added
stringdate 2024-06-03 18:26:11
2024-06-04 03:14:13
| created
stringdate 2013-04-29 18:49:42
2014-01-03 01:38:26
| id
stringlengths 32
32
| metadata
dict | source
stringclasses 2
values | text
stringlengths 237
356k
| version
stringclasses 1
value |
|---|---|---|---|---|---|---|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:34.000Z
|
sa5mkgrwdfzjzs6mxdqlyhb6ogai3z2g
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67438",
"uncompressed_offset": 301249975,
"url": "wikitravel.org/en/Dinas_Mawddwy",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://wikitravel.org/en/Dinas_Mawddwy"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Dinas Mawddwy
From Wikitravel
Jump to: navigation, search
Dinas Mawddwy is a village in Gwynedd.
[edit] Get in
Dinas Mawddwy is just off the A470, the main north-south trunk road in Wales. The nearest railway station is at Machynlleth, from where there is a regular bus service.
[edit] Get around
[edit][add listing] See
[edit][add listing] Do
• Take the unclassified road from the village centre to Llanuwchllyn, at the southern end of Bala Lake, across Bwlch y Groes, the highest road in Wales.
• The Bwlch yr Oerddrws pass to the west, which carries the A470 towards Dolgellau is a popular location for photographers trying to catch spectacular shots of low-flying military jets [1]
[edit][add listing] Buy
• Meirion Mill, (Right next to the A470), 01650 531311, [2]. Well known outlet for woollen items and other traditional goods. edit
[edit][add listing] Eat
[edit][add listing] Drink
• Red Lion Hotel (Gwesty'r Llew Coch), 01650 531247, [3]. The oldest building in the village, dating back to the 12th Century. Real ales and traditional food. Rooms available. edit
[edit][add listing] Sleep
• Buckley Pines Hotel, 01650 531261, [4]. Built in 1873, this is said to be the oldest reinforced-concrete building in Europe. This may bring to mind images of grim 1960s shopping centres or tower blocks, but the reality could not be more different as the building resembles many other Welsh country house hotels. edit
• Celyn Brithion Caravan and Camping Site, 01650 531 344, [5]. edit
[edit] Contact
[edit] Get out
This article is an outline and needs more content. It has a template, but there is not enough information present. Please plunge forward and help it grow!
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
other sites
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:23:03.000Z
|
mwntwaxgnffm7spey42nt6ki7fm4shia
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67446",
"uncompressed_offset": 311587157,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Previousproducts/1301.0Feature%20Article292001?issue=2001&prodno=1301.0&tabname=Summary",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Previousproducts/1301.0Feature%20Article292001?opendocument&tabname=Summary&prodno=1301.0&issue=2001&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1301.0 - Year Book Australia, 2001
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 25/01/2001
Page tools: Print Page RSS Search this Product
ACCOUNTING FOR AUDIENCES IN AUSTRALIAN MUSEUMS
Dawn Casey and Kirsten Wehner
Dawn Casey was appointed as Director of the National Museum of Australia in 1999. Prior to her appointment she was Chief General Manager of the Acton Peninsula Project Task Force, the body responsible for the construction of the new National Museum.
Ms Casey has wide-ranging experience in the management of indigenous and cultural heritage policy issues. As a member of the Department of Prime Minister and Cabinet, she was responsible for the establishment of the Council for Aboriginal Reconciliation.
She has provided policy advice on issues associated with Australia's national cultural institutions and served as Chair of the Heritage Collections Committee, the body with responsibility for implementing specific programs to address issues of collection management, preservation and conservation, research and documentation, and access.
Ms Casey has received three Commonwealth Public Service Australia Day Medals for work of outstanding achievement.
Kirsten Wehner is currently a Content Developer at the National Museum of Australia and a doctoral candidate in the Department of Anthropology, New York University, where she is preparing a dissertation on the development of the National Museum. Her research interests include museum and exhibition content and design, the role of museums and other media in negotiating cultural identities, and contemporary Australian cultural politics and popular culture.
INTRODUCTION
Australia boasts over 1,700 museums, including museums housing collections of cultural and historical interest, art galleries, science centres, historic sites, house museums, outdoor museums and interpretation centres.1 Each year, more than 16 million visitors journey through these institutions, encountering and engaging with Australia’s cultural and natural heritage.2 Who are these visitors and why do they go to museums? What do they expect to find in a museum? What does a visitor take away with them after a day at a museum? In the 1990s, Australian museums have become increasingly interested in such questions. Positions have been created for staff dedicated to investigating museum audiences, sophisticated research and evaluation tools have been developed, and a Special Interest Group of the museum profession’s national association has been formed to work towards refining and improving means of knowing about museum audiences. In 1993-94, when the Council of Australian Museum Directors surveyed 23 participating institutions about their evaluation and visitor research activity, the museums indicated that they had completed 47 visitor research projects, 65 exhibition evaluations and another 15 associated program evaluations. Three years later, in 1996-97, the Council’s survey showed that the 20 participating institutions had conducted 121 visitor research studies, 86 exhibition evaluations and 78 program evaluations. Budget expenditure on visitor research and evaluation over the three years had increased by 3723
These figures seem to indicate an explosion in the attention museums are paying to their visitors in the last decade. Questions about who museum visitors are and what they do when visiting have, however, interested Australia’s museums since the first such institution was founded in the 1820s. Museums have always understood themselves to possess a dual mandate, to collect, research and preserve material evidence of people, cultures and environments and to interpret those collections for the education and sometimes entertainment of particular audiences. These two tasks have provided an ongoing dynamic at the heart of Australia’s museums, but the nature and relationship of each has changed significantly since the 1820s. How have museums in Australia imagined, constituted and sought to understand their audiences over this period, and what does this reveal of the changing ways museums have understood their role in and contributions to Australian society?
Colonial museums and ‘respectable individuals’
Australia’s first museums were established by the élite of colonial society, and they did not wait long after arriving in the new continent to get started. In the first century of European settlement in Australia, major museums, often associated with a library and an art gallery, were established in each of the metropolitan centres. The Australian Museum was founded in Sydney in 1827, and the Tasmanian Museum and Art Gallery in Hobart in 1848. In the 1850s, the colonies of Victoria, Queensland and South Australia all established museums, and Western Australia followed suit in the early 1890s. By Federation in 1901, Australia’s cities already boasted significant museums, their edifices, sited prominently in the centre of town, declaring the rule of civilisation in the Antipodes.
These early museums were formed primarily through the efforts of clubs of amateur gentlemen scientists, such as the Philosophical Society of Australasia, the Philosophical Institute of Victoria and the Royal Society of Tasmania. Eager to institute in the colonies the organisations for enlightened discussion, scientific debate and serious research which had been their domain in Europe, these societies developed museum collections for their own edification and enjoyment, often housing them in part of the local university. Access to these early museums was restricted to members of the learned society, professors or students from associated universities, and other local or visiting members (usually male) of the educated class who might be granted permission through reputation or connection.
By the 1850s, the founders of Australia’s museums were petitioning colonial governments to provide public monies to construct significant buildings to house their institutions. In part, perhaps, this reflects the growth in museum collections up to this time, but more importantly, it also signals a profound change in the conception of the museum itself. By the middle of the nineteenth century, the notion of the museum as a technology for universal public education had gained a strong hold in the Australian colonies, imported primarily from England where the idea of a ‘public museum’ open to all had been developing since the 1830s. The idea of the museum as a cultural resource for the educated classes had been joined by the concept of the museum as a means of reforming the uneducated. At the heart of this new conception of the museum was a widespread concern among social reformers that what they saw as the depredations of the working classes were leading to social decline and political unrest. Exposing the working classes to the refining influences of science and art through institutions such as the museum, the library and the school was believed to be one way in which the working classes could be diverted from such behaviours. Time spent at the museum would, at its most practical, be time not spent at the public house or in other ‘common excitements’.
Working class men in particular were seen as the target of the museum’s civilising influence. Social philosophies of the time held that such men, through absorbing the principles of rational thought embodied in science and the examples of virtue and courage expressed in art, might be set on a road of self-improvement through which they would become the “prudent, thrifty and responsible heads of households” 4 The museum was a means by which the dissolute might become useful contributors to society and economy. Australia’s colonial governments were evidently persuaded relatively quickly of the social value of museums as, from the 1850s, they contributed funds to establish what are now the major State museums. Australia’s museums were, from the first, created as public institutions.
The idea of the museum as a tool of public education and improvement entailed a new relationship between the museum and its visitors. The audience for any museum now ideally included all members of society, and the success of a museum depended not only on its collections but also on the number of people it attracted. Visitor numbers could now provide some measure of how effectively the museum was fulfilling its mandate to enlighten and civilise all sectors of society. In 1859, for example, when the Royal Society of Tasmania petitioned the colonial Governor for funds to construct a building to house a ‘national museum of natural history and the arts’, together with the Society’s library, it cited the fact that the number of visitors to its existing premises had doubled in two years. This was evidence, the Society argued, of the value of the museum in "stimulating and promoting mental culture and intellectual improvement".5 It appears, however, that although many museums kept statistics on the number of visitors, the methodology of collection was never anything but impressionistic. A favourite technique for measuring visitors was to count numbers of visitors over bank holidays or weekends, the most popular visiting times for working class people, and to use these numbers to assess how effectively the museum was fulfilling its educational mandate. The well-to-do middle and upper classes, it seems, were safely assumed to be already dutifully visiting.
The museum’s new understanding of its audience as the entire general public created new challenges for the institution. It now had to get new visitors in the door, drawing the working classes away from their everyday amusements such as the circus and the vaudeville and teaching them to enjoy the restrained satisfaction of acquiring new knowledge. Museum curators clearly wished to distance their institutions from these plebeian entertainments. Anxious to maintain the air of scientific endeavour and civilised authority which they took as their mission, they also recognised the problems of attracting visitors. Museums experimented with new display techniques such as dioramas and panoramas, designed to impress visitors with new viewpoints and interesting subjects. Australia’s museums became some of the first to develop what later became known as ‘outreach programs’ designed to bring the museum to social groups who would not regularly visit. And by the 1880s, children became seen less as unsavoury nuisances and more as ideal visitors upon whom the civilising mission of the museum could be effected through targeted education programs.6
Australia’s colonial museums also participated in the creation of displays for the international exhibitions and worlds fairs of the nineteenth and early twentieth centuries. These extravaganzas, often combining sideshow with scientific exhibition, drew a diverse crowd. The upper classes enjoyed the curiosities of the world as did the working classes, and the mercantile middle class perhaps saw new opportunities for trade and industry. In keeping with this diverse audience, displays representing the various Australian colonies at international exhibitions tended to combine specimens of the continent’s unusual flora and fauna, Aboriginal artefacts, and examples of the colonies’ natural resources and primary industries such as wool and gold. The colonial museums often participated in such events, sometimes by supplying artefacts for exhibition and advising on display and sometimes absorbing the contents of displays into their collections after the major exhibition closed. Through such work, museums showed themselves as places of potential interest to a wide variety of people. They became the repositories of the rare and curious, and sources of information about economic opportunities in the Australian colonies, while maintaining their association with scientific education.
Beyond their commitment to educating the general public, Australia’s museums continued their commitment to a long established audience. Australia’s first museums were primarily natural history museums, dedicated to developing large collections of the geological, floral and faunal resources of the continent. These museums encapsulated the Victorian enthusiasm for collecting, ordering and preserving the natural world within a unified system of classification. The process of cataloguing the new continent’s natural history was a process of incorporating what appeared to European eyes ‘new’ forms of life into established European scientific taxonomies. In understanding their collecting work in this way, Australia’s colonial museums implicitly recreated an international scientific community as their audience. This was a community, moreover, with its centre in Europe. This is abundantly evident in the considerable passage of specimens of indigenous species or geological formations from the Australian colonies to the collections of European museums, and the dissemination of European systems of thought through the practice of science.
Australia’s colonial museums thus positioned themselves between two audiences. On the one hand, the ‘public’, often thought of as an undifferentiated mass requiring enlightenment and needing to be attracted, and on the other hand, a scholarly community of scientists and intellectuals who would provide the resources for enlightenment and education. At times, museums were evidently squeezed between the two as, throughout the nineteenth century, critics charged museums both with abandoning intellectual rigour in favour of the lowest common denominator and of alienating visitors through being high-brow and inaccessible. Despite these pressures, the colonial museum remained a place where the educated expert would provide information, and the uneducated everyday visitor would absorb it. There was no sense that all members of the audience should have access to the museum in terms of the museum representing and speaking to their own particular interests and concerns.
Evolving an audience
The focus of Australia’s early museums on natural history gained strength throughout the nineteenth century. Practices of exhibition emphasised the display of collections of flora and fauna, and mineralogical and geological specimens, according to scientific systems of classification which demonstrated typological relationships. Frederick McCoy, for example, the first director of the National Museum of Victoria, stipulated that the specimens of the Museum’s palaeontological collections would be
"… first divided into geological groups or periods according to the distribution in time and analogous to the distribution in space indicated by the arrangement of the collections of specimens of the living species. The fossils of each formation are then arranged in zoological systematic order, and fully named with genus, species, locality and formation"7
Such exhibitions were seen to embody and communicate the principles of order, rationality and considered examination which lay at the heart of enlightened thinking and behaviour. These exhibitions were seen as one of the tools through which the masses might learn such attitudes and self-disciplines; and they consequently rested at the heart of the museum’s ‘civilising mission’.8
The new role for museums as educators of the public also emphasised the importance of art, sculpture, literature and other products of ‘civilisation’ in refining the morals and sentiments of working people. Art and culture would improve ‘taste’, while natural history taught ‘reason’. This emphasis on the possibilities of high culture led almost every Australian colony to found, between the 1860s and 1900, public art galleries and museums of applied arts, science and technology. These new museums, and particularly the museums of applied arts, science and technology, also represented a continuation of an alternative museum tradition in the Australian colonies. From the 1830s to the 1860s, Mechanics Institutes flourished in Australia, offering labourers and the less well-to-do middle classes lessons and lectures in both technical and intellectual subjects. Attached to these Institutes were often small collections of objects, art and books, providing teaching and cultural resources. As the larger metropolitan museums (and libraries) were founded and developed a public education mandate, the collections of urban Institutes tended to be absorbed by them. Some Institutes, and particularly rural ones, persisted longer, often until governments created colony- or State-wide technical schooling organisations and libraries to take up and extend the work of the Institutes.9
After the 1860s, the collection and exhibition practices of all these museums came to be increasingly shaped by theories of natural and social selection, succession and progress deriving from evolutionary thinking. Exhibitions of art and culture were important in declaring the common heritage of Australian and European society through bringing the masterpieces, or at least copies of masterpieces, of European civilisation to Australia. Natural history and particularly ethnological collections and exhibitions, however, carried the primary burden of communicating concepts of social evolution.
Australia’s colonial museums had collected Aboriginal and Torres Strait Islander artefacts, and sometimes human remains, since their foundation, understanding Australia’s Indigenous inhabitants as part of the curious natural history of the continent. After the 1860s, as ideas about social evolution gained wider acceptance, museums rapidly increased the size of these ethnological collections. Aboriginal people came to be seen as part of a ‘nature’ which would inevitably be destroyed by the advance of white civilisation, or as members of a ‘primitive’ race who would naturally be superseded by more ‘highly developed’ human races. These ideas were embodied in exhibitions expressing principles of hierarchical categorisation and succession and positioning men of white European extraction, or their artistic, cultural and technological products, at the hierarchical apex. Museum visitors were implicitly addressed as the inheritors of the progressive triumph of superior races.
Australia’s colonial museums thus displayed and validated the perspectives and experiences of a very limited group of people - educated, white European men. Australian Aboriginal and Torres Strait Islander peoples, although not formally excluded, clearly only found their way into the museum as dead specimens of a ‘primitive’ people, or were represented through their artefacts displayed as ‘simple technologies’. There was no sense in which Aboriginal and Torres Strait Islander people constituted a part of the audience imagined by the museum. Other groups, such as women and non-European ethnic minorities, were more complexly addressed. White women at least were evidently regarded as a part of the museum audience, but their specific interests and knowledges were rarely addressed. By the turn of the century, American feminists in particular began to argue that although museums purported to offer a universal representation of the world - its natural, social and cultural development - they failed to address women or accord sufficient attention to their art and culture. Museums, first-wave feminists proclaimed, were missing out on half the world.10
Discovering national history
When Australia celebrated its federation in 1901, the efforts of the colonial élites had ensured that the new nation boasted a good number of well-established museums. Dedicated to natural history, ethnology, art and technology, and informed by ideas about evolutionary progress and public education, these museums formed a network of collecting and exhibiting institutions that bound Australia firmly to the Empire. Australian museums were interested in representing Australia as a distinct place, developing displays for local and international exhibitions of the nineteenth and early twentieth centuries. These displays focused on what was rare, curious and exciting about Australia, as defined by metropolitan European eyes. Collections of Aboriginal artefacts, for example, were displayed as markers of Australia as a unique location, as well as in contrast to the fruits of Australian colonisation. Collections of unusual faunal species and displays of mineral wealth similarly presented Australia as the land of things one would never find in Europe.
Representations of Australia in museums and at world exhibitions demonstrated a nascent sense of national difference, but it was not a sense of identity based around either a narrative of Australian human history or the Australian nation. Unlike the exhibitions of contemporary European museums, Australian exhibitions did not reflect on the qualities and courses of the past hundred years of life in Australia, but rather on how far the nation had come since European colonisation.11 It was the accomplishment of civilisation rather than the character of Australian society that mattered. Not one colonial museum held a significant collection of historical material, although some odd relics had found their way into the natural history museums,12 and by 1908 the Commonwealth Government had accumulated a haphazard ‘national collection’ of historic artefacts. These small collections focused on those men seen as the founding fathers of Australia: explorers, politicians, and scientists. Of course, the large collections of Aboriginal artefacts held by Australia’s museums were themselves historical objects, testaments not only to centuries of Indigenous experience in the continent but also to the more immediate history of colonisation. It was not until the decades after the 1960s, however, that museum professionals and the broader public would come to think of Aboriginal history in the same way as they understood human history more generally.
The buildup of national sentiment in Australia as the colonies approached federation generated a number of proposals for a national museum, although these contained little more than a glimmer of interest in exploring the human history of the continent rather than asserting the success of Australian society. In 1887, for example, Henry Parkes proposed a Memorial State House for Sydney’s Centennial Park that would celebrate the centenary of colonial settlement. The monument would include a great hall containing documents and relics illustrating the historical, material and industrial stages of the Colony’s progress, and the “customs, languages and ethnological characteristics of the aboriginal races of Australia”. 13 A second proposal at the time of Federation suggested a grand arch standing in Sydney which might contain a room for historical records and curios. In 1902, Arthur Woodward, Head of the Art Department at the Bendigo School of Mines, proposed a museum, to be located in the federal capital, covering archaeology, paintings, prints and drawings, Australian and natural history, and a portrait gallery; and Walter Burley Griffin’s plan for Canberra included a monument storing archives and relics and located on Capital Hill. None of these projects ever got off the ground.
The 1920s saw two further proposals for national museums, although these retreated further from any interest in national history. By 1924 Professor Colin Mackenzie had secured government funds to build a National Museum of Australian Zoology displaying the comparative anatomy of Australian fauna. Opened in 1931 as the Australian Institute of Anatomy, the institution focused on natural history and ethnological collections. In 1927, A.R. Radcliffe-Brown, Professor of Anthropology at the University of Sydney, also proposed a national museum focusing on ethnology, primarily Australian but encompassing eventually "all peoples and ages of the world". The museum was designed to prevent the ongoing export of Australian ethnological collections to Europe and also to function as a resource for anthropological research. When Radcliffe-Brown’s proposal was submitted to Cabinet, a Departmental submission suggested that the museum should encompass not only ethnological material but also "articles of historic interest and articles Australian in character", such as a Cobb & Co coach owned by the Government and Charles Sturt’s surveying equipment.14 An inquiry into the proposal, however, reduced the museum again to a focus on natural history, and eventually the project foundered in the face of the 1930s Depression.
This lack of sustained interest in Australia’s history since 1788 derived perhaps from the fact that Australians felt little direct connection to the kinds of events which, at the time, were understood to constitute history. European museums housed objects of classical antiquity, royalty, imperial conquest, nation formation and war. Australians, however, brought little consciousness of their national identity to their experience of such events until the war of 1914-18. Moreover, the study of Australian history was born at a time when history was understood as a discipline of words, and a discipline dedicated to calculating the progress of civilisation and the formation of the state. Written or printed evidence, records, correspondence, documents, registers and census data were constituted as the key material remains of history in Australia. 15 It is perhaps consequently unsurprising that the first major museum which explicitly took the historical experience of Australians as its focus was the Australian War Memorial.
Developed since 1918 and eventually opened in its permanent home in Canberra in 1941, the Australian War Memorial was intended both to commemorate the sacrifice of Australians in war and to present the experience of Australian servicemen (and, to a lesser extent, women). This latter function was to be achieved through extensive exhibitions of objects, images and dioramas evoking the experience of battle. The War Memorial was to be a place to which returned veterans could bring their families to help explain to them what they had experienced, and a focus for grieving for widows and parents whose husbands, lovers and children had not returned home. 16 The Memorial emphasised the subject of patriotic sacrifice within the frame of the Australian nation, its displays centred around the figure of a serviceman who, while of European stock and still rather fond of England, was definitively Australian. 17 As such, the Memorial became the first major museum in Australia to explicitly imagine its audience as a national community, rather than an imperial or a racial one.
Audiences and their behaviours
Apart from the establishment of the Australian War Memorial, it appears from the available research that there was little substantive change in the way Australia’s museums understood their purpose and character between the close of the nineteenth century and the middle of the twentieth. In the 1950s, Australia’s major museums were mostly still presenting exhibitions informed by the ideas of social and natural evolution and racial progress that had emerged in the previous century. Museums continued to assert that such representations encapsulated the natural and human worlds. Australian museums also continued to understand themselves as primarily institutions for public education, as arenas where the knowledgeable few might create technologies which would encourage the rest of society to rational enjoyment, greater knowledge and improved sentiment. From the 1920s, however, Australian museums began to envisage the process of education in which they were engaged, and particularly the audiences which they were educating, in new ways. The process of education was no longer assumed, or estimated from the fact of people visiting the museum, but itself became a subject of analysis.
At the beginning of the twentieth century, museum professionals, and especially those in the United States, began to look at what visitors actually did in the museum and particularly within exhibitions themselves, and what they derived from the experience of visiting. Inspired by new methods and ideas in psychology and education that emphasised experimental research and statistical analysis of behaviour, visitor research began with simply observing and recording what people did in museum exhibitions. Early research identified phenomena such as ‘museum fatigue’, generated by exhibitions requiring too much effort to apprehend and understand, and was concerned to identify how to make museums more enjoyable and comfortable experiences by altering exhibit design.18
Studies of the 1920s and into the 1930s employed hidden observers to record how visitors moved through exhibitions, identifying how long they paused in front of particular objects and whether exits distracted visitors from the exhibits. Experimentally minded researchers persuaded museums to design maze-like exhibitions in which observers could record visitors’ reactions to various spatial and aesthetic qualities. These studies stimulated new approaches to exhibition design as they encouraged an understanding of the exhibition as an environment for processing visitors. Museums sought new techniques, such as the division of exhibition space into cells or chambers, and the use of clear organisational plans, to direct and hold visitors at the most important parts of the exhibition. The time visitors spent observing or dwelling in one area was equated with the visitors’ absorption of knowledge from that area.19
These early studies constituted the first steps in the development of exhibition evaluation methodologies designed to establish what visitors were actually learning during their visits to museums. As evaluation emerged as a distinct practice in the late 1950s, the earlier focus on visitor observation was largely replaced by survey research designed to elicit visitor parameters and their attitudes to exhibitions, and to estimate the amount and nature of information visitors derived or retained from museums programs. During the 1960s, primarily through the work of the American researchers Harris Schettel and C.G. Screven, this practice was formalised as an evaluation process demanding the prior clarification of the cognitive or affective objectives of an exhibition, a statement of practical behavioural objectives for the exhibition, and the measurement of the achievement of those objectives.20 This approach to evaluation, which dominated museums through the 1960s and is still a powerful influence, tended to see exhibitions as extensions of the school or book and focused almost exclusively on learning objectives. Visitors were understood as essentially the passive recipients of the museum’s educational message, and the museum retained a vision of itself as a technology for the transmission of expert knowledge to a relatively uneducated visitor. Evaluation was simply providing information on how to better effect that transmission.
It is somewhat unclear how influential these early evaluative studies were in Australian museums, although the predominantly American methodologies were certainly being implemented by the 1970s. By the 1960s, Australian museums had also started to investigate their visitors in another way. Museums began trying to establish who their visitors were and why they visited, employing survey questionnaires, sometimes supported by interview, to develop complete sociographic profiles of visitors. The first major survey conducted by the Australian Museum in 1976, for example, sought to establish general patterns of visitation, frequency of visit, associated visiting habits, place of residence of the visitor, method of travel to the Museum, source of information about the Museum, and preferences for certain exhibitions. Place of residence was used to deduce the socioeconomic status of visitors, and data on age and ethnic background was gathered through observation. 21 These early systematic surveys were devoted to gathering quantitative data from which generalisations about the typical museum visitor might be drawn.
The development of visitor studies was driven by the continuing need for museums to demonstrate that they were attracting a significant portion of the general public, and that people were actually learning something, given contemporary understandings of education, when they visited. Both of these criteria were central to their continued life as public institutions, and statistical data on visitors were often understood to be useful in disproving the public’s supposed image of the museum as a boring and irrelevant place. The increasing profile, from the 1960s, of marketing as a profession and practice also had a significant impact on Australian museums’ attitudes to visitors. From a marketing perspective, visitor research was important as a tool for devising policies and strategies that would enable museums to better tailor their programs to their audiences, both people who were already visitors, and eventually those who were not. Marketing, based on visitor research, became seen as one of the most important tools through which museums could attract the widest possible range and greatest possible number of visitors.
Disturbingly for Australian museums, the data provided by visitor research seemed to indicate that museums were far from fulfilling their public educational mandate. Studies confirmed what seemed to have been implicitly understood in the nineteenth century - that visitors to museums tended to be restricted to people who were well-educated and came from higher than average socioeconomic backgrounds. One interpretation was that museums were in fact discriminating against people without the educational and cultural skills needed to apprehend and enjoy museum displays. In addition, evaluation studies seemed to suggest that visitors were not merely absorbing information from exhibitions, but were supplying as much as receiving meanings and understandings. This evidence made it very difficult to demonstrate behavioural changes occasioned by the museum visit. Until the 1970s, Australian museums tended to continue responding to these results by seeking to bend the population to their will, understanding that methods of marketing and display were inadequate to the educational task and needed to be improved, rather than considering that museums were failing because they did not address the contemporary interests of diverse social groups.
The museum transformed
Between the 1970s and the end of the twentieth century Australian museums began a profound transformation in their collecting and exhibitionary practices that derived from a new understanding of the relationship between museums and their publics. By the 1970s, museum practices which emphasised, often exclusively, the perspectives, experiences and interests of educated, white men were being challenged in a number of ways. Challenges from within museums tended to draw on a new body of museum scholarship that focused on the ways that museum exhibitions addressed and validated limited notions of who their visitors were and partial visions of history and society. Critics argued that these practices alienated potential visitors who felt, upon visiting the museum, excluded and derided rather than incorporated into an encompassing story of the world.22
Museums also faced often vehement criticisms from the variety of new social movements which gathered momentum during the 1970s. The women’s movement led the way in many respects, following feminists of the late nineteenth century in arguing that if public museums were going to claim to represent the entire range of human knowledge, they needed to pay more attention to women’s culture and experience. Similar arguments were made, with equal fervour, by working class movements, minority ethnic communities and Indigenous Australians. The challenges these groups sent out to museums entailed not only calls that they be accorded equal representation in the museum, but also that there be improved opportunities for women, working class communities, ethnic minorities and Indigenous people to participate in governing museum collections and in producing museum exhibitions and programs.23
Indigenous challenges to Australian museum practice have been perhaps the most telling and required the greatest changes. In most Australian museums of the 1960s, Aboriginal and Torres Strait Islander peoples tended still to figure only as representing ‘stages’ in hierarchies of cultural or racial evolution. Indigenous Australians were understood as essentially people outside of time, their cultures frozen beyond history and consequently an anachronism in the contemporary world. Aboriginal and Torres Strait Islander artefacts were displayed exclusively in terms of European-Australian cultural understandings. By the 1980s, Australian museums were beginning to understand the negative impact such representations and appropriations were having on the cultural and material conditions of Indigenous people. From this period, museums began to accede to demands and sometimes initiated programs to incorporate Indigenous protocols and understandings into museum practices. Repatriation programs started to return human remains to Aboriginal communities for burial. Secret/sacred objects were removed from public display and collection storage reconfigured to respect Indigenous classifications. Consultation processes with Indigenous communities and employment initiatives were established to include Indigenous people in museum decision making.
It was not until the 1990s, however, that Australian museum exhibition practices really began to reflect new understandings of Aboriginal and Torres Strait Islander peoples as historical actors and participants in living, continuing cultures. In 1993, the Australian Museum opened a new Indigenous Australians gallery focusing on contemporary issues of importance to Aboriginal people such as cultural heritage, land and social justice. In 1999, the Western Australian Museum opened its refurbished Aboriginal gallery looking at continuity and innovation in Aboriginal cultures. In 2000, the South Australian Museum opened a new Aboriginal gallery redeploying its extensive ethnographic collections, and Museum Victoria also opened Bunilaka, its Aboriginal Centre, exploring the historical experiences and contemporary cultures and issues of Victorian Indigenous people. All these exhibitions emphasise the ongoing adaptation of Aboriginal peoples, their distinct location and interests within Australian society, and their participation in the broader history shaping contemporary Australia.
As these new exhibitions indicate, Australian museums since the 1970s have responded to criticisms about access and representation in a new way. Rather than reverting, as they had done in previous decades, to attempts to convert excluded social groups to élite interests in culture and science, Australian museums began to see themselves as needing to cater equally to the cultural interests and preferences of all sectors of the population. In many ways, this change reflects museums adapting to the changing character of Australia as the country came to embrace ethnic and cultural diversity as a core element of its society. This change required in museums, however, a quite profound reconceptualisation of their mandate. Museums continued to understand themselves as essentially institutions of public education, but the public to which they spoke was no longer an undifferentiated mass. The public was composed of a range of different audiences, each with different interests and experiences. More radically, the public now not only represented an audience, but was also possessed of cultural rights of access to the museum. The museum’s mandate was now to ensure that those rights were satisfied through according equal representation to all the diverse social groups. The education function of the museum became less to disseminate a single view of history and culture, but rather to offer up multiple visions and to promote tolerance and acceptance of those different visions.
This new appreciation of the diverse interests of the public explains, at least in part, the emergence in Australia since the 1970s of a variety of smaller museums, often catering to the interests of specific groups in the general population. Institutions such as local history museums, Melbourne’s Chinese and Jewish museums, and museums dedicated to a specific industry or way of life, have flourished over the last few decades. Some Indigenous communities have established local keeping places, often built around collections repatriated from larger museums. Like the major museums, these smaller institutions seek to educate the wider public about the distinctive experiences of specific social groups while providing a focus for local culture.
The drive for Australia’s museums to respond to the interests and experiences of diverse social groups also stimulated the emergence in museums, since the 1980s, of collections and exhibitions devoted to the social, cultural and technological history of nineteenth and twentieth century Australia. In part, this new field of practice represents museums attempting to speak more closely to subjects of interest and relevance to ordinary Australians; but it must also be seen as a response to the changing priorities of Australian public culture.24 Since the 1970s, history has emerged as a key arena through which Australians negotiate senses of national identity. The focus for historiography in Australia has shifted from detailing Australia’s connections to England to exploring the specific dynamics, challenges and problems of Australian societies. It is unsurprising that museums, as sites of collective memory, should engage with these new questions.
In addition, the development of national and international tourism has created new audiences for Australian museums. The numbers of international visitors to museums vary considerably depending on where the museum is located within Australia, but for high profile institutions, and especially those in cities such as Sydney, anecdotal evidence suggests that up to a quarter of total visitors are international tourists. Unlike local visitors who may engage with a museum in multiple ways over several visits, visitors on tour expect a concise experience through which they can glean a coherent understanding of the locality they are visiting. Since the 1970s, this experience has come increasingly to be framed in terms of the local or national culture or history, and Australian museums are consequently increasingly interested in creating exhibitions that can meet this expectation.
Australia’s museums have consequently encountered the end of the twentieth century with a revised public education mandate. Rather than disseminating élite notions of science and culture and speaking exclusively to an assumed white male visitor, museums now attempt to represent and speak to a diversity of people, interests and viewpoints. This new commitment to representing diversity raises potential conflicts for Australian museums. As public institutions, they must now answer both to a diverse public and to the specific governments which fund them. It is the nature of democratic society that these two will not always agree, and contemporary museums often find themselves attempting to answer both masters. In addition, the complexities of exploring social, natural and historical diversity are often poorly served by museums seeking to create quick, coherent experiences for tourists.
The audience figures
The transformations occurring in Australian museums since the 1970s have been accompanied by an explosion of interest in understanding and examining museum visitors and the professionalisation of visitor research. In 1991, the first permanent position for an evaluation and visitor research coordinator was created at the Powerhouse Museum in Sydney. In 1994, the Australian Museum and Museum Victoria followed suit, and in 1996, the Australian War Memorial made a further appointment. These designated positions represent in many respects the tip of the iceberg, as evaluation and visitor research are also now habitually carried out by other staff and by consultant research companies. Evaluation of exhibitions, both establishing prior visitor expectations and interests and assessing visitor experience at the exhibition, is now quite widely carried out. Much of this research tends to remain, however, poorly disseminated within the museum profession generally, with the results of studies tending to lodge within institutions rather than contributing to the broader development of knowledge about museum visitors. The first national conference devoted to visitor research, for example, was held in Australia only in 1995. This lack of communication of results between museums derives, perhaps, from the fact that museums are reluctant to share information obtained through commercial consultancies, or from the atmosphere of competition between museums as leisure choices that is generated by scarcity of funding to museums generally.
The development of visitor research since the early 1990s has grown in part from the revision of the public museum’s mandate described above. Museums worldwide now enshrine equity and access to collections for all social groups as part of their core mandate. Maximum participation from all members and sectors of the community is desired, and is sometimes captured as a requirement in government policies applying to museums. The New South Wales Government’s Charter of Principles of Cultural Diversity, for example, requires public institutions to ensure that their programs and services make possible maximum participation from all sectors of the community. Museums’ new attention to equity and access recreates the ‘public’ as a potential audience who, as they have been since the nineteenth century, need to be attracted to the museum. A substantial body of research now attends not only to sectors of the audience who become visitors, but also to potential audiences who do not visit. During the 1990s, a number of large scale audience surveys have focused on people who do not visit museums, attempting to discover the social characteristics, cultural horizons, attitudes and interests of non-visitors. The impetus behind these ‘barrier studies’ has been explicitly to turn non-visitors into visitors.25
While these studies are motivated in part by principles of equity and access, visitor research is also driven by the more mundane need to demonstrate the utility of museums as public institutions in order to guarantee their continued funding. The ‘public good’ of a museum is no longer, if it ever was, unquestioned, and museums continue to need to respond to claims that they are the province of a small, privileged group of cultural élites. This requirement to maximise the number of visitors to the museum has gained considerable weight as the notion of a ‘cultural industry’ encompassing museums has developed. In the early 1980s, the federal Cultural Ministers’ Council, dedicated to developing Australia’s cultural industry, began to realise the lack of reliable statistical data on the activities of institutions such as museums. With their support, the Australian Bureau of Statistics established the National Centre for Culture and Recreation Statistics in 1991. One of its activities is to undertake surveys on attendance at cultural venues such as museums. The periodic availability of official statistics means that museums must now increasingly argue for their value in quantitative rather than qualitative terms.
In addition, in recent decades Australian museums have increasingly needed to develop audiences in order to increase revenue from non-governmental sources. In part, this derives from efforts to curtail government spending on public institutions, but it also reflects the great diversification and number of museums in Australia. Museums are coming to see themselves as competitors in a field of options through which people may spend their leisure dollars, and research into who visits and why, and especially who doesn’t visit and why, is important to any one museum and all museums securing and increasing market share. The trend to view visitor research in this way has been strengthened by the increasing influence of marketing and corporate development programs within Australian museums over the last few decades.
Figures on visitors to Australian museums collected by the Australian Bureau of Statistics indicate that 20% of Australians aged 15 and over visited a museum and 21% visited an art museum (i.e. non-commercial art gallery) during the year ending April 1999 (see the section Museum and art museum attendance in the Culture and recreation chapter). Total attendance figures of more than 16 million visitors per year indicate that some people visit a museum or art museum more than once per year. Attendance at art museums peaks between 45 and 54 years, while attendance at other types of museums peaks between 35 and 44 years of age. For the latter, these figures may correlate to parents taking their children to museums, as family visitation is very common. The ABS figures do not include visits by people under 15, but attendance figures for National Museum of Australia venues indicate that visits by school children, as part of organised school programs, account for a high percentage of total museum attendances. It appears that museum visitors from Australia continue to be drawn from higher than average educational backgrounds, with 46% of people with a Bachelor's degree visiting an art museum and 36% visiting other types of museums during the year ending April 1999. In contrast, people with trade qualifications, apprenticeships or no qualifications are the least likely to visit. (Note that there are no consolidated statistics on the socio-demographic profiles of international tourists.)26
The development of evaluation studies within museums has also grown significantly since the 1970s. While sometimes still informed by scientistic modes of assessing behavioural change and learning outcomes in visitors, exhibition evaluation also sometimes incorporates a more open-ended vision of the role of the museum in learning and a less mechanistic vision of the visitor. Visitors are now often understood to take an active role in interpreting the material of exhibitions, bringing to the museum attitudes, ideas and expectations, and knowledge, through which they construct responses to museum programs.27 The development of ‘front-end evaluation’ in which ideas and prototypes for exhibitions are introduced to potential audiences to gauge interest, expectations and existing knowledge, has facilitated the emergence of ‘audience advocates’ in museums. These staff work to ensure that a vision of the visitor is at the centre of any museum development. The museum’s role in learning is more frequently, or at least ideally, understood not as a technology for the transmission of information, but as a facilitator for stimulating inquiry and discovery over the long term. These understandings of visitors and of learning tend often to sit at odds with the needs of museum administrators to demonstrate measurable behavioural outcomes from exhibition visits.
The growth in visitor research, and the factors driving it, have resulted in Australian museums becoming increasingly ‘visitor focused’. A century ago, museums were concerned to distance themselves from the excitements and pleasures of ‘entertainments’. At the close of the twentieth century, museums’ interest in attracting increased numbers of visitors, and especially visitors uncomfortable with the sober display techniques of traditional museums, has led museums to reintroduce techniques more often associated with entertainment than education. The use of multimedia and computer technology, stronger reliance on narrative, and different aesthetics of colour and sound, indicate museums’ attempts to move closer to the styles of popular culture. Australian museums now attempt to integrate their traditional pedagogic function with the concept of visitors having fun, being moved, and feeling excited.
Conclusion
In March 2001, the National Museum of Australia will open its new exhibition showcase in Canberra as part of Australia’s celebrations of its centenary of Federation. Opening almost two hundred years after museums were founded in Australia, the National Museum will encapsulate in some ways much of that history. The Museum will focus on Aboriginal history and culture, Australian history since European settlement in Australia, and the continent’s environmental history, integrating these three themes to tell the ‘stories of Australia’. The National Museum claims some of the nineteenth century heritage of Australian museums, drawing on the ethnological collections of the Australian Institute of Anatomy which it acquired in the 1980s, but weaving these into contemporary stories about the continuity and experiences of Aboriginal and Torres Strait Islander cultures and peoples. Incorporating some of the earliest government collections of historical artefacts, the Museum will follow developments since the 1980s to explore the social history of Australia’s people. And regarding Australia’s environment in a new way, the National Museum will examine the continent’s natural history in the context of how people from many different backgrounds have forged connections on and with the land, and how the land has shaped Australians’ diverse experiences.
Consciousness of the ‘visitor’ sits at the heart of the National Museum. The institution seeks to reach out and speak to all Australians, bringing a sense of the diversity of Australian society and history to all its exhibitions. The Museum’s programs are designed to be as accessible as possible, attempting to incorporate even audiences distant from the physical exhibitions through technologies such as broadcast and computer media. Information about visitors, their interests and attitudes, have informed exhibition development, influencing the Museum’s character and aesthetic. The Museum, remains, however, acutely aware of its role as an institution for public education, seeking to disseminate information about the forces which shaped Australia historically and as it is today, and taking seriously its mandate to encourage visitors to reflect on their role within the Australian nation. Like all of Australia’s contemporary museums, the National Museum of Australia will be required to both educate and entertain, to reach and be relevant to all sectors of Australian society while also maintaining an intellectual rigour in its programs and providing an accessible experience for international tourists. Ongoing investigation of its actual and potential audiences, assessments of their experiences in the Museum, and exploration of how the Museum can become more relevant, exciting and interesting for them, will be an important aspect of the National Museum’s ongoing development.
Endnotes
1 Cultural Ministers Council Statistics Working Group 1993, cited in Australian Bureau of Statistics and the Department of Communications and the Arts 1997, Cultural Trends in Australia: A statistical overview , Commonwealth of Australia, p. 51.
2 Museums Australia Inc. 1996, cited in Australian Bureau of Statistics and the Department of Communications and the Arts 1997, Cultural Trends in Australia: A statistical overview, Commonwealth of Australia, p. 53.
3 Carol Scott 1998, The Long and Winding Road: Evaluation and visitor research in museums in Australia and New Zealand, paper presented to the Visitor Centre Stage: Action for the Future conference.
4 Tony Bennett, “The Museum and the Citizen”, in T. Bennett, R. Trotter & D. McAlear (eds), Museums and Citizenship: A resource book, Memoirs of the Queensland Museum 1996. South Brisbane: Queensland Museum, p. 6.
5 Ian McShane, “Building a National Museum of Australia: A history”, Public History Review, 7, 1998, p. 77.
6 Tony Bennett, “The Museum and the Citizen”, in T. Bennett, R. Trotter & D. McAlear (eds), Museums and Citizenship: A resource book, Memoirs of the Queensland Museum 1996. South Brisbane: Queensland Museum, p. 11.
7 McCoy, n.d. (c.1856), cited in David Goodman, “Fear of Circuses: Founding the National Museum of Victoria”, in David Boswell & Jessica Evans (eds) 1999, Representing the Nation: A reader. London: Routledge, p. 265.
8 David Goodman, “Fear of Circuses: Founding the National Museum of Victoria”, in David Boswell & Jessica Evans (eds) 1999, Representing the Nation: A reader. London: Routledge, p. 265.
9 M. Talbot 1992, A Chance to Read: A history of the Institutes movement in South Australia, Adelaide: Libraries Board of South Australia; P. Candy & J. Laurent (eds) 1994, Pioneering Culture: Mechanics Institutes and schools of art in Australia, Adelaide: Auslib Press.
10 K. McCarthy 1991, Women’s Culture: American philanthropy and art, 1830-1930, Chicago and London: University of Chicago Press; J. Weimann 1981, The Fair Women: The story of The Woman’s Building, World’s Columbian Exhibition, Chicago, 1893, Chicago: Academy Chicago.
11 Kimberley Webber, “Constructing Australia’s Past: The development of historical collections, 1888-1938” in Patricia Summerfield (ed.) 1986, Proceedings of the Council of Australian Museum Associations Conference, Perth WA, pp. 155-173.
12 Chris Healy 1997, From the Ruins of Colonialism: History as Social Memory, Cambridge: Cambridge University Press, p. 86n.
13 Ian McShane, “Building a National Museum of Australia: A history”, Public History Review 7, 1998, p. 78.
14 Ian McShane, “Building a National Museum of Australia: A history”, Public History Review 7, 1998, p. 81.
15 Chris Healy 1997, From the Ruins of Colonialism: History as Social Memory, Cambridge: Cambridge University Press, p. 88.
16 Michael McKernan 1991, Here is Their Spirit: A history of the Australian War Memorial, 1917-1990, St Lucia: University of Queensland Press in association with the Australian War Memorial.
