY ENERGY PRODUCTS(a)
1991
2001
Change
Fuel
'000 PJ
'000 PJ
%
Black coal
1,387.8
1,152.8
-16.9
Brown coal
404.5
365.7
-9.6
Crude oil
9.5
8.4
-11.6
Condensate
4.4
10.4
136.4
LPG
3.4
6.9
102.9
Natural gas
26.9
86.5
221.6
Uranium
222.8
307.4
38.0
Total
2,059.3
1,938.1
-5.9
(a) Non-renewable resources only.
Source: ABS data available on request, Australian System of National Accounts.
Table 17.4 shows the net present value (NPV) of demonstrated energy assets within Australia. The NPV is the expected value of the resource based on current market value, with some modifications based on depletion and economic forces. At June 2002 total subsoil assets had an NPV of $245b, of which 74% was attributed to the NPV of energy assets (over $181b). The two most significant energy assets were black coal and natural gas which accounted for 32% and 36%, respectively. The increase in the value of energy resources between 1992 and 2002 was primarily due to increases in the NPV of black coal and natural gas over this period - the NPV of black coal alone increased seventeen-fold.
17.4 NET PRESENT VALUE OF PRIMARY ENERGY PRODUCTS
30 June 1992
30 June 2002
Change
Fuel
$m
$m
%
Black coal
3,282
57,915
1,665
Brown coal
169
706
318
Crude oil
13,385
26,416
97
Condensate
2,575
20,511
696
LPG(a)
1,253
6,806
443
Natural gas
14,770
64,713
338
Uranium
2,187
4,237
94
Total
37,621
181,304
382
(a) Naturally occurring.
Source: ABS data available on request, Australian System of National Accounts.
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:03:35.000Z
|
r4zkmzv4mbzzyuy6hzu6x667bwxxxmcz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52445",
"uncompressed_offset": 296255016,
"url": "www.biomedcentral.com/1471-2229/4/1",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.biomedcentral.com/1471-2229/4/1"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Production of Se-methylselenocysteine in transgenic plants expressing selenocysteine methyltransferase
Danielle R Ellis1,2, Thomas G Sors1, Dennis G Brunk1, Carrie Albrecht1, Cindy Orser3, Brett Lahner1, Karl V Wood4, Hugh H Harris5,6, Ingrid J Pickering5,7 and David E Salt1*
Author Affiliations
1 Center for Plant Environmental Stress Physiology, 1165 Horticulture Building, Purdue University, West Lafayette, IN 47907, USA
2 Visiting Scientist: NuCycle Therapy, Inc, Hillside, NJ, 07205, USA
3 Arete Associates, Gaithersburg, MD 20878, USA
4 Chemistry Department, Purdue University, West Lafayette, IN 47907, USA
5 Stanford Synchrotron Radiation Laboratory, Stanford Linear Accelerator Center, Menlo Park, CA 94025, USA
6 School of Chemistry, University of Sydney, NSW, 2006, Australia
7 Department of Geological Science, University of Saskatchewan, Saskatoon, SK S7N 5E2, Canada
For all author emails, please log on.
BMC Plant Biology 2004, 4:1 doi:10.1186/1471-2229-4-1
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2229/4/1
Received:10 November 2003
Accepted:28 January 2004
Published:28 January 2004
© 2004 Ellis et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media for any purpose, provided this notice is preserved along with the article's original URL.
Abstract
Background
It has become increasingly evident that dietary Se plays a significant role in reducing the incidence of lung, colorectal and prostate cancer in humans. Different forms of Se vary in their chemopreventative efficacy, with Se-methylselenocysteine being one of the most potent. Interestingly, the Se accumulating plant Astragalus bisulcatus (Two-grooved poison vetch) contains up to 0.6% of its shoot dry weight as Se-methylselenocysteine. The ability of this Se accumulator to biosynthesize Se-methylselenocysteine provides a critical metabolic shunt that prevents selenocysteine and selenomethionine from entering the protein biosynthetic machinery. Such a metabolic shunt has been proposed to be vital for Se tolerance in A. bisulcatus. Utilization of this mechanism in other plants may provide a possible avenue for the genetic engineering of Se tolerance in plants ideally suited for the phytoremediation of Se contaminated land. Here, we describe the overexpression of a selenocysteine methyltransferase from A. bisulcatus to engineer Se-methylselenocysteine metabolism in the Se non-accumulator Arabidopsis thaliana (Thale cress).
Results
By over producing the A. bisulcatus enzyme selenocysteine methyltransferase in A. thaliana, we have introduced a novel biosynthetic ability that allows the non-accumulator to accumulate Se-methylselenocysteine and γ-glutamylmethylselenocysteine in shoots. The biosynthesis of Se-methylselenocysteine in A. thaliana also confers significantly increased selenite tolerance and foliar Se accumulation.
Conclusion
These results demonstrate the feasibility of developing transgenic plant-based production of Se-methylselenocysteine, as well as bioengineering selenite resistance in plants. Selenite resistance is the first step in engineering plants that are resistant to selenate, the predominant form of Se in the environment.
Background
Selenium is an essential nutrient for animals, microorganisms and some other eukaryotes [1]. While Se deficiency is rare in the US, it does occur in several low Se parts of the world such as China, and can lead to heart disease, hypothyroidism and a weakened immune system [2,3]. The toxic effects of excess Se have been known for some time. Short-term consumption of high levels of Se may cause nausea, vomiting, and diarrhea, whereas chronic consumption of high concentrations of Se compounds can result in a disease called selenosis [4]. Only one form of Se, selenium sulfide, has been implicated as a carcinogen [4]. The recognition of Se bioaccumulation and resulting wildlife toxicity at Kesterson reservoir in California and other sites has resulted in a surge of interest in phytoremediation of Se [5-8]. Selenium in the environment can be the result of either natural geological processes or human activities. The USGS has identified 160,000 miles2 of land in the western US enriched in Se from natural processes that is susceptible to irrigation-induced Se contamination, including 4,100 miles2 of land currently irrigated for agriculture [9]. Selenium pollution can also arise from various industrial and manufacturing processes including procurement, processing, and combustion of fossil fuels [10], and mining [11].
Interestingly, in the last decade it has become increasingly evident that Se also has potential health benefits. Anticarcinogenic activities of specific organic forms of Se against certain types of cancer have been demonstrated [3,12-14]. In a long term, double-blind study, supplemental dietary Se was associated with significant reductions in lung, colorectal and prostate cancer in humans [3]. Other studies have also demonstrated the chemoprotective effects of Se against breast, liver, prostate, and colorectal cancers in model systems [15-17]. Importantly, there is a great deal of variation in the efficacy of different Se compounds against cancer [13,18]. Numerous studies have demonstrated the efficacy of Se-methylselenocysteine (MeSeCys) in preventing mammary cancer in rat model systems [16,19-23], and importantly, MeSeCys has been shown to be twice as active as Se-methionine (the primary component of Se-yeast supplements) in preventing the development of mammary tumors in rats [18]. Furthermore, MeSeCys in both garlic and broccoli has also been shown to be more effective than either Se-methionine (SeMet) in yeast, or broccoli supplemented with selenite, at reducing both the incidence of mammary and colon cancer in rats [19,21]. This nonprotein seleno amino acid is produced in certain plants including members of the Brassica and Allium genera [3,24], and in Se accumulating plants such as Astragalus bisulcatus [25,26]. While the specific mechanism for the anticancer activity of Se has not been fully elucidated, multiple studies have demonstrated the ability of Se to affect the cell cycle and induce apoptosis in cancer cell lines [14,24,27-35]. There is also evidence that Se may inhibit tumor angiogenesis [36,37]. Both of these activities would inhibit progression of early cancerous lesions.
Plants primarily take up Se as selenate or selenite [38], which is then metabolized, via the sulfur assimilation pathway, resulting in the production of selenocysteine, SeMet and other Se analogues of various S metabolites, as reviewed by Ellis and Salt (2003) [39]. The nonspecific incorporation of seleno amino acids into proteins is thought to contribute to Se toxicity [40]. One proposed mechanism of Se tolerance in plants is the specific conversion of potentially toxic seleno amino acids into nonprotein derivatives such as MeSeCys [41,42]. Some Brassica and Allium species, when grown in Se enriched medium, can accumulate 0.1–2.8 μmol g-1 dry weight MeSeCys or its functional equivalent γ-glutamylmethylselenocysteine (γGluMeSeCys) [13,15,16,21,24,43]. However, certain specialized Se accumulating plants, such as A. bisulcatus, accumulate up to 68 μmol g-1 dry weight Se (6000 μg g-1 dry weight), of which 90–95% is MeSeCys in young leaves [44-46].
Selenocysteine methyltransferase (SMT), the enzyme responsible for the methylation of selenocysteine to MeSeCys in A. bisulcatus, has recently been cloned and characterized [47]. The availability of such genetic material opens a practical avenue for the development of plants with an enhanced ability to biosynthesize MeSeCys. Such plants would be expected to not only be more resistant to Se, a valuable trait for phytoremediation of Se contaminated land, but also provide a plant based source of the anticarcongenic compound MeSeCys [44]. Here, we describe the successful use of A. bisulcatus genetic material to engineer MeSeCys metabolism in the Se non-accumulator A. thaliana. By over-producing the A. bisulcatus enzyme SMT in A. thaliana, we have introduced a novel biosynthetic ability that has increased the concentration of MeSeCys and its functional derivative γGluMeSeCys, from essentially non-detectable levels in the leaves of wild-type A. thaliana up to 3.9 μmol g-1 dry weight in shoots.
Results and Discussion
Se speciation and accumulation
Over-production of SMT in A. thaliana (Fig 1A) increased the accumulation of MeSeCys from essentially zero in control plants (Fig 1B) to an average of 0.5 μmol g-1 dry weight in the highest SMT accumulating line (Fig 1B), with MeSeCys concentrations ranging from 0.09 – 1.3 μmol g-1 dry weight in individual plants from this line. MeSeCys accumulation was strongly correlated with the level of SMT protein in transgenic plants (Fig 1A and Fig 1B), confirming a causal link between SMT accumulation and the biosynthesis and accumulation of MeSeCys.
Figure 1. Impact of SMT protein levels on accumulation of MeSeCys and total Se. (A) Relative SMT protein accumulation. Relative SMT protein levels were determined from digitized immunoblots, and represent the average band intensity (± SE) from 12 – 18 individual plants for each line. (B) Concentration of MeSeCys in transgenic plants. MeSeCys was quantified using HPLC (AccQ Tag amino acid analysis system) and its identify confirmed using MALDI-MS. Data represents the average (± SE) MeSeCys concentrations in 11 – 18 individual plants for each line. (C) Concentration of total Se in transgenic plants. Total Se was quantified by ICP-MS, and data represents the average (± SE) of 7 – 13 individual plants for each line.
To further characterize the effect of SMT over-production, Se was extracted from shoot tissue and speciated using HPLC/ICP-MS and HPLC-ESI-MS. Of the total shoot Se in smt2-9, 27% was unextractable in the aqueous phase of a methanol/chloroform/water extraction, and assumed to represent mainly Se assimilated into proteins. Of the extractable Se, HPLC-ESI-MS and quantitative HPLC/ICP-MS revealed that 26%, or 1.16 μmol g-1 shoot dry weight, to be γGluMeSeCys, a derivative of MeSeCys (Table 1A, Figure 2). The identity of this compound was confirmed by coelution of Se in peak 4 with an ion of m/z = 313 [M+H]+ [80Se] (Figure 2A,2C) showing the predicted Se isotopic ratio [76Se(9%), 77Se(8%), 78Se(24%), 80Se(50%), 82Se(9%)] [21] and a consistent empirical formula derived from accurate mass measurement. γGluMeSeCys, is known to accumulate to high concentrations in both Se exposed garlic [21] and A. bisulcatus seeds [25]. γGluMeSeCys is comparable to MeSeCys with regard to its anticarcinogenic capacity [16], with γGluMeSeCys being rapidly converted to MeSeCys by a transpeptidase in the body.
Table 1. Identity and percent composition of Se species in shoot tissue of SMT over-producing A. thaliana line smt2-9.
Figure 2. Speciation of Se in shoots of A. thaliana over-producing SMT. (A) Arabidopsis thaliana smt2-9 HCl extract injected onto a reverse phase C8 column, eluted with water:methanol (99:1 v/v) containing 0.1% TFA, and fractions analyzed for Se using ICP-MS with 83% recovery of injected Se. (B) Mass spectrum collected in the region of peak 1–3 from the chromatogram shown in Figure 2A, revealing the expected [M+H]+ m/z = 184 and [M+H-NH3]+ m/z = 167 for MeSeCys, as well as the expected Se isotopic signature. (C) Mass spectrum collected in the region of peak 4 from chromatogram shown in Figure 2A, revealing the expected ion m/z = 313 for γGluMeSeCys, as well as the expected Se isotopic signature. (D) Arabidopsis thaliana smt2-9 HCl extract injected onto a reverse phase C8 column, eluted with water:methanol (99:1 v/v) containing 0.1% HFBA, and fractions analyzed for Se using ICP-MS with 55% recovery of injected Se.
The majority of the remaining extractable Se eluted in an early running Se peak that contains MeSeCys, as identified by coelution of Se in this peak with an ion of m/z = 167 [M+H-NH3]+ [80Se] (Figure 2A,2B) showing the predicted Se isotopic ratio [76Se(9%), 77Se(8%), 78Se(24%), 80Se(50%), 82Se(9%)], and a consistent empirical formula derived from accurate mass measurement. Authentic MeSeCys standard also showed a major ion with m/z = 167, representing the loss of 17 as ammonia from m/z = 184 (data not shown). This early running Se-containing peak likely represents a mixture of Se-containing compounds [43], and was further resolved using the strong ion-pairing reagent HFBA to reveal the presence of three Se-containing compounds (Figure 2C, peak 1, 2 and 3). Peaks 1 and 2 were identified as MeSeCys by the presence of an ion of m/z = 184 [M+H]+ [80Se] and fragmentation of this ion, by the loss of ammonia, to m/z = 167 [M+H-NH3]+ [80Se]. Elution of MeSeCys as a double peak has been previously observed, and is though to be due to its partial protonation [43]. Quantification of the total Se in these two peaks revealed that MeSeCys represents 43% of the total extractable Se (Table 1), or 2.4 μmol g-1 shoot dry weight. For this analysis, smt2-9 shoot samples containing the highest concentration of MeSeCys, determined using the AccQ Tag amino acid analysis system, were used. MeSeCys concentrations of 1.3 and 2.4 μmol g-1 dry weight, quantified using these two independent methods differ significantly, and we suspect that AccQ Tag may underestimate the concentration of MeSeCys due to the reduced derivatization efficiencies observed with standard MeSeCys. Of the Se injected onto the column, only 17% was found to be unaccounted for by peaks 1–5 when eluted with mobile phase containing 0.1% TFA (Figure 2A, Table 1). When using HFBA as the ion pairing reagent (Figure 2D), γGluMeSeCys was not expected to be eluted under the conditions used, leading to 28% reduction (83% – 55%) in recovery of injected Se.
The minor Se peak (Figure 2, peak 5) representing 6 % of total extractable Se (Table 1), most likely represent a doublet peak of γGluMeSeCys produced by partial protonation [43]. MeSeCys and its derivative γGluMeSeCys comprise 75% of the total extractable Se, or 3.9 μmol g-1 shoot dry weight, in SMT over-producing A. thaliana line smt2-9 (Table 1).
X-ray absorption spectroscopy (XAS) can be used to obtain direct information on the in vivo speciation of Se in plants, avoiding the possibility of extraction artifacts [41,42]. XAS of shoot tissue from SMT over-producing A. thaliana indicates that the majority of shoot Se is associated with two C atoms (R-Se-R) (Fig 3), and the concentration of Se in this chemical form increases in direct proportion to the level of SMT over-production (Fig 1A, Fig 3). XAS results are consistent with MeSeCys and its derivative γGluMeSeCys accounting for the majority of Se in planta in the SMT over producing plants. The XAS also revealed the presence of a minor selenonium species (Fig 3), which may represent Se-adenosylselenohomocysteine as observed in yeast [21]. This compound would be expected to be strongly retained during HPLC [43], and may represent a portion of the 17% of Se in the smt2-9 extracts that was not recovered from the column during HPLC/ICP-MS (Figure 2A, Table 1).
Figure 3. Se K X-ray absorption near-edge spectra of shoots of A. thaliana over-producing SMT and control plants. (A) Normalized spectra of different plant lines (filled circles), overlaid with the results of fitting each spectrum to a linear combination of spectra of standards (solid line). (B) Fit deconvolutions for two examples of the samples shown in A. Each panel shows the data and fit (as in A), the residual (dotted line beneath) and the spectra of standards scaled according to their contributions to the fit. The best fits were obtained using selenomethionine (RSeR), aliphatic selenonium (R3Se+), selenite (SeO32-) (all in aqueous solution) and elemental selenium (Se0). Other standards (not shown) were tested: aqueous selenate did not contribute to the fits, and dimethyl selenoxide gave poorer fits (as judged by the residuals) than the selenonium species. Note that selenomethioninine is chosen to be representative of RSeR species, and its spectrum is not reliably distinguishable from that of MeSeCys. (C) Chemical speciation of Se in planta in shoots of A. thaliana over-producing SMT and control plants. Se K X-ray absorption near-edge spectra were fit, as described in Figure 2, to produce quantitative data on the speciation of Se in shoots of A. thaliana. Total Se accumulation (Fig 1C) and percent speciation are combined to produce absolute concentrations of the various Se species.
Exposure of plants to selenate produced no detectable MeSeCys in either SMT over-producing plants or controls (data not shown). Measurement of Se speciation by XAS in selenate treated plants revealed that approximately 70% of total Se remained as selenate in both SMT over-producing and control plants. This confirmed that reduction of selenate to selenite is a rate-limiting step for Se assimilation into selenocysteine in plants as established previously [48], and explains our observation that SMT over-production does not significantly increase the biosynthesis of MeSeCys in selenate exposed plants. The XAS speciation data also supports the conclusion that over production of SMT does not affect the rate of selenate reduction. However, by exposing SMT over-producing plants to selenite, the rate-limiting step of selenate reduction is bypassed and only 1 – 4% of the accumulated Se remains as selenite in SMT over-producing plants, and 3 – 11% in control plants (Fig 3). This high rate of selenite assimilation explains why, when SMT is present, MeSeCys and γGluMeSeCys are efficiently biosynthesized (Fig 1A,1B).
Significantly, along with accumulation of MeSeCys and γGluMeSeCys, the concentration of total Se in shoots (Fig 1C) also positively correlates with SMT over production (Fig 1A). Total Se increases from approximately 1 μmol g-1 dry weight in control plants (range 31 – 168 μg g-1) up to 8 μmol g-1 dry weight (range 358 – 1020 μg g-1) in the highest SMT accumulating line (Fig 1C).
Selenium tolerance
Over-production of SMT resulted in a remarkable increase in resistance to selenite, with SMT accumulating plants showing both increased growth and reduced accumulation of stress related anthocyanin pigments (Fig 4A). To quantify selenite tolerance, a relative tolerance index was calculated that represents the percentage difference between the final fresh weight of each transgenic plant line after growth in the presence and absence of selenite. This relative tolerance measurement clearly establishes that selenite tolerance is strongly correlated with accumulation of MeSeCys, as well as SMT production in 4 independent transgenic lines (Fig 4B). The correlation between MeSeCys biosynthesis and selenite tolerance strongly supports the proposed role of MeSeCys in Se tolerance in Astragalus [40,47]. However, SMT over-production does not increase tolerance to selenate (data not shown). Because selenate reduction to selenite is very inefficient in A. thaliana and SMT acts to detoxify Se downstream of selenite, it is consistent that SMT does not confer tolerance to selenate. From this, we propose that selenate is directly toxic to plants and efficient reduction of selenate to selenite is required for tolerance. This is supported by the earlier observation that efficient reduction of selenate to selenite, by overexpression of ATP sulfurylase [48], confers significant tolerance to selenate in Brassica juncia. Whereas Pilon-Smit et al. (1999) [48] concluded that selenate tolerance was due to increased volatilization of Se in the ATP sulfurylase over-producing plants, we propose that the efficient reduction of selenate is the primary cause of enhanced Se resistance. We would predict that the increased selenocysteine produced in these transgenic plants was detoxified by the low level SMT activity known to exist in B. juncia [43]. In contrast, overexpression of ATP sulfurylase in tobacco cell culture, which does not produce MeSeCys, did not result in measurable selenate tolerance [49]. We suggest that Se is toxic to plants at two biochemical stages, directly as selenate [41] and via the biosynthesis of Se analogues of S amino acids [34]. The Se hyperaccumulator A. bisulcatus is known to accumulate both selenate and MeSeCys [41,46]. Therefore, we propose that these plants use SMT to detoxify selenocysteine, and also have the ability to detoxify selenate by utilizing a mechanism that may involve compartmentalization into the vacuole. This proposed mechanism has yet to be identified.
Figure 4. Selenite tolerance of SMT over-producing A. thaliana. (A) Growth of SMT over-producing and empty vector control plants in soil treated with selenite. (B) Relative selenite tolerance in soil grown plants is positively correlated with the concentration of methylselenocysteine, and (C) total shoot Se concentration. Relative tolerance is quantified as the percent fresh weight of selenite treated plants relative to the same line grown in the absence of selenite. Data represents averages (± SE) from between 10 – 16 individual plants from each line.
Furthermore, selenite tolerance was strongly correlated with total shoot Se accumulation, with the most tolerant lines accumulating the highest shoot Se concentrations (Fig 4C). This increased Se accumulation may be simply due to the more efficient uptake and transport of selenite in the healthy, SMT over-producing plants. However, another possible explanation would be that over-production of SMT may deplete cellular free cysteine, by methylation to methylcysteine (MeCys). Such depletion of cysteine would act to increase the activities of the sulfur assimilation enzymes serine acetyltransferase and O-acetylserine thiol lyase [50], leading to increased incorporation of Se into selenocysteine. This increased biosynthesis of selenocysteine, and accumulation of MeSeCys, would be expected to form a sink for Se, driving increased accumulation of Se into shoot tissue.
In support of this, expression of SMT does result in the accumulation of MeCys, a metabolite not normally observed in A. thaliana (data not shown). Methylcysteine and MeSeCys are produced in approximately equal concentrations, and biosynthesis of MeCys in the SMT-producing plants demonstrates that in vivo SMT has significant methyltransferase activity using either cysteine or selenocysteine as substrates. This contrasts the situation in vitro where SMT has very low activity with cysteine as a substrate [51]. Such in planta methyltransferase activity with cysteine as a substrate is also supported by the earlier observations that increasing the concentration of selenate in nutrient solution resulted in increased concentration of MeSeCys and a decrease in MeCys in A. bisulcatus [52], while increasing sulfate resulted in the increase in MeCys and a decrease in MeSeCys. This suggests that a common pathway is involved in the synthesis of both compounds.
Conclusions
Although MeSeCys is one of the most biologically active Se compounds, the less active SeMet and selenite are the Se forms currently available in the majority of nutritional supplements. The genetic modification of plants to increase the levels of enzymes involved in Se metabolism into MeSeCys would provide a possible source of this chemopreventative molecule. The results presented here demonstrate, for the first time, the practicality of using genetic material from the Se hyperaccumulator A. bisulcatus to bioengineer plants that are enriched in MeSeCys, as previously proposed by Orser et al., (1999) [44]. Shoot tissue of A. thaliana over-producing SMT has a combined concentration of MeSeCys, and its functional equivalent γGluMeSeCys, of up to 3.9 μmol g-1 shoot dry weight (Table 1) after only 6-weeks growth including a 2-week exposure to selenite. Concentrations of MeSeCys and MeCys were also approximately equal in SMT over-producing plants. Since MeCys has been identified as a chemopreventative agent [53], such a dual function of SMT is expected to further enhance the anticarcinogenic potential of this transgenic plant material. While garlic and ramps have been used to produce similar concentrations of MeSeCys and γGluMeSeCys [15,21], production of plant material took 6 months [20] and biomass yields can be expected to be low. The ability to transfer the SMT gene into a higher biomass, rapidly growing, and edible plant could lead to a cost effective method of producing MeSeCys/γGluMeSeCys enriched plant material.
The over-production of SMT in A. thaliana also leads to increased Se accumulation and selenite resistance. In the environment, Se occurs mainly as the selenate oxyanion. Detoxification of accumulated selenate requires its reduction to selenite and metabolism into a dead end metabolite such as MeSeCys. Therefore, the ability to engineer selenite resistance in plants, as demonstrated here, is a critical first step in the development of plants capable of hyperaccumulating Se from selenate. Further important steps in this process will be the engineering of enhanced uptake of selenate over sulfate, and its reduction to selenite. In our study, SMT over-producing plants were able to grow normally while containing up to 1020 μg g-1 total foliar Se. Tolerance to such high internal foliar Se concentrations are within the same range observed for naturally evolved Se accumulator plants such as A. bisulcatus (25, 26), and if reproduced in a high biomass plant, these foliar Se concentrations are within the range required for practical phytoremediation of Se contaminated soils and waters. Therefore, engineering of selenite tolerance in plants moves us one step closer to our goal of bioengineering plants ideally suited for phytoremediation of Se.
Methods
Plant transformation and growth
The gene encoding selenocysteine methyltransferase (SMT1) was amplified from A. bisulcatus as described previously [45], and cloned in the pKYLX plant transformation vector [54,55] downstream of the cauliflower mosaic virus (CaMV) 35S promoter [45]. Arabidopsis thaliana was transformed using Agrobacterium by floral dipping [56], and transformed seed selected on kanamycin. Empty pKYLX vector control lines were generated concurrently. Selected T1 plants were allowed to self fertilize, and plant lines homozygous for the SMT1 transgene selected in the T3 generation. Bulk T4 seed was collected and used in all experiments presented. Seeds were planted in Scotts Redi-earth artificial soil mix in 72-cell plug trays, cold treated at 4°C for 3-days to synchronize germination and grown in a climate-controlled room at 19–24°C with 10 hours of light at 90 to 150 μ E. After 4-weeks growth vegetative plants were watered with 100 μM sodium selenite as needed for a further 2 weeks after which shoot tissue of individual plants was harvested, fresh weight determined, washed in 18 MΩ water, ground in liquid nitrogen and stored at -80°C. Each individually stored plant sample was subsampled and used for subsequent analyses.
Analysis of total shoot Se
For analysis of total Se, samples of frozen plant material were dried overnight at 60°C, weighed and digested in concentrated HNO3 acid (EM Omni Trace) at 118° C for 4 hours. Se was quantified in the samples using a Thermo Elemental PQ ExCell ICP-MS (Thermo elemental, Franklin, MA) with a gallium internal standard, a NIST traceable calibration standard and external drift correction [57].
Analysis of shoot Se speciation
To determine extractable and non-extractable Se, shoot tissue (0.25 g – 0.5 g fresh weight) was extracted in 10 ml methanol for 24 hr at 4°C, 6 ml water and 5 ml chloroform added [58] and total Se measured by ICP-MS in the aqueous phase, and in the chloroform and residual tissue. Extractable Se was functionally defined as the total Se extracted into the aqueous phase, and non-extracted Se was defined as the sum of that in the residual tissue and the chloroform. For routine quantification of SeMeCys and MeCys plant samples were extracted over night at 4°C in 50 mM HCl (2:1 v/w), with 78% recovery of total extractable Se. Alpha amino butyric acid was added to each extracted sample as an internal standard, the samples derivatized and analyzed using the AccQ Tag amino acid analysis system (Waters Corp., Milford, MA) using a Waters HPLC system consisting of a Waters Separation module 2695 with a Waters 2475 fluorescence detector. The identity of MeSeCys in the chromatogram was confirmed by coelution with an authentic MeSeCys standard and of the m/z = 354 ion characteristic of the MeSeCys [6-aminoquinolyl-N-hydroxy-succinimidyl carbamate] AccQ Tag derivative using MALDI-MS on post column fractions after cleanup on Dowex-1-acetate. The presence of Se in the fractions containing MeSeCys was confirmed by ICP-MS (Thermo Elemental PQ ExCell). Recoveries of MeSeCys during HPLC analysis were determined to be 100% using a MeSeCys spiked sample. The identity of MeCys was confirmed by coelution with an authentic standard and by GC-MS after 24 h of extraction in 50 mM HCl and subsequent derivatization with MTBSTFA following standard procedures [59]. Se speciation was further analyzed by HPLC/ICP-MS and HPLC-ESI-MS. Tissue was extracted in 50 mM HCl (2:1 v/w), injected onto a 5-μm Symmetry Shield RP8 (15 cm × 3.9 mm) column (Waters Corp., Milford, MA) and eluted with a mobile phase of water-methanol (99:1, v/v) containing either 0.1% TFA or HFBA at the resulting pH [43]. For quantification of Se in the eluant, fractions (0.5 – 1 mL) were collected and analyzed by ICP-MS (Thermo Elemental PQ ExCell). For molecular mass spectral studies the eluant was analyzed using electrospray ionization on a FinniganMAT LCQ (ThermoFinnigan Corp. San Jose, CA), or LC-Q-Tof micro (Waters Corp., Milford, MA) mass spectrometer system. A tissue sample from one representative plant from each transgenic and empty vector control line was also shipped on dry ice to the Stanford Synchrotron Radiation Laboratory (SSRL) for Se K-edge XAS analysis following our established protocols [45].
SMT protein quantification
Production of SMT in tissue samples from individual plants was determined by immunoblotting and quantified by digitizing developed immunoblots [45].
Authors' contributions
DES and CO co-conceived the experiment with DES guiding the work; DRE, TGS and DGB were primarily responsible for carrying it out with CA contributing to generation of transgenic plants, BL performing ICP-MS analysis, KVW performing LC-ESI-MS, and IJP and HHH performing XAS analysis.
Acknowledgments
This project was funded through an STTR grant from the NIH National Cancer Institute (R41 CA80444-01, R42 CA80444-02) awarded to NuCycle Inc. and subcontracted to DES. We would also like to thank Burt Ensley, Graham George, Michael Persans, Jeff Denault and Andrew Baker. The Stanford Synchrotron Radiation Laboratory is supported by the Department of Energy, Office of Biological and Environmental Research, and by the National Institutes of Health, National Center for Research Resources, Biomedical Technology Program.
References
1. Birringer M, Pilawa S, Flohe L: Trends in selenium biochemistry.
Nat Prod Rep 2002, 19:693-718. PubMed Abstract | Publisher Full Text
2. Combs GF Jr: Food system-based approaches to improving micronutrient nutrition: The case for selenium.
BioFactors 2000, 12:39-43. PubMed Abstract | Publisher Full Text
3. Clark LC, Combs GF Jr, Turnbull BW, Slate EH, Chalker DK, Chow J, Davis LS, Glover RA, Graham GF, Gross EG, Krongrad A, Lesher JL Jr, Park HK, Sanders BB Jr, Smith CL, Taylor JR: Effects of selenium supplementation for cancer prevention in patients with carcinoma of the skin.
J Amer Med Assoc 1996, 276:1957-1963. Publisher Full Text
4. Agency for Toxic Substances and Disease Registry [http://www.atsdr.cdc.gov/] webcite
5. Ohlendorf HM, Hoffman DJ, Saiki MK, Aldrich TW: Embryonic mortality and abnormalities of aquatic birds-Apparent impact of selenium from irrigation drainwater.
Sci Total Environ 1986, 52:49-63. Publisher Full Text
6. Banuelos GS: The green technology of selenium phytoremediation.
Biofactors 2001, 14:255-260. PubMed Abstract | Publisher Full Text
7. Berken A, Mulholland MM, LeDuc DL, Terry N: Genetic Engineering of plants to enhance selenium phytoremediation.
Crit Rev Plant Sci 2002, 21:567-582.
8. Wu L: Review of 15 years of research on ecotoxicology and remediation of land contaminated by agricultural drainage sediment rich in selenium.
Ecotox Enviromen Safety 2002, in press.
9. Seiler RL, Skorupa JP, Peltz LA: Areas susceptible to irrigation-induced selenium contamination of water and biota in the western United States.
USGS Survey Cir 1999., 1180:
10. Lemly AD: Enviromental implications of excessive selenium: A review.
Biomed Environ Sci 1997, 10:415-435. PubMed Abstract
11. Sharmasarkar S, Vance GF: Ecological risk assessment: Soil and plant selenium at a reclaimed uranium mine.
J Environ Qual 2002, 31:1516-1521. PubMed Abstract
12. Reid M, Duffield-Lillico AJ, Garland L, Turnbull BW, Clark LC, Marshall JR: Selenium supplementation and lung cancer incidences: an update of the nutritional prevention cancer trial.
Cancer Epidemiol Biomarkers Prev 2002, 11:1285-1291. PubMed Abstract | Publisher Full Text
13. Whanger PD: Selenocompound in plants and animals and their biological significance.
J Am College Nutr 2002, 21:223-232.
14. Combs GF Jr, Gray WP: Chemopreventive agents: selenium.
Pharmacol Ther 1998, 79:179-192. PubMed Abstract | Publisher Full Text
15. Whanger PD, Ip C, Polan CE, Uden PC, Welbaum G: Tumorigenesis, metabolism, speciation, bioavailability, and tissue deposition of selenium in selenium-enriched ramps (Allium tricoccum).
J Agric Food Chem 2000, 48:5723-5730. PubMed Abstract | Publisher Full Text
16. Dong Y, Lisk D, Block E, Ip C: Characterization of the biological activity of gamma-glutamyl-Se-methylselenocysteine: A novel, naturally occurring anticancer agent from garlic.
Cancer Res 2001, 61:2923-2928. PubMed Abstract | Publisher Full Text
17. Vadgama JV, Wu Y, Shen D, Hsia S, Block J: Effect of selenium in combination with adriamycin or taxol on several different cancer cells.
Anticancer Res 2000, 20:1391-1414. PubMed Abstract
18. Ip C, Ganther HE: Relationship between the chemical form of selenium and anticarcinogenic activity. In In Cancer Chemoprevention. Edited by Wattenberg I, Lipkin M, Boon CW, Kellott GJ. Boca Raton, FL: CRC Press; 1992:479-488.
19. Finley JW, Ip C, Lisk DJ, Davis CD, Hiuntze KJ, Whanger PD: Cancer-protective properties of high-selenium broccoli.
J Agric Food Chem 2001, 49:2679-2683. PubMed Abstract | Publisher Full Text
20. Ip C, Ganther HE: Comparison of selenium and sulfur analogs in cancer prevention.
Carcinogenesis 1992, 13:1167-1170. PubMed Abstract
21. Ip C, Birringer M, Block E, Kotrebai M, Tyson J, Uden PC, Lisk D: Chemical speciation influences comparative activity of selenium-enriched garlic and yeast in mammary cancer prevention.
J Agric Food Chem 2000, 48:2062-2070. PubMed Abstract | Publisher Full Text
22. Lu J, Pei H, Ip C, Lisk DJ, Ganther H, Thompson HJ: Effect of an aqueous extract of selenium-enriched garlic on in vitro markers and in vivo efficacy in cancer prevention.
Carcinogenesis 1996, 17:1903-1907. PubMed Abstract
23. Medina D, Thompson H, Ganther H, IP C: Se-Methylselenocysteine: A new compound for chemoprevention of breast cancer.
Nutr Cancer 2001, 40:12-17. PubMed Abstract | Publisher Full Text
24. Cai XJ, Block E, Uden PC, Zhang X, Quimby BD, Sullivan JJ: Allium chemistry: Identification of selenoamino acids in ordinary and selenium-enriched garlic, onion, and broccoli using gas chromatography with atomic emission detection.