17 Ken Inglis, “A sacred place: the making of the Australian War Memorial”, War and Society 3(2): 99-126.
18 Benjamin Gilman, “Museum fatigue”, The Scientific Monthly, 1916, 12: 62-74.
19 See for example, Arthur Melton et al. 1935, Experimental Studies of the Education of Children in a Museum of Science, New Series, no. 15, Washington D.C.: American Association of Museums; Edward Robinson 1928, The Behavior of the Museum Visitor, New Series no. 5, Washington DC: American Association of Museums Monograph.
20 Bernard Schiele, “Creative interaction of visitor and exhibition”, in Don Thompson et al. (eds.) 1992, Visitor Studies: Theory, Research and Practice, volume 5. Jacksonville, Alabama: The Visitor Studies Association, p. 32.
21 D.J.G. Griffin, The Australian Museum Visitor 1976, The Australian Museum Trust, Sydney, p. 4.
22 Peter Vergo (ed.) 1989, The New Museology, London: Reaktion Books; Ivan Karp & Steven Lavine (eds) 1991, Exhibiting Cultures: The poetics and politics of museum display, Washington DC: Smithsonian Institution.
23 Tony Bennett, Robin Trotter & Donna McAlear 1996, Museums and Citizenship: A resource book, Memoirs of the Queensland Museum 39(1), Queensland Museum; Margaret Anderson & Andrew Reeves, “Contested Identities: Museums and the nation in Australia”, in Flora Kaplan (ed.) 1994, Museums and the Making of “Ourselves”: The role of objects in national identity, London and New York: Leicester University Press, pp. 78-124.
24 Margaret Anderson, “Selling the past: History in museums in the 1990s”, in J. Rickard & P. Spearritt (eds) 1991, Packaging the Past? Public Histories, Melbourne: Melbourne University Press, pp. 130-141.
25 Tony Bennett, Chilla Bulbeck & Mark Finnane 1991, Accessing the Past, Brisbane: Griffith University; Tony Bennett 1994, The Reluctant Museum Visitor: A study of non-goers to history museums and art galleries, Australia Council.
26 Australian Bureau of Statistics 1999, Attendance at Selected Cultural Venues (4114.0), Canberra.
27 Carol Scott, “Evaluation and Visitor Research in Australia: Developments and trends”, Visitor Behaviour, 1997, 12(3-4): 22-23.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:21:05.000Z
|
4rohtvscco3j62qyfj6r3xs2h747jbjv
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67451",
"uncompressed_offset": 361546342,
"url": "www.biomedcentral.com/1472-6750/11/114/abstract",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.biomedcentral.com/1472-6750/11/114/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Transient transfection of serum-free suspension HEK 293 cell culture for efficient production of human rFVIII
Kamilla Swiech1,2*, Amine Kamen3, Sven Ansorge3, Yves Durocher3, Virgínia Picanço-Castro1, Elisa MS Russo-Carbolante1,4, Mário SA Neto1 and Dimas T Covas1,5
Author Affiliations
1 Regional Blood Center of Ribeirão Preto, University of São Paulo (USP), Ribeirão Preto, Brazil
2 Department of Pharmaceutical Sciences, Faculty of Pharmaceutical Sciences of Ribeirão Preto, University of São Paulo, Ribeirão Preto, Brazil
3 National Research Council Canada, Biotechnology Research Institute, Montreal, Quebec, Canada
4 Department of Clinical, Toxicological and Food Science Analysis, Faculty of Pharmaceutical Sciences of Ribeirão Preto, University of São Paulo, Ribeirão Preto, Brazil
5 Department of Clinical Medicine, Faculty of Medicine of Ribeirrão Preto, University of São Paulo (USP), Ribeirão Preto, Brazil
For all author emails, please log on.
BMC Biotechnology 2011, 11:114 doi:10.1186/1472-6750-11-114
Published: 24 November 2011
Abstract
Background
Hemophilia A is a bleeding disorder caused by deficiency in coagulation factor VIII. Recombinant factor VIII (rFVIII) is an alternative to plasma-derived FVIII for the treatment of hemophilia A. However, commercial manufacturing of rFVIII products is inefficient and costly and is associated to high prices and product shortage, even in economically privileged countries. This situation may be solved by adopting more efficient production methods. Here, we evaluated the potential of transient transfection in producing rFVIII in serum-free suspension HEK 293 cell cultures and investigated the effects of different DNA concentration (0.4, 0.6 and 0.8 μg/106 cells) and repeated transfections done at 34° and 37°C.
Results
We observed a decrease in cell growth when high DNA concentrations were used, but no significant differences in transfection efficiency and in the biological activity of the rFVIII were noticed. The best condition for rFVIII production was obtained with repeated transfections at 34°C using 0.4 μg DNA/106 cells through which almost 50 IU of active rFVIII was produced six days post-transfection.
Conclusion
Serum-free suspension transient transfection is thus a viable option for high-yield-rFVIII production. Work is in progress to further optimize the process and validate its scalability.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:02:00.000Z
|
7pd5sl4qp2p5trulvdajotakx2fzyz5s
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67463",
"uncompressed_offset": 449151312,
"url": "www.eea.europa.eu/data-and-maps/figures/urban-morphological-zones-umz-2000/sendto_form",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.eea.europa.eu/data-and-maps/figures/urban-morphological-zones-umz-2000/sendto_form"
}
|
cccc_CC-MAIN-2013-20
|
Personal tools
Sign up now!
Get notifications on new reports and products. Currently we have 55622 subscribers. Frequency: 3-4 emails / month.
Follow us
Twitter
Facebook
YouTube channel
RSS Feeds
Notifications archive
Write to us
For the public:
For media and journalists:
Contact EEA staff
Contact the web team
FAQ
Call us
Reception:
Phone: (+45) 33 36 71 00
Fax: (+45) 33 36 71 99
next
previous
items
Skip to content. | Skip to navigation
Sound and independent information
on the environment
You are here: Home / Data and maps / Maps and graphs / Urban morphological zones (UMZ) 2000
Send this page to someone
Fill in the email address of your friend, and we will send an email that contains a link to this page.
Address info
(Required)
The e-mail address to send this link to.
(Required)
Your email address.
A comment about this link.
European Environment Agency (EEA)
Kongens Nytorv 6
1050 Copenhagen K
Denmark
Phone: +45 3336 7100
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:19:21.000Z
|
mrsqb6oy2psnfalzsi3fw7nf4gtqlxc6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67464",
"uncompressed_offset": 449169842,
"url": "www.eea.europa.eu/highlights/europe2019s-mountains-rich-in-biodiversity",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.eea.europa.eu/highlights/europe2019s-mountains-rich-in-biodiversity"
}
|
cccc_CC-MAIN-2013-20
|
Personal tools
Sign up now!
Get notifications on new reports and products. Currently we have 55597 subscribers. Frequency: 3-4 emails / month.
Follow us
Twitter
Facebook
YouTube channel
RSS Feeds
Notifications archive
Write to us
For the public:
For media and journalists:
Contact EEA staff
Contact the web team
FAQ
Call us
Reception:
Phone: (+45) 33 36 71 00
Fax: (+45) 33 36 71 99
next
previous
items
Skip to content. | Skip to navigation
Sound and independent information
on the environment
You are here: Home / News / Europe's mountains: rich in biodiversity but increasingly vulnerable
Europe's mountains: rich in biodiversity but increasingly vulnerable
Published : Jul 28, 2010 Last modified : Apr 13, 2011 07:17 PM
Snow-capped peaks, rocky inclines, rich forests and sloping meadows provide recreation and economic opportunities for humans and a home to many plants and animals. The European Environment Agency's new assessment of mountain ecosystems sheds light on their state and the pressures they face.
Mountain ecosystems are essential for regulating our climate and water cycles. Increasingly, however, they are threatened by land abandonment, intensification of agriculture, infrastructure development, unsustainable exploitation and climate change. Eighth in the series of '10 messages for 2010', the EEA's new assessment on mountain ecosystems indicates that managing mountains sustainably relies on effective policies and actions at regional and local levels.
Mountain ecosystems cover 36 % of the continent (29 % of the European Union). Around 40 % of this area is forested. Compared with lowlands, the variation in altitudes, temperatures and precipitation have resulted in a richer variety of plant and animal species in mountains.
Key pressures and policies
• Intensified agriculture and land abandonment: in lower altitudes, non-intensive traditional farming has created and maintains semi-natural habitats, supporting a wide range of grassland species. More than half of Europe's High Nature Value farmland, typically associated with low-intensity agriculture and grazing, is found in mountain areas. Any change to agricultural intensity threatens such habitats and species. Land abandonment occurs across the EU and threatens ecosystems such as grasslands, which are highly dependent on human management.
• Climate change: average temperatures increased by approximately 2 degrees in the Alps between the late 19th century and early 21st centuries. This is twice the average rate in the Northern hemisphere and has caused a significant decrease in glacier volume. Higher temperatures also mean less snow and more rain in the winter, resulting in more runoff in winter and less in spring and summer. Where they are able to move uphill or northwards, flora and fauna can retain the bioclimatic conditions to which they are adapted. For mountain plant species, however, migration is obviously more difficult and more than half could face extinction by 2100.
• Infrastructure development: construction of highways and motorways increases the fragmentation in mountain areas, isolating and limiting the movement of many species. In certain locations, the development of skiing infrastructure can make soil more vulnerable to water erosion.
• Unsustainable exploitation: Fuel wood harvesting and timber trade in the Caucasus mountains irreversibly reduce both biodiversity and the goods and services on which local people depend. Hunting and poaching of rare and endangered species in the Carpathians have reduced populations, threatening their long-term viability. Mass tourism often favours the introduction of invasive alien species.
• Policy frameworks: international and regional agreements and processes, including the Convention on Biological Diversity and the Alpine Convention, indicate that there is adequate recognition at the European level of the need for international cooperation. It is important to consider which policies have been successful at regional and local levels.
European Environment Agency (EEA)
Kongens Nytorv 6
1050 Copenhagen K
Denmark
Phone: +45 3336 7100
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:10:36.000Z
|
nnyt5bhdd544eb35csp5cryvik6rg3wn
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67465",
"uncompressed_offset": 451500356,
"url": "www.elinux.org/index.php?diff=4982&oldid=4981&title=Flyswatter",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.elinux.org/index.php?title=Flyswatter&diff=4982&oldid=4981"
}
|
cccc_CC-MAIN-2013-20
|
Difference between revisions of "Flyswatter"
From eLinux.org
Jump to: navigation, search
Line 28: Line 28:
*[[Media:libftd2xx0.4.13.tar.gz|LibFTD2xx library files]]
*[[Media:libftd2xx0.4.13.tar.gz|LibFTD2xx library files]]
+
[[Category:TinCanTools]]
[[Catagory:TinCanTools]]
+
Revision as of 21:14, 21 November 2007
The Flyswatter JTAG board is a low cost USB based JTAG programmer for the Hammer CPU board. It can be used with all ARM processors that are supported by OpenOCD. It is based upon FTDI's popular FT2232 USB UART/FIFO IC. The Flyswatter provides a standard JTAG interface as well as a standard RS232 port with support for full modem signals.
Features:
• USB 2.0 Full Speed device (12 Mbits/sec) interface
• Can be used to debug and program all ARM processors supported by OpenOCD
• Provides a standard 2x7 pin JTAG interface
• Adds a virtual RS232 serial port to your computer or laptop with full modem signals: TXD, RXD, RTS, CTS, DTR, DSR, DCD, RI
• Supports ARM target voltages of: 3.3V, 2.5V, 1.8V, 1.5V, 1.2V (voltage range: 1.2V to 3.6V)
• Adds a virtual RS232 serial port to your computer or laptop with all of the modem signals: DTR, DSR, DCD, RTS, CTS, Rx, Tx
• No external power supply required – it runs off of the USB voltage from the computer
• Open hardware – complete schematic provided
• Open software - software supported by OpenOCD (open source) debugger
• Included CD comes with OpenOCD for Linux
• Dimensions: 2.5 inches (width) x 3.0 inches (height)
• Package Includes: Flyswatter board, USB Cable, 8 inch JTAG ribbon cable (14 pin - 2x7)
Documents:
Source Code:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:50:37.000Z
|
vx5d7pg3rj7cjole3abmvvm53irv6ca4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67469",
"uncompressed_offset": 465644186,
"url": "www.familysearch.org/learn/wiki/en/Prussia-Posen_Gazetteers",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Prussia-Posen_Gazetteers"
}
|
cccc_CC-MAIN-2013-20
|
Prussia-Posen GazetteersEdit This Page
From FamilySearch Wiki
Back to Prussia - Posen Page
To locate Lutheran and Catholic parishes as well as civil registration offices in Posen, please use the Gemeindelexikon Posen. FHL call number 943 E5kp or FHL film number 806634 Item 5.
The Gemeindelexikon für das Königreich Preussen is now also available online at Ancestry.com. You can find it by clicking on the Search Tab and choosing the Card Catalog option. Type in the title/or part of the title, and it will appear on the right sidebar. Choose the volume for the area of interest.
Here is a diagram showing the column headings in German and their English translations:
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 15 May 2013, at 14:44.
• This page has been accessed 534 times.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:40:52.000Z
|
wzpwclivzh7tykb22cljv6cuala2br45
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67470",
"uncompressed_offset": 465655517,
"url": "www.familysearch.org/learn/wiki/en/Special:WhatLinksHere/Manitoba_Collections",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Special:WhatLinksHere/Manitoba_Collections"
}
|
cccc_CC-MAIN-2013-20
|
Pages that link to "Manitoba Collections"
From FamilySearch Wiki
What links here
Filters Hide transclusions | Hide links | Hide redirects
No pages link to Manitoba Collections.
New to the Research Wiki?
In the FamilySearch Research Wiki, you can learn how to do genealogical research or share your knowledge with others.
Learn More
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:39:31.000Z
|
msvca4woqttny2pu4szzhy373ujskg45
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67471",
"uncompressed_offset": 479892718,
"url": "www.forensicswiki.org/w/index.php?diff=13236&oldid=8222&title=Ext3",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.forensicswiki.org/w/index.php?title=Ext3&diff=13236&oldid=8222"
}
|
cccc_CC-MAIN-2013-20
|
Error
Jump to: navigation, search
2 revisions of this difference (8222 and 13236) were not found.
This is usually caused by following an outdated diff link to a page that has been deleted. Details can be found in the deletion log.
Personal tools
Namespaces
Variants
Actions
Navigation:
About forensicswiki.org:
Toolbox
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:51:06.000Z
|
ztnm2ss42s7ozmhqr77mwtlzyd7rixay
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67480",
"uncompressed_offset": 517363519,
"url": "www.hindawi.com/crim/obgyn/2013/350894/",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.hindawi.com/crim/obgyn/2013/350894/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
Case Reports in Obstetrics and Gynecology
Volume 2013 (2013), Article ID 350894, 3 pages
http://dx.doi.org/10.1155/2013/350894
Case Report
Abdominal Wall Desmoid during Pregnancy: Diagnostic Challenges
1Department of Obstetrics and Gynecology, American University of Beirut Medical Center, P.O. Box 113-6044, Beirut, Lebanon
2Department of Pathology and Laboratory Medicine, American University of Beirut Medical Center, P.O. Box 113-6044, Beirut, Lebanon
3Department of Surgery, American University of Beirut Medical Center, P.O. Box 113-6044, Beirut, Lebanon
Received 13 November 2012; Accepted 20 December 2012
Academic Editors: S. Salhan and E. Vaisbuch
Copyright © 2013 Johnny Awwad et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background. Desmoids are benign tumors, with local invasive features and no metastatic potential, which have rarely been described to be pregnancy associated. Case. We described the rapid growth of an anterior abdominal wall mass in a 40-year-old pregnant woman. Due to its close proximity to the enlarged uterus, it was misdiagnosed to be a uterine leiomyoma by ultrasound examination. Final tissue diagnosis and radical resection were done at the time of abdominal delivery. Conclusion. Due to the diagnostic limitations of imaging techniques, desmoids should always be considered when the following manifestations are observed in combination: progressive growth of a solitary abdominal wall mass during pregnancy and well-delineated smooth tumor margins demonstrated by imaging techniques. This case emphasizes the importance of entertaining uncommon medical conditions in the differential diagnosis of seemingly common clinical manifestations.
1. Introduction
Desmoid tumors are benign slowly growing fibroblastic neoplasms that arise from muscle fascia or aponeurosis. Although they lack metastatic potential, they are known for their propensity for local recurrence, even after complete surgical resection. Despite being histologically benign, they are locally infiltrative and can cause death through destruction of adjacent vital structures and organs. These rare tumors occur in patients with familial adenomatous polyposis and in patients with previous surgical trauma (previous surgery). Although uncommon, desmoids are found to be associated with women of fertile age, especially during and after pregnancy [16].
In this paper, we report on a desmoid tumor that developed during the course of pregnancy and was misdiagnosed to be a uterine leiomyoma by ultrasonography. Final diagnosis and treatment were made at the time of cesarean delivery.
2. Case Presentation
A 40-year-old woman presented for cesarean delivery for fetal breech presentation at 39 weeks’ gestation under spinal anesthesia. Her previous obstetrical history included two previous first trimester abortions and a full-term pregnancy delivered by cesarean section due to breech presentation. Her present antenatal course was smooth, except for a progressive painless swelling in the right flank noticed at 20 weeks’ gestation. Multiple ultrasound examinations were done at different intervals during the course of pregnancy. They demonstrated a rapidly growing sharply defined abdominal mass, heterogeneous in echogenicity and smooth in contour, highly suggestive of a subserosal uterine leiomyoma. No other signs and/or symptoms were reported. The patient denied smoking, drinking alcohol, or taking any medications besides her prenatal vitamins.
Intraoperatively, the tumor was found to be extra-peritoneal originating from the right abdominal wall. It was whitish in color, hard in consistency, and fixed to its surroundings. It was arising from the lateral wall (rectus and external oblique muscles) reaching the vicinity of the anterior superior iliac spine. Following the delivery of a live male newborn (Birthweight: 3560 g; Apgar score 9 at 5 min) through a lower segment transverse uterine incision, a general surgeon was called in for an intraoperative consultation. Frozen sections revealed benign spindle cells suggestive of a desmoid tumor (Figure 1), although a sarcoma could not be ruled out in view of the tumor rapid growth. The patient consented to a wide surgical excision of the mass within the same surgery. Radical resection of the tumor was performed including affected abdominal wall muscle and a peripheral margin of healthy tissues surrounding it. The patient tolerated the procedure well. She developed right femoral lateral cutaneous neuralgia that resolved spontaneously a few weeks later.
Figure 1: Desmoid tumor spindle cells surrounding and destroying skeletal muscle cells (hematoxylin-eosin, original magnification ×100).
Grossly, the tumor was a 12 × 9.5 × 7 cm mass weighing 457 g, ovoid in shape, firm in consistency, covered by a smooth glistening layer with some attached adipose tissue in areas. Cut sections showed tan fleshy softer tissue in the inside. This was surrounded by a capsule and an inner rim of brown gray firm tissue measuring 0.6 cm in average thickness. The final diagnosis of musculoaponeurotic fibromatosis/desmoid tumor was made.
Two years later, the same women gave birth to her third child by cesarean section. Surgical inspection of the previous resection site was unremarkable. There was no evidence of tumor recurrence.
3. Discussion
This case report demonstrates that abdominal wall tumors detected after the first trimester of pregnancy may be clinically challenging and may be easily confused with subserosal uterine leiomyomata. Ultrasonographic features are all too often nonspecific in suggesting a definitive diagnosis. An abdominal wall solid mass exceeding 5 cm in diameter may be difficult to separate by imaging techniques from an enlarged second- or third-trimester gravid uterus. This case emphasizes the importance of entertaining uncommon medical conditions in the differential diagnosis of seemingly common clinical manifestations.
Desmoid tumors are cytologically bland fibrous neoplasms of musculo-aponeurotic origin. Their incidence in the general population is relatively rare where it is detected in only two to four per million individuals each year [2].
Although the etiology of desmoid tumors remains unknown, increasing evidence points to involvement of the APC gene and beta-catenin in the molecular pathogenesis of inherited desmoids (Gardner’s syndrome) as well as in sporadic cases [1, 2, 5]. Since desmoid tumors have been frequently associated with high estrogen conditions, an endocrine etiology has been suggested. First, occurrence of extra-abdominal and abdominal desmoids has been reported in women during or after pregnancy [2, 3]. Second, the fibroblast has been shown to exhibit a proliferative response to estrogen. Finally, women with desmoids had regression of their lesions after attaining menopause [1].
The typical clinical manifestation of desmoids consists of a slowly growing deep-seated painless or minimally painful mass. The most common location of desmoids occurring during pregnancy is within the abdominal wall [2]. Their classical presentation is that of an enlarging abdominal mass separate from the uterus. Trauma related to pregnancy including a scar from a prior cesarean section [7] and exposure to elevated hormone levels may both be contributory factors [1, 2]. Subsequent pregnancy is not necessarily a risk factor for recurrence or development of new disease in a woman with a pregnancy-related desmoid, although the data are quite limited (three cases described in which there was no recurrence with subsequent pregnancy [2, 8]). Our case constitutes the fourth reported in which no recurrence was detected in subsequent pregnancies.
Ultrasound remains the most frequently utilized imaging modality for initial assessment of masses compatible with a desmoid tumor. Cross-sectional imaging of the affected area with CT or MRI technology may be more helpful in defining the relationship of the tumor to adjacent structures in order to delineate surgical borders and determine surgical respectability [14]. There are no imaging characteristics that can reliably distinguish desmoids from malignant soft tissue tumors. Radiologic imaging may nevertheless be misleading particularly when diagnosis is attempted on the second or third trimester of pregnancy at a time when the gravid uterus comes in tight proximity with the abdominal wall, making the delineation of cleavage planes by imaging techniques very challenging. In our case, ultrasound findings did not raise suspicions of an abdominal wall tumor to warrant the use of further diagnostic modalities. An enlarging uterine fibroid remained the working diagnosis until the time of abdominal delivery.
For asymptomatic desmoids, close observation is acceptable strategy [6]. Surgical treatment is reserved for symptomatic manifestations of the tumor and for cosmetic considerations. Complete surgical resection of the tumor with negative microscopic margins is the gold surgical standard of care [13]. Radiation therapy is used in patients with radiosensitive desmoid tumors not amenable to surgical resection, local recurrences, or incompletely excised lesions. Chemotherapy and endocrine therapy have also been used to treat desmoid tumors in patients in whom resection is technically impossible because of a widespread tumor infiltration [1, 3, 4].
Although a very rare entity, the diagnosis of desmoid tumors should always be entertained when the following clinical manifestations are observed in combination: mass located to the abdominal wall, progressive pattern of growth during the course of pregnancy, and well-defined smooth tumor margins demonstrated by ultrasound examination. Definitive treatment is wide surgical resection and may be deferred till after vaginal birth or during the course of a cesarean delivery. This case emphasizes the importance of entertaining uncommon medical conditions in the differential diagnosis of seemingly common clinical manifestations.
Conflict of Interests
All authors have no conflict of interests.
References
1. A. Economou, X. Pitta, E. Andreadis, L. Papapavlou, and T. Chrissidis, “Desmoid tumor of the abdominal wall: a case report,” Journal of Medical Case Reports, vol. 5, article 326, 2011.
2. A. Johner, P. Tiwari, P. Zetler, and S. M. Wiseman, “Abdominal wall desmoid tumors associated with pregnancy: current concepts,” Expert Review of Anticancer Therapy, vol. 9, no. 11, pp. 1675–1682, 2009. View at Publisher · View at Google Scholar · View at Scopus
3. A. B. Shinagare, N. H. Ramaiya, J. P. Jagannathan, K. M. Krajewski, A. A. Giardino, J. E. Butrynski, et al., “A to Z of desmoid tumors,” American Journal of Roentgenology, vol. 197, no. 6, pp. W1008–W1014, 2011.
4. S. Salas, A. Dufresne, B. Bui, J. Y. Blay, P. Terrier, D. Ranchere-Vince, et al., “Prognostic factors influencing progression-free survival determined from a series of sporadic desmoid tumors: a wait-and-see policy according to tumor presentation,” Journal of Clinical Oncology, vol. 29, pp. 3553–3558, 2011.
5. D. Kotiligam, A. J. F. Lazar, R. E. Pollock, and D. Lev, “Desmoid tumor: a disease opportune for molecular insights,” Histology and Histopathology, vol. 23, no. 1–3, pp. 117–126, 2008. View at Scopus
6. M. Al-Jefout, A. Walid, A. Esam, A. Amin, H. Nather, N. Sultan, et al., “Abdominal wall desmoid tumor mimicking a subserosal uterine leiomyoma,” International Journal of General Medicine, vol. 4, pp. 443–446, 2011.
7. I. Dahn, N. Jonsson, and G. Lundh, “Desmoid tumours. A series of 33 cases,” Acta chirurgica Scandinavica, vol. 126, pp. 305–314, 1963. View at Scopus
8. F. De Cian, E. Delay, R. C. Rudigoz, D. Ranchère, and M. Rivoire, “Desmoid tumor arising in a cesarean section scar during pregnancy: monitoring and management,” Gynecologic Oncology, vol. 75, no. 1, pp. 145–148, 1999. View at Publisher · View at Google Scholar · View at Scopus
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:21:41.000Z
|
bq36bgh3krews4ukioyyevncpsh6wwuf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67483",
"uncompressed_offset": 540576350,
"url": "www.isfdb.org/cgi-bin/ea.cgi",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.isfdb.org/cgi-bin/ea.cgi?Don_Callander"
}
|
cccc_CC-MAIN-2013-20
|
Don Callander - Summary Bibliography
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Other views: Awards Alphabetical Chronological
Fiction Series Novels Interior Art
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:12:02.000Z
|
nn7qc3oggag5ewpyiwzi3mywl642vfdb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67484",
"uncompressed_offset": 540579683,
"url": "www.isfdb.org/cgi-bin/title.cgi",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.isfdb.org/cgi-bin/title.cgi?139298"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: Cover: Early Harvest
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Title: Cover: Early Harvest
Author: David Mattingly
Year: 1988
Variant Title of: Cover: Early Harvest (by David B. Mattingly ) [may list more publications, awards and reviews]
Type: COVERART
ISFDB Record Number: 139298
User Rating: This title has fewer than 5 votes. VOTE
Current Tags: None
Publications:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:59:47.000Z
|
bfkbpacwogzkypeyg3tfdmn5j4imc6ay
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67493",
"uncompressed_offset": 588383697,
"url": "www.mariowiki.com/SM3DL",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.mariowiki.com/SM3DL"
}
|
cccc_CC-MAIN-2013-20
|
Super Mario 3D Land
From the Super Mario Wiki
(Redirected from SM3DL)
Jump to: navigation, search
Super Mario 3D Land
North American box art
Developer(s) Nintendo EAD
Publisher(s) Nintendo
Platform(s) Nintendo 3DS
Release date Retail
November 3, 2011
November 13, 2011
November 18, 2011
November 24, 2011
April 28, 2012
December 7, 2012
Digital Download
October 4, 2012
October 18, 2012
November 1, 2012
Genre Platformer
Rating(s)
ESRB: - Everyone
PEGI: - Three years and older
CERO: - All ages
ACB: - General
Mode(s) Single-player
Media Nintendo 3DS Game Card
Digital Download
Input
Nintendo 3DS:
Super Mario 3D Land (Japanese: スーパーマリオ ３Ｄランド Sūpā Mario 3D Rando) is a game in the Super Mario franchise for the Nintendo 3DS. It is closely based on side-scrolling Mario games, but it is a 3D platformer in the vein of games like Super Mario 64 and Super Mario Galaxy. As noted by Reggie Fils-Aime, president and COO of Nintendo of America, at E3 2011, this game marks the first time a 3D Mario platformer has been built from the ground up for a handheld system. The game was created by the same development team that worked on the Super Mario Galaxy games and Donkey Kong Jungle Beat, currently part of Nintendo EAD Tokyo. As it is a new installment in the main Mario series, Super Mario 3D Land follows Super Mario Galaxy 2 in this respect.
Contents
Story
Bowser capturing Peach.
Outside of Princess Peach's Castle stands the Tail Tree, a Tanooki-tailed tree with Super Leaves on its branches. All of the Mushroom Kingdom is familiar with the tree. One night, a huge storm blows all of the leaves off, as Bowser laughs in the background.
Later on, Mario and three Toads (Red, Yellow, and Blue) go looking for the princess. Eventually, they discover that she is missing and the Super Leaves are gone too. Yellow Toad notices a hovering letter near the tree, and the group of four goes to investigate. Mario grabs and opens the letter, and a picture of Bowser holding Princess Peach with Super Leaves flying in the background pops out. The message shocks the three Toads and Mario, and immediately, Mario and the three Toads run to save Princess Peach.[video 2] Throughout his adventure, Mario receives more letters about Peach's predicament and about various stages of Bowser's Super Leaf-related plan.
Becoming lonely due to Mario's absence, Peach ultimately attempts to escape from Bowser and his army, but she is soon recaptured. Mario travels through 8 worlds and defeats Bowser, only to be tricked as Bowser escapes with Peach. Mario eventually finds Bowser's lair, but before they can battle, the floor beneath them breaks and they fall. After being chased through various obstacles, Mario manages to press a switch making the bridge under Bowser collapse, sending Bowser into a pool of lava. At last, Mario and the three Toads find Princess Peach and, using their Tanooki powers, bring Peach back to her castle.
Peach attempting an escape from Bowser and the Koopa Troop.
After that, a short cutscene appears with a letter floating down in World 1-1. It appears to be Luigi being kidnapped by Dry Bowser. Mario then sets off to save Luigi. After rescuing him in Special World 1-Castle, he becomes a playable character.
After Mario beats Special 8-Castle, another cutscene appears. Another letter has floated down on World 1-1, and the three Toads who accompanied Mario in his adventure investigates while sporting their Tanooki forms. To their surprise, Bowser has kidnapped Princess Peach again. Then, Mario or Luigi must play World 8-2 again to defeat Bowser. After that, a letter of Peach wearing a Tanooki Suit is unlocked. Once 5 stars are present on the profile, Special 8-Crown is unlocked.
Gameplay
Mario in World 1-1.
The levels of Super Mario 3D Land are much more linear and compact than the other 3D titles, more along the lines of the sidescrolling games. Levels have a time limit and even feature flagpoles, a staple of the original Super Mario Bros. and the New Super Mario Bros. games, rather than Power Stars, as the level goals. When Mario is defeated, the "Too Bad" banner from every 3D Mario platformer since Super Mario Sunshine appears near the top of the screen and falls to the bottom of the screen, but a circle covers the screen instead of a Bowser symbol. Also, when the timer reaches zero, the "Time's Up" banner appears at the top of the screen. To enter pipes, the player must press or ; for the first time in the series, the player can re-enter areas through pipes at will (for example, after being transported to the above-ground flagpole in World 1-2, the player can go back down the pipe to go underground). The graphics of the game greatly resemble those of the Super Mario Galaxy games, while the levels show visual similarities to the New Super Mario Bros. titles. Gameplay also takes cues from Super Mario Sunshine, notably tight-rope walking. Unlike the 2D Mario games, the level themes in a world tend to be more generic like the galaxies of Super Mario Galaxy 2 compared to the world, instead of focusing on a particular setting per world.
Due to the merging of the 2D and 3D play styles, Mario's moveset is slightly more limited than other 3D games; he cannot triple-jump or even double-jump. He also cannot Spin Jump. However, the Wall Jump, Sideways Somersault, Long Jump, and the Backflip can still be performed. Other controls take cues from the 2D titles; Mario can crouch and slide while running, which now requires the use of a run button, like in the 2D games. In addition, the version of the Backflip seen in this game is the same as the type in Super Mario Bros. 2. Finally, Mario has a new roll move that can be used to break blocks from the side and fit through small gaps.
Tanooki Mario in World 2-Airship.
While giving examples of how the Nintendo 3DS enhances gameplay, Shigeru Miyamoto has stated that hitting blocks from underneath in 3D Mario games would be easier with stereoscopic 3D.[1] Blocks are more prevalent in the title, unlike past 3D games, where blocks were more few and far between. Star Medals that have a similar design to the Comet Medals from Super Mario Galaxy 2 are found in each level, with collecting all three being part of the level's challenge, like in the New Super Mario Bros. games. Plus Clocks can be picked up to give the player more time to complete the level, the latter a mechanic only seen previously in Super Mario Galaxy 2's Speedy Comet missions. Mario himself returns with some of his trademark 3D abilities, such as the Wall Jump, Long Jump, and Ground Pound, and is now capable of performing rolling, which is done by crouching while moving. By rolling and jumping at the same time, the player can do a somersault during the long jump. Mario's health system is now based on the side-scrolling titles rather than being a numbered meter: one hit shrinks Mario to a smaller size and removes his cap, while power-ups give him an extra health point. These power-ups include the Super Mushroom, the Fire Flower, the Boomerang Flower, the Statue Leaf and the Super Leaf, the last of which has not been seen since Super Mario Bros. 3. Notably, the Fire Flower, unlike its previous 3D appearances in Super Mario Galaxy and its sequel, no longer has a time limit imposed on it and is retained until Mario is hit, as in the side-scrolling games. When Mario dies, he respawns in Super Mario form, not his Small Mario form, unlike previous titles. When Mario dies twice in one level, a flying Roulette Block appears. Unlike the previous Mario games, the lives counter in Super Mario 3D Land extends beyond 99 and goes up to the max of 1,110 (3 crowns). This 1,110 max lives counter is also included in New Super Mario Bros. 2.
The game also makes extended use of the Nintendo 3DS hardware. When the player uses a cannon or the Binoculars, the Nintendo 3DS accelerometer can be used to aim by tilting the 3DS. The game also includes a Streetpass option, where upon encounters, Mystery Boxes and Toad House items are exchanged between players. Items in Toad Houses sent by another player are recorded, including the amount of items sent by the user.
There are at least four returning tracks from Super Mario Galaxy: the Airship theme, the Sweet Sweet Galaxy theme, and a remixed version of Flipswitch Galaxy's theme, Ghostly Galaxy's mansion theme, and the Cosmic Mario theme. There is also one track returning from Super Mario Galaxy 2: the Peewee Piranha theme used on Bonus Planets. (This boss theme was also present during the battle with Boom Boom at the E3 Demo as placeholder music. The track is nowhere to be found in the full game). The "tick-tock" that is heard when a timed Ground Pound Switch in the Super Mario Galaxy series is activated is used for when a P-Switch has been jumped on.
Controls
• : Move.
• /: Choose level, Jump, Wall Jump.
• Hold (/): Slow fall (Tanooki Mario).
• Hold (/)+: Dash
• /: Crouch, enter a Warp Pipe, enter a cannon.
• (/)+: Crawl.
• (/)+/(): Roll.
• +(/)+(/): Long Jump.
• +(/)+(/)+(/): Rolling Long Jump.
• (/)+(/): Ground Pound, transform into Statue Mario/Luigi (Tanooki Mario/Luigi with scarves)
• Hold (/)+(/): Backwards Somersault
• /: Shoot Fireballs (Fire Mario), throw a boomerang (Boomerang Mario), attack with tail (Tanooki Mario).
• /: Pause menu.
• (Hold right or left)+:Side Jump
• Left or right, change camera angle. Up, enter normal view (objects on the screen pop-out more). Down, enter extended depth view (the objects push further into the screen).
Nintendo eShop Description
Platforming with serious depth! With the 3D visuals of Super Mario 3D Land, players can see exactly where floating ? Blocks and flying Paragoombas are, so that they can jump and stomp with the precision of the pros. Expert gamers will appreciate the way 3D graphics reveal the true challenge of the levels, so that they can focus on nailing the perfect jump or shaving precious seconds off their speed runs, while new players will find that 3D makes platforming simple to grasp and satisfying to master.
Try on Mario's Tanooki Suit, and put some spring in your step! While longtime gamers will delight in using Tanooki Mario's tail-spin attack to sweep enemies off their feet and fluttering through the air to land super-long jumps, a new generation will learn what makes this classic suit a fan favorite. But even seasoned players will be in for a surprise--Mario's enemies may be sporting the familiar Tanooki tail too!
Mario at his very best! Mario returns to his roots in his first 3D platforming adventure designed exclusively for a handheld system. From the frantic race-against-the-clock dash through the Mushroom Kingdom to that final leap to grab the top of the flagpole, this eye-popping addition to the Super Mario series combines everything that makes Mario great from one generation to the next.
Characters
Playable Characters
Boom Boom and his female counterpart Pom Pom.
Villains
Supporting Characters
Transformations
A power-up chart.
Small Mario/Luigi
(After taking damage or eating a Poison Mushroom)
Mario/Luigi
(Starting form, Super Mushroom required)
Fire Mario/Luigi
(Fire Flower required)
Tanooki Mario/Luigi
(Super Leaf required)
Boomerang Mario/Luigi
(New, Boomerang Flower required)
Statue Mario/Luigi
(Statue Leaf required)
Invincible Mario/Luigi
(Star required)
White Tanooki Mario/Luigi
(New, Invincibility Leaf required)
Enemies
New Enemies
Returning Enemies
Features
Power-Ups
Other Items
Worlds
Normal Worlds
Special Worlds
Others
• Toad Houses - They work the same way as in Super Mario Bros. 3, but StreetPass friends can send gifts to the Toad House that contain items.
• Mystery Boxes - Mario can go inside them, and they contain various different tasks, such as defeating all the enemies in the box. After completing the tasks, Mario will receive Coins, 1-Up Mushrooms, and/or a Star Medal. Friends via StreetPass can also send the player Mystery Boxes, which always contain at least one Star Medal.
• A room with colored blocks that cause an optical illusion, where Mario can train and learn movements. It is accessed by remaining idle at the end of the title cutscene. The room strongly resembles Peach's Castle.
Development
Game screenshots as seen at Game Developers Conference in 2011.[2]
Super Mario 3D Land was first mentioned in an "Iwata Asks" interview with Shigeru Miyamoto in October 2010, where he confirmed that a brand-new Super Mario Bros. game for the Nintendo 3DS was already in development, but had not yet been given a proper title.[3] It was known by its tentative title, Super Mario at the time. In November 2010, Shigeru Miyamoto announced that both 2D world and 3D world Mario games were in the works for the 3DS.[4] Four screenshots were available on March 2 2011, and the game was officially announced during the Game Developers Conference, under the name Super Mario. The logo had a Raccoon Tail on the "O" letter, similar to that of Super Mario Bros. 3's logo, which had Raccoon Mario's tail shadow behind the "3". Available screenshots of Super Mario revealed that the game is a 3D platformer and the game was stated to be developed by Nintendo EAD Tokyo's same team which had previously developed Super Mario Galaxy and its sequel, as shown how a Goomba runs after Small Mario. It even contained features from the 2D Mario side-scrolling games. Satoru Iwata stated that a more official announcement would be shown at E3 2011 on June 7. According to Iwata, "it will be a game that will come with the kind of surprises and fun that only the 3DS can offer."[5] Shigeru Miyamoto has stated that the development took over two years and started with 2 to 30 staff members working on the game.[6]
In a later interview, Shigeru Miyamoto described the title as being a combination of Super Mario Galaxy and Super Mario 64, with a little bit of New Super Mario Bros. and New Super Mario Bros. Wii. He mentioned there would be an option for a fixed camera system, very similar to the one in Super Mario 64, to demonstrate depth and the 3DS's 3D. He added, however, that it was tough to describe it, before mentioning that not only would the title be shown, but that it would also be playable at E3 2011. Shigeru Miyamoto explained that playing it will give fans a better idea of what it's like. He also commented on the speculation regarding the temporary logo, already confirming that the tail on the end of the logo's "O" was a hint at the return of Super Mario Bros. 3's Tanooki Mario.[7]
The four-level demo.
The game was given a full reveal with a trailer at E3 2011 and was playable on the show floor, as previously stated. It was announced that the game was targeted for a release by the end of the year. Attendees were allowed to try the game for themselves in four different levels - a standard plain area, an underground area, a level of switch-activated platforms, reminiscent of a few galaxies from the Super Mario Galaxy titles, and an airship level ending in a fight with Bowser's henchman, Boom Boom. In addition, the E3 2011 trailer and the conference trailer were put up for download on the 3DS eShop for a limited time. By playing the trailer on their 3DS, viewers could then see the game in stereoscopic 3D for themselves.
The main ambition of the design team was to "reset" the conventions of 3D Mario games, which were mostly designed for home consoles.[8] One of the ways of doing that was to create short, pick-up and play levels more suitable to a handheld, as opposed to the Super Mario Galaxy series, and more specifically Super Mario Galaxy 2, which director Koichi Hayashida described as a "Manchu Han Imperial Feast."[8]
The developers also wanted the game to serve as a jumping point for players that liked 2D Mario but did not want to play the 3D installments.[8] One of the solutions was to eschew the exploration-based level design of the traditional 3D Marios so that the players would not get "lost", and return the focus on reaching the end of linear levels. The levels were carefully designed to lead the player toward the end goal.[8] However, the developers included Star Medals hidden throughout the levels to cater to the 3D Mario players and thus bridge the two game design sensibilities.[8]
The development was heavily affected by the 2011 Tōhoku earthquake and tsunami.[9] Damage to the train network led to developers visiting the Kyoto office to be stuck there, and fear of aftershocks and radiation emanating from the damaged Fukushima nuclear plant caused several developers to lock themselves in their homes. These events made Nintendo unsure of whether development could continue in Tokyo.[9] Tired of not doing anything, Hayashida risked sharing his personal contact information with other members. This lead to a web forum being set up so that work could be continued while the Tokyo office was closed.[9]
The developers were pressured to finish the game in time for the 2011 holiday Season, which lead to parts of 3D Land being outsourced to other Nintendo-affiliated developers such as Brownie Brown,[9] something that does not typically happen with Mario games.
Reception
Since the Japanese release, the game has been reviewed positively by critics. IGN rated this game a 9.5/10[10], Euro Gamer 9/10[11], Joystiq 4.5/5[12], GamePro 5/5[13], GameInformer 9.5/10[14], N-Zone 90/100, Famitsu 38/40[15], and Edge with 8/10[16]. As of December 10, 2011, gamerankings has an average score of 90.02% out of 46 scores[17] and metacritic with an average score of 90% out of 71 reviews, 70 were positive, 1 was mixed[18]. The game has sold over 8.29 million units[19] so far and is causing a great boost in 3DS sales.[20] It is also the fastest-selling portable Mario game ever.
Gallery
For this subject's image gallery, see Gallery:Super Mario 3D Land.
Beta Elements
Main article: List of Super Mario 3D Land beta elements
Glitches
Main article: List of glitches in Super Mario 3D Land
Staff
Main article: List of Super Mario 3D Land staff
References to Other Games
• Donkey Kong: In the final battle with Bowser, Bowser throws barrels at Mario, similar to Donkey Kong.
• Super Mario Bros.: Mario's original sprite from this game appears as his world map icon on the touch screen. False Bowsers return with a similar battle style. A remix of the main theme from this game is played in Coin Heavens and in World 2-3 (Mario is also humming the theme in the cutscene between Worlds 5 and 6). This level also contains platforms identical to sprites of Mario, Peach, Luigi and a Super Mushroom from this game and the end of the level is designed like the commonly seen end of level in that game. Special 1-3 contains platforms that are identical to a ? Block, a Goomba, a Cloud, a Bullet Bill, a Cheep-Cheep, and three fireballs and the end of the level is designed like a night time end of a level in that game. The end of level music also plays at the end of 2-3 and Special 1-3. The "crown award" used to represent a further obtention of extra lives returns, but now 3 Crowns appear instead. Mario's first encounter with False Bowser is modeled after the original encounters in SMB, including pressing a switch that will send False Bowser to his doom. True to the original game, the first False Bowser is a Goomba.
• The Legend of Zelda series: World 5-2 is based on the gameplay of the early The Legend of Zelda games (with the overhead camera view). In a particular area of that level, lighting all of the torches there opens up a gate and plays the classic "puzzle solved" tune from this series.
• Super Mario Bros.: The Lost Levels: Poison Mushrooms return from this game. Mario and Luigi retain their singular characteristics (Mario is more stable and balanced while Luigi jumps higher at the cost of worse traction). The phrase "THANK YOU!!" appears in the last level, but is in English instead.
• Super Mario Bros. 2: Mario and Luigi's chargeable jumps while crouching work in an identical way to that of the Power Squat Jump ability that the playable characters can perform in Super Mario Bros. 2 while crouching. The back flip addition works similarly to the upgraded version of the jump from the remake of the game in Super Mario Advance. After losing a life, Mario and Luigi start in their super forms, which is similar to how a character in this game will retain their super form after losing a life (This is also like in the 3D titles).
• Super Mario Bros. 3: Tanooki Mario, Jump Blocks and Super Leaves return; Boom Boom also makes his first appearance since this game. A remix of the Toad House theme from this game plays while outside and inside a Toad House. The backgrounds of some cutscenes between worlds (such as after completing World 2) have mountains and item sprites reminiscent to this game. Some levels have a remix of an overworld theme from Super Mario Bros. 3. The background of Special 8 highly ressembles a Super Mario Bros. 3 level, even having the same ground style.
• Super Mario World: Some enemies, such as Grinders and Mega Moles, return from this game. The backgrounds of some cutscenes between worlds strongly resemble those of Chocolate Island. The sound heard when Mario exits the level after beating it in this game is present in Super Mario 3D Land after Luigi's letter is seen. Also, in the E3 2011 demo, a Jump Block would make the sound when Yoshi is mounted occasionally. Mario can also keep items that he grabs. World 4-2 may be a reference to Vanilla Secret 1 and World 5-4, a reference to Valley of Bowser 1. Also, in the letter received when World 3 is completed, Mario's jumping out of the bubble will have a Super Mario World jump or Cape swing sound effect.
• Super Mario 64: Mario's voice when falling from a high place is reused during the cutscene before Bowser's last fight. Also, a sped up version of this sound is used when Mario's falling to death. Boos also have their iconic laugh from this game.
• Super Mario Sunshine : Many of the platforming areas are actually reminiscent of those in Super Mario Sunshine, especially those involving tightropes. World 6-1 seems to have slight similarities too. Also, the cutscene before the true final battle features Bowser trying to squish Mario but, accidentally breaking the floor instead causing the two to fall to another part of the castle. This is similar to the cutscene before Petey Piranha's first battle; in both cases, Mario and the boss look around as the floor cracks just before they fall.
• Mario and Luigi: Superstar Saga: Tail Goombas look like Tanoombas, but without the raccoon ears and leaf on their heads. They also can't transform.
• New Super Mario Bros.: Star Coins return as Star Medals and have a similar use (unlock levels). Some flowers and bushes have a similar design to the ones from this game. Also, some levels share a similar design. A lot of returning enemies keep their NSMB designs.
• Super Princess Peach: Ball 'n' Chains swing in a pendulum-like manner again and are similar to appearance except the spiked ball is purple and not Bowser-styled.
• Flipnote Studio: The background music from Special 8 map is based on the Mario's Drawing Song.
• New Super Mario Bros. Wii: Upon getting the maximum amount of lives (1,110 lives), Super Mario loses his hat and Small Mario does the opposite; he gains his hat instead. The Propeller Block returns in the form of a box. Most of Mario's voices are reused. Flophoppers act a bit like Bramballs, as they walk around, and for every step they flip 180 degrees, and have similar suction cups (except without the leaves).
• Super Mario Galaxy / Super Mario Galaxy 2: Many level obstacles return from these games along with some of the levels' music. The Blue and Red Flipping Platforms return, but they are activated by jumping. Many levels involve traveling from one floating platform to the next, comparable to traveling to each planetoid in the Galaxy series. Also, the way Goombas "charge" returns. Luigi's death scream from these games is reused in this game. Flophoppers are similar to Swaphoppers, and Cosmic Clones and Magmaarghs return.
References in Later Games
• Mario Kart 7: The new design for the Super Leaf is used in this game - both for the item and a replacement of the old emblem of a generic leaf for the Leaf Cup. Stingbies return in the Honeybee Hive, and Cardboard Goombas also return in Piranha Plant Slide.
• Mario Tennis Open: The new Tanooki Suit design is unlockable as a costume for a player's Mii in the game, plus a racket was made to fit it. Inky Piranha Plants reuturn.
• StreetPass Mii Plaza: One of the newer Puzzle Swap panels in the StreetPass Mii Plaza app for the Nintendo 3DS is Super Mario 3D Land.
• New Super Mario Bros. 2: The Invincibility Leaf, Peepas, Coin Coffers, and Goomba Towers return. Also, the Gold Block acts much like the Question Box, makes the same sound effects, but produces coins more frequently. The Super Leaf has the same design again.
• Paper Mario: Sticker Star: The Poison Mushroom has the same design as in this game.
• New Super Mario Bros. U: Some of Boom Boom's voices in this game are reused.
Media
Main article: List of media from Super Mario 3D Land
Super Mario 3D Land - The game's trailer.
1:15
File info
Super Mario 3D Land - The game's second trailer as seen at Nintendo 3DS Conference 2011.[video 1]
1:06
File info
Super Mario 3D Land - The game's third trailer.
1:23
File info
Super Mario 3D Land - Title screen theme
1:29
File info
Having trouble playing?
Trivia
• According to Mario creator Shigeru Miyamoto, the term Land is used in the title of this game to pay homage to past Mario titles, like Super Mario Land and its 2D art style.[21]
• The yellow switch that changes the camera angle from this game has an eye icon. This eye is the same as the one seen when in first-person mode in the Super Mario Galaxy games.
• This is the first Mario platformer game since Super Mario World where Mario cannot perform a Triple Jump (released 21 years prior). This is also the first 3D Mario platformer game where he cannot perform this move.
• This is also the first Mario platformer game since Super Mario Bros. 3 and Super Mario 64 where neither Yoshi (including cameos in Super Mario Galaxy and minigames in New Super Mario Bros.) nor Bowser Jr., respectively make an appearance, despite their constant involvement in the previous installments.
• Super Mario 3D Land is the first installment in the Mario series overall (excluding crossover installments) to be officially localised to Dutch, Portuguese and Russian. [22] [23] [24]
• Mario & Sonic at the Olympic Winter Games is actually the first game with Mario officially localised to Dutch. However, it is a crossover game and it is localised and published by Sega. Nintendo also stated on its official news update: "SUPER MARIO 3D LAND™ and Mario Kart 7 include for the first time [in the Mario series] fully Dutch screen texts." [22]
External links
References
1. ^ GDC: Super Mario 3DS Revealed
2. ^ Nintendo @ GDC 2011
3. ^ Iwata Asks: Super Mario Bros. 25th Anniversary
4. ^ Video Games Blogger - Super Mario 3DS games on the way in 2D and 3D, says Shigeru Miyamoto
5. ^ Nintendo CEO Satoru Iwata on 3DS Mario and Sales Targets
6. ^ [1]
7. ^ Super Mario 3DS Combines Galaxy and Mario 64, Will be at E3
8. ^ a b c d e Iwata Asks: Super Mario 3D Land (accessed April 02 2012)
9. ^ a b c d How Super Mario Survived the Quake (accessed April 02 2012)
10. ^ http://ds.ign.com/articles/121/1211974p1.html
11. ^ http://www.eurogamer.net/articles/2011-11-10-super-mario-3d-land-review
12. ^ http://www.joystiq.com/2011/11/09/super-mario-3d-land-review/
13. ^ http://www.gamepro.com/article/reviews/224745/review-super-mario-3d-land-3ds/
14. ^ http://www.gameinformer.com/games/super_mario_3d_land/b/3ds/archive/2011/11/09/super-mario-3d-land-review-mario-returns-to-rescue-the-princess-and-the-3ds.aspx
15. ^ http://gonintendo.com/?mode=viewstory&id=164781
16. ^ http://n4g.com/news/884809/edge-super-mario-3d-land-review
17. ^ http://www.gamerankings.com/3ds/620831-super-mario-3d-land/index.html
18. ^ http://www.metacritic.com/game/3ds/super-mario-3d-land
19. ^ http://gonintendo.com/?mode=viewstory&id=201026
20. ^ http://www.zdnet.com/blog/btl/super-mario-3d-land-release-in-japan-skyrockets-nintendo-3ds-sales/63054
21. ^ http://www.youtube.com/watch?v=yJHeRRp_R_Y
22. ^ a b Nintendo of the Netherlands - Geef Bowser een zwieper - de Tanooki power-up is terug
23. ^ Nintendo of Portugal - SUPER MARIO 3D LAND e Mario Kart 7 chegam à Nintendo 3DS em português!
24. ^ Nintendo Russia - Official Super Mario 3D Land Website
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:10.000Z
|
muq65sxyq4re522cvuiws466pv6uxltr
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67494",
"uncompressed_offset": 592087941,
"url": "www.mdpi.com/1420-3049/6/12/M248",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.mdpi.com/1420-3049/6/12/M248"
}
|
cccc_CC-MAIN-2013-20
|
Molecules 2001, 6(12), M248; doi:10.3390/M248
Short Note
4-Hydroxyphenyl 4-Ferrocenylbenzoate
Department of Chemistry, Sichuan Normal University, Chengdu, 610066, China
* Author to whom correspondence should be addressed.
Received: 12 May 2001 / Accepted: 15 May 2001 / Published: 25 May 2001
(This article belongs to the Section Molbank Section of Molecules, 1997-2001)
Download PDF Full-Text [125 KB, uploaded 27 April 2009 15:28 CEST]
No abstract available
Keywords: liquid crystal; non-linear optical material; metallomesogen; ferrocene; 4-ferrocenylbenzoic acid; 1; 4-dihydroxybenzene; esterification reaction; 4-hydroxyphenyl 4-ferrocenylbenzoate; ester
Supplementary Files
Article Statistics
Click here to load and display the download statistics.
Cite This Article
MDPI and ACS Style
Zhao, K.-Q.; Hu, P.; Xu, H.-B. 4-Hydroxyphenyl 4-Ferrocenylbenzoate. Molecules 2001, 6, M248.
AMA Style
Zhao K-Q, Hu P, Xu H-B. 4-Hydroxyphenyl 4-Ferrocenylbenzoate. Molecules. 2001; 6(12):M248.
Chicago/Turabian Style
Zhao, Ke-Qing; Hu, Ping; Xu, Hong-Bo. 2001. "4-Hydroxyphenyl 4-Ferrocenylbenzoate." Molecules 6, no. 12: M248.
Molecules EISSN 1420-3049 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:18.000Z
|
y5dda3z3e76q5yxim2zmoloq222uibun
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67508",
"uncompressed_offset": 639590552,
"url": "www.openwetware.org/index.php?diff=prev&oldid=603727&title=IGEM",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.openwetware.org/index.php?title=IGEM&diff=prev&oldid=603727"
}
|
cccc_CC-MAIN-2013-20
|
IGEM
From OpenWetWare
(Difference between revisions)
Jump to: navigation, search
(2012)
(2012)
Line 13: Line 13:
===2012===
===2012===
-
*[[IGEM:Paris_Bettencourt_2012| Paris]]
+
*[[IGEM:Paris_Bettencourt_2012/| Paris]]
===2010===
===2010===
Revision as of 12:01, 22 May 2012
iGEM is the international genetically engineered machines competition. The objective of the competition is to design and build an engineered biological system using DNA. Systems will be constructed from standard biological parts. You can read more about last year's competition here.
See iGEM:Help for useful help pages for iGEM teams! Please add to the list.
2012
2010
2009
2008
2007
2006
Useful pages for inter-team collaboration
Good Lab Citizenship
Wiki tips
1. To easily add a link to a part's Registry page, use the <bbpart></bbpart> tags. For instance, <bbpart>BBa_R0011</bbpart> gives <bbpart>BBa_R0011</bbpart>.
History
IGEM recent changes
16 May 2013
17:48 IGEM:UC-Merced/2009/Notebook/E. hydro Express (diff; hist) . . (+432) . . Sunny Seth (Talk | contribs) (Notes: )
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:12:29.000Z
|
6lcsjy64ubsfeq5rwhvjdwbmrramjb22
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67510",
"uncompressed_offset": 653826852,
"url": "www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A1999.04.0060%3Aentry%3Dspectaculum&toc=Perseus%3Atext%3A1999.04.0060%3Aalphabetic+letter%3Dl",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=Perseus:text:1999.04.0060:entry=spectaculum&toc=Perseus%3Atext%3A1999.04.0060%3Aalphabetic+letter%3Dl"
}
|
cccc_CC-MAIN-2013-20
|
spectāculum (-tāclum, Pr.), ī, n
specto, a place from which shows are witnessed, spectator's seat, place in the theatre : ex omnibus spectaculis plausus est excitatus: spectacula sibi facere, L.A show, sight, spectacle : superarum rerum atque caelestium: bis terque mutatae dapis, H.: scorti procacis, L.: Non hoc ista sibi tempus spectacula poscit, V.: praebent spectacula capti, O.: homini non amico nostra incommoda spectaculo esse nolim.— A public sight, show, stage-play, spectacle : spectacula sunt tributim data: gladiatorum, L.: scenae, O.: nondum commisso spectaculo, L.
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
hide Dictionary Entry Lookup
Use this tool to search for dictionary entries in all lexica.
Search for in
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:38:57.000Z
|
yrt5nxbpdcck67muvjv6zspvg2hrlhns
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67511",
"uncompressed_offset": 653871999,
"url": "www.perseus.tufts.edu/hopper/text?doc=urn%3Acts%3AgreekLit%3Atlg0032.tlg006.perseus-eng1%3A7.3.5",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=urn:cts:greekLit:tlg0032.tlg006.perseus-eng1:7.3.5"
}
|
cccc_CC-MAIN-2013-20
|
[5] My own opinion is, seeing that here we neither have money with which to buy nor are permitted to take anything without money, that we ought to set forth to the villages from which we are permitted to take, since their inhabitants are weaker than ourselves, and that there, possessed of provisions and hearing what the service is that one wants us for, we should choose whatever course may seem best to us.
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
load focus Greek (1904)
hide Places (automatically extracted)
View a map of the most frequently mentioned places in this document.
Visualize the most frequently mentioned Pleiades ancient places in this text.
Download Pleiades ancient places geospacial dataset for this text.
hide References (1 total)
hideData/Identifiers
Citation URN: urn:cts:greekLit:tlg0032.tlg006.perseus-eng1:7.3.5
Document URN: urn:cts:greekLit:tlg0032.tlg006.perseus-eng1
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:12:26.000Z
|
sy7ndzxdagzoaxxg2ufdozhh4jbea4cd
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67516",
"uncompressed_offset": 705215844,
"url": "www.seroundtable.com/archives/002677.html",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.seroundtable.com/archives/002677.html"
}
|
cccc_CC-MAIN-2013-20
|
Toolbar PageRank Update Imminent
Oct 18, 2005 • 9:19 am | (3) by | Filed Under Google Search Engine
Matt Cutts wrote on his blog today:
Just to give you a heads-up, I think a new set of backlinks (and possibly PageRank) will probably be visible relatively soon; I’m guessing within the next few days. I still expect some flux after that though, just to let you know.
You can pretend you don't care, but then you'd be lying :-)
Previous story: Face of Jesus Found In Sand Dune Using Google Maps
blog comments powered by Disqus
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:03:41.000Z
|
7cf33q6etoidqgjqkujmtjbqddm6hz5p
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67532",
"uncompressed_offset": 811008969,
"url": "www.werelate.org/wiki/Place:La_Mirada,_Los_Angeles,_California,_United_States",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.werelate.org/wiki/Place:La_Mirada,_Los_Angeles,_California,_United_States"
}
|
cccc_CC-MAIN-2013-20
|
Place:La Mirada, Los Angeles, California, United States
Watchers
NameLa Mirada
Alt namesMirada Hills
TypeInhabited place
Coordinates33.917°N 118°W
Located inLos Angeles, California, United States
the text in this section is copied from an article in Wikipedia
La Mirada is a city in southeast Los Angeles County, California, United States, and is one of the Gateway Cities. The population was 48,527 at the 2010 census, up from 46,783 at the 2000 census. The city of La Mirada was listed on CNN Money Magazine's "Best Place to Live" list. La Mirada placed 34th on the list, with the La Mirada Theatre for the Performing Arts and the Splash! La Mirada Regional Aquatics Center as two of its main attributes. It is the home of Biola University, an evangelical Christian institution of higher education. It is also the home of the La Mirada Theatre for the Performing Arts. The Elephant Bar restaurant chains offices are located there.
Contents
History
the text in this section is copied from an article in Wikipedia
La Mirada (Spanish for The Look) was the creation of two men, Andrew McNally, a printer and mapmaker from Chicago (see Rand McNally) and his son-in-law Edwin Neff. In 1888, McNally purchased over of Rancho Los Coyotes, south of Whittier, for $200,000. He developed into his own home called Windermere Ranch and surrounded it with olive, orange and lemon groves. McNally built a plant to process the olive oil, which was of the best quality, as well as a railroad station on Stage Road. From here his olive oil and fruit were shipped all over the U.S.
In 1896, McNally turned his property over to his daughter and his son in law. McNally and Neff formed the La Mirada Land Company, which published a booklet entitled "The Country Gentleman in California", advertising parcels of land for sale including pictures, a map and descriptions of the scenic olive, alfalfa, lemon and grapefruit groves.
In 1946, "Along Your Way", a "Station by Station Description of the Santa Fe Route Through the Southwest," describes La Mirada with a population of 213, surrounded by orange, lemon, walnut and olive groves; oil wells; olive oil factory; and fruit packing houses.
The city received a lot of attention for the fact that it was going to be completely structured and planned out. Referred to as "the Nation's completely planned city" during the early 1950s, the city of La Mirada received a lot of attention from the State Fair. The Fair praised the city for planning for the future while still maintaining practicality for today.
In 1953, the land was sold to subdivisions for 5.2 million dollars, one of the largest real estate transactions in California. By 1960, the year the city was incorporated, La Mirada had grown from a mere 100 homes to over 8,000.[1] The city was incorporated as "Mirada Hills" on March 23, 1960. On November 8, 1960, voters approved a change of name to the current La Mirada, which was officially certified on December 15, 1960.
Today, the current population is just over 50,000 with the addition of a new subdivision on the eastern portion of the town.
See Also
Notes and References
source: Getty Thesaurus of Geographic Names
source: Family History Library Catalog
Further Reading
External Links
• Our La Mirada - photos and memorabilia from the 1955-1975 era, plus some earlier historical photos and articles.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:40:21.000Z
|
whjmudr7jv3segwkafwnvrwbbtikjhof
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67533",
"uncompressed_offset": 811016779,
"url": "www.werelate.org/wiki/Place:Taylor,_Lackawanna,_Pennsylvania,_United_States",
"warc_date": "2013-11-22T14:34:09.000Z",
"warc_filename": "<urn:uuid:db397b03-5955-406d-9f8e-7df4a1b64ca5>",
"warc_url": "http://www.werelate.org/wiki/Place:Taylor,_Lackawanna,_Pennsylvania,_United_States"
}
|
cccc_CC-MAIN-2013-20
|
Place:Taylor, Lackawanna, Pennsylvania, United States
Watchers
NameTaylor
Alt namesTaylorvillesource: USGS, GNIS Digital Gazetteer (1994) GNIS42026690
TypeBorough
Coordinates41.391°N 75.715°W
Located inLackawanna, Pennsylvania, United States
source: Getty Thesaurus of Geographic Names
source: Family History Library Catalog
the text in this section is copied from an article in Wikipedia
Taylor is a borough in Lackawanna County, Pennsylvania, United States, four miles (six km) southwest of Scranton on the Lackawanna River. It was founded in 1790 by Cornelius Atherton. Silk manufacturing and coal mining were once practiced in the borough. Most of Taylor is over abandoned mines. In 1900, 4,215 people lived in Taylor; in 1910, 9,060; and in 1940, 9,002 people resided in the borough. The population at the 2010 census was 6,263.
Research Tips
This page uses content from the English Wikipedia. The original content was at Taylor, Pennsylvania. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:00:14.000Z
|
m6cl2hurhdlc2ytqa2paxmp5tnbfpbbm
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67553",
"uncompressed_offset": 12667724,
"url": "archive.mises.org/8199/the-government-wrecks-the-economy/",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://archive.mises.org/8199/the-government-wrecks-the-economy/"
}
|
cccc_CC-MAIN-2013-20
|
1. Skip to navigation
2. Skip to content
3. Skip to sidebar
Source link: http://archive.mises.org/8199/the-government-wrecks-the-economy/
The Government Wrecks the Economy
June 15, 2008 by
At this point it is just a waiting game for the National Bureau of Economic Research to declare that we have been in recession. Of course they work from past data; we all do. But the data will show what has been true for months. Investment is falling. Unemployment is rising. The trends are consistent with every single recession on record. Have a look for yourself.
All that is bad enough. Maybe your job is secure. Maybe you are out of the stock market. Maybe you aren’t waiting for a return on some real estate investment. The problem that hits everyone is inflation, which is roaring out of control in all the sectors we care about. We have entered the double digits, and if producer prices forecast consumer prices, we are in for tougher times ahead.
So what does Washington do? In an act of incredible stupidity, Congress has passed an extension of unemployment benefits. The old rule remains true: if you subsidize something, you get more of it. So this will give us more unemployment. No question about that. It will thereby worsen and prolong the problem. FULL ARTICLE
Previous post:
Next post:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:48:40.000Z
|
3ku24tdiai2dq7qf3hl5rbdzivrjo2a4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67555",
"uncompressed_offset": 14477775,
"url": "arthritis-research.com/content/7/S1/P53/citation",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://arthritis-research.com/content/7/S1/P53/citation"
}
|
cccc_CC-MAIN-2013-20
|
Download references
This article is part of the supplement: 25th European Workshop for Rheumatology Research
Neutralizing IL-17 during re-activation of experimental arthritis prevents joint inflammation and bone erosion by decreasing RANKL and IL-1
MI Koenders, E Lubberts, LAB Joosten and WB van den Berg
Arthritis Research & Therapy 2005, 7(Suppl 1):P53 doi:10.1186/ar1574
Include
Format
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:27:33.000Z
|
fbac4exz3fwthx3lbu5szxv5b2jgqfsj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67561",
"uncompressed_offset": 30842931,
"url": "blog.mozilla.org/privacy/2013/01/28/newdntui/",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://blog.mozilla.org/privacy/2013/01/28/newdntui/"
}
|
cccc_CC-MAIN-2013-20
|
“do track or do not track?” — that is the question
Sid Stamm
5
For a while now, we’ve been talking about how the Do Not Track feature really has three states: “user says nothing”, “user says track”, and “user says don’t track”. In Firefox 4, we introduced two of these states with a checkbox (“user says nothing” and “user says don’t track”), and many people are voicing their desire to opt-out.
Of course, it’s reasonable to expect some people want the tracking to improve the quality of ads they see; after all, the goal of this feature is to help each individual say what they want, whether it’s pro-tracking or not.
I just finished updating the Firefox tracking preference interface to give people the ability to say, “this tracking thing is fine, bring on the custom content!” This change is still experimental, but within a day or so it will be available in our Nightly builds for testing. Take a look, let us know what you think.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:59:53.000Z
|
vhd22yqgtes6pj7v5yrfrt77w5pwmayu
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67578",
"uncompressed_offset": 53958610,
"url": "cnx.org/content/m13647/latest/content_info",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://cnx.org/content/m13647/latest/content_info"
}
|
cccc_CC-MAIN-2013-20
|
Connexions
Sections
You are here: Home » Content » Tutorial de Roadmap
View the content: Tutorial de Roadmap
Metadata
Name: Tutorial de Roadmap
ID: m13647
Language: Español (es-es)
Summary: Descripción de Connexions Roadmap y las funcionalidades de anotación.
Subject: Science and Technology
Keywords: anotaciones, Connexions, Courseview, navegador, roadmap, tutorial
Document Type: -//CNX//DTD CNXML 0.5//EN
License: Creative Commons Attribution License CC-BY 2.0
Authors: Carlos Ananías Del Águila (cananiasdelaguila@yahoo.es)
Copyright Holders: Carlos Ananías Del Águila (cananiasdelaguila@yahoo.es)
Maintainers: Carlos Ananías Del Águila (cananiasdelaguila@yahoo.es)
Latest version: 1.1 (history)
First publication date: May 23, 2006 11:19 am -0500
Last revision to module: Jun 6, 2006 2:57 am -0500
Based On: Roadmap Tutorial
Originally By: Elizabeth Bartmess (bartmess@alumni.rice.edu), Mark Husband (mshusband@comcast.net)
Downloads
PDF: m13647_1.1.pdf PDF file, for viewing content offline and printing. Learn more.
EPUB: m13647_1.1.epub Electronic publication file, for viewing in handheld devices. Learn more.
XML: m13647_1.1.cnxml XML that defines the structure and contents of the module, minus any included media files. Can be reimported in the editing interface. Learn more.
Source Export ZIP: m13647_1.1.zip ZIP containing the module XML plus any included media files. Can be reimported in the editing interface. Learn more.
Version History
Version: 1.1 Jun 6, 2006 2:57 am -0500 by Carlos Ananías Del Águila
Changes:
Primera versión de la traducción al castellano del módulo "Roadmap Tutorial" de Mark Husband.
How to Reuse and Attribute This Content
If you derive a copy of this content using a Connexions account and publish your version, proper attribution of the original work will be automatically done for you.
If you reuse this work elsewhere, in order to comply with the attribution requirements of the license (CC-BY 2.0), you must include
• the authors' names: Carlos Del Águila
• the title of the work: Tutorial de Roadmap
• the Connexions URL where the work can be found: http://cnx.org/content/m13647/1.1/
See the citation section below for examples you can copy.
How to Cite and Attribute This Content
The following citation styles comply with the attribution requirements for the license (CC-BY 2.0) of this work:
American Chemical Society (ACS) Style Guide:
Del Águila, C. Tutorial de Roadmap, Connexions Web site. http://cnx.org/content/m13647/1.1/, Jun 6, 2006.
American Medical Assocation (AMA) Manual of Style:
Del Águila C. Tutorial de Roadmap [Connexions Web site]. June 6, 2006. Available at: http://cnx.org/content/m13647/1.1/.
American Psychological Assocation (APA) Publication Manual:
Del Águila, C. (2006, June 6). Tutorial de Roadmap. Retrieved from the Connexions Web site: http://cnx.org/content/m13647/1.1/
Chicago Manual of Style (Bibliography):
Del Águila, Carlos. "Tutorial de Roadmap." Connexions. June 6, 2006. http://cnx.org/content/m13647/1.1/.
Chicago Manual of Style (Note):
Carlos Del Águila, "Tutorial de Roadmap," Connexions, June 6, 2006, http://cnx.org/content/m13647/1.1/.
Chicago Manual of Style (Reference, in Author-Date style):
Del Águila, C. 2006. Tutorial de Roadmap. Connexions, June 6, 2006. http://cnx.org/content/m13647/1.1/.
Modern Languages Association (MLA) Style Manual:
Del Águila, Carlos. Tutorial de Roadmap. Connexions. 6 June 2006 <http://cnx.org/content/m13647/1.1/>.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:28:52.000Z
|
dejhunu2cba3kcwyvuywck646vfzcvl5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67594",
"uncompressed_offset": 79755418,
"url": "dotnetkicks.com/stories/18272/Introduction_to_Layout_Controls_in_Silverlight_2",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://dotnetkicks.com/stories/18272/Introduction_to_Layout_Controls_in_Silverlight_2"
}
|
cccc_CC-MAIN-2013-20
|
Error!
Success!
Introduction to Layout Controls in Silverlight 2
0
kicks
Introduction to Layout Controls in Silverlight 2 (Unpublished)
Arranging controls on a user interface in a flexible manner is key to building successful applications. Silverlight 2 provides three main controls that can be used for layout management: · Canvas Control · StackPanel Control · Grid Control In this post I'll provide an introductory look at these controls and show how they can be defined in XAML. Future articles will use the layout controls to arrange controls that are capable of displaying data retrieved from remote sources. Let's start out by examining the Canvas control.
Kicked By:
Drop Kicked By:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:49:04.000Z
|
xue7szyur46juxsboq54lutw7hykbke5
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67595",
"uncompressed_offset": 79769358,
"url": "dotnetkicks.com/stories/5777/Show_all_GridView_Rows_in_EditMode",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://dotnetkicks.com/stories/5777/Show_all_GridView_Rows_in_EditMode"
}
|
cccc_CC-MAIN-2013-20
|
Error!
Success!
Show all GridView Rows in EditMode
0
kicks
Show all GridView Rows in EditMode (Unpublished)
Sometimes, in the application we have a requirement that you need to show the GridView rows in edit mode. This means that all the rows will contain textboxes and the data should be present in the textboxes. Once, you are done with editing you can update and get back to the view mode. In this post I will simply show you how to change the mode of the GridView from view to edit.
Kicked By:
Drop Kicked By:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:37:44.000Z
|
rmygihgqgnj33id5rvxfcb3uesw2uj2e
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67599",
"uncompressed_offset": 88112246,
"url": "elinux.org/index.php?oldid=72139&title=OMAP_RT",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://elinux.org/index.php?title=OMAP_RT&oldid=72139"
}
|
cccc_CC-MAIN-2013-20
|
OMAP RT
From eLinux.org
Revision as of 21:47, 27 October 2011 by Cschalle (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search
This page is for tracking the development and status of the real-time (RT) kernel on TI OMAP platforms.
Links
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:39:25.000Z
|
fkm6nzmjjnc2smgf7gkdkfrf32cmeh2s
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67614",
"uncompressed_offset": 98287549,
"url": "familysearch.org/learn/wiki/en/Sudbury_District,_Ontario",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://familysearch.org/learn/wiki/en/Sudbury_District,_Ontario"
}
|
cccc_CC-MAIN-2013-20
|
Sudbury District, OntarioEdit This Page
From FamilySearch Wiki
Canada Ontario Sudbury District
Contents
Getting Started
1. What information do you wish to locate about your ancestor? To choose the sources you need to search first, please click on RECORD SELECTION TABLE: Ontario, which will help you decide.
2. From the above Record Selection Table, which sources do you wish to check in this county? To check the availability of your sources of interest as well as to check the websites that have them online, please click on this county's SOURCES LINKS TABLE .
3. Do you know the location that you wish to search in this county? If so, please check for some possible sources and some online information about your location of interest, by clicking on this county's POPULATED PLACES TABLE .
4. For further information regarding your sources of interest, see "4 Resources" ABOVE in the "CONTENTS" table and click on the source of interest.
Remember that you should always try to get an original copy of that source to verify information.
Please be aware that this is a growing Pilot program, with new information being added on a regular basis.
NOTE: If you would like to participate in contributing information into this WIKI program, please go to the "Create a New Page" section of this screen, and follow the guidelines.
WELCOME ABOARD! More sharers of information = more information available for everyone!
History
Parent County
Boundary Changes
Record Loss
Places/Localities
Populated Places
Neighboring Counties
Resources
Biographies
At this time, please read about Biographies in the Province of Ontario Resources - Ontario Biography Biography.
Cemeteries
At this time, please read about Cemeteries in the Province of Ontario Resources - Cemeteries .
Census Records
At this time, please read about Census Records in the Province of Ontario Resources - Census .
Church Records
At this time, please read about Church Records in the Province of Ontario Resources - Church Records .
Court Records
At this time, please read about Court Records in the Province of Ontario Resources - Court Records.
Directories
At this time, please read about Directories in the Province of Ontario Resources - Directories.
Genealogy
At this time, please read about Genealogies in the Province of Ontario Resources - Genealogy.
Land and Property Records
At this time, please read about Land and Property Records in the Province of Ontario Resources - Land and Property.
Local Histories
At this time, please read about Local Histories in the Province of Ontario Resources - History.
Maps
At this time, please read about Maps in the Province of Ontario Resources - Maps.
Military Records
At this time, please read about Military Records in the Province of Ontario Resources - Military Records.
Newspapers & Obituaries
At this time, please read about Newspapers and Obituaries in the Province of Ontario Resources - Newspapers.
Probate Records
At this time, please read about Probate Records in the Province of Ontario Resources - Probate Records.
Taxation Records
At this time, please read about Taxation Records in the Province of Ontario Resources - Taxation.
Vital Records
At this time, please read about Vital Records in the Province of Ontario Resources - Vital Records.
Societies and Libraries
Web Sites
References
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 20 December 2012, at 04:17.
• This page has been accessed 397 times.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:38:53.000Z
|
so4rq352qd3gjbk464df4xohipz2nigf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67647",
"uncompressed_offset": 141185561,
"url": "issuepedia.org/David_Brin/The_Ultimate_Goal",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://issuepedia.org/David_Brin/The_Ultimate_Goal"
}
|
cccc_CC-MAIN-2013-20
|
David Brin/The Ultimate Goal
From Issuepedia
Jump to: navigation, search
In the previous section, we covered a short list of unconventional questions designed to avoid the stereotyped totems of typical political argument, and instead dive much deeper, to explore root attitudes. No doubt there are many other questions which might illuminate the opinions of diverse people heretofore trapped by the old, linear (left v. right) model. The objective was to provide room so that differences and quirks, as well as various styles of madness, might stand alone for inspection, unshaded and unsheltered by their neighbors.
(For an extensive exploration of this kind of assumption-checking, try taking "An Informal Questionnaire Regarding Fundamental Assumptions of Politics, Ideology and Human Destiny" http://www.davidbrin.com/questionnaire.html)
But let's say you don't have this checklist with you. Say you've forgotten (or don't particularly agree with!) the multi-dimensional models described in the previous section. Is there one simple question you can ask, to get a good idea where another person is coming from politically?
Ideally, it should be one that avoids standard rhetorical positions and postures. If possible, you want not to trigger automatic Republican or Democratic or Libertarian slogans. A better target lies at a deeper level: the level of myth.
For example, you can tell a lot about people by asking what they think of Robin Hood, Galileo, Henry VIII, Czar Nicholas, Plato, Pericles, Nat Turner and George Armstrong Custer, none of whom we readily relate to present-day politics. Without a pantry already filled with stock answers, the responses may lay open insights to attitudes about aristocracy, nobility, free inquiry, free speech, social obligation, charity, taxation, religious, sexual and ethnic tolerance, property rights, authority... and vanity. There are scores of other possibilities, providing only that your objective is to listen and understand the other person, not to take turns haranguing each other.
Here is my favorite question of them all.
If you had your way, and your revolution succeeded, what would the world of your great-grandchildren be like, in a hundred or two hundred or a thousand years?
Failure to ask this simple question in detail led to some of Karl Marx's worst errors. Making this basic inquiry allows one to discover astonishing commonalities and differences among people today.
To illustrate, let me offer up an answer of my own – in the allegorical form of a science fiction story I once read. How you react will tell a lot about, among other things, your position on the model political spectrum we discussed a little while ago.
In this story, a mad scientist manages to project the mind of a "volunteer" far ahead in time, into the brain of a person living in the 35th century. The subject finds himself suddenly occupying the body of a wonderfully healthy human specimen, walking through the most beautiful park-city he could have imagined. Wildly varied architecture mixes tastefully with lovely countryside. And many other handsome, healthy people of all ages and colors are moving about as well... dressed in a plethora of styles, laughing, playing, making music, or poring together over blueprints for brave new ventures in science or art.
This is no land of lotus eaters. There is even plenty of argument going on, though apparently nearly always even-tempered and friendly.
“A utopia?" the man speculates. Can it be? This appears to be a nation of vigorous, free, happy people. He wonders how they govern themselves.
At the edge of the park he encounters their House of Law – a small, slightly dusty building with only a few people lounging around, disputing amiably. And there, carved over the arched portal, can be read the society's only two laws.
1. Thou Shalt Not Offend Others.
2. Thou Shalt Not Allow Thyself To Be Offended Too Easily.
To his amazement, the time traveler finds over the course of his stay that the system works quite well. Whenever citizens are in dispute over a moderately serious matter – and in the unlikely event they cannot come to an agreement by themselves — they simply call on six randomly chosen individuals to hear them out and decide the case.
"Oh, was I being offended too easily?" one disputant says, on hearing the ad-hoc jury's considered opinion. Then, because it is the way a polite person behaves, and because he so chooses, he accepts their ruling and apologizes.
I will not go into the rest of the story. What matters is only that the allegory stuck in my mind. To me this seemed quite a fine place... one in which human beings were raised to be civilized, and to behave that way of their own volition, without coercion. I am well aware that idealized utopias can never adequately represent the gritty complexity and chaos of a real world. (Indeed, a key element of the Modernist Enlightenment is to know the difference between idealized notions and practical reality!) Nevertheless, this allegory distills something I would like to imagine possible for my descendants.
Obviously, it also tells you something about my beliefs. Truly mature citizens ought not to need an intricate wrapping of laws and regulations, in order to do what common sense dictates as good for all. Members of such a society, while vigorously and competitively pursuing their own fulfillment, would also see far enough ahead to know that their own self interest demands some degree of altruism and benevolence, because by acting that way they help maintain the culture that they love – a culture that maximizes their own opportunities for success.
Now comes the test. Did this little allegory please you? Did it approach describing what you would have for your grandchildren? If so, you belong somewhere in the bottom half of figure two (see the previous section of this series), with an arrow (representing your idealism) aimed generally downward. You also, clearly, believe in our improvability. (Note, we have no idea if this utopia-of-maturity was achieved through genetic manipulation or teaching, or some combination. Therefore, the third axis is provisionally neutral.)
In fact, I have found it amazing how many people respond positively to that little story. It sounds so essentially libertarian! But that should not be surprising. Stop and consider how well endowed our society is in anti-authority myths. Deep down, it appears to be an attitude shared by most Americans.
Take your typical Republican. He speaks in anti-authority terms... against the accumulation of power in the hands of snooty intellectuals and Big Government bureaucrats. His liberal Democrat son, too, decries conspiracies to gather power. Only he sees the threat posed by Big Business, religious fanatics and a conniving Aristocracy. Father and son do not recognize that, while they differ in important details, they share a premise. A Jeffersonian premise (actually dating back to Locke) stating that, all else being equal, people shouldn't push other people around, and those seeking power should be carefully watched. (Ah, but WHICH people?) Both would likely respond to my question in affirmation, agreeing that the depicted world of the 35th century would be a pretty nice place to raise kids.
They share a goal. It is the question, “How do we get there?" which divides father and son.
Here, indeed, is where many of the people so far joined in the anti-authority half of figure two part company. Some believe collective action will be necessary in order to arrive at that beautiful future. Others think that that is exactly the wrong road, leading instead straight down the road to hell.
Contents
[edit] More Questions, More Metaphors
How do we get to that (or any related) promised land? Having eliminated from our discussion (momentarily) those who seek coercion and authoritarianism, we see that remaining major political arguments may have much less to do with goals than means of bringing them about.
Having disposed of linear and two and three dimensional models... and allegorical stories, I would now like to propose that the strategies people choose, in deciding on their favorite program to reach utopia, often depend on how they would answer one more question.
Are human beings fundamentally rational and/or good? Or must they learn reason?
There are three prominent theories based on this question. They are represented best by Karl Marx, by classical Libertarianism, and by a third idea that has cropped up from time to time, but has only recently pushed its way into the mainstream of 20th Century thought.
1. Classical Marxists (note that I exclude Soviet-style state socialism) believe a society much like the 35th century utopia described above will come about naturally and inevitably via a “withering-away of the state"... but only after certain primary conditions have been achieved. Those conditions include the accumulation of tertiary industrial capital and the growth of a skilled proletarian class.
2. Classical Libertarian philosophy states that achievement of a near-ideal society resembling the one described in our story awaits simply cutting away the shackles of the state and returning to a natural free market, which will provide surplus wealth adequate for all. Government may be dismantled slowly (as prescribed by libertarian gradualists) or all at once (as urged by radicals) but when it is gone, people will behave maturely and fairly simply in their own self interest.
Note that both of these idealisms side with Rousseau's fundamental assumption, that human beings are either inherently good, or need only follow a simple prescribed path in order to transcend into a state of much greater good. Marx perceives this state ultimately unleashed after generations of capital accumulation finally creates a populace that is both satiable and satiated enough for animal and predatory drives to quell and for better human qualities to come to the fore.
Libertarians see competition as essential and endlessly needed, though competition is not the same thing as predation. Satiation is not the same thing as goodness. Rather, goodness arises when predators can no longer use state force to repress fair competition. Goodness arises from reciprocal accountability.
Still, despite these differences, the underlying similarity of Marxist and libertarian fantasies is really remarkable. Both hanker for that 35th century utopia and a state that has withered away. Both yearn for an epoch without coercion. Both would claim credit for its success. Also, of course, both purist approaches are naive and utterly cuckoo.
Jay Kinney, in an article in the Summer 1988 issue of Whole Earth Review, sheds some interesting light on this. “Both left and right analyses describe the present economic order as ‘monopoly capitalism’... Both analyses contrast this with an earlier system of free enterprise capitalism. For the left, the monopolization of capital is not necessarily the result of a sneaky plot by some backroom elite; rather the system of capitalism produces monopolies and elites as natural byproducts of its own evolution. The right usually presumes that if the elite conspirators behind this usurpation were identified on a mass scale, and their influence and control destroyed, the US economy could then be returned to a system of free enterprise.”
Putting aside Kinney's use of hoary left-right imagery, it illustrates how two groups with very similar complaints and goals each take a romantic view of how transformation can be achieved – one by waiting for inevitable social forces to work their way through, and the other by calling for the clearing away of debris blocking the natural social perfection of the market.
3. Our third group shares the same goal as the other two, but believes that hope for that era of mature individualism lies in the gradual maturation of humankind.
They see, in the last six thousand years of darkness and cruelty, one simple lesson – that human beings who are frightened, ignorant, tribal or desperate have nearly always behaved badly. People who are insecure will steal and cheat, if that is what it takes to feed their babies. Also, they will all too often gang up on each other, and conspire to create dynasties. The Marxists are right, that some kind of satiation must be achieved, before this fear-driven predation can end. And libertarians are right that markets are crucial in order to get there. But both groups oversimplify a complex process. They seek a magic wand.
The unique and startling hypothesis held by this third group of individualist-utopians is this—that mature, knowledgeable people will tend to approach the near-ideal society of our fairy tale from nearly any starting point, since to almost any unafraid adult it must seem the only decent way to live.
Absence of fear is key. In other words, the precondition necessary for creating paradise is... near-paradise. And, viewed in the context of human history, that is exactly what we've got right now. (One piece of evidence? Name another society that ever made more libertarians!)
What these three outlooks demonstrate is that sharing a common goal is obviously not enough. The three world views differ fundamentally over who is to “blame” for our present condition, as well as how to reach that utopia of freedom and dignity all claim to desire.
All three world views depend upon unproved assumptions.
Both Marxists and libertarians had pieces of the puzzle. General wealth, achieved via accumulated capital and increasing worker skill, does help engender the satiability needed, in order for humans to calm down enough to turn predation into maturity. But that maturity MUST include competition! Not only because competition is deeply part of human nature. But also because the libertarians are partly right, too – that satiability, all by itself, will not end predatory behavior. There is a far more important condition. Reciprocal accountability – freeing individuals to hold each other accountable – is the only truly long term solution to predation.
Each had ways they were right. And, of course, both are desperately wrong. Because each claims to prescribe THE WAY.
The path of Marxism is the most easily disposed of, for while its criticisms of nineteenth century capital were incisive, none of its major predictions of events to follow ever came to fruition as prescribed. In science, that is primary disproof. Period. In retrospect, the image of humanity as a locomotive, constrained to a sequential series of psycho-historical "stages" – like railroad ties on the way to some foretold workers' nirvana – seems pathetically silly.
I will refrain for now from a full-scale critique of underlying Libertarian assumptions—such as the unsupported notion that a true free market society has ever existed in the past, or that immature, neurotic people, freed suddenly of social restraints, will refrain from fighting, as they always have, to create aristocracies and make their neighbors' children slaves to their own. (See: http://www.davidbrin.com/libertarianarticle1.html)
I will instead use another allegory to show a clear distinction between propositions 2 and 3.
[edit] Explicit and Implicit Social Contracts
Cynics have occasionally made fun of the Libertarian Proposition by comparing it to the beliefs of the French philosopher Jean Rousseau. Rousseau contended that society itself was responsible for all of the evils of mankind. If only the wickedness of law and religion, of technology and intricate custom, were removed, he said, men would return to the condition for which they were meant – that of "noble savages."
Of course we should mention also Hobbes and the inverse notion, that humans are inherently devils who must be fiercely constrained by society and elites... a version of Plato's prescription for fierce aristocratic control. (The closest adherents to Hobbes, today, are the Neoconservatives, who openly call for establishment of Plato's prescription of rule by a "benevolent" aristocracy of "philosopher kings".)
Of more relevance was the Englishman, John Locke, who refused to accept this false dichotomy. Especially since any reasonably person can see plenty of evidence in his or her neighbors, that human beings are a copious mixture of bothinner angels and devils. (Duh!) We deserve something better than Hobbes or Rousseau or Plato ever offered. And Locke began to take us down that path.