J Agric Food Chem 1995, 43:1754-1757.
25. Nigam SN, McConnel WB: Seleno amino compounds from Astragalus bisulcatus isolation and identification of γ-L-glutamyl-Se-methyl-seleno-L-cysteine and Se-methylseleno-L-cysteine.
Biochim Biophys Acta 1969, 192:185-190. PubMed Abstract | Publisher Full Text
26. Trelease SF, DiSomma AA, Jacobs AL: Seleno-amino acid found in Astragalus bisulcatus.
Science 1960, 132:618. PubMed Abstract
27. Ganther HE, Lawrence JR: Chemical transformations of selenium in living organisms. Improved forms of selenium for cancer prevention.
Tetrahedron 1997, 53:12299-112310. Publisher Full Text
28. Ip C: Lessons from basic research in selenium and cancer prevention.
J Nutr 1998, 128:1845-1854. PubMed Abstract | Publisher Full Text
29. Ip C, Dong Y, Ganther HE: New concepts in selenium chemoprevention.
Cancer Metast Rev 2002, 21:281-289. Publisher Full Text
30. Lu J, Jiang C: Antiangiogenic activity of selenium in cancer chemoprevention: metabolite-specific effects.
Nutr Cancer 2001, 40:64-73. PubMed Abstract | Publisher Full Text
31. Foster SJ, Kraus RJ, Ganther HE: The metabolism of selenomethionine, Se-methylselenocysteine, their selenonium derivatives, and trimethylselenonium in the rat.
Arch Biochem Biophys 1986, 251:77-86. PubMed Abstract
32. Andreadou I, Menge WMPB, Commandeur JNM, Worthington EA, Vermeulen NPE: Synthesis of novel Se-substituted selenocysteine derivatives as potential kidney selective prodrugs of biologically active selenol compounds: evaluation of kinetics of β-elimination reactions in rat renal cytosol.
J Med Chem 1996, 39:2040-2046. PubMed Abstract | Publisher Full Text
33. Sinha R, Kiley SC, Lu JX, Thompson HJ, Moraes R, Jaken S, Medina D: Effects of methylselenocysteine on PKC activity, cdk2 phosphorylation and gadd gene expression in synchronized mouse mammary epithelial tumor cells.
Cancer Lett 1999, 146:135-145. PubMed Abstract | Publisher Full Text
34. Wang Z, Jiang C, Lu J: Induction of caspase-mediated apoptosis and cell-cycle G1 arrest by selenium metabolite methylselenol.
Mol Carcinog 2002, 34:113-120. PubMed Abstract | Publisher Full Text
35. Kim T, Jung U, Cho DY, Chung AS: Se-Methylselenocysteine induces apoptosis through caspase activation in HL-60 cells.
Carcinogenesis 2001, 22:559-565. PubMed Abstract | Publisher Full Text
36. Jiang C, Ganther H, Lu J: Monomethyl selenium-specific inhibition of MMP-2 and VEGF expression: Implications for angiogenic switch regulation.
Mol Carcinog 2000, 29:236-250. PubMed Abstract | Publisher Full Text
37. Jiang C, Jiang W, Ip C, Ganther H, Lu J: Selenium-induced inhibition of angiogenesis in mammary cancer at chemopreventive levels of intake.
Mol Carcinog 1999, 26:213-225. PubMed Abstract | Publisher Full Text
38. Terry N, Zayed AM, De Souza MP, Tarun AS: Selenium in higher plants.
Annu Rev Plant Physiol Plant Mol Biol 2000, 51:401-432. PubMed Abstract | Publisher Full Text
39. Ellis DR, Salt DE: Plants, selenium and human health.
Curr Opin Plant Biol 2003, 6:1-7. Publisher Full Text
40. Brown TA, Shrift A: Exclusion of selenium from proteins in selenium-tolerant Astragalus species.
Plant Physiol 1981, 67:1951-1953.
41. Virupaksha TK, Shrift A: Biochemical differences between selenium accumulator and non-accumulator Astragalus species.
Biochim Biophys 1965, 107:69-80. Publisher Full Text
42. Wang Y, Bock A, Neuhierl B: Acquisition of selenium tolerance by a selenium non-accumulating Astragalus species via selection.
Biofactors 1999, 9:3-10. PubMed Abstract | Publisher Full Text
43. Kotrebai M, Birringer M, Tyson JF, Block E, Uden PC: Selenium speciation in enriched and natural samples by HPLC-ICP-MS and HPLC-ESI-MS with perfluorinated carboxylic acid ion-pairing agents.
Analyst 2000, 125:71-78. PubMed Abstract | Publisher Full Text
44. Orser CS, Salt DE, Pickering IJ, Prince R, Epstein A, Ensley BD: Brassica plants to provide enhanced human mineral nutrition: selenium phytoenrichment and metabolic transformation.
J Med Food 1999, 1:253-261.
45. Pickering IJ, Wright C, Bubner B, Ellis D, Persans MW, Yu EY, George GN, Prince RC, Salt DE: Chemical form and distribution of selenium and sulfur in the selenium hyperaccumulator Astragalus bisulcatus.
Plant Physiol 2003, 131:1-8. Publisher Full Text
46. Pickering IJ, Prince RC, Salt DE, George GN: Quantitative, chemically specific imaging of selenium transformation in plants.
PNAS 2001, 97:10717-10722. Publisher Full Text
47. Neuhierl B, Thanbichler M, Lottspeich F, Bock A: A family of S-methylmethionine-dependent thiol/selenol methytransferases.
J Biol Chem 1999, 274:5407-5414. PubMed Abstract | Publisher Full Text
48. Pilon-Smits EAH, Hwang S, Lytle CM, Zhu Y, Tai JC, Bravo RC, Chen Y, Leustek T, Terry N: Overexpression of ATP sulfurylase in Indian mustard leads to increased selenate uptake, reduction and tolerance.
Plant Physiol 1999, 119:123-132. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
49. Hatzfeld Y, Cathala N, Grignon C, Davidian JC: Effect of ATP sulfurylase overexpression in bright yellow 2 tobacco cells: Regulation of ATP sulfurylase and SO42- transport activities.
Plant Physiol 1998, 116:1307-1313. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
50. Leustek T: Sulfate metabolism. [http://www.aspb.org/publications/arabidopsis/] webcite
In In The Arabidopsis book Edited by Sommerville CR, Meyerowitz EM , Rockville MD. American Society of Plant Biologist; 2002, 171-180.
51. Neuhierl B, Bock A: On the mechanism of selenium tolerance in selenium-accumulating plants: Purification and characterization of a specific selenocysteine methyltransferase from cultured cells of Astragalus bisculatus.
Eur J Biochem 1996, 239:235-238. PubMed Abstract
52. Chow CM, Nigam SN, McConnell WB: Biosynthesis of Se-methylselenocysteine and S-methylcysteine in Astragalus bisulcatus: effect of selenium and sulfur concentrations in the growth medium.
Phytochemistry 1971, 10:2693-2698. Publisher Full Text
53. Fukushima S, Takada N, Hori T, Min W, Wanibuchi H, Yamamoto S: Suppression of chemical carcinogenesis by water-soluble organosulfur compounds.
J Nutr 2001, 131:1049S-1053S. PubMed Abstract | Publisher Full Text
54. Schardl C, Byrd AD, Benzion G, Altschuler MA, Hildebrand DF, Hunt AG: Design and construction of a versatile system for the expression of foreign genes in plants.
Gene 1987, 61:1-11. PubMed Abstract | Publisher Full Text
55. An G, Watson BG, Stachel S, Gordon MP, Nester EW: New cloning vehicles for transformation of higher plants.
EMBO J 1985, 4:277-284.
56. Clough SJ, Bent AF: Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J 1998, 16:735-43. PubMed Abstract | Publisher Full Text
57. Lahner B, Gong J, Mahmoudian M, Smith EL, Abid KB, Rogers EE, Guerinot ML, Harper JF, Ward JM, McIntyre L, Schroeder JI, Salt DE: Genomic scale profiling of nutrient and trace elements in Arabidopsis thaliana.
Nature Biotech 2003, 21:1215-1221. Publisher Full Text
58. Rhodes D, Deal L, Haworth P, Jamieson GC, Reuter CC, Ericson MC: Amino acid metabolism of Lemna minor LI responses to methionine sulfoximine.
Plant Physiol 1986, 82:1057-1062.
59. Mackenzie SL, Tenaschuk D, Fortier G: Analysis of amino acids by gas-liquid chromatography as tert butyldimethylsilyl derivatives preparation of derivatives in a single reaction.
J Chrom 1987, 387:241-254. Publisher Full Text
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:00:37.000Z
|
ekhsowrlrg64rnb4dwaem2clwyjzxwi4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52450",
"uncompressed_offset": 333003956,
"url": "www.comics.org/issue/206063/",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.comics.org/issue/206063/"
}
|
cccc_CC-MAIN-2013-20
|
(May 1940)
United Features, 1936 Series
< Previous Issue |
| Next Issue >
Volume:
5
Price:
0.10 USD
Pages:
68
Indicia frequency:
Monthly
Indicia Publisher:
United Feature Syndicate, Inc.
Format:
Standard Golden Age U.S.; Full Color; Glossy Cover: Newsprint Interior; Saddle-Stitched; On-Going Series
Editing
Table of Contents
This issue was most recently modified by:
• Gary L. Watson
Issues in this series have been indexed by:
• Lou Mougin
• Tim Cotrill
• Jim Walls
• Craig Delich
• Gary L. Watson
• Gregory Fischer
• Merlin Haas
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:05:51.000Z
|
o32mkwloorqwdddqyf3lbaiqv5425hv4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52456",
"uncompressed_offset": 366763605,
"url": "www.eea.europa.eu/data-and-maps/figures/changes-in-wastewater-treatment-in-regions-of-europe-between-1990-and-1",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.eea.europa.eu/data-and-maps/figures/changes-in-wastewater-treatment-in-regions-of-europe-between-1990-and-1"
}
|
cccc_CC-MAIN-2013-20
|
Personal tools
Sign up now!
Get notifications on new reports and products. Currently we have 55591 subscribers. Frequency: 3-4 emails / month.
Follow us
Twitter
Facebook
YouTube channel
RSS Feeds
Notifications archive
Write to us
For the public:
For media and journalists:
Contact EEA staff
Contact the web team
FAQ
Call us
Reception:
Phone: (+45) 33 36 71 00
Fax: (+45) 33 36 71 99
next
previous
items
Skip to content. | Skip to navigation
Sound and independent information
on the environment
You are here: Home / Data and maps / Maps and graphs / Changes in wastewater treatment in regions of Europe between 1990 and 2009
Changes in wastewater treatment in regions of Europe between 1990 and 2009
Created : Mar 16, 2012 Published : Mar 20, 2012 Last modified : Jan 06, 2013 08:48 PM
Topics: ,
This figure illustrates the percentage population per European region connected to a waste water collection and treatment systems (UWWTPs) over the period 1990 to 2009. In addition, a breakdown by treatment type is portrayed.
Download
European data
Metadata
Additional information
The numbers of countries are given in parentheses. Regional percentages have been weighted by country population. More information on methodology.
North: Norway, Sweden, Finland and Iceland
Central : Austria, Denmark, England & Wales, Scotland, the Netherlands, Germany, Switzerland, Luxembourg and Ireland
Southern: Cyprus, Greece, France, Malta, Spain and Portugal
East: Czech Republic, Estonia, Hungary , Latvia, Lithuania, Poland, Slovenia, Slovakia
South Eastern: Bulgaria , Romania and Turkey
European Environment Agency (EEA)
Kongens Nytorv 6
1050 Copenhagen K
Denmark
Phone: +45 3336 7100
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:49:32.000Z
|
aczjmagglvm37ebubbuxhqhl7jiwizzt
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52457",
"uncompressed_offset": 368326754,
"url": "www.elinux.org/index.php?diff=89306&oldid=89288&title=Busybox_replacement",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.elinux.org/index.php?title=Busybox_replacement&diff=89306&oldid=89288"
}
|
cccc_CC-MAIN-2013-20
|
Difference between revisions of "Busybox replacement"
From eLinux.org
Jump to: navigation, search
(Prioritization)
(Standard commands)
Line 75: Line 75:
Toolbox in Android (what version?) implements the following standard commands:
Toolbox in Android (what version?) implements the following standard commands:
cat chmod chown cmp date dd dmesg df hd
+
cat chmod chown cmp cp date dd dmesg df hd
id ifconfig iftop insmod ioctl ionice
id ifconfig iftop insmod ioctl ionice
kill ls netstat ln lsmod lsof
+
kill netstat ln ls lsmod lsof
mkdir mount mv newfs_msdos notify
mkdir mount mv newfs_msdos notify
ps printenv reboot renice rm rmdir rmmod route
ps printenv reboot renice rm rmdir rmmod route
Revision as of 21:52, 26 January 2012
This page has information about the commands and features desired for a busybox replacement program.
See Busybox replacement project for the project proposal for this work.
Contents
Command List
We have several potential use cases for a busybox replacement, and are using those to determine a consensus on which commands to target for a 1.0 release of an unencumbered busybox replacement package.
Our current candidate list combines the commands toybox already implements, the development environment command list, the toolbox standard commands, the Sony configuration of busybox, and the selected subset of the SUSv4 standard.
Thus the first release of a busybox replacement should include the following commands:
at awk basename bc bunzip2 bzcat bzip2 cal cat catv chgrp chmod
chown chroot chvt cksum cmp comm count cp cpio csplit cut date dd df
diff dirname dmesg dnsdomainname du echo egrep env expand expr
false fgrep file find fold freeramdisk ftpd ftpget ftpput fuser
getconf getty grep gunzip gzip halt hd head help hostname id
ifconfig iftop init insmod install ioctl ionice join kill
killall klogd less link ln logger login logname losetup ls lsmod
lsof man md5sum mdev mkdir mkfifo mknod mkswap mktemp modprobe
more mount mountpoint mv nc netcat netstat newgrp newfs_msdos
nice nl nohup notify od oneit paste patch pathchk pgrep pidof
ping ping6 pivot_root pkill poweroff printenv printf ps pwd
readlink reboot renice rm rmdir rmmod route sed seq setsid
sfdisk sh sha1sum sleep sort split start stat stop stty swapoff
swapon switch_root sync syslogd tabs tac tail tar taskset tee
telnet telnetd test time top touch tput tr true truncate tty
umount uname unexpand uniq unlink unshare uptime usleep uudecode
uuencode vconfig vi vmstat wc wget which who whoami xargs yes
zcat
Plus additional to-be-determined shell functionality.
Toybox currently implements
Here's a link to the toybox project: http://www.landley.net/toybox/about.html which is a prime candidate for replacing busybox.
The triaged toybox (2 clause BSD license) is currently implementing usable versions of:
bzcat cal cat catv chroot chvt cksum count cp df dirname dmesg
echo false help link mkswap nc netcat nice nohup oneit patch pwd
rmdir seq setsid sha1sum sleep sort sync tee true truncate tty
uname unlink unshare wc which yes
And contains partial implementations of:
mdev sh
See the Toybox todo list for the most up to date status.
Use case: provide a self-hosting development environment
The following commands are enough to build the Aboriginal Linux development environment, boot it to a shell prompt, and build Linux From Scratch 6.8 under it. (Aboriginal Linux currently uses BusyBox for this, thus provides a corresponding test environment for toybox.)
This use case includes running init scripts and other shell scripts, running configure, make, and install in each package, and providing basic command line facilities such as a text editor. (It does not include a compiler toolchain or C library, those are outside the scope of this project.)
Already in toybox
bzcat cat cp dirname echo patch rmdir sha1sum sleep sort sync
true uname wc which yes env
Additional commands for development environment
zcat awk basename bzip2 chmod chown cmp cut date dd diff
egrep expr find grep gzip head hostname id install ln ls
mkdir mktemp mv od readlink rm sed sh tail tar touch tr uniq
wget whoami xargs chgrp comm gunzip less logname man split
tee test time bunzip2 chgrp chroot comm cpio dmesg
dnsdomainname ftpd ftpget ftpput gunzip ifconfig init less
logname losetup man mdev mount mountpoint nc pgrep pkill
pwd route split stat switch_root tac tee test time umount vi
Note: Aboriginal Linux installs bash 2.05b as #!/bin/sh and its scripts require bash extensions not present in busybox ash.
Use case: replacing Toolbox commands
Standard commands
Toolbox in Android (what version?) implements the following standard commands:
cat chmod chown cmp cp date dd dmesg df hd
id ifconfig iftop insmod ioctl ionice
kill netstat ln ls lsmod lsof
mkdir mount mv newfs_msdos notify
ps printenv reboot renice rm rmdir rmmod route
sleep start stop sync top umount uptime vmstat
Android-specific commands
Toolbox also provides the following nonstandard commands, which are unique to Android (or at least do not appear in Ubuntu or SUSv4):
alarm schedtop getprop log setprop watchprops notify wipe
getevent sendevent nandread smd setconsole r ioctl
Busybox commands
default 1.10 build
A default build of Busybox 1.10 has the following commands:
[, [[, addgroup, adduser, adjtimex, ar, arp, arping, ash,
awk, basename, bunzip2, bzcat, bzip2, cal, cat, catv,
chattr, chgrp, chmod, chown, chpasswd, chpst, chroot,
chrt, chvt, cksum, clear, cmp, comm, cp, cpio, crond,
crontab, cryptpw, cut, date, dc, dd, deallocvt, delgroup,
deluser, df, dhcprelay, diff, dirname, dmesg, dos2unix,
du, dumpkmap, dumpleases, echo, ed, egrep, eject, env,
envdir, envuidgid, expand, expr, false, fbset, fdflush,
fdformat, fdisk, fgrep, find, fold, free, freeramdisk,
fsck, fsck.minix, fuser, getopt, getty, grep, gunzip,
gzip, halt, hdparm, head, hexdump, hostid, hostname, hwclock,
id, ifconfig, ifdown, ifup, inetd, init, insmod, install,
ip, ipaddr, ipcalc, ipcrm, ipcs, iplink, iproute, iprule,
iptunnel, kbd_mode, kill, killall, killall5, klogd, last,
length, less, linux32, linux64, linuxrc, ln, loadfont,
loadkmap, logger, login, logname, logread, losetup, lpd,
lpq, lpr, ls, lsattr, lsmod, lzmacat, makedevs, md5sum,
mdev, mesg, microcom, mkdir, mkfifo, mkfs.minix, mknod,
mkswap, mktemp, modprobe, more, mount, mountpoint, mt,
mv, nameif, netstat, nice, nmeter, nohup, nslookup, od,
openvt, passwd, patch, pgrep, pidof, ping, pipe_progress,
pivot_root, pkill, poweroff, printenv, printf, ps, pscan,
pwd, raidautorun, rdate, readlink, readprofile, realpath,
reboot, renice, reset, resize, rm, rmdir, rmmod, route,
rpm, rpm2cpio, run-parts, runlevel, runsv, runsvdir, rx,
script, sed, sendmail, seq, setarch, setconsole, setkeycodes,
setlogcons, setsid, setuidgid, sh, sha1sum, sleep, softlimit,
sort, split, start-stop-daemon, stat, strings, stty, su,
sulogin, sum, sv, svlogd, swapoff, swapon, switch_root,
sync, sysctl, syslogd, tac, tail, tar, taskset, tee, telnetd,
test, time, top, touch, tr, true, tty, ttysize, udhcpc,
udhcpd, umount, uname, uncompress, unexpand, uniq, unix2dos,
unlzma, unzip, uptime, usleep, uudecode, uuencode, vi,
vlock, watch, watchdog, wc, wget, which, who, whoami,
xargs, yes, zcat
Sony CE Linux (internal distribution) 1.13.4 build
This is from a version of busybox used in lots of Sony products: Currently defined functions:
[, [[, ash, basename, bunzip2, bzcat, cat, chgrp, chmod, chown,
chroot, cmp, cp, cpio, cut, date, dd, dirname, dmesg, echo, egrep,
env, expr, false, fgrep, freeramdisk, ftpget, ftpput, getty, grep,
gunzip, gzip, halt, ifconfig, insmod, kill, killall, klogd, ln,
logger, login, ls, lsmod, md5sum, mkdir, mkfifo, mknod, mktemp,
modprobe, mount, mv, pidof, ping, ping6, pivot_root, poweroff,
pwd, readlink, reboot, rm, rmdir, rmmod, route, sed, sfdisk, sh,
sha1sum, sleep, sort, stty, swapoff, swapon, switch_root, sync,
syslogd, tail, tar, taskset, telnet, telnetd, test, touch, true,
umount, uname, uniq, usleep, vconfig, wc, xargs, zcat
POSIX-2008/SUSv4
The best standards are the kind that describe reality, rather than attempting to impose a new one. (I.E. a good standard should document, not legislate.)
The kind of standards which describe existing reality tend to be approved by more than one standards body, such ANSI and ISO both approving C. That's why the IEEE POSIX committee's 2008 standard, the Single Unix Specification version 4, and the Open Group Base Specification edition 7 are all the same standard from three sources.
The [http://opengroup.org/onlinepubs/9699919799/idx/utilities.html "utilities" section] these standards is devoted to the unix command line, and are the best such standard for our purposes. (BusyBox was implemented with regard to SUSv3, an earlier version of this standard.)
Problems with the standard
Unfortunately, these standards describe a subset of reality, lacking any mention of commands such as init, login, or mount required to actually boot a system. It provides ipcrm and ipcs, but not ipcmk, so you can use System V IPC resources but not create them.
These standards also contain a large number of commands that are inappropriate for toybox to implement in its 1.0 release. (Perhaps some of these could be reintroduced in later releases, but not now.)
Starting with the full "utilities" list, we first remove generally obsolete commands (compess ed ex pr uncompress uccp uustat uux), commands for the pre-CVS "SCCS" source control system (admin delta get prs rmdel sact sccs unget val what), fortran support (asa fort77), and batch processing support (batch qalter qdel qhold qmove qmsg qrerun qrls qselect qsig qstat qsub).
Some commands are for a compiler toolchain (ar c99 cflow ctags cxref getcat iconv lex m4 make nm strings strip tsort yacc), which is outside of toybox's mandate and should be supplied externally. (Again, some of these may be revisited later, but not for toybox 1.0.)
Some commands are part of a command shell, and cannot be implemented as separate executables (alias bg cd command fc fg getopts hash jobs kill read type ulimit umask unalias wait). These may be revisited as part of a built-in toybox shell, but are not exported into $PATH via symlinks. (If you fork a child process and have it "cd" then exit, you've accomplished nothing.)
A few other commands are judgement calls, providing command-line internationalization support (iconv locale localedef), System V inter-process communication (ipcrm ipcs), and cross-tty communication from the minicomputer days (talk mesg write). The "pax" utility was supplanted by tar, "mailx" is a command line email client, and "lp" submits files for printing to... what exactly? (cups?) The standard defines crontab but not crond.
Removing all of that leaves the following commands, which toybox should implement:
at awk basename bc cal cat chgrp chmod chown cksum cmp comm cp
csplit cut date dd df diff dirname du echo env expand expr false file find
fold fuser getconf grep head id join kill link ln logger logname ls man
mkdir mkfifo more mv newgrp nice nl nohup od paste patch pathchk printf ps
pwd renice rm rmdir sed sh sleep sort split stty tabs tail tee test time
touch tput tr true tty uname unexpand uniq unlink uudecode uuencode vi wc
who xargs zcat
Prioritization
The following is Tim's prioritization of the above list, based on his own experience with embedded systems. I will divide the above list into 3 groups: must-have, nice-to-have, not-that-important.
Must-have:
cat chgrp chmod chown cp date df
echo env expr false find grep head id kill ln
ls mkdir more mv nice ps pwd rm rmdir sh sleep
sort tail test touch true uname uniq wc xargs
(must have, not in the above list: chroot, dmesg, sync)
Nice-to-have:
basename cut dd diff dirname du mkfifo printf sed tee time vi who zcat
Not-that-important:
at awk bc cal cksum cmp comm csplit expand file
fold fuser getconf link logger logname man newgrp nl
nohup od paste patch pathchk renice split stty tabs
tput tr tty unexpand unlink uudecode uuencode
Must-have unimplemented: The following list has Tim's must-have commands, which are currently not implemented in toybox:
chgrp chmod chown date dd
expr find grep head id kill ln
ls mkdir more mv nice ps rm
tail test touch uniq xargs
prioritized, must-have, unimplemented list
Prioritized top 13:
1. ls
2. mkdir
3. rm
4. ln
5. mv
6. ps
7. kill
8. chmod
9. chown
10. date
11. grep
12. find
13. xargs
Second prioritized group:
chgrp id nice expr head tail test touch uniq dd more
IMHO - ls needs to support -ladR at first
toolbox complement
If we omit toolbox supported commands from the must-have, unimplemented list, we get:
chgrp expr false find grep head more
nice tail test touch true uname xargs
I would add tab completion and globbing for toysh to the list.
This would be for a toolbox complement.
Random Notes
Can implement incrementally
Rob wrote:
One nice thing about busybox/toybox/toolbox is you can install multiple implementations side by side, and have what symlinks you create (or what comes first in the $PATH) determine who is implementing what.
This allows gradual transitions. Each release, we replace a couple more commands from the old one, until the old one finally isn't being used for anything anymore and we can uninstall it...
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:20:43.000Z
|
4xnhvru3vxvdi4y2hbroux3bgyayfedg
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52459",
"uncompressed_offset": 379063856,
"url": "www.familysearch.org/learn/wiki/en/Royalston,_Massachusetts",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Royalston,_Massachusetts"
}
|
cccc_CC-MAIN-2013-20
|
Royalston, MassachusettsEdit This Page
From FamilySearch Wiki
United States Massachusetts Worcester Royalston
Modern town borders of Royalston in Worcester County, Massachusetts.
Brief History
References
Adjacent towns: Worcester Co.: Athol | Phillipston | Templeton | Winchendon | Franklin Co.: Orange | Warwick | New Hampshire: Cheshire Co.: Fitzwilliam | Richmond
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 19 March 2013, at 19:47.
• This page has been accessed 124 times.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:28:45.000Z
|
7sqgdtyvljawsxepqa5fhesx6c44jtys
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52469",
"uncompressed_offset": 445436187,
"url": "www.isfdb.org/cgi-bin/title.cgi",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.isfdb.org/cgi-bin/title.cgi?1398171"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: Il ponte di quattro giorni (Complete Novel)
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Title: Il ponte di quattro giorni (Complete Novel)
Author: George Henry Smith
Year: 1971
Variant Title of: The Four Day Weekend (by George H. Smith ) [may list more publications, awards and reviews]
Type: SERIAL
Language: Italian
ISFDB Record Number: 1398171
User Rating: This title has fewer than 5 votes. VOTE
Current Tags: None
Publications:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:45:19.000Z
|
2mjfgeogvdtywbcvcveqsh532vbtfm5v
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52484",
"uncompressed_offset": 524529790,
"url": "www.ohloh.net/p/pj4j/contributors/summary",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.ohloh.net/p/pj4j/contributors/summary"
}
|
cccc_CC-MAIN-2013-20
|
Activity Not Available
Contributors
Commits by Top Contributors
Number of Contributors
Newest Contributors
Name Commits First Commit
yuin405 3 about 4 years ago
[anonymous] 1 about 4 years ago
Top Contributors
Name Kudos 12 Month Commits All Time Commits 5 Year Trend Primary Language First Commit Last Commit
yuin405 0 3 Java about 4 years ago about 4 years ago
[anonymous] 0 1 about 4 years ago about 4 years ago
See All Contributors
Copyright © 2013 Black Duck Software, Inc. and its contributors, Some Rights Reserved. Unless otherwise marked, this work is licensed under a Creative Commons Attribution 3.0 Unported License . Ohloh ® and the Ohloh logo are trademarks of Black Duck Software, Inc. in the United States and/or other jurisdictions. All other trademarks are the property of their respective holders.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:20:31.000Z
|
w6sykwgdwsxmam4i5jfz4j6vpk6745ge
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52495",
"uncompressed_offset": 527461690,
"url": "www.openwetware.org/index.php?diff=prev&oldid=51762&title=User%3AChuehloo",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.openwetware.org/index.php?title=User:Chuehloo&diff=prev&oldid=51762"
}
|
cccc_CC-MAIN-2013-20
|
User:Chuehloo
From OpenWetWare
(Difference between revisions)
Jump to: navigation, search
Revision as of 09:22, 19 July 2006
Chueh-Loo Poh
Department of Bioengineering
Imperial College London
South Kensington, SW7
London, UK
email: chueh.poh@ic.ac.uk
Hi! I am Chueh-Loo. I am a Phd student from the department of Bioengineering at Imperial College London. I am under the supervision of Prof Kitney. My research project involves developing visualisation interfaces for biomedical data.
Education
• B.Eng (Electrical and Electronic Eng), Nanyang Technological University Singapore
Interests
• Mini ping pong
• Travelling
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:46:46.000Z
|
txtyoppgtnm2mzivjgwgevd3kpvbtznl
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52514",
"uncompressed_offset": 669893606,
"url": "www.werelate.org/wiki/Person:Harry_Copp_%282%29",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.werelate.org/wiki/Person:Harry_Copp_(2)"
}
|
cccc_CC-MAIN-2013-20
|
Person:Harry Copp (2)
Watchers
Harry Copp
d.04 Oct 1917
Facts and Events
Name Harry Copp
Gender Male
Birth? Corscombe, Dorset, England
Death? 04 Oct 1917 Killed in Action
Military? 04 Oct 1917 Private. 3/7536, 5th Bn., Dorsetshire Regiment.
Burial? Zonnebeke, West-Vlaanderen, BelgiumTyne Cot Memorial, No known grave.
Harry Copp was born in Corscombe and enlisted at Beaminster.
It is probable that Private Harry Copp was killed in action during the Battle of Broodside that took place on 4th October 1917.
Military Service
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:00:37.000Z
|
pqzocce24p2ejcbcxroeblwwylvqetqj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52515",
"uncompressed_offset": 669899904,
"url": "www.werelate.org/wiki/Place:Beal,_Yorkshire,_England",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.werelate.org/wiki/Place:Beal,_Yorkshire,_England"
}
|
cccc_CC-MAIN-2013-20
|
Place:Beal, Yorkshire, England
Watchers
NameBeal
Alt namesBegalesource: Domesday Book (1985) p 313
TypeInhabited place
Coordinates53.717°N 1.186°W
Located inYorkshire, England
Also located inNorth Yorkshire, England
source: Getty Thesaurus of Geographic Names
source: Family History Library Catalog
the text in this section is copied from an article in Wikipedia
Beal is a village and civil parish in the District of Selby in North Yorkshire, England. It is located on the River Aire, north east of Knottingley, south west of Selby, and south of York. The parish includes the village of Kellingley, and borders the City of Wakefield in West Yorkshire. At the 2001 census it had a population of 720.
The name "Beal" is of Old English origins and means "Nook of land in a river-bend". It is composed of the elements bēag ("river-bend") and halh ("nook of land"). The village was recorded as Begale in the Domesday Book of 1086.
Kellingley Colliery, one of the last deep coal mines in the United Kingdom, is located in the parish.
Fishing on the River Aire is controlled by Leeds and District Amalgamated Society of Anglers. The main catches are roach and bream.
Bus service 150, operated by Arriva Yorkshire, connects the village with Pontefract, Selby and Wakefield.
Research Tips
This page uses content from the English Wikipedia. The original content was at Beal, North Yorkshire. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:52:02.000Z
|
jw6a4i7ajgu6b7ugter2axyol7v2u4fa
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52516",
"uncompressed_offset": 669906768,
"url": "www.werelate.org/wiki/Place:Dickson_City,_Lackawanna,_Pennsylvania,_United_States",
"warc_date": "2013-11-22T19:23:25.000Z",
"warc_filename": "<urn:uuid:a95b7755-3345-4b94-bb0b-377e0dababf8>",
"warc_url": "http://www.werelate.org/wiki/Place:Dickson_City,_Lackawanna,_Pennsylvania,_United_States"
}
|
cccc_CC-MAIN-2013-20
|
Place:Dickson City, Lackawanna, Pennsylvania, United States
Watchers
NameDickson City
Alt namesDicksonsource: USGS, GNIS Digital Gazetteer (1994) GNIS42006593
Priceburgsource: USGS, GNIS Digital Gazetteer (1994) GNIS42006593
Pricevillesource: USGS, GNIS Digital Gazetteer (1994) GNIS42006593
TypeBorough
Coordinates41.466°N 75.625°W
Located inLackawanna, Pennsylvania, United States
source: Getty Thesaurus of Geographic Names
the text in this section is copied from an article in Wikipedia
Dickson City is a borough in Lackawanna County, Pennsylvania, north of Scranton. Coal mining had been an important industry in the past. Some of the population totals follow: in 1900, 4,948; in 1910, 9,331; in 1920, 11,049; and in 1940, 11,548. Coal miners are much scarcer in Pennsylvania today than they had been, so populations have fallen in many places such as Dickson City; The population was 6,070 at the 2010 census.
History & Notable Features
the text in this section is copied from an article in Wikipedia
Research Tips
This page uses content from the English Wikipedia. The original content was at Dickson City, Pennsylvania. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:47:01.000Z
|
yftdcp3l7bkzftei7fftpv6pnsc5b5ov
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52538",
"uncompressed_offset": 36096253,
"url": "buffalo.nas-central.org/w/index.php?diff=4634&oldid=2974&title=Linkstation_Hardware",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://buffalo.nas-central.org/w/index.php?title=Linkstation_Hardware&diff=4634&oldid=2974"
}
|
cccc_CC-MAIN-2013-20
|
Linkstation Hardware
From NAS-Central Buffalo - The Linkstation Wiki
(Difference between revisions)
Jump to: navigation, search
m
Line 1: Line 1:
#Redirect
#Redirect
-
[[Information/Information]]
+
[[LS Hardware and Software information]]
[[category:Hardware]]
[[category:Hardware]]
[[category:FAQ]]
[[category:FAQ]]
Latest revision as of 01:44, 23 July 2006
1. Redirect
LS Hardware and Software information
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:01:51.000Z
|
iqzjw6obkonqcbm4tzvsgww6oli66h4g
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52555",
"uncompressed_offset": 71824490,
"url": "dotnetkicks.com/stories/38828/Visual_Studio_2010_Service_Pack_1_now_available",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://dotnetkicks.com/stories/38828/Visual_Studio_2010_Service_Pack_1_now_available"
}
|
cccc_CC-MAIN-2013-20
|
Error!
Success!
Visual Studio 2010 Service Pack 1 now available
0
kicks
Visual Studio 2010 Service Pack 1 now available (Unpublished)
Microsoft has now released Service Pack 1 for Visual Studio 2010 to MSDN subscribers, with the public release due on March 10th. Along with a number of fixes, service Pack also includes the Team Foundation Server Project Server Integration Feature Pack, and the Visual Studio 2010 Load Test Feature Pack.
Kicked By:
Drop Kicked By:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:36:56.000Z
|
opol7c2kl675z3ryavojp66kcav2umn5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52558",
"uncompressed_offset": 77406254,
"url": "elinux.org/index.php?diff=70135&oldid=70129&title=Eclipse",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://elinux.org/index.php?title=Eclipse&diff=70135&oldid=70129"
}
|
cccc_CC-MAIN-2013-20
|
Difference between revisions of "Eclipse"
From eLinux.org
Jump to: navigation, search
(Usage examples and tutorials (relevant to Embedded Linux))
(Cross-compiling and debugging your embedded Linux application within Eclipse)
Line 110: Line 110:
=== Cross-compiling and debugging your embedded Linux application within Eclipse ===
=== Cross-compiling and debugging your embedded Linux application within Eclipse ===
[[CrossCompileInEclipse|Cross-compiling and debugging your embedded Linux application within Eclipse] describes how to build and debug an embedded Linux application within Eclipse.