He proposed that societies were built upon "social contracts" between rulers and those governed. At the time he meant something quite simple; the "contract" was nothing explicitly written down and signed by all parties. Rather, it was implicit in the relationship between king and subject. The lord ruled benevolently or else, in the long run, the people would have his head. In an early, primitive form, he was talking about reciprocal accountability.
Locke's basic idea still appears sound, as a rough metaphor. An implicit contract does make sense as a model of what we observe in primitive societies. Consider the dark millennia which lasted until a few centuries ago. During most of those years, the lives of peasants and poor craftsmen were brutal and short. Bandits were always conspiring to steal what little people had, or worse, to become aristocrats themselves, and make slaves of everyone else.
But once a line of aristocracy was established, a curious thing happened. Quite often the grandchildren of bandit lords, well-fed from birth and benefiting from what passed for education in such times, turned out to be rather well suited to rule. It wasn't that they were in any way more deserving, only that nourished brains and literacy could only be provided to a few individuals from the meager surplus available at the time. A young man who was already part of a dynasty, and not rapaciously obsessed with creating a new one, might actually, on occasion, rule wisely.
A careful look at history shows that, for all of their petty wars and brutality, this pattern seemed to work about as well as could be hoped. And when it failed, peasants often did rebel.4 In a sense, Locke's implicit social contract is simply a description of the obvious.
Contrast this age-old pattern with one of the dream icons held dear by Libertarians – the explicit social contact. This is a contractual agreement between the individual and his or her society, worked out anew with each adult, who knowledgeably signs away a carefully chosen, narrow range of action-rights in exchange for certain benefits of cooperative society. For example, some contend that under true federalism each state in the Union should experiment with its own social structure, under the very broad umbrella of national defense and the Bill of Rights. Any man or woman, at age eighteen, would have the opportunity to sign a covenant, explicitly agreeing to the codes and customs and laws of his or her home state. Or, disagreeing, the youth would move to another commonwealth with institutions more to his or her liking.
In this way, people preferring paternalism could live in a cradle-to-grave welfare state (and pay for it!) in, say, New York. Others, traveling to Nevada or Alaska, might find “Respect Life and Property" and “Don't Pollute" the only laws in the book, along with the unwritten but implied caveat emptor. (Robert Heinlein depicted just such a social order in his novella "Coventry.")
If Locke's vision of implicit charters between peasants and bandit kings lies at one pole, this libertarian idea of an explicit social contract, one negotiated afresh with each new citizen, is at the other. We see where we have been and where we might go. To those who dream of this particular end to authority, any present-day society might therefore be judged by two simple criteria --
1. by how far it has progressed, evolving from the implicit to the explicit social contract, and,
2. by its prospects for further evolution in that direction.
Now let's return to those three anti-authoritarian assumptions we examined earlier. The first two, Marxism and Libertarianism, each posit that an ideal society of freedom, dignity and prosperity is possible, indeed likely, if only certain impediments are removed.
While Marxism foresees that era coming as a natural consequence of capital accumulation and the behavior of mass classes, Libertarians prescribe removing government shackles to begin the era of explicit contracts and true individual liberty. If today's neocons are heirs of Hobbes and Plato, Libertarians and Marxists are both true heirs of Rousseau.
The third philosophy – which might be called Maturationism – is descended from the pragmatists of the 18th Century Enlightenment, such as Locke, Washington, Franklin, Madison and Jefferson. Sharing the goal of an open, coercion-resistant society of free adults, it contends that no such ideal society was possible during thousands of years of darkness, but now it may be.
Marxists and Libertarians agree that our present civilization is thwarting progress and thus in desperate need of drastic surgery, Maturationism, in contrast, makes the provocative suggestion that we might not be doing so badly, all considered. That progress from the implicit to explicit social contract is actually quite rapid, in the society around us.5
Who is right? Who has the correct prescription for getting us to the near-ideal world we anti-authority-folk dream of for our grandchildren? Each movement has hordes of sincere followers. United, they might all achieve something toward their common goal. Alas, each seems to demand action contrary to the proposals of the others.
Or do they? Is that conflict more illusory than real?
Rather than writing prescriptions, the purpose of this article has been to criticize and set in perspective some of the totems which have crippled reasoned political debate for far too long. Stereotypes and unquestioned caricatures, while deeply, sensuously satisfying, have all too often caused us to wind up lumped in alliance with folks whose deepest goals would be anathema to us, while locking us in conflict against some with whom we might have common cause. In criticizing these stereotypes, I've offered a few suggestions for alternative ways of looking at things, ways which might illuminate issues better than the fatuous "left" and "right" model.
I don't pretend these metaphors are perfect. If they stir a debate, leading to something even better, that would be fine.
The best use of metaphors, after all, is to help us pry away from our rigid assumptions in order to learn something, rather than serving as stage scenery to cover and conceal the real world. They should elicit discussion and inquiry, rather than shouting matches. They should free us, rather than constrain us.
If these aren't the effects your metaphors have on you, and those around you, it just may be time to find some new ones, and throw the old ones away.
[edit] Footnotes
[edit] note4
Almost always immediately handing their leashes over to new bandits, alas.
[edit] note5
It is a viewpoint that has one major drawback. Maturationism does not provide potential adherents the delicious satisfactions of self-righteousness and resentment, offered by most political-religious movements. (See: http://www.davidbrin.com/addiction.html)
One especially jarring irony emerges from this metaphor of implicit->explicit social contracts. Suddenly, one can see the reason for the complexity of modern law. You would expect, during this progression from arbitrary whim-rule by kings toward full autonomy for all adults, for more and more of the social "contract" to involve negotiated deals, not just in (libertarian approved) commercial deals but also in codes enacted via negotiated political processes – in other words state law. Because, until the Internet, there were no tools for dealing with the vast number of possible contingencies on an individual by individual basis. Even now it is only starting to seem possible, though these tools are rapidly taking shape. Hence, might one look at today's complex law as an awkward intermediate stage? On the way from simple tyranny to another simple condition called maturity? From implicit social contracts toward individually explicit ones?
More on this later.
[edit] Reader Comments
from the original posting at LRC
This essay offers nothing for persons like myself, who deny utopia and who do not believe in the perfectability of humanity.
I do not believe in utopia, but believe that we do have much potential to improve our current society. Perhaps mine is an ironic viewpoint, for I believe that while rejecting utopia, one must never cease striving towards it.
Nevertheless this essay is interesting. In addition to raising some thought-provoking questions and attempting to answer them, it was written in an interesting and sometimes downright humorous way that few political-oriented documents are.
Exactly! You guys demonstrate two of the basic political personalities. Cynicism and modernism. Cynics learn on the playground, early, to snarl with a curled lip at kids who express eagerness to improve, even when they achieve their goals. It wins points... but it' a silly basis for fostering progress.
Modernists have a different madness, a belief in incremental improvability that would have been deemed insane in most human cultures, when there were so few modalities to use in pursuing that goal. Today we DO have a myriad modalities and have improved more that all other generations combined. Yet try persuading a cynic!
This leaves out the third general class, of romantic utopians... by far the worst and most dangerous. They believe in improving humans and humanity via drastic experimental surgery! Yipes! From Marxists to Randroids, they have a "way" and heaven help any society where the romantics take over.
Liberal modernism is the root of markets, wherein self-improvement AND social improvement take place via incremental creativity in goods, services and solutions. It it TOTALLY illogical for a "libertarian" not to be a modernist... yet most are not. As I said, this runs deeper than logic. It's personality. The movement is controlled by fanatics WHO DO NOT ACTUALLY BELIEVE IN IT!
Today, modernism is under seige by romantics of left, right, whatever. But it must be allowed to move ahead. The crux? Either we improve or we die.
drop by http://www.davidbrin.blogspot.com/ !
db
This doesn't change the fact that your article is based upon the eventual change of human nature. I believe that human nature has not changed a bit in all of recorded history; we have just made some improvements in dealing with it.
There is no space in your article for the viewpoint that human beings default to being petty, selfish, sadistic and corrupt, that a perfect system is impossible while this nature presists, and that the best we can do is channel these urges in directions where they will do the most good and least harm.
I don't identify with any of the catagories. I just want folks to stop bullying each other. I also don't believe that freedom requires a change in human nature. I think freedom is an individuals natural state. 'Improvement' is a very subjective word. I agree that basic human nature is fundamentally unchanged since before the first tools. Technological and cultural 'improvement' has happened in fits and starts, though.
People don't have to change from everybody being 'bad' to everybody being 'good' for liberty to succeed. Just attacking peaceful, honest people should be made illegal for everybody, and enforced equally. If the option of the legal authority to impose your will on others is removed; and all theft, assault, fraud, etc., become crimes prosecuted by law, then society will necessarily become more civil.
'offended' is completely subjective, too. "Thou shalt not change what belongs to someone else against their will and without their consent." (you need both to allow for surprise parties and such; they may still want something that they didn't consent to; or change may occur that ) would be a more objective and universal law. Then the 'jury', when necessary, would have only to prove ownership, the change wrought, and the fact that the owner didn't want the change. Then the one who made the change would have to make the owner 'whole'. It would cover fraud, too; since the 'victim' actually owned what was agreed to, and the 'change' was the difference between the agreement and the performance.
Anyway, it would be a start.
I meant
....or change may occur that the owner likes, or is indifferent to, even though they didn't consent to it.)
I completely agree with Kristan.
While our culture and technology has evolved, the fundamental nature of human beings has not. Plato and Socrates were complaining about corruption in democracy 2,300 years ago. Today we have cars, the internet, and I-Pods... but we still have corruption in democracy. I have the sneaking suspicion - and a number of anthropoligists I have read about would agree - that our amazing social progress over the past 6,000 years has more to do with the evolution of technology than the evolution of human nature.
So, until we can change human nature via psychological training or genetic manipulation (QUITE un-libertarian), we will never have a utopian society. Alas, we must be content to make small gains here and there, knowing that we will never be perfect.
eh. I'm overloading on this stuph.
you know what was good about MY day? First day without chemo drugs and radiation treatments in 34 days. :D
I think a lot about how the US and the LP could be better, but today I'm thinking it's more cool that I feel better for the first time in a long time.
self serving but accurate.
Thanks for putting my being stranded in Dallas with no auto transmission this past weekend in perspective, Tim.
One need not believe in a fundamental change in human nature to appreciate what David Brin is saying, I think.
Has anyone here ever tutored kids? Especially kids who have a very different background than yours (e.g. inner city or indian res. or rich urbanite or whatever) Oh you should. i did this for a brief stint in highschool and again in college.
I observed that the environment in which a child develops strongly influences how trusting (s)he is of others and ** how much patience they have to learn **. I am not advocating environmental determinism by any means, but the economic and social environment in which you develop helps certain innate qualities shine through or smolder within. It is exactly this kind of social environment we are really trying to improve through our effforts at attaining more freedom. So, no, utopias don't exist, and human nature doesn't change, but there are processes of innovation and validation that allows the state in which we live to improve.
And thus hopefully our great-grandchildren wil look back and laugh at our silly notions (while also acknowledging our earnest efforts), not because they are innately better people, but because the society in which they grew up has allowed them the freedom and the tools (e.g. the technology and the knowledge) to *develop* into better people.
In a way, this points out why the current LP is not very good at forming and maintaining coalitions.</div><p>You must be a member and logged in to add a comment of your own.
Personal tools
bookmarking
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:18:32.000Z
|
pyl62stedxsjyi42dybkkkydl6mwbgz4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67650",
"uncompressed_offset": 146517214,
"url": "josm.openstreetmap.de/ticket/7296",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://josm.openstreetmap.de/ticket/7296"
}
|
cccc_CC-MAIN-2013-20
|
Modify
#7296 closed enhancement (fixed)
Add place=neighbourhood to presets
Reported by: joshdoe Owned by: team
Priority: minor Component: Internal preset
Version: Keywords: preset place neighbourhood
Cc: joshdoe
Description
I helped with the proposal, so I may be a bit biased, but please consider adding place=neighbourhood to the preset list:
http://wiki.openstreetmap.org/wiki/Tag:place%3Dneighbourhood
Something like the following (based on place=hamlet):
<item name="Neighbourhood" icon="presets/places.png" type="node,closedway">
<label text="Edit Neighbourhood" />
<space />
<key key="place" value="neighbourhood" />
<text key="name" text="Name" default="" delete_if_empty="true" />
<text key="wikipedia" text="Wikipedia" default="" delete_if_empty="true" />
<text key="population" text="Population" default="" delete_if_empty="true" />
<text key="website" text="Website" default="" delete_if_empty="true" />
</item>
(If there are standards/guidelines for what to accept for the internal presets, I can't find it.)
Attachments (0)
Change History (3)
comment:1 Changed 16 months ago by SDT_420
comment:2 Changed 16 months ago by anonymous
comment:3 Changed 15 months ago by simon04
• Resolution set to fixed
• Status changed from new to closed
Modify Ticket
Change Properties
<Author field>
Action
as closed .
as The resolution will be set. Next status will be 'closed'.
The resolution will be deleted. Next status will be 'reopened'.
Author
E-mail address and user name can be saved in the Preferences.
Note: See TracTickets for help on using tickets.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:48:06.000Z
|
tbj4tdgsmrp3whrfacsqoggovi4yrvbh
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67651",
"uncompressed_offset": 146651948,
"url": "journals.tdl.org/icce/index.php/icce/article/view/6508/0",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://journals.tdl.org/icce/index.php/icce/article/view/6508/0"
}
|
cccc_CC-MAIN-2013-20
|
PREDICTION OF BEACH EROSION CAUSED BY REDUCTION OF FLUVIAL SAND SUPPLY DUE TO EXCESS SAND MINING AND BEACH RECOVERY AFTER PROHIBITION OF MINING
Toshiro San-nami, Takaaki Uda, Norikazu Ohashi, Hitoshi Iwamoto, Masumi Serizawa, Toshinori Ishikawa, Shiho Miyahara
Abstract
Long-term topographic changes since 1968 along the entire Shizuoka and Shimizu coasts including a 17 km stretch extending between the Abe River mouth and the tip of the Mihono-matsubara sand spit were investigated. Beach erosion of these coasts was triggered by the decrease in sediment supply from the Abe River due to excessive riverbed mining until 1967. After 1982/1983, natural sand supply from the river increased and accretion occurred on these coasts. Measured topographic changes were reproduced using the contour-line-change model considering changes in grain size. Not only the movement of the sand body but also the shoreline and bathymetric changes were numerically reproduced. The calculated results were in good agreement with the measured topographic changes.
Keywords
beach erosion; sand body; contour-line-change model; Shizuoka coast; sand mining
References
Fukuhama, M., T. Uda, K. Yamada, M. Serizawa, T. San-nami, and T. Ishikawa. 2009. Prediction of development of sand body and movement of fine sand offshore of detached breakwaters, Proc. Coastal Dynamics 2009, Paper No. 39, pp. 1-12.
Miyahara, S., T. Uda, K. Furuike, M. Serizawa, T. San-nami, and T. Ishikawa. 2010. Effect of sand bypassing at Sakuma dam in Tenryu River as a measure against erosion of Tenryu delta coast, Proc. 32nd ICCE, sediment.106, pp.1-12.
Nishitani, M., T. Uda, M. Serizawa, and T. Ishikawa. 2008. Measurement and prediction of deformation of conveyer belts carrying gravel and fine sand off Shimizu coast, Proc. 31st ICCE, pp. 2570-2582.
Ozasa, H., and A. H. Brampton. 1980. Model for predicting the shoreline evolution of beaches backed by seawalls, Coastal Eng., Vol. 4, pp. 47-64.http://dx.doi.org/10.1016/0378-3839(80)90005-8
Sakai, K., T. Uda, M. Serizawa, T. Kumada, and Y. Kanda. 2006. Model for predicting threedimensional sea bottom topography of statically stable beach, Proc. 30th ICCE, pp. 3184-3196.
Uda, T., and S. Kawano. 1996. Development of a predictive model of contour line change due to waves, Proc. JSCE, No. 539/-35, pp. 121-139. (in Japanese)
Uda, T., M. Serizawa, M. Nishitani, and T. Ishikawa. 2008. Field investigation and numerical simulation of movement of sand body, Proc. 31st ICCE, pp. 2051-2063.
Uda, T., and M. Serizawa. 2010. Model for predicting topographic changes on coast composed of sand of mixed grain size and its applications, in 'Numerical simulations - examples and applications in computational fluid dynamics' Angermann, L. ed., INTEC, pp. 327-358.http://dx.doi.org/10.5772/12926
Uda, T. 2010. Japan's Beach Erosion - Reality and Future Measures, World Scientific, 418 pp.
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:28:12.000Z
|
o3qdry7e74c2xjv2vualw6kficahg6d4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67652",
"uncompressed_offset": 146658391,
"url": "journals.tdl.org/icce/index.php/icce/article/view/6846",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://journals.tdl.org/icce/index.php/icce/article/view/6846"
}
|
cccc_CC-MAIN-2013-20
|
SHOALING OF NONLINEAR INTERNAL WAVES ON A UNIFORMLY SLOPING BEACH
Kei Yamashita, Taro Kakinuma, Keisuke Nakayama
Abstract
The internal waves in the two-layer systems have been numerically simulated by solving the set of nonlinear equations in consideration of both strong nonlinearity and strong dispersion of waves. After the comparison between the numerical results and the BO solitons, as well as the experimental data, the internal waves propagating over the uniformly sloping beach are simulated including the cases of the mild and long slopes. The internal waves show remarkable shoaling after the interface touches the critical level. In the lower layer, the horizontal velocity becomes larger than the local linear celerity of internal waves in shallow water just before the crest peak and the position is defined as the wave-breaking point when the ratio of nonlinear parameter to beach slope is large. The ratio of initial wave height to wave-breaking depth becomes larger as the slope is milder and the wave nonlinearity is stronger. The wave height does not increase so much before wave-breaking on the mildest slope.
Keywords
nonlinear internal wave; two-layer system; variational principle; shoaling; wave-breaking point
References
Aghsaee, P., L. Boegman, and K. G. Lam. 2010. Breaking of shoaling internal solitary waves, The Journal of Fluid Mechanics, 659, 289-317.http://dx.doi.org/10.1017/S002211201000248X
Benjamin, T. B. 1966. Internal waves of permanent form in fluids of great depth, The Journal of Fluid Mechanics, 25, 559-592.http://dx.doi.org/10.1017/S0022112066001630
Choi, W., and R. Camassa. 1999. Fully nonlinear internal waves in a two-fluid system, The Journal of Fluid Mechanics, 396, 1-36.http://dx.doi.org/10.1017/S0022112099005820
Helfrich, K. R. 1992. Internal solitary wave breaking and run-up on a uniform slope, The Journal of Fluid Mechanics, 243, 133-154.http://dx.doi.org/10.1017/S0022112092002660
Horn, D. A., L. G. Redekopp, J. Imberger, and G. N. Ivey. 2000. Internal wave evolution in a spacetime varying field, The Journal of Fluid Mechanics, 424, 279-301.http://dx.doi.org/10.1017/S0022112000001841
Kakinuma, T. 2001. A set of fully nonlinear equations for surface and internal gravity waves, Proceedings of 5th International Conference on Computer Modelling of Seas and Coastal Regions, WIT Press, 225-234.
Koop, C. G., and G. Butler. 1981. An investigation of internal solitary waves in a two-fluid system, The Journal of Fluid Mechanics, 112, 225-251.http://dx.doi.org/10.1017/S0022112081000372
Nakayama, K., and T. Kakinuma. 2010. Internal waves in a two-layer system using fully nonlinear internal-wave equations, International Journal for Numerical Methods in Fluids, 62, 574-590.
Ono, H. 1975. Algebraic solitary waves in stratified fluids, Journal of the Physical Society of Japan, 39, 1082-1091.http://dx.doi.org/10.1143/JPSJ.39.1082
Yamashita, K., T. Kakinuma, and K. Nakayama. 2011. Numerical analyses on propagation of nonlinear internal waves, Proceedings of 32nd International Conference on Coastal Engineering, ASCE, waves. 24, 1-15.
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:38:58.000Z
|
k5o4bz6emvsw27hzhocmnrezvksabtyq
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67656",
"uncompressed_offset": 150544643,
"url": "kk.org/cooltools/ask/questions/720/best-microscope-camera-setup-for-a-classroom",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://kk.org/cooltools/ask/questions/720/best-microscope-camera-setup-for-a-classroom"
}
|
cccc_CC-MAIN-2013-20
|
login ask-a-question questions unanswered tags faq
We are looking to start taking digital photos in our forensics-science classroom where I teach and the instructor is looking for a reasonably priced setup. Anybody out there have a good solution?
asked Sep 11 '11 at 10:26
Al Gunn
1
Define reasonably priced. You could make do with a digital camera and a good pair of binoculars. You could buy a cheapie USB camera. You could buy a fairly decent introductory biological microscope (400x will let you see a bacterium, good enough for my college bacteriology class) and hook a webcam or digital camera up to it.
link
answered Sep 13 '11 at 16:02
Courtney Ostaff
76
I am an archaeology graduate student and I've been using a Dino-Lite digital microscope to take pictures of artifacts and store them on my computer. I've been using the 313T which I think has been replaced by the 411/413, but the microscopes come with a variety of features depending on your needs. The software is also quite good, available for mac and PC, and you can take photos and video and store them on your computer to show in class later. For my purposes, it is helpful that you can annotate your images as you take them (i.e. with a catalog number) and there are also options to measure samples on the screen, although I've never used it. If your class has a projector set-up you can use the microscope live on your computer and project the results on a screen. I ordered mine from BigC (you will have to google this because my answers keep getting flagged as SPAM with the URL included).
link
answered Sep 19 '11 at 07:35
Alisonkyra
1
You can get the Dino-Lite microscopes at The Microscope Store. You should give them a call and ask their phone reps, they're really friendly and helpful without pressuring you.
link
answered Dec 15 '11 at 12:48
Microscope
1
Your answer
toggle preview
Follow this question
By Email:
Once you sign in you will be able to subscribe for any updates here
By RSS:
Answers
Answers and Comments
Markdown Basics
• *italic* or __italic__
• **bold** or __bold__
• link:[text](http://url.com/ "title")
• image?
• numbered list: 1. Foo 2. Bar
• to add a line break simply add two spaces to where you would like the new line to be.
• basic HTML tags are also supported
Tags:
Asked: Sep 11 '11 at 10:26
Seen: 3,042 times
Last updated: Dec 15 '11 at 12:48
powered by OSQA
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:10:30.000Z
|
gro24l4uunn3x742xmk3sxjf55726xqv
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67663",
"uncompressed_offset": 159408551,
"url": "lists.maemo.org/pipermail/maemo-developers/2008-August/016641.html",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://lists.maemo.org/pipermail/maemo-developers/2008-August/016641.html"
}
|
cccc_CC-MAIN-2013-20
|
[maemo-developers] PowerVR MBX driver for Maemo?
From: Kate Alhola kate.alhola at nokia.com
Date: Fri Aug 1 13:53:23 EEST 2008
ext KwangYul Seo wrote:
> Hello,
>
> After deparately looking for OpenGL ES driver for Maemo, I've found
> that Nokia does not provide the PowerVR MBX driver for OpenGL ES 1.1
> for some reasons.
>
> https://bugs.maemo.org/show_bug.cgi?id=1028
>
> It says that this does not mean that Nokia won't support OpenGL ES
> forever. Is there any schedule on this? When can I create OpenGL
> applications on Maemo?
>
>
We are not providing it at the moment for legal / Licensing reasons.
The current closed source driver for Omap 2420 is not GPL compliant
and Nokia can't deliver such a driver.
We are working to get some version of driver available to developpers but
it won't be any Nokia supported version. The plan is least tell in
Maemo Summit
could we resolve existing problem and make driver some way available.
More info from https://wiki.maemo.org/Talk:Drivers_justification
Kate
> Regards,
> Kwang Yul Seo
> _______________________________________________
> maemo-developers mailing list
> maemo-developers at maemo.org
> https://lists.maemo.org/mailman/listinfo/maemo-developers
>
More information about the maemo-developers mailing list
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:19:05.000Z
|
25agy7ftkmyy3vuwn6g4vxh3mgsyjdiv
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67686",
"uncompressed_offset": 199719736,
"url": "opendotdotdot.blogspot.com/2008/01/mark-his-words.html",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://opendotdotdot.blogspot.com/2008/01/mark-his-words.html"
}
|
cccc_CC-MAIN-2013-20
|
23 January 2008
Mark His Words
Here's a post well worth reading:
Yesterday, we saw the most extraordinary failure of economic leadership in recent years, when the US Federal Reserve pressed the “emergency morphine” button and cut Federal Reserve rates by 0.75%. It will not help.
These are extremely testing times, and thus far, the US Fed under Bernanke has been found wanting. Historians may well lay the real blame for current distress at the door of Alan Greenspan, who pioneered the use of morphine to dull economic pain, but they will probably also credit him with a certain level of discretion in its prescription. During Greenspan’s tenure at the Fed, economic leaders became convinced that the solution to market distress was to ensure that the financial system had access to easy money.
Pretty standard Economist-type analysis you might think; but what's interesting about this lengthy piece is that it's written by Mark Shuttleworth, head of Canonical, the company behind Ubuntu. What struck was not just that it's extremely well written, but that he took the time and trouble to pen it. I don't think there are many CEOs who would be both willing and able to do so.
I think we can deduce from from this is that Canonical - and hence a key player working towards GNU/Linux on the desktop - is in good hands.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:24:08.000Z
|
awpzga2g7b2p2zujmndro3ywr2bgwd7w
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67687",
"uncompressed_offset": 200236238,
"url": "openwetware.org/index.php?diff=prev&oldid=660415&title=BME103%3AT130_Group_12_l2",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://openwetware.org/index.php?title=BME103:T130_Group_12_l2&diff=prev&oldid=660415"
}
|
cccc_CC-MAIN-2013-20
|
BME103:T130 Group 12 l2
From OpenWetWare
(Difference between revisions)
Jump to: navigation, search
(Research and Development)
(Research and Development)
Line 212: Line 212:
Bayesian Stats
Bayesian Stats
-
The following equation can be used to find the Bayesian statistics:
+
The following equation can be used to find the Bayesian statistics:
+
[[Image:GQPTk.jpg]]
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}
Revision as of 00:21, 29 November 2012
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Contents
OUR TEAM
Name: James
Open PCR machine engineer
Name: Heidi Hall
Open PCR machine engineer
Name: Justin Landstrom Student
Protocol Planner
Name: Chaio
Protocol Planner
Name: Jakob Wells
R&D scientist
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
New System Design
The two parts below that will be removed are the the knob and the bolt attached to it. These parts are present on the lid currently as a tightening mechanism but they will be removed to improve the design. On the side of the picture are the two heating plates present in the lid. To compensate for removing the tightening mechanism, the plates will be lowered to the point it makes contact with the samples in the heating block at the correct point in which the lid snaps into place.
Below is the top part of the general body of the PCR machine. It will be altered so buttons can be placed next to the LED screen.
Key Features
The design changes are predominately focused on the lid and the top body part next to the LED screen. Regarding the lid, the tightening mechanism was deemed ineffective due to not knowing how much to tighten the knob. To compensate for removing the mechanism, the heating plates will be lowered onto a specified height that it will make contact with the samples when the lid snaps into its natural place. Since sample containers are universally similar, one specified height will relinquish the need of having to set the heating plates themselves.
Design changes on the top body part will include changing the layout so that it may fit input buttons that will be connected and programmed internally later. These buttons will allow an individual to set up cycling details and will remove the need of an external computer to run the device.
Instructions
For the lid design
1. Remove the knob on the lid
2. Once the knob is removed, the bolt will be able to be removed.
3. Lower the bottom heating plate to the desired height
4. Lower the higher heating plate so the difference in space between the two plates was similar as before
For the top body part
1. Attach the part as you would normally
2. Connect the input buttons to the circuit board.
Protocols
Materials
Supplied in the Kit Amount
PCR Machine (assembled) 1
Power Cord1
Flourimeter Box1
Flourimeter1
Hydrophobic Slides5
Supplied by User Amount
Camera Phone 1
DNA Samples & Target MixAs many as desired
Bulb pipettesAs many as desired
SYBR GreenAs much as desired
Computer w/ ImageJ Software1
PCR Protocol
A polymerase chain reaction (PCR) is based on the enzyme DNA Polymerase's ability to synthesize complementary DNA strands. Through a series of steps involving polymerase breaking apart a DNA strand and then synthesizing a specified complementary piece, a PCR machine is able to isolate and amplify a desired strand of DNA.
Steps to Amplify a Patient's DNA Sample
1. PCR uses controlled temperature changes to make copies of DNA. Heat (about 95°C) separates double-stranded DNA into two single strands; this process is called denaturation.
2. "Primers", or short DNA strands, binds to the very end of the complimentary sequence that is being replicated. This step is called annealing, which takes place between 40°C and 65°C. The temperature that we used was 57°C.
3. Once the annealing process is done, the temperature is raised to about 72°C and DNA polymerase then extends from the primers copying the DNA.
4. PCR then amplifies a segment of a DNA sequence. In the end, there will be two new DNA strands identical to the original strand.
Components of PCR Master Mix
• A modified form of the enzyme Taq DNA polymerase that lacks 5´→3´ exonuclease activity.
• dNTPs
• MgCl2
• Colorless Reaction Buffer (pH 8.5)
Reagent Volume
Template DNA (20 ng)0.2μL
10μM forward primer1.0μL
10μM reverse primer1.0μL
GoTaq master mix50.0μL
dH2O47.8μL
Total Volume100μL
DNA Measurement Protocol
1. With a permanent marker, number your transfer pipettes at the bulbs so that you only use if for one sample. With the permanent marker number your Eppendorf tubes at the top.
2. Transfer each sample seperatly (using one pipette per sample) into an Eppendorf tube containing 400 mL of buffer. Label this tube with the number of your sample. Get your entire sample into this Eppendorf tube. You can use this sample number transfer pipette to place only this sample drop onto the fluorescent measuring device.
3. Take the specially labeled Eppendorf tube containing Sybr Green I using the specifically labeled pipette only place two drops on the first two centered drops as seen on the video.
4. Now take your diluted sample and place two drops on top of the Syber Green I solution drops.
5. Align the light going through the drop, as seen in the video.
6. After setting up the Flourimeter and the samples set a Smartphone’s photo settings to the ones listed.
1. Inactivate the flash
2. Set ISO To 800 (or higher if possible)
3. Set White Balance to Auto
4. Set Exposure to Highest Setting
5. Set Saturation to the Highest Setting
6. Set Contrast to Lowest Setting
7. Place the Flourimeter in the light box.
8. Let the smart-phone operator take as many pictures using the light box as he/she wants. Their goal is to take pictures clear enough so ImageJ can take data from the images.
9. Once they have taken enough photos of that sample give the Flourimeter back to the sample preparer to prepare the next sample.
10. Now either rerun the sample again or discard that sample and it’s pipette. Keep the Sybr Green I labeled pipette.
11. Repeat this procedure for all the samples. You can run 5 samples per glass slide.
12. As the last sample run the water from the scintillation vial as a blank using the same procedure as with the other samples.
14. Collect the INTDEN for your positive and negative controls and your patient samples. 21. Calculate the DNA μg/mL with this equation: 2*INTDEN of sample/INTDEN of DNA Calf Thymus.
Research and Development
Background on Disease Markers
Human Immunodeficiency Virus, or HIV is a horrible disease and is running ramped everywhere, especially in underdeveloped countries. There are also many people with HIV in developed countries such as the United States. This disease affects chromosome 17 and the genome build 36.3. After researching the SNP for HIV, which is rs1024611, the mutation in the sequence was discovered to be ATA. So then a primer to be used along side a PCR was developed.
http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=1024611
Primer Design
The primer that can be used to detect HIV is CGTCTGTCGATAGTGAAAGG and its reverse GCAGACAGCTATCACTTTCC. A diseased allele will only give results because of the way the PCR works and how the primers will attach. If the sample has the disease then the primer will attach to the DNA and as the PCR goes through its cycles there will be a multitude of the same DNA strand with the SNP rs1024611. If the sample does not have the disease allele then there will be no interaction with the DNA and the primer, therefore there will be no change from the original and the end results.
Illustration
Bayesian Stats
The following equation can be used to find the Bayesian statistics:
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:11:29.000Z
|
atat56uc4r4mmhmkeizdexbfvt4y4c4b
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67688",
"uncompressed_offset": 200246990,
"url": "openwetware.org/index.php?oldid=426535&title=BioMicroCenter%3AFAQ",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://openwetware.org/index.php?title=BioMicroCenter:FAQ&oldid=426535"
}
|
cccc_CC-MAIN-2013-20
|
BioMicroCenter:FAQ
From OpenWetWare
Revision as of 21:22, 22 June 2010 by Stuart S. Levine (Talk | contribs)
Jump to: navigation, search
Contents
HOW DO I GET MY DATA
You will be notified by email that your data is ready. The data will be placed on our server for you the download.
Windows
Macintosh Application
UNIX
• Samples can be copied from our servers using scp
• Use the SSH client or Fetch to find the precise filenames / directory you want.
Direct Mount
Illumina data is also made available by direct mount for users on the MIT campus or who are running VPN. Instructions are at BMCPub_Download
Accessing the server
Your user name and password will be included in the email. To obtain your data, enter the following in your client:
Host: bmc-150.mit.edu
user: provided in email
Password: provided in email
Please contact Stephen Goldman if you have difficulty obtaining your data.
NON MIT USERS
Do you take samples from outside MIT?
The BioMicro Center is built to serve the MIT community. As such, members of the MIT community have priority on all of our services. However, if we have extra capacity, we are happy to make is available scientists not affiliated with MIT provided they understand that MIT samples *always* have priority and that access is finite. The BioMicro Center retains the right to refuse any sample.
How can we ship samples to you?
Please email biomicro@mit.edu to arrange a drop off date and time. DNA samples should be shipped at 4C and RNA samples should be shipped on dry ice.Samples should be submitted with a completed order form and shipped by overnight delivery to:
MIT BioMicro Center
31 Ames Street, Building 68-316
Cambridge, MA 02139
The pricing form says "NA". What does that mean?
Some of our services are specifically restricted to the MIT community and we cannot offer them to outside users. Others are restricted to academic labs. Please email us at biomicro@mit.edu if you have any questions.
CONTACT
Please contact Stuart Levine at 617-452-2949 if you have any questions, or stop by our lab at 68-316.
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:50:14.000Z
|
huhhla3es2zi7tlf6hmtjrigdsjlzre4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67689",
"uncompressed_offset": 200255577,
"url": "openwetware.org/index.php?diff=628722&oldid=628721&title=Endy%3AReprints",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://openwetware.org/index.php?title=Endy:Reprints&diff=628722&oldid=628721"
}
|
cccc_CC-MAIN-2013-20
|
Endy:Reprints
From OpenWetWare
(Difference between revisions)
Jump to: navigation, search
(Peer Reviewed Research Articles)
(Peer Reviewed Research Articles)
Line 46: Line 46:
===Peer Reviewed Research Articles===
===Peer Reviewed Research Articles===
'''Precise and reliable gene expression engineering via active coupling and genetic nesting'''<br>
'''Precise and reliable gene expression engineering via active coupling and genetic nesting'''<br>
-
''Nature Methods,'' in prep.<br>
+
''Nature Methods,'' in review<br>
Vivek Mutalik et al.<br>
Vivek Mutalik et al.<br>
[http://www.nature.com URL pending] [http://www.nature.com/| PDF reprint pending]
[http://www.nature.com URL pending] [http://www.nature.com/| PDF reprint pending]
'''Composition and quality of irregular genetic elements controlling transcription and translation'''<br>
'''Composition and quality of irregular genetic elements controlling transcription and translation'''<br>
-
''Nature Methods,'' in prep.<br>
+
''Nature Methods,'' in review<br>
Vivek Mutalik et al.<br>
Vivek Mutalik et al.<br>
[http://www.pnas.org URL pending] [http://www.pnas.org/| PDF reprint pending]
[http://www.pnas.org URL pending] [http://www.pnas.org/| PDF reprint pending]
Revision as of 17:25, 22 September 2012
Home Lab Members Research Notebooks Publications Internal Contact
• Note: We also publish thesis proposals, dissertations, and technical reports via DSpace, an online digital repository operated by the MIT Library.
• Note: PDF reprints are provided below within the context of fair use. Please obtain copies from the publisher if appropriate.
• Note: Search "endy d" via PubGet for a third-party automatically generated set of PubMed-listed publications from the lab.
Contents
Student Dissertations
Barry Canton
Engineering the interface between cellular chassis and synthetic biological systems
MIT PhD, 2008 dissertation (PDF), doi: 1721.1/44918
Jeff Gritton
Architecture and evolutionary stability of yeast signaling pathways
MIT MS, 2006 thesis (PDF), doi: 1721.1/37258
Jason Kelly
Tools and reference standards supporting the engineering and evolution of synthetic biological systems
MIT PhD, 2008 dissertation (PDF), doi: 1721.1/44917
Sriram Kosuri
Simulation, models, and refactoring of bacteriophage T7 gene expression
MIT PhD, 2007 dissertation (PDF), doi: 1721.1/39912
Alex Mallet
Analysis of Targeted and Combinatorial Approaches to Phage T7 Genome Generation
MIT MS, 2007 thesis (PDF), doi: 1721.1/35880
Reshma Shetty (co-advisee with Tom Knight
Applying engineering principles to the design and construction of transcriptional devices
MIT PhD, 2008 dissertation (PDF), doi: 1721.1/44921
Francois St-Pierre
Determination of cell fate selection during phage lambda infection
MIT PhD, 2009 dissertation (PDF), doi: pending
Samantha Sutton
Engineering phosphorylation-dependent post-translational protein devices
MIT PhD, 2008 dissertation (PDF), doi: 1721.1/45205
Ty Thompson
Models and analysis of yeast mating response: tools for model building, from documentation to time-dependent stimulation
MIT PhD, 2008 dissertation (PDF), doi: 1721.1/45206
Peer Reviewed Research Articles
Precise and reliable gene expression engineering via active coupling and genetic nesting
Nature Methods, in review
Vivek Mutalik et al.
URL pending PDF reprint pending
Composition and quality of irregular genetic elements controlling transcription and translation
Nature Methods, in review
Vivek Mutalik et al.
URL pending PDF reprint pending
A fully decompressed synthetic bacteriophage øX174 genome assembled and archived in yeast
Virology, in press
Paul Jaschke et al.
URL pending PDF reprint pending
Engineered cell-cell communication via DNA messaging
Journal of Biological Engineering Sept 2012, 6:16 doi:10.1186/1754-1611-6-16
Monica Ortiz and Drew Endy
URL Final PDF pending
Refactored M13 bacteriophage as a platform for tumor cell imaging and drug delivery
ACS Synthetic Biology, in press
Debadyuti Ghosh et al.
URL pending PDF reprint pending
Rewritable digital data storage in live cells via engineered control of recombination directionality
PNAS USA, 21 May 2012, doi: 10.1073/pnas.1202344109
Jerome Bonnet, Pakpoom Subsoontorn and Drew Endy
URL PDF reprint
Scaffold number in yeast signaling system sets tradeoff between system output and dynamic range
PNAS USA, 2011 November; doi: 10.1073/pnas.1004042108
Ty Thomson, Kirsten Benjamin, Alan Bush, Tonya Love, David Pincus, Orna Resnekov, Richard Yu, Andrew Gordon, Alejandro Colman-Lerner, Drew Endy, Roger Brent
URL | PDF reprint
Gemini, a bifunctional enzymatic and fluorescent reporter of gene expression
PLoS ONE 4(11): e7569. doi:10.1371/journal.pone.0007569
Lance Martin, Austin Che, Drew Endy
URL PDF reprint
Measuring the activity of BioBrick promoters using an in vivo reference standard
Journal of Biological Engineering, 2009 March 20;3:4
Jason R Kelly, Adam J Rubin, Caroline M Ajo-Franklin, John Cumbers, Michael J. Czar, Kim de Mora, Aaron L Glieberman, Dileep D Monie, Drew Endy
URL PDF reprint
Determination of cell fate selection during phage lambda infection
PNAS USA, 2008 December; 105(52), 20705-20710
Francois St-Pierre, Drew Endy
URL PDF reprint
Refinement and standardization of synthetic biological parts and devices
Nature Biotechnology, 2008 July; 26(6), 787-93
Barry Canton, Anna Labno, Drew Endy
URL PDF reprint News & Views
Engineering BioBrick vectors from BioBrick parts
Journal of Biological Engineering, 2008 Apr 14;2:5
Reshma Shetty, Drew Endy, Tom Knight
URL
Stimulus design for model selection and validation in cell signaling
PLoS Comput Biol. 2008 Feb 15;4(2):e30
Josh Apgar, Jared Toettcher, Drew Endy, Forest White, Bruce Tidor
URL
TABASCO: A single molecule, base-pair resolved gene expression simulator
BMC Bioinformatics 2007, 8:480
Sriram Kosuri, Jason R Kelly, Drew Endy
URL
DNA synthesis and biological security
Nature Biotechnology June 2007
Hans Bugl, John P Danner, Robert J Molinari, John T Mulligan, Han-Oh Park, Bas Reichert, David A Roth, Ralf Wagner, Bruce Budowle, Robert M Scripp, Jenifer A L Smith, Scott J Steele, George Church & Drew Endy
URL PDF reprint
Synthetic genomics: Options for governance
Biosecur Bioterror 2007 Dec;5(4):359-62
Michele Garfinkel, Drew Endy, Gerald Epstein, Robert Friedman
URL (Full Report)
Foundations for engineering biology
Nature 24 November 2005 doi:10.1038/nature04342
Drew Endy
URL PDF reprint
Refactoring bacteriophage T7
Nature/EMBO Molecular Systems Biology 13 September 2005 doi:10.1038/msb4100025
Leon Y. Chan, Sriram Kosuri and Drew Endy
URL PDF reprint News & Views October 2004 version
Regulated cell to cell variation in a cell fate decision system
Nature 18 September 2005 doi:10.1038/nature03998
Alejandro Colman-Lerner, Andrew Gordon, Eduard Serra, Tina Chin, Orna Resnekov, Drew Endy, C. Gustavo Pesce and Roger Brent
URL PDF reprint News & Views
Modelling cellular behaviour (insight feature)
Nature 409, 391-395
Drew Endy and Roger Brent
PDF reprint
Computation, prediction, and experimental test of fitness for bacteriophage T7 mutants with permuted genomes
Proceedings of the National Academy of Sciences USA 97, 5375-5380
Drew Endy, Lingchong You, John Yin and Ian Molineux
PDF reprint
Toward antiviral strategies that resist viral escape
Antimicrobial Agents & Chemotherapy 44, 1097-1099
Drew Endy and John Yin
PDF reprint
Intracellular kinetics of a growing virus: A genetically-structured simulation for bacteriophage T7
Biotechnology & Bioengineering 55, 375-389
Drew Endy, Deyu Kong, and John Yin
PDF reprint
Transcribed Lectures
Synthetic biology: Can we make biology easy to engineer? <--note: transcription was not proofed
Industrial Biotechnology' 1 December 2008, 4(4): 340-351
Drew Endy
URL PDF reprint
Other Articles, Not Peer Reviewed
Cribsheet #16: Synthetic Biology
SEED July 2008
Lee Billings, Drew Endy
Illustrator: Thomas Porostocky
URL PDF reprint
Reconstruction of the genomes
Science 2008 Feb 29;319(5867):1196-7
Drew Endy
URL PDF reprint
Building a fab for biology
Scientific American June 2006
David Baker, George Church, Jim Collins, Drew Endy, Joe Jacobson, Jay Keasling, Paul Modrich, Christina Smolke, Ron Weiss
PMID: 16711359
A biological engineer searches for simplicity
Nature 449, 5
Drew Endy
URL
Useful construction
The Scientist January 2006
Drew Endy
URL (login likely req'd.)
URL (login not req'd., as of 24 March 2009)
2003 Synthetic Biology study
US Government October 2003
Drew Endy, Patrick Lincoln, Richard Murray
doi:1721.1/38455
Molecular monogamy
Nature 426, 614-615
Drew Endy and Michael B. Yaffe
PDF reprint
Decoding NF-kB signaling
Science 298, 1189-1190
Alice Y. Ting and Drew Endy
PDF reprint
A standard parts list for biological circuitry
DARPA white paper October 1999
Drew Endy, Adam Arkin
doi:1721.1/29794
Books
Adventures in synthetic biology
Nature 24 November 2005 Cover & Online
Drew Endy, Isadora Deese and Chuck Wadey
PDF, links, and background information
For a reprint, please email isadora AT mit DOT edu
Edited Book Chapters
Synthetic Biology
Bioethics Briefing Book, The Hastings Center, 2008, Chapter 35
Michele Garfinkel, Drew Endy, Gerald Epstein, Robert Friedman
Free Online
Towards a predictive biology: The example of bacteriophage T7
Evolution as Computation, Landweber & Winfree (eds.), DIMACS Workshop, Princeton, 1999, 201-209 (book chapter).