+
[[CrossCompileInEclipse]] describes how to build and debug an embedded Linux application within Eclipse.
=== BeagleBoard and Eclipse, with JTAG ===
=== BeagleBoard and Eclipse, with JTAG ===
Revision as of 10:59, 27 October 2011
Eclipse is a integrated development environment (IDE) which consists of a "plug-in framework" written in Java. See the Eclipse wikipedia entry.
Many embedded Linux vendors ship tools based on Eclipse, including TimeSys, MontaVista, Wind River Systems and LynuxWorks. Android uses Eclipse as it's main application development environment, and the Yocto Project also includes Eclipse support.
Eclipse started as an IDE for writing Java programs, but has been extended to support numerous other languages, and development activities.
Contents
Eclipse basics
Plugins/Projects
All real functionality in Eclipse is provided via plugins (themselves written Java). That is, Eclipse itself is really just a plugin framework.
Eclipse is primarily geared to support Java development. On Fedora 12, the default Eclipse installation has support for writing Java programs, but not C. Support for developing in other languages, or in performing other development activities (e.g. launching other tools), is provided by plugins.
The following plugin project may be relevant for embedded Linux developers:
• JDT = Java Development tools - for Java development (usually included with a default Eclipse installation)
• CDT = C/C++ Development tools - for C and C++ development
• linuxtools = additional Linux-specific tools (like valgrind, lttng, oprofile, etc.)
• This is a superset of CDT
• PDE = Plugin development environment
• PyDev = python development IDE
• Target Management/Remote System Explorer (TM/RSE)
• Is used to discover and manage targets
• It can use ssh on the host and sshd on the target, to view and transfer files, and to execute commands on the target.
• It has the ability to launch shells and "terminals. Shells allow you to run individual commands on a target, and see their output. A terminal provides an interactive shell.
I downloaded RSE as part of the Yocto ADT, and found it easy to view files on a target that was running sshd.
• Is used by Wind River for their embedded Linux IDE product
Eclipse and Yocto
Yocto has an eclipse
• Yocto uses CDT remote launch, org.eclipse.cdt.launch.remote and TCF file/shells to transfer binaries and launch applications
• CDT = (C Development Toolkit)
• See: http://www.yoctoproject.org/projects/eclipse-ide-plug
• supports communication with emulator or real device, via Yocto Eclipse TCF
• emulated devices use NFS rootfs so host and target access same filesystem
• debugging is via cross-gdb (gdbserver and gdb client on host)
The Yocto plug-in provides the following tools:
• OProfile: Selecting this tool causes the oprofile-server to be launched on the remote machine. The oprofile-viewer must be installed on the local host machine and the oprofile-server must be installed on the remote target, respectively, in order to use. You can locate both the viewer and server from http://git.yoctoproject.org/cgit/cgit.cgi/oprofileui/. You need to compile and install the oprofile-viewer from the source code on your local host machine. The oprofile-server is installed by default in the image.
• Lttng-ust: Selecting this tool runs "usttrace" on the remote target, transfers the output data back to the local host machine and uses "lttv-gui" to graphically display the output. The "lttv-gui" must be installed on the local host machine to use this tool. For information on how to use "lttng" to trace an application, see http://lttng.org/files/ust/manual/ust.html
• PowerTOP: Selecting this tool runs "PowerTOP" on the remote target machine and displays the results in a new view called "powertop".
• LatencyTOP and Perf: "LatencyTOP" identifies system latency, while "perf" monitors the system's performance counter registers. Selecting either of these tools causes an RSE terminal view to appear from which you can run the tools. Both tools refresh the entire screen to display results while they run.
Eclipse and Android
Eclipse is the main application development environment for Android.
To develop programs for Android, a developer installs a Java development kit (JDK), Eclipse itself, and the Android Platform Tools, which is an SDK with class libraries and target management tools (like fastboot and adb). Finally, the developer installs the Android Development Tools (ADT), which has plugins and add-ons for Eclipse.
• Android Development Tools
• Android Development Tools is installed as a plugin to Eclipse (using eclipse software manager)
• Android SDK and AVD manager
• window to control Android SDK component installs
• can install or uninstall SDK parts (including different API class libs, examples, and tools)
• windows to control AVD (QEMU sessions)
• AVD = Android Virtual Device
• AVD manager can:
• define sessions
• start sessions
• A different window/dialog is used for selecting a target for deployment and debug
• Underneath everything are command line tools
• sometimes you have to use command line adb to "repair" something (uninstall an app on the target)
• DDMS = Set of windows to show process information from Android
• DDMS can also be run as a stand-alone application
• This shows some system-wide information that the Eclipse version does not
Android development install process overview
• install JDK
• install eclipse
• install JDT (inside eclipse, using the "install software" option)
• install Android SDK
• install platforms and platform tools (using Android SDK manager)
• install ADT (using eclipse "install software" option)
• configure ADT with path to Android SDK
• can then create Android projects
• select platform (library and class) version
• can debug on target or on qemu
• can also run DDMS
• view more target-specific info
• can run Android SDK and AVD manager
• to create new AVDs or launch them, or to install/uninstall platforms (libraries and classes)
Android eclipse plugins
• Source code for the Eclipse plugins for Android is in: <aosp_root>/sdk/eclipse/plugins
• The following plugins are available:
• com.android.ide.eclipse.adt
• com.android.ide.eclipse.hierarchyviewer
• com.android.ide.eclipse.tests
• com.android.ide.eclipse.ddms
• com.android.ide.eclipse.pdt
• com.android.ide.eclipse.traceview
Usage examples and tutorials (relevant to Embedded Linux)
Cross-compiling and debugging your embedded Linux application within Eclipse
CrossCompileInEclipse describes how to build and debug an embedded Linux application within Eclipse.
BeagleBoard and Eclipse, with JTAG
BeagleBoard Eclipse describes how to install and use Eclipse with BeagleBoard, focused on JTAG debugging.
Using Eclipse with the Linux kernel
Eclipse is commonly used to develop user-space applications and programs, but it is also possible to use the IDE to work on the Linux kernel.
See http://wiki.eclipse.org/HowTo_use_the_CDT_to_navigate_Linux_kernel_source
For cross-compilation tips, see: http://kloggsays.blogspot.com/2011/06/kernel-development-using-eclipse-omap4.html
Tips/Tricks
• With CDT, the resource scanner can get into cycles with symbolic links of folders. You must set up a resource filter ignoring these links to prevent the memory leaks that result.
Miscellaneous Notes
• Eclipse is a derivative of VisualAge by IBM (which was originally a smalltalk IDE)
• Eclipse uses SWT graphics and windowing (not AWT or SWING)
• AWT is too native, SWING is too non-native
• SWT is supposed to be "just right" tradeoff between performance and look and feel.
• can get Vim-like keybindings with vwrapper - http://vrapper.sourceforge.net/home/
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:00:32.000Z
|
ulnlrug74g7vnhqiopbxczt6xovginas
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52559",
"uncompressed_offset": 77448973,
"url": "elinux.org/index.php?oldid=221402&title=RPi_Distributions",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://elinux.org/index.php?title=RPi_Distributions&oldid=221402"
}
|
cccc_CC-MAIN-2013-20
|
RPi Distributions
From eLinux.org
Revision as of 15:48, 19 February 2013 by Yanglifu90 (Talk | contribs)
Jump to: navigation, search
Contents
Back to the Hub.
Software & Distributions:
Software - an overview.
Distributions - operating systems and development environments for the Pi.
Kernel Compilation - advice on compiling a kernel.
Performance - measures of the Pi's performance.
Programming - programming languages that might be used on the Pi.
Available Distributions
What is armhf
The official Debian Squeeze image issued by the Raspberry Pi foundation uses "soft float" settings. The foundation found it necessary to use the existing Debian port for less capable ARM devices due to time and resource constraints during development of the Raspberry Pi. Therefore, it does not make use of the Pi's processor's floating point hardware - reducing the Pi's performance during floating point intensive applications - or the advanced instructions of the ARMv6 CPU.
The official Raspberry Pi distributions are now optimized for ARMV6 and for "hard float" which should have better performance on certain CPU intensive tasks.
There are some info on the news groups that "hard float" optimization can speed up floating point operating up to 10x, please read detailed discussion on Raspberry Pi forums - http://www.raspberrypi.org/phpBB3/viewtopic.php?p=61497#p61497
Comparison
Operating Systems for Raspberry Pi models A and B
Distribution Latest First Type License Memory footprint armhf Image/Installer Packages Username:Password default GUI
Arch Linux ARM 2012-09-18 2012-03-01 Linux OSI GPLv2 Yes raw image 4,604 root:root none
BerryTerminal 2012-06-02 2012-06-02 Linux No Image N/A ltsp
Bodhi Linux 2012-09-13 (raspbian/wheezy) 2012-06-12 (wheezy) Raspbian Core: OSI mixed (GPLv2 BSD etc) Yes img+md5sum 35,000+
ARMHF
pi/bodhilinux
(sudo su root/bodhilinux)
Enlightenment
Debian ARM 2012-04-19 (Squeeze) 2012-02-16 (Squeeze) Linux Core: OSI mixed (GPLv2 BSD etc) No raw image 20,000+ pi:raspberry ?
Fedora Remix 2013-02-11 (F18) 2012-07-07 (F14) Linux OSI mixed (GPLv2 BSD etc) Yes Fedora RPM: installer
Windows Zip: installer
Other Linux: Python script
16,464? N/A Xfce
Gentoo Linux weekly autobuilds 2012-04-27 Linux GPLv2 ~23 MiB Yes Wiki article Quick Install Guide
stage3 tarball
N/A
IPFire 2012-06-27 (2.11) 2012-06-27 (2.11) Linux Open Source ~20 MiB No raw image (404 error from their own website) 144 N/A none
Meego MER + XBMC 2012-04-27 (0.2) 2012-04-11 (0.1) Linux (embedded) OSI mixed (GPLv2 BSD etc) ~34 MiB + XBMC No ~320 (core) N/A XBMC
Moebius 2012-09-11 (1.0.1) 2012-08-01 (1.0.0) Raspbian (GPLv2) ~20 MiB Yes Raw Image (core) + Raspbian Repositories root: raspi none
openSUSE 2012-10-16 2012-07-30 Linux 3.1 OSI mixed (GPLv2 BSD etc) 279 MiB (inc. X11) No raw image 5000 root:linux icewm via startx
OpenWRT 2012-10-23 2012-08-15 Linux OSI mixed (GPLv2 BSD etc) 3,3MiB No Image Packages first login with telnet
set your SSH pw
LuCI
PiBang Linux 2013-02-14 2012-10-29 Linux Core: OSI mixed (GPLv2 BSD etc) Yes Latest image (user created at first boot) Openbox
PwnPi 2012-06-29 (Squeeze) 2012-05-26 (Squeeze) Linux GNU General Public License version 3.0 No Image 20,000+ root:toor xfce
QtonPi 2012-05-27 (0.2) 2012-05-07 (0.1) Linux No qt 5 sdk + sdcard image root:rootme
qtonpi:qtonpi
?
Raspbian 2012-09-18 2012-05-28 (Wheezy) Linux Core: OSI mixed (GPLv2 BSD etc) ~30 MiB w/o desktop Yes pi image list
qemu image
35,000+ root:hexxeh
root:raspbian
pi:raspberry
LXDE Openbox
OpenELEC 2013-01-03 (3.0 RC 1) 2012-05-10 Linux 3.6.11 (embedded) OSI mixed (GPLv2 BSD etc) 85 MiB (inc. XBMC) Yes install instructions
build instructions - part 1
build instructions - part 2
official builds
raw image (unofficial)
~140 (+ 7 via xbmc) root:openelec
(ssh only)
XBMC-PVR
XBian 2012-11-27 2012-07-29 Raspbian OSI mixed (GPLv2 BSD etc) Yes Windows installer
Latest images
Install instructions
35,000+ xbian:raspberry XBMC
raspbmc 2012-10-10 2012-06-30 (Squeeze) Raspbian custom Yes nightlies
linux installer
windows installer
20,000+ pi:raspberry XBMC
RISC OS 2012-11-01 (5.19 RC6) 2012-07-09 (5.19) RISC OS Shared Source No Latest official image
(not applicable) RISC OS WIMP
SliTaz 2012-12-14 (cooking) 2012-05-29 (4.0) Linux 3.2.27 GPLv2 ~10 MiB Yes raw image Packages root:root Openbox ?
Aros hosted on Raspbian Limited Demo 2012-06-14 2012 Mixed Debian6 and Aros Mixed - GPLv2 and APL (MPL derivative) <~50 MiB No Binaries and run ./where/ever/AEROS/boot/AROSbootstrap pi:raspberry Aros Wanderer
Plan9 2012-11-26 2012-11-12 Plan 9 Lucent No raw image Rio
Android
Discuss: Forum at raspberrypi.org
Wiki & Main site
Fedora Remix
The Raspberry Pi Fedora Remix is a Linux software distribution for the Raspberry Pi computer. It contains software packages from the Fedora Project (specifically, the Fedora ARM secondary architecture project), packages which have been specifically written for or modified for the Raspberry Pi, and proprietary software provided by the Raspberry Pi Foundation for device access.
Debian (Squeeze/6.x)
http://www.debian.org/ports/arm/
Debian was the default distribution on the Alpha boards. Boot time depends on width & speed of SD-card. Alpha board boot into Debian prompt (no GUI) was timed taking about 34 seconds.
The Debian distro for Raspberry Pi is the Cambridge reference filesystem, which is a fully functional Debian Squeeze installation containing LXDE (desktop) and Midori (browser); development tools; and sample code for accessing the multimedia functionality on the device.
Arch
Arch Linux ARM is based on Arch Linux, which aims for simplicity and full control to the end user. It provides a lightweight base structure that allows you to shape the system to your needs. For this reason, the Arch Linux ARM image for the Raspberry Pi does not come with a graphical user interface, though you can easily install one yourself. Please note that the Arch distribution may not be suitable for beginners.
Arch Linux ARM is on a rolling-release cycle that can be updated daily through small packages instead of huge updates every few months.
More information is available at http://archlinuxarm.org
Raspbian
Raspberry Pi + Debian = Raspbian. A project to create a hard float port of Debian Wheezy (7.x) armhf for the Raspberry Pi. The intent of Raspbian is to bring to the Raspberry Pi user 10,000s of pre-built Debian packages specifically tuned for optimal performance on the Raspberry Pi hardware. The project is still in it's early phases, but the major push to rebuild nearly all Debian packages for the Raspberry Pi is expected to be completed by early June, 2012 (only several hundred packages remain as of June 1st). After that, efforts will focus on making Raspbian the easiest to use, most stable and best performing Linux distribution available for the Raspberry Pi.
More information is available at http://www.raspbian.org
Moebius
A very compact ARM HF debian based distribution, it fits in a 1Gb SD card, has autoresizing features to better adapt to your SD card size and uses Raspbian huge repositories for installing everything you need. A wise configuration and a small memory footprint are ideal for an headless machine or for interacting with real word I/O devices, take a look at Moebius Website
Raspbian Server Edition
It's a stripped version of Raspibian with some other packages
Red Sleeve Linux
Red Sleeve Linux is a Linux distribution that aims to bring the RHEL clone design to the ARM architecture. There are images for several ARM devices including the Raspberry Pi.
IPFire
IPFire is an Open Source firewall distribution for x86 and ARM-based systems. It turns the Raspberry Pi computer into a small router for home networks and very small businesses. As the Raspberry Pi computer comes with only one NIC, it works perfectly as a 3G router without plugging in additional hardware.
The generally small system that provides essential services for networks can be enhanced by addons which add new features to IPFire. So the system can be turned into a file server and much more.
More information is available at http://www.ipfire.org
Raspberry Pi Thin Client
Thin Client project want to create a very low price thin client over Raspberry Pi board! Microsoft RDC, Citrix ICA & VMWare View
DarkElec
None of the currently available solutions do a perfect job with running XBMC on the Pi, however OpenELEC comes by far the closest, in spite of its locked down nature.
This fork aims to remedy the very few flaws in its implementation and to focus 100% on the Pi, while also sticking to the upstream and incorporating its updates.
Features:
•Low idle CPU usage (< 15%)
•Smoother and more responsive
•Built in XBMC addons: iPlayer, custom fixed version of Demand 5, various unofficial repos
•iPlayer, 4oD, Demand 5, ITV Player, SportsDevil all fully tested+working
•Improved wifi connectivity
•Added test-connman scripts for easy wifi setup
•Added wireless_tools (iwconfig etc.)
•Added rndis_wlan wifi driver (broadcom 4320 chipset)
•Easy SD card installation script for building from source
OpenELEC
OpenELEC is an embedded operating system built specifically to run XBMC, the open source entertainment media hub. The idea behind OpenELEC is to allow people to use their Home Theatre PC (HTPC) like any other device you might have attached to your TV, like a DVD player or Sky box. Instead of having to manage a full operating system, configure it and install the packages required to turn it into a hybrid media center, OpenELEC is designed to be simple to install, manage and use, making it more like running a set-top box than a full-blown computer.
Raspbmc
Raspbmc is a minimal Linux distribution based on Debian that brings XBMC to your Raspberry Pi. This device has an excellent form factor and enough power to handle media playback, making it an ideal component in a low HTPC setup, yet delivering the same XBMC experience that can be enjoyed on much more costly platforms. Raspbmc is brought to you by the developer of the Crystalbuntu Linux Distribution, which brings XBMC and 1080p decoding to the 1st generation Apple TV.
XBian
XBian is a small, fast and lightweight media center distro for the Raspberry Pi, based on a minimal Raspbian image. It's slogan is "XBMC on raspberry pi, bleeding edge" and thus it's main focus is delivering the fastest XBMC solution for the Raspberry Pi. Thereby making most of the commercial media-center products obsolete...
Features:
• Fits on a 1GB SD card
• Low RAM usage and low CPU usage
• Very smooth UI
• Auto mount USB
• AFP support
• NFS support
• AirPlay support
• CEC support
• Lirc support
• PVR support
• Kernel 3.6.7 + a lot of modules
• Performance as the default governor
• Out of the box support for almost all wlan adapters
• User friendly configuration tool xbian-config
• Source code on git
• Large community
• Apt repo so updated was never easier!
PwnPi
PwnPi is a Linux-based penetration testing dropbox distribution for the Raspberry Pi. It currently has 181 network security tools pre-installed to aid the penetration tester. It is built on the debian squeeze image from the raspberry pi foundation's website and uses Xfce as the window manager
ha-pi
Description This debian squeeze image created to perform "pwn plug" type of attacks using Raspberry pi. pleas look at the wiki for further details Wiki
Bodhi
Bodhi Linux is a small Linux distribution using the Enlightenment window manager and the ARM build is based on Debian.
If you hit any snags or find bugs with this image please let us know in the R_Pi section of our user forums so we can improve this release.
Alpha Release | Link Alpha Bodhi R_Pi) User/Password: bodhi/bodhi root/raspberry Beta Release | Link Beta Bodhi R_Pi User/Password: pi/bodhilinux Root: sudo su root/bodhilinux
Bodhi Linux moves ARM Branch to ARMHF Download newest Release from Sourcforge The R_Pi Bodhi build is built directly on top of Raspbian and incorporates all of their changes and improvements.
Gentoo
Gentoo Linux is a source based rolling-release distribution which emphasizes choice and flexibility. Gentoo ARM aims to be the most up to date and fastest ARM distribution available.
A Quick Start Guide exists how to install Gentoo on the Raspberry Pi.
Gentoo Section on the official Raspberry Pi forum.
Adafruit - Occidentalis v0.1
http://learn.adafruit.com/adafruit-raspberry-pi-educational-linux-distro/occidentalis-v0-dot-1 Occidentalis v0.1. Rubus occidentalis is the black raspberry. It is derived from Raspbian Wheezy July 15 Made a few key changes to make it more hardware-hacker friendly!
• I2C and hardware SPI support
• I2C/SPI modules initialized on boot
... Please keep in mind, adafruit is not full time linux distro maintainers - we will try to fix any bugs we find but this distro is not for beginners or people who are new to linux!
RISC OS
RISC OS is a fast and lightweight computer operating system designed in Cambridge, England by Acorn. First released in 1987, its origins can be traced back to the original team that developed the ARM microprocessor. RISC OS includes BBC BASIC which was primarily conceived to teach programming skills as part of the BBC computer literacy project.
PiBang Linux
PiBang linux is a Raspbian based distribution. PiBang is inspired by Crunchbang Linux, an i686 and x86_68 Debian based distribution. It comes preconfigured with many helpful scripts and pipemenus as well as a fork of Raspi-config with increases functions such as support for changing the user and hostname. PiBang is also one of the heavier Rasperry Pi distributions boasting a complete package set with favorites such as Abiword, OMXPlayer, GIMP, and VLC all pre-installed.
http://www.pibanglinux.org
Plan 9
Plan 9 is a distributed operating system originally designed and implemented by Ken Thompson, Rob Pike, Dave Presotto, and Phil Winterbottom @ Bell Labs. It is a lean operating system that has been ported to super computers such as IBM's Blue Gene down to tiny boards such the RaspberryPi.
NetBSD
NetBSD is an operating system based off 4.3BSD and is geared towards embedded systems. There has been an unofficial public release here comments about the release here
FreeBSD
Details of the FreeBSD port Dowload here
Announced distributions
The following distributions have been announced and may have been publicly demonstrated but distributions are not generally available quite yet.
Chromium OS
Details about the work Chromium OS is Google own version of linux os
KidsRuby
KidsRuby is what it sounds like – a Ruby for kids – and it’s running beautifully on the Raspberry Pi. This is exactly the sort of application we want to see on the device, and we’re really pleased to see it up and running. It looks like there will be some optimisation for speed before we launch, but what’s there already is very useable.
R.Pi blog entry: http://www.raspberrypi.org/2011/09/kidsruby-on-raspberry-pi-another-video-demo/ More info & Video: http://confreaks.net/videos/637-gogaruco2011-kidsruby-think-of-the-children?player=html5
Meego MER & XBMC
The MeeGo MER project provides a Linux-based, open source software platform for the next generation of computing devices. The MeeGo MER software platform is designed to give developers the broadest range of device segments to target for their applications, including netbooks, handheld computing and communications devices, in-vehicle infotainment devices, smart TVs, tablets and more – all using a uniform set of APIs based on Qt. XBMC is an award-winning free and open source (GPL) software media player and entertainment hub for digital media. Meego TV 1.2 uses XBMC as a reference GUI (that is, a starting point for creating a custom GUI).
Puppy
Puppy Linux is designed to be a small tiny Linux distribution (<100MB). One distro version of Puppy for ARM is SAP6 Debian6 armel binaries and another PuppiPlan all under the Puppy initiative. Puppy Linux is going back to his roots. Designed to run from 256MB ram. Making every bit count. Join the Puppy geek adventure for 2012. Woof Woof
OpenWrt
OpenWrt is described as a Linux distribution for embedded devices. The Rpi is now supported by the Attitude Adjustment (12.09-beta) release available here:
http://downloads.openwrt.org/attitude_adjustment/12.09-beta/brcm2708/generic/
OpenWrt Wiki for R_pi http://wiki.openwrt.org/toh/raspberry_pi
Related links:
RPi-Buildroot
RPi-Buildroot is a set of Makefiles and patches that make it easy to generate a complete customized embedded Linux system for your Raspberry Pi. This distro is based on Buildroot so it's perfect for somebody looking to build a trimmed down or task-specific system.
Please note that this distro is intended for advanced users.
Aros Hosted on Linux
Aros is an open source Amiga like operating system (OS) at the api level. This version runs as a task under Linux to take advantage of the drivers available inside the GNU Linux OS core.
Related links
Other Distributions
These are other popular distributions that are often asked about for Raspberry Pi but are not available.
GeeXboX ARM
GeeXboX is a free and Open Source Media-Center purposed Linux distribution for embedded devices and desktop computers. GeeXboX is not an application, it’s a full-featured OS, that one can boot as a LiveCD, from a USB key, an SD/MMC card or install on its regular HDD. The GeeXboX distribution is lightweight and designed for one single goal: embed all major multimedia applications as to turn your computer into an HTPC.
http://www.geexbox.org/category/arm/
Ubuntu
Ubuntu was initially planned to be the default distribution, but the current version of Ubuntu only supports ARMv7 onwards, not the ARMv6 architecture used by the Raspberry Pi's processor. Therefore Ubuntu does not work on Raspberry Pi, and there is no further information about this changing in the near future.
A bug report on this subject was submitted to Ubuntu's bug tracker. The responses to that bug include an unofficial viewpoint from a Canonical employee, outlining the amount of work required to support ARMv6 (and therefore, potentially, Raspberry Pi). See Bug 848154
https://wiki.ubuntu.com/ARM
References
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:46:38.000Z
|
jcjpauelhqb7sblx4n2tcnxovicsgxhz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52566",
"uncompressed_offset": 84908225,
"url": "familysearch.org/learn/wiki/en/index.php?oldid=1226902&title=Main_Page",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://familysearch.org/learn/wiki/en/index.php?title=Main_Page&oldid=1226902"
}
|
cccc_CC-MAIN-2013-20
|
From FamilySearch Wiki
Revision as of 14:21, 28 January 2013 by Wyzer17 (Talk | contribs)
Beginning Genealogy
More research helps
Find Records by Place
All countries
Research Tools
More research tools
Wiki for Groups
User Group Meetings
Wiki News
More News
Build the Wiki
More help articles
Research Questions?
There are many places to get research help from an individual
Wiki Contributor Questions?
Contact FamilySearch or ask the community for help
Featured Article
Iceland Marriages (FamilySearch Historical Records)
Did you know that this Iceland article contains a wealth of information about Iceland Marriages, 1770 – 1920?
Virginia African Americans
In 1790, which two Virginia counties had more than 10,000 slaves?
Share your knowledge
How to Locate Your Ancestor in the United States
We Need Your Help!
This Finding your Ancestors article needs updated information. The factual accuracy of this article or section may be compromised due to out-of-date information.
See articles that need to be updated on the Outdated Articles page.
View popular articles View featured article archive
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:33:53.000Z
|
74lsk27isdeppw22lokh5rg4dq4eomrf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52567",
"uncompressed_offset": 87931979,
"url": "finds.org.uk/database/artefacts/record/id/130664",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://finds.org.uk/database/artefacts/record/id/130664"
}
|
cccc_CC-MAIN-2013-20
|
COIN
Unique ID: SF-8CA687
Object type certainty: Certain
Workflow status: Awaiting validation
silver pennies from the reign of King Edward I (1279-1307) and thus their metal fineness will be of the traditional sterling standard of 92.5% fine metal.
Their details are as follows.
Pennies of Edward I 1. Class 1d (May-December 1279) London 1.35g 2. Class 2b (January-May 1280) London 1.13g 3. Class 4a4 (1282-9) Canterbury 1.36g 4. Class 4b London 1.35g 5. Class 4b London 1.39g 6. Class 4b London 1.41g 7. Class 4c London 1.33g 8. Class 4e London 1.40g
As can be seem, the coins all belong to the start of the Edwardian sterling coinage (introduced in 1279) and are also of very good weight. It is very probable indeed that they represent a single deposit made in the course of the 1280s (class 4 was in production 1282-9, but it is likely that the bulk of this issue belongs to the early part of the period). It is my opinion, therefore, that the find fulfils the criteria of Treasure, according to the terms of the Act.
Dr Barrie J. Cook Curator of Medieval and Early Modern Coinage Department of Coins and Medals British Museum 5 May 2005
Subsequent actions
Subsequent action after recording: Returned to finder
Treasure details
Treasure case tracking number: 2006 T212
Chronology
Broad period: MEDIEVAL
Period from: MEDIEVAL [scope notes | view all attributed records]
Date from: AD 1279
Date to: AD 1307
Dimensions and weight
Quantity: 7
Discovery dates
Date(s) of discovery: Tuesday 18th April 2006
Personal details
Found by: This information is restricted for your login.
Recorded by: Miss Faye Minter - [ view all attributed records]
Identified by: Mr Barrie Cook - [view all attributed records]
Other reference numbers
Other reference: 2006 T212
Treasure case number: 2006 T212
Materials and construction
Primary material: Silver [scope notes | view all attributed records]
Coin data (numismatics)
Denomination: Penny [ scope notes | view all attributed records]
Ruler/issuer: Edward I of England [ scope notes | view all attributed records]
Category: English coin Edwardian type 1279 - 1377 [ scope notes | View all attributed records]
QR barcode
The barcode on the right is a unique identifier for this record. If your phone has scanning software installed, then this can be used for sharing or you can print it off and attach it to the object.
Spatial metadata
Region: East
County: Suffolk
District: Suffolk Coastal
To be known as: Rendham
Spatial coordinates
Grid reference source: From a paper map
Unmasked grid reference accurate to a 10 metre square.
Discovery metadata
Method of discovery: Metal detector [scope notes]
General landuse: Cultivated land[scope notes]
Specific landuse: Character undetermined[scope notes]
References cited
No references cited so far.
Similar objects
Find number: DENO-F2D717
Object type: COIN HOARD
Broadperiod: MEDIEVAL
Medieval coin; hoard of struck silver pennies of Edward I. The hoard is made up of 25 complete coins, 11 incomplete coins and 3 fragments of c…
Workflow: Published
Find number: SWYOR-3DC580
Object type: HOARD
Broadperiod: MEDIEVAL
Treasure Case 2010 T496 and T496a "I have examined eight coins reported. All are silver pennies of the English kings Edward I and…
Workflow: Awaiting validation
Find number: WMID-C603E1
Object type: COIN
Broadperiod: MEDIEVAL
A complete silver penny of Edward I (1272-1307).York mint. Class 2b (N1015), January-May 1280. Mass: 1.4g. Diameter: 20.3mm.
Workflow: Awaiting validation
Spotted a mistake? Tell us. Be the first to comment
Comment on this artefact's record
Data entered via this form is checked against the akismet service to recognise spam.
Audit data
Created: Friday 21st April 2006
Updated: Thursday 24th February 2011
This page is available in: qrcode json xml geojson representations.
Social Bookmarking:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:24:12.000Z
|
djntkq6lhoviuajp2brpihvd42olcuuv
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52573",
"uncompressed_offset": 94947110,
"url": "forums.netduino.com/index.php",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://forums.netduino.com/index.php?/statuses/all/page__status_id__113"
}
|
cccc_CC-MAIN-2013-20
|
Jump to content
Community Status Updates
Paul Newtonweixiongmei
Hi, did you finish your big LED display?
May 09 2013 09:46 PM
Paul Newtonhanzibal
Has some of your hair fallen out Hanz? You've gone all yellow too.....
Apr 07 2013 01:07 PM
Paul Newton
Happy easter everyone. My Easter gift from google - all my appointments screwed up by daylight saving time change. Did a seatch online - people have been complaining about this for years on Android.
Mar 31 2013 08:18 AM
NeonMika / Markus VV.
Whoop whoop. NeonMika.Webserver Version 1.1 and NeonMika.NetduinoControl Version 0.1 released! :)
Mar 28 2013 07:47 PM
Paul Newton
Updated my second Netduino plus v1. Now I can connect them "back-to-back" and send UDP messages to remote control a gpio. Only took 2 months!
Mar 24 2013 06:36 PM
Paul Newton
So it turns out that Android isn't that bad after all - IF YOU BUY A DECENT DEVICE. Its still really confusing coming from a Palm!
Mar 22 2013 06:54 PM
• Paul Newton
Until daylight savings time starts or ends.
Mar 31 2013 08:20 AM
soloelectronico
I have a Netduino bricked
Mar 17 2013 07:57 AM
Paul Newton
My hated Sumvision Android tablet killed itself. So I have got an Archos 43 Internet Tablet. It's Android but it works!
Mar 14 2013 09:27 PM
QED58
My ND+2 has passed away I think
Mar 13 2013 04:16 PM
mHammer
3 hours of messing with drivers only to find the problem is the USB controller. ARGH!!!
Mar 01 2013 07:33 AM
YuvaRaja
Nothing is difficult But Nothing is Easy...
Feb 20 2013 02:10 PM
Dave VanderWekke
Working on Pandora's Box software tonight while listening to Paranormal Investigation Evidence.
Feb 19 2013 10:46 PM
Dave VanderWekke
Time to watch Ancient Aliens
Feb 16 2013 01:53 AM
Dave VanderWekke
Time to watch Ancient Aliens
Feb 16 2013 01:53 AM
Paul Newton
I bought two 2nd hand Netduino plus rev B's. Tried to send UDP from one to the other - failed miserably. Going to update to v4.2.
Jan 26 2013 10:18 PM
• hanzibal
Sorry you had gave up on the electric bike Paul. It seemed like such a nice idea :-)
Mar 14 2013 07:49 PM
• Paul Newton
I have not given up completely, I am just waiting for a whole week without rain!
Could be a long wait....
Mar 14 2013 09:24 PM
home hardware projects downloads community where to buy contact Copyright © 2010-2013 Secret Labs LLC | Legal |
This webpage is licensed under a Creative Commons Attribution-ShareAlike License.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:39:06.000Z
|
suwgagnj7h7z73b7xi6gofdex4tumcb2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52594",
"uncompressed_offset": 124701283,
"url": "josm.openstreetmap.de/browser/josm/trunk/data/da.lang?rev=3139",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://josm.openstreetmap.de/browser/josm/trunk/data/da.lang?rev=3139"
}
|
cccc_CC-MAIN-2013-20
|
source: josm/trunk/data/da.lang @ 3139
Last change on this file since 3139 was 3139, checked in by bastiK, 3 years ago
i18n update
• Property svn:mime-type set to application/octet-stream
File size: 129.3 KB
HTML preview not available, since no preview renderer could handle it. Try downloading the file instead.
Note: See TracBrowser for help on using the repository browser.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:02:03.000Z
|
xtp2l4mtmbup7kjvvsobtwsdx2szrc5h
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52622",
"uncompressed_offset": 169491429,
"url": "openwetware.org/index.php?oldid=433915&title=User%3AXiaodong_Liu",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://openwetware.org/index.php?title=User:Xiaodong_Liu&oldid=433915"
}
|
cccc_CC-MAIN-2013-20
|
User:Xiaodong Liu
From OpenWetWare
Revision as of 08:28, 19 July 2010 by Xiaodong Liu (Talk | contribs)
Jump to: navigation, search
I am a new member of OpenWetWare!
Contents
Contact Info
Xiaodong Liu
• Xiaodong Liu, Ph.D.
• Principle Investigator, X-Laboratory
• Department of Biomedical Engineering, School of Medicine
• Tsinghua University, Beijing
Education
• Postdoctoral Fellow, Johns Hopkins University, Neuroscience and Biomedical Engineering
• Ph.D., Case Western Reserve University, Biomedical Engineering
• M.S., Tsinghua University, Biomedical Engineering
• B.S., Zhejiang University, Biomedical Engineering and Instrumentation
Research interests
1. Sensory Neuroscience (Vision and Taste)
2. Membrane Excitability (Ion Channels)
3. Transmembrane Signaling (Physical and Chemical Cues)
Publications
ResearcherID
1. Liu X, Yang PS, Yang W, and Yue DT. Enzyme-inhibitor-like tuning of Ca(2+) channel connectivity with calmodulin. Nature 2010 Feb 18; 463(7283) 968-72. doi:10.1038/nature08766 pmid:20139964.
2. Chen P, Liu XD, Zhang W, Zhou J, Wang P, Yang W, and Luo J. Modeling and simulation of ion channels and action potentials in taste receptor cells. Sci China C Life Sci 2009 Nov; 52(11) 1036-47. doi:10.1007/s11427-009-0138-9 pmid:19937202.
3. Liu XD and Kourennyi DE. Effects of tetraethylammonium on Kx channels and simulated light response in rod photoreceptors. Ann Biomed Eng 2004 Oct; 32(10) 1428-42. pmid:15535060.
4. Kourennyi DE, Liu XD, Hart J, Mahmud F, Baldridge WH, and Barnes S. Reciprocal modulation of calcium dynamics at rod and cone photoreceptor synapses by nitric oxide. J Neurophysiol 2004 Jul; 92(1) 477-83. doi:10.1152/jn.00606.2003 pmid:14985410.
5. Sun H, Liu X, Xiong Q, Shikano S, and Li M. Chronic inhibition of cardiac Kir2.1 and HERG potassium channels by celastrol with dual effects on both ion conductivity and protein trafficking. J Biol Chem 2006 Mar 3; 281(9) 5877-84. doi:10.1074/jbc.M600072200 pmid:16407206.
6. Kourennyi DE, Liu X, and Barnes S. Modulation of rod photoreceptor potassium Kx current by divalent cations. Ann Biomed Eng 2002; 30(9) 1196-203. pmid:12502230.
7. Liu XD and Kourennyi DE. Linear system analysis of ion channel modulation in rod photoreceptors under dim light conditions. Conf Proc IEEE Eng Med Biol Soc 2004; 6 4037-40. doi:10.1109/IEMBS.2004.1404127 pmid:17271185.
8. Chen P, Liu XD, Wang B, Cheng G and Ping Wang (2009) A biomimetic taste receptor cell based biosensor for electrophysiology recording and acidic sensation", Sensors and Actuators, B: Chemical 139: 576-583
9. Chen P, Cheng G, Wang B, Wang P* and Liu XD* (2008) Design of a novel acid-sensing biosensor based on taste neurons and LAPS. In: 2nd International Conference on Bioinformatics and Biomedical Engineering, iCBBE 2008, pp 1561-1564 (*corresponding authors)
Useful links
Biomedical Engineering at Tsinghua University
School of Medicine at Tsinghua University
School of Life Sciences at Tsinghua University
Neural Engineering Center at CWRU
Dr. Min Li's Lab
Dr. David Yue's Lab
Dr. Steven Barnes's Lab
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:12:09.000Z
|
jgxnnco7ticwsgfdwqljkdmukqrfhpzz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52636",
"uncompressed_offset": 183939487,
"url": "quotationsbook.com/book/bredelgal/page=3/",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://quotationsbook.com/book/bredelgal/page=3/"
}
|
cccc_CC-MAIN-2013-20
|
bredelgal's bookmarks
"Work is the meat of life, pleasure the dessert."
Forbes, B. C. on work
7 fans of this quote
"Through wisdom is a house built; and by understanding it is established; and by knowledge shall every room be filled with precious and pleasant riches."
Bible on wisdom
8 fans of this quote
"Without adversity a person hardly knows whether they are honest or not."
Fielding, Henry on honesty
3 fans of this quote
"Repeat anything often enough and it will start to become you."
Hopkins, Tom on suggestion
4 fans of this quote
"The mind is its own place, and in itself can make heaven of hell, a hell of heaven."
Milton, John on mind
10 fans of this quote
"Grow old along with me! The best is yet to be, The last of life, for which the first was made."
Browning, Robert on age and aging
7 fans of this quote
"The greatest mistake a man can make is to be afraid of making one."
Hubbard, Elbert on mistakes
12 fans of this quote
"Art is the beautiful way of doing things. Science is the effective way of doing things. Business is the economic way of doing things."
Hubbard, Elbert on methods
"A retentive memory may be a good thing, but the ability to forget is the true token of greatness."
Hubbard, Elbert on memory
3 fans of this quote
"Life in abundance comes only through great love."
Hubbard, Elbert on love
7 fans of this quote
"Laughter is higher than all pain."
Hubbard, Elbert on laughter
3 fans of this quote
"God will not look you over for medal, degrees or diplomas, but for scars."
Hubbard, Elbert on achievement
51 fans of this quote
"Men are rich only as they give. He who gives great service gets great rewards."
Hubbard, Elbert on giving
6 fans of this quote
"Your friend is that man who knows all about you, and still likes you."
Hubbard, Elbert on friends and friendship
19 fans of this quote
"Never explain -- your friends do not need it, and your enemies will not believe you anyway."
Hubbard, Elbert on nations
15 fans of this quote
"We find what we expect to find, and we receive what we ask for."
Hubbard, Elbert on expectation
3 fans of this quote
"It does not take much strength to do things, but it requires great strength to decide what to do."
Hubbard, Elbert on decisions
15 fans of this quote
"A pessimist is one who has been compelled to live with an optimist."
Hubbard, Elbert on pessimism
"Where parents do too much for their children, the children will not do much for themselves."
Hubbard, Elbert on parents and parenting
12 fans of this quote
"My reading of history convinces me that most bad government results from too much government."
Jefferson, Thomas on government
9 fans of this quote
"We hold these truths to be self-evident: that all men are created equal; that they are endowed by their Creator with certain unalienable rights; that among these are life, liberty, and the pursuit of happiness"
Jefferson, Thomas on equality
7 fans of this quote
"Either men will learn to live like brothers, or they will die like beasts."
Lerner, Max on cooperation
"We work to become, not to acquire."
Hubbard, Elbert on work
5 fans of this quote
"Live truth instead of professing it."
Hubbard, Elbert on truth
4 fans of this quote
"The teacher is one who makes two ideas grow where only one grew before."
Hubbard, Elbert on teacher
6 fans of this quote
"Character is the result of two things: Mental attitude and the way we spend our time."
Hubbard, Elbert on character
6 fans of this quote
This quotation can be viewed in the context of a book
"If you suffer, thank God! It is a sure sign that you are alive."
Hubbard, Elbert on suffering
5 fans of this quote
"He who has achieved success has worked well, laughed often and loved much."
Hubbard, Elbert on success
4 fans of this quote
"The man who has no more problems to solve, is out of the game."
Hubbard, Elbert on problems
7 fans of this quote
"Play needs direction as well as work."
Hubbard, Elbert on plays
This quotation can be viewed in the context of a book
"Intelligence without ambition is a bird without wings."
Danielson, C. Archie on ambition
9 fans of this quote
"The big print giveth, and the fine print taketh away."
Sheen, Fulton John on giving
"A successful marriage is an edifice that must be rebuilt every day."
Maurois, Andre on marriage
5 fans of this quote
"The best way to pay for a lovely moment is to enjoy it."
Bach, Richard on joy
7 fans of this quote
"In order to win, you must expect to win."
Bach, Richard on expectation
5 fans of this quote
"One must really have suffered oneself to help others."
Mother Teresa on suffering
12 fans of this quote
"Every writer creates his own precursors. His work modifies our conception of the past, as it will modify the future."
Borges, Jorge Luis on writers and writing
"The human brain is a wonderful organ. It starts to work as soon as you are born and doesn't stop until you get up to deliver a speech."
Jessel, George on mind
3 fans of this quote
"Marriage is a mistake every man should make."
Jessel, George on marriage
3 fans of this quote
"The biggest disease today is not leprosy or tuberculosis, but rather the feeling of being unwanted."
Mother Teresa on disease
7 fans of this quote
But wait... my book has more: prev 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 next
Debbie Coates's quote collection
I'm female and made my book on 27th July 2007.
My book as a pdf
My feed
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:33:46.000Z
|
5iy7molugpwqmz6gcpnxgdzyk6t6qqxt
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52638",
"uncompressed_offset": 183969908,
"url": "quotationsbook.com/quote/bookmark_users/8470/",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://quotationsbook.com/quote/bookmark_users/8470/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
I used to say: there is a God-shaped hole in me. For a long time I stressed the absence, the hole. Now I find it is the shape which has become more important. Rushdie, Salman
This quote is about conversion · Search on Google Books to find all references and sources for this quotation.
A bit about Rushdie, Salman ...
Salman Rushdie
These people bookmarked this quote:
• Nobody has bookmarked this quote yet.
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:33:30.000Z
|
dbbdthtc2ovmd3gppeumkdozwxcr3vg2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52639",
"uncompressed_offset": 183976140,
"url": "quotationsbook.com/quote/gift/5443/",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://quotationsbook.com/quote/gift/5443/"
}
|
cccc_CC-MAIN-2013-20
|
It's easy! Just pick the product you like and click-through to buy it from trusted partners of Quotations Book. We hope you like these personalized gifts as much as we do.
Make and then buy your OWN fantastic personalized gift from this quote
Caution is the confidential agent of selfishness. Wilson, Woodrow T.
Make a fabulous personalised bracelet or other form of jewellery with this quote
Click the banner below to pick the kind of jewellery you'd like ...
Choose something popular ...
Make a custom wrapped canvas ...
Make custom holiday cards ...
Make custom t-shirts ...
Make custom holiday gifts for boys ...
Make custom holiday gifts for girls ...
Make custom holiday gifts for men ...
A selection of more great products and gifts!
212 - The Extra Degree
The one extra degree makes the difference. This simple analogy reflects the ultimate definition of excellence. Because it's the one extra degree of effort, in business and life, that can separate the good from the great. This powerful book by S.L. Parker and Mac Anderson gives great examples, great quotes and great stories to illustrate the 212° concept. A warning - once you read it, it will be hard to forget. Your company will have a target for everything you do ... 212°
Click here to buy this »
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:44:13.000Z
|
3g55g7ba5rr4h3wyd5kn7jhwwxzkdvdd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52642",
"uncompressed_offset": 186940712,
"url": "rationalwiki.org/wiki/Template_talk:Communism",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://rationalwiki.org/wiki/Template_talk:Communism"
}
|
cccc_CC-MAIN-2013-20
|
Template talk:Communism
From RationalWiki
Jump to: navigation, search
.
[edit] New template proposal
Join the party!
Communism
Opiates for the masses
From each
To each
Just sayin'. I won't cry if it stays as it is. Much. -- DasRationalpersone (Annoy me!) 14:05, 18 November 2011 (UTC)
I can't see the difference. pathetic 14:25, 18 November 2011 (UTC)
"Join the party," instead of "Come the revolution, we will all be..." Acer Blue 14:27, 18 November 2011 (UTC)
"join the party", i think. and that's cute if he did. by the way, the reds don't match. Not sure why i noticed that, i suck at colors.GodotSome would use a tautology to describe it ("The way things are done around here is the wa 14:28, 18 November 2011 (UTC) (ec)
It was funny before. Now it's not. B♭maj7 (talk) Anachronistically anachronistic 14:29, 18 November 2011 (UTC)
Really? I never liked "we will all be communists." Acer Blue 14:30, 18 November 2011 (UTC)
You know B maj, you going over every single edit of mine and always saying "not funny" or "crappy writing" makes me think you hate me ... -- DasRationalpersone (Annoy me!) 14:41, 18 November 2011 (UTC)
I don't hate you at all. You're just not very funny and your writing is hard to read. That's all. B♭maj7 (talk) Anachronistically anachronistic 14:54, 18 November 2011 (UTC)
Good to know. But c'mon, "join the party?" That's classic, like "war never changes." -- DasRationalpersone (Annoy me!) 15:03, 18 November 2011 (UTC)
There's always my original... Acer Blue 14:31, 18 November 2011 (UTC)
Personal tools
Namespaces
Variants
Actions
Navigation
Community
Toolbox
support
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:00:33.000Z
|
zz374b5zdctk5lub4b7ljbfjqdvpkaie
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52643",
"uncompressed_offset": 192856358,
"url": "rocwiki.org/Coach_Sports_Bar",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://rocwiki.org/Coach_Sports_Bar"
}
|
cccc_CC-MAIN-2013-20
|
Coach Sports Bar
Info Map
Search:
Coach Front Entrance (5/2008) - Photo by Tricia Seymour
Location
19 W Main St, Webster NY, 14580
Hours (as of January 2009)
Daily: 11:00AM to 2:00AM
Phone
585 872 2910
Accessible
No
Alcohol
Yes
The Coach is a staple of Webster and has been around for many, many years. They have karaoke TVs and live acts at least on the weekends, if not during the week. It is much bigger inside than it seems from the outside, and includes a kitchen.
Comments:
Note: You must be logged in to add comments
2008-03-06 23:02:54 I realize this is a super-lame description of The Coach, but I've only been here twice so far, and I was beyond wasted both times. They play Sabres games and have live music. Drinks are cheap. It's a pretty cool place to go when you're broke and already drunk and enjoy dive-y "locals only" places. —CalebKelsey
2008-03-07 10:14:11 I go here frequently for lunch and sometimes after work for happy hour. The food is very good! Also after work they sometimes have really cheap drafts. There is alot of parking behind the bar. They serve free popcorn and sometimes free wings to bar patrons. —KimBee
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:32:46.000Z
|
633u4xtdnqd6jpyiumpzichmeiwakudo
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52669",
"uncompressed_offset": 219951339,
"url": "strategywiki.org/wiki/Grand_Theft_Auto:_San_Andreas/Gone_Courting",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://strategywiki.org/wiki/Grand_Theft_Auto:_San_Andreas/Gone_Courting"
}
|
cccc_CC-MAIN-2013-20
|
Grand Theft Auto: San Andreas/Gone Courting
From StrategyWiki, the video game walkthrough and strategy guide wiki
Jump to: navigation, search
Prerequisites
• Mission: First Base
• Location: Catalina's hideout, Fern Ridge, Red County
This is similar to First Date. Choose another mission from the list:
[edit] Rewards
None
Social networking
Personal tools
Namespaces
Variants
Views
Actions
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:39:47.000Z
|
jcqxmhprvpqzutd4oaci5hmqdfhypsau
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52673",
"uncompressed_offset": 222630678,
"url": "talk.maemo.org/showthread.php?t=5243",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://talk.maemo.org/showthread.php?t=5243"
}
|
cccc_CC-MAIN-2013-20
|
Administrator | Posts: 1,436 | Thanked: 3,135 times | Joined on Jul 2005
#1
After much delay, as suggested, we now have created three new forums:
• Newbie - Just purchased an Internet Tablet? Don't know anything about its operating system? Ask your questions here. No such thing as silly questions on this forum.
• Nokia N800 - General discussion on the Nokia N800 Internet Tablet.
• Nokia 770 - General discussion on the Nokia 770 Internet Tablet.
We have retained the General forum for general Internet Tablet discussions which are not model specific.
Thanks.
__________________
Reggie Suplido
Thread Tools Search this Thread
Search this Thread:
Advanced Search
Forum Jump
All times are GMT -4. The time now is 03:39 AM.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:19:21.000Z
|
6bcokrnxsnv4cfdt3654ltu6nlu6u77c
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52682",
"uncompressed_offset": 231452203,
"url": "thevaultofhorror.blogspot.com/2009/05/thirteen-most-badass-heroes-in-horror.html?showComment=1242351480000",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://thevaultofhorror.blogspot.com/2009/05/thirteen-most-badass-heroes-in-horror.html?showComment=1242351480000"
}
|
cccc_CC-MAIN-2013-20
|
"A REALLY INTELLIGENT INTERVIEWER." -- Lance Henriksen
"QUITE SIMPLY, THE BEST HORROR-THEMED BLOG ON THE NET." -- Joe Maddrey, Nightmares in Red White & Blue
**Find The Vault of Horror on Facebook and Twitter, or download the new mobile app!**
**Check out my other blogs, Standard of the Day, Proof of a Benevolent God and Lots of Pulp!**
Thursday, May 14, 2009
The Thirteen Most Badass Heroes in Horror
RayRay is back again, true believers, and this time I am bringing you my exclusive list of the 13 greatest horror movie heroes. Why thirteen? Why not? And thirteen is a pretty scary number, so I am going with it. Or maybe I couldn’t come up with 15. Whatever.
This list was inspired by B-Sol’s post a short while ago regarding his top ten favorite horror movies characters, and I realized that there was only one protagonist. Since then I have thought deeply about the subject of the protagonist, and realized there were too many. So I decided to go for the heroes.
In any event, I want all to know I do not think this list is exhaustive, and would like stir some discussion on the topic. I surely missed some great horror heroes, and want to hear about it.
Also, I want to let everyone know this list is not about the final girl, or last survivor, or the best scream queen. This list is reserved for characters that saw the evil with their own eyes and went out to confront it, and then did so in as badass a manner as humanly (or superhumanly) possible, and often paid the ultimate price for their heroism.
So, without any further delay:
13) Dr. Sam Loomis (Halloween, 1978, Halloween II, 1981)
Dr. Loomis, played by the wonderful Donald Pleasance, did it more with his brains rather than brawn. But he was also the only person to realize the depth of the evil in Myers, and realized he had to try to keep him locked away. When he realized that was impossible, he knew he had to confront his patient, and knew he had to pack heat to do so. And when it came to it, he also knew he had to sacrifice himself to do the deed. [After the sequel, the series sorta dumbed down a lot].
12) Alice (Resident Evil, 2002, etc.)
Milla’s Alice, one of the few heroes on the list that could do a swimsuit calendar, is one lady you don’t want to mess with. She deals with the chemically undead caused by the T-virus handily, never backing down. She is a bad broad, and as the series went onward, only got badder.
11) John Constantine (Constantine, 2005)
Maybe you hate Keanu, and maybe you didn’t think this was the best movie. But to be real, the man is accursed and condemned to Hell, yet in thrall to God, and still wrestles demons like hillbillies rassle ‘gators, and is one of the few humans that can tell Satan to shove it. Plus, the crucifix-come-shotgun is a badass weapon.
10) Hellboy (Hellboy, 2004)
Hellboy, played by Hollywood’s man in makeup, Ron Perlman, is a super, duper badass. He has it all: no looks, one good hand, and a Good Samaritan. Plus, he can speak to the dead. Being the son of Satan, yet fighting for the good guys has to wear on a guy’s psyche, but that has not stopped ol’ Red yet. Few of our heroes can deliver a snappy line while fighting creatures of Lovecraftian terror, like Samiel, The Desolate One.
9) Michael (Dawn of the Dead, 2004)
Michael, played by Jake Weber, is the Superego awash in Id at the Crossroads Shopping Mall. He keeps his cool, puts the other hormonally challenged males in their place, and quietly becomes the leader of the small band of survivors. He faces the horror of the situation without fear, and when his chips are cashed, he walks away from the table with a nary a complaint.
8) Dutch (Predator, 1987)
I am sure I will hear it that this is not really a horror movie, but if not, then neither is Godzilla. In any event, Dutch, one of Ahnold’s best played roles, is a super badass. First, he and his team dispose of an entire company of bad guys, and then, like little Indians, his squad is picked off. But does Dutch panic? No, he tells the little Commie girl to get to the chopper, and then takes care of business. Which is not a problem, except business is 7 feet tall and packs a small nuke. Just for surviving, Dutch makes the list.
7) Wray (Planet Terror, 2007)
Not only does Freddie Rodriguez’s Wray never miss, he makes his girl Cherry Darling into a walking zombie destroyer. But before she rules the wasteland, he has to take care of business, which includes taking out most of the zombies in Texas. Though his origins aren’t clear, what is is that Wray was an undercover agent and/or commando, and if killing was his business……
6) Clarice Starling (Silence of the Lambs, 1991)
Jodie Foster’s Starling is at once a delicate, pale West Virginian girl running from demons, and at the same time a vicious hellcat with a big brain. She not only figured out who he was, she single-handedly went after Buffalo Bill into his lair. Not for the faint of heart. And while she did get a little lucky that Bill was cocky, as they say: fortune favors the bold. And most importantly, she was the music to tame the most savage of hearts, that of the good doctor’s.
5) Professor Abraham Van Helsing (Bram Stoker’s Dracula, 1992)
Sir Anthony’s Van Helsing was, in my humble opinion, the version of the character played with the most vim and vigor. While stodgy and old, he was nonetheless the most knowledgeable of the vampire hunters, as well as the one who stiffened the others’ backbones for the hunt and kill of “wampyres…….nosferatu……” Not to mention he seemed to get a kick out of it, and the slaying of the blood sucking undead never seemed to bother his appetite for rare beef or strong, dark ales. My kind of guy!
4) Father’s Merrin & Karras (The Exorcist, 1973)
For this one there is a double bill. I could not decided which of Pazuzu’s nemeses to choose, so I went with both. Max von Sydow’s Merrin brought gravity and professorial steadiness, while Jason Miller’s Karras was devotional anger at the defilement of innocence. Both priests fought for the soul of young Regan, no matter what temporal torments, or whose voice, the demon threw at them. And in their single combats each paid the ultimate price for that little girl, but they succeeded.
3) Ash (Evil Dead I-II, Army of Darkness, 1992)
I know this is going to get me grief. Ash is only number 3?!! Sorry, kiddies, but at least he cracked this rarified air. Hey, if asswhippery were a religion, Ash would be the patron saint. He also gets points for introducing the phrase “pillow talk” to medieval Europe. But the man can’t remember 7 lousy syllables. However, he did lop off his own hand, and he can handle a rifle like few others. And he saved the world in both the 13th and 20th centuries, so he gets to be in the high pantheon. Plus, being the King of the One Liners makes him that much more awesome.
2) Ellen Ripley (Alien 1979, Aliens 1986, etc.)
Sigourney Weaver’s Ellen Ripley is the very first female action hero. She goes from junior officer on a doomed interstellar freighter to leading a bunch of badass space marines, to the savior of mankind. Not only does she tangle with one of the most fearsome creatures man ever encountered in the stars, she wins. And she only got angrier and more badass as the series went along, though the quality of the movies declined as an inverse proportion to her badassery. Notwithstanding, she took the Queen on, woman to woman, and it was no small feat to have defeated such an implacable, indefatigable foe. Especially one so pissed off.
1) R.J. McReady (The Thing, 1982)
Kurt Russell’s McReady, the surly, Scotch swilling, chess playing chopper pilot at
Outpost 31, is number 1 on this list. This may be controversial, but that’s why people do silly lists like this. McReady is number 1 because a) he faces what I consider to be the scariest monster of all time, b) he does it in the worst conditions I can think of, c) he rapidly realizes the gravity of the situation and does not lose his mind (unlike Blair, who does, or Fuchs, who commit suicide), and computes that this is a battle for the planet. He also gets that if they lose, humanity is gone. He takes control in a situation more suited to madness, never loses his cool, and is willing to pay the ultimate price from the word go. That, and he is handy with a flamethrower.
So there it is, true believers. I look forward to hearing from all the Vault Dwellers on how awesome I am for making this list. I hope you enjoy chewing it over as much as I enjoyed making it. Until next time……..
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:21:27.000Z
|
vysk3onsttrjwoguybijnsnuj32icpyr
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52703",
"uncompressed_offset": 253158260,
"url": "wikitravel.org/wiki/en/index.php?oldid=1907692&title=Hampton_%28Virginia%29",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=Hampton_(Virginia)&oldid=1907692"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Hampton (Virginia)
From Wikitravel
North America : United States of America : South : Virginia : Eastern Virginia : Hampton Roads : Hampton
Revision as of 00:03, 9 August 2012 by Eco84 (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
Hampton [1] is a city in Eastern Virginia.
[edit] Get in
[edit] By bus
Inter-city buses arrive and depart at the Hampton Transit Center, 2 W Pembroke Ave (at N King St).
[edit] Get around
[edit][add listing] See
[edit][add listing] Do
Virginia Air & Space Center - Besides having a number of aircraft and exhibits, it also has a IMAX Theater
[edit][add listing] Buy
[edit][add listing] Eat
• Brent's Fine Foods, 9 E Queensway, 757-722-1185, [4]. Cooked to order and made in house food including bread, salad dressings and desserts. edit
[edit][add listing] Drink
Downtown Hampton - During the summer months every Saturday night they close off Queen Street for "Block Party." With live bands, four bars, inflatables for children, beer trucks serving Bud, Bud Light, and Mich Ultra, and other interesting treats like Smirnoff Ice Slushies and Winearitas you can't lose!
Power Plant - The strange but memorable name given to the shopping center just down Pine Chapel Road, one block from the Coliseum. McFaddens, Saddle Ridge and Saddle Ridge's more live music oriented Cheyenne’s all share a block of store front right not to Cold Stone Creamery. Joe's Crab Shack and Lonestar Steakhouse and Saloon also rest in this shopping center if you wanted to grab a few drinks out with dinner before you head over to the bars. There are always plenty of taxi cabs and people to meet.
Tidemill Sports Bar - A little known hole in the wall (unless you're a local) karaoke and sports bar off of Armistead. Heading away from Mercury Blvd you pass the Hampton Roads Center Parkway on your left and it's in the next shopping center on your right. Plenty of parking and fun people. If you like pool, darts, or watching the game on a big screen - this is the place to be.
[edit][add listing] Sleep
• Crowne Plaza Hampton Marina, 700 Settlers Landing Rd, 757-727-9700, [5]. Recently-renovated accommodations on the waterfront. edit
• Embassy Suites Hampton, 1700 Coliseum Drive, 757-827-8200, [6]. A full-service hotel with 295 spacious two-room suites. edit
• Marriott Courtyard Hampton, 1917 Coliseum Drive, 757-838-3300, [7]. Walking distance of the new Hampton Roads Convention Center and Hampton Coliseum. edit
• Suburban Extended Stay Hotel, 1616 Hardy Cash Drive , Hampton, VA 23666, [8]. checkin: 3pm; checkout: 12pm. An extended stay hotel with well-equipped kitchens and weekly housekeeping services with free wi-fi Internet. edit
• Magnolia House Inn Bed and Breakfast (MagHouseHampton.com), 232 S. Armistead Ave (I-64 ( Exit 267 )), 757 722 2888, [9]. checkin: 3PM; checkout: 11AM. The historic Queen Anne Victorian has 3 guestrooms. edit
[edit] Get out
Routes through Hampton
RichmondNewport News W E NorfolkChesapeake
This article is an outline and needs more content. It has a template, but there is not enough information present. Please plunge forward and help it grow!
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
other sites
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:45:57.000Z
|
ctktmu75ljju2cnneblwvzm5zxrgrrt5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52714",
"uncompressed_offset": 261856807,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/allprimarymainfeatures/B7691A5B2E5683FDCA257571001048D4",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/allprimarymainfeatures/B7691A5B2E5683FDCA257571001048D4?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
5372.0.55.001 - International Merchandise Trade: Confidential Commodities List, Jan 2009
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 09/02/2009
Page tools: Print Page Print All RSS Search this Product
PREFACE
This document details all import and export commodities which have been subject to confidentiality restrictions since 1 January 1988. The data cube containing the details of the confidentialisation is referred to as the Confidential Commodities List (CCL).
The CCL is available from the Downloads tab of this document. The data cube presents information under the following four headings:
• changes and new restrictions to import items in the current month
• changes and new restrictions to export items in the current month
• all import restrictions from January 1988 to the current month
• all export restrictions from January 1988 to the current month.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:49:38.000Z
|
lpfkvac7wkixsikepgjqt3zzm74kh7h4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52715",
"uncompressed_offset": 261863879,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/mediareleasesbyReleaseDate/B6A97A6E4855A211CA256F3800800250",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/mediareleasesbyReleaseDate/B6A97A6E4855A211CA256F3800800250?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
5495.0 - Australian Outward Foreign Affiliates Trade, 2002-03
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 26/10/2004
Page tools: Print Page Print All RSS Search this Product
Foreign businesses affiliated with Australian resident businesses generated $142.3 billion (b) in sales revenue for goods and services in 2002-03, according to new globalisation figures released today by the Australian Bureau of Statistics (ABS).
Australian businesses had 4,012 foreign affiliates that employed 321,924 staff.
Manufacturing was the dominant industry of foreign affiliates, with sales revenue of $36.7b (26% of total sales revenue) and employing 120,368 staff (37% of total employment).
Foreign affiliates residing in New Zealand, the United Kingdom and the United States of America together accounted for more than 50% of all key measures of foreign affiliate trade activity, including:
• number of foreign affiliates
• employment and wages/ salaries of foreign affiliates
• sales and purchases of goods and services.
Foreign affiliates operated in similar industries to those of their Australian parent. They also were primarily established to service the markets where they resided, with around 90% of sales revenue for goods and services in the host country of the foreign affiliate.
This release is part of an ABS initiative to improve globalisation statistics for Australia.
Further information is available in the new publication Survey of Outward Foreign Affiliates Trade, experimental results, 2002-03 (cat. no. 5495.0).
Media Note: A foreign affiliate is an overseas business that is more than 50% owned by an Australian resident enterprise. This includes offshore subsidiaries, branches and majority-owned foreign joint ventures.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:33:50.000Z
|
orbwilx7m6u7qudic35jcdkn4jzynk3f
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52716",
"uncompressed_offset": 261871461,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/ProductsbyReleaseDate/10EFC7E141A0FE59CA2570B600186A20",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/ProductsbyReleaseDate/10EFC7E141A0FE59CA2570B600186A20?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
4103.0 - Population Survey Monitor, Nov 2000
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 01/02/2001 Ceased
Page tools: Print Page Print All RSS Search this Product
• About this Release
ABOUT THIS RELEASE
Presents statistics from an omnibus household survey which collects data on a wide and varied range of topics each quarter. Topics to date have included sport and recreation participation, computer usage, consumer expectations, housing issues, satisfaction with police services and data on a variety of health issues.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:50:34.000Z
|
5xzuyembf7w74o6m57g7lp7mg5dhmahb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52722",
"uncompressed_offset": 306247227,
"url": "www.biomedcentral.com/1471-2164/13/99",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.biomedcentral.com/1471-2164/13/99"
}
|
cccc_CC-MAIN-2013-20
|
Research article
A new RNASeq-based reference transcriptome for sugar beet and its application in transcriptome-scale analysis of vernalization and gibberellin responses
Effie S Mutasa-Göttgens1,4*, Anagha Joshi2, Helen F Holmes1, Peter Hedden3 and Berthold Göttgens2*
Author Affiliations
1 Rothamsted Research-Broom's Barn, Department of Applied Crop Science, Higham, Bury St Edmunds, Suffolk IP26 6NP, UK
2 University of Cambridge, CIMR, Hills Road, Cambridge CB2 0XY, UK
3 Rothamsted Research, Department of Plant Science, Harpenden, Herts AL5 2JQ, UK
4 School of Life Sciences, University of Hertfordshire, Hatfield, Herts AL10 9AB, UK
For all author emails, please log on.
BMC Genomics 2012, 13:99 doi:10.1186/1471-2164-13-99
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2164/13/99
Received:27 November 2011
Accepted:19 March 2012
Published:19 March 2012
© 2012 Mutasa-Göttgens et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
Sugar beet (Beta vulgaris sp. vulgaris) crops account for about 30% of world sugar. Sugar yield is compromised by reproductive growth hence crops must remain vegetative until harvest. Prolonged exposure to cold temperature (vernalization) in the range 6°C to 12°C induces reproductive growth, leading to bolting (rapid elongation of the main stem) and flowering. Spring cultivation of crops in cool temperate climates makes them vulnerable to vernalization and hence bolting, which is initiated in the apical shoot meristem in processes involving interaction between gibberellin (GA) hormones and vernalization. The underlying mechanisms are unknown and genome scale next generation sequencing approaches now offer comprehensive strategies to investigate them; enabling the identification of novel targets for bolting control in sugar beet crops. In this study, we demonstrate the application of an mRNA-Seq based strategy for this purpose.
Results
There is no sugar beet reference genome, or public expression array platforms. We therefore used RNA-Seq to generate the first reference transcriptome. We next performed digital gene expression profiling using shoot apex mRNA from two sugar beet cultivars with and without applied GA, and also a vernalized cultivar with and without applied GA. Subsequent bioinformatics analyses identified transcriptional changes associated with genotypic difference and experimental treatments. Analysis of expression profiles in response to vernalization and GA treatment suggested previously unsuspected roles for a RAV1-like AP2/B3 domain protein in vernalization and efflux transporters in the GA response.
Conclusions
Next generation RNA-Seq enabled the generation of the first reference transcriptome for sugar beet and the study of global transcriptional responses in the shoot apex to vernalization and GA treatment, without the need for a reference genome or established array platforms. Comprehensive bioinformatic analysis identified transcriptional programmes associated with different sugar beet genotypes as well as biological treatments; thus providing important new opportunities for basic scientists and sugar beet breeders. Transcriptome-scale identification of agronomically important traits as used in this study should be widely applicable to all crop plants where genomic resources are limiting.
Background
Sugar beet crops account for about 30% of world sugar production and are important in Europe, North America, and increasingly in Asia, South America and North Africa. In temperate climates, sugar beet is grown as a spring crop, whereas in warmer climates, such as in the Californian Imperial Valley, it is grown as a winter crop having been sown in the autumn. There is increasing interest in developing winter crop varieties for cultivation in the cooler temperate regions. It is estimated that extending the growing season by autumn sowing in these regions could result in at least a 26% yield advantage [1], offering opportunities for additional applications for sugar beet as a sustainable feedstock for bio-fermentation processes. A key breeding target for both autumn and spring sown crops is the suppression of cold temperature induced stem elongation (bolting) and flowering (reproductive growth) during the growing season. This is because, in sugar beet crops, prolonged exposure to cold temperatures in the range 6°C to 12°C [2], a process known as vernalization, is obligatory for the induction of reproductive growth, which requires that the plants must first bolt and then flower. An incidence of one premature bolting plant per square metre in the field can cause a 12% loss in root sugar yield [3]. Improved knowledge of the vernalization mechanism is widely regarded as an important prerequisite for the identification of new breeding targets. Currently, the key breeding strategy is to select against the early bolting gene B [4], thereby maintaining the biennial habit so that crops remain vegetative as long as temperatures do not become vernalizing during the growing season.
Attempts to find alternative breeding targets are largely reliant on reverse genetics approaches, whereby putative sugar beet flowering genes are identified based on homology with counterparts of the Arabidopsis model. This has uncovered several factors [5,6], including some which have been shown to affect vernalization responses [7]. The role of gibberellins (GAs) has also been examined and it has been demonstrated that there is an interaction between vernalization and GA-dependent bolting responses although the underlying mechanisms are not known [8]. A picture is beginning to emerge for gene regulatory networks in sugar beet, in which genes homologous by sequence and protein function to their Arabidopsis counterparts are not necessarily conserved with respect to their developmental roles [5,7]. It is therefore important to study vernalization directly in sugar beet in order to gain new mechanistic insight. Comprehensive transcriptome-scale analysis of sugar beet is complicated by the fact that there is no reference genome and also no commercial array platforms for expression profiling. The only public resource for sugar beet gene sequences is the sugar beet plant gene index database of EST collections at http://compbio.dfci.harvard.edu/cgi-bin/tgi/gimain.pl?gudb=beet webcite. Recent breakthroughs in next generation sequencing technology and data analysis suggest that it is now possible to generate a reference transcriptome in the absence of a reference genome [9], and then to use this reference transcriptome to perform comparative expression profiling by methods such as digital gene expression profiling. This novel technology therefore offers exciting new opportunities to crop geneticists who hitherto had to rely on a handful of model plant species for transcriptome-scale studies. The physiological characteristics of these species are often very different from the crop under investigation, thus, making them less than ideal model systems.