Drew Endy
no e-print currently available (sorry!)
Selected Online Lectures or Debates
Synthetic Biology Debate with Jim Thomas, moderated by Stewart Brand
The Long Now Foundation, 17 November 2008
Cowell Theater, Fort Mason Center, San Francisco
Online w/ transcription via FORA.tv, DVD for purchase via Whole Earth Films
Programming DNA: A 2-bit language for engineering biology
24C3, The 24th Chaos Communication Congress, 27 December 2007
Berliner Congress Center, Berlin
Online via Google video
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:01:43.000Z
|
52tqrkhlsnak6hbgcoeg2wlamhanjar7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67691",
"uncompressed_offset": 200305349,
"url": "openwetware.org/index.php?oldid=627608&title=User%3ADita_Hasni",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://openwetware.org/index.php?title=User:Dita_Hasni&oldid=627608"
}
|
cccc_CC-MAIN-2013-20
|
User:Dita Hasni
From OpenWetWare
Revision as of 06:20, 19 September 2012 by Dita Hasni (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
I am a new member of OpenWetWare!
Contents
Contact Info
Dita Hasni dan suami saya (budi febrianto)
• Dita Hasni, MD
• staff pengajar Fakultas Kedokteran Universitas Baiturrahmah
• Jalan denai no 65, sukarame medan
• Komplek Perumahan Shafa Marwa, lubuk Minturun. Padang.
• Email me through OpenWetWare atau bisa menghubungi saya didit_girl@yahoo.com
. .
Education
• 2011 sampai saat ini, Mahasiswa Magister Biomedik, Fakultas Kedokteran Universitas Sumatera Utara
• 2004-2010, Medical doctor, Fakultas Kedokteran Universitas Sumatera Utara Institute
Research interests
1. Interest 1
2. Interest 2
3. Interest 3
Publications
1. Goldbeter A and Koshland DE Jr. . pmid:6947258. PubMed HubMed [Paper1]
2. JACOB F and MONOD J. . pmid:13718526. PubMed HubMed [Paper2]
leave a comment about a paper here
3. Mark Ptashne. A genetic switch. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, 2004. isbn:0879697164. [Book1]
All Medline abstracts: PubMed HubMed
Useful links
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:49:58.000Z
|
dohegfxazgplirgq5h7mrm7vtli5efvl
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67692",
"uncompressed_offset": 200317873,
"url": "openwetware.org/index.php?curid=98714&oldid=668896&title=User%3AKatrina_Sherbina",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://openwetware.org/index.php?title=User:Katrina_Sherbina&curid=98714&oldid=668896"
}
|
cccc_CC-MAIN-2013-20
|
User:Katrina Sherbina
From OpenWetWare
Revision as of 18:11, 19 January 2013 by Katrina Sherbina (Talk | contribs)
Jump to: navigation, search
I am a new member of OpenWetWare!
Contents
Contact Info
Katrina Sherbina (an artistic interpretation)
I work in the Dahlquist Lab at Loyola Marymount University. I learned about OpenWetWare from Dr. Dahlquist, and I've joined for research purposes.
Education
• In Progress, BS in Individualized Studies (Biomathematics) and Biochemistry minor, Loyola Marymount University
• Upper division course work: Biochemistry with lab, Advanced Biochemistry, Molecular Biology of the Genome, Intro to Probability and Statistics, Biostatistics, Methods of Applied Mathematics
Research interests
• Modeling the transcriptional response of S. cerevisiae to cold shock using ordinary differential equations.
• Statistical analysis of microarray data to determine significant changes in gene expression between wild type and deletion strains of S. cerevisiae .
Summer Research
Summer 2011 Computational Journal
Summer 2012 Computational Journal
Fall 2011 Research
Computational Journal
Fall 2012 Research
Computational Journal
Useful links
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:12:03.000Z
|
26l3ig245x4iuls2e4oevk4rp527id3r
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67693",
"uncompressed_offset": 200324548,
"url": "openwetware.org/wiki/Kafatos:Retreat",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://openwetware.org/wiki/Kafatos:Retreat"
}
|
cccc_CC-MAIN-2013-20
|
Kafatos:Retreat
From OpenWetWare
Jump to: navigation, search
Home Lab Members Research Publications Contact
Pictures say more than a thousand words - or so they say...
16th & 17th of March @ the Wye Campus:
• catch the 9:53 am train from Charing Cross Station. The train will arrive at Wye at 11:07. It is a 15 min walk from the station to the campus. We will then start our first session at 11:30, which is slightly later than originally planned.
(Anyone missing this train may have to consider taking a train to Ashford or Ashford International, which are served more frequently and only a short taxi ride away from Wye Conference Centre.)
• We couldn't purchase tickets in advance, so please allow enough time to buy these yourselves.
• Remember to keep the tickets for reimbursement.
• Most of us will return the next day and should buy a NETWORK AWAY BREAK (£20.80). If you need to return to London the same evening, buy a CHEAP DAY RETURN (£17.60). (Avoid buying single tickets at £15.40 each way.)
• Those of you travelling by car can get instructions here.
Wye Retreat Final Programme
assigned times in brackets include discussion
Thursday March 16
12:00 - 13:00 Introduction and PI presentations
13:00 - 14:30 Lunch break and check-in
14:30 - 16:00 Round table discussion
16:00 - 16:30 Coffee break
16:30 - 18:25 Session I: Working groups on novel approaches to malaria control
1. Vaccines (50 min)
• a. Target Identification (20 min):
Julian Gray (Crisanti), Andrew Blagborough (Sinden)
• b. Transmission blocking (30 min):
Ellen Runn(Kafatos/Christophides), Kalpana Lal (Sinden), Rebecca Stanway (Sinden), Souraya Ramjanee(Sinden), Anastasios Koutsos (Kafatos/Christophides)
2. Transgenic mosquitoes (65 min)
• a. Sterile Insect Technique:
Jason Benton (Crisanti), Gianmaria Liccardi (Crisanti), Kristin Michel (Kafatos), Lietta Nicolaides (Crisanti), Flaminia Catteruccia (Crisanti)
• b. Resistance genes:
Stephan Meister (Kafatos/Christophides), Idir Akhouayri (Billker)
• c. Drive mechanisms:
Philippos Papathanos (Crisanti)
18:25 - 18:40 Break
18:40 - 19:30 Session I continued
3. Chemical approaches to transmission control (50 min)
• a. Insecticides and insecticide resistance (25 min):
Hilary Ranson (Crisanti)
• b. Smart sprays and transmission blocking inhibitors (25 min):
Andreas Raabe (Billker), Rob Moon(Billker), Tibebu Habtewold (Kafatos/Christophides), Michael Povelones (Kafatos/Christophides)
20:00 - 21:30 Dinner
21:30 Mixer
Friday March 17
08:30 - 09:45 Session II: Vector-parasite genome interactions
1. High throughput genetic screens in the mosquito (45 min)
• a. Genome-wide RNAi (25 min):
George Christophides (Kafatos/Christophides), Timm Schlegelmilch (Kafatos/Christophides)
• b. Mutagenesis (25 min):
Nikolai Windbichler (Crisanti),
2. Identification of gene function (30 min)
• a. Microarrays analysis in mosquitoes (30 min):
Kalle Magnusson (Crisanti), Dina Vlachou (Kafatos/Christophides), Antonio Mendes (Kafatos/Christophides)
09:45 - 10:15 Coffee break
10:15 - 11:25 Session II.2 continued
• b. Knockout screens in the parasite (25 min):
Ellen Runn (Kafatos/Christophides), Andrea Ecker (Sinden),Rita Tewari (Sinden)
• c. Inducible KO technologies (20 min):
Paco Pino (Billker)
• d. Protein-protein interactions (25 min):
Chandra Ramakrishnan (Sinden), Anastasios Koutsos (Kafatos/Christophides), Mike Osta (K/C), Marta Tufet (Sinden)
11:25 - 12:25 Session III: Model systems and bioinformatics
• a. A. gambiae/A. stephensi - P. berghei (20 min):
Dina Vlachou (Kafatos/Christophides), Antonio Mendes (Kafatos/Christophides), Mike Osta (K/C), Tibebu Habtewold (Kafatos/Christophides)
• b. Differences and similarities between plasmodia (20 min):
Jacqui Mendoza (Sinden), Geoff Butcher (Sinden)
• c. Bioinformatics in vector biology (20 min):
Robert Waterhouse (Kafatos/Christophides), Robert MacCallum (Kafatos/Christophides), Seth Redmond (Kafatos/Christophides)
12:30 - 14:00 Lunch break
14:00 - 16:00 Free time
16:00 - 16:30 Reporting
Stephan Meister(Kafatos/Christophides), Nikolai Windbichler (Crisanti), Kalpana Lal (Sinden), Michael Povelones (Kafatos/Christophides)
Participants and email addresses by lab:
Crisanti Lab:
Kafatos/Christophides Labs:
Sinden Lab:
Billker Lab:
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:12.000Z
|
j4c4dr73othcuedmzoi64egvfrc3skth
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67712",
"uncompressed_offset": 218479108,
"url": "quotationsbook.com/quote/20508/",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://quotationsbook.com/quote/20508/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
You have all the reason in the world to achieve your grandest dreams. Imagination plus innovation equals realization. Waitley, Denis
This quote is about imagination · Search on Google Books to find all references and sources for this quotation.
A bit about Waitley, Denis ...
We don't have a biography.
These people bookmarked this quote:
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:01:15.000Z
|
xtsy3o6otqwtlj7g2aobv6iqqd66tujh
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67713",
"uncompressed_offset": 218485387,
"url": "quotationsbook.com/quote/22209/",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://quotationsbook.com/quote/22209/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
Oh how fine it is to know a thing or two! Moliere
This quote is about knowledge · Search on Google Books to find all references and sources for this quotation.
A bit about Moliere ...
Jean-Baptiste Poquelin, better known as Moliere (January 15, 1622 February 17, 1673), was a French theatre writer, director and actor, one of the masters of comic satire.
These people bookmarked this quote:
• Nobody has bookmarked this quote yet.
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:13:37.000Z
|
d2nabk7tqznaqgyv72rlqmxpytpbg6jt
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67714",
"uncompressed_offset": 218491586,
"url": "quotationsbook.com/quote/31371/",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://quotationsbook.com/quote/31371/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
I've discovered I've got this preoccupation with ordinary people pursued by large forces. Spielberg, Steven
This quote is about possibilities · Search on Google Books to find all references and sources for this quotation.
A bit about Spielberg, Steven ...
We don't have a biography.
These people bookmarked this quote:
• Nobody has bookmarked this quote yet.
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:50:08.000Z
|
zyc3vjz4fk5wjbbf24xdbole2lyspr2d
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67715",
"uncompressed_offset": 218497692,
"url": "quotationsbook.com/quote/8993/",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://quotationsbook.com/quote/8993/"
}
|
cccc_CC-MAIN-2013-20
|
Quotation added by staff
Why not add this quote to your bookmarks?
Had I been present at the creation of the world I would have proposed some improvements. Alfonso X
This quote is about creativity · Search on Google Books to find all references and sources for this quotation.
A bit about Alfonso X ...
Alfonso X, El Sabio, the Learned, the Astronomer, or the Wise (November 23, 1221 April 4, 1284) was a king of Galicia, Castile and Len (1252 - 1284). He is perhaps the most interesting, though far from the most capable, of the Spanish kings of the Middle Ages. His nickname "El Sabio" usually means "the Wise", but in his case, a translation "The Learned" is more accurate.
These people bookmarked this quote:
• Nobody has bookmarked this quote yet.
More on the author
This quote around the web
Loading...
Search Quotations Book
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:19:11.000Z
|
62qexappyht2xgm4foc2prcfcrjxjn63
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67719",
"uncompressed_offset": 234867445,
"url": "scholarship.rice.edu/handle/1911/9901",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://scholarship.rice.edu/handle/1911/9901"
}
|
cccc_CC-MAIN-2013-20
|
Home Browse About Contact Help
CAIRO. - Opera Square
Files in this item
File Description
Front
Back
Need help?
About this item
Title: CAIRO. - Opera Square
Author: B. Livadas & Coutsicos
Summary: Public square with a statue on a pedestal on the left side and a hotel named "Russia" on the right side
Citable link to this page: http://hdl.handle.net/1911/9901
Date: n.d.
Original Source Original postcard album: "CAIRO. - Opera Square." (B. Livadas & Coutsicos). 5.5"x 3.5". From the collection of Dr. Paula Sanders, Rice University.
Subject Streets--Egypt--Cairo; Cairo (Egypt)--Buildings, structures, etc.
Related Resource Locate TIMEA places on a GIS map
Related Resource Browse more TIMEA resources related to this location
Related Resource Find more information on sites that appear in TIMEA
About This Resource: Forms part of the Travelers in the Middle East Archive (TIMEA)
Citation
B. Livadas & Coutsicos CAIRO. - Opera Square (n.d.).
From Travelers in the Middle East Archive (TIMEA). http://hdl.handle.net/1911/9901
For more on properly formatting citations, see Citing TIMEA Resources.
This item appears in the following Collection(s)
• TIMEA Visual Materials [1769]
This collection contains book illustrations, postcards, stereocards, photographs, and ephemera related to travel in the Middle East, primarily Egypt.
Show full item record
Rice Scholarship Archive Navigation
Browse
My Account
Statistics
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:47:21.000Z
|
jl4mihppbf57zdgq7c32zsy45jheom3s
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67735",
"uncompressed_offset": 259683746,
"url": "surface.syr.edu/architecture_tpreps/76/",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://surface.syr.edu/architecture_tpreps/76/"
}
|
cccc_CC-MAIN-2013-20
|
Authors/Contributors
SarahJo Bellissimo
Document Type
Thesis Prep
Publication Date
Fall 2009
Degree
B. ARCH
Keywords
Watervliet, housing, sustainability, environmental design, passive design
Language
English
Disciplines
Architecture | Environmental Design
Description/Abstract
"Our society is a dependent of the inevitably doomed industry of fossil fuels. We rely heavily on nonrenewable resources to maintain our lifestyles. Ethically, our relationship to the earth is unbalanced. In order to balance the scales of our future in architecture we must look toward sustainability through technology."
Creative Commons License
This work is licensed under a Creative Commons Attribution 3.0 License.
Share
COinS
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:19:38.000Z
|
bpvyrjdoyjgxm7tw7755jv5tzdaewczf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67758",
"uncompressed_offset": 293724613,
"url": "wiki.osgeo.org/index.php?oldid=60072&title=FOSS4G_NA_2012_Code_Sprint",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://wiki.osgeo.org/index.php?title=FOSS4G_NA_2012_Code_Sprint&oldid=60072"
}
|
cccc_CC-MAIN-2013-20
|
FOSS4G NA 2012 Code Sprint
From OSGeo Wiki
Revision as of 23:48, 20 January 2012 by Pwramsey3 (Talk | contribs)
Jump to: navigation, search
The code sprint will happen all day on Thurday April 12, 2012 at the conference center. Room TBD.
Participation
If you are planning on attending the sprint, please fill in your project and name so we can do food and beverage planning appropriately.
MapServer
• Someone!
• Someone else!
PostGIS
• Someone!
• Someone else!
Personal tools
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:36:57.000Z
|
uaxxv2qoqhyckusvk2chcems6kstwk3h
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67761",
"uncompressed_offset": 293887628,
"url": "wikieducator.org/User:Snadek",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://wikieducator.org/User:Snadek"
}
|
cccc_CC-MAIN-2013-20
|
User:Snadek
From WikiEducator
Jump to:navigation, search
Nikolaos Kourakos
Blog:My blog
Nationality:Greek
Country: Greece
email
This user was certified a Wiki Apprentice Level 2 by Mackiwg .
This user is a WikiNeighbour
for WikiEducator.
Contents
About Me
Hello, my name is "Nikolaos Kourakos" and I'm from Greece. My studies are in IT area and education (Msc in Adult Education and in E-commerce with focus in E-learning). I do my PhD research in the area of customized e-learning. I'm working in education department in Hellenic Navy and in the area of adults learning. Its really very exiting to participate in Learning4Content group. I'm very happy for this!!!
My interests
I'm interested in:
My Website, blog and contact particulars
Comments and Notes
Dear Nikolaos, your page is looking good now. Please keep updating the information on it. Hope you are not facing any difficulty. if so, pl do let us know. Warm Wishes.--Ramesh Sharma 18:15, 30 October 2010 (UTC)
(: Hi to Greece from Trinidad and Tobago! Triniwebdiva)
(: Welcome Nikolaos - so glad you're sticking through with this! Randy Fisher 02:01, 18 December 2008 (UTC)) (: Dear Nikolaos, Great to see you here again. Warm wishes, --Patricia 19:06, 27 July 2009 (UTC))
WikiEducator News & Events
Storytelling WiZiQ Meeting
Storytelling and Culture
Saturday, September 5, 2009
6:00pm GMT
Check your time JOIN US
EL4C31 WiZiQ Meeting
Copyrighty Law in Education
Saturday, October 24, 2009
12:00 GMT
Check your time JOIN US
EL4C38 WiZiQ Meeting
Wiki Skills & Collaborative Learning
Saturday, May 29, 2010
1:00pm GMT
RECORDING
Welcome to eL4C38
• Hello and welcome to eL4C38, a free online Learning4Content wiki skills workshop.
• You may wish to check the Daily Instructions for the workshop, introduce yourself, and check the list of participants.
• Whenever you have the time, click on each of the above links and/or start ahead of time with the workshop.
• Enjoy the workshop :-)
Your facilitators:
Notes and Feedback from my Wiki Neighbours
Welcome to eL4C32
Your facilitators:
Navigation
Community
Create a book
Toolbox
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:31:49.000Z
|
ktgjyhg4xirvyj5acs5ojt4omwlqiai4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67764",
"uncompressed_offset": 294176027,
"url": "wikitravel.org/wiki/en/index.php?oldid=859780&title=Chincoteague",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://wikitravel.org/wiki/en/index.php?title=Chincoteague&oldid=859780"
}
|
cccc_CC-MAIN-2013-20
|
Help Wikitravel grow by contributing to an article! Learn how.
Chincoteague
From Wikitravel
Jump to: navigation, search
Chincoteague is a city in Virginia.
Get in
To get to Chincoteague Island, take 64 east from Richmond until you reach Norfolk. From there, take 13 North. You will need to pay a $12 bridge toll to cross the Chesapeake Bay-Bridge Tunnel. Once on the other side, continue up the Eastern Shore for about an hour and a half. In Oak Hall, there is a Food Lion and Sonic. Turn right onto Rt. 175. Continue following 175 past the NASA base and across the bridges. There is a stoplight after the last bridge--Welcome to Chincoteague Island! Relax, you're on Island Time.
Get around
See
• Annual Pony Swim, Pony Swim Lane. Last Wednesday in July.
Do
Buy
Eat
• Captain Zack's Seafood Carry-Out, corner of Maddox and Deep Hole Road. Don't be fooled by the unassuming little building – Crystal is serving up some mighty fine local seafood. Try the clam fritter and single fried oyster sandwiches. She's a Chincoteague native and a delightful one at that. Ask her about Halloween costumes!
Drink
Sleep
Miss Mollys Inn, 4141 Main Street, 757-336-6686 or 800-221-5620, [1]. At this bed and breakfast you will find a warm and inviting parlor that is just the place to curl up with a good book, chat, play board games or just sit by the fire.
Contact
Get out
This article is an outline and needs more content. It has a template, but there is not enough information present. Please plunge forward and help it grow!
Personal tools
Namespaces
Variants
Actions
Navigation
feeds
Destination Docents
Toolbox
In other languages
other sites
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:30:20.000Z
|
lpsyucnqyamywzebwyaabnqo7qkstkht
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67771",
"uncompressed_offset": 304719602,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/DOSSbyTopic/2C1D2617E23B5879CA256BD00027ED02",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/DOSSbyTopic/2C1D2617E23B5879CA256BD00027ED02?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Methods & Standards > Directory of Statistical Sources by Topic
Agricultural Survey
Page tools: RSS Search this Product
NAME OF ORGANISATION
Australian Bureau of Statistics (ABS)
OVERVIEW
The Agricultural Survey is the basic source of Australian agricultural commodity statistics.
Frequency: The Agricultural Survey (AS) is conducted annually. Approximately every fifth year an Agricultural Census will be conducted in place of the AS.
Scope: The frame population of the AS is all establishments with an Estimated Value of Agricultural Operations (EVAO) of $5,000 or more. The sample size for 2001/02 was approximately 35,000 respondents, and for 2002/03 it was 28,000. The sample for the 2003/04 Agricultural Survey is a combination of:
(a) a reduced sample from the same selections as the 2001/02 Agricultural Survey (about 28,000 of the original 35,000 units); and
(b) 3,000 new selections from the 2002 frame (to account for sample loss due to the increasing number of deaths). This extra sample will target industries where survey results for commodities are creeping out towards or beyond design parameters.
Statistical unit: Data is collected at the establishment level.
Information: The Agricultural Survey collects area and production data for a wide range of agricultural commodities. This commodity data is used to produce data on the Value of Agricultural Commodities Produced (VACP). Information on inputs to the production process is also collected and disseminated.
Major Area of holding
commodity Land use
categories: Cereals and other broadacre crops
Vegetables
Fruit
Vineyards
Livestock
Breakdowns: Data are available at State and Statistical Division (SD).
Data are available by Estimated Value of Agricultural Operations (EVAO), Australian and New Zealand Standard Industrial Classification (ANZSIC), commodity and specified size ranges (e.g. herd size) and Area of Holding classes.
Two complementary collections are run in conjunction with the Agricultural Survey, namely Apples and Pears (user-funded) and Vineyards (user-funded). The two user-funded surveys have their own separate entries.
Design Constraints for major data items:
Relative Standard Errors (RSEs) 2.5 % for Australian level
6% for State level
12% for regional level
Minimum stratum sample size: 15 for size 1; 10 for others
PURPOSE
Primary producers, industry organisations and suppliers, and other agricultural service and support industries use agricultural statistics for planning and decision making. The Federal and State Governments make extensive use of agricultural statistics for planning, budgets advisory services and for policies related to marketing agricultural commodities.
The prime objective of the Agricultural Survey (AS) is to act as a source of basic agricultural statistics about a wide variety of commodities.
The AS is designed primarily to collect data about commodities (including area and production for crops, number of livestock and area irrigated). Data are also available on the number of producers for each commodity, and on the counts of producers by Australian and New Zealand Standard Industrial Classification (ANZSIC) class.
The AS is also the major source of commodity data input into the calculation of Value of Agricultural Commodities Produced (VACP). VACP is a major output from the survey which is in turn used as an input to the Australian National Accounts.
SCOPE
Main Survey
The scope is all establishments with an Estimated Value of Agricultural Operations (EVAO) of $5,000 or above. There are approximately 147,000 such establishments in Australia.
The sample size for 2001/02 was approximately 35,000 respondents, and for 2002/03 it was 28,000. The sample for the 2003/04 Agricultural Survey was a combination of:
(a) a reduced sample from the same selections as the 2001/02 Agricultural Survey (about 28,000 of the original 35,000 units); and
(b) 3,000 new selections from the 2002 frame (to account for sample loss due to the increasing number of deaths). This extra sample will target industries where survey results for commodities are creeping out towards or beyond design parameters.
Supplementary Surveys
Within the normal $5,000 EVAO constraint:
Coverage checking is a continual process. Sources of coverage include front-of-form (FOF) information, lists from industry groups, and the ABS Business Register.
DATA DETAIL
Conceptual framework
The Agricultural Survey (AS) provides a measure of agricultural activity. The scope is all Establishments with an Estimated Value of Agricultural Operations (EVAO) of $5,000 or above. The population is stratified by State, sub-State Region, Industry, Australian and New Zealand Standard Industrial Classification (ANZSIC) and Size (EVAO and Area of Holding).
An establishment with agricultural activity is usually a single physical location which is used for the production of crops (including fruit and vegetables) and/or for the raising of livestock and the production of livestock products.
Establishments in the agricultural sector were classified in accordance with the methodology described in the 1993 Australian and New Zealand Standard Industrial Classification (ABS cat. no.1292.0).
The ANZSIC codes of agricultural units are determined annually by valuing physical crop and livestock information collected. The valuation procedure allows for the industry classification of individual units to be changed to reflect significant or long term changes in their activities (e.g. a unit may change from the Grain ANZSIC to the Sheep ANZSIC if the farmer changes production patterns).
The procedure provides for a dampening or resistance effect to offset instability in allocation to particular classes of the classification which would arise from short-term factors such as large price movements, floods and drought. To obviate such effects, the valuation procedure takes into account (without double counting) the area of crops sown and numbers of livestock on holdings at a point in time as well as the crops produced and livestock turnover during the year.
The resultant aggregation of commodity values is termed the EVAO. It should be noted that EVAO is applicable only for industry coding and size valuation purposes. It is not an indicator of receipts obtained by units or of the value of agricultural commodities produced by these units.
Main outputs
Number-raised estimates of activity undertaken throughout the year, and levels of stock etc. held on farm at 30 June, including estimates of population participation by commodity.
Counts of respondents by commodity.
Publications to which the Agricultural Survey contributes:
Principal Agricultural Commodities, Australia, Preliminary (ABS Cat. No 7111.0)
Preliminary statistics on area and production of principal cereals for grain; area intended to be sown to barley, oats and wheat for all purposes; livestock numbers, lambing and intended matings.
Agricultural Commodities, Australia (ABS cat. no. 7121.0).
Presents final estimates of production for all commodities collected in the Agricultural Survey. These include broadacre crops, fruit and vegetables as well as the number of livestock and livestock products. Also includes details of industry structure including counts of farms by Australian and New Zealand Standard Industrial Classification (ANZSIC) and size (physical and economic).
Classifications
Standards used in the Agricultural Survey include:
A - Geographical regions
State
Statistical Division (SD)
Statistical Local Area (SLA)
B - Industry ( ANZSIC )
C - Size ( Area of Holding, EVAO)
D - Commodity classes
Non-standard. The ANZSCC is not suitable for the collection and compilation of the commodities covered by the Agricultural Survey/Census and other agricultural collections such as Apples and Pears and Vineyards.
Other concepts (summary)
The commodity classification is broadly broken down as follows
Commodity CCN Group
Area of holding 01
Information Technology 08
Pastures
Excluding pastures harvested for seed 10
Harvested for seed 11
Crops
Cereal crops 15
Non cereal crops 18 and 19
Crop forecast, stocks 33
Vegetables
Potatoes 35
Other vegetables 36
Fruit
Area of orchard fruit trees 40
Orchard fruit intended for sale 42
Other fruit intended for sale 42
Non orchard fruit intended for sale 43
Apple varieties 45
Pear varieties 46
Vineyards
Area and production of grapevines 48
Red grape varieties 51
White grape varieties 51
Artificial fertilisers and soil conditioners used 56
Irrigation 57
Livestock
Sheep and lambs 60
Wool production 63
Lambing and lamb forecasts 64
Cattle and calves 70
Calves - births 72
Pigs 75
Other livestock 76
Sales of livestock 77
Livestock deaths/losses 78
Poultry 80
Beekeeping 85
GEOGRAPHIC DETAIL
Australia
New South Wales
Victoria
Queensland
South Australia
Western Australia
Tasmania
Northern Territory
ACT
Statistical Division
Other (specify below)
Comments and/or Other Regions
Agro-Ecological Region (AER)
COLLECTION FREQUENCY
Annually
Frequency comments
The current strategy is for a 5 yearly census with sample surveys in inter-censal years.
1996-97 Census; 1997-98 Sample; 1998-99 Sample; 1999-2000 Sample; 2000-01 Census; 2001-02 Sample; 2002-03 Sample; 2003-04 Sample
Following discussions between ABS and Agriculture, Fisheries and Forestry Australia (AFFA) in June 2000, a decision was made to advance the Agriculture Census by a year. The next Ag Census is scheduled for the year ended 30 June 2006.
COLLECTION HISTORY
Prior to the 1997/98 cycle, the history of the collection is that of the Agricultural Census.
2003-04 Agricultural Survey
2002-03 Agricultural Survey
2001-02 Agricultural Survey
2000-01 Agricultural Census
1999-00 Reference period changed to 'Year Ended 30 June'.
1997-98 Agricultural Commodity Survey introduced
1996-97 Long form, all establishments with an EVAO greater than or equal to $5,000
1995-96 Short form, all establishments with an EVAO greater than or equal to $5,000
1994-95 Short form, all establishments with an EVAO greater than or equal to $5,000
1993-94 Long form. This was the first year of the long form/short form cycle.
Change in EVAO level to $5,000 and over.
1992-93 EVAO level to $22,000 and over.
1991-92 Change in EVAO level to $22,500 and over.
1990-91 EVAO level to $20,000 and over.
1989-90 EVAO level to $20,000 and over.
1988-89 EVAO level to $20,000 and over.
1987-88 EVAO level to $20,000 and over.
1986-87 Change in EVAO level to $20,000 and over.
1982-83 Change in EVAO level to $2,500 and over.
Prior to this, EVAO level was $1,500 and over.
Earliest year for which electronic data is available is 1982-83.
Information before 1982-83 is available only in printed form.
DATA AVAILABILITY
Yes
Data availability comments
Forms are dispatched in June, preliminary estimates are available in November and final estimates are available in July of the following year.
DATE OF LAST UPDATE FOR THIS DOCUMENT
06/04/2011 02:40 PM
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:13:57.000Z
|
d6tup6xnpzwe3v6qwfuhpe66qutuhpi4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67772",
"uncompressed_offset": 304729738,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/DetailsPage/7502.02005-06",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/DetailsPage/7502.02005-06?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
7502.0 - Value of Selected Agricultural Commodities Produced, Australia, Preliminary, 2005-06
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 06/09/2007
Page tools: RSS Search this Product
Help for : Adobe PDF Zip File.
Publications
7502.0 - Value of Selected Agricultural Commodities Produced, Australia, Preliminary
Data Cubes
Gross value, Selected Agricultural Commodities, Preliminary-Year ended 30 June 2006
Gross value, Fruit and nuts, Preliminary-Year ended 30 June 2006
Gross value, Vegetables, Preliminary-Year ended 30 June 2006
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:38:00.000Z
|
nj3cmmot5ldqqrgg4ded4mb227gv7liz
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67774",
"uncompressed_offset": 304743479,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Latestproducts/3238.0Main%20Features21991%20to%202021?issue=1991+to+2021&prodno=3238.0&tabname=Summary",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Latestproducts/3238.0Main%20Features21991%20to%202021?opendocument&tabname=Summary&prodno=3238.0&issue=1991%20to%202021&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
3238.0 - Experimental Estimates and Projections, Aboriginal and Torres Strait Islander Australians, 1991 to 2021 Quality Declaration
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 08/09/2009
Page tools: Print Page Print All RSS Search this Product
NOTES
ABOUT THIS PUBLICATION
In this publication the word 'Indigenous' refers to Aboriginal and Torres Strait Islander peoples of Australia.
This publication contains experimental estimates and projections of the Aboriginal and Torres Strait Islander (Indigenous) population of Australia and the states and territories for 30 June 1991 to 30 June 2021, based on the 2006 Census of Population and Housing. Estimates for 30 June 1986 to 30 June 1990 are also included, however these estimates should be interpreted with caution.
Detailed information is available in data cubes from the ABS web site <http://www.abs.gov.au>.
Projections of the Indigenous population by Indigenous Regions and Remoteness Areas (scheduled for release 30 September 2009) for 30 June 2007 to 30 June 2021 will also be available from the ABS web site.
CHANGES TO THIS ISSUE
SuperTABLE data cubes attached to this issue contain 14 projection series for Australia and the states and territories, for 2007 to 2021. Population estimates for 1986 to 2006 are also included as spreadsheets.
SuperTABLE data cubes for Indigenous Regions and Remoteness Areas for 2006 to 2021 are scheduled for release 30 September 2009 as part of this publication.
These estimates and projections supercede the 2001 census-based series published in Experimental Estimates and Projections, Aboriginal and Torres Strait Islander Australians, 1991 to 2009 (cat. no. 3238.0) released in September 2004.
DATA NOTES
The projections presented are not intended as predictions or forecasts, but are illustrations of growth and change in the population that would occur if assumptions made about future demographic trends were to prevail over the projection period.
While the assumptions are formulated on the basis of an assessment of demographic trends, there is no certainty that any of the assumptions will be realised. In addition, no assessment has been made of possible future changes in non-demographic conditions.
ROUNDED FIGURES
Population estimates and projections in this publication have been rounded to the nearest hundred. Calculations of percentage and numeric change and proportions are based on unrounded data.
INQUIRIES
For further information about these and related statistics, contact the National Information and Referral Service on 1300 135 070 or Ellouise Hyams on Canberra (02) 6252 6820.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:32:47.000Z
|
3wenuy3vqsh7bntts4xo7z2yxw3creqi
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67775",
"uncompressed_offset": 304751479,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Latestproducts/519273BD961F38E2CA2577EE000D7692",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Latestproducts/519273BD961F38E2CA2577EE000D7692?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
6469.0 - Outcome of the 16th Series Australian Consumer Price Index Review, Dec 2010
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 06/12/2010 First Issue
Page tools: Print Page Print All RSS Search this Product
Contents >> Evaluation of the Deposit and Loan facilities index
EVALUATION OF THE DEPOSIT AND LOAN FACILITIES INDEX
This section contains the following subsection :
Background
Recent developments
User views
Evaluation
Outcome
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:51:22.000Z
|
oi7dggbkv2ow4fhohigiokgzzhjxq4tw
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67776",
"uncompressed_offset": 304758472,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Latestproducts/BB04997EF426FAF1CA25711F00146E3C",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Latestproducts/BB04997EF426FAF1CA25711F00146E3C?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
1292.0 - Australian and New Zealand Standard Industrial Classification (ANZSIC), 2006 (Revision 1.0)
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 19/09/2008
Page tools: Print Page RSS Search this Product
Contents >> Chapter 8 The detailed classification >> Division C Manufacturing >> Subdivision 17 Petroleum and Coal Product Manufacturing
Subdivision 17 PETROLEUM AND COAL PRODUCT MANUFACTURING
This section contains the following subsection :
Group 170 Petroleum and Coal Product Manufacturing
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:03:53.000Z
|
lrjoaozhetad6praptdlcho5wt5oeoj6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67777",
"uncompressed_offset": 304765265,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Latestproducts/FD9EFC26FAB7BF3FCA256AAF001FCA6D",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Latestproducts/FD9EFC26FAB7BF3FCA256AAF001FCA6D?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
1272.0 - Australian Standard Classification of Education (ASCED), 2001
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 22/08/2001
Page tools: Print Page RSS Search this Product
Contents >> Additional Information >> Level of Education Correspondence Tables >> Appendix 3, ABSCQ - ASCED Level Correspondence Table
APPENDIX 3
ABSCQ Level of AttainmentASCED Level of Education
1Higher Degree111Higher Doctorate
112Doctorate by Research
113Doctorate by Coursework
114Professional Specialist Qualification at Doctoral Degree Level
121Master Degree by Research
122Master Degree by Coursework
123Professional Specialist Qualification at Master Degree Level
2Postgraduate Diploma211Graduate Diploma
212Graduate Qualifying or Preliminary
213Professional Specialist Qualification at Graduate Diploma Level
221Graduate Certificate
222Professional Specialist Qualification at Graduate Certificate Level
3Bachelor Degree311Bachelor (Honours) Degree
312Bachelor (Pass) Degree
4Undergraduate Diploma411Advanced Diploma
5Associate Diploma421Diploma
511Certificate IV
6Skilled Vocational Qualifications514Certificate III
7Basic Vocational Qualifications521Certificate II
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:40:51.000Z
|
2xjbe6lcpaje2bx3pd245uczz6xeoqa4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67778",
"uncompressed_offset": 304772539,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/Previousproducts/7215.0Main%20Features9999Dec%202006?issue=Dec+2006&prodno=7215.0&tabname=Summary",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/Previousproducts/7215.0Main%20Features9999Dec%202006?opendocument&tabname=Summary&prodno=7215.0&issue=Dec%202006&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
7215.0 - Livestock Products, Australia, Dec 2006
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 14/02/2007
Page tools: Print Page Print All RSS Search this Product
Provides quarterly statistics on livestock slaughterings (including chickens), meat production, milk intake by factories, market milk sales by factories, receivals of wool by brokers and dealers, exports of live sheep and cattle and exports of meat. Includes seasonally adjusted and trend totals for numbers slaughtered, meat produced, whole milk intake and wool receivals.
The frequency of this publication changed to quarterly with the release of the September 1998 issue. See also 7218.0.55.001
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:52:14.000Z
|
zhlavquu3wt5hfiwhm4xtkapzva7ocux
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67779",
"uncompressed_offset": 304793906,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/ProductsbyReleaseDate/9BF03E65D68DA9BFCA25724A00108F1D",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/ProductsbyReleaseDate/9BF03E65D68DA9BFCA25724A00108F1D?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
8221.0 - Manufacturing Industry, Australia, 2003-04
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 05/07/2006
Page tools: Print Page Print All RSS Search this Product
NOTES
ABOUT THIS PUBLICATION
This publication presents estimates for the manufacturing industry for 2003-04 from the Economic Activity Survey, together with data on a comparable basis for 2001-02 and 2002-03.
CHANGES TO THIS PUBLICATION
This publication includes the first release of employment estimates (and related ratios) using the new statistical infrastructure described in the previous issue of this publication. These were not included in the previous issue, due to methodological problems in deriving employment data from the taxation system data used. (See Appendix 2 for details.) A time series of employment estimates using the new statistical infrastructure is presented in table 1.1.
Estimates of most assets and liabilities items (and related ratios) are not available from the 2003-04 collection, and hence are not included in this issue.
REVISIONS
Data for 2001-02 and 2002-03 have been revised since the previous issue of this publication. All comparisons with earlier years are based on revised data. Revisions to key data items are presented in table 1.1. Revised data for other items are available on-line in updated versions of the original datasets. Please see below.
INFORMATION AVAILABLE ON-LINE
The text components of this publication are available free on-line. A PDF publication and extended data spreadsheets are also available free on-line. To access this information, go to the ABS website home page <http://abs.gov.au>. Open the Industry link shown under Themes (located in the left-side navigator), then open the Manufacturing Statistics link shown under Industry.
INQUIRIES
For further information about these and related statistics, contact the National Information and Referral Service on 1300 135 070 or John Ridley on Sydney (02) 9268 4541.
CHAPTER 1 SUMMARY
INTRODUCTION
This publication presents 2003-04 estimates for the manufacturing industry based on new statistical infrastructure introduced for 2001-02.
KEY DATA
Table 1.1 presents a time series for selected items, from 2001-02 to 2003-04. All value data in this table are shown at current prices.
For more information about:
• employment estimates, see Appendix 2, page 49
• survey methodology, see Technical Note 1, page 50.
The Glossary provides definitions for terms used.
GROSS VALUE ADDED
Table 1.2 illustrates the growth of Australian industries over time using chain volume measures of their gross value added. Chain volume measures provide estimates free of the direct effects of price change.
Of the seventeen industries shown in table 1.2, Manufacturing ranked fifteenth in its average annual growth rate over the past 10 years and lowest over the past 25 years, with increases of 2.0% and 1.7% respectively. By comparison, the highest growth rates were recorded by Communication services, with annualised rates of 6.1% and 6.7% for the 10 year and 25 year periods.
FURTHER COMMENTARY
Please see:
• National data: Chapter 2, page 9
• States, territories and Australia: Chapter 3, page 29
• Exports: Chapter 4, page 37.
CHAPTER 2 NATIONAL DATA
INTRODUCTION
Statistics in this publication relate to the manufacturing industry as defined by the Australian and New Zealand Standard Industrial Classification (ANZSIC), 1993 edition. These data are presented at the ABN unit/TAU level (see the Glossary for definitions) and, therefore, can contain data about activities normally associated with industries other than manufacturing. See Explanatory Notes paragraphs 4-16 for further details. The commentary focuses mainly on the major data variables for the nine ANZSIC industry subdivisions that comprise the manufacturing industry.
OVERVIEW
Most major indicators of activity for the Australian manufacturing industry increased, in current price terms, during 2003-04. Sales and service income increased 3.5% and industry value added (IVA) rose by 4.1%. Manufacturers paid $46.2b in wages and salaries in 2003-04, 3.1% more than in 2002-03 (despite a decline in employment). The increase in net capital expenditure was 9.0% (from $9.9b in 2002-03 to $10.8b in 2003-04). Export sales of goods produced decreased by 1.1% (from $48.3b in 2002-03 to $47.8b in 2003-04).
SELECTED VARIABLES, 2002-03 AND 2003-04
EMPLOYMENT
Australian manufacturing industry employed 1,095,300 persons at the end of June 2004, a decrease of 9,500 (or 0.9%) compared to the end of June 2003.
Employment fell in six of the nine manufacturing industry subdivisions between June 2003 and June 2004. The industry subdivisions which experienced the greatest percentage declines in employment were Metal product manufacturing (down 4.7%, from 178,700 to 170,300), Textile, clothing, footwear and leather manufacturing (down 3.7%, from 69,100 to 66,600), and Other manufacturing (down 3.1%, from 85,900 to 83,300). The increases were recorded by Petroleum, coal, chemical and associated product manufacturing (up 3.6%, from 104,200 to 107,900), Wood and paper product manufacturing (up 2.5% from 72,300 to 74,100), and Machinery and equipment manufacturing (up 1.9%, from 239,700 to 244,200).
At the industry class level, the five largest manufacturing industries as measured by employment at the end of June 2004 were Printing (ANZSIC Class 2412) (44,500 persons), Wooden furniture and upholstered seat manufacturing (ANZSIC 2921) (36,700 persons), Fabricated metal product manufacturing n.e.c. (ANZSIC 2769) (31,400 persons), Meat processing (ANZSIC 2111) (28,800 persons) and Motor vehicle manufacturing (ANZSIC 2811) (28,700 persons).
At the end of June 2004, employment in Australian manufacturing was marginally lower (by 2,000 persons) than at the end of June 2002.
WAGES AND SALARIES
The Australian manufacturing industry paid $46.2b in wages and salaries in 2003-04, 3.1% higher than in 2002-03.
Total wages and salaries paid rose, in current price terms, in seven of the nine manufacturing industry subdivisions between 2002-03 and 2003-04.
The manufacturing industry subdivision showing the largest percentage increase in wages and salaries in 2003-04 was Other manufacturing (up 6.5%, or $0.1b, to $2.3b). In absolute terms, Machinery and equipment manufacturing recorded the largest increase (up $0.5b, or 4.4%, to $10.7b).
The industry group, of those available for publication, which recorded the highest wages and salaries expense was Motor vehicle and part manufacturing (ANZSIC Group 281), with $3.3b or 7.2% of total manufacturing.
WAGES AND SALARIES PER PERSON EMPLOYED AT END OF JUNE, 2002-03 and 2003-04
Wages and salaries per person employed in manufacturing in 2003-04 were $42,200, representing an increase of $1,600 (or 4.0%) compared to 2002-03. In 2003-04 at the subdivision level, wages and salaries per person employed ranged from $50,500 in Petroleum, coal, chemical and associated product manufacturing to $27,300 in Textiles, clothing, footwear and leather manufacturing. The greatest percentage change over the period from 2001-02 to 2003-04 was an increase of 12.5% for Other manufacturing.
SALES & SERVICE INCOME
Sales and service income of manufacturing industry in Australia in 2003-04, at $315.6b, was $10.6b (or 3.5%) higher than in 2002-03.
Over the period from 2001-02 to 2003-04, manufacturing's total sales and service income increased by 8.0%.
At the industry group level, of those groups available for publication, Non-metallic mineral product manufacturing n.e.c. (ANZSIC group 264) recorded the largest percentage increase in sales and service income (16.6%) between 2002-03 and 2003-04. The largest absolute increase, of $2.1b, was recorded by Motor vehicle and part manufacturing (ANZSIC group 281), which also contributed the largest share (7.5%) of sales and service income.
Sales and service income per person employed in Australian manufacturing in 2003-04 was $288,200, 4.4%, or $12,100, higher than for 2002-03, and 8.2%, or $21,900, higher than in 2001-02.