Here, we report a transcriptome-scale analysis of the transcriptional programs in sugar beet plants subjected to either vernalization, GA treatment or a combination of both. The analysis was restricted to the shoot apex, which includes apical meristematic tissues within which the developmental transitions leading to flowering are known to occur [10]. We therefore isolated shoot apices by micro dissection from appropriately treated plants and subsequently extracted total RNA for mRNA sequencing. We selected the next generation HiSeq2000 technology platform, with the intention of (i) constructing an assembly of our shoot apex transcriptome; (ii) conducting a digital expression profile analysis of transcripts in each sample; (iii) mapping the expressed transcripts back to our reference transcriptome and (iv) gaining insight into the potential key candidates underlying vernalization and GA-dependent responses in sugar beet. In addition to gaining knowledge of new sugar beet genes, we also expected to conduct an assessment of our strategy as a method for transcriptome-scale analyses of agronomically important traits in sugar beet, as an example of the potential for application in other crop plants.
Results
Sample generation and sampling strategy for analysis of vernalization-induced and GA-dependent gene expression in shoot apices
Sugar beet plants are out-breeding, with a tendency to suppress self-compatibility and therefore are naturally highly variable at the population level. This makes it difficult to interpret genetic data unless the experimental populations are fixed to some extent. The level of genetic variability can be reduced by selecting lines that are generated through single seed decent. To achieve this, we first selected C600 lines of the genotype bb, lacking the early bolting gene B and therefore unable to bolt without prior vernalization. These lines are considered to carry the late bolting gene Lb-lb [11] which is known to be linked to the monogerm character [12]. Siblings from one of these C600 bb lines were grown to maturity, vernalized for 18 wks and scored for bolting and flowering time. Sibling plants which bolted and flowered within 1-2 days of each other and designated C600 MB1-7; C600 MB1-13 and C600 MB1-35 were inter-crossed to provide bulk seed for our experiment. This bulked seed lot, designated C600 MB1 SibA, was then used to raise plant material for the experiment described here. In our hands, the generation time of biennial plants can be reduced to 1 year by artificial vernalization, in a controlled environment chamber, without compromising seed quality and quantity. Thus it took just over 2.5 yrs (including seed maturation/drying) to generate material suitable for our experiment. A second bb genotype, Roberta, a proprietary commercial cultivar was included in our experiment. We could then evaluate and quantify differences and/or similarities between our experimental line and commercial varieties, which are normally generated as hybrids of 3 different genetic backgrounds, combined in 2-way crosses between F1 cytoplasmic male sterile plants and a pollinator line [13].
It is generally accepted that vernalization alters meristem competence to flower [14] and, in sugar beet evidence exists to suggest that vernalization signals are perceived in the leaves [15]. Further, our previous studies (unpublished) have indicated that vernalization-dependent GA-induced developmental processes leading to reproductive growth appear to be localized to the apical shoot meristematic tissues. The role of GA in floral regulatory networks is well established [16] and has been demonstrated for bolting and flowering in sugar beet [8,17]. To perform transcriptome-scale analysis of associated changes in gene expression, we harvested between 30-50 plants per treatment and micro-dissected apical tissues (Figure 1B), under the stereo microscope. A total of 184 apices were used in this experiment, distributed amongst the treatments as indicated (Figure 1A). Dissections were carried out ensuring that as much of the vascular and leaf tissues as possible were removed, whilst taking care to retain the meristem (Figure 1B iv). Following total RNA extraction, in-house quality assurance was carried out by first ensuring that there was no genomic DNA contamination. This was achieved by conducting a no-RT endpoint PCR reaction targeted at the housekeeping BvEF1a gene, using primers: L1: GATTCCCACCAAGCCTATGG and R1: GATGACACCAACAGCGACAG, optimised at 150 nM and 60°C. Next, the integrity of the RNA samples was confirmed on a standard denaturing formaldehyde RNA gel and by BvEF1a RT-PCR. Minimum 30 μg aliquots of total RNA for each treatment were then sent for custom sequencing prior to which the samples were quality controlled further by the service provider.
Figure 1. Experiment overview and sampled tissues. A) Different sugar beet genotypes C600 and Roberta (Rob) were kept in short days (8 h photoperiod) and treated with GA4, added by pipette directly to the shoot apex without having been vernalized (/+GA) or after having been vernalized at 6°C for 18 weeks (/vern + GA). Shoot apices were pooled from individual plants prior to RNA isolation to allow sufficient material for robust RNA purification. The total number of apices analysed/treatment is indicated, as are the final yield of total RNA. The RNA-Seq method used required a minimum of 30 μg of total RNA/sample. B) The picture shows a typical example of the developmental stage and condition of plants when sampled - i) view of plants in the growth chamber with the GA-treated plants in the background marked with wooden canes; ii) a close up of the shoot tip, arrow; iii) example of plant apices as harvested; ii) typical example of the shoot apex after dissection, next to a ruler with 1 mm divisions.
A sugar beet reference transcriptome generated by mRNA-sequencing
Digital gene expression (DGE) profiling using next generation sequencing depends on a reference transcriptome, which was not available for sugar beet prior to this study. Pooled total RNA from all six samples was therefore used to generate a normalised cDNA library which was then sequenced using the Illumina HiSeq2000 platform (100 bp single read module - see Figure 2A). The application of short reads is now significantly improved by the increase in read length to 100 bp, such that it now provides high throughput and good value for money and is therefore commonly used for de novo transcriptome assemblies in non-model species [18-20]. Here, this generated a total of 6.6 Gb of sugar beet transcript sequences. De novo assembly using the software tool Velvet/Oases [21] and http://www.ebi.ac.uk/~zerbino/oases/ webcite, yielded a total of 225,385 unique transcripts which corresponded to 165,742 unique loci. The assembly software tools were chosen because of their previous application for the assembly of similar RNA -seq data sets [19]. In this first pass assembly, the N50 value for all loci was 1185 bp and for large transcript loci, 1573. A BLAST search of the assembly against itself revealed that there was no redundancy although we found that 250 of the 17,186 unique entries (as of 17 March 2011 update) in the public sugar beet EST database (EST-DB) hosted at http://compbio.dfci.harvard.edu/cgi-bin/tgi/gimain.pl?gudb=beet webcite mapped to more than 1 of the large transcript loci. To verify our assembly further, we performed a second pass assembly using Minimus [22], which gave an assembly with an N50 value of 1678 bp. In contrast to the Velvet/Oases assembly, a significant proportion of these "doubly assembled" loci mapped to multiple Arabidopsis peptide sequences, thus suggesting that the Minimus assembly comes at the potential cost of over-merging, a feature that has been previously reported for peas [23]. We therefore elected to use the Velvet/Oases assembly in order to retain maximum information for subsequent analysis. The Minimus assembly output is however freely available (Additional file 1). Since there is as yet no consensus on the single best algorithm for sequence assembly [24,25], we have made our raw data (Accession ID ERP000947 in the European Sequencing Archive at EBI) freely available to the scientific community for reassessment as new tools come on line. In the meantime, our Velvet/Oases assembly is also available in Additional file 2.
Figure 2. Overview of the reference transcriptome sequencing, and result of the Velvet/Oases assembly. A) RNA for the reference was pooled from all of the test samples. The Illumina HiSeq2000 platform was used to generate data for de novo assembly including large transcripts (LT) equivalent to 15,493 potential protein coding sequences. B) The accuracy and integrity of the assembly was assessed by BLAST comparison (100 bp overlap and ≥ 98% sequence identity) with the publicly available collection of sugar beet ESTs at the Sugar Beet Gene Index (SBGI), hosted at the Dana Farber Cancer Institute (DFCI).
Additional file 1. Minimus second pass assembly output data.
Format: ZIP Size: 5.8MB Download file
Additional file 2. Sugar beet shoot apex transcriptome assembly- Illumina 100 bp reads. Generated from C600 and Roberta Genotypes with and without vernalisation and/or applied GA.
Format: ZIP Size: 19.8MB Download file
In order to focus subsequent analysis on those transcripts/loci most likely to correspond to protein coding genes, we also determined the number of large transcripts (> 0.5 kb) which, in our de novo assembly would have required at least 6 independent 100 bp reads. We identified a total of 53,175 large transcripts, in the size range 0.5 to 8.729 kb, corresponding to 15,493 loci and hence putative protein coding sequences. To further substantiate our hypothesis that these were coding sequences, we explored the overlap between our de novo assembled loci and "large transcript loci" with the sugar beet EST-DB (as above), largely identified by conventional Sanger sequencing of EST collections from different sugar beet tissues. BLAST sequence similarity searches [26,27] set to a stringency of 100 bp overlap and 98% sequence identity of all 17,186 sugar beet EST-DB entries against all our 15,493 large transcript loci identified 7,925 loci common to both (Figure 2B), that is 46% of all the unigene ESTs currently in the public sugar beet EST-DB. This overlap rose to 12,810 unigene EST sequences, equivalent to 75% of the sugar beet EST-DB entries, following a comprehensive BLAST analysis with all our 165,742 shoot apex transcriptome loci.
Taken together, this analysis demonstrates a significant overlap of our new transcriptome with the existing sugar beet EST database. Moreover, the 7,568 large transcript loci with no matches in the current sugar beet EST-DB (Figure 2B) represent potential candidates of previously unknown (novel) sugar beet genes although, the possibility that some of these sequences may be the result of mis-assembly cannot be overlooked. Finally, our finding that 4,376 unigene ESTs in the existing public sugar beet database have no corresponding matches in our transcriptome is not unexpected since the public EST database is assembled from a wider range of tissue sources and experimental conditions, in contrast to the single source of shoot apices used in the current study. We elected not to perform a full-scale amalgamation of our transcriptome with the public EST database and to instead provide our database as a uniquely defined resource for vernalized and GA-treated shoot apices. In this way, it is more readily available to both breeders and academics with a specific interest in gene discoveries associated with the induction of reproductive growth in sugar beet. To facilitate such exploitation of our dataset further, we have mapped all loci to the Arabidopsis proteome by BLASTX alignment (cut off 1 × 10-10) with the 27,416 peptide sequences in the TAIR database (version TAIR10), and have made these data freely available (see Additional file 3).
Additional file 3. Annotation of the sugar beet shoot apex reference transcriptome. All loci were mapped to the Arabidopsis proteome (version TAIR10 database) by BLASTX comparison with a cut off E-value of 1 × 10-10.
Format: ZIP Size: 8.3MB Download file
Digital gene expression profiling enables transcriptome-scale analysis of shoot meristem transcriptional programmes in sugar beet
Having generated a sugar beet shoot meristem reference transcriptome, our next goal was to perform quantitative comparisons of the transcriptional programmes in shoot apices with respect to vernalization and/or GA treatment. We also aimed to investigate the potential impact of genotypic differences. To achieve this, un-normalised cDNA libraries were generated from subsamples of the same RNA as originally used to generate the reference and extracted from apices of the genotypes C600 variously treated with vernalization and GA, and, non-vernalized Roberta, variously treated with GA. A total of six independent libraries consisting of C600/untreated (sample A); C600/GA treated (sample B); Roberta/untreated (sample C); Roberta/GA treated (sample D); C600/vernalized (sample E) and C600/vernalized and GA treated (sample F), as shown in Figure 1A, were sequenced using the Illumina HiSeq2000 50 bp single read module. For each library/sample, the total number of counts for each sequencing read were determined and the reads were mapped back to our newly established reference transcriptome using Bowtie software [28]. Mapping programs continue to evolve [29,30] hence, we are mindful of the fact that slightly different results may be obtained with alternative mappers. Nevertheless, in this study, between 13.786 million and 20.360 million uniquely mappable reads, representing between 71% - 77% of total reads, were obtained from the six libraries (Figure 3A) thus, providing good coverage for the differential expression profiling.
Figure 3. Global analysis of digital gene expression profiles. A) The total number of reads that were mapped back to the reference transcriptome, together with unmapped reads, for each genotype and the sample codes designated to each treatment. B) Hierarchical clustering of digital gene expression profiles for samples shown in A) reveals a major influence of genotype on global gene expression levels. Pearson correlation coefficients were calculated for all pairwise comparisons, and displayed as a heatmap following unsupervised clustering. C) Principle component analysis of digital gene expression matrix (see methods). Principal components 1 and 2 separate samples based on genotype. D) Principle component analysis displaying components 2 and 3 which separate the vernalized and non-vernalized C600 samples. E) Principle components 5 and 6 separate samples based on GA treatment (A/C vs. B/D and E vs. F).
We next generated a matrix containing the tag counts for each locus in each of the six samples and to reduce bias due to the slight variation in sequencing depths between samples (Figure 3A), for each sample, the tag count as a ratio of the total number of mappable reads was multiplied by 10 million, thus normalizing the values to tag counts per 10 million mappable reads. To perform the subsequent global comparative analysis, only the loci with a tag count ≥ 10 in at least 1 sample were retained. This resulted in a 7-column matrix (Locus ID plus tag counts for six samples) with 23,460 rows being equivalent to the total number of loci with a tag count ≥ 10 in at least 1 sample (Additional file 4). Analysis of this matrix by hierarchical clustering based on Pearson correlation coefficients showed high correlation (0.91 - 0.99) between all 6 samples, consistent with their shared tissue origin (Figure 3B). Within this, the biggest separation was observed for the two Roberta samples, suggesting that genotype had a greater overall impact on the global transcriptome than either GA or vernalization (Figure 3B). To further explore the impact of genotype, vernalization and GA treatment on shoot apex transcriptional programmes, we next analysed our 6 digital gene expression profiles by principal component analysis (PCA). In agreement with hierarchical clustering, a PCA plot based on principal components 1 and 2 resulted in a separation based on genotype (Figure 3C). However, a PCA plot based on principal components 2 and 3 showed a clear separation on the 3rd component (Y-axis) between the non-vernalized and vernalized C600 samples A, B and E, F respectively (Figure 3D). Moreover, principal component 5 further separated the non-vernalized samples (irrespective of genotype), according to GA treatment (samples A, C and B, D) while principal component 6 clearly separated the vernalized C600 samples (E, F) according to GA treatment (Figure 3E). Taken together therefore, transcriptome-scale analysis of the digital gene expression profiles suggested that transcriptional responses to treatment can be revealed from the data generated here. Our data also revealed a major impact of genotype on shoot apex transcriptional programmes. This is important because vernalization and GA treatment induce reproductive growth [8]. Currently, it is generally accepted that response to these inductive treatments is affected by genotype although it is not clear how. The data reported in this study provide a platform for future experimentation to reveal the molecular basis of genetic components that influence bolting and flowering.
Additional file 4. DGE tag count matrix for all loci. Normalized DGE profile tag counts for all loci with a count of 10 in at least one of the test samples.
Format: XLS Size: 3.1MB Download file
This file can be viewed with: Microsoft Excel Viewer
Characterisation of genotype-driven expression differences in sugar beet shoot apex transcriptomes
Having identified genotype as the main factor determining transcriptional variation in our 6 datasets, we next set out to determine a gene set that showed high confidence expression differences between C600 and Roberta genotypes. To achieve this, we took advantage of the fact that our analysis included 4 × C600 and 2 × Roberta samples, which allowed us to determine statistical confidence scores for any potential expression differences driven by the 2 genotypes. In other words, we were able to exclude the additional variability due to treatment, thus enabling the assignment of higher statistical significance to those genotype-driven expression differences that are not also affected by GA treatment or vernalization.
As shown in Figure 4A, most loci fall on or close to the horizontal intersecting the Y-axis at zero when plotting the average expression scores in the C600 versus Roberta genotype. However, 4,880 loci showed differential expression at a p-value < 0.01 which corresponds to 21% of the 23,460 loci analysed. When the same analysis was repeated for the large transcript loci, 1,966 were differentially expressed at p-value < 0.01, corresponding to 15% of the 13,107 large transcript loci with an expression tag count ≥ 10 in at least 1 sample (Figure 4B). A bias towards C600 was observed in the differentially expressed loci which we suspect may have been a reflection of the higher number of C600 samples in our analysis. Collectively, the analyses performed here clearly demonstrate that the transcriptome datasets generated for the current study enable the global identification of genotype-specific expression differences. All differentially expressed gene loci presented in Figure 4 are listed in Additional file 5.
Figure 4. MA plots to show transcriptome-scale difference in genotype-dependent gene expression for loci with a normalized cut off of ≥ 10 tags in at least 1 test sample. A) Expression of all 23,460 loci in C600 versus Roberta genotype, of which 4,880 were differentially expressed as indicated. Expression values (normalised tag counts) were plotted on a log scale, so that the difference in expression is M = log2R - log2G and the average expression is A = 1/2 × (log2R + log2G); where R = C600 and G = Rob. B) Expression of all 13,125 large loci (> 500 bp with a tag count of > 10 in at least 1 sample) in C600 versus Roberta of which 1966 were differentially expressed as indicated.
Additional file 5. Differentially expressed loci for C600 vs Roberta genotypes.
Format: XLS Size: 699KB Download file
This file can be viewed with: Microsoft Excel Viewer
Transcriptome-scale characterisation of the transcriptional response to GA and vernalization
Having demonstrated that the transcriptome data generated for the current study allowed for the identification of genotype-specific differences in transcriptional programmes, we next explored whether the comparison of untreated shoot apices with GA-treated and vernalized samples would allow us to define responses to these two treatments at the transcriptome-scale. Comparisons were conducted only in the C600 genotype because it had the complete set of treatments. To this end, we performed BLAST searches against our reference transcriptome using cDNA sequences from putative sugar beet candidate regulators of bolting and flowering originally cloned in-house and/or identified by in silico BLAST searches of the sugar beet EST sequences in public databases (Sugar Beet Gene Index at http://compbio.dfci.harvard.edu/cgi-bin/tgi/gimain.pl?gudb=beet webcite and GenBank) using known sequences from the Arabidopsis model. Of particular interest were GA metabolism genes, and apical shoot meristem identity genes expected respectively to participate in stem elongation (bolting) and to indicate the transition to flowering [10,16]. The expression profiles of matching gene loci with at least 100 bp overlap and ≥ 98% sequence identity were selected and then interrogated against our DGE dataset. This revealed that a greater change in expression profiles occurred in response to vernalization than to applied GA. Amongst the GA metabolic genes, we found that BvGA20ox1 (GenBank: DQ864510.1), which mapped to our Locus 24372, was up-regulated by vernalization, with a ~2-fold increase in expression in vernalized C600 apices (Figure 5A). Amongst the meristem identity genes, our data revealed the up-regulation of a MADS domain protein, which mapped to Locus 6819 with strong homology to FRUITFUL-like sequences (e.g. the sugar beet GeneBank: BQ584677 - BLASTN p value = 4.6 × 10-107 and spinach GenBank: ACE75945.2 - BLASTX p value = 1 × 10-102). Locus 6819 maps to the Arabidopsis APETALA 1 gene (TAIR: AT1G69120.1, BLASTX p value = 2 × 10-70) although it does not show significant similarity to the sugar beet cDNA recently deposited at GenBank, labelled AP1 (GenBank: HQ454504.1). MADs domain transcription factors like APETALA1 are, in dicotyledonous plants, generally associated with floral organ development and therefore downstream of the floral transition [31].
Figure 5. Expression profiles of functionally annotated and novel genes in the sugar beet shoot apex. A) Up-regulation of BvGA20ox1 (Locus 24372; DQ864510.1) in vernalized C600 samples. The normalised (per 10 million reads) DGE profile tag counts were 8 (sample A), 2 (sample B), 19 (sample E) and 16 (sample F). B) Up-regulation of BvRAVL1-like (locus 29609) in vernalized C600 samples. The normalised (per 10 million reads) DGE profile tag counts were 147 (sample A), 55 (sample B), 474 (sample E) and 1410 (sample F). C) Plot to show all loci (blue lines) that are positively correlated (p > 0.95) with BvRAV1-like (red line) and up-regulated by vernalization in C600 samples. D) Plot to show all loci (blue lines) that are negatively correlated (p > 0.95) with BvRAV1-like (red line) and down-regulated by vernalization. A = Sample C600; B = Sample C600/+GA; E = Sample C600/vern; F = Sample C600/vern + GA. Expression was relative to the mean of all samples.
To interrogate vernalization responses further, we used our DGE profile matrix to rank transcripts according to expression levels in vernalized apices. We selected only those transcripts that were expressed in both non-vernalized and vernalized samples and discovered that a RAV1 (Related to ABA-insensitive 3/viviparous1) homologue, mapping to Locus 29609, now designated BvRAV1-like was, after Locus 6819, the most highly up-regulated transcript by vernalization. BLASTX analysis of this BvRAV1-like Locus 29609 showed that it contained 49% sequence identity to the Arabidopsis RAV1 (GeneBank: Gene ID 837886) over 256 amino acids and 66% similarity, with an E-value of 4 × 10-68 (Additional file 6: Figure S1A). This was further substantiated by in silico conserved protein domain analysis, which revealed that this sugar beet homologue contained the characteristic AP2/B3 domains respectively at N- and C-terminal positions (Additional file 6 Figure S1B) as found in RAV1 [32]. The AP2/B3 domain proteins are known to bind DNA in a sequence specific manner [32] and although the function of RAV1 is not known, it is generally recognised as having a repressive effect on plant growth and development, including flowering [33]. In Arabidopsis, RAV1 transcripts are known to be immediately (within 1 hr) up-regulated on exposure to cold temperature [34], and are thought to play an important role in the cold stress response pathway, most likely as a component of the CBF regulon [35]. To the best of our knowledge, RAV1 has not until now been associated with vernalization responses. Here, we show for the first time that BvRAV1-like was stably up-regulated (2.5-fold) in vernalized apices (Figure 5B Sample E vs. Sample A), a response that is enhanced (~3-fold) in response to applied GA (Figure 5B Sample F vs. Sample E). In the absence of vernalization, our data indicate that BvRAV1-like was down-regulated by GA (Figure 5B Sample B vs. Sample A).
Additional file 6. Supplementary Figure 1. BvRAV1-like/AtRAV1 alignment and BvRAV1-like conserved protein domains.
Format: PPT Size: 113KB Download file
This file can be viewed with: Microsoft PowerPoint Viewer
BvRAV1-like expression is negatively correlated with genes associated with cold responses and reproductive growth
We next used our DGE matrix to identify all gene loci whose expression profiles across our C600 samples either positively or negatively correlated with BvRAV1-like (see Figure 5C and 5D, respectively). For a p-value > 0.95, 732 genes showed positive correlation, and 34 genes showed negative correlation (all gene sets are listed in Additional file 7), thus demonstrating that this approach can readily identify gene sets with highly correlated expression profiles. Given that BvRAV1-like encodes a putative repressive transcription factor, with a negative regulatory role on flowering [33], we suspected that amongst the correlated genes may be candidates with recognised functions in reproductive growth, including some which may be direct targets of BvRAV1. To test this, we analysed the smaller negatively correlated 34 gene set by first mapping each of the 34 transcripts to the Arabidopsis proteome, to identify homologous gene loci and selected those with E-value scores of 1 × 10 -10 or less. A total of 20 transcripts satisfied this criterion as indicated in Table 1 and were further analysed by proxy, using the best matched Arabidopsis gene locus IDs to conduct Gene Ontology (GO), Plant Ontology (PO) and network analysis using AraNet [36], to enable inference of putative gene function and regulatory networks. A total of 18 out of 21 (including BvRAV1) of the Arabidopsis gene homologues were present in the AraNet database and as indicated in Table 2 the associated GO terms, by collective analysis of the gene set, were enriched for plant terms including some that we considered to be consistent with reproductive growth (e.g. as for AT4G2600, LOB, RAV1) and plant development (e.g. as for AT5G14450-lipid metabolism; AT1G68830-starch metabolism; LTP4; AT1G16070-transcriptional regulation; AT3G58690-protein modification) as well as hormone responses (MYB30; AT2G45640-abscisic acid response). This was supported further by GO analysis of the 20 query genes negatively correlated with the BvRAV1-like homologue, in combination with the top 200 associated new candidate genes revealed by AraNet. In this case, the 39 PO enriched terms included at least 13 developmental processes that could be directly associated with reproductive growth (see Table 3). Next, we conducted more specific GO analysis of individual query loci, based on inferences from direct assays, mutant phenotype, genetic interaction, physical interaction, expression patterns and traceable author statement. This enabled the assignment of putative gene functions based on network neighbours. Consequently, (as indicated in Additional file 8) we found that loci such as AT3G58690, AT4G25720, for which there was previously no functional information (from the gene set analysis - Table 2), may also be involved in processes associated with reproductive growth including regulation of meristem organisation, primary shoot apical meristem specification and flower development; while AT1G56580 is associated with GA biosynthesis, signalling and cell growth. Full details of enriched GO terms by inference from network neighbours for each of the 18 genes are given in Additional file 8 which also shows the 6 (out of 3,063) generally enriched (p < 0.05) GO terms (out of 3,063) and the 57 (out of 5,048) enriched (p < 0.05) InterPro Domains for the 20 query genes and their associated new candidates from AraNet.
Additional file 7. List of gene loci that are positively and negatively correlated with BvRAV1-like at a probability of p > 0.95.
Format: XLS Size: 63KB Download file
This file can be viewed with: Microsoft Excel Viewer
Table 1. BvRAV1-like transcript locus together with associated negatively regulated transcript locus IDs together with their best matched homologous Arabidopsis gene loci and their annotations
Table 2. Gene ontology terms enriched for the 18 gene set validated for analysis using AraNet
Table 3. Plant ontology terms enriched for 20 query genes (excluding RAV1) and top 200 new candidates revealed in AraNet.
Additional file 8. Gene Ontology and InterPro Domain enrichment analyses. For genes that are negatively correlated with BvRAV1 together with their associated candidates as revealed by network analysis using AraNet.
Format: XLS Size: 100KB Download file
This file can be viewed with: Microsoft Excel Viewer
Network analysis revealed that 10 of the 18 genes in the AraNet database were highly connected within extended regulatory networks, the largest of which included 7 query genes, connected as shown in Figure 6. The unknown gene locus AT5G19300 was the central node, with links to loci broadly involved with translation, rRNA biogenesis and assembly, protein modification, signalling, hormone and cold responses. A gene involved in reproductive organogenesis encoding the WD40 domain protein SLOW WALKER1 (SWA1), which is known to mediate mitotic cell division during female gametogenesis [37] was also directly connected to this central AT5G19300 node. A branch of the network extending to AT4G25720 (Figure 6A) included well established floral transcription factors such as the retinoblastoma-associated protein FVE which regulates flowering time [38]; and the PHD-type transcription factor MALE STERILITY1 (MS1), which regulates pollen and tapetum development [39]. A second extension of the network converged on AT4G26000 (Figure 6B), known to be associated with GO plant terms for gynoecium and shoot development (Table 2 & Additional file 8), while others converged on AT2G45640 largely associated with GO plant terms for cold and hormone regulated responses and including histone modification affecting traits such as juvenility, apical dominance and floral organ development (Table 2 & Additional file 8) and as supported by the presence of HISTONE DEACETYLASE1 (HD1) [40] in this branch of the network (Figure 6C). Of note, histone methylation has also recently been demonstrated to play a role in vernalization induced bolting in sugar beet [41].
Figure 6. Prediction of the extended regulatory network of genes that are negatively correlated with BvRAV1-like. The network was based on analysis of homologous Arabidopsis proteins and constructed using AraNet at http://www.functionalnet.org/aranet webcite Red nodes are unknown, yellow nodes are associated with reproductive growth; grey node is associated with protein modification; dark blue node with histone modification and the light blue node with hormonal signalling. White nodes with red outline represent loci of known genes with GO terms associated with processes including cold regulated biosynthesis (MTO3); amino acid/protein transport (PEX7, CAT9); translation, rRNA processing/biogenesis (EIF3C, IMP4, HD1, NRPA2, APG3, NAP570; ethylene induced biosynthesis (SAM1) embryonic development leading to seed dormancy (ARP1, RPE) and cell wall biogenesis (DGL1). MTO3 = Methionin Over-Accumulator 3; PEX7 = Peroxin 7; CAT9 = Cationic amino Acid Transporter 9; EIF3C = Eukaryotic translation initiation Factor 3 C; HD1 = Histone Deacetylase 1; NRPA2 = DNA binding/DNA-directed RNA polymerase/ribonucleoside binding; APG3 = Albino and Pale Green; SAM1 = S-Adenosylmethionine Synthetase 1; ARP1 = Arabidopsis Ribosomal Protein 1, RPE = Ribulose Phospate 3-Epimerase; DGL1 = dolichyl-diphosphooligosaccharide-protein glycotransferase.
Responses to GA are not highly dynamic in the GA treated apices
None of our candidate genes revealed highly dynamic differences in response to GA treatment. Therefore, we interrogated our dataset for all those gene loci that displayed similar expression levels across all three non-GA treated samples (C600; C600/vern and Roberta), and at the same time, at least a 2-fold increase in expression following the application of GA. These loci were therefore expected to represent those genes whose expression reflects a generalised response to GA treatment, irrespective of the genetic background. This analysis identified 19 gene loci with robust GA-induction under all three experimental conditions (see Figure 7), thus demonstrating the utility of our DGE dataset for the identification of gene sets of interest without the need to have any prior candidate gene information.
Figure 7. Expression profiles of genes with robust GA induction under all experimental conditions. All loci that are consistently up-regulated by GA and displaying similar expression profiles across all 6 samples. A = Sample C600; B = Sample C600/+GA; C = Sample Roberta; D = Sample Roberts/+GA; E = Sample C600/vern; F = Sample C600/vern + GA.
Results of BLASTX searches with these GA-induced genes are given in Table 4, showing that amongst the sugar beet transcripts with significant matches to known genes were included an acetoacetyl-CoA thiolase (Locus 12027), a GA-regulated gene (Locus 30091); and 3 genes encoding efflux-type pumps of the ATP-binding cassette (ABC) transporter (Locus 43376), and multidrug and toxin extrusion (MATE; Locus 54049) families of proteins. Two genes (Locus 39283 and Locus 6420) had weaker homologies with known counterparts but were nevertheless interesting in that protein kinases (e.g. Locus 39283) may have roles in GA-dependent signalling, whilst arabinogalactan proteins (e.g. Locus 6420), are known to have a role in apical cell expansion in the moss Physcomitrella patens [42]; in the acceleration of elongation in Arabidopsis root meristems [43] and, one GA-induced protein is known to participate in stem elongation [44]. Just over half (12/19) of the GA-induced genes are unknown, amongst which only 1 (Locus 10708), had a significant BLASTX hit to an unidentified Vitis vinifera protein. Interestingly, both the sugar beet and V. vinifera genes encode proteins containing a Mediator complex subunit 27 (Med27) super family conserved domain. Med27 proteins are well recognised co-factors that mediate the association of transcription factors with the basal transcriptional machinery to modulate the activity of RNA polymerase II [45,46].
Table 4. Table to show the list of loci up-regulated by GA application, together with predicted annotations based on BLASTX hits in public databases
Data access
All raw sequencing data have been submitted to the European sequencing archive at the European Bioinformatics Institute under accession number EBI: ERP000947. In addition, a number of supplementary data files are attached to this manuscript including the transcriptome assembly used for the analysis presented above (Additional file 2), the digital gene expression profiling table (Additional file 4) and files containing the data plotted in Figures 4 and 5 (Additional files 5 and 7). To enhance utility of the transcriptome data generated within this paper, we have generated two Additional files. The first one (Additional file 1) contains the results of further processing of our transcriptome assembly and was generated using the Minimus assembly tool [22]. As such, it represents a consolidation of the transcripts into a smaller number of overall contigs and may therefore be particularly useful for the identification of near full length transcripts. As with all RNA-Seq assemblies, careful case-by-case evaluation of transcripts will be advisable given the possibility that highly related genes may have been inadvertently merged [47], a particular concern given the substantial expansion of gene families commonly seen in crop plants [48,49]. The final file (Additional file 3) contains a complete mapping of our transcripts to the Arabidopsis proteome, as a searchable tab delimited file. This file will be particularly useful for the sugar beet research community as it provides streamlined access to primary sugar beet mRNA sequences that correspond to a given Arabidopsis protein.
Discussion
The application of next generation sequencing technology to RNA/cDNA sequencing (RNA-Seq) provides a rapid and cost-effective way to obtain large amounts of transcriptome data for any type of biological sample for which reasonable amounts of RNA can be extracted. One important consequence of these developments is that transcriptome-scale investigations, which were hitherto limited to a small range of model organisms, can now be employed much more widely. This includes the study of agronomically important crop plants. Here, we have used RNA-Seq to generate the first shoot apex transcriptome for sugar beet, and to study the transcriptional response to vernalization and GA treatment at the transcriptome-scale.
Within the field of RNA-Seq, the development of new sequencing platforms as well as bioinformatic tools for reference assembly and mapping is an area of active investigation with constant development of new sequencing technology and data processing algorithms. Consequently there is as yet no definitive consensus on a single best approach. The application of short reads is well proven in other non-model systems [18-20] and we expect may become the method of choice, as it currently provides the best value for money. Nevertheless, it is likely that future algorithm development will improve upon current sequence assembly tools for the assembly of transcriptome data from 100 bp reads. It may indeed be that one day; a gold standard will be established. Since all our data are publicly accessible, we hope that they may be helpful in contributing towards that goal, and in any case will be available for re-analysis by the wider scientific community.
A sugar beet reference transcriptome generated by RNA-seq
As for many other agronomically important crop plants, the development of genomics resources for sugar beet has lagged far behind model organisms, with no public reference genome or expression array platforms reported to date. However, the compilation of a sugar beet gene index from a variety of EST collections such as those generated by [50-53], has provided a valuable resource. It was therefore necessary to benchmark the RNA-Seq-derived transcriptome generated here against this existing sugar beet gene index. This analysis revealed several important points:
i) Approximately 75% of the 17,186 unigene ESTs in the sugar beet gene index had a counterpart in our RNA-Seq transcriptome. This demonstrated that a large proportion of genes previously defined using traditional sequencing technologies were recovered in our RNA-Seq based study.
ii) 25% of previously known sugar beet unigene ESTs were not recovered which may be indicative of our tissue type and/or conditions to which the plants were subjected. Further, RNA-Seq based studies of additional sugar beet tissues are likely to increase the proportion of ESTs recovered by RNA-Seq.
iii) We identified 7,468 large transcript loci with no counterparts in the sugar beet gene index collection. Since these loci contain transcripts assembled from at least 6 independent 100 bp reads, extending over a minimum of 500 bp of mRNA sequence, the majority of these loci can be expected to represent bona fide protein-encoding mRNA. Notwithstanding the possibility that some of these loci could be the result of mis-assemblies, our data may now have expanded the total known gene count of sugar beet by up to 40%. Such an enlarged gene count will not only facilitate future efforts to assemble a sugar beet reference at the genome level, but also represents an immediately exploitable resource for gene discovery by both basic scientists and the sugar beet breeding community. The original data sets may be accessed in the sequence read archive (SRA) database at EBI under study accession number EBI: ERP000947.
As a general resource to the wider sugar beet community, the reference transcriptome described here is limited by having been generated not from the whole plant but from a single tissue type and under specified treatments and conditions. As a resource, it is therefore most suited to the analysis of reproductive developmental transitions in the shoot apex and hence for applications in genetic crop improvement for bolting and flowering time control. It is widely recognised that Illumina HiSeq technology can generate a significant amount of reads that are difficult to incorporate in the final assembly with currently available bioinformatics tools (~23%-29% with our samples). This suggests that our assembly could improve further as new tools come on line.