INDUSTRY VALUE ADDED (IVA)
DISTRIBUTION OF IVA ACROSS INDUSTRIES, 2002-03 and 2003-04
IVA for the manufacturing industry increased by $3.5b (4.1%) to $90.4b in 2003-04. This increase consists of the $10.6b increase in sales and service income mentioned above, less a $4.8b (2.9%) increase in purchases of goods and materials and a $1.1b (2.0%) increase in other intermediate input expenses, and a decrease in the value of the change in inventories of $1.1b (73.2%).
All nine manufacturing industry subdivisions increased IVA in current price terms between 2002-03 and 2003-04.
At the industry group level, of those groups available for publication, Furniture manufacturing (ANZSIC group 292) recorded the largest percentage increase in IVA (17.3%) in 2003-04. Motor vehicle and part manufacturing (ANZSIC group 281) experienced the largest growth in IVA, $0.7b (12.4%), followed by Publishing (ANZSIC group 242) with $0.6b (13.3%).
As measured by contribution to IVA, the largest manufacturing industry groups in 2003-04 (of those available for publication) were Motor vehicle and part manufacturing (ANZSIC group 281), with $5.9b, or 6.5% of total manufacturing, Publishing (ANZSIC group 242), with $5.4b, or 6.0%, and Basic non-ferrous metal manufacturing (ANZSIC group 272), with $4.4b, or 4.9%.
IVA per person employed in manufacturing has increased by 5.0%, from $78,700 in 2002-03 to $82,600 in 2003-04.
EMPLOYMENT SIZE
In 2003-04, businesses employing 100 or more persons accounted for 46.4% of total manufacturing employment in Australia and 61.1% of wages and salaries. Their contribution to sales and service income was 64.7% and to industry value added 62.6%.
CONTRIBUTION TO MANUFACTURING INDUSTRIES BY BUSINESSES EMPLOYING 100 OR MORE PERSONS, 2003-04
Of the employment size categories shown in Table 2.2, businesses employing 1,000 or more persons accounted for the largest share of all four variables at the total manufacturing level. For further discussion of the contribution of businesses categorised by employment size see the Industry Subdivision Analysis below.
NET CAPITAL EXPENDITURE
Net capital expenditure by manufacturing businesses rose by 9.0%, or $0.9b, to $10.8b between 2002-03 and 2003-04. Total acquisitions grew by 3.1% ($0.4b), mainly reflecting a 16.6% ($0.2b) increase in outlays on dwellings, other buildings and structures and a 2.0% ($0.2b) increase in plant, machinery and equipment. Asset disposals in 2003-04 were 17% ($0.5b), lower than in the previous year.
LABOUR COSTS
The value of the selected non-wage labour costs as a proportion of wages and salaries increased for total manufacturing from 17.3% in 2002-03 to 18.3% in 2003-04. This mainly reflected an increase (from 8.4% to 9.2%) in the proportion represented by employer contributions into superannuation. Apart from Textile, clothing, footwear and leather manufacturing, this proportion rose in all manufacturing subdivisions.
INDUSTRY SUBDIVISION ANALYSIS
Food, beverage and tobacco manufacturing
Food, beverage and tobacco manufacturing recorded increases of 2.2% in sales and service income and 2.5% in IVA. Although wages and salaries increased by 2.0%, employment fell by 1.0%.
In 2003-04, Food, beverage and tobacco manufacturing was the largest manufacturing industry as measured by its share of sales and service income (21.7%); it ranked second in IVA (19.5%) and wages and salaries (18.4%). This industry also outlayed the largest amount on purchases of goods and materials, $38.3b, or 22.6%, of the Australian manufacturing total. The value of assets acquired by Food, beverage and tobacco manufacturing ($2.8b, or 21.4% of total acquisitions) and net capital expenditure ($2.4b, or 21.9%) also exceeded that of all other manufacturing industry subdivisions.
Of the nine manufacturing industry subdivisions, Food, beverage and tobacco manufacturing is the second largest employer, accounting for 17.6% of the estimate for total manufacturing. In percentage terms, the industry is dominated by businesses employing 100 or more persons. These businesses contribute 82.1% of the subdivision's IVA, 80.3% of wages and salaries, 78.3% of sales and service income and 69.9% of employment. Compared to businesses employing 100 or more persons across the other eight industry subdivisions, those in Food, beverage and tobacco manufacturing provided the greatest proportion of total manufacturing employment (26.6%), sales and service income (26.3%), IVA (25.6%) and wages and salaries (24.2%). One half of this industry's IVA is produced by businesses employing 1,000 or more persons.
Textile, clothing, footwear and leather manufacturing
Despite sales and service income declining during 2003-04 by 4.0%, IVA of Textiles, clothing, footwear and leather manufacturing rose by 3.9%. This was mainly due to a $0.5b decrease in the value of purchased goods and materials compared to 2002-03.
The smallest manufacturing subdivision by most key measures presented, the industry accounted for less than 4% of total manufacturing IVA, sales and service income, purchases of goods and materials, and wages and salaries. Textile, clothing, footwear and leather manufacturing was the second smallest manufacturing employer in 2003-04, with 6.1% of total persons employed in Australian manufacturing.
Over the period from 2001-02 to 2003-04, employment in this industry has decreased by 8.1%. Within Textile, clothing, footwear and leather manufacturing, businesses employing 0-4 persons accounted for 30.3% of the subdivision's estimated total employment. However, of the employment size categories presented, businesses employing from 20 to 49 persons (with 14.5% of the industry's employment) made the greatest contribution to the subdivision's sales and service income (18.7%), wages and salaries (18.6%) and IVA (17.2%).
Exports made up 17.6% of the industry's sales of goods produced.
Wood and paper product manufacturing
IVA and sales and service income of Wood and paper product manufacturing increased by 3.9% between 2002-03 and 2003-04, accompanied by growth of 3.0% in purchases of goods and materials and 4.9% in other intermediate input expenses. Wages and salaries rose by 5.0% and employment by 2.5% to 74,100 persons.
In 2003-04, Wood and paper product manufacturing accounted for 7.2% of total IVA for manufacturing, 6.8% of employment, 6.3% of wages and salaries, and 5.9% of sales and service income, and 5.2% of purchases of goods and materials.
Wood and paper product manufacturing recorded a 45.1% increase in net capital expenditure during 2003-04, the strongest percentage growth of any manufacturing subdivision. The industry accounted for 7.4% of manufacturing asset acquisitions and 8.1% of net capital expenditure.
Printing, publishing and recorded media
During 2003-04 the industry recorded an 4.4% increase in IVA. This increase was mainly attributable to a 3.9% decrease in other intermediate input expenses, with purchases of goods and materials increasing by 2.5% and a modest rise of 1.5% in sales and service income. Wages and salaries increased by 5.2%.
Printing, publishing and recorded media's share of manufacturing purchases of goods and materials in 2003-04 was, at 3.6%, substantially less than its contribution to manufacturing's total IVA (10.3%), wages and salaries (10.2%), and sales and service income (6.5%). Of total employment in manufacturing at the end of June 2004, 10.0% was accounted for by this subdivision. Printing, publishing and recorded media exported 4.5% of the value of its sales of goods produced, and non-exporting businesses represented over 75% of its employment, wages and salaries, sales and service income and IVA.
Petroleum, coal, chemical and associated product manufacturing
IVA increased marginally (1.2%) in 2003-04, following a rise of 10.5% the previous year. Petroleum, coal, chemical and associated product manufacturing sales and service income and purchases of goods and materials both increased by 4.2% in 2003-04, and wages and salaries by 5.1%. The industry accounted for 12.4% of IVA for manufacturing, 16.7% of sales and service income, 19.7% of purchases of goods and materials and 11.8% of wages and salaries. Total assets acquired by the subdivision represented 17.3% of total manufacturing and net capital expenditure 18.3%. The increase of $0.6b (34.6%) in total capital acquisitions was the largest increase of any manufacturing industry.
Employment in the Petroleum, coal, chemical and associated product manufacturing industry constituted 9.9% of total manufacturing employment at the end of June 2004. Businesses employing 100 or more people accounted for 53.8% of employment in Petroleum, coal, chemical and associated product manufacturing. Such businesses produced 77.5% of the industry's sales and service income and 68.3% of its IVA, and paid 66.4% of its wages and salaries.
Non-metallic mineral product manufacturing
This industry increased its wages and salaries paid by 4.4% from 2002-03 to 2003-04. IVA increased by 7.4%, reflecting a 9.2% increase in sales and service income and a 7.3% increase in purchases of goods and materials. In 2003-04, the subdivision's share of total acquisition of assets in manufacturing was 8.0% and 7.9% of net capital expenditure.
As well as being the smallest manufacturing subdivision in terms of employment (contributing 4.2%), Non-metallic mineral product manufacturing is the subdivision in which businesses employing fewer than 100 persons made the smallest contributions in 2003-04 to total manufacturing sales and service income, IVA and wages and salaries. In contrast, Non-metallic mineral product manufacturing recorded the highest IVA per person employed, at $104,000.
Metal product manufacturing
In 2003-04, IVA of Metal product manufacturing increased by 0.6%. Sales and service income increased by 2.3%, and purchases of goods and materials by 2.8%. Wages and salaries fell marginally, by 0.5%. The industry was a significant contributor to manufacturing total asset acquisitions (20.2%) and net capital expenditure (18.8%).
Metal product manufacturing is the most heavily export-oriented manufacturing industry. In 2003-04, 36.5% of sales of goods produced were exported. Businesses exporting 50% or more of sales contributed 30.4% of the Metal product manufacturing's sales and service income and 29.3% of IVA, much higher than such businesses in any other manufacturing subdivision.
Businesses employing fewer than 100 persons provided 59.5% of this industry's employment at the end of June 2004. The contribution of businesses in this employment size category was greater in Metal product manufacturing than to manufacturing overall. The percentage difference was especially marked in relation to IVA, to which they contributed 48.6% for this industry but only 22.9% at the total manufacturing level.
Machinery and equipment manufacturing
The largest industry in terms of employment (244,200 or 22.3%) and wages and salaries ($10.7b or 23.2%), Machinery and equipment manufacturing was also the largest contributor to manufacturing IVA ($17.8b or 19.7%). The subdivision's contribution to total capital acquisitions and net capital expenditure were both proportionately lower, at 13.1%. In 2003-04, IVA increased by 8.1%, sales and service income 5.4% and purchases of goods and materials by 5.5%. Wages and salaries grew by 4.4% (following a 9.5% increase in 2002-03), and employment increased at a more moderate rate of 1.9%.
Uniquely among the manufacturing industries, employment within Machinery and equipment manufacturing was almost equally shared between businesses employing fewer than 100 persons (50.7%) and those employing 100 or more (49.3%). However, businesses employing 100 or more persons paid 60.1% of the industry's wages and salaries, and made similar contributions to sales and service income (63.2%) and IVA (60.6%).
Other manufacturing
Sales and service income of this industry increased by 7.6% and purchases of goods and materials by 4.5%. In 2003-04, Other manufacturing accounted for 7.6% of total manufacturing employment but 5.0% or less of wages and salaries, IVA, sales and service income and purchases of goods and materials.
Of the nine manufacturing industry subdivisions, Other manufacturing is heavily dominated by businesses employing fewer than 100 persons. In this industry, these businesses account for 88.3% of employment, 82.5% of wages and salaries, 85.3% of sales and service income, and 84.2% of IVA. In all the employment size categories representing businesses employing fewer than 20 persons, Other manufacturing made the greatest percentage contribution of any manufacturing industry.
Other manufacturing exported 3.3% of its sales of goods produced, the second lowest of any other manufacturing subdivision. Businesses which did not export accounted for 81.6% of employment in the industry, with similar levels of contribution to wages and salaries, sales and service income and IVA.
CHAPTER 3 STATES, TERRITORIES AND AUSTRALIA
INTRODUCTION
This chapter presents estimates of key variables at the state and territory level. For information about how these estimates are derived, please see paragraphs 20-22 of the Explanatory Notes. The commentary outlines features of the distribution of these key variables across states and territories, together with a summary of the state and territory dimension of each of the nine manufacturing industry subdivisions.
OVERVIEW
CONTRIBUTION OF STATES / TERRITORIES TO TOTAL MANUFACTURING
The above graphic illustrates each state or territory's share of economic aggregates relating to Australian manufacturing in 2003-04. The distribution is very similar across all four variables presented.
DISTRIBUTION OF EMPLOYMENT AND WAGES AND SALARIES
Compared to the previous year, manufacturing employment has increased in five of the eight states and territories. Similarly, all states and territories apart from Victoria recorded an increase in wages and salaries paid.
Compared to 2002-03, sales and service income and IVA of the manufacturing industry increased in all eight states and territories.
DISTRIBUTION OF SALES AND SERVICE INCOME AND IVA
INDUSTRY COMPOSITION
Of those industries available for publication, the industry which most heavily dominates manufacturing IVA in any state or territory is Printing, publishing and recorded media in the Australian Capital Territory (which accounts for 35% of Australian Capital Territory manufacturing IVA, compared to 10% nationally). This is followed by Machinery and equipment manufacturing in South Australia (32%; nationally 20%), Metal product manufacturing in Western Australia (31%; nationally 18%), and Wood and paper product manufacturing in Tasmania (26%; 7% nationally).
Metal product manufacturing was the major manufacturing industry, as measured by share of industry value added, in two states (Queensland and Western Australia), and Machinery and equipment manufacturing in two others (Victoria and South Australia). Food, beverage and tobacco manufacturing dominated in New South Wales, as did Wood and paper product manufacturing in Tasmania. Not all subdivisions are available for publication for the two territories.
INDUSTRY SUBDIVISION ANALYSIS
Food, beverage and tobacco manufacturing
Food, beverage and tobacco manufacturing is the largest manufacturing industry in New South Wales as measured by contribution to that state's manufacturing sales and service income (23%) and IVA (22%). It is also the largest contributor to manufacturing in Queensland and Tasmania as measured by employment (22% for Queensland and 23% for Tasmania), sales and service income (26% in Queensland and 25% in Tasmania) and wages and salaries (22% in Queensland and 24% in Tasmania).
New South Wales businesses contributed 33% of the sales and service income of the Food, beverage and tobacco manufacturing industry, Victoria 30% and Queensland 20%. Corresponding proportions of employment were 30%, 27% and 22%.
Textile, clothing, footwear and leather manufacturing
This industry is heavily concentrated in Victoria, where some 44% of the industry's sales and service income is produced. New South Wales's share is 32% and Queensland's 10%. Their contributions to IVA and employment show a similar pattern.
Wood and paper product manufacturing
Victoria's share of this industry's sales and service income, at 32%, just exceeded that of New South Wales (31%) in 2003-04. These are more than double Queensland's contribution (15%). New South Wales, however, contributes slightly more than Victoria to employment (31% vs 28%) and IVA (30% vs 28%). In terms of its share of IVA, Wood and paper product manufacturing is the major manufacturing industry in Tasmania, contributing 26%.
Printing, publishing and recorded media
Printing, publishing and recorded media is dominated by New South Wales businesses. They contribute 43% of the industry's sales and service income, compared to 30% from Victoria and 11% from Queensland. New South Wales also accounts for 38% of employment in this industry, and 41% of its wages and salaries. Of the manufacturing industries available for publication for the Australian Capital Territory Printing, publishing and recorded media is the largest, contributing 31% of Australian Capital Territory manufacturing sales and service income, 30% of employment, 35% of IVA and 33% of wages and salaries paid.
Petroleum, coal, chemical and associated product manufacturing
New South Wales businesses contributed 34% of the industry's sales and service income, Victoria 33% and Queensland 15%. Corresponding proportions of IVA are 31%, 38% and 13%. Although the distribution of sales and service income among the three largest states follows the pattern typical of several other manufacturing subdivisions (New South Wales 34%, Victoria 33% and Queensland 15%), their shares of IVA are very different. Victoria dominates IVA in Petroleum, coal, chemical and associated product manufacturing, accounting for 38% compared to New South Wales's 31% and 13% for Queensland. This pattern also characterises their shares of wages and salaries and employment.
Non-metallic mineral product manufacturing
In terms of sales and service income, New South Wales contributes 32% of this industry, Victoria 25% and Queensland 18%. Their shares of employment and IVA are similar.
Metal product manufacturing
New South Wales contributes 31% of the employment and 28% of the sales and service income of the Metal product manufacturing industry. The shares of the next three biggest states are 26% of employment and 19% of sales and service income for Victoria, 19% and 20% respectively for Queensland, and 13% and 23% for Western Australia. The relative importance of Western Australia and Queensland reflects the location of major smelting and refining operations in those states, where Metal product manufacturing is the major manufacturing industry as measured by share of state IVA (31% and 23% respectively).
Machinery and equipment manufacturing
Concentration of the Motor vehicle and part manufacturing and Electrical equipment and appliance manufacturing industries in Victoria and South Australia is mainly responsible for those states' shares (respectively, 38% and 16%) of sales and service income for Machinery and equipment manufacturing; New South Wales contributes 26% and Queensland 12%. Of employment in this industry at the end of June 2004, 31% is attributed to Victoria, 29% to New South Wales, 16% to Queensland and 15% to South Australia.
By all four measures presented, Machinery and equipment manufacturing is the largest manufacturing industry in South Australia and Victoria. Its domination of South Australian manufacturing is the most pronounced of any state or territory: 35% of South Australia's manufacturing employment, 32% of IVA, and 37% of both sales and service income and wages and salaries paid are attributable to Machinery and equipment manufacturing. Corresponding proportions for Victoria are, respectively, 23%, 22%, 24% and 25%.
Other manufacturing
Measured by sales and service income, New South Wales contributes 34% of this industry, Victoria 30% and Queensland 20%. Their shares of employment, wages and salaries and IVA are similar.
COMPARISON ACROSS INDUSTRY
Table 3.2 shows the contribution of industries to the production (as measured by total factor income) of each state and territory, as well as Australia, in 2003-04. For the purposes of this table, the activity of general government and the ownership of dwellings are each treated as industries.
Of the nineteen industries shown in the table, Property and business services ranked first (at 13.0%) in its contribution to Australian production for 2003-04. Manufacturing was the second largest industry (at 12.8%). Manufacturing was the largest industry in Victoria, Queensland, South Australia and Tasmania, and in New South Wales was exceeded only by Property and business services. South Australia and Tasmania (at 16.7%) had the highest proportion of state or territory production attributed to Manufacturing, followed by Victoria (15.7%).
CHAPTER 4 EXPORTS
INTRODUCTION
This chapter illustrates the extent and importance of export activity by Australian manufacturing businesses. Table 4.1 presents estimates of the value of exports by Australian manufacturing businesses of goods that they produced. Table 4.2 categorises businesses by their involvement in exporting, and presents estimates of the contribution of each category to industry aggregates. For information about how these data have been derived, please see Explanatory Notes paragraphs 26 to 30. Even though, as explained there, the exports data presented in these tables are not directly comparable with the ABS's overseas trade series, the commentary below also uses the trade series to illustrate some characteristics of Australian manufacturing's export performance.
INDUSTRY COMPARISON
The October and November 2004 issues of International Trade in Goods and Services, Australia (ABS cat. no. 5368.0) report that, in terms of value of goods exports, the most significant exporting industries (of the 'owning business' of the goods exported) in 2003-04 were manufacturing (40% of the value of goods exports), mining (31%) and wholesale trade (20%). The exporting business as defined in this analysis is the owner of the good at the time of export and not necessarily the producer of the good. Approximately 60% of exports of manufactured goods were exported by the manufacturing industry, 18% by the wholesale trade industry, and 12% by the mining industry.
VALUE OF EXPORTS
In 2003-04, the Economic Activity Survey indicated that Australian manufacturers directly exported $47.8b worth of the goods they produced. This represented 19.1% of their value of sales of goods produced and a decrease of $534m (or 1.1%) compared to the value for 2002-03, when the proportion was 19.8%. The following graph illustrates the percentage contribution of each manufacturing industry subdivision to total manufacturing exported sales of goods produced.
Of the nine manufacturing industry subdivisions, the value of exports of goods produced decreased between 2002-03 and 2003-04 in five and increased in the remaining four. In percentage terms, the manufacturing industry with the largest decrease in value of goods exported was Other Manufacturing, exports of which fell by 34.0% (or $141m) to $274m. The largest absolute decreases in the value of goods exported were recorded by Petroleum, coal, chemical and associated product manufacturing (down $746m, or 15.5%) and Machinery and equipment manufacturing (down $402m, or 4.8%).
EXPORTED SALES OF GOODS PRODUCED, PERCENTAGE CONTRIBUTION BY INDUSTRY SUBDIVISION
The value of goods exported by the Printing, publishing and recorded media rose by 46.5% (or $162m) between 2002–03 and 2003–04, the largest percentage increase in manufacturing. Over the same period, Food, beverage and tobacco manufacturing recorded the greatest increase in value of goods exported in dollar terms, $648m (or 5.0%). The other subdivisions in which the value of goods exported increased were Wood and paper product manufacturing (up $231m, or 18.3%) and Non-metallic mineral product manufacturing (up $6m, or 1.6%).
EMPLOYMENT SIZE OF EXPORTING BUSINESSES
Excluding Metal product manufacturing (see paragraphs 23 and 24 of the Explanatory Notes), manufacturing businesses employing 100 or more persons tend to export a higher proportion (by value) of the goods that they produce, compared to businesses employing fewer than 100 persons.
The industry subdivision in which export activity is most heavily concentrated in businesses employing 100 or more persons is Wood and paper product manufacturing, where 87.7% (or $1.3b) of total exports are produced by businesses in this size category. This is followed by Machinery and equipment manufacturing, where businesses in this category account for 83.5% (or $6.7b) of total exports. The $101m in exports produced by businesses classified to Other manufacturing represents the lowest proportion (36.8%) of exports produced by businesses employing 100 or more persons.
CONTRIBUTION OF BUSINESSES THAT EXPORT
Depending on the measure selected, businesses that do not export accounted for between 41% and 56% of activity at the total manufacturing level in 2003-04. For manufacturing subdivisions, their percentage contribution was greatest, across all variables, in Other manufacturing, Printing, publishing and recorded media and Non-metallic mineral product manufacturing.
Petroleum, coal, chemical and associated product manufacturing remains the industry in which businesses which export up to and including 50% of their sales of goods produced make the greatest contribution to the key aggregates presented.
Businesses which exported more than 50% of their sales of goods produced tended to contribute a higher proportion to sales and service income than to employment and wages and salaries.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:00:27.000Z
|
gkkv5w2rxm3audrxgkwakje5bsgosqjj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67780",
"uncompressed_offset": 304811388,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/ProductsbyReleaseDate/ED46EE3DD37BE744CA2570AF00019284",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/ProductsbyReleaseDate/ED46EE3DD37BE744CA2570AF00019284?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1105.0 - Release Advice, 24 Aug 1999
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 24/08/1999
Page tools: Print Page Print All RSS Search this Product
• About this Release
ABOUT THIS RELEASE
Previously: Publications Advice (ISSN: 0156-4722)
Lists products released by all ABS offices on the day of issue of the Release Advice and those expected to be released on the following four working days.
Copies are available free of charge on Tuesdays and Fridays over the counter from ABS bookshops, or by subscription. A daily Release Advice is also available from the ABS Statsite on the Internet (www.abs.gov.au).
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:13:37.000Z
|
ljjhvcgfjxg43acygnztssoxymfenpuk
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67781",
"uncompressed_offset": 304818404,
"url": "www.abs.gov.au/AUSSTATS/abs%40.nsf/second%2Blevel%2Bview?issue=Oct+2007&prodno=1330.0&prodno=1330.0&tabname=Past+Future+Issues&viewtitle=Education+News~Oct+2007~Previous~22%2F10%2F2007",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/AUSSTATS/abs@.nsf/second+level+view?ReadForm&prodno=1330.0&viewtitle=Education%20News~Oct%202007~Previous~22/10/2007&tabname=Past%20Future%20Issues&prodno=1330.0&issue=Oct%202007&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1330.0 - Education News, Oct 2007
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 22/10/2007
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:47:46.000Z
|
cge4mxm22irohw4hkpftsm3qvrnplypn
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67783",
"uncompressed_offset": 304833540,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/66f306f503e529a5ca25697e0017661f/606edac32e5c41d9ca256a5b001bd779!OpenDocument",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/66f306f503e529a5ca25697e0017661f/606edac32e5c41d9ca256a5b001bd779!OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
5489.0 - International Merchandise Trade, Australia, Concepts, Sources and Methods, 2001
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 30/05/2001
Page tools: Print Page Print All RSS Search this Product
Contents >> Appendixes >> Appendix 3. Major Country Groups - as at July 2000
Asia-Pacific Economic Cooperation (APEC)
Australia
Brunei Darussalam(a)
Canada
Chile(a)
China(a)
Hong Kong (SAR of China)(a)
Indonesia(a)(b)
Japan
Korea, Republic of(a)
Malaysia(a)
Mexico(a)
New Zealand
Papua New Guinea
Peru(a)
Philippines(a)
Russian Federation
Singapore(a)
Taiwan(a)
Thailand(a)
United States of America
Viet Nam(a)
Association of Southeast Asian Nations (ASEAN)
Brunei Darussalam(a)
Cambodia(a)
Indonesia(a)(b)
Laos(a)
Malaysia(a)
Myanmar(a)
Philippines(a)
Singapore(a)
Thailand(a)
Viet Nam(a)
European Union (EU)
Austria
Belgium-Luxembourg(d)
Denmark
Finland
France
Germany
Greece
Ireland
Italy
Netherlands
Portugal
Spain
Sweden
United Kingdom
Developing Countries (DCs)(d)
Afghanistan
Albania
Algeria
American Samoa
Angola
Anguilla
Antigua and Barbuda
Argentina
Bahamas
Bahrain
Bangladesh
Barbados
Belize
Benin
Bermuda
Bhutan
Bolivia
Bosnia and Herzegovina
Botswana
Brazil
British Indian Ocean Territory
British Virgin Islands
Brunei Darussalam(a)
Bulgaria
Burkina Faso
Burundi
Cambodia(a)
Cameroon
Cape Verde
Cayman Islands
Central African Republic
Chad
Chile(a)
China(a)
Colombia
Comoros, Republic of
Congo
Cook Islands
Costa Rica
Cote d’Ivoire
Croatia
Cuba
Cyprus
Czech Republic
Democratic Republic of
Congo, Zaire
Djibouti
Dominica
Dominican Republic
Ecuador(a)
Egypt
El Salvador
Equatorial Guinea
Developing Countries (DCs)(d) (continued)
Eritrea
Ethiopia
Falkland Islands (Malvinas)
Fiji
French Polynesia
Gabon
Gambia
Ghana
Gibraltar
Grenada
Guam
Guatemala
Guinea
Guinea-Bissau
Guyana
Haiti
Honduras
Hong Kong (SAR of China)(a)
Hungary
India
Indonesia(a)(b)
Iran
Iraq
Israel
Jamaica
Johnston Islands
Jordan
Kenya
Kiribati
Korea, People’s Democratic
Republic of
Korea, Republic of(a)
Kuwait
Laos(a)
Lebanon
Lesotho
Liberia
Libya
Macau (SAR of China)
Former Yugoslav Republic
of Macedonia
Madagascar
Malawi
Malaysia(a)
Maldives
Mali
Malta
Marianas, Northern
Marshall Islands
Mauritania
Mauritius
Mexico(a)
Developing countries (DCs)(c) (continued)
Micronesia, Fed States of
Midway Islands
Mongolia
Montserrat
Morocco
Mozambique
Myanmar(a)
Nauru
Namibia
Nepal
Netherlands Antilles
New Caledonia
Nicaragua
Niger
Nigeria
Niue
Oman
Pakistan
Palau
Panama
Paraguay
Peru(a)
Philippines(a)
Pitcairn Island
Poland
Developing countries (DCs)(c) (continued)
Qatar
Romania
Rwanda
St Christopher and Nevis
St Helena
St Lucia
St Pierre and Miquelon
St Vincent and the Grenadines
Samoa
Sao Tome and Principe
Saudi Arabia
Senegal
Seychelles
Sierra Leone
Singapore(a)
Slovak Republic
Slovenia
Solomon Islands
Somalia
Sri Lanka
Sudan
Suriname
Swaziland
Syria
Developing countries (DCs)(c) (continued)
Taiwan(a)
Tanzania
Thailand(a)
Togo
Tokelau
Tonga
Trinidad and Tobago
Tunisia
Turkey
Turks and Caicos Islands
Tuvalu
Uganda
United Arab Emirates
Uruguay
Vanuatu
Venezuela
Viet Nam(a)
Virgin Islands of the United
States
Wake Island
Wallis and Futuna Islands
Yemen
Zambia
Zimbabwe
(a) Also included in other country groups.
(b) Indonesia totals include East Timor.
(c) Developing Countries as defined in Schedule 1 of the Harmonized Tariff (includes Forum Island Countries, Developing Countries and places treated as Developing Countries). Excludes Papua New Guinea.
(d) Combined total as unable to separate.
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:41:53.000Z
|
gy26vcln6bv5kx34i4bhxt5mbifqbsph
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67784",
"uncompressed_offset": 304842134,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/Latestproducts/46EDB8FE522E4372CA25741800050CB9",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/Latestproducts/46EDB8FE522E4372CA25741800050CB9?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Catalogue Number
1297.0 - Australian and New Zealand Standard Research Classification (ANZSRC), 2008
Latest ISSUE Released at 11:30 AM (CANBERRA TIME) 31/03/2008
Page tools: Print Page RSS Search this Product
This group covers R&D directed towards understanding economic issues at the microeconomic level, including effects on taxation, consumption, industrial organisations, industry policy, industry cost and structure and other microeconomic issues.
This group has twelve objectives:
910201 Consumption
910202 Human Capital Issues
910203 Industrial Organisations
910204 Industry Costs and Structure
910205 Industry Policy
910206 Market-Based Mechanisms
910207 Microeconomic Effects of Taxation
910208 Micro Labour Market Issues
910209 Preference, Behaviour and Welfare
910210 Production
910211 Supply and Demand
910299 Microeconomics not elsewhere classified
Exclusions:
a) Economics of health policy outcomes is included in Group 9202 Health and Support Services.
b) Environmental aspects of resource consumption are included in Group 9607 Environmental Policy, Legislation and Standards.
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:52.000Z
|
6ro3ollxkuz77muigflogs664qglnehe
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67786",
"uncompressed_offset": 304857876,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/Previousproducts/BCAC44BE68E8B2D3CA2573D200109F07",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/Previousproducts/BCAC44BE68E8B2D3CA2573D200109F07?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1301.0 - Year Book Australia, 2008
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 07/02/2008
Page tools: Print Page RSS Search this Product
Contents >> Culture and recreation >> Culture and recreation Bibliography
BIBLIOGRAPHY
ABS PRODUCTS
Attendance at Selected Cultural Venues and Events, Australia, 2005-06 (4114.0)
Australian and New Zealand Standard Industrial Classification (ANZSIC), 1993 Edition (1292.0)
Book Publishers, Australia, 2003-04 (1363.0)
Book Retailers, Australia, 2003-04 (1371.0)
Children's Participation in Cultural and Leisure Activities, Australia, April 2006 (4901.0)
Cultural Funding by Government, Australia, 2005-06 (4183.0)
Environmental Issues: People's Views and Practices, March 2004 (4602.0)
Employment in Culture, Australia, 2001 (6273.0)
Employment in Sport and Recreation, Australia, 2001 (4148.0)
General Social Survey: Summary Results, Australia, 2006 (4159.0)
Household Expenditure Survey, Australia: Detailed Expenditure Items, 2003-04 (Reissue) (6535.0.55.001)
Involvement in Organised Sport and Physical Activity, Australia, April 2001 and April 2004 (6285.0)
Museums, Australia, 2003-04 (8560.0)
National Health Survey: Summary of Results, Australia, 2004-05 (4364.0)
Public Libraries, Australia, 2003-04 (8561.0)
Participation in Sports and Physical Recreation, Australia, 2005-06 (4177.0)
Performing Arts, Australia, 2002-03 (8697.0)
Sports Attendance, Australia, 2005-06 (4174.0)
Sports and Physical Recreation Services, Australia, 2004-05 (8686.0)
Television, Film and Video Production, Australia, 2002-03 (8679.0)
Work in Selected Culture and Leisure Activities, Australia, April 2004 (6281.0)
REFERENCES
Australia Council for the Arts 2006, Annual Report, 2005-06, Australia Council for the Arts, Sydney
Australian Communications and Media Authority (ACMA) 2007, At a Glance: Key Statistics for the Australian Communications Industry, ACMA, Sydney
Australian Film Commission (AFC)
Foreign Film and Television Drama Production in Australia, June 2002, AFC, Sydney
National Survey of Feature Film and TV Drama Production, 2005-06, November 2006, AFC, Sydney
Department of Immigration and Multicultural Affairs, Annual Report, 2005-06
Goldsmith B & O'Regan T September 2003, Cinema Cities, Media Cities: The Contemporary International Studio Complex, AFC, Sydney
Lockwood L, Wilson J & Fagg M 2001, Botanic Gardens of Australia - A Guide to 80 Gardens, New Holland Publishers, Sydney
National Archives of Australia 2006, Annual Report, 2005-06, National Archives of Australia, Canberra
Public Lending Right Committee 2007, Annual Report, 2006-07, Department of Communications, Information Technology and the Arts, Canberra
Wilson J & Fagg M 1998, Directory of Australian Botanic Gardens and Arboreta, 3rd edition, Australian National Botanic Gardens, Canberra
WEBSITES
Archives of Australia, last viewed July 2007, <http://www.archivenet.gov.au>
AusStage, last viewed July 2007, <http://www.ausstage.edu.au>
Australia Council for the Arts, last viewed July 2007, <http://www.ozco.gov.au>
Australia Dancing, last viewed July 2007, <http://www.australiadancing.org>
Australian Broadcasting Corporation, last viewed July 2007, <http://www.abc.net.au>
Australian Communications and Media Authority, last viewed July 2007, <http://www.acma.gov.au>
Australian Film Commission, last viewed July 2007, <http://www.afc.gov.au>
Australian Institute of Sport, last viewed July 2007, <http://www.ais.org.au>
Australian National Botanic Gardens, last viewed July 2007, <http://www.anbg.gov.au>
Australian Sports Commission, last viewed July 2007, <http://www.ausport.gov.au>
Australian Sports Anti-Doping Authority, last viewed July 2007, <http://www.asada.gov.au>
Collections Australia Network, last viewed July 2007, <http://www.collectionsaustralia.net>
Council of Heads of Australian Botanic Gardens, last viewed July 2007, <http://www.chabg.gov.au>
Council of Heads of Australasian Herbaria, last viewed July 2007, <http://www.chah.gov.au>
Cultural Ministers Council, last viewed July 2007, <http://www.dcita.gov.au/cmc>
Culture and Recreation Portal, last viewed July 2007, <http://www.cultureandrecreation.gov.au>
Department of Communications, Information Technology and the Arts, last viewed July 2007, <http://www.dcita.gov.au>
Department of Immigration and Citizenship, last viewed July 2007, <http://www.immi.gov.au>
Film Finance Corporation Australia, last viewed July 2007, <http://www.ffc.gov.au>
Musica Viva Australia, last viewed July 2007, <http://www.musicaviva.com.au>
National Archives of Australia, last viewed July 2007, <http://www.naa.gov.au>
National Film and Sound Archive, last viewed July 2007, <http://www.nfsa.afc.gov.au>
National Library of Australia, last viewed July 2007, <http://www.nla.gov.au>
Opera Australia, last viewed July 2007, <http://www.opera-australia.org.au>
SCORS Research Group (SRG), last viewed July 2007, <http://www.ausport.gov.au/scorsresearch>
Special Broadcasting Service (SBS), last viewed July 2007, <http://www20.sbs.com.au>
Symphony Services Australia, last viewed July 2007, <http://www.symphony.net.au>
The Australian Ballet, last viewed July 2007, <http://www.australianballet.com.au>
The Sport and Recreation Ministers' Council, last viewed July 2007, <http://www.dcita.gov.au/sport/the_sport_and_recreation_ministers_council>
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:48:46.000Z
|
6rb6d3aedn76gfqtdv7w4gblnvhblnbf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67787",
"uncompressed_offset": 304866846,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/Previousproducts/E760155B32E916D8CA256CAE0015DA37",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/Previousproducts/E760155B32E916D8CA256CAE0015DA37?opendocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1301.0 - Year Book Australia, 2003
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 24/01/2003
Page tools: Print Page RSS Search this Product
Contents >> Mining >> Research
Research into exploration, mining, ore dressing and metallurgy is conducted by government bodies, universities, private enterprise, and by the combined efforts of all these. A summary of the main organisations and their functions follows.
Geoscience Australia
Geoscience Australia is the national geoscience research and spatial information agency. It assists government and the community to make appropriate and informed decisions about the use of resources, management of the environment, and the safety and wellbeing of Australians. Its main activities centre on the following:
• geoscience for onshore activities, focusing on enhancing mineral exploration and environmental land-use planning through the production of geoscientific maps, databases and information systems, and conducting regional geological and mineral systems research
• geoscience for offshore activities, focusing on identifying potential hydrocarbon areas and new prospective basins in Australia's offshore territories, mapping the outer limits of Australia's jurisdiction under the UN Convention on the Law of the Sea, and undertaking studies of the marine environment and estuarine health studies
• spatial information activities, focusing on the provision of fundamental spatial data of Australia from national mapping, remote sensing and geodesy. The activity also includes the maintenance of fundamental gravity and seismic networks and the coordination of the implementation of the Commonwealth Policy on Spatial Data and Access and Pricing.
AMIRA International Limited
AMIRA is a not-for-profit private sector company, established in 1959 to facilitate the technological advancement of its members in the mineral, coal, petroleum and associated industries. It has membership and support of more than 90 companies in Australia and internationally.
AMIRA brokers and manages jointly funded research projects on a fee for service basis. Project sponsors are required to be AMIRA members. Typically, at any one time there are 70 projects under management valued at $40m.
The primary benefit delivered by AMIRA is the output from project sponsorship.
Australian Bureau of Agricultural and Resource Economics (ABARE)
ABARE is a professionally independent agency devoted to applied economic research. For over 50 years ABARE has worked with industry and government to provide stakeholders in Australia's rural and resource industries with up-to-date public policy analysis and commodity forecasts. ABARE's research seeks to clearly and independently identify the benefits and costs of alternative policy options for consideration by government and private decision makers.
ABARE services include:
• deriving supply and demand projections
• assessing the outlook for commodity prices
• examining patterns of national and world production and consumption
• analysing the impact of economic policies
• developing analytical computer programs and economic policies
• undertaking regional and environmental economic assessments
• providing economic assessments of factors affecting the competitiveness of the resources sector.
ABARE undertakes economic research on issues affecting the full range of major minerals, energy, agricultural and natural resources industries, as well as on climate change, and on macroeconomic, microeconomic and trade issues relating to these industries.
Previous PageNext Page
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:32:23.000Z
|
grogmljmhmvo3zvq4bgyiakbt5qn6jr2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67788",
"uncompressed_offset": 304875737,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/ProductsbyReleaseDate/7BB855FA38F32DB7CA2579670011937C",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/ProductsbyReleaseDate/7BB855FA38F32DB7CA2579670011937C?OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
8501.0 - Retail Trade, 1989
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 22/03/1989
Page tools: Print Page Print All RSS Search this Product
• About this Release
Previously, Retail Sales of Goods (Excluding Motor Vehicles, Parts, Petrol, Etc)
Monthly; ISSN:1032-3651; Contains monthly estimates of turnover for retail and selected service establishments. Original, seasonally adjusted and trend estimates are included for Australia in current price terms. The original and trend estimates are disaggregated by State and by industry. Constant price data are published quarterly classified by State or industry.
This publication has been converted from older electronic formats and does not necessarily have the same appearance and functionality as later releases.
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:31:07.000Z
|
rjowfkyumg7addx2b3kf32ozv4l2seoq
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67789",
"uncompressed_offset": 304882721,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/a866861f12e106e0ca256a38002791fa/86adc8b67b08fd89ca257308001aee69!OpenDocument",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/a866861f12e106e0ca256a38002791fa/86adc8b67b08fd89ca257308001aee69!OpenDocument"
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
1300.1.55.001 - Statistics News NSW, Mar 2007
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 29/03/2007
Page tools: Print Page Print All RSS Search this Product
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:59:44.000Z
|
jrexe6v4l7aoc4viiyncdlu4pmkh7clf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67790",
"uncompressed_offset": 304891018,
"url": "www.abs.gov.au/ausstats/abs%40.nsf/second%2Blevel%2Bview?issue=Jun+2006&prodno=8635.0.55.002&prodno=8635.0.55.002&tabname=Related+Products&viewtitle=Tourist+Accommodation%2C+Small+Area+Data%2C+Australia+-+Electronic+Delivery~Jun+2006~Previous~10%2F10%2F2006",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.abs.gov.au/ausstats/abs@.nsf/second+level+view?ReadForm&prodno=8635.0.55.002&viewtitle=Tourist%20Accommodation,%20Small%20Area%20Data,%20Australia%20-%20Electronic%20Delivery~Jun%202006~Previous~10/10/2006&tabname=Related%20Products&prodno=8635.0.55.002&issue=Jun%202006&num=&view="
}
|
cccc_CC-MAIN-2013-20
|
Australian Bureau of Statistics
Celebrating the International Year of Statistics 2013
ABS Home > Statistics > By Release Date
8635.0.55.002 - Tourist Accommodation, Small Area Data, Australia - Electronic Delivery, Jun 2006
Previous ISSUE Released at 11:30 AM (CANBERRA TIME) 10/10/2006
© Commonwealth of Australia 2013
Unless otherwise noted, content on this website is licensed under a Creative Commons Attribution 2.5 Australia Licence together with any terms, conditions and exclusions as set out in the website Copyright notice. For permission to do anything beyond the scope of this licence and copyright terms contact us.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:47:32.000Z
|
3rknpug34qgnntnac4o3hxwegyu2btza
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67794",
"uncompressed_offset": 355455943,
"url": "www.biomedcentral.com/1471-2105/6/S1/S2/email",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.biomedcentral.com/1471-2105/6/S1/S2/email"
}
|
cccc_CC-MAIN-2013-20
|
This article is part of the supplement: A critical assessment of text mining methods in molecular biology
Email this article to a friend
BioCreAtIvE Task 1A: gene mention finding evaluation
Alexander Yeh*, Alexander Morgan, Marc Colosimo and Lynette Hirschman
BMC Bioinformatics 2005, 6(Suppl 1):S2 doi:10.1186/1471-2105-6-S1-S2
Fields marked * are required
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:49:48.000Z
|
zev4xfaz2kogq25a3orqg2jt6cyu3dvk
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67795",
"uncompressed_offset": 355473680,
"url": "www.biomedcentral.com/1471-2164/13/285/abstract",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.biomedcentral.com/1471-2164/13/285/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Transcriptome analysis of the honey bee fungal pathogen, Ascosphaera apis: implications for host pathogenesis
R S Cornman1, Anna K Bennett3, K D Murray1, Jay D Evans2, Christine G Elsik3 and Kate Aronstein1*
Author Affiliations
1 Honey Bee Research Unit, USDA-ARS, Weslaco, TX, 78596, USA
2 Honey Bee Research Laboratory, USDA-ARS, Beltsville, MD, 20705, USA
3 Department of Biology, Georgetown University, Washington, DC, 20057, USA
For all author emails, please log on.
BMC Genomics 2012, 13:285 doi:10.1186/1471-2164-13-285
Published: 29 June 2012
Abstract
Background
We present a comprehensive transcriptome analysis of the fungus Ascosphaera apis, an economically important pathogen of the Western honey bee (Apis mellifera) that causes chalkbrood disease. Our goals were to further annotate the A. apis reference genome and to identify genes that are candidates for being differentially expressed during host infection versus axenic culture.
Results
We compared A. apis transcriptome sequence from mycelia grown on liquid or solid media with that dissected from host-infected tissue. 454 pyrosequencing provided 252 Mb of filtered sequence reads from both culture types that were assembled into 10,087 contigs. Transcript contigs, protein sequences from multiple fungal species, and ab initio gene predictions were included as evidence sources in the Maker gene prediction pipeline, resulting in 6,992 consensus gene models. A phylogeny based on 12 of these protein-coding loci further supported the taxonomic placement of Ascosphaera as sister to the core Onygenales. Several common protein domains were less abundant in A. apis compared with related ascomycete genomes, particularly cytochrome p450 and protein kinase domains. A novel gene family was identified that has expanded in some ascomycete lineages, but not others. We manually annotated genes with homologs in other fungal genomes that have known relevance to fungal virulence and life history. Functional categories of interest included genes involved in mating-type specification, intracellular signal transduction, and stress response. Computational and manual annotations have been made publicly available on the Bee Pests and Pathogens website.