Digital gene expression profiling is a powerful tool for new gene discovery & functional annotation
Reverse genetic-based approaches for the identification of gene candidates associated with key agronomic traits in crop plants are useful and informative. However, they may be encumbered by the need for transgenic analyses in crop plants, some of which may be recalcitrant to transformation. Expression assays of target genes may also be limited by the ability to design suitable qRT-PCR primers. Here, we have demonstrated the utility of next generation sequencing-based DGE profiling, not only as a tool for screening known gene candidates, but also for selectively identifying genes that are directly regulated by specified cues. For example, a MADS box transcription factor was revealed to be strongly up-regulated by vernalization. This was unexpected, since in dicotyledonous plants, MADS box transcription factors examined so far are repressors of floral induction that are known to be down-regulated by vernalization, as exemplified by FLC [14,54]. Nevertheless, we cannot discount the possibility that MADS box proteins may have a different role in sugar beet, indeed, in the shoot apex transcriptome, we found that the sugar beet FLC homologue, (BvFL1 -[55]) is not down-regulated by vernalization (data not shown). Further, the discovery that transcripts which encode an AP2/B3 BvRAV1-like protein are strongly up-regulated by vernalization, now establish a role for a member of this protein family in vernalization responses for the first time. In the vernalized sugar beet apex transcriptome, we identified at least 14 other transcripts encoding AP2/B3 domain proteins (data not shown), none of which were similarly up-regulated by vernalization. The distinctive behaviour of BvRAV1-like therefore suggests a different role in vernalization which may extend beyond the generalized role in cold stress responses as for AtRAV1 [34,35,56]. Transcriptome-scale analysis also enabled inference of putative gene functions of co-regulated transcripts, providing further support of a role for BvRAV1 in vernalization-induced reproductive growth processes in sugar beet. Thus, although the type of network analysis based on inference from co-regulated genes as described for BvRAV1 may be regarded as speculative, it nevertheless provides a rapid and comprehensive approach to candidate gene discovery. Hence, our discovery of BvRAV1 as a likely regulator of vernalization provides an attractive new hypothesis, which certainly will require further experimental validation, but nevertheless already adds an interesting new dimension to the identification of novel breeding targets for the sugar beet crop.
Another powerful application of DGE data, in cases such as that described here where expression array platforms and reference genomes are not available, is the ability to selectively identify, at the transcriptome-scale, those genes that behave in a specified manner under given conditions. Thus, we discovered 19 sugar beet genes that are directly up-regulated at least 2-fold by GA treatment of shoot apices. Although our analysis was conducted in a manner expected to reveal genes whose expression patterns would represent a general response to GA treatment, we cannot exclude the possibility that a different set of genes might be revealed in experiments with alternative genotypes. Nevertheless, for the genes discovered here, amongst the 8 genes that we putatively annotated using BLASTX, four appear to be consistent with the expected physiological effect of applied GA. For example, the added GA is well in excess of normal physiological levels hence, we might speculate that an immediate response of the plant may be to actively remove the excess GA. Here, we found that two of the GA-induced genes are predicted to have efflux pump associated functions, as represented by the ABC transporter and MATE family protein genes [57,58]. The unknown Med27 domain protein gene is also plausible since GA participates in the hormonal orchestration of transcriptional regulation. It is therefore encouraging to find that one of the GA-responses in the sugar beet shoot apex appears to involve the up-regulation of a protein with strong similarity to a well characterised family of co-transcription factors. Detailed analysis of the remaining, as yet unknown genes will, in future, reveal new insight into the molecular basis of GA-dependent bolting and flowering mechanisms in sugar beet.
Conclusions
Here, we have shown that next-generation sequencing technology permits quantitative analysis of gene expression in sugar beet, at the level of the whole transcriptome, without the need for a reference genome or established array platforms. Comprehensive bioinformatic analysis identified transcriptional programmes associated with different genotype as well as biological treatments; thus, providing a wealth of new opportunities for both basic scientists and sugar beet breeders. In addition to applications for addressing basic biological questions, as described in this manuscript, next generation reference transcriptomes will also be very useful for the assembly of the anticipated crop reference genomes.
We believe that our approach is widely applicable to other crop species and will be ideally suited to the study of key agronomic traits which, in future, will certainly be driven by the food security agenda. The demonstrated ability to generate robust reference transcriptome assemblies and digital gene expression profiling, coupled with the decreasing costs of next generation sequencing technologies, will make this method ever more accessible. Indeed, it may become the routine workhorse for a systems-based approach in those crops where publicly available genomic resources are limited. Specifically for the sugar beet crop, this manuscript lays the foundation for future detailed analysis of bolting mechanisms at the molecular level.
Methods
Plants
C600 MB1 sibA plants were raised from seeds generated in-house from a sibling cross whose original biennial parent was propagated by single seed decent from a line that was segregating for vernalization requirement. Genotype at the bolting locus (B-gene) was confirmed using a PCR marker as previously described [8]. The original C600 lines were a kind gift from Bob Lewellen, (Plant Geneticist, USDA ARS, Salinas, California - now retired), and are closely related to the previously described C600 line, PI 520748 [59].
Roberta is our lab standard commercial sugar beet cultivar, which in common with most commercial genotypes, is a combination of 3 genetic backgrounds and has an obligate requirement for vernalization. Although this is a legacy cultivar it is representative of current European varieties and is kindly maintained and provided to us by Gunter Diener at KWS SAAT AG, Einbeck, Germany.
Plant growth and cultivation
Plants were grown and vernalized as previously described [6] except that photoperiod was set to 8 h light and they were vernalized for 21 weeks. Non-vernalized plants were chronologically younger than vernalized plants but considered to be at the same developmental stage as determined by the number of fully expanded leaves at apex harvest. During the experiment, plants were kept in a controlled environment room at 22°C, under short day (SD) conditions (8 h light) in light intensities of ~285 μmol m-2 s-1 of photosynthetically active radiation (PAR).
GA4 application, apex harvest and RNA extraction
GA treatment started at 5 weeks post vernalization and was continued for two weeks immediately prior to the harvest date. In this case, GA4 was applied to plant shoot apices (10 μL of 200 μM stock) on alternate days and always at 7.5-8 h after lights came on, being the time since the environmental cue (ZEITGEBER (ZT); in this case light) that sets the circadian clock is expressed, entraining biological and hence expression rhythms in the plants. Figure 1B i) - iii) shows the appearance of plants immediately prior to harvest, which was carried out consistently at 4 hours after the lights came on (ZT4), by harvesting plant shoot apices (Figure 1B iii)) into 50-mL Falcon tubes, and keeping them cool on ice until the shoot apices were dissected out as indicated (Figure 1B iv), while taking care to remove all leaf and vascular tissues as visualised under the stereo dissection microscope. Dissected apices were transferred to RNALater and stored at 4°C until total RNA was extracted using the Qiagen Plant RNAeasy Kit. Apex tissues were disrupted using ceramic beads in the Bertin Technologies Precellys 24 Lysis & Homoginization machine (supplied by Stretton Scientific Ltd, UK), and the Qiagen RLT buffer was selected for RNA extraction. The RNA was DNAse treated with Ambion DNA-free™ DNase Treatment and quantified using the NanoDrop 2000/2000c (Thermo Fisher) machine.
mRNA sequencing and cDNA de novo assembly
To create a reference sequence, aliquots of total RNA (~5 μg) from each sample (Figure 1A) were pooled and used to create a custom normalised cDNA library which was sequenced by Illumina HiSeq2000 (100 bp single read module) and processed for assembly into contigs and loci using the software tools Velvet/Oases (v1.04 and v0.1.21 respectively). Sequencing and assembly were provided as a custom service by Eurofins MWG GmbH, Ebersberg, Germany. A schematic of the process is shown in Figure 2A. To evaluate the selected assembly tools further, the reads were re-assembled in-house, using Minimus [22].
Digital gene expression profiling and mapping to reference
cDNA libraries generated from sub-samples of each test sample were sequenced (Illumina HiSeq2000, 50 bp single read module). Reads for each sequence tag were counted and mapped back to the reference using the software tool Bowtie [28]. cDNA library construction, sequencing DGE profiling and mapping back to the reference transcriptome as above were carried out as a custom service by Eurofins MWG GmbH. The outsourcing of these tasks, to highly experienced and reputable service providers, and in particular library construction, is recommended to reduce the risk of potential technical problems which may introduce bias in the final data sets.
Validation of the reference assembly
Reference transcripts assembled from the 6.6 Gb of total reads from the pooled cDNA samples were validated by direct comparison with EST sequences in the sugar beet gene index data base at http://compbio.dfci.harvard.edu/cgi-bin/tgi/gimain.pl?gudb=beet webcite using BLAST, set to a stringency of 100 bp overlap and ≥ 98% sequence identity. Further validation was obtained by comparison with peptide sequences in the Arabidopsis TAIR database (version TAIR10), using BLAST and an E-value cut off of 1 × 10-10. These analyses were carried out in-house.
Analysis of expression profiles in experimental samples
A matrix was generated with tag counts for each locus in each sample, and normalised to counts per 10 million reads [(reads/total reads per sample) × 10 million]. Only those loci with tag counts of 10 or above in at least one experimental sample were retained for further analysis. All correlation analyses, hierarchical clustering and principal component analysis were performed using Matlab http://www.mathworks.com webcite. This was carried out in-house.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
ESM-G conceived and designed the study; carried out experiments and wrote the manuscript. AJ carried out the bioinformatics and statistical analyses and contributed to writing the manuscript. HFH carried out experiments and contributed to writing the manuscript. PH contributed to the conception and design of the study and to writing the manuscript. BG directed and contributed to the bioinformatics and statistical analyses and to writing the manuscript. All authors read and approved the final manuscript
Acknowledgements
We thank the referees for their thorough review of our manuscript and assisting us in providing additional data resources to the wider scientific community. We thank Tinashe Chiurugwi for a critical review of our manuscript, Kevin Sawford and Andrea Jennings for technical assistance. Anagha Joshi is the recipient of an EMBO Long Term Fellowship. This research was funded by the British Beet Research Organisation (BBRO) using facilities funded by the Biotechnology and Biological Sciences Research Council (BBSRC). The authors declare that they have no competing interests.
References
1. Jaggard KW, Werker AR: An evaluation of the potential benefits and costs of autumn-sown sugarbeet in NW Europe.
J Agric Sci 1999, 132:91-102. Publisher Full Text
2. Milford GFJ, Jarvis PJ, Walters C: A vernalization-intensity model to predict bolting in sugar beet.
Journal of Agricultural Science 2010.
doi:10.1017/S0021859609990323
3. Longden PC: Effects of Increasing Weed-Beet Density on Sugar-Beet Yield and Quality.
Ann Appl Biol 1989, 114(3):527-532. Publisher Full Text
4. Abegg FA: A genetic factor for the annual habit in b eets and linkage relationships.
J Agric Res 1936, 53:493-511.
5. Abou-Elwafa SF, Büttner B, Chia T, Schulze-Buxloh G, Hohmann U, Mutasa-Göttgens ES, Jung C, Müller AE: Conservation and divergence of autonomous pathway genes in the flowering regulatory network of Beta vulgaris.
J Exp Bot 2011, 62(10):3359-3374. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
6. Chia TY, Muller A, Jung C, Mutasa-Gottgens ES: Sugar beet contains a large CONSTANS-LIKE gene family including a CO homologue that is independent of the early-bolting (B) gene locus.
J Exp Bot 2008, 59(10):2735-2748. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
7. Pin PA, Benlloch R, Bonnet D, Wremerth-Weich E, Kraft T, Gielen JJ, Nilsson O: An antagonistic pair of FT homologs mediates the control of flowering time in sugar beet.
Science 2010, 330(6009):1397-1400. PubMed Abstract | Publisher Full Text
8. Mutasa-Göttgens ES, Qi A, Zhang W, Schulze-Buxloh G, Jennings A, Hohmann W, Müller AE, Hedden P: Bolting and flowering control in sugar beet: Relationships and effects of gibberellin, the bolting gene B and vernalization.
AoB Plants 2010.
doi: 10.1093/aobpla/plq012
9. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, Adiconis X, Fan L, Raychowdhury R, Zeng Q, et al.: Full-length transcriptome assembly from RNA-Seq data without a reference genome.
Nat Biotechnol 2011, 29(7):644-652. PubMed Abstract | Publisher Full Text
10. Blazquez MA, Ferrandiz C, Madueno F, Parcy F: How floral meristems are built.
Plant Mol Biol 2006, 60(6):855-870. PubMed Abstract | Publisher Full Text
11. Shavrukov YN: Localization of New Monogerm and Late-bolting Genes in Sugarbeet using RFLP Markers.
J Sugar Beet Research 2000, 37(4):107-115. Publisher Full Text
12. Savitsky VF: Genetic study of monogerm and multigerm characters in beets.
Proceedings of the American Society of Sugar Beet Technologists 1952, 7:331-338.
13. Bosemark NO: Genetics and Breeding. In Sugar Beet. Edited by Draycott AP. Oxford: Blackwell Publishing Ltd; 2006:50-83.
14. Searle I, He Y, Turck F, Vincent C, Fornara F, Krober S, Amasino RA, Coupland G: The transcription factor FLC confers a flowering response to vernalization by repressing meristem competence and systemic signaling in Arabidopsis.
Genes Dev 2006, 20(7):898-912. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
15. Crosthwaite SK, Jenkins GI: The Role of Leaves in the Perception of Vernalizing Temperatures in Sugar-Beet.
J Exp Bot 1993, 44(261):801-806.
16. Mutasa-Gottgens E, Hedden P: Gibberellin as a factor in floral regulatory networks.
J Exp Bot 2009, 60(7):1979-1989. PubMed Abstract | Publisher Full Text
17. Mutasa-Gottgens E, Qi A, Mathews A, Thomas S, Phillips A, Hedden P: Modification of gibberellin signalling (metabolism & signal transduction) in sugar beet: analysis of potential targets for crop improvement.
Transgenic Res 2009, 18(2):301-308. PubMed Abstract | Publisher Full Text
18. Garg R, Patel RK, Tyagi AK, Jain M: De novo assembly of chickpea transcriptome using short reads for gene discovery and marker identification.
DNA research: int j rapid publ rep genes genomes 2011, 18(1):53-63.
19. Jager M, Ott CE, Grunhagen J, Hecht J, Schell H, Mundlos S, Duda GN, Robinson PN, Lienau J: Composite transcriptome assembly of RNA-seq data in a sheep model for delayed bone healing.
BMC Genomics 2011, 12:158. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
20. Mizrachi E, Hefer CA, Ranik M, Joubert F, Myburg AA: De novo assembled expressed gene catalog of a fast-growing Eucalyptus tree produced by Illumina mRNA-Seq.
BMC Genomics 2010, 11:681. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
21. Zerbino DR: Using the Velvet de novo assembler for short-read sequencing technologies.
Curr Protoc Bioinformatics 2010., Chapter 11:
Unit 11 15
22. Sommer DD, Delcher AL, Salzberg SL, Pop M: Minimus: a fast, lightweight genome assembler.
BMC Bioinformatics 2007, 8:64. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
23. Franssen SU, Shrestha RP, Brautigam A, Bornberg-Bauer E, Weber AP: Comprehensive transcriptome analysis of the highly complex Pisum sativum genome using next generation sequencing.
BMC Genomics 2011, 12:227. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
24. Rizk G, Lavenier D: GASSST: global alignment short sequence search tool.
Bioinformatics 2010, 26(20):2534-2540. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
25. Miller JR, Koren S, Sutton G: Assembly algorithms for next-generation sequencing data.
Genomics 2010, 95(6):315-327. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
26. Altschul SF, Koonin EV: Iterated profile searches with PSI-BLAST-a tool for discovery in protein databases.
Trends Biochem Sci 1998, 23(11):444-447. PubMed Abstract | Publisher Full Text
27. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res 1997, 25(17):3389-3402. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
28. Langmead B: Aligning short sequencing reads with Bowtie.
Curr Protoc Bioinformatics 2010., Chapter 11:
Unit 11 17
29. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, Proc GPD: The Sequence Alignment/Map format and SAMtools.
Bioinformatics 2009, 25(16):2078-2079. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
30. Zhang Z, Lin H, Ma B: ZOOM Lite: next-generation sequencing data mapping and visualization software.
Nucleic Acids Research 2010, (38 Web Server):W743-748.
31. Parcy F: Flowering: a time for integration.
Int J Dev Biol 2005, 49(5-6):585-593. PubMed Abstract | Publisher Full Text
32. Swaminathan K, Peterson K, Jack T: The plant B3 superfamily.
Trends Plant Sci 2008, 13(12):647-655. PubMed Abstract | Publisher Full Text
33. Hu YX, Wang YX, Liu XF, Li JY: Arabidopsis RAV1 is down-regulated by brassinosteroid and may act as a negative regulator during plant development.
Cell Res 2004, 14(1):8-15. PubMed Abstract | Publisher Full Text
34. Fowler S, Thomashow MF: Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway.
Plant Cell 2002, 14(8):1675-1690. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
35. Vogel JT, Zarka DG, Van Buskirk HA, Fowler SG, Thomashow MF: Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature transcriptome of Arabidopsis.
The Plant journal: for cell and molecular biology 2005, 41(2):195-211.
36. Lee I, Ambaru B, Thakkar P, Marcotte EM, Rhee SY: Rational association of genes with traits using a genome-scale gene network for Arabidopsis thaliana.
Nat Biotechnol 2010, 28(2):149-156. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
37. Shi DQ, Liu J, Xiang YH, Ye D, Sundaresan V, Yang WC: SLOW WALKER1, essential for gametogenesis in Arabidopsis, encodes a WD40 protein involved in 18S ribosomal RNA biogenesis.
Plant Cell 2005, 17(8):2340-2354. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
38. Ausin I, Alonso-Blanco C, Jarillo JA, Ruiz-Garcia L, Martinez-Zapater JM: Regulation of flowering time by FVE, a retinoblastoma-associated protein.
Nat Genet 2004, 36(2):162-166. PubMed Abstract | Publisher Full Text
39. Ito T, Nagata N, Yoshiba Y, Ohme-Takagi M, Ma H, Shinozaki K: Arabidopsis MALE STERILITY1 encodes a PHD-type transcription factor and regulates pollen and tapetum development.
Plant Cell 2007, 19(11):3549-3562. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
40. Tian L, Chen ZJ: Blocking histone deacetylation in Arabidopsis induces pleiotropic effects on plant gene regulation and development.
Proc Natl Acad Sci USA 2001, 98(1):200-205. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
41. Trap-Gentil MV, Hebrard C, Lafon-Placette C, Delaunay A, Hagege D, Joseph C, Brignolas F, Lefebvre M, Barnes S, Maury S: Time course and amplitude of DNA methylation in the shoot apical meristem are critical points for bolting induction in sugar beet and bolting tolerance between genotypes.
J Exp Bot 2011, 62(8):2585-2597. PubMed Abstract | Publisher Full Text
42. Lee KJ, Sakata Y, Mau SL, Pettolino F, Bacic A, Quatrano RS, Knight CD, Knox JP: Arabinogalactan proteins are required for apical cell extension in the moss Physcomitrella patens.
Plant Cell 2005, 17(11):3051-3065. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
43. McCartney L, Steele-King CG, Jordan E, Knox JP: Cell wall pectic (1- > 4)-beta-d-galactan marks the acceleration of cell elongation in the Arabidopsis seedling root meristem.
Plant J 2003, 33(3):447-454. PubMed Abstract | Publisher Full Text
44. Park MH, Suzuki Y, Chono M, Knox JP, Yamaguchi I: CsAGP1, a gibberellin-responsive gene from cucumber hypocotyls, encodes a classical arabinogalactan protein and is involved in stem elongation.
Plant Physiol 2003, 131(3):1450-1459. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
45. Malik S, Roeder RG: Dynamic regulation of pol II transcription by the mammalian Mediator complex.
Trends Biochem Sci 2005, 30(5):256-263. PubMed Abstract | Publisher Full Text
46. Bourbon HM, Aguilera A, Ansari AZ, Asturias FJ, Berk AJ, Bjorklund S, Blackwell TK, Borggrefe T, Carey M, Carlson M, et al.: A unified nomenclature for protein subunits of mediator complexes linking transcriptional regulators to RNA polymerase II.
Mol Cell 2004, 14(5):553-557. PubMed Abstract | Publisher Full Text
47. Martin J, Bruno VM, Fang Z, Meng X, Blow M, Zhang T, Sherlock G, Snyder M, Wang Z: Rnnotator: an automated de novo transcriptome assembly pipeline from stranded RNA-Seq reads.
BMC Genomics 2010, 11:663. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
48. Zhang M, Wu YH, Lee MK, Liu YH, Rong Y, Santos TS, Wu C, Xie F, Nelson RL, Zhang HB: Numbers of genes in the NBS and RLK families vary by more than four-fold within a plant species and are regulated by multiple factors.
Nucleic Acids Res 2010, 38(19):6513-6525. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
49. Li J, Ding J, Zhang W, Zhang Y, Tang P, Chen JQ, Tian D, Yang S: Unique evolutionary pattern of numbers of gramineous NBS-LRR genes.
Molecular genetics and genomics: MGG 2010, 283(5):427-438. PubMed Abstract | Publisher Full Text
50. Schneider K, Kulosa D, Soerensen TR, Mohring S, Heine M, Durstewitz G, Polley A, Weber E, Lein J, et al.: Analysis of DNA polymorphisms in sugar beet (Beta vulgaris L.) and development of an SNP-based map of expressed genes.
Theor Appl Genet 2007, 115(5):601-615. PubMed Abstract | Publisher Full Text
51. Bellin D, Schulz B, Soerensen TR, Salamini F, Schneider K: Transcript profiles at different growth stages and tap-root zones identify correlated developmental and metabolic pathways of sugar beet.
J Exp Bot 2007, 58(3):699-715. PubMed Abstract | Publisher Full Text
52. Reyes BG, Myers SJ, McGrath JM: Differential induction of glyoxylate cycle enzymes by stress as a marker for seedling vigor in sugar beet (Beta vulgaris).
Mol Genet Genomics 2003, 269(5):692-698. PubMed Abstract | Publisher Full Text
53. Trebbi D, McGrath JM: Functional differentiation of the sugar beet root system as indicator of developmental phase change.
Physiol Plant 2009, 135(1):84-97. PubMed Abstract | Publisher Full Text
54. Sheldon CC, Rouse DT, Finnegan EJ, Peacock WJ, Dennis ES: The molecular basis of vernalization: the central role of FLOWERING LOCUS C (FLC).
Proc Natl Acad Sci USA 2000, 97(7):3753-3758. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
55. Reeves PA, He Y, Schmitz RJ, Amasino RM, Panella LW, Richards C: Evolutionary conservation of the FLC mediated vernalization response: evidence from the sugar beet (Beta vulgaris).
Genetics 2006, 176(1):295-307. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
56. Jan N, Andrabi KI: Cold resistance in plants: A mystery unresolved.
Electron J Biotechn 2009., 12(3):
doi:10.2225/vol12-issue3-fulltext-3
57. Omote H, Hiasa M, Matsumoto T, Otsuka M, Moriyama Y: The MATE proteins as fundamental transporters of metabolic and xenobiotic organic cations.
Trends Pharmacol Sci 2006, 27(11):587-593. PubMed Abstract | Publisher Full Text
58. Rees DC, Johnson E, Lewinson O: ABC transporters: the power to change.
Nat Rev Mol Cell Biol 2009, 10(3):218-227. PubMed Abstract | Publisher Full Text | PubMed Central Full Text
59. Lewellen RT: Regulation of cytoplasmic male sterile sugar beet germplasm C600 CMS.
c 1989, 29:246.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:53:11.000Z
|
skxbfi7nvim4ajaj3ihi3m3yvoxlnzxo
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52723",
"uncompressed_offset": 307588675,
"url": "www.bizsugar.com/Taxes/are-you-overlooking-these-8-tax-deductions/",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.bizsugar.com/Taxes/are-you-overlooking-these-8-tax-deductions/"
}
|
cccc_CC-MAIN-2013-20
|
Are You Overlooking these 8 Tax Deductions?
Posted by MMarquit under Taxes
From http://personaldividends.com 856 days ago
Made Hot by: maplesummit on January 13, 2011 7:35 pm
Don't overlook these 8 tax deductions that could reduce your tax liability. You might find that you don't owe as much after all.
Subscribe
Frederique Murphy: BizSugar Contributor of the Week
Frederique Murphy has wanted to have her own business since she was 11 years old. Back then she was given a … More
Editor's Picks
Got small business blog posts? Register and submit them today!
Shazam! Meet Contributor of the Week Paul Cox...Congrats, Paul!
See if you're one of our Top 10 Members this week!
Add BizSugar buttons and plugins to your small biz toolkit!
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:49:24.000Z
|
xoap2eiafgyprmn35k6zkx5vnh3ipfln
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52727",
"uncompressed_offset": 329143008,
"url": "www.ccsenet.org/journal/index.php/ijc/article/view/6883",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.ccsenet.org/journal/index.php/ijc/article/view/6883"
}
|
cccc_CC-MAIN-2013-20
|
Retention Profile of Selenium (IV) from Aqueous Media Containing Bromide Ions Employing Polyurethane Foams
A. S. Bashammakh
Abstract
A simple and accurate method for the quantitative retention of traces of selenium (IV) from aqueous media was
developed employing polyurethane foams (PUFs).The dependences of selenium (IV) uptake by the unloaded and
tributyl phosphate (TBP) plasticized PUFs on pH, salt effect, nature and concentration of surfactant, etc. was
critically studied. The sorption data have followed Langmuir, and Dubinin - Radushkevich (D-R) type sorption
isotherms. Thus, "a dual-mode" sorption mechanism involving both absorption related to "solvent extraction"
and an added component for "surface adsorption" may be simultaneously present. The sorption and recovery
percentage of selenium (IV) from fresh and natural water by the proposed loaded and unloaded foam columns
were quantitatively achieved. The method was applied for the retention and recovery of selenium (IV) species
spiked to fresh water employing PUFs packed columns.
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
International Journal of Chemistry ISSN 1916-9698 (Print) 1916-9701 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:49:32.000Z
|
67t3veqx3qkhcqc22rij25hmqkb3err5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52729",
"uncompressed_offset": 352232774,
"url": "www.crummy.com/writing/postcards/1987/19870523-5.html",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.crummy.com/writing/postcards/1987/19870523-5.html"
}
|
cccc_CC-MAIN-2013-20
|
Roy's Postcards: 1987/05/23
Inscription:
We saw so many of these giants today - and we're camping right in them.
Postcard back:
THE MAJESTIC REDWOODS
Some of the many stands of Redwoods to be seen along the highways of Northern California and Souther Oregon.
Leonard's comments:
Depending on context, that inscription could be really ominous.
See also: northwest
This document (source) is part of Crummy, the webspace of Leonard Richardson (contact information). It was last modified on Wednesday, May 15 2013, 13:00:11 Nowhere Standard Time and last built on Saturday, May 18 2013, 08:00:03 Nowhere Standard Time.
Crummy is © 1996-2013 Leonard Richardson. Unless otherwise noted, all text licensed under a Creative Commons License.
Document tree:
http://www.crummy.com/
writing/
postcards/
1987/
19870523-5.html
Site Search:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:19:49.000Z
|
hvn47ctbeguk5nwzdnvzuiugvf2x474a
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52733",
"uncompressed_offset": 364554567,
"url": "www.diagnosticpathology.org/content/7/1/38/abstract?fmt_view=classic",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.diagnosticpathology.org/content/7/1/38/abstract?fmt_view=classic"
}
|
cccc_CC-MAIN-2013-20
|
Case Report
Case report: a unique pediatric case of a primary CD8 expressing ALK-1 positive anaplastic large cell lymphoma of skeletal muscle
Timo Gaiser1,5*, Eva Geissinger6, Torsten Schattenberg2, Hanns-Peter Scharf2, Matthias Dürken3, Dietmar Dinter4, Andreas Rosenwald6 and Alexander Marx1
Author Affiliations
1 Institute of Pathology, Medical Faculty Mannheim, University of Heidelberg, Theodor-Kutzer-Ufer 1-3, 68167 Mannheim, Germany
2 Orthopedic Clinic, Medical Faculty Mannheim, University of Heidelberg, Theodor-Kutzer-Ufer 1-3, 68167 Mannheim, Germany
3 Department of Pediatrics, Medical Faculty Mannheim, University of Heidelberg, Theodor-Kutzer-Ufer 1-3, 68167 Mannheim, Germany
4 Radiology and Nuclear Medicine, Medical Faculty Mannheim, University of Heidelberg, Theodor-Kutzer-Ufer 1-3, 68167 Mannheim, Germany
5 Section of Cancer Genomics, Center for Cancer Research, National Cancer Institute, National Institutes of Health, National Insitutes of Health, 50 South Drive, Bldg. 50, Bethesda, MD 20892, USA
6 Institute of Pathology, University of Würzburg, Josef-Schneider-Straße 2/Bau E2, 97080 Würzburg, Germany
For all author emails, please log on.
Diagnostic Pathology 2012, 7:38 doi:10.1186/1746-1596-7-38
Published: 12 April 2012
Abstract
Primary involvement of skeletal muscle is a very rare event in ALK-1 positive anaplastic large cell lymphoma (ALCL). We describe a case of a 10-year old boy presenting with a three week history of pain and a palpable firm swelling at the dorsal aspect of the left thigh. Histological examination of the lesion revealed a tumoral and diffuse polymorphic infiltration of the muscle by large lymphoid cells. Tumor cells displayed eccentric, lobulated "horse shoe" or "kidney-shape" nuclei. The cells showed immunohistochemical positivity for CD30, ALK-1, CD2, CD3, CD7, CD8, and Perforin. Fluorescence in situ hybridization analysis revealed a characteristic rearrangement of the ALK-1 gene in 2p23 leading to the diagnosis of ALK-1 positive ALCL. Chemotherapy according to the ALCL-99-NHL-BFM protocol was initiated and resulted in a complete remission after two cycles. This case illustrates the unusual presentation of a pediatric ALCL in soft tissue with a good response to chemotherapy.
Keywords:
ALK-1; Anaplastic large cell lymphoma; CD30; Pediatric lymphoma
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:45:12.000Z
|
ngjljk4oaiufthidm4r2aw6wsqen23ue
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52737",
"uncompressed_offset": 380422967,
"url": "www.eea.europa.eu/data-and-maps/data/nationally-designated-areas-national-cdda-7/mail_password_form",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.eea.europa.eu/data-and-maps/data/nationally-designated-areas-national-cdda-7/mail_password_form?userid="
}
|
cccc_CC-MAIN-2013-20
|
Personal tools
Sign up now!
Get notifications on new reports and products. Currently we have 55549 subscribers. Frequency: 3-4 emails / month.
Follow us
Twitter
Facebook
YouTube channel
RSS Feeds
Notifications archive
Write to us
For the public:
For media and journalists:
Contact EEA staff
Contact the web team
FAQ
Call us
Reception:
Phone: (+45) 33 36 71 00
Fax: (+45) 33 36 71 99
next
previous
items
Skip to content. | Skip to navigation
Sound and independent information
on the environment
You are here: Home / Data and maps / Datasets / Nationally designated areas (CDDA)
Lost Password
For security reasons, we store your password encrypted, and cannot mail it to you. If you would like to reset your password, fill out the form below and we will send you an email at the address you gave when you registered to start the process of resetting your password.
To reset your password visit Reset Eionet account password page.
European Environment Agency (EEA)
Kongens Nytorv 6
1050 Copenhagen K
Denmark
Phone: +45 3336 7100
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:46:24.000Z
|
kmbnrkjuloucjux7xkqt6h77dafztmf2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52738",
"uncompressed_offset": 383257501,
"url": "www.elinux.org/index.php?direction=prev&oldid=216794&title=RPi_Hub",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.elinux.org/index.php?title=RPi_Hub&direction=prev&oldid=216794"
}
|
cccc_CC-MAIN-2013-20
|
RPi Hub
From eLinux.org
Revision as of 12:48, 7 January 2013 by Peba (Talk | contribs)
Jump to: navigation, search
Contents
Raspberry Pi Wiki Hub eng | fra | pt-br
Notice: The Raspberry Pi Wiki pages on this site is collaborative work - the Raspberry Pi Foundation is not responsible for content on these pages.
I need help with...
Buying a new Raspberry Pi
Please visit the Model Wizard to select your Raspberry Pi.
Booting an OS onto my Raspberry Pi
Please visit the OS Wizard to select your Raspberry Pi OS distribution, or if you'd like to compare the OS distros, visit OS Distributions page to select an OS to boot onto your Raspberry Pi.
Now shipping to customers
Update on lead times as of 17 November 2012: The lead time is around 2 days from Farnell and RS.
Don't have an idea on which to buy? Use the Model Wizard to select your Raspberry Pi!
See the Buying Guide on how to order one, or visit the Raspberry Pi Foundation Home Page
About
The Raspberry Pi production board (model B Rev 2.0)
The Raspberry Pi (short: RPi or RasPi) is an ultra-low-cost ($25-$35) credit-card sized Linux computer which was conceived with the primary goal of teaching computer programming to children. It was developed by the Raspberry Pi Foundation, which is a UK registered charity (Registration Number 1129409). The foundation exists to promote the study of computer science and related topics, especially at school level, and to put the fun back into learning computing. The device is expected to have many other applications both in the developed and the developing world (Read more).
Raspberry Pi is manufactured and sold in partnership with the worldwide industrial distributors Premier Farnell/Element 14 and RS Components.
• Products are RoHS, CE, FCC, CTick, CSA and WEEE compliant[1]. In common with all Electronic and Electrical products the Raspberry Pi should not be disposed of in household waste. Please contact the distributor from whom you purchased your Raspberry Pi device for details regarding WEEE in your country.
• Price: 25USD Model A, 35USD for Model B, excluding taxes, postage and packaging. For information about availability and shipping see the Buying Guide.
History
If you are interested in why the Raspberry Pi was created, and why it is what it is, check the General History page, which highlights relevant events in its history. It is not intended to be a detailed history, so it can be read quickly. You could also check the design changes page for how the Raspberry Pi has evolved, and the manufacturing differences page that may help if you are having problems with your board.
Getting Started
Buying Guide
The Model Wizard will help you select your model to buy.
Where can I get one and for how much?
• The Raspberry Pi can no longer only be purchased via their official distribution partners - detailed information can be found on the RPi Buying Guide page.
Basic Setup
First little Raspberry Pi Steps...
• Ensure you have all the equipment you need to go with your Raspberry Pi.
• Become familiar with the board layout and connect it ready for power up.
• If you have not been provided with a pre-setup SD card you will need to prepare one with your chosen Operating System distribution
• Note: On the Debian OS after you log in you need to type startx at the prompt to get a graphic desktop.
• Particularly after first boot its important to do a clean shutdown with the command sudo halt
Beginners Guide
You've just got your new Raspberry Pi device - what now?
• Read a small book for the Raspberry Pi Beginner [1]
• Get started with some basic projects and tutorials:
Raspberry Pi YouTube Tutorials
Another set of video tutorials
My First Raspberry Pi Game
Easy GPIO Hardware & Software - in-progress at the moment
Example projects/tuts which can be linked from here
(or from within a beginners guide page perhaps):
Setup XBMC media centre
Programming tutorials (Liams YouTube etc)
Easy GPIO (when complete or similar thing).
Also links to some basic linux user guides.
• Take a look through the Community section, which contains a range of beginner and advanced tutorials and guides, as well as groups to help you find like-minded developers.
Resources
Hardware & Peripherals
Software & OS Distributions
The Raspberry Pi will run a range of OS Distributions and run a variety of software.
Documentation
Documentation relating to the Raspberry Pi can be found here.