Conclusions
This comprehensive transcriptome analysis substantially enhances our understanding of the A. apis genome and its expression during infection of honey bee larvae. It also provides resources for future molecular studies of chalkbrood disease and ultimately improved disease management.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:40:20.000Z
|
da4c6hwnz6yoovcwfvb3z5czhfmv54lw
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67796",
"uncompressed_offset": 355486383,
"url": "www.biomedcentral.com/1471-2393/12/9",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.biomedcentral.com/1471-2393/12/9"
}
|
cccc_CC-MAIN-2013-20
|
Research article
Factors influencing the use of antenatal care in rural West Sumatra, Indonesia
Yenita Agus1,2 and Shigeko Horiuchi1*
Author Affiliations
1 St. Luke's College of Nursing, Maternal Infant Nursing and Midwifery, 10-1 Akashi-cho, Chuo-ku, Tokyo 104-0044, Japan
2 Syarif Hidayatullah State Islamic University, Faculty of Medicine and Health Science, Jl. Kertamukti Pisangan Ciputat, Jakarta, Indonesia
For all author emails, please log on.
BMC Pregnancy and Childbirth 2012, 12:9 doi:10.1186/1471-2393-12-9
The electronic version of this article is the complete one and can be found online at: http://www.biomedcentral.com/1471-2393/12/9
Received:28 June 2011
Accepted:21 February 2012
Published:21 February 2012
© 2012 Agus and Horiuchi; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Background
Every year, nearly half a million women and girls needlessly die as a result of complications during pregnancy, childbirth or the 6 weeks following delivery. Almost all (99%) of these deaths occur in developing countries. The study aim was to describe the factors related to low visits for antenatal care (ANC) services among pregnant women in Indonesia.
Method
A total of 145 of 200 married women of reproductive age who were pregnant or had experienced birth responded to the questionnaire about their ANC visits. We developed a questionnaire containing 35 items and four sections. Section one and two included the women's socio demographics, section three about basic knowledge of pregnancy and section four contained two subsections about preferences about midwives and preferences about Traditional Birth Attendant (TBA) and the second subsections were traditional beliefs. Data were collected using a convenience sampling strategy during July and August 2010, from 10 villages in the Tanjung Emas. Multiple regression analysis was used for preference for types of providers.
Results
Three-quarter of respondents (77.9%) received ANC more than four times. The other 22.1% received ANC less than four times. 59.4% received ANC visits during pregnancy, which was statistically significant compared to multiparous (p = 0.001). Women who were encouraged by their family to receive ANC had statistically significant higher traditional belief scores compared to those who encouraged themselves (p = 0.003). Preference for TBAs was most strongly affected by traditional beliefs (p < 0.001). On the contrary, preference for midwives was negatively correlated with traditional beliefs (p < 0.001).
Conclusions
Parity was the factor influencing women's receiving less than the recommended four ANC visits during pregnancy. Women who were encouraged by their family to get ANC services had higher traditional beliefs score than women who encouraged themselves. Moreover, traditional beliefs followed by lower income families had the greater influence over preferring TBAs, with the opposite trend for preferring midwives. Increased attention needs to be given to the women; it also very important for exploring women's perceptions about health services that they received.
Keywords:
Pregnant women; Traditional birth attendant and traditional beliefs
Background
According to the United Nations Millennium Development Goals [1], every year, at least half a million women and girls needlessly die as a result of complications during pregnancy, childbirth or the 6 weeks following delivery. Almost all (99%) of these deaths occur in developing countries.
Reproductive health is a priority program for all the Southeast Asia Regional countries, including Indonesia, a developing country, where maternal mortality continues to be a major problem. According to a World Health Organization (WHO) report [2], the Indonesia Maternal Mortality Rate (MMR) continues in the high range of 420/100,000 live births, while coverage of births assisted by skilled providers is still low. The deaths are due mainly to five major causes: hemorrhage; followed by eclampsia, infection (sepsis), abortion complications and obstructed labor [3]. Other issues compounding maternal mortality are lack of knowledge and preparedness about reproductive health in the family, community and health providers. Also there are inadequate numbers of reproductive health specialists to manage complicated pregnancies and deliveries and there is inadequate quality and access to all levels of obstetric care and other reproductive health service.
To prevent unwanted outcomes of pregnancy, antenatal care (ANC) is the most important method for detecting pregnancy problems in the early period [4]. ANC is a critical element for reducing maternal mortality, and for providing pregnant women with a broad range of health promotion and preventive health services [5]. One of the most important functions of ANC is to offer health information and services that can significantly improve the health of women and their infants. ANC is also an opportunity to inform women about the danger signs and symptoms for which immediate assistance should be sought from a health care provider [6]. The numbers of ANC visits vary depending on the country. In Western Europe, North America and many other countries ANC includes 12-16 visits to health care services by the pregnant woman, as well as provider visits to her home [7]. Even so, the WHO and the Indonesia government recommended a minimum of four ANC visits for a woman with a normal pregnancy; that is one visit each in the first and second trimester, and two visits in the third trimester (1-1-2 frequency). Unfortunately, the actual number of visits does not always reach the recommended number of minimum visits, signaling a need for closer examination of causal factors.
The number of ANC visits varies within Indonesia. Surveys indicated that the 1-1-2 frequency was more likely to be completed by urban women (72%) compared to rural women (57%) [8]. Based on WHO statistics [2], only 81% of the women in Indonesia attended the recommended four antenatal visits.
The percentage of pregnant women who received ANC services in Indonesia particularly on the island of Java (1997), receiving at least one visit, was higher (82.3%) compare to islands outside of Java (West Nusa Tenggara, Maluku and Irian Jaya) (65.9%). Half of the women received less than the 1-1-2 frequencies and of those only 60% received the standard care such as measurements of weight, height, blood pressure, weight of womb, tetanus toxin injection and given iron tablets [9].
A review of studies from various countries indicates that the ANC utilization rate is still low due to many factors that need to be examined such as socio-demographic features, knowledge of social support and ANC services [10]. Maternal and child welfare is not only related to health services provided by government and private organizations, it is also related to women as mothers including their education, economic status, culture, environment, and professional development [11]. For example, a study in Xien Khouang Province, Lao PDR [12] showed that significant predictors of ANC utilization were level of education, income, knowledge, attitude, distance to service, availability of public transportation, cost of transportation, and cost of services.
Furthermore, in many developing countries a Traditional Births Attendant (TBA) is still the dominant person, especially in rural areas. Tugiminize in Uganda [13] found that the TBA was popular with pregnant women for a number of reasons such as not being expensive, similar beliefs, tolerant and kind. In addition, some of the reasons for high antenatal visit drop-outs in Maluku, Indonesia were: women perceived the need for the midwife only if there was a problem; women were more comfortable with a TBA because she spent more quality time with them and used a barter system for payment; women feared they could not afford to pay the price of the health center midwives; and women didn't have confidence in the new village midwives because they were often young, unmarried, and inexperienced [14].
Inadequate access and under-utilization of modern health care services were major reasons for poor health in developing countries [15]. To improve planning and provision of ANC in a specific setting it is important first to be able to characterize those women and their families not receiving adequate care. Few studies with that perspective have been conducted in developing countries including Indonesia.
Statement of the problem
ANC is a necessary component of maternal health in order to identify complications and danger signs during pregnancy. Regular ANC visits can provide some benefits for the women such as a strong relationship between women and the health care provider that can result in reducing complications during pregnancy. Women in rural areas in Indonesia tend to receive less ANC visits than urban women. This study was needed to find the key factors involved in why women in rural areas could not or do not go to ANC.
Purpose
To describe the factors related to low utilization of ANC services among pregnant women in a rural area in Indonesia.
Methods
Design of the study
A descriptive design was used for identifying factors of why women do not take advantage of appropriate ANC services.
Setting and samples
Setting
Tanah Datar is a regency (local government unit) of West Sumatera province of Indonesia. The regency is divided into 14 districts and has a total population of 334,000. Each district has a Public Health Centre (PHC) responsible for the sub districts and their village level midwifery clinic. The researcher selected the PHC Tanjung Emas based on convenience sampling. The research data was collected in 10 villages of the 14 villages of Tanjung Emas, during July and August 2010. The researcher invited 14 village midwives in this area and requested their cooperation. Four village midwives refused to participate in this study. Midwives distributed questionnaires after receiving training from the researcher.
Sample
Potential participants were 200 women selected under the following conditions: married women who were pregnant or had experienced birth; living in the village; able to communicate in the Indonesian language; and living with their nuclear family or extended family.
Instrument
The researcher developed a questionnaire containing 35 items, based on the PRECEDE-PROCEED Model (PPM) [16]. It was translated from English into Indonesian as a language familiar to most Indonesians.
This questionnaire contains four sections. Section one and two included women's socio demographics factors such as age, living situation, health insurance status, education, mode of transportation to health care, distance to health care, employment and history of pregnancy.
Section three contained about women's basic knowledge of pregnancy questions. It consisted of eight items (see Table 1) scored as '1' for yes and '0' for no, yielding a maximum of 8 points to a minimum of zero. Each subject's total score was converted into a mean. The highest mean indicated superior knowledge, while the lowest mean was treated as inferior knowledge. For purposes of this study knowledge meant the fact or condition of knowing something with familiarity gained through experience.
Table 1. Basic knowledge of pregnancy questionnaire by number of women responding correctly in rural area of Indonesia, 2010 (N = 145)
Section four contains two subsections. The first is about preferences for ANC (total of 22 items). Preference for TBAs consisted of 12 items and preference for midwives consisted of 10 items. Women were asked to indicate their preference using a 5-point Likert-type scale: 1) strongly disagree, to 5) strongly agree. The higher the points the more they preferred the TBA. Lower points indicated a preference for midwives. Several reverse items were included. To prefer a TBA meant that a woman was more likely go to a TBA for ANC rather than to a trained midwife. The second subsection asked about traditional beliefs related to ANC and consisted of five questions using a 5-point Likert -type scale. The higher score meant that women welcomed traditional beliefs from her community.
Procedure
The researcher and trained assistant researcher distributed the questionnaires to the midwives in the villages who had recruited women meeting the eligibility criteria. The midwives provided them with the informed consent information.
Questionnaires and informed consent forms were collected by the midwives and returned to the assistant researcher.
Data analysis
The questionnaire used in this study had 35 items developed from the PPM and an appropriate sample size of over 140. Non-parametric statistics: means, medians, quartiles and percentages were used for descriptions. Chi square, T-test and F-test were used for comparing knowledge scores, traditional belief scores, and TBAs scores and midwives or nurses scores between subgroups from different demographics and socio economic statuses. Multiple regression analysis was conducted with section four (preference for types of care provider). All tests were two tailed with a p value of < 0.05 considered significant. SPSS ver.17.0 was used for data analysis.
Ethical consideration
The Ethics Review Board of St. Luke's College of Nursing Tokyo, Japan (approval number: 10-023) approved the study. In addition Badan Kesatuan Bangsa, Politik dan Perlindungan Masyarakat West Sumatera Province (N0.B.070/864/WAS-BKPL/2010) and Badan Kesatuan Bangsa, Politik dan Perlindungan Masyarakat Regency of Tanah Datar (No. 070/354/KBPLM/2010) provided approval.
Results
Of the 200 questionnaires distributed, 147 (73.5%) were returned and after questionnaires with incomplete data were excluded, 145 remained for the final analysis. In keeping with the trend of previous studies about what influences antenatal clinic visits, items in the questionnaire are referred to as factors and should not be confused with the term factors resulting from scale development.
Characteristics of women
The average age of the women was 29.7 years (SD = 5.6). The majority of the sample was age 21 to 34 (75.9%) and 22.1% of women 35 or older. All of the women were Muslim. Most of the women lived with their husbands (94.5%). Sixty-six percent of the women had more than two children and 31% were experiencing their first pregnancy. Living in an extended family were 52.4% and 47.6% lived in a nuclear family. A majority of the women (65.5%) finished secondary education and only 34.5% finished basic education. However, the majority of the women (74.5%8) did not work, and only 11% worked in the farming sector.
More than half of the women (55.9%) used public transportation for ANC visits. The average distance from their home to hospital was 1,570 m (SD = 2,009, M = 1,000). The number of women who were encouraged by their family to receive ANC (44.8%, n = 65) was almost same compared to those who encouraged themselves (55.2%, n = 80). Only 13.1% of respondent used ASKESKIN (health insurance for poor families) as their usual health care payment and the majority were self pay (86.9%). Midwives assisted 65.5% of the women while TBAs assisted only 3.4%. The government hospital was chosen for delivery by (44.1%), followed by village midwives practice (29.0%), and private hospitals (18.6%). There were no statistically significant differences comparing women's socio-demographic.
Scores of knowledge, traditional belief, preference for TBAs and preference for midwives
The questionnaire used in this research had four sections; (1) knowledge, (2) traditional beliefs, (3) preference for TBAs and (4) preference for midwives. The average mean score of basic knowledge was 7.1 out of 8 (SD = 8.8) range of 5-8. Traditional belief mean score was 10.31 out of 25 (SD = 2.61) range 5-21. Preference for TBAs mean score was 25.52 out 60 (SD = 7.25) with a range 12 to 50. Preference for midwives mean score was 36.84 out 50 (SD = 4.45) with a range 14 to 46.
Basic knowledge of pregnancy
The majority of subjects scored highly in the knowledge section (Table 1). Most of the subjects gave the correct answer to items on basic health knowledge. In seven out of eight items, women answering correctly was over 80%: "ANC is important", "eating iron containing food prevents anemia, "pregnant women need calcium", "pregnant women must have their blood pressure checked", "pregnant women need to go to the hospital if they have high blood pressure" and "bleeding is a normal sign during pregnancy (false)". However, for the item "headache is normal sign during pregnancy (false)", only 62% answered correctly.
Distribution of ANC visit during pregnancy
The Indonesia government recommends ANC four times during pregnancy. Nearly 80% (77.9%) of respondents received ANC more than four times. The other 22.1% received ANC less than four times.
The researcher divided the sample into two groups for analysis: women who had less than four ANC visits and women who had four or more ANC visits. Women aged 21 to 34 were more likely to receive less than four ANC visit (87.5%) compared to those who were over 35 years old. As a group primiparous received less than four ANC visits, which was statistically significant compared to multiparous (p = 0.001). Women who finished basic education tended to receive fewer than four ANC visits compared to women who finished secondary education (p = 0.07). Women who accessed ANC services by walking were more likely receive less than four ANC visits compared to women who used transportation (p = 0.069). See Table 2 for specific details.
Table 2. Distribution of ANC visits during pregnancy by socio-demographic characteristics in rural area of Indonesia, 2010 (N = 145)
Factors related to the family income
The average monthly family income was Rupiah (Rp.) 831,034 (SD = 587,316) (1 USD = Rp. 9,070). This was lower than the minimum wage of West Sumatra (Rp. 1,055,000).
Among the three factors which were significantly different we found that: 1) The basic education group had lower incomes than the secondary education group (M = Rp. 591,000, SD = 343,99; M = Rp.957,368, SD = 679,954, respectively, t = 3.5, p = < 0.001), 2) Women who walked to receive ANC had lower income compared to the other group (M = Rp.703,125, SD = 486,718, M = Rp.932,098, SD = 678,753, respectively, t = 2.27 p = 0.024),3) Not surprisingly, women who used ASKESKIN as their usual source of payment revealed significantly lower incomes compare to women who were self pay (M = Rp.407,894, SD = 235,267; M = Rp.894,841, SD = 624,462, respectively, t = 3.35, p = 0.001).
Factors related to preference for TBA
Table 3 shows the scores of preference for TBA which were analyzed between women's choice about delivery settings. It was found that women going to TBA ("yes" group) (n = 32) had a significantly higher mean score than the "never" group (M = 31.34, SD = 7.49; M = 23.87, SD = 6.30, respectively, t = -5.66, p < 0.000). Women who chose the government hospital to deliver had a significantly higher scores than women who delivered at the village midwives practice and private hospital (F = 7.80, p = 0.001). In addition, women who delivered with the assistance of TBA, had a statistically significant higher score compared to the others (t = 4.61, p = 0.011).
Table 3. Factors related to preference for TBA in rural area of Indonesia, 2010 (N = 145)
Encouragement to receive antenatal care
What factors were associated with encouraging women to receive antenatal care? Data were divided into two groups based on who encouraged the woman to seek ANC services: self or family. The scores on the factors, knowledge, traditional belief, preference for TBAs and preference for midwives, were compared between women who encouraged themselves and those who were encouraged by their family. Knowledge and preference for TBA was not significant. Interestingly, women who were encouraged by their family to receive ANC had statistically significant higher traditional belief scores compared to those who encouraged themselves (M = 9.13, SD = 2.40), (t = 3.03, p = 0.003). On other hand, women who encouraged themselves to go to ANC had statistically significant higher score in preference for midwives compared to those who were encouraged by their family (M = 37.62 SD = 3.96; M = 35.89, SD = 4.85, t = 2.36, p = 0.019).
Multiple regression analysis
The results of multiple regression analysis are presented in Table 4. Variables such as traditional belief, distance to hospital and family income were significantly related to a preference for midwives. Traditional belief made the greatest contribution (ß = -0.492, t = 7.01, p < 0.001). Women's age and knowledge were excluded.
Table 4. Multiple regression analysis of preferences for midwives and preferences for TBAs in rural area of Indonesia, 2010 (N = 145)
Three items associated with preference for TBAs were traditional belief, women's age and family income with traditional belief making the greatest contribution (ß = 0.432, t = 5.93, p < 0.001). This trend was the same as preference for midwives. Regarding the preference for TBAs, two items knowledge and distance to hospital were excluded.
The results showed that traditional belief and family income were influential for women who chose both preference for TBAs and preference for midwives.
Discussion
Antenatal care visit
The results showed that 77.9% women in the Tanjung Emas area received more than the recommended minimum number of pregnancy ANC visits, which was close to the national average of 81% [2]. Compared to the Indonesia Demographics Health Survey [17], 75.5% of women in rural areas received ANC more than four times, whereas in urban areas it was 89.9%. Our study showed the same trend as the national survey. Other studies found a somewhat different trend. While, Doctor [18] reported that in Nigeria urban women also attended more ANC visits (82%), than rural women (45%) Pallikadavath [19] found that in India about 60% of rural women did not receive any ANC checkups during their last pregnancy.
Our results indicated that the main predictor of receiving less than four ANC visits was parity. However, these results are contrary to previous studies. Women with two or more children receiving antenatal care were 20-40%; lower compared to women with one child; [19] likewise Trinch [20] found that women with three or more children utilized less ANC. Similarly, Doctor [18] also reported that women who had given birth to one child had more ANC attendance than women with six or more children. However, high parity was also found to be significantly higher in women who did not attend ANC [21].
One possible explanation for the low ANC attendance among primiparous was a lack of understanding concerning the importance of ANC during pregnancy. This study examined attendance only by primiparous or multiparous rather than by specific number of children.
An interesting finding was mothers with a low education level were more likely to receive less than four ANC visits, although it was not statistically significant after adjusting for other factors. One reason was a small sample size. Taguchi's [22] study pointed out that higher education levels of women were associated with greater use of antenatal care in Indonesia Similarly, women's education consistently showed a positive association with antenatal care check-ups through visits to a health facility in all the states in India [19].
Basic knowledge of pregnancy
Many respondents misunderstood the falsely worded item that "headache is normal sign during pregnancy". Likewise, in China [23] most women had knowledge about maternal health care but some items they missed. For the item "should pregnant women often check blood pressure", the majority answered correctly. Koblinsky [24] reported that in Bolivia, Indonesia and Pakistan the knowledge of danger signs was generally low; only 2-7% of women knew that eclampsia (convulsions) was a complication. In Gambia only 24.6% pregnant women were aware that hypertension and, headaches were a danger signs during pregnancy [25]. Only 7.9% women in India received information regarding danger signs during pregnancy and 8.7% in Tanzania [19,26].
In any ANC visit women should be informed of the signs of pregnancy complication. Only 19.6% women who completed primary school and 41.7% women who completed secondary school received information about signs of pregnancy in Indonesia [16]. Education is considered to be one reason influencing adequate ANC services among women in this area.
It is clearly a crucial problem, because the second cause of maternal death in Indonesia is eclampsia. This means it is critical to provide health education programs about the danger signs during pregnancy. Education is believed to be the most powerful influencing factor to increasing women's knowledge of a healthy pregnancy. Our study suggests that developing an education plan about danger signs is greatly needed.
Where did women prefer to seek health care provider during pregnancy?
Our data indicated that women who preferred a TBA chose a TBA to check her pregnancy and they chose the government hospital as place of delivery. Titaley [27], reported that the role of the TBA was considered essential especially in remotes areas, and indicates that the women in developing countries especially in rural areas preferred TBA to check their pregnancy. Women were only seeking a professional health care provider if they had some kind of complication during their delivery.
Our findings showed that traditional beliefs were positively correlated with preferences of TBAs. Similarly, Koblinsky's [24] study found that preference for TBAs indicates tradition, because of TBA's interpersonal skill, special care, and respect for local customs. Likewise, the study by Titaley [27] in three districts of West Java, Indonesia using a purposive sampling method, focus group discussion and in-depth interviews as data collection found that in some communities, members perceived village midwives as too young and inexperienced, whereas TBAs were more mature, patient and caring compared with the midwife.
As expected, there was a strong association between family income and preference of TBAs and preference for midwives. This finding supports several other studies that confirmed family income is one of the factors influencing whether women decide to seek ANC [28]. In Indonesia pregnant women with higher family incomes had the highest percentage of adequate ANC utilization [29]. Cost was one of the main reasons women stated for using the services of TBA [27]. Poor women are most at risk of maternal mortality due to their lack of access to skilled care.
These findings indicate that women who held traditional beliefs need coaching in decision making about how to manage a healthy pregnancy. Health professionals should understand and respect the women's preferences then develop an educational plan during pre-pregnancy. This is important especially for primiparous and young women.
Traditional beliefs and encouraging factors related to ANC visit
Traditionally, there has been discrimination towards women in decision-making, access to resources such as food, education and health care [30]. Many traditional communities across the country restrict a woman's food intake. Some women especially in rural areas agreed that following the traditional belief was necessary.
Women who were encouraged by their family to seek ANC had statistically significant higher traditional belief scores. This study supports Aikawa's [31] findings, where the majority of pregnancy women were encouraged and supported by their husband or their family members during pregnancy.
In Egypt, Indonesia, and Pakistan, beliefs include associating eclamptic convulsions with supernatural causes (e.g., spirit possession), requiring exorcism by faith healers rather than medical treatment [24].
Strong beliefs about the role of chance in determining the health of an infant had discouraged pregnant women from undergoing prenatal testing in Indonesia. Pregnant women admitted that they took their family advice without question because they trusted them and they wanted their family to be happy with them [32].
This study found no relationship between fewer ANC visits compared to traditional beliefs. It is possible that the five items about traditional beliefs were too few and additional items would increase the reliability and validity of questionnaire. There may also have been a selection bias because the subjects were recruited by village midwives and they tended to recruit women who came to their clinic. To explore information about the traditional belief context is more appropriate for further investigation through in-depth interviews. Health care providers should know the traditional beliefs of the women for whom they provide care. This will enable health care providers to have a more comprehensive understanding of the women's world view and they can provide appropriate decision- making and education. Encouragingly, better promotion of improving women's health will be an effective route to safe motherhood.
Limitations and future plan
Although this study was limited by a small sample size, a researcher-developed questionnaire with minimal reliability and validity testing and selection bias, the findings still indicate some areas for attention. On the other hand, the ambiguous question whether headache is a normal sign during pregnancy needs to be a more clear statement if it is to be used for the next study. Based on our findings, psychometric development of the questionnaire and increasing the sample size are needed to generalize findings. Previous research has documented the need for increasing awareness of women's health especially increasing the number of ANC visits during pregnancy, intervention such as health education and health promotion. What this research contributes is a beginning understanding of determinants of Indonesian women's decision making so that health education can be more effective.
Conclusions
In conclusion, the results of this study confirmed that parity was the main factor influencing women who received less than four ANC during pregnancy. An increased proportion attending ANC in pregnancy and an increased number of visits especially for primiparous women is important. Further, our study found that women who were encouraged by their family had higher traditional beliefs score. The results also indicated that traditional beliefs followed by family income dictated choice of care-giver. These findings were very important for understanding and exploring women's perceptions about the health services that they received.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
YA and SH were responsible for the study conception and design and the drafting of the manuscript. YA performed the data collection and YA and SH performed the data analysis. Both authors read and approved the final manuscript for submission.
Acknowledgements
We are very thankful to the sub district health centre of Tanjung Emas, West Sumatra for allowing us to conduct this study. We are also indebted to the village midwives of the Public Health Community for helping us to collect the baseline data. Finally, we would extend a special thanks to all the respondents for their useful information and cooperation. We hope this study will make a positive impact on their lives in the future. This work was supported by St. Luke's College of Nursing, Tokyo and Syarif Hidayatullah State Islamic University, Jakarta. We are also grateful to the College for its generous financial support and scholarly guidance. Finally, we would like to thank Dr. Sarah E. Porter for her editorial assistance.
References
1. United Nations 2009: The Millennium Development Goals Report. [http://www.un.org/millenniumgoals] webcite
2. World Health Statistics [http://www.who.int/whosis/whostat/2008/en/index.html] webcite
3. UNFPA Indonesia 2011: (2nd). Reproductive and maternal health. [http://indonesia.unfpa.org/mmr.htm] webcite
4. Nuraini E, Parker E: Improving knowledge of ANC among pregnancy women in field trial in Central Java Indonesia. [http://http//www:cababtratspku.org/google/abstract/asp/ac] webcite
5. USAID 2007: Focused antenatal care: providing integrated, individualized care during pregnancy. [http://www.accesstohealth.org/toolres/pdfs/ACCESStechbrief_FANC.pdf] webcite
6. WHO & UNICEF: Antenatal Care in Developing Countries: Promises, Achievement and Missed Opportunities: An Analysis of Trends, Levels, and Differentials. 1990-2001. Geneva: WHO & UNICEF; 2003.
7. WHO 2003: What is the efficacy/effectiveness of antenatal care and the financial and organizational implications? (WHO Europe). [http://www.euro.who.int/__data/assets/pdf_file/0007/74662/E82996.pdf] webcite
8. Ministry of Health: Indonesia Reproductive Health Profile. [http:/ / www.searo.who.int/ LinkFiles/ Reporductive_Health_Profile_RHP-Ind onesia.pdf] webcite
The World Health Organization; 2003.
9. Ministry of Health: Indonesia Health Profile; 1997. [http://http//www.depkes.go.id/ind/data/profile/index,htm] webcite
10. Simkhada B, Teijlingen E, Porter M, Simkhada P: Factors affecting the utilization of antenatal care in developing countries: systematic review of the literature.
J Adv Nurs 2007, 61:244-260.
11. Hoesein AA: Empowering women in autonomy and decentralization processes: an Indonesian experience. [http://www.indonesiamission-ny.org/issuebaru/Mission/empwr/paper_abdulazis] webcite
12. Ye Y, Yoshida Y, Rashid OR, Sakamoto J: Factors affecting the utilization of antenatal care services among women in Kham District, Xieng Khouang Province, Lao PDR.
Nagoya J Med Sci 2010, 72:23-33. PubMed Abstract
13. Tuguminize L: The role of TBAs in midwifery care: the Ugandan experience.
Br J Midwifery 2005, 14:276-278.
14. Bongiovanni A: Health Project IV Workshop September 23-27; 1996: Jakarta, Indonesia. [http://pdf.usaid.gov/pdf_docs/PNABZ677.pdf] webcite
15. Amin R, Chowdhury SA, Kamal GM, Chowdhury J: Community health services and health care utilization in rural Bangladesh.
Soc Sci Med 1989, 29:1343-1349. PubMed Abstract | Publisher Full Text
16. Green L, Kreuter M: Health program planning: An educational and ecological approach. 4th edition. New York: McGraw-Hill; 2005:7-18.
17. Ministry of Health: Indonesia Demographics Health Survey. [http:/ / www.google.co.jp/ search?hl=ja&biw=1004&bih=582&q=Ind onesia+demographics+health+survey&a q=f&aqi=&aql=&oq=] webcite
18. Doctor HV: Intergenerational differences in antenatal care and supervised deliveries in Nigeria.
Health Place 2010.
doi:10.1016/j.healthplace.2010.12.003
19. Pallikadavath S, Foss M, Stones RW: Antenatal care: provision and inequality in rural North India.
Soc Sci Med 2004, 59:1147-1158. PubMed Abstract | Publisher Full Text
20. Trinch TTL, Dibley JM, Byles J: Determinants of antenatal care utilization in three rural areas of Vietnam.
Public Health Nurs 2007, 24:300-310. PubMed Abstract | Publisher Full Text
21. Ali A, Osman MM, Abbaker OA, Adam I: Use of antenatal care services in Kassala, Eastern Sudan.
BMC Pregnancy & Childbirth 2010, 10:67. PubMed Abstract | BioMed Central Full Text
22. Taguchi N, Kawabata N, Maekawa M, Maruo T, Aditiawarman Dewata L: Influence of socioeconomic background and maternal care programmes on maternal mortality in Surabaya, Indonesia.
Trop Med Int Health 2003, 8(9):847-852. PubMed Abstract | Publisher Full Text
23. Zhao Q, Kulane A, Gao Y, Xu B: Knowledge and attitude on maternal health care among rural-to-urban migrant women in Shanghai, China.
BMC Wom Health 2009, 9:1-8. BioMed Central Full Text
24. Koblinsky M, Conroy C, Kureshy M, Statnton EL, Jessop S: Issues in programming for safe motherhood. [http://pdf.usaid.gov/pdf_docs/PNACK513.pdf] webcite
25. Anya ES, Hydara A, Jaiteh ESL: Antenatal care in The Gambia: missed opportunity for information, education and communication.
BMC Pregnancy and Childbirth 2008, 8:9. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
26. Pembe AB, Carlstedt A, Urassa DP, Lindmark G, Nystrom L, Darj E: Quality of antenatal care in Rural Tanzania: counseling on pregnancy danger signs.
BMC Pregnancy and Childbirth 2010, 10:35. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
27. Titaley RC, Hunter LC, Dibley JM, Heywood P: Why do some women prefer traditional birth attendants and home delivery?: A qualitative study on delivery care services in West Java Province, Indonesia.
BMC Pregnancy and Childbirth 2010, 10:43. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text
28. Jansen I: Decision making in childbirth: the influence of traditional structures in a Ghanian village.
Int Nurs Rev 2006, 53:41-46. PubMed Abstract | Publisher Full Text
29. Erlindawati , Chompikul J, Isaranuruq S: Factors related to the utilization of antenatal care services among pregnant women at health centers in Aceh Besar District, Nanggroe Aceh Darussalam Province, Indonesia.
J Public Health Dev 2008, 6:99-108.
30. Bheenaveni R: Beliefs and practice in Women Health. [http://promote-healthylife.Info/beliefs-and-practiced-in-women-health.php] webcite
31. Aikawa R, Jimba M, Nguen KC, Zhao Y, Binns CW, Lee MK: Why do adult women in Vietnam take iron tablets?
BMC Publ Health 2006, 6:144. BioMed Central Full Text
32. Wulandari LPL, Whelan KA: Beliefs, attitudes and behavior of pregnant women in Bali.
Midwifery 2010.
doi:10.1016/j.midw.2010.09.005
Pre-publication history
The pre-publication history for this paper can be accessed here:
http://www.biomedcentral.com/1471-2393/12/9/prepub
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:39:25.000Z
|
huvg6gnhc3s5lo75pq4exc5pvlmtdnd6
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67802",
"uncompressed_offset": 379866082,
"url": "www.ccsenet.org/journal/index.php/elt/article/view/15939/0",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.ccsenet.org/journal/index.php/elt/article/view/15939/0"
}
|
cccc_CC-MAIN-2013-20
|
A Study on EFL Students’ Use of E-Learning Programs for Learning English —Taking a Taiwanese University as an Example
Darcy Soong
Abstract
With its characteristics of repeated practice and easy review, e-Learning programs have been hailed as an effective way for learning foreign languages nowadays. Supported by ICT (Information & Communication Technology), e-Learning offers students self-paced learning whereby learners can control their schedules and it is presumed to be a round-the-clock teaching aid to EFL students. As many scholars anticipate that e-Learning will become a future trend in EFL, more and more higher education institutions are investing money on English e-Learning programs in the hope that students’ English proficiency will be further upgraded by using the ubiquitous system. After investigating students’ frequency of using English e-learning programs in a local university in Taipei, the author argues in this paper that e-Learning programs do not benefit EFL students to the degree as we anticipated given the fact that cold technology and machines can never successfully become a “facilitator” that should be played by a teacher. (Harmer, 2000) After all, technology can never take the place of the teacher, who is thought to be the most crucial element of any teaching activities.
Full Text: PDF DOI: 10.5539/elt.v5n4p87
This work is licensed under a Creative Commons Attribution 3.0 License.
English Language Teaching ISSN 1916-4742 (Print) ISSN 1916-4750 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:12:10.000Z
|
2hq5tjaqs5hzqfk2q4c7d3vvzckc4wew
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67803",
"uncompressed_offset": 379871330,
"url": "www.ccsenet.org/journal/index.php/ies/article/view/21172/0",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.ccsenet.org/journal/index.php/ies/article/view/21172/0"
}
|
cccc_CC-MAIN-2013-20
|
The Influence of RET’s on Elementary and Secondary Grade Teachers’ Views of Scientific Inquiry
Sibel Bahbah, Barry W. Golden, Katrina Roseler, Patrick Enderle, Yavuz Saka, Sherry A. Southerland
Abstract
This study explores in-service elementary and secondary science teachers’ conceptions of the Nature of Scientific Inquiry and the influence of participation in two different Research Experience for Teacher (RET) programs had on these conceptions. Participant teachers attended one of two six week RET programs in which they worked with scientists to engage in scientific inquiry. Before and after the RETs, teachers completed the Views of Scientific Inquiry (VOSI) questionnaire. Teachers’ answers were analyzed to determine the degree of sophistication of their understanding of five facets of scientific inquiry. Both elementary and secondary teacher participants showed improvement in their understanding of nature of scientific inquiry as a result of program participation, and both programs were successful in supporting the development of inquiry conceptions, although secondary science teachers started and finished the RET’s with a more sophisticated understandings of scientific inquiry. Areas of improvement for elementary teachers included the role of questions in science and the role subjectivity and creativity play in the processes of science, and for secondary teachers growth was seen in the role of questions, the relationship of data and evidence, the distinction of experiments and other means of investigations, and the varied methods of science. Implications of these results are discussed.
Full Text: PDF DOI: 10.5539/ies.v6n1p117
This work is licensed under a Creative Commons Attribution 3.0 License.
International Education Studies ISSN 1913-9020 (Print), ISSN 1913-9039 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:14:33.000Z
|
xfyyqt77i2ha3vhnb4dzare3tsvd7wsw
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67809",
"uncompressed_offset": 441755187,
"url": "www.eea.europa.eu/events/the-xii-international-symposium-on",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.eea.europa.eu/events/the-xii-international-symposium-on"
}
|
cccc_CC-MAIN-2013-20
|
Personal tools
Sign up now!
Get notifications on new reports and products. Currently we have 55595 subscribers. Frequency: 3-4 emails / month.
Follow us
Twitter
Facebook
YouTube channel
RSS Feeds
Notifications archive
Write to us
For the public:
For media and journalists:
Contact EEA staff
Contact the web team
FAQ
Call us
Reception:
Phone: (+45) 33 36 71 00
Fax: (+45) 33 36 71 99
next
previous
items
Skip to content. | Skip to navigation
Sound and independent information
on the environment
You are here: Home / Environmental events calendar / The XII International Symposium on Environmental Geotechnology, Energy and Global Sustainable Development
The XII International Symposium on Environmental Geotechnology, Energy and Global Sustainable Development
Get ready to be pleasantly surprised! The Symposium will be unlike any symposium you have ever attended. The goal is to develop concrete strategies through participant interaction and lively discussion that promotes global sustainability.
Vertical listing
When Jun 27, 2012 to
Jun 29, 2012
Where
Contact Name
Add event to calendar vCal
iCal
More information about this event…
European Environment Agency (EEA)
Kongens Nytorv 6
1050 Copenhagen K
Denmark
Phone: +45 3336 7100
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:04:03.000Z
|
gy4qvy5zxut3gp6sf7oulkbzmlak6y3x
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67812",
"uncompressed_offset": 454303598,
"url": "www.familysearch.org/learn/wiki/en/Kansas_City_Missouri_Family_History_Center",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/Kansas_City_Missouri_Family_History_Center"
}
|
cccc_CC-MAIN-2013-20
|
Kansas City Missouri Family History CenterEdit This Page
From FamilySearch Wiki
This article describes the services and resources available at a Family History Center, a branch facility of the Family History Library.
Serving southern Jackson and Cass Counties, Missouri, eastern Johnson County, Kansas, and other areas along the State Line corridor south of midtown Kansas City.
Contents
Center Contacts and Hours
Location & Map:
1. 13025 Wornall Rd
Kansas City, MO 64145
2. Directions: From southern loop of I-435, take Wornall exit south to Blue Ridge Road. Center is located inside the church building on the NE corner of Wornall and Blue Ridge Roads. Enter the Family History Center from the parking lot on the north side of the building.
Phone: 816-941-7389
Emergency Phone: 816-942-8117
Open Hours: Tuesday & Wednesday 6-9pm; Thursday 10am-1pm & 6-9pm; 2nd, 3rd & 4th Saturday of month 10am-2pm
Holiday Schedule: Closed the week of Thanksgiving, the last 2 weeks in December through New Year's Day, the week preceeding Easter, and the 4th of July.
Calendar and Events
Staff Training Meetings
Center Resources
Collections
Databases and Software
• FHC Portal This center has access to the Family History Center Portal page which gives free access in the center to premium family history software and websites that generally charge for subscriptions, such as Ancestry.com (world membership) and others.
Hardware and Equipment
• 6 Computers with internet access
• Printers ($.10/copy for each page printed)
• Microfilm and microfische readers and printer ($.25/copy for each printed page)
• Suggest bringing a digital camera to photograph film images as an alterntive to printing.
Center Services
Staff Research Specialties
By appointment for consultation on research in Germany, Italy and British Isles
Volunteer at the Center
If you have a research specialty and are available for occasional consults with family history center patrons, please volunteer by calling 816-942-8117. Thank you.
For help and guidelines for editing this page, see the Adding details to a FHC page article.
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 11 April 2013, at 20:11.
• This page has been accessed 361 times.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:28:30.000Z
|
4eus5vbvxbqh2gzt5j6fdqvfuolor5iv
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67813",
"uncompressed_offset": 454326717,
"url": "www.familysearch.org/learn/wiki/en/index.php?diff=prev&oldid=1243268&title=Eagle_Mountain_Utah_Family_History_Center",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/index.php?title=Eagle_Mountain_Utah_Family_History_Center&diff=prev&oldid=1243268"
}
|
cccc_CC-MAIN-2013-20
|
Eagle Mountain Utah Family History Center
From FamilySearch Wiki
(Difference between revisions)
Line 19: Line 19:
*'''Thurs''': 6pm - 9pm
*'''Thurs''': 6pm - 9pm
*'''Sat''': 9am - 12pm
*'''Sat''': 9am - 12pm
*'''Sun: '''By Appointment -- 801-789-8833
+
*'''Sun: '''By Appointment -- 801-789-8833
*'''Sister Session:''' Tue, 12pm - 2pm (by Apppmt -- 801-376-0962)<br>
*'''Sister Session:''' Tue, 12pm - 2pm (by Apppmt -- 801-376-0962)<br>
Revision as of 21:58, 12 February 2013
This article describes the services and resources available at a Family History Center, a branch facility of the Family History Library.
Contents
Center Contacts and Hours
Location & Map:
Phone: 801-789-7089
E-mail: gpford5@yahoo.com (Director)
Hours Open
• Tues: 9am - 12 pm, 6pm - 9pm
• Wed: 10am - 1pm, 6pm - 9pm
• Thurs: 6pm - 9pm
• Sat: 9am - 12pm
• Sun: By Appointment -- 801-789-8833
• Sister Session: Tue, 12pm - 2pm (by Apppmt -- 801-376-0962)
Holiday Schedule: Closed holidays
Calendar and Events
Upcoming Events
Class Schedule
Staff Training Meetings
Center Resources
Collections
Databases and Software
• FHC Portal: This center has access to the Family History Center Portal page which gives free access in the center to premium family history software and websites that generally charge for subscriptions.
Hardware and Equipment
• 8 desktop computers and laptop positions (cable provided).
• Full Church portal access on the 8 desktop computers.
• Two film readers.
Center Services
Staff Research Specialties
(Include sections for any other services your center provides. Add additional sections for those services. See the Mesa and Logan FHC pages for examples.)
Resources in the Local Area
(This section is to highlight other resources in your area that will be helpful for individuals doing research there in your location, if there are any, such as government offices, historical societies, etc.)
Links
(Include links to other websites of interest to those who visit your center such as links to the city, county and state wiki pages where your center is located.)
Volunteer at the Center
(Include information here about the volunteers you are looking for.)
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:22:06.000Z
|
4jj4rh33erumiaodwpf22ux5vfsxjzkb
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67814",
"uncompressed_offset": 454339318,
"url": "www.familysearch.org/learn/wiki/en/index.php?action=history&title=Eureka_California_1st_Ward_Family_History_Center",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/index.php?title=Eureka_California_1st_Ward_Family_History_Center&action=history"
}
|
cccc_CC-MAIN-2013-20
|
Revision history of "Eureka California 1st Ward Family History Center"
From FamilySearch Wiki
Diff selection: Mark the radio boxes of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:59:56.000Z
|
choacufsuqm3azwsbfwxuscyhpnx3et7
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67815",
"uncompressed_offset": 454350606,
"url": "www.familysearch.org/learn/wiki/en/index.php?oldid=475692&title=FamilySearch_Wiki%3AWikiProjects_Seeking_Contributors",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/index.php?title=FamilySearch_Wiki:WikiProjects_Seeking_Contributors&oldid=475692"
}
|
cccc_CC-MAIN-2013-20
|
FamilySearch Wiki:WikiProjects Seeking ContributorsEdit This Page
From FamilySearch Wiki
Revision as of 19:50, 15 November 2010 by JensenFA (Talk | contribs)
This is a list of the WikiProject that are currently active and working on content. The projects are always seeking contributors, so feel free to join a group and have fun!
Contents
Creating New Projects
If you would like to create a new project, following the naming conventions for WikiProjects to help make your project easy to find:
1. The name of the project should begin with the word "FamilySearch Wiki" and followed by a colon :
2. After the colon type the word "WikiProject"
3. The type the name of the project. Example: FamilySearch Wiki:WikiProject Utah
4. Be sure to add the new project to the list below, under the subject heading that is related to the new project:
For more details about naming new WikiProject pages, see FamilySearch Wiki:Naming Conventions for Project Pages
FamilySearch Records Project
Historical Records Wiki Pages
FamilySearch Records -- add content to articles describing collections on FamilySearch Historical Records
FamilySearch Indexing Projects
See xxx for more details
United States Projects
Idaho
Idaho -- adding content to the county pages of Idaho
Indians of North America Project
Indians of North America
Maryland Project
WikiProject Maryland News and Events needs volunteers to find genealogical news and events relating to Maryland and link to them from the News and Events section of the Maryland Portal.
Southern US Rural Records Project
US Vital Records Project
Europe Projects
Sweden Project
See the Sweden project page for more details.
Ireland Project
See the Ireland Court Records project page for more details.
England Content Project
The England Barn Raising project has launched! Tasks await English experts, wiki experts, and volunteers willing to help with routine editing. Anyone willing to help can sign up now.
Danish Articles Revision Project
Denmark has several individual projects that need volunteers to help with expanding and improving content about Danish research.
Improving Your Wiki User Page Project
The Professional Genealogist User Page Project
The Professional Genealogists wiki project will help professional genealogical researchers market their services for free on their user pages.
Wiki Content Improvement Projects
PERSI Linking Project
Link wiki articles mentioning the Periodical Source Index to the main PERSI article.
BYU Books Archive Linking Project
WikiProject Linking to Books in the BYU Family History Archives needs volunteers to link wiki pages to digitized county and state histories on the BYU Family History Archives site.
Julian and Gregorian Calendar Project
The Julian and Gregorian calendars page is an article with very little content. Work with others or by yourself to improve the information on this page.
The Barbour Collection Project
The Barbour Collection is a small article that needs lots of improvement! Work with others or by yourself to improve the content on this page.
Wiki Development Projects
Portals to un-portals
Portals to un-portal pages All portal pages on the wiki need to be converted to un-portal pages. Questions can be directed to Laralee
Copy Old FamilySearch Content
Copying Research Guidance and Help Content from FamilySearch.org into the Wiki.
FamilySearch Topic Taxonomy Project
See xxx for more details.
FamilySearch Place Standards Project
Integrating Place Standards Database with FamilySearch Wiki
WikiProjects for Tier 2 and 3 Support
The Vision of Wiki Support Project
WikiProject The Vision of Wiki Support - this project will lay the foundation for understanding and operating within the vision of wiki support from both the tier two and tier three perspectives. In addition to tier 2 and 3 support personnel, anyone interested in wiki maintenance is invited to participate in this project.
Wiki Tier 2 Support Project
WikiProject Tier 2 Support - this project will identify all the sub-projects needed to support the wiki on the tier two level. In addition to tier 2 and 3 support personnel, anyone interested in wiki maintenance is invited to participate in this project.
Wiki Tier 3 Support Project
WikiProject Tier 3 Support - this project will identify all the sub-projects needed to support the wiki on the tier three level. In addition to tier 2 and 3 support personnel, anyone interested in wiki maintenance is invited to participate in this project.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:11:25.000Z
|
wpfx7rsdrbjith5msz7avjatxj3i3nyg
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67816",
"uncompressed_offset": 454364098,
"url": "www.familysearch.org/learn/wiki/en/index.php?redirect=no&title=North_Dakota_Digital_Collections",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.familysearch.org/learn/wiki/en/index.php?title=North_Dakota_Digital_Collections&redirect=no"
}
|
cccc_CC-MAIN-2013-20
|
North Dakota Digital CollectionsEdit This Page
From FamilySearch Wiki
Redirect page
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 5 March 2013, at 16:49.
• This page has been accessed 37 times.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:19:30.000Z
|
ys3ysqiygwpjh4jmwonegyzugjlatpap
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67817",
"uncompressed_offset": 476663083,
"url": "www.ga.gov.au/cedda/publications/794?p=1&s=TITLE",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.ga.gov.au/cedda/publications/794?p=1&s=TITLE"
}
|
cccc_CC-MAIN-2013-20
|
What is a Cyclone? - Publications
See all Geoscience Australia Publications
Title ↑ Authors Published Released
Community risk in Gladstone: a multi-hazard risk assessment Granger, K.Michael-Leiba, M.O. 2001 12/Nov/2003
Earthquake risk in Newcastle and Lake Macquarie Jones, T.Dhu, T.Fulford, G.Corby, N.Sinadinovski, C. 2002 30/Sep/2002
Natural Hazards in Australia: Identifying Risk Analysis Requirements Middelmann, M.H. 2007 21/Dec/2007
Natural hazard risk in Perth, Western Australia - Cities Project Perth Report - 2005 Jones, T.Middelmann, M.H.Corby, N. 2005 28/Oct/2009
Natural hazards and the risks they pose to Southeast Queensland Granger, K.Hayne, M.Jones, T.Middelmann, M.H.Leiba, M.Scott, G. 2001 17/Nov/2009
(5 products total)
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:13:07.000Z
|
i7lnv6atc6q6277ricj64e67ryp3ingb
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67825",
"uncompressed_offset": 506656929,
"url": "www.hindawi.com/journals/jsc/2012/917346/abs/",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.hindawi.com/journals/jsc/2012/917346/abs/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
Journal of Skin Cancer
Volume 2012 (2012), Article ID 917346, 8 pages
doi:10.1155/2012/917346
Clinical Study
Epidemiological Profile of Patients with Cutaneous Melanoma in a Region of Southern Brazil
Universidade Comunitária da Região de Chapecó-Unochapecó, Avenida Senador Atílio Fontana, 591-E. Efapi, Caixa Postal 1141 89809-000, Chapecó, SC, Brazil
Received 21 September 2011; Revised 20 December 2011; Accepted 29 December 2011
Academic Editor: Mohammed Kashani-Sabet
Copyright © 2012 Marcelo Moreno et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
Cutaneous melanoma (CM) is responsible for 75% of deaths from malignant skin cancer. The incidence of CM in the southern region of Brazil, particularly in the western region of Santa Catarina, is possibly higher than estimated. In this study, the clinical and epidemiological profile of patients with CM treated in the western region of Santa Catarina was examined. A cross-sectional study was performed with patients diagnosed with CM from January 2002 to December 2009, from 78 counties of the western region of the state of Santa Catarina. Data were collected using a protocol adapted from the Brazilian Melanoma Group and 503 patients were evaluated. The incidence and prevalence of CM found in this region are much higher than those found elsewhere in the country. This fact is most likely due to the phenotypic characteristics of the population and the high incidence of UV radiation in this region due to its location in southern Brazil, as is the case in the countries of Oceania.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:14:37.000Z
|
4zvv7nsbb77kwxilxm5yvquwwz4qvbff
|
{
"content_type": "application/xhtml+xml",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67826",
"uncompressed_offset": 506662137,
"url": "www.hindawi.com/journals/mpe/2013/109340/cta/",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.hindawi.com/journals/mpe/2013/109340/cta/"
}
|
cccc_CC-MAIN-2013-20
|
About this Journal Submit a Manuscript Table of Contents
Mathematical Problems in Engineering
Volume 2013 (2013), Article ID 109340, 9 pages
http://dx.doi.org/10.1155/2013/109340
Research Article
A Mollification Regularization Method for a Fractional-Diffusion Inverse Heat Conduction Problem
1School of Mathematical Sciences, University of Electronic Science and Technology of China, Chengdu 610054, China
2School of Mathematics, Southwest Jiaotong University, Chengdu 610031, China
3Department of Mathematical Sciences, Xidian University, Xi'an 710071, China
Received 12 June 2012; Revised 19 December 2012; Accepted 20 December 2012
Academic Editor: Fatih Yaman
Copyright © 2013 Zhi-Liang Deng et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
How to Cite this Article
Zhi-Liang Deng, Xiao-Mei Yang, and Xiao-Li Feng, “A Mollification Regularization Method for a Fractional-Diffusion Inverse Heat Conduction Problem,” Mathematical Problems in Engineering, vol. 2013, Article ID 109340, 9 pages, 2013. doi:10.1155/2013/109340
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:41:00.000Z
|
tk43rbray3j2yyoxampxwhfrcirxk7na
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67827",
"uncompressed_offset": 524668596,
"url": "www.indiaenvironmentportal.org.in/category/thesaurus/madras-cements",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.indiaenvironmentportal.org.in/category/thesaurus/madras-cements"
}
|
cccc_CC-MAIN-2013-20
|
New Delhi Eleven cement makers whom the fair trade regulator CCI has found guilty of adopting anti-competitive practices, on Thursday approached Competition Appellate Tribunal (COMPAT) challenging its July 30 findings.
It issued notices to the Competition Commission of India and listed the matter for next hearing on November 22. The 3-member COMPAT bench, headed by its chairman Justice VS Sirpurkar, however, asked the CCI not to take any coercive action against Shree Cement Ltd against whom penalty of Rs 397.51 crore was imposed by the regulator on July 30.
New Delhi Competition Appellate Tribunal today served notices to the Competition Commission and the Builders Association of India, on whose complaint the fair trade regulator had imposed a penalty of Rs 6,307 crore on 11 cement firms on charges of cartelisation.
Hearing an appeal by cement companies, including UltraTech and ACC, the tribunal also asked the CCI not to take any coercive action in the matter till October 11, when the COMPAT would next hear the case.
The commission in its Q1 on June 20 had imposed a penalty of Rs 6,307.32 crore on 11 cement companies
Cement manufactures, which have been slapped a penalty of over Rs 6,700 crore for price cartelisation, will have to comply with the order of the Competition Commission of India (CCI) within 90 days from the issue of the same, Parliament was informed today. The CCI in two cases has found 11 cement manufacturers... "in contravention of Section 3(3) (a) and 3 (3) (b) read with section 3 (1) of the Competition Act. The loss to consumers due to such violations has not been quantified," Minister of State for Corporate Affairs R P N Singh said in a written reply to the Rajya Sabha.
New Delhi After penalising 11 cement companies last month for violating the provisions of the Competition Act, 2002, the Competition Commission of India (CCI) on Monday found Shree Cement also guilty of cartelisation. As a result, CCI has imposed a penalty of R397.51 crore penalty on Shree Cements, fixed at 0.5 times of the company's net profit for the year 2009-10 and 2010-11.
CCI had not found Shree Cement guilty in its June 21 order in which it had imposed a financial penalty of about R6,200 crore on 11 cement companies and their trade association — Cement Manufacturers Association (CMA).
They were found to be reducing supplies and increasing prices
In a ‘body blow’ to the industry, which is fighting a demand slide, the Competition Commission of India (CCI) has slapped a hefty penalty of over Rs.6,300 crore on 11 cement producers, who were found violating the provisions of the Competition Act, 2002. The Act deals with anti-competitive agreements, including cartels.
Villagers fear adverse effect on agriculture operations
VIRUDHUNAGAR: Collector M. Balaji has instructed the officials of Madras Cements Limited (MCL) to take up various confidence building measures to clear environmental concerns of the people of eight panchayats in and around R.R.
Cement manufacturing is a dry process: from mining limestone to packaging cement. An average cement plant handles and stores millions of tonnes of raw material annually.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:31:04.000Z
|
qy6j4bo2yfxytnlasf6kz5hyte26u644
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67829",
"uncompressed_offset": 531044411,
"url": "www.isfdb.org/cgi-bin/pl.cgi",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.isfdb.org/cgi-bin/pl.cgi?59198+f"
}
|
cccc_CC-MAIN-2013-20
|
Publication Listing
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Cover art hosted by ISFDB
Contents (view Concise Listing)
Verification Status
Reference Status
Primary Verified by Mhhutchins on 2008-07-21 13:27:30
Clute/Nicholls Not Verified
Clute/Grant Not Verified
Contento1 (anth/coll) Not Verified
Locus1 Not Verified
Reginald1 Not Verified
Reginald3 Not Verified
Tuck Not Verified
Miller/Contento Verified by Hauck on 2011-07-01 12:44:55
Bleiler1 (Gernsback) Not Verified
Currey Not Verified
Primary (Transient) Not Verified
Bleiler78 Not Verified
OCLC/Worldcat Not Verified
Primary2 Verified by Hauck on 2011-07-01 12:44:55
Primary3 Not Verified
Primary4 Not Verified
Primary5 Not Verified
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:13:22.000Z
|
ztu52cgzqsemy5ut7c5sumpluu3muyjl
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67830",
"uncompressed_offset": 531049600,
"url": "www.isfdb.org/cgi-bin/title.cgi",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.isfdb.org/cgi-bin/title.cgi?1436708"
}
|
cccc_CC-MAIN-2013-20
|
Bibliography: Personaggi (Nell'occhio del gigante)
You are not logged in. If you create a free account and sign in, you will be able to customize what is displayed.
Title: Personaggi (Nell'occhio del gigante)
Authors: Larry Niven and Jerry Pournelle
Year: 1994
Variant Title of: Dramatis Personae (The Gripping Hand) (by Larry Niven and Jerry Pournelle ) [may list more publications, awards and reviews]
Type: ESSAY
Language: Italian
ISFDB Record Number: 1436708
User Rating: This title has fewer than 5 votes. VOTE
Current Tags: None
Publications:
Copyright (c) 1995-2011 Al von Ruff.
ISFDB Engine - Version 4.00 (04/24/06)
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:28:00.000Z
|
axwo5ek2kny22pnmxm6jyshpgrozv7cx
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67840",
"uncompressed_offset": 569896655,
"url": "www.libreoffice.org/download/?lang=zu&type=rpm-x86&version=3.5.7",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.libreoffice.org/download/?type=rpm-x86&lang=zu&version=3.5.7"
}
|
cccc_CC-MAIN-2013-20
|
The free office suite
Download LibreOffice
LibreOffice Linux - rpm (x86), version 3.5.7, Zulu. Not the version you wanted? Change System, Version or Language
You need to download and install these files in order:
• Source code
LibreOffice is an open source project and you can therefore download the source code to build your own installer.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:58:30.000Z
|
s7ivybhs7f6nyfqv6i6fnycefevftdl4
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67844",
"uncompressed_offset": 595001025,
"url": "www.michaelgeist.ca/content/view/6811/196/",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.michaelgeist.ca/content/view/6811/196/"
}
|
cccc_CC-MAIN-2013-20
|
Text:
Blog Archive
May 2013
SMTWTFS
1234
567891011
12131415161718
19202122232425
262728293031
Debunking the Wireless Myth Busters, Redux
PDF | Print | E-mail
Monday March 18, 2013
Peter Nowak has a great post that takes another look at the state of the Canadian wireless market. Nowak uses the latest data from Bank of America Merrill Lynch Wireless Matrix to find that the Canadian carriers' ARPU ranks as the highest in the world, that profit margin is the fifth highest in the world, and that Canada's smartphone penetration is not nearly as strong as some suggest.
A Minion said:
March 19, 2013
Ole Juul said:
March 25, 2013
smaller | bigger
Tags:
,
Share: Slashdot, Digg, Del.icio.us, Newsfeeder, Reddit, StumbleUpon, TwitterEmailPrintPDF
Related Items:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:30:23.000Z
|
lovk3ep7mzqhtanvqcivsuxv4jryxplj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67851",
"uncompressed_offset": 636002117,
"url": "www.ohloh.net/p/kate/contributors/28241557971618",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.ohloh.net/p/kate/contributors/28241557971618"
}
|
cccc_CC-MAIN-2013-20
|
Very High Activity
Contributors : Vegard Øye
Analyzed 2 days ago based on code collected 2 days ago.
Activity on Kate (KDE) by Vegard Øye
All-time Commits: 49
12-Month Commits: 49
30-Day Commits: 0
Overall Kudo Rank:
First Commit: 20-May-2012
Last Commit: 20-Aug-2012
Names in SCM: Vegard Øye
Commit history:
Recent Kudos...
... for Kate (KDE) given by:
There are no kudos for this contributor at this time.
Do you know this contributor?
Ohloh computes statistics about contributors by analyzing their commits on all FOSS projects. We would like to be able to attribute this work to the right person, so if you know the contributor, please help out:
Are you this developer?
Add this position to your profile!
Know this developer?
Send him or her an invite to join Ohloh.
Project Commits
Approximately one year of commit activity shown
Project Languages
Language Aggregate Coding Time Total Commits Total Lines Changed Comment Ratio
C++ 4m 49 3,132 35.2%
CMake 2m 2 8 -
C 1m 2 180 23.1%
Python 1m 1 1,096 13.6%
XML 1m 1 476 0.4%
All Languages 4m 49 4,892 27.7%
Copyright © 2013 Black Duck Software, Inc. and its contributors, Some Rights Reserved. Unless otherwise marked, this work is licensed under a Creative Commons Attribution 3.0 Unported License . Ohloh ® and the Ohloh logo are trademarks of Black Duck Software, Inc. in the United States and/or other jurisdictions. All other trademarks are the property of their respective holders.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:38:53.000Z
|
ehyd3s5djtyqsmx7okekmwqbgkj67vom
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67852",
"uncompressed_offset": 636021959,
"url": "www.ohloh.net/p/twimi/enlistments",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.ohloh.net/p/twimi/enlistments"
}
|
cccc_CC-MAIN-2013-20
|
Very Low Activity
× You must be logged in to change this data. If you don't have an account, Please join.
Settings : Code Locations
Analyzed 8 days ago based on code collected 8 days ago.
Showing page 1 of 1
Repository URL SCM Type Update Status Ignored Files
http://twimi.googlecode.com/svn/trunk Subversion (via SvnSync) Ohloh update completed 8 days ago. All files included.
About Code Locations
• Ohloh's statistics are derived from analysis of the project's source code history as maintained by the project's repository. Accordingly, it is crucial that this information be maintained accurately.
• Ohloh currently supports repositories maintained using Git, Mercurial, Bazaar, Subversion, and CVS.
• For Subversion repositories, submit only the trunk subdirectory. Don't submit the tags or branches directories.
• As soon as you add a new repository, Ohloh will immediately verify settings and successful connection to the source control server. The repository will then be added to a queue for later processing. Depending on the load on Ohloh's crawlers and the size of the repository, it may be several hours before the project's statistics have been updated to reflect the new repository.
• If a repository requires login credentials, those credentials will become public information. Do not submit a username and password to Ohloh unless you are certain that it is safe for this information to become public.
• Ohloh can combine data from multiple code lcoations to create a composite and complete set of statistics for a project. This means that a project:
• can consist of multiple sub-projects, each with its own repositories
• can include both a read-only historical repository and a newer, active repository that accurately reflect the entire history of a project even if its code has been moved or its SCM has been changed.
• A code location (repository) can be part of multiple projects. The code in such a repository will be counted for each project, so please consider carefully how to organize Ohloh's view of a project and its sub-projects, to prevent double-counting while still reflecting the chosen organizational structure for the project.
Copyright © 2013 Black Duck Software, Inc. and its contributors, Some Rights Reserved. Unless otherwise marked, this work is licensed under a Creative Commons Attribution 3.0 Unported License . Ohloh ® and the Ohloh logo are trademarks of Black Duck Software, Inc. in the United States and/or other jurisdictions. All other trademarks are the property of their respective holders.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:48:35.000Z
|
hwebzkyvapgo4ndx27wqtyf5j36x2pmu
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67860",
"uncompressed_offset": 646168894,
"url": "www.panarmenian.net/eng/news/150370/",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.panarmenian.net/eng/news/150370/"
}
|
cccc_CC-MAIN-2013-20
|
Greg Kinnear joins Steve Carell in "Anchorman" comedy sequel
PanARMENIAN.Net - The cast for director Adam McKay’s sequel Anchorman: The Legend Continues has grown by two, even though production on the film is already underway in Atlanta, Collider said,
As Collider reported citing Deadline, Greg Kinnear and Josh Lawson (The Campaign, House of Lies) have signed on to the follow-up in a couple of unspecified roles.
They join returning castmembers Will Ferrell, Steve Carell, Paul Rudd, David Koechner, and Christina Applegate as well as newcomers Harrison Ford, Kristen Wiig, James Marsden, Meagan Good, and Dylan Baker.
The film hits theaters later this year on December 20th.
Partner news
Top stories
The jewels were to be loaned to celebrities who have arrived on the French Riviera town for its famous annual film festival.
The list of the finalists also includes Hungary, Azerbaijan, Georgia, Romania, Norway, Iceland, Finland and others.
Set in the gritty blue-collar neighborhood of God’s Pocket, story follows a man stuck with a debt he can't pay.
"Catching Fire" follows Katniss and fellow Hunger Games victor Peeta as they embark on a "Victor's Tour" throughout 12 districts of Panem.
Partner news
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:59:28.000Z
|
hpihcwhojesm3545l2qove7avjvbwmnf
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67863",
"uncompressed_offset": 652618909,
"url": "www.perseus.tufts.edu/hopper/text?doc=urn%3Acts%3AlatinLit%3Aphi0474.phi056.perseus-lat1%3A16.16.2",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.perseus.tufts.edu/hopper/text?doc=urn:cts:latinLit:phi0474.phi056.perseus-lat1:16.16.2"
}
|
cccc_CC-MAIN-2013-20
|
Click on a word to bring up parses, dictionary entries, and frequency statistics
This work is licensed under a Creative Commons Attribution-ShareAlike 3.0 United States License.
An XML version of this text is available for download, with the additional restriction that you offer Perseus any modifications you make. Perseus provides credit for all accepted changes, storing new additions in a versioning system.
load focus Notes (Frank Frost Abbott, 1909)
load Vocabulary Tool
hideData/Identifiers
Citation URN: urn:cts:latinLit:phi0474.phi056.perseus-lat1:16.16.2
Document URN: urn:cts:latinLit:phi0474.phi056.perseus-lat1
hide Display Preferences
Greek Display:
Arabic Display:
View by Default:
Browse Bar:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T10:00:25.000Z
|
fxmzwq6pjfcfqmwqjbhnrjsz4qjpcslq
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67882",
"uncompressed_offset": 754619927,
"url": "www.theworldsbestever.com/2012/07/24/the-house-that-spawned-a-serial-killer/",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.theworldsbestever.com/2012/07/24/the-house-that-spawned-a-serial-killer/"
}
|
cccc_CC-MAIN-2013-20
|
The House That Spawned A Serial Killer
The childhood home of Jeffrey Dahmer is up for sale in Akron, Ohio. As an added piece of history, it is also the location of his first murder —“a hitchhiker named Steven Hicks whom he lured back to the house with promises of drugs and alcohol, and then clubbed with a barbell after Hicks said he wanted to leave. Dahmer later dismembered Hicks’ corpse in the house’s crawlspace.”
Anyway, the 3 bedroom, 2 1/2 bath house is listed at $329,000 and can be viewed here
via, @rogergastman / radar
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:23:04.000Z
|
mhgjdomouk5gdt33petso2ikeibiqiz2
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67893",
"uncompressed_offset": 804484931,
"url": "www.werelate.org/wiki/Place:Ardington,_Oxfordshire,_England",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.werelate.org/wiki/Place:Ardington,_Oxfordshire,_England"
}
|
cccc_CC-MAIN-2013-20
|
Place:Ardington, Oxfordshire, England
Watchers
NameArdington
Alt namesArdintonesource: Domesday Book (1985) p 35
TypeVillage
Coordinates51.6°N 1.367°W
Located inOxfordshire, England
Also located inBerkshire, England
source: Getty Thesaurus of Geographic Names
source: Family History Library Catalog
the text in this section is copied from an article in Wikipedia
Ardington is a village within the civil parish of Ardington and Lockinge about east of Wantage in the Vale of White Horse. Ardington was part of Berkshire until the 1974 boundary changes transferred it to Oxfordshire.
Ardington is a downland village, with its parish stretching from the loam rich north to the chalk downlands to the south. The ancient path of the Ridgeway runs through the southern part of the parish. There are several racing stables in and around the village, most of which use the Downs for gallops. Being set in the Lockinge Estate, Ardington and the nearby villages of East and West Locking are owned by Thomas Loyd and managed by Adkin Rural and Commercial, who manage the whole estate.
Local amenities include a public house - The Boar's Head, a sports club, village store, post office and tearoom, and the Loyd-Lindsay Rooms - a set of rooms which are let out to the community and on a commercial basis for weddings, parties and conferences. Local charities can use the rooms to hold events to raise money.
The oldest part of the Church of England parish church of Holy Trinity is the chancel arch, built about 1200. The Gothic Revival architect Joseph Clarke added the tower and spire in 1856. Somers Clarke remodelled the remainder of the church in 1887.
Ardington House was built in 1721. It is a Georgian Grade II* listed building and is open to the public in the summer months.
Research Tips
This page uses content from the English Wikipedia. The original content was at Ardington. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:21:56.000Z
|
2ygmmmldxt7scqnoc7cw6j3zgbjti623
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67894",
"uncompressed_offset": 804497746,
"url": "www.werelate.org/wiki/Place:Ladner%2C_British_Columbia%2C_Canada",
"warc_date": "2013-11-22T14:35:12.000Z",
"warc_filename": "<urn:uuid:06782d10-9458-4984-9386-94b136213c00>",
"warc_url": "http://www.werelate.org/wiki/Place:Ladner%2C_British_Columbia%2C_Canada"
}
|
cccc_CC-MAIN-2013-20
|
Place:Ladner, British Columbia, Canada
Watchers
NameLadner
TypeCommunity
Coordinates49.1°N 123.083°W
Located inBritish Columbia, Canada
source: Getty Thesaurus of Geographic Names
source: Family History Library Catalog
the text in this section is copied from an article in Wikipedia
Ladner was created as a fishing village on the banks of the Fraser River. It is a part of the Municipality of Delta, British Columbia, Canada, and a suburb of Vancouver.
Named for Thomas and William Ladner, who came to the area in 1868 and began large farming and fishing operations, it developed as a centre for these operations. The ferry at Captain's Cove allowed for access across the river to Richmond, British Columbia. The George Massey Tunnel provided a permanent connection in 1959.
Ladner and its suburban neighbour to the south, Tsawwassen, make up the unofficial region known as "South Delta".
Research Tips
This page uses content from the English Wikipedia. The original content was at Ladner, British Columbia. The list of authors can be seen in the page history. As with WeRelate, the content of Wikipedia is available under the Creative Commons Attribution/Share-Alike License.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:39:49.000Z
|
hk5dvskz5yx2q4ct7t57qnznjg2imimn
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67903",
"uncompressed_offset": 11565137,
"url": "answers.onstartups.com/questions/16531/how-do-you-financially-support-yourself-during-start-up/16546",
"warc_date": "2013-11-22T14:33:35.000Z",
"warc_filename": "<urn:uuid:3be3f960-c374-47c6-a438-748f21aa7960>",
"warc_url": "http://answers.onstartups.com/questions/16531/how-do-you-financially-support-yourself-during-start-up/16546"
}
|
cccc_CC-MAIN-2013-20
|
Tell me more ×
Answers OnStartups is a question and answer site for entrepreneurs looking to start or run a new business. It's 100% free, no registration required.
I am looking for some suggestions. Currently I am in a startup, finishing my product.
I can't get a job because I am working all week long all day on the product, and nearing completion...
I barely make the rent by doing some internet marketing.
At this point, I might have to move back in to my parents house....I want to avoid this because of the distraction.
What are some ways you can make extra cash to support yourself financially during the start up ? You know the basics like food, rent etc.
I thought about freelancing but don't know where to find freelancing jobs. Even if it means I also have to compete at commodity wage prices (something I don't mind at the moment).
I can write code and make the things I want but I don't think I have enough experience to take on whole projects or get a part time job (since the requirement is lot of experience, a CS degree which I don't have).
Where can I find more resource about freelancing, as I am quite new to it.
What other things can I do to make extra cash ?
share|improve this question
4 Answers
Move into your parents house. You gotta scrap and claw until you get enough traction to either:
1. get funded; or
2. cover your costs
Most of us have been there before, there is no shame.
share|improve this answer
Honestly, I would do what I have to do (legally)to pull through. I was in the same tough situation 5 years ago during my first startup. I moved into my car and called it home for some 6 months. This in turn allowed me to self fund the startup and get it off the ground entirely on my own. Later on when things became viable and looked like a business was emerging, it became a lot easier to talk to people and convince them to lend some cash.
Frankly speaking I am glad it went down the way it did. It was the greatest and most valuable lesson learned up to that point in my life. Do what you have to do. Be honorable and always see a glass half full where doubters tend to discount you. Hope this helps.
share|improve this answer
Find a new, rich spouse? ;)
I would think "working all week long all day on the product" and "freelancing jobs" are almost mutually exclusive. However, you can try the freelancing sites like GetAFreelancer or ELance and find something there.
Your other option is to find a part-time job that won't leave you tired but give you enough to make the essentials.
Becoming a "professional mooch" is not the answer. Quite frankly, there's almost as much work there as not.
One important question: Do you have a business plan of some sort? Can you show someone how much and for how long you'll be in the red if you worked at it non-stop? Any investor, from family and friends to a real investor would want to see your numbers. But, most importantly, you should have those numbers for yourself. You are investing in yourself and you owe it to yourself to have this organized, and to know when to cut your losses.
share|improve this answer
I'd only take the option of moving in with your parents if they are absolutely clear that it's a business choice, and will require as much of their co-operation as your own. If you can do this professionally, you will want to save every penny you can.
Personally, I have a family to take care of with fairly high expenses, so my business model has to include a a strong enough revenue stream to continue life early on. So, having said that, here is my rough plan (and it's been working great the past 6 months):
1. Take on client work as much as it takes to pay the bills
2. In the 20-40% spare time from that, develop products
3. Transition away from contract work as product builds traction
Balancing freelance work (in my base, through the startup) and product development can be very tough and requires a lot of discipline. If you haven't freelanced much before, this may not be a viable option (way too distracting from your core goals).
Bottom line: reduce your costs wherever possible! If this means living with your parents, or in your car, or cutting TV, etc. do it! Make the sacrifices to make it happen.
share|improve this answer
Your Answer
discard
By posting your answer, you agree to the privacy policy and terms of service.
Not the answer you're looking for? Browse other questions tagged or ask your own question.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:48:52.000Z
|
uys6fmyvlix45qp3c2t7jfhtohxfc2aa
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67930",
"uncompressed_offset": 47403487,
"url": "ccsenet.org/journal/index.php/cis/article/view/3495/0",
"warc_date": "2013-11-22T14:33:35.000Z",
"warc_filename": "<urn:uuid:3be3f960-c374-47c6-a438-748f21aa7960>",
"warc_url": "http://ccsenet.org/journal/index.php/cis/article/view/3495/0"
}
|
cccc_CC-MAIN-2013-20
|
Development of Individual Learners: Perspective on the Uncertain Future Contribution of E-Learning
Zaki Ahmad Dahlan, Nor Arzami Othman, Mohd Fazril Izhar Mohd Idris, Hj. Kamaruzaman Jusoff
Abstract
E-learning in the educational world has grown and changed rapidly in recent years. Both private and public sector organizations have embraced the practice of reaching their students at a distance via new technologies afforded them by Information Communication Technology (ICT) infrastructure. E-learning is grounded on technology, and without it, its practice would be difficult, if not impossible. We can see that the use of the internet and ICT are becoming an important part of learning and teaching strategies in many educational institutions. Knowing that education has always been an important engine for economic development, the Malaysian government has taken initiative steps to implement public awareness on the ICT issues. An important part of e-learning has been to contribute to the development of individual learners whatever their life circumstances. E-learning as a field of educational endeavor is at a crucial juncture in its historical development. The notion of learning at a distance has gained wide acceptance across the developed world. Instructors, physically and temporally separated from learners using newly emerging information and communication technologies, are widespread. The potential of latest technology has adopted in creating new learning environments. The rational behind this endeavor is the expectation that unique features of the Information Communication technology. It also can include a range of powerful media forms and its interactive capability that support sophisticated range and interaction in teaching. As a result, these approaches will provide a rich environment for teaching.
Full Text: PDF
This work is licensed under a Creative Commons Attribution 3.0 License.
Computer and Information Science ISSN 1913-8989 (Print) ISSN 1913-8997 (Online)
Copyright © Canadian Center of Science and Education
To make sure that you can receive messages from us, please add the 'ccsenet.org' domain to your e-mail 'safe list'. If you do not receive e-mail in your 'inbox', check your 'bulk mail' or 'junk mail' folders.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:29:20.000Z
|
v2e4qst267rnjmy4uq5mn2sjzdvb7zkj
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67952",
"uncompressed_offset": 78711804,
"url": "dotnetkicks.com/stories/47789/ef-6-async",
"warc_date": "2013-11-22T14:33:35.000Z",
"warc_filename": "<urn:uuid:3be3f960-c374-47c6-a438-748f21aa7960>",
"warc_url": "http://dotnetkicks.com/stories/47789/ef-6-async"
}
|
cccc_CC-MAIN-2013-20
|
Error!
Success!
EF 6: Async
0
kicks
EF 6: Async (Unpublished)
this post is the first in a series about what's new in EF 6. great improvements are about to come with Entity Framework 6. it is a major release and the first one since EF become an open source. each post in the series will be dedicate to a single feature. this post will focus on a new EF a-sync features.
Kicked By:
Drop Kicked By:
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:20:23.000Z
|
5euwoo3xjtcp6kev7k6kw5kvwp6qlnjl
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67954",
"uncompressed_offset": 82860186,
"url": "dungeons.wikia.com/wiki/SRD:Ranged?direction=prev&oldid=9421",
"warc_date": "2013-11-22T14:33:35.000Z",
"warc_filename": "<urn:uuid:3be3f960-c374-47c6-a438-748f21aa7960>",
"warc_url": "http://dungeons.wikia.com/wiki/SRD:Ranged?direction=prev&oldid=9421"
}
|
cccc_CC-MAIN-2013-20
|
Wikia
SRD:Ranged
Talk0
9,503pages on
this wiki
Revision as of 03:53, April 23, 2009 by Dmilewski (Talk)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
This material is published under the OGL
Ranged: The wielder of a ranged shield can throw it in combat, with a range increment of 30 feet. While in the air, the shield is treated in all ways as a ranged weapon and cannot be blocked or grabbed except by those with appropriate feats. No matter the size of the wielder, a buckler or light shield deals 1d6 points of damage and a heavy one 1d8 points. (A tower shield cannot be created with this special ability.) The wielder’s Strength modifier and the shield’s enhancement bonus add to the base damage.
A ranged shield flies through the air back to the creature that threw it. It returns to the wielder just before the creature’s next turn (and is therefore ready to use again in that turn).
Catching a ranged shield when it comes back is a free action. If the wielder can’t catch it, or if the wielder has moved since throwing it, the shield drops to the ground in the square from which it was thrown.
Faint psychokinesis; ML 5th; Craft Psionic Arms and Armor, far hand; Price +1 bonus.
Back to Main PageSystem Reference DocumentPsionic Items
Advertisement | Your ad here
Photos
Add a Photo
1,231photos on this wiki
See all photos >
Recent Wiki Activity
See more >
Around Wikia's network
Random Wiki
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:47:32.000Z
|
eub2j5zrhhk6sl7jx6zbhd6whow5ojwx
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67966",
"uncompressed_offset": 94912931,
"url": "familysearch.org/learn/wiki/en/Limburg_Municipalities_before_1998",
"warc_date": "2013-11-22T14:33:35.000Z",
"warc_filename": "<urn:uuid:3be3f960-c374-47c6-a438-748f21aa7960>",
"warc_url": "http://familysearch.org/learn/wiki/en/Limburg_Municipalities_before_1998"
}
|
cccc_CC-MAIN-2013-20
|
Limburg Municipalities before 1998Edit This Page
From FamilySearch Wiki
◄ Back to Limburg Page
• Grevenbricht
Need additional research help? Contact our research help specialists.
Need wiki, indexing, or website help? Contact our product teams.
Did you find this article helpful?
You're invited to explain your rating on the discussion page (you must be signed in).
• This page was last modified on 3 July 2012, at 13:26.
• This page has been accessed 375 times.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:28:47.000Z
|
ggpilkf3pxoqhbamj7zsiceznbtwjelc
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67976",
"uncompressed_offset": 114553767,
"url": "genomebiology.com/2012/13/7/R62/abstract",
"warc_date": "2013-11-22T14:33:35.000Z",
"warc_filename": "<urn:uuid:3be3f960-c374-47c6-a438-748f21aa7960>",
"warc_url": "http://genomebiology.com/2012/13/7/R62/abstract"
}
|
cccc_CC-MAIN-2013-20
|
Software
CIDeR: multifactorial interaction networks in human diseases
Martin Lechner1, Veit Höhn1, Barbara Brauner1, Irmtraud Dunger1, Gisela Fobo1, Goar Frishman1, Corinna Montrone1, Gabi Kastenmüller1, Brigitte Waegele1,2 and Andreas Ruepp1*
Author Affiliations
1 Institute for Bioinformatics and Systems Biology (MIPS), Helmholtz Center Munich - German Research Center for Environmental Health (GmbH), Ingolstädter Landstraße 1, D-85764 Neuherberg, Germany
2 Department of Genome-oriented Bioinformatics, Life and Food Science Center Weihenstephan, Technische Universität München, Alte Akademie 1, 85354 Freising, Germany
For all author emails, please log on.
Genome Biology 2012, 13:R62 doi:10.1186/gb-2012-13-7-r62
Published: 18 July 2012
Abstract
The pathobiology of common diseases is influenced by heterogeneous factors interacting in complex networks. CIDeR http://mips.helmholtz-muenchen.de/cider/ webcite is a publicly available, manually curated, integrative database of metabolic and neurological disorders. The resource provides structured information on 18,813 experimentally validated interactions between molecules, bioprocesses and environmental factors extracted from the scientific literature. Systematic annotation and interactive graphical representation of disease networks make CIDeR a versatile knowledge base for biologists, analysis of large-scale data and systems biology approaches.
|
v0
|
2024-06-03T21:29:50.578Z
|
2013-05-18T09:19:27.000Z
|
ol5pvcw2m2noq7gzgaz6am2xeahw7pow
|
{
"content_type": "text/html",
"provenance": "cccc-CC-MAIN-2013-20-0000.json.gz:67978",
"uncompressed_offset": 116501319,
"url": "globalvoicesonline.org/2012/11/19/chileans-protest-in-support-of-gaza/",
"warc_date": "2013-11-22T14:33:35.000Z",
"warc_filename": "<urn:uuid:3be3f960-c374-47c6-a438-748f21aa7960>",
"warc_url": "http://globalvoicesonline.org/2012/11/19/chileans-protest-in-support-of-gaza/"
}
|
cccc_CC-MAIN-2013-20
|
GlobalVoices in Learn more »
Chileans Protest in Support of Gaza
This post also available in:
Malagasy · Shiliana Manao Hetsi-panoherana Ho Fanohanana An'i Gaza
Español · Chilenos protestan en apoyo a Gaza
Despite the fact that Chile is located more than 8,000 miles away from the Palestinian Territories and Israel, many Chileans have not been oblivious to the continued exchange of makeshift rockets and missiles between the Israeli Defense Forces (IDF) and Hamas militants in the Gaza-Israel border.
On Thursday November 15, netizens started circulating a call to attend a march that began in Santiago's Palestinian Stadium and ended at the Israeli Stadium:
@Karina_Aravena_: @DonDatos: En minutos: Comienza la CAMINATA X GAZA desde el Club Palestino (21:00 hrs) #PalestinaLibre RT
@Karina_Aravena_@DonDatos: In minutes: The WALK FOR GAZA is starting from the Palestinian Club (21:00 hrs) #FreePalestine RT
Call to protest in support of Gaza, shared via Twitter and Facebook.
The march had a small turn out and did not get enough attention from the media. Hence, another protest was called for Saturday, November 17.
The protest was organized by the “Comité Chileno de Solidaridad con Palestina” or Chilean Committee of Solidarity with Palestine (@conpalestina) [es]. On that day, according to CNN Chile (@cnnchile) [es], hundreds of people took to the streets in front of the Israeli Embassy in Santiago, Chile's capital, to protest Israel's attack on the Gaza Strip [es].
Chile's EMOL newspaper reported that only around seven hundred people attended the march [es]. The Israeli ambassador in Chile, David Dadonn, reacted by saying:
Viene gente a manifestarse en contra de la víctima. El hecho de que Israel se defiende en legítima defensa de un hecho de provocación de Hamas para asegurar la vida de los ciudadanos no está siendo tomando en consideración. La mayoría de las personas en esta manifestación no conoce la situación real, en el terreno. A los organizadores de esa manifestación, no se les verá nunca frente a la embajada de Siria aunque la represión del Gobierno sirio llegó a 39 mil muertos civiles y de oposición según el conteo oficial de la ONU, pero ellos sí vienen inmediatamente a la de Israel después de 14 muertos palestinos por razón de la provocación de Hamas.
People here come to protest against the victim. That fact that Israel is acting in legitimate defense in reaction to a provocation by Hamas in order to protect the lives of [its] citizens is not being considered. Most of these people in the protest do not know the real situation in the field. One will never see the organizers of this protest in front of the Syrian Embassy, though repression by the Syrian government left 39 thousand civilians and opposition members dead, according to the official count of the UN, but they do come to the Israeli Embassy after 14 palestinians are dead because of the provocation by Hamas.
He prompted many reactions from citizens in social media when he referred to the organizers of the protest in the following terms [es]:
Son enemigos profesionales de Israel que esperan cualquier oportunidad para venir a manifestar su odio al estado de Israel, no importa las circunstancias.
They are professional enemies of Israel that await for any opportunity to come and profess their hatred towards the Israeli state, no matter the circumstances.
During the day, Chileans had been discussing the issue through social media. The Twitter account for Difamadores (@Difamadores) [es], a satirical group of TV presenters who demand political reform, tweeted:
@Difamadores: Te pasaste!! Embajador israelí en Chile por manifestación pro Palestina: “Son enemigos profesionales de Israel”http://www.emol.com/noticias/nacional…
@Difamadores: You crossed the line!! Israeli Ambassador in Chile on pro Palestinian protest: “They are professional enemies of Israel.”http://www.emol.com/noticias/nacional…
Pablo Lira (@pablolirar) [es], a political scientist from Chile's Catholic University, said:
@pablolirar: Ojalá algún día haya ‘paz’ entre Israel y Palestina!
@pablolirar: I hope that one day there will be “peace” between Israel and Palestine!
Cristian Mauricio (@negromartínez) [es] asked people to keep Palestinian children in their thoughts:
@negromartínez: Buenas noches para tod@s y antes de dormir ojalá recordemos a todos los niños que sufren en #Gaza la violencia de Israel, paz para Palestina
@negromartínez: Good night everyone. Before going to bed, I hope we keep all the children suffering in #Gaza from Israel's violence in our thoughts. Peace for Palestine.
Marcelo Hilsenrad (@mhilsenrad) [es] took a more critical view of Hamas:
@mhilsenrad: Mientras el mundo siga apoyando a los terroristas de Hamas, pierde Palestina, Abbas, Israel y todo el planeta
@mhilsenrad: As long as the world continues to support Hamas terrorists, Palestine, Abbas, Israel and the whole planet will loose.
Chilean Senator Francisco Chahuán (@chahuan) [es], a center-right politician and a Palestinian descendant himself, said:
@chahuan: La paz en Palestina e Israel implica que nedie tiene derecho a atacar descaradamente a poblacion civil. Reconocer que hay q agotar dialogo
@chahuan: Peace in Palestine and Israel means that no one has the right to shamelessly attack the civilian population. Recognize that we must exhaust dialogue.
In a similar light, far-right politician Ivan Moreira (@ivanmoreirab) [es] had been using Twitter to express his dissatisfaction with the current government's reaction to the crisis in Gaza. He complained:
@ivanmoreirab: Declaración Cancilleria x ataques y muerte d Israel a Palestina,lamentablemente Teoría Empate,tibia no me parece.Tan corta bastaba 1 Twitter
@ivanmoreirab: Statement by the Foreign Ministry for attacks and deaths [brought upon] Palestine by Israel. Sadly a draw's theory, lukewarm, I don't like it. It was enough with one tweet.
He received many responses. Alvaro Sandoval (@asandovalu) [es] said:
@asandovalu: @ivanmoreirab toda la razon… tipico de pais timorato… #fuerzapalestina
@asandovalu: @ivanmoreirab you are absolutely right… typical of a shy country… #strengthpalestine
Rolando Loi (@RolandoLoi) [es] responded:
@RolandoLoi: @ivanmoreirab ¿Que quiere que haga Israel? Hamas no quiere “2 estados para 2 pueblos” quieren 1 estado Islámico EN VEZ de Israel.
@RolandoLoi: @ivanmoreirab What do you want Israel to do? Hamas does not want “2 states for 2 peoples”. They want 1 Islamic state INSTEAD of Israel.
Moreira, the politician, replied:
@ivanmoreirab: @RolandoLoi Yo Proclamo La Paz,de dos Estados que coexistan con delimitación de Fronteras,sin muros,sin ocupación,Palestina Libre!!!
@ivanmoreirab: @RolandoLoi I proclaim Peace between two states that coexist with demarcated frontiers, without walls, without occupation, a Free Palestine!!!
Chile, despite being so far away from Israel and Palestine, is home to around 350,000 ethnic Palestinians, which makes it the country with the largest group of ethnic Palestinians living outside of the Arab World [es]. Chile's Palestinian community in Chile is mostly comprised of Christians and is the result of a century of immigration. Today, they are present in all spheres of Chilean society.
The first waves of Palestinian immigration to Chile occurred early in the 20th century. Because Palestine was part of the Ottoman Empire, most Palestinian immigrants arrived with Turkish papers, which led to Chileans mistakenly calling them “turcos” (turks in Spanish). In 2008, under a United Nations agreement, the Chilean Government of Michelle Bachelet received a group of Palestinian refugees that had been living in Syria.
World regions
Countries
Languages
|
v0
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.