Frambozenier.org Documentation Project Datasheets
Example documents which can be linked from here (or sub page):
Official Datasheets
White Papers
User Manuals
Recommended books (perhaps)
RPi Troubleshooting
Head over to the troubleshooting page for help fixing common problems.
RPi Bugs
Head over to the bugs page for a list of known bugs.
RPi Model B 3D CAD files
Theses are various 3D CAD Versions in both RAR and ZIP.
Community
Projects, Guides & Tutorials
Schools, Universities, Clubs & Groups
• The Raspberry Pi Foundation's aims include encouraging education. Several groups including Computing At School aim to bring Computing Science back into schools.
• Go to the Education Page to add your project and find helpful links.
Supporting Communities
The Raspberry Pi Community is steadily growing:
About the RPi Wiki
Do not be afraid to add your bit, content is vital for the wiki to function.
A 3D rendering of the Raspberry Pi logo
We are governed by the RPi Wiki Council (RPWC). New guidelines not made by Ghans alone are currently being drafted. As the RPi wiki is currently a wreck, the council's current goal is to clean up the RPi Wiki!
Translations
The wiki is being translated into several languages, some of which can be seen on the hub banner above. Current languages include:
Any help translating would be greatly appreciated. Thank you to those who have already contributed!
Admins/Contributors
The wiki is governed by the Raspberry Pi Wiki Council.
References
1. http://www.element14.com/community/docs/DOC-44828/l/raspberry-pi-safety-data-sheet
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:50:35.000Z
|
ds5puh7hasnryfq2j6sly2ulu65yxwpb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52740",
"uncompressed_offset": 393567687,
"url": "www.familysearch.org/learn/wiki/en/1st_Regiment,_US_Veteran_Volunteer_Infantry_%28Union%29",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/1st_Regiment,_US_Veteran_Volunteer_Infantry_(Union)"
}
|
cccc_CC-MAIN-2013-20
|
1st Regiment, US Veteran Volunteer Infantry (Union)Edit This Page
From FamilySearch Wiki
United States U.S. Military United States Civil War Union Volunteers 1st Regiment, US Veteran Volunteer Infantry (Union)
Contents
Brief History
"Compendium of the War of the Rebellion" by Frederick H. Dyer contains no history for this unit.[1]
Companies in this Regiment with the Counties of Origin
Men often enlisted in a company recruited in the counties where they lived though not always. After many battles, companies might be combined because so many men were killed or wounded. However if you are unsure which company your ancestor was in, try the company recruited in his county first.
Other Sources
• Beginning United States Civil War Research gives steps for finding information about a Civil War soldier or sailor. It covers the major records that should be used. Additional records are described in 'Union Volunteers in the Civil War' and 'United States Civil War, 1861 to 1865' (see below).
• National Park Service, The Civil War Soldiers and Sailors System, is searchable by soldier's name and state. It contains basic facts about soldiers on both sides of the Civil War, a list of regiments, descriptions of significant battles, sources of the information, and suggestions for where to find additional information.
• Union Volunteers in the Civil War describes many Union sources, specifically for the Union Volunteers, and how to find them.. These include compiled service records, pension records, rosters, cemetery records, Internet databases, published books, etc.
• United States Civil War, 1861 to 1865 describes and explains United States records, rather than state records, and how to find them. These include veterans’ censuses, compiled service records, pension records, rosters, cemetery records, Internet databases, published books, etc.
References
1. The Civil War Soldiers and Sailors System, (accessed February 2011).
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 27 March 2012, at 06:23.
• This page has been accessed 281 times.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:58:21.000Z
|
wp6hcxm5fbkoqzo6ujojbhhwceofukkr
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52741",
"uncompressed_offset": 398074922,
"url": "www.fides.org/en/news/33301-AFRICA_SOUTH_SUDAN_From_the_Nuba_Mountains_to_Uganda_to_receive_new_limbs_thanks_to_the_Catholic_Church",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.fides.org/en/news/33301-AFRICA_SOUTH_SUDAN_From_the_Nuba_Mountains_to_Uganda_to_receive_new_limbs_thanks_to_the_Catholic_Church"
}
|
cccc_CC-MAIN-2013-20
|
http://www.fides.org
Africa
2013-02-27
AFRICA/SOUTH SUDAN - From the Nuba Mountains to Uganda to receive new limbs thanks to the Catholic Church
Juba (Agenzia Fides) - The Catholic Church is sponsoring 20 amputees, all war victims, who suffered amputations in the war in the Nuba Mountains (Sudan) to reach a hospital in Uganda where they can get new implants. These people will join another 13 from Yida Refugee Camp (South Sudan).
The Sudan Catholic Network quoted a medical officer that explained how His Exc. Mgr. Macram Max, Bishop of El Obeid lobbied for funds to fit the patients with artificial limbs and allow them to lead normal lives.
The first batch of 35 people had been sent to Uganda to undergo the implantation of artificial limbs.
An amputee said he was happy to be on the list of those who will be traveling to Uganda to receive a new leg and thanked the Diocese of El Obeid for the opportunity.
Ten different groups of amputees were planned for trips to different hospitals in Uganda to be fitted with new limbs. (L.M.) (Agenzia Fides 27/02/2013)
Share: Facebook Twitter Google Blogger Altri Social Network
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:02:20.000Z
|
ryxmjrvfe4oz2vrgnvhwm3mskhorfbim
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52742",
"uncompressed_offset": 406845921,
"url": "www.forensicswiki.org/w/index.php?diff=prev&oldid=13254&title=HFS%2B",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.forensicswiki.org/w/index.php?title=HFS%2B&diff=prev&oldid=13254"
}
|
cccc_CC-MAIN-2013-20
|
Error
Jump to: navigation, search
2 revisions of this difference (12212 and 13254) were not found.
This is usually caused by following an outdated diff link to a page that has been deleted. Details can be found in the deletion log.
Personal tools
Namespaces
Variants
Actions
Navigation:
About forensicswiki.org:
Toolbox
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:48:40.000Z
|
euwmo7ea7whnw2lr74z2ppp3rbh2u4pc
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52748",
"uncompressed_offset": 422772756,
"url": "www.go4expert.com/forums/linux-problem-t4683/",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.go4expert.com/forums/linux-problem-t4683/"
}
|
cccc_CC-MAIN-2013-20
|
Linux Problem
Ambitious contributor
14Jun2007,16:17 #1
hi, everyone.
I am learning about linux. So , I feel it is difficult.
But I have default document about linux( It's name is Programming Linux.
However, It's not careful. SO, if you have particular document about
this problem, please, send it for me.
thanks so much.
clocking!
(the best is Linux Adminstrator.)
Go4Expert Founder
14Jun2007,17:12 #2
I am not sure which document you are looking for and do you say that the document is not careful? I don't get you.
Go4Expert Member
11Jul2008,00:46 #3
default document about linux ? i dont understand ...i can show you Linux systems that when you type uname -a it says : Linux localhost.localdomain etc and when you try to use a simple command like "w" you got the "command not found" si when you say the "default document about linux" .. please insert in your comment your distro.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:04:28.000Z
|
zmhfabaetsjcy343qrypgxso2bpqpst6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52754",
"uncompressed_offset": 458524696,
"url": "www.isfdb.org/cgi-bin/title.cgi",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.isfdb.org/cgi-bin/title.cgi?16554"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: Sandkings
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Title: Sandkings
Author: George R. R. Martin
Year: 1981
Type: COLLECTION
Language: English
Wikipedia Entry: http://en.wikipedia.org/wiki/Sandkings_(fiction)
ISFDB Record Number: 16554
User Rating: This title has fewer than 5 votes. VOTE
Current Tags: None Add Tags
Variant Titles:
Awards:
Publications:
Reviews:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:20:28.000Z
|
ehqkyxcm6gnht3dtcyln4ahhxcxnwoun
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52767",
"uncompressed_offset": 501283838,
"url": "www.mdpi.com/1424-8220/7/4/589",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.mdpi.com/1424-8220/7/4/589"
}
|
cccc_CC-MAIN-2013-20
|
Sensors 2007, 7(4), 589-614; doi:10.3390/s7040589
Article
Biosensors and Bio-Bar Code Assays Based on Biofunctionalized Magnetic Microbeads
1 LSA, Claude Bernard University Lyon 1, 69622 Villeurbanne Cedex, France 2 AMPERE, Ecole Centrale de Lyon, 69134 Ecully Cedex, France 3 INL, Ecole Centrale de Lyon, 69134 Ecully Cedex, France
* Author to whom correspondence should be addressed.
Received: 5 March 2007 / Accepted: 10 April 2007 / Published: 30 April 2007
Download PDF Full-Text [356 KB, uploaded 20 June 2008 16:51 CEST]
Abstract: This review paper reports the applications of magnetic microbeads in biosensors and bio-bar code assays. Affinity biosensors are presented through different types of transducing systems: electrochemical, piezo electric or magnetic ones, applied to immunodetection and genodetection. Enzymatic biosensors are based on biofunctionalization through magnetic microbeads of a transducer, more often amperometric, potentiometric or conductimetric. The bio-bar code assays relie on a sandwich structure based on specific biological interaction of a magnetic microbead and a nanoparticle with a defined biological molecule. The magnetic particle allows the separation of the reacted target molecules from unreacted ones. The nanoparticles aim at the amplification and the detection of the target molecule. The bio-bar code assays allow the detection at very low concentration of biological molecules, similar to PCR sensitivity.
Keywords: Affinity Biosensors; Enzymatic Biosensors; Bio-Bar Code; Magnetic Microbeads
Article Statistics
Click here to load and display the download statistics.
Cite This Article
MDPI and ACS Style
Jaffrezic-Renault, N.; Martelet, C.; Chevolot, Y.; Cloarec, J.-P. Biosensors and Bio-Bar Code Assays Based on Biofunctionalized Magnetic Microbeads. Sensors 2007, 7, 589-614.
AMA Style
Jaffrezic-Renault N, Martelet C, Chevolot Y, Cloarec J-P. Biosensors and Bio-Bar Code Assays Based on Biofunctionalized Magnetic Microbeads. Sensors. 2007; 7(4):589-614.
Chicago/Turabian Style
Jaffrezic-Renault, Nicole; Martelet, Claude; Chevolot, Yann; Cloarec, Jean-Pierre. 2007. "Biosensors and Bio-Bar Code Assays Based on Biofunctionalized Magnetic Microbeads." Sensors 7, no. 4: 589-614.
Sensors EISSN 1424-8220 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:37:44.000Z
|
3uz3mjwunhddsqdzemudddtzfacvdomd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52778",
"uncompressed_offset": 546944320,
"url": "www.openwetware.org/index.php?diff=prev&oldid=631460&title=Image%3ALAPORAN_PRAKTIKUM_02_tehnik_dasar.pdf",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.openwetware.org/index.php?title=Image:LAPORAN_PRAKTIKUM_02_tehnik_dasar.pdf&diff=prev&oldid=631460"
}
|
cccc_CC-MAIN-2013-20
|
Image:LAPORAN PRAKTIKUM 02 tehnik dasar.pdf
From OpenWetWare
(Difference between revisions)
Jump to: navigation, search
LAPORAN_PRAKTIKUM_02_tehnik_dasar.pdf (file size: 685 KB, MIME type: application/pdf)
Current revision
File history
Click on a date/time to view the file as it appeared at that time.
Date/TimeDimensionsUserComment
current12:02, 2 October 2012 (685 KB)Yulia Fitri Djaribun (Talk | contribs)
The following file is a duplicate of this file:
There are no pages that link to this file.
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:21:03.000Z
|
ngazsk3uiwyifgh3b6eidfqumpal4pja
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52780",
"uncompressed_offset": 546974093,
"url": "www.openwetware.org/wiki/DataONE:meeting_notes:17_June_2010_chat",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.openwetware.org/wiki/DataONE:meeting_notes:17_June_2010_chat"
}
|
cccc_CC-MAIN-2013-20
|
DataONE:meeting notes:17 June 2010 chat
From OpenWetWare
Jump to: navigation, search
9:01 AM Heather: You've been invited to this chat room!
Hi Sarah and Nic.
Nicholas: Hello
Sarah: good morning
Heather: Valerie will be joining in a sec I'm guessing
9:02 AM Nic, did you have a chance to see the chat log from yesterday?
Any questions out of that?
Nicholas: I did
Valerie has joined
9:03 AM Heather: and btw the agenda for today, very similar to what we didn't get to yesterday:
Nicholas: I think there was a question for me about the content in treebase? yes?
Heather: http://www.openwetware.org/wiki/DataONE:Notebook/Summer_2010/2010/06/17
Nicholas: From what I know, is that its mostly data matrices
9:04 AM Valerie: ah
Nicholas: "It includes phylogenetic trees and data matrices, together with information about the relevant publication, taxa, morphological and sequence-based characters, and published analyses."
Heather: I just had an interesting conversation in the hall of the Biodiversity Centre at UBC
Sarah: yep that's what i noticed when i downloaded some data
Heather: supposedly there is a thing called "super trees" which is people building big trees out of other trees
Sarah: a lot of it is phylo figures from the paper itself
Heather: other trees = potentially things in TreeBASE
Sarah: i.e. actual intext figures
plus the data matriz
9:05 AM thanks for that confirmation though
Heather: so might see reuse in that context. The prof I was talking to didn't say if it was on the order of 5 trees or 200 trees... obviously citation patterns would be different.
Anyway, thought it was interesting.
hmmmm, not seeing Valerie
Valerie: I'm here
9:06 AM Heather: oh, hi Valerie! Sorry about that
Valerie: it's cool
Heather: great. ok, so agenda is here: http://www.openwetware.org/wiki/DataONE:Notebook/Summer_2010/2010/06/17
anythign to add?
9:07 AM ok, let's start then.
want to finalize friday blog plans here, since you are all together?
Nicholas: sure.. did we want to do some kind of poll ?
Valerie: I like that Idea
9:08 AM Sarah: i like it (just sent an email in response before this chat)
Heather: make it easy to vote, easy to see results
Valerie: I was about to send a message saying it's a great way to make sure we have something to comment on the following friday
9:09 AM Heather: yup. so want to hash out the question here or on email?
Valerie: I don't see why we couldn't do it here
er, discuss here
Heather: somebody going to look into what poll-hosting tech you'll use? there is a popular plug in for wordpress, probably?
Nicholas: I'm on it
Heather: good. begin :)
9:10 AM you're on the tech, nic? great.
Sarah: i'm fine with the question heather already proposed
9:11 AM Heather: here it is, for ref:
"As a researcher, what prevents you from citing data according to best practices?"
- I don't reuse data - I don't know what the best practices are for citing data - I do cite data according to best practices. Definitely. - I do cite data according to best practices. I think. - There are contradictory best practices. - It takes too long - I tried but my publisher wouldn't let me - Other with easy commenting on the blog post.
Valerie: it's a good initial question
since Sarah's post was about this
9:12 AM Heather: nic? Or other answer possibilities?
Nicholas: no I think this is good,,, I was just browsing for poll plug ins
9:13 AM I think it gets to the point of what we are doing
Heather: ok, cool. One idea is to create an OWW page for brainstorming future poll ideas....
that way people can add as they come up with them, might get some mentor feedback, etc
Sarah: yeah. i keep a personal log of the questions i have
some philosophical, some about my research, some about "what if.."
9:14 AM so, that might be good to do as a group
also helps generate ideas for analysis and write up
Heather: yup! maybe even link to the OWW page from the initial poll page, so that people who visit the poll who are interested can throw in ideas....
good idea, Sarah.
Valerie: cool
Nicholas: ditto Sarah, I need to get better at putting these into my oww space though
9:15 AM Sarah: yeah, i have some on scrap paper or email i still need to txfr, but i'm trying
Heather: Nic, any barriers to doing that other than time? ie do you have any questions about it or things we can help with?
9:16 AM Nicholas: no no, I think it's just getting into the habit of keeping a central place for my notes
and getting it into my workflow
Heather: yup, definitely forming new habits. me too.
9:17 AM ok, knoxville.
everybody got that the plan is to meet in Knoxville TN on July 7 and 8th? that works for everyone?
Valerie: yes
Nicholas: yes
Sarah: yes
Heather: good! then write it on calendars and we'll figure out details soon
9:18 AM Valerie: ok, excellent
Nicholas: great
Heather: for now, just wanted to say that we will aim to have explicit goals for the meeting
and that will probably mean that to get the most out of it, we'll all have to do some prep
I don't know what kind of prep yet :) it depends on the goals, which I also don't know yet ;)
9:19 AM Valerie: ok
Heather: but I'm guessing it might be something like draft posters or presentations, and also
perhaps things beyond that, like some draft analysis
or paper outlines, or something like that
9:20 AM Sarah: like a mini conference meeting?
Heather: it probably will include some detailed work, and to prep for that we'll probably want to have gotten our feet dirty with statts
Yeah, Sarah, I actually have no idea yet.
I'm mostly just giving you all a heads up to say that
9:21 AM you might want to mentally consider the week before the meeting to be "meeting prep" time, to a large degree
the meeting prep will (hopefully) be right in line with work you'd be doing on your projects anyway....
it just has a due date of July 7th.
that make sense?
Valerie: we also have a due date on the 30th, right?
9:22 AM Heather: right, for your project milestones.
In the next week or two we'll figure out what we want to get out of the knoxville meeting, and then
figure out how best to present the project milestone work, the open questions, etc....
9:23 AM Nicholas: I like the idea of a mini conference- at least in terms of how we consider preparing 9:24 AM Heather: I could ask you know what you think you want to get out of the Knoxville meeting, but I think we'll hold off on a big discussion about that till next week, once your feet are more deeply into your projects
good to know, Nic
other thoughts or questions about that?
Sarah: and, the knoxville meeting might be a good time to "report" on our june 30 milestones, rather than being redundant
Heather: yes
Valerie: I definitely agree
9:25 AM Heather: fyi, Todd and I will both be in Portland OR at the end of june, for the Evolution and ievobio conferences 9:26 AM so at least two people on the team won't be remote from each other for a week or so lol
Valerie: ah, I hope you enjoy Portland (I used to live there)
9:27 AM Heather: I definitely will! I've visited, and have friends there. great town. Thanks, Valerie.
ok, next....
abstracts.
Just wanted to put a plug in for a research approach that many people swear by....
writing your abstracts before you've finished the work.
9:28 AM Often very instructive about where to focus your research. Anyone have experience doing that?
Valerie: I agree (not so much from experience in science writing, but in general)
Sarah: i've used that as a good trick for conferences where i haven't collected all my data yet.
9:29 AM but i have yet to try it for manuscripts...i usually save the abstract for last
Heather: yes. It is probably a case of writing it first, throwing that version away when you have your data, and then writing it again last,,,,,
9:30 AM Nicholas: I think I have a similar approach,, not in the form of an abstract, but a mock-up of what I expect to gather and how I can discuss this clearly
Heather: cool.
ok, well consider this a nudge to give it a try when you need a break from data collection someday soon.
and when you do, circulate it around to us for visibility, feedback.
9:31 AM (that sort of thing makes me want us to have a box somewhere saying "collaborators, look at these pages" or something. hrm)
Valerie: definitely (since this is my first time doing this)
Heather: ok.
9:32 AM stats.
who has experience running stats? who doesn't? what software packages have you used?
has anyone used SAS or SPSS or R?
Sarah: R
primer (ecological, multivariate....expensive)
Nicholas: I do not
9:33 AM Sarah: excel packages (extensions?)
Valerie: I have not had experience with any of them.
Sarah: access (custom)
R's good b/c open access
Heather: so we've got a range of experience. That'll work.
Sarah: and almost always has a package written for the thing you want to do
9:34 AM Heather: yup... so I'm thinking we standarize on R for this project. Makes sense, you think, Sarah?
it has a bit of a steep learning curve, but we'll help you up it Nic and Valerie
Sarah: yeah
the programming isn't too bad
Valerie: excellent, thanks
Sarah: i have a good tutorial
that i can dig up
from a past class
Heather: it makes stat analysis very transparent and easy to reuse and redo
9:35 AM Sarah: yeah. we could easily post our coding
and input files
Heather: and will be a great tool for you in your future life
yup
Sarah: plus, it's easy to download
Nicholas: I need more experience so I'm up for it
Sarah: packages and the software itself
Heather: that would be great, sarah. I'll try to post a few helpful intros too. There are oodles on the web.
Sarah: i'm not an expert, but I like learning new things in it
Heather: fyi, googling for "R" is problamatic but "R-project" is useful
Sarah: or cran r
Valerie: cool, good to know
9:36 AM I'm still on Windows XP
is that an issue?
Sarah: nope
Heather: or there is a specific R google engine, I'll post a link
nope, R is on everything
Sarah: it's basic code, not platform dependent
Valerie: ah
Heather: Nic, what OS are you on, fmi?
Sarah, you are on a Windows machine?
Nicholas: mac
os x
Sarah: windows
Nicholas: I have access to a pc though
Sarah: running windows 7
but used to run on xp
i think r works for mac too
9:37 AM Heather: ok. Good. installation a bit different obviously but no problem
Nicholas: xp on my pc
Sarah: though, i know some people in my class ran into weird quirks
Heather: yup it does. I'm on a mac, osx
great. then if/when you need a break from data collection, you can install R and look around a bit.
we'lll post some links.
9:38 AM Nicholas: excellent
Heather: running stats in R also means that we can cheat forward about planning and coding statistical analsis before all of the data is in
since you write a script, you can do it and test it on pilot data or dummy data.... then rerun it once all your real data is in. handy for overlapping projects like ours, I think
9:39 AM Sarah: and for iterative analyses
Heather: anyway, we won't dive full into R just yet because important to focus on data collection right now I think, just wanted to give you some info on future
yes
Sarah: i'll send along the tutorial
Valerie: ok, thanks
Heather: great
Nicholas: thanks
Heather: related question.
9:40 AM has anyone used source control before? subversion, cvs, git? or know what I'm talking about? :)
Sarah: not a clue
Valerie: have no idea
Heather: no problem.
9:41 AM Nicholas: nope
Heather: so source control is a way that programmers keep track of all of the versions of their computer source code
Valerie: is it like version control?
Heather: themselves, as they change things, and between coworkers when there are many people working on the same project
yes, exactly.
it is version control for computer source code
9:42 AM anyway, I don't know for sure that we will go there... but as we develop R scripts, it is a "best practice" to keep them under version control
plus it would help us!
9:43 AM Valerie: will there be file naming conventions?
Heather: so we'll see how it goes, but I'd like to see if we can keep track of our scripts using git and github
valerie, maybe, but source control makes naming conventions a bit less important.
version information is stored in metadata around the files.
9:44 AM we could post the R scripts directly in our OWW pages, but git (for example) is better designed for this kind of thing, kind of like google spreadsheets are better designed for sharing tabular data 9:45 AM ok, well, enough on that for now, I'll look to see if there is a really simple way we can work this into our R workflow.
Any questions about all of that?
Sarah: nope. it's over my head, but i'll figure it out when we get there
9:46 AM Heather: I'm guessing we'll come back to thinking about stats, at least as methods, in the next week or three.
Valerie: I'm sure I'll have questions along the way
Nicholas: same here -- I'm going to need this over the next year so I'd appreciate digging into this summer
Heather: great!
ok. so the only other thing on my list to cover is data coordination.
9:47 AM Sarah: did you see my additions to that?
i linked up the ss i shared
so we can talk about them
Heather: I didn't Sarah, sorry.
Valerie: I have the ss open
Sarah: maybe just refresh the agenda page
Heather: got it
9:48 AM Valerie: I added the fields for Journal ISSN, year and volume to my ss 9:49 AM Sarah: i'm wondering if you can maybe use this exact ss (just your own copy)....that would make our field standardization easier even if you don't use all the fields
and by standardization, i also mean eventual combination
Valerie: ok
Sarah: i dunno, just a thought
i don't want you to have to conform to my system per say
that's why i put it on the doc so we can both modify it
9:50 AM and i indicated what fields match with your existing fields
Valerie: I'm not sure how I would switch around the information, but I could do that
Sarah: i have to reanalyze some of my articles to make mine fit too, i expected that would happen in these early stages
Heather: Valerie, if you experimented with using your own copy of this exact SS and then figured out whether there were things about it that woudl need to change a bit to work for you....
9:51 AM could definitely make data combination easy later.
Valerie: ok
the one labeled DataONECitationsMETADATA?
Sarah: that's for everyone
Valerie: or the second one?
Sarah: just to cover basic fields
not necessarily where we keep data
just to make sure everyone is getting the fields that will be necessary to link our data in the future
9:52 AM so, the SharedFields sheet has all the fields we need for articles from the Metadata ss
Heather: so Valerie, it would be your own copy of the 2nd sheet, the SharedFields sheet
Valerie: oh, ok
9:53 AM got it
Sarah: nic, have you looked at the Metadata sheet?
Heather: (and you could obviously delete the columns that weren't relevant to your extraction, if they got in the way)
Sarah: it looks like most of what you are collecting is on par already
Nicholas: Im looking now
Sarah: but we do need to work out what you are collecting about citation policies
Heather: Valerie, have a look and see what you think and maybe chat with Sarah about it later today so you guys can tweek the relevant columns to work for both of you?
Nicholas: issue volume and funder are out of scope... I think I'm covering everything else though
9:54 AM Sarah: will you be covering funder eventually?
i thought that was under you
Nicholas: it is
Sarah: but it's not super impt
i can just classify as public or private
for each article that is
Nicholas: but collecting the funding of a journal is not applicable
or an article I mean
9:55 AM Sarah: what do you mean?
I collect the funding info for each article
Nicholas: right and I collect the metadata for the funder
and the policy for the funder
Sarah: ok
but you haven't quite delved into that, right?
from what i saw on your ss
9:56 AM Nicholas: no not at all
I did an initial sample to see if there would be enough there, and it seemed like there would be so I've kept it in my scope
today I'm hoping to finish most of the ecology journals
9:57 AM and if I find good policy I'll send you the names
Heather: whooosh you go, Nic!
Nicholas: yup
Sarah: ok, meaning citation policy?
or funding?
Nicholas: yeah
citation
Sarah: ok. valerie (and I for that matter) is interested in rating an article according to if it meets the journal or depositories policy
9:58 AM so we need to figure out how to code the policy to match
can you send me the text of a good policy so i can look over it too?
Nicholas: yes
Sarah: that way we can figure out how our extraction fields can match with it to yield something meaningful
9:59 AM do the depositories have citation policies as well?
Valerie: some seem to
Sarah: the ones i've seen mention accession at least
10:00 AM is nic or valerie collecting/coding those?
meaning the citation policies of depositories
Nicholas: sharing policies are definitely present so far... but citation directions ( i.e cite this way) are very rare, in fact I think there is only one I've found so far that even mentions how one should cite data
10:01 AM Valerie: I started something awhile back, but I think Nic's doing it (unless I'm wrong)
Heather: There might be an advantage to holding off coding for a bit, until we have more raw data to understand the alternatives
Sarah: can you send me a sharing policy too? i'm wondering what we can collect at the article level about that besides yn
Heather: so collect the data now, but don't attempt to make it formally coded into categories yet. I'm not sure we know 100% what would be good categories.
10:02 AM Valerie: sure
Sarah: yeah, that's why i keep full text of any relevant excerpt
Nicholas: http://www3.interscience.wiley.com/journal/118512781/home/ForAuthors.html
Sarah: but somethings i code now b/c it's easier while i'm fresh from the article
Nicholas: this is cladistics sharing policy
Sarah: thanks
Nicholas: under subject matter
10:03 AM Sarah: thanks
Nicholas: http://www.biomedcentral.com/bmcevolbiol/ifora/
Sarah: this is mostly concerned with the formats of the shared data files
10:04 AM should we record that from the articles?
Nicholas: in the metadata I am collecting, I am noting if formats are required
Sarah: this seems like it's mostly for data sharing within the journal (i.e. internal)
10:05 AM Nicholas: These data will be made available to the referees but not to the community at large until such time as the paper is accepted.
Sarah: it seems a little silly for me to dig up data format info from each article, since I assume it's a requirement for even getting it posted
10:06 AM i.e. at cladistics, if you submit a .png file, they'll ask you for a .jpg or .gif instead
the editor should have to take care of that technicality
b/c it probably has to do more with storage space
etc
Nicholas: I don't think you should collect that info
Sarah: not data quality
Heather: yeah, I think data format info can be outside our scope
Nicholas: Im just noting it when I come across it
10:07 AM Sarah: what would be more interesting is if you came across a data metadata part of the policy, i.e. requiring detailed documentation of how to use the data file
but again, probably outside of the scope
10:08 AM Nicholas: well so far, that's not present in journal policy
Sarah: yeah, understandable
is this the section of the BMC policy you wanted me to see:
The Accession Numbers of any nucleic acid sequences, protein sequences or atomic coordinates cited in the manuscript should be provided, in square brackets and include the corresponding database name; for example, [EMBL:AB026295, EMBL:AC137000, DDBJ:AE000812, GenBank:U49845, PDB:1BFM, Swiss-Prot:Q96KQ7, PIR:S66116].
The databases for which we can provide direct links are: EMBL Nucleotide Sequence Database (EMBL), DNA Data Bank of Japan (DDBJ ), GenBank at the NCBI (GenBank), Protein Data Bank (PDB), Protein Information Resource (PIR) and the Swiss-Prot Protein Database (Swiss-Prot).
That's awesome (for our purposes)
10:09 AM that's what I was hoping we'd have for citation policies. unfortunately i don't have bmc on my journal list (but could if we want to focus on journals that have actual citation policies)
Nicholas: yes
10:10 AM thus far, its the best one
Sarah: oh, and it keeps going on and on
do my journals have comparable ones (or even any)
am nat
sysbio
ecology
molecular ecology
i'm seeing major inconsistencies in molec ecology
10:11 AM Nicholas: http://www.oxfordjournals.org/our_journals/sysbio/for_authors/ms_preparation.html
under DATA
Sarah: thanks
is this recorded in your spreadsheet?
10:12 AM sorry, i haven't looked over it super throughly
Nicholas: yes
line 3
Sarah: thanks
i won't pester you anymore about that then.
Nicholas: I need to put the full text in, since I did that journal I've revised my fields
10:13 AM Sarah: ok. and let me know if you find any other really good journals like bmc evo bio so i consider sampling at least a few of those articles
Nicholas: I will
Sarah: great
heather, what else did you want to discuss about data coordination?
10:14 AM Heather: one other thing
wanted to explicitly talk about article metadata, since it might help Valerie and Sarah, and might be something Nic could do
specifically, Nic, I was thinking that there are some article metadata fields in ISI Web of Science or Scopus or similar
10:15 AM that would list all authors, corresponding author address, etc
things that Valerie and Sarah could extract, but might be more easily and cleanly pulled from other sources
Easiest for Sarah's stuff, because it woudl just be issues a, b, c of journals x and y (or something)
10:16 AM Sarah: i'm finding it easiest just to pull from the article pdf
Heather: Harder for Valerie's because the spread of articles is wider. Thus might be more pain than it is worth to try for systematic crossreferencing.
Sarah: but their are a few things on isi that i would like
like funding source
Valerie: same here. although I haven't been pulling the author address
should I do that?
Sarah: but my citation software isn't pulling it out
Heather: No.
Valerie: (also, sometimes I used the "et al." should I capture all author names?)
Sarah: oh, i say yes to author address
10:17 AM Heather: So I think it might behoove us to have someone look into extracting the article metadata from a bibliographic source like ISI or Scopus
Sarah: for nationality and discipline of author...like heather's biomed study
Heather: so Sarah I think yes we want it, bu tI think mostly no on Valerie extracting it
because ideally we want to pull it systematically from somewhere
Sarah: ok...having it auto extract from isi then
yeah
Heather: anyway, Nic, would you look into it?
10:18 AM Nicholas: yes
Sarah: i'll look into it to b/c i need to figure out a method for my random sample like we discussed previously and will be experimenting in isi
Heather: great. thanks. Report back on what fields you can pull from which sources, how easy it is to export the data, your recommended approach
10:19 AM Nicholas: yes, sarah if you feel like it's something I can gather then pass it on 10:20 AM Heather: nic, I think you should do it too if you can... it is kind of parallel to other things you are doing, article metadata as opposed to journal metadata etc
Sarah: nic...are you familiar with scopus? or have access? i don't
Nicholas: I have access
Sarah: ok. i might, but i don't think so
also, per heather's comment
Heather: Nic I think your information science background would be great here :)
10:21 AM Sarah: i think nic could extract it and we link to it through doi, but also valerie and i might need it for populating our fields
Heather: Valerie, you might have ideas and direction suggestions too? If so, chime in
Sarah: so it might be easier for us to collect once we figure out what can be collected
Valerie: not really, I'm still just collecting data so far
I have found a couple of interesting things
Heather: Valerie, to your "et al" above.... I think leave it at et al, and I hope we can capture list of full authors (or at least count of athors) from ISI or Scopus or something
10:22 AM Valerie: ok
admittedly I don't have Scopus access
but I have been using ISI a lot
Heather: Sarah, yes on "once we know what can be extracted"
good stuff, valerie.
10:23 AM cool. So Nic if you can have some info on that in the next day or two, I think it will help finalize a few data extraction fields for Sarah and Valerie.
Valerie: should I just stick to one depository for depth purposes?
I sort of started on Pangaea
Heather: Yes, great, do start on others
Valerie: ok
Heather: I think it will help you figure out different alternatives.
Nicholas: I'm on it
10:24 AM Heather: I think starting with one and looking at it from different directions, then moving on to another, then maybe a third will help you finalize a set of search methods that you can then apply to all of them
Valerie: it's interesting to see the differences in how things are cited. it seems more likely that people cite the article originally tied to the data as opposed to the data itself
Sarah: agreed
Valerie: ok, that makes sense
Sarah: that's coded in the new ss
Heather: yes, definitely true for some datatypes.
10:25 AM Sarah: under "how cited" i believe 10:26 AM nic (as and aside) - i definitely don't have scopus. i'll look at isi today, but you should probably look too b/c you probably know more about extraction...we can compare fields later
Heather: cool. So Valerie, I'm thinking that in a few days? a week? I'm not sure... you have a list of five (or 3 or 10) search strings/methods you finalize on.
is that consistent with what you were thinking?
Valerie: sure
Heather: they will not be perfect obviously and will still need manual review to separate
Valerie: that sounds right since some search strings don't work as well when looking for citations of some repositories
Heather: instances of shared data from instances of reuse... and they won't find all instances of reuse....
10:27 AM but comparing whhat they do find will be informative across databases and journals, I think. make sense?
Sarah: and, you can have my annotated articles for test search...just remind me when you need them
i.e. i label them all as dataSharing or dataReuse
Valerie: ok, thanks
Sarah: and what depository
i had trouble sending it the other day, but i'm sure we could figure it out
Valerie: I'll upload my citations to connotea for your reference once I get more solid search hits
ok
Heather: Valerie, your project definitely has an upfront stage of exploration in a way that the other projects don't!
Valerie: I've been searching for TreeBASE and Pangaea
10:28 AM if there's one more you're seeing a lot, I could search that too to make sure we have enough overlap
Heather: I'd add DAAC to your shorrt list too
esp since there is some of the preliminary DOI reuse data from Bruce
Valerie: oh yeah, the spreadsheet they sent us
10:29 AM I posted a link to that on my lab notebook page
Heather: you have that presentation and the related articles from Bob?
yup
so searching for those using DOIs might be very informative, for example.
One other one, in case you wanted a fourth, would be Genbank
Sarah: yeah
Heather: just because it is so huge and well established, it will make for an interesting comparison
Sarah: i see genbank the most
10:30 AM i think b/c scientists are used to it
Valerie: ok, so DAAC, then Genbank after Pangaea (time permitting)
Heather: yup.
Valerie: ok
10:31 AM Heather: great.
anything else people want to talk abut today?
Sarah: nope.
Valerie: I'm good for now
Heather: Valerie and Sarah I'm guessing you guys will pow-wow later today on tweaking fields so they work for both of you
Valerie: yeah
Heather: Nic, we'll here from you in the next few days about article metadata
hear
10:32 AM Nicholas: yes
Sarah: oh wait...heather, can i just verify that you got my "plan of action" email to the mentors....i haven't got any feedback yet.
Heather: I'll post a blog
yes, I did Sarah! Nice details
Nicholas: I think I can extract a lot of citation info from scopus
Heather: I wont' be too surprised if you don't hear anything
Sarah: i've got article metadata from isi...i'll send to nic right now
and all i guess
Nicholas: thanks
Heather: so in that case.... proceed.
Sarah: ok.
10:33 AM i'm sticking with sysbio right now...seems like the safest in terms of good citation policy, interest, etc
but then i'll move onto the others unless i hear otherwise
Heather: sounds good sarah.
Sysbio is weird because it has been more data sharing heavy than the rest
but that makes it important to include
10:34 AM Sarah: but good in that regard then
Heather: yes
Sarah: yeah. okay
sorry to prolong the chat
Heather: ok!
I'll be around... feel free to ping me for a chat whenever
Valerie: neat.
will d
o
Heather: I'll be keeping tabs on the OWW stuff
10:35 AM otherwise shall we just plan to reconnect on Monday?
Sarah: or wed?
Valerie: sounds good for either
Sarah: what will our regular meeting time(s) be?
Heather: Yup, so could just be Tuesday for the whole-group telecon, unless you see value in something scheduled before then
10:36 AM I think there might be value in a meeting on Monday
since we are still getting data collection stuff finalized
Nicholas: I agree
Sarah: sure
Valerie: ok
10:37 AM Heather: Monday 9am pacific, again? Valerie, your poor lunchtime.
Valerie: eh, it's fine
I eat at my desk if I'm not at the library anyway
10:38 AM and I tend to eat a later lunch/dinner
Heather: ok, good.
don't wait on spontaneous chats though
but will reconnect for sure on Monday at 9am pacific.
10:39 AM Valerie: ok, excellent. I'll send any questions I have prior to that
Heather: wishing you many productive data extraction vibes until then :)
Valerie: thanks
10:40 AM Heather: bye!
Nicholas: bye
Heather has left
Valerie: bye
Valerie has left
Nicholas has left
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:43:49.000Z
|
wh4g6iwq752cckiwuwpsdk6evywnfk66
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52781",
"uncompressed_offset": 546991610,
"url": "www.openwetware.org/wiki/IBE:_Synthetic_Biology_2008",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.openwetware.org/wiki/IBE:_Synthetic_Biology_2008"
}
|
cccc_CC-MAIN-2013-20
|
IBE: Synthetic Biology 2008
From OpenWetWare
Jump to: navigation, search
Presentations
Presenter Title Presentation
Karmella A. Haynes, Oyinade Adefuye, Jordan Baumgardner, Tom Crowley, Will Deloache, James O. Dickson, Lane H. Heard, Andrew Martens, Nickolaus Morton, Michelle Ritter, Amber Shoecraft, Jessica Treece, Matthew Unzicker, Amanda Valencia, Mike Waters, A. Malcolm Campbell, Todd Eckdahl, Laurie Heyer, Jeffrey Poet Solving the Hamiltonian Path Problem with Living Hardware Media:DMW IBE Presentation.pdf
Kaustubh D. Bhalerao, Ph.D. , Goutam Nistala,, Karan Bansal Couple applications of the positive feedback motif Media:BhaleraoPresentation.pdf
John Schumm, Aaron Young, Janie Stine, Craig Barcus, Dan Sheik, Erin Rosswurm, Meng Zhou, Dr Kari Clase, Dr Jenna Rickus Bacterial Warfare, The Rock Paper Scissors Approach Media:barcus_purdue.pdf
G. Sampath Electrical circuit models of protein structure. A framework for the analysis, classification, and synthesis of protein shapes Media:ibe-2008-pres Sampath.pdf
Cheemeng Tan, Lingchong You Growth modulation turns a non-cooperative positive feedback bistable Media:ibe TAN.pdf
J Christopher Anderson Synthesis of Therapeutic Bacteria Media:030708-IBE Meeting-Anderson.pdf
Links
Personal tools
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:20:28.000Z
|
wsqrbpoy26k43svq4bdjv7elgbi7p7ow
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52783",
"uncompressed_offset": 551181764,
"url": "www.panarmenian.net/eng/news/126025/",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.panarmenian.net/eng/news/126025/"
}
|
cccc_CC-MAIN-2013-20
|
Strike-hit Indonesia vows to increase worker pay
PanARMENIAN.Net - Indonesia said on Thursday, October 4 it would improve worker pay and restrict the use of temporary contracts in the face of a vow by union leaders, who staged a national strike this week, to press ahead with industrial action, Reuters said.
Chief Economics Minister Hatta Rajasa said the government would draft a regulation to increase worker pay and would quickly implement rules to improve conditions for workers not on fixed contracts. He gave no details of the pay increase.
Indonesia's booming economy and sustained annual growth of more than 6 percent has contributed to a rise in union militancy as workers seek a larger share of the cake in Southeast Asia's biggest economy.
Union influence could grow in the run-up to an election in 2014 when President Susilo Bambang Yudhoyono steps down after two terms and as politicians from all parties become wary of falling afoul of labor.
Police said hundreds of thousands of people went on strike on Wednesday in the world's fourth most populous nation. Union leaders said two million workers took to the streets in cities across the archipelago.
The main union grievance is so-called outsourcing, the practice of using contract workers with no non-financial benefits to do jobs that otherwise could be done by staff.
There are 16 million outsourced workers, according to media estimates.
Last year, workers at Freeport-McMoRan Copper & Gold'sN Indonesia unit staged a three-month strike at its mine in eastern Indonesia to demand better pay and conditions. That triggered greater labor assertiveness across the country.
Partner news
Top stories
Jorge Rafael Videla, an austere former army commander, led Argentina during the bloodiest days of its Dirty War dictatorship.
According to the United Nations, April was Iraq's bloodiest month for almost five years, with 712 people killed.
Reports suggest the rebel fighters may have tried to blow up the walls of the prison, which holds some 4,000 inmates.
Moscow has condemned other nations for supporting rebel forces and failing to condemn what it describes as terrorist attacks on the Syrian regime.
Partner news
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:20:48.000Z
|
jpiricvrbtoq7j4o72vnzv34yjoz2cqj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52785",
"uncompressed_offset": 557056506,
"url": "www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A1999.01.0156%3Abook%3DLeviticus%3Achapter%3D8%3Averse%3D30",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A1999.01.0156%3Abook%3DLeviticus%3Achapter%3D8%3Averse%3D30"
}
|
cccc_CC-MAIN-2013-20
|
[30] Moses took some of the anointing oil, and some of the blood which was on the altar, and sprinkled it on Aaron, on his garments, and on his sons, and on his sons' garments with him, and sanctified Aaron, his garments, and his sons, and his sons' garments with him.
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
load focus Latin (Saint Jerome, Bible Foundation and On-Line Book Initiative)
hide Places (automatically extracted)
View a map of the most frequently mentioned places in this document.
Visualize the most frequently mentioned Pleiades ancient places in this text.
Download Pleiades ancient places geospacial dataset for this text.
hideData/Identifiers
Citation URN: urn:cts:greekLit:tlg0527.tlg003.perseus-eng1:8.30
Document URN: urn:cts:greekLit:tlg0527.tlg003.perseus-eng1
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:37:03.000Z
|
opatf2fy6lwfjumrj5ycvfd4wn77mnnp
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52786",
"uncompressed_offset": 557082243,
"url": "www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A2008.01.0176%3Astephpage%3D126d",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A2008.01.0176%3Astephpage%3D126d"
}
|
cccc_CC-MAIN-2013-20
|
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
load Vocabulary Tool
hideData/Identifiers
Citation URN: urn:cts:greekLit:tlg0007.tlg077.perseus-grc1:126d
Document URN: urn:cts:greekLit:tlg0007.tlg077.perseus-grc1
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:20:48.000Z
|
4q7ymzyy4yvqhrfhwiboojni26pwvftg
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52797",
"uncompressed_offset": 596206544,
"url": "www.seroundtable.com/archives/015764.html",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.seroundtable.com/archives/015764.html"
}
|
cccc_CC-MAIN-2013-20
|
Reading Between the Lines: Matt Cutts on Reciprocal Linking
Dec 21, 2007 • 9:15 am | (3) by | Filed Under Google Search Engine Optimization
At Pubcon, Matt Cutts was asked about reciprocal linking. We already explored the reciprocal linking question with Adam Lasnik who said that reciprocal linking with relevant sites is better than reciprocal linking with every possible site on the Internet.
A WebmasterWorld thread quotes my coverage of the Matt Cutts keynote (shout out to cnvi for reading!) where I pretty much cover the question about reciprocal linking:
Q: People are all about links but then there's a concern about linking to bad neighborhoods. How do you identify bad neighborhoods? Should you nofollow them or stay away totally?
Matt: Use your gut. Trading links is natural and it's natural to have reciprocal links. At some level, natural reciprocal links happen, but if you do it way too often, it looks artificial. My advice is to go with your gut and if you're worried, you can use nofollow.
Yup, that's what I said. Then I talked about birds. (Actually, Matt did. See coverage here.) In any event, martinibuster expounds upon the statement by Matt to say what we pretty much already know. Matt isn't saying anything different with regards to reciprocal links. He's just saying that you need to be careful with your reciprocal linking approach:
1. Heavy reciprocal linking won't pass a hand check.
2. Light reciprocal linking, both as naturally occurs between similar sites, and apparently the unnatural kind may pass a hand check if it's light.
3. The limits of reciprocal linking are purposely left ambiguous which means either there is no clear number by policy or algo to how many recips you can have, it is hard to put a number to it because it occurs naturally, and/or the limits are left to the judgement of individual hand checkers, i.e. Google reserves editorial discretion when performing a hand check.
That makes complete sense. Be careful in your strategy if you really are inclined to do reciprocal linking.
Forum discussion continues at WebmasterWorld.
Previous story: Google Gets Green Light from FTC for DoubleClick Acquisition
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:02:06.000Z
|
q5h2m4skvkt4mvbvrvvenqmfa66wuogb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52798",
"uncompressed_offset": 596216090,
"url": "www.seroundtable.com/archives/022944.html",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.seroundtable.com/archives/022944.html"
}
|
cccc_CC-MAIN-2013-20
|
Some IE Users Experiencing Bugs With AdSense Ads
Sep 22, 2010 • 8:14 am | (0) by | Filed Under Google AdSense
There are several reports of users surfing sites with Google AdSense on them and receiving Internet Explorer saying, "Internet Explorer Cannot Open Internet Site." I spotted threads on this topic at WebmasterWorld and several at Google AdSense Help.
Here is a picture of a warning:
I don't see a response from Google on this issue or how wide spread it is. But as you can imagine, this can be pretty annoying for some users.
Forum discussion at WebmasterWorld and several at Google AdSense Help.
Previous story: Google Begins Calling Businesses To Confirm Map Information?
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:27:42.000Z
|
ehjvrmab7uj4t4p53j5uodn2krqlzrhd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52809",
"uncompressed_offset": 684326700,
"url": "www.werelate.org/wiki/Place:Windsor_%28township%29,_York,_Pennsylvania,_United_States",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.werelate.org/wiki/Place:Windsor_(township),_York,_Pennsylvania,_United_States"
}
|
cccc_CC-MAIN-2013-20
|
Place:Windsor (township), York, Pennsylvania, United States
Watchers
NameWindsor (township)
Alt namesWindsor Township
Windsorsource: WeRelate abbreviation
TypeTownship
Located inYork, Pennsylvania, United States
source: Family History Library Catalog
the text in this section is copied from an article in Wikipedia
Windsor Township is a township in York County, Pennsylvania, United States. The population was 17,504 at the 2010 census.
Research Tips
This page uses content from the English Wikipedia. The original content was at Windsor Township, York County, Pennsylvania. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:26:03.000Z
|
ju5rwdcce2i376a2k37j6rkk7pyj7odh
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52810",
"uncompressed_offset": 684332559,
"url": "www.werelate.org/wiki/User_talk:Marty_Quaas",
"warc_date": "2013-11-22T19:23:23.000Z",
"warc_filename": "<urn:uuid:5329db00-500b-4221-85a4-4665731b1af5>",
"warc_url": "http://www.werelate.org/wiki/User_talk:Marty_Quaas"
}
|
cccc_CC-MAIN-2013-20
|
User talk:Marty Quaas
Welcome
Welcome to WeRelate, your virtual genealogical community. We're glad you have joined us. At WeRelate you can easily create ancestor web pages, connect with cousins and other genealogists, and find new information. To get started:
1. Take the WeRelate tour to see what you can do.
2. Review the tutorials to learn how to make wiki pages for your ancestors.
3. Read the etiquette page to learn expected behavior in a wiki.
If you need any help, I will be glad to answer your questions. Just click on my signature link below and then click on the “Leave a message” link under my name in the upper left corner of my profile page. Thanks for participating and see you around!--Jstump 11:01, 11 September 2008 (EDT)
Note from Don
Well, congratulations, Marty! We're on the same phone line now. The reason that you went to a blank page is that the last parenthesis in the emailed link was left off.
We're now at your User talk: page, and I want you to go to Frederick's Person: page by clicking on this underlined link. Then, when you get more time, you'll be able to follow the migrating around instructions that I sent you in the previous email.
Editing some changes [21 September 2008]
I can see that you made a number of contributions yesterday, even uploading two images. Congratulations!! Wow, you're learning fast. Be sure to watch the tutorials as you progress.
I can see that you created a Person:Fred Quaas page, which was assigned an index number (1). Since, this is the same as the Person:Frederick Quaas (3) page, I redirected it there. I did the same thing with the Person:Caroline Trimpert (2) page that you created.
I also created links for the two pictures that you uploaded. I've also sent you an email about this.--Dquass 22:18, 21 September 2008 (EDT)
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:39:27.000Z
|
ibbqcbrwmgrf6i5udqt3qewsu53i37x4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52819",
"uncompressed_offset": 9508561,
"url": "answers.onstartups.com/questions/11468/hiring-interaction-design-firms",
"warc_date": "2013-11-22T19:24:13.000Z",
"warc_filename": "<urn:uuid:97bc9d30-8a96-40be-818e-a57cb580dc27>",
"warc_url": "http://answers.onstartups.com/questions/11468/hiring-interaction-design-firms"
}
|
cccc_CC-MAIN-2013-20
|
Tell me more ×
Answers OnStartups is a question and answer site for entrepreneurs looking to start or run a new business. It's 100% free, no registration required.
I am starting a new project for my web-based company and I think the services of an interaction design company would really help me flesh out a beautiful / usable product for my customers.
Can anyone recommend interaction designers or firms they have worked with in the past and really liked?
share|improve this question
closed as not constructive by Zuly Gonzalez Aug 29 '12 at 1:26
As it currently stands, this question is not a good fit for our Q&A format. We expect answers to be supported by facts, references, or specific expertise, but this question will likely solicit debate, arguments, polling, or extended discussion. If you feel that this question can be improved and possibly reopened, see the FAQ for guidance.
3 Answers
up vote 2 down vote accepted
Please don't take this personal, but posts like this read "like a lamb walking into a den of wolves" ;)
I believe this type of forum would best help you on determining what type of usability features to think of, how to engage with a design firm, or which attributes to look for in an interaction firm. There are many good posts on these topics in this forum - take a look through the tags.
When it comes down to it, the type of firm you select is closely typed to your target market and your specific views about your product - so while I may have had a great experience working with a firm on streamlining conversions in an ecommerce project, that doesn't mean that they will be successful with your tween oriented crowdsourcing site (if that's your target).
Good luck, and happy reading!
share|improve this answer
You might want to check out www.spadeworx.com. Their User Centered Software Engineering methodology has helped us in focusing on end-user requirements.
share|improve this answer
You can find the professional designers at 99desk.com. Just post a project there and take advice from professionals. Its free to post your job.
share|improve this answer
Not the answer you're looking for? Browse other questions tagged or ask your own question.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:52:08.000Z
|
sqkpgxs2j2rlmcykkm2rwqgmcron5zwk
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52820",
"uncompressed_offset": 9519371,
"url": "answers.onstartups.com/users/6318/maxime-r?tab=activity",
"warc_date": "2013-11-22T19:24:13.000Z",
"warc_filename": "<urn:uuid:97bc9d30-8a96-40be-818e-a57cb580dc27>",
"warc_url": "http://answers.onstartups.com/users/6318/maxime-r?tab=activity"
}
|
cccc_CC-MAIN-2013-20
|
181 reputation
2
bio website twitter.com/maxMRE
location Paris, France
age 29
visits member for 2 years, 4 months
seen Oct 29 '12 at 17:40
stats profile views 10
Hello! Welcome here,
I'm an Entrepreneur & Full-stack Web Engineer in Paris, France. I create stuff. Feel free to say hi.
I have some time available as an independent contractor for consulting or web development as a good way to meet interesting people while improving my skill set.
Studied engineering and computer science in Paris and Madrid. After some years in a consulting firm I started to work for myself.
Discovered StackExchange with askubuntu when I started to use the 7.10 release back in the day. Great support we get in the open-source community.
French, so feel free to improve my english :)
Aug
1
comment How to start a software company?
Well, at that time I wasn't building webapps for everyone where you want to tell the world about it. When working in finance or for governments, you may want to be careful in your communication. But as I said, don't take my word for it !
Jan
4
answered Giving away free licences to universities, charities and open source projects
Jan
4
comment Who to contact to get projects for a start-up software company?
I can confirm we have the same system in France : big 'preferred suppliers' for big companies with subcontractors of any size.
Jan
3
awarded Teacher
Jan
3
answered How to start a software company?
Jan
3
awarded Supporter
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:02:49.000Z
|
ok5sogupakdbsvtfdzeqqun7vmkmuct3
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52827",
"uncompressed_offset": 14163640,
"url": "ask.libreoffice.org/en/question/1826/window-7-running-lo-342/",
"warc_date": "2013-11-22T19:24:13.000Z",
"warc_filename": "<urn:uuid:97bc9d30-8a96-40be-818e-a57cb580dc27>",
"warc_url": "http://ask.libreoffice.org/en/question/1826/window-7-running-lo-342/"
}
|
cccc_CC-MAIN-2013-20
|
Ask Your Question
0
Window 7 running LO 3.4.2
asked 2012-04-10 03:31:30 +0200
Sir Les
26 1 1 3
updated 2013-01-27 17:38:27 +0200
qubit
5693 3 48 41
I cannot uninstall 3.4, in order to install 3.5.2. I get a message that LO 3.4 is running, although it is closed and in Task Manager I have stopped soffice.bin and .exe.
If I attempt to install 3.5.2 over the top, I get a message at the final install screen saying,
"Please exit LibreOffice 3.4 and the LibreOffice 3.4 Quickstarter before you continue. If you are using a mulit-user system, also make sure that no other user has LibreOffice open."
My system only has one user.
delete close flag offensive retag edit
1 Answer
Sort by » oldest newest most voted
0
answered 2013-01-27 17:37:34 +0200
qubit
5693 3 48 41
Hi @Sir Les,
It looks like you need to shut down the LO 3.4 Quickstarter process. Please refer to the answers on these questions:
link delete flag offensive edit
Login/Signup to Answer
Donate
LibreOffice is made available by volunteers around the globe, backed by a charitable Foundation. Please support our efforts: Your donation helps us to deliver a better product!
Question tools
Follow
subscribe to rss feed
Stats
Asked: 2012-04-10 03:31:30 +0200
Seen: 111 times
Last updated: Jan 27
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:26:47.000Z
|
pgj5nictjfdzcwchafoesipoir7uqg3n
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52849",
"uncompressed_offset": 43500801,
"url": "cnx.org/content/m37601/1.1/content_info",
"warc_date": "2013-11-22T19:24:13.000Z",
"warc_filename": "<urn:uuid:97bc9d30-8a96-40be-818e-a57cb580dc27>",
"warc_url": "http://cnx.org/content/m37601/1.1/content_info"
}
|
cccc_CC-MAIN-2013-20
|
Connexions
Sections
You are here: Home » Content » Project Calendar
About: Project Calendar
Module by: Peter Abboud. E-mail the author
View the content: Project Calendar
Metadata
Name: Project Calendar
ID: m37601
Language: English (en)
License: Creative Commons Attribution License CC-BY 3.0
Authors: Peter Abboud (pabboud@newtechnetwork.org)
Copyright Holders: Peter Abboud (pabboud@newtechnetwork.org)
Maintainers: Peter Abboud (pabboud@newtechnetwork.org)
Latest version: 1.1 (history)
First publication date: Apr 20, 2011 3:23 pm -0500
Last revision to module: Apr 20, 2011 3:25 pm -0500
Downloads
PDF: m37601_1.1.pdf PDF file, for viewing content offline and printing. Learn more.
EPUB: m37601_1.1.epub Electronic publication file, for viewing in handheld devices. Learn more.
XML: m37601_1.1.cnxml XML that defines the structure and contents of the module, minus any included media files. Can be reimported in the editing interface. Learn more.
Source Export ZIP: m37601_1.1.zip ZIP containing the module XML plus any included media files. Can be reimported in the editing interface. Learn more.
Version History
Version: 1.1 Apr 20, 2011 3:25 pm -0500 by Peter Abboud
Changes:
Project Calendar
How to Reuse and Attribute This Content
If you derive a copy of this content using a Connexions account and publish your version, proper attribution of the original work will be automatically done for you.
If you reuse this work elsewhere, in order to comply with the attribution requirements of the license (CC-BY 3.0), you must include
• the authors' names: Peter Abboud
• the title of the work: Project Calendar
• the Connexions URL where the work can be found: http://cnx.org/content/m37601/1.1/
See the citation section below for examples you can copy.
How to Cite and Attribute This Content
The following citation styles comply with the attribution requirements for the license (CC-BY 3.0) of this work:
American Chemical Society (ACS) Style Guide:
Abboud, P. Project Calendar, Connexions Web site. http://cnx.org/content/m37601/1.1/, Apr 20, 2011.
American Medical Assocation (AMA) Manual of Style:
Abboud P. Project Calendar [Connexions Web site]. April 20, 2011. Available at: http://cnx.org/content/m37601/1.1/.
American Psychological Assocation (APA) Publication Manual:
Abboud, P. (2011, April 20). Project Calendar. Retrieved from the Connexions Web site: http://cnx.org/content/m37601/1.1/
Chicago Manual of Style (Bibliography):
Abboud, Peter. "Project Calendar." Connexions. April 20, 2011. http://cnx.org/content/m37601/1.1/.
Chicago Manual of Style (Note):
Peter Abboud, "Project Calendar," Connexions, April 20, 2011, http://cnx.org/content/m37601/1.1/.
Chicago Manual of Style (Reference, in Author-Date style):
Abboud, P. 2011. Project Calendar. Connexions, April 20, 2011. http://cnx.org/content/m37601/1.1/.
Modern Languages Association (MLA) Style Manual:
Abboud, Peter. Project Calendar. Connexions. 20 Apr. 2011 <http://cnx.org/content/m37601/1.1/>.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T09:01:40.000Z
|
ustsc6mxzeicsbex7vn24sh7ryp3ha7g
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52872",
"uncompressed_offset": 81019679,
"url": "familysearch.org/learn/wiki/en/Amherst,_New_York",
"warc_date": "2013-11-22T19:24:13.000Z",
"warc_filename": "<urn:uuid:97bc9d30-8a96-40be-818e-a57cb580dc27>",
"warc_url": "http://familysearch.org/learn/wiki/en/Amherst,_New_York"
}
|
cccc_CC-MAIN-2013-20
|
Amherst, New YorkEdit This Page
From FamilySearch Wiki
United States New York Erie CountyTown of Amherst
Contents
Resources
Church Records
History
Additional Resources:
Erie County, New York History
Genealogical Resources: History of Amherst, NY
Repositories
Archives, Libraries and Museums
Amherst Main Library at Audubon
350 John James Audubon Parkway
Amherst, NY 14228
Phone: 716-689-4922
Fax: 716-689-6116
Nederlander Research Library and Archives
c/o Amherst Museum
3755 Tonawanda Creek Road
Amherst, NY 14228
E-mail: library@amherstmuseum.org
Genealogical Resources: Genealogy Collection, edgers, scrapbooks, maps photographs. Catalog Search
Amherst Museum
3755 Tonawanda Creek Road
Amherst, NY 14228
Phone: 716-689-1440
Contact Form
Societies
Buffalo and Erie County Historical Society
25 Nottingham Court
Buffalo, NY 14216
716-873-9644
Facebook page
Genealogical Resources: Library, Guide to Genealogical Materials, city directories, church records (many Roman Catholic parishes), cemetery transcriptions, censuses, genealogy books, obituary index to Buffalo newspapers (1811-2001), private papers, obituary request form, published family histories, list of professional researchers for hire.
Erie County Historical Federation
11 Danforth Street
Chektowaga, NY 14227
Facebook page[1]
Genealogical Resources: "Loosely organized group of local historical societies and appointed town historians of Erie County, acting as a liaison between groups and providing a speakers bureau."[1]
Western New York Genealogical Society
P.O. Box 338
Hamburg, N.Y. 14075-0338
Genealogical Resources: Surname list, locality list, 1865 Census index, journal, research library.
Town Clerk
Town of Amherst, Clerk
Amherst Municipal Building
5583 Main Street
Williamsville, NY 14221
Phone: 716-631-7045
Email: sjaros@amherst.ny.us
Town Historian
Joseph Weichert[2]
3069 Tonawanda Creek Road
North Tonawanda, NY 14228
Town Records
To locate additional published and transcribed records for Amherst, New York check:
• Gordon L. Remington, New York Towns, Villages, and Cities: A Guide to Genealogical Sources (Boston: New England Historic Genealogical Society, 2002). American Ancestors online edition; At various libraries (WorldCat); FHL Book 974.7 D27r. Alphabetical list including date founded, if a town history exists, church and cemetery sources, and if a Civil War register (TCR) exists. The codes used under Church and Cemetery are defined in the link above the listing of towns, cities and villages.
Vital Records
References
1. 1.0 1.1 Erie County, New York Town Historians, Historical Societies and Historical Museums, Updated: 20 October 2004, http://wnyroots.tripod.com/index-historians.html (accessed 15 December 2011).
2. Elizabeth Petty Bentley, Genealogist's Address Book: State and Local Resources, with Special Resources Including Ethnic and Religious Organizations, 6th ed. (Baltimore, Md.: Genealogical Pub., 2009), 402. At various libraries (WorldCat); FHL Book 973 D24ben 2009.
Places
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 5 March 2012, at 23:00.
• This page has been accessed 292 times.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:21:11.000Z
|
ojlpd37zcutf6efz3oicsuwv4y2kqy2o
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52873",
"uncompressed_offset": 81039446,
"url": "familysearch.org/learn/wiki/en/Lombardy%28Lombardia%29_Jurisdictions",
"warc_date": "2013-11-22T19:24:13.000Z",
"warc_filename": "<urn:uuid:97bc9d30-8a96-40be-818e-a57cb580dc27>",
"warc_url": "http://familysearch.org/learn/wiki/en/Lombardy(Lombardia)_Jurisdictions"
}
|
cccc_CC-MAIN-2013-20
|
Lombardy (Lombardia) JurisdictionsEdit This Page
From FamilySearch Wiki
Contents
Province (Provincia)
The State Archive (Ufficio dello Stato Civile) of each province is located in the provincial capital. Municipalities provided the state archives with copies of their original civil registration during the years 1809-1865.
Tribunal (Tribunale)
From 1866 to the present time, copies of civil registration are sent to the Tribunale (much like a county court in the United States) from the towns that lie within its jurisdiction. Each province has several tribunali.
Town/Municipality (Comune)
A town (comune) recorded and still records the births, marriages, and deaths of everyone within its jurisdiction. This may include outlying smaller villages and farms. The original is kept in the comune while copies were sent to the state archives (1809-1866) and to thetribunale (1866-present).
Hamlet/Ward/Village (Frazione)
A hamlet is referred to as a frazione. A comune may have several frazioni within its boundaries. Usually the civil records for a frazione are kept in the larger comune.
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 13 September 2011, at 07:14.
• This page has been accessed 757 times.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T07:49:50.000Z
|
go6v6li6qfp6vv6l6k4gswzs4ze27g22
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52903",
"uncompressed_offset": 119407647,
"url": "josm.openstreetmap.de/ticket/5965",
"warc_date": "2013-11-22T19:24:13.000Z",
"warc_filename": "<urn:uuid:97bc9d30-8a96-40be-818e-a57cb580dc27>",
"warc_url": "http://josm.openstreetmap.de/ticket/5965"
}
|
cccc_CC-MAIN-2013-20
|
Modify
Opened 2 years ago
Closed 2 years ago
Last modified 2 years ago
#5965 closed defect (fixed)
NullPointerExeptition when enabling wms in rev 3906 (local build)
Reported by: anonymous Owned by: team
Priority: critical Component: Core
Version: latest Keywords: template_report
Cc:
Description
What steps will reproduce the problem?
What is the expected result?
What happens instead?
Please provide any additional information below. Attach a screenshot if
possible.
Build-Date: 2011-02-15 20:30:09
Revision: 3906
Is-Local-Build: true
Identification: JOSM/1.5 (3906 SVN da)
Memory Usage: 144 MB / 672 MB (19 MB allocated, but free)
Java version: 1.6.0_22, Sun Microsystems Inc., Java HotSpot(TM) Server VM
Operating system: Linux
Dataset consistency test: No problems found
Plugin: DirectUpload (25199)
Plugin: buildings_tools (25192)
Plugin: editgpx (25192)
Plugin: graphview (25199)
Plugin: mapdust (25199)
Plugin: osmarender (25192)
Plugin: reverter (25190)
Plugin: routing (25199)
Plugin: undelete (25199)
java.lang.NullPointerException
at org.openstreetmap.josm.gui.layer.TMSLayer.paint(TMSLayer.java:1199)
at org.openstreetmap.josm.gui.MapView.paintLayer(MapView.java:450)
at org.openstreetmap.josm.gui.MapView.paint(MapView.java:504)
at javax.swing.JComponent.paintChildren(JComponent.java:862)
at javax.swing.JSplitPane.paintChildren(JSplitPane.java:1030)
at javax.swing.JComponent.paint(JComponent.java:1038)
at javax.swing.JComponent.paintToOffscreen(JComponent.java:5124)
at javax.swing.RepaintManager$PaintManager.paintDoubleBuffered(RepaintManager.java:1479)
at javax.swing.RepaintManager$PaintManager.paint(RepaintManager.java:1410)
at javax.swing.BufferStrategyPaintManager.paint(BufferStrategyPaintManager.java:294)
at javax.swing.RepaintManager.paint(RepaintManager.java:1224)
at javax.swing.JComponent._paintImmediately(JComponent.java:5072)
at javax.swing.JComponent.paintImmediately(JComponent.java:4882)
at javax.swing.RepaintManager.paintDirtyRegions(RepaintManager.java:785)
at javax.swing.RepaintManager.paintDirtyRegions(RepaintManager.java:713)
at javax.swing.RepaintManager.seqPaintDirtyRegions(RepaintManager.java:693)
at javax.swing.SystemEventQueueUtilities$ComponentWorkRequest.run(SystemEventQueueUtilities.java:125)
at java.awt.event.InvocationEvent.dispatch(InvocationEvent.java:209)
at java.awt.EventQueue.dispatchEvent(EventQueue.java:597)
at java.awt.EventDispatchThread.pumpOneEventForFilters(EventDispatchThread.java:269)
at java.awt.EventDispatchThread.pumpEventsForFilter(EventDispatchThread.java:184)
at java.awt.EventDispatchThread.pumpEventsForHierarchy(EventDispatchThread.java:174)
at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:169)
at java.awt.EventDispatchThread.pumpEvents(EventDispatchThread.java:161)
at java.awt.EventDispatchThread.run(EventDispatchThread.java:122)
Attachments (0)
Change History (11)
comment:1 Changed 2 years ago by Zverikk
comment:3 Changed 2 years ago by Zverikk
comment:4 Changed 2 years ago by Zverikk
comment:5 Changed 2 years ago by glebius
comment:6 Changed 2 years ago by Zverikk
comment:7 Changed 2 years ago by Upliner
• Resolution set to fixed
• Status changed from new to closed
comment:8 Changed 2 years ago by Zverikk
comment:9 Changed 2 years ago by skyper
comment:10 Changed 2 years ago by skyper
comment:11 Changed 2 years ago by skyper
Modify Ticket
Change Properties
<Author field>
Action
as closed .
as The resolution will be set. Next status will be 'closed'.
The resolution will be deleted. Next status will be 'reopened'.
Author
E-mail address and user name can be saved in the Preferences.
Note: See TracTickets for help on using tickets.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:40:33.000Z
|
ljnlak6ag3bqgc5jxcfrb6bgde7l362j
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52905",
"uncompressed_offset": 119500021,
"url": "journals.iucr.org/a/issues/2012/01/00/ib5003/ib5003fig8.html",
"warc_date": "2013-11-22T19:24:13.000Z",
"warc_filename": "<urn:uuid:97bc9d30-8a96-40be-818e-a57cb580dc27>",
"warc_url": "http://journals.iucr.org/a/issues/2012/01/00/ib5003/ib5003fig8.html"
}
|
cccc_CC-MAIN-2013-20
|
Figure 8
Simulations of two-dimensional intensity maps obtained with model 1 for various values of the disorder parameters. The results for the geometry [the probing beam perpendicular to the in-plane component of the basis vector ] are shown. We assumed and . (a)-(c) Influence of . The dashed lines parallel to the Qz axis indicate the sheets caused by the in-plane correlation of the QD positions. The correlation of the dot position in different layers gives rise to tilted sheets indicated by dash-dotted lines. (d)-(f) Influence of . (g)-(i) Influence of . (j)-(l) Influence of . The symbols P1-P12 denote the sets of disorder parameters given in Table 1. The QDs are assumed to be spherical.
|
v0
|
2024-06-03T21:29:49.458Z
|
2013-05-18T08:50:01.000Z
|
bfhg24eaw2cejgsc6esj3z7y45aye7jw
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:52906",
"uncompressed_offset": 119568602,
"url": "journals.tdl.org/icce/index.php/icce/article/view/2995",
"warc_date": "2013-11-22T19:24:13.000Z",
"warc_filename": "<urn:uuid:97bc9d30-8a96-40be-818e-a57cb580dc27>",
"warc_url": "http://journals.tdl.org/icce/index.php/icce/article/view/2995"
}
|
cccc_CC-MAIN-2013-20
|
NEW WAVE PRESSURE FORMULAE FOR COMPOSITE BREAKWATERS
Yoshimi Goda
Abstract
A proposal is made for new wave pressure formulae, which can be applied for the whole ranges of wave action from nonbreaking to postbreaking waves with smooth transition between them. The design wave height is specified as the maximum wave height possible at the site of breakwater. The new formulae as well as the existing formulae of Hiroi, Sainflou, and Minikin have been calibrated with the cases of 21 slidings and 13 nonslidings of the upright sections of prototype breakwaters. The calibration establishes that the new formulae are the most accurate ones.
Keywords
wave pressure; composite breakwater; breakwater desgin
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
|
v0
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